Replication origin of bacteriophage f1

J. Mol. Rd. (1982) 162, 335-343 Replication Origin of Bacteriophage fl Two Signals Required for its Function (Received 17 June 1982) 1’1~sstrand synthesis in bacteriophage fl initiates in a region of dyad symmetry at a specific site (plus origin) recognized and nicked by the viral gene TI protein. In this paper we describe several small deletions on the 5’ side of the fl plus origin which disrupt the region of dyad svmmetry and extend up to only four nucleotides from the gene II protein nicking site. These deletions do not impair the ability of gene II protein in vitro to nick this site. However, they do inhibit in z~no plus strand synthesis. We conclude that the nucleotide sequence at the fl plus origin contains at least two specific signals that are required for efficient plus strand synthesis. 1. Introduction DNA replication of the single-stranded DNA phages fl, M13, or fd, requires t,wo mechanisms, one for the synthesis of the viral (plus) strand and one for that of the complementary (minus) strand (Horiuchi & Zinder, 1976: Eisenberg et al., 1976). The origins of plus and minus strand synthesis (plus and minus origin) map in the intergenic region and are separated from each other by 24 nucleotides. The minus origin is biochemically defined as the first nucleotide on the plus strand transcribed by the host RNA polymerase to prime the synthesis of the minus strand (Geider et nl.. 1978). Upon completion of one round of minus strand synthesis, a doublestranded, circular, superhelical molecule (RFI) is formed (Horiuchi et al., 1978a). The origin of plus strand synthesis (plus origin) is biochemically defined as the specific site on the plus strand of the RF1 molecule at which a nick is introduced by the action of the viral gene II protein (Meyer et al.. 1979). Elongation of the 3’ end of the nick is accompanied by displacement of the viral strand via a rolling circle mechanism (Gilbert & Dressler, 1968). The nick introduced in vitro by purified gene II protein has been located at position 5780 (Meyer et al., 1979) in a nucleotidc sequence with S-fold symmetry (Schaller, 1978) (Fig. 1) that was thought likely to interact specifically with the gene II protein. This paper is concerned with the elucidation of the sequence around the plus origin that is required for efficient plus strand synthesis as well as the sequence necessary for gene II protein recognition. For these studies, we used a chimerich plasmid containing the fl “functional origin” of DNA replication (Dotto et al.. 335 Oo22-2836/R2/34o335-09 $03.00/O ‘4” l!J82 Ac:d~rnic~ l’wss 1IIC. (I~r~ntiorr) I,ttl. C:. 1’. 1)OTTO E?’ AL. 6000 IGenelI C : , \ \ \ \ TT GT;’ FII:. 1. Map of the intergenir region (IG) of bacteriophage fl (Horiuchi ~1 al., 19786). The numbers indicate the nucleotidt~ lxx&ion (Heck B Zink. I!181 ). (+ ) and (- ) IPtbpresent the origins of plus and minus strand synthGs. resp~ctivc~lv. -+~ lndic,atis thr sitta in R283 whrrc~ a I’st linker has heen ins&cd. Y. Indicates the HidI cleavage s&s. The nucleotidr sequence (Schallrr. 197X: Beck & Zink. 1981) around the plus origin is shown in detail as a region with P-fold symmetry. 0. Site of gene II protein nicking. In this and subsequent Figures hyphens have heen omitted from the sequence for clarity. 19Xla). Several deletions on the 5’ side of the fl plus origin were introduced which disrupted the region of dyad symmet,ry and extended up to only four nucleotides from the gene II protein nicking site (Fig. 1). The effects of these changes on the synthesis of plus strand were established irr /*i/lo by measuring the production of virion-like particles containing chimeric plasmid single-st’randed DNA. The effects of the deletions on gene II protein recognition were investigated in N&O hy treating their DNAs with purified gene II protein and determining the efficiency of nicking. 2. Materials and Methods The bacterial strain used was Eschvrichin coli lC3H (Lyons K: Zirrdcr. 1972). fl phap was from our laboratory stock. R283 is an fl variant, lvith a I’st linker (octamer) inserted at position 5766 of the fl map (Horiucahi. unpublished results). pI)8 has beell described (Dotto cut ol., 1981n). pl)I I was constructed by insrrting the HpaII-H fragment of R283 at the BumHI site of pACYC184 (Chang & Cohen, 19X4), using RamHI linkers (Collaborative Research). pD12 was obtained by recloning the R283 HFII-H fragment from pDll into the RumHl site of pD17, a pBR322 (Bolivar et al., 1977) derivative harboring the fl HaeIII-F fragment at the EcoRI site (Dotto et al., 1981a). Similarly, the fl fragments of the deletion mutants (see below) site of pD17. In all cases, the clones used had the fl HpaII-H same orientation as they are in fl wild type (Fig. 1). were recloned and HaeIII-F at the BumHI fragments in the REYLICATIOS (I)) ORIGIX OF fl 33; IklPtiO?l vnutallts The deletions WWP obtained by digesting pDl1 DNA with I’d. The linearized DNA was t,reated with exonuclease Bn131 (BRI,) (Grav et nl.. 1975): 01 unit ofenzyme/pmol of DN.4. at a concentration of @l pg/,.d at 12°C for i min. The reaction was stopped by addition of E(:TA. 160 mM final concentration. After circularization with Td DNA ligase. the 1)X,\ was E. coli K38 cells ( I)otjto again treated with PstI and then used to transform calciumtreated it rrl.. 19810). (“hloramphenicol-resistant colonies were isolated a,nd the plasmid DN;\ charactrrized (Davis ut 01.. 1980; Boeke ut al., 1979). Th e nucleotide sequence of the drletiotrs was determined as follows. ilfter BnnrHI cleavage. the fl HpaII-H fragments from the various mut.ants U.ere purified and digested with =IwI : the 3’ ends were labeled 1)~ addit,iotl of Klcno\c fragmcant and [ ~-321’jdGTP (Maxam & (Gilbert. 1980). The DNA \vas subsequc~ntl?. clravc~l with Hiufl and the fragments of interest were grl-purified. The nurleotide s~~clurnc~t~ was dt,trrmined 1)~ the method of Maxam CCGilbert (1980). Phage yields were obtained as follows: @3 ml of E. coli K38 cells containing the various plssmids and grown to stationary phase were infected with fl wild-type (10’ plaque-forming units) and plated. After overnight incubation at 37°C’. phagr stocks were prepared 1)~ plat,e scraping and were titrated for plaqutl-forming units. I’hage stocks were used as previousI> described (Dotto rt rrl.. 1981a) to infect exponentially growing K38 cells that \verc subseclur~rrtly plated on either chloramphenicol (1 mg/plate) or ampicillin (1 mglplate). Thea number of transdurtants (chloramphenicol- or ampic~illir~-resistant colonies) was takrn as a me~asurf~of thcx atltibiotic rrsistancae transducing particles produced. (d) Gr~e I/ protritr puv-ijcotion rrrld in vitro trssay Gene II protein was purified from E’. coli K 38 (pD2) ~11s that contain a plasmid into which grnc II has been cloned, and produce large amounts of gene II protein (Dotto rt (I/.. 1981h). The assav for the purification was based on the ability of gene II protein to linearizcl specifically fl RF1 DNA in the presence of Mn’+ (Dotto et al.. 19816). The gene II protein was purified approximately :iOOO-fold 1)~ using minor modifications of the method of Meyer & Geider (1979~). One unit of enzyme is measured l,g the complete conversion of 05 tug of fl RF1 DXA into RF11 and RFIV in 20 ~1 of 20 mM-Tris . HC’I (pH 8,0), 5 m&l-MgCl, and 5 mMdithiothreitol. The reactions were performed at 30°C for 30 min and were stopped with 2 ~1 of 2Oqb (w/v) sucrose, O+$, (w/v) sodium dodeeyl sulfate. 200 mM-EDTA and Ol0/0 (w/v) bromphenol blue. 3. Results (a) Isolation qf deletion mutavb at the .fl @rigin The phage “functional origin” of replication is defined as the minimal fl sequence t,hat, when present in a plasmid, confers on it the ability to interfere with fl T)NA replication and to yield, in the presence of helper phage, virion-like particles that transduce resistance to antibiotics (antibiotic resistance transducing particles: Dotto et al.. 198la). Such a sequence includes the fl plus origin and it extends for more than 100 nucleotides on its 3’ side (Dotto et al., 1981a: Cleary & Ray, 1980). (The fl minus origin is dispensable. since other sequences elsewhere in the plasmid DNA can serve for minus strand initiation (Cleary B Ray, 1981).) The functions and the precise boundaries of the stretch of nucleotides on the 3’ side of the plus origin required for efficient replication remain to be determined. In the present study, we set out to establish the 6’ boundary of the “functional plus origin”. For this purpose, we cloned the functional origin (H;oaIT-H fragment,, Fig. 1) of R283, an fl variant with a Pst linker (ortamer) inserted at position 5766, 338 G. I’. DOTTO K:T ill,. 57fo 5’170 CGCCCTTTGACGTTGGAGT~~~AGTCCACGTTCTTTAATAGTGG 5’l*o fourteen nucleotides upstream from the plus origin (Fig. 1), into pA C YC’184 ((Thang & Cohen, 1978), which does not contain any I’st sites. The replication of R283 is not affected significantly by the presence of the octamer. The DNA of the resulting chimeriu plasmid (pD11) was linearized with Pst. keated with exonuclease &z/31 (Gray et al., 1975) under very limiting conditions, and religated to transform calcium-treated E. coli cells (Dotto et al... 1981a). The ability of a chimeric plasmid to yield transducing particles, following infection with fi. was used as an indication of the functionality of its fl origin (Dotto et al.. 1981a). pDl1 was used as a standard. Several clones with absent, reduced, or nearly normal ability to yield transducing particles were chosen and the nucleotide sequences of their fl fragments were determined. As shown in Figure 2. a detailed deletion map on the 5’ side of the plus origin was obtained. (b) 1’1~~ strand synthesis in viva is &wqly ajyected by the deletiorls In order to quantify more accurately the residual i71 Co activity of the various deletions, all the fl fragments were recloned in pD17, a pBR322 (Bolivar et al.. 1977) derivative that already contains the fl NaeIII-F fragment (Fig. 1). We have shown previously (Dot.to e.f al.. 198la) that this fragment contains a signal important for virion morphogenesis and in its presence the yield of transducing particles of chimeras that already cont,ain the fl functional origin of replication is enhanced by approximately 20-fold. pD12 was obtained by recloning into pD17 the R283 HpaII-H fragment. pD8 is the same as pD12, except that it contains the fl wild-type HpaII-H fragment (without the Pst linker). The biological activities of pD8 and pD12, measured either hg their ability to yield transducing particles or to interfere with fl replication, are very high and practically identical (Table 1). When the irr Avo data for deletion 468 (extending from inside the Pst linker to two nucleotides out of it. toward t,he plus origin: Fig. 2) are compared with those REPLICATION ORIGIN 339 OF fl for pD8 and pD12 (Table l), it is clear that 468 has suffered no loss of biological activity from the deletion. The deletion of two additional nucleotides (470) in the direction of the plus origin causes a fivefold drop in activity. However, because of the new nucleotide sequence created by the deletion, A70 differs from A68 by only one of the two deleted nucleotides (see Fig. 3). In 070. the nucleotides corresponding to positions 5769, 5770, 5771 in wild-type fl are TGC rather than TC’C’ : i.e. the (’ + G change at position 5770 caused a fivefold drop in activity. The loss of one more nucleotide (471) causes an additional 30-fold drop in activity. The nucleotides corresponding to positions 5769. 5770, 5771 are now TTG. Quite Biological activity of the deletion mutants Transductants: p.f.n.: I’lanmids .SOW pm pI)l% A68 AiO Ail Ail A72I) Ail Ai(i A X3 3x 3x 2x 3x 2x 2x Ix Ix 3x 2x 5x 1(P2 l(VO 1o’O IO’O IO” lo’* lo’* Io’2 1O’2 lOI 1o’2 < oaooo5 2 24 1.x 04 0.014 007 0.047 0405 OGon < oaooo.5 Relative biological artivitv$ * (96) loo 100 !)O ( 100) 20 (10) 07 (1 ) 3.5 (2) 2.3 (2) 0.35 (1 ) 045 (1) p.f.u.. plaque-forming units. t Phage yields were obtained as described in Matrrials and Methods. $ Thr number of transdnctants (ampicillin-resistant colonies) is taken as a mrasure of the ampicillin resist,anw transducing particles produced. It was determined as described in Materials and Methods. 5 The relative biological activity of the plus origin is defined in each case as the ratio between the yield of transducing particles obtained with a certain deletion and that obtained with pD8. the biological activity of which is arbitrarily svt at lOOo,b.In parentheses are the values that would be obtained if the biological activity were defined as the inverse ratio between the yield of phage obtained with the dtBlet,ions and that ohtainrd with pD8 (a mrasure of interference wit,h fl phage replication). unexpectedly, when one more nucleotide is removed (A72 and A72b), there is a fivefold increase in relative activity. Examination of the sequence created in A72 (Fig. 3) shows that the three nucleotides corresponding to positions 5769, 5770. 5771 are TQC, the same found in 470. However, A72 does have sixfold less activity than 470. The A -+ T change at position 5772 might be the cause. A72b has the same sequence as 472, with the addition of one extra nucleotide: its biological similar to activity is approximately half that of 472. A residual biological activity, that observed for A71 (- 05%), remains even with deletions extending up to four nucleotides from the plus origin (A74 and 476). AX3 is not active, as expected, since the plus origin has been deleted (Fig. 2). These results directly demonstrate the requirement for I2 nucleotides on the 5’ side of the plus origin for full activity of the origin in k/?o. 310 c:. 5767 pDl2 1’. I)C)T’I’O FT 1 .-I I.1 60 69 70 71 72 73 74 75 76 77 70 79 00 81 II III II III Ill II AGTCCACGTTCTTTA II III Ill II III l II II Btol. octiv. $ 100% Ill ’ II II 90% The effects observed with the various deletions could result from the disruption of the gene II protjein recognition sequence around the plus origin. In particular. the persistence of some activity ( - OS%,) even with deletions up to position 5776, four nucleotides from the gene II protein nicking site, could be explained by a diminished but not, completely abolished affinity of t,he enzyme for these we usetl DNAs from the various deletion sub&rates. To test such a possibility, mutants as substrat)es for purified gene 11 protein. This protein, in addition to its nicking function. possesses a closing activny so t,hat, in /-itro. in the presence of Mg. it, converts fl RF1 molecules into RF11 (relaxed. nicked circles) and RFI\’ (relaxed, closed circles) in approximately equimolar amounts (Meyer & Geider. 19796). We used this reaction to determine the efficiency with which the gene II protein can acat’ on the various delet,ion mutant,s. pD8 and pD12 RF1 were converted int,o RF11 and RFIV as efficiently as fl, and were used as controls (Fig. 4). 483 is not, nicked by gene TI protein, as expected. because the gene II protein nicking site has been deleted. Quite unexpectedly. when the RFI of all the other deletion mutants were incubated with gene I1 identical to protein, the efficiency of conversion to RF11 and RFIV was practically that of pD8 and pD12 (Fig. 4). A titration of t,he amount of purified gene II protein required to convert, completely a given amount of RF1 to RFII and RFIV showed that all of the deletion mutants (except 483) are as efticient as substrates for REI’I~I(‘ATlON pD8 pD12 A68 +-+-t-t-t-t- A70 A71 A72 C)RI(:IS 34 I OF fl A72bA74 A76 A83 +-t-+-+-t-+- fl pBR322 -fl z--f1 ‘II- ‘FIm- gene II protein as fl RF1 (data not shown). Moreover. the relative amounts of KFII and RN\’ formed were the same as in the control (Fig. 1). From these results. we can conclude that the 5’ end of t,he recognition sequence for gene II protein lies wit’hin four nucleotides from its nicking site. The possibilit? that the region of dyad symmetry around the plus origin is required for grrw II protein recaognition is ruled out>. 4. Conclusions M’e have direc%ly demonstrated the requirement for 12 nucleotides on the 5’ side of the plus origin for the full a&ivity of t.he origin in P&J. Our results are c:onsistzent with the fact that in M13, deletions of various lengths extending up to position 5767 do not ttlock phagr replication (Kim rt nl.. 1981). The 5’ boundary of the irr &Y) “functional plus origin” can be mapped to the sequence 5’.T-C-C’-A-(‘-3’, starting at position 5769. The first eight nueleot,idea. 5769 to 5778. involve a region of dpad symmetry that can be drawn as a hairpin with the gene I1 protein nicking site in its loop (Fig. 1). The structure of such a region was assumed to be important for gene II protein recognition, since this protein reacts specifically only with closed superhelical fl l)pl’A. We have shown. however, that this is not the case and that contains all that is required on the 5’ side of the pll~s the sequence 5’-(‘-T-T-T’A-3’ origin for the gene II protein nicking (and closing) a&v&v. The region of d+vad RFII RF1 342 Q. P. DOTTO ET AL. symmetry may be required in some later steps in plus strand synthesis. e.g. formation of the replication fork or termination of replication. It should be mentioned that the nicking (and closing) activity we measured in vitro using RF1 molecules as substrates to form RF11 (and RFIV) is necessary for initiation of plus strand synthesis, but it is only a reflection of the gene II protein activity required to cleave and seal the single-stranded tail after one round of plus strand synthesis to form single-stranded circles. In +X174, the plus origin is not located in the middle of a palindromic sequence as is that of fl (van Mansfield et al., 1980; Sanger et al., 1977). Also, unlike the fl gene II protein, the +X gene A protein remains covalently attached to the .5’ end of the nick it produces (Eisenberg & Koruberg, 1979). Both proteins are thought to be involved in the termination as well as the initiation of plus strand synthesis. It might be that for efficient termination to occur, either a covalent linkage of the initiator protein to the nick or a palindromic sequence around the nick is required. The 3’ boundary of the gene II protein recognition sequence has yet to be established but must extend at least four nucleotides beyond the gene II protein nicking site to form a recognition sequence of a minimum of eight nucleotides. This can be deduced by the fact that the same stretch of seven nucleotides at the plus origin (5’.C-T-T-TLA-T-T-3’) is found in two other locations in fl DNA (position 2211 and 5406 of the fl map) (Beck & Zink, 1981) and once in pBR322 (position 32 of the pBR322 map) (Sutcliffe, I978), and none of these sequences is nicked by gene II protein. The fl plus origin has been shown t,o behave as a specific signal not only for the initiation but, also for the termination of plus strand synthesis (Horiuchi. 1980; Dotto & Horiuchi. 1981: Meyer at al., 1981). Here we have shown that the sequence at the fl plus origin contains additional specific information besides that required for gene 11 protein nicking (and closing) activity. The detailed nature of this information as required for the initiation and/or termination of plus strand synthesis remains to be determined. We gratefully acknowledge the skilful technical assistance of Judy Schurko, and we thank Peter Model for ma,ny helpful suggestions and critica,l rt,ading of the manuscri@. We also thank Klaus Ceidrr for helpful suggestions regarding the gene I I protrin purification. This work was supported in part hy grants from thr, National Science Foundation and ttw National Institutes of Health. REFF,RE:N(:ES Krck. E. & Zink. B. (1981). ~GPILP, 16. 3+5X. Boeke, J. I).. Vovis. G. F. & Zinder. h’. II. (1979). I ‘TOP. Sat. Acnd. Sci.. 1CS.d. 76, 26QQ2702. Bolivar. F.. Rodriguez. R. I,.. (+reen. 1’. ,J.. Hetlach. 31. C”.. Hepneker. H. I,. & Koyer. H. W. (1977). Oenr. 2. 95-113. Chang. A. C. Y. & Cohen, S. N. (1978). ,/. Unctrriol. 134. 1 l-21.-1156. Cleary. J. M. & Ray. D. S. (1980). I ‘rot. Sat. Adcud. Ski., C,‘.S.A 77. 4638-4642. Cleary. J. M. &r Ray. D. S. (1981). .J. C’irol. 40. l!)T-203. Davis. R. W.. Thomas. M.. Cameron. J.. St. John. T. I’.. Scherer. 8. di Padgett. R. A. (1980). In Mfthods in Enzymology (Grossman. L. & Moldave. K.. eds), vol. 65, pp. 404-411. Academic Press. New York. REPLICATION ORIGIN OF fl 313 Dot,to, (:. P. & Horiuchi. K. (1981). J. Mol. Biol. 153. 16%176. Dotto, (:. P.. Enea, V. & Zinder. N. D. (1981~). T’irology. 114, 463-473. Dotto, (:. P.. Enea, V. & Zinder, S. D. (198lb). Proc. Nat. Acad. Sci., C.S.;I. 78. 5421-5424. Eisenberg. S. & Kornberg, A. (1979). J. Riol. Chrm. 254. 532%5332. Eisenberg. S.. Scott. J. F. & Kornberg. A. (1976). Proc. Sot. .A&. Sci.. (‘S..4. 73. 3151-m 3 155. (ieider, K.. Beck. E. B Schaller. H. (1978). l’roc. Sat. 4cad. Sci.. I ‘.S.,3. 75. 645-649. (Gilbert. W. B Dressier, I). (1968). Cold Spring Hrrrhor Symp. Quaint. Biol. 33. 473-485. (iray. H. B., Ostrander. D. A.. Hodnett. ,J. L.. Legerski. R. .J. Kr Robberson. T). 1,. (1975). Sucl. Acids Rra. 2. 1459-1492. Horiuchi. K. (1980). Proc. Snt. Acad. Sci.. /IS.=l. 77. 522G.5229. Horiuchi. K. 8r Zinder, N. I>. (1976). Z’roc. ,I’at. Acud. Sci.. C’.A’.il. 73. 2341m-2345. Horiuchi. Ii.. Ravetch. J. V. 8 Zinder. N. I). (197%). (“old Spring Hnrhor Xymp. Q~~rrt. Rio/. 43. 389-399. Horiuchi. K.. lTovis. G. F. & Model, 1’. (1978). In The Singlr-A’tmrrdrd DIVA J’hagrs (1)cnhardt. I). T.. Dressler. I). & Ray. 1). S.. eds). pp. 113-137. Cold Spring Harbor Laboratory, Nrw York. Kim. >I. H.. Hines, J. (‘. & Ray. D. S. (1981). Proc. Snt. .-lcmd. Sci.. I:.S.A. 78, 6784-678X. Lyons, I,. B. & Zinder, N. D. (1972). Virology, 49, 45-60. Maxam. A. M. & (:iIbert. W. (1980). In Methods in Enzymology ((:rossma,n. 1,. & Moldave. K.. ~1s). vol. 65. pp. 49%560. Academic Press. New York. ~Te~er. 7’. F. bi (ieider, K. J. (1979n). J. Biol. Phem. 254, 12636-12641. Meyer. T. F. & (ieider, K. .J. (1!)79h). J. Rio/. Chem. 254, 32642-12646. Meyer. T. F., (Gler. K.. Kurz. (‘. 8r Srhaller. H. (1979). Snturr (London), 278. 365-367. Meyer. T. F.. Blumel, 1.. (ieider. K. & Redinger. P. (1981). .J. Biol. Chem. 256. 581~5813. Sanger. F.. Air. (:. 31.. Rarrell. B. G.. Brown. N. L., (‘oulson, A. R.. Fiddes, J. C.. Hutchison. (‘. ,t.. III. Slocombe, 1’. M. Rr Smith. $1. (1977). ,V’nfuw (London). 265. 687495. Schallrr. H. (1978). (‘old Spri,rg Hnrhor %ymp. Quatrt. Biol. 43. 401-408. Sutcliffe. .J. (:. (I!)78). (‘old Spring Hnrhor ~Symp. @tnnt. Bio/. (1978). 43. 77-90. van Mansfeld. A. I). M.. Langeveld, S. A.. Baas. 1’. I).. ~Jansz. H. S., van der Marel. (:. A.. \-wnrman. (:. H. & van Boom. ,J. H. (1980). Sntltrv (Lortdotr). 288. 561-566. Edited by S. Rrenner