cracking open a lukewarm one with the nobody

cracking open a boiling one with the felt absence of people who will never be there again


asker portrait
mayonnaise-sock asked:

If the creator or something explicitly states they don’t want two characters shipped will you respect it?

moniquill:

yesornopolls:

If the creator or something explicitly states they don’t want two characters shipped will you respect it?

Yes

No

As a creator? Making such a request is a weird thing to do. Like interacting with reviews (specifically fighting with people you think have given you bad ones), it’s a boundary-breaking behavior. You should not, generally, be in the fandom space of your own work. Once you publish a work, you have no control and no input about how it’s received, interacted with, reflected upon, etc. You can give extra or clarifying information when asked questions but that is, fundamentally, NOT CANON.

Bring back a sense of basic professionalism.

image

The neighbor's zucchini must be starting early this year

“We need better public transit and more passenger railways” — fuck yeah I’m all about this~

“… and we need to actively discourage people from owning and driving cars and it should be illegal actually” — FUCK NO.

I don’t know why pro-public transit people have to be so obnoxious about this and ostracize people who would otherwise support their cause. I also find it amusing that they’re more than willing to be massive dicks to me for not hating on cars, until I mention I’m disabled and immune compromised and a lot of times not being able to go DIRECTLY from point A to point B (and limit my exposure to other people’s germs) will stop me from being able to do things and go places. At which point they usually stop engaging with me because I don’t fit the stereotype of disabled and unable to drive.

Overall, a lot of causes shoot themselves in both feet by saying that in order to do X thing (which most people would agree is positive) they need to take Y away from you (for no good reason).

We do NOT need to ban cars, but we (In the US) need somewhat more stringent laws regarding vehicle size, sight-lines, and fuel efficiency. Cars are good! And Necessary!

Pavement princess land yachts are not.

An important thing to understand about revolutions is that regardless of theme and goal they offer no real guarantee of major overhaul of the--the institutional habits of a place.

When you hear of a post-revolutionary government engaging in brutal excesses of some kind, there's a very high chance that if you look closely, it will turn out to be a slight remix of the bullshit of the previous regime.

Easy one is the French Revolution, with its notorious spree of increasingly off-topic decapitations. Easy to center the social destabilization and lure of guillotine and so forth in interpreting this, but also.

The kings of France had for a long time been inordinately fond, even by the standards of medieval monarchs, of staging highly conspicuous mass executions of traitors, as an example to the rest.

The high-handed nationalization strategies of the soviet government and the speed with which Lenin pivoted to making war against his own peasants for withholding resources becomes perfectly legible when you place it in the context that imperial russia had been working on centralizing and modernizing the state via methods like 'nationalizing the serfs' (transferring increasing numbers of unfree farmers, which was a whole lot of them, to crown/state ownership and then leasing some of them out to large landholders for $$) for the past century or so; soviet rule reorganized a lot of things but didn't on some levels change the attitudes and patterns of how government related to the people that much at all, when you came down to it.

In post-Revolutionary Iran, the veil police roaming around oppressing women on the street becomes much less shocking and more predictable when you know that the Pahlavi shahs, in their modernization-by-fiat project, had the cops go around Tehran beating men who wore incorrect hats and stripping women who persisted in veiling to their underwear. In the street.

Very high statistical chance that your revolution will not come equipped with new tools for the exercise of power, or a whole new population of individuals with no preconceptions or habits to interpret and enact your policies, and will consequently tend to keep doing the same things slightly differently.

Anyone who doesn't understand how likely this is is especially unlikely to avoid it.

I wish depression were an emergency. I wish someone could take one look at how sick I am and go “oh my god, we need to get you to a hospital!” and then when we get there I get rushed into surgery and the surgeons say “it’s a good thing you brought her here when you did, this is a seriously advanced case” and then they put me under and spend the next ten hours pulling metres of long, sticky black strands of gunk out of my body, throwing it immediately into an incinerator so that it can’t infect anyone else. And then they could stitch me back up and I could rest a few days, and when I leave the hospital everyone can see how much better I am and they congratulate me saying “well done, you’ve been so brave, I’m so glad you’re ok. I love you.”

what you need to understand is that textile work is basically the closest i have seen to Real Magic and the reason old ladies in quilting spaces are either the grumpiest or the most whacky cheerful people you'll ever meet is because they're basically wizards who have studied the ancient crafts too long

"knitting circle" ma'am that's a coven

Golden belly

tonysopranobignaturals-deactiva

image

OMG???? FUCKING EMERGANCY

 “hi welcome to mcdonalds what can i get for you?”

“yeah can i get a deluxe quarter pounder with cheese?”

“absolutely, do you want the meal or just the sandwich?’

“uuuuuh hold on”

*fishes something out of my pocket*

“mikey what do i do?”

image

“get the fries. youll need the energy in the coming days”

*stuffs it back in my pocket*

“uhh yes please  the meal would be great”

String identified:
ctcaatcagtacagtaattcatattattactgtctatgtttgtcgattacctatagat

Closest match: Udea ferrugalis genome assembly, chromosome: 11
Common name: Rusty Dot Pearl

image

(image source)

sorry but someone assuming you have "left a fandom" when you don't post about it a lot anymore feels like bilbo coming home to the sackville bagginses having him presumed dead and selling all his stuff. girl i was just on a little quest????

The filter relies on manually curated open-source blocklists, including the ‘nuclear’ list, provided by uBlockOrigin and uBlacklist Huge AI Blocklist,” DuckDuckGo said in a post on X. “While it won’t catch 100% of AI-generated results, it will greatly reduce the number of AI-generated images you see.

image
image

Left: AI filter is off Right: AI filter is on

Another tip for DDG - if you want to permanently get rid of DDG's AI features (which you can turn off in settings, but only temporarily) - for now you can just use noai.duckduckgo.com as your search engine. Works as advertised in the name.

image

I’m not going to explain myself

thanks to this workplace harassment training video my coworkers and I now say this to each other on a near-daily basis

Previous 1 2 3 4 5 Next