Experimental pathology

Nephrology Dialysis Transplantation 27 (Supplement 2): ii427–ii449, 2012 doi:10.1093/ndt/gfs241 EXPERIMENTAL PATHOLOGY SAP330 THE TUBULAR EXPRESSION OF MESENCHYMAL MARKERS INCLUDES EXTRACELLULAR MATRIX PROTEINS Introduction and Aims: Interstitial fibrosis and tubular atrophy (IF/TA) are the major mechanisms of long-term renal graft loss, and no treatment can reverse fibrosis once it has developped. Early markers are needed to assess patients at risk of IF/TA and invent early interventions. Our previous studies showed that tubular epithelial phenotype changes (EPC), reminiscent of the epithelial to mesenchymal transition (EMT) process, constitute an early biomarker that predicts late renal graft fibrosis and loss of function. However, the mechanisms that link EPC and tissue fibrosis remain to be identified. The hypothesis that interstitial fibroblasts may be derived from tubular epithelial cells is vividly disputed. In the present study, we wanted to test the hypothesis that activated epithelial cells exhibiting EMT-like changes could, by an autocrine or paracrine signaling mechanism, produce extracellular matrix components and thereby directly contribute to fibrogenesis, even within renal tubules. Methods: Using immunohistochemistry we detected the presence in tubular cells of a) Connective Tissue Growth Factor (CTGF), a key mediator of fibrogenesis, b) HSP47, an important chaperon protein for collagen synthesis, and 3) laminin, a major component of the basement membranes, in 93 renal graft biopsies from 77 patients. We then analyzed the association between these three molecules and the intensity of two EPC/EMT markers (the de novo expression of vimentin and the translocation of β catenin into the cytoplasm). Results: We observed an up-regulated production of CTGF, hsp47, and laminin in the tubular epithelial cells of most renal transplants. These pro-fibrotic molecules colocalized in tubules showing EPC markers. In particular, the score of expression of the mesenchymal cell marker vimentin was significantly correlated with that of CTGF (r=0.79, p<0.0001), HSP47 (r=0.89, p<0.0001) and laminin (r=0.84, p<0.0001). In addition, the expression of vimentin in renal grafts was significantly correlated with the estimated glomerular filtration rate (r=-0.61, p<0.0001), as well as with the proteinuria (r=0.42, p=0.0006) at the moment of the biopsy. Conclusions: Our present study demonstrates that the phenoytpic switch that epithelial cells undergo in the context of renal transplantation results in the aberrant production of extracellular matrix proteins by tubular cells themselves, thus directly contributing to graft fibrogenesis, and also in the production of pro-fibrotic growth factors such as CTGF, which could activate myofibroblast from a distance, in a paracrine fashion, and similarly accelerate graft fibrogenesis. Overall, the fundamental question of whether or not EMT+ cells do migrate and swell the population of interstitial fibrosis should not eclipse the strong predictive value of EPC with respect to progression of fibrosis. SAP331 1,25-DIHYDROXYVITAMIN D3 SUPPRESSES HIGH GLUCOSE ACTIVATED MACROPHAGE DROVED TUBULAR EPITHELIAL TO MESENCHYMAL TRANSITION IN PROXIMAL TUBULAR EPITHELIAL CELLS Xiaoliang Zhang1 and Yansheng Jin1 Zhong Da Hospital, School of Medicine, Southeast University, Nanjing, China 1 Introduction and Aims: 1,25-dihydroxyvitamin D3 [1,25(OH)2D3] associates with amelioration of renal fibrotic lesions in patients of diabetic nephropathy (DN). Epithelial–mesenchymal transition (EMT) is essential in development of DN and the key process in this issue is the influx of macrophages. Classically activated macrophage may promote fibrosis process,while alternatively activated macrophage play a role in repairing process. The aim of this study is to investigate the effect of 1,25(OH)2D3 on glucose induced macrophage activation and subsequent influence to EMT. Methods: U937 cells were incubated with a glucose-dose dependent manner and a time dependent manner. Activity of intracellular iNOS and cytokines of IL-6, IL-12 and TNF-α in supernatant were measured. The high glucose incubated U937 cells were removed from supernatant and put into HK2 cells followed by co-culturing for 24 hours. a-SMA, fibronectin and E-cadherin in HK2 cells were examined. 1,25(OH) 2D3. pre-treatment with macrophages was done before high glucose treated macrophage being put into HK2 cells for co-culture. Fibroncectin, mannose SAP332 RENAL TUBULAR FLUID SHEAR STRESS FACILITATES MONOCYTE ACTIVATION TOWARDS INFLAMMATORY MACROPHAGES Mathieu Miravete1, Romain Dissard1, Julie Klein1, Julien Gonzalez1, Cécile Caubet1, Christiane Pecher1, Bernard Pipy2, Jean-Loup Bascands1, Muriel Mercier-Bonin3, Joost Schanstra1 and Bénédicte Buffin-Meyer1 1 Inserm U1048, 2Umr-Md3 Ea2405, 3Insa, Ups, Inpt, Lisbp Introduction and Aims: Modified urinary fluid shear stress (FSS) induced by variations of urinary fluid flow and composition is observed in early phases of most kidney diseases. Recently, we reported that renal tubular FSS promotes endothelial cell activation and subsequent adhesion of human monocytes, thereby suggesting that changes in urinary FSS can induce the development of inflammation (BBRC 407: 813-817, 2011). Here, we evaluated the influence of tubular FSS on monocytes as they play an important role in the progression of inflammation in nephropathies. Methods and Results: Human renal tubular cells (HK-2) were exposed to FSS 0.01Pa for 30 min or 5h. Treatment of human THP-1 monocytes with the resulting conditioned medium (FSS-CM) modified the expression of macrophage differentiation markers suggesting differentiation towards the inflammatory M1 type macrophage. The effect was confirmed using freshly isolated human monocytes. In contrast to endothelial cells, the effect of FSS-CM on THP-1 cells did not require TNF-α since it was not modified by neutralization of TNF-α. Cytokine array analysis of FSS-CM identified a number of cytokines potentially involved in monocyte activation, including increased TGF-β and decreased CCL2. Finally, FSS injured HK-2 cells expressed and secreted early biomarkers of tubular damage such as kidney injury molecule 1 (KIM1) and neutrophil gelatinase-associated lipocalin (NGAL). Conclusions: In conclusion, changes in urinary FSS should now also be considered as potential insults for tubular cells that initiate/perpetuate interstitial inflammation. SAP333 CD154 INDUCES MATRIX METALLOPROTEASE-9 SECRETION IN HUMAN PODOCYTES Rigothier Claire1, Claire Rigothier2, Daculsi Richard1, Lepreux Sébastien3, Saleem Moin4, Bourget Chantal1, Combe Christian1 and Ripoche Jean1 1 Inserm U1026, Université Bordeaux 2, Bordeaux, France, 2Inserm U1026, Bordeaux, France, 3Service D’sanatomie Pathologique, Chu Bordeaux, France, 4 Children's Renal Unit and Academic Renal Unit, University of Bristol, Bristol, United Kingdom Introduction and Aims: The CD40/CD154 signalisation is involved in various kidney diseases such as lupus nephritis or renal graft rejection. CD154 modulates matrix remodelling through the synthesis of matrix metalloproteases (MMPs) and tissue inhibitors of MMPs (TIMPs) in endothelial and mesangial glomerular cells. Its role in the glomerulus needs to be fully understood. Matrix remodelling is observed in glomerulosclerosis secondary to hypertension or diabetes. The aim of our work is to evaluate role of the CD154/CD40 signalisation in matrix remodelling associated to these conditions. Here, we studied CD40 expression in podocytes and the regulatory effect of CD154 on MMPs expression. © The Author 2012. Published by Oxford University Press on behalf of ERA-EDTA. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com Downloaded from https://academic.oup.com/ndt/article-abstract/27/suppl_2/ii427/1935270 by guest on 17 June 2020 Dubois Xu Yi Chun1, Hertig Alexandre2, Baugey Edith2, Ouali Nacéra1, Peltier Julie3, Jouanneau Chantal4 and Rondeau Eric1 1 Aphp, Hôpital Tenon, 2Inserm U702, 3Aphp, Hopital Tenon, 4Inserm Umr_s 702 receptor C, iNOS and pro-inflammatory cytokines in macrophages and E-cadherin, a-SMA and fibronectin in HK2 cells were examined.). Results: The iNOS activity was increased in a glucose-dose-dependent manner. Particularly, 30mM glucose gave the maximum response. U937 cells stimulated with high glucose produced the similar up-regulated amounts of iNOS activity as in the IFNγ?/LPS group, while the maximal level of iNOS activity achieved at 12h after high glucose stimulation. Meanwhile, the cytokines of IL-6, IL-12 and TNF-α were increased. Upon co-culture with high glucose incubated U937 cells, HK-2 cells developed a series of phenotypic changes including elongation, branching, and losing cobblestone like feature. The protein and mRNA levels of E-cadherin in HK-2 cells were decreased, while a-SMA and fibronectin increased. In subsequent experiments, 1,25(OH)2D3 caused an increased proportion of fibronectin and mannose receptor C. The cytokines of IL-6, IL-12, and TNF-α were decreased in the presence of 1,25 (OH)2D3. While the mRNA lever of iNOS was lower in the 1,25(OH)2D3-treated cells. Upon co-culture experiment, 1,25(OH)2D3 reversed the phenotype changes of HK-2 cells. RT-PCR and Western blot analysis revealed an inversion changes in the expression of E-cadherin, a-SMA, or fibronectin in HK-2 cells. Conclusions: High glucose induced classically activated macrophage facilitates the process of Epithelial- Mesenchyreal Transition in Renal Proximal Tubular Epithelial Cell. 1,25-Dihydroxyvitamin D3 suppresses high glucose-induced classically activated macrophage and may be responsible for blocking tubular epithelial to mesenchymal transition in tubular cells. Abstracts SAP334 BRAIN-DERIVED NEUROTROPHIC FACTOR (BDNF) MEDIATES THE ANTI-PROTEINURIC EFFECT OF FLUOXETIN THROUGH PRESERVATION OF PODOCYTE INTEGRITY Massimiliano Migliori1, Massimiliano Migliori1, Vincenzo Cantaluppi2, Claudio Mannari3, Davide Medica2, Luca Giovannini3 and Vincenzo Panichi1 1 Nephrology and Dialysis Unit, Versilia Hospital, 2Nephrology, Dialysis, Renal Transplantation Unit and Centre for Experimental Medical Research (Cerms), University of Turin, 3Department of Neuroscience, University of Pisa Introduction and Aims: Brain-Derived Neurotrophic Factor (BDNF) is a small peptide physiologically detected in the central nervous system (CNS) playing a role in neurogenesis, cellular trophism, differentiation, survival and synaptic plasticity. We previously demonstrated a reduction of BDNF in CNS, serum and urine of 5/6 nephrectomyzed (Nx) rats (EDTA 2009). These alterations were partially reduced by treatment with Fluoxetine (F). Surprisingly, we also evidenced a partial recovery of renal function in Nx rats treated with F (NxF). The aim of this study was to investigate the role of BDNF in the anti-proteinuric effect of fluoxetin and in the inhibition of progression of chronic kidney injury. Methods: Female Wistar rats (n=30) were randomized in 3 different groups: controls (C), Nx and NxF (treated with F at the dose of 15 mg/kg/die for 2 weeks). Rats were sacrificed 12 weeks after nephrectomy and samples of serum, urine and kidney tissue were collected. In vitro, we studied the effect of BDNF on proliferation, resistance to apoptosis, cell polarity, permeability to albumin and expression of the slit diaphragm protein nephrin in human podocytes cultured with inflammatory cytokines (10 ng/ ml TNF-αlpha and IFN-gamma). Results: Creatinine clearance was significantly reduced in Nx (Nx:0.061±0.018 vs C:1.103±0.108 ml/min; p<0.01), while in the Nx-F group there was a partial recover respect to the Nx group (NxF: 0.219±0.094 vs Nx: 0.061±0.018 ml/min; p<0.05). F treatment also reduced 24 hr proteinuria (NxF: 2.63±1.21 mg/die; Nx: 7.34±2.36 vs C: 1.35±0.73 mg/die; p<0.05), glomerular sclerosis and tubular atrophy. Moreover, the expression of desmin, a marker of cellular de-differentiation, was significantly reduced in podocytes in the NxF group. We also found a reduction of BDNF levels in urine (29.2±12.5 pg/mg creat vs 90.3±99.3 pg/mg creat. in C) and in plasma (228.7±90.7 pg/ml vs 429.7±137.4 pg/ml in C) of Nx, while a partial recovery was evidenced in the NxF (54.6±25.8 pg/mg creat and 364.6±112.4 pg/ml, respectively, p<0.05). In vitro, Immunofluorescence, FACS and western blot revealed that podocytes express both BDNF and its receptor TrkB. In podocytes exposed to an inflammatory micro-environment: BDNF 1) inhibited apoptosis, 2) preserved their functional activities by maintaining correct cell polarity assesse by trans-epithelial electrical resistance and permeability to albumin, 3) preserved expression of nephrin which is essential for podocyte permeselectivity. Conclusions: The results of the present study suggest a potential role for BDNF to decrease proteinuria and to slow progression of chronic kidney disease. Indeed, BDNF-enhancing treatments not only may counteract the development of neuro-psychiatric alterations typical of CKD, but they may also protect podocytes, a cell type similar to neurons. Further studies will be necessary to better understand the interaction between neurotrophins and kidney. ii | Abstracts SAP335 IMPAIRMENT OF PODOCYTE FUNCTION BY DIPHTERIA TOXIN - A NEW REVERSIBLE PROTEINURIA MODEL IN MICE Andreas Goldwich1, Steinkasserer Alexander2, Gessner André3 and Kerstin Amann4 1 University Hospital, 2University Hospital Erlangen, 3University Regensburg, 4 Nephropathology Introduction and Aims: Diphteria toxin (DTx) receptor-mediated conditional cell ablation in transgenic mice is a powerful tool to analyze cell function in vivo. Transgenic mice with cell-specific expression of the human DTx receptor allow conditional depletion of these cells through DTx administration. We carefully analysed mice after DTx injection and found proteinuria as unexpected renal side effect. Since non-genetic mouse models of proteinuric glomerular damage are limited we aimed to characterize the DTx-induced model of transient proteinuria in mice. Methods: C57/Bl6, SCID Balb/c and rag-/- mice were treated with 40μg/kg DTx/bw i.p. (day 0 and -1) with DEREG mice as positive depletion controls. To exclude undesired LPS-effects heat- treated DTx and LPS-resistant C3H/HeJ mice were used. For comparison the anti-GBM nephritis and LPS-induced proteinuria models were analysed. Kidneys were investigated by immunofluorescence, confocal and electron microscopy. Cell culture studies (HeLa, NIH 3T3, murine podocyte cell line) were also performed. Results: C57/Bl6 mice tolerated up to 80μg/kg DTx whereas higher doses were lethal. Injection of 40μg/kg DTx led to a marked transient and completely reversible proteinuria morphologically characterized by foot process fusion. 5-9 days after DTx application mice recovered completely. In in vitro analysis DTx treated podocytes showed diminished attachment to basal membrane proteins. Confocal microscopy shows signs of slit membrane endocytosis and on electron microscopy mild podocyte damage with effacement of the foot processes and enlarged cytoplasm as well as swelling of the glomerular endothelium is seen. Of note, no alterations of the glomerular basement membrane are seen. The induce proteinuria is repeatable. Conclusions: Most animal models of non-genetic proteinuric glomerular disease were induced in the rat. The advantage of genetic manipulation technology favor the use of murine models. There is, however, only a limited number of murine podocyte injury models. Hence there is need for mouse models resembling human glomerular diseases. We suggest DTx-induced kidney dysfunction as a new reversible model of podocyte injury with transient proteinuria. which could be used as an additional approach to complement studies in humans. SAP336 IFN-ALPHA AND IFN-BETA SPECIFICALLY AFFECT RENAL PROGENITORS AND PODOCYTES IN-VITRO AND IN-VIVO Adriana Migliorini1, Costanza Sagrinati2, Maria Lucia Angelotti2, Shrikant R. Mulay1, Elisa Ronconi2, Anna Peired3, Paola Romagnani2 and Hans-Joachim Anders1 1 Nephrological Center, Medical Policlinic, University of Munich, Germany, 2 Excellence Center for Research, Transfer and High Education Denothe, University of Florence, Italy, 3University of Florence, Florence, Italy Introduction and Aims: Viral infections can be associated with glomerulonephritis in various ways which is likely to involve antiviral immunity. IFNα and IFNβ orchestrate antiviral defence and potentially contribute to glomerulonephritis. Assuming that viral glomerulopathies will expose podocytes and parietal epithelial cells (PECs) to IFNα and IFNβ, we seeked to determine their functional impact on both cell types. We hypothesized that IFNα and IFNβ will both activate and induce IFN-stimulated genes in podocytes and PECs. Furthermore, we speculated that IFNα and IFNβ will affect the cell cycle and favor cell death of these glomerular cell types, a mechanism that should aggravate proteinuria and glomerular pathology in-vivo. Methods: C133+CD24+ human renal progenitors and podocytes cultured +/- hIFNα and hIFNβ. Primary murine podocytes. SCID mice injected with adriamycin +/recombinant mIFNα and mIFNβ. Results: IFNα and IFNβ both activated renal progenitors to express several interferon-related (antiviral) genes such as MX1, IFIT1 and CXCL10. IFNα significantly decreased the proliferation of human renal progenitors, inducing cell cycle arrest following the up regulation of p53 and p21. Both IFNα and IFNβ inhibited differentiation of renal progenitors towards podocytes as determined by induced nephrin expression. IFNβ but not IFNα promotes permeability of primary murine podocyte in culture, as determinate by ECIS (Electric Cell- substrate Impedance Sensing). Next we compared the impact of recombinant IFNα and IFNβ injections on adriamycin-induced nephropathy in SCID mice which allowed us to exclude IFN-dependent effects on adaptive immunity. Both IFNs increased proteinuria as compared to control mice injected with adriamycin only. Real Time-PCR analysis showed an increased expression of interferon-related genes in the kidney of the mice injected with IFNα and IFNβ compared to the control. Quantitative morphometry by confocal microscopy revealed that IFNβ injections had specifically reduced the number of WT1+/nephrin+ podocytes while IFNα injections specifically reduced the numbers of proliferating parietal epithelial cells, respectively. Conclusions: Both type I IFNs can aggravate glomerular pathology, albeit in different ways. IFNα impairs the proliferation of potential podocyte progenitors, while IFNβ Volume 27 | Supplement 2 | May 2012 Downloaded from https://academic.oup.com/ndt/article-abstract/27/suppl_2/ii427/1935270 by guest on 17 June 2020 Methods: Kidney tissue sections were used to assess CD40 expression in podocytes in vivo. Recombinant human CD154 (rhCD154) stimulation experiments (n=5) were performed by growing human cultured podocytes in the presence of 100ng/ml rhCD154 for 48 hours. CD40 podocyte expression, localisation and transcription were assessed by immunocytolocalisation (IC), Western blot (WB) and quantitative RT-PCR (qRT-PCR) on cultured podocytes. Mab89, a blocking anti-CD40 antibody, was used in IC experiment. The level of secretion, cell expression and transcription of MMPs (MMP2 and 9) and TIMPs (TIMP1 and 2) was determined by zymography, WB, ELISA and qRT-PCR. The effect of activated platelet supernatant from healthy human subjects (n=3) was also tested on podocytes. Results: CD40 was weakly expressed by podocytes in kidney tissue sections as well as in human cultured podocytes, in basal conditions. In cultured podocytes, CD40 expression was predominantly localized at the plasma membrane and was increased upon exposure to rhCD154. qRT-PCR and WB confirmed CD40 messenger RNA and protein expression in podocytes. Adding mab89 to CD154, CD40 podocyte expression was similar to native conditions. Podocyte stimulation with CD154 significantly induced the secretion of pro-MMP9 into the medium whereas no changes in the secretion of MMP2, TIMP1 and TIMP2 were observed. The secretion of MMP9 into the culture medium was associated with a 30% significant decrease of its expression level in podocytes. MMP9 transcription tended to be increased. Transcription and secretion of MMP2, TIMP1 and TIMP2 upon exposure to rhCD154 remained unchanged. Supernatant of activated platelets induced secretion of pro-MMP9 into the medium and a decrease of MMP9 expression in podocytes. Conclusions: CD40 is expressed by human podocytes in basal conditions, and its expression is enhanced by CD154. CD154 and activated platelet supernatant induces the secretion of MMP9 by human podocytes. Platelets are the major reservoir of CD154 in the body and release CD154 upon activation. The fact that CD154 induces MMP9 expression by podocytes may suggest that, in glomerular diseases such as in hypertensive glomerulosclerosis and lupus nephritis, CD154 released by activated platelets could play a role in the matrix remodelling that is observed in these diseases. Nephrology Dialysis Transplantation Abstracts Nephrology Dialysis Transplantation SAP339 mostly impairs podocyte viability. These data propose that IFNα and IFNβ contribute to glomerulosclerosis and proteinuria by specifically affecting homeostasis of podocytes and their potential repair by local progenitors, a mechanism that may contribute to in viral infection-associated glomerular pathology. SAP337 ANGIOPOIETINS MODULATES ENDOTHELIAL ADAPTATION, GLOMERULAR AND PODOCYTE HYPERTROPHY AFTER UNINEPHRECTOMY Introduction and Aims: Angiopoietins are important growth factors in the development and maintenance of blood vessel. Glomerular branching and elongation happens in glomerular hypertrophy. This study is to evaluate the role of angiopoietins in glomerular hypertrophy. Methods: Glomerular hypertrophy was induced by uninephrectomy. The action of angiopoietin 1 (Angpt 1) and angiopoietin 2 (Angpt 2) was blocked by administration of antagonist by mL4- 3 and L1-10 respectively. Renal pathology, podocyte hypertrophy and endothelial density were examined. Glomerular foot process and basement membrane morphology were examined by EM. Gene expression was evaluated by quantitative PCR. Results: Angpt 1 was first up-regualted 1 month after uninephrectomy, followed by Angpt 2 two months after operation. Blockade of Angpt 1 or 2 decreased the activation of angiopoietin receptor, tyrosine kinase with Ig and EGF homology domains 2, and attenuated the development of glomerular and podocyte hypertrophy. The glomerular endothelial density (CD31), foot process width and glomerular basement membrane thickness were lower in Angpt 1 or 2 blockade groups. Administration of Angpt 1 or Angpt 2 antagonist also down regulated the gene expression of glomerular matrix and basement membrane genes , including collagen type IV α1, α2, α5 and laminin α5. Conclusions: Angpt 1 or 2 has an important role in the development of glomerular hypertrophy after uninephrectomy. In addition to endothelium, Angpt 1 or 2 also influcened the behavior of podocyte during the process of glomerular hypertrophy. SAP338 C-MIP DOWNREGULATES NF-KB ACTIVITY AND PROMOTES APOPTOSIS IN PODOCYTES OF PATIENTS WITH IDIOPATHIC NEPHROTIC SYNDROME Ory Virgine1, Fan Qing Feng1, Shao-Yu Zhang2, Desvaux Dominique3, Audard Vincent3, Candelier Marina1, Lang Philippe3, Guellaen Georges4, Andre Pawlak1 and Djillali Sahali1 1 Inserm U955 Group 21, Créteil, France, 2Imserm U955 Group 21, 3Department of Nephrology, Henri-Mondor Hospital, Créteil, France, 4Inserm U955, Créteil, France Introduction and Aims: The mechanisms of podocyte disorders in idiopathic nephrotic syndrome (INS) are unknown. Abnormal regulation of NF-kB might play a key role in the pathophysiology of these podocytes diseases, but it has little been investigated. We have previously reported that c-mip was increased in the podocytes of patients with INS. We show here that c-mip interacts with RelA, and inhibits its nuclear translocation, resulting in down regulation of NF- kB activity. Methods: IHC was performed for RelA in human biopsies and normal human kidney. Double immunofluorescence with rabbit anti-c-mip and guinea pig anti-nephrin Abs was performed on both human biopsy and mouse kidney section including c-mip transgenic mice and wild type mice. Murine podocytes were stably transfected with c-mip expression plasmid or empty vector. Caspase-3 activity was monitored in a quantitative assay using a fluorogenic substrate for these cells. RelA was tested by RT-PCR and real time PCR. Western blotting was processed with different Abs. Results: We report here that induction of c-mip in podocytes of patients with INS was associated with a profound downregulation of RelA. Stable over expression of c-mip in podocytes promoted apoptosis by inducing caspaces-3 activity, an upregulation of the pro-apoptotic protein Bax and a decrease of the anti-apoptotic protein Bcl-2 levels. We show that targeted induction of c-mip in podocytes in vivo inhibits the expression of the RelA protein, and increased the Bax/Bcl2 ratio. Conclusions: In this work, we provide evidence that: i) increased expression of c-mip in podocytes of patients with INS is correlated with a destabilization of RelA protein; ii) downregulation of RelA in c-mip-transfected podocyte cell line suggests a molecular link between RelA dysfunction and c-mip expression; iii) c-mip induces an upregulation of Bax and a decrease of Bcl-2, which suggests that c-mip is a proapoptotic protein. These results suggest that alterations of NF-kB activity result from upregulation of c-mip and likely contributes to podocyte disorders in INS. Volume 27 | Supplement 2 | May 2012 Sachiko Matsumoto1, Hideyasu Kiyomoto2, Atsuhiro Ichimura3, Takashi Dan3, Takashi Nakamichi4, Tadashi Tsujita5, Koji Akahori5, Sadayoshi Ito6 and Tosho Miyata5 1 Tohoku University Graduate School of Medicine, Sendai, Japan, 2Division of Nephrology, Department of Endocrinology and Vascular Medicine, Tohoku University Graduate School of Medicine, Sendai, Japan, 3Department of Molecular Medicine and Therapy, United Centers for Advanced Research and Translational Medicine (Art), Tohoku University Graduate School of Medicine, 4 Division of Nephrology, Department of Endocrinology and Vascular Medicine, Tohoku University Graduate School of Medicine, 5Department of Molecular Medicine and Therapy, United Centers for Advanced Research and Translational Medicine (Art), 6Tohoku University, Sendai, Japan Introduction and Aims: There is increasing evidence that a deterioration of glomerular podocyte cause endothelial dysfunction via reducing the secretion of vascular endothelial growth factor (VEGF), and finally it may lead to thrombotic microangiopathy (TMA). Plasminogen activator inhibitor (PAI)-1, a serine protease inhibitor, is involved in numerous renal pathological processes including thrombosis, fibrosis, and inflammation. Therefore, inhibition of PAI-1 is postulated to protect the progression of glomerular injury as well as suppression of clot formation in the vasculature that are usually observed in severe nephritis such as crescentic glomerulonephritis (GN) and TMA. However, the roles of PAI-1 in the experimental GN have not yet been well elucidated. To clarify the role of PAI-1 in podocyte injury of GN, we utilized a TM-5275, a newly synthesized small molecule inhibitor to PAI-1, in anti-Thy1.1-serum induced glomerular nephritis (ATS-GN) model which develops both advanced endocapillaries and extracapillaries lesions involving mesangial cells, endothelial cells, podocytes and infiltration of macrophages in glomeruli. Methods: Experimental GN was induced by an intravenous injection of anti-Thy1.1 antibody (ER4G; 1mg/Kg) in 6 weeks old male Sprague-Dawley rats. The rats were given orally by gavage either vehicle, clopidogrel (30mg/kg/day) or a specific PAI-1 inhibitor (TM5275; 30mg/kg/day) beginning at 3 days before induction of ATS-GN. The rats were kept in metabolic cages to collect their urine, and they were sacrificed at day 7. The perfused kidneys were processed for light microscopic evaluation and immunohistochemical staining for ED-1, WT-1, desmin and fibrin deposition. At least 40 glomeruli were randomly selected and evaluated for morphologic scoring. RT-PCR was also performed to determine the mRNA expression of desmin, VEGF and PAI-1 in the kidney. Results: An intravenously injection of ATS (ER4G) successfully induced mesangial proliferative GN with microaneurysm formation in glomerulus at Day 7. A specific PAI-1 inhibitor, TM-5275 (30mg/kg/day), reduced the proteinuria and improved the pathological abnormality at 7 days after induction of GN. Thrombi formation in glomeruli was attenuated by daily oral administration of TM-5275 with inhibition of plasma PAI-1 activity. The frequency of aneurysm formation and ED-1 positive macrophage infiltration in glomeruli were also reduced significantly by PAI-1 inhibition at Day 7 in ATS-GN. Interestingly, TM-5275 also ameliorated the deterioration of podocyte that was evaluated by WT-1 and desmine staining. Moreover, the mRNA expression of nephrin and VEGF in the kidney was remarkably decreased in GN, and those mRNA expressions were resorted to normal levels by TM-5275. In contrast, an anti-platelet agent, clopidogrel, did not exert any protective effects against ATS-GN. Conclusions: The insult of podocyte caused by ER4G antibody was postulated as the initial step of ATS- GN, and the deterioration of podocyte might cause endothelial dysfunction leading finally to TMA. Our experiments suggest that the specific PAI-1 inhibition by TM-5275 may provide potential therapeutic benefits for GN in the future. SAP340 PHARMACEUTICAL INHIBITION OF PODOCYTE UPAR EXPRESSION REDUCES PROTEINURIA IN NTX RATS AND LPS MICE Shaoting Xie1, Bin Zhang2, Wei Shi3 and Yun Yang3 Guangdong General Hospital,Guangzhou,China, 2Guangdong General Hospital, 3 Guangdong General Hospital, Guangzhou, China 1 Introduction and Aims: A novel role for podocyte urokinase receptor (uPAR) and its soluble form (suPAR) has been described in podocyte injury and the pathogenesis of focal segmental glomerulosclerosis (FSGS). Amiloride is reported to inhibit uPAR expression in tumor-infiltrating lymphocytes and colon cancer cells. However, amiloride’s effect on podocyte uPAR is unknown; Moreover, does it have an antiproteinuria via its possible inhibitory effect on podocyte uPAR? The study is aimed to investigate the effect of amiloride on podocyte uPAR expression and proteinuria. Methods: The 5/6 nephrectomy rat model (NTX rats) was induced in male Sprague-Dawley rats and all animals having undergone 5/6 renal mass reduction were then randomized to (1) receive amiloride (3mg kg-1day-1, n = 15); (2) receive triamterene (25mg kg-1day-1, n = 15); (3) or receive vehicle (sterile amiloride-free doi:10.1093/ndt/gfs241 | ii Downloaded from https://academic.oup.com/ndt/article-abstract/27/suppl_2/ii427/1935270 by guest on 17 June 2020 Wen Chih Chiang1, Chun Fu Lai2, Wei-Hao Peng3, Ching Fang Wu4, Fan-Chi Chang5, Yi-Ting Chen6, Shuei-Liong Lin2, Yung Ming Chen2, Kwan Dun Wu2, Kuo-Shyan Lu3 and Tun Jun Tsai2 1 National Taiwan University Hospital, 2National Taiwan University Hospital, Taipei, Taiwan, 3College of Medicine, National Taiwan University, Taipei, Taiwan, 4 National Taiwan University Hospital, Taipei Taiwan, 5National Taiwan University Hospital Chudong Branch, Yunlin County, Taiwan, 6E-Da Hospital, Kaohsiung City, Taiwan PHARMACOLOGICAL SUPPRESSION OF PLASMINOGEN ACTIVATOR INHIBITOR-1 (PAI-1) AMELIORATES THE INJURY OF GLOMERULAR PODOCYTE IN THE EXPERIMENTAL GLOMERULONEPHRITIS Abstracts SAP341 KLOTHO PROTEIN REDUCES MOUSE RENAL FIBROSIS AFTER UNILATERAL URETERAL OBSTRUCTION THROUGH INHIBITION OF WNT SIGNALING Hajime Nagasu1, Minoru Satoh1, Kengo Kidokoro1, Yuko Nishi2, Chieko Ihoriya1, Hiroyuki Kadoya1, Tamaki Sasaki1 and Naoki Kashihara1 1 Kawasaki Medical School, 2Kawasaki Medical School, Kurashiki, Japan Introduction and Aims: The extracellular domain of klotho protein is secreted, potentially functioning as a humoral factor. The secreted klotho protein can regulate multiple growth factor signaling pathways, including insulin/IGF-1 and Wnt, yet the precise mechanism of renal protection remains to be determined. Wnt-klotho interaction resulted in the suppression of Wnt biological activity. Wnt proteins play important roles in regulating cell differentiation, proliferation, and polarity. Increased Wnt signaling has been implicated in many fibrotic diseases including obstructive nephropathy. Blockade of Wnt/beta-catenin signaling may offer a novel therapeutic strategy in renal fibrosis. Therefore, we explored the possibility that klotho protein could reduce renal fibrosis by inhibition of Wnt signaling. Methods: To examine the activation of Wnt/beta-catenin signaling in UUO, we used BAT-LacZ mice that over-expressing the beta-galactosidase gene under the control of seven repeat T cell factor/lymphoid enhancer-binding factor 1 promoter. To investigate the effects of klotho on renal fibrosis after UUO, transgenic mice that over-expressing the alpha-klotho gene under the control of human elongation factor 1 alpha promoter (Kl-TG; C57BL/6 background) and C57BL/6 mice (Wild) underwent UUO, and were studied after 3, 7 and 14 days. In some Wild mice, plasmid encoding mouse klotho ( pCAGGS-Kl) was transferred into the skeletal muscle by electroporation. Quantitative real time PCR was used to assess the expression of CTGF, TGF-βeta1 and type III collagen. Protein expression for alpha-SMA and vimentin were assessed by western blotting and immunostaining. Wnt signaling was examined by expression of Wnt/beta-catenin target genes (c-myc, T cell factor/lymphoid enhancer-binding factor 1, and fibronectin). Results: After 7 days of UUO, Wnt signaling was activated in tubulo-interstitium. UUO in Wild mice leads to increased extracellular matrix deposition and tubulointerstitial fibrosis within 7 to 14 days. The weight of the obstructed kidney was significantly decreased 14 days after UUO compared with sham-operated kidney. Kidneys of Kl-TG mice or pCAGGS-Kl mice, however, had markedly reduced extracellular matrix deposition after UUO. The kidney weight loss after UUO was significantly smaller than Wild mice. The expressions of CTGF, TGF-βeta1, and type III collagen after UUO were decreased in Kl-TG or pCAGGS-Kl compared to Wild. Kl-TG exhibited less increase in tubular epithelial Wnt signaling compared to Wild. Moreover, Kl-TG also suppressed the accumulation of myofibroblast compared to Wild after UUO, as evidenced by a reduction in the amount of alpha-SMA and vimentin proteins. Conclusions: The secreted protein Klotho was found as a negative regulator of the Wnt pathway. We demonstrated that Wnt/beta-catenin signal was up-regulated at late stage of UUO, and Klotho protein inhibited Wnt/beta-catenin signal and ii | Abstracts reduced renal fibrosis after UUO. Klotho protein is a critical negative regulator of Wnt signaling and plays a negative regulating role in renal fibrosis after UUO. SAP342 TRANSFORMING GROWTH FACTOR B STIMULATES PROFIBROTIC EPITHELIAL SIGNALING TO ACTIVATE PERICYTE-MYOFIBROBLAST TRANSITION IN OBSTRUCTIVE KIDNEY FIBROSIS Ching-Fang Wu1, Fan-Chi Chang1, Yi-Ting Chen1, Yu-Hsiang Chou1, Jeremy Duffield2 and Shuei-Liong Lin3 1 National Taiwan University Hospital, 2University of Washington, 3National Taiwan University Introduction and Aims: Pericytes have been identified as a major source of precursors of scar-producing myofibroblasts during kidney fibrosis. The underlying mechanisms triggering pericyte- myofibroblast transition are poorly understood. Transforming growth factor β (TGFb) is well recognized as a pluripotent cytokine that drives organ fibrosis. Here we show the role of TGFβ in inducing profibrotic signaling from epithelial cells to activate pericyte-myofibroblast transition. Methods: Using Coll-GFP reporter mice to study the response of kidney pericytes to injury, we performed unilateral ureteral obstruction (UUO). We prurified normal kidney pericytes and performed primary pericyte culture for in vitro study. Results: Increased expression of TGFβ was detected predominantly in injured epithelium after UUO, whereas downstream signaling from the TGFβ receptor increased in both injured epithelium and pericytes. In mice with ureteral obstruction, treated with the pan anti-TGFβ antibody (1D11) or TGFβ receptor type I inhibitor (SB431542), kidney pericyte-myofibroblast transition was blunted. The consequence was marked attenuation of fibrosis. In addition, epithelial cell cycle G2/M arrest and production of profibrotic cytokines were both attenuated. Although TGFβ1 alone did not trigger pericyte proliferation in vitro, it robustly induced α smooth muscle actin. In cultured kidney epithelial cells, TGFβ1 stimulated G2/M arrest and production of profibrotic cytokines that had the capacity to stimulate proliferation and transition of pericytes to myofibroblasts. Conclusions: This study identifies a novel link between injured epithelium and pericyte-myofibroblast transition through TGFβ during kidney fibrosis. SAP343 MESENCHYMAL STROMAL CELLS AND LISINOPRIL COMBINATION THERAPY INDUCE RENAL REPAIR MODULATING SCATTER FACTORS IN UNILATERAL URETERAL OBSTRUCTION EXPERIMENTAL MODEL Chiara Rocca1, Chiara Rocca1, Marilena Gregorini1, Valeria Corradetti1, Teresa Valsania1, Giulia Bedino1, Francesca Bosio1, Eleonora Francesca Pattonieri1, Pasquale Esposito1, Vincenzo Sepe1, Carmelo Libetta1, Teresa Rampino1 and Antonio Dal Canton1 1 Unit of Nefrology , Dialysis and Transplantation, University and Fondazione Irccs Policlinico San Matteo Introduction and Aims: Hepatocyte Growth Factor (HGF)/ Met and Macrophage Stimulating Protein (MSP)/ Ron systems are Scatter Factors that regulate pathologic tissue remodelling and inflammatory cells response in renal diseases, including unilateral ureteral obstruction (UUO). It is known that HGF was released by mesenchymal stromal cells (MSC), while nothing is known about link between MSP and MSC. We have recently proved that angiotensin-converting enzyme inhibitors and MSC, when administered in mono and combination therapy, attenuate significantly renal fibrosis and accelerate renal repair in UUO. The aim of this study was to evaluate whether lisinopril (angiotensin-converting enzyme inhibitor, ACEi) and MSC in mono and combination therapy induce renoprotective effect by modulating Scatter Factors. Methods: Sprague-Dawley rats (SD), transgenic for enhanced green fluorescent protein (EGFP) were used as donors of MSC, and SD wild type rats as test animals. We studied five groups of rats. Group A: 5 rats sham operated. Group B: 8 rats undergone UUO received saline solution on day 0 (vehicle control), Group C: 8 rats undergone UUO received MSC 3X106 on day 0 via tail vein. Group D: 8 rats undergone UUO received ACEi in the drinking water (100 mg/L) from day 1 to day 21. Group E: 8 rats undergone UUO received MSC on day 0, and ACEi from day 1 to day 21. Rats were sacrified on day 7 and day 21 and obstructed kidneys were removed for immunohistological and biomolecular analysis. HGF and MSP mRNA (RT- PCR), HGF, Met, MSP, Ron proteins (Western blot) were analysed in all obstructed kidneys and in kidneys of sham operated rats on day 7. Ron and Met expression were evaluated on day 7 and day 21 by immunohistochemistry using specific antibodies and positive stained area were semi-quantified using microscope imaging analysis. Results: HGF and MSP mRNA were not significantly different in all group of rats. HGF and Met proteins were similar in sham operated rats (A) and vehicle-treated controls (B), increased significantly in rats treated with monotherapy respectively MSC (C) and ACEi (D)(p<0.001 vs A and B), and rose further in rats treated with combination therapy (E) (p<0.0001vs A and B). Similarly MSP and Ron proteins were similar in A and B, but increased significantly only in rats treated with MSC (C), (p<0.005 vs A,B,D,E) . Compared to sham operated rats (A) and vehicle- treated controls (B) monotherapy with ACEi (D) and MSC (C) increased significantly the extent of tubular Volume 27 | Supplement 2 | May 2012 Downloaded from https://academic.oup.com/ndt/article-abstract/27/suppl_2/ii427/1935270 by guest on 17 June 2020 saline, n=14). The rats of sham-operated group(n=14) also received vehicle once daily. For the LPS mouse model of transient proteinuria(LPS mice), we injected C57BL/6 mice intraperitoneally with 200 μg LPS. Controls(n=5) received sterile LPS-free saline. After LPS injection, mice were gavaged with saline alone (n=7), amiloride once daily (5 mg kg-1day-1, n = 6; 10 mg kg-1day-1, n = 6; 50mg kg-1day-1, n = 6 ) ,and triamterene once daily (25 mg kg-1day-1, n = 6; 50 mg kg-1day-1, n = 6; 100 mg kg-1day-1, n = 6). Real-time quantitative PCR for cultured podocytes and kidney cortex isolated from rodent proteinuric models was performed using the following primers: rat PLAUR (encoding uPAR,forward, AGATGTGCTGGGAAACCG; reverse, CAGGGAGGCAATGAGGAT ) yielding a 196-bp product; mouse PLAUR (forward, AAGCCTGCAATGCCGCTATC; reverse, GGGTGTAGTTGCAACACTTCAGGA) yielding a 182-bp product. For immunofluorescent labeling,murine kidneys and cultured podocytes were stained by the primary antibodies (synaptopodin(N-14), uPAR (FL-290), AP5 antibody) for 2 hours at room temperature. Flow cytometry assay is used to assess uPAR induction and active beta 3 integrin on cell surface of podocytes during the treatment with LPS alone(50ug ml-1), LPS (50ug ml-1)plus amiloride (5~100ug ml-1 ) or LPS(50ug ml-1) plus triamterene(0.25~25ug ml-1 ). Podocyte motility is accessed by scrape-wound assay and transwell migration assay. Results: Podocyte uPAR expression can be reduced using amiloride. Amiloride has a significant reduction on podocyte cell motility in vitro and proteinuria in mice. Amiloride inhibited induction of uPAR protein and PLAUR mRNA (encoding uPAR) and with that it reduced uPAR-mediated β3 integrin activation in LPS-treated podocytes. Transwell migration assay and wound healing assay showed that directed and random podocyte motility of LPS-treated podocytes were increased and substantially reduced by amiloride. The off-target effect of amiloride, was indepemdent of its function as ENaC blocker and different from triamterene. Amiloride was also effective in the LPS mouse model of transient proteinuria (LPS mice) and in the 5/6 nephrectomy rat FSGS model (NTX) by significantly inhibiting podocyte uPAR induction, reducing proteinuria. Conclusions: Our observations show that amiloride inhibits podocyte uPAR induction and reduces proteinuria in NTX rats and LPS mice. Given the pathological relevance of the uPAR-β3 integrin signaling axis in FSGS, amiloride may be utilized in patients with FSGS. Nephrology Dialysis Transplantation Abstracts Nephrology Dialysis Transplantation Met staining ( p<0.005 vs A and B), but combination therapy (E) induced additional increase of positive tubular area (p<0.001 vs A and B). The extent of tubular area stained for Ron was significantly lesser in B than in A ( p<0.005), but combination therapy induced an increase of Ron tubular expression on day 7 and 21 (p<0.001 vs A, B,D,E). Conclusions: Our results show that both ACEi and MSC may promote repair process, reduce renal fibrosis modulating Scatter Factors in UUO, yet the combination of the two lead to additive upregulation of HGF/Met and MSP/ Ron signaling. SAP344 COMBINATION THERAPY WITH MESENCHYMAL STROMAL CELLS AND LISINOPRIL REDUCES RENAL FIBROSIS IN A RAT EXPERIMENTAL MODEL OF UNILATERAL URETERAL OBSTRUCTION INHIBITING RENIN ANGIOTENSIN SYSTEM Introduction and Aims: Renin-angiotensin system (RAS) plays a pivotal role in renal fibrosis and agents that target angiotensin II, principal mediator of RAS, are the most effective therapy to reduce progression of chronic kidney disease. Its known that angiotensin-converting enzyme inhibitors (ACEi) induce a compensatory increase in plasma renin levels because of the disruption of the negative feedback of its production. However renin (R) promotes renal injury not only by stimulating angiotensin II (ANG II) generation, but also up-regulating pro- fibrotic genes through renin/prorenin receptor activation. We have recently proved that ACEi and mesenchymal stromal cells (MSC), in mono and combination therapy, reduce renal fibrosis in unilateral ureteral obstruction (UUO). The aim of this study was to understand the mechanisms underlying the protective effects of ACEi and MSC in UUO. Methods: Sprague-Dawley (SD rats, transgenic for enhanced green fluorescence protein were used as donor of MSC, and SD wild type rats as test animals. We studied 5 groups of rats. A: 5 rats sham operated. B: 8 rats UUO received saline solution on day 0 (vehicle control). C: 8 rats UUO received MSC 3X106 on day 0 via tail vein. D: 8 rats UUO received lisinopril (ACEi) in the drinking water (100 mg/L) from d 1 to 21. E: 8 rats UUO received MSC on d 0, and ACEi from d 1 to 21. Rats were sacrified on d 7 and 21. Serum ANGII levels were measured by ELISA. Renin mRNA expression was evaluated by RT-PCR. ED 1 positive cells was evalutated by immunohistochemistry. Interstitial fibrosis was measured by Masson’s trichrome staining (score 1-4: Masson’s trichrome positive area/HPF). Obstructive injury caused a disruption of tubular basal membrane (TBM) integrity, therefore the percentage of broken tubules/HPF was evaluated in renal sections. Results: Serum ANG II levels increased after UUO in B (1.50 ±0.49 ng/ml vehicle control) compared to sham operated rats (A 0.6±0.27), monotherapy with MSC (C 1.27 ±0.56) induced a reduction of ANG II levels compared to B but ACEi (D 0.31±0.01) and combination therapy (E 0.6±0.16) determined a further suppression effect ( p<0.05 D and E vs B) on day 7. After 21 days from ureteral ligation serum ANGII levels were significantly lower in all groups of rats. Renin mRNA expression did not increase significantly in rats of B (0.92±0.66 fold increase) and C (0.67±0.3), compared to A set as calibrator, while, as expected, increased in rats treated with ACEi (D 3.82±2). Rats receiving combination therapy showed lower renin mRNA levels (E 2.62±0.65) compared with D. In rats of group B monocyte infiltration was significantly greater than in rats with MSC (C) and ACEi (D) (d 21, number of ED1 cells/microscopic field B: 22.3±2.4, C: 6.1±0.5, D:10.5±1.02, p< 0.05). ED1 positive cells number was further reduced (E:7.2±1.5, p<0.005 vs B) in E. The fibrosis was significantly less severe in rats of group C and D, than in group B (B:3.4±0.1, C: 2.3±0.16, D: 2.8±0.13, p<0.05). Combination therapy had additive efficacy in fibrosis (E: 1.6±0.18, p<0.001 vs B, p<0.05 vs C and D). The percentage of broken tubules/HPF was significantly reduced in D compared B and C (p<0.05), but combination therapy prevented even more the breaking of TBM (B: 45.7±4.2, C:43±4, D: 31±4.8, E: 20.2±2.4, p<0.005 E vs B) CONCLUSIONS: Our results show that MSC in UUO rat model prevent renin increase, reduce angiotensin II generation and in combination therapy with ACEi suppress further ANG II block, thereby lead to a synergy in ameliorating renal fibrosis. SAP345 USE OF XANTHINE OXIDASE INHIBITOR FEBUXOSTAT INHIBITS RENAL INTERSTITIAL INFLAMMATION AND FIBROSIS IN UNILATERAL URETERAL OBSTRUCTIVE NEPHROPATHY Hiroki Omori1, Noritaka Kawada1, Kazunori Inoue1, Yoshiyasu Ueda1, Ryohei Yamamoto1, Isao Matsui1, Jyunya Kaimori1, Yoshitsugu Takabatake1, Toshiki Moriyama1, Yoshitaka Isaka1 and Hiromi Rakugi1 1 Departments of Geriatric Medicine and Nephrology, Osaka University Graduate School of Medicine Introduction and Aims: Renal interstitial fibrosis is the common pathway in progressive renal diseases, where oxidative stress promotes inflammation and macrophage infiltration. Febuxostat is a novel nonpurine xanthine oxidase (XO)-specific inhibitor for treating hyperuricemia. While some reports suggest a Volume 27 | Supplement 2 | May 2012 SAP346 KIM-1 AND NGAL: NEW MARKERS OF OBSTRUCTIVE NEPHROPATHY Anna Wasilewska1, Katarzyna Taranta-Janusz1, Wojciech De˛ bek1 and Elz_ bieta Kuroczycka-Saniutycz1 1 Department of Pediatrics and Nephrology Introduction and Aims: Congenital obstructive nephropathy is the primary cause of chronic renal failure in children. Rapid diagnosis and initiation of the treatment are vital to preserve function and/ or to slow down renal injury. We aimed to check whether uKIM-1 and uNGAL may be useful non - invasive biomarkers in children with congenital hydronephrosis (HN) caused by ureteropelvic junction obstruction (UPJO). Methods: The study group consisted of 20 children with severe HN, requiring surgery (median aged 2.16 yrs), and 2 control groups (20 patients with mild, non obstructive HN - control 1, and 25 healthy children – control 2). All examined children had normal renal function. Immunoenzymatic ELISA commercial kits were used to measure KIM-1 and NGAL urinary concentrations. Results: Preoperative median uKIM-1/ cr. levels were significantly greater than in both control groups. The median uNGAL level was significantly higher in severe HN patients, when compared to control 1 and 2. Three months after surgery urine NGAL decreased significantly ( p< 0.05), but was still higher than in control 2 ( p< 0.05). ROC analyses have shown a good diagnostic profile for uKIM-1 and uNGAL in identifying differential renal function < 40% in HN patients (AUC – 0.8, 0.814, respectively) and < 45% in all examined children (AUC - 0.779, 0.868, respectively). Conclusions: Urinary NGAL and KIM-1 levels are associated with worsening obstruction. Further studies are required to confirm a potential application of uKIM-1 and uNGAL as useful biomarkers for the diagnosis and progression of chronic kidney disease. SAP347 URETERAL ANGIOGENESIS AND LYMPHANGIOGENESIS AFTER URETERAL OBSTRUCION IN MICE Ae Sin Lee1, Ae Sin Lee2, Jung Eun Lee1, Yu Jin Jung3, Kyung Pyo Kang1, Sik Lee1 and Won Kim1 1 Department of Internal Medicine and Institute for Medical Sciences, Chonbuk National University Medical School, Jeonju, Korea, 21department of Internal Medicine and Institute for Medical Sciences, Chonbuk National University Medical School, Jeonju, Korea, 3Department of Internal Medicine and Institute for Medical Sciences,Chonbuk National University Medical School, Jeonju, Korea Introduction and Aims: Vascular or lymphatic angiogenesis has been demonstrated in chronic or acute inflammatory conditions, fibrosis, cancer, and development. However, there is no report in changes of vascular and lymphatic vessel of ureter after obstruction. To investigate the effects of ureteral obstruction on angiogenesis and lymphangiogenesis in obstructed ureter, we evaluated the changes of ureteral vascular and lymphatic endothelial cell density in a unilateral ureteral obstruction model by immunofluorescent staining, immunohistochemistry. Methods: Male C57BL/6 mice were used for UUO model. For histologic examination of vascular and lymphatic endothelial cells, PECAM-1, LYVE-1, prox-1 and podoplain were stained. Inflammatory cells were stained by macrophage marker, F4/ 80 and proliferating vascular and lymphatic endothelial cells were stained by Ki-67. For systemic depletion of macrophages, clodronate liposome (CDL, 50 mg/kg) was administrated through peritoneum at one day before operation and every 2 other day before harvest kidney sample. Results: Gross morphologic examination indicated that increased vasculature in obstructed ureters compared to contralateral control ureters 1, 2 and 3 weeks after ureteral obstruction. Microscopic findings showed that PECAM-1-positive vascular endothelial cell density was increased in dilated ureters. We also found that there was increased diameter of lymphatic vessels which was positively stained with lymphatic endothelial cell markers such as LYVE-1, prox-1 and podoplanin. These doi:10.1093/ndt/gfs241 | ii Downloaded from https://academic.oup.com/ndt/article-abstract/27/suppl_2/ii427/1935270 by guest on 17 June 2020 Giulia Bedino1, Marilena Gregorini1, Valeria Corradetti1, Chiara Rocca1, Eleonora Francesca Pattonieri1, Teresa Valsania1, Francesca Bosio1, Pasquale Esposito1, Vincenzo Sepe1, Carmelo Libetta1, Teresa Rampino1 and Antonio Dal Canton1 1 Dipartimento DI Nefrologia, Dialisi E Trapianto, Universita' E Policlinico San Matteo, Pavia relationship between hyperuricemia and chronic kidney disease (CKD), the renoprotective mechanism of an XO inhibitor in CKD remains unknown. Recent reports have focused on XO as a source of oxidative stress. Methods: Here, we investigate the potential of febuxostat to reduce fibrogenic and inflammatory responses in an established interstitial fibrosis model, unilateral ureteric obstruction (UUO). Male Sprague-Dawley rats were divided into three groups: sham-operated group, vehicle- treated UUO group, and febuxostat-treated UUO group. Results: Treatment with febuxostat diminished XO activity in obstructed kidneys, and suppressed nitrotyrosine, a marker of oxidative stress. Consequently, febuxostat inhibited early proinflammatory cytokine expression, followed by a reduction of interstitial macrophage infiltration. In addition, febuxostat suppressed TGF-β mRNA expression, thereby ameliorating SMαA and type I collagen expression. Conclusions: Our results provide evidence for the renoprotective action of febuxostat against the formation of interstitial fibrosis. A decrease in macrophage infiltration and interstitial fibrosis, along with a decrease of the oxidative stress marker, strongly suggests the existence of a causal relationship between them. Febuxostat may have therapeutic value in slowing or preventing interstitial fibrosis in patients with CKD. Abstracts PECAM-1-positive vascular endothelial cell and LYVE-1- positive lymphatic endothelial cell were also costained with Ki67, a proliferation marker. The number of monocytes/macrophages, as identified by the immunohistochemistry of F4/80 antigen per unit area in dilated ureter increased seven-fold for 1 week after UUO compared with contralateral ureter. These F4/80-positive macrophages were also stained with vascular endothelial cell growth factor-C. Administration of liposomal clodronate reduced the number of F4/80+ macrophages in the dilated ureter and inhibited UUO-induced ureteral lymphangiogenesis. Conclusions: All of these data suggest that ureteral obstruction induces angiogenesis and lymphangiogenesis in ureter through Akt phosphorylation and these effects may be associated with VEGF-C-positive macrophage infiltration. Nephrology Dialysis Transplantation Results: There is an increase in ECM protein expression in both ALK1+/+ and ALK1+/obstructed kidneys, but obstructed kidneys from ALK1+/- mice show significantly higher expressions of type I collagen and fibronectin than obstructed kidneys from ALK1+/+ mice. Proliferation markers such as PCNA and ki67 increase 15 days following UUO in both ALK1+/+ and ALK1+/- obstructed kidneys, but this increase is significantly higher in ALK1+/- kidneys than in wild type (ALK1+/+) mice. There is also an increase in myofibroblasts markers (α-sma and S100A4) following UUO, without any difference between ALK1+/+ and ALK1+/- obstructed kidneys. Conclusions: Our data suggest a relevant role of the ALK1 receptor in the development of renal fibrosis. SAP350 SAP348 DELETION OF ENDOTHELIN-1 FROM ENDOTHELIAL CELL IN-VIVO AND ETAR BLOCKING IN-VITRO ATTENUATE KIDNEY FIBROSIS AND MYOFIBROBLAST FORMATION Introduction and Aims: Chronic kidney Diseases (CKDs) lead to kidney fibrosis that’s known as a final pathway of CKDs.Endothelin-1 (ET-1) and its receptors have contribution in CKDs pathologies, although clear mechanism in kidney fibrosis is still un-clear. We want to observe whether ET-1 deletion from endothelial cells in-vivo and ET-1 receptors blocking in-vitro can attenuate kidney fibrosis through reduction of myofibroblast formation. Methods: We performed Unilateral Ureteral Obstruction (UUO) in Vascular Endothelial Endothelin-1 Knock-Out (VEETKO) and WT mice, sacrificed in 3 and 14 days. Myofibroblast was cultured from fibrosis kidney. Histology analyses were done for fibrosis and myofibroblast fraction area. ET-1 and its receptors expression were measured by ELISA and real-time PCR. VEGF, VE-Cadherin, α -SMA, PDGFR β, and TGFβ1 expressions were examined by western blot. Double staining of PDGFR β and αSMA was done to examine renal interstitial cells expansion and myofibroblast transition. Immunostainings were done for PCNA, CD31, ETAR and ETBR. In-vitro, we treated myofibroblast with ET-1 and ETAR inhibitor to examine αSMA expression. Results: Lower fibrosis, myofibroblast faction area, renal interstitial cells expansion and TGFβ1 expression ( p<0.05) were found in VEETKO compare to WT. VEETKO also had higher renal blood flow, capillary number, VE-Cadherin and VEGF expression ( p<0.05) after UUO. WT mice had higher kidney ET-1, ETAR, but not ETBR. We found ETAR expression in myofibroblast. There was increased activation of ETAR downstream signaling through ERK1/2 after UUO, and reduced in VEETKO. In-vitro treatment of ETAR inhibitor, BQ13 reduced α-SMA expression after ET-1 incubation. Conclusions: We show that deletion of ET-1 from EC attenuates kidney fibrosis, reduces myofibroblast formation through reduction ETAR activation. ETAR treatment in-vitro also reduces αSMA expression in myofibroblast culture. Targeting ET-1 and ETAR interaction may give best approach to treat kidney fibrosis. SAP349 ALK1 HETEROZYGOUS DISRUPTION INCREASES RENAL FIBROSIS FOLLOWING URETERAL OBSTRUCTION José Manuel Muñoz-Félix1, Jose M. Lopez-Novoa2 and Carlos Martinez-Salgado3 1 Unidad de Fisiopatología Renal Y Cardiovascular, Instituto Reina Sofía de Investigación Nefrológica, Salamanca, Spain, 2University of Salamanca, Salamanca, Spain, 3Instituto de Estudios de Ciencias de la Salud de Castilla Y León (Iecscyl), Unidad de Investigacion, Hospital Universitario de Salamanca, Spain Introduction and Aims: Tubulointerstitial fibrosis, one of the common end points of chronic renal insufficiency, is characterized by an excessive accumulation of extracellular matrix (ECM) in the renal interstitium, myofibroblast activation, cell infiltration, tubular apoptosis and proliferation. Transforming growth factor-beta 1 (TGFβ1) is considered a fundamental profibrotic cytokine. ALK1 (activin receptor-like kinase I) is a type I receptor for TGFβ1 with a pivotal role in endothelial proliferation and migration. ALK1 promotes ECM protein synthesis in scleroderma fibroblasts. Nevertheless, the role of ALK1 in obstructive nephropathy is unknown. Methods: We performed unilateral ureteral obstruction (UUO), an obstructive nephropathy experimental model, in haploinsufficient (ALK1+/-) and control (ALK1+/ + ) mice in order to analyze the role of ALK1 haploinsufficiency 15 days following ureteral obstruction. We analyzed ECM proteins such as type I collagen and fibronectin, proliferation markers such as proliferation cell nuclear antigen (PCNA) and Ki67, and myofibroblast markers like alpha- smooth muscle actin (α-sma) and S100A4, by western-blot and immunohistochemistry. Kidney ultrastructure was analyzed by Masson`s trichrome and red Sirius staining. ii | Abstracts Barbara Oujo1, José Manuel Muñoz-Félix2, Miguel Arevalo1, Carmelo Bernabeu3, Fernando Perez-Barriocanal1 and Jose M. Lopez-Novoa4 1 University of Salamanca, Salamanca, Spain, 2Unidad de Fisiopatología Renal Y Cardiovascular, Instituto Reina Sofía de Investigación Nefrológica, Salamanca, Spain, 3Centro de Investigaciones Biologicas, Csic, Madrid, Spain, 4University of Salamanca, Salamanca, Spain, Introduction and Aims: Tubulo-interstitial fibrosis is characterized by the synthesis and accumulation of extracellular matrix, inflammatory cell infiltration, tubular cells apoptosis, accumulation of fibroblasts and rarefaction of the microvasculature. Transforming growth factor-β (TGF-β) plays a pivotal role in renal fibrosis. Endoglin, a 180KDa membrane glycoprotein, is a co-receptor of TGFβ which has been described to be increased in kidney and liver fibrosis. Two membrane isoforms generated by alternative splicing have been described: L(large) -Endoglin and S(short) -Endoglin that differ in their cytoplasmic tails, L-Endoglin being the most abundant isoform. Our aim was to assess the role of L-Endoglin in renal fibrosis. Methods: A transgenic mouse strain which overexpresses human L-Endoglin ubiquitously (L-Eng +) was generated. Unilateral ureteral obstruction (UUO) was performed in L-Eng + mice and their respective controls (WT mice). ECM proteins (type I collagen and fibronectin), proliferating cell nuclear antigen (PCNA), myofibroblasts –associated proteins (S100A4 and α-smooth muscle actin, α-SMA) and the inflammatory proteins cyclooxygenase-2 (COX-2) and inducible nitric oxide synthase (iNOS) were assessed by western blot and immunohistochemistry in both obstructed and non obstructed kidneys. Results: Our results show that in obstructed kidneys expression of type I collagen, fibronectin and proliferation cellular nuclear antigen (PCNA) was higher in L-Eng + than in WT mice. Both α-SMA and S100A4 were higher in the obstructed than in non obstructed kidney but there were no significant differences in αSMA expression between obstructed kidneys from L-Eng + and WT mice, whereas S100A4 expression was higher in L-Eng + mice. The expression of COX2, which was increased after UUO in the obstructed kidney, was higher in L-Eng + than in WT mice. Both phospho-Smad1 and phospho-Smad3 increased in the obstructed kidney, and there was no significant difference in phospho-Smad3 between control and L-Eng + obstructed kidney, whereas the activation of Smad1 was significantly higher in L-Eng + than in WT mice. Conclusions: Our results suggest that in the OUU model, L-Endoglin overexpression promotes renal fibrosis through the Smad1 pathway. SAP351 IMPACT OF TWO IMMUNOSUPPRESSIVE DRUGS (CYCLOSPORINE AND EVEROLIMUS) ON IRI-INDUCED FIBROSIS Kers Jesper1, Vittoz Nathalie2, Galichon Pierre3, Dubois Xu Yi Chun2, Hertig Alexandre3 and Rondeau Eric2 1 Department of Pathology, 2Aphp, Hôpital Tenon, 3Inserm U702 Introduction and Aims: The chronic nephrotoxicity of calcineurin inhibitors is currently debated, and is no more the first culprit to explain the interstitial fibrosis and tubular atrophy (IF/TA) that ultimately lead to graft loss. We and others however demonstrated that cyclosporine (CsA) could alter the program of tubular epithelial cells both in vitro and in vivo, in human recipients as well as in animal models, switching the cells towards a mesenchymal phenotype. Here, we tested the hypothesis that CsA would still be a pro-fibrotic drug when administrated on top of some form of injury. Methods: We used a severe model of ischemia/reperfusion injury (IRI) induced by the prolonged (45 min) and biateral ligature of renal arteries in adult Sprague Dawley rats. Animals were then subcutaneously treated with 10 mg/kg/d of CsA or its vehicle for 28 days. A third group of rats was subjected to IRI, exposed to CsA during 10 days, and then then withdrawn from CsA to be given 10 mg/kg of sirolimus, a mTOR inhibitor, to create an experimental model of an en vogue CsA-withdrawal strategy. Last, rats subjected to sham surgery but not exposed to immunosuppressive drugs, and rats exposed to CsA but not subjected to IRI, were used as negative controls. Animals were euthanized at day 28 (d28) to measure a) serum creatinine, b) IF/TA which was measured using a quantitative and morphometric method with the Image J® NIH software, c) the tubular expression of two epithelial-to-mesenchymal Volume 27 | Supplement 2 | May 2012 Downloaded from https://academic.oup.com/ndt/article-abstract/27/suppl_2/ii427/1935270 by guest on 17 June 2020 Nur Arfian1, Noriaki Emoto1, Keiko Yagi2, Kazuhiko Nakayama2, Anggoro Budi Hartopo1, Dwi Aris Nugrahaningsih1, Masashi Yanagisawa3 and Ken-Ichi Hirata1 1 Cardiovascular Division Internal Department, Graduate School of Medicine Kobe University, 2Clinical Pharmacy Department, Kobe Pharmaceutical University, 3Howard Hughes Medical Institute, University of Texas Southwestern Medical Center, Dallas L-ENDOGLIN OVEREXPRESSION INCREASES RENAL FIBROSIS AFTER UNILATERAL URETERAL OBSTRUCTION Abstracts Nephrology Dialysis Transplantation SAP352 THERAPEUTIC EFFECTS OF MESENCHYMAL STEM CELLS IN WISTAR-KYOTO RATS WITH ANTI-GLOMERULAR BASEMENT MEMBRANE GLOMERULONEPHRITIS Masayuki Iyoda1, Takanori Shibata1, Kei Matsumoto1, Yuki Shindo-Hirai1, Yoshihiro Kuno1, Yukihiro Wada1 and Tadao Akizawa1 1 Division of Nephrology, Department of Medicine, Showa University School of Medicine Introduction and Aims: Multipotent mesenchymal stem cells (MSC) have become a popular and promising therapeutic approach in many clinical conditions. In this study, we tested the hypothesis that MSC can provide a potential therapy for human anti-glomerular basement membrane (GBM) glomerulonephritis (GN). Methods: Nephrotoxic serum nephritis was induced in Wistar-Kyoto (WKY) rats on day 0. Groups of animals were given either human MSC (3 x 106) or vehicle by intravenous injection on day 4; all rats were sacrificed at either day 7 or day 13. Vehicle-treated groups received an equal volume of Hank’s balanced salt solution (HBSS). For each group, 10 to 15 rats were analyzed. Proteinuria (U-P), serum creatinine (Cr), and body weight (BW) were measured periodically. Renal morphological investigations were performed at sacrifice. Results: BW was comparable between the two treatment groups throughout the study. Serum Cr level was significantly lower in the MSC-treated rats than in the HBSS-treated rats on day 13 (WKY-HBSS vs. WKY-MSC, Day 7: 0.33 ± 0.001 vs. 0.34 ± 0.01 mg/dL, NS; Day 13: 0.31 ± 0.001 vs. 0.28 ± 0.01 mg/dL, p < 0.05). When compared to vehicle treatment, MSC-treated rats had reduced U-P on day 7 and 13 (Day 7: 66.66 ± 5.22 vs. 56.81 ± 5.87 mg/day, p < 0.05; Day 13: 102.10 ± 7.52 vs. 69.37 ± 5.95 mg/day, p < 0.01). MSC treatment also decreased kidney weight (Day 7: 1.50 ± 0.02 vs. 1.42 ± 0.02 g, p < 0.05; Day 13: 1.59 ± 0.04 vs. 1.45 ± 0.02 g, p < 0.01) and glomerular tuft area (Day 7: 8709.13 ± 175.74 vs. 8322.00 ± 94.49 mm2, p < 0.05; Day 13: 9627.10 ± 473.28 vs. 8631.56 ± 98.96 mm2, p < 0.05). The percentage of crescentic glomeruli was identical between the two treatment groups. ED1-positive macrophages ( p < 0.05), CD8-positive cells ( p < 0.05), and apoptotic cells ( p < 0.001), assessed by TUNEL staining, in glomeruli were significantly reduced by MSC treatment on day 7. Renal cortical mRNA for TNF-α ( p < 0.0001), IL-1β ( p < 0.001), and IL-17 ( p < 0.01) was decreased, whereas IL-4 ( p < 0.05) and Foxp3 ( p < 0.01) was increased in the MSC- treated group on day 7. Collagen type I ( p < 0.01), type III ( p < 0.01), and TGF-β ( p < 0.05) mRNA were significantly decreased by MSC treatment on day 13. Conclusions: MSC treatment attenuates the progression of renal injury in experimental anti-GBM GN via anti-inflammatory and immunomodulatory effects. SAP353 ATTENUATED GLOMERULAR ARGININE TRANSPORT PREVENTS HYPERFILTRATION AND INDUCES HIF-1A IN THE PREGNANT UREMIC RAT Idit Schwartz1 and Doron Schwartz1 Tel Aviv Sourasky Medical Center CAT-1 abundance was unchanged in all experimental groups, PKCa and phosphorylated PKCa (CAT-1 inhibitor), were significantly augmented in CRF, pregnant, and pregnant CRF animals, phenomena which were prevented by co-administrating L-arginine. α-tocopherol (PKC inhibitor) significantly increased arginine transport in both pregnant and CRF pregnant rats, effects which were attenuated by ex vivo incubation of glomeruli with PMA (a PKC stimulant). Renal histology revealed no differences between all experimental groups. Creatinine clearance failed to augment and renal cortical expression of HIF-1α significantly increased in CRF pregnant rat, findings which were prevented by arginine. Conclusions: These studies suggest that in CRF rats, pregnancy induces a profound decrease in glomerular arginine transport, through post translational regulation of CAT-1 by PKCα, resulting in attenuated NO generation. These events provoke renal damage manifested by upregulation of renal HIF-1α and loss of the ability to increase GFR during gestation. SAP354 INTERACTION BETWEEN IGA AND PROXIMAL TUBULAR CELLS DURING GLOMERULAR DISEASES Caroline Prot Bertoye1, Caroline Prot Bertoye2, Sara Terryn3, Julien Claver2, Walid Beghdadi Beghdadi2, Renato Monteiro2, Uli Blank2, Olivier Devuyst4 and Eric Daugas5 1 Inserm U699, Paris France, 2Inserm U699, Paris, France, 3Division of Nephrology- Nefr Unit- Université Catholique de Louvain Medical School, Brussels, Belgium, 4Division of Nephrology - Nefr Unit - Université Catholique de Louvain Medical School, Brussels, Belgium, 5Nephrology Dpt Bichat Hospital Aphp, Paris, France Introduction and Aims: The final common pathway of many glomerular diseases is the progression to end-stage renal failure regardless of the initial insult. The amount of high molecular weight proteins in proteinuria is a reliable indicator of increased glomerular permeability and of severity of the disease. In addition, some of these proteins could have an intrinsic tubular toxicity, but they remain to be identified. In severe glomerular diseases non selective proteinuria include high level of monomeric IgA that we hypothesized to interact with proximal tubular cells (PTC) and promote renal tubulo-interstitial damage. Methods: To this end, murine PTC from primary culture were challenged with monomeric or dimeric human IgA, human IgG, mouse IgA or IgM, albumin or IgA preincubated with soluble transferrin receptor, with different transferrin concentrations. Apoptosis was measured by flow cytometry. Monocyte chemoattractant protein-1 (MCP-1) and Macrophage inflammatory protein-2 (MIP-2) releases from proximal tubular cells were measured. Mitochondrial reactive oxygen species production (Ca3, Ca2, SOD1, SOD2, Catalase, Gpx4) and expression of proliferation and differentiation markers (PCNA, Zonab, Hnf1α) were recorded. Mechanisms of tagged-IgA and lysotracker stained-PTC interactions were investigated by Live cell imaging. Expression of endocytosis markers (Megalin, Cubilin, VATPase E) was also measured. Results: IgA did not promote PTC apoptosis. However, IgA induced time dependant (from 6 to 72h) and dose dependant production (from 1μg/ml IgA concentration) of MCP-1 and MIP-2 by PTC. Conversely, high concentrations of albumin induced only low production of MIP-2. On polarized proximal tubular cells, IgA induced apical secretion of MCP-1 and MIP-2. Production of cytokines was not stimulated by IgG or IgM. There was no difference between monomeric and dimeric IgA and their effect on cytokine production was not inhibited by transferrin or soluble transferrin receptor (CD71). These results were not consistent with an interaction between IgA-CD71 or IgA-Fcα/μ receptor on proximal tubular cells. Moreover, IgA induced PTC to exhibit oxidative stress markers (Ca3, SOD1, SOD2 and catalase) and proliferation markers (PCNA, Zonab) whereas they downregulated differentiation markers expression (Hnf1α). The expression of endocytosis markers (megalin, cubilin) was inhibited by IgA. IgA were absorbed by endocytosis (Live cell imaging, colocalisation with lysotracker). Conclusions: These data support that IgA included in nonselective proteinuria during the course of glomerular diseases are an important contributor of tubulo-interstitial injury through PTC pro- inflammatory chemokines secretion and PTC oxidative stress induction. Megalin is a good candidate for the interaction between IgA and PTC. 1 Introduction and Aims: Pregnancy worsens renal function in females with renal failure (CRF) through an unknown mechanism. Reduced nitric oxide (NO) generation induces renal injury. Arginine transport by cationic amino acid transporter-1 (CAT-1), which governs endothelial NO generation, is reduced in both renal failure and pregnancy. We hypothesize that attenuated maternal glomerular arginine transport promotes renal damage in CRF pregnant rats. Methods: Studies were performed using female Wistar rats at 12-14 weeks of age. Chronic renal failure was induced by a two stage 5/6 nephrectomy (interval of one week). The experiments which included: renal hemodinamic measurment, arginine transport assays, western blotting and histology evaluation were performed 6 weeks following the second surgery or 14 days after day one of pregnancy. Results: In uremic rats, pregnancy induced a significant decrease in glomerular arginine transport and c-GMP generation (a measure of NO production) compared to CRF or pregnancy alone and these effects were prevented by L-arginine. While Volume 27 | Supplement 2 | May 2012 SAP355 COMPARATIVE STUDY OF VALPROIC ACID AND TRICHOSTATIN A IN AN EXPERIMENTAL MODEL OF FSGS Katrien Van Beneden1, Caroline Geers2, Marina Pauwels1, Inge Mannaerts1, Christiane Van den Branden1 and Leo A. Van Grunsven1 1 Vrije Universiteit Brussel, Brussels, Belgium, 2Universitair Ziekenhuis Brussel, Brussels, Belgium Introduction and Aims: Histone deacetylase (HDAC) inhibitors, a relatively new group of anticancer compounds, have been implied as possible anti-fibrotic agents. In the present study, we compare the effect of two HDAC inhibitors, namely valproic acid (VPA) and trichostatin A (TSA), in the murine adriamycin (ADR) nephropathy model. In rodents, ADR causes chronic proteinuria and renal disease, comparable to human FSGS. doi:10.1093/ndt/gfs241 | ii Downloaded from https://academic.oup.com/ndt/article-abstract/27/suppl_2/ii427/1935270 by guest on 17 June 2020 transition (EMT) markers, vimentin and betα-catenin, and d) the expression of fibrogenesis-related mRNA transcripts. Results: When compared to rats subjected to sham surgery (IF 1.2±0.2%), and in contrast with rats that were exposed to IRI but not to CsA (IF: 8.4±3.9%), or to CsA but not to IRI (IF<5%), which developed few if any interstitial fibrosis, the superimposition of CsA had a dramatic effect on fibrogenesis after severe IRI (IF 14.3 ±4.0%, p<0.01). The CsA!mTORi switch at day 10 reduced IF numerically but not significantly (IF 10.4±2%). A very strong correlation was found between IF and the expression of EMT markers (r=0.93, p< 0.001). However, the EMT score was not decreased by the CsA!mTORi switch (CsA: 3.45±0.7 vs CsA!mTORi: 3.25±0.6, p NS). It is in this very group that the fibrogenic transcripts were the highest. Renal function was significantly impaired at d28 in the group of rats still exposed to CsA. Conclusions: With respect to renal fibrogenesis, our results suggest that CsA plays a synergistic role with IRI, and acts as a pro-EMT drug, in a way that is not rapidly reversible. CsA sparing strategies should be discussed to prevent fibrogenesis in patients transplanted with a kidney graft that yields severe vascular lesions, but its impact should be assessed on the long term. Abstracts SAP356 TRANSPORT IN PODOCYTES OF ACUTE PUROMYCIN AMINONUCLEOSIDE NEPHROSIS (PAN) Ismail Seckin1, Meltem Pekpak2, Mumin Uzunalan3, Bulent Uruluer4, Sibel Köktürk5, Zeynep Öztürk6, Hüseyin Sönmez6 and Elif Yaprak7 1 Istanbul University, Cerrahpasa Medical Faculty, Dept Histology and Embryology, 2University Istanbul Cerrahpasa Med.Faculty, Internal Medicine/ Nephrology, 3Laboratory Memorial Hospital, 4Ist.University, Cerrahpasa Med. Fac., Dept. Histology and Embryology, 5Istanbul University, Cerrahpasa Med. Fac., Histology and Embryology, 6Ist. Univ., Cerrahpasa Med. Fac., Biochemistry, 7 Ist. Univ., Cerrahpasa Med. Fac., Histology and Embryology Introduction and Aims: The common way of protein absorption through glomerular epithelial cells ( podocyte) has been investigated by tracking techniques (ferritin, dextran) and been demonstrated generally as following a lysosomal process in nephrotic rats. Puromycine aminonucleoside (PA) has been generally utilized as a model of the podocyte injury followed by a massive proteinuria (1,2,3,4,5). In this study, we aimed to search these protein transport ways in the podocytes which causes high proteinuria values in acute PAN rats. Methods: Two groups were chosen as each group comprised of 6 rats. The first group was used as control. PA was applied to the second group intraperitonally for 10 days. At the end of experimental period, the pieces of kidney cortex resected from rats under anesthesia were prepared for TEM examination. Proteinuria and creatinine was detected in the urines of rats after 24 hours and in the blood samples, taken under anesthesia, creatinine and albumin levels were measured. Results: The averages of the proteinuria levels in the acute nephrosis rats were significantly elevated 18 times more than at the beginning levels. However, creatinine clearance, serum albumin levels and urine volumes were significantly diminished (Table see below). The most distinctive feature of the acute nephrosis group was the protein absorption granules (PAG) in high numbers and different sizes inside hypertrophic podocyte cytoplasm (Figure a, b, c see below). Endocytotic vesicles were frequently SAP356 Figure. (a) Endocytotic vesicles (red stars) formation in the side of podocyte foot processes facing GBM, C: Capillary lumen, GBM: Glomerular basal membrane, x60000. (b) Transport ways inside a podocyte, PAG: Protein Absorption Granulles, RB: Residual Body, Blue stars: Microfilaments, x6300. (c) Exocytosis (black star) in a podocyte (PO), Blue star: Microfilaments, Arrows: Endocytotic vesicles, PAG, GBM, x31500. ii | Abstracts SAP356 Table 1. Urine volumes, proteinuria, serum albumin and creatinine clearance levels of control and acute nephrosis groups. encountered in the podocyte membranes facing the glomerular basal membrane (GBM) (Figure a). PAG, lysosomes and big vesicles of the residual bodies in which these endocytotic vesicles were gathered, were observed inside the podocyte cytoplasm (Figure b). Residual bodies were tightly covered by widespread, electron-dense microfilament bundles (Figure b). We frequently observed some images with the residual bodies secreting the ingredients of electron-dense materials to the urinary region (Figure c). In the rats with a high-proteinuria, we also observed some locally nude GBM regions as a result of foot process ( pedicel) loss in glomeruli. Conclusions: Our results suggested that in acute PAN, the generally used way for initial protein secretion to the urinary region was intracytoplasmic transport in which proteins taken by endocytosis were digested by cellular lysosomal activity and afterwards secreted by exocytosis. SAP357 NOVEL VASCULOPROTECTIVE ROLE OF NITRIC OXIDE SYNTHASE (NOS) SYSTEM IN MICE: INVOLVEMENT OF NOS SYSTEM IN BONE MARROW-DERIVED VASCULAR PROGENITOR CELLS Yumi Furuno1, Masato Tsutsui2, Tsuyoshi Morishita3, Hiroaki Shimokawa4, Yutaka Otsuji3, Nobuyuki Yanagihara5, Narutoshi Kabashima6, Serino Ryota3, Kaori Kanegae7, Tetsu Miyamoto3, Junichi Nakamata8, Nana Ishimatsu3 and Masahito Tamura9 1 Second Department of Internal Medicine, University of Occupational and Environmental Health, 2Department of Pharmacology, Graduate School of Medicine, University of the Ryukyus, 3Second Department of Internal Medicine, School of Medicine, University of Occupational and Environmental Health, 4 Department of Cardiovascular Medicine, Tohoku University Graduate School of Medicine, 5Department of Pharmacology, School of Medicine, University of Occupational and Environmental Health, 6Kidney Center, University of Occupational and Environmental Health, 7Kidney Center, University of Occupational and Environmental Health, 8The 2nd Department of Internal Medicine, University of Occupational and Environmental Health, Kitakyushu, Japan, 9University of Occupational and Environmental Health Introduction and Aims: Although nitric oxide (NO) is synthesized by three NO synthases (nNOS, iNOS and eNOS), the role of the whole NOS system in vascular lesion formation of injured artery remains to be elucidated. Furthermore, although bone-marrow-derived vascular progenitor cells have been shown to be involved in vascular lesion formation of injured artery, the role of the NOS system in the cells also remains unknown. We addressed these issues in mice deficient in all NOS genes. Methods and Results: Vascular injury was induced by permanent ligation of a unilateral carotid artery in wild-type, singly, and triply NOS-/- mice. Two weeks after the procedure, constrictive vascular remodeling and neointimal formation were recognized in the ligated arteries of all genotypes. While constrictive vascular remodeling was noted in nNOS-/- and iNOS-/- genotypes, it was most accelerated in n/i/eNOS-/- genotype. While neointimal formation was evident in eNOS-/- and nNOS-/- genotypes, it was also most aggravated in n/i/eNOS-/- genotype. Those findings were reversed by long-term oral treatment with isosorbide dinitrate, a NO donor. Blood pressure was significantly elevated in eNOS-/- and n/i/eNOS-/genotypes, whereas those changes were not significantly correlated with the extents of vascular lesion formation, suggesting a minor role of hypertension. Recent studies reveal that circulating vascular progenitor cells of bone marrow origin accumulate in vascular wall, differentiate into vascular cells, and cause arteriosclerosis. Thus, we finally examined the involvement of NOSs in bone marrow-derived vascular progenitor cells. Bone marrow of wild-type or n/i/eNOS-/- mice was transplanted into irradiated wild-type or n/i/eNOS-/- recipients, and then the carotid artery ligation was performed. Importantly, constrictive vascular remodeling and neointimal formation were both markedly accelerated in wild-type mice that received transplantation of n/i/eNOS-/- bone marrow as compared with wild-type mice that received transplantation of wild-type bone marrow. Furthermore, vascular NOS activities were markedly reduced in wild-type mice that received transplantation of n/i/eNOS-/- -bone marrow compared with wild- type mice that received transplantation of wild-type-bone marrow. These results suggest that NOSs Volume 27 | Supplement 2 | May 2012 Downloaded from https://academic.oup.com/ndt/article-abstract/27/suppl_2/ii427/1935270 by guest on 17 June 2020 Methods: Adult female Balb/c mice were divided at random into 10 groups (n = 6-9/ group). Three groups of mice were injected with saline solution in the tail vein (control; VPA-treated control; TSA-treated control). The other groups were administrated ADR through a single intravenous tail vein injection (10 mg/kg). Four groups of ADR-injected animals received treatment either with VPA (0.4% in drinking water) or TSA (0.5 mg/kg intraperitoneal injection), respectively 3 days prior to ( pre-VPA group; pre-TSA group) or 13 days after ( post-VPA; post-TSA) ADR administration. Three groups of untreated ADR animals were sacrificed at relevant time points. During the course of the experiment, mice were regularly housed in metabolic cages for the collection of 24-hour urine samples. Kidneys were harvested for histological evaluation and for assessment of mRNA expression of fibrotic (α- SMA, collagen 1α1 and TIMP-1) and inflammatory (MCP-1, MIP-1β and TNF-α) markers by RT-PCR. Results: Administration of VPA three days prior to ADR injection prevents the development of proteinuria and glomerulosclerosis. In a similar experimental set-up, TSA cannot prevent proteinuria, however glomerulosclerosis is significantly hampered. Postponing treatment, until a significant peak in proteinuria is observed, results in a drop of proteinuria to control level within three days after the start of VPA administration, whereas TSA treatment is not able to correct proteinuria. In contrast, for both postponed VPA and TSA set-ups the glomerulosclerosis score is comparable to the level reached at the start of the treatment. Furthermore, the process of renal fibrosis and inflammation is attenuated by both HDAC inhibitors. Conclusions: Together, these data suggest a role for HDACs in renal pathogenesis and point towards a therapeutic potential for HDAC inhibitors. However, not all HDAC inhibitors seem to have the same effect on renal disease progression. In the experimental adriamycin nephropathy model, VPA seems the most promising anti-proteinuric agent. Nephrology Dialysis Transplantation Abstracts Nephrology Dialysis Transplantation deficiency in bone marrow-derived vascular progenitor cells contribute to a decrease in vascular NOS activities and exacerbation of vascular lesion formation in the ligated arteries. Conclusions: These results demonstrate that complete disruption of all NOS genes causes markedly accelerated vascular lesion formation caused by blood flow disruption in mice in vivo, demonstrating the novel vasculoprotective role of the whole endogenous NOS system. Our findings also indicate that the NOS system in bone marrow-derived vascular progenitor cells is involved in this vasculoprotective mechanism. SAP358 PLATELET-DERIVED GROWTH FACTOR RECEPTOR BETA SIGNAL COULD CONTRIBUTE TO VULNERABILITY AND REPAIRABILITY OF GLOMERULAR CAPILLARY STRUCTURE Introduction and Aims: Many data have been accumulated to show that platelet-derived growth factor receptor β (PDGFR-β) is involved in the mesangial cell proliferation and sclerosis in glomerular diseaseses. However, our recent study indicated the involvment of PDGFR-β in the remodeling of injured glomerulus after subtotal nephrectomy. In the present study, Habu-snake venom-induced glomerulonephritis (HV-GN) was introduced into conditional knockout mouse of PDGFR-β gene. Then we evaluted the relevance of PDGFR-β in the mesangiolysis (ML), a hallmark of HV-GN pathology, and in the following remodeling of the glomerulus. Methods: Conditional konckout mice were obtained by giving tamoxifen to mice harboring both PDGFR-β floxed allele and transgenes encoding Cre recombinase with a tamoxifen- sensitive estrogen receptor at 4 weeks of age (Deletant, n=40). Mice harboring PDGFR- β floxed allele but not Cre-transgene, that preserved PDGFR-β expression, were used as controls (Floxed, n=30). Kidneys were harvested at 0, 1, 3, and 11 days (d) after HV infusion. HV was intravenously injected at 5mg/ kg of body weight. Group of mice were given 6mg/kg of HV to evoke more sever ML, and were investigated at only 11d . ML-score quantitatively represented capillary ballooning and microaneurysm of HV- GN by our scoring system. Data indicate means ± SE and are described as (Deletant vs. Floxed, p-values between two genotypes). Results: After HV-injection at 5mg/kg, the increase of ML-score was significant in Deletant ( p<0.01), but not in Floxed ( p=0.09) in analysis of variance. In detail, ML was observed at very small fraction of glomeruli in both genotypes at 0d (ML-score, 1.2±0.4 vs. 1.2±0.4). ML significantly increased at 1d than at 0d and appeared more in Deletant than in Floxed (50.2±15.1 vs. 34.5±19.3, p=0.53). After that, ML promptly decreased by 3d in Floxed. By contrast, in Deletant, ML remained at high level at 3d, and it was 3.7-fold of Floxed (35.8±9.2 vs 9.8±3.1, p=0.04). ML-score was significantly higher at 3d than at 0d in Deletant, but not in Floxed. Interestingly, MLwas mostly repaired at 11d in two genotypes of mice (1.6±0.4 vs 1.5±0.3, p=0.90). After HV-injection at 6mg/kg, ML-score remained at significantly high levels in Deletant than Floxed at 11 d (10.0±3.1 vs. 2.3±0.8, p=0.04). The mesangial cell numeber per glomerulus was comparable in two genotypes at 0d (21.7±0.8 vs. 22.7±0.7, p=0.38), and was significantly smaller in Deletant than in Floxed at 11 d (18.0±0.8 vs. 22.4±0.9, p<0.01). Conclusions: ML in HV-GN was augmented in PDGFR-β-depleted mice. Mesangial cells expresses PDGFR-β and they are thought as primary target of PDGF in glomerulus. The fragility of the mesangial extracellular matrix (ECM) may be involved as the underling mechanism of this augmented ML, since ECM is a primary target of HV. Furthermore, the repair of ML was delayed and the mesangial cell number was not restored after HV- GN in PDGFR-β-depleted mice. Suppressed mesangial cell responses could be the underlying cause of disturbed glomerular remodeling after HV-injection. SAP360 Kiyoko Inui1, Fumihiko Sasai2, Yuichi Maruta1, Hiroki Nishiwaki1, Eri Kawashima3, Yoshihiko Inoue1 and Ashio Yoshimura1 1 Showa University Fujigaoka Hospital Yokohama Japan, 2Showa University Fujigaoka Hospiral Yokohama Japan, 3Showa University Fujigaoka Yokohama Japan Introduction and Aims: There are three isoforms of smooth muscle calponin. In them, the calponin-h2 (CN2, neutral calponin) suppresses smooth muscle cell migration and effects physiological roles on cytoskeletal organization. However its precise function to the kidney is still unknown. We examined the role of CN2 in the interstitial injury of both kidneys and heart in old mice, for studying the mechanism for relationship between heart and kidney in chronic kidney disease (CKD). Methods: Transgenic mice for CN2 was established (CN2-Tg) using the CRE-loxP site-specific recombination system, in that CN2 expression is induced only during the treatment of cadmium sulfate (CS, 0.5mg/kg BW/day). CS intraperitoneal injection was performed 7-10 days/month from 6 months old on all mice. Both heart and kidneys were removed from eight mice (four of CN2-Tg and four of wild type mice (WT)) with 20-26 months old. Immunohistochemistry for ki-67+ (interstitial proliferating cells), F4/80+ (monocyte/macrophages) and collagen I was performed for all kidney tissues. Interstitial fibrosis was studied by Masson-Trichrom staining on both kidneys and heart, and were shown as a staining score respectively. All data were evaluated by computer-analysis system and were expressed as mean (m)±SE. Results: There was no significant difference in the weight of kidneys (both kidneys weight (g) / body weight (g) x100, 0.79±0.04 (m±SE) in CN2-Tg, vs 0.72±0.06 in WT) and heart (g) (/body weight (g) x 100, 0.22±0.03 vs 0.18±0.02). There was no significant difference in the interstitial cell proliferation (ki-67+ cells/high power field, hpf ) (22.8±4.3 in CN2-Tg, vs 25.5±2.0 in WT), however monocyte/ macrophages recruitment in the interstitium (F4/80+ cells/hpf ) was significantly reduced in CN2-Tg (15.9±4.4 vs 32.8±1.6, p<0.05). Intersititial staining for collagen I was also suppressed in CN2-Tg (staining score: 1.22±0.02 vs 1.43±0.05, p0.05). Development of fibrosis was significantly suppressed in both kidneys (staining score: 0.052±0.002 vs 0.071±0.060, p0.05) and the heart (0.079±0.013 vs 0.104±0.004 , p0.05) of CN2-Tg. Conclusions: Old CN2-Tg mice showed suppression of interstitial inflammation in the kidney and of the development of interstitial fibrosis in both heart and kidneys. Therefore, the induction of CN2 may provide a new way to suppress the development of both CKD and chronic vascular disease (CVD) (cardio-renal syndrome) in old-age CKD patients. SAP361 SAP359 SILENCING THE EXPRESSION OF NOTCH3 RECEPTOR PREVENTS THE DEVELOPMENT OF GLOMERULONEPHRITIS Fala El Machhour1, Monique Kerroch1, Laurent Mesnard1, Christos Chatziantoniou1 and Jean-Claude Dussaule1 1 Inserm Umr S 702, Paris, France Introduction and Aims: Recent studies showed that the de novo activation of Notch3 receptor is involved in the vascular remodeling during pulmonary hypertension (Nat Med 2010). Moreover, our team identified that Notch3 is important in the regulation of the renal vascular tone (Hypertension 2011). The aim of this work is to study the involvement of Notch3 receptor in the mechanisms of progression of experimental crescentic glomerulonephritis (GN). Methods: GN was induced in mice that were treated either with the Notch3 DNA antisense or with the scrambled sequence for 9 days. In the end of the protocol, mice Volume 27 | Supplement 2 | May 2012 CALPONIN-H2 SUPPRESSES THE DEVELOPMENT OF INTERSTITIAL FIBROSIS OF BOTH KIDNEYS AND HEART IN OLD MICE RECOMBINANT HUMAN SOLUBLE THROMBOMODULIN ATTENUATES ANTI-GLOMERULAR BASEMENT MEMBRANE GLOMERULONEPHRITIS IN WISTAR-KYOTO RATS Kei Matsumoto1, Kei Matsumoto1, Masayuki Iyoda1, Takanori Shibata1, Yukihiro Wada1, Yuki Shindo-Hirai1, Yoshihiro Kuno1 and Tadao Akizawa1 1 Division of Nephrology, Department of Medicine, Showa University School of Medicine, Tokyo, Japan Introduction and Aims: Recombinant human soluble thrombomodulin (RH-TM) is newly developed for the treatment of DIC. Since RH-TM has anti-inflammatory properties, the protective effects of RH-TM were examined in nephrotoxic serum nephritis (NTS-N) of Wistar-Kyoto (WKY) rats, in which CD8+ T cells and macrophages are major pathogenetic factors. Methods: NTS-N (N=26) was induced in WKY rats on day 0. Groups of animals were given either RH- TM (3mg/kg x 2/day, n=13) or vehicle (an equal volume of doi:10.1093/ndt/gfs241 | ii Downloaded from https://academic.oup.com/ndt/article-abstract/27/suppl_2/ii427/1935270 by guest on 17 June 2020 Taizo Nakagawa1, Taizo Nakagawa1, Kumi Ichikawa1, Mayumi Miyamoto1, Daisuke Takabayashi1, Hidenori Yamazaki1, Kouta Kakeshita1, Tsutomu Koike1, Satoshi Kagitani1, Fumihiro Tomoda1, Takeru Hamashima2, Yoko Ishii2, Hiroshi Inoue1 and Masakiyo Sasahara2 1 The Second Department of Internal Medicine, University of Toyama, Toyama, Japan, 2Department of Pathology, University of Toyama, Toyama, Japan were sacrificed and tissue, urine and plasma samples were obtained and used for subsequent analysis. Results: The mRNA and protein expressions of Notch3 were significantly reduced in the renal cortex of mice that received Notch3 DNA antisense compared to scrambled injected mice ( p<0,05). The 2 groups progressed to chronic renal disease, but the mice injected with Notch3 DNA antisense were relatively protected compared to scrambled group as evidenced by the values of plasma urea ( p<0,05) and proteinuria ( p<0,05). This improvement of renal function was accompanied by fewer deposits of fibrin within glomeruli and less peritubular and glomerular inflammation. Moreover, the inhibition of Notch3 was associated with blunted activation of growth factor signaling pathways well known to be involved in the development of the GN such as the PDGFRβ and HB-EGF expressions. Conclusions: Our study shows that the activation of Notch3 is involved in the remodeling occurring in the kidney during the GN especially by promoting proliferative and pro-inflammatory pathways. These results imply that Notch3 activation is involved in the physiopathology of CKD, at least in this model, and suggest that inhibiting the activation of Notch3 could be a novel therapeutic approach. Abstracts SAP362 PROTECTIVE EFFECT OF N-3 FATTY ACIDS AGAINST CYCLOSPORIN A-ASSOCIATED CYTOTOXICITY IN CULTURED HUMAN MESANGIAL CELLS Estella Musacchio1, Giovanna Priante2, Chiara Valvason3, Leonardo Sartori1 and Bruno Baggio3 1 Clinica Medica I, Department of Medicine, University of Padova, 2Department of Medicine, University of Padova, Padova, Italy, 3Nephrology Unit, Department of Medicine, University of Padova Introduction and Aims: Cyclosporin A (CyA) is a potent immunosuppressant widely employed in the prevention of organ transplant rejection as well as in the treatment of autoimmune diseases. While its use has improved both allograft survival and patients’s quality of life, unfortunately it is also associated with several side effects among which severe nephrotoxicity with large decrease in renal hemodynamics. Epidemiological and clinical studies clearly demonstrate that fatty acids (PUFAs) and their metabolites play an important role as autocrine and paracrine mediators in various patho-physiological conditions at different tissue and organ levels including kidney disease. Our aim was to investigate, an in vitro model, a possible protective effect of the fish oil components eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA), n-3 PUFAs, in counteracting the adverse effects developed in the course of immunosuppressive therapy. Methods: Primary human mesangial cells (HMC) were cultured in complete RPMI 1640 medium supplemented with 20% FCS, 1% nonessential amino acids, 125U/ml insulin, 5mg/ml transferrin, 5ng/ml Se, At passage 6, cells were treated for 24 hrs with (CyA) at 1 or 5 μg/ml either alone or simultaneously with both fatty acids (50 mM EPA and DHA). In order to test the possible toxic effect of such treatment, morphology and viability were assessed at light microscopy by Trypan blue exclusion. Gene expression analysis was performed by RT-PCR to evaluate the renal fibrosis markers Transforming Growth Factor β (TGFβ), Fibronectin (FN), type IV Collagen (COL IV) and Connective Tissue Growth Factor (CTGF). Results: CyA, particularly at 5 μg/ml, induced a significant up-regulation of all four genes considered,: TGFβ +140%, FN +128%, COLIV +140%, CTGF +250% (p0.05). On the contrary, the effect of fatty acid treatment resulted in a significant down-regulation: TGFβ - 35%, FN –55%, COLIV –70%, CTGF –20% with respect to controls (untreated cells). When fatty acids were used in simultaneous treatment with CyA, they exerted a significant inhibitory effect on CyA-induced upregulation of all four genes: TGFβ -78%, FN –70%, COLIV –110%, CTGF –60% (p0.01 vs CyA-treated cells) Conclusions: These preliminary data are particularly encouraging, as they confirm the beneficial effect of fish oil at renal cells level. Our in vitro results substantiate clinical reports of CyA-induced nephrotoxicity and the beneficial effect of n-3 PUFAs at renal level. The favourable action of EPA and DHA on CyA-altered pro-fibrotic cytokines profile may suggest their use in the non- pharmacological management of adverse outcomes in kidney transplanted patients undergoing CyA treatment. SAP363 INFLUENCE OF CYCLOSPORINE A ON GLOMERULAR GROWTH AND PROTECTIVE EFFECT OF MIZORIBINE AND LOSARTAN ON CYCLOSPORINE A NEPHROTOXICITY IN RAT Ji Hong Kim1 Ganagnam Severance Hospital. Yonsei University College of Medicine, Seoul, Korea 1 Introduction and Aims: The therapeutic benefits of cyclosporine A (CsA) are often limited by the chronic histologic nephrotoxicity of its long-term use. The main pathogenetic factors of chronic CsA-induced nephropathy include activation of the intrarenal renin-angiotensin system(RAS), renal ischemia via arteriolar constriction, increases in transforming growth factor(TGF-β1) and inflammatory cytokines such as osteopontin(OPN). This study tested the hypothesis that the concurrent ii | Abstracts administration of mizoribine(MZR) and either losartan(LSRT) may prevent CsA induces chronic nephropathy and retardation of glomerular growth in rats via suppression of pro-inflammatory mediators and profibrogenic cytokines such as TGF-β1 and OPN. Methods: Six weeks old male Spuraque-Dawley rats (weighing 200-220g) maintained on a low salt diet were given vehicle, CsA (15 mg/kg), CsA+LSRT (30 mg/kg/day), CsA+MZR (5 mg/kg), CsA+LSRT+MZR for 4 and 7weeks. Basic blood chemistry examination (CsA level, BUN, creatinine, cholesterol, triglyceride) and histopathologic change (tubular vacuolization and drop out, arteriolopathy, tubulointerstitial fibrosis, and inflammatory cell infiltration) was compared among treated groups. Inflammatory and profibrotic factors(anti rat ED-1 cell, OPN and TGF-β1) were studied by immune histochemistry and mRNA quantification of OPN and TGF-β1 were studied by real-time PCR. Results: MZR attenuated the tubular cell vacuolization and drop out at 4weeks ( p0.05). MZR and MZR+LSRT reduced tubulointerstitial fibrosis at 7 weeks (P<0.01, p0.05). Arteriolopathy was decreased in MZR+LSRT at 7 weeks (p0.05). OPN and TGF-β1 mRNA expression was decreased in MZR ( p0.01) and MZR+LSRT ( p0.05) at 4 weeks. OPN mRNA expression was decreased at 7weeks in MZR+LSRT (p0.05). TGF-β1 mRNA expression was decreased at 7 weeks in MZR (p0.01) and MZR+LSRT (p0.01). ED-1(+) cell decreased in MZR (p0.05) and MZR+LSRT (p0.05). Glomerular size (Bowman’s area and tuft area) decreased in CsA only group and recovered in MZR (p0.01) and MZR+LSRT (p0.05) at 7weeks. Conclusions: This study demonstrated that MZR has protective effects on inflammatory process in chronic CsA nephropathy and led to improvement of tubular damage, tubulointerstitial fibrosis and arteriolopathy by down regulation of OPN and TGF-β1. In combined treatment with MZR, LSRT provided synergistic effects in attenuating inflammatory and fibrotic processes in this rat model of chronic CsA induced nephropathy. Glomerular size is significantly reduced CsA treated rat in Bowman's and glomerular tuft area. MZR and LSRT treated groups showed significant little decrease of glomerular size than CsA tread group. In conclusion, MZR and LSRT can be used for protecting agent of chronic histologic CsA nephrotoxicity and glomerular size contraction as a adjuvant for long term CsA treatment. SAP364 EVALUATION OF EARLY DIAGNOSTIC MARKERS FOR ALPORT SYNDROME BEFORE THE ONSET OF MICROALBUMINURIA IN THE COL4A3-KNOCKOUT ANIMAL MODEL OF CHRONIC PROGRESSIVE RENAL FIBROSIS Oliver Gross1, Rubel Diana2, Dihazi Gry H.2, Bibi Asimal2, Temme Johanna2, Schmidt-Eylers Imke2, Weimer Lydia2, Müller Gerhard-Anton2 and Dihazi Hassan2 1 Universitätsmedizin Göttingen, 2University Medicine Goettingen, Goettingen, Germany Introduction and Aims: The hereditary kidney disease Alport syndrome leads to end stage renal failure early in life. ACE-inhibitors can - depending on the onset of therapy - delay kidney failure by decades and thus improve the life expectancy of Alport patients. This increases the pressure on early diagnosis of yet oligosymptomatic children. Therefore, the present study investigates early markers of Alport disease before the onset of microalbuminuria in the mouse model. Methods: Using differential 2D gel electrophoresis (DIGE), urine proteins of Alport mice at preclinical stages were separated by molecular weight and charge, and compared to healthy animals. Subsequently, the differentially excreted proteins were identified using mass spectrometry and validated by Western blot in the urine of a large number of Alport mice. Results: Before the onset of microalbuminuria, Alport mice excreted abnormal proteins in the low molecular weight, but also in the high molecular weight range in their urine: both DIGE and Western blot showed plasminogen, antithrombin III, parvalbumine, serpin A3K, haptoglobine and amyloid precursor protein 1 in at least 5-fold concentration compared to healthy controls. Conclusions: For the first time, our experiments demonstrated that Alport mice exhibit early markers of renal disease already in preclinical stages (before the onset of microalbuminuria). As a next step, the significance of these biomarkers in monitoring efficiancy of nephroprotective ACE- inhibitor therapy will be examined in the animal model. Subsequently, the biomarkers found will be validated prospectively in humans in the clinical EARLY PRO-TECT Alport trial in 120 children in the early stages of the Alport disease. SAP365 REGULATION OF THE MOUSE GLOMERULAR FILTRATION BY THE INTEGRIN LINKED KINASE (ILK). ROLE OF THE VASODILATORY CGMP PATHWAY Jose Luis Cano1, Mercedes Griera2, Gemma Olmos3, Paloma Martin1, Maria Alicia Cortes1, Susana Lopez-Ongil4, Diego Rodriguez-Puyol5 and Sergio DE Frutos1 1 Alcala University. Alcala DE Henares, Spain, 2Physiology Department, Alcala University, Alcala de Henares, Madrid, España, 3Universidad de Alcala, Facultad de Medicina, Alcala de Henares, Madrid. Spain, 4Fundacion Para la Investigacion Biomedica Del Hospital Principe de Asturias, Alcala de Henares, Madrid, Spain, 5Nephrology Section and Research Unit, Hospital Príncipe de Asturias, Alcalá de Henares and Irsin, Alcala De Henares, Madrid Volume 27 | Supplement 2 | May 2012 Downloaded from https://academic.oup.com/ndt/article-abstract/27/suppl_2/ii427/1935270 by guest on 17 June 2020 saline, n=13) daily by intraperitoneal injection from day 0 to day 6; all rats were sacrificed at day 7. Proteinuria, serum creatinine (Cr), and kidney weight were measured at sacrifice. Routine histology, immunohistochemistry for ED1 and CD8, and real-time RT-PCR for cytokines in renal cortex were performed. Results: There was no significant difference in rabbit IgG, rat IgG, and rat C3 glomerular staining and the levels of serum anti-rabbit IgG antibody between vehicleand RH-TM-treated rats with NTS-N. Compared to controls, RH-TM-treated rats had less proteinuria (68.6 ± 3.26 vs. 45.15 ± 8.51 mg/day, p < 0.01), serum Cr (0.35 ± 0.01 vs. 0.32 ± 0.05 mg/dl, p 0.01) level, and kidney weight (1.49 ± 0.02 vs. 1.25 ± 0.06 g, p < 0.01), as well as reduced glomerular tuft area (8572.69 ± 151.21 vs. 7044.46 ± 530.75 mm2, p < 0.01), and percentage of glomeruli with crescent (95.15 ± 1.16 vs. 81.54 ± 3.47 %, p 0.001). Furthermore, RH-TM-treated rats had significantly reduced glomerular macrophage accumulation (ED1 score: 1.51 ± 0.05 vs. 1.25 ± 0.10 , p < 0.01) as well as reduced renal cortical IL-6 mRNA expression (IL-6/GAPDH mRNA: 1.04 ± 0.09 vs. 0.66 ± 0.16 , p 0.05). The CD8+ cell numbers per glomerular cross- section and renal cortical TNF-α, IL-1β, MCP-1, INF-g, IL-4, and IL-17 mRNA expression were identical between the two groups. Conclusions: RH-TM treatment attenuates the progression of renal injury in experimental anti-glomerular basement membrane glomerulonephritis through the suppression of macrophages infiltration. Nephrology Dialysis Transplantation Abstracts Nephrology Dialysis Transplantation SAP366 HSP70 INCREASE THE PRODUCTION OF EXTRACELLULAR MATRIX BY VASCULAR SMOOTH MUSCLE CELLS THROUGH TGFB1 UP-REGULATION Marta Gonzalez1, Sergio DE Frutos1, Jose Luis Cano1, Alicia Luengo1, Paloma Martin1, Manuel Rodriguez-Puyol2 and Laura Calleros1 1 Alcala University, Alcala DE Henares, Spain, 2Universidad de Alcala, Facultad de Medicina, Alcala de Henares, Madrid, Spain Introduction and Aims: Heat shock proteins (HSP) allow cells to adapt to several stressful stimuli and their serum levels are increased in cardiovascular diseases of atherosclerotic origin that courses with fibrosis, constituting a clinical marker of the atherosclerotic severity. However, its implication in the vascular fibrosis process remains unclear. The extracellular HSP70 can interact with the vascular smooth muscle cells (SMC) through the Toll-like receptors 4 (TLR4) translating the pro-inflammatory signals to the SMC. In the atherosclerotic blood vessel, SMCs are the major producer of extracellular matrix (ECM) proteins, such as type I collagen and fibronectin. A well known profibrotic cytokine that leads to vascular fibrosis is the transforming growth factor type-β (TGF-β) which promotes the ECM protein expression. The aim of the present study was to investigate the effect of extracellular HSP70 in the TGF-β1-dependent expression of ECM proteins, in vascular smooth muscle cells. Methods: Confluent SMC were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% FBS and antibiotics in 37°C, 5% CO2 incubator and then incubated for different times with 500 pg/ml recombinant Heat shock protein 70 (HSP70). The protein level of transforming growth factor type-β (TGF-β) was determined by western blot, ELISA assay and confocal microscopy, and collagen type I and fibronectin production by western blot. The immunoprecipitation assay was performed with a specific TLR4 antibody and reveled with an antibody recognizing specifically HSP70. Results: Here for the first time we demonstrate that extracellular HSP70 increases TGF-β1 transcription in SMC, which is responsible of the increased expression of ECM proteins, in particular collagen type I and fibronectin, by this type of cells. This increase in fibronectin levels was blocked by a specific TGF-β1 blocker antibody. In addition, we shown that this transcriptional regulation starts with extracellular HSP70 binding to TLR4, and the knockdown of TLR4 with small interfering RNA (siRNA) suppress the increase in TGF-β1 expression induced by HSP70. Conclusions: This novel observation may elucidate the mechanisms by which HSP70 contributes to the pro- inflammatory state present in atherosclerosis and cardiac, vascular and renal fibrosis-related diseases. SAP367 PROTEINURIC EFFECTS OF TANSCRANIAL MAGNETIC STIMULATIONS Rosaria Lupica1, Antonio Lacquaniti2, Valentina Donato2, Rossella Maggio2, Claudia Mastroeni2, Silvia Lucisano2, Valeria Cernaro2, Maria Rosaria Fazio2, Angelo Quartarone2 and Michele Buemi2 1 Policlinico G.Martino Messina Italy, 2Policlinico Universitario G. Martino Messina Italy Introduction and Aims: The glomerular filtration barrier consists of cells whose alteration causes functional changes associated with proteinuria and / or hematuria. Recent evidence has amply demonstrated the similarities between some cellular elements of the glomerulus and neuronal cells. In the podocyte in fact, has been demonstrated the presence of synaptic-like vesicles, containing: Rab 3A, glutamate and its receptor and cannabinoid receptor type 1 (CB1) proteins involved in the Volume 27 | Supplement 2 | May 2012 neuronal transmission. The similarities between the central nervous system (CNS) and kidneys had been demonstrated by previous studies which emphasized the importance of the neurotrophins and their receptors in various stages of embryonic kidney development in rats. Based on these findings we wanted to study, for the first time in vivo the presence of connections between the CNS and kidney. We used the technique of repetitive transcranial magnetic stimulation (rTMS.), a non-invasive method used to study the motor cortex and cortico-spinal tract, able to release several neurotrophins also in the peripheral circulation. As a marker of renal response was studied proteinuria in subjects with diabetic nephropathy and in a healthy group receiving rTMS . Methods: The study was conducted on 16 subjects, 8 with diabetic nephropathy and chronic renal failure, and 8 healthy subjects. All subjects underwent five consecutive days to repetitive transcranial magnetic stimulation delivered at a frequency corresponding to the 60% threshold at rest. Proteinuria and albuminuria of 24 h and the creatinine clearance were measured before the treatment (TO), after the first session (T1), at the end of treatment (T5) and after twenty-four hours by the suspension of stimulation (Post 24). Results: We observed a statistically significant increase in both albuminuria (5.65 ± 0.52 mg/24h vs 12 ± 0.55 mg/24h, p = 0,0001) and proteinuria (6.05 ± 0.48 mg/24h vs 13.1± 0.60 mg/24h, p = 0,0001) at T5 compared to the starting values (T0) in the healthy subjects, with a return to baseline values 24 hours after the end of treatment. In the group of patients with diabetic nephropathy, albuminuria was statistically higher than baseline ( (416.2 ± 181 mg/24h vs 677.25 ± 280mg/24h, p = 0,002), as well as proteinuria (561,37 ± 86 mg/24h vs 865 ± 104 mg/24h, p = 0,0001), at T5; in this group a statistically significant increase in both albuminuria (T0 vs Post24h p = 0,002) and proteinuria (T0 vs Post 24h p = 0,0002) persisted 24h after the cessation of treatment . Conclusions: For the first time, these results show that rTMS have effects not only on neuronal cells but also on the kidney. The stimulations were made subthreshold and act on the inhibitory neurotransmitter pathways. This intensity induced an increase in protein urinary excretion in both healthy and diabetic subjects. In the group of healthy subjects the proteinuria increased statistically significantly from baseline (T0) and after the first (T1)and the last session (T5) and returned to baseline to twenty-four hours after cessation of treatment. In the CKD population however, these changes persisted even at the end of the sessions of TMS. We hypothesize that the electromagnetic stimuli have direct effects on glomerular filtration barrier via the same pathways in the neuronal cells. For the first time it has been demonstrated in vivo that blocking some neurotransmitter pathways in the kidney, cause functional changes in the glomerular filtration barrier and then increase in proteinuria. SAP368 REGULATION OF RENAL FIBROBLAST FUNCTION BY POTASSIUM CHANNELS Michael Kacik1, Sybell Goedicke1, Holger Eggert1 and Joachim Dirk Hoyer2 Philipps-University, Department of Nephrology, Marburg, Germany, 2 Department of Nephrology, Marburg, Germany 1 Introduction and Aims: Potassium channels are important regulators of cellular function during cell cycle and proliferation. In recent studies proliferation of renal fibroblasts has been shown to depend on Cα-activated potassium channels. In the present study we identified a new type of potassium channels and characterized its role in resting and proliferating fibroblasts. Methods: Potassium channel function was characterized in murine renal fibroblasts with whole cell and single channel patch-clamp experiments and cell potential recordings. Expression of potassium channels was determined with quantitative RT-PCR and experimentally regulated by use of si-RNA technique. Channel localisation was examined by immunofluorescence microscopy. Fibroblast proliferation was activated by TGF-βeta and b-FGF and quantified with a colorimetric assay (MTT). Results: In murine renal fibroblasts we newly identified a THIK-1 potassium channel, a member of the two-pore-domain potassium channel (K2P) family. In resting fibroblasts THIK-1 was the predominant potassium channel and responsible for maintaining the hyperpolarized cell membrane potential after activation of resting fibroblast. THIK-1 current was Ca2+- independent and typically activated by arachidonic acid (AA) leading to a mean current of 100 ± 8 pA/pF at a membranpotential of 0mV. In another series of experiments we observed the effective block of THIK-1 currents by the compounds Chlorpromazine and Flupentixol, and by the antiarrhytmic compound Quinidine. There blocking effects on THIK-1 have not been shown so far. After treatment (24h) with the profibrotic factors b-FGF or TGF-βeta the proliferating fibroblasts regulate the THIK-1 current down by about 70 %. Instead the potassium current was carried by the Cα-activated potassium channel KCa3.1. Conclusions: During transition from resting to proliferation state fibroblasts show a distinct switch in potassium channel expression and function. A newly identified Cα-independent THIK-1 channel is predominant in resting fibroblasts and enables a hyperpolarized membrane potential. During proliferation the expression of this channel is downregulated and substituted by the Cα-activated KCa3.1 channel which then regulates Ca2+ ion fluxes in the proliferation state. The study demonstrates a specific switch of potassium channels in proliferated fibroblasts which might proof to be a target for therapeutic intervention in renal fibrosis. doi:10.1093/ndt/gfs241 | ii Downloaded from https://academic.oup.com/ndt/article-abstract/27/suppl_2/ii427/1935270 by guest on 17 June 2020 Introduction and Aims: The guanosine 30 ,50 -cyclic monophosphate (cGMP)-dependent signalling pathway plays an important role in the glomerular filtration, since vessel dilation appears when NO activates soluble guanylyl cyclase (sGC) that produces cGMP, which activates cGMP-dependent protein kinases (PKG). In most renal chronical diseases, the extracellular matrix (ECM) altered composition decreases the cGMP system activity. We demonstrated (de Frutos S et al, JASN 2005) that altered ECM and its interaction with the integrin-linked kinase (ILK) regulates mesangial sGC. Here, we studied the role of ILK in the mice renal cGMP-dependent vasodilatory system and the consequent glomerular filtration. Methods: We used a conditional ILK-deleted mice model (conditional KO) where the cGMP pathway was pharmacologically activated by NO-donor Isosorbide Dinitrate treatment for 24 hours. We analyzed urine volumes, creatine clearance and changes in cortical cGMP-releated protein levels by western blot. Results: We observed a quite significant poliuria in the ILK-conditional KO mice compared with controls. In order to study the role of the cGMP signalling pathway, we observed enhanced poliuria and creatine clearance levels after NO treatment, pointing to an increased cGMP- dependent pathway activity. Indeed, we observed increased cortical sGC and PKG protein levels expression in ILK-conditional KO mice, even though the 24 hours NO-treatment produced tachyphylaxis in these proteins. Conclusions: We propose ILK as a major player in the glomerular physiology and pathology. The lack of ILK increased cGMP-dependent glomerular filtration since ILK seems to regulate sGC and PKG expression in the glomeruli. Abstracts SAP369 Nephrology Dialysis Transplantation CCR7 DEFICIENCY CAUSES A RENAL PHENOTYPE Wurm1, Wurm1, Steege1, Banas1, Simone Andreas Miriam Simone and Bernhard Banas1 2 University Medical Center Regensburg, University Regensburg Armin Kurtz2 1 SAP370 EFFECTS OF GSK3 INHIBITION ON THE REGENERATIVE CAPACITY OF RENAL PROGENITOR CELLS Laura Lasagni1, Elena Lazzeri2, Anna Peired3, Maria Lucia Angelotti3, Elisa Ronconi3, Simone Romoli3 and Paola Romagnani3 1 University of Florence, Florence, Italy, 2University of Florence, 3University of Florence, Italy Introduction and Aims: In adult human kidneys podocytes can get replaced from a resident population of progenitors (RPC) localized along Bowman's capsule, characterized by the presence of surface markers, CD133 and CD24. Understanding of how self-renewal and fate decision of RPC may be perturbed in pathological conditions is of crucial importance. However, the mechanisms that regulate the growth and differentiation of RPC are still unknown. Several evidence demonstrated the involvement of glycogen synthase kinase (GSK3) in kidney physiology. The aim oft he present work was to analyzed the effects of GSK3 inhibition by 6-bromoindirubin- 30 -oxime (BIO) on RPC physiology both in vitro and in vivo. Methods: In vitro proliferation of RPC has been evaluated by thymidine incorporation; the cell cycle has been analysed by FACS. To assess vitality of RPC, FACS analysis for annexin V/propidium iodide has been used. To evaluate the effect of GSK3 inhibition on the capacity of RPC to differentiate toward podocyte cells, RPC have been cultured in podocyte differentiative medium (VRAD medium) in presence or absence of BIO and the expression of podocyte specific markers has been evaluated at both mRNA and protein level. The role of GSK3 in the podocyte regenerative process associated with a glomerular damage has been assessed in an in vivo model of adriamycin-induced nephropathy induced in SCID and Balb/c mice by single intravenous injection of adriamycin. BIO was administered daily by intraperitoneal injection starting from the day of adriamycin injection or starting from day 8 after Adriamycin injection. Results: To investigate the role of GSK3 on RPC proliferation, cells were exposed to different concentrations of BIO. Assessment of 3H-thymidine incorporation demonstrated that BIO- treatment induced a dose-dependent growth inhibition. Viability of BIO-treated and BIO- untreated cells was comparable, thus demonstrating that inhibition of GSK3 was not associated with a reduction in RPC viability. Analysis of the cell cycle distribution after 24 hours of BIO treatment demonstrated that in BIO treated RPC the percentage of cells in the G0/G1 phase was significantly increased in comparison with untreated cells. To evaluate the possible role of GSK3 inhibition in the differentiation of RPC, cells were exposed to VRAD in presence or absence of BIO for 48 hours and expression of podocyte markers was assessed. The differentiation process occurred normally in untreated RPC, and it was greatly augmented in BIO-treated cells. To evaluate the role of GSK3 in renal injury and podocyte regeneration, Balb/C and SCID mice affected by adriamycin-induced nephropathy were treated with BIO or its vehicle. Injection of BIO induced a strong reduction of proteinuria, even after postponing treatment until the peak of adriamycin-induced proteinuria. Accordingly, in vehicle-treated mice there was a decrease in the number of podocytes, identified as nephrin-expressing cells, whereas in BIO-treated mice podocytes were preserved. Conclusions: These data demonstrated that GSK3 is a key enzyme in the regulation of RPC proliferation and quiescence and it has a central role in their differentiative program toward podocyte. GSK3 inhibition strongly ameliorates the renal function, ii | Abstracts SAP371 TYROSINE PHOSPHORYLATION SITES Y4/8/10 OF CD2AP DETERMINE BINDING TO NEPHRIN Irini Schaefer1, Beina Teng2, Kirstin Worthmann2, Hermann Haller2 and Mario Schiffer2 1 Medical School Hannover, Nephrology, 2Medical School Hannover, Germany Introduction and Aims: CD2AP is an adaptor protein that can transmit intracellular signals involved in survival and cytoskeletal regulation of the cell. Until now it is unknown if the activation of CD2AP and its potential to interact with multiple downstream effectors is regulated by phosphorylation. The aim of these studies was to identify tyrosine-phosphorylation sites of CD2AP and to analyze in detail if the phosphorylation of these residues are of fundamental importance. Methods: First we analyzed a potential phosphorylation of CD2AP by 2D-gel-electrophoresis and immunoprecipitation. By alignment of CD2AP of different species we analyze potential tyrosine residues that are evolutionary conserved. To explore if these sites are important for nephrin binding we created CD2AP tyrosine-mutants and performed immunoprecipitations. Furthermore we generated phospho-specific polyclonal antibodies for these sites and performed western blotting, cellular-βased confluence assays, immunofluorescence and – histochemistry. Results: We can demonstrate a significant shift of the isoelectrical point of CD2AP after VEGF- stimulation. Endogenous immunoprecipitation of CD2AP showed specifically that CD2AP is tyrosine-phosphorylated after VEGF-stimulation. TKX1 bacterial cells reveal a tyrosine phosphorylation which is related only to the SH3-domains of CD2AP. Highly conserved tyrosine residues are in every SH3 domain on position Y4/8/10, Y119 and Y273/280. Stimulation of murine and human podocytes with VEGF showed a typical phosphorylation profile of CD2AP with the generated antibodies. Confocal microscopy of the phospho- specific antibody against Y4/8/10 on murine and human podocytes showed after stimulation with VEGF a colocalization of phospho-CD2AP spots with actin-endings especially at the leading edges. To further investigate the physiological relevance of CD2AP phosphorylation we performed a cellular-βased confluence assay that shows a confluence-dependent increase of CD2AP phosphorylation in murine and humane podocytes indicating that cellular contact plays an important role for CD2AP phosphorylation. Cotransfection of the generated CD2AP mutants with nephrin showed an enhanced binding of nephrin to the triple-mutant Y4/8/10 compared to WT-CD2AP and to the Y119 and Y273/280 mutants. Immunofluorescence stainings on parafine sections of mouse and human reveal that the phospho-specific antibodies against Y119 and Y273/280 showed a specific slit-diaphragm staining whereas the phospho- specific antibody against Y4/8/10 showed a more cytosol-specific staining. Furthermore in human diabetic conditions, where VEGF expression is enhanced in the kidney, CD2AP phosphorylation on position Y4/8/10 is increased in the cytoplasm of podocytes. Conclusions: These results propose that CD2AP is a tyrosine phosphorylated protein and that phosphorylation on position Y4/8/10 determine localization of CD2AP and interaction with nephrin. SAP372 PROTEOMIC PROFILE OF CD24+ CD133+ RENAL MULTIPOTENT PROGENITORS (RMP) Clelia Prattichizzo1, Giuseppe Stefano Netti2, Maria Teresa Rocchetti1, Luigi Cormio3, Giuseppe Carrieri3, Giovanni Stallone1, Giuseppe Grandaliano1, Elena Ranieri1 and Loreto Gesualdo4 1 Nephrology, Dialysis and Transplantation Unit, Clinical Pathology Unit, Dept. of Biomedical Sciences, University of Foggia, 2University of Foggia, Foggia, Italy, 3 Urology Unit, Dept. of Surgical Sciences, University of Foggia, 4Nephrology, Dialysis and Transplantation Unit, Deto, University of Bari Introduction and Aims: Renal Multipotent Progenitors (RMP) represent a population of undifferentiated pluripotent cells with both self-renewal and multilineage differentiation characteristics. A population of CD24+/CD133+ RMP in adult human kidneys is able to repair injured renal tissue. Proteomics provides a powerful approach for studying the characteristics of RMP and discovering molecular markers. Methods: RMP lines were isolated from normal kidneys of 30 patients undergoing nephrectomy for renal cell carcinoma. We have analyzed proteome profiles of two RMP lines using 2- Dimensional Electrophoresis analysis combined to nano-High Performance Liquid Chromatography-Electro Spray Ionization (HPLC-ESI)-ion trap and Matrix-Assisted Laser Desorption/Ionization-Time of Flight (MALDI TOF) analysis. The identified protein were studied by Ingenuity Pathway Analysis (IPA). The data obtained were validated by Immunoblot analysis. Results: An average of about 1080 spots, characterized by their pI and MW, were detected in the silver stained gels of total protein extract. The protein spots identified were involved in cellular cytoskeleton (28.6%), stress response (23.8%), cellular metabolism (14.3%), cell proliferation and differentiation (9.5%). In detail, a large number of proteins were identified as chaperones, heat shock proteins, ubiquitin/ Volume 27 | Supplement 2 | May 2012 Downloaded from https://academic.oup.com/ndt/article-abstract/27/suppl_2/ii427/1935270 by guest on 17 June 2020 Introduction and Aims: Chemokines represent a large group of chemotactic cytokines that are classified in four families (CL, CCL, CXCL and CX3CL). These molecules and their receptors do not only effect the progress of inflammatory responses such as leukocytes recruitment, but play also a role in various physiological processes like angiogenesis, haematopoiesis and nephrogenesis. Previous studies from our group revealed that human mesangial cells constitutively express the receptor CCR7, while podocytes express the CCR7 ligand CCL21. To examine the role the CCL21 and CCR7 for the renal morphology and function the kidneys of 20 and 30 weeks old CCR7-/- mice were studied. Methods: Blood and urine samples were taken from 20 and 30 weeks old CCR7-/mice as well as from age-matched wt mice. Renal tissue was embedded in paraffine for (immuno-) histochemical examinations and preserved for electron microscope photographs, respectively. For qPCR analyses renal RNA was isolated. Results: CCR7-/- mice had significantly elevated proteinuria compared to wt mice. Electron- microscopic analyses showed signs of podocyte foot effacement, reduced mesangial cellularity and amorphous deposits in the extracellular matrix. Histochemical stainings displayed further structural glomerular alterations of CCR7-/mice: Morphometric evaluation of periodic acid-schiff (PAS) staining reveals deposition of PAS-positive material in glomeruli. Sirius Red staining indicated an elevated amount of glomerular collagen. Conclusions: Based on these findings we suggest that CCL21 and CCR7 play an important role for renal development and function. Interventions in the murine CCL21/CCR7 system effect the renal architecture as well as the functionality of the kidney. thus suggesting that it contributes to the pathogenesis of renal disease and that GSK3 inhibitors may have therapeutic potential in kidney diseases. Abstracts Nephrology Dialysis Transplantation proteasome, and oxidative stress responsive proteins underscoring the ability of these cells to resist oxidative stress and increase their lifespan. Functional clustering of differentially expressed proteins by IPA TM in comparison with the Proximal Tubular Epithelial Cells (PTEC) proteome from the same donors revealed that 17betα-estradiol pathway was overexpressed in RMP (IPA score 32). To confirm this observation we investigated the expression of 3 upregulated key proteins of the pathway (17betα-estradiol receptor, NME1 and Zyxin) by immunoblot analysis and observed a significant increase of their expression in RMP cell lines compared to PTEC from the 3 donors. Conclusions: To our knowledge, this study represents the first proteomic dataset for RMP lines and may provide a better insight into RMP biology. Several studies explore the direct effects of sex hormones on kidney and our data may suggest that RMP may represent a key target for 17- betα-estradiol. Knowledge of renal progenitor cell biology may enable a better comprehension of the mechanisms of renal repair. THE INFLUENCE OF HIGH PROTEIN SOY BEAN DIET ON BLOOD SERUM NIITRATE LEVEL IN SPONTANEOUSLY HYPERTENSIVE RATS WITH EXPERIMENTAL RENAL FAILURE Anatoliy Kucher1, Alexey Smirnov2, Marina Parastayeva1, Olga Beresneva1, Ivan Kayukov1, Irina Zubina1 and Galina Ivanova3 1 Saint-Petersburg State Medical University Named after I.P. Pavlov, 2Institute of Nephrology, Saint-Petersburg State Medical University Named after I.P. Pavlov, 3 Pavlov Institute of Physiology, Saint-Petersburg, Russia Introduction and Aims: Finding of methods of correction of metabolic and functional abnormalities in arterial hypertension (AH) complicated by chronic kidney disease (CKD) remains an imported problem. Nitric oxide is an important regulator of vascular tone and platelet adhesion. Aim of this study was to evaluate the concentrations of nitrate (NO3-) - indirect marker of the concentration of nitric oxide in the body and other biochemical parameters in blood serum, blood pressure (BP) and left ventricular mass (LVM) in spontaneously hypertensive rats (SHR), were subjected to 5/6 nephrectomy (NE), against a background of a standard diet or a high-protein soy-βean diet (HPD). Methods: We used adult male SHR in following experimental groups: 1) control (C) – sham-operated (N) rats receiving a standard diet (20% of animal protein; n = 8); 2) rats with NE, received a standard diet (n = 8); 3) sham-operated rats receiving HPD (containing 50% soybean protein – SUPRO 760; n=10); 4) rats with NE on HPD (n = 10). To create a model of renal failure removed 5/6 renal mass. NE were carried out in two steps with an interval of one week under deep intraperitoneal anesthesia by sodium thiopental (50 mg/kg). Rats were taken out of the experiment by decapitation under light ether anesthesia 2 months after NE. At this time, blood sampling was received for subsequent determination of serum concentrations of urea (SUr), creatinine (SCr), inorganic phosphorus (Pi) and NO3-. NO3- in the blood serum was evaluated by capillary electrophoresis ("Capel-103”, “LUMEX”, Russia). The degree of left ventricular hypertrophy was estimated as a ratio: left ventricular mass/body mass (LVH; mg/g). BP was measured in the awaked rats by the tail cuff method. Results: 2 months after 5/6 NE in rats on standard diet was an increase in blood pressure (220 ± 10 mm Hg) with respect to C (165 ± 5 mm Hg, p <0.001). In rats with NE who ate HPD blood pressure was significantly lower (180 ± 5 mm Hg, p <0.01), than in the sham-operated group on the standard diet. Soybean diet slowed the development of myocardial hypertrophy in rats with NE (LVH in the fourth group was 3.69 ± 0.07; in 2nd: 4.23 ± 0.25 mg / g. p <0.001). NO3- level in rats with NE on the standard diet (0.81 ± 0.07 mg / l) significantly from the C did not differ. HPD increased the level of NO3-. as in animals with NE (1.10 ± 0.03 mg / l) and in sham-operated rats compared with C (0.76 ± 0.02 mg / l. p <0.001). Levels of Ur (21.74±1.5 mmol/L ), Cr (0.088 ± 0.003 mg / l). Pi (2.59 ± 0.09 mmol / l) in rat second group were significantly higher than in fourth group (Ur: 12.98 ± 0.9. p <0.0001; Cr: 0.061 ± 0.004. p <0.01; Pi: 2.32 ± 0.07 mmol / l. p <0. 01). Conclusions: High protein soybean diet increased the level of nitrates in the blood serum, slowed the progression of experimental renal failure and exerted antihypertensive and cardio protective effects. SAP374 IMPLICATION OF CX37 IN EXPERIMENTAL NEPHROPATHY Ahmed Abed1, Ludwig Schlekenbach2, Bernard Foglia2, Christos Chatziantoniou1, Brenda Kwak2 and Christos Chadjichristos3 1 Inserm U702, 2Cardiology Dpt, Geneva University Hospitals, 3Inserm Umr S 702, Paris, France Introduction and Aims: Chronic kidney disease (CKD) is promoted by a variety of factors that induce chronic inflammation and fibrosis. Alterations of the expression of the gap junction protein connexin 37 (Cx37) have been associated to the development of inflammation in some chronic and acute pathologies. We have recently demonstrated that altered expression of Cx37 is an early signal of CKD. The objectives of our study were to characterize different cell types that express Cx37 in the renal cortex of healthy mice and to investigate the role of this Cx in obstructive nephropathy. Volume 27 | Supplement 2 | May 2012 SAP375 INCREASED ANGIOTENSIN II AND ALDOSTERONE LEVELS INDUCE OXIDATIVE STRESS AND DNA DAMAGE IN THE KIDNEY INDEPENDENT OF THEIR HEMODYNAMIC EFFECTS Nina Queisser1, Nicole Schupp1 and Susanne Brand1 University of Würzburg, Würzburg, Germany 1 Introduction and Aims: Increased activity of the renin angiotensin system (RAS) leads to hypertension and oxidative stress. A stimulated RAS can also cause an inappropriate increase of the mineralocorticoid hormone aldosterone (Ald). Epidemiological studies revealed a higher cancer mortality and an increased kidney cancer incidence in hypertensive patients. Among other factors, elevated concentrations of angiotensin II (AngII) or Ald, found to be genotoxic in vitro, or both might contribute to carcinogenesis, in particular of the kidney. Methods: Experimental hypertension models were used to analyse the effect of increased blood pressure and of increased levels of AngII and Ald on the genomic integrity of kidney cells. DNA damage like double strand breaks and the mutagenic DNA lesion 7,8-dihydro-8-oxo-guanine (8-oxodG) were detected by immunohistochemistry and mass spectrometry. Oxidative stress was quantified using the oxidant-sensitive probe dihydroethidium. Results: Mice were infused with AngII in four different concentrations between 60 ng/kg min, which did not raise the blood pressure, and 1 μg/kg min, which significantly increased the blood pressure after 48 hours. After 28 days the AngII-treatment had decreased the renal function, assessed as creatinine clearance, and had resulted in histopathological changes of the kidney. The high AngII levels furthermore led to a dose-dependent increase of superoxide radical production in kidney tissue, as well as to a dose-dependent increase of double strand breaks, detected by an antibody against g-H2AX, irrespective of the obtained blood pressure values. Finally the potential mutagenic oxidative DNA base modification 8-oxodG was significantly higher due to the AngII-treatment. In rats infused with Ald also an increase of oxidative stress and DNA damage was detected. Treatment with the mineralocorticoid receptor antagonist spironolactone and the superoxide radical scavenger tempol prevented the occurence of this damage, although they were used in doses not significantly lowering the blood pressure. Hydralazin on the other hand, a vasodilator, decreased the blood pressure to control values, without being able to ameliorate oxidative damage. Conclusions: The results of the presented experiments hint to a DNA damaging potential of AngII and Ald in vivo in the kidney, which seems to depend on the substance effects rather than on the caused hypertension. SAP376 ROLE OF IL-17 IN THE PATHOMECHANISM OF RENAL FIBROSIS Leonóra Himer1, Leonóra Himer2, Beáta Szebeni1, Erna Sziksz1, Shinobu Saijo3, Éva Kis4, Ágnes Prókai4, Nóra F. Bánki4, Andrea Fekete4, Tivadar Tulassay5 and Ádám Vannay5 1 Research Laboratory of Paediatrics and Nephrology, Hungarian Academy of Sciences, Budapest, Hungary, 2Semmelweis University 1st Department of Paediatrics, Budapest, Hungary, 3Center for Experimental Medicine, Institute of Medical Science, University of Tokyo, Japan, 4First Department of Paediatrics, Semmelweis University, Budapest, Hungary, 5Research Laboratory of Paediatrics and Nephrology, Hungarian Academy of Sciences; First Department of Paediatrics, Semmelweis University, Budapest, Hungary Introduction and Aims: The incidence of chronic kidney disease (CKD) is increasing and becoming a major public health problem worldwide. Regardless of the initiating cause, the mechanism of organ fibrosis is similar in the different CKDs and always has an inflammatory component. Recently, a new T helper cell lineage, doi:10.1093/ndt/gfs241 | ii Downloaded from https://academic.oup.com/ndt/article-abstract/27/suppl_2/ii427/1935270 by guest on 17 June 2020 SAP373 Methods: Double immunofluorescence staining for Cx37 and appropriate markers for different cell types of the nephron, were performed in renal cortical sections of healthy C57BL/6 mice. In addition, 3 month-old Cx37 knock-out and WT mice underwent unilateral ureteral obstruction (UUO) for 7 days before tissue collection (n=8 per group). Results: Cx37 expression was abundant in the glomerular and peritubular endothelium (co-localized with MECA-32). In addition, a positive co-localization of Cx37 was observed with both NCCT and AQP2 which are specific markers for distal convoluted tubules and collecting ducts respectively. By using both qPCR and immunofluorescence studies we noticed a dramatic reduction of the Cx37 expression 7 days after UUO. Interestingly, Cx37 KO mice were protected in terms of tubular dilation (tubular index: 1±0.21 for Cx37-/- and 2.45±0.2 for WT mice, P<0.05), showed less tubulo-interstitial proliferation (Ki67 positive cells/field: 11±1 and 20±1 for Cx37-/- and WT respectively, P<0.05) and lower tubular apoptosis (Tunel positive cells/field: 4±0.25 and 8±0.5 for Cx37-/- and WT respectively, P<0.05), after 7 days of UUO. At the same time point, F4-80 staining showed reduced monocyte infiltration in the renal cortex of Cx37-/- mice compared to littermates (15±2% and 25±2.4% of cortex surface respectively, p0.05). Conclusions: Our study highlights the importance of the gap junctional intercellular communication in obstructive nephropathy and suggests that Cx37 may play a major role in the development of CKD. Abstracts SAP377 SELECTIVE INDUCTION AND MODULATION OF MTORC1 AND MTORC2 SIGNALING DURING OSTEOBLASTIC DIFFERENTIATION AND CALCIFICATION OF MESENCHYMAL STEM CELLS Björn Hegner1, Theres Schaub2, Claudia Lange3 and Duska Dragun4 Department of Nephrology and Intensive Care Medicine, 2Charite, 3Clinic for Stem Cell Transplantation, 4Charite, Berlin Germany 1 Introduction and Aims: A central role for mTOR in translating the microenvironmental signals to cell differentiation responses is emerging. We reasoned that pharmacologic mTOR targeting may confer protection from arteriosclerosis by enhancing regenerative capacity of circulating bone marrow derived mesenchymal stem cells (MSC). Methods: We treated human MSC under calcifying conditions with growth factors (GF) implicated in adverse arterial remodeling (CTGF, b-FGF, FGF-23, PDGF-BB, TGF-β1) with or without Rapa. Osteoblastic differentiation (Ca deposition, ALP activity), activation of mTORC1 and mTORC2 signaling by western blot analysis with phospho-specific antibodies, and downstream cellular functional responses ( proliferation by BrdU incorporation; apoptosis by Bcl-2 expression and LDH release) were determined. Results: B-FGF and PDGF-BB enhanced calcification and osteoblastic differentiation which was precluded by TGF-β1. CTGF and FGF-23 did not modulate the response to calcifying medium. Rapa potently inhibited calcification as well as osteoblastic differentiation in terms of pro-arteriosclerotic transformation. In parallel we documented reduced mTORC1 signaling by decreased p70S6K-Thr389 and enhanced mTORC2 activity as increased AKT-Ser473 phosphorylation. Lower mTORC1 activity was linked to reduced MSC proliferation, while enhanced mTORC2 effects acted anti-apoptotic. Conclusions: Our findings define selective roles for mTORC1 and mTORC2 during pharmacologic mTOR inhibition in the differentiation response of MSC to growth factors released in the pro- arteriosclerotic vascular microenvironment. Rapa mediated inhibition of mTORC1 resulted in decreased proliferation of osteoblast like cells. In addition, Rapa treatment released the mTORC1 activity related inhibition of mTORC2 which was associated with reduced apoptosis. Since apoptotic bodies function as a nidus for calcification we propose that this mechanism in addition to direct inhibition of osteoblastic differentiation by Rapa reduces calcified extracellular matrix produced by MSC. We provide a new mechanistic link between mTORC2 activation via mTORC1 inhibition and boosting of endogenous regeneration potential of MSC. Strategies aiming to enhance mTORC2 activity could help to reduce systemic arteriosclerosis in transplant patients as well as transplant vasculopathy. SAP378 CKD IMPAIRS FUNCTIONALITY OF MESENCHYMAL STEM CELLS (MSC) IN VITRO AND IN VIVO Barbara Mara Klinkhammer1, Kramann Rafael1, Mallau Monika1, Makowska Anna1, Claudia Van Roeyen2, Peter Boor1, Buecher Eva Bettina1, Otten Simon1, Stuettgen Esther1, Jürgen Floege1 and Uta Kunter1 1 University Hospital RWTH Aachen, Nephrology and Clinical Immunology, Aachen, Germany, 2RWTH Aachen University Introduction and Aims: MSC hold promise in many renal diseases, but little is known about the effects of CKD on long term MSC function. We isolated MSC from the bone marrow of CKD rats and tested their functionality in the acute anti-Thy1.1 nephritis model. ii | Abstracts Methods: MSC from “healthy” male F344 rats, “CKD” rats 22 weeks after 5/6 Nx, and healthy MSC from transgenic “hPLAP” (human placental alkaline phosphatase) rats were analyzed in vitro for proliferation capacity, actin stress fiber accumulation, adipogenic differentiation, cellular senescence and growth factor production. To evaluate MSC function in vivo, anti-Thy1.1 nephritis was induced in F344 rats. On day 2 after disease induction, 250 000 MSC (“healthy”, “CKD” or “hPLAP”) or DMEM were injected into the left renal artery. Untreated right kidneys served as controls. Rats were sacrificed at days 4 or 6. Results: In vitro, “CKD” MSC exhibited spontaneous adipogenic differentiation, high levels of active senescence-associated-β-galactosidase, and reduced proliferation capacity (cell population doublings: 134±14 h vs. 43±4 h in “healthy” MSC, p0.002). Stress fiber accumulation was significantly more frequent in “CKD”MSC compared to “healthy” MSC ( p0,0005). PDGF-A and -C mRNA expression was significantly higher in “CKD” MSC compared to “healthy” MSC. Culture supernatants of “CKD” MSC contained less TGFβ but similar amounts of VEGF165 compared to “healthy” MSC. In vivo, treatment with “hPLAP” or “healthy” MSC decreased proteinuria on day 6 compared to “CKD” MSC or DMEM (“hPLAP” 9±6 vs. “CKD” 34±16 vs. DMEM 27±4 mg/24h, p0,001 and n.s., respectively). BrdU positive cells and glomerular mitotic figures on day 4 increased in kidneys treated with “healthy” MSC whereas there was no difference between the “CKD” and DMEM group. On day 6 “healthy” or “hPLAP” MSC reduced mesangiolysis scores, while “CKD” MSC or DMEM did not ( percent damage reduction treated vs. untreated kidney: “healthy” 26±24; “hPLAP” 51±18; “CKD” -3±31; DMEM 2±21 (“hPLAP” vs. DMEM ( p0,001); “CKD” vs. DMEM n.s.). Conclusions: CKD induces a sustained loss of in vivo functionality in MSC, possibly by reducing cell proliferation, modulating the secretory phenotype and a shift towards adipogenic differentiation in vitro, i.e. changes that resemble cellular senescence. Autologous MSC from CKD patients might thus not be a suitable source for regenerative therapies. SAP379 PRO-CALCIFYING CELL FUNCTIONS OF MESENCHYMAL STEM CELLS IS DIFFERENTIALLY MODULATED BY UREMIC RETENTION SOLUTES – A SYSTEMATIC ANALYSIS Björn Hegner1, Daniel Janke1, Theres Schaub2, Claudia Lange3, Joachim Jankowski4 and Duska Dragun5 1 Department of Nephrology and Intensive Care Medicine, 2Charite, 3Clinic for Stem Cell Transplantation, 4Department of Nephrology, 5Charite, Berlin Germany Introduction and Aims: Uremic patients suffer from accelerated vascular calcification and disturbed bone metabolism indicating defective function of cells capable of osteoblast differentiation and tissue calcification such as mesenchymal stem cells (MSC). We sought to determine the distinct effects of single uremic retention solutes (URS) on MSC biology to assess their ability for adverse effects on MSC mediated vascular calcification and bone mineralization. Methods: Human bone marrow derived MSC were separately treated with more than 70 known URS at the highest reported concentration in growth medium or in osteoblast induction medium. Viability was assessed with the MTT-assay. Proliferation was measured by BrdU- incorporation. Osteoblast differentiation was quantified by measurement of alkaline phosphatase (ALP) activity. Results: The highest reduction in viability (-23%) was found for indol-3-acetic acid (I3AA). Thymine, PTH1-84, urea, N2,N2-dimethylguanosine, endothelin-1, and guanidinoacetic acid also reduced viability by more than 10%. Other substances (e. g. mannitol) increased metabolism of MSC as indicated by enhanced MTT measurements. Many URS impaired proliferation. I3AA, indoxyl sulphate (IXS), benzylalcohol, and uric acid had the greatest anti-proliferative effects (up to -86%). Uridine and 1-methyladenosine increased proliferation up to 17%. Osteoblast differentiation was constrained most effectively by spermidine, spermine, IXS, and thymine (>50% reduced ALP activity). Leptin, p-OH hippuric acid, oxalate, IL-1β, and TNF- a increased ALP activity (+66-98%). Conclusions: Our findings reveal both, synergistic and opposing effects of single URS on MSC functions relevant for vascular calcification and bone turnover. The specific combination of URS in a patient seems to be important for the resulting biologic outcome. Modification of dialysis regimens to target URS with adverse effects more effectively could improve morbidity and mortality in dialysis patients. SAP380 LIPOPOLYSACCHARIDE INCREASES CALCIFICATION IN VASCULAR SMOOTH MUSCLE CELLS BY HIGH INORGANIC PHOSPHATE AND HIGH CALCIUM CONCENTRATION MEDIA Matsuhiko Hayashi1, Ichiro Takamatsu2, Chihiro Horimai2 and Tadashi Yoshida2 1 Apheresis and Dialysis Center, Keio University, School of Medicine, 2Apheresis and Dialysis Center, Keio University, School of Medicine, Tokyo, Japan Introduction and Aims: Uremia and disturbances in calcium/phosphate metabolism induce vascular calcification (VC), which contributes to cardiovascular diseases in the patients on chronic hemodialysis (HD), while inflammation plays key roles in VC Volume 27 | Supplement 2 | May 2012 Downloaded from https://academic.oup.com/ndt/article-abstract/27/suppl_2/ii427/1935270 by guest on 17 June 2020 termed Th17 cells, has been identified based on their capacity to produce interleukin (IL)-17A but not the classic Th1 or Th2 cytokines. IL-17A recruits neutrophils and macrophages and stimulates the production of pro-inflammatory cytokines. Interestingly, less attention has been paid to the impact of Th17 cells on epithelial cells, although IL-17A receptors (IL-17RA) are intensively expressed in the kidney, especially on the tubular epithelial cells. Our present work investigates the role of IL-17A on renal tubular epithelial cells and renal fibrosis. Methods: We evaluated the renal level and localization of IL-17A and IL-17RA in a mouse model of ureteric obstruction (UUO). For this purpose real-time PCR, immunhistochemical staining and flow cytometry were used. The role of IL-17A on activated signaling pathways was tested in vitro using HK-2 renal tubular epithelial cells by flow cytometry. The impact of IL- 17A on fibrosis was studied in vivo by Western blot determination of αSMA levels after UUO using IL-17A knock-out and wild-type animals. Results: The number of IL-17A producing T-cells and IL17RA-positive epithelial cells elevated 5 days after UUO. After IL-17A treatment of HK-2 cells we found increased phosphorylation of Erk1/2, Jnk1/2, Smad2/3 signaling pathways. At the same time, we found increased number of αSMA-positive HK-2 cells. Finally, after UUO the level of αSMA was less increased in the kidney of IL-17KO mice compared to that of control mice. Conclusions: Our results show that IL-17A induces activation of Erk1/2, Jnk1/2, Smad2/3 signaling pathways in vitro and increases the number of αSMA positive myofibroblasts suggesting its role in renal fibrosis in vivo as well. However, further works are needed to elucidate its exact effects on renal injury. Nephrology Dialysis Transplantation Abstracts Nephrology Dialysis Transplantation SAP381 HYPERPHOSPHATEMIA DIRECTLY AFFECTS ENDOTHELIAL FUNCTION BY DOWN-REGULATING ANNEXIN II Giovanna Seno DI Marco1, Maximilian Koenig1, Christian Stock1, Stephanie Reiermann1, Susanne Amler1, Gabriele Koehler1, Manfred Fobker1, Friedrich Buck2, Hermann Pavenstaedt1, Detlef Lang1 and Marcus Brand1 1 University of Muenster, 2University of Hamburg Introduction and Aims: Hyperphosphatemia is associated with increased cardiovascular risk in chronic kidney disease (CKD) patients and healthy subjects. We hypothesized that high phosphate levels play a role in the pathophysiology of cardiovascular events also by interfering with endothelial function, therefore impairing microvascular function and angiogenesis. Methods: Angiogenesis was assessed in vivo by using the chorioallantoic membrane (CAM) assay. Hyperphosphatemia (>2.5 mM) was systemically induced by intravitellus injection of a phosphate stock solution. Vessel wall morphology and endothelial cell apoptosis were determined by electron microscopy and TUNEL assay, respectively. For in vitro experiments, human coronary artery endothelial cells (HCAEC) and EAhy 926 cells were incubated with high phosphate levels (2.5 and 5.0 mM) or sera from 20 uremic patients (the degree of hypherphosphatemia was the only parameter that varies in our patient population). Cells incubated with normal culture medium ( phosphate 1.0 mM) were set as control. Cell migration was analyzed using a video-assisted assay and endothelial tube formation was assessed by using matrigel basement membrane matrix. Mouse anti-Annexin II antibody (10 μg/ ml) added to the culture medium was used to block the extracellular protein in vitro. Protein expression was determined by proteomic screen and confirmed by Western blotting, while extracellular membrane-βound Annexin II was analyzed by flow cytometry. Results: By using endothelial cell-βased assays in vitro and the CAM assay in vivo, SAP381 Figure 1 Volume 27 | Supplement 2 | May 2012 SAP381 Figure 2 we showed that angiogenesis, vessel wall morphology, endothelial cell migration, capillary tube formation (Fig. A) and endothelial survival are impaired in a hyperphosphatemic milieu. Protein expression analyses show that high phosphate levels down-regulate annexin II and decrease Akt phosphorylation in human endothelial cells. Blocking of annexin II with a specific antibody mimics the high phosphate-associated effects (e.g. Fig. A). Endothelial cells exposed to sera from hyperphosphatemic patients also display decreased annexin II, evidencing a negative correlation between serum phosphate levels and annexin II expression (Fig. B). Multivariate regression analysis also shows that phosphate levels are an independent determinant of annexin II expression. Conclusions: These results indicate that hyperphosphatemia affects the vasculature by directly impairing endothelial cell function and angiogenesis, and provide annexin II as a new regulator protein in phosphate-mediated endothelial dysfunction in CKD. SAP382 ANTIOXIDATIVE STRATEGY TO PROTECT THE KIDNEY FROM EXPERIMENTAL PYELONEPHRITIS IN VITRO AND IN VIVO Egor Plotnikov1, Maria Morosanova2, Irina Pevzner3, Ljubava Zorova4, Natalya Pulkova2 and Dmitry Zorov5 1 Belozersky Institute of Physico-Chemical Biology, Moscow State University, 2 Faculty of Bioengineering and Bioinformatics, Lomonosov Moscow State University, Moscow, Russia, 3Mitoengineering Research Institute, Lomonosov Moscow State University, Moscow, Russia, 4Mitoengineering Research Institute, Lomonosov Moscow State University, Moscow, Russia, 5Belozersky Institute of Physico-Chemical Biology, Lomonosov Moscow State University, Moscow, Russia Introduction and Aims: During lifetime a lot of people are experiencing urinary tract infections among whose acute pyelonephritis plays a most significant role. Important component contributing to inflammation and further destruction of a renal tissue is infiltration of leukocytes as a response to bacterial invasion. This reaction does not result in tissue damage until reactive oxygen species (ROS) formed by leukocytes stay within vacuoles inside of these cells. However, under extracellular release of ROS, the latter become damaging and leading to the kidney injure and dysfunction. In the present study, the mechanisms of inflammation under pyelonephritis were investigated using a created cellular model of pyelonephritis in vitro, compared with conventional in vivo model. The development of oxidative damage and applicability of antioxidative therapy to minimize oxidative damage and prevent kidney cells death were explored. Methods: Pyelonephritis modeling in vitro was made by co-culturing of renal tubular cells, leucocytes and bacterial lysate or lypopolysaccharide (LPS). Depending on the purpose, cultures were incubated with: LiCl, Trolox, 10-(60 -plastoquinonyl) decylrhodamine (SkQR1). Modeling of acute pyelonephritis in rats was made by intrauretheral infection of E.coli suspension. ROS production was estimated in renal cells by fluorescent probe, 2,7-dichlorofluorescein (DCF) followed by imaging on laser confocal microscope. Formalin-fixed kidney tissue, embedded in paraffin was used for histopathological examination Results: The essence of developed cellular model of pyelonephritis is that renal cells are co-cultivated with bacterial lysate-activated leucocytes. Using this model we observed a significant rise of DCF fluorescence renal tubular cells which reports on the burst of secondary ( pathologic) ROS as a consequence of ROS-signaling originating from leucocytes. To prevent incidence of oxidative stress in renal cells and to diminish their death we used few drugs with potent antioxidative (antiapoptotic) capacity, namely conventional antioxidant (Trolox), GSK3b inhibitor (LiCl) and mitochondriα-targeted antioxidant (SkQR1). All these agents dramatically diminish ROS levels and renal cells death. The oxidative-stress-dependent injury was further explored using an in vivo model of acute pyelonephritis. We found that leucocytes from rats with this pathology had higher level of ROS significantly lowering in rats receiving SkQR1. The level of peroxidative products (malondiladehyde, MDA) in kidney tissue was elevated after incidence of pyelonephritis demonstrating intensive oxidative tissue injury. MDA level was significantly diminished in animals receiving SkQR1 showing protection of the kidney tissue afforded by this mitochondriα-targeted antioxidant.On a histological level, a number of signs of inflammation and kidney tissue damage were observed in pyelonephritis rats. Introduction of SkQR1 to the rat resulted in diminished inflammation and decreased mortality. doi:10.1093/ndt/gfs241 | ii Downloaded from https://academic.oup.com/ndt/article-abstract/27/suppl_2/ii427/1935270 by guest on 17 June 2020 by atherosclerosis. To examine the roles of pro-inflammatory factors in VC, TNF-α and lipopolysaccharide (LPS), which is reported to be contaminated in the water for dialysis, we performed the in vitro studies with cultured human vascular smooth muscle cells (VSMC). Methods: VSMC was cultured in control (C, phosphate concentration; Pi 1.0 mM, calcium concentration; Ca 1.8 mM), high inorganic phosphate (HPi, Pi 3.6 mM, Ca 1.8 mM), and high calcium (HCa, Pi 1.0 mM, Ca 3.6 mM) media. After 10 days of cell culture, calcium contents of the cells were measured and RNA was extracted for real time PCR. Results: HPi and HCa media significantly increased calcium contents of VSMC and the effects of HPi and HCa on VC were additive. TNF-α (10 ng/ml) and LPS (500 ng/ml) increased calcium contents further in either HPi (2.25 and 2.31 fold increases, respectively) or HCa (1.92 and 1.27 fold increases, respectively), significantly, as previously reported for TNF-α. Since recent reports suggested involvement of endochondral transformation in vascular calcification by uremia, mRNA expressions of BMP2, an osteoblast marker, and RUNX3/cbfa3, a chondrocyte marker, were determined by real-time PCR, showing that TNF-α and LPS significantly increased BMP2 but not RUNX3/cbfa3. Furthermore, to examined roles of nuclear factor kB (NFkB), which plays key roles in both of inflammation and bone metabolism, a specific inhibitor for IKKb activation, IMD-0354 was added to the incubation media, although inhibition of NFkB activation did not prevent VSMC calcification induced by either TNF-α or LPS with or without HPi. Conclusions: TNF-α and LPS aggravate VC, involving osteoblastic but not chondrocytic transformation via NFkB-independent pathway. Since LPS is often contaminated in water for hemodialysis, it is suggested that water purification is important to prevent progression of VC in the patients on chronic HD. Abstracts Conclusions: Thus exploring both in vitro and in vivo modeling of pyelonephritis we emphasize the key role of oxidative stress in kidney cells death and renal damaging. Under these conditions mitochondria are the source of ROS, their target and cell death regulators. We conclude that considering important role of mitochondria in incidence and progression of pyelonephritis they might be a main target for pharmacological intervention to treat this pathology. SAP383 RESPONSE OF VEGF TO ACTIVATION OF VIRAL RECEPTORS AND TNFA IN IMMUNE MEDIATED GLOMERULONEPHRITIS Markus Wörnle1, Andrea Ribeiro1, Franziska Belling1 and Monika Merkle1 Medical Policlinic, University of Munich, Germany 1 SAP384 ABNORMAL CONFORMATION AND IMPAIRED DEGRADATION OF NEUTROPHIL EXTRACELLULAR TRAPS INDUCED BY PROPYLTHIOURACIL ARE IMPLICATED IN THE PATHOGENESIS OF MPO-ANCA-ASSOCIATED VASCULITIS Daigo Nakazawa1, Saori Nishio2, Sekiya Shibasaki2, Utano Tomaru3 and Ishizu Akihiro4 1 Hokkaido University Hospital, Internal Medicine II, 2Hokkaido University, Internal Medicine II, 3Hokkaido University, Department of Pathology, 4Hokkaido University, Faculty of Health Sciences Introduction and Aims: The pathogenesis of small vessel vasculitis is critically associated with ANCA. Since the mechanism of ANCA production remains unclear, the treatment is limited as a nonspecific immunosuppression. Investigation into the mechanism may lead to the specific and essential therapeutic strategy. Neutrophil extracellular traps (NETs) composed of chromatin fibers and antimicrobial proteins, such as MPO, PR3, and elastase, play important roles in the innate immune system. Recent studies suggest that NETs may be involved in the pathogenesis of MPO-ANCA-associated vasculitis (MPO-AAV), and impaired regulation of NETs may trigger autoimmune response to NETs. On the other hand, propylthiouracil (PTU), an anti- thyroid drug, is known to have a risk to induce MPO-ANCA production and MPO-AAV. Thus, we hypothesized that PTU can induce impaired regulation of NETs and consequently result in the induction of MPO-ANCA and MPO-AAV. ii | Abstracts Methods: <In vitro experiments> NETs were induced by treatment of neutrophils with PMA in vitro. We examined whether the addition of PTU can influence the NETs formation induced by PMA and the degradation by DNase I, which is regarded as a regulator of NETs. <In vivo experiments> To determine whether the NETs generated by PMA with addition of PTU can induce MPO- ANCA and MPO-AAV in vivo, we conducted two series of animal experiments. Experiment 1: Rat neutrophils were extracted from the peritoneal cavity. Next, NETs were induced using the neutrophils by PMA with or without PTU in vitro, and then the NETs were inoculated into WKY rats (NETs rats: n=5, PTU/NETs rats: n=6). Experiment 2: WKY rats were given oral administration of PTU (0 or 10 mg/day) for 30 days combined with intrα-peritoneal PMA-injection (1 μg) at day 0 and 7. (PMA rats: n=4, PTU/PMA rats: n=6) Results: When NETs were induced by PMA with PTU in vitro, abnormal conformation of NETs was observed. Interestingly, the abnormal NETs were hardly digested by DNase I. In vivo experiment 1, rats immunized with the abnormal NETs with PTU produced MPO-ANCA. The serial dilution method of indirect immunofluorescence showed that the titer of MPO- ANCA was 128 ± 43. Four rats (67 %) developed pulmonary hemorrhage, which was macroscopically identified. Microscopically, infiltration of neutrophils was observed around the capillaries in the lesions of alveolar hemorrhage. Rats immunized with normal NETs did not produce ANCA, and did not develop vasculitis. In vivo experiment 2, rats given PTU with PMA injection produced MPO-ANCA (the titer of MPO-ANCA was 86.6 ± 39.3). Four rats (67 %) developed lung hemorrhage. Pauci-immune glomerulonephritis was also developed in PTU/PMA rats. In this study, we first demonstrated that abnormal conformation and impaired degradation of NETs induced by PTU were critically implicated in MPO-ANCA production and subsequent development of MPO-AAV in vivo. The abnormal NETs were hardly digested by DNase I. Consequently, the abnormal NETs containing MPO exist for a long time outside of the cells and can trigger autoimmune response to MPO. Conclusions: PTU can induce the disorder of NETs and trigger the MPO-ANCA production resulting in the development of MPO-AAV. To regulate the NETs may lead to new therapeutic strategy of MPO-AAV. SAP385 AMELIORATED DUAL ABNORMALITIES OF MEGALIN AND NAPI-IIC EXPRESSIONS IN PROXIMAL RENAL TUBULES BY ORAL PREDNISOLONE THERAPY IN A CASE OF ANTI-MITOCHONDRIAL ANTIBODIES-M2 POSITIVE TUBULOINTERSTITIAL NEPHRITIS WITH FANCONI SYNDROME Ikue Kobayashi1, Yasuo Imanishi1, Masafumi Kurajoh1, Yuki Nagata1, Masayo Yamagata2, Masanori Emoto1, Toshimi Michigami3, Eiji Ishimura1 and Masaaki Inaba1 1 Osaka City University Graduate School of Medicine, Osaka, Japan, 2Osaka Ohtani University, Osaka, Japan, 3Research Institute, Osaka Medical Center for Maternal and Child Health, Osaka, Japan Introduction and Aims: Antimitochondrial antibodies-M2 positive tubulointerstitial nephritis (M2-TIN) is a rare disease, which sometimes exhibits renal Fanconi syndrome. Megalin is a multifunctional endocytic receptor expressing in renal proximal tubules. Megalin knockout mice exhibit a tubular resorption deficiency and excrete low molecular weight plasma proteins in urine. Acceleration of megalin-mediated endocytosis by the administration of receptor-associated protein causes phosphaturia via altered subcellular distribution of sodium phosphate cotransporter NaPi-IIc, suggesting megalin has a crucial role in hypophosphatemia in Fanconi syndrome. The purpose of this study is to determine the role of megalin in phosphate metabolism in Fanconi syndrome. Methods: Oral prednisolone therapy (0.86 mg/kg/d, with progressive tapering over 14 months) was administered on a 54-year-old woman with Fanconi syndrome who was suffered from severe bone pain. Renal and bone biopsies were performed before and after prednisolone therapy. Results: Bone biopsy revealed generalized osteomalacia. Despite of hypophosphatemia, serum fibroblast growth factor 23 was undetectable. Fanconi syndrome was diagnosed based on hypouricemia, hypophosphatemia (2.4 mg/ dl), generalized aminoaciduria, and normoglycemic glycosuria. Tubulointerstitial nephritis with severe lymphocyte infiltration was proved by renal biopsy, in which absent expressions of megalin and NaPi-IIc in the proximal tubules. The patient was started on alfacalcidol and sodium bicarbonate therapy, but hypophosphatemia was not normalized. Oral prednisolone therapy gradually improved urinary protein excretion, hypouricemia, hypophosphatemia, and bone abnormalities. Follow- up renal biopsy revealed attenuation of lymphocyte infiltration, and ameliorated expressions both megalin and NaPi-IIc. In the part lymphocyte infiltration remained, the megalin and NaPi-IIc expressions were not recovered. Follow-up bone biopsy exhibited marked recovery of osteomalacia. Conclusions: Attenuated expressions of both megalin and NaPi-IIc could cause phosphaturia in M2-TIN independent from FGF-23 pathway. Steroid therapy can be beneficial in the recovery of both megalin and NaPi-IIc in the proximal tubules. Volume 27 | Supplement 2 | May 2012 Downloaded from https://academic.oup.com/ndt/article-abstract/27/suppl_2/ii427/1935270 by guest on 17 June 2020 Introduction and Aims: Viral infections are a major problem worldwide and many of them are complicated by virally induced glomerulonephritis (GN). We have previously demonstrated a predominant role of Toll-like receptor 3 (TLR3) in Hepatitis C associated glomerulonephritis. Thereby mesangial cells are a source of proinflammatory cytokines, chemokines, adhesion molecules and growth factors. Vascular endothelial growth factor (VEGF) is primarily known for its proangiogenetic effects; in kidney, it is essential for glomerulogenesis and maintenance of glomerular filtration barrier. Alterations in VEGF expression have been related to a variety of glomerulopathies without being consistent between disease entities, though. Not only an increased expression of VEGF seemingly protective in one condition can be deleterious in another, but changes in expression can occur only at particular time points in disease course. Excess VEGF is thought to be relevant for pathogenesis of diabetic nephropathy and focal glomerular sclerosis; as well, increased serum levels of VEGF have been associated with an aggravated disease course in rapidly progressive glomerulonephritis GN and lupus nephritis. Methods: Experiments were performed on human mesangial cells in cell culture. Stimulation experiments were performed with poly (I:C) and Hepatitis C RNA from patients with Hepatitis C infection. Results: We hereby show a TLR3 mediated upregulation of VEGF and its receptor subtype 2 (VEGF- R2) in human mesangial cells upon activation of viral receptors by poly (I:C) and hepatitis C virus. The increase in VEGF expression levels is further enhanced by tumor necrosis factor alpha (TNFa) which also induces the cytokines IL-6 and IL-8 as well as the chemokines MCP-1 and RANTES. These effects are potentiated by preincubation of MC with poly (I:C), just as the induction of the viral receptors TLR3, RIG-1 and MDA5 themselves. Moreover, MCP-1 itself is able to significantly increase mesangial VEGF expression. Conclusions: Therefore, with VEGF and VEGF-R 2 being induced upon viral receptor activation in human mesangial cells, a novel role of TLR3 in mediating glomerular damage in virally induced or aggravated GN is inferred. TNFa and MCP-1 are seemingly important in amplifying VEGF effects in the setting of virally induced inflammation, with TNFa being also able to induce other mediators of glomerular pathology in GN. We suggest these processes to be relevant in autoimmune diseases as well, for nuclear acid fragments originating from cell debris being considered to be TLR3 ligands besides viral RNA originating from RNA viruses or generated in the course of replication of DNA viruses. Nephrology Dialysis Transplantation Abstracts Nephrology Dialysis Transplantation SAP386 RALOXIFENE AMELIORATES PROTEINURIA-INDUCED INFLAMMASOME ACTIVATION AND TUBULAR INJURY Yuko Nishi1, Minoru Satoh1, Tamaki Sasaki1 and Naoki Kashihara1 Kawasaki Medical School, Kurashiki, Japan 1 SAP387 RESVERATROL ENHANCES ENDOGENOUS HEME OXYGENASE-1 AND ANTI-COMPLEMENTARY ACTIVITY TO AMELIORATE EXPERIMENTAL MURINE MEMBRANOUS NEPHROPATHY Chiα-Chao Wu1, Kuo-Cheng Lu2, Jin-Shuen Chen1, Pauling Chu1 and Yuh-Feng Lin3 1 Division of Nephrology, Department of Medicine, Tri-Service General Hospital, National Defense Medical Center, Taipei, Taiwan, 2Department of Medicine, Cardinal Tien Hospital, School of Medicine, Fu Jen Catholic University, New Taipei City, Taiwan, 3Division of Nephrology, Department of Medicine, Shuang-Ho Hospital, Taipei Medical University, Taipei, Taiwan Introduction and Aims: Idiopathic membranous nephropathy (MN) is an autoimmune-mediated glomerulonephritis resulted as one of the most common causes of nephrotic syndrome in adults. Therapeutic agents for MN remain ill defined. We assessed the efficacy of resveratrol therapy for MN. Methods: Experimental murine MN was induced with cationic bovine serum albumin, and the mice were immediately administered 30mg/kg/bw resveratrol or phosphate-βuffered saline subcutaneously once a day. Disease severities were verified by metabolic and histopathology profiles. The expression of cytokines and oxidative stress markers, cell apoptosis, and the associated mechanisms were also determined. Results: Mice treated with resveratrol displayed a significant reduction in proteinuria and a marked amelioration of glomerular lesions. Significantly attenuated immunofluorescent staining of C3 despite of no changes of immunocomplex deposition were found. The expression of cytokine mRNAs in splenocytes indicated that resveratrol reduced the expression of proinflammatory cytokines and increased the expression of anti-inflammatory cytokines (interleukin 10). The production of reactive oxygen species and TUNEL-positive apoptotic cells in the kidney were also significantly reduced in the resveratrol -treated MN mice. Resveratrol also upregulated heme oxygenase 1 (HO1) and ameliorated MN. The blockade of HO1 expression with SnPP, a HO1 inhibitor, attenuated HO1 induction by resveratrol and thus mitigated its renoprotective effects during MN. Conclusions: Our results suggest that resveratrol enhances endogenous heme oxygenase-1 and anti- complementary activity to ameliorate experimental murine Volume 27 | Supplement 2 | May 2012 SAP388 LIPOCALIN-2 IS AN ENDOGENOUS INHIBITOR OF INFLAMMATION IN MURINE NEPHROTOXIC SERUM NEPHRITIS Kathrin Eller1, Andrea Schroll2, Miriam Banas3, Alexander Kirsch1, Julia Huber2, Günter Weiss2, Igor Theurl2 and Alexander R. Rosenkranz1 1 Medical University of Graz, Graz, Austria, 2Medical University Innsbruck, Innsbruck, Austria, 3Medical University Regensburg, Regensburg, Germany Introduction and Aims: Lipocalin-2 (Lcn-2) has been proposed to be an early marker of kidney failure. Our study was designed to evaluate the functional role of Lcn-2 in nephrotoxic serum nephritis (NTS). Methods: We used Lcn-2 knock-out mice and wild-type controls as well as Lcn-2 chimerics throughout the study. Mice were subjected to nephrotoxic serum nephritis and followed for 7 or 14 days. Additionally, in vitro studies using tubular epithelial cells and macrophages were performed. Results: Mice subjected to NTS expressed increased Lcn-2 in tubular epithelial cells and innate immune cells. After induction of NTS, Lcn-2 knock-out mice presented with significantly increased disease indices as compared to wild type controls. They displayed a massive infiltration of innate and adaptive immune cells into the kidneys. By inducing NTS in Lcn-2 chimerics, we found Lcn-2 expressed in circulating innate immune cells to be responsible for the protection from NTS. The lack of Lcn-2 in these cells led to decreased rates of apoptosis but increased necrosis and formation of intracellular damage-associated molecular patterns (DAMPs) in the kidney. Via TLR-2 signalling DAMPs increased the transcription rate of pro- inflammatory cytokines in tubular epithelial cells and macrophages resulting in increased disease activity. In parallel, Lcn-2 was also found to be increasingly transcribed by TLR-2 signalling. Conclusions: Thus, Lcn-2 expressed in innate immune cells is protective in NTS by inducing concerted apoptosis and inhibiting the formation of DAMPs thereby limiting cytokine production via TLR-2 signalling. TLR-2 dependent transcription of Lcn-2 is an endogenous inhibitor of inflammation in NTS. SAP389 DEVELOPMENTAL RELATIONSHIP OF HUMAN MONOCYTE SUBSETS AND THE IMPACT OF IMMUNOSUPPRESSANTS ON MONOCYTE SUBPOPULATIONS Adam Zawada1, Kyrill Rogacev2, Marina Achenbach3, Danilo Fliser2, Gerhard Held3 and Gunnar Henrik Heine2 1 Department of Internal Medicine IV, Saarland Universitiy Medical Center, Homburg, Germany, 2Department of Internal Medicine IV, Saarland University Medical Center, Homburg, Germany, 3Department of Internal Medicine I, Saarland University Medical Center, Homburg, Germany Introduction and Aims: Monocytes drive diverse pathological processes in chronic kidney disease (CKD), such as CKD-associated accelerated atherosclerosis and transplant rejection. Of note, monocytes are a heterogeneous cell population, and three distinct monocyte subsets can be differentiated flow- cytometrically according to their surface expression of CD14 and CD16: classical CD14++CD16-, intermediate CD14++CD16+ and non-classical CD14+CD16++ monocytes. Given their central role in CKD, we set out to analyse monocyte subset development in vivo and in vitro, and to study potential immunomodulation of distinct monocyte subsets. Methods: For analyzing monocyte differentiation in vivo, we recruited 21 patients after autologous (n = 10) and allogenic (n = 11) stem cell transplantation and measured monocyte subset counts at pre-defined time points. Moreover, we assessed differentiation of monocyte subsets in vitro using hematopoetic stem cells. For testing functionality of these in vitro generated monocyte subsets, we analyzed their capacity to phagocyte, to produce ROS and to co-stimulate T-cells. Furthermore, the impact of dexamethasone, rapamycine and cyclosporine on monocyte heterogeneity was assessed in vitro and in patients. Results: Developing from a CD14-CD16- precursor, CD14++CD16- cells were the first monocytes which appeared 5 – 7 days after autologous and after allogenic stem cell transplantation in the peripheral blood. CD14++CD16- monocytes then further differentiated into CD14++CD16+ and subsequently into CD14+CD16++ monocytes. Of note, patients after allogenic stem cell transplantation displayed a significantly ( p < 0.05) reduced expression of distinct proinflammatory surface proteins (CCR2, HLA DR, TLR4) on monocyte subsets, in line with their intake of immunosuppressive medication. In vitro generated monocytes followed the same developmental pathway and displayed functional characteristics of in vivo differentiated monocyte subsets. Dexamethasone and rapamycine were stronger inhibitors of monocyte differentiation in vitro than cyclosporine ( p < 0.05). Conclusions: Our findings demonstrate a gradual differentiation of monocyte subsets in vivo as well as in vitro. After a subset-specific impact of monocytes on CKD-associated atherosclerosis has been hypothesized, these findings may help to develop new therapeutic strategies in nephrology. doi:10.1093/ndt/gfs241 | ii Downloaded from https://academic.oup.com/ndt/article-abstract/27/suppl_2/ii427/1935270 by guest on 17 June 2020 Introduction and Aims: Proteinuria is an independent risk factor for progressive renal diseases by initiating or aggravating tubulointerstitial injury. Albumin-βound free fatty acid (FFA) overloaded in proximal tubule evokes inflammatory responses. However, the mechanisms underlying the induction of inflammation have not yet been fully elucidated. Recent study showed that inflammasome-dependent inflammatory responses were triggered by FFA and mitochondriα- derived reactive oxygen species (ROS) were required for this response. We hypothesized that albumin-βound FFA triggers inflammasomes activation through mitochondrial ROS production and raloxifene, selective estrogen receptor modulator, ameliorates tubular injury by reducing inflammasome-activation associated with mitochondrial oxidative stress. Methods: Female ICR-driven glomerulonephritis (ICGN) mice, an inbred strain with hereditary nephrotic syndrome, underwent ovariectomy and treatment with raloxifene. Human renal proximal epithelial cells were cultured with human fatty acid-βearing human albumin (FA- HSA) or human fatty acid free human albumin (Free-HSA) for 24 h with or without raloxifene and antiestrogen, ICI 182,780. Results: Ovariectomized-ICGN mice exhibited severe glomerular and tubuto-interstitial injuries characterized by mononuclear cell infiltration and interstitial fibrosis. These mice also showed tubular activation of inflammasomes, indicated by increased expression of ASC and conversion of pro-caspase-1 to activated caspase-1. The imflammasome-dependent cytokines, such as IL-18, were increased in tubular tissues. Raloxifene attenuated these changes and ameliorated tubulointerstitial damages. Moreover, raloxifene reduced mitochondrial ROS production, consequently prevented morphological changes of mitochondria, and improved mitochondrial respiratory function. FA-HSA but not Free-HSA caused loss of mitochondrial membrane potential, increased mitochondrial oxidative stress, and inflammasome activation. Pretreatment with raloxifene improved the FA-HSA-induced these changes via amelioration of mitochondrial function. These beneficial effects of raloxifene were blocked by coincubation with ICI 182,780. Conclusions: Albumin bound FFA activates inflammasomes in tubular cells through induction of ROS production in mitochondria. Raloxifene ameliorates proteinuriα-induced inflammasome activation through suppression of mitochondrial oxidative stress. Thus, Inflammasomes could be regarded as a novel and promising therapeutic target for proteinuriα-induced renal injuries. membranous nephropathy. Resveratrol should be considered a potential therapeutic intervention for MN in the future. Abstracts SAP390 Nephrology Dialysis Transplantation A UREMIC TOXIN, 3-CARBOXY-4-METHYL-5-PROPYL-2-FURANPROPIONATE ACCUMULATES IN PROXIMAL TUBULAR CELLS AND INDUCES CELL DAMAGE THROUGH INCREASING OXIDATIVE STRESS Miyamoto1, Iwao2, Watanabe1, Kadowaki1, Yasunori Hiroshi Daisuke Yohei Yu Ishima1, Victor Tuan Giam Chuang3, Keizo Sato4, Masaki Otagiri5 and 1 Toru Maruyama 1 Department of Biopharmaceutics, Graduate School of Pharmaceutical Sciences, Kumamoto University, Kumamoto, Japan, 2School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka, Japan, 3School of Pharmacy, Faculty of Health Sciences, Curtin Health Innovation Research Institute, Curtin University, Western Australia, Australia, 4School of Pharmacy, Kyushu University of Health and Welfare, Nobeoka, Japan, 5Faculty of Pharmaceutical Sciences, Sojo University, Kumamoto, Japan SAP391 THE EFFECT OF INDOXYL SULFATE ON INTESTINAL IMMUNOLOGY IN CHRONIC KIDNEY DISEASE Yoshiyasu Ueda1, Hirotsugu Iwatani2 and Yoshitaka Isaka2 1 Osaka University, Suita and Japana, 2Osaka University, Suita and Japan Introduction and Aims: Indoxyl sulfate is markedly accumulated in the serum of chronic kidney disease (CKD) patients. A part of the dietary protein-derived tryptophan is metabolized into indole by tryptophanase in intestinal bacteria. Indole is absorbed into the blood from the intestine, and is metabolized to indoxyl sulfate in the liver. Indoxyl sulfate is normally excreted into urine. In CKD, however, an inadequate renal clearance of indoxyl sulfate leads to its elevated serum levels. Aryl hydrocarbon receptor (AhR) is a ligand-dependent transcription factor involved in the regulation of multiple cellular pathways, such as xenobiotic metabolism and Th17 cell differentiation. Indoxyl sulfate is known as a potent endogenous ligand of AhR. We aimed to examine whether indoxyl sulfate effects the intestinal immunology in CKD. Methods: Naïve T cells were cultured in the presence of indoxyl sulfate in Th17 skewing condition. We analyzed whether naive T cells induce Th17 cell by indoxyl sulfate in vitro. CKD mice were produced by 5/6 nephrectomy. After 3months, their intestines and kidneys were excised for flowcytometry and immunohistochemical analysis. Results: Indoxyl sulfate induced Th17 differentiation in vitro.CKD mice showed increased Th17 cells in small intestine lamina propria and enhanced expression of AhR in small intestine compared with sham mice. Conclusions: We conclude that indoxyl sulfate increased Th17 cells in small intestine lamina propria through AhR. This finding suggest that the intestine may be a therapeutic target of CKD. SAP392 P-CRESYL SULFATE CAUSES RENAL TUBULAR CELL DAMAGE BY INDUCING OXIDATIVE STRESS THROUGH THE ACTIVATION OF NADPH OXIDASE Hiroshi Watanabe1, Daisuke Honda1, Yohei Miyamoto1, Tsuyoshi Noguchi1, Daisuke Kadowaki1, Yu Ishima1, Motoko Tanaka2, Hisae Tanaka3, Masafumi Fukagawa3, Masaki Otagiri4 and Toru Maruyama1 1 Department of Biopharmaceutics, Graduate School of Pharmaceutical Sciences, Kumamoto University, Kumamoto, Japan, 2Department of ii | Abstracts Introduction and Aims: The accumulation of p-cresyl sulfate (PCS), a uremic toxin, is associated with cardiovascular risk in chronic kidney disease patients. However, the biological functions of PCS and the mechanism of its action remain largely unknown. The purpose of this study was to determine whether PCS enhances the production of reactive oxygen species (ROS) in renal tubular cells and hence causes cytotoxicity. Methods: In vitro experiments, HK-2 cells were used as a model of human renal proximal tubular cells. In animal study, 5/6-nephrectomized rats with intraperitoneally administration of PCS (50mg/kg/day) for 4 weeks were used. Results: PCS exhibited pro-oxidant properties in HK-2 cells via enhancing NADPH oxidase activity, and its effect was concentration-dependent manner. PCS also induced mRNA levels of inflammatory cytokines, TGF-β1, TIMP-1 and pro-a1(I) collagen, that are involved in renal fibrosis, to a similar extent of indoxyl sulfate. The siRNA-mediated knockdown of p22phox expression, a member of NADPH oxidase subunits, suppressed PCS toxicities above mentioned, emphasizing the importance of NADPH oxidase activation. PCS also reduced cell viability in a concentration-dependent manner. This cytotoxicity was dependent on PCS- induced ROS production, strongly suggesting that pro-oxidant property of PCS was important for its cytotoxic action. The above PCS actions were largely suppressed by the presence of probenecid, an organic anion transporters inhibitor. In animal study using 5/6-nephrectomized rats, PCS administration significantly increased plasma PCS level, which caused tubular damage via the enhancement of oxidative stress. Conclusions: The renal toxicity of PCS can be attributed to the intracellular accumulation of PCS, which leads to an enhanced NADPH oxidase activity thus causing increased ROS production. This, in turn, triggers the induction of inflammatory cytokines that are involved in renal fibrosis. Interestingly, this mechanism is similar in many respects to that reported previously for the renal toxicity of indoxyl sulfate. SAP393 IMMUNOMODULATORY EFFECTS OF TUMOR NECROSIS FACTOR ALPHA AND TNF RECEPTOR SYSTEM: IMPLICATIONS FOR IMMUNE MEDIATED GLOMERULAR AND VASCULAR DISORDERS AND THEIR THERAPY WITH BIOLOGICAL AGENTS Markus Wörnle1, Andrea Ribeiro1, Joachim Pircher2, Simone Köppel1, Hanna Mannell2, Florian Krötz2 and Monika Merkle1 1 Medical Policlinic, University of Munich, Germany, 2Walter-Brendel-Centre for Experimental Medicine, University of Munich, Germany Introduction and Aims: Glomerulonephritis is often immune mediated and may result from several viral infections, most commonly from infections with hepatitis B, hepatitis C virus (HCV) or HIV. Disease mechanisms include deposition of immune complexes as well as the release of proinflammatory cytokines, chemokines, adhesion molecules and growth factors. The TNFa / TNF receptor system plays a predominant immunoregulatory role during these processes. Elevated serum levels of TNFa correlate with an increased risk for atherothrombotic events in immune mediated disease and TNFa is known to induce prothrombotic molecules in endothelial cells. Based on the preexisting evidence for the impact of TNFa in the pathogenesis of autoimmune disorders and their known association with an acquired hypercoagulability we investigated the effects of TNFa and the role of the TNFa receptor subtypes TNFR1 and TNFR2 for glomerular disease and arteriolar thrombosis in vitro and in vivo. Methods: Experiments were performed on human mesangial cells and microvascular endothelial cells in culture. Stimulation experiments were performed with poly (I:C) and Hepatitis C RNA from patients with Hepatitis C infection. To show specific effects of viral receptors of the innate immune system transfection with siRNA for Toll-like receptor 3 (TLR3) and retinoic acid- inducible gene-I (RIG-I) was used. Arteriolar thrombosis and platelet-rolling in vivo were observed in wildtype, TNFR1-/-, TNFR2-/- and TNFR1-/-R2-/- C57BL/6 mice using intravital microscopy in the dorsal skinfold chamber model. Results: In HCV associated glomerulonephritis, analysis of TNFa shows a significant upregulation, which is mediated by the viral receptor TLR3 expressed on mesangial cells. Expression of cytokines and chemokines is further potentiated by TNFa with its signalling occurring preferentially via the TNFa receptor subtype 2 that is selectively increased upon stimulation of viral receptors. In wildtype mice stimulation with TNFa significantly accelerated thrombotic vessel occlusion upon ferric chloride injury. Arteriolar thrombosis was much more pronounced in TNFR1-/- animals, where TNFa additionally led to a greater amount of rolling platelets. In vitro, TNFa induced superoxide production, NF-?B activation as well as tissue factor, p-selectin and PAI-1 synthesis in human endothelial cells. Conclusions: TNFa exerts proinflammatory effects on mesangial cells which are mediated by TNFR2 and prothrombotic effects in vivo dependent on endothelial mechanisms, which are also mediated by TNFR2 and partly compensated for by TNFR1 signalling. The occlusion of capillary vessels might be relevant in Volume 27 | Supplement 2 | May 2012 Downloaded from https://academic.oup.com/ndt/article-abstract/27/suppl_2/ii427/1935270 by guest on 17 June 2020 Introduction and Aims: 3-Carboxy-4-methyl-5-propyl-2-furanpropionate (CMPF) is a furan fatty acid derivative, a uremic toxin and a substrate of transporters for organic anions that contribute to the accumulation of CMPF in renal tubular cells. However, information regarding cytotoxicity of CMPF is limited. The purpose of this study was to develop the redox properties of CMPF and its association with renal cellular damage. Methods: Chemiluminescence was measured to investigate the interaction between CMPF and superoxide anion radicals (O2 •-) and peroxy radicals (LOO•). The effect of CMPF on the production of intracellular reactive oxygen species (ROS), cell viability and the secretion of the active transforming growth factor (TGF)-β1 were studied using human renal proximal tubular epithelial cells (HK-2 cells). Results: The present study showed that CMPF directly interacts with O2 •- and LOO• to produce CMPF radicals. The subsequent interaction of CMPF radicals with dissolved oxygen leads to the overproduction of O2 •-. CMPF enhances the production of ROS in HK-2 cells in the presence of angiotensin II (A-II), an inducer of O2 •-. When iron is present with CMPF and A-II, the Fenton reaction is induced, and a further increase in the ROS production was observed in HK- 2 cells. Such CMPF-induced oxidative stress increases the levels of active TGF-β1secretion in HK-2 cells. Interestingly, a positive correlation between CMPF-induced ROS production and the secretion of active TGF-β1 was observed. CMPF caused a reduction in cell viability which was negatively correlated with intracellular ROS production. These deteriorative effects of CMPF in HK-2 cells were completely suppressed by probenecid, an inhibitor of the transport of organic anions. Conclusions: CMPF, which accumulates in the renal cells, appears to play a prominent role as a pro-oxidant which subsequently leads to renal cellular damage via the overproduction of O2 •-. Nephrology, Akebono Clinic, Kumamoto, Japan, 3Division of Nephrology, Endocrinology and Metabolism, Tokai University School of Medicine, Kanagawa, Japan, 4Faculty of Pharmaceutical Sciences, Sojo University, Kumamoto, Japan Abstracts Nephrology Dialysis Transplantation autoimmune disorders well beyond mere thrombosis, as both endothelial cell activation and an enhanced influx of inflammatory cells are able to promote many of the known disease manifestations. Furthermore, our results support a more selective therapeutic approach in anticytokine therapy favouring TNFR2 specific antagonists. SAP394 EFFECT OF CARDIORENAL SYNDROME TYPE 1 PLASMA ON MONOCYTES APOPTOSIS: A PILOT STUDY Introduction and Aims: Cardiorenal syndrome (CRS) Type I is characterized by a rapid worsening of cardiac function leading to acute kidney injury (AKI). CRS Type I pathophysiology is complex and unclear as it involves several interrelated factors. An immune-mediated damage, an alterations in the immune response with apoptosis, cytokine-release and changes in immune cell functions, have been postulated as a potential mechanisms involved in the pathogenesis of CRS. In this pilot study, we examined the possible role of the immune-mediated mechanisms in the pathogenesis of this syndrome. The main objective was to analyze in vitro that plasma of patients with CRS Type I was able to trigger a response in monocytes, resulting in apoptosis and in cytokine-release. Methods: We enrolled twelve patients with AHF (AHF group), seven patients with CRS Type I (CRS Type I group) and five healthy volunteers (Control group). Heparinized plasma from different groups were incubated with monocytes and, subsequently, cell apoptosis was evaluated by fluorescence microscopy and DNA Ladder Kit. Moreover the activity of Caspase-3 was assessed after 24 h incubation. In addition, quantitative determination of TNF-α and IL-6 productions in the supernatants was performed by ELISA Kit. Results: In U937 cells treated with CRS Type I plasma, the results showed DNA ladder formation with different molecular weight fractions, suggesting the presence of apoptotic event. In fact, a quantitative analysis of apoptosis showed significantly higher apoptosis rates ( p0.005)(Fig.1). In concordance with the apoptosis rate, Caspase-3 levels in cells incubated with the plasma from CRS Type I patients demonstrated a significantly higher concentration (Fig.2). When compared with healthy control subjects, TNF-α levels in supernatant was significantly elevated both in AHF that in CRS Type1 group ( p0.05)(Fig.3). Furthermore, in CRS Type1 patients the pro-inflammatory cytokines IL-6 was significantly higher compared with AHF patients and control group ( p0.05) (Fig.4). Conclusions: This pilot study suggest that there is a defective regulation of monocyte apoptosis in CRS Type I patients, and that an immune-mediated mechanism may play a role in the pathophysiology of this syndrome. Furthermore, these preliminary results suggest that inflammatory pathways may have a central role in the pathogenesis of the CRS Type I and may be fundamental to damage distant organs. SAP394 Figure 1. percentage of apoptosis detected after 24 hours of incubation SAP394 Figure 2. levels of Caspase-3 detected in U937 after 24 hours of incubation Volume 27 | Supplement 2 | May 2012 SAP394 Figure 3. levels of TNF-α detected in monocytes supernatant after 24 hours of incubation SAP394 Figure 4. levels of IL-6 detected in monocytes supernatant after 24 hours of incubation SAP395 TYPICAL PLASMA PROFILE IN CARDIORENAL SYNDROME TYPE 1 PATIENTS Grazia Maria Virzì1, Chiara Bolin2, Dinna Cruz3, Elisa Scalzotto4, Massimo De Cal5, Giorgio Vescovo2 and Claudio Ronco6 1 Department of Nephrology, Dialysis and Transplant, St Bortolo Hospital, Irriv-International Renal Resarch Institute Vicenza, Italy, 2Internal Medicine, St Bortolo Hospital , Vicenza, Italy, 3San Bortolo Hospital Vicenza, 4Department of Nephrology, Dialysis and Transplant, St Bortolo Hospital, Irriv-International Renal Resarch Institute Vicenza, Vicenza, Italy, 5Division of Nephrology, University of Padua, Padua, Italy, 6San Bortolo Hospital, Vicenza Introduction and Aims: Cardiorenal syndrome (CRS) Type 1 is characterized by a rapid worsening of cardiac function leading to acute kidney injury (AKI); the pathophysiology of this syndrome is complex and unclear. In addition, Heat Failure (HF) can be also considered an inflammatory state that may contribute to gradual toxic injury to renal cells. Moreover, experimental studies indicated that pro-inflammatory cytokines were associated with some molecular, clinical and physiology aspects of heart failure. Furthermore, cytokines were released by leukocytes and renal tubular cells in the injured kidney, were important components of both the initiation and extension of inflammation and contributed to the pathogenesis of AKI. An alterations in the immune response with cytokine-release have been postulated as a potential mechanisms involved in CRS Type 1. In this pilot study, we examined the presence of typical plasma profile in CRS Type 1 patients to better understand the mechanisms of this syndrome. Methods: We enrolled 12 patients with HF; these patients had HF of any cause and subsequently not developed AKI (HF group). In addition, we enrolled seven patients with CRS Type 1(CRS Type 1 group). AKI was defined by AKIN criteria. Five healthy volunteers without HF or AKI were recruited (Control group). Blood samples were collected from patients on admission into Hospital. We also collected a blood sample within 24h of AKI for CRS Type 1 patients. Quantitative determination of TNF-α and IL-6 in EDTA plasma was performed by ELISA kit. Statistical analysis was performed using the SPSS 15 software. A p-value of <0.05 was considered statistically significant. Results: When compared with control [2.79 pg/ml (IQR, 2.55-3.70)], TNF-α levels were significantly elevated both in HF that in CRS Type 1 group ( p0.05). In contrast, compared with HF group [38.49 pg/ml (IQR, 29.45-43.8)], the TNF-α value of CRS Type 1 [32.09 pg/ml (IQR, 26.4- 40.6)] was not significantly different (Figure 1). Furthermore, in CRS Type 1 patients the pro-inflammatory cytokine IL-6 [90.68 pg/ ml (IQR, 59.9-105.3)] was significantly higher compared with HF [22.19 pg/ml (IQR, 16.6-24.6)]and control group ( p0.05) [1.16 pg/ml (IQR, 0.92-2.98] (Figure 1). In Fact, numerous studies reported that plasma levels of inflammatory markers and cytokines are increased in AKI and in HF, but the development of AKI during HF is described by multiple pathways. For this reason, we investigated cytokines levels in plasma of these patients. Although, the observed increase levels of these inflammatory cytokines should not necessary be interpreted as a central role for IL-6 and TNF-α in the pathogenesis of CRS Type 1. In fact, it is possible that these elevated levels are dependent on a generalized inflammatory state. Therefore, others doi:10.1093/ndt/gfs241 | ii Downloaded from https://academic.oup.com/ndt/article-abstract/27/suppl_2/ii427/1935270 by guest on 17 June 2020 Grazia Maria Virzì1, Chiara Bolin2, Dinna Cruz3, Elisa Scalzotto4, Massimo De Cal5, Giorgio Vescovo2 and Claudio Ronco6 1 Department of Nephrology, Dialysis and Transplant, St Bortolo Hospital, Irriv-International Renal Resarch Institute Vicenza, Italy, 2Internal Medicine, St Bortolo Hospital , Vicenza, Italy, 3San Bortolo Hospital Vicenza, 4Department of Nephrology, Dialysis and Transplant, St Bortolo Hospital, Irriv-International Renal Resarch Institute Vicenza, Vicenza, Italy, 5Division of Nephrology, University of Padua, Padua, Italy, 6San Bortolo Hospital, Vicenza Abstracts Nephrology Dialysis Transplantation alpha and promotes the recovery of postischemic tubular injury. Persistent renal macrophage activation, like in IRAK-deficiency, leads to persistent renal damage, insufficient tubular repair and finally to shrunken kidneys as a result of renal parenchyma loss (rather than renal fibrosis). Loss of function mutations in the IRAK-M gene seems to be a genetic risk factor for chronic after AKI. SAP397 VITAMIN D RECEPTOR ACTIVATORS INHIBIT VASCULAR SMOOTH MUSCLE CELL MINERALIZATION INDUCED BY PHOSPHATE AND TNF-A Yumie Aoshima1, Masahide Mizobuchi2, Hiroaki Ogata3, Chiaki Kumata3, Ai Nakazawa3, Fumiko Kondo3, Naoko Ono3, Fumihiko Koiwa3, Eriko Kinugasa3 and Tadao Akizawa3 1 Showa University, 2Department of Nephrology, Showa University School of Medicine, Tokyo, Japan, 3Japan experiments are necessary to better understand inflammatory aspects of CRS Type 1 and the humoral signalling. Otherwise, the humoral signal for a distant organ effect could be proved an important contribution of the inflammatory pathway to the development of CRS Type1 and we can speculate that cytokines or other mediators such as endothelin-1 and nitric oxide may play a role in the mechanism of Cardiorenal Syndrome Type 1. Conclusions: This pilot study suggest that inflammatory pathways have a central role in the pathogenesis of the CRS Type 1 and may be fundamental to damage distant organs. SAP396 INTERLEUKIN-1 RECEPTOR-ASSOCIATED KINASE M PREVENTS CHRONIC AFTER ACUTE KIDNEY INJURY THROUGH SUPPRESSION OF RENAL INFLAMMATION Regina Gröbmayr1, Maciej Lech2, MI Ryu3 and Hans-Joachim Anders4 Medizinische Klinik und Poliklinik IV, University of Munich, Munich, Germany, 2 Renal Division, Medizinische Klinik und Poliklinik IV, University of Munich, Munich, Germany, 3Lmu, Munich, Germany, 4Nephrological Center, Medical Policlinic, University of Munich, Germany 1 Introduction and Aims: Acute kidney injury (AKI) is defined as a rapid decrease in the glomerular filtration rate with an accumulation of serum urea and creatinine. If the kidney functional parameter returns to normal levels within 30 days of dialysis the AKI is considered as reversible. Nevertheless, patients that recovered from AKI are in higher risk to develop chronic kidney disease (CKD), probably due to incomplete regeneration and persistent renal inflammation. IRAK M is an inhibitor of TLR- and IL-1R-signaling. IRAK-M prevents the dissociation of IRAK and IRAK-4 from MyD88 and the formation of TRAF6 complexes and thus inhibits proinflammatory signals in macrophages. Macrophages are important regulators of renal inflammation and tubular healing. Hence, we hypothesize, that genetic factors which influence the activation state of renal macrophages have influence on inflammatory processes and regeneration after AKI. Methods: We performed the ischemia/reperfusion kidney surgery (transient unilateral renal artery clamping) in wildtyp (WT) and IRAK M knockout mice (IRAK M -/-) to model ARF. We evaluated kidney size, histological structure, inflammatory markers, fibrosis, and the influx of macrophages at different time points after reperfusion. We focused on the chronic phase 5 weeks after surgery. Results: 5 weeks after ischemia of 45 minutes, WT mice had completely regenerated the postischemic kidney with no detectable changes in size and structure compared to the sham-operated contralateral kidney. In contrast, the IRAK M-/- kidneys shrank to 1/3 of their original size. A tetragonolobus lectin staining showed that this was due to a loss of proximal tubules. Atubular glomeruli occurred at high density. There where significantly more macrophages in the IRAK-M-/- compared to WT kidneys. The mRNA expression of TNF alpha and the kidney damage marker NGAL was increased in postischemic kidneys of IRAK-M-/- mice. A comparison of kidney samples collected 3, 5 and 10 weeks after the surgery showed an increasing expression of TNF alpha. The TNF inhibitor etanercept prevented loss of renal tissue in postischemic kidneys of IRAK M -/- mice. Conclusions: We conclude that IRAK M suppresses the persistent activation of renal macrophages and renal inflammation upon transient renal ischemia. This avoids intrarenal overexpression of the proinflammatory and proapoptotic cytokine TNF ii | Abstracts SAP398 RENAL AFFERENT NEURONS EXHIBIT AN ALTERED FIRING PATTERN IN AN IN VITRO MODEL OF KIDNEY INFLAMMATION Wolfgang Freisinger1, Nena Lale1, Angelika Lampert2, Tilmann Ditting1, Sonja Heinlein1, Roland E. Schmieder1 and Roland Veelken1 1 Med. Clinic 4, University Erlangen-Nürnberg, Germany, 2Institute of Physiology and Pathophysiology, University Erlangen-Nürnberg, Germany Introduction and Aims: Renal innervation plays undisputedly an important role in physiological and pathological conditions, e.g. hypertension and inflammation. Nevertheless, especially renal afferent innervation is not fully understood. Recently, we found that renal afferent neurons showed a higher excitability compared to nonrenal neurons, exhibiting predominantly a repetitive (“tonic”) firing pattern upon depolarizing current injection. This phenomenon is most likely due to a kidney specific expression of voltage gated sodium channels. In pathophysiological states associated with increased efferent nerve activity, the role of these neurons is unclear. With this study we aim to investigate the firing patterns of renal afferent neurons in an in vitro model of inflammation. Methods: Retrograde fluorescent labeling (DiI) allowed the identification of dorsal root ganglion (DRG) neurons with projection to the kidney. DRG neurons (Th11-L2) were incubated with the inflammatory chemokine CXCL1 (1,5nmol/ml) for 12 hours before patch clamp recordings. Current clamp was used to characterize neurons as “tonic”, i.e. sustained action potential (AP) firing or “phasic”, i.e. <5 APs according to their firing response to depolarizing current injections. Firing threshold, overshoot and AP-duration was determined in renal and non-renal neurons incubated with CXCL1, compared to controls. Results: Current clamp recordings of 268 DRG neurons, of which 142 stained positive for DiI, were analysed. DiI-positive, renal neurons exposed to CXCL1 showed a significant decrease of tonic firing pattern compared to unexposed renal controls (35,6% vs. 57%, p0.05). Whereas renal tonic neurons exposed to CXCL1 exhibited no significant changes in action potential shape compared to controls, renal neurons with phasic firing exposed to CXCL1 showed a significantly lower firing threshold (600pA [320-1000] vs. 1000pA [400-3200], p0,05) and shorter AP- duration (2,095ms [1,725-4,250] vs. 5,150ms [4,3-8,7], p0,01) than respective controls. Conclusions: We could demonstrate that after CXCL1 incubation, an in vitro model of inflammation, renal afferent DRG neurons exhibited to a significantly lesser degree Volume 27 | Supplement 2 | May 2012 Downloaded from https://academic.oup.com/ndt/article-abstract/27/suppl_2/ii427/1935270 by guest on 17 June 2020 SAP395 Introduction and Aims: Vascular calcification is a highly regulated process. Tumor necrosis factor-a (TNF-α) has been shown to accelerate the highly regulated osteogenic process in vascular smooth muscle cells (VSMCs). Vitamin D receptor activators (VDRA) have been associated with beneficial cardiovascular outcomes in patients with CKD. We examined whether maxacalcitol, a vitamin D3 analog, exhibits a suppressive effect on VSMC mineralization induced by phosphate and TNF-α. Methods: Human VSMCs were treated with either vehicle, maxacalcitol (10-9 M to 10-7M), or calcitriol (10-9 M to 10-7 M) in 2.5 mM of phosphate media with TNF-α (1 ng/ml) for 9 days. VSMC mineralization was determined and expression of genes associated with the osteogenic process was examined by real-time RT-PCR. Expression of matrix metalloproteinase-2 (MMP-2) mRNA in VSMCs and MMP-2 protein in media were also analyzed. Results: Vehicle-treated VSMCs exhibited massive mineralization, which was inhibited by maxacalcitol in a concentration-dependent manner. Calcitriol also inhibited the mineralization. While vehicle-treated VSMCs exhibited increased mRNA expression of genes associated with the osteogenic process (Cbfa1/Runx2 and osteocalcin) compared with VSMCs grown in normal media without TNF-α (control), maxacalcitol and calcitriol suppressed the increase in mRNA species. Furthermore, vehicle-treated VSMCs exhibited increased MMP-2 mRNA and protein in the media that were suppressed notably by maxacalcitol. Conclusions: Both of the VDRAs abrogated the acceleration of the osteogenic process induced by phosphate and TNF-α in VSMCs, which was linked to inhibition of mineralization in VSMCs. MMP-2 blockade by VDRAs may contribute to an inhibitory effect on vascular calcification. Abstracts Nephrology Dialysis Transplantation a tonic firing pattern as compared to unexposed controls. Action potential changes in renal neurons with phasic firing point to an altered expression of voltage gated sodium channels. This could lead to a faster inactivation of these channels under inflammatory conditions and thus lead to a decreased firing activity of renal neurons. SAP399 EFFECT OF CHRONIC ADMA INFUSION IN RATS ON WHITE BLOOD CELL COUNT, LEUKOCYTE SUBSETS AND TISSUE NK CELLS Heike Nave1, Ronny Perthel2, Mayuren Suntharalingam2, Stefanie Bode-Böger3, Gernot Beutel2 and Jan Kielstein4 1 Martin Luther University Halle-Wittenberg, 2Medical School Hannover, 3 Otto-von-Guericke Universtiy, 4Medical School of Hannover SAP399 Figure 3. Representative cryostat sections of the spleen of an ADMA-infused (A) and a saline-infused (B) animal. Representative cryostat sections of the liver from a ADMA-infused (C) and a saline-infused (D) animal. Immunohistochemical NK-cell staining was performed with the APAAP technique. No differences in NK-cell numbers and localization could be detected between the two experimental groups. the cause of chronic inflammation. Moreover, elevated ADMA levels, which are always found in advanced CKD, do not lead to anemia. SAP400 CONNECTIVE TISSUE GROWTH FACTOR INDUCES A SUSTAINED INFLAMMATORY RESPONSE IN THE KIDNEY AND VESSELS VIA LOCAL INTERLEUKIN 17A PRODUCTION Raquel Rodrigues-Díez1, Raul Rodrigues-Diez2, Sandra Rayego-Mateos1, Carolina Lavoz1, Luiz Guilherme Stark Aroeira3, Macarena Orejudo1, Matilde Alique1, Alberto Ortiz4, Jesus Egido5 and Marta Ruiz-Ortega1 1 Cellular Biology in Renal Diseases Laboratory. Universidad Autónoma Madrid. Spain, 2Cellular Biology in Renal Diseases Laboratory. Universidad Autónoma Madrid. Spain, 3Idipaz. Madrid, Spain, 4Dialysis Unit. Fundación Jiménez Díaz. Madrid, Spain, 5Iis-Fjd, Madrid, Spain SAP399 Figure 1. Effect of 28 day ADMA infusion whole blood count. SAP399 Figure 2. Effect of 28 day ADMA infusion on leukocyte subsets. Volume 27 | Supplement 2 | May 2012 Introduction and Aims: Connective tissue growth factor (CTGF) is overexpressed in tissues during renal and vascular injury and may behave as a risk biomarker. Hitherto, CTGF had been considered a profibrotic mediator. However a novel concept of CTGF as a proinflammatory cytokine is emerging. Indeed, data on the in vivo actions of CTGF are scarce. We have recently demonstrated that CTGF induced an acute inflammatory response in murine kidney. The classical view of the immune system has changed by the recent discover of novel T helper (Th) subsets, including Th17 (IL-17A producing cells). Emerging evidence suggest that IL-17A, as effector cytokine, is involved in chronic inflammatory diseases, including kidney injury and atherosclerosis. Our aim was to explore the renal and vascular response to CTGF in vivo. As we found that CTGF promoted sustained renal inflammation, but not fibrosis, we have evaluated the contribution of Th cells and its effectors cytokines to CTGF responses. Methods: Systemic administration of CTGF was done into C57BL/6 mice (n=5-10 mice per group) as a single intraperitoneal injection of 2.5 ng/g of body weight recombinant. For IL-17 and TGF-β neutralization experiments, mice were injected with anti–IL-17A neutralizing antibody or anti-TGF-β pan specific neutralizing antibody or their corresponding IgG isotype control, starting 24h before CTGF injection and every 72 h thereafter until sacrifice at 10 days. Results: CTGF caused a sustained inflammatory response in the kidney and aorta, characterized by elevated local production of IL-17A and chemokines that persisted for 15 days. Blockade of IL-17A, using an IL-17 neutralizing antibody, diminished CTGF-induced renal and vascular inflammation. In the kidney, we further investigated the molecular and cellular mechanisms involved in CTGF responses. Th17 cells (CD4/IL17A+) were found in CTGF-treated mice, associated to renal activation of Th17-related differentiation factors, including elevated IL-6 production and activation of STAT3 and ROR?t. However, CTGF did not modify renal levels of the Th1/Th2 cytokines or the T regulatory (Treg)-related factors, TGF-β and Foxp-3. We further evaluate the relation between CTGF and TGF-β. In CTGF-injected mice, TGF-β blockade markedly upregulated chemokine gene expression in renal and vascular tissues and decreased circulating levels of CD4+/Foxp3+Treg cells, confirming the anti-inflammatory properties of TGF-β. Conclusions: Our findings reveal that CTGF elicits a sustained inflammatory doi:10.1093/ndt/gfs241 | ii Downloaded from https://academic.oup.com/ndt/article-abstract/27/suppl_2/ii427/1935270 by guest on 17 June 2020 Introduction and Aims: The endogenous nitric oxide synthase (NOS) inhibitor asymmetric dimethylarginine ADMA) is elevated in both, animal models of chronic inflammation as well as in patients with chronic inflammatory states. There is in vivo evidence that ADMA influences the number of circulating monocytes as well as their adhesion properties in vitro. The aim of our study was to evaluate the effect of elevated ADMA levels on the white blood count as well as on leukocyte subsets in a rat model of chronic ADMA infusion. Methods: Male Sprague-Dawley rats (n=20), 10 weeks of age were randomly assigned into two groups receiving either 1) isotonic saline or 2) ADMA via osmotic mini pumps. After 28 days of infusion, all animals were sacrificed for blood and tissue sampling. Total blood cell count, flow cytometry and histological assessment had been performed. Results: ADMA infusion over a period of 28 days lead to a significant increase in mean plasma ADMA levels (1.26 ± 0.07 μmol/l) as compared to saline infusion (0.57 ± 0.02 μmol/l). As compared to the infusion of normal saline, chronic ADMA infusion in healthy rats showed no effect on white blood cells count (Fig. 1A), on red blood cell count (Fig. 1B), on platelets (Fig. 1C)or on hematocrit (Fig. 1D). As for the total white blood cell count (Fig. 2A), chronic ADMA administration did not affect the following leukocyte subsets: granulocytes (Fig. 2B); T-cells (Fig. 2C); B-cells (Fig. 2D); NK-cells (Fig. 2E) or monocytes (Fig. 2F). Even at the organ level (spleen and liver) the number of tissue NK-cells was not influenced by chronic elevated ADMA levels. Conclusions: Chronic elevated ADMA levels in otherwise healthy rats have no effect on blood cell counts or on leukocyte subtypes. These data suggest that elevated ADMA levels in the state of chronic inflammation are rather the consequence than Abstracts response in the kidney and aorta mainly through IL-17A production. CTGF could be a target for therapeutic intervention in renal and vascular inflammatory diseases. SAP401 NON-HLA ANTIBODIES TARGETING G-PROTEIN COUPLED RECEPTORS INDUCE MTORC1 AND MTORC2 SIGNALLING IN HUMAN MICROVASCULAR ENDOTHELIUM Wischnewski Oskar1, Catar Rusan2, Theres Schaub1, Björn Hegner3 and Duska Dragun4 1 Charite, 2Charité-Universitätsmedizin Berlin, 3Department of Nephrology and Intensive Care Medicine, 4Charite, Berlin Germany SAP402 ENDOTHELIAL GLYCOCALYX DAMAGE IN CHRONIC KIDNEY DISEASE COINCIDENCES WITH ENDOTHELIAL DYSFUNCTION Jan-Sören Padberg1, Anne Wiesinger2, Marcus Brand2, Giovanna Seno DI Marco3, Stefan Reuter2, Alexander Grabner2, Dominik Kentrup2, Alexander Lukasz4, Hans Oberleithner5, Hermann Pavenstädt2 and Philipp Kümpers6 1 Department of Medicine D, Division of Internal Medicine, Nephrology, and Rheumatology, University Hospital Münster, 2Department of Medicine D, Division of General Internal Medicine, Nephrology, and Rheumatology, University Hospital Muenster, 3University of Muenster, 4Department of Nephrology & Hypertension, Hannover Medical School, 5Institue of Physiology II, University of Muenster, 6 Department of Medicine D, Division of General Internal Medicine, Nephrology, and Rheumatology, University Hospital Münster, Münster, Germany Introduction and Aims: The endothelial glycocalyx (eGC), a mesh of anionic biopolymers covering the luminal surface of endothelial cells, is increasingly considered as an intravascular compartment that protects the vessel wall against pathogenic insults in cardiovascular disease. We hypothesized that chronic kidney disease (CKD) is associated with reduced eGC integrity and subsequent endothelial dysfunction. Methods & Results: Shedding of two major components of the eGC, namely Syndecan-1 (Syn-1) and Hyaluronan (HA), was measured by ELISA in 108 patients with CKD (stages 3-5) and 30 apparently healthy controls. Plasma levels of Syn-1 and HA increased steadily across CKD stages (Syn-1 4-fold, HA 15-fold in CKD 5 vs. controls, P<0.0001). Impaired renal function was independently associated with elevated Syn-1 and HA plasma levels after multivariate adjustment. Furthermore, Syn-1 and HA correlated tightly with plasma markers of endothelial dysfunction, such as soluble vascular adhesion molecule-1 (sVCAM-1), soluble fms-like tyrosine kinase-1 (sFlt-1), von-Willebrand-Factor (vWF) and angiopoietin-2 (all P<0.01). Using an established rat model of CKD (5/6-nephrectomy), we observed excessive shedding of the eGC, as evidenced by 3.5-fold higher Syn-1 plasma levels in 5/ 6-nephrectomized rats compared to sham-operated controls at day 14 post-surgery (136 ± 60 ng/ml vs. 39 ± 11 ng/ml, P<0.001). Moreover, we used a novel atomic force microscopy-βased approach to directly assess eGC integrity on the luminal endothelial surface of aortic explants. Consistent with increased Syn-1 shedding, 5/6-nephrectomy caused a significant decrease in aortic eGC height (321 ± 77 vs. 157 ± 30 nm, P<0.0001) and eGC stiffness (0.33 ± 0.028 vs. 0.223 ± 0.014 pN/nm, P<0.0001) compared to controls. ii | Abstracts Conclusions: This study provides first evidence for shedding of the atheroprotective endothelial glycocalyx as a consequence of CKD. This novel finding potentially opens new perspectives on pathophysiology and treatment of cardiovascular disease in CKD. SAP403 COMPLEMENT REGULATION BY HUMAN FACTOR H-RELATED PROTEIN 2 (CFHR2) IS LINKED TO MPGN I Hannes U Eberhardt1, Christine Skerka1, Qian Chen1, Teresia Hallstroem1, Andrea Hartmann1, Markus J Kemper2 and Peter F Zipfel1 1 Leibniz Institute for Natural Product Research and Infection Biology, Jena, Germany, 2University Hospital Eppendorf, Hamburg, Germany Introduction and Aims: Membrano-proliferative-glomerulonephritis type 1 (MPGN I) is a rare kidney disease that manifests with proteinuria, hematuria and acute nephrotic syndrome. MPGNI is the most common variant of MPGN and defined by the presence of subendothelial deposits of immune complexes in the kidney containing immune complexes and complement activation products. Overactivation or deregulation of the human complement system, which is part of the innate immune system, is associated with MPGN. Methods: DNA Analysis (sequencing and determination of the copy number variations in the factor H- CFHR gene cluster) from a patient with MPGN I. CFHR2 and CFHR2 deletion mutants were cloned and recombinantly expressed with the yeast expression system Pichia pastoris and the physiological role of CFHR2 was determined. Complement assays were performed such as assembly of the C3 convertase and the terminal complement complex. Binding of CFHR2 to necrotic cell surfaces and to complement components was determined by flow cytometry and ELISA. Results: Here we describe a patient with MPGN I who has a heterozygous stop mutation in the factor H related gene 2 (CFHR2) and severely low CFHR2 serum levels. Reconstitution of the patient serum with CFHR2 resulted in a significant gain of complement control. However the function of CFHR2 is still unclear. Therefore CFHR2 and CFHR2 deletion mutants were cloned and recombinantly expressed with the yeast expression system Pichia pastoris and the physiological role of CFHR2 was determined. We identified CFHR2 as a surface acting regulator of the alternative pathway C3-convertase and as an inhibitor of the terminal complement complex (TCC). CFHR2 interacts with the central complement component C3b via the C-terminal SCRs 3-4 and mediates complement inhibition via the N-terminal region. Conclusions: These data present a novel human complement regulator which is linked to the development of MPGN I. SAP404 C-MIP IS A NEGATIVE REGULATOR OF T-LYMPHOCYTE ACTIVATION AND REPRODUCES IN VIVO SOME T LYMPHOCYTE DISORDERS OBSERVED IN ACTIVE MCNS Kélhia N'gomé-Sendeyo1, Qing-Feng Fan1, Shao-Yu Zhang1, André Pawlak1 and Djillali Sahali1 1 Inserm U955 Équipe 21, Créteil, France Introduction and Aims: Current knowledge about the molecular pathophysiology of acquired idiopathic nephrotic syndrome (INS), especially minimal change nephrotic syndrome (MCNS) and focal segmental glomerular sclerosis (FSGS) with relapse, still represents a challenge. Active MCNS is associated with immune system disorders including hyporesponsiveness of lymphocytes to mitogens, decreased delayed hypersensitivity, defects in immunoglobulin switch and unclassical T helper polarization. We recently reported that c-mip (c-Maf inducing protein) is overproduced in T cells of patients with MCNS relapse. We showed that c-mip interferes with NF-?B and MAP kinase pathways that are critical for T cell signaling. In this work, we studied the expression of c-mip in mice treated by adriamycine, which is believed as an experimental model of INS. To investigate the functional consequences of c- mip in T cells, we generate transgenic mice overexpressing selectively c-mip in mature lymphocytes. Methods: Two animal models are generated in our laboratory and simultaneously analyzed: 1. Adriamycin model: mice (N=30) received intravenous adriamycin injection (10mg/kg). 2. Lck-cmip transgenic(Tg) mice: Tg mice were constructed by using a targeting system based on reconstitution of functionnal X-linked hypoxanthine-guaninephosphorybosyltransferase (HPRT) locus by homologuous recombinaison. Full length coding sequence of human c-mip was inserted under distal Lck promoter allowing c-mip expression only in peripherical T-lymphocytes. Results: In adriamycin mice, c-mip expression was detected at day 5 in lymphocytes and culminated at day 7, then decreased, while overpoduction of c-mip in the podocytes was evident at day 7 until day 14, then decreased progressively. Proteinuria occurred from day 7, culminated at day 10 – day 14, then declined . Study of c-mip transgenic mice showed that B-cell and T cell populations were transiently altered. Indeed, before 3 months, mice presents a decrease of CD3+ T-cells. At 6 months, the rate of CD3+CD4+ T-helper was increased. This phenotype was reversed at 9 months. Upon ex vivo stimulation by anti-CD3/anti-CD28 (1 mg/ Volume 27 | Supplement 2 | May 2012 Downloaded from https://academic.oup.com/ndt/article-abstract/27/suppl_2/ii427/1935270 by guest on 17 June 2020 Introduction and Aims: Functional non-HLA antibodies targeting G protein-coupled receptors (GPCR) Angiotensin II Type 1 receptor (AT1R) and Endothelin-1 Type A receptor (ETAR) are implicated in pathogenesis of renal and cardiac transplant vasculopathy. Both antibodies activate canonic G-protein related ERK 1/2. While Erk-signaling may represent general cellular response to agonist stimulation, the molecular link between receptor stimulation and development of vascular obliterative lesion has not been fully established yet. We hypothesized the involvement of PI3K/Akt downstream signalling target mammalian target of rapamycin (mTOR) and assessed the relative importance of the two different signalling complexes mTORC1 and mTORC 2. Methods: Human microvascular endothelial cells (hMEC) with reliable expression of target antigens were stimulated with AT1R-Ab and ETAR-Ab containing IgG from patients with obliterative vasculopathy. Phospho-specific antibodies directed against mTOR downstream targets was used to assess activation of mTORC1 ( pp70S6K at Thr 389) and mTORC2 ( pAkt at Ser 473). Results: Signalling activity of both, mTORC1 and mTORC2, was increased after short-term treatment with patient IgG compared to cells treated with IgG from healthy controls. This effect could be inhibited by preincubating the cells with specific blockers of the AT1R (Valsartan) and ETAR (Sitaxentan). Phosphorylation of p70S6K as well as of pAkt at Ser 473 was completely abolished by the pharmacologic mTOR inhibitor. Additional experiments demonstrated an ERK 1/2 independent activation of both mTOR complexes indicating a direct activation via PI3K/Akt. Conclusions: We provide evidence that functional non-HLA antibodies targeting AT1R and ETAR induce mTORC1 and mTORC2 signalling which is independent of canonic ERK 1/2 activation in human microvascular endothelium. Our data may provide a translational rationale for therapeutic mTOR inhibition in patients with non-HLA antibodies. Nephrology Dialysis Transplantation Abstracts Nephrology Dialysis Transplantation ml), transgenic splenocytes displayed an induction of c-mip that was associated with decreased production of IFNg (Th1-like cytokine) and IL4 (Th2-like cytokine), while the production of IL10 did not change. Morphological analysis of 5 month-old transgenic mice showed follicular hyperplasia in red pulp associated with white pulp hyperplasia, these changes were no detected in spleen of wild-type mice of the same age. Structural and architectural organization was conserved in thymus and nodes as compared to wild-type mice of the same age. Conclusions: Adriamycin induces upregulation of c-mip, which is firstly detected in T lymphocytes and lastly in podocytes. Overproduction of c-mip in the podocytes was correlated with proteinuria occurrence. Overexpression of c-mip in transgenic mice induced downregulation of Th1 and Th2-like cytokines, suggesting that c-mip is a negative regulator of T cell activation and may be involved in hyporesponsiveness of lymphocytes to mitogens in patients with active MCNS. SAP405 SAP406 Table 1 Markus Wörnle1, Andrea Ribeiro1 and Monika Merkle1 Medical Policlinic, University of Munich, Germany 1 Introduction and Aims: Viral infections are a major problem worldwide and many of them are complicated by virally induced glomerulonephritides. Progression of kidney disease to renal failure is mainly attributed to the development of renal fibrosis characterized by the accumulation of extracellular matrix components in the mesangial cell compartment and the glomerular basement membrane. Tissue factor (TF), plasminogen activator inhibitor type 1 (PAI-1) and tissue plasminogen activator (t-PA) are major regulators of plasmin turnover and play an important role in generation and degradation of glomerular fibrin deposits and extracellular matrix components. Viral receptors expressed by mesangial cells are known to be key mediators in immune mediated glomerulonephritis. We have previously shown an expression of the viral receptors Toll-like receptor 3 (TLR 3) and retinoic acid-inducible gene-I (RIG-I) in human mesangial cells and investigated now the effect of activation of these receptors on the expression of TF, PAI-1 and t-PA. Methods: Experiments were performed on immortalized human mesangial cells (MC) in cell culture. Expression of TF, PAI-1 and t-PA was analyzed by real-time RT-PCR and ELISA after stimulation with poly (I:C), a synthetic analogue of viral RNA and viral RNA from patients with a Hepatitis C infection. To show specific effects of viral receptors transfection with siRNA for TLR3 and RIG-I was performed. Results: Activation of mesangial viral receptors upregulates the expression of TF, PAI-1 and t-PA in a time- and dose dependent manner. Knockdown of viral receptors with specific siRNA for TLR3 abolishes the induction of TF, PAI-1 and t-PA. In contrast, viral RNA from Patients with HCV infection upregulated synthesis of procoagulatory factors TF and PAI without affecting PAI-1 synthesis. Conclusions: Our findings demonstrate a link between the activation of viral receptors on mesangial cells and potentially causative agents in the development of glomerulosclerosis and tubulointerstitial fibrosis. Therefore progression of inflammatory processes to glomerulosclerosis can be postulated to be directly enhanced by viral infection under special conditions. SAP406 IRON DEFICIENCY ANAEMIA INCREASES RENAL OXIDATIVE STRESS AND INFLAMMATION IN SPONTANEOUSLY HYPERTENSIVE STROKE PRONE RATS TREATED WITH DOXORUBICIN Jorge Toblli1, Jorge Toblli2, Gabriel Cao1, Jorge Fernando Giani3 and Fernando Pablo Dominici3 1 Laboratory of Experimental Medicine, Hospital Alemán, 2University of Buenos Aires, School of Medicine, Buenos Aires, Argentina, 3School of Pharmacy University of Buenos Aires, Argentina Introduction and Aims: Co-morbidities such as arterial hypertension and anaemia, due to diverse causes including iron deficiency (ID), are common problems in patients with neoplasm. Doxorubicin (DOX), a recognized useful agent in cancer chemotherapy, is associated with increased risk of cardio- renal toxicity. Although not totally elucidated, the mechanism of DOX toxicity seems to be linked to oxidative stress. The aim of this study was to evaluate whether ID anaemia aggravates DOX renal toxicity in a rat model of hypertension. Methods: Male Spontaneously Hypertensive Stroke Prone Rats (SHRSP) were randomized into six groups: A, B, C, D, E and F. ID was induced by a low iron diet (LID) to A, B, C and D for 12 weeks. Groups E and F received normal diet. While DOX 3, 4 and 5mg/kg bw was weekly administered to A,B,C and D respectively by six weeks, E received DOX 4m/kg bw and F, saline solution. Hb, serum iron (SI) and transferrin saturation (TSAT%) were tested. Oxidative stress/ nitrosative stress were evaluated in kidney homogenates and immunostaining in histology samples. Results: High degree of oxidative stress and nitrosative stress in kidney was observed in the association with LID and DOX. Inflammation was increased in the groups with LID and DOX administration. Conclusions: ID significantly aggravated dose-dependent, DOX-induced renal toxicity in SHRSP. Volume 27 | Supplement 2 | May 2012 *p0.05 vs all groups; †p0.05 vs A,B,C; ††p0.01 vs A,B,C,D; #p0.05 vs A,B; ##p0.05 vs A. 1,2 and 4 deaths in groups A,B and C, respectively; TBARS thiobarbituric acid reactive substances; MDA malondialdehyde; TNF tumour necrosis factor. SAP407 THE BLOCKING OF RENIN-ANGIOTENSIN-ALDOSTERONE SYSTEM CAN DECLINE BOTH EPO AND EPO RECEPTOR IN CKD RAT Jae Seok Kim1, Jae Won Yang1, Min Keun Kim2, Byoung Geun Han1 and Seung Ok Choi1 1 Yonsei University Wonju College of Medicine, Wonju, Korea, 2Yonsei University Wonju College of Medicine Introduction and Aims: While many investigators often observe reduced hematocrit associated with inhibitors of angiotensin-converting enzyme (ACE), the basis for this effect is not well understood. The angiotensin II may be considered as one important physiological modulator of EPO production. However, the effect of ACE inhibitor administration on the change of the EPO receptor has not been established. We investigated that the ACE inhibitor can modulate the EPO in kidney and EPO receptor in bone marrow. Methods: A 5/6 nephrectomy was performed in Sprague-Dawley rats (N= 24, 200g, male), and divided three groups after 8 weeks. We supplied general diet to the control group (N=8), low salt diet to the LSD (N=8) group, and low salt diet with enalapril 50mg/L in drinking water to the ACEI group (N=8) for 2 weeks. After the collection of blood on day 14, the remaining kidney and right femur was ressected surgically, the serum erythropoietin and angiotensin II levels were assessed ELISA, and tissues were investigated by immunohistochemical stain, and RT-PCR for EPO and EPO receptor. Results: The hemoglobin levels were increased in LSD group (17.30±1.21g/L) relative to control (12.55±0.86g/L), but decreased in ACEI group (16.40±1.30g/L) relative to LSD group ( p=0.002). The serum angiotensin II levels were decreased in ACEI group (1,968.71±101.82pg/mL) compared to control (2,159.93±172.14 pg/mL) and LSD group (2,090.39±323.94pg/mL). The serum EPO levels were increased in LSD (16.02 ±28.95 mIU/mL) and ACEI group (32.05±30.12mIU/mL) compared to control group (4.67±8.70mIU/mL). Also, In immunohistochemistry, the EPO in kidney was stained more strongly in ACEI group compared to control and LSD group, but the EPO receptor in bone marrow was stained less strongly in ACEI group relative to control and LSD group. In RT- PCR, the mRNA expression of EPO in kidney was decreased in ACEI group (1.86±0.41) relative to control (5.06±8.59) and LSD group (3.10±4.39) and the mRNA expression of EPO receptor in bone marrow was increased in ACEI group (4.80±2.34) relative to control (1.59±0.61) and LSD group (1.19±0.56). Conclusions: The blocking renin-angiotensin-aldosterone system in CKD rats can cause anemia via both mechanism to decline erythropoietin in kidney and erythropoietin receptor in bone marrow. doi:10.1093/ndt/gfs241 | ii Downloaded from https://academic.oup.com/ndt/article-abstract/27/suppl_2/ii427/1935270 by guest on 17 June 2020 ROLE OF RECEPTORS OF THE INNATE IMMUNE SYSTEM IN GLOMERULAR FIBRIN DEPOSTIION AND FIBROSIS