The nature of Escherichia coli's resistance to antibiotics results in limited treatment options. ... more The nature of Escherichia coli's resistance to antibiotics results in limited treatment options. Further development of bacterial resistance can lead to the emergence of multidrug resistance, there by increasing morbidity and mortality. The interaction of the spread of multidrug resistance Escherichia coli that occur in populations is very complex, so it is difficult to understand the dynamics of large-scale spread. The modeling approach becomes very important for decision making for disease control programs. This research is a descriptive analytic epidemiological study with a cross-sectional design. Sampling was conducted by stratified random sampling with a total sample of 73 farms. Data analysis uses linear regression analysis. The results of the distribution cases of multidrug resistance Escherichia coli in commercial chicken farms, Blitar District showed a prevalence of 95.9%. Risk factor correlations showed that chicken species, breeders education, breed types, feed types, veterinary support, chlorine in water, antibiotic programs, and antibiotic references were significant risk factors correlated with the incidence of Escherichia coli multidrug resistance. Linear regression modeling shows Y=0.52+0.15NonPddkPT+0.19JUMitra-0.15SaniKan+0.15ProgAb, with wilk saphiro W=0.9701. The equation model can be a reference in efforts to prevent and control the prevalence of Escherichia coli multidrug resistance in commercial chicken farms. Animal husbandry management and antibiotic use programs as disease prevention need to be aware, because it is a risk factor that can increase the prevalence of Escherichia coli multidrug resistance in commercial chicken farms, while sanitary cage hygiene needs to be improved because it can reduce or prevent the prevalence of Escherichia coli multidrug resistance in commercial chicken farms.
Dewasa ini dilaporkan banyak kasus pada burung merpati (Columba Livia) dan burung tekukur (Strept... more Dewasa ini dilaporkan banyak kasus pada burung merpati (Columba Livia) dan burung tekukur (Streptopilia Chinensis) menunjukkan gejala syaraf, terutama: tortikolis, dan kepala gemetar, yang merupakan indikasi penyakit Newcastle Disease (ND). Kedua spesies burung tersebut banyak berkeliaran di lokasi farm ayam komersial untuk mencari pakan. Kondisi tersebut dapat bertindak sebagai faktor penular penyakit ND. Penelitian ini bertujuan mendeteksi virus ND pada burung merpati dan burung tekukur yang memperlihatkan gejala saraf, dengan uji serologis dan molekuler. Sampel darah diambil dari vena brakhialis, diproses untuk mendapatkan serum darah. Serum tersebut selanjutnya diuji dengan uji hemaglutinasi inhibisi (HI), untuk mendeteksi titer antibodi ND. Sampel pool otak, trakea, dan lien diekstraksi RNA-nya dan diamplifikasi dengan primer spesifik gen F virus ND. Sampel pool tersebut juga dikultur pada telur ayam berembrio specific pathogen free (TAB-SPF). Identifikasi dilakukan dengan uji ...
Sifat resistensi bakteri Escherichia coli terhadap antibiotik mengakibatkan terbatasnya pilihan p... more Sifat resistensi bakteri Escherichia coli terhadap antibiotik mengakibatkan terbatasnya pilihan pengobatan. Perkembangan lebih lanjut dari resistensi bakteri dapat menyebabkan munculnya multidrug resistance pada bakteri, sehingga meningkatkan morbiditas dan mortalitas penyakit. Interaksi penyebaran kejadian multidrug resistance pada Escherichia coli yang terjadi pada populasi sangat kompleks, sehingga sulit memahami dinamika penyebaran berskala besar. Pendekatan pemodelan menjadi sangat penting untuk pengambilan keputusan tentang program pengendalian penyakit infeksi. Penelitian ini merupakan penelitian epidemiologi deskriptif analitik dengan desain cross-sectional study. Metode analisis menggunakan analisis regresi logistic untuk mendapatkan pemodelan kejadian multidrug resistance bakteri Escherichia coli pada tingkat ternak, dan menggunakan regresi linier untuk mendapatkan pemodelan kejadian multidrug resistance bakteri Escherichia coli pada tingkat peternakan. Hasil dari penelit...
Biodiversitas Journal of Biological Diversity, 2020
This study was aimed to determine the incidence of Extended-Spectrum Beta-Lactamase (ESBL) produc... more This study was aimed to determine the incidence of Extended-Spectrum Beta-Lactamase (ESBL) producing Escherichia coli on layer chicken in Blitar area. This was a cross-sectional study with a total of 205 cloacal swabs of layer chicken taken randomly. The sample was in isolation identification on MacConkey media and ESBL confirmation test produced by Escherichia coli was then carried out by the Double Disc Synergy Test (DDST) method and the VITEK® 2 Compact Automated System method. This study showed that 185 (90.24%) isolates of positive Escherichia coli from a total of 205 samples of cloacal swabs of the layer chicken. The incidence of ESBL-producing Escherichia coli in cloacal swabs on layer chicken with the Double Disc Synergy Test (DDST) method and the VITEK® 2 compact automatic method was 13 (7.03%). Results in this study indicated that layer chicken has potential as reservoir for spreading ESBL to public health and needs strict hygienic measures to prevent their transmission to humans.
Chicken is a major source of animal protein consumption in Indonesia. The problem facing the poul... more Chicken is a major source of animal protein consumption in Indonesia. The problem facing the poultry industry is the incidence of resistance which increases mortality of the chicken production. One of the causes of resistance case is the use of antibiotics in feed additives. The public understanding about the effects of the use of antibiotic growth promoters (AGP) in chickens in antibiotic resistance and the digestive tract of chicken needs to be done to avoid the impact on economic losses and health problems. This study aims to provide an understanding of the effects of the use of antibiotic growth promoters (AGP) on antibiotic resistance and the digestive tract of broiler chickens. This study was carried out at a broiler chicken farm in Sleman, Yogyakarta. Based on the histopathological result of the digestive tract of chickens that were given antibiotics as AGP, there was no inflammation occurs, but the administration of antibiotics caused antibiotic resistance in various type of...
Highly pathogenic avian influenza virus (HPAI) differ from Low pathogenic avian influenza virus (... more Highly pathogenic avian influenza virus (HPAI) differ from Low pathogenic avian influenza virus (LPAI) based on multiple basic amino acid motif of the carboxylterminus of HA1, especially arginine and lysine. The propose of this work was toamplify and sequence the cleavage site region of HA gene of avian influenza virusisolated from both cases with characteristic or unspecific lesion, using reversetranscriptase polymerase chain reaction (RT-PCR). Primer desaigned for amplification and sequence was H5-F: 5’ ggagactcagcaatcccatgaaaag 3’ and H5- R:5’ccataccaaccgtctaccattcc 3’, and expected product size was 246 bp. The result indicated that all avian influenza virus (AIV)-isolates originated from chicken with both specific and non specific lesion show a multiple basic amino acid motif -PQRERRRKKR//GLF- and classified as highly pathogenic avian influenza. Philogenetic study of HA genefragment indicated that each type of characteristic lesion created philo-groups. Key words: avian influenz...
Aeromonas hydrophila telah diidentifikasi sebagai agen penyebab penyakit pada ikan Nila. Mikroorg... more Aeromonas hydrophila telah diidentifikasi sebagai agen penyebab penyakit pada ikan Nila. Mikroorganisme ini diketahui patogen terhadap manusia terutama sebagai penyebab gastroentritis, meskipun demikian, belum dilaporkan adanya infeksi pada manusia di Yogyakarta. Uji karakteristik biokimiawi dapat mengarahkan pada diagnosa yang kurang akurat, oleh karena itu terdapat kebutuhan untuk mengembangkan metode yang lebih spesifik dan akurat, yaitu dengan metode agar gel presipitasi (AGP). Dua sampel yang dikoleksi berasal dari lokasi budidaya ikan Nila di Yogyakarta yang terjadi outbreak A. hydrophila dengan mortalitas lebih dari 50%. Antigen terlarut yang tahan terhadap panas dipersiapkan dari 4 kultur isolat murni yang diperoleh untuk uji AGP. Antiserum yang digunakan untuk uji pada sumuran adalah antiserum A. hydrophila (ATCC 35654) yang diproduksi dengan menginokulasikan whole-cell antigen (heat-stable) dan antigen flagellar (formalin-killed) pada kelinci. Kontrol positif yang digunaka...
Colibacillosis a disease that can cause considerable economic loss, remains an important health p... more Colibacillosis a disease that can cause considerable economic loss, remains an important health problem. Phyllanthus (Phyllanthus niruri L) and turmeric (Curcuma domestica) are herbs that can be used as immunomodulators. This study was aimed to determine the level of safety of the combination of phyllanthus and turmeric on hematology profile and liver histopathology of layers with colibacillosis. The layers were assigned to the following of 5 groups: a) colibacillosis group without treatment, b) colibacillosis group with 500 mg/kg BW of phyllanthus, c) colibacillosis group with 300 mg/kg BW of turmeric, d) colibacillosis group with phyllanthus and turmeric combination (1:1), e) colibacillosis group with combination of phyllanthus and turmeric (1:2) . After 21 days of treatment, blood and liver sample were collected. The hematological profile (hemoglobin, hematocrit, erythrocyte and leukocyte counts) and liver histology were examined. The result were analyzed statistically by one-way...
Background and Aim: Anthrax is a non-contagious infectious disease caused by Bacillus anthracis. ... more Background and Aim: Anthrax is a non-contagious infectious disease caused by Bacillus anthracis. The bacteria form spores that are resistant to extreme conditions and can contaminate the environment for decades. This study aimed to detect and characterize B. anthracis found in endemic areas of anthrax in Yogyakarta and Central Java province, Indonesia. Materials and Methods: Soil samples were collected from Gunungkidul regency, Yogyakarta province (n=315) and Boyolali regency, Central Java province (n=100). Additional soil samples (n=10) and straw samples (n=5) were obtained from Pati regency, Central Java province. The isolation and identification of B. anthracis were performed using conventional methods: Morphology of bacteria colony in solid media, Gram staining, capsule staining, spores staining, and motility test. Isolates were further identified using polymerase chain reaction (PCR) against Ba813, lef (pXO1), and capC (pXO2) gene. An avirulent vaccine strain of B. anthracis (s...
Background and Aim: Avian pox is a contagious disease caused by the avian pox virus (APV). Mangos... more Background and Aim: Avian pox is a contagious disease caused by the avian pox virus (APV). Mangostin and γ-mangostin in mangosteen rind (MR) and gingerol in red ginger (RG) exhibit antiviral activity. In this study, we evaluated the effect of MR and RG ethanolic extracts on APV based on pock lesions on the chorioallantoic membrane (CAM) of specific pathogen-free (SPF) embryonated chicken eggs (ECEs). Materials and Methods: Three APVs from chicken isolates (C1, C2, and C3), one APV from a pigeon isolate (P), 1.5% and 3% MR ethanolic extract, 5% and 10% RG ethanolic extract, and a combination of 1.5% MR and 5% RG at 0.1 mL/ egg were inoculated in ovo (7th day incubation, chorioallantoic route) in SPF ECEs. A control group inoculated in ovo with APV alone was also established. Each treatment consisted of three replicates. Parameters including embryo survival, CAM lesions, and average number of pock lesions were determined. Results: In ovo inoculation of MR and RG ethanolic extracts was...
Background and Objective: Colibacillosis caused by Escherichia coli (E. coli ) and can cause econ... more Background and Objective: Colibacillosis caused by Escherichia coli (E. coli ) and can cause economic losses in the poultry industry. One of the failures to overcome colibacillosis is the occurrence of bacterial resistance to some antibiotics. This study aimed to determine the effect of Phyllanthus niruri and Curcuma longa on the function of liver and renal layer chicken infected E. coli. Methodology: Fifty layers (DOC) were used in this study. After having infected E. coli, the layers were grouped into 5 and labeled with groups A, B, C, D and E. Group A was those who were treated with Curcuma longa 300 mg kgG 1 , group B was treated with Phyllanthus niruri 500 mg kgG 1 , group C was treated with equal dosage (1:1) of Curcuma longa and Phyllanthus niruri, group D was treated with Curcuma longa and Phyllanthus niruri whose dosages were 2: 1 and group E was without herbal treatment. Blood and organ samples were collected at 3 weeks post-herbal-treatment. Blood sample were used for examination of Alanine Transaminase (ALT) and creatinine concentration. Liver and renal samples were for histological examination. The results were analyzed by one-way ANOVA test. Results: Concentration of group B ALT was significantly different with group A, D and E (p<0.05). Group A had the highest ALT concentration i.e., 23.77±0.44 IU LG 1 and Group E (without herbal treatment) had the highest creatinine concentration i.e., 0.38±0.02 mg dLG 1 . Creatinine concentration of group B was significantly different with all treatment groups (p<0.05). Histological observation of liver organs of group A showed infiltration of heterophile cells in the kiernan trigonum areas. Histological observation of renal organs showed that all groups were normal and there was no pathology. Conclusion: Phyllanthus niruri does not cause toxic effects for 21 days, so it can be alternative in the treatment of infectious disease of diarrhea caused by E. coli.
Biodiversitas Journal of Biological Diversity, 2020
The aims of this study were to determine the susceptibility pattern of phenotypic antibiotics on ... more The aims of this study were to determine the susceptibility pattern of phenotypic antibiotics on extendedspectrum beta-lactamases (ESBL) genes and genotype profiles of ESBL producing Escherichia coli strains isolated from cloacal samples of laying hens in Blitar. A total of 165 cloacal swab samples were successfully isolated 145 E. coli strains during the study taken from 5 subdistricts in Blitar. All the strains were examined for antibiotic resistance patterns by disk diffusion method with doubledisk synergy test (DDST), followed testing with VITEK ® 2 methods, molecular identification of ESBL coding genes using PCR. The results of this study showed that the characterization of nucleotide analysis from PCR amplification of ESBL-producing E. coli bacteria isolated from laying hens in Blitar showed that eight isolates were the dominant of CTX gene, followed by the TEM encoding gene of two isolates, and the SHV coding gene as much as one isolate. The presence of more than 1 encoding genes in the E. coli bacterial isolate was seen in 1 isolate, where the isolate carried the CTX gene and the SHV gene as well. All ESBL producing E. coli isolates were resistant to amoxicillin, ampicillin, cefazolin, cefotaxime, and ceftriaxone, and these ESBL isolates were more than 70% resistant to gentamicin, aztreonam, and trimethoprim/sulfamethoxazole. These results indicated that poultry is a potential reservoir for ESBLproducing E. coli. The presence of ESBL-producing E. coli in poultry requires strengthening antibiotic policy. This is important because the regulation of antibiotic use in poultry is gaining momentum to increase animal productivity and food safety in Blitar, Indonesia.
This study aimed to determine the resistance profile and the nature of multidrug resistance in Ex... more This study aimed to determine the resistance profile and the nature of multidrug resistance in Extended Spectrum Beta Lactamase (ESBL)-producing Escherichia coli (E.coli) against several classes of antibiotics. Positive isolates of ESBL-producing E.coli were tested for antibiotic sensitivity using the VITEK® 2 compact method which then analyzed automatically. The results showed an antibiotic resistance profile against ESBL-producing E.coli showed the highest level of antibiotics in beta lactam, amoxicillin, ampicillin, cefazolin, cefotaxime, and ceftriaxone at 100%. Subsequent results found a relatively high level of resistance in the antibiotics aztreonam (86.36%), trimethoprim/sulfamethoxazole (77.27%), gentamicin (72.73%), and ciprofloxacin (68.18%). Antibiotics from carbapenem groups such as ertapenem and memenem, and antibiotics from the aminoglycosides (amicasin) and tigecycline groups of tetracycline still showed a high sensitivity level of 100%. The most common resistance pa...
Aim: Previous research has shown that bovine herpesvirus-1 (BHV-1) in Indonesia was closely relat... more Aim: Previous research has shown that bovine herpesvirus-1 (BHV-1) in Indonesia was closely related to subtype-1 based on glycoprotein D genes. This study aimed to analyze the genetic variability of the BHV-1 isolated from the recent case in Indonesia not only based on gD but also other genes such as gB and gM and to study the homology and similarity of the sample to other BHV-1 isolated in other countries or regions. Materials and Methods: Samples were drawn from the tracheal organ in recent field case and prepared for DNA extraction. The gB, gD, and gM were amplified using nested polymerase chain reaction (nPCR) with our specifically designed primer pair and based on the specified bands of 350 bp gB, 325 bp gD, and 734 bp gM confirmed as BHV-1. The PCR product was ligated into pGEM-T and transformed into competent Escherichia coli. The purified plasmid was subsequently sequenced. The virus sample isolated from the recent field case of infectious bovine rhinotracheitis (IBR) from Indonesia showed variability based on the gB, gD, and gM sequences. However, all of the genes had high similarity (98-100%) to BHV-1.2. The recent field case of IBR in Indonesia was similar to BHV-1.2.
Considering the increasing incidence of infectious bovine rhinotracheitis (IBR) in Indonesia, it ... more Considering the increasing incidence of infectious bovine rhinotracheitis (IBR) in Indonesia, it is necessary to conduct a more in-depth study of bovine herpesvirus-1 (BHV-1) as the causative agent of IBR disease. Previous research reports indicate that one of the BHV-1 subtypes found in Indonesia is the subtype 1.1. Currently, IBR field case detection in Indonesia still uses the serological method (ELISA) that has the potential to give false positive results and cannot explain the virus subtype. Other detection methods such as viral isolation methods take longer time and require adequate resources. This study aimed to determine the BHV-1 subtypes of Indonesian isolates using molecular techniques. The nested PCR using two pairs of primers has succeeded. The nested PCR using two pairs of primers has succeeded to amplify the glycoprotein D (gD) gene. The gD gene fragment was cloned into the pGEM-T plasmid. The analysis of the gD gene sequence was carried out to determine the BHV-1 cha...
IOP Conference Series: Earth and Environmental Science, 2019
This study aimed at replacing the use of antibiotic growth promoters (AGP) as the feed additive w... more This study aimed at replacing the use of antibiotic growth promoters (AGP) as the feed additive with the Zingiber zerumbet (L.) Smith extract (ZZE) to control Salmonellosis in broiler chickens. This study employed the completely randomized design (CRD), five treatments, namely: T0 (basal diet), T1 (basal diet + S. enteridis infection), T2 (basal diet + S. enteridis infection + 0.33 % ZZE), T3 (basal diet + S. enteridis infection + 0.67 % ZZE), and T4 (basal diet + S. enteridis infection + 1 % ZZE). The addition of the Z. zerumbet extract did not seem to affect the production performances, in which the average feed consumption was 69.38 g ± 4.43 g to 72.71 g ± 4.92 g, body weight gain was 35.67 g ± 1.40 g to 38.30 g ± 3.85 g, feed conversion was 1.89 ± 0.11 to 2.04 ± 0.11, final weight was 1 287.80 g ± 49.97 g up to 1 380.50 g ± 134.90 g, and percentage of carcass was 60.90 % to 68.48 %. However, the use of Z. zerumbet extract with the highest concentration at 1 % decreased the crude...
Telah dilakukan penelitian tentang efektivitas antibiotika golongan fluoroquinolon (flumequin dan... more Telah dilakukan penelitian tentang efektivitas antibiotika golongan fluoroquinolon (flumequin dan enrofloksasin) terhadap Salmonella dan E. coli yang diisolasi dari saluran pencernaan ular sanca batik (Python reticulatus). Penelitian ini bertujuan untuk mengetahui efektivitas fluoroquinolon terhadap infeksi saluran pencernaan pada ular dan reptil pada umumnya. Penelitian dilakukan dengan menggunakan 8 ekor sanca batik dewasa yang menderita gangguan pencernaan dengan lesi klinis berupa mouthrot. Sampel ulas kloaka dan mulut serta sampel darah diambil dari semua ular, untuk selanjutnya dilakukan uji mikrobiologis berupa isolasi dan identifikasi bakteri melalui media Brilliant Green Agar (BGA), Mc Conkay Agar (MCA), Triple Sugar Iron (TSI) dan media biakan murni. Isolat murni yang didapatkan adalah Salmonella spp. dan E. coli dan selanjutnya dilakukan uji sensitivitas bakteri terhadap flumequin dan enrofloksasin serta penentuan Minimum Inhibitory Concentration (MIC) untuk enrofloksasin...
Avian influenza virus is poultry viral disease, which causes high economic losses. Various effort... more Avian influenza virus is poultry viral disease, which causes high economic losses. Various efforts have been made to control the disease. One effort is required screening fast and precise diagnostic test. This study was aimed to determine the potential of rapid test kit of AIV/H5 Anigen Rapid Test for the detection of AI virus types A and subtype H5 in the field. Some tests were carried out, e.g.: the potential test, cross-reaction test, sensitivity and specificity test. Potency test was done to evaluate potential of detection limits of the kit, by having the test of serial dilution of AI virus positive control. Cross-reaction test was done to detect antigens other than AI virus H5N1, e.g.: IB virus of Massachuset strain, IBV strain 4-91, Newcastle Disease virus, and Escherichia coli. Sensitivity and specificity test were applied to the filed samples which clinically and laboratory were confirmed as H5N1 positive. To confirm the result of rapid test was then being done by reverse t...
The nature of Escherichia coli's resistance to antibiotics results in limited treatment options. ... more The nature of Escherichia coli's resistance to antibiotics results in limited treatment options. Further development of bacterial resistance can lead to the emergence of multidrug resistance, there by increasing morbidity and mortality. The interaction of the spread of multidrug resistance Escherichia coli that occur in populations is very complex, so it is difficult to understand the dynamics of large-scale spread. The modeling approach becomes very important for decision making for disease control programs. This research is a descriptive analytic epidemiological study with a cross-sectional design. Sampling was conducted by stratified random sampling with a total sample of 73 farms. Data analysis uses linear regression analysis. The results of the distribution cases of multidrug resistance Escherichia coli in commercial chicken farms, Blitar District showed a prevalence of 95.9%. Risk factor correlations showed that chicken species, breeders education, breed types, feed types, veterinary support, chlorine in water, antibiotic programs, and antibiotic references were significant risk factors correlated with the incidence of Escherichia coli multidrug resistance. Linear regression modeling shows Y=0.52+0.15NonPddkPT+0.19JUMitra-0.15SaniKan+0.15ProgAb, with wilk saphiro W=0.9701. The equation model can be a reference in efforts to prevent and control the prevalence of Escherichia coli multidrug resistance in commercial chicken farms. Animal husbandry management and antibiotic use programs as disease prevention need to be aware, because it is a risk factor that can increase the prevalence of Escherichia coli multidrug resistance in commercial chicken farms, while sanitary cage hygiene needs to be improved because it can reduce or prevent the prevalence of Escherichia coli multidrug resistance in commercial chicken farms.
Dewasa ini dilaporkan banyak kasus pada burung merpati (Columba Livia) dan burung tekukur (Strept... more Dewasa ini dilaporkan banyak kasus pada burung merpati (Columba Livia) dan burung tekukur (Streptopilia Chinensis) menunjukkan gejala syaraf, terutama: tortikolis, dan kepala gemetar, yang merupakan indikasi penyakit Newcastle Disease (ND). Kedua spesies burung tersebut banyak berkeliaran di lokasi farm ayam komersial untuk mencari pakan. Kondisi tersebut dapat bertindak sebagai faktor penular penyakit ND. Penelitian ini bertujuan mendeteksi virus ND pada burung merpati dan burung tekukur yang memperlihatkan gejala saraf, dengan uji serologis dan molekuler. Sampel darah diambil dari vena brakhialis, diproses untuk mendapatkan serum darah. Serum tersebut selanjutnya diuji dengan uji hemaglutinasi inhibisi (HI), untuk mendeteksi titer antibodi ND. Sampel pool otak, trakea, dan lien diekstraksi RNA-nya dan diamplifikasi dengan primer spesifik gen F virus ND. Sampel pool tersebut juga dikultur pada telur ayam berembrio specific pathogen free (TAB-SPF). Identifikasi dilakukan dengan uji ...
Sifat resistensi bakteri Escherichia coli terhadap antibiotik mengakibatkan terbatasnya pilihan p... more Sifat resistensi bakteri Escherichia coli terhadap antibiotik mengakibatkan terbatasnya pilihan pengobatan. Perkembangan lebih lanjut dari resistensi bakteri dapat menyebabkan munculnya multidrug resistance pada bakteri, sehingga meningkatkan morbiditas dan mortalitas penyakit. Interaksi penyebaran kejadian multidrug resistance pada Escherichia coli yang terjadi pada populasi sangat kompleks, sehingga sulit memahami dinamika penyebaran berskala besar. Pendekatan pemodelan menjadi sangat penting untuk pengambilan keputusan tentang program pengendalian penyakit infeksi. Penelitian ini merupakan penelitian epidemiologi deskriptif analitik dengan desain cross-sectional study. Metode analisis menggunakan analisis regresi logistic untuk mendapatkan pemodelan kejadian multidrug resistance bakteri Escherichia coli pada tingkat ternak, dan menggunakan regresi linier untuk mendapatkan pemodelan kejadian multidrug resistance bakteri Escherichia coli pada tingkat peternakan. Hasil dari penelit...
Biodiversitas Journal of Biological Diversity, 2020
This study was aimed to determine the incidence of Extended-Spectrum Beta-Lactamase (ESBL) produc... more This study was aimed to determine the incidence of Extended-Spectrum Beta-Lactamase (ESBL) producing Escherichia coli on layer chicken in Blitar area. This was a cross-sectional study with a total of 205 cloacal swabs of layer chicken taken randomly. The sample was in isolation identification on MacConkey media and ESBL confirmation test produced by Escherichia coli was then carried out by the Double Disc Synergy Test (DDST) method and the VITEK® 2 Compact Automated System method. This study showed that 185 (90.24%) isolates of positive Escherichia coli from a total of 205 samples of cloacal swabs of the layer chicken. The incidence of ESBL-producing Escherichia coli in cloacal swabs on layer chicken with the Double Disc Synergy Test (DDST) method and the VITEK® 2 compact automatic method was 13 (7.03%). Results in this study indicated that layer chicken has potential as reservoir for spreading ESBL to public health and needs strict hygienic measures to prevent their transmission to humans.
Chicken is a major source of animal protein consumption in Indonesia. The problem facing the poul... more Chicken is a major source of animal protein consumption in Indonesia. The problem facing the poultry industry is the incidence of resistance which increases mortality of the chicken production. One of the causes of resistance case is the use of antibiotics in feed additives. The public understanding about the effects of the use of antibiotic growth promoters (AGP) in chickens in antibiotic resistance and the digestive tract of chicken needs to be done to avoid the impact on economic losses and health problems. This study aims to provide an understanding of the effects of the use of antibiotic growth promoters (AGP) on antibiotic resistance and the digestive tract of broiler chickens. This study was carried out at a broiler chicken farm in Sleman, Yogyakarta. Based on the histopathological result of the digestive tract of chickens that were given antibiotics as AGP, there was no inflammation occurs, but the administration of antibiotics caused antibiotic resistance in various type of...
Highly pathogenic avian influenza virus (HPAI) differ from Low pathogenic avian influenza virus (... more Highly pathogenic avian influenza virus (HPAI) differ from Low pathogenic avian influenza virus (LPAI) based on multiple basic amino acid motif of the carboxylterminus of HA1, especially arginine and lysine. The propose of this work was toamplify and sequence the cleavage site region of HA gene of avian influenza virusisolated from both cases with characteristic or unspecific lesion, using reversetranscriptase polymerase chain reaction (RT-PCR). Primer desaigned for amplification and sequence was H5-F: 5’ ggagactcagcaatcccatgaaaag 3’ and H5- R:5’ccataccaaccgtctaccattcc 3’, and expected product size was 246 bp. The result indicated that all avian influenza virus (AIV)-isolates originated from chicken with both specific and non specific lesion show a multiple basic amino acid motif -PQRERRRKKR//GLF- and classified as highly pathogenic avian influenza. Philogenetic study of HA genefragment indicated that each type of characteristic lesion created philo-groups. Key words: avian influenz...
Aeromonas hydrophila telah diidentifikasi sebagai agen penyebab penyakit pada ikan Nila. Mikroorg... more Aeromonas hydrophila telah diidentifikasi sebagai agen penyebab penyakit pada ikan Nila. Mikroorganisme ini diketahui patogen terhadap manusia terutama sebagai penyebab gastroentritis, meskipun demikian, belum dilaporkan adanya infeksi pada manusia di Yogyakarta. Uji karakteristik biokimiawi dapat mengarahkan pada diagnosa yang kurang akurat, oleh karena itu terdapat kebutuhan untuk mengembangkan metode yang lebih spesifik dan akurat, yaitu dengan metode agar gel presipitasi (AGP). Dua sampel yang dikoleksi berasal dari lokasi budidaya ikan Nila di Yogyakarta yang terjadi outbreak A. hydrophila dengan mortalitas lebih dari 50%. Antigen terlarut yang tahan terhadap panas dipersiapkan dari 4 kultur isolat murni yang diperoleh untuk uji AGP. Antiserum yang digunakan untuk uji pada sumuran adalah antiserum A. hydrophila (ATCC 35654) yang diproduksi dengan menginokulasikan whole-cell antigen (heat-stable) dan antigen flagellar (formalin-killed) pada kelinci. Kontrol positif yang digunaka...
Colibacillosis a disease that can cause considerable economic loss, remains an important health p... more Colibacillosis a disease that can cause considerable economic loss, remains an important health problem. Phyllanthus (Phyllanthus niruri L) and turmeric (Curcuma domestica) are herbs that can be used as immunomodulators. This study was aimed to determine the level of safety of the combination of phyllanthus and turmeric on hematology profile and liver histopathology of layers with colibacillosis. The layers were assigned to the following of 5 groups: a) colibacillosis group without treatment, b) colibacillosis group with 500 mg/kg BW of phyllanthus, c) colibacillosis group with 300 mg/kg BW of turmeric, d) colibacillosis group with phyllanthus and turmeric combination (1:1), e) colibacillosis group with combination of phyllanthus and turmeric (1:2) . After 21 days of treatment, blood and liver sample were collected. The hematological profile (hemoglobin, hematocrit, erythrocyte and leukocyte counts) and liver histology were examined. The result were analyzed statistically by one-way...
Background and Aim: Anthrax is a non-contagious infectious disease caused by Bacillus anthracis. ... more Background and Aim: Anthrax is a non-contagious infectious disease caused by Bacillus anthracis. The bacteria form spores that are resistant to extreme conditions and can contaminate the environment for decades. This study aimed to detect and characterize B. anthracis found in endemic areas of anthrax in Yogyakarta and Central Java province, Indonesia. Materials and Methods: Soil samples were collected from Gunungkidul regency, Yogyakarta province (n=315) and Boyolali regency, Central Java province (n=100). Additional soil samples (n=10) and straw samples (n=5) were obtained from Pati regency, Central Java province. The isolation and identification of B. anthracis were performed using conventional methods: Morphology of bacteria colony in solid media, Gram staining, capsule staining, spores staining, and motility test. Isolates were further identified using polymerase chain reaction (PCR) against Ba813, lef (pXO1), and capC (pXO2) gene. An avirulent vaccine strain of B. anthracis (s...
Background and Aim: Avian pox is a contagious disease caused by the avian pox virus (APV). Mangos... more Background and Aim: Avian pox is a contagious disease caused by the avian pox virus (APV). Mangostin and γ-mangostin in mangosteen rind (MR) and gingerol in red ginger (RG) exhibit antiviral activity. In this study, we evaluated the effect of MR and RG ethanolic extracts on APV based on pock lesions on the chorioallantoic membrane (CAM) of specific pathogen-free (SPF) embryonated chicken eggs (ECEs). Materials and Methods: Three APVs from chicken isolates (C1, C2, and C3), one APV from a pigeon isolate (P), 1.5% and 3% MR ethanolic extract, 5% and 10% RG ethanolic extract, and a combination of 1.5% MR and 5% RG at 0.1 mL/ egg were inoculated in ovo (7th day incubation, chorioallantoic route) in SPF ECEs. A control group inoculated in ovo with APV alone was also established. Each treatment consisted of three replicates. Parameters including embryo survival, CAM lesions, and average number of pock lesions were determined. Results: In ovo inoculation of MR and RG ethanolic extracts was...
Background and Objective: Colibacillosis caused by Escherichia coli (E. coli ) and can cause econ... more Background and Objective: Colibacillosis caused by Escherichia coli (E. coli ) and can cause economic losses in the poultry industry. One of the failures to overcome colibacillosis is the occurrence of bacterial resistance to some antibiotics. This study aimed to determine the effect of Phyllanthus niruri and Curcuma longa on the function of liver and renal layer chicken infected E. coli. Methodology: Fifty layers (DOC) were used in this study. After having infected E. coli, the layers were grouped into 5 and labeled with groups A, B, C, D and E. Group A was those who were treated with Curcuma longa 300 mg kgG 1 , group B was treated with Phyllanthus niruri 500 mg kgG 1 , group C was treated with equal dosage (1:1) of Curcuma longa and Phyllanthus niruri, group D was treated with Curcuma longa and Phyllanthus niruri whose dosages were 2: 1 and group E was without herbal treatment. Blood and organ samples were collected at 3 weeks post-herbal-treatment. Blood sample were used for examination of Alanine Transaminase (ALT) and creatinine concentration. Liver and renal samples were for histological examination. The results were analyzed by one-way ANOVA test. Results: Concentration of group B ALT was significantly different with group A, D and E (p<0.05). Group A had the highest ALT concentration i.e., 23.77±0.44 IU LG 1 and Group E (without herbal treatment) had the highest creatinine concentration i.e., 0.38±0.02 mg dLG 1 . Creatinine concentration of group B was significantly different with all treatment groups (p<0.05). Histological observation of liver organs of group A showed infiltration of heterophile cells in the kiernan trigonum areas. Histological observation of renal organs showed that all groups were normal and there was no pathology. Conclusion: Phyllanthus niruri does not cause toxic effects for 21 days, so it can be alternative in the treatment of infectious disease of diarrhea caused by E. coli.
Biodiversitas Journal of Biological Diversity, 2020
The aims of this study were to determine the susceptibility pattern of phenotypic antibiotics on ... more The aims of this study were to determine the susceptibility pattern of phenotypic antibiotics on extendedspectrum beta-lactamases (ESBL) genes and genotype profiles of ESBL producing Escherichia coli strains isolated from cloacal samples of laying hens in Blitar. A total of 165 cloacal swab samples were successfully isolated 145 E. coli strains during the study taken from 5 subdistricts in Blitar. All the strains were examined for antibiotic resistance patterns by disk diffusion method with doubledisk synergy test (DDST), followed testing with VITEK ® 2 methods, molecular identification of ESBL coding genes using PCR. The results of this study showed that the characterization of nucleotide analysis from PCR amplification of ESBL-producing E. coli bacteria isolated from laying hens in Blitar showed that eight isolates were the dominant of CTX gene, followed by the TEM encoding gene of two isolates, and the SHV coding gene as much as one isolate. The presence of more than 1 encoding genes in the E. coli bacterial isolate was seen in 1 isolate, where the isolate carried the CTX gene and the SHV gene as well. All ESBL producing E. coli isolates were resistant to amoxicillin, ampicillin, cefazolin, cefotaxime, and ceftriaxone, and these ESBL isolates were more than 70% resistant to gentamicin, aztreonam, and trimethoprim/sulfamethoxazole. These results indicated that poultry is a potential reservoir for ESBLproducing E. coli. The presence of ESBL-producing E. coli in poultry requires strengthening antibiotic policy. This is important because the regulation of antibiotic use in poultry is gaining momentum to increase animal productivity and food safety in Blitar, Indonesia.
This study aimed to determine the resistance profile and the nature of multidrug resistance in Ex... more This study aimed to determine the resistance profile and the nature of multidrug resistance in Extended Spectrum Beta Lactamase (ESBL)-producing Escherichia coli (E.coli) against several classes of antibiotics. Positive isolates of ESBL-producing E.coli were tested for antibiotic sensitivity using the VITEK® 2 compact method which then analyzed automatically. The results showed an antibiotic resistance profile against ESBL-producing E.coli showed the highest level of antibiotics in beta lactam, amoxicillin, ampicillin, cefazolin, cefotaxime, and ceftriaxone at 100%. Subsequent results found a relatively high level of resistance in the antibiotics aztreonam (86.36%), trimethoprim/sulfamethoxazole (77.27%), gentamicin (72.73%), and ciprofloxacin (68.18%). Antibiotics from carbapenem groups such as ertapenem and memenem, and antibiotics from the aminoglycosides (amicasin) and tigecycline groups of tetracycline still showed a high sensitivity level of 100%. The most common resistance pa...
Aim: Previous research has shown that bovine herpesvirus-1 (BHV-1) in Indonesia was closely relat... more Aim: Previous research has shown that bovine herpesvirus-1 (BHV-1) in Indonesia was closely related to subtype-1 based on glycoprotein D genes. This study aimed to analyze the genetic variability of the BHV-1 isolated from the recent case in Indonesia not only based on gD but also other genes such as gB and gM and to study the homology and similarity of the sample to other BHV-1 isolated in other countries or regions. Materials and Methods: Samples were drawn from the tracheal organ in recent field case and prepared for DNA extraction. The gB, gD, and gM were amplified using nested polymerase chain reaction (nPCR) with our specifically designed primer pair and based on the specified bands of 350 bp gB, 325 bp gD, and 734 bp gM confirmed as BHV-1. The PCR product was ligated into pGEM-T and transformed into competent Escherichia coli. The purified plasmid was subsequently sequenced. The virus sample isolated from the recent field case of infectious bovine rhinotracheitis (IBR) from Indonesia showed variability based on the gB, gD, and gM sequences. However, all of the genes had high similarity (98-100%) to BHV-1.2. The recent field case of IBR in Indonesia was similar to BHV-1.2.
Considering the increasing incidence of infectious bovine rhinotracheitis (IBR) in Indonesia, it ... more Considering the increasing incidence of infectious bovine rhinotracheitis (IBR) in Indonesia, it is necessary to conduct a more in-depth study of bovine herpesvirus-1 (BHV-1) as the causative agent of IBR disease. Previous research reports indicate that one of the BHV-1 subtypes found in Indonesia is the subtype 1.1. Currently, IBR field case detection in Indonesia still uses the serological method (ELISA) that has the potential to give false positive results and cannot explain the virus subtype. Other detection methods such as viral isolation methods take longer time and require adequate resources. This study aimed to determine the BHV-1 subtypes of Indonesian isolates using molecular techniques. The nested PCR using two pairs of primers has succeeded. The nested PCR using two pairs of primers has succeeded to amplify the glycoprotein D (gD) gene. The gD gene fragment was cloned into the pGEM-T plasmid. The analysis of the gD gene sequence was carried out to determine the BHV-1 cha...
IOP Conference Series: Earth and Environmental Science, 2019
This study aimed at replacing the use of antibiotic growth promoters (AGP) as the feed additive w... more This study aimed at replacing the use of antibiotic growth promoters (AGP) as the feed additive with the Zingiber zerumbet (L.) Smith extract (ZZE) to control Salmonellosis in broiler chickens. This study employed the completely randomized design (CRD), five treatments, namely: T0 (basal diet), T1 (basal diet + S. enteridis infection), T2 (basal diet + S. enteridis infection + 0.33 % ZZE), T3 (basal diet + S. enteridis infection + 0.67 % ZZE), and T4 (basal diet + S. enteridis infection + 1 % ZZE). The addition of the Z. zerumbet extract did not seem to affect the production performances, in which the average feed consumption was 69.38 g ± 4.43 g to 72.71 g ± 4.92 g, body weight gain was 35.67 g ± 1.40 g to 38.30 g ± 3.85 g, feed conversion was 1.89 ± 0.11 to 2.04 ± 0.11, final weight was 1 287.80 g ± 49.97 g up to 1 380.50 g ± 134.90 g, and percentage of carcass was 60.90 % to 68.48 %. However, the use of Z. zerumbet extract with the highest concentration at 1 % decreased the crude...
Telah dilakukan penelitian tentang efektivitas antibiotika golongan fluoroquinolon (flumequin dan... more Telah dilakukan penelitian tentang efektivitas antibiotika golongan fluoroquinolon (flumequin dan enrofloksasin) terhadap Salmonella dan E. coli yang diisolasi dari saluran pencernaan ular sanca batik (Python reticulatus). Penelitian ini bertujuan untuk mengetahui efektivitas fluoroquinolon terhadap infeksi saluran pencernaan pada ular dan reptil pada umumnya. Penelitian dilakukan dengan menggunakan 8 ekor sanca batik dewasa yang menderita gangguan pencernaan dengan lesi klinis berupa mouthrot. Sampel ulas kloaka dan mulut serta sampel darah diambil dari semua ular, untuk selanjutnya dilakukan uji mikrobiologis berupa isolasi dan identifikasi bakteri melalui media Brilliant Green Agar (BGA), Mc Conkay Agar (MCA), Triple Sugar Iron (TSI) dan media biakan murni. Isolat murni yang didapatkan adalah Salmonella spp. dan E. coli dan selanjutnya dilakukan uji sensitivitas bakteri terhadap flumequin dan enrofloksasin serta penentuan Minimum Inhibitory Concentration (MIC) untuk enrofloksasin...
Avian influenza virus is poultry viral disease, which causes high economic losses. Various effort... more Avian influenza virus is poultry viral disease, which causes high economic losses. Various efforts have been made to control the disease. One effort is required screening fast and precise diagnostic test. This study was aimed to determine the potential of rapid test kit of AIV/H5 Anigen Rapid Test for the detection of AI virus types A and subtype H5 in the field. Some tests were carried out, e.g.: the potential test, cross-reaction test, sensitivity and specificity test. Potency test was done to evaluate potential of detection limits of the kit, by having the test of serial dilution of AI virus positive control. Cross-reaction test was done to detect antigens other than AI virus H5N1, e.g.: IB virus of Massachuset strain, IBV strain 4-91, Newcastle Disease virus, and Escherichia coli. Sensitivity and specificity test were applied to the filed samples which clinically and laboratory were confirmed as H5N1 positive. To confirm the result of rapid test was then being done by reverse t...
Uploads
Papers by Tri Untari