Respiratory Research

Download as pdf or txt
Download as pdf or txt
You are on page 1of 8

Respiratory Research

Research

BioMed Central

Open Access

Downregulation of peroxisome proliferator-activated receptors (PPARs) in nasal polyposis


Lars-Olaf Cardell, Magnus Hgge, Rolf Uddman and Mikael Adner*
Address: Laboratory of Clinical and Experimental Allergy Research, Department of Otorhinolaryngology, Lund University, Malm University Hospital, Malm, Sweden Email: Lars-Olaf Cardell - Lars-Olaf.Cardell@med.lu.se; Magnus Hgge - Magnus.Hagge@skane.se; Rolf Uddman - Rolf.Uddman@med.lu.se; Mikael Adner* - Mikael.Adner@med.lu.se * Corresponding author

Published: 07 November 2005 Respiratory Research 2005, 6:132 doi:10.1186/1465-9921-6-132

Received: 03 April 2005 Accepted: 07 November 2005

This article is available from: http://respiratory-research.com/content/6/1/132 2005 Cardell et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract
Background: Peroxisome proliferator-activated receptor (PPAR) , and are nuclear receptors activated by fatty acid metabolites. An anti-inflammatory role for these receptors in airway inflammation has been suggested. Methods: Nasal biopsies were obtained from 10 healthy volunteers and 10 patients with symptomatic allergic rhinitis. Nasal polyps were obtained from 22 patients, before and after 4 weeks of local steroid treatment (fluticasone). Real-time RT-PCR was used for mRNA quantification and immunohistochemistry for protein localization and quantification. Results: mRNA expression of PPAR, PPAR, PPAR was found in all specimens. No differences in the expression of PPARs were obtained in nasal biopsies from patients with allergic rhinitis and healthy volunteers. Nasal polyps exhibited lower levels of PPAR and PPAR than normal nasal mucosa and these levels were, for PPAR, further reduced following steroid treatment. PPAR immunoreactivity was detected in the epithelium, but also found in smooth muscle of blood vessels, glandular acini and inflammatory cells. Quantitative evaluation of the epithelial immunostaining revealed no differences between nasal biopsies from patients with allergic rhinitis and healthy volunteers. In polyps, the PPAR immunoreactivity was lower than in nasal mucosa and further decreased after steroid treatment. Conclusion: The down-regulation of PPAR, in nasal polyposis but not in turbinates during symptomatic seasonal rhinitis, suggests that PPAR might be of importance in long standing inflammations.

Background
Seasonal allergic rhinitis is the result of an immunologically mediated hypersensitivity reaction of the nasal mucosa, initiated by exposure to specific allergens. The reaction is characterized by the infiltration of various inflammatory cells, like eosinophils, neutrophils, basophils, monocytes, and lymphocytes. When the sea-

son is over, symptoms and signs of inflammation disappear and the nasal mucosa gradually returns to a situation close to that in healthy non-allergic subjects [1-4]. Nasal polyposis is another inflammatory disorder of the upper airways and is, like allergic rhinitis, related to an infiltration of inflammatory cells [5]. The allergic inflammation is driven by a network of pro-inflammatory cytokines [6]
Page 1 of 8
(page number not for citation purposes)

Respiratory Research 2005, 6:132

http://respiratory-research.com/content/6/1/132

and several of these mediators also appear to be involved in nasal polyposis [7]. In addition, there is an emerging concept that anti-inflammatory pathways affect the outcome of inflammatory diseases, including those in the airways [8]. Peroxisome proliferator-activated receptors (PPARs) have been suggested to play such an anti-inflammatory role [9-11]. Peroxisome proliferator activated receptors (PPARs) are DNA-binding nuclear hormone receptors that are up-regulated in response to high fat diets [12]. PPARs are structurally related to the type II nuclear receptors, including the thyroid hormone receptors and occur intracellularly both in the cytosol and in the nucleus. Although today there are no proven high-affinity pathways for endogenous ligands in-vivo, all PPARs are activated by fatty acids. To date, three mammalian PPAR subtypes have been identified, referred to as , or (here named ), and , which are encoded by separate genes [13,14]. They share a 6080% homology in their binding domains and have subtle differences in ligand specificity in that e.g. eocosanoid products of the lipooxygenase pathway such as leukotriene B4 and 8-S-hydroxytetraenoic acid (8-SHETE) activates PPAR [15], prostaglandin (PG) I2 activates PPAR and, 15-HETE and the PGD2 derivative, 15deoxy-12,14-PGJ2, activates PPAR [16,17]. PPARs are generally expressed at a high level in adipose tissue, and play a prominent role in several physiological processes including the control of lipid and lipoprotein metabolism, and glucose homoeostasis [18]. PPARs might also be involved in cardiovascular disease [19] and cancer [20]. A role for PPAR in allergic conditions as well as asthma has been suggested, but remains controversial [21]. In murine models of human asthma, it has been demonstrated that local administration of PPAR agonists decreases serum levels of IgE, and have beneficial effects on airway hyperresponsiveness and lung eosinophilia [22,23]. One study of PPAR in samples from inflamed human airways has demonstrated that the immunoreactivity for PPAR is augmented in the bronchial submucosa, the airway epithelium and the smooth muscle cells of asthmatics compared to healthy subjects [24]. The increasing number of reports describing an anti-inflammatory role for PPARs (especially PPAR) in various disease models [9-11], have prompted us to examine the expression and localization of PPARs in allergic rhinitis and nasal polyposis using nasal polyps as model to investigate the effects of local steroid treatment.

50) years and 32 (2246) years, respectively. In addition, 22 patients with bilateral nasal polyposis (four women) were included before or after treatment with steroids (median age 52 [2279] years). In 7 of these patients, two sets of polyps were obtained, one before and one after steroid treatment (fluticasone, see below). The diagnosis of birch and grass pollen induced allergic rhinitis was based on a positive history of intermittent allergic rhinitis and positive skin prick tests to birch and/ or timothy. Exclusion criterias included a history of perennial symptoms, upper airway infection during the time of visit, positive skin prick tests to house dust mite (Dermatophagoides Pteronyssimus and D. Farinae) and molds (Cladosporium and Alternaria), and treatment with local or systemic corticosteroids during the last 2 months. Occasional use of antihistamines was accepted. The controls were all symptom-free, had no history of allergic rhinitis and had negative skin prick tests to a panel of allergens including birch, timothy, mugwort, house dust mite horse, dog, cat and molds. Nasal polyposis was identified on the basis of clinical symptoms (nasal obstruction and anosmia) and the visualization of polyps by anterior rhinoscopy. A complete ear, nose-, and throat examination was performed before inclusion. Patients with cystic fibrosis and ciliary dyskinesia were excluded from the study along with subjects with a history of concurrent purulent nasal infection in the six weeks before the study or any kind of nasal surgery during the last year. None of the patients suffered from asthma that required continuous medication. All patients were recruited through physician referrals and the healthy volunteers were recruited via advertisements in the local press. The study was approved by the Ethics Committee of the Medical Faculty, Lund University.
Study design for obtaining nasal biopsies The patients were seen either during the birch (5 patients) or during the grass pollen season (5 patients). They were included when they had experienced substantial symptoms of rhinoconjunctivitis (itchy nose and eyes, sneezing, nasal secretion and nasal blockage) during 35 consecutive days. All patients were seen within 510 days after the first appearance of symptoms. A local pollen count confirmed the presence of relevant pollen during this period. During the visit patients were asked to evaluate their nasal symptoms, itching/sneezing, secretion and blockage, individually using an arbitrary scale from 0 to 3 (0 = no, 1 = mild, 2 = moderate, 3 = severe symptoms) A total nasal symptom score was then calculated by addition of the three scores. Anterior rhinoscopy was performed and oedema and secretion in each nostril were scored from 02 (0 = no, 1 = mild, 2 = severe). Total

Methods
Subjects The study included 10 patients (five women) with symptomatic birch or grass pollen-induced allergic rhinitis and 10 healthy volunteers (four women), serving as controls. The median age of the patients and controls was 36 (28

Page 2 of 8
(page number not for citation purposes)

Respiratory Research 2005, 6:132

http://respiratory-research.com/content/6/1/132

Table 1: Intron over-spanning oligonucleotide primers

Target PPAR PPAR PPAR -actin

Accession nr NM005036 NT007592 NM005037 NM001101

Primer forward reverse forward reverse forward reverse forward reverse

Sequence (5'-3') ACTCAACAGTTTGTGGCAAGACA GGAAGCACGTCCTCACATGA GCACATCTACAATGCCTACCTGAA CTCGATGTCGTGGATCACAAA AAGTTCAATGCACTGGAATTAGATGA TGTAGCAGGTTGTCTTGAATGTCTTC GCCAACCGCGAGAAGATG ACGGCCAGAGGCGTACAG

oedema/secretion scores were then computed by adding the scores for each sign from each nostril. All participants had at least 6 in total symptom score and at least in 5 total oedema/secretion score. The healthy volunteers were seen during the same period. Biopsies were taken from the inferior turbinate after topical application of local anesthesia containing lidocainhydrochloride-nafazoline for 20 minutes. The specimens for mRNA extraction were immediately placed in RNA-later (QIAGEN) and frozen. For immunohistochemistry, specimens were immersed in an ice-cold fixative solution composed of 2% formaldehyde and 0.2% picric acid, buffered to pH 7.2 with 0.1 M phosphate buffer.
Study design for obtaining nasal polyps Patients with nasal polyposis participated in the study during the autumn/winter (outside the pollen season). In patients supplying polyps before treatment all steroids (systemic, inhaled and intranasal) were withheld during a minimum of six weeks before the study (three patients were steroid nave). All patients supplying polyps after treatment were seen by the surgeon and medication with fluticasone, 200 g twice a day initiated. After four weeks on this course one set of polyps was removed. Polyps were removed using topical application of local anesthesia containing lidocainhydrochloride-nafazoline for about 20 minutes. In patients providing two sets of polyps a washing out period of two weeks were used after the first set was removed and the Fluticasone medication started. RNA extraction and RT-PCR RNA was extracted from homogenized biopsies using the RNeasy Mini Kit (QIAGEN GmbH), according to the supplier's protocol including an optional DNaseI (Qiagen) treatment. Total RNA quantity and quality were assessed by a spectrophotometer and the wavelength absorption ratio (260/280 nm) was between 1.8 and 2.0 in all preparations. Reverse transcription to cDNA was carried out with Omniscript reverse transcriptase kit (QIAGEN GmbH) with oligo-dT primer in a final volume of 20 l using the Mastercycler personal PCR machine (Eppendorf AG, Germany), at 37C for 1 h.

Quantitative real time-PCR Quantitative real-time PCR assays were performed using the Smartcyckler II detection system (Cephied, USA). Intron over-spanning oligonucleotide primers for detection of PPAR, PPAR, PPAR and -actin were designed using Primer Express 2.0 software (Applied Biosystem, USA) and synthesized by DNA Technology A/S (Aarhus, Denmark, table 1). PCR was performed using QuantiTect SYBR Green RT-PCR kit (QIAGEN) in a final volume of 25 l. Reactions were incubated at 95C for 15 min, then incubated 46 cycles at 94C for 30 s followed by 55C for 60 s (initially 65C, followed by a 2C decrease of the first 6 cycles). Standard curves for the PCR reactions were prepared using half 10log dilutions of PCR product generated from target cDNA. Specific PCR products were analysed by running melting curve and visualized by agarose electrophoresis.

Gene expression changes were assessed using the comparative cycle threshold (Ct) method http://docs.appliedbio systems.com/pebiodocs/04303859.pdf. The relative amounts of mRNA for PPAR, PPAR and PPAR were determined by subtracting Ct values for these genes from the -actin Ct value (housekeeping gene) and expressed as the amount of mRNA in relation to 100,000 mRNA molecules of -actin (100,0002Ct).
Immunohistochemistry The sections from nasal biopsies and nasal polyps were processed for the immunocytochemial demonstration of PPAR. The PPAR antibody (Cayman Chemical Company, Ann Arbor, Mi, USA) was raised in rabbit against a peptide corresponding to amino acids 82101 of human PPAR1. It cross-reacts with PPAR2. The antibody was used in dilution 1:800. For the demonstration of the antigen-antibody reaction indirect immunofluorescence was used. Briefly, the cryostat sections were first washed with PBS and then rinsed in PBS for 15 min followed by incubation for 45 min with secondary antibodies raised against rabbit IgG and conjugated to FITC (1:80; swine anti-rabbit FITC, DAKO, Copenhagen, Denmark). Slides were cover-slipped in glycerol/PBS 2:1 (v/v) containing

Page 3 of 8
(page number not for citation purposes)

Respiratory Research 2005, 6:132

http://respiratory-research.com/content/6/1/132

signed rank test was performed and expressed as median value (minimum-maximum), whereas the immunohistochemistry data that were found Gaussian distributed were analyzed by t-test and expressed as mean value s.e.m. The null hypothesis was rejected at P < 0.05. The standard curves for PPAR, PPAR, PPAR and actin had correlation coefficients ranging between 0.93 and 0.99 and generated slope values not significantly different from each other. The efficiency of the PCR reaction was calculated and ranged between 1.96 and 2.01. The RTPCR analysis of total RNA extracted from nasal biopsies and nasal polyps demonstrated the presence of PPAR, PPAR, PPAR and -actin in all samples. Melting curve analysis revealed a single peak in each sample and agarose electrophoresis generated expected PCR products with a single band close to the 100 bp marker. Of the three PPARs, the expression of PPAR and were generally higher than the levels of PPAR. No differences were obtained when expression levels for the different PPARs in nasal biopsies from healthy volunteers were compared with biopsies derived from patients with symptomatic allergic rhinitis (Figure 1): PPAR (mRNA in relation to 100,000 mRNA molecules of -actin) 170 (53 4512) and 82 (43491), PPAR 52 (14481) and 43 (18464) and PPAR 305 (1442628) and 321 (171 699) in controls and patients with rhinitis, respectively. All three PPARs were also detected in nasal polyps obtained from patients not subjected to steroid treatment (Figure 1). The mRNA levels for PPAR and PPAR were significantly lower in polyps than in normal nasal mucosa (mRNA in relation to 100,000 mRNA molecules of actin; 31 (12232) and 132 (52243) for PPAR and PPAR, respectively). No corresponding differences were seen for and PPAR In order to evaluate if local steroid treatment could affect the expression of the different PPARs we managed to obtain one set before and another set after treatment with steroids from seven of the polyposis patients (Figure 2). Four weeks of treatment resulted in a reduction in the expression of PPAR (mRNA in relation to 100,000 mRNA molecules of -actin; 154 (87244) before and 72 (50111) after treatment). The expression of PPAR and PPAR was not affected by steroid treatment. Using immunohistochemistry the protein expression of PPAR was localized and evaluated (Figure 3AD). In the nose, PPAR immunofluorescence was prominent in the surface epithelium, but was also detected in smooth muscle around blood vessels and in acini of small seromucous glands. In addition, PPAR immunofluorescence was seen

Results

Figure Expression of 10 together bilateral the patients nasal 1 nasal with levels with mucosa polyposis biopsies symptomatic of from PPAR of (polyp) 10 nasal , healthy PPAR allergic polyps volunteers and rhinitis from PPAR 11 (allergic) patients (control) in biopsies with and Expression levels of PPAR, PPAR and PPAR in biopsies of the nasal mucosa from 10 healthy volunteers (control) and 10 patients with symptomatic allergic rhinitis (allergic) together with biopsies of nasal polyps from 11 patients with bilateral nasal polyposis (polyp). Levels of PPAR mRNA are calculated in relation to 100,000 mRNA molecules of -actin. Bold lines represent the median values. The expression of PPAR and PPAR was lower in polyps than in normal nasal mucosa (**p < 0.01).

DAP 1 (1 mg/L) and observed under microscope with chromefluorescence filters. Negative controls for non-specific binding included normal rabbit serum without primary antibody and secondary antibody alone. Since cross-reactions with other proteins containing amino acid sequences recognized by the antisera could not be excluded, it is appropriate to refer to the immunoreactive material as "PPAR-like". For brevity, the immunoreactive material is referred to as PPAR in the text. For quantification, sections were analyzed with Visiopharm Integrator System v2.1.2 (Visiopharm, Hrsholm, Denmark). The whole batch was immunostained and processed at the same time and the slides were analysed at the same time. Since the background level can differ between the specimens, each slide was individually analysed in that the background level was used as a reference to the induced immunostaining. An intensity reaching a certain threshold was regarded as positive and the area of this staining was measured in relation to the length of the epithelium. The computer program does not analyse the intensity of the staining but only staining that reached a certain level of intensity.
Statistical analysis All data sets were analysed by Kolmogorov Smirnov test and since the data for PCR expression predominantly not was Gaussian distributed, Kruskal-Wallis test or Wilcoxon

Page 4 of 8
(page number not for citation purposes)

Respiratory Research 2005, 6:132

http://respiratory-research.com/content/6/1/132

and its activation has been shown to antagonize proinflammatory events in this system [25]. In monocytes and macrophages PPAR-agonists inhibit the expression of proinflammatory cytokines, such as TNF-, IL-1, and IL-6 [26,27]. PPAR is also expressed by eosinophils and agonists inhibit eosinophil chemotaxis and antibodydependent cellular cytotoxicity reactions in vitro [22]. Similar in vivo findings have been seen in a murine model of asthma, where treatment with a PPAR agonist inhibited the development of allergic inflammation, including pulmonary eosinophilia and airway hyperreactivity [22,28]. Furthermore, it was recently demonstrated that cultured human airway smooth muscle cells express PPAR and PPAR [29], which might relate to the present finding of PPAR positive cells in conjunction with the vascular smooth muscle in biopsies from both the inferior turbinate and polyps. Based on animal studies and in vitro data, an anti-inflammatory role for PPAR has been suggested. However, human data to support this idea are still limited. Benayoun and colleagues have shown that PPAR is augmented in the bronchial submucosa, the airway epithelium, and the smooth muscle of asthmatic patients, as compared with control subjects [24]. The enhanced PPAR expression is accompanied by increased proliferation and apoptosis of airway epithelial and submucosal cells. In addition, several studies have demonstrated that PPAR plays an important role in the control of the inflammatory response [21,30], acting on T cells, macrophages, dendritic cells, and mast cells [31-34]. Therefore, an increased expression of PPAR could have been expected in conjunction with the increased amount of inflammatory cells seen during symptomatic allergic rhinitis. This alteration could not be found in the present study. Since PPAR appears to be expressed in response to the ongoing inflammation, it might be that it takes more than 34 days of pollen exposure to fully activate this putative "defense system". Nasal polyposis represents a chronic type of inflammation and the lower levels of PPAR in comparison with normal nasal mucosa might reflect a reduced ability of the diseased mucosa to respond to airway inflammation, thereby facilitating the polyp formation. Steroids (locally administrated, with or without an oral supplement) have, in analogy with our experiments, been reported to down regulate PPAR expression in bronchial epithelium, mucosa and smooth muscle [24]. Thus, the beneficial effect of glucocorticoid treatment on nasal polyposis may adversely affect the down-regulation of PPAR. On the other hand, if the inflammatory response is reduced, there will be less need for anti-inflammatory mediators. Notwithstanding whether this is beneficial or not, these stud-

Figure Expression from and after 7 patients 2 steroid levels with treatment of PPAR bilateral , PPAR nasal polyposis and PPAR before in (control) polyps Expression levels of PPAR, PPAR and PPAR in polyps from 7 patients with bilateral nasal polyposis before (control) and after steroid treatment. Levels of PPAR mRNA are calculated in relation to 100,000 mRNA molecules of -actin. Bold lines represent the median values. The PPAR levels were reduced following steroid treatment (*p < 0.05).

in infiltrating inflammatory cells. No differences in PPAR staining could be calculated between nasal biopsies obtained from healthy controls and in biopsies derived from patients with symptomatic allergic rhinitis. In polyps, the PPAR staining was most prominent in the basal epithelial cells. Quantitative computerized analysis revealed a higher immunoreactivity in the epithelium from biopsies than polyps (area/length units: 94.3 16.4 and 52.6 6.7, respectively; 5 patients from each group; Figure 4). In sections from 5 patients without and 6 patients with steroids, the treatment revealed a reduction after the treatment (area/length units: 52.6 6.7 and 27.5 8.1, respectively). In the present study mRNA expression of PPAR, PPAR, PPAR was found in all specimens. The expression of PPARs between patients with allergic rhinitis and healthy volunteers was more or less identical. Nasal polyps exhibited lower mRNA expression levels of PPAR and PPAR than normal nasal mucosa and these levels were, for PPAR, further reduced following four weeks of treatment with local steroids. PPAR immunofluorescence was prominent in the epithelium of both normal nasal mucosa and polyps. The epithelial PPAR immunoreactivity was similar in nasal biopsies from patients with allergic rhinitis and healthy volunteers, but was lower in polyps and further decreased after treatment with fluticasone. In concordance with the present findings PPAR has been found to be expressed in cultured human epithelial cells

Discussion

Page 5 of 8
(page number not for citation purposes)

Respiratory Research 2005, 6:132

http://respiratory-research.com/content/6/1/132

Figure Immunohistochemical nasal allergic ment mucosa with rhinitis 3 steroids from (B), control and (D) localization in polyps subjects before of(A) PPAR and (C) in patients and biopsies after with treatof the Immunohistochemical localization of PPAR in biopsies of the nasal mucosa from control subjects (A) and patients with allergic rhinitis (B), and in polyps before (C) and after treatment with steroids (D). Magnification: 200.

ies indicate that PPAR might be regulated by steroid therapy and that increased knowledge of the physiological effect of PPAR within the airways might be of importance for our understanding of airway regulation Neither PPAR nor exhibited any difference in their expression when specimens from healthy volunteers were compared with samples obtained from patients with symptomatic allergic rhinitis. Nor did local steroid treatment affect the expression of these PPARs in nasal polyposis. Inflammation induced by LTB4, a PPAR ligand, has been shown to be prolonged in PPAR-deficient mice [15], suggesting an anti-inflammatory role for this receptor. In contrast, in mice injected with lipopolysaccharide (LPS), activation of PPAR induced a significant increase in plasma tumour necrosis factor- (TNF) levels [35]. Pro-differentiation and anti-proliferative effects in conjunction with PPAR-stimulation have been demonstrated in various skin models, as well as an ability for this type of stimulation to reduce cutaneus inflammation in vivo [36,37]. Albeit the lower expression of PPAR in polyps, the present study did not give any further evidence for a role for PPAR in airway inflammation. For PPAR, which is ubiquitously expressed in the human body, the eventual function in inflammation remains uncertain. The relatively low expression level and the unaltered expression seen in the present study add no further information. The present polyp data could be interpreted as a support for the widespread idea of an anti-inflammatory role for PPAR within the human airways. However, data contra-

Quantitative epithelium nasal Figure treatment polyps 4 infrom computerized sections 5 patients, from analysis biopsies and 6 patients of of PPAR nasal with mucosa immunostained fluticasone and Quantitative computerized analysis of PPAR immunostained epithelium in sections from biopsies of nasal mucosa and nasal polyps from 5 patients, and 6 patients with fluticasone treatment. The area of those parts of the epithelium that were immunostained by PPAR antibodies was measured in relation to the length of the epithelium. Bold lines represent the median values. * P < 0.05.

dicting an anti-inflammatory role for PPAR has been published [38,39]. This discrepancy has been attributed to the use of nonselective ligands [38] or the use of very high concentrations of more selective ligands [39]. In this context, it is essential to recognize that inflammation is normally a self-resolving process with the existence of both positive and negative regulators that ultimately allow complete resolution and homeostasis. In the absence of resolution and clearance or in the event of a dampened healing response, persistent inflammation can arise in the form of tissue damage as associated with chronic disease. The down-regulation of PPAR, in nasal polyposis but not in turbinates during symptomatic seasonal rhinitis, suggests that PPAR might be of importance in long standing inflammations, causing polyps, whereas an eventual role in allergic rhinitis remains to be established. It is tempting to speculate in a therapeutic future for PPAR activating agonists in the treatment of long standing airway inflammation.

Competing interests
The author(s) declare that they have no competing interests.

Authors' contributions
LOC performed the sample preparation and together with MA analyzed the data and drafted the manuscript. RU and MA performed the immunohistochemistry. MH partici-

Page 6 of 8
(page number not for citation purposes)

Respiratory Research 2005, 6:132

http://respiratory-research.com/content/6/1/132

pated in the design of the study and revising the manuscript.

19. 20.

Acknowledgements
The present work was supported by the Swedish Medical Research Council, the Swedish Heart Lung Foundation, the Swedish Association for Allergology, the Swedish Foundation for Health Care Science and Allergic Research, Magn. Bergvall Foundation, Tore Nilsson Foundation, Crafoord Foundation and the Royal Physiographic Society. 21. 22.

23.

References
1. Wang D, Clement P, Smitz J, De Waele M, Derde MP: Correlations between complaints, inflammatory cells and mediator concentrations in nasal secretions after nasal allergen challenge and during natural allergen exposure. Int Arch Allergy Immunol 1995, 106:278-285. Bachert C, Hauser U, Prem B, Rudack C, Ganzer U: Proinflammatory cytokines in allergic rhinitis. Eur Arch Otorhinolaryngol 1995, 252 Suppl 1:S44-9. Baraniuk JN: Pathogenesis of allergic rhinitis. J Allergy Clin Immunol 1997, 99:S763-72. Kinhult J, Egesten A, Benson M, Uddman R, Cardell LO: Increased expression of surface activation markers on neutrophils following migration into the nasal lumen. Clin Exp Allergy 2003, 33:1141-1146. Pawankar R: Nasal polyposis: an update: editorial review. Curr Opin Allergy Clin Immunol 2003, 3:1-6. Benson M, Adner M, Cardell LO: Cytokines and cytokine receptors in allergic rhinitis: how do they relate to the Th2 hypothesis in allergy? Clin Exp Allergy 2001, 31:361-367. Bernstein JM, Ballow M, Rich G, Allen C, Swanson M, Dmochowski J: Lymphocyte subpopulations and cytokines in nasal polyps: is there a local immune system in the nasal polyp? Otolaryngol Head Neck Surg 2004, 130:526-535. Dinarello CA: Role of pro- and anti-inflammatory cytokines during inflammation: experimental and clinical findings. J Biol Regul Homeost Agents 1997, 11:91-103. Law RE, Goetze S, Xi XP, Jackson S, Kawano Y, Demer L, Fishbein MC, Meehan WP, Hsueh WA: Expression and function of PPARgamma in rat and human vascular smooth muscle cells. Circulation 2000, 101:1311-1318. Ellis CN, Varani J, Fisher GJ, Zeigler ME, Pershadsingh HA, Benson SC, Chi Y, Kurtz TW: Troglitazone improves psoriasis and normalizes models of proliferative skin disease: ligands for peroxisome proliferator-activated receptor-gamma inhibit keratinocyte proliferation. Arch Dermatol 2000, 136:609-616. Saubermann LJ, Nakajima A, Wada K, Zhao S, Terauchi Y, Kadowaki T, Aburatani H, Matsuhashi N, Nagai R, Blumberg RS: Peroxisome proliferator-activated receptor gamma agonist ligands stimulate a Th2 cytokine response and prevent acute colitis. Inflamm Bowel Dis 2002, 8:330-339. Issemann I, Green S: Activation of a member of the steroid hormone receptor superfamily by peroxisome proliferators. Nature 1990, 347:645-650. Kliewer SA, Forman BM, Blumberg B, Ong ES, Borgmeyer U, Mangelsdorf DJ, Umesono K, Evans RM: Differential expression and activation of a family of murine peroxisome proliferatoractivated receptors. Proc Natl Acad Sci U S A 1994, 91:7355-7359. Braissant O, Foufelle F, Scotto C, Dauca M, Wahli W: Differential expression of peroxisome proliferator-activated receptors (PPARs): tissue distribution of PPAR-alpha, -beta, and gamma in the adult rat. Endocrinology 1996, 137:354-366. Devchand PR, Keller H, Peters JM, Vazquez M, Gonzalez FJ, Wahli W: The PPARalpha-leukotriene B4 pathway to inflammation control. Nature 1996, 384:39-43. Hatae T, Wada M, Yokoyama C, Shimonishi M, Tanabe T: Prostacyclin-dependent apoptosis mediated by PPAR delta. J Biol Chem 2001, 276:46260-46267. Forman BM, Tontonoz P, Chen J, Brun RP, Spiegelman BM, Evans RM: 15-Deoxy-delta 12, 14-prostaglandin J2 is a ligand for the adipocyte determination factor PPAR gamma. Cell 1995, 83:803-812. Duval C, Fruchart JC, Staels B: PPAR alpha, fibrates, lipid metabolism and inflammation. Arch Mal Coeur Vaiss 2004, 97:665-672. 24.

2. 3. 4.

25. 26. 27. 28.

5. 6. 7.

8. 9.

29.

30. 31. 32.

10.

11.

12. 13.

33.

34.

14.

35.

15. 16. 17.

36.

37. 38.

18.

Hsueh WA, Bruemmer D: Peroxisome proliferator-activated receptor gamma: implications for cardiovascular disease. Hypertension 2004, 43:297-305. Michalik L, Desvergne B, Wahli W: Peroxisome-proliferator-activated receptors and cancers: complex stories. Nat Rev Cancer 2004, 4:61-70. Daynes RA, Jones DC: Emerging roles of PPARs in inflammation and immunity. Nat Rev Immunol 2002, 2:748-759. Woerly G, Honda K, Loyens M, Papin JP, Auwerx J, Staels B, Capron M, Dombrowicz D: Peroxisome proliferator-activated receptors alpha and gamma down-regulate allergic inflammation and eosinophil activation. J Exp Med 2003, 198:411-421. Trifilieff A, Bench A, Hanley M, Bayley D, Campbell E, Whittaker P: PPAR-alpha and -gamma but not -delta agonists inhibit airway inflammation in a murine model of asthma: in vitro evidence for an NF-kappaB-independent effect. Br J Pharmacol 2003, 139:163-171. Benayoun L, Letuve S, Druilhe A, Boczkowski J, Dombret MC, Mechighel P, Megret J, Leseche G, Aubier M, Pretolani M: Regulation of peroxisome proliferator-activated receptor gamma expression in human asthmatic airways: relationship with proliferation, apoptosis, and airway remodeling. Am J Respir Crit Care Med 2001, 164:1487-1494. Wang AC, Dai X, Luu B, Conrad DJ: Peroxisome proliferatoractivated receptor-gamma regulates airway epithelial cell activation. Am J Respir Cell Mol Biol 2001, 24:688-693. Ricote M, Li AC, Willson TM, Kelly CJ, Glass CK: The peroxisome proliferator-activated receptor-gamma is a negative regulator of macrophage activation. Nature 1998, 391:79-82. Jiang C, Ting AT, Seed B: PPAR-gamma agonists inhibit production of monocyte inflammatory cytokines. Nature 1998, 391:82-86. Honda K, Marquillies P, Capron M, Dombrowicz D: Peroxisome proliferator-activated receptor gamma is expressed in airways and inhibits features of airway remodeling in a mouse asthma model. J Allergy Clin Immunol 2004, 113:882-888. Patel HJ, Belvisi MG, Bishop-Bailey D, Yacoub MH, Mitchell JA: Activation of peroxisome proliferator-activated receptors in human airway smooth muscle cells has a superior antiinflammatory profile to corticosteroids: relevance for chronic obstructive pulmonary disease therapy. J Immunol 2003, 170:2663-2669. Delerive P, Fruchart JC, Staels B: Peroxisome proliferator-activated receptors in inflammation control. J Endocrinol 2001, 169:453-459. Harris SG, Phipps RP: The nuclear receptor PPAR gamma is expressed by mouse T lymphocytes and PPAR gamma agonists induce apoptosis. Eur J Immunol 2001, 31:1098-1105. Faveeuw C, Fougeray S, Angeli V, Fontaine J, Chinetti G, Gosset P, Delerive P, Maliszewski C, Capron M, Staels B, Moser M, Trottein F: Peroxisome proliferator-activated receptor gamma activators inhibit interleukin-12 production in murine dendritic cells. FEBS Lett 2000, 486:261-266. Sugiyama H, Nonaka T, Kishimoto T, Komoriya K, Tsuji K, Nakahata T: Peroxisome proliferator-activated receptors are expressed in human cultured mast cells: a possible role of these receptors in negative regulation of mast cell activation. Eur J Immunol 2000, 30:3363-3370. Sugiyama H, Nonaka T, Kishimoto T, Komoriya K, Tsuji K, Nakahata T: Peroxisome proliferator-activated receptors are expressed in mouse bone marrow-derived mast cells. FEBS Lett 2000, 467:259-262. Hill MR, Clarke S, Rodgers K, Thornhill B, Peters JM, Gonzalez FJ, Gimble JM: Effect of peroxisome proliferator-activated receptor alpha activators on tumor necrosis factor expression in mice during endotoxemia. Infect Immun 1999, 67:3488-3493. Thieringer R, Fenyk-Melody JE, Le Grand CB, Shelton BA, Detmers PA, Somers EP, Carbin L, Moller DE, Wright SD, Berger J: Activation of peroxisome proliferator-activated receptor gamma does not inhibit IL-6 or TNF-alpha responses of macrophages to lipopolysaccharide in vitro or in vivo. J Immunol 2000, 164:1046-1054. Kuenzli S, Saurat JH: Peroxisome proliferator-activated receptors in cutaneous biology. Br J Dermatol 2003, 149:229-236. Wiesenberg I, Chiesi M, Missbach M, Spanka C, Pignat W, Carlberg C: Specific activation of the nuclear receptors PPARgamma

Page 7 of 8
(page number not for citation purposes)

Respiratory Research 2005, 6:132

http://respiratory-research.com/content/6/1/132

39. 40.

and RORA by the antidiabetic thiazolidinedione BRL 49653 and the antiarthritic thiazolidinedione derivative CGP 52608. Mol Pharmacol 1998, 53:1131-1138. Spiegelman BM: PPARgamma in monocytes: less pain, any gain? Cell 1998, 93:153-155. Chawla A, Barak Y, Nagy L, Liao D, Tontonoz P, Evans RM: PPARgamma dependent and independent effects on macrophagegene expression in lipid metabolism and inflammation. Nat Med 2001, 7:48-52.

Publish with Bio Med Central and every scientist can read your work free of charge
"BioMed Central will be the most significant development for disseminating the results of biomedical researc h in our lifetime."
Sir Paul Nurse, Cancer Research UK

Your research papers will be:


available free of charge to the entire biomedical community peer reviewed and published immediately upon acceptance cited in PubMed and archived on PubMed Central yours you keep the copyright
Submit your manuscript here:
http://www.biomedcentral.com/info/publishing_adv.asp

BioMedcentral

Page 8 of 8
(page number not for citation purposes)

You might also like