(Prof. Dr. Klaus Wolf (Auth.) ) Nonconventional Yea (B-Ok - Xyz)

Nonconventional Yeasts in Biotechnology
Springer
Berlin
Heidelberg
New York
Barcelona
Budapest
Hong Kong
London
Milan
Paris
Santa Clara
Singapore
Tokyo
Klaus Wolf
Nonconventional Yeasts
in Biotechnology
A Handbook
With 94 Figures and 45 Tables
Springer
Prof. Dr. Klaus Wolf
RWTHAachen
Institut fUr Biologie IV (Mikrobiologie)
Worringer Weg
52056 Aachen, Germany
Cover Illustration: Kluyveromyces lactis. A scanning electron micrograph of K.

lactis strain CBS 2359. Courtesy of Professor Masako Osumi, Department of Biol-
ogy, Japan Women's University, Tokyo (see Chap. 5, Fig. 1)
ISBN-13: 978-3-642-79858-0 e-ISBN-13: 978-3-642-79856-6

DOl: 10.1007/978-3-642-79856-6
Library of Congress Cataloging-in-Publication Data. Nonconventional yeasts in biotechnology: a handbook!

Klaus Wolf. p. cm. Includes bibliographical references and index. l.
Yeast fungi-Biotechnology-Handbooks, manuals, etc. l. Wolf. K. (Klaus), 1994- . TP248.27.Y43N66 1996
660'.62-dc20 96-4935
This work is subject to copyright. All rights are reserved, whether the whole or part of the material is concerned,
specifically the rights of translation, reprinting, reuse of illustrations, recreation, broadcasting, reproduction on
microfilm or in any other way, and storage in data banks. Duplication of this publication or parts thereof is permitted
only under the provisions of the German Copyright Law of Septermber 9, 1965, in its current version, and permission
for use must always be obtained from Springer-Verlag. Violations are liable for prosecution under the German
Copyright Law.
© Springer-Verlag Berlin Heidelberg 1996
Softcover reprint of the hardcover 1st edition 1996
The use of general descriptive names, registered names, trademarks, etc. in this publication does not imply, even in the
absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and
therefore free for general use.
Product liability: The publishers cannot guarantee the accuracy of any information about dosage and application
contained in this book. In every individual case the user must check such information by consulting the relevant
literature.
Cover design: Springer-Verlag, Erich Kirchner
Typesetting: Best-set Typesetter Ltd., Hong Kong
SPIN: 10037326 39/31371SPS - 5 432 1 0 - Printed on acid-free paper
Preface
It is a difficult task to define a yeast and, even more so, a nonconventional yeast.
According to the yeast taxonomists Guilliermond and Lodder, yeasts are unicellu-
lar fungi which reproduce by budding or fission. In this sense, only unicellular
organisms belong to the yeast group, but many yeast species are dimorphic and
produce yeast and hyphal forms. Similarly, many filamentous fungi have yeast
stages. Therefore the reader will miss one or the other organism in this volume.
In this book, all yeasts except Saccharomyces and Schizosaccharomyces are
classified as nonconventional. This may change over the years, as is evident from
the wealth of information collected for some of these yeasts, as well as their
applications in many fields. Therefore some of the nonconventional yeasts of today
will be the conventional yeasts of tomorrow.
The reader is always referred to the excellent guides to genetics and molecular
biology of Saccharomyces by Guthrie and Fink (l991)! and of Schizosaccharomyces
by Alfa, Fantes, Hyams, McLeod and Warbrick (1993).2
In contrast to these books, this volume is aimed to provide much more back-
ground information on the organisms and their biotechnological use.
Since many techniques are used in all yeast systems, there will be some overlap.
This may, however, be helpful for the reader, since the experimental variants are
adaptations of a technique for the special yeast.
This book will be a good introduction into the special properties of yeasts for
beginners and also for current practitioners. Molecular biology is progressing so
fast, that some of the techniques will certainly have been altered by the time of
appearance of this book. Nevertheless, the detailed descriptions by the authors
should help in avoiding experimental pitfalls.
The volume is preceded by a chapter on principles and methods of yeast classi-
fication in order to provide a framework for the nontaxonomically trained user of
yeasts and to give an impression of the wealth of potentially useful organisms.
Identifying and classifying organisms is of great importance to many areas of
science, including agriculture, medicine, biology, biotechnology and the food in-
dustry, and also for assessment of industrial property rights.
1 Guide to yeast genetics and molecular biology. Methods in enzymology, vol 194. Academic
Press, New York

2 Experiments with fission yeast. A laboratory course manual. Cold Spring Harbor Labora-
tory Press, Cold Spring Harbor
VI Preface
Two more chapters are devoted to an introduction into the basic techniques of
protoplast fusion and karyotyping. Variants of these techniques will also be found
for some of the yeast species.
I thank all the authors for their care in preparing their chapters, and all my
colleagues for their help in editing this book.
Aachen Klaus Wolf

Summer 1995
Contents
Chapter 1
Principles and Methods Used in Yeast Classification, and an Overview
of Currently Accepted Yeast Genera
Teun Boekhout and Cletus P. Kurtzman. ... . . . .. .. . . .. .. ....... ... . . 1
1 Introduction................................................... 1
2 Some Principles of Yeast Taxonomy. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2
3 Trends in the Systematics of Yeasts. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3
4 Phylogeny..................................................... 8
5 Methods...................................................... 9
5.1 Morphology................................................ 9
5.1.1 Vegetative Morphology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10
5.1.2 Generative Morphology. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13
5.2 Physiological Characterization of Yeasts .. . .. ... .. ... ... ... . ... . 18
5.2.1 Fermentation Tests. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18
5.2.2 Assimilation Tests ..................................... 19
5.2.3 Vitamin Requirements ................................. 21
5.2.4 Other Tests ........................................... 21
5.3 Mating.................................................... 22
5.3.1 Ascomycetes.......................................... 22
5.3.2 Basidiomycetes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22
5.4 Nuclear Staining. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23
5.4.1 Staining Nuclei Using DAPI ............................. 23
5.4.2 Staining Nuclei with Propidium Iodide ................... 23
5.4.3 Staining Nuclei with Mithramycin and Ethidium Bromide ... . 24
5.4.4 Staining Nuclei with Giemsa . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 24
5.5 DNA ..................................................... 25
5.5.1 Isolation ............................................. 25
5.5.2 Analysis of Base Composition ........................... 27
5.5.3 Hybridization of Nuclear DNA .......................... 28
5.5.4 Amplification of Yeast DNA
Using Polymerase Chain Reaction (PCR) . . . . . . . . . . . . . . . . . . . 30
5.5.5 Electrophoretic Karyotyping ............................ 32
6 Overview of Yeast Genera ....................................... 36
6.1 Teleomorphic Ascomycetous Genera .......................... 36
VIII Contents
6.2 Anamorphic Ascomycetous Genera ........................... 51

6.3 Teleomorphic Heterobasidiomycetous Genera . . . . . . . . . . . . . . . . . . . 53
6.4 Anamorphic Heterobasidiomycetous Genera . . . . . . . . . . . . . . . . . . . . 58
7 Appendix .................................................... 63
7.1 Media .................................................... 63
7.2 Recipes of Some Media ...................................... 65
7.3 Culture Collections. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 66
References 67
Chapter 2
Protoplast Fusion of Yeasts
Martin Zimmermann and Matthias Sipiczki 83
1 Introduction ................................................. 83
2 Transfer of Cytoplasmic Genes .................................. 84
3 Production of Polyploid Strains ................................. 85
4 Fusion of Strains with Identical Mating Type ...................... 85
5 Establishment of Parasexual Genetic Systems ...................... 86
6 Fusion of Strains Belonging to Different Species or Genera. . . . . . . . . . . 87
7 Practical Recommendations. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 89
8 Analysis of the Fusants . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 92
8.1 Preparation of Protoplasts .................................. 92
8.2 Fusion of Protoplasts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 94
9 Additional Protocols . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 94
9.1 Alginate Encapsulation of Protoplasts ........................ 94
9.2 Induction of Haploidization or Mitotic Segregation
by p-Fluoro-Phenylalanine ................................... 95
9.3 Staining of Cells Prior to Protoplasting . . . . . . . . . . . . . . . . . . . . . . . . 95
10 Concluding Remarks. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 95
References ...................................................... 96
Chapter 3
Electrophoretic Karyotyping of Yeasts
Martin Zimmermann and Philippe Fournier . . . . . . . . . . . . . . . . . . . . . . . . .. 101
1 Introduction and Theory. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 101
2 Fields of Application. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 103
2.1 Yeast Taxonomy ........................................... 103
2.2 Study of Chromosome Polymorphisms ........................ 104
2.3 Typing of Yeast Strains... .. . .... . .. ... .. .. . . ..... . .. .. .. .. .. 104
2.4 Genome Mapping. .... . .. .. . . . ... . . .. . .. .. .. . . .... .. .. .. .. .. 104
2.5 Characterization of Hybrids .................................. 105
2.6 Probe Preparation and Transformation ........................ 105
2.7 Miscellaneous ............................................. 105
3 Practical Recommendations. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 106
Contents IX
3.1 Sample Preparation ......................................... 106

3.1.1 Procedure A: Protoplast Formation by Zymolyase . . . . . . . . . .. 107
3.1.2 Procedure B: Protoplast Formation by Novozym . . . . . . . . . . .. 108
3.1.3 Markers . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 108
3.2 Electrophoresis Apparatus. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 108
3.3 Electrophoresis Conditions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 109
3.4 Blotting of the Gels. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. III
References ...................................................... 112
Chapter 4
Schwanniomyces occidentalis
R. Jiirgen Dohmen and Cornelis P. Hollenberg. .. .. .... .. ...... .. . .... 117
1 History of Schwanniomyces occidentalis Research .................. 117
2 Physiology................................................... 118
3 Media ...................................................... 119
4 Available Strains. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 119
5 Genetic Techniques ........................................... 120
5.1 Description and Life Cycle .................................. 120
5.2 Strain Construction ........................................ 120
5.3 Mutagenesis .............................................. 121
5.4 Transformation ........................................... 121
5.5 Gene Disruptions and Deletions ............................. 122
6 Chromosomal DNA ........................................... 123
7 Genes and Genetic Markers .................................... 123
8 Vector Systems ............................................... 127
9 Heterologous Gene Expression .................................. 127
10 The Amylolytic System . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 128
11 Industrial Applications . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. l33
References ...................................................... 134
Chapter 5
Kluyveromyces lactis
Micheline Wesolowski-Louvel, Karin D. Breunig, and Hiroshi Fukuhara... l39
1 History of Kluyveromyces lactis Research ......................... l39
2 Physiology .................................................. 140
3 Growth Media... ....... .... ...... .... ...... .. ......... .. . .. .. 141
5 Genetic Techniques. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 144
5.1 Life Cycle. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 144
5.2 Sexual Crosses and Tetrad Analysis. . . . . . . . . . . . . . . . . . . . . . . . . .. 144
5.3 Mutagenesis .............................................. 145
6 Chromosomal DNA ........................................... 145
6.1 Chromosomal DNAs and Genome Size ....................... 145
x Contents
6.2 Chromosome Separation by Pulsed Field Gel Electrophoresis ..... 146

7 Genes and Genetic Markers.... .. ... .... .. .. .. . .. .. .. ... .... .... 147
8 K. lactis Genes vs. S. cerevisiae Genes . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 149
8.1 Sequence Homology of Gene Products ........................ 149
8.2 Codon Usage ............................................. 154
9 Regulation of Carbon Metabolism ............................... 154
9.1 Lactose and Galactose Metabolism ........................... 154
9.2 Glucose Repression of Lactose/Galactose Metabolism. . . . . . . . . . .. 156
9.3 Regulation of Fermentation and Respiration ................... 157
10 Mitochondria. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 159
10.1 Mitochondrial Mutations .................................. 159
10.2 Mitochondrial DNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 160
11 A Few Notes on Biochemical Procedures.... . . .. . . .. . .. .. . . . .. . ... 162
11.1 Cell Mass Determination. .. ... .. .. ... . .... ... ... .. ... . .... 162
11.2 Cell Extracts for Preparation of Nucleic Acids.. ... . .. . ... .. ... 162
11.2.1 Nucleic Acids Prepared from Spheroplasts . . . . . . . . . . . . .. 162
11.2.2 Nucleic Acids Prepared by Mechanical Extraction ....... 162
11.3 Small-Scale Preparation of DNA ............................ 163
11.4 Large-Scale Preparation of Nuclear and Mitochondrial DNA. .... 163
11.5 Cell Disruption for Enzyme Assays .......................... 164
11.5.1 Disruption by Braun Homogenizer .................... 164
11.5.2 Disruption by Vortexing... .. .. .. . . . . ... .... . ... ..... 164
11.5.3 Permeabilized Cells ................................. 165
11.6 Gene Fusions ............................................ 165
11.7 DNA-Binding Studies ..................................... 166
12 Plasmids . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 167
12.1 Circular Plasmids . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 167
12.2 Linear DNA Plasmids and the Killer System .................. 168
12.3 RNA Plasmids . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 170
12.4 Killer Assay. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 170
12.5 Detection of Plasmids in Colony Lysates . . . . . . . . . . . . . . . . . . . . .. 171
12.6 Preparation of Killer Plasmid DNAs ......................... 172
13 Vector Systems ............................................... 172
13.1 Transformation Markers .................................. 172
13.2 pKD1 Plasmid-Derived Vectors. . .. . ... . . .. .. ... .. . . . .. .. ... 173
13.3 ARS Vectors. ..... .. . .. .. . ... . . . . .. . . .. ... .. . .. .. ... .. ... 173
13.4 Centromeric Vectors. . .. . ... . .. .. . ... .. .... . ... ... . ... .... 173
13.5 K. lactis/S. cerevisiae Shuttle Vectors and Shuttle Libraries ...... 175
13.6 Expression and Secretion Vectors ........................... 175
13.7 Killer Plasmid DNAs as a Possible Vector.. .. .. . .. . .. . . . . . . . .. 175
14 Transformation Procedures. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 179
14.1 Various Methods of Transformation ... . . . . . . . . . . . . . . . . . . . . .. 179
14.2 Transformation by Spheroplasting . . . . . . . . . . . . . . . . . . . . . . . . . .. 180
14.3 Transformation by Electroporation .... . . . . . . . . . . . . . . . . . . . . .. 181
14.3.1 Transformation by the Electropulsateur ................ 181
Contents XI
14.3.2 Transformation by the Gene Pulser . . . . . . . . . . . . . . . . . . .. 182

14.4 Transformation by a LiCI Method ........................... 183
14.5 Transformation of Frozen Competent Cells ................... 183
14.6 Release of Plasmids from K. lactis Transformants .............. 184
14.7 Use of G418 Resistance Marker in Transformation ............. 184
15 K. lactis for Industrial Application ............................... 186
References ...................................................... 188
Chapter 6
Pichia pastoris
Koti Sreekrishna and Keith E. Kropp 203
1 History of Pichia pastoris . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 203
2 Growth and Storage ........................................... 204
2.1 Shake Flask, Shake Tube, Plate, and Slant Cultures. . . . . . . . . . . . .. 204
2.2 Media ................................................... 205
2.2.1 Stock Solutions. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 205
2.2.2 Minimal Media Compositions. . . . . . . . . . . . . . . . . . . . . . . . . .. 205
2.2.3 Supplemental Minimal Media Compositions .............. 206
2.2.4 Complex Medium Composition ......................... 206
2.3 Storage ........................................ .......... 207
3 Available Strains .............................................. 207
4 Genetic Techniques ........................................... 207
4.1 Life Cycle ...................................... .......... 207
4.2 Mating and Sporulation .................................... 208
4.2.1 Mating . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 208
4.2.2 Sporulation .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 208
4.2.3 Random Spore Preparation . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 208
5 Fermentation Process . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 209
5.1 Continuous Culture of Mut+ and Mut- Strains on Methanol. . . . . .. 210
5.1.1 Inoculum for the Fermentor . . . . . . . . . . . . . . . . . . . . . . . . . . .. 210
5.1.2 Media .............................................. 210
5.1.3 Batch Phase.. .. .. .. .. ... ... .. ... .. .... . .. ... .. .. .. ... 211
5.1.4 Continuous Phase .................................... 211
5.1.5 Equipment .............................. .. ......... 212
5.1.6 Methods of Monitoring the Fermentation. . . . . . . . . . . . . . . .. 212
5.2 Fed-Batch Fermentation of Mut+ and Mut- Strains
on Methanol.. .... ....... ....... ... .. .. .... ....... ..... ... 214
5.2.1 Inoculum for Fermentor ............................... 214
5.2.2 Batch Phase ......................................... 214
5.2.3 Fed-Batch Phase on Glycerol. . . . . . . . . . . . . . . . . . . . . . . . . . .. 214
5.2.4 Fed-Batch Phase on Methanol .......................... 215
6 Transformation .............................................. 215
6.1 Spheroplast Transformation Procedure. . . . . . . . . . . . . . . . . . . . . . .. 216
6.1.1 Composition of Reagents .............................. 216
XII Contents
6.1.2 Procedure ........................................... 219

6.1.3 Plating of Transformants ........ .. .. .. . . ... ..... .. .. ... 221
6.1.4 Plating for Determination of Spheroplast Viability. . . . . . . . .. 221
6.1.5 Screening for AOXI Gene Disruption .................... 222
6.2 Lithium Chloride Transformation Method ..................... 223
6.3 Transformation Method Using Frozen Competent Cells
(PEG-1000 Method) .. . .. ... ..... .... .. .. ... . ... ... . ... .. ... 224
6.3.1 Composition of Reagents .............................. 224
6.3.2 Preparation and Freezing of Competent Cells. . . . . . . . . . . . .. 225
6.3.3 Transformation....................................... 225
6.4 Transformation by Electroporation . . . . . . . . . . . . . . . . . . . . . . . . . .. 226
7 Induction of Protein Expression ................................. 227
7.1 Continuous Induction. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 227
7.2 Stepwise Induction ........................................ 227
7.3 Evaluation of Product Toxicity. . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 227
7.4 Efficient Secretion of Proteins. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 228
7.4.1 Secretion Media Composition. . . . . . . . . . . . . . . . . . . . . . . . . .. 228
7.4.2 Shake Tube Cultures .................................. 228
7.4.3 Shake Flask Cultures .................................. 229
7.4.4 Plates............................................... 229
8 Analysis of Protein Expression ................................. 229
8.1 Mechanical Lysis of Cells. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 229
8.2 Alkaline Lysis of Cells ...................................... 230
8.3 Acid Lysis of Cells ......................................... 231
8.4 Enzymatic Lysis of Cells .................................... 231
9 Vectors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 232
9.1 Compilation of Vectors and Their Origins. ... .. .... ... . ... .... 232
10 Optimization of Protein Expression .............................. 244
10.1 Autonomous Replication or Integration? . . . . . . . . . . . . . . . . . . . .. 244
10.2 Gene Dosage . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 244
10.3 Mut+ or Mut- Host? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 246
10.4 Site of Integration. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 246
10.5 mRNA 5' and 3' Untranslated Sequences. ... .. .... ....... .... 247
10.6 Translation Initiation Codon (AUG) Context . . . . . . . . . . . . . . . .. 247
10.7 A+T Composition. .. ..... ..... ... .. .. .. .. . .. .. ....... .... 247
10.8 Secretion Signal ......................................... 248
10.9 Glycosylation............................................ 249
10.10 Product Stability. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 249
10.11 Future Perspectives. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 250
10.11.1 Expression Without Methanol. . . . . . . . . . . . . . . . . . . . . .. 250
10.11.2 Improved Posttranslational Modifications
in Yeast . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 250
11 Miscellaneous Procedures. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 250
References ...................................................... 250
Contents XIII
Chapter 7
Pichia guilliermondii
Andrei A. Sibirny. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 255
1 History of Pichia guilliermondii Research .......................... 255
2 Physiology .................................................... 255
3 Available Strains ............................................... 256
4 Genetic Techniques. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 257
4.1 Life Cycle. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 257
4.2 Sexual Crosses ............................................. 257
4.3 Protoplast Fusion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 257
4.4 Protocol for Isolation and Fusion of Protoplasts ................. 258
4.5 Analysis of Meiotic Segregants . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 259
4.6 Protocol for Random Spore Analysis . . . . . . . . . . . . . . . . . . . . . . . . . .. 259
5 Chromosomes, Genes, and Genetic Markers ........................ 260
5.1 Pulsed Field Electrophoresis ............................ ..... 260
5.2 Genetic Mapping ........................................... 260
6 DNA Isolation and Transformation ............................... 260
6.1 Isolation of Chromosomal DNA and Construction of a Gene Bank.. 260
6.2 Transformation............................................. 262
7 Biochemical Genetics ........................................... 265
7.1 Hydrocarbon Utilization. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 265
7.2 Riboflavin Biosynthesis. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 265
7.3 Riboflavin Transport ........................................ 269
8 Biotechnological Applications . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 270
9 Concluding Remarks. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 271
References ...................................................... 272
ChapterS
Pichia methanolica (Pichia pinus MH4)
Andrei A. Sibirny . . . . . . . . . . . . .. .................................. 277
1 History of Pichia methanolica Research. . . . . . . . . . . . . . . . . . . . . . . . . .. 277
2 Physiology .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 277
5 Chromosomes ................................................ 278
6 Genes and Genetic Markers . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 279
6.1 Meiosis................................................... 279
6.2 Nomenclature............................................. 279
6.3 Induced Haploidization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 279
6.4 Tetrad Analysis. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 279
7 Transformation .............................................. 280
7.1 Transformation Procedure .................................. 280
XIV Contents
7.2 Molecular Cloning of SUP2 and ADEI . . . . . . . . . . . . . . . . . . . . . . . .. 281

8 Genetic Control of Mating. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 281
9 Biochemical Genetics of Purine Biosynthesis. . . . . . . . . . . . . . . . . . . . . .. 282
10 Genetic Control of Methanol Metabolism. . . . . . . . . . . . . . . . . . . . . . . . .. 282
10.1 Catabolite Repression and Catabolite Inactivation
of Enzymes Involved in Methanol Metabolism. . . . . . . . . . . . . . . .. 285
10.2 Identification of Genes Controlling Catabolite Repression ....... 286
11 Biotechnological Applications ................................... 288
References ...................................................... 289
Chapter 9
Hansenula polymorpha (Pichia angusta)
Hans Hansen and Comelis P. Hollenberg. . . . . . . . . . . . . . . . . . . . . . . . . . . .. 293
1 History of Hansenula polymorpha Research ....................... 293
2 Physiology .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 294
3 Media ....................................................... 295
5.1 Life Cycle. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. ......... 297
5.2 Induction of Mutants. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 298
6 Chromosomes ................................................ 299
7 Genes and Genetic Markers ... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 299
8 Vector Systems ............................................... 301
9 Heterologous Gene Expression .................................. 302
10 Peroxisomal Biogenesis. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 303
11 Applied Aspects. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 305
12 Concluding Remarks. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 306
References ...................................................... 306
Chapter 10
Yarrowia lipolytica
Gerold Barth and Claude Gaillardin 313
1 History of Yarrowia lipolytica Research . . . . . . . . . . . . . . . . . . . . . . . . . . .. 313
2 Physiology/Biochemistry/Cell Structure. . . . . . . . . . . . . . . . . . . . . . . . . . .. 315
2.1 Occurrence in Nature. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 315
2.2 Main Substrates and Biochemical Tests. . . . . . . . . . . . . . . . . . . . . . . .. 316
2.3 Phylogenetic Relationships. . . . .. ............................. 316
2.4 Dimorphism............................................... 318
2.5 Studied Metabolic Pathways. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 319
2.5.1 Utilization of Hydrocarbons as Carbon Source.... ... .. .. ... 319
2.5.2 Fatty Acid Biosynthesis and Degradation .................. 320
2.5.3 Assimilation of Alcohols ................................ 320
2.5.4 Assimilation of Acetate ................................. 321
Contents XV
2.6 Secretion of Metabolites ..................................... 321

2.6.1 Citrate and Isocitrate . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 321
2.6.2 a-Ketoglutarate and Other Organic Acids. . . . . . . . . . . . . . . . .. 322
2.6.3 Lysine................................................ 322
2.7 Secretion of Proteins ........................................ 324
2.7.1 Extracellular Alkaline Protease (AEP) ..................... 324
2.7.2 Extracellular RNase .................................... 325
2.7.3 Acid Extracellular Protease. . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 325
2.7.4 Extracellular Phosphatases .............................. 325
2.7.5 Extracellular Lipase and Esterase. . . . . . . . . . . . . . . . . . . . . . . .. 326
2.7.6 a-Mannosidase . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 326
2.7.7 Genes and Mutations of the Secretory Pathway. . . . . . . . . . . . .. 327
2.8 Peroxisome Biosynthesis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 328
3 Life Cycle . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 328
3.1 Heterothallism and Mating Type Alleles . . . . . . . . . . . . . . . . . . . . . . .. 328
3.2 Mating Frequency .......................................... 329
3.3 Sporulation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 329
3.4 Inbred Strains . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 332
3.5 Spontaneous Haploidization and Stability of Diploid Strains . . . . . .. 332
4 Genetic and Molecular Data ..................................... 332
4.1 Mutagenesis and Mutants .................................... 332
4.2 Genome and Gene Structure . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 334
4.2.1 Genome Structure ..................................... 334
4.2.2 Genetic Linkage Groups and Chromosome Maps. . . . . . . . . . .. 334
4.2.3 ARS and Centromeres .................................. 335
4.2.4 Ribosomal RNA and Other RNA Genes. .. . . .. .... .. .. . .... 336
4.2.5 Features of Structural Genes . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 337
4.3 Transposon . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 337
4.4 Plasmids and VLPs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 340
4.5 Mitochondrial Genome ...................................... 340
5 Transformation, Vectors, and Expression Systems . . . . . . . . . . . . . . . . . .. 340
5.1 Integrative Transformation. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 341
5.1.1 Single-Copy Integration. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 341
5.1.2 Multiple-Copy Integration. . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 344
5.2 Replicative Transformation. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 344
5.3 Creation of a Set of Nonreverting Markers.. .. .. .. .. . ... ... ... .. 347
5.4 Marker Genes and Vectors ................................... 347
5.4.1 Biosynthetic Genes. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 347
5.4.2 Heterologous Markers and Reporter Genes. . . . . . . . . . . . . . . .. 348
5.4.3 Expression and Secretion Vectors ........................ 350
5.4.4 Vectors for Multicopy Integration ........................ 352
6 Media and Culture Conditions. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 354
6.1 Media ................................................... 354
6.1.1 Complete Media.. .. . ... . ... ... .. .. .. .. .. .. . ... .. .. .. .. 354
6.1.2 Synthetic Minimal Media. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 355
XVI Contents
6.1.3 Conjugation Media. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 356

6.1.4 Sporulation Media ..................................... 356
6.1.5 Special Media ......................................... 356
6.2 Temperature . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 358
6.3 pH Values of the Growth Media . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 359
6.4 Aeration .................................................. 359
6.5 Conservation of Strains . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 359
6.5.1 Conservation with Glycerol. . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 359
6.5.2 Liquid Nitrogen and Freeze-Drying Preservation. . . . . . . . . . .. 359
7 Genetic Techniques. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 360
7.1 Mutagenesis................................................ 360
7.1.1 UV-Light Mutagenesis... ... .... ... ...... .. ... . .. .. .. ... 360
7.1.2 N-Methyl-N'-Nitro-N-Nitroso-Guanidine (MNNG)
Mutagenesis. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 360
7.1.3 Enrichment of Mutants by Nystatin. . . . . . . . . . . . . . . . . . . . . .. 361
7.2 Mating and Sporulation ..................................... 362
7.2.1 Conjugation on Solid Medium... .. .. .. .. . . ...... .. .. .. .. 362
7.2.2 Conjugation in Liquid Medium .......................... 362
7.2.3 Sporulation........................................... 362
7.3 Isolation of Ascospores ...................................... 363
7.3.1 Random Spore Selection Using Nystatin. . . . . . . . . . . . . . . . . .. 363
7.3.2 Micromanipulation .................................... 363
7.4 Use of Dimethylformamide to Induce Chromosome Loss.... .. .. .. 364
8 Methods of Cell Biology (Structural Studies) . . . . . . . . . . . . . . . . . . . . . . .. 364
8.1 Available Antibodies ........................................ 364
8.2 Immunofluorescence ... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 365
8.3 Embedding, Thin Sectioning, and Immunogold Labeling . . . . . . . . .. 366
9 Methods of Molecular Biology/Gene Technology. . . . . . . . . . . . . . . . . . . .. 369
9.1 Transformation Systems ..................................... 369
9.1.1 LiAc/LiCI Method. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 369
9.1.2 Electroporation........................................ 370
9.1.3 Single Colony Method. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 371
9.2 Preparation of Protoplasts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 372
9.3 Isolation of Genomic DNA ................................... 373
9.3.1 Minipreparation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 373
9.3.2 Maxipreparation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 374
9.3.3 Isolation of Yeast Plasmid DNA
for E. coli Transformation. . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 375
9.4 Separation of Chromosomes. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 375
9.4.1 Plug Preparation. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 375
9.4.2 Chromosome Separation. . .. ... .. ... ..... ... ...... .. .... 376
9.5 Isolation of RNA ........................................... 377
9.5.1 The Procedure Described by Chomczynski
and Sacchi (1987) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 377
9.5.2 The Procedure Described by Domdey et al. (1984) . . . . . . . . . .. 378
Contents XVII
9.6 Available Gene Libraries 378

References 380
Chapter 11
Arxula adeninivorans
Gotthard Kunze and Irene Kunze 389
1 History of Arxula adeninivorans Research ......................... 389
2 Physiology and Biochemical Procedures. . . . . . . . . . . . . . . . . . . . . . . . . . .. 389
2.1 Physiology.......................................... ...... 389
2.2 Biochemical Procedures. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 391
2.2.1 Cell Mass Determination . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 391
2.2.2 Preparation of DNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 392
2.2.3 Preparation of Probes for Enzyme Activity . . . . . . . . . . . . . . . .. 392
3 Growth Media ................................................. 393
4 Available Strains and Preservation Methods ........................ 393
4.1 Strains ....... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 393
4.2 Preservation Methods ....................................... 394
5 Parasexual Genetics. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 395
5.1 Protoplast Fusion. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 395
5.2 Mitotic Haploidization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 395
6 Chromosomal DNA ............................................ 395
6.1 DNA Reassociation..... ... .. .... ..... .. ..... .... ... .... .. ... 395
6.2 Pulsed Field Gel Electrophoresis. . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 396
6.3 DNA Fingerprinting . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 397
7 Mitochondrial DNA. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 398
8 Transformation System ......................................... 399
8.1 Genetic Markers and Isolation of Genes ........................ 399
8.2 Transformation Markers . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 402
8.3 Various Methods of Transformation . . . . . . . . . . . . . . . . . . . . . . . . . .. 402
8.4 Transformation Protocols . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 404
8.4.1 Transformation by Lithium Salt Treatment. ........ ... . ... 404
8.4.2 Transformation of Frozen Competent Cells ................ 405
8.4.3 Transformation by Electroporation ....................... 405
9 Expression of Heterologous Genes in A. adeninivorans .. . . . . . . . . . . . .. 406
References ...................................................... 407
Chapter 12
Candida maltosa
Stephan Mauersberger, Moriya Ohkuma, Wolf-Hagen Schunck,
and Masamichi Takagi ....... " ......... " .. ..... .. ... ... .. .. .. ... 411
1 History and Taxonomy of Candida maltosa . ....................... , 413
1.1 History of Research Candida maltosa on
and Its Taxonomic Position .................................. 413
XVIII Contents
1.2 Phylogenetic Relation of Candida maltosa to Other Yeasts ........ 420

1.3 Handling of Candida maltosa Strains .......................... 422
2 Physiology and Biochemistry of Candida maltosa . . . . . . . . . . . . . . . . . . .. 422
2.1 Occurrence in Nature. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 422
2.2 The Problem of Pathogenicity and Toxicity
for Candida maltosa and Its SCP . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 423
2.3 Physiology of Growth. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 426
2.3.1 Temperature and pH ................................... 426
2.3.2 Growth Rate and Yield Coefficients ....................... 426
2.3.3 Biomass Composition .................................. 428
2.3.4 Media... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 429
2.3.5 Cultivation Conditions ................................. 430
2.4 Substrate Utilization Spectrum of Candida maltosa . . . . . . . . . . . . . .. 431
2.4.1 Nitrogen Sources and Amino Acid Catabolism.. ...... .. .. .. 431
2.4.2 Carbon Sources. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 434
2.4.3 Miniaturized Fermenter System
for Physiological and Biochemical Studies . . . . . . . . . . . . . . . . .. 447
2.5 The Enzymology of the Alkane Catabolic Pathway
and Its Regulation in Candida maltosa . . . . . . . . . . . . . . . . . . . . . . . .. 449
2.5.1 Alteration in Yeast Cells During Growth
on n-Alkanes. .... . . . . . ... .. . ..... . . .. .. .. .. ... ... .. ... 450
2.5.2 Uptake of n-Alkanes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 452
2.5.3 The Enzymes of Primary Alkane Oxidation to Fatty Acids
and Their Regulation in Candida maltosa . . . . . . . . . . . . . . . . .. 453
2.5.4 Fatty Acid Oxidation ......................•............ 463
2.5.5 Intermediate Metabolism and Gluconeogenesis . . . . . . . . . . . .. 464
2.6 Biosynthetic Pathways . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 466
2.6.1 Amino Acid Biosynthesis. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 466
2.6.2 Biosynthesis of Lipids .................................. 469
2.6.3 Biosynthesis of Polysaccharides .......................... 470
2.7 Protein Transport and In Vitro Translation System. . . . . . . . . . . . . .. 470
2.7.1 Protein Transport Studies with Candida maltosa ........... 470
2.7.2 In Vitro Translation System Using Cell-Free Extracts
Isolated from Candida maltosa .......................... 471
2.8 Some Peculiarities of Candida maltosa ......................... 474
3 Cytology and Morphology of Candida maltosa . . . . . . . . . . . . . . . . . . . . .. 476
3.1 Morphology................................................ 476
3.2 Ultrastructure of Glucose- and Alkane-Grown
Candida maltosa Cells. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 476
3.3 Electron Microscopy Methods ................................ 480
3.3.1 Electron Microscopy of Cells and Cell Fractions
Using Resin Embedding. ... .. ... ..... .. .. .. .. . .. . .. .. ... 481
3.3.2 Immunoelectron Microscopy. ... .. .. . .. . . .. ... .. ... .. ... 481
3.4 Subcellular Organization of the Alkane Metabolism .............. 483
3.5 Cell Fractionation and Preparation of Organelles. . . . . . . . . . . . . . . .. 484
Contents XIX
4 Genetics and Molecular Biology of Candida maltosa ................. 486

4.1 Strains Used in Different Laboratories. . . . . . . . . . . . . . . . . . . . . . . . .. 486
4.2 Mutagenesis and Mutants .................................... 486
4.2.1 Mutagenesis of Candida maltosa ......................... 486
4.2.2 Mutant Phenotypes .................................... 489
4.2.3 Mutant Isolation in Candida maltosa ..................... 497
4.2.4 Classical Genetic Techniques for Candida maltosa .......... 499
4.2.5 Method of Protoplast Fusion ............................ 500
4.3 Characterization of the Candida maltosa Genome. . . . . . . . . . . . . . .. 501
4.3.1 Genome Characteristics and Ploidy. . . . . . . . . . . . . . . . . . . . . .. 501
4.3.2 Electrophoretic Karyotype. . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 504
4.3.3 Separation of Chromosomes
by Pulsed Field Gel Electrophoresis ....................... 505
4.3.4 Mitochondrial DNA .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 507
4.4 Genes of Candida maltosa . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 507
4.4.1 Gene Cloning Strategies and Gene Libraries . . . . . . . . . . . . . . .. 507
4.4.2 Cloned Genes and Regulation of Their Expression .......... 511
4.4.3 Codon Usage.. ..... ............. ...... . ... .... .. .. .. .. 524
4.4.4 Gene Mapping. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 527
4.5 Preparation of DNA from Candida maltosa Cells. . . . . . . . . . . . . . . .. 528
4.6 Preparation of RNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 530
4.6.1 Isolation of Translatable mRNA . . . . . . . . . . . . . . . . . . . . . . . . .. 530
4.6.2 Isolation of Total tRNA .......... . . . . . . . . . . . . . . . . . . . . . .. 530
5 Host-Vector Systems for Candida maltosa ......................... 531
5.1 ARS and CEN Regions of Candida maltosa . . . . . . . . . . . . . . . . . . . . .. 532
5.2 Development of Host-Vector Systems.. ... ..... ... .. .... .. . .... 535
5.2.1 Transformation Systems, Marker Genes, and Vectors.. .. .... 535
5.2.2 Transformation Methods. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 539
5.3 Heterologous Gene Expression in Candida maltosa . . . . . . . . . . . . . .. 543
6 Potential Biotechnological Application of Candida maltosa ........... 547
References ...................................................... 552
Chapter 13
Trichosporon
Jakob Reiser, Urs A. Ochsner, Markus Kalin, Virpi Glumoff,
and Armin Fiechter .............................................. 581
1 History of Trichosporon Research. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 581
2 Available Strains and Mutant Collections. . . . . . . . . . . . . . . . . . . . . . . . .. 584
3 Media for Different Purposes. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 584
4 Conservation of Strains. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 587
5.1 Mutant Induction. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 587
5.1.1 UV Mutagenesis. . . ...... .... . .. .. .... . ... . ... .. .. .... 587
5.1.2 Nitrosoguanidine Mutagenesis. . . . . . . . . . . . . . . . . . . . . . . . .. 588
xx Contents
5.2 Preparation of Protoplasts and Protoplast Fusion ...... ........ 588

6 Biochemical Techniques. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 589
6.1 Preparing Trichosporon Chromosomal DNA ................... 589
6.1.1 Large-Scale Procedure 1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 589
6.1.2 Large-Scale Procedure 2. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 590
6.1.3 Small-Scale Procedure. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 592
6.2 Preparing Trichosporon Total RNA. . . . . . . . . . . . . . . . . . . . . . . . . . . 592
6.3 Preparing Trichosporon Protein Extracts. . . . . . . . . . . . . . . . . . . . . .. 594
6.3.1 Large-Scale Extracts. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 594
6.3.2 Small-Scale Extracts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 594
7 Molecular Techniques .......................................... 594
7.1 Transformation Systems Based on Dominant Markers... ...... .. 594
7.2 Transformation Systems Based on Cloned Biosynthetic Genes. . . .. 596
7.3 Genes from Trichosporon cutaneum .......................... 596
8 Specific Biochemical Properties of Trichosporon Yeasts . . . . . . . . . . . . . .. 598
8.1 Physiology of Trichosporon Yeasts . . . . . . . . . . . . . . . . . . . . . . . . . . .. 598
8.2 Biochemistry of Trichosporon Yeasts . . . . . . . . . . . . . . . . . . . . . . . . .. 600
9 Trichosporon Cell Biology: Staining of Nuclei ...................... 601
10 Applications of Trichosporon Yeasts . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 602
References ...................................................... 602
Subject Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 607

List of Contributors
(Their addresses can be found at the beginning of their respective chapters.)
Barth, G. 313 Kunze, I. 389

Boekhout, T. 1 Kurtzman, C.P. 1
Breunig, K.D. 139 Mauersberger, S. 411
Dohmen, R.J. 117 Ochsner, U.A. 581
Fiechter, A. 581 Ohkuma, M. 411
Fournier, P. 101 Reiser, J. 581
Fukuhara, H. 139 Schunck, W.H. 411
Gaillardin, C. 313 Sibirny, A.A. 225, 277
Glumoff, V. 581 Sipiczki, M. 83
Hansen, H. 293 Sreekrishna, K. 203
Hollenberg, C.P. 117,293 Takagi, M. 411
Kalin, M. 581 Wesolowski-Louvel, M. 139
Kropp, K.E. 203 Zimmermann, M. 83,101
Kunze, G. 389
CHAPTER 1
Principles and Methods Used in Yeast

Classification, and an Overview of Currently
Accepted Yeast Genera
Teun Boekhout1 and Cletus P. Kurtzman2
1
Introduction
Yeasts are of benefit to mankind because they are widely used for production of
foods, wine, beer, and a variety of biochemicals. Yeasts also cause spoilage of foods
and beverages, and are of medical importance. At present, approximately 700 yeast
species are recognized, but only a few are commonly known. Relatively few natural
habitats have been thoroughly investigated for yeast species; consequently, we can
assume that many more species await discovery. Because yeasts are widely used in
traditional and modern biotechnology, the exploration for new species should lead
to additional novel technologies.
Several definitions have been used to describe the yeast domain. According to
Guilliermond (1912) and Lodder (1970), yeasts are unicellular fungi which repro-
duce by budding or fission. In this sense, only true unicellular fungi are regarded
as yeasts, but, in reality, many yeast species are dimorphic and produce
pseudohyphae and hyphae in addition to unicellular growth. Similarly, many
hyphal fungi are dimorphic and are usually referred to as yeast-like. Because of the
overlap in morphological appearance, some authors regard yeasts merely as fungi
that produce unicellular growth, but that otherwise are not different from
filamentous fungi (Flegel 1977), or as unicellular fungal growth forms which have
resulted as a response to a commonly encountered set of environmental pressures
(Kendrick 1987). Oberwinkler (1987) placed the yeasts in a phylogenetic frame-
work and defined them as unicellular, ontogenetic stadia of either asco- or basidi-
omycetes (see also van der Walt 1987). In summary, yeasts are ascomycetous or
basidiomycetous fungi that reproduce vegetatively by budding or fission, and that
form sexual states which are not enclosed in a fruiting body. Molecular compari-
sons show the ascomycetous yeasts to be phylogenetically distinct from the
filamentous species. In this chapter, we present an introduction to the principles,
trends, and methods of yeast systematics with the aim of providing a framework
for the non-taxonomically trained user of yeasts.
1 Centraalbureau voor Schimme1cultures, Yeast Division, Julianalaan 67, 2628 BC Delft, The
Netherlands
2 National Center for Agricultural Utilization Research, USDA, ARS, 1815 North University
Street, Peoria, Illinois 61604, USA
2 T. Boekhout and C.P. Kurtzman
2
Some Principles of Yeast Taxonomy
Identifying, naming, and placing organisms in their proper evolutionary frame-

work is of importance to many areas of science that include agriculture, medicine,
the biological sciences, biotechnology, food industry, and for assessment of indus-
trial property rights. As evolutionary uniqueness can be expressed at all levels
between gene and the whole organism, comparative investigations also need to be
performed at various levels of biological development and diversification. Areas of
comparison include morphology, physiology, genetics, biochemistry, ecology, and
molecular genetics. Taxonomic concepts change as the result of developments in
science and philosophy. As a consequence, several different species concepts have
been applied in yeast systematics.
The phenetic species concept is based on discontinuities of phenotypic charac-
teristics. In the past, delimitation of yeast taxa was mainly based on morphological
and physiological differences between strains or groups of strains. Kreger-van Rij
(1 984b), for instance, defined yeast species as an assemblage of clonal populations.
The reliability of the phenetic approach largely depends on the quality and number
of characters investigated. Interpretation of physiological data is complicated,
because many of the carbon sources used in discriminatory growth tests can be
metabolized by common pathways (Barnett 1977; Golubev 1989). Furthermore,
the metabolism of many mono-, di- and trisaccharides is controlled by only one
or a few genes (Winge and Roberts 1949; Barnett 1968), and physiological charac-
teristics are not always genetically stable and reproducible (Scheda 1966; Scheda
and Yarrow 1966). Extension of the series of carbon and nitrogen compounds
used in growth tests may increase the significance of this approach to yeast classi-
fication. Phaff (1989) suggested that compounds with a complicated metabolic
route will be most useful in this respect. The weakness of the phenetic approach
has been stressed by several authors (Phaff 1981, 1989; Kurtzman et al. 1983;
Kurtzman and Phaff 1987; van der Walt 1987). However, from a practical point
of view, fermentation and assimilation reactions are still widely used for
identification.
The biological species concept assumes the existence of arrays of Mendelian
populations which are reproductively isolated from other population arrays (e.g.,
Dobzhansky 1976). The occurrence of a perfect (sexual) state following mating of
complementary strains is commonly interpreted to indicate conspecificity of the
mated strains. However, unless viability of the FJ and F2 generations is verified, the
presumption of conspecificity may be incorrect because some closely related spe-
cies may mate but the progeny are not viable (for examples see Kurtzman 1987).
Among basidiomycetous yeasts, gene exchange has only been documented in a
limited number ofheterothallic species such as Rhodosporidium toruloides (Banno
1967), and Filobasidiella neoformans (Kwon-Chung 1980). By definition, the bio-
logical species concept cannot be applied to asexual (anamorphic) yeast species
such as the genus Candida, but measurements of DNA relatedness can lead to an
approximation.
1. Principles and Methods Used in Yeast Classification 3
A third species concept is the evolutionary or phylogenetic species concept

(Wiley 1981), which regards a species as a single phylogenetic ally derived lineage.
The phylogenetic species concept cannot be applied directly to the yeast domain
because of the lack of genealogical evidence (e.g., lack of fossils), and because
of morphological and physiological plasticity. However, the increasing number of
molecular evolutionary studies of yeasts, e.g., those using sequence analysis of
ribosomal DNA, should result in a clearer understanding of the applicability of the
phylogenetic species concept to yeasts. Presently, many taxa are best interpreted as
genetically uncertain entities whose definition needs to be tested by the analysis of
independent phylogenetically derived character sets. Ideally, these approaches,
together with a critical evaluation of phenetic and genetic data, should lead to a
stable species concept.
3
Trends in the Systematics of Yeasts
The first period of yeast systematics (until approximately 1960) is characterized by

a thorough study of morphology, comparative nutritional physiology, and conven-
tional genetics. Important workers in this period were M. Reess (morphology),
E.C. Hansen (application of pure cultures and physiology), A.J. Kluyver (physiol-
ogy), 1.J. Wickerham (physiology, genetics, ecology), and A. Guilliermond, O.
Winge and C.c. Lindegren (genetics). Comparative taxonomic studies performed
at the CBS Yeast Division (e.g., Stelling-Dekker 1930; Lodder 1934; Diddens and
Lodder 1942), resulted in a series of monographs, which made the so-called Delft
School well known.
Initially, responses on only a limited number of carbon and nitrate compounds
were used for taxonomic purposes. Wickerham (1951) extended this series, and
today approximately 60 tests are being performed routinely, including fermenta-
tion and assimilation of carbon compounds, assimilation of nitrogen compounds,
vitamin requirements, resistance to cycloheximide, temperature requirements,
etc. (see Sect. 5, Methods).
Genetic studies revealed the presence of different sexual strategies. Sexual
cycles of ascomycetous yeasts may be haplontic, diplontic, or diplohaplontic.
Yeast species may be homothallic, heterothallic, or a combination of these.
Monokaryotic fruiting is tentatively assumed to occur in species presently placed
in the genus Mrakia (Fell and Statzell Tallman 1984a), and apomixis has been
observed in the heterobasidiomycete genus Itersonilia (Boekhout 1991a). Incom-
patibility systems of basidiomycetous yeasts are bipolar, tetrapolar, or modified
tetrapolar, and mating factors can be biallelic or multiallelic (Fell 1984; Fell and
Statzell Tallman 1984a,b; Kwon-Chung and Fell 1984; Wong 1987).
The second period of yeast systematics (1960 until present) is characterized by
an extension of morphological characteristics because of the introduction of the
electron microscope, the application of biochemical criteria, and the introduction
of molecular genetic studies. Transmission electron microscopy has revealed dif-
ferences between ascomycetous and basidiomycetous yeasts. Ascomycetous yeasts
4 T. Boekhout and c.P. Kurtzman
have electron-transparent cell walls, mainly made up of J3-glucans, and a thin

electron-dense outer layer which consists of a-mannans. Basidiomycetous yeasts
have lamellate and electron-dense cell walls which are mainly built up of J3-glucans
(Fig. 1; Kreger-van Rij and Veenhuis 1971). Bud formation is also different in these
two groups of yeasts. Ascomycetous yeasts show holoblastic budding, i.e., the
entire cell wall seems to be involved in the formation of the newly formed wall of
the bud, while basidiomycetous yeasts have enteroblastic budding in which only
the inner cell wall layer is involved in this process (Figs. 1,2). Other ultrastructural
differences between these two groups of yeasts are found in the mitotic apparatus
(Heath 1978; Heath et al. 1987), and can be summarized as follows. Ascomycetous
.,
.
.,
Fig. 1. Multilayered
cell wall and
enteroblastic
budding in
Rhodotorula acuta
(CBS 7053, x13500)
..
Fig.2. Bilayered cell wall and holoblastic budding in Saccharomyces cerevisiae (CBS 1171,
X8400)
yeasts have a layered spindle pole body (SPB) which is closely associated with the
nuclear envelope, and spindle formation takes place inside the mother cell. Elon-
gation of the mitotic spindle is towards the bud. The SPB of basidiomycetous
yeasts is not layered, is initially positioned in the cytoplasm, and spindle formation
takes place inside the bud. Elongation of the spindle is towards the mother cell.
Septal ultrastructure shows important differences between the two classes of
yeasts. Septa of many ascomycetous yeasts have one or several micropores. These
are very thin electron-dense connections between two adjacent cells (Fig. 3). Addi-
tionally, diaphragma-like pores occur as well, and Woronin bodies may be present.
Pores of Ambrosiozyma species are swollen around the pore, thus having some
resemblance with the dolipores of basidiomycetes (Fig. 4). Heterobasidiomycetous
yeasts show a greater variation in septal ultrastructure. In the cytoplasm, a struc-
ture made up of modified endoplasmic reticulum, the parenthesome, may be
present. The parenthesome can have a different morphology. Tremellaceous yeasts
usually have dolipores in which the septum is swollen around a central pore (Figs.
S, 6). Filobasidiella and Bulleromyces have a parenthesome made up ofU-shaped
vesicles (Tremellales type). Other basidiomycetous yeasts (e.g., Itersonilia) lack a
parenthesome. Another group of basidiomycetous yeasts has diaphragma-like
pores reminiscent of those found in the higher ascomycetes, but without Woronin
bodies. These yeasts may be related to the smuts (Ustilaginales). A third group of
basidiomycetous yeasts has micropore-like structures (Boekhout et al. 1992). The
fine structure of septa seems to reflect the affinity to higher taxonomic categories.
Biochemical characteristics, such as carbohydrate composition of cell walls and
capsules (e.g., Weijman and Rodrigues de Miranda 1983; Weijman and Golubev
1987; Suzuki and Nakase 1988; Prillinger et al. 1993), proton magnetic resonance
spectra of cell walls (e.g., Spencer and Gorin 1969, 1970), number of isoprene units
of the coenzyme Q (e.g., Yamada and Kondo 1973; Yamada et al. 1973, 1987),
cytochromes (e.g., Claisse et al. 1970; Fiol and Claisse 1987; Montrocher and
Fig. 3. Micropore in Sporothrix guttuliformis (CBS 437.76, x27000)

Fig. 4. Dolipore-
like structure in
Ambrosiozyma
platypodis (CBS
4111, X36000)
Fig. 5. Dolipore
in Trichosporon
beige/ii (CBS
5791, x25000)
Fig. 6. Dolipore with parenthesome in Bulleromyces alb us (CBS 500 x CBS 7440, x60000)
Claisse 1988), fatty acid composition (e.g., Cottrell et al. 1986; Viljoen et al. 1986;
Westhuizen et al. 1991), and isozyme patterns (e.g., Yamazaki et al. 1983, 1985)
have been used for taxonomic distinctions.
The introduction of DNA studies provides, in principle, an objective parameter
for estimating evolutionary distances among taxa. Different methods offer resolu-
tion at different taxonomic levels. The taxonomic value of nucleic acid base com-
position (mol% G+C) is mainly exclusionary (see Sect. 5, Methods). Phenotypically
similar strains differing more than ca. 2-3% in their base composition are usually
regarded as different species (Kurtzman 1985; Kurtzman and Phaff 1987; Phaff
1989), while strains with the same base composition do not necessarily represent
one and the same species. The range of nucleic acid base compositions differs for
ascomycetous and basidiomycetous yeasts. Most ascomycetous yeasts have a
mol% G+C lower than 50, whereas most basidiomycetous yeasts have a mol% G+C
above 50 (Table 1).
DNA hybridization studies are used to determine DNA similarity between spe-
cies. Commonly used methods (for reviews see Jahnke 1987; Kurtzman 1993)
include spectrophotometric analysis of heteroduplex formation, membrane-
bound reassociation techniques using isotopes or fluorochromes and methods in
which the reassociated heteroduplex is bound on hydroxylapatite columns
(Britten et al. 1974). Recently, fluorometric and colorimetric methods using
microtiter plates have been developed (Ezaki et al. 1989; Hara et al. 1991) and are
being applied in yeast taxonomy (Kaneko and Banno 1991). DNA-binding percent-
ages above 65-70% are interpreted to indicate conspecificity (Phaff 1981;
Kurtzman 1987; Kurtzman et al. 1980). A proportional relationship has been sug-
gested between the occurrence of gene flow and high values of DNA similarity
(Lachance 1985). A positive correlation seems to exist between DNA
complementarity and interfertility (Phaff 1981; Kurtzman and Phaff 1987;
Kurtzmen et al. 1980). However, low values of DNA similarity, even up to ca. 25%,
do not necessarily exclude gene exchange (Kurtzman et al. 1980; Aulakh et al. 1981;
Vaughan Martini and Kurtzman 1985; Kurtzman and Phaff 1987). Consequently, a
rigid application of any lower limit up to ca. 25% DNA similarity as the sole
criterion for species delimitation does not seem justified. Intermediate values of
DNA similarity (40-70%) sometimes are interpreted to indicate the presence of
infraspecific taxa (Kurtzman et al. 1980; Phaff et al. 1987).
Pulsed-field electrophoretic techniques are a promising tool for yeast systemat-
ics, as they provide the possibility for study of individual chromosomes (Table 2;
see Chap. 3, this Vol.). Many species show a considerable variation in number and
size of chromosomal DNAs (see Boekhout et al. 1993b, and references therein).
Chromosomal length polymorphisms are apparent in most species studied so far.
In contrast, all strains investigated of the medical yeast Malassezia pachydermatis
have similar karyotypes. In combination with approaches like gene assessment,
macrorestriction analysis, densitometry, chromosome-based hybridization ex-
periments, and random amplification of polymorphic DNA (RAPD), electro-
phoretic karyotyping may provide answers on the role of chromosomal
diversification in speciation processes.
Table 1. Distribution of mol% G+C among ascomycetous

and basidiomycetous yeast species. (Data from Barnett et al.
1990)
Mol% Percentage of Percentage of

G+C ascomycetous yeasts basidiomycetous
yeasts
25-29 0.75
30-34 14.5
35-39 28.0 1.0
40-44 32.5 1.0
45-49 16.0 10.0
50-54 5.5 35.0
55-59 2.0 31.0
60-64 0.75 18.0
65-69 4.0
Molecular approaches applied at or below the species level are restriction analy-
sis of mtDNA (e.g., McArthur and Clark-Walker 1983) and rDNA (Laaser et al.
1987; Vilgalys and Hester 1990; Molina et al. 1993a,b; Shen and Lachance 1993),
and random amplification of polymorphic DNA (RAPD) (for review on PCR see
Foster et al. 1993). RAPD is a promising tool in biotyping and epidemiology.
4
Phylogeny
Most present-day yeast taxonomists follow the opinion that a taxonomic scheme
should represent the phylogeny of the group of organisms concerned. One has to
assume an orthologous relationship between the characters studied and the actual,
but unknown, evolutionary relationship of the group of organisms concerned
(Ragan 1988). Phylogenetic reconstructions based on sequence analysis of riboso-
mal RNA (rRNA) and ribosomal DNA (rDNA) recently received much attention
(for reviews see Bruns et al. 1991; Kurtzman 1992, and references therein). These
molecules are considered to be chronometers because of their universal occur-
rence, functional constraints, and the presence of both variable and less variable
regions (Woese 1987). Application of PCR and universal primers (White et al.
1990) makes it easy to compare different species. The most frequently used nu-
merical methods for sequence comparison are parsimony, distance methods, and
maximum likelihood methods (Felsenstein 1988). Resulting phylogenetic trees
need to be statistically tested to set confidence limits for the branching order, e.g.,
by bootstrap or jackknife analysis (Felsenstein 1988).
Nucleotide sequences of 5S rRNA (ca. 120 nucleotides) are highly conserved,
and were found to correlate well with septal ultrastructure within the basidiomyc-
etous yeasts (Templeton 1983). However, the Uredinales (rust fungi), which show
diaphragma-like pores, were found to cluster with doliporous species (Gottschalk
and Blanz 1985). However, this unexpected result needs verification, as the use of
contaminant strains cannot be ruled out.
Entire 185 rRNA or rDNA of a number of yeasts species have been sequenced
(Hendriks et al. 1992a,b; Van de Peer et al. 1992). Some genera are found to be
phylogenetically heterogeneous, e.g., Pichia and Candida. Most phylogenetic stud-
ies on yeasts performed thus far have been based on partial sequences of the 185
and/or 25-285 rRNA or rDNA. This approach appears justified, as the phylogenetic
resolution of partial sequence comparisons was found to be similar to that from
entire sequences (McCarroll et al. 1983; Lane et al. 1985). Several yeast genera have
been studied, e.g., Debaryomyces, Saccharomyces, and Schizosaccharomyces
(Kurtzman and Robnett 1991), Lipomyces and Myxozyma (Kurtzman and Liu
1990), Metschnikowia (Mendoca-Hagler et al. 1993), Torulaspora and
Zygosaccharomyces (Yamada et al. 1991a), Debaryomyces (Kurtzman and Robnett
1991; Yamada et al. 1991b), and several basidiomycetous yeasts (Gueho et al. 1990;
Yamada et al. 1989a,b; 1990a,b, Yamada and Kawasaki 1989a; Yamada and
Nakagawa 1992; Fell et al. 1992).
Resolution of close genetic relationships from rRNA sequence divergence was
examined from comparisons of sibling species. The sibling pairs Pichia
mississippiensis/P. amylophila, P. americana/Po bimundalis, Issatchenkia scutulata
var. scutulata/var. exigua, Saccharomyces cerevisiae/S. bayanus/S. pastorianus
showed identical sequences in four areas of the 185 rRNA, whereas differentiation
was found to occur in the most variable region of the 255 rRNA (Peterson and
Kurtzman 1991).
Within the basidiomycetous yeasts, a correlation was observed between clusters
based on partial sequences of 185 and/or 285 rRNA or rDNA, carbohydrate com-
position of cell walls, and septal ultrastructure. Clusters 1, 2, and 3 of Fell et al.
(1992) contain species which lack a dolipore and have no xylose in their cell walls
or capsules. Clusters 4 and 5 contain doliporous species which contain xylose in
their cell walls. However, cluster 6, which includes species lacking xylose, seems
closely related to clusters 4 and 5. Unfortunately, the septal ultrastructure of the
species belonging to this cluster is unknown. Some of these species clusters have a
uniform coenzyme Q composition, whereas others are found to be heterogeneous
in this respect. To a certain extent, the clustering of species based on partial 285
rRNA sequences correlates with the capacity to assimilate D-glucuronic acid and
myo-inositol (Boekhout et al. 1993a).
5
Methods
5.1
Morphology
Morphological characteristics are still of great taxonomic importance. Generic

differentiation of yeasts is often based on morphology, e.g., conidiogenesis, pres-
ence or absence of hyphae, pigmentation, characteristics of ascus formation, and
morphology of asci, ascospores, teliospores, basidia, etc. Some morphological

characteristics indicate whether imperfect (anamorphic) yeasts belong to the asco-
or to the basidiomycetes, e.g., mode of conidiogenesis (enteroblastic budding
versus holoblastic budding), presence of ballistoconidia or clamp connections,
and ultrastructure of cell walls and pores. Due to the pleomorphic character of
many yeasts and yeast-like organisms, the use of standardized experimental con-
ditions for the investigation of morphological features is strongly recommended.
5.1.1
Vegetative Morphology
Yeasts show different modes of vegetative reproduction (sometimes referred to as

conidiogenesis) .
Blastoconidia (Bud Formation)

Young cells, formed by cell wall expansion at a limited locus, gradually increase in
size during maturation. The succession of conidia is schizolytic. Depending on the
positioning of the bud formation, three types of blastoconidiogenesis are distin-
guished: (1) monopolar budding in which buds originate at only one pole of the
cell (example: Malassezia, Fig. 7); (2) bipolar budding where buds originate with a
broad base at both poles of the cell (examples: Hanseniaspora, Nadsonia, Fig. 8).
(3) multipolar (multilateral) budding where buds originate over a wider range of
the cell surface (examples: Saccharomyces (Fig. 9), Kluyveromyces, Pachysolen,
Pichia).
In monopolar and bipolar conidiogenesis, formation of successive conidia may
occur at the same locus (percurrent conidiogenesis), finally resulting in the forma-
Fig. 7. Monopolar budding in Malassezia pachydermatis (CBS 1879, 3d YPGA)

Fig. 8. Bipolar budding in Nadsonia fulvescens (CBS 2596, 10d YMA)
Fig.9. Multipolar budding in Saccharomyces cerevisiae (CBS 1171, 3d YPGA)
tion of annellidic scars (annellations). In multipolar budding, young cells usually

originate at different loci. For many basidiomycetous yeasts, formation of conidia
is limited to an area around the poles of the cells. Contrary to bipolar budding,
these buds have a relatively narrow base, and frequently proliferate sympodially
(examples: Cryptococcus, Rhodotorula).
A special type of blastoconidiogenesis is the formation of ballistoconidia (ex-
amples: Bullera, Sporobolomyces), which are actively discharged and originate at
tapering outgrowths (sterigmata) on the cell. The formation of ballis to conidia may
be stimulated by growth on malt extract agar, cornmeal agar, or yeast morphology

agar. Ballistoconidia may be distinctly bilaterally symmetrical (example:
Sporobolomyces) or more or less rotationally symmetrical (example: most species
of Bullera).
Buds formed on short denticles or long stalks frequently occur among basidi-
omycetous yeasts. The presence of conidia formed on stalks is characteristic for a
limited number of genera (examples: Sterigmatomyces, Fellomyces, Tsuchiyaea,
Kurtzmanomyces, Kockovaella).
Arthroconidia (Thalloconidia)
Young cells originate after disarticulation of differentiated hyphae. Young

arthroconidia are cylindrical and finally round off (examples: Geotrichum, Arxula,
Trichosporon). Fission, as it occurs in Schizosaccharomyces (Fig. 10), can be con-
sidered as percurrent arthroconidiogenesis. Here, two daughter cells separate after
schizolytic dissolution of the septum, leaving a scar. After growth at the poles of
the new daughter cells, annellidic scars are left.
Hyphae, Pseudohyphae, Chlamydospores, and Endospores
Many yeasts have the capability to form hyphae or pseudohyphae. Hyphae are not
constricted at their septa, whereas pseudohyphae show distinct constrictions.
Pseudohyphae are formed when more or less elongate budded yeast cells adhere in
branched or unbranched chains. Different types of pseudohyphae have been dis-
tinguished (see Diddens and Lodder 1942). Proliferation occurs acropetally, so
that the youngest cell is formed at the apex of the chain of cells.
Fig. 10. Fission in Schizosaccharomyces pombe (CBS 356, 3d YPGA)

Dimorphism, the alternate occurrence of unicellular and hyphal and/or

pseudohyphal phases occurs in many yeasts (example: Candida albicans, Fig. 11).
Life cycles of many basidiomycetous yeasts are dimorphic as well. Vegetative
monokaryotic yeast cells alternate with dikaryotic hyphae on which the sexual
form of sporulation may be formed.
Hyphae and pseudohyphae are best studied in slide cultures, as their formation
is stimulated by reduced oxygen levels. It is also useful to investigate microscopi-
cally the margins of long-standing colonies on culture plates at low magnification
(objective 4x or 1Ox) for the possible occurrence of hyphae and pseudohyphae.
Chlamydospores are thick-walled vegetative resting spores which occur in some
yeasts. The formation of chlamydospores is regarded as a diagnostic test for Can-
dida albicans (Fig. 12). Slide cultures with rice agar give good results with this
species. It may be difficult to differentiate chlamydospores from teliospores
morphologically (see below).
Endospores also occur in some yeasts such as Candida, Cryptococcus, Tricho-
sporon, Cystofilobasidium, and Leucosporidium. They are vegetative cells formed
endogenously inside other cells and mostly occur in long-standing cultures.
5.1.2
Generative Morphology
Yeast species may differ widely in their strategies for sexual reproduction. Life
cycles may be haplontic, diplontic, or haplo-diplontic. Homothallic yeast species
may form asci or basidia without mating, whereas heterothallic species require
strains of opposite mating type. For detailed morphogenetic information on the
mating processes of ascomycetous and basidiomycetous yeasts, the reader is re-
Fig. 11. Pseudomycelium in Candida albicans (CBS 5982, 3d Dalmau plate on rice agar)
Fig. 12. Chlamydospore in Candida albicans (CBS 5982, 3d Dalmau plate on rice agar)
ferred to specialized references (e.g., Flegel 1981; Wong 1987; Casselton et al. 1989;
Kurjan 1991; Lipke and Kurjan 1992).
Ascomycetes
Homothallic ascomycetous yeasts can form asci in different ways. In parent cell-
bud conjugation, two haploid nuclei, one each from the parent cell and the bud,
fuse and give rise to the diploid phase. Subsequent meiosis results in the formation
of haploid ascospores (example: Debaryomyces, Fig. 13). In Nadsonia, a compa-
rable mechanism seems to occur. Here the diploid nucleus, newly formed by fusion
of nuclei from the parent cell and bud, migrates from the bud to the opposite pole
of the parent cell, where it becomes enclosed in a newly formed bud that serves as
an ascus (Miller and Phaff 1984).
In other species, short protuberances (gametangia) frequently develop adjacent
to a septum, fuse, and form a diploid pro ascus. After meiosis, one to four, or
sometimes more, ascospores are formed (examples: Saccharomycopsis,
Galactomyces (Fig. 14), Dipodascus). Representatives of the Lipomycetaceae form
multispored asci directly on apparent vegetative cells, or after fusion of short
protuberances that originate either on a single cell or on two adjacent cells (van der
Walt, pers. comm.).
Besides the preceding strategies, autodiploidization of the haploid phase may
occur. Both the haploid and diploid yeast cells may reproduce by budding, but
only the diploid cells undergo meiosis and form asci (example: Saccharomyces
cerevisiae) .
Heterothallic species require pairing of opposite mating types before induction
of plasmogamy and karyogamy. When mixed on an appropriate medium, comple-
mentary cells each form conjugation tubes that grow toward one another, fuse,
and allow passage of the haploid nuclei, which then diploidize. After meiosis,
00 0
(f; ®
®
0
C'J
0
®
C9 (0
b
Fig. 13. a Asci with ascospore in Debaryomyces hansenii (CBS 767, 7d V8-agar). b Asci
with ascospores in Wingea robertsii (now transferred to Debaryomyces, CBS 5637, 5d YPGA)
haploid ascospores are formed, either one or both of the conjugating vegetative
cells serving as the ascus (examples: Pichia, and Zygosaccharomyces Fig. 15). Con-
jugation also can occur between hyphae (example: Zygoascus). In many species,
haploid, diploid, polyploid, or aneuploid cells may propagate by budding,
resulting in rather complicated life cycles. Diploid cells do not require prior con-
jugation to undergo ascosporulation. In the case of Saccharomycodes ludwigii,
ascospores of the opposite mating type conjugate while still in the ascus and
produce diploid cells capable of forming new ascospores. Asci can be persistent or
evanescent.
Fig. 14. Asci with ascospore and arthroconidia in Galactomyces geotrichum (CBS 772.71, 3d
YPGA)
Fig. 15. Ascus with ascospores in Zygosaccharomyces bailii (CBS 1097, 7d YPGA)
Ascospore morphology is often used for genus delimitation. For most

yeasts, the number of ascospores varies from one to four (or to eight). However,
multispored asci occur in several genera (examples: Ascoidea, Lipomyces,
Dipodascus). Ascospores are usually hyaline, but occasionally pigmented (e.g.,
Lipomyces), and can be globose, ellipsoidal, hat-shaped, saturn-shaped, arrow-
like, or elongate-fusiform with thread-like appendages. The spore surface may be

smooth, verrucose, or ridged.
Basidiomycetes
Many basidiomycetous yeast species have dimorphic life cycles in which
monokaryotic yeast phases alternate with dikaryotic hyphal phases. Clamp con-
nections are frequently present. The incompatibility system can be bipolar,
tetrapolar, or modified tetrapolar (Bandoni 1963). The presence of dissimilar mat-
ing factors results in completion of conjugation, plasmogamy, and karyogamy.
Many species form teliospores which are thick-walled probasidia (examples:
Sporidiobolus, Rhodosporidium (Fig. 16), Leucosporidium, Cystofilobasidium).
They can only be differentiated from vegetative chlamydospores by karyology
(karyogamy and meiosis), and typically germinate with basidia. Teliospores may
be intercalary or terminal, single or in small clusters, (sub)globose or angular,
hyaline or pigmented, and are usually smooth. However, teliospores of Tilletiaria
anomala are covered with warts. The teliospores germinate, often enhanced by
being soaked in water for several weeks (Fell et al. 1969), by transversely septate or
one-celled basidia on which basidiospores are formed. Monokaryotic fruiting, i.e.,
formation of apparent sexual structures on monokaryotic hyphae without an
obvious sexual mechanism, has been observed to occur in several taxa (example:
Mrakia).
Some species do form basidia directly at the dikaryotic hyphae (examples:
Filobasidiella, Filobasidium, Bulleromyces) . The basidia of Filobasidiella and
Filobasidium are one-celled, clavate to capitate (Filobasidiales type), whereas in
Fig. 16. Teliospores and hyphae with clamp connections in Rhodosporidium toruloides
(CBS 14 x CBS 349, 7d PDA)
Bulleromyces they are longitudinally or obliquely septate (Tremellales type, Fig.

17). Basidiospores in Filobasidiella are formed basipetally, viz. the youngest spore
originates at the base of a chain of spores.
5.2
Physiological Characterization of Yeasts
Physiological characterization is still important for the identification of unknown
yeasts strains. Two methods are commonly used, namely the auxanographic tech-
nique and growth in liquid medium. Recently, several commercial kits have been
introduced that use a limited series of compounds (e.g., API 32C). Anaerobic
utilization of sugars is generally tested by measuring the amount of CO 2 that is
trapped in Durham tubes. It has been argued that this method is not very accurate
for detecting fermentation in slowly fermenting yeast species because the CO 2 may
not evolve rapidly enough to be collected as a gas bubble. Because of this, many
yeast species long considered to be non-fermentative proved capable of producing
ethanol (van Dijken et al. 1986). However, for identification purposes, the use of
Durham tubes is recommended because of easy preparation and scoring. An initial
fermentation test using only glucose is advisable. If no fermentation is detected,
other sugars need not be tested. The sugars tested for identification purposes
usually include glucose, galactose, maltose, sucrose, lactose, raffinose, trehalose,
and xylose.
5.2.1
Fermentation Tests
Sugars are tested at a concentration of 2% (w/v) (or 4% for raffinose) in a basal

medium of 2% (w/v) yeast extract, yeast infusion, or 0.3% yeast extract-0.5%
peptone (Wickerham 1951). Depending on the size of the test tubes used, the
Fig. 17. Phragmobasidia and hy-

phae with clamp connections in
Bulleromyces albus (CBS 6302 x
CBS 7441, 14d CMA)
volume of medium ranges from 3.0 to 4.5 mI. Each tube contains a small inverted
insert tube to collect CO 2 that may be formed.
Sugars are filter-sterilized at a 3x concentration and added aseptically to the

autoclaved basal medium concentrate, which often contains bromthymol blue as
pH indicator.
Fermentation tubes are inoculated with 0.1-0.2mI of a heavy aqueous cell suspen-
sion prepared from an actively growing slant culture. Tubes are incubated at 25-
28°C and observed every few days for up to 4 weeks. Psychrophilic species require
12 or 17°C.
5.2.2
Assimilation Tests
Assimilation of carbon compounds can be tested by the auxanographic method or

in test tubes with liquid medium. Auxanograms can be read after 2 to 3 days,
whereas test tubes need up to 4 weeks. However, the latter method is more sensi-
tive. For identification purposes, growth reactions on the following compounds
are usually determined:
• Hexoses: (D-glucose, D-galactose, L-rhamnose, L-sorbose).

• Pentoses: (D-xylose, D-ribose, L-arabinose, D-arabinose).
• Disaccharides: (sucrose, maltose, cellobiose, trehalose, lactose, melibiose).
• Trisaccharides: (raffinose, melezitose).
• Polysaccharides: (soluble starch, inulin).
• Alcohols: (erythritol, ribitol (adonitol), D-mannitol, m-inositol, methanol,

ethanol, glycerol, glycol, propane 1,2 diol, butane 2,3 diol, galactitol
(dulcitol), D-glucitol (sorbitol)).
• Organic acids: (succinate, citrate, DL-Iactate, D-gluconate, D-glucuronate, D-

galacturonate, 2-keto-D-gluconate, 5-keto-D-gluconate).
• Glycosides: (a-methyl-D-glucoside, arbutin, salicin).

• Other compounds: (glucono-8-lactone, D-glucosamine-HCI, N-acetyl glu-
cosamine, decane, hexadecane).
Carbon Assimilation by Auxanogram
Nitrogen-containing agar: 0.5% w/v (NH4)2S04' 0.1% KH 2P04, 0.05% MgS04' 2%

agar (Difco), 0.1 % v/v vitamin solution (according to Wickerham 1951) in distilled
water. Commercially available Yeast Nitrogen Base with agar is a convenient
alternative.
An inoculum of the strain to be tested is suspended in 5 ml sterile distilled water,

poured in a petri dish (diam. ca. 9-11 cm), and thoroughly mixed with 10 ml of
cooled, molten nitrogen-containing agar.
After solidification, crystals of the compounds to be tested are placed on the
surface of the agar. Glucose is used as a positive control. Growth is examined after
2-3 days.
Assimilation of Carbon Compounds in Liquid Medium

Stock lOx solutions of Yeast Nitrogen Base (Difco), each with the carbon source to
be tested, are sterilized by filtration. Final concentrations of the carbon sources are
0.5%, except for raffinose, which is 1%.
The pH of the lOx stock needs to be readjusted to 5.6 for those carbon compounds
that are not neutral, such as organic acids. Water blanks consisting of test tubes
with 4.5 ml of distilled water are autoclaved, and each then receives 0.5 ml of the
appropriate lOx stock solution.
Soluble starch and inulin are exceptions to this treatment. Each is made as a 0.5%
aqueous solution. For soluble starch, 4.5-ml amounts are placed in test tubes and
autoclaved for 15 min. Because inulin is easily degraded by heat, the solution is
filter-sterilized and 4.5 ml is added to sterile test tubes.
The soluble starch and inulin tubes each receive 0.5 ml of lOx Yeast Nitrogen Base.
Assimilation tubes are inoculated with an aqueous suspension of starved yeast
cells as described by Wickerham (1951). Turbidity, used as a measurement of
growth, is scored after 7, 14, and 21, or 28 days at 25°C.
Growth is faster and more consistent if tubes are shaken during incubation on a
rocking shaker (30 x min-I), a reciprocal shaker, or a rotary shaker. Psychrophilic
species require lower temperatures, e.g., 12 or l7 dc.
Nitrogen Assimilation by Auxanogram

The following compounds are tested for routine identifications: nitrate,
ethylamine, L-Iysine, and cadaverine. Additional compounds are nitrite, creatine,
creatinine, and imidazole.
Carbon-containing agar: 2% w/v glucose, 0.1% w/v KH 2P0 4, 0.05% w/v
MgS0 4·7Hp, 2% w/v agar (Difco), 0.1% v/v vitamin solution (according to
Wickerham 1951) in distilled water. Commercially available Yeast Carbon Base
with agar is a convenient alternative.
An inoculum of the strain of interest is made in 5 ml sterile distilled water,
poured into a petri dish (diam. ca. 9-11 cm), and thoroughly mixed with ca. 10 ml
molten, cooled agar. After solidification, some crystals of the compounds to be
tested are placed on the surface of the agar. Peptone or (NH4)2S04 are used as
positive controls. Growth is recorded after 2-3 days.
Alternatively, assimilation of nitrogen compounds can be tested in liquid me-
dium as described by Wickerham (1951).
5.2.3
Vitamin Requirements
Vitamin requirements are tested by slightly inoculating a test tube containing 5 ml

vitamin-free medium (Difco). If growth occurs, a second tube is inoculated from
the first to rule out carryover of vitamins.
5.2.4
Other Tests
A number of other tests may facilitate identification of strains: resistance to cyclo-

heximide (actidion), growth on 50% glucose, production of acetic acid, urease
activity, staining reaction with Diazonium Blue B, starch production, and growth
at 17,25, and 37°C.
Resistance to Cycloheximide
In lOx concentrated Yeast Nitrogen Base (Difco) 0.5 ml of a filter-sterilized 0.1 % or

1.0% cycloheximide is added to 4.5 ml 0.5% w/v glucose in distilled water, giving
final concentrations of 0.01% (100ppm) or 0.1% (1000ppm) cycloheximide, re-
spectively. After inoculation with the strain of interest, growth is scored.
Growth on 50% Glucose
A small amount of inoculum is streaked on slants or plates containing yeast extract

agar with 50% w/v glucose. Growth is scored, usually at 1 and 2 weeks.
Production of Acetic Acid
A small amount of inoculum streaked on slants or plates of YPGA with 0.5% w/v
CaC03 • Production of acetic acid results in a clear zone around the culture.
Urease Activity
Difco Bacto Urea R broth (O.5ml) is dispensed into tubes and stored in a freezer.
After inoculation, tubes are placed at 37°C, or the maximum growth temperature
for the strain if lower than 37°C. Change of color of the suspension to deep red
after ca. 4-20h indicates urease activity.
Diazonium Blue B Reaction
This test is used to differentiate between ascomycetous and basidiomycetous

yeasts. The latter organisms show a color reaction in this test.
Directly before use, 0.1 % w/v Diazonium Blue B (DBB) salt is dissolved in ice-
cold 0.1 M Tris-HCI, pH 7.0. Strains are inoculated on YMA plates or slants for 10
days to 3 weeks, and a drop of the freshly prepared ice-cold DBB reagent is placed
on the culture. Immediate change of color of the colony to dark red indicates a
positive DBB reaction.
Extracellular Starch Production
Iodine (0.33%) and potassium iodide (0.66%) are dissolved in distilled water
(Lugol's solution). A drop of reagent is added to the culture in an assimilation tube
containing D-glucose. Dark blue coloration indicates presence of extracellar
starch-like compounds. It is often helpful to have duplicate glucose assimilation
tubes in order to test for starch-like compounds at 1 and 2 weeks after inoculation.
5.3
Mating
5.3.1
Ascomycetes
Strains can be grow for 2 days on YMA and paired by mixing a loopful of growth
from each strain on fresh YMA. Alternatively, up to eight strains may be mixed in
one test, with the strategy that if mating is detected, strains will then be paired in
all combinations. Mixtures should be examined under the microscope at daily
intervals, for at least a week, although mating usually occurs within the first day
or two after mixing. Mated cells are joined by fused conjugation tubes that are
usually long enough to be easily discerned. Occasionally, conjugation tubes are
quite short and require careful observation for detection. Conjugating cells may be
of equal size or one of the conjugants can be quite small and misinterpreted as a
bud if the conjugation tube is short. If ascosporulation does not follow mating, the
pairings can be repeated on other media that may be more conducive to ascospore
formation such as those listed below. Lack of ascosporulation following mating
may also indicate incompatibility, which could be due to ploidy differences or
phylogenetic divergence sufficiently great to prevent karyogamy (Kurtzman et al.
1980).
5.3.2
Basidiomycetes
The strains of interest are mixed in pairs near the margin of an agar plate (e.g.,
modified Flegel's conjugation medium, PDA, MEA, or YMP A). With a flattened
needle, three to five streaks are made across the petri dish. When many strains
need to be investigated, the procedure described above may be followed. Mating
reactions frequently occur along these streaks.
The first indication of the occurrence of a mating reaction is the formation of
conjugation tubes, followed by the development of dikaryotic hyphae, which fre-
quently grow submerged. Formation of clamp connections, dikaryotic cells,
teliospores, and/or basidia can indicate a sexual reaction.
Commonly used media include corn meal agar, modified Flegel'S conjugation
medium, V8 juice agar, 5% malt extract agar, potato-dextrose agar, and 1.5% malt
extract-0.05% yeast extract-0.25% peptone agar. For mating of Filobasidiella
neoformans, the following media have been suggested: corn meal agar, hay infu-
sion agar, VS juice agar, pigeon manure agar, or sunflower seed agar (see
Appendix).
Germination of teliospores is sometimes difficult, and it can be enhanced by a
temporary increase of the temperature to 50-55°C for 5 or 10 min (Bandoni et al.
1971), or soaking in sterile distilled water for 2-10 weeks at 12°C (Fell et al. 1969)
prior to transfer to appropriate media for germination, e.g., corn meal agar, or 2%
water agar.
5.4
Nuclear Staining
The number of nuclei and their behavior play an important role in life cycles of
yeasts. A number of rapid and reliable fluorescent nuclear staining techniques
have been developed. Nuclear staining of thick-walled and/or pigmented cells,
such as teliospores, is sometimes difficult. Some fluorochromes permit quantifica-
tion of nuclear DNA, such as para-rosanaline (Feulgen), propidium iodide, and 4'-
6' -diamino-2-phenolindole (DAPI). For nonfluorescent staining with Giemsa is
convenient. Cells can be fixed and stained using 1.5-ml microfuge tubes, or ad-
hered to a cover glass using egg albumin as an adhesive.
5.4.1
Staining Nuclei Using DAPI (Coleman et al. 1981)
Stock solution: 1 mg DAPI ml- 1 distilled water, store at 4°C in the dark. Working
solution: 0.5 JIg DAPI ml-1 McIlvaine's buffer, pH 4.4 (44.1 ml 0.2 M NazHPO4· 2HzO
and 55.9 ml 0.1 M citric acid).
Fix cells in 70% ethanol for 60 min in a 1.5-ml centrifuge tube; centrifuge.
Rinse 5 min in McIlvaine's buffer, pH 4.4; centrifuge.
Resuspend cells in DAPI working solution for ca. 3 h, or overnight; centrifuge.
Mount cells in 90% v/v glycerol in McIlvaine's buffer and seal coverglass with nail
polish. Preparations made in this way may last longer than a year when stored in
the dark.
For rapid analysis of the number of nuclei, yeast cells may be suspended directly
in DAPI working solution. An additional advantage of DAPI is that mitochondria
stain as well. The emission of DAPI depends on the mol% G+C, and therefore the
method has to be applied with caution for quantitative fluorescence microscopy.
5.4.2
Staining Nuclei with Propidium Iodide
(After Uno et al. 1984; Eilan et al. 1992)
Propidiumiodide (PI) stock solution: 150 JIg PI ml-1 NS buffer (20mM tris-HCl pH
7.6, 0.25 M sucrose, 1 mM MgClz' 0.1 mM ZnSO 4' 0.1 mM CaClz, O.S mM
phenylmethylsulphonylfluoride (PMSF, toxic), 0.05% b-mercaptoethanol).
Propidium iodide working solution: 1.5-1O,ug PI ml-1 NS buffer, and containing

50-500,ug RNase ml-1•
Rnase stock solution: 10mg RNase ml-1 0.1 M Na-acetate, pH 5.2. Heat 15 min at
100°C, cool down slowly, and adjust pH to 7.4 by adding 0.1 volumes O.IM Tris-
HCI (pH 7.5).
Fix cells with 50% ethanol for 10 min, and subsequently with 70% ethanol for 12 h.
Stain with PIon a microscope slide for 30 min to 16h (under a coverglass), remove
excess dye with tissue, and seal with nail polish.
Staining of RNA by PI may cause high background fluorescence. Preparations
sometimes improve after a longer incubation time (e.g., cells of Galactomyces
geotrichum need up to ca. 4 days). Propidium iodide can be used for cytometric
quantification of DNA as the emission is independent of the mol% G+c.
5.4.3
Staining Nuclei with Mithramycin and Ethidium Bromide
(After Barlogie et al. 1976)
Mithramycin working solution: 100,ug mithramycin ml- 1 15 mM MgCl z + 30%

ethanol.
Ethidium bromide working solution: 25,ug ethidium bromide ml-1 0.1 M Tris +
0.6% NaCl, pH 7.4 (Cole 1983).
Mix equal volumes of mithramycin and ethidium bromide working solutions, and
suspend cells in this mixture for ca. 30 min. Preparations can be viewed directly.
Thick-walled cells may give better results after gentle heating.
Acriflavine has been used to stain meiotic chromosomes in fungi (Neurospora
crassa) (Raju 1986), and may be useful for yeasts as well.
5.4.4
Staining Nuclei with Giemsa (After Bauer 1987)
Giemsa stock solution: 0.76g Giemsa powder ml-1 50% (v/v) glycerol in absolute
methanol (Gurr 1965).
Phosphate buffer (pH 7.0): mix 60.8ml 0.15M NazHP0 4 ·2H zO with 39.8ml 0.15M
KH zP0 4 •
Cells are dried for 20 min at room temperature, fixed for 30 min in a 3: 1 mixture of
92% ethanol and acetic acid, repeatedly rinsed with water, and hydrolyzed in IN
HCI for 7 min at 60°C.
After rinsing once with water and five times with phosphate buffer (pH 7.0), the
cells are stained with Giemsa working solution (one volume Giemsa stock solution
and nine volumes phosphate buffer, pH 7.0) for 2h.
After rinsing in phosphate buffer (pH 7.0), and dipping in water, the preparations
are dried and ready for use.
5.5
DNA
5.5.1
Isolation
Methods used for DNA isolation for taxonomic studies need to be rapid and
reliable. Several methods are in use by yeast systematists. Two commonly used
large-scale DNA isolation methods are described below. The first method is based
on adsorption of DNA on hydroxylapatite columns as described by Britten et al.
(1970). The second is based on extraction with various reagents and subsequent
precipitation with ethanol or iso-amylalcohol. Small-scale methods for DNA isola-
tion (minipreps) are widely used for PCR amplification. We describe a miniprep
method which we have successfully applied to PCR amplification of ribosomal
DNA. Further DNA isolation protocols can be found in Cryer et al. (1975), Holm et
al. (1986), Taylor and Natvig (1987) Johnston (1988), Mann and Jeffery (1989), and
Treco (1989).
DNA Isolation Using Hydroxylapatite (Britten et al. 1970)
DNA isolated by this method has been used extensively for spectrophotometric
analysis of base composition, and DNA reassociation experiments.
Phosphate buffer 5.1 M: 2.4 M Na2HPO 4· 2HP + 2.7 M NaH 2PO4· 1HP in distilled
water.
Grow cells in ca. 400 ml YM, YPG, or YPM broth, until the late logarithmic or early
stationary phase.
Harvest by centrifugation or, in the case of extensive hyphal growth, by filtration
through a Buchner funnel. Wash with tap water and with saline EDT A (0.1 M NaCI,
O.lSM EDTA). Cells can be stored at -20 DC until use.
Usually ca. 5 g wet-packed cells is sufficient. Add an equal volume of lysing buffer
[900ml 10M urea, 56.2ml 5.1M phosphate buffer, 43.8ml 20% sodium
dodecylsulfate (SDS)], break cells at least three times with, e.g., a French Press,
and check microscopically (the majority of cells should be broken). Repeat if
necessary.
Centrifuge broken cell debris for 10min at 10000rpm. The supernatant contains
the DNA.
Suspend ca. 5g hydroxylapatite in washing buffer [800ml10M urea, SOmI5.1M
phosphate buffer, 150ml distilled water], and pour column.
Pour supernatant containing the DNA on the hydroxylapatite column and let DNA
adsorb. Wash with ca. 200 ml washing buffer until A260 = 0.0.
Remove excess urea with ca. 30 ml low phosphate buffer [1 ml 5.1 M phosphate
buffer and 480ml distilled water], elute DNA with eluting buffer (30ml 5.1 M
phosphate buffer and 450ml distilled water), and collect DNA fractions with a
fraction collector at A260 (threshold value: A260 = 0.25, which equals ca. l2.5)1g DNA
ml-1 ).
Pool fractions and measure A26o.
Dialyze overnight against 0.1 x SSC (1 x SSC: 0.15M NaCI, 15mM trisodium citrate.
2H20), repeat once, and measure absorbance at 260, 230, and 280nm. Ratios for
purified DNA are A2301260 = 0.5 and A260128o = 1.85.
For spectrophotometric DNA reassociations, the A260 has to be at least 1.5. If
necessary, concentrate the sample as follows.
Add ca. 2.5 vol of ice-cold ethanol, let DNA precipitate for 24h, centrifuge 1 hat
17 000 rpm, remove supernatant and, add 0.1 SSc to a final A260 oB.O. The samples
can be stored at -20°C until further use.
DNA Isolation by a Modified Marmur Method

Isolation of DNA from yeasts by a modification of Marmur's (1961) method has
been used successfully in many laboratories, and the procedure given here is
similar to that reported by Price et al. (1987).
Strains are usually grown for 3 days at 25°C on a rotary shaker (200 rpm) in
Fernbach flasks containing 1500ml ofYM broth and harvested by centrifugation.
Two flasks are usually prepared for each strain.
Following harvesting, the cells are suspended in 2x SSE buffer (Timberlake 1978)
and either broken in a Braun cell homogenizer (B. Braun Biotech, Allentown, PA)
with O.5-mm glass beads or by enzymatic digestion (see Chap. 2, this Vol.).
Following cell breakage, sodium perchlorate and sodium sarcosine are added to
the suspension to give concentrations of 1 M and 1%, respectively, and the mixture
is then emulsified by swirling with an equal volume of chloroform: isoamyl alcohol
(CIA) (24:1, v/v).
The emulsion is maintanined for 3 h on a rotary shaker and then separated by
centrifugation. The upper DNA-containing aqueous layer is removed by a wide-
mouth pipette, and the DNA is precipitated by addition of 1.3 vol. of cold (-20°C)
ethanol.
The precipitate is collected by centrifugation, dissolved in 20 ml of 1 xSSC contain-
ing 2mg a-amylase and 2mg of pancreatic RNase, and incubated overnight at
room temperature on a rotary shaker. One mg of pronase is then added, and the
solution is incubated for an additional4h.
The preparation is placed in a 300-ml Erlenmeyer flask with an equal volume of
CIA, emulsified for 30min on a rotary shaker, and then centrifuged. The upper
layer is removed with a wide-mouth pipette and placed in a beaker where the DNA
is spooled following addition of 1.3 volumes of cold ethanol.
The spooled DNA can be dissolved in 20 ml of 0.001 M sodium phosphate buffer for
later use.
At this point, the DNA may be further purified by cesium chloride gradient
ultracentrifugation or by hydroxylapatite chromatography.
If the latter option is chosen, the DNA spool is dissolved in 20ml of 0.001 M sodium
phosphate buffer and treated with a mixture of enzymes containing 2 mg a-amy-
lase, 2mg pancreatic RNase, and 400 units T1 RNase.
The DNA-enzyme solution is dialyzed against 0.001 M sodium phosphate buffer
overnight at room temperature. The solution is treated with CIA as before and
adjusted to 0.2 M with sodium phosphate buffer if the G+C content of the DNA is
under 55% or else to 0.15 M. The solution is now passed through a hydroxylapatite
column and the DNA eluted with 0.5 M sodium phosphate buffer.
Miniprep Method for Isolation of DNA for PCR Amplification

(After Raeder and Broda 1985)
Cells are grown in 25 ml YM broth on a 200 rpm shaker at 25°C for ca. 48 h, and
harvested by centrifugation. After being washed with tap water, the cells are lyo-
philized overnight.
The lyophilized cell mass is pulverized with a pipette tip, and shaken with glass
beads (diameter 0.5mm) for ca. 15 min using a wrist-action shaker.
Following breaking, 1000.u1 extraction buffer (200mM Tris-HCI, pH 804; 200mM
NaCI; 25mM EDTA; 0.5% SDS) is added. After pelleting by centrifugation,
600.u1 of the supernatant is transferred to a new tube, to which 420,ul phenol is
added.
After vortexing, 180,ul chloroform is added. Centrifuge for 10 min at 14000rpm;
550,ul of the (upper) aqueous phase is transferred to a new tube without disturbing
the interphase. Add 1 vol chloroform, and vortex briefly.
Centrifuge 5 min at 14000 rpm, and transfer 400,ul of the (upper) aqueous phase to
a new tube. Add 0.54 vol isopropanol, and shake briefly.
Centrifuge the precipitated DNA for 1O-60s at 14000rpm. Discard the superna-
tant, and wash the pellet once with 70% ethanol.
Centrifuge for 3 min at 14000 rpm, and decant the ethanol carefully. Add 100 ,ul TE
buffer (lOmM Tris-HCI; 1 mM EDTA, pH 8.0), loosen the pellet, and solubilize the
DNA for 1h (or overnight) at 55°C. The DNA can be stored at -20°C.
5.5.2
Analysis of Base Composition
Spectrophotomeric Determination of Mol% G+C

Dilute the DNA with 0.1 x SSC in quartz cuvettes until an A260 of 0.3-004. Candida
parapsilosis CBS 604 (mol% G+C = 40.8) is used as a reference strain, and O.lx SSC
is used as a blank. Increase of temperature is 0.5 °C min-I, and the A260 is recorded
using a microprocessor-controlled spectrophotometer. Tm values from melting
curves can be calculated graphically, or from the first or second derivative (Jahnke
1987). Mol% G+C can be calculated as follows (in 0.1 x SSC): mol% G + C = Tm x
2.08 - 106.4. Melting curves of basidiomycetous yeasts frequently show one or two
shoulders, which probably represent mtDNA and/or rDNA.
Determinations of mol% G+C obtained with HPLC are frequently lower than
those obtained from spectrophotometric analyses. This may be due to the presence
of mtDNA in the fractions. A short protocol for analyzing the mol% G + C using the
high performance liquid chromatography (HPLC) method can be found in
Hamamoto et al. (1986) and Nakase et al. (1989).
Determination of Mol% G+C Content from Buoyant Density

When a cesium chloride solution is spun in an ultracentrifuge, a density gradient
is formed. The position of DNA in the gradient is determined by its G+C content,
which can be calculated from the relative position of a second DNA of known
density. Determinations are generally made in an analytical ultracentrifuge, but a
preparative ultracentrifuge will also serve the purpose.
Begin by making a stock cesium chloride solution in the following manner. Add
130 g CsCl to 75 ml of 10 mM Tris buffer, pH 8.5. Dissolve and treat for 20 min with
2 g activated charcoal to remove any material absorbing at 260 nm. Remove the
charcoal by filtration through Whatman No.1 filter paper. Determine the exact
concentration of CsCl from the refractive index. Solutions are usually approxi-
mately 1.87 g ml-l, and about 405.ul is used in a total volume of 500.ul.
Combine the required amount of CsCI stock solution, l.ug of undetermined DNA,
l.ug of Micrococcus luteus reference DNA (buoyant density 1.7311 gml-1), and
bring to a final volume of 500.ul with distilled water.
Load centrifuge cells. Centrifugation is generally for 20 h at 44 000 rpm.
Determine distances of peak center points for unknown and reference DNAs
and determine the G+C content using the following equations (Schildkraut et al.
1962).
P=Po+4.2w2(r2+r02)XlO-lOg/cm\ (1)
where P is the density of unknown DNA, Po the density of known DNA, w the
radians/s (27r radians/revolution), r the distance of unknown from the center of
rotation, and ro the distance of standard from the center of rotation.
Mol%G+C=(p-1.66)/0.098XI00. (2)
5.5.3
Hybridization of Nuclear DNA
Hybridization or reassociation of nuclear DNA is a reliable means for estimating

the extent of genetic relatedness between strains (Price et al. 1978; Kurtzman and
Phaff 1987). DNAs that have approximately 80% or more nucleotide similarity can
form a duplex under appropriate conditions of incubation. Because duplex forma-
tion requires considerable nucleotide similarity, genetic resolution from measure-
ments of reassociation extends only to the distance of sibling species.
Protocols commonly used to measure DNA reassociation have been compiled
by Kurtzman (1993), and the following account represents only a brief summary of
these methods. Methods for measuring DNA relatedness fall into two general
categories: (1) the free-solution technique, in which all of the reactants are solubi-
lized, and (2) the filter-binding technique, in which the DNA of the strain is
immobilized on nitrocellulose or other filter materials and DNA from the other
strain is solubilized in the buffer surrounding the membrane. Each method has its
strengths and, when properly done, each provides the same measure of relatedness
(Seidler and Mandel 1971; Kurtzman et al. 1980).
In order to satisfy reaction kinetics, free-solution hybridizations require
fragmentation of the genomic DNA in 400-500 base pairs. The DNA can be sheared
to this length by double passage through a French pressure cell at 10 000 psi
or greater. Any fragments that escape shearing can be removed by passage of
the solution of sheared DNA through a 0.45-J1m membrane filter. The DNA
bound to filters for filter hybridization is not sheared, but the probe is of sheared
DNA.
Free-Solution Hybridization
Spectrophotometric Method. The spectrophotometric (optical) method is a

convenient non-isotopic procedure that has the advantage of simultaneously
providing data for estimates of genome size. The rationale for this method is based
on the observation that DNA reassociation is a concentration-dependent, second-
order reaction. As a result, if 50 J1g/ml of DNA reassociates at a certain rate, 25 J1g/
ml will take twice as long. Consequently, if a mixture of two DNAs reassociates at
the same rate as an equivalent concentration of unmixed DNA, the organisms
providing this DNA belong to the same species. If the reaction time of the mixture
is the sum of that of the two unmixed DNAs, the organisms are different species.
Because the genome sizes of yeasts are relatively small, the midpoint of the
reaction, which is often used as a reference, is reached within about 2-12 h,
depending on reaction conditions and actual genome sizes.
Hydroxylapatite Method. Hydroxylapatite (HA) is a form of calcium phosphate

that preferentially binds double-stranded DNA when in an appropriate
concentration of phosphate buffer. This specificity provides a means for
separating renatured DNA duplexes from free-solution reassociation reactions.
The technique requires use of radiolabeled probe DNA, but has the potential for
relative ease in processing large numbers of samples.
57 Nuclease Method. DNA hybridization mixtures are freed of single-stranded,

unhybridized DNA by hydrolysis with SI endonuclease. The double-stranded
hybrids are then removed from the reaction mix by precipitation with
trichloroacetic acid or collected on Whatman DE-81 filters. The probe DNA is

radiolabeled.
Filter Hybridization
Unsheared, single-stranded DNA is attached to nitrocellulose or nylon membrane
filters. The filters are incubated in a liquid medium containing a sheared, single-
stranded probe that is either labeled with a radioisotope or has another means for
detection. Following incubation, the filters are washed and assayed for extent of
binding by the probe. The filter method is amenable to easily performing large
numbers of comparisons, but leaching of unsheared target DNA from filters dur-
ing incubation can be a problem.
Interpretation of DNA Hybridization Data

Data from DNA reassociation experiments require interpretation in the context
of the species concept. Dobzhansky (1976) has championed the idea that species
can be described in terms of genetics and that, among sexually reproducing
and outbreeding organisms, species can be defined as mendelian populations or
arrays of populations that are reproductively isolated from other population
arrays. The concept seems apparent for mammals, but its application to yeasts is
less straightforward because not all taxa are known to have sexual cycles, and some
that do may show little outbreeding. Further, species formation does not usually
leave a clear-cut separation between groups comprising the new species,
and geneticaly intermediate populations may initially survive. Consequently,
in order to use DNA reassociation data to define species, there must be some
knowledge ofthe extent of DNA divergence to be found among members of a yeast
species.
On the bases of comparisons between the extent of nuclear DNA relatedness
and fertility of progeny arising from conventional genetic crosses, conspecific
strains generally exhibit DNA relatedness in excess of 70%. Varietal designations
can be accorded to those strains showing 40-70% DNA relatedness unless genetic
crosses demonstrate the absence of interfertility. An exception is the varieties of
Issatchenkia scutulata, which show only 25% DNA relatedness, but exhibit some
intervarietal fertility (Kurtzman 1987; Kurtzman and Phaff 1987).
5.5.4
Amplification of Yeast DNA Using Polymerase Chain Reaction (PCR)
DNA isolated by different methods may be used for enzymatic amplification. We

obtained good results with DNA isolated according to the miniprep method as
described earlier. Either DNA in TE buffer or diluted DNA in TEllO buffer (add 4,ul
of the DNA solution in TE buffer to 1 ml TEllO buffer), can be used as template in
the PCR reactions.
TEllO: IOmM Tris-HCI pH 8.0, 0.1 mM EDTA pH 8.0.
Amplification of Double-stranded DNA (dsDNA)

by Symmetrical peR Amplification
Prepare a mastermix containing the following (for one strain): 8.25 til double-
distilled (dd) HzO, 5 til lOx buffer (25ml 0.5M KC1; sml O.lM Tris-HCl pH 8.4;
1.25ml25mM MgClz; 50mg gelatin; 18.75ml ddHzO); 9 til nucleotide mix [0.25ml
of each dNTP (Li-salt, Boehringer) 100mmoll-1], 1.25,ul each offorward (F) and
reverse (R) primers (lOpmol/til).
After mixing (vortex mix and centrifuge) 0.25,ul Taq polymerase is added, fol-
lowed by 25 til of DNA in TEllO. After carefully mixing by hand and short centrifu-
gation, two droplets of sterile mineral oil are added, after which thermo cycling is
performed.
Typical cycling parameters for dsPCR are the following: initial denaturation
for 60 s at 94°C, annealing for 60 s at 50-60°C, extension for 90 s at 72 DC; number
of cycles 20-30, and hold at 4°C. After amplification, 100,ul chloroform
is added, mix well (vortex), and centrifuge for 5 min at 10000rpm. Remove the
lower, DNA-containing, layer to a new centrifuge tube. Store in freezer until
further use.
Visualization of the amplified products is performed by electrophoresis in 1%
agarose minigels in Ix TBE (0.045M Tris borate, 0.001 M EDTA pH 8.0), using
agarose dye mix (2% bromophenol blue; 2% xylene cyanol; 1 ml ddHzO, 0.2 g
sucrose) and a DNA ladder [lOtil DNA ladder stock (1,ugml-1, Gibco); 10,ul TE
buffer; 50,ul ddHzO; lO0til agarose dye mix (see above)].
Staining is performed with ethidium bromide (8 x 1O-5 ,ug,ul-l) and visualized on a
UV transilluminator.
Amplification of Single-stranded DNA (ssDNA)

by Asymmetrical Amplification
We successfully applied the method of Kaltenboeck et al. (1992). Prepare a

mastermix containing the following (for one reaction): 67.5 til ddHzO; 10.0 til
single-stranded (ss) buffer (12.5 ml1 M KC1; 2.5 ml1 M Tris-HCl pH 8.4; 625 ,ul1 M
MgClz; 9.37 ml HzO; 2.5,ul Tween 20; 2.5 til Nonidet P-40); 4.0 til F or R primer
(lOpmoltil-1); after mixing (vortex) and short centrifugation (10 000 rpm), O.5til
Taq polymerase is added.
After careful mixing (hand) and short centrifugation, lO,ul dsDNA from the sym-
metric amplification is added. Mix carefully (hand, centrifuge) and add two drop-
lets of sterile mineral oil.
Typical parameters for asymmetric amplification of DNA are the following:
initial denaturation for 30 s at 92°C, annealing for 60 s at 50-60°C, extension for
120 s at 72 DC; repeat 20-30 times, followed by a final extension for 4 min at 72 DC,
and store at 4°C.
After thermo cycling is completed, add 100.uI chloroform, mix well (vortex) and
centrifuge 5 min at 10 000 rpm. Transfer DNA-containing layer to a new centrifuge
tube.
Check asymmetric PCR products on a 1% agarose/2% Nusieve agarose minigel in
Ix TPE (O.09M Tris-phosphate, 0.02M EDTA pH 8.0). Depending on the primers
used and size of the DNA to be amplified, the cycling parameters used may need
modification.
Single-stranded DNA has to be cleaned (e.g., Geneclean II, Bio 101, La Jolla, CA;
or by washing in Millipore Ultrafree-MC NMWL cellulose filter-microfuge tubes)
to remove unincorporated nucleotides. The ssDNAs can be used directly in se-
quencing reactions, e.g., using Sequenase T7 DNA polymerase (USB, Cleveland,
OH). In most cases, use of 5.0,u1 ssDNA solution yielded satisfactory sequencing
results. For protocols on manual and/or automated DNA sequencing procedures,
the reader should consult specialized references.
Universal primers for amplification of the nuclear small-subunit rDNA, inter-
nally transcribed spacers (ITS 1 and 2), and mitochondrially encoded small and
large subunit rDNA are given by White et al. (1990). For amplification of ca. 600
nucleotides near the 5' end of the large subunit rDNA, we successfully used the
primers NL 1, NL 3 (both forward), and NL 2 and NL 4 (both reverse; O'Donnell
1993). Nishida and Sugiyama (1993) used the following primers to amplify the
nuclear small subunit rDNA of some ascomycetous yeast-like fungi: 5'-
ATCTGGTTGATCCTGCCAGT-3' and 5'-GATCCTTCCGCAGGTTCACC-3'. For
basidiomycetous yeasts slightly modified internal primers have to be used (J.W.
Fell, pers. comm.).
S.S.S
Electrophoretic Karyotyping
Electrophoretic patterns of chromosomal DNAs (electrophoretic karyotypes) pro-

vide data of potential use in systematic studies of yeasts (Table 2, see also Chap. 3,
this Vol.). The analysis ofkaryotypes by pulsed-field techniques has received wide
application in yeast systematics and genetics. Number and size of individual chro-
mosomes, estimates of total genome sizes, chromosomal rearrangements, and
gene assessment are among the characters studied. Taxonomically, these data are
mainly used at or below the species level, e.g. to differentiate species, strains, and/
or populations.
Due to the presence of chromosomal length polymorphisms, aneuploidy, and
comigrating bands, a straightforward taxonomic interpretation of electrophoretic
karyotypes is sometimes complicated. Ribosomal DNA-containing chromosomes
frequently show considerable size variation (Maleszka and Clark-Walker 1989;
Rustchenko-Bulgac 1991). Many species studied show rather variable karyotypes,
e.g., Candida albicans (Iwaguchi et al. 1990; Rustchenko-Bulgac 1991). In contrast,
other species show remarkably stable karyotypes, e.g., the basidiomycetous yeast
Table 2. Electrophoretic parameters successfully applied to separate chromosomes in some

selected yeasts by pulsed-field electrophoresis
Species Runtime Pulse time Agarose System Reference

(h) (%)
Saccharomyces 18 50s 1.5 OFAGE Carle and

cerevisiae Olson
(1985)
23 60s 1.0 CHEF Bakalinsky

7 100s and Snow
(1990)
18 60s 1.0 TAFE Vezinhet et

6 35s al. (1990)
Schizosacchamyces 130 60 min 0.6 CHEF Vollrath

pombe and Davis
(1987)
162 75 min 1.0 PULSAPHORE Smith et aI.

(1987)
150 60 min 1.0 PULSAPHORE Smith et aI.

(1987)
Kluyveromyces 25 30-300s 1.5 OFAGE Sor and

marxianus and 18 300s Fukuhara
K. lactis 25 600s (1989)
48 600-1200s
32 20-120s 1.5 CHEF Sor and

20 120s Fukuhara
40 120-600s (1989)
65 300s 1.0 OFAGE Steensma et

18 65s al. (1988)
Pachysolen 70 60-120s 1.2 PULSAPHOR Maleszka

tannophilus 24 300s and
24 500s Skrzypek
48 600-800s (1990)
Filobasidiella 22 20 min 1.0 CHEF Perfect et

neoformans 20 5 min aI. (1989)
18 120s
16 50-130s 0.6 CHEF Kwon-

32 170-300s Chung et
al. (1992)
Table 2 (contd.)
Species Run time Pulse time Agarose System Reference

(h) (%)
Candida 48 4 min 1.0 TAFE McEachern

albicans 24 9 min and
48 14 min Hicks
(1991)
14 2 min 0.6 TAFE McEachern

18 4 min and
18 7 min Hicks
18 10 min (1991)
Malassezia 36 300s 1.0 CHEF Boekhout

furfur 36 300-600s and
Bosboom
(1994)
Malassezia 48 50-300s 1.0 CHEF Boekhout

pachydermatis and
Bosboom
(1994)
Malassezia pachyderrnatis. All strains of this species show a slight length variation
of only the smallest chromosomal DNA (Boekhout and Bosboom 1994). In Saccha-
romyces cerevisiae, a correlation has been demonstrated between similarities of
DNA as observed in DNA reassociation experiments, and similarities of karyo-
types (Vaughan Martini et al. 1993).
At present, it is possible to separate chromosomal DNAs of up to ca. 6Mb
(Gunderson and Chu 1991), but even 10Mb has been reported (Zhang et al. 1991).
Separation of chromosomal DNAs larger then ca. 6 Mb is still difficult, and requires
long pulse and run times. Chromosomal DNAs of Saccharomyces cerevisiae, Pichia
canadensis (Hansenula wingei), and Schizosaccharomyces pombe are commer-
cially available as size standards.
For each yeast species with an unknown karyotype, the parameters used during
electrophoresis have to be optimized (Table 2). As a rule of thumb, the size of the
chromosomal DNAs is inversely proportional to the agarose concentration of the
gels and the field strength to be used. The pulse time is directly proportional to the
chromosomal size.
Several modifications of the methods used have been described. Mathaba et al.
(1993) used microtiter trays for culturing and preparing agarose blocks of Candida
albicans. Cook (1984) and Dear and Cook (1991) described a method for the
isolation of nuclear DNA using cells encapsulated in agarose minibeads.
McCluskeyet al. (1990) and Gardner et al. (1993) analyzed electrophoretic karyo-
types of a variety of plant pathogenic fungi and Saccharomyces cerevisiae, respec-
tively, Without protoplasting the cells. Other modifications are the use of
macrorestriction enzymes (see Dixon and Kinghorn 1990; Gardiner 1991), hybrid-
ization with chromosome-specific probes (Torok et al. 1992), and densitometric
analysis (Mahrous et al. 1990).
Protoplasts of ascomycetous yeasts usually are prepared using zymolyase (de
Jonge et al. 1986). However, this enzyme is not suitable for the preparation of
protoplasts of basidiomycetous yeasts. Therefore, we prefer to use Novozym 234
(Novo Biolabs) for protoplasting both asco- and basidiomycetous yeasts. Further
protocols can be found in Anand and Southern (1988), Sambrook et al. (1989) and
Johnston (1988) (see also Chap. 3, this Vol.). We have used the following protocol
successfully for the preparation of agar-embedded protoplasts of many basidi-
omycetous yeasts (according to de Jonge et al. 1986). Alternatively, protoplasts can
be made before embedding in low-melting point agarose.
Preparation of Agar-Embedded Protoplasts Using Novozym 234

Rotary-shaken (ca. 200rpm) cultures are grown until late logarithmic phase in
50mll % yeast extract-O.5% peptone-4% glucose (YPG) broth at 25°C. For basidi-
omycetous yeasts, 0.05% yeast extract-0.5% peptone-0.7% malt extract (YPM)
broth is preferred. Psychrophilic species require lower temperatures, e.g., 12 or
17°C.
Approximately 0.5 x 109 cells are harvested by centrifugation, and washed in 2ml
0.05M EDTA, pH 7.5.
The pellet is resuspended in ca. 2ml buffer made up ofO.05M EDTA, lOmM Tris-
HCL, and lOmM dithiothreitol (DTT), final pH 7.5.
After centrifugation, the pellet is washed with 2 ml CPE buffer [100 ml40 mM citric
acid, 120mM NaZP0 4 (pH 6.0) and 4ml 0.5M EDTA, pH 7.5]. Centrifuge and
resuspend in 0.3 ml CPES buffer (CPE buffer containing 1.2 M sorbitol and 5 mM
DTT).
Dissolve 2mg Novozym 234 in O.5mll % w/v low-melting agarose in CPE buffer at
38°C. Mix equal volumes ofNovozym 234/agarose solution and the cell suspension
(when preparing protoplasts of hyphal species or large-sized cells, the volumes
have to be adjusted).
Pipette the cell/Novozym/agarose mixture in a precooled matrix and allow to gel
on ice. The agarose/cell blocks are incubated for 1 hat 30°C in ca. 5 ml CPE buffer.
The agarose blocks are rinsed with ca. 5ml NDS (O.5M EDTA, pH 7.5, lOmM Tris-
HCI, pH 7.5), 1% v/v sodium N-Iauroylsarcosinate, and subsequently placed for
16 h at 50°C in 2 ml NDS buffer to which 0.4 mg proteinase K and 1% v/v sodium N-
lauroylsarcosinate have been added.
After lysis, the agarose blocks are rinsed in NDS buffer containing 1% v/v sodium
N-Iauroylsarcosinate and stored in NDS buffer containing 1% v/v sodium N-
lauroylsarcosinate and 0.2mgml- 1 proteinase K. Sodium N-Iauroylsarcosinate and
proteinase K have to be added just prior to use. The agarose/cell blocks can be
stored for several months at 4°C.
Alternatively, protoplasts of cells can be prepared before embedding in low-melt-

ing agarose as follows. Add 2mg Novozym 234 in 0.5ml CPE to the resuspended
cells in 0.3 ml CPES (see above), and allow degradation of the cell wall for 2-3 hat
30°C.
Check protoplast formation microscopically, and in the case of sufficient cell wall
degradation, centrifuge for 3 min at 13 000 rpm. Resuspend the protoplasts in
0.3 ml CPES, after which an equal volume 1% low-melting agarose in CPE buffer is
added.
Pipette the protoplast/agarose mixture in a precooled matrix and allow to gel on
ice. Rinse the agarose blocks in 2 ml NDS, 1% v/v lauroylsarcosinate, and incubate
for 16 h at 50°C in NDS to which 1% v/v lauroylsarcosinate and 0.02% Proteinase
K are added. Proceed according to the above protocol.
Prior to electrophoresis, the agarose blocks are rinsed in O.5x TBE (1x TBE: 90 mM
Tris base, 90mM boric acid, 2.5mM EDTA disodium salt, final pH 8.2) for 1h.
Depending on the size of the chromosomal DNAs to be separated, 0.5-1.5%
agarose gels (chromosomal grade) in 0.25-0.5x TBE are prepared.
The positioning of the agarose/cell blocks in the gel inserts is facilitated by
initially flooding the inserts with 0.5x TBE buffer. 0.25-0.5x TBE is used as
electrophoretic buffer, and the temperature is kept between 12 and 15°C.
Some electrophoretic parameters, taken from the literature, are presented in
Table 2.
After completion, the gels are stained in 0.5,ugml-1 ethidium bromide for 30-
120 min, destained with demineralized water, and the DNA visualized with an UV
transilluminator. If the DNA banding is obscured by a smear, an RNase treatment
is suggested (de Jonge et al. 1986) as follows.
Incubate the gel for 2h at 37°C with gentle shaking in a sealed bag containing 30ml
0.5x TBE and 1.5ml RNase solution (500,ugml-1 pancreatic RNase + 100 units
ml- 1 T1 RNase in 10mM Tris-HCI, pH 7.5, 15 mM NaCI, heated for 10 min at 100°C
and slowly cooled to room temperature). Rinse twice with electrophoresis buffer
for 60 min.
6
Overview of Yeast Genera
6.1
Teleomorphic Ascomycetous Genera
Ambrosiozyma van der Walt, Mycopath. Mycol. Appl. 46,305 (1972).

Two species: A. cicatricosa (Scott et van der Walt) van der Walt, A. monospora
(Saito) van der walt.
Vegetative reproduction is by multipolar budding, pseudohyphae, and septate
hyphae. The septa are doli pore-like. Asci are spheroidal to ovoidal, generally
formed on hyphae, and persistent or deliquescent. Ascospores are hat-shaped with
1-4 per ascus.
The species are often isolated from insects or insect tunnels in woody plants.
Species are slow or weak fermenters of sugars. A. monospora forms CoQ-7.
Kurtzman and Robnett (1995) demonstrated from rDNA sequence analysis
that Ambrosizyma and Hormoaxus are congeneric and transferred the three
Mormoascus species to Ambrosiozyma.
Arthroascus von Arx, Antonie van Leeuwenhoek J. Microbiol. 38, 289 (1972).
Three species: A. javanensis (Klocker) von Arx, A. schoenii (Nadson et
Krasilnikov) Bab'eva et al., A. Jermentans Lee et al.
Vegetative reproduction is by multipolar budding, pseudohyphae, and septate
hyphae. The septa have a single micropore. Asci are swollen hyphal cells that
deliquesce at maturity. Asci form up to four spores which are spheroidal,
subspheroidal with a circumfluent ledge, or occasionally hat-like. Some spores
may be warty. Habitats are soil and plant materials.
Two of the species are nonfermentative. A. javanensis forms CoQ-8.
Species of Arthroascus were recently transferred to Saccharomycopsis because
phylogenetic analysis of rDNA sequences showed species of both genera to be
members of a single clade (Kurtzman and Robnett 1995). The species assigned to
Arthroascus were characterized by asci that are swollen hyphal cells, but this type
of ascus formation may occassionally be seen among other members of
Saccharomycopsis.
Arxiozyma van der Walt and Yarrow, S. African J. Bot. 3, 340 (1984).
One species: A. telluris (van der Walt) van der Walt et Yarrow.
Anamorph: Candida pintolopesii (van Uden) S.A. Meyer et Yarrow.
Vegetative reproduction is by multipolar budding and pseudohyphae. The persis-
. tent asci arise from the conversion of vegetative cells and are spheroidal to ovoidal.
Ascospores are warty and spheroidal to ovoidal with 1-2 per ascus.
The species ferments sugars and is isolated primarily from poultry and other
birds. CoQ-6 is formed.
Ascoidea Brefeld and Lindau, Unters. Gesammtgeb. Mykol. 9, 91 (1891).
The six species are listed by Gams and Grinbergs (1970).
Vegetative reproduction is predominantly by true hyphae but budding yeast
cells and pseudohyphae are produced by some species. Asci are formed on
hyphae and are ellipsoidal or acicular. Ascospores are released through a terminal
opening in the ascus. New asci develop within the remains of previous asci.
Ascospores are generally hat-shaped and may number from 16 to several hundred
per ascus.
The species are isolated from tree bark, bark beetles, or the slime flux of trees.
Fermentation of sugars is absent or weak.
Ashbya Guilliermond, Rev. Gen. Bot. 40, 328 (1928).
One species: Ashbya gossypii (Ashby et Nowell) Guilliermond.
Vegetative reproduction is by septate hyphae. Asci are elongate to fusiform, deli-
quescent at maturity, and produce 8 or more two-celled, needle-like ascospores
that have long, whip-like appendages. The species can often be found on cotton
where it forms a yellow discoloration of the bolls.
Sugars are not fermented. A. gossypii is a commercial source of riboflavin and in

culture the presence of riboflavin turns the medium yellow.
Phylogenetic analysis of rDNA sequences from Ashbya, Eremothecium, Holleya
and Nematospora showed species of all four genera to be closely related members
of a single clade. Consequently, Kurtzman (1995) placed all species in
Eremothecium, the genus of taxonomic priority.
Botryoascus von Arx, Antonie van Leeuwenhoek J. Microbiol. 38, 289 (1972).
One species: B. synnaedendrus (Scott et van der Walt) von Arx.
Vegetative reproduction is by pseudohyphae and septate hyphae.
Budding yeast cells were reported not to be present. The septa have plasmodes-
mata. Asci are spheroidal to elongate, deliquescent at maturity, and contain 1-4
hat -shaped spores.
The species is non-fermentative and found in the tunnels of insects. CoQ-8 is
formed. Botryoascus is identical to Saccharomycopsis except that von Arx (1972)
reported budding cells to be absent. Budding cells were detected in two strains
of B. synnaedendrus, and rDNA analysis places it among species of
Saccharomycopsis, the genus to which it was recently returned (Kurtzman and
Robnett 1995).
Cephaloascus Hanawa, Jpn. J. Dermatol. Urol. 20, 103 (1920).
Two species: C. albidus Kurtzman, C. fragans Hanawa.
Vegetative growth is by budding cells, pseudohyphae, and true hyphae.
Hyphal septa have a single, central micropore. Asci are deliquescent and borne in
clusters on erect branched ascophores. Ascophores may be smooth and hyaline, or
roughened and with a brown pigmentation. Asci produce 1-4 hat-shaped spores.
One of the species is homothallic while the other is heterothallic. C. fragrans is
common to various types of wood, although one strain was from a human ear. C.
albidus was isolated from cranberry pumace. Fermentation of sugars is weak or
absent.
Citeromyces SantaMaria, Inst. Nac. Invest. Agron., Sec. Bioquimica, Cuaderno No.
258,269 (1957).
One species: C. matritensis (Santa Maria) Santa Maria.
Vegetative reproduction is by multilateral budding. Pseudohyphae and true hy-
phae are not produced. Asci are spheroidal, heavy-walled and persistent. Each
forms 1-2 spheroidal ascospores that have roughened surfaces. The species is
heterothallic.
The species is a strong fermenter of sugars and is usually isolated from sugar
concentrates and slime fluxes. CoQ-8 is formed.
Clavispora Rodrigues de Miranda, Antonie van Leeuwenhoek J. Microbiol. 45, 479
(1979).
Two species: C. lusitaniae Rodrigues de Miranda, C. opuntiae Phaff et al.
Vegetative reproduction is by multipolar budding and pseudohyphae. True
hyphae are not formed. Asci are spheroidal to elongate and develop following
conjugation of complementary mating types. Ascospores are clavate, finely
warted, and released at maturity. There are 1-2 spores per ascus. C. lusitaniae
is known from human and animal sources, while C. opuntiae has only been
isolated from rotting Opuntia cactus. The species ferment sugars and both produce
CoQ-8.
Coccidiascus Chatton, C. R. Soc. Biol. 75, 117 (1913).
One Species: C. legeri Chatton.
Vegetative reproduction is by multipolar budding. Pseudohyphae and true hyphae
do not occur. Asci are elongate and curved and form up to eight spindle-shaped
ascospores. The species is known only from the tissue of Drosophila spp.
Cyniclomyces van der Walt and Scott, Mycopath. Mycol. Appl. 43, 279 (1971).
One species: C. guttulatus (Robin) van der Walt & D.E. Scott.
Vegetative reproduction occurs by multipolar budding, occurring predominantly
near the poles of the cell. Pseudohyphae occur, but true hyphae are not formed.
Asci are elongate and are seldom deliquescent. Ascospores are generally elongate,
1-4 per ascus.
The species weakly ferments sugars. C. guttulatus is restricted to the feces and
stomach contents of rabbits. Laboratory cultivation requires a high CO 2
atmosphere.
Debaryomyces Lodder and Kreger-van Rij, Taxon 27, 306 (1978).
The presently accepted 14 species are described by Kurtzman and Robnett (1991)
and Yamada et al. (1991a).
Vegetative reproduction is by multipolar budding and pseudohyphae. The species
are homothallic, and asci show parent cell-bud conjugation or, infrequently, cell-
cell conjugation. Asci form 1-4 spores. For most species, asci are persistent. As-
cospores are usually spheroidal and often roughened, but certain species may form
roughened spores with equatorial ledges, spores with spiral ridges, or smooth,
lenticular spores. All produce CoQ-9, and are commonly found in soil, plant
products, foods, and in clinical specimens.
Comparisons of ribosomal RNA sequence similarities resulted in the transfer to
Debaryomyces of several species from other genera, namely Schwanniomyces
occidentalis (Kurtzman and Robnett 1991), Wingea robertsii (Kurtzman and
Robnett 1994), and Pichia carsonii and P. etchellsii (Yamada et al. 1991). The
species give a weak to strong fermentation of sugars. The species formerly classi-
fied as Schwanniomyces, S. occidentalis, shows a high amylase activity (De Mot et
al. 1984a) and a transformation system has been developed (Klein and Favreau
1988; see Chap. 4, this Vol.).
Dekkera van der Walt, Antonie van Leeuwenhoek J. Microbiol. 30, 273 (1964).
Two species: D. anomala Smith et van Grinsven, D. bruxellensis van der Walt.
Anamorph: Brettanomyces.
Vegetative reproduction is by multipolar budding and pseudohyphae. Some of the
yeast cells have an ogival shape at one end. Asci are spheroidal to elongate, form 1-
4 hat-shaped spores, and become deliquescent at maturity. All produce CoQ-9. The
species are usually isolated from beer, wine and soft drinks.
The species may show a variable fermentation of sugars, which is stimulated by

the presence of oxygen (Custers effect). Species are noted for a vigorous produc-
tion of acetic acid and this causes early cell death in cultures.
Dipodascopsis Batra and P. Millner, Proc. Int. Symp. Taxon. Fungi, Madras 1973,
187 (1978).
Two species: D. uninucleata (Biggs) Batra et Millner, D. tothii Zsolt.
Vegetative growth is occasionally by budding, but predominantly by true hyphae.
Hyphal septa have a single, central pore. Asci are initiated by the fusion of gamet-
angia from adjacent hyphae or adjacent hyphal cells. The asci become elongated
and produce from 30 to over 100 ellipsoidal to reniform ascospores which are
released when the ascus tip deliquesces. The species are homothallic. Isolates have
been obtained from tree wounds and insects. Sugars are not fermented.
Dipodascus Lagerheim, Jb. Wiss. Bot. 24, 549 (1892).
The l3 species have been reported by de Hoog et al. (1986).
Anamorph: Geotrichum.
Vegetative reproduction is by hyphae and arthroconidia. Hyphal septa have
micropores. Asci are initiated from the fusion of gametangia and are spheroidal or,
more frequently, elongate. Ascospores are hyaline, ellipsoidal and, depending on
the species, from 4 to over 100 in each ascus. The tips of asci deliquesce for spore
release. Some of the species are heterothallic. Strains are obtained from plant
materials and insects, usually those associated with trees. Most species are non-
fermentative.
Endomyces Reess, Botanische Untersuchungen fiber die Alcoholgarungspilze, p.
77. A. Felix, Leipzig (1870).
Three species: E. cortinarii Redhead et Malloch, E. parasiticus Fayod, E.
polyporicola (Schumacher et Ryvarden) de Hoog, M.Th. Smith & Gueho.
Vegetative reproduction is by septate hyphae that form small chains of
blastoconidia. Asci form on hyphae and are ellipsoidal to elongate. The asci pro-
duce 2-12 helmet-shaped spores that are released by deliquescence of the ascus
apex. Species of Endomyces are parasitic on mushrooms.
Eremothecium Borzi, Nuovo Giorn. Bot. Ital. 20,452-456 (1888).
Five species: E. cymbalariae Borzi, E. ashbyi (Guilliermond ex Routien) Batra, E.
coryli (Peglion) Kurtzman, E. gossypii (Ashby et Nowell) Kurtzman, E. sinecaudum
(Holley) Kurtzman.
Vegetative reproduction is by pseudohyphae and true hyphae. E. coryli and
E. sinecaudum also show budding whereas the other three species do not.
Asci, which are elongate or spindle-shaped, are produced on hyphae and may be
terminal or intercalary. There are generally at least 8 ascospores per ascus,
and they are released at maturity by deliquescence of the ascus wall. Ascospores
are elongate, straight or curved, and sharply tapered on one end. The ascospores
of E. coryli have a whip-like appendage. The species are homothallic; they
have been isolated from cotton bolls, citrus, several other plant species and an
insect.
Sugars are not fermented. Cultures of E. ashbyi and E. gossypii are often yellow-
orange in color from formation of riboflavin, and are used for commercial produc-
tion of this vitamin.
Species assigned to Ashbya, Eremothecium, Holleya, and Nematospora show
considerable phenotypic similarity, but had been assigned to their respective gen-
era because of the presence or absence of budding cells and differences in as-
cospore shape and the number of isoprene units on their coenzyme Q molecules.
Phylogenetic analysis of rDNA sequences showed the species to be closely related
members of a single clade, Kurtzman (1995) placed all species in Eremothecium,
the genus of taxonomic priority.
Galactomyces Redhead et Malloch, Can. J. Bot. 55,1701 (1977).

Two species: G. geotrichum (E. E. Bulter et 1. J. Petersen) Redhead et Malloch, G.
reessii (van der Walt) Redhead et Malloch.
Anamorph: Geotrichum.
Vegetative reproduction is by hyphae and arthroconidia. Hyphal septa have
micropores. Asci are spheroidal to ellipsoidal and arise from the fusion of hyphal
gametangia. Ascospores are spheroidal, pale brown, and roughened. Each ascus
forms 1 or, rarely, 2 spores that are released at maturity. G. geotrichum has both
heterothallic and homothallic strains, whereas G. reesii appears to be homothallic.
The species are common in soil, plant material, food (dairy products), and clinical
specimens. The species may weakly ferment sugars.
Guilliermondella Nadson and Krassilnikov, C. Seanc. hebd. Acad. Sci. 187,307

(1928).
One species: G. selenospora Nadson et Krassilnikov.
Vegetative reproduction is by multipolar budding, mainly occurring near the
poles of the parent cell. Pseudohyphae and true hyphae are also formed. The septa
of true hyphae have plasmodesmata. Asci are formed following conjugation of
adjacent hyphal cells and form 1-4 spores that may be spheroidal, reniform or
sickle-shaped. Ascospores are released at maturity. The species is homothallic.
Isolates have been obtained from tanning fluid and the slime fluxes of trees. Of the
commonly tested sugars, only glucose is fermented. The species produces CoQ-8.
Kurtzman and Robnett (1995) showed from similarity of rDNA sequences that
G. selenospora is a member of the Saccharomycopsis clade. On the basis of this
analys is, they transferred G. selenospora to Saccharomycopsis.
Hanseniaspora Zikes, Zentbl. Bakteriol. Parasitenk, Abt. 2, 30, 145 (1911).
The six species are discussed by Meyer et al. (1978).
Anamorph: Kloeckera.
Members of this genus are noted for producing apiculate or lemon-shaped cells.
Vegetative reproduction is by bipolar budding and occasionally by formation of
rudimentary pseudohyphae. Asci are generally elongate, forming 1-4 spores. As-
cospores may be hat-shaped or spheroidal, and with or without an equatorial ring.
Species forming hat-shaped ascospores have deliquescent asci. The species are
most frequently isolated from soil, fruits, and plant exudates.
The species ferment glucose and occasionally other sugars. All member of the
genus produce CoQ-6
Holleya Yamada, J. Gen. Appl. Microbiol. 32, 447 (1986).
One species: H. sinecauda (Holley) Yamada.
Vegetative reproduction is by multipolar budding, pseudohyphae, and true hy-
phae. Asci are elongate and deliquesce at maturity. Each ascus produces 4-8
needle-shaped spores that show a central globose swelling at germination.
The species is non-fermentative, forms CoQ-9, and has been isolated from the
seeds of oriental and yellow mustard. On the basis of rDNA comparisons,
Kurtzman (1995) transferred H. sinecauda to the genus Eremothecium.
Hormoascus von Arx, Antonie van Leeuwenhoek J. Microbiol. 38,289 (1972).
Three species: H. ambrosiae (van der Walt et D.B. Scott) van der Walt et von Arx,
H. philentomus (van der Walt et al.) van der Walt et von Arx, H. platypodis (Baker
et Kreger-van Rij) von Arx.
Vegetative reproduction is by multipolar budding, pseudohyphae, and true hy-
phae. The hyphae produce dolipore-like septa. Asci are spheroidal to elongate and
may show cell-to-cell conjugation. The asci produce 1-4 hat-shaped ascospores
that are released at maturity. All three species have been isolated from insect
tunnels under bark.
Species often show a weak fermentation of sugars and are characterized by
CoQ-7.
Members of Hormoascus assimilate nitrate as a sole source of nitrogen whereas
species of Ambrosiozyma do not. Von Arx (1972) used this growth reaction to
separate the two genera. Kurtzman and Robnett (1995) demonstrated from rDNA
sequence analysis that Hormoascus and Ambrosiozyma are congeneric and trans-
ferred species of the former genus to Ambrosiozyma.
Issatchenkia Kudriavzev, Die Systematik der Hefen, p. 161. Akademie Verlag,
Berlin (1960).
Four species: I. occidentalis (Phaff, Miller et Miranda) Kurtzman, Smiley et
Johnson, I. orientalis Kudriavzev, I. scutulata (Phaff, Miller et Miranda) Kurtzman,
Smiley et Johnson, I. terricola (van der Walt) Kurtzman, Smiley et Johnson.
Vegetative reproduction is by multipolar budding and by pseudohyphae. Asci are
spheroidal to elongate, persistent, and form 1-4 roughened, spheroidal spores.
The species are heterothallic. Common habitats are soil, fruits, flowers, and tree
exudates. I. orientalis and its anamorph C. krusei are also isolated from human and
animal sources.
All species ferment glucose but not other commonly tested sugars. Species are
characterized by CoQ-7.
Kluyveromyces van der Walt emend. van der Walt, Antonie van Leeuwenhoek J.
Microbiol. 31, 314 (1965).
The presently accepted 13 species are described by Fuson et al. (1987).
Vegetative reproduction is by multipolar budding and pseudohyphae. Asci are
spheroidal to elongate and generally unconjugated. A genus characteristic is deli-
,. Principles and Methods Used in Yeast Classification 43
quescence of the ascus wall at maturity. Ascospores are smooth and spheroidal to
reniform. Most species form 1-4 ascospores, but K. africanus may produce up to
16-20, and K. polysporus can produce in excess of 100. The species appear to be
homothallic except for K. lactis. Species of Kluyveromyces are isolated from soil,
water, fruit and other plant materials, tree fluxes, dairy products, Drosophila and
occasionally from clinical specimens.
All species ferment glucose and usually at least one other sugar. The species
form CoQ-6. Because of their ability to ferment lactose, K. lactis (anamorph Can-
dida sphaerica) and K. marxianus (anamorph Candida kefyr) have been used
industrially to produce ethanol from waste dairy products such as whey. Lactose
utilization from whey has also been reported for K. marxianus (as K. fragilis; Jenq
et al. 1989). Kluyveromyces marxianus shows a high inulinase activity (Vandamme
and Derycke 1983). Kluyveromyces lactis is used for heterologous gene expression
(Reiser et al. 1990; van den Berg et al. 1990; Fleer et al. 1991; Bergkamp et al. 1992;
Gellisen et al. 1992; Romanos et al. 1992; see Chap. 5, this Vol.).
Lipomyces Lodder and Kreger-van Rij, The yeasts, a taxonomic study, p. 669.
North-Holland Publ. Co., Amsterdam (1952).
The presently accepted five species are described by Kurtzman and Liu (1990).
ellipsoidal to elongate, frequently conjugated, and deliquescent at maturity. As-
cospores are spheroidal to elongate and covered with warts and ridges. The spores
are pigmented, amber to brown and up to 30 may be produced in a single ascus.
The species are isolated from soil.
Lipomyces is non-fermentative. Most species form CoQ-9, but L. lipofer (syn-
onym Waltomyces lipofer) produces CoQ-10. In culture, the species are quite
mucoid because of the copious production of an extracellular polysaccharide.
Lipomyces kononenkoae was found to have a high extracellular amylase activity
(De Mot et al. 1984a). Lipomyces lipofer and L. starkey are oleaginous (Ratledge
1986, 1993; Rezanka 1991).
Lodderomyces van der Walt, Antonie van Leeuwenhoek J. Microbiol. 32,1 (1966).
One species: L. elongisporus (Recca et Mrak) van der Walt.
spheroidal to ellipsoidal, unconjugated, and persistent. Each ascus forms 1-2
spores, and the spores are elongate, slightly tapered, and may have somewhat
blunt ends. Isolates have come from soil and orange juice. The species ferments
sugars, utilizes higher alkanes, and forms CoQ-9.
Metschnikowia Kamienski, Trav. Soc. Imp. Natural. St. Petersbourg 30,363 (1899).
The presently accepted eight species are listed by Mendon~a-Hagler et al. (1993).
unusual in shape and range from clavate to sphero- or ellipsopedunculate. They
are nonconjugated, persistent, and for some species, arise from the morphogenesis
of chlamydospores. Ascospores are unusual in shape, elongated and arrow-like
(Fig. 18). Generally, there are 1-2 spores per ascus. Some of the species are
Fig. 18. Ascus with needle-shaped ascospores in Metschnikowia zobellii (6d McClary's agar)
heterothallic. The species are isolated from seawater, freshwater, flowers, inverte-
brates, and Drosophila.
The species ferment sugars and form CoQ-9. Some strains of M. pulcherrima
produce pulcherrimin, a reddish pigment that may diffuse into the growth
medium.
Nadsonia Sydow, Ann. Mycol. 10,347 (1912).
Three species: Nadsonia commutata Golubev, Nadsonia elongata Konokotina,
Nadsonia fulvescens (Nadson et Konokotina) Sydow.
Vegetative reproduction is by bipolar budding. Asci are persistent, elongate, and
formed by a parent-bud conjugation. Depending on the species, either the parent
cell or an opposite bud becomes the ascus. Ascospores are spheroidal and rough-
ened with 1-2 per ascus. The species are commonly found in soil and the slime
fluxes of trees.
Two of the species ferment sugars, and CoQ-6 is present in those species that
have been examined.
Nematospora Peglion, Atti R. Accad. Naz. Lincei, Ser. 5, 6, 216 (1897).
One species: Nematospora coryli Peglion.
Vegetative reproduction is predominantly by multilateral budding, but also by
pseudohyphae and true hyphae. The yeast cells often have unusual shapes. Asci are
relatively large, elongate, and the walls are deliquescent at maturity. Asci generally
form 8 spores that are quite elongated and have a whip-like terminal appendage.
The species ferments sugars and has CoQ-S or 6. Nematospora shows many
similarities with Holleya, Ashbya, and Eremothecium, and, as discussed earlier, N.
coryli was transferred to the genus Eremothecium (Kurtzman 1995). The species
causes diseases in hazelnuts, cotton bolls, and various beans.
Pachysolen Boidin and Adzet, Bull. Trimest. Soc. Mycol. Fr. 73, 331 (1957).
One species: P. tannophilus Boidin et Adzet.
Vegetative reproduction is by multipolar budding and pseudohyphae. Ascus
formation by this genus is unique. A diploid cell, which may show an attached
conjugant, gives rise to a heavy-walled, refractile tube that flares outward slightly
on the end. The ascus develops within the distal flared end and forms 4 hat-shaped
ascospores that are released at maturity. The species is homothallic. It forms CoQ-
8. Isolates of P. tannophilus are from tanning liquors and leather.
The species ferments a variety of sugars. Of interest to biotechnology is the
ethanolic fermentation ofD-xylose (Schneider et al. 1981; Dekker 1982; Kurtzman
et al. 1982), D-galactose and glycerol (Maleszka et al. 1982), and the bioconversion
of wheat straw (Detroy et al. 1982). P. tannophilus is also noted for production of
an extracellular polysaccharide.
Pachytichospora van der Walt, Bothalia 12, 563 (1978).

One species: P. transvaalensis (van der Walt) van der Walt.
Vegetative reproduction is by multipolar budding and poorly developed
pseudohyphae. Asci are ellipsoidal, unconjugated, and persistent. The feature that
distinguishes this genus from Saccharomyces is its ascospores, which are spheroi-
dal to ellipsoidal and have notably thickened walls. There are usually 1-2 spores
per ascus. The species is heterothallic. Strains have been isolated from soil and an
animal cecum. The species is fermentative and forms CoQ-6.
Pichia E.C. Hansen, Zentbl. Bakteriol. Parasitenk., Abt. 2, 12, 529 (1904) emend.
Kurtzman, Antonie van Leeuwenhoek J. Microbiol. 50, 209 (1984).
The presently accepted ca. 100 species are described by Kurtzman (1984) and
Barnett et al. (1990).
Vegetative reproduction is by multipolar budding and pseudohyphae and/or true
hyphae are sometimes present. The septa of species with true hyphae are charac-
terized by a single, central micropore. Asci may be spheroidal to ellipsoidal, con-
jugated or unconjugated, and persistent or deliquescent. Species generally form 4
ascospores per ascus, but rarely there may be as many as 8. Most of the species
have hat -shaped ascospores, but a few are known for spheroidal spores that may be
roughened or have ledges. Members of the genus are common in soil, water, trees,
fruits, insects, and clinical specimens.
Species are fermentative and nonfermentative, and have CoQ-7, -8, or -9. Pichia
appears to be extremely heterogeneous. Some of the species have, somewhat pre-
maturely, been moved to the genus Yamadazyma Billon-Grand. Before additional
changes are made, all of the species need careful comparison by molecular meth-
ods. The genus nearly doubled in size with the transfer of Hansenula species to
Pichia (Kurtzman 1984). Saturn-spored species have been reassigned to Williopsis
and Saturnispora, and those with smooth spheroidal spores to Debaryomyces.
Besides Yamadazyma, the genus Hyphopichia von Arx & van der Walt is presently
considered a synonym of Pichia.
Pichia stipitis (anamorph Candida shehatae) is of biotechnological importance,
because of its fermentation of xylose (Dellweg et al. 1984; Bjorling and Lindman
1989; Prior et al. 1989) a major component of plant biomass. For Pichia pastoris
and P. angusta (synonym Hansenula polymorpha) heterologous gene expression
systems have been developed (e.g., Reiser et al. 1990; Buckholz and Gleeson 1991;
Clare et al. 1991; Gellissen et al. 1992; Romanos et al. 1992; Cregg et al. 1993). Pichia
nakazawae was found to have high amylase activity (De Mot et al. 1984a; see also
Chap. 6 and 9, this Vol.). Pichiaguilliermondi is a producer of riboflavin (see Chap.
7, this Vol.). Pichia methanolica mutants defective in acetyl-CoA synthetase can be
used in a biosensor (see Chap. 8, this Vol.).
Saccharomyces Meyen ex Reess, Sber. Phys. Med. Soz. Erlangen 9,190 (1877).
The presently accepted ten species have been defined by Vaughan Martini and
Martini (1987) and Kurtzman and Robnett (1991).
Vegetative reproduction is by multipolar budding and occasionally by
pseudohyphae. Asci are ellipsoidal to elongate, unconjugated, and persistent. As-
cospores are smooth, spheroidal to short ellipsoidal, and 1-4 are usually formed in
an ascus. Species are commonly isolated from soil, fruits, foods, beverages, and,
rarely, from clinical specimens.
The species are fermentative and characterized by CoQ-6. Four of the species in
this genus, which form the S. cerevisiae sibling species complex, are widely used for
bread-making, production of beer, wine, distilled beverages, and fuel alcohol.
Saccharomyces cerevisae is used for heterologous protein production (e.g., Sleep et
al. 1991; Gellissen et al. 1992; Romanos et al. 1992).
Saccharomycodes Hansen, Zentlbl. Bakteriol. Parasitenk., Abt. 2, 12,529 (1904).
One species: S. ludwigii Hansen.
Yeast cells are apiculate and vegetative reproduction is by bipolar budding and by
poorly developed pseudohyphae. Asci are spheroidal to ellipsoidal, unconjugated,
and persistent. Asci produce 1-4 ascospores that are spheroidal and have a fine
subequatorial ledge.
The species is fermentative, forms CoQ-6, and has been isolated from slime
fluxes of trees.
Saccharomycopsis Schionning, C. R. Trav. Lab. Carlsberg 6, 101 (1903).

The ten species were described by Kurtzman and Robnett (1995). Vegetative repro-
duction is by multipolar budding, arthrospores, pseudohyphae, and true hyphae.
Hyphal septa of most species are characterized by plasmodesmata. Asci are sphe-
roidal to ellipsoidal, conjugated or unconjugated, and either free or attached to
hyphae. The asci may be either deliquescent or persistent. There are usually 1-4
ascospores per ascus, but ascospore morphology varies markedly among species.
Some of the species form hat-shaped spores, while others have reniform, spher-
oidal or ellipsoidal spores, two of which have circumfluent ledges. Strains have
been isolated from trees, pollen, fruit, insects, and various starchy foods.
The species give a slow or weak fermentation of sugars and form CoQ-8.
Saccharomycopsis fibuligera is noted for the production of amylase. Some of the
species were previously assigned to Arthroascus, Botryoascus, Guilliermondella,
Endomyces, and Endomycopsella. Kurtzman and Robnett (1995) demonstrated
from rDNA sequence analysis that the ten species currently accepted are members
of the same clade and therefore appear congeneric. With the apparent exception
of En do myces, the preceding genera are considered to be synonyms of
Saccharomycopsis.
Saturnispora Liu and Kurtzman, Antonie van Leeuwenhoek J. Microbiol. 60: 21

(1991).
Four species: S. ahearnii Kurtzman, S. dispora (Dekker) Liu et Kurtzman, S. saitoi
(Kodama, Kyono et Kodama) Liu et Kurtzman, S. zaruensis (Nakase et Komagata)
Liu et Kurtzman.
Vegetative reproduction is by multipolar budding and occasionally
pseudohyphae. Asci are spheroidal to elongate and may be unconjugated or show
conjugation between either independent cells or a parent cell and a bud. Asci may
be persistent or deliquescent. Asci contain 1-4, or rarely 8, saturn-shaped as-
cospores. All four species are homothallic. Common habitats are soil and the
exudates of trees.
The species ferment sugars and have CoQ-7. Species of Saturnispora can be
readily separated from members of the genus Williopsis, which also form saturn-
shaped ascospores, because they do not assimilate D-xylose or glycerol.
Schizosaccharomyces Lindner, Wochenschr. Brau. 10, 1298 (1893).
Three species: S. japonicus Yukawa et Maki, S. octosporus Beyerinck, S. pombe
Lindner.
Vegetative reproduction occurs by fission which makes this genus unique. Occa-
sionally, true· hyphae are also produced. Asci are elongated, conjugated or
unconjugated, and either persistent or deliquescent. Ascospores are smooth,
spheroidal to ellipsoidal, and generally 4-8 per ascus (Fig. 19). One of the species
is heterothallic. The species have CoQ-9 or -10. The species are isolated from fruits
and fruit juices, wines, and high-sugar substrates.
The recently segregated genera Hasegawaea and Octosporomyces, are in this
treatment considered to be synonyms of Schizosaccharomyces. The species are
strong fermenters of sugars and have been used for the production of ethanol.
Systems for heterologous protein secretion have been developed (e.g., Reiser et al.
1990; Toyama and Okayama 1990; Buckholz and Gleeson 1991; Romanos et al.
1992).
Sporopachydermia Rodr. de Miranda, Antonie van Leeuwenhoek J. Microbiol. 44,

439 (1978).
Three species: S. cereana Rodr. de Miranda, S. lactativora Rodr. de Miranda, S.
quercuum Lachance.
Vegetative reproduction is by multipolar budding and occasionally by rudimen-
tary pseudohyphae. Asci are spheroidal to elongate, conjugated or unconjugated,
Fig. 19. Ascus with ascospores in Schizosaccharomyces pombe (CBS 356, 7d YPGA)
and deliquescent. Ascospores are smooth, spheroidal to ellipsoidal, and have very
thick walls. Asci produce 1-4 spores. The species are heterothallic. The species
have been isolated from seawater, an asphalt waste lagoon, rotting cacti, and fluxes
from oak trees.
Two of the species do not ferment sugars. The genus is characterized by thick-
walled ascospores, an offensive odor when grown on certain media, and the utili-
zation of m-inositol as a carbon source.
Stephanoascus M. Th. Smith et al., Antonie van Leeuwenhoek J. Microbiol. 42, 119
(1976).
Two species: S. ciferrii M.Th. Smith et al., S. farinosus de Hoog et al.
Anamorph: Blastobotrys.
Vegetative reproduction is by multipolar budding yeast cells, pseudohyphae, and
true hyphae. Hyphal septa are characterized by plasmodesmata. The spheroidal
asci form on hyphae and have a distinctive apical cap cell. Asci are persistent and
produce 1-4 ascospores which have a hemispherical shape. One of the species is
heterothallic. Isolates are from soil, fruiting bodies of fungi, and from human and
animal sources.
Fermentation is either slow or absent. S. farinosus has a maximum growth
temperature of 25°C, whereas S. ciferrii can grow at 40°C.
Torulaspora P. Lindner, Jb. Versuchs.-Lehranst. Brau. Berl. 7,448 (1904).

Three species: T. delbrueckii (Lindner) Lindner, T. globosa (Klocker) van der Walt
& E. Johannsen, T. pretoriensis (van der Walt & Tscheuschner) van der Walt & E.
Johannsen.
Vegetative reproduction is by multipolar budding and rudimentary pseudo-
hyphae. Asci are spheroidal to ellipsoidal, persistent, and often have a tapered
protuberance. Asci produce 1-4 spores, which may be either rough or smooth,
depending on the species. Two of the species are heterothallic. Strains are fre-
quently isolated from soil, fruits, fruit juices, and other plant products, and occa-
sionally from human and animal sources.
The species strongly ferment sugars and are characterized by CoQ-6. Separation
of Torulaspora, Saccharomyces, and Zygosaccharomyces has been problematic.
The tapered protuberances formed on asci of Torulaspora are not usually pro-
duced by Saccharomyces or Zygosaccharomyces.
Wickerhamia Soneda, Nagaoa, Mycol. J. Nagao Inst. 7, 9 (1960).
One species: W. fluorescens Soneda.
Vegetative reproduction is by bipolar budding of the apiculate yeast cells.
Pseudohyphae and hyphae are not produced. Asci are ellipsoidal, unconjugated,
and deliquescent. Up to 16 ascospores may be produced in an ascus, but 1 or 2 are
usually observed. The ascospores somewhat resemble a baseball cap.
The species is fermentative and forms CoQ-9. The single known isolate was
obtained from squirrel dung.
Among the ascomycetous yeasts are four genera that exhibit bipolar budding.
These are Wickerhamia, Saccharomycodes, Nadsonia, and Hanseniaspora. The
main morphological distinction among the genera is based on ascospore shape.
Wickerhamiella van der Walt, Antonie van Leeuwenhoek J. Microbiol. 39, 121
(1973).
One species: W. domercqii van der Walt.
Vegetative reproduction is by multipolar budding. The cells are among the small-
est produced by yeasts. The sexual state of this species is unusual. Asci are conju-
gated and ellipsoidal. A single oblong ascospore forms, and at maturity the end of
the ascus deliquesces and the spore appears to be forcibly ejected. The empty ascus
is somewhat elongated and wrinkled. The two known isolates originated from a
wine vat and the effluent of a sugar cane factory. However, the species is non-
fermentative.
Williopsis Zender, Bull. Soc. Bot. Geneve 17,272 (1925).
The five species are described by Kurtzman (1991) and Liu and Kurtzman (1991).
Vegetative reproduction is by multipolar budding and, in some species,
pseudohyphae. Asci are spheroidal to ellipsoidal, persistent or deliquescent, and
may be unconjugated or show parent-bud or cell-to-cell conjugations. Ascospores
are saturn-shaped with 1-4 per ascus. Common habitats include soil, water, tree
fluxes and other plant sources, and human and animal feces.
The species are fermentative and synthesize CoQ-7. The similarities between
Williopsis and Saturnispora were noted earlier.
Yarrowia van der Walt and von Arx, Antonie van Leeuwenhoek J. Microbiol. 46,
517 (1980).
One species: Y. lipolytica (Wickerham et al.) van der Walt et von Arx.
Anamorph: Candida lipolytica (F.e. Harrison) Diddens et Lodder.
Vegetative reproduction is by multipolar budding, arthrospores, pseudohyphae,
and true hyphae. Hyphal septa are characterized by a single central micropore.
Asci are spheroidal to ellipsoidal and usually attached to hyphae. Asci form 1-4
ascospores, which are released at maturity. The morphology of ascospores ranges
from spheroidal and roughened, to hat-shaped, crescentiform, or saucer-like. The
species is heterothallic and ascospore shape is influenced by the mating strains
that are paired. CoQ-9 is formed. Isolates are from soil, agricultural and industrial
processing wastes, lipidic and proteinaceous materials, and animal and human
clinical specimens.
The species is non-fermentative. Y. lipolytica is an important industrial yeast
(see Chap. 10, this Vol.). It is markedly proteolytic and lipolytic, and because of its
ability to grow on hydrocarbons, has been used to produce single-cell protein from
petroleum. More important is its capability to produce high yields of citric acid
(Furukawa et al. 1982). For a review on the molecular genetics and biotechnologi-
cal aspects of the species the reader is referred to Heslot (1990), and for heterolo-
gous protein production to Franke et al. (1988), Buckholz and Gleeson (1991),
Reiser et al. (1990), and Romanos et al. (1992).
Zygoascus M.Th. Smith, Antonie van Leeuwenhoek J. Microbiol. 52, 25 (1986).

One species: Z. hellenicus Smith.
Vegetative reproduction is by multipolar budding, pseudohyphae and true hy-
phae. Hyphal septa have a single central pore. Asci are spheroidal to ellipsoidal and
form on the bridge between two conjugating hyphal cells of opposite mating type,
thus giving a distinct, diagnostic morphology. Asci are persistent and form 1-4
hemispheroidal to hat-shaped ascospores.
Strains have been isolated from grape must, organic industrial waste, and
mastitic cows. The species is fermentative.
Zygosaccharomyces Barker, Phil. Trans. R. Soc., Ser. B 194,467 (190l).

The currently accepted nine species are listed by Kurtzman (1990).
Vegetative reproduction is by multipolar budding and sometimes by
pseudohyphae. Asci are persistent, and usually consist of two conjugating cells,
each of which contains one or more ascospores. Ascospores are smooth, spher-
oidal to ellipsoidal, and 1-4 are formed per ascus.
The species is fermentative and forms CoQ-6. Isolates are commonly obtained
from wine, various foods, fruit, trees, and Drosophila. Species of
Zygosaccharomyces often cause spoilage of acidified foods and condiments. The
distinction between Zygosaccharomyces, Saccharomyces, and Torulaspora has
been noted in the discussion of the latter genus.
Zygozyma van der WaIt et aI., Syst. Appl. Microbiol. 9, 115 (1987).
Four species: Z. arxii van der Walt et al., Z. oligophaga van der Walt et von Arx, Z.
smithiae van der Walt et al., Z. suomiensis Smith et al.
Vegetative reproduction is by multipolar budding. Asci are ellipsoidal to elongate,
deliquescent and form 1-4 smooth ovoidal to elongate spores.
The species are non-fermentative and form CoQ-8. In culture, colonies
are mucoid because of the production of large amounts of extracellular
polysaccharide.
6.2
Anamorphic Ascomycetous Genera
Aciculiconidium D.S. King and s.c. Jong, Mycotaxon 3,401 (1976).

One species: A. aculeatum (Phaff et al.) D.S. King & S.C. Jong. Vegetative growth is
by budding yeast cells that form a multitude of shapes and by true hyphae. In
addition, needle-shaped cells with rounded bases are formed on hyphae and as
buds on yeast cells. These unusual and unique cells characterize the genus. The two
known strains have been isolated from Drosophila spp.
The species weakly ferments sugars and forms CoQ-9.
Arxula van der Walt et al. Antonie van Leeuwenhoek J. Microbiol. 57, 59 (1990).
Two species: A. adeninivorans (Middelhoven et al.) van der Walt et al., A. terrestre
(van der Walt et Johannsen) van der Walt et al.
Vegetative reproduction is by budding, arthroconidia and true hyphae. Hyphal
septa are multi perforate.
The species are non-fermentative, xerotolerant, and form CoQ-9. The genus
was defined because of its xerotolerance, budding, formation of arthroconidia, and
production of narrow, slow-growing hyphae. However, comparisons of rDNA
sequences show the Arxula spp. to be members of a clade composed of
Blastobotrys spp., Sympodiomyces parvus, Stephanoascus spp., and several species
of Candida (Kurtzman and Robnett 1995). Several aromatic compounds are as-
similated by A. adeninivorans (Middelhoven et al.I991), and two extracellular acid
phosphatases have been characterized from this species (Buttner et al. 1991; see
also Chap. 11, this VoL).
Brettanomyces Kufferath and van Laer, Bull. Soc. Chim. BeIge 30, 270 (1921).
The five species are listed by Smith et al. (1990).
Teleomorph: Dekkera.
Vegetative reproduction is by multipolar budding and pseudomycelium. Some of
the yeast cells have an ogival shape at one end. The species may show variable
fermentation of sugars, which is stimulated by the presence of oxygen (Custers
effect). Species are noted for vigorous production of acetic acid and this causes
early cell death in cultures. All species have CoQ-9. The species have been isolated
from beer, wine and soft drinks.
Eeniella nana M.Th Smith et al. (1981) has been reclassified as Brettanomyces
based on partial28S ribosomal DNA sequences (Boekhout et al. 1994). Contrary to
a series of papers (Jong and Lee 1986; Lee and Jong 1986), we consider B.
custersianus and B. naardenensis as asexual species.
Candida Berkhout, De schimmelgeslachten Monilia, Oidium, Oospora en Torula,

p. 41. Thesis, Utrecht (1923).
The most recent summary of the ca. 160 Candida species is given by Barnett et al.
(1990).
Candida is a taxonomic form-genus to which the ascomycetous species that ex-
hibit multipolar budding and have no known sexual state are assigned. The genus
Torulopsis Berlese is now considered a synonym of Candida, and consequently,

Candida includes those species that form pseudohyphae and hyphae as well as
those that do not. Because Candida is so broadly defined, phylogenetic affinities
may be found with any teleomorphic ascomycetous genus that exhibits multilat-
eral budding.
Several Candida species are of medical importance, e.g., C. albicans, C. glabrata,
C. parapsilosis, and C. tropicalis.
Several Candida species have been investigated for biotechnological aspects,
e.g., Candida utilis (Pasari et al. 1989) and C. maltosa (see Chap. 12, this Vol.) are
used for biomass production from carbohydrate substrates, Candida blankii may
be a good candidate for single-cell protein production using pentoses as substrate
(Meyer et al. 1992), and C. tropicalis has been found to utilize hydrocarbons (Cook
et al. 1973).
Kloeckera Janke, Zentbl. Bakteriol. Parasitenk., Abt. 2, 76, 161 (1928).
This genus represents the anamorphic state of Hanseniaspora and only one spe-
cies, K. lindneri (Klocker) Janke, remains for which the ascosporic state has not yet
been found. Vegetative reproduction is by bipolar budding. The species ferments
glucose and has CoQ-6. It has been isolated from soil in Java.
Myxozyma van der WaIt et aI., Sydowia 34,191 (1981).
The five species are described by Barnett et al. (1990).
Vegetative reproduction is by multipolar budding. Pseudohyphae and true hyphae
are not produced. Growth in culture is mucoid.
The species are non-fermentative and form either CoQ-8 or-9. Isolates have been
obtained from soil, bark beetles, rotting cacti, and a corticolous lichen. Ribosomal
RNA sequence comparisons indicate a close relationship to Lipomyces, though
Myxozyma probably is not the anamorph of Lipomyces (Kurtzman and Liu 1990).
Oosporidium Stautz, Phytopath. Z. 3, 163 (1931).
One species: O. margaritiferum Stautz.
Vegetative reproduction is by multipolar budding, pseudohyphae, and asexual
endospores. Cultures often show a light pink to light orange color. Analysis of
rDNA sequences shows this taxon to be a dimorphic member of the euascomycetes
(Kurtzman and Robnett 1995).
The species is non-fermentative. Strains have been obtained from slime fluxes
of trees.
Saitoella Goto et a!., J. Gen. Appl. Microbiol. 33, 75 (1987).
One species: S. complicata Goto et al.
Vegetative reproduction is by enteroblastic budding. Pseudohyphae and hyphae
are not formed.
The species is non-fermentative and forms CoQ-lO. Isolates have been obtained
from soil. Colonies in culture are orange and butyrous and somewhat similar to
Rhodotorula. However, the Diazonium Blue B reaction is negative, indicating
Saitoella to be an ascomycete. It may be phylogenetically related to Taphrina
(Nishida and Sugiyama 1993).
Schizoblastosporion Ciferri, Arch. Protistenk. 71,405 (1930).

Two species: S. starkeyi-henricii Ciferri, S. chiloense Ramirez et Gonzalez.
Vegetative growth is by budding on a broad base, almost exclusively at the poles of
the cells. S. starkeyi-henricii sometimes produces a primitive pseudomycelium. S.
chiloense forms pseudohyphae and true hyphae.
The species are non-fermentative and have been isolated from soil, rotten
wood, and stomach contents.
Sympodiomyces Fell and Statzell, Antonie van Leeuwenhoek J. Microbiol. 37, 359
(1971).
One species: S. parvus Fell et Statzell.
Vegetative growth is by budding and true hyphae. Conidiophores arise from some
cells and produce terminal conidia by sympodial proliferation. Phylogenetic place-
ment of this genus is discussed under Arxula.
The species is non-fermentative. All isolates are from seawater of the Indian and
Pacific Oceans.
Trigonopsis Schachner, Z. Ges. Brauwesen 52, 137 (1929).

One species: T. variabilis Schachner.
Vegetative growth is by multilateral budding. Pseudohyphae and hyphae are ab-
sent. This species is unique because of the triangular shape (actually tetrahedral) of
the yeast cells. The proportion of triangular to ellipsoidal cells is strain-dependent
and is also influenced by the composition of the culture medium. Budding on the
triangular cells is from the cell apices.
The species is non-fermentative. Isolates are from beer and grape must.
6.3
Teleomorphic Heterobasidiomycetous Genera
Bulleromyces Boekhout and A. Fonseca, Antonie van Leeuwenhoek J. Microbiol.

59, 90 (1991).
One species: B. albus Boekhout et A. Fonseca.
Anamorph: Bullera.
Heterothallic, but occasionally self-sporulating. Hyphae producing clamp con-
nections, haustorioid branches, and transversely, obliquely or longitudinally
septate phragmobasidia, which germinate with yeast cells, hyphae, or
ballistoconidia. Teliospores are absent. Vegetative reproduction is by polar
budding, and rotationally symmetrical ballistoconidia. The species contain xylose
in the cell walls and have CoQ-lO. Hyphal septa have dolipores with a
parenthesome made up ofU-shaped vesicles. Commonly isolated from such habi-
tats as air and leaves.
Chionosphaera Cox, Mycologia 68,503 (1976).

One species: C. apobasidialis Cox.
Heterothallic. Basidiocarps stilboid, made up of hyphae without clamp connec-
tions. Basidia clavate. Vegetative reproduction may occur by budding.
Ballistoconidia are absent (Cox 1976). No data on cell wall composition and CoQ
are available. Isolated from dead corticated branches of tree.
Cystofilobasidum Oberwinkler and Bandoni, Syst. Appl. Microbiol. 4,116 (1983).
Four species: C. bisporidii (Fell et al.) Oberwinkler & Bandoni, C. capitatum (Fell et
al.) Oberwinkler et Bandoni, C. infirmominiatum (Fell et al.) Hamamoto et al., C.
lari-marini (Saez et Nguyen) Fell et Tallman.
Anamorph: Cryptococcus.
Heterothallic or homothallic. Hyphae with or without clamp connections, and
lacking haustorioid branches. Teliospores are present, germinating with capitate
or pyriform holobasidia. Vegetative reproduction usually is by polar budding, but
endospores may be present. Ballistoconidia are absent. The species contain xylose
in the cell wall and have CoQ-8. Hyphal septa have dolipores without a
parenthesome. Isolated from various substrates, like seawater, plankton, soil,
trees, food, and birds.
Erythrobasidium Hamamoto et al., J. Gen. Appl. Microbiol. 34,285 (1988).
One species: E. hasegawianum Hamamoto et al.
Anamorph: Rhodotorula.
Homothallic. Hyphae have clamp connections and holobasidia, but teliospores
and haustorioid branches are absent. Vegetative reproduction is usually by polar
budding. Ballistoconidia are absent. The species has no xylose in the cell walls, and
has CoQ-1O(H2}. Hyphae have a simple diaphragma-like pore (Suh et al. 1993).
Isolated from spent brewers's yeast.
Filobasidiella Kwon-Chung, Mycologia 67, 1198 (1975).
One species: F. neoformans Kwon-Chung with two varieties, var. neoformans and
var. bacillispora.
Anamorph: Cryptococcus.
Heterothallic, but occasionally self-sporulating. Hyphae have clamp connections,
haustorioid branches, and clavate holobasidia, on which chains of basidiospores
are formed basipetally. Teliospores are absent. Vegetative reproduction is by polar
budding. Ballistoconidia are absent. The species has xylose in the cell walls and has
CoQ-10. Septa have dolipores without parenthesomes (Kwon-Chung and Popkin
1976). Isolated from man, pigeon droppings, Eucalyptus species and soil, but also
from fruit juice.
Filobasidiella neoformans is of medical importance, and can cause meningitis.
The natural habitat of the variety neoformans is known to be pigeon droppings,
and variety bacillispora is associated with Eucalyptus trees (Ellis and Pfeiffer 1990,
1992).
Filobasidium Olive, J. Elisha Mitchell Scient. Soc. 84, 261 (1968).
Five species: F. floriforme Olive, F. capsuligenum Rodrigues de Miranda, F.
uniguttulatus Kwon-Chung, F. elegans Bandoni & Oberwinkler, F. globisporum
Bandoni et Oberwinkler.
Anamorphs: Cryptococcus.
Heterothallic, but apparently also homothallic. Hyphae have clamp connections,

haustorioid branches, and form cylindrically clavate holobasidia. Teliospores are
absent. Vegetative reproduction is by polar budding. Ballistoconidia are absent.
The species contain xylose in the cell walls and have CoQ-9 or -10. Septa have
dolipores with or without parenthesomes. Parenthesomes, if present, are made up
of U-shaped vesicles (Kreger-van Rij and Veenhuis 1971; Moore and Kreger-van
Rij 1972). Filobasidium floriJorme, F. elegans, and F. globisporum are known from
plant material, F. uniguttulatus is known from clinical specimens, and F.
capsuligenum is isolated from soil and wine-making products.
Filobasidium capsuligenum shows extracellular amylolytic activity because of
production of a-amylase and glucoamylases (De Mot et al. 1984a; De Mot and
Verachtert 1985).
Leucosporidium Fell et a!., Antonie van Leeuwenhoek J. Microbio1. 35, 438 (1969).
Three species: L. antarcticum Fell et al., L. Jellii Gimenez-Jurado, L. scottii Fell et a1.
Heterothallic and homothallic. Hyphae mayor may not have clamp connections.
Teliospores are present and germinate by septate or aseptate metabasidia.
Haustorioid branches are absent. Vegetative reproduction is by polar budding.
Ballistoconidia are absent. The species lack xylose in the cell walls and have CoQ-
7,-9 or -10 (Yamada and Nakagawa 1990). Hyphae have diaphragma-like septa
with a central pore (Kreger-van Rij and Veenhuis 1971). Isolated from soil, fresh
water, seawater, seaweeds, food, and trees.
The reported heterogeneity in the coenzyme Q may indicate taxonomic hetero-
geneity, which needs to be examined carefully. The degradation of L(+)-tartaric
acid by L. Jellii may be of interest to the wine industry (Gimenes-Jurado and van
Uden 1989). Aromatic compounds are assimilated by L. scottii (Middelhoven et al.
1992).
Kondoa Yamada et al., J. Gen. App1. Microbio1. 35, 383 (1989).
One species: K. malvinella (Fell et Hunter) Yamada et al.
Heterothallic. Hyphae have clamp connections. Teliospores are present and germi-
nate with two-celled metabasidia (Fell 1970). Haustorioid branches are absent.
Vegetative reproduction is by polar budding. Ballistoconidia are absent. The spe-
cies lacks xylose in the cell wall, and has CoQ-9 (Yamada et a1. 1989a). Isolated
from seawater.
Kondoa is considered a genus distinct from Rhodosporidium, because of dis-
similar partial nucleotide sequences of the 18S and 26S ribosomal RNA, stalked
teliospores, and two-celled metabasidia (Yamada et al. 1989a).
Mrakia Yamada and Komagata, J. Gen. App1. Microbio1. 33, 456 (1987).
Four species: M. jrigida (Fell et al.) Yamada et Komagata, M. gelidum (Fell et al.)
Yamada & Komagata, M. nivalis (Fell et a1.) Yamada et Komagata, M. stokesii (Fell
et al.) Yamada et Komagata.
Self-sporulating. Hyphae do not form clamp connections and haustorioid
branches. Teliospores are present and germinate with one- to three-celled
metabasidia (Fell and Statzell Tallman 1984a). Vegetative reproduction is by polar
budding. Ballistoconidia are absent. The species contain xylose in the cell wall, and
have CoQ-8 (Yamada and Komagata 1987). Isolated from antarctic soil and snow.
Isozyme and whole-cell protein patterns, and partial 18S and 26S ribosomal
RNA sequences of all species are similar or identical (Yamada and Matsumoto
1988, Yamada and Kawasaki 1989a; Fell et al. 1992; Vancanneyt et al. 1992). There-
fore, it is expected that the number of species can be reduced.
Rhodosporidium Banno, J. Gen. Appl. Microbiol. 13, 192 (1967).
As several species have been described recently, we present a list of the eight
species presently known: R. dacryoideum Fell et al., R. diobovatum Newell &
Hunter, R. fluviale Fell et al., R. kratochvilovae Hamamoto et al., R. lusitaniae
Fonseca et Sampaio, R. paludigenum Fell et Statzell Tallman, R. sphaerocarpum
Newell et Fell, R. toruloides Banno.
Anamorphs: Rhodotorula.
Homothallic or heterothallic. Hyphae with or without clamp connections.
Teliospores are present and germinate with transversely septate metabasidia.
Haustorioid branches are absent. Vegetative reproduction usually is by polar bud-
ding. Ballistoconidia are absent. The species lack xylose in the cell wall and have
CoQ-9 or -10. Hyphae have diaphragma-like septa with a central pore (Kreger-van
Rij and Veenhuis 1971; Johnson-Reid and Moore 1972). Isolated from various
substrates such as soil, fresh water, seawater, mangrove swamps, air, and wood
pulp.
Rhodosporidium kratochvilovae, R. diobovatum, R. paludigenum, R. toruloides,
and R. sphaerocarpum form one species cluster based on partial 28s rRNA se-
quences, whereas R. dacryoideum is in a separate cluster (Fell et al. 1992).
Rhodosporidium lusitaniae has been reported to degrade phenolic compounds
(Fonseca and Sampaio 1992). Rhodosporidium toruloides can accumulate large
amounts of lipids (Ratledge 1978, 1982, 1986; Ratledge and Evans 1989). This
process was found to be largely influenced by the nitrogen sources used (e.g.,
Evans and Ratledge 1984a,b).
Sporidiobolus Nyland, Mycologia 41,686 (1949).
Four species: S. johnsonii Nyland, S. pararoseus Fell et Tallman, S. ruineniae
Holzschu et al., S. salmonicolor Fell et Tallman.
Anamorph: Sporobolomyces.
Homothallic or heterothallic. Hyphae have clamp connections. Teliospores are
present and germinate with phragmo- or holometabasidia. Haustorioid branches
are absent. Vegetative reproduction usually is by polar budding. Bilaterally sym-
metrical ballistoconidia are present. The species lack xylose in the cell wall and
have CoQ-10. Hyphae have diaphragma-like septa with a central pore (Kreger-van
Rij and Veenhuis 1971; Boekhout et al. 1992). The species occur mainly on leaves,
but have also been isolated from air, fruit, skin, fodder, seawater, wood chips, and
oil.
Species of Sporidiobolus belong to one species cluster based on partial nucle-
otide sequences of 28S ribosomal RNA (Fell et al. 1992). Because of rather high
DNA relatedness, S. salmonicolor is sometimes considered synonymous with S.
johnsonii (Boekhout 1991b). Fell et al. (1992) observed a number of differences in

partial nucleotide sequences of the 28S rRNA (Fell et al. 1992) between the two
species, which may justify their distinction. Torularhodine is found to be the main
carotenoid pigment, but ~-carotene, torulene, and r-carotene occur as well
(Valadon 1976).
Sterigmatosporidium Kraepelin and V. Schulze, Antonie van Leeuwenhoek J.
Microbiol48, 479 (1982).
One species: S. polymorphum Kraepelin et Schulze.
Heterothallic, but apparently homothallic strains occur as well. Hyphae have
clamp connections and haustorioid branches. Teliospore-like cells are present.
The life cycle has not been fully elucidated, because the sites of karyogamy and
meiosis could not be identified with certainty. Vegetative reproduction is by mul-
tipolar budding on short denticles. Ballistoconidia are absent. The species contains
xylose in the cell wall and has CoQ-lO (Yamada et al. 1989b). It has been isolated
from waterlogged planks in an old mine.
Tilletiaria Bandoni and Johri, Can. J. Bot. 50, 39 (1972).
One species: T. anomala Bandoni et Johri.
Homothallic. Hyphae lack clamp connections and haustorioid branches.
Teliospores are present and germinate with phragmobasidia (Bandoni and Johri
1972). Yeast cells are absent, but ballistoconidia are present. The species lacks
xylose in the cell wall and has CoQ-10 (Boekhout 1991b). Hyphal septa have
dolipore-like structures (Boekhout et al. 1992). It has been isolated from decaying
wood.
Tremellales with Yeast Phases
Yeast stages have been isolated from a limited number of species belonging to the
genera Tremella Persoon and Sirobasidium Lagerheim & Patouillard, (e.g.,
Bandoni 1984). Most species are heterothallic, but homothallic species occur as
well. Hyphae have clamp connections, haustorioid branches, and form obliquely
or longitudinally septate basidia. Teliospores are absent. Vegetative reproduction
usually is by polar budding. Ballistoconidia may be formed by yeast stages of
Sirobasidium. These genera are characterized by the presence of xylose in the cell
wall, and have CoQ-9 or -10 (Kuraishi et al. 1985; Yamada et al. 1987). Septa have
a dolipore with a parenthesome made up of V-shaped vesicles (Tremellales type;
Patrignani et al. 1984), or lack a parenthesome. Most species occur on decaying
wood, or are mycoparasitic.
Partial nucleotide sequences of 28S rRNA of some Tremella species and
Sirobasidium magnum suggest a close phylogenetic relationship with certain spe-
cies of Cryptococcus (Fell et al. 1992). This is also supported by a number of
physiological and biochemical characteristics (e.g., assimilation of m-inositol and
extracellular carbohydrate composition).
Xanthophyllomyces Golubev, Yeast 11, 105 (1995).
One species: X. dendrorhous Golubev.
Anamorph: Phaffia rhodozyma Miller et al. (= Rhodomyces dendrorhous).
Homothallic, hyphae and haustorioid branches are absent, but chlamydospores

may be present. Mother cell-bud conjugation, induced by polyols (Golubev 1995),
results in cylindrical holobasidia on which basidiospores are formed. The cell wall
contains xylose and rhamnose (Golubev 1995) and CoQ-lO is present (Yamada and
Kawasaki 1989b).
The species is mainly isolated from exuded sap from trees (e.g., Betula ssp.),
especially from arctic and alpine habitats.
6.4
Anamorphic Heterobasidiomycetous Genera
Bensingtonia Ingold, Trans. Br. Mycol. Soc. 86, 325 (I986).

Nine species are listed in Boekhout (I991b).
Vegetative reproduction is by polar budding, bilaterally symmetrical
ballistoconidia, hyphae and pseudohyphae. The species lack xylose in the cell wall
and have CoQ-9. Hyphae have diaphragma-like septa with a central pore
(Boekhout et al. 1992). The species have been isolated mainly from leaves, but also
from fungi. Partial nucleotide sequences of the 28S rRNA indicate that the genus in
its present circumscription may be polyphyletic (Fell et al. 1992).
Bullera Derx, AnnIs Mycol. 28, 11 (I930).
Thirteen species are listed in Boekhout (I991b).
Teleomorph: Bulleromyces.
Vegetative reproduction is by polar budding, rotationally or bilaterally symmetri-
cal ballistoconidia, hyphae, and pseudohyphae. The species contain xylose in the
cell wall and have CoQ-10. The dikaryophase of B. variabilis has a dolipore with a
parenthesome made up of U-shaped vesicles (Tremellales type; Boekhout et al.,
1991). The species have been isolated mainly from leaves, but also from fruit,
plants, larvae of Buprestid beetles, wood, frozen salmon, air, etc.
Mating, followed by formation of dikaryotic hyphae with clamp connections
and pro basidium-like structures has been observed in B. variabilis (Boekhout et al.
1991). Bullera alba seems phylogenetically close to Cryptococcus (Fell et al. 1992).
Recently, species with bilaterally symmetrical ballistoconidia have been trans-
ferred to Udeniomyces (Nakase and Takematsu 1992).
Cryptococcus Kiitzing, Linnaea, 371 (I833).
Thirty-eight species are listed in Barnett et al. (I990).
Recently additional species have been added (Chernov and Bab'eva 1988; Fonseca
and Van Uden 1991; Vaughan-Martini 1991; Vishniac and Kurtzman 1992).
Vegetative reproduction usually is by polar budding, and, more rarely by
pseudohyphae and hyphae. Ballistoconidia are absent. The species contain xylose
in the cell wall and have CoQ-8, -9 or-l0. Septa of C. laurentii have dolipores
without parenthesomes (Rhodes et al. 1981). The species have been isolated from
diverse substrates such as soil, fruit, water, man, animals, wine, leaves, fungi.
Apiotrichum Stautz is considered a synonym of Cryptococcus (Golubev 1981;
Weijman et al. 1988; Barnett et al. 1990). Mating, followed by formation of hyphae
and chlamydospore-like structures has been observed to occur in C. laurentii

(Kurtzman 1973). The genus seems phylogenetically heterogeneous based on par-
tial28S rRNA sequences (Fell et al. 1992).
Cryptococcus flavus and C. tsukubaensis are amylolytic (de Mot et al. 1984b).
Cryptococcus laurentii (Ratledge and Evans 1989) and Cryptococcus curvatus have
been reported to accumulate large amounts of lipids (Ratledge 1978, 1982, 1986;
Park et al. 1990), using whey as a substrate (c. curvatus; Ykema et al. 1988, 1989a).
Mutants of this latter species able to produce cocoa butter equivalents have been
described (Ykema et al. 1989b). It has been suggested that strain IFO 1322 (= CBS
4567) of C. albidus (= c. terricolus) may be useful for single-cell oil production
(Boulton and Ratledge 1984).
Degradation of phenol by an immobilized mixed culture of C. elinovii and
Pseudomonas putida has been reported (Zache and Rehm 1989). Utilization of a
variety of aromatic compounds was reported for C. diffluens (as C. albidus var.
diffluens), C. terreus (Mills et al. 1971), C. humicolus, and C. laurentii
(Middelhoven et al. 1992). Several species, e.g., C. flavus, c. laurentii and C.
luteolus form ~-carotene as the main pigment, but lycopene and y-carotene are
formed as well (Valadon 1976).
Fellomyces Yamada and Banno, J. Gen. Appl. Microbiol. 30, 524 (1984).
Four species: F. juzhouensis (Yue) Yamada et Banno, F. horovitziae Spaaij et al., F.
penicillatus (Rodrigues de Miranda) Yamada et Banno, F. polyborus (D.B. Scott et
van der Walt) Yamada et Banno.
Vegetative reproduction is by budding and by conidia formed on stalks.
Ballistoconidia are absent, but pseudohyphae may be present. The species contain
xylose in the cell wall (Yamada et al. 1988) and have CoQ-10. Isolated from diverse
substrates, such as food, flowers, tree, and fungi.
Based on partial ribosomal RNA sequences, a considerable heterogeneity
has been observed among heterobasidiomycetous yeasts forming conidia on
stalks (Yamada et al. 1989a; Gueho et al. 1990). Mainly according to biochemical
characteristics (composition of extracellular carbohydrates, CoQ) five genera are
currently distinguished that form stalked conidia, namely Fellomyces,
Kurtzmanomyces, Sterigmatomyces, Tsuchiyaea, and Kockovaella.
Itersonilia Derx, Bull. Bot. Gdn Buitenzorg, Ser. 3, 17,471 (1948).

One species: 1. Perplexans Derx.
Vegetative reproduction of the yeast stage usually is by polar budding, and more
rarely by ballistoconidia. Dikaryotic hyphae have damp connections, chlamy-
dospores, teliospore-like cells, and form ballistoconidia. Monokaryotic hyphae
form incomplete clamp connections. The species contains xylose in the cell wall
and has CoQ-9. Commonly isolated from leaves. Itersonilia perplexans is reported
to be a plant pathogen (Channon 1956, 1963; Gandy 1966).
Kockovaella Nakase et aI., J. Gen. Appl. Microbiol. 37, 178 (1991).

Two species: K. imperatae Nakase et aI., K. thailandica Nakase et al.
Vegetative reproduction is by formation of conidia on stalks, ballistoconidia and,

more rarely, by budding. Hyphae and pseudohyphae are absent. The species con-
tain xylose in the cell wall and have CoQ-10 (Nakase et al.1991). The species have
been isolated from leaves.
The genus Kockovaella forms conidia on stalks, and ballistoconidia. Because of
the presence of xylose, an affilation is inferred with the Tremellales (Boekhout et
al. 1993a).
Kurtzmanomyces Yamada et al., J. Gen. Appl. Microbiol. 34, 505 (1988).
Two species: K. nectairii (Rodrigues de Miranda) Yamada et al., K. tardus
Gimenez-Jurado et van Uden.
Vegetative reproduction is by conidium formation on stalks. Ballistoconidia and
pseudohyphae are absent. The species lack xylose in the cell wall and have CoQ-10
(Yamada et al. 1988). The species has been isolated from cheese and water.
Malassezia Baillon, Traite Bot. Med. Cryptog., P. 243, O. Doin, Paris (1889).
Three species: M. furfur (Robin) Baillon, M. pachydermatis (Weidman) Dodge, M.
sympodialis R.B. Simmons et Gueho.
Vegetative reproduction is by monopolar and more rarely by sympodial budding
(M. sympodialis). Ballistoconidia, hyphae and pseudohyphae are absent. The spe-
cies are characterized by lack of xylose in the cell wall and have CoQ-9 (Hamamoto
et al. 1992). The species have been isolated mainly from medical sources, dandruff,
ears of dogs etc.
Species of Malassezia are of medical importance. Malassezia furfur and M.
sympodialis require the addition of olive oil or long-chain fatty acids in the culture
medium.
Phaffia Miller et al., Int. J. Syst. Bact. 26, 287 (1976).
One species: P. rhodozyma Miller et al.
Vegetative reproduction is by polar budding. Ballistoconidia and hyphae are ab-
sent, but spherical chlamydospores may be present. The species contains xylose in
the cell wall (Sugiyama et al. 1985) and has CoQ-lO (Yamada and Kawasaki 1989b).
Phaffia rhodozyma ferments D-glucose (Miller et al. 1976). Partial 18S rRNA
nucleotide sequences suggest that the genus is phylogenetically distinct from
Cryptococcus (Yamada and Kawasaki 1989b). The species produces the carotenoid
pigment astaxanthin, and is used as a dietary pigment source of salmonids,
crustaceans, and chickens (Johnson et al. 1977, 1980). Recently, mutants with an
increase in pigment production have been isolated (An et al. 1989; Lewis et al.
1990).
Rhodotorula F.C. Harrison, Trans. R. Soc. Can., Sect. 3, 21, 349 (1927).
Thirty-three species are listed by Barnett et al. (1990). Vegetative reproduction
usually is by polar budding. Ballistoconidia are absent, but hyphae and
pseudohyphae may be present. The species lack xylose in the cell wall, but fucose
and rhamnose may be present. They have CoQ-9,-10 or -10 (H 2 ). The species have
been isolated from a wide range of substrates.
Rhodotorula in its present circumscription seems phylogenetically heteroge-

neous, as can be concluded from the species distribution among the dendrograms
based on partial rRNA sequences (Fell et al. 1992).
Many Rhodotorula species form torulene or torularhodine as the main pigment,
but y-carotene and ~-carotene are usually present as well and some species also
form neurosporene and/or lycopene (Valadon 1976).
Degradation of phenol is reported for R. glutinis var. glutinis (Nei 1971a,b) and
R. rubra (Katayama-Hirayama et al. 1991). Rhodotorula glutinis, R. minuta, R.
rubra, and R. aurantiaca are reported to utilize a variety of aromatic compounds
(Mills et al. 1971; Middelhoven et al. 1992). Rhodotorula graminis, R. glutinis var.
glutinis, R. gracilis and R. mucilaginosa are oleaginous (Nilsson et al. 1943;
Ratledge 1978, 1982, 1986; Ratledge and Hall 1979; Ratledge and Evans 1989; Rolph
et al. 1989). Two extracellular lipases are secreted by R. rubra (as R. pilimanae;
Muderhwa et al. 1986).
Sporobolomyces Kluyver et van Niel, Centbl. Bakt. Parasitenk., Abt. 2, 63, 19
(1924).
Eighteen species are listed by Boekhout (1991b).
Vegetative reproduction is by polar budding and ballistoconidia, but hyphae and
pseudohyphae may be present as well. The species lack xylose in the cell wall, but
fucose may be present. They have CoQ-10 or CoQ-lO (H2 ). The species occur
mainly in the phyllosphere, but have been isolated from a wide range of other
substrates.
Partial rRNA nucleotide sequences suggest phylogenetic heterogeneity of the
genus in its present delimitation (Fell et al. 1992). Sporobolomyces rose us contains
torularhodine as its main pigment, but torulene and J3-carotene occur as well
(Valadon 1976).
Sterigmatomyces Fell, Antonie van Leeuwenhoek J. Microbiol. 32, 101 (1966).
Two species: S. elviae Sonck et Yarrow, S. halophilus Fell.
Vegetative reproduction is by budding on stalks (Fig. 20). Ballistoconidia, hyphae,
and pseudohyphae are absent. The species lack xylose in the cell walls, and have
CoQ-9. The species have been isolated from diverse substrates, e.g., man, pastry,
and soil.
Sympodiomycopsis J. Sugiyama et al., Antonie van Leeuwenhoek J. Microbiol. 59,
99 (1991).
One species: S. paphiopedili J. Sugiyama et al.
Vegetative reproduction is by polar, annellidic, and sympodial budding.
Ballistoconidia are absent. Hyphae are present and have diaphragm a-like septa
with a central pore (Suh et al. 1993). The species contains trace amounts of xylose
in the cell wall and has CoQ-10 (Sugiyama et al. 1991). The species has been
isolated from orchid nectar.
Tilletiopsis Derx, Annls Mycol. 28, 3 (1930).
Six species are listed by Boekhout (1991b).
(:)
Q'
o
o
o
Fig. 20. Vegetative reproduction on stalks in Sterigmatomyces halophilus (CBS 5632, 7d

YPGA)
Vegetative reproduction of the yeast stage usually is by polar budding. Hyphae

and ballistoconidia are present. The species lack xylose in the cell wall and have
CoQ-10. The species mainly occur on leaves, but have been isolated from other
sources as well, e.g., fungi, man, etc. Tilletiopsis pallescens is being tested as an
antagonist for use in biological control of powdery mildews.
Trichosporon Behrend, Bed. Klin. Wschr. 21,467 (1890).
Nineteen species are listed by Gueho et al. (1992).
Vegetative reproduction is by budding and arthroconidia. Ballistoconidia are
absent, but hyphae are present. Septa have dolipores or micropore-like structures.
Parenthesomes, if present, are tubular (Gueho et al. 1992). The species contain
xylose in the cell wall (Weijman 1979) and have CoQ-9 or -10 (Gueho et al.
1992).
Because of recent changes in species concepts the observations reported below
may refer to different taxa. Sarcinosporon King & Tong is considered a synonym of
Trichosporon Behrend (Gueho et al. 1992). Several species of Trichosporon are of
medical importance.
Trichosporon pullulans degrades starch and pullulan due to the production of
a-amylase and glucoamylase(s) (De Mot et al. 1984b; De Mot and Verachtert 1986).
Two lactose hydrolases have been characterized from T. cutaneum (West et al.
1990), and degradation of phenol is reported for this species (Shoda and Udaka
1980; Neujahr and Varga 1970; Mills et al. 1971). Trichosporon cutaneum, T.
moniliiforme, and T. dulcitum are found to assimilate a wide variety of aromatic
compounds (Reiser et al. 1990; Middelhoven et al. 1992). Trichosporon beigelii is
able to utilize cheese whey as a carbon and energy source for biomass production.
Trichosporon cutaneum and T. pullulans are able to accumulate substantial

amounts oflipid (Ratledge 1978, 1982, 1986; Ratledge and Evans 1989). Addition of
sodium chloride was found to increase lipid production in T. beigelii, which makes
this species a potential candidate for single-cell oil production (Tahoun et al.
1987). A transformation system has been developed for T. cutaneum (Reiser et al.
1990, see Chap. 13, this Vol.).
Tsuchiyaea Yamada et al., J. Gen. Appl. Microbiol. 34, 509 (1988).
One species: T. wingfieldii (van der Walt et al.) Yamada etal.
Vegetative reproduction is by budding and conidium formation on stalks.
Ballistoconidia and pseudohyphae are absent. The species contains xylose in the
cell wall and has CoQ-9 (Yamada et al. 1988). It has been isolated from frass of a
Scolytid beetle.
Some Notes on Vanrija and Anamorphs of Smuts
Vanrija R.T. Moore, Bot. Mar. 23, 367 (1980).
This genus has been introduced to accommodate certain basidiomycetous Can-
dida species (Moore, 1980, 1987). The genus in its present circumscription seems
heterogeneous as it comprises species lacking xylose (e.g., Vanrija antarctica), and
species containing xylose in their cell walls (e.g., Vanrija curvata and V. nivalis).
Consequently, several of the species are better maintained in genera like Crypto-
coccus, Mrakia, and Leucosporidium.
Anamorphs of Ustilaginales (Smuts)
Several basidiomycetous yeast-like organisms, classified as diversely as Candida
(Sporobolomyces, Vanrija) antarctica (Goto et al.) Kurtzman et al. Candida
107, Sterigmatomyces aphidis Henniger & Windisch, Trichosporon oryzae Ito et al.,
and Pseudozyma prolifica Bandoni, most likely represent anamorphs of Ustilag-
inales (Boekhout 1987). The taxonomy of this group of organisms urgently needs
revision. Partial 28S ribosomal RNA sequences of Candida (Sporobolomyces)
antarctica suggest a position rather close to Malassezia (Fell et al. 1992).
Candida 107 (NCYC 911), which appparently is closely related to or identical
with C. antarctica, accumulates large amounts of fatty acids (ca. 41 % of the
dry weight, and ca. 40 % of the total fatty acid content as saturated triglycerides;
Gill et al. 1977). Candida (Vanrija, Sporobolomyces) antarctica is reported to
produce extracellular mannosylerythritollipids when grown on soybean oil as a
carbon source (Kitamoto et al. 1990a,b). The industrial synthesis of glucoside
esters by B lipase from C. antarctica is in development (Bjorkling et al. 1991).
7
Appendix
7.1
Media
Many of these media are commercially available. (* Recipe given below)

General media
• Malt extract agar (MEA, Difco) *
• Potato-dextrose agar (PDA, Difco) *
• Yeast extract-peptone-glucose agar (YPGA) *
• Yeast extract-malt extract-agar (YMA, Difco) *
• Yeast morphology agar (YMoA, Difco)
Media for ballistoconidium formation

• Corn meal agar (CMA, Difco)
• Yeast morphology agar (YMoA, Difco)
Sporulation media commonly used for ascomycetous yeasts

• Gorodkowa agar *
• 2% or 5% Malt extract-3% agar (MEA, Difco) *
• McClary's acetate agar *
• V8 juice agar and diluted V8 juice agar *
• YM agar and diluted YM agar *
Media used for mating of basidiomycetous yeasts

• Conjugation medium according to Flegel (modified) *
• 5% Malt extract agar (MEA, Difco) *
• V8 juice agar *
• Malt extract-yeast extract-peptone agar *
Filobasidiella (Cryptococcus) neoformans requires specific media

for induction of the teleomorph
• Hay infusion agar (Know-Chung and Bennett 1978) *
• Pigeon manure agar (Staib 1981) *
• Sunflower seed agar (Pal et al. 1991) *
Media for endospore formation

• Yeast extract-malt extract agar (YMA, Difco) *
Medium for chlamydospore formation in Candida albicans

• Rice agar (Difco) *
7.2
Recipes of Some Media
Conjugation medium after Flegel (modified)
O.5%w/v glucose, 0.1 %w/v (NH4)2S04' 0.02%w/v MgS04.7H20, 0.01 %w/v CaCl2,
1.5%w/v agar in distilled water. After sterilization, 0.01 vlv of a sterile vitamin
solution is added.
Gorodkowa agar
0.5%w/v NaCl, 0.1 %w/v glucose, 1%w/v peptone, 3%w/v agar in distilled water.
Hay infusion agar

50.0 g of partially decomposed hay is added to 1000 ml distilled water. After auto-
claving and filtering, the volume is adjusted to 1000ml, after which 0.2%w/v
K2HP0 4 and 1.5%w/v agar is added.
Ma/assezia furfur and M. sympodia/is agar (Leeming and Notman medium)

1% w/v peptone, 0.5% w/v glucose, 0.01% w/v yeast extract, 0.4% w/v desiccated
oxbile, 0.1 % v/v glycerol, 0.05% w/v glycerol monostearate, 0.05% v/v Tween 60,
1% vlv high fat cow's milk, 1.5% w/v agar in distilled water.
Malt extract agar (MEA)

2 to 5% w/v malt extract, 3% w/v agar in distilled water
Malt extract-yeast extract-pepton agar

1.5% w/v malt extract, 0.05% w/v yeast extract, 0.25% w/v pepton, 3% w/v agar in
distilled water.
McClary's acetate agar

O.I%w/v glucose, 0.12%w/v NaCl, 0.98%w/v KC 2H0 2, 0.07%w/v MgS0 2.7H20,
0.25w/v yeast extract, 2%w/v agar in distilled water.
Pigeon manure agar (Staib 1981)

100 g of pigeon manure is added to 900 ml distilled water, and magnetically stirred
for 1 h. After several filtrations, the filtrate is passed through a membrane filter
(pore size 0.2 Jlm). 40Uml- 1 penicillin G and 80Uml- 1 streptomycin are added.
Equal volumes of pigeon manure filtrate (ca. 40 DC) and 4% nutrient-free agar of ca.
60°C are mixed, after which the pH is adjusted to 6.2.
Potato-dextrose agar (PDA)

100 g scrubbed and diced potatoes are added to 300 ml distilled water, and placed
overnight at 4 DC. After filtration through filter paper, the filtrate is sterilized
(120°C, 20 min). 230 ml potato extract, 20 g glucose and 20 g agar are added to
770ml distilled water, and sterilized 20 min at no°c.
Sunflower seed agar (Pal et al. 1991)

22 g of ground sunflower seed are boiled in 400 ml distilled water for 1 h. After
filtration through cheese cloth the volume is adjusted to 1000 ml, to which 0.01%
w/v KH2P0 4, 0.005%w/v MgS04' and 2%w/v agar are added.
Rice agar
2 g of peeled rice are boiled in 100 ml distilled water for 45 min. After filtration
through cheese cloth, the volume is adjusted to 100ml, and 2%w/v agar is added.
V8 juice agar
Add 40g bakers yeast to 100ml V8 juice (Campbell Soup Co.; pH 6.8). After
steaming (10 min) and filtration, adjust the volume and pH to 6.S. Melt 2% w/v agar
in 100 ml distilled water and add to VS juice.
Vitamin solution (Wickerham 1951)
20pg Biotin, 2pg folic acid, 2mg calcium pantothenate, lOmg m-inositol, 400mg
niacin, 200pg p-aminobenzoic acid, 440pg pyridoxine-HCl, 200pg riboflavine,
and 400 pg thiamine HCl are added to 1000 ml distilled water and filter-sterilized.
For easy preparation, a stock solution is 1000x concentrated, and subsequently
diluted.
Yeast extract-peptone-glucose agar (YPGA)

4% w/v glucose, 0.5% w/v peptone, 2% w/v agar and 1% w/v yeast extract in dis-
tilled water (or 50% yeast infusion with 50% distilled water).
Yeast extract-malt extract agar (YMA)

0.05%w/v yeast extract-0.7%w/v malt extract-O.l%w/v peptone-3%w/v agar in
distilled water.
Yeast infusion
Suspend 1 kg baker's yeast in 51 demineralized water. Add egg white of two eggs
and shake well, sterilize at 120°C, filter directly, and dispense in bottles. Sterilize
again and filter the yeast infusion just prior to use.
7.3
Culture Collections
Yeast strains can be obtained from a number of culture collections. The most
important are listed below:
• ATCC, American Type Culture Collection, 12301 Parldawn Drive, Rockville,

Maryland 20852-1776, USA.
• CBS, Yeast Division, Julianalaan 67, 2628 BC Delft, The Netherlands.
• DSM, Deutsche Sammlung von Mikroorganismen und Zellkulturen,
Mascheroder Weg lB, Braunschweig, Germany.
• IFO, Institute of Fermentation, 17-85, Juso-honmachi 2-chome, Yodogawa-ku,
Osaka 532, Japan.
• JCM, Japan Collection of Microorganisms, Riken, Wako-shi, Saitama 351-01,
Japan.
• MUCL, Mycotheque de l'Universite Catholique de Louvain, Place Croix du Sud 3,
l348 Louvain-Ia-Neuve, Belgium.
• NCYC, National Collection of Yeast Cultures, AFRC Institute of Food Research,
Colney Lane, Norwich NR4 7UA, UK.
• NRRL, ARS Culture Collection, National Center for Agricultural Utilization Re-
search, USDA, ARS, 1815 North University Street, Peoria, Illinois 61604, USA.
• PYC, Portuguese Yeast Collection, Centro de Biologfa, Instituto Gulbenkian de
Ciencia, Rua da Quinta Grande, Apartado 14,2781 Oeiras, Portugal.
• VKM, All-Union Collection of Microorganisms, Institute of Biochemistry and
Physiology of Microorganisms, Pushchino on the Oka, Russia.
• Yeast Genetics Stock Center, Department of Biophysics and Medical Physics,
University of California, Berkeley, California 94720, USA.
Acknowledgments. Wilma Batenburg-van der Vegte and Annette Beijn kindly

assisted in the preparation of the plates, for which they are thanked.
References
An G-H, Schuman DB, Johnson EA (1989) Isolation of Phaffia rhodozyma mutants with
increased astaxanthin content. Appl Environ Microbiol55: 116-124
Anand R, Southern EM (1988) Pulsed field electrophoresis. In: Rickwood D, Hames BD
(eds) Gel electrophoresis of nucleic acids. A practical approach. IRL Press, Oxford, pp
101-123
Aulakh HS, Straus SE, Kwon-Chung KJ (1981) Genetic relatedness of Filobasidiella
neoformans (Cryptococcus neoformans) and Filobasidiella bacillispora (Cryptococcus
bacillisporus) as determined by deoxyribonucleic acid composition and sequence ho-
mology studies. Int J Syst Bacteriol31: 97-103
Bakalinsky AT, Snow R (1990) The chromosome constitution of wine strains of Saccharo-
myces cerevisiae. Yeast 6: 367-382
Bandoni RJ (1963) Conjugation in Tremella mesenterica. Can J Bot 41: 467-474
Bandoni RJ (1984) Tremellales with a yeast phase (Sirobasidiaceae and Tremellaceae) In:
Kreger-van Rij NJW (ed) The yeasts, a taxonomic study, 3rd edn. Elsevier, Amsterdam,
pp 541-544
Bandoni RJ, Johri BN (1972) Tilletiaria: a new genus in the Ustilaginales. Can J Bot 50:
39-43
Bandoni RJ, Lobo KJ, Brezdan SA (1971) Conjugation and chlamydospores in
Sporobolomyces odorus. Can J Bot 49: 683-686
Banno I (1967) Studies on the sexuality of Rhodotorula. J Gen Appl Microbiol13: 167-196
Barlogie B, Spitzer G, Hart JS, Johnston DA, Buchner T, Schumann J, Drewinko B (1976)
DNA histogram analysis of human hemopoietic cells. Blood 48: 245-258
Barnett JA (1968) Biochemical differentiation of taxa with special reference to the yeasts.
In: Ainsworth GC, Sussman AS (eds) The fungi, vol 3. Academic Press, London, pp 557-
595
Barnett JA (1977) The nutritional tests in yeast systematics. J Gen Microbiol 99: 183-190
Barnett JA, Payne RW, Yarrow D (1990) Yeasts: characteristics and identification. Cam-
bridge University Press, Cambridge
Batra LR (1973) Nematosporaceae (Hemiascomycetidae): taxonomy, pathogenicity, distri-
bution, and vector relations. Tech Bull US Dep Agric 1469: 1-71
Bauer R (1987) Uredinales - germination ofbasidiospores and pycnospores. Stud Mycol30:
111-125
Bergkamp RJM, Kool 1M, Geerse RH, Planta RJ (1992) Multiple-copy integration of the (X-
galactosidase gene from Cyamopsis tetragonoloba into the ribosomal DNA of
Kluyveromyces lactis. Curr Genet 21: 365-370
Bjorkling F, Godtfredsen SE, Kirk 0 (1991) The future impact of industriallipases. Tibtech
9:360-363
Bjorling T, Lindman B (1989) Evaluation of xylose-fermenting yeasts for ethanol production
from spent sulfite liquor. Enzym Microb Technol11: 240-246
Boekhout T (1987) Systematics of anamorphs of Ustilaginales (smut fungi) - a preliminary
survey. Stud Mycol30: 137-149
Boekhout T (1991a) Systematics of Itersonilia: a comparative phenetic study. Mycol Res 95:
135-146
Boekhout T (1991b) A revision ofballistoconidia-forming yeasts and fungi. Stud Mycol33:
1-194
Boekhout T, Bosboom RW (1994) Karyotyping of Malassezia yeasts: taxonomic and epide-
miological implications. Syst Appl Microbiol17: 146-153
Boekhout T, Fonseca A, Batenburg-van der Vegte WH (1991) Bulleromyces genus novum
(Tremellales), a teleomorph for Bullera alba, and the occurrence of mating in Bullera
variabilis. Antonie van Leeuwenhoek J Microbiol59: 81-93
Boekhout T, Kurtzman CP, O'Donnell K, Smith MT (1994) Phylogeny of the yeast genera
Mansemiaspura (anamorph Klueckera), Dekkera (anamorph Brettanomyces), and
Eeniella as inferred from partial 26S ribosomal DNA nucleotide sequences. Int J Syst
Bact 44: 781-786
Boekhout T, Yamada Y, Weijman ACM, Roeijmans HJ, Batenburg-van der Vegte WH (1992)
The significance of coenzyme Q, carbohydrate composition and ultrastructure for the
taxonomy ofballistoconidia-forming yeasts and fungi. Syst Appl Microbiol15: 1-10
Boekhout T, Fonseca A, Sampaio J-p, Golubev WI (1993a) Classification of
heterobasidiomycetous yeasts: characteristics and affiliation of genera to higher taxa of
heterobasidiomycetes. Can J Microbiol 39: 276-290
Boekhout T, Renting M, Scheffers WA, Bosboom R (1993b) The use ofkaryotyping in the
systematics of yeasts. Antonie van Leeuwenhoek J Microbiol63: 157-163
Boulton CA, Ratledge C (1984) Cryptococcus terricolus, an oleaginous yeast re-appraised.
Appl Microbiol Biotechnol20: 72-76
Britten RJ, Pavich M, Smith J (1970) A new method for DNA purification. Yearb Carnegie
Inst 68: 400-402
Britten RJ, Graham DE, Neufeld BR (1974) Analysis of repeating DNA sequences by
reassociation. In: Grossman L, Moldave K (eds) Methods in enzymology, vol 29, Nucleic
acids and protein synthesis. Academic Press, New York, pp 363-418
Bruns TD, White TJ, Taylor JW (1991) Fungal molecular systematics. Annu Rev Ecol Syst 22:
525-564
Bucknolz RG, Gleeson MAG (1991) Yeast systems for the commercial production ofheter-
ologous proteins. Bio/technology 9: 1067-1072
Buttner R, Bode R, Birnbaum D (1991) Characterization of extracellular acid phosphatases
from the yeast Arxula adeninivorans. Zentralbl Mikrobiol146: 399-406
Carle GF, Olson MV (1985) A karyotype for yeast. Proc Natl Acad Sci USA 82: 3756-3760
Casselton LA, Mutasa ES, Tymon A, Mellon FM, Little PFR, Taylor S, Benhagen J, Stratman
R (1989) The molecular analysis ofbasidiomycete mating type genes. In: Nevalainen H,
Penttila M (eds) Proc EMBO-Alko Workshop Molec. BioI Filamentous Fungi. Found
Biotech Ind Ferm Res 6: 139-148
Channon AG (1956) Association of a species of Itersonilia with parsnip canker in Great
Britain. Nature (Lond) 178: 217
Channon AG (1963) Studies on parsnip canker I. The causes of the diseases. Ann Appl BioI
51: 1-15
Chernov IY, Bab'eva IP (1988) New species Cryptococcus yeast from tundra soil.
Mikrobiologiya 57: 1031-1034
Claisse ML, Pen!-Aubert GA, Clavillier LP, Slonimski P (1970) Methodes d'estimation de la
concentration des cytochromes dans les cellules entieres de levures. Eur J Biochem 16:
430-438
Clare JJ, Rayment FB, Ballantine SP, Sreekrishna K, Romanos MA (1991) High-level expres-
sion of tetanus toxin fragment C in Pichia pastoris strains containing multiple tandem
integrations of the gene. Bio/technology 9: 455-460
Cole GT (1983) Graphiola phoenicis: a taxonomic enigma. Mycologia 75: 93-116
Coleman AW, Maguire MJ, Coleman JR (1981) Mithramycin- and 4'-6'diamidino-2-
phenylindole (DAPI)-DNA staining for fluorescence micro spectrophotometric mea-
surement of DNA in nuclei, plastids, and virus particles. J Histochem Cytochem 29:
959-968
Cook PR (1984) A general method for preparing intact nuclear DNA. EMBO J 3: 1837-1842
Cook WL, Massey JK, Ahearn DG (1973) Degradation of crude oil by yeasts and its effects on
Lesbistes reticulatus. In: Ahearn DG, Meyers SP (eds) The microbial degradation of oil.
Louisiana State University, Baton Rouge, pp 279-282
Cottrell M, Kock JLF, Lategan PM, Britz TJ (1986) Long-chain fatty acid composition
as an aid in the classification of the genus Saccharomyces. Syst Appl Microbiol 8: 166-
168
Cox DE (1976) A new homobasidiomycete with anomalous basidia. Mycologia 68: 481-510
Cregg JM, Vedvick TS, Raschke WC (1993) Recent advances in the expression of foreign
genes in Pichia pastoris. Bio/technology 11: 905-910
Cryer DR, Eccleshall R, Marmur J (1975) Isolation of DNA. In: Prescott DM (ed) Methods in
cell biology, vol 12. Academic Press, New York, pp 39-44
Dear PH, Cook PR (1991) Cellular gels, purifying and mapping long DNA molecules.
Biochem J 273: 695-699
de Hoog GS, Rantio-Lehtimiiki AH, Smith MTh (1985) Blastobotrys, Sporothrix and
Trichosporiella: generic delimitation, new species, and a Stephanoascus teleomorph.
Antonie van Leeuwenhoek J Microbiol51: 79-109
de Hoog GS, Smith MTh, Gueho E (1986) A revision of the genus Geotrichum and its
teleomorphs. Stud Mycol29: 1-131
de Jonge P, de Jongh FCM, Meijers R, Steensma HY, Scheffers WA (1986) Orthogonal-
field-alternation gel electrophoresis banding patterns of DNA from yeasts. Yeast 2: 193-
204
Dekker RFH (1982) Ethanol production from D-xylose and other sugars by the yeast
Pachysolen tannophilus. Biotechnol Lett 4: 411-416
Dellweg H, Rizzi M, Methner H, Debus D (1984) Xylose fermentation by yeasts 3. Compari-
son of Pachysolen tannophilus and Pichia stipitis. Biotechnol Lett 6: 395-400
De Mot R, Verachtert H (1985) Purification and characterization of extracellular amylolytic

enzymes from the yeast Filobasidium capsuligenum. Appl Environ Microbiol50: 1474-
1482
De Mot R, Verachtert H (1986) Secretion of a-amylase and multiple forms of glucoamylase
by the yeast Trichosporon pullulans. Can J Microbiol32: 47-51
De Mot R, Andries K, Verachtert H (1984a) Comparative study of starch degradation and
amylase production by ascomycetous yeast species. Syst Appl Microbiol5: 106-118
De Mot R, Demeersman M, Verachtert H (1984b) Comparative study of starch degradation
and amylase production by non-ascomycetous, yeast species. Syst Appl Microbiol 5:
421-432
Detroy RW, Cunningham RL, Bothast RJ, Bagby MO, Herman A (1982) Bioconversion of
wheat straw cellulose/hemicellulose to ethanol by Saccharomyces uvarum and
Pachysolen tannophilus. Biotech Bioeng 24: 1105-1113
Diddens HA, Lodder J (1942) Die anaskosporogenen Hefen, zweite Hiilfte. Noord-Hollandse
Uitgevers Maatschappij, Amsterdam
Dixon R, Kinghorn JR (1990) Separation oflarge DNA molecules by pulsed-field gel electro-
phoresis. Soc gen Microbiol Quart 17: 86-88
Dobzhansky T (1976) Organismic and molecular aspects of species formation. In: Ayala FJ
(ed) Molecular evolution. Sinauer, Sunderland, pp 95-105
Eilam T, Bushnell WR, Anikster Y, McLaughlin DJ (1992) Nuclear DNA content of basid-
iospores of selected rust fungi as estimated from fluorescence of propidium iodide-
stained nuclei. Phytopathology 82: 705-712
Ellis DH, Pfeiffer TJ (l990) Natural habitat of Cryptococcus neoformans var. gattii. J Clin
Microbiol28: 430-431
Ellis DH, Pfeiffer T (1992) The ecology of Cryptococcus neoformans. Eur J Epidemiol8: 321-
325
Evans CT, Ratledge C (1984a) Effect of nitrogen source on lipid accumulation in oleaginous
yeasts. J Gen Microbiol130: 1693-1704
Evans CT, Ratledge C (1984b) Influence of nitrogen metabolism on lipid accumulation by
Rhodosporidium toruloides CBS 14. J Gen Microbiol130: 1705-1710
Ezaki T, Hashimoto Y, Yabuuchi E (1989) Fluorometric deoxyribonucleic acid-deoxyribo-
nucleic acid hydridization in microdilution wells as an alternative to membrane filter
hybridization in which radioisotopes are used to determine genetic relatedness among
bacterial strains. Int J Syst Bacteriol39: 224-229
Fell JW (1984) Teliospore-forming yeasts. In: Kreger-van Rij NJW (ed) The yeasts, a taxo-
nomic study, 3rd edn. Elsevier, Amsterdam, pp 491-495
Fell JW (l970) Yeasts with heterobasidiomyctous life cycles. Chap 3. In: Ahearn DG (ed)
Recent trends in yeast research. School of arts and sciences, Georgia State University,
Atlanta, pp 49-66
Fell JW, Statzell Tallman A (1989a) Leucosporidium Fell, Statzell, Hunter & Phaff. In:
Kreger-van Rij NJW (ed) The yeasts, a taxonomic study, 3rd edn. Elsevier, Amsterdam,
pp 496-508
Fell JW, Statzell Tallman A (1984b) Rhodosporidium Banno. In: Kreger-van Rij NJW (ed)
The yeasts, a taxonomic study, 3rd edn. Elsevier, Amsterdam, pp 509-531
Fell JW, Statzell AC, Hunter IL, Phaff HJ (l969) Leucosporidium gen. n., the
heterobasidiomycetous stage of several yeasts of the genus Candida. Antonie van
Leeuwenhoek J Microbiol 35: 433-462
Fell JW, Statzell-Tallman A, Lutz MJ, Kurtzman CP (1992) Partial rRNA sequences in
marine yeasts: a model for identification of marine eukaryotes. Mol Mar BioI Biotechnol
1: 175-186
Felsenstein J (1988) Phylogenies from molecular sequences: inference and reliability. Annu
Rev Genet 22: 521-565
Fiol JB, Claisse M (1987) Les cytochromes des Kluyveromyces: determination et implications
systematiques. Mycopathologia 78: 177-184
Fleer R, Yeh P, Amellal N, Maury I, Fournier A, Bacchetta F, Baduel P, Jung G, L'Hote H,

Becquart J, Fukuhara H, Mayaux JF (1991) Stable multicopyvectors for high-level secre-
tion of recombinant human serum albumin by Kluyveromyces yeasts. Bio/technology 9:
968-975
Flegel TW (1977) Let's call a yeast a yeast. Can J Microbiol23: 945-946
Flegel TW (1981) The pheromonal control of mating in yeasts and its phylogenetic implica-
tion: a review. Can J Microbiol27: 373-389
Fonseca A, Sampaio JP (1992) Rhodosporidium lusitaniae sp. nov., a novel homothallic
basidiomycetous yeast species from Portugal that degrades phenolic compounds. Syst
Appl Microbiol15: 47-51
Fonseca A, van Uden N (1991) Cryptococcus yarrowii sp. nov., a novel yeast species from
Portugal. Antonie van Leeuwenhoek J Microbiol59: 177-181
Foster LM, Kozak KR, Loftus MG, Stevens JJ, Ross IK (1993) The polymerase chain reaction
and its application to filamentous fungi. Mycol Res 97: 769-781
Franke AE, Kaczmarek FS, Eisenhard ME, Geoghegan KF, Danley DE, De Zeeuw JR,
O'Donnell MM, Gollaher MG, Davidow LS (1988) Expression and secretion of bovine
prochymosin in Yarrowia lipolytica. Dev Ind Microbiol 29: 43-57
Furukawa T, Ogino T, Matsuyoshi T (1982) Fermentative production of citric acid from n-
paraffins by Saccharomycopsis Lipolytica. J Ferment Technol60: 281-286
Fuson GB, Presley HL, Phaff HJ (1987) Deoxyribonucleic acid base sequence
relatedness among members of the yeast genus Kluyveromyces. Int J Syst Bacteriol 37:
371-379
Gams W, Grinbergs J (1970) Ascoidea corymbosa n. spec., ein hefeiihnlicher Pilz im Bast von
Araucaria araucana. Acta Bot Neerl19: 794-798
Gandy DG (1966) Itersonilia perplexans on chrysanthemums: alternative hosts and ways of
overwintering. Trans Br Mycol Soc 49: 499-507
Gardiner K (1991) Pulsed field gel electrophoresis. Anal Chern 63: 658-665
Gardner Dq, Heale SM, Stateva LI, Oliver SG (1993) Treatment of yeast cells with wall lytic
enzymes is not required to prepare chromosomes for pulsed-field gel analysis. Yeast 9:
1053-1055
Gellissen G, Melber K, Janowicz ZA, Dahlems UM, Weydemann U, Piontek M, Strasser
AWM, Hollenberg CP (1992) Heterologous protein production in yeast. Antonie van
Gill CO, Hall MJ, Ratledge C (1977) Lipid accumulation in an oleaginous yeast (Candida
107) growing on glucose in single-stage continuous culture. Appl Environ Microbiol33:
231-239
Gimenez-Jurado G, van Uden N (1989) Leucosporidium Jellii spec. nov., a basidio-
mycetous yeast that degrades L(+)-tartaric acid. Antonie van Leeuwenhoek 55: 133-
141
Golubev WI (1981) New combinations in Cryptococcus yeasts. Mikol Fitopatol 15: 467-
468
Golubev WI (1995) Perfect state of Rhodomyces dendrorhous (Phaffia rhodozyma). Yeast 11:
101-110
Golubev WI (1989) Catabolism of m-inositol and taxonomic value ofD-glucuronate assimi-
lation in yeasts. Mikrobiologiya 58: 276-283
Goto S, Sugiyama J, Hamamoto M, Komagata K (1987) SaitoeIla, a new anamorph genus in
the Cryptococcaceae to accommodate two Himalayan yeasts isolates formerly identified
as Rhodotorula glutinis. J Gen Appl Microbiol 33: 75-85
Gottschalk M, Blanz P (1985) Untersuchungen an 5S ribosomalen Ribonukleinsiiuren als
Beitrag zur Kliirung von Systematik und Phylogeny der Basidiomyzeten. Z Mykol 51:
205-243
Gueho E, Kurtzman CP, Peterson SW (1990) Phylogenetic relationship among species of
Sterigmatomyces and Fellomyces as determined from partial rRNA sequences. Int J Syst
Bacteriol 40: 60-65
Gueho E, Smith MTh, de Hoog GS, Biilon-Grand G, Christen R, Batenburg-van der Vegte
WH (1992) Contributions to a revision of the genus Trichosporon. Antonie van
Leeuwenhoek J Microbiol61: 289-316
Guilliermond A (1912) Les levures. Doin, Paris
Gunderson K, Chu G (1991) Pulsed-field electrophoresis of megabase-sized DNA. Mol Ceil
BioI 11: 3348-3354
Gurr E (1965) The rational use of dyes in biology. Leonard Hill, London
Hamamoto M, Sugiyama J, Komagata K (1986) DNA base composition of strains in the
genera Rhodosporidium, Cystofilobasidium, and Rhodotorula determined by reverse-
phase high-performance liquid chromatography. J Gen Appl Microbiol32: 215-223
Hamamoto M, Uchida K, Yamaguchi H (1992) Ubiquinone system and DNA base compo-
sition of strains in the genus Malassezia determined by high-performance liquid chro-
matography. J Gen Appl Microbiol 38: 79-82
Hara T, Shimoda T, Nonaka K, Ogata S (1991) Colorimetric detection of DNA-DNA hybrid-
ization in micro dilution wells for taxonomic application on bacterial strains. J Ferment
Bioengin 72: 122-124
Heath IB (1978) Experimental studies of fungal mitotic systems. A review. In: Heath IB (ed)
Nuclear division in the fungi. Academic Press, New York, pp 89-176
Heath IB, Ashton ML, Kaminskyi SGW (1987) Mitosis as a phylogenetic marker among the
yeasts - review and observations on novel mitotic systems in freeze substituted cells of
the Taphrinales. Stud Mycol30: 279-297
Hendriks L, Goris A, Van de Peer Y, Neefs J-M, Vancanneyt M, Kersters K, Hennebert G, De
Wachter R (1992a) Phylogenetic analysis of five medically important Candida species as
deduced on the basis of small ribosomal subunit RNA sequences. J Gen Microbiol 137:
1223-1230
Hendriks L, Goris A, Van de Peer Y, Neefs J-M, Vancanneyt M, Kersters K, Berny J-F,
Hennebert G (1992b) Phylogenetic relationships among Ascomycetes and Ascomycete-
like yeasts as deduced from small ribosomal subunit RNA sequences. Syst Appl
Microbiol15: 98-104
Heslot H (1990) Genetics and genetic engineering of the industrial yeast Yarrowia lipolytica.
In: Fiechter A (ed) Advances in biochemical engineering/biotechnology, vol 43.
Springer, Berlin Heidelberg New York, pp 43-73
Holm C, Meeks-Wagner DW, Fangman WL, Botstein D (1986) A rapid, efficient method for
isolating DNA from yeast. Gene 42: 169-173
Iwaguchi S, Homma M, Tanaka K (1990) Variations in the electrophoretic karyotype
analysed by the assignment of DNA probes in Candida albicans. J Gen Microbiol 136:
2433-2442
Jahnke K-D (1987) Assessing natural relationships by DNA analysis: techniques and appli-
cations. Stud Mycol30: 227-246
Jenq WJ, Speckman RA, Crang RE, Steinberg MP (1989) Enhanced conversion oflactose to
glycerol by Kluyveromyces fragilis utilizing whey permeate as a substrate. Appl Environ
Microbiol 55: 573-578
Johnson EA, Conklin DE, Lewis MJ (1977) The yeast Phaffia rhodozyma as a dietary source
for salmonids and crustaceans. J Fish Res Board Can 34: 2417-2421
Johnson EA, Lewis MJ, Grau CR (1980) Pigmentation of egg yolks with astaxanthin from the
yeast Phaffia rhodozyma. Poult Sci 59: 1777-1782
Johnson-Reid JA, Moore RT (1972) Some ultrastructural features of Rhodosporidium
toruloides Banno. Antonie van Leeuwenhoek J Microbiol38: 417-435
Johnston JR (1988) Yeast genetics, molecular aspects. In: Campbell I, Duffus JH (eds) Yeast,
a practical approach. IRL Press, Oxford, pp 107-123
Jong S-C, Lee F-L (1986) The new species Dekkera naardenensis, teleomorph of
Brettanomyces naardenensis. Mycotaxon 25: 147-152
Kaltenboeck B, Spatafora JW, Zhang X, Kousalas KG, Blackwell M, Storz J (1992) Efficient
production of single-stranded DNA as long as 2kb for sequencing of PCR-amplified
DNA. Biotechniques 12: 164-171
Kaneko Y, Banno I (1991) Reexamination of Saccharomyces bayanus strains by DNA-DNA

hybridization and electrophoretic karyotyping. IFO Res Comm 15: 30-41
Katayama-Hirayama K, Tobita S, Hirayama K (1991) Degradation of phenol by yeast
Rhodotorula. J Gen Appl Microbiol37: 147-156
Kendrick B (1987) Yeasts and yeast-like fungi - new concepts and new techniques. Stud
MycoI30:479-486
Kitamoto D, Akiba S, Hioki C, Tabuchi T (1990a) Extracellular accumulation of
mannosylerythritol lipids by a strain of Candida antarctica. Agric BioI Chem 54:
31-36
Kitamoto D, Haneishi K, Nakahara T, Tabuchi I (1990b) Production of mannosylerythritol
lipids by Candida antarctica from vegetable oils. Agric BioI Chem 54: 37-40
Klein RD, Favreau MA (1988) Transformation of Schwanniomyces occidentalis with an
ADE2 gene cloned from S. occidentalis. J Bacteriol170: 5572-5578
Kreger-van Rij NJW (1984a) Saccharomycopsis Schionning. In: Kreger-van Rij NJW (ed)
The yeasts, a taxonomic study, 3rd edn. Elsevier, Amsterdam, pp 399-413
Kreger-van Rij NJW (1984b) The species. In: Kreger-van Rij NJW (ed) The yeasts, a taxo-
nomic study, 3rd edn. Elsevier, Amsterdam, p 16
Kreger-van Rij NJW, Veenhuis M (1971) A comparative study of the cell wall structure of
basidiomycetous and related yeasts. J Gen Microbiol68: 87-95
Kuraishi H, Katayama-Fujimura Y, Sugiyama J, Yokoyama T (1985) Ubiquinone systems in
fungi 1. Distribution of ubiquinones in the major families of ascomycetes, basidi-
omycetes, and deuteromycetes, and their taxonomic implications. Trans Mycol Soc Jpn
26: 383-395
Kurjan J (1991) Cell-cell interactions involved in yeast mating. In: Dworkin M (ed) Micro-
bial cell-cell interactions. American Society for Microbiology, Washington, pp 113-144
Kurtzman CP (1973) Formation of hyphae and chlamydospores by Cryptococcus laurentii.
Mycologia 65: 388-395
Kurtzman CP (1984) Synonymy of the yeast genera Hansenula and Pichia demonstrated
through comparisons of deoxyribonucleic acid relatedness. Antonie van Leeuwenhoek J
Kurtzman CP (l985) Molecular taxonomy of fungi. In: Bennett JW, Lasure LL (eds) Gene
manipulation in fungi. Academic Press, New York, pp 35-56
Kurtzman CP (l987) Prediction of biological relatedness among yeasts from comparison of
nuclear DNA complementarity. Stud Mycol 30: 459-468
Kurtzman CP (1990) DNA relatedness among species of the genus Zygosaccharomyces.
Yeast 6: 213-219
Kurtzman CP (1991) DNA relatedness among saturn-spored yeasts assigned to the genera
Williopsis and Pichia. Antonie van Leeuwenhoek J Microbiol60: 13-19
Kurtzman CP (1992) rRNA sequence comparisons for assessing phylogenetic relationships
among yeasts. Int J Syst Bacteriol 42: 1-6
Kurtzman CP (1995) Relationships among the genera Ashbya, Eremothecium, Holleya and
Nematospora determined from rDNA sequence divergence. J Indust Microbiol14: 523-
530
Kurtzman CP (1993) DNA-DNA hybridization approaches to species identification in small
genome organisms. Methods Enzymol224: 335-348
Kurtzman CP, Liu Z (1990) Evolutionary affinities of species assigned to Lipomyces and
Myxozyma estimated from ribosomal RNA sequence divergence. Curr Microbiol 21:
387-393
Kurtzman CP, Phaff HJ (1987) Molecular taxonomy. In: Rose AH, Harrison JS (eds) The
yeasts, 2nd edn, vol 1. Academic Press, London, pp 63-94
Kurtzman CP, Robnett CJ (l991) Phylogenetic relationships among species of Saccharomy-
ces, Schizosaccharomyces, Debaryomyces and Schwanniomyces determined from partial
ribosomal RNA sequences. Yeast 7: 61-72
Kurtzman CP, Robnett CJ (l994) Synonymy of the yeast genera Wingea and Debaryomyces.
Kurtzman CP, Robnett q (1995) Molecular relationships among hyphal ascomycetous

yeasts and yeastlike tara. Can J Bot 73: S824-S830
Kurtzman CP, Smiley MJ, Johnson q, Wickerham LJ, Fuson GB (1980) Two new and closely
related heterothallic species. Pichia amylophila and Pichia mississippiensis: characteriza-
tion by hybridization and deoxyribonucleic acid reassociation. Int J Syst Bacteriol 30:
208-216
Kurtzman CP, Bothast RJ, VanCauwenberge JE (1982) Conversion ofD-xylose to ethanol by
the yeast Pachysolen tannophilus. US Patent 4, 359, 534
Kurtzman CP, PhaffHJ, Meyer SA (1983) Nucleic acid relatedness among yeasts. In: Smith
ARW, Spencer JFT, Spencer DM (eds) Yeast genetics. Fundamental and applied aspects.
Springer, Berlin Heidelberg New York, pp 139-166
Kwon-Chung KJ (1980) Nuclear genotypes of spore chains in Filobasidiella neoformans
(Cryptococcus neoformans). Mycologia 72: 418-422
Kwon-Chung KJ, Bennett JE (1978) Distribution of a and a mating types of Cryptococcus
neoformans among natural and clinical isolates. Am J Epidemiol108: 337-340
Kwon-Chung KJ, Fell JW (1984) The genus Filobasidiella Kwon-Chung. In: Kreger-van
Rij NJW (ed) The yeasts, a taxonomic study, 3rd edn. Elsevier, Amsterdam, pp 472-
482
Kwon-Chung KJ, Popkin TJ (1976) Ultrastructure of septal complex in Filobasidiella
neoformans (Cryptococcus neoformans). J Bacteriol126: 524-528
Kwon-Chung KJ, Wickes BL, Stockman L, Roberts GD, Ellis D, Howard DH (1992) Viru-
lence, serotype, and molecular characteristics of environmental strains of Cryptococcus
neoformans var. gattii. Infect Immun 60: 1869-1874
Laaser G, Moller E, Jahnke K-D, Prillinger H, Prell H (1987) Ribosomal restriction analysis
as a taxonomic tool in separating physiologically similar basidiomycetous yeasts. Syst
Appl Microbiolll: 170-175
Lachance M-A (1985) Current views on the yeast species. Microbiol Sci 2: 122-126
Lane DJ, Pace B, Olsen GJ, Stahl DA, Sogin ML, Pace NR (1985) Rapid determination of 16S
ribosomal RNA sequences for phylogenetic analysis. Proc Natl Acad Sci USA 82: 6955-
6959
Lee F-L, Jong S-C (1986) New species of Dekkera custersiana and D. lambica, teleomorphs
of Brettanomyces. Mycotaxon 25: 455-460
Lewis MJ, Ragot N, Berlant MC, Miranda M (1990) Selection of astaxanthin-overproducing
mutants of Phaffia rhodozyma with f3-ionone. Appl Environ Microbiol 56: 2944-2945
Lipke PN, Kurjan J (1992) Sexual agglutination in budding yeasts: structure, function, and
regulation of adhesion glycoproteins. Microbiol Rev 56: 180-194
Liu Z, Kurtzman CP (1991) Phylogenetic relationships among species of Williopsis and
Saturnospora gen. nov. as determined from partial rRNA sequences. Antonie van
Lodder J (1934) Die anaskosporogenen Hefen, erste HaIfte. Noord-Hollandsche Uitgevers
Maatschappij, Amsterdam
Lodder J (ed) (1970) The yeasts, a taxonomic study, 2nd edn. North-Holland Publ,
Amsterdam
Mahrous M, Lott TJ, Meyer SA, Sawant AD, Ahearn DG (1990) Electrophoretic karyotyping
of typical and atypical Candida albicans. J Clin Microbiol 28: 876-881
Maleszka R, Clark-Walker GD (1989) A petite positive strain of Kluyveromyces lactis has a
300kb deletion in the rDNA cluster. Curr Genet 16: 429-432
Maleszka R, Skrzypek M (1990) Assignment of cloned genes to electrophoretically separated
chromosomes of the yeast Pachysolen tannophilus. FEMS Microbiol Lett 69: 79-82
Maleszka R, Wang PY, Schneider H (1982) Ethanol production from D-galactose and glyc-
erol by Pachysolen tannophilus. Enzyme Microb Technol 4: 349-352
Mann W, Jeffery J (1989) Isolation of DNA from yeasts. Anal Biochem 178: 82-87
Marmur J (1961) A procedure for the isolation of DNA from microorganisms. J Mol Bioi 3:
208-218
Mathaba LT, Franklyn KM, Warmington JR (1993) A rapid technique for the isolation of
DNA from clinical isolates of Candida albicans. J Microbiol Meth 17: 17-25
McArthur CR, Clark-Walker GD (1983) Mitochondrial DNA size diversity in the Dekkeral
Brettanomyces yeasts. Curr Genet 7: 29-35
McCarroll R, Olsen GJ, Stahl YD, Woese CR, Sogin ML (1983) Nucleotide sequence of the
Dictyostelium discoideum small-subunit ribosomal acid inferred from the gene se-
quence: evolutionary implications. Biochemistry 22: 5858-5868
McCluskey K, Russell BW, Mills D (1990) Electrophoretic karyotyping without the need for
generating protoplasts. Curr Genet 18: 385-386
McEachern MJ, Hicks JB (1991) Dosage of the smallest chromosome affects both the yeast-
hyphal transition and the white-opaque transition of Candida albicans WO-l. J Bacteriol
173: 7436-7442
Mendon-;:a-Hagler LC, Hagler AN, Kurtzman CP (1993) Phylogeny of Metschnikowia species
estimated from partial rRNA sequences. Int J Syst Bacteriol 43: 368-373
Meyer PS, Du Preez JC, Kilian SG (1992) Isolation and evaluation of yeasts for biomass
production from bagasse hemicellulose hydrolysate. Syst Appl Microbiol15: 161-165
Meyer SA, Smith MT, Simione FP Jr (1978) Systematics of Hanseniaspora Zikes and
Kloeckera Janke. Antonie van Leeuwenhoek J Microbiol44: 79-96
Middelhoven WJ, de Jong 1M, de Winter M (1991) Arxula adeninivorans, a yeast assimilat-
ing many nitrogen and aromatic compounds. Antonie van Leeuwenhoek 59: 129-137
Middelhoven WJ, Koorevaar M, Schuur GW (1992) Degradation of benzene compounds by
yeasts in acidic soils. Plant Soil 145: 37-43
Miller MW, Phaff HJ (1984) Nadsonia Sydow. In: Kreger-van Rij NJW (ed) The yeasts, a
taxonomic study, 3rd edn. Elsevier, Amsterdam, pp 279-285
Miller MW, Yoneyama M, Soneda M (1976) Phaffia, a new yeast genus in the
Deuteromycotina (Blastomycetes). Int J Syst Bacteriol26: 286-291
Mills SC, Child JJ, Spencer JFT (1971) The utilization of aromatic compounds by yeasts.
Molina FI, Jong S-C, Huffman JL (1993a) PCR amplification of the 3' external transcribed
and intergenic spacers of the ribosomal DNA repeat unit in three species of Saccharomy-
ces. FEMS Microbiol Lett 108: 259-264
Molina FI, Shen P, Jong S-C (1993b) Validation ofthe species concept in the genus Dekkera
by restriction analysis of genes coding for rRNA. Int J Syst Bacteriol43: 32-35
Montrocher R, Claisse M (1988) Spectrophotometric analysis of yeasts: cytochrome spectra
of some Candida and related taxa. J Gen Appl Microbiol34: 221-232
Moore RT (1980) Taxonomic proposals for the classification of marine yeasts and other
yeast-like fungi including the smuts. Bot Mar 23: 361-373
Moore RT (1987) Additions to the genus Vanrija. Bibl Mycol108: 167-173
Moore RT, Kreger-van Rij NJW (1972) Ultrastructure of Filobasidium olive. Can J Microbiol
18: 1949-1951
Muderhwa JM, Ratomahenina R, Pina M, Graille UJ, Galzy P (1986) Purification and prop-
erties of the lipases from Rhodotorula pilimanae Hedrick & Burke. Appl Microbiol
Biotechnol 23: 348-354
Nakase T, Takematsu A (1992) Udeniomyces, a new ballistosporous anamorphic yeast genus
in the Cryptococcaceae proposed for three Bullera species which produce large bilater-
ally symmetrical ballistospores. FEMS Microbiol Lett 100: 497-502
Nakase T, Okada G, Sugiyama J, Itoh M, Suzuki M (1989) Ballistosporomyces, a new
ballistospore-forming anamorphic yeast genus. J Gen Appl Microbiol 35: 289-309
Nakase T, Itoh M, Takematsu A, Mikata K, Banno I, Yamada Y (1991) Kockovaella, a new
ballistospore-forming anamorphic yeast genus. J Gen Appl Microbiol37: 175-197
Nei N (1971a) Microbiological decomposition of phenol!. Isolation and identification of
phenol metabolizing yeasts. J Ferment Technol 49: 655-660
Nei N (1971b) Microbiological decomposition of phenol II. Decomposition of phenol by
Rhodotorula glutinis. J Ferment Technol49: 852-860
Neujahr HY, Varga JM (1970) Degradation of phenols by intact cells and cell-free prepara-
tions of Trichosporon cutaneum. Eur J Biochem 13: 37-44
Nilsson R, Enebo L, Lundin H, Myrback K (1943) Mikrobielle Fettsynthese unter
Verwendung von Rhodotorula glutinis nach dem Lufthefeverfahren. Sven Kern Tidskr
55:41-51
Nishida H, Sugiyama J (1993) Phylogenetic relationships among Taphrina, Saitoella, and
other higher fungi. Mol BioI Evoll0: 431-436
Oberwinkler F (1987) Heterobasidiomycetes with ontogenetic yeast-stages - systematic and
phylogenetic aspects. Stud Mycol30: 61-74
Oberwinkler F, Bandoni R, Blanz P, Kisimova-Horovitz L (1983) Cystofilobasidium: a new
genus in the Filobasidiaceae. Syst Appl Microbiol4: 114-122
O'Donnell K (1993) Fusarium and near relatives. In: Reynolds DP, Taylor JW (eds) The
fungal holomorph: mitotic, meiotic and pleomorphic speciation in fungal systematics
CAB, Wallingford, pp 225-233
Pal M, Onda C, Hasegawa A (1991) Sexual compatibility and environmental isolates of
Cryptococcus neoformans. Jpn J Med Mycol32: 101-106
Park WS, Murphy PA, Glatz BA (1990) Lipid metabolism and cell composition of the
oleaginous yeast Apiotrichum curvatum grown at different carbon to nitrogen ratios.
Can J Microbiol36: 318-326
Pasari AB, Korus RA, Heimsch RC (1989) A model for continuous fermentations with
amylolytic yeasts. Biotechnol Bioeng 33: 338-343
Patrignani G, Pellegrini S, Gerola FM (1984) Difference in septal pore apparatus ultrastruc-
ture of Tremella mesenterica. Caryologia 37: 77-86
Perfect JR, Magee BB, Magee PT (1989) Separation of chromosomes of Cryptococcus
neoformans by pulsed field gel electropheresis. Infect Immunol 57: 2624-2627
Peterson SW, Kurtzman CP (199!) Ribosomal RNA sequence divergence among sibling
species of yeasts. Syst Appl Microbiol 14: 124-129
Phaff HJ (198!) The species concept in yeasts: physiologic, morphologic, genetic, and
ecological parameters. In: Stewart GG, Russell I (eds) Current developments in yeast
research. Pergamon Press, Oxford, pp 635-643
PhaffHJ (1989) Trends in yeast research. Yeast (Spec Issue) 5: 341-349
PhaffHJ, Starmer WT, Tredick-Kline J (1987) Pichia kluyveri sensu lato - a proposal for two
new varieties and a new anamorph. Stud Mycol30: 403-414
Price CW, Fuson GB, PhaffHJ (1978) Genome comparison in yeast systematics: delimitation
of species within the genera Schwanniomyces, Saccharomyces, Debaryomyces, and
Pichia. Microbiol Rev 42: 161-193
Prillinger H, Oberwinkler F, Umile C, Tlachac K, Bauer R, Dorfler C, Taufratzhofer E
(1993) Analysis of cell wall carbohydrates (neutral sugars) from ascomycetous and
basidiomycetous yeasts with and without derivatization. J Gen Appl Microbiol 39: 1-
34
Prior BA, Kilian SG, Du Preez JC (1989) Fermentation of D-xylose by the yeasts Candida
shehatae and Pichia stipitis. Prospects and problems. Proc Biochem 24: 21-32
Raeder U, Broda P (1985) Rapid preparation of DNA from filamentous fungi. Lett Appl
Microbioll: 17-20
Ragan MA (1988) Ribosomal RNA and the major lines of evolution: a perspective.
Biosystems 21: 177-188
Raju NB (1986) A simple fluorescent staining method for meiotic chromosomes of Neuro-
spora. Mycologia 78: 901-906
Ratledge C (1978) Lipids and fatty acids. In: Rose AH (ed) Economic microbiology, vol 2,
Primary products of metabolism. Academic Press, London, pp 263-302
Ratledge C (1982) Microbial oils and fats: an assessment of their commercial potential. Prog
Ind Microbiol16: 119-206
Ratledge C (1986) Lipids. In: Pape H, Rehm H-J (eds) Biotechnology, vol 4, 1st edn.,
Microbial products II. VCH, Weinheim, pp 185-213
Ratledge C (1993) Single cell oils - have they a biotechnological future? Tibtech 11: 278-284
Ratledge C, Evans CT (1989) Lipids and their metabolism. In: Rose AH, Harrison JS (eds)
The yeasts, vol 3, 2nd edn. Academic Press, London, pp 367-455
Ratledge C, Hall MJ (1979) Accumulation of lipid by Rhodotorula glutinis in continuous
culture. Biotechnol Lett 1: 115-120
Reiser J, GlumoffV, Kalin M, Ochsner U (1990) Transfer and expression of heterologous
genes in yeasts other than Saccharomyces cerevisiae. In: Fiechter A (ed) Advances in
biochemical engineeringlbiotechnology vol 43. Springer, Berlin Heidelberg New York,
pp 75-102
Rezanka T (1991) Overproduction of microbial lipids and lipases. Folia Microbiol36: 211-
224
Rhodes JC, Kwon-Chung KJ, Popkins TJ (1981) Ultrastructure of the septal pore complex in
hyphae of Cryptococcus laurentii. J Bacteriol145: 1410-1412
Rolph CE, Moreton RS, Harwood JL (1989) Acyl lipid metabolism in the oleaginous yeast
Rhodotorula gracilis (CBS 3043). Lipids 24: 7l5-720
Romanos MA, Scorer CA, Clare JJ (1992) Foreign gene expression in yeast: a review. Yeast
8:423-488
Rustchenko-Bulgac EP (1991) Variations of Candida albicans electrophoretic karyotypes.
J Bacteriol173: 6586-6596
Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning, a laboratory manual, 2nd edn.
CSH Press, New York, pp 6.50-6.59
Scheda R (1966) Merkmalsveranderungen bei Hefen der Gattung Saccharomyces.
Monatsschr Brau 19: 256-258
Scheda R, Yarrow D (1966) The instability of physiological properties used as criteria in the
taxonomy of yeasts. Arch Mikrobiol55: 209-225
Schildkraut CL, Marmur J, Doty P (1962) Determination of the base composition of deoxyri-
bonucleic acid from its buoyant density in CsCl. J Mol BioI 4: 430-433
Schneider H, Wang PY, Chan YK, Maleszka R (1981) Conversion ofD-xylose into ethanol by
the yeast Pachysolen tannophilus. Biotechnol Lett 3: 89-92
Seidler RJ, Mandel M (1971) Quantitative aspects of DNA renaturation: DNA base compo-
sition, state of chromosome replication, and polynucleotide homologies. J Bacterioll06:
608-614
Shen R, Lachance M-A (1993) Phylogenetic study of ribosomal DNA of cactophilic Pichia
species by restriction mapping. Yeast 9: 315-330
Shoda M, Udaka S (1980) Preferential utilization of phenol rather than glucose by
Trichosporon cutaneum possessing a partially constitutive catecholl,2-oxygenase. Appl
Environ Microbiol 39: 1129-1133
Sleep D, Belfield GP, Ballance DJ, Steven J, Jones S, Evans LR, Moir PD, Goodey AR (1991)
Saccharomyces cerevisiae strains that overexpress heterologous proteins. Bio/technology
9: 183-187
Smith CL, Matsumoto T, Niwa 0, Klco S, Fan J-B, Yanagida M, Cantor CR (1987) An
electrophoretic karyotype for Schizosaccharomyces pombe by pulsed field electrophore-
sis. Nucleic Acids Res 15: 4481-4489
Smith MTh, van der Walt JP, Johannsen E (1976) The genus Stephanoascus gen. nov.
(Ascoideaceae). Antonie van Leeuwenhoek J Microbiol42: 119-127
Smith MTh, Batenburg-van der Vegte WH, Scheffers WA (1981) Eeniella, a new yeast gen us
of the Torulopsidales. Int J Syst Bacteriol31: 196-203
Smith MTh, Yamazaki M, Poot GA (1990) Dekkera, Brettanomyces and Eeniella: electro-
phoretic comparison of enzymes and DNA-DNA homology. Yeast 6: 299-310
Sor F, Fukuhara H (1989) Analysis of chromosomal DNA patterns of the genus
Kluyveromyces. Yeast 5: 1-10
Spencer JFT, Gorin PAJ (1969) Systematics of the genus Candida Berkhout: proton mag-
netic resonance spectra of the mannans and mannose-containing polysaccharides as an
aid in classification. Antonie van Leeuwenhoek J Microb 35: 33-44
Spencer JFT, Gorin PAJ (1970) Systematics of the genus Torulopsis: proton magnetic reso-
nance spectra of the mannose-containing polysaccharides as an aid in classification.
Antonie van Leeuwenhoek J Microbiol 36: 509-524
Staib F (1981) The perfect state of Cryptococcus neoformans, Filobasidiella neoformans, on
pigeon manure agar. Zentralbl Bakteriol, Parasitenkd, Abt 1, 248: 575-578
Steensma HY, de Jongh FCM, Linnekamp M (1988) The use of electrophoretic karyotypes in
the classification of yeasts: Kluyveromyces marxianus and K. lactis. Curr Genet 14: 311-
317
Stelling-Dekker NM (1930) Die sporogenen Hefen. Verh K Akad Wet Sect 2, pp 1-547
Sugiyama J, Kukagawa M, Chiu SW, Komagata K (1985) Cellular carbohydraubiq composi-
tion, DNA base composition, ubiquinone systems, and diazoneum blue B color test in
the genera Rhodosporidium, Leucosporidium, Rhodotorula and related basidiomycetous
yeasts. J Gen Appl Microbiol31: 519-550
Sugiyama J, Tokuoka K, Suh S-O, Hirata A, Komagata K (1991) Sympodiomycopsis: a new
yeast-like anamorph genus with basidiomycetous nature from orchid nectar. Antonie
van Leeuwenhoek J Microbiol59: 95-108
Suh S-O, Hirata A, Sugiyama J, Komagata K (1993) Septal ultrastructure of basidiomycetous
yeasts and their taxonomic implications with observations on the ultrastructure of
Erythrobasidium hasegawianum and Sympodiomycopsis paphiopedili. Mycologia 85: 30-
37
Suzuki M, Nakase T (1988) The distribution of xylose in the cells ofballistosporous yeasts:
application of high performance liquid chromatography without derivatization to the
analysis of xylose in whole cell hydrolysates. J Gen Appl Microbiol 34: 95-103
Tahoun MK, EI-Merleb Z, Salam A, Youssef A (1987) Biomass and lipids from lactose or
whey by Trichosporon beigelii. Biotechnol Bioeng 24: 358-360
Taylor JW, Natvig DO (1987) Isolation of fungal DNA. In: Fuller MS, Jaworski A (eds)
Zoosporic fungi in teaching and research. Southeastern Publ Corp, Athens, pp 252-
258
Templeton AR (1983) Systematics of basidiomycetes based on 5S r RNA sequences and other
data. Nature (Lond) 303: 731
Timberlake WE (1978) Low repetitive DNA content in Aspergillus nidulans. Science 202:
973-975
Torok T, Royer C, Rockhold D, King AD (1992) Electrophoretic karyotyping of yeasts, and
southern blotting using whole chromosomes as templates for the probe preparation.
J Gen Appl Microbiol38: 313-325
Toyama R, Okayama H (1990) Human chorionic gonadotropin a and human cytomegalovi-
rus promoters are extremely active in the fission yeast Schizosaccharomyces pombe.
FEBS Lett 268: 271-221
Treco DA (1989) Preparation of yeast DNA. In: Ausubel FM (ed) Current protocols in
molecular biology Wiley, New York, pp 13.11.1-13.11.5
Uno I, Matsumoto K, Adachi K, Ishihana T (1984) Characterization of cyclic AMP-requiring
yeast mutants altered in the catalytic subunit of proteinkinase. J BioI Chern 259: 12508-
12513
Valadon LRG (1976) Carotenoids as additional taxonomic characters in fungi: a review.
Trans Br Mycol Soc 67: 1-15
Vancanneyt M, Van Lerberge E, Berny J-F, Hennebert GL, Kersters K (1992) The application
of whole-cell protein electrophoresis for the classification and identification of basidi-
omycetous yeast species. Antonie van Leeuwenhoek J Microbiol61: 69-78
Vandamme EJ, Derycke DG (1983) Microbial inulases: fermentation process, properties,
and applications. Adv Appl Microbiol 29: 139-175
van den Berg JA, van der Laken KJ, van Ooyen AJJ, Renniers TCHM, Rietveld K, Schaap A,
Brake AJ, Bishop RJ, Schultz K, Moyer D, Richman M, Shuster JR (1990) Kluyveromyces
as a host for heterologous gene expression: expression and secretion of prochymosin.
Bio/technology 8: 135-139
Van de Peer Y, Hendriks L, Goris A, Neefs J-M, Vancanneyt M, Kersters K, Berny

J-F, Hennebert G, De Wachter R (1992) Evolution of basidiomycetous yeasts as
deduced from small ribosomal subunit RNA sequences. Syst Appl Microbiol 15: 250-
258
van der Walt JP (1987) The yeasts - a conspectus. Stud Mycol30: 19-31
van der Westhuizen JPJ, Kock JLF, Smith EJ (1991) The potential use of cellular long-
chain fatty acid composition in the taxonomy of the carotenoid pigment producing
genera Rhodosporidium Banno and Rhodotorula Harrison. Syst Appl Microbiol14: 282-
290
Vaughan Martini A (1991) Intraspecific discontinuity within the yeast species Cryptococcus
albidus as revealed by nDNAlnDNA reassociations. Exp Mycol15: 140-145
Vaughan Martini A, Kurtzman CP (1985) Deoxyribonucleic acid relatedness among species
of the genus Saccharomyces sensu stricto. Int J Syst Bacteriol 35: 508-511
Vaughan Martini A, Martini A (1987) Three newly delimited species of Saccharomyces sensu
stricto. Antonie van Leeuwenhoek J Microbiol53: 77-84
Vaughan Martini A, Martini A, Cardinale G (1993) Electrophoretic karyotyping as a taxo-
nomic tool in the genus Saccharomyces. Antonie van Leeuwenhoek 63: 145-156
Vezinhet F, Blondin B, Hallet J-N (1990) Chromosomal DNA patterns and mitochondrial
DNA polymorphism as tools for identification of enological strains of Saccharomyces
cerevisiae. Appl Microbiol Biotechnol 32: 568-571
Vilgalys R, Hester M (1990) Rapid genetic identification and mapping of enzymatically
amplified ribosomal DNA from several Cryptococcus species. J Bacterioll72: 4238-4246
Viljoen BC, Kock JLF, Lategan PM (1986) Long-chain fatty acid composition of selected
genera of yeasts belonging to the Endomycetales. Antonie van Leeuwenhoek J Microbiol
52:45-51
Vishniac HS, Kurtzman CP (1992) Cryptococcus antarcticus sp. nov. and Cryptococcus
albidosimilis sp. nov., basidioblastomycetes from Antarctic soils. Int J Syst Bacteriol42:
547-553
Vollrath D, Davis RW (1987) Resolution of DNA molecules greater than 5 megabases by
contour-clamped homogeneous electric fields. Nucleic Acids Res 15: 7865-7876
Weijman ACM (1979) Carbohydrate composition and taxonomy of Geotrichum,
Trichosporon and allied genera. Antonie van Leeuwenhoek J Microbio145: 119-127
Weijman ACM, Golubev WI (1987) Carbohydrate patterns and taxonomy of yeasts and
yeast-like fungi. Stud Myco130: 361-371
Weijman ACM, Rodrigues de Miranda L (1983 ) Xylose distribution within and taxonomy of
the genera Bullera and Sporobolomyces. Antonie van Leeuwenhoek J Microbio149: 559-
562
Weijman ACM, Rodrigues de Miranda L, van der Walt JP (1988) Redefinition of Candida
Berkhout and the consequent emendation of Cryptococcus Kiitzing and Rhodotorula
Harrison. Antonie van Leeuwenhoek J Microbiol 54: 545-553
West M, Emerson GW, Sullivan PA (1990) Purification and properties of two lactose hydro-
lases from Trichosporon cutaneum. J Gen Microbiol136: 1483-1490
White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal
ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ
(eds) PCR protocols: a guide to methods and applications. Academic Press, New York,
pp 315-322
Wickerham LJ (1951) Taxonomy of yeasts. Tech Bull US Dept Agric 1029: 1-56
Wiley EO (1981) Phylogenetics. The theory and practice of phylogenetics systematics.
Wiley, New York
Winge 0, Roberts C (1949) Inheritance of enzymatic characters in yeasts, and the phenom-
enon oflong-term adaptation. CR Trav Carlsberg Ser Physio124: 263-315
Woese CR (1987) Bacterial evolution. Microbiol Rev 51: 221-271
Wong GJ (1987) A comparison of the mating system of Tremella mesenterica and other
modified bifactorial species. Stud Mycol 30: 431-441
Yamada Y, Kawasaki H (1989a) The molecular phylogeny of the Os-equipped basidiomyc-

etous yeast genera Mrakia Yamada et Komagata and Cystofilobasidium Oberwinkler et
Bandoni based on the partial sequences of 18S and 26S ribosomal ribonucleic acids.
Yamada Y, Kawasaki H (1989b) The genus Phaffia is phylogeneticlly separate from the
genus Cryptococcus (Cryptococcaceae). Agric Bioi Chern 53: 2845-2846
Yamada Y, Komagata K (1987) Mrakia gen. nov., a heterobasidiomycetous yeast genus
for the Os-equipped, selfsporulating organisms which produce a unicellular
metabasidium, formerly classified in the genus Leucosporidium. J Gen Appl Microbiol
33:455-457
Yamada Y, Kondo K (1973) Coenzyme Q system in the classification of the yeast genera
Rhodotorula and Cryptococcus, and the yeast-like genera Sporobolomyces and
Rhodosporidium. J Gen Appl Microbiol19: 59-77
Yamada Y, Matsumoto A (1988) An electrophoretic comparison of enzymes in strains of
species in the genus Mrakia Yamada et Komagata (Filobasidiaceae). J Gen Appl
Yamada Y, Nakagawa (1990) The molecular phylogeny of the basidiomycetous yeast species
Leucosporidium scottii based on the partial sequences of 18S and 26S ribosomal ribo-
nucleic acids. J Gen Appl Microbiol 36: 63-68
Yamada Y, Nakagawa Y (1992) The phylogenetic relationships of some
heterobasidiomycetous yeast species based on the partial sequences of 18S and 26S
ribosomal RNAs. J Gen Appl Microbiol 38: 559-565
Yamada Y, Ohishi T, Kondo I (1973) Coenzyme Q system in the classification of the
ascosporogenous yeast genera Hansenula and Pichia. J Gen Appl Microbiol19: 189-208
Yamada Y, Banno I, von Arx JA, van der Walt JP (1987) Taxonomic significance of the
coenzyme Q system in yeasts and yeast-like fungi. Stud Mycol30: 299-308
Yamada Y, Kawasaki H, ItohM, Banno I, Nakase T (1988) Tsuchiyaea gen. nov., an anamor-
phic yeast genus for the Q9-equipped organisms whose reproduction is either by
enteroblastic budding or by the formation of conidia which are disjointed at a septum in
the mid-region of the sterigma and whose cells contain xylose. J Gen Appl Microbiol34:
507-510
Yamada Y, Nakagawa Y, Banno I (1989a) The phylogenetic relationship of the Q9-equipped
species of the heterobasidiomycetous yeast genera Rhodosporidium and Leucosporidium
based on the partial sequences of 18S and 26S ribosomal ribonucleic acids: the proposal
of a new genus Kondoa. J Gen Appl Microbiol35: 377-385
Yamada Y, Kawasaki H, Nakase T, Banno I (1989b) The phylogenetic relationship of the
conidium-forming anamorphic yeast genera Sterigmatomyces, Kurtzmanomyces,
Tsuchiyaea, and Fellomyces, and the teleomorphic yeast genus Sterigmatosporidium on
the basis of the partial sequences of 18S and 26S ribosomal ribonucleic acids. Agric Bioi
Chern 53: 2993-3001
Yamada Y, Nakagawa Y, Banno I (1990a) The molecular phylogeny of the QlO-equipped
species of the heterobasidiomycetous yeast genus Rhodosporidium Banno based on the
partial sequences of 18S and 26S ribosomal ribonucleic acids. J Gen Appl Microbiol36:
435-444
Yamada Y, Nagahama T, Kawasaki H, Banno I (1990b) The phylogenetic relationships of the
genera Phaffia Miller, Yoneyama et Soneda and Cryptococcus Kiitzing emend. Phaff et
Spencer (Cryptococcaceae) based on the partial sequences of 18S and 26S ribosomal
ribonucleic acids. J Gen Appl Microbiol36: 403-414
Yamada Y, Nagahama T, Banno I (1991a) The molecular phylogeny of the Q9-equipped
ascomycetous teleomorphic yeast genus Debaryomyces Lodder et Kreger-van Rij based
on the partial sequences of 18S and 26S ribosomal ribonucleic acids. J Gen Appl
Yamada Y, Nagahama T, Banno I, GimeneZ-Jurado G, van Uden N (1991b) The phylogenetic
relationship of Kurtzmanomyces tardus Gimenez-Jurado et van Uden
(Cryptococcaceaea) based on the partial sequences of 18S and 26S ribosomal RNA's.
Yamazaki M, Goto S, Komagata K (1983) An electrophoretic comparison of the enzymes of
Saccharomyces yeasts. J Gen Appl Microbiol29: 305-318
Yamazaki M, Goto S, Komagata K (1985) Taxonomic studies of the genus Tilletiopsis on
physiological properties and electrophoretic comparison of enzymes. Trans Mycol Soc
Jpn 26: 13-22
Ykema A, Verbree EC, Kater MM, Smith B (1988) Optimization of lipid production in the
oleaginous yeast Apiotrichum curvatum in whey permeate. Appl Microbiol Biotechnol
29: 211-218
Ykema A, Kater MM, Smit B (1989a) Lipid production in whey permeate by an unsaturated
fatty acid mutant of the oleaginous yeast Apiotrichum curvatum. Biotechnol Lett 11:
477-482
Ykema A, Verbree EC, Nijkamp BJB, Smit B (1989b) Isolation and characterization of fatty
acid autotrophs from the oleaginous yeast Apiotrichum curvatum. Appl Microbiol
Zache G, Rehm B-J (1989) Degradation of phenol by a coimmobilized entrapped mixed
culture. Appl Microbiol Biotechnol 30: 426-432
Zhang TY, Smith CL, Cantor CR (1991) Secondary pulsed field gel electrophoresis: a new
method for faster separation oflarger DNA molecules. Nucleic Acids Res 19: 1291-1296
CHAPTER 2
Protoplast Fusion of Yeasts

Martin Zimmermann l and Matthias SipiczkF
1
Introduction
This chapter deals with the possible use of protoplast fusion for hybridization and
genetic analysis of yeasts. For a more general overview the reader is referred to a
review by Ferenczy (1981) on microbial protoplast fusion.
Protoplast fusion has been used in yeast genetics since 1976, when Sipiczki
reported on the first fusion of Schizosaccharomyces pombe strains at a conference
in Schliersee, Germany. The first papers on the use of protoplast fusion in yeasts
date from 1977 (Ferenczy and Maraz 1977; Fournier et al. 1977; Sipiczki and
Ferenczy 1977a,b; van Solingen and van der Plaat 1977). At that time, protoplast
fusion was used mostly in fungi and plants. Since that time, it has become an
important tool in the genetics of nonconventional (i.e., non-Saccharomyces) and
industrial yeasts.
The general rationale of protoplast fusion is that the cell walls are removed
enzymatically, so that protoplasts are formed. These protoplasts are kept in a
medium that is stabilized osmotically. Under the influence of a fusogenic agent
such as polyethylene glycol or a strong electric field (Weber et al.1981), protoplasts
will aggregate and subsequently fuse. A mixture of calcium ions and PEG has been
used as fusogenic agent since the first reports on protoplast fusion in yeast. This
method had found wide use in plants and fungi before. The process of protoplast
fusion will bring together the cytoplasms, organelles, and nuclei of the different
strains, even in cases where a sexual hybridization is impossible. If a suitable
selection is available, fusants or hybrids can be isolated.
Strains from one species, from the same genus, or from different genera have
been fused, and viable fusants have been obtained. The resulting fusants are then
classified as intraspecific, interspecific, or intergeneric, respectively. As yeast tax-
onomy is still subject of intense discussion (see Chap. 1, this Vol.), this classifica-
tion should be considered with some caution.
The fusants can be analyzed with regard to their morphology, physiology, and
genetics. A genetic analysis is possible when the fusant can undergo meiosis or
lInstitut rur Biologie IV (Mikrobiologie) cler Rheinisch-WestfaIischen Technischen

Hochschule Aachen, Worringer Weg, 52056 Aachen, Germany
2 Department of Genetics, L.K. University, P.O. Box 56, 4010 Debrecen, Hungary
84 M. Zimmermann and M. Sipiczki
when mitotic segregation, either spontaneous or induced by haploidizing agents,

can be observed. Haploidizing agents are for instance benomyl (an agent disturb-
ing the assembly of the microtubules), p-fluorophenylalanine (Sipiczki and
Ferenczy 1977a,b; van de Broock et al. 1983) or UV light (Whelan et al. 1980).
Sometimes, the fusant can be mated to another strain and the resulting progeny
can be analyzed.
Protoplast fusion has been used for genetical research concerning nuclear and
cytoplasmatic genes and for strain improvement. In the following, some results
will be highlighted.
2
Transfer of Cytoplasmic Genes
Fusing Saccharomyces cerevisiae strains, Ferenczy and Maraz (1977) demon-

strated that mitochondrial genes can be transferred irrespective of the mating
type. Maraz and Ferenczy (1980) were able to obtain protoplasts from Saccharomy-
ces cerevisiae which contained only mitochondria, but no nuclei. They used a
centrifugation step to remove the nuclei containing protoplasts from those
without nuclei. When fusing these small protoplasts with protoplasts containing
nuclei, a selective transfer of mitochondrial genomes was accomplished. Working
on Schizosaccharomyces pombe, Liickemann et al. (1979) showed that the average
frequency of transmission and recombination of mitochondrial genes was the
same after protoplast fusion as after normal mating. In individual clones,
however, the frequencies were very different; a strong influence of the regeneration
time, not of the mating process itself, was demonstrated. These findings were
supported by Maraz and Subik (1981), who showed for Saccharomyces cerevisiae
that the behavior of mitochondrial genes was identical in sexual and somatic
hybridization experiments. These results opened the way for genetic analysis of
mitochondrial genes in cases where sexual mating was impossible. Allmark et al.
(1978) could differentiate mitochondrially and nuclearily encoded respiratory de-
ficiencies in Kluyveromyces lactis. After protoplast fusion of Saccharomycopsis
lipolytica (Yarrowia lipolytica) strains, Matsuoka et al. (1982) obtained only
fusants where the cytoplasms had fused (called cybrids). They could observe the
transfer of resistance to oligomycin; karyogamy did not take place.
DNA killer plasmids could be transferred from Kluyveromyces lactis to Saccha-
romyces cerevisiae where they were stable and expressed (Gunge and Sakaguchi
1981) and to Candida pseudotropicalis (Sugisaki et al. 1985). Goodey and Bevan
(1983) obtained fusion products of Saccharomyces cerevisiae which contained the
nuclei of one parent and the combined cytoplasms of both parents. They could
demonstrate the transfer of the dsRNA (double-stranded) killer plasmid as well as
of the 2-J1 plasmid. DsRNA killer plasmids could also be transferred by protoplast
fusion into brewing yeasts and used as selection markers (Vondrejs et al. 1982;
Bendova et al. 1983; Rocken 1984).
2. Protoplast Fusion of Yeasts 85
3
Production of Polyploid Strains
It was expected that technical yeasts might be improved by polyploidization.

Johannsen et al. (1985) tried to improve the ability of Candida shehatae to ferment
xylose to ethanol by producing polyploid strains. Using mutant strains as fusion
partners, they produced diploid, triploid, and tetraploid fusants. They observed
karyogamy and recombination of the parental markers among the progeny of the
fusants. The ethanol production was slightly improved. Gupthar (1987) tried to
improve Pichia stipitis by a similar approach. The resulting fusants were aneup-
loid, meiotic and mitotic segregation was possible, and proved that karyogamy had
taken place; the ethanol fermentation, however, was not improved.
A Candida blankii strain was used to produce single cell protein from bagasse.
As its cells were rather small, Gericke and van Zyl (1992) tried successfully to
facilitate the cell harvest by producing polyploid strains.
The carotinoid production of Phaffia rhodozyma was improved by Chun et al.
(l992) after polyploidization. The fusants were analyzed by mitotic segregation,
proving that karyogamy had taken place.
From the haplontic yeast Schizosaccharomyces pombe polyploid hybrids were
constructed by repeated protoplast fusion. The ploidy could be increased up to
tetraploidy; the fusants, however, were not very stable and often mitotic chromo-
some losses occurred (Molnar and Sipiczki 1993).
4
Fusion of Strains with Identical Mating Type
Strains from heterothallic yeasts can mate only with a partner having the opposite
mating type. Protoplast fusion can overcome that barrier. Stable diploid
Schizosaccharomyces pombe strains with h- mating type were obtained by Sipiczky
and Ferenczy (l977b). The strains could be mated with h+ strains and showed
recombination of parental markers. In Rhodosporidium, Sipiczky and Ferenczy
(l977a) induced hybridization and recombination without a heterokaryotic phase
when they fused two "a" strains. Stahl (l978) showed that the mating types of
Saccharomycopsis (Yarrowia) lipolytica control only the first reaction of cell recog-
nition, and not karyogamy or sporulation. He obtained +1+ diplonts which sporu-
lated and showed recombination of parental genes. The results are different from
those observed in Saccharomyces cerevisiae or Schizosaccharomyces pombe.
Maraz et al. (1978) could surmount the mating barrier in Saccharomyces
cerevisiae fusing strains of identical mating type. The resulting diploid had the
same mating type as the parents and did not sporulate, but could copulate with a
strain of the opposite mating type. Arima and Takano (l979) found that multiple
fusions took place, resulting in diploid, triploid, and tetraploid Saccharomyces
cerevisiae strains from the same experiment. They could demonstrate that in the
fusants karyogamy had occurred. To this end, they mated the fusants to strains of
opposite mating type and analyzed the resulting spores.
By using electrophoretic karyotyping, Hoffmann et al. (1987) extended the
analysis to chromosomes for which no marker was present. They found diploid to
tetraploid Saccharomyces cerevisiae hybrids, and the banding patterns correlated
with the genetical analysis.
5
Establishment of Parasexual Genetic Systems
Yeast species for which a sexual mating is missing or unknown can be hybridized
by protoplast fusion. The resulting fusants can undergo mitotic segregation and
the data from this segregation can be used to establish genetic maps. Fournier et al.
(1977) obtained hybrids from Candida tropicalis and observed recombination
events. Whelan et al. (1980) introduced UV light as an agent to induce mitotic
segregation in Candida albicans. Poulter et al. (1981) established a parasexual
cycle in Candida albicans, using four markers and demonstrating mitotic cross-
ing-over. Kakar and Magee (1982) demonstrated complementation groups in aux-
otrophic mutants of Candida albicans by protoplast fusion.
Sarachek and Rhoads (1981) determined the ability of fusants to regenerate as
a function of the regenerative capacity of both parents. Fusants could regenerate,
even if one partner could hardly do so. They showed that in the primary event of
fusion, many protoplasts interact, a finding that was supported by the production
of polyploid Saccharomyces cerevisiae fusants. After protoplast fusion in Candida
albicans, more or less stable heterokaryons are formed. The transfer of genetic
material between the nuclei is temperature-dependent (Sarachek and Weber 1984)
and mostly partial hybrids originate. The heterokaryotic cells can produce seg-
regant-defective variants (Sarachek and Weber 1986), indicating significant ge-
netic instabilities.
A review of Scherer and Magee (1990) shows how far genetics of Candida
albicans has progressed. Similar experiments have been carried out in other im-
perfect yeasts. Klinner et al. (1984) have demonstrated linkage groups of aux-
otrophic markers in Candida maltosa. When using mitotic segregation induced by
UV, Klinner and Boettcher (1985) observed chromosomal rearrangements after
fusion, i.e., different fusant clones gave reproducibly different cosegregation fre-
quencies for the markers. This finding paralleled the observations of Boettcher et
al. (1979), who after protoplast fusion found cosegregation of markers that were
not linked as determined by sexual analysis in Pichia guilliermondii. Fusants in
Pichia guilliermondii behaved differently from hybrids obtained by mating. Fur-
ther work on Pichia guilliermondii showed that besides homokaryotic fusants
heterokaryotic cells originated (Klinner and Boettcher 1984a,b). The results de-
pended on the strains used; the fusants seemed aneuploid and recombination of
parental markers occurred. This strain specificity also occurred in fusions within
Rhodosporidium toruloides (Becher and Boettcher 1979). The stability of the
fusants depended on the strains used.
Parasexual hybridizations have also been done in Torulopsis glabrata (Whelan

and Kwong-Chung 1987) and Candida boidinii (Lakhchev et al. 1992). Corner
and Poulter (1989) have used protoplast fusion of Candida tropicalis strains,
auxotrophic for adenine with Candida albicans strains with known adel and
ade2 genes to establish complementation groups for the adenine defects in Can-
dida tropicalis. Parasexual genetics by protoplast fusion have allowed the analysis
of imperfect yeasts; the results, however, show that one must take care when
genetic maps are established. The results can be specific for a strain rather than a
species and, even within one strain, different hybrid clones can yield different
results.
6
Fusion of Strains Belonging to Different Species or Genera
As it became obvious that sexual barriers could be overcome by protoplast fusion,

many groups tried to hybridize yeasts from different species or genera. One impor-
tant objective of these experiments was to transfer useful traits such as the ability
to ferment lactose or xylose into industrial strains of Saccharomyces cerevisiae.
When fusing auxotrophic strains from Kluyveromyces lactis and Saccharomyces
cerevisiae, Galeotti and Clark-Walker (1983) obtained hybrids which had most of
their genomes from the Kluyveromyces parent. They showed that a fragment of
chromosome XV from Saccharomyces cerevisiae must have been integrated into
the genome of the hybrid.
Upon fusion of a Saccharomyces cerevisiae brewing yeast with Kluyveromyces
lactis (Taya et al. 1984), an intermediate hybrid was obtained. It showed comple-
mentation of natural markers, Le., auxotrophy for nicotinic acid, pantothenate,
and a good fermentation of lactose. Farahnak et al. (1986) fused Saccharomyces
cerevisiae with Kluyveromyces fragilis and obtained hybrids with good fermenta-
tion oflactose and high ethanol tolerance. Fusants of Saccharomyces cerevisiae and
Zygosaccharomyces fermentati showed combined traits from both parents, as they
were able to grow on lactate and cellobiose (Pina et al. 1986). Fusants of Saccharo-
myces cerevisiae with Candida shehatae or Pichia stipitis were not stable, and the
ethanol production was not improved (Gupthar 1992). Hybrids between Candida
utilis and Saccharomyces cerevisiae were produced and analyzed by Perez et al.
(1984). During mitotic segregation, the chromosomes from Saccharomyces
cerevisiae were lost rapidly. Genes from Saccharomyces cerevisiae segregated to-
gether in the hybrid, though they are not linked in Saccharomyces cerevisiae. One
hybrid could be mated to a Saccharomyces cerevisiae strain (Perez and Benitez
1986) and the resulting mating product produced ascospores. Some of these as-
cospores showed markers from both parents of the fusion experiment. The spores,
however, could no longer be mated, since they were impaired in karyogamy. De
Richard et al. (1984) fused respiratory deficient strains from Candida utilis with
auxotrophic strains from Saccharomyces cerevisiae. They found respiratory com-
petent fusants which strongly resembled the Candida utilis parent. They con-
cluded that only mitochondrial genes had been transferred.
As it is often difficult to introduce auxotrophic markers into industrial Saccha-

romyces cerevisiae yeasts, Spencer et al. (1980) used respiratory-deficient mutants
of Saccharomyces cerevisiae as partners for fusion experiments. They could restore
mitochondrial functions in these yeasts by fusion with other yeasts from different
species (Spencer and Spencer 1981). A fusion of Saccharomyces diastaticus with
Hansenula capsulata yielded sporulating hybrids. Hybrids between Saccharomy-
ces diastaticus and yeasts from other species or genera (Hansenula capsulata,
Hansenula wingei, Torulopsis glabrata, Candida pseudotropicalis, Saccharomyces
rouxii, Saccharomyces kluyveri, Saccharomyces bayanus) were analyzed by DNA-
DNA reassociation. It was found that the hybrids had high homology to the Sac-
charomyces diastaticus parent and only very little homology to the other parent.
There was one exception: a hybrid between Torulopsis glabrata and Saccharomyces
diastaticus had only little homology to both parents. The authors concluded that
only few chromosomes or parts of chromosomes had been transferred into the
dominant partner.
Fusion of Saccharomyces cerevisiae with Schwanniomyces castellii (Tamaki
1986) yielded sporulating hybrids. It was postulated that both strains were closely
related as the spores showed perfect disomic segregation of the auxotrophic mark-
ers from the parents. Hintz (1987) did not obtain fusion products between these
species, though she could show by labeling of the protoplasts that fusion had taken
place. Two days after the fusion experiment, she observed that the nuclei did not
fuse. When both parental strains were used for intraspecific fusions, the nuclei
fused much earlier.
The dominance of one fusion partner had already been demonstrated
by Sipiczki (1979) in a fusion of Schizosaccharomyces pombe with
Schizosaccharomyces octosporus. The hybrids were unstable and resembled the
Schizosaccharomyces octosporus parent.
The same phenomenon was observed by Groves and Oliver (1984) after the
fusion of Kluyveromyces lactis and Yarrowia lipolytica. The hybrids had a DNA
content almost equal to the sum of both parents, but the genome was almost
exclusively derived from the Yarrowia parent, as shown by analytical density-
gradient centrifugation of the DNA and two-dimensional electrophoresis of the
cell proteins.
Hybrids between Kluyveromyces lactis and Kluyveromyces jragilis often had a
DNA content lower than the sum of the two parents, and the mitochondrial DNA
came exclusively from the Kluyveromyces lactis parent (Whittaker and Leach
1978). Johannsen et al. (1984) fused several strains from the genus Kluyveromyces
and found only hybrids that were unstable on rich medium.
After fusion of Pichia stipitis with Candida shehatae, Gupthar and Garnett
(1987) observed stable fusants. They could induce segregation and recombination
of parental markers. Selebano et al. (1993) obtained hybrids between these species
which were very similar to the Pichia stipitis parent. By means of electrophoretic
karyotyping, they showed that only minor portions of DNA from the Candida
shehatae parent had been transferred.
The transfer of single chromosomes could be demonstrated in fusion products

of Kluyveromyces marxianus with its anamorph Candida macedoniensis by
Zimmermann et al. (1988) using electrophoretic karyotyping. Fusion products
between Saccharomyces cerevisiae and Kluyveromyces marxianus were very simi-
lar to the Kluyveromyces marxianus parent (Witte et al. 1989). Attempts to deter-
mine the Saccharomyces cerevisiae part in the fusants' genomes had failed.
Hybrids were obtained by illegitimate mating of Kluyveromyces marxianus and
Kluyveromyces thermotolerans. The analysis by means of physiological analysis,
isoenzyme patterns, DNA reassociation, and RFLPs of rDNA showed that only
incomplete addition of the parental genomes had taken place (Vaughan-Martini et
al. 1987). The hybridization process was described as some sort of transformation
rather than copulation. Provost et al. (1978) fused Candida tropicalis and
Saccharomycopsis lipolytica and found unstable hybrids whose genomes were
obviously composed mainly of the genome of one parent and only minor portions
of the other one. Hybrids between Candida boidinii and Candida tropicalis had
electrophoretic karyotypes resembling that of the Candida boidinii parent (Kobori
et al. 1991).
Skala et al. (1988) fused Saccharomyces cerevisiae with Saccharomyces
Jermentati. Two types of hybrids were recovered. One type seemed to contain the
total Saccharomyces Jermentati genome plus one additional Saccharomyces
cerevisiae chromosome. The other type was thought to have the complete Saccha-
romyces cerevisiae genome plus one chromosome from Saccharomyces Jermentati.
All these results indicate that interspecific and intergeneric hybridization is
possible in yeasts. Complete addition of genomes or integration of intact chromo-
somes, however, seems to be a rare event. Integration of minor parts of DNA from
One parent into the chromosomes of the other parent seems to be the more likely
consequence.
7
Practical Recommendations
In the following section, practical hints for the preparation, treatment, and
fusion of protoplasts are given. These hints can serve only as general guideline, as
the experimental conditions must be optimized for each strain system. The first
point is the choice of suitable fusion partners. As the formation of a fusant may
be a rare event, the parental strains must bear stable markers to allow the selection
of a fusant. Markers frequently used are different complementing auxotrophies,
respiratory deficiencies, or differences in the utilization of carbon sources. The
efficiency of a selective system should be checked before a fusion experiment is
done.
A next point is the protoplasting of the cells. Many strains from most genera can
be protoplasted by either Novozym G234 or by Zymolyase together with reducing
agents. Novozym shows good results with strains containing a high amount of a-
1,3-glucan, while Zymolyase works best on strains with f3-1,3-glucan. Other
protoplasting enzymes are for instance Lyticase, Glusulase, or Helicase. A mixture

of different enzymes can help if a single preparation is ineffective. The susceptibil-
ity of a strain towards protoplasting enzymes can be used as a trait in yeast
taxonomy (Bastide et al. 1975). When using Zymolyase, it is often advantageous to
cleave the disulfide bonds of the proteins in the cell wall. To this end, reducing
agents such as mercaptoethanol or dithiothreitol can be used. Mercaptoethanol is
volatile and highly toxic; it might also injure the cell membrane (Sipiczki et al.
1985). The negative effects can be avoided if it is only used in a pretreatment and
omitted in the enzyme treatment. The physiological status of the cells often has a
tremendous effect on the protoplasting efficiency. Cells from the early to middle
logarithmic phase are usually more easily protoplasted, so the cultivation of the
cells can be optimized.
The synthesis of the cell wall can be impaired by the addition of 2-deoxy-D-
glucose (DOG) to the medium prior to protoplasting. This will make the cells more
susceptible to protoplasting enzymes. The treatment with 2-DOG should be kept
short (Foury and Goffeau 1973; Sipiczki and Ferenczy 1978). If no conditions can
be found which lead to the formation of protoplasts, a screening for producers of
protoplasting enzymes can serve as a last resort (Kaul et al. 1993). The
protoplasting of the cells can be monitored microscopically by adding distilled
water to the protoplast suspension on the slide. Protoplasts will then burst. Cell
walls can be stained by UVITEX 2B. Further information can be found in the
papers by Torres-Bauza and Riggsby (1980), Stephen and Nasim (1981), Sipiczki et
al. (1985), and Lin and Levin (1990). The stabilizer which creates the osmotic
pressure necessary to keep the protoplasts from bursting can have some effect on
the regeneration of the protoplasts. The osmotic pressure of the medium should be
equal to or slightly higher than the pressure in the cytoplasm. Often 0.7-0.9M
sorbitol or 0.6-0.7 M KCI are used. The osmotic value of the buffer must also be
considered. Too high a concentration of stabilizer will cause the protoplasts to
shrink and impair fusion. Novozym will be greatly reduced in activity by concen-
trations of sorbitol exceeding 0.7M KCI or 0.9M sorbitol. Other substances,
such as mannitol, can be tried, either alone or in a mixture with sorbitol.
When trying to protoplast osmotolerant yeasts, higher concentrations of stabilizer
might be needed (Spencer et al. 1988). For further information read Sipiczki et al.
(1985).
A good protoplasting scheme should convert more than 99% of the cells into
protoplasts within 1 h. If the cells tend to form clumps during protoplasting, one
should try to increase the agitation.
When optimizing the conditions for protoplasting, the following parameters
should be monitored:
• Initial number of colony-forming units (cfu) on an unstabilized medium.

• Cell number as counted in a hemocytometer as a control for the lysis of cells
during protoplasting.
• Colony-forming units on an unstabilized medium after protoplasting, giving the
amount of cells which were not protoplasted.
• Colony-forming units on a stabilized medium, giving, compared to step 3, the

regeneration rate of the protoplasts.
• Regeneration of protoplasts on the selective medium.
• Regeneration of protoplasts on the selective medium supplemented according to
the markers, giving some impression of the stress that the selective medium
imposes on the regenerating cells.
The aim of the optimization can be defined as follows:
• The cell number should remain constant during protoplasting.
• The cfu on unstabilized medium should decrease by some two orders of
magnitude.
• The cfu on stabilized rich medium should equal the cfu prior to protoplasting.
• There should be no regeneration on selective medium.
• The regeneration on the selective medium supplemented for the markers should
be as good as on rich medium.
To reach this aim, treat the protoplasts as carefully as possible, i.e., keep the
protoplasting step as short as possible with as little enzyme as possible, do not
vortex the protoplasts, pipette them slowly through wide-bore pipettes, centrifuge
them as gently as possible (1000 rpm in a standard laboratory centrifuge), and do
not subject them to elevated temperatures. To induce protoplast fusion, proto-
plasts from both strains are mixed in similar numbers, centrifuged, and suspended
in a solution of 25-30% PEG 6000 and 10-100 mM Ca2+. It is well established that
PEG and Ca2+ are both necessary to induce fusion. Work from Kobori et al. (1991)
indicates that filter-sterilized PEG leads to much higher fusion rates than PEG that
was autoclaved. Kavanagh et al. (1991) found that the use of calcium propionate
can greatly improve hybrid recovery.
After the PEG treatment, the protoplasts are transferred to regeneration me-
dium. Usually, it is better to embed the protoplasts in regeneration agar than to use
liquid media or plate the protoplasts onto the surface of a plate (Svoboda 1978).
The protoplast suspension should be diluted in regeneration medium to reduce the
PEG concentration below the inhibitory concentration of PEG.
As the regeneration of the protoplasts in selective medium might impose too
much pressure onto the cells, alternative procedures have been developed. These
involve the encapsulation of the protoplasts in alginate (Vidoli et al. 1982; Hansen
et al. 1990) or agar-gelatine beads (Spencer et al. 1989). The beads can be incubated
in rich medium, allowing for a better regeneration. After regeneration, the cells are
transferred into selective medium. These procedures, however, allow no precise
determination of the fusion rate. It is advisable to separate the beads into many
flasks in order to obtain fusion products which have originated independently.
It is possible to stain the cells prior to protoplasting with different fluorescent
dyes that do not impair the regeneration of the cells. After the fusion experiment,
protoplasts which have fused can be detected, as they show the mixed color. In the
same experiment, the nuclei can also be stained with DAPI, so their development
can also be followed (Hintz 1987). The protoplasts might take several days or even
weeks to regenerate, therefore the plates should be incubated in a humid atmo-
sphere in order to keep them from drying up.
Most authors stabilize the fusion products by subculturing them several times
on selective medium. During this step, one should look for sectored colonies,
which indicate segregation processes. Though one normally wants to have stable
fusion products, these segregants should not be discarded, as they can serve as
additional proof for a fusion. The stability of the fusants can be checked by
culturing on rich medium for some passages, plating on rich medium, and subse-
quently plating on selective media. When segregants are obtained, one should look
for colonies that bear the parental markers and search for recombinants.
8
Analysis of the Fusants
Stable fusants can be analyzed further by investigating traits of the parental
strains, which were not selected for. Such traits are for instance morphological
features, DNA content, or isoenzyme patterns. Strain-specific gene probes, DNA-
DNA reassociation, RFLP markers, RAPD markers, or electrophoretic karyotyping
can be used to assess the contribution of each parent to the fusant's genome.
As an example, a protoplast fusion protocol is given that is used in a ge-
netical course in our laboratory. It works with strains of Saccharomyces
cerevisiae Kluyveromyces marxianus, Schwanniomyces occidentalis and Candida
macedoniensis. Figure 1 gives the suitable controls.
8.1
Preparation of Protoplasts
1. Preculture: 24 h in YEPD, 50 ml.

2. Main culture: 16h in YEPD, SOOml, inoculated with Sml preculture.
3. Centrifuge cells from 200ml culture and resuspend cells in 8ml EDTA solu-
tion, 100mM pH 7.5.
4. Wash twice with EDT A solution.
5. Wash once with SORTRISCA (1.2M sorbitol, lOmM CaC12, 100mM TRIS/HC1,
pH 7.5).
6. Resuspend cells in 8ml SORTRISCA.
7. Add 20,ul mercaptoethanol and 1 ml Zymolyase, 1 mg/ml in SORTRISCA,
filter-sterilized CAUTION: mercaptoethanol is highly toxic!
8. Incubate at 35°C with mild agitation.
9. Check for protoplasts by microscopy.
10. Wash protoplasts five times with SORTRISCA.
11. Regenerate protoplasts by:
Strain A Strain B
!'"
"1:1
1 1 ~
"1:1
Protoplasts Protoplasts iii
l!I.
""c
'"cr
~
2-
Plate on Mix Plate on
m
~ ~ Ii
Rich/selective medium Un stabilized medium Unstabilized medium Rich/selective medium
Supp. select. medium 1 Suppl. SeIer medium
+ 1
Regeneration rat;] I~;~ of pro top lasts INumber of pro top lasts II~er~tI.;~r~t;-1
PEG-Treatment No PEG-Treatment
+
Plate on
+
Plate on
t t
Selective medium Selective medium
Hybrids
• Revertants, crossfeeding
•
Fig. 1 I~
a) plating on YEPD without sorbitol,

b) mixing of IOO,uI suspension/dilution with 4m1liquified YEPD agar
stabilized with 1.2 M sorbitol, warmed to 50°C, and plating on stabilized
medium.
12. Incubate 5-7 days, calculate regeneration rate.
8.2
Fusion of Pro toplasts
1. Prepare protoplasts from two strains.
2. Mix 1 x 108 protplasts from either strain.

3. Centrifuge the protoplasts.
4. Resuspend pellet in 5 m1 PEG-solution (25-30% PEG 4000 or 6000 in 10-
100 mM calcium).
5. Incubate 30 min at 30°C.
6. Dilute PEG by adding five times 1 m1 stabilized medium at intervals of 3 min.
7. Add 100,uI of suspension to 4 m1 liquified, stabilized selective agar and plate
onto selective agar.
Controls
• Regeneration on stabilized rich medium.
• Regeneration of a mixture of protoplasts without PEG treatment.
• Regeneration of protoplasts from either strain alone after PEG treatment on rich
and on selective medium.
9
Additional Protocols
9.1
Alginate Encapsulation of Protoplasts
(Vidoli et al. 1982; Hansen et al. 1990)
1. Mix equal volumes of protoplast suspension and 5% alginate solution.

2. Pour the mixture dropwise into 100 mM CaClz, the drops will form beads.
3. Transfer the beads into several batches of rich, stabilized medium and incubate
until the protoplasts have regenerated into cells.
4. Wash the beads twice with 1.2 M sorbitol.
5. Transfer the beads into selective medium and incubate several days.
6. Dissolve the beads in a solution of 2.5% sodium-hexa-meta-phosphate and

plate the cells onto selective medium.
9.2
Induction of Haploidization or Mitotic Segregation
by p-Fluoro-Phenylalanine (Wilson et al. 1983)
I. Inoculate 20ml YEPD with the fusant, incubate 24h.

2. Inoculate 50 ml YEPD containing 100.ug/ml p-fluoro-phenylalanine with 0.5 ml
preculture, incubate 48 h.
3. Dilute the culture appropriately and plate onto YEPD agar, incubate some days.
4. Replica plate onto selective medium, identify auxotrophic colonies.
9.3
Staining of Cells Prior to Protoplasting (Hintz 1987)
Suitable dyes are fluorescein isothiocyanate (FlTC) and rhodamin isothiocyanate

(RITC), both from Sigma.
1. The dyes are dissolved in ethanol (FlTC) or water (RITC) at a concentration of
2.5mg/ml.
2. Add 3 to 4 ml of the solution to 500 ml of culture 5 h prior to protoplasting.
3. Observe the cells by fluorescent microscopy using an excitation wavelength of
4lOnm. The staining remains visible for almost 40h (Hintz 1987).
A vital stain of the nuclei is possible by adding l.ug/ml DAPI to the culture
medium.
10
Concluding Remarks
The survey of the literature has shown that possible consequences of protoplast
fusion are:
• Exchange of cytoplasm and cytoplasmatic genes
• Polyploidization due to fusion of several protoplasts
• Aneuploidy due to segregation of polyploids or diploids
• Complete addition of two or more parental genomes
• Exchange of single chromosomes or addition of single chromosomes from one
parent to the genome of the other parent
• Integration of small pieces of DNA from one parent into the genome of the other.
It becomes clear from this list of possible events (which is probably not complete)
that the analysis of a fusant can be a formidable task. Nevertheless, protoplast
fusion is a valuable tool for the hybridization and genetic analysis of yeasts which
cannot be crossed by conventional methods.
References
Allmark BM, Morgan AJ, Whittaker PA (1978) The use of protoplast fusion in demonstrat-
ing chromosomal and mitochondrial inheritance of respiratory-deficiency in
Kluyveromyces lactis, a petite-negative yeast. Mol Gen Genet 159: 297-299
Arirna K, Takano I (1979) Multiple fusion of protoplasts in Saccharomyces yeasts. Mol Gen
Genet 173:271-277
Bastide M, Trave P, Bastide JM (1975) L'hydrolyse enzymatique de la paroi applique a la
classification des levures. Ann Microbiol (lnst Pasteur) 126 A: 275-294
Becher D, Boettcher F (1979) Hybridization of Rhodosporidium toruloides by protoplast
fusion. In: Advances in protoplast research. Publishing House of the Hungarian Acad-
emy of Sciences, Budapest, pp 105-111
Bendova 0, Kupcova L, Janderova B, Vondrejs V, Vernerova J (1983) Ein Beitrag zur
Brauereihefehybridisierung. Monatsschr Brauwiss 36: 167-171
Boettcher F, Becher D, Klinner U, Samsonova lA, Schilova B (1979) Genetic structure of
yeast hybrids constructed by protoplast fusion. In: Advances in protoplast research.
Publishing House of the Hungarian Academy of Sciences, Budapest, pp 99-104
Chun SB, Chin JE, Bae S, An GH (1992) Strain improvement of Phaffia rhodozyma by
protoplast fusion. FEMS Microbiol Lett 93: 221-226
Corner BE, Poulter RTM (1989) Interspecific complementation analysis by protoplast fu-
sion of Candida tropicalis and Candida albicans adenine auxotrophs. J Bacteriol 171:
3586-3589
de Richard MS, van de Broock MR (1984) Protoplast fusion between a petite strain of
Candida utilis and Saccharomyces cerevisiae respiratory-competent cells. Curr
MicrobiollO: 117-120
Farahnak F, Seki T, Ryu DDY, Ogrydziak D (1986) Construction oflactose-assimilating and
high-ethanol-producing yeasts by protoplast fusion. Appl Environ Microbiol 51:
362-367
Ferenczy L (1981) Microbial protoplast fusion. In: Glover SW, Hopwood DA (eds) Genetics
as a tool in microbiology. 31st Symp Soc Gen Microbiol, University Press, Cambridge, pp
1-34
Ferenczy L, Maraz A (1977) Transfer of mitochondria by protoplast fusion in Saccharomy-
ces cerevisiae. Nature 268: 524-525
Fournier P, Provost A, Bourguignon C, Heslot H (1977) Recombination after protoplast
fusion in the yeast Candida tropicalis. Arch Microbiol115: 143-149
Foury F, Goffeau A (1973) Combination of 2-deoxyglucose and snail-gut enzyme treatments
for preparing sphaeroplasts of Schizosaccharomyces pombe. J Gen Microbiol 75:
227-229
Galeotti CL, Clark-Walker GD (1983) Changes of gene expression in fusion products be-
tween Saccharomyces cerevisiae and Kluyveromyces lactis. In: Nagley P, Linnane AW,
Peacock WJ, Payeman JA (eds) Manipulation and expression of genes in eukaryotes.
Academic Press Australia, Melbourne, pp 159-166
Gericke M, Van-Zyl WH (1992) Improvement of the cell volume of Candida blankii through
protoplast fusion. J Ind Microbiol10: 117-122
Goodey AR, Bevan EA (1983) Production and genetic analysis of yeast hybrids. Curr Genet
7: 69-72
Groves DP, Oliver SG (1984) Formation ofintergeneric hybrids of yeast by protoplast fusion
of Yarrowia and Kluyveromyces species. Curr Genet 8: 49-55
Gunge N, Sakaguchi K (1981) Intergeneric transfer of desoxyribonucleic acid killer plas-

mids, pGKIl and pGKI2, from Kluyveromyces lactis into Saccharomyces cerevisiae by cell
fusion. J Bacteriol147: 155-160
Gupthar AS (1987) Construction of a series of Pichia strains with increased DNA content.
Curr Genet 12: 605-610
Gupthar AS (1992) Segregation of altered parental properties in fusions between Saccharo-
myces cerevisiae and the D-xylose fermenting yeasts Candida shehatae and Pichia
stipitis. Can J Microbiol38: 1233-1237
Gupthar AS, Garnett HM (1987) Hybridization of Pichia stipitis with its presumptive imper-
fect partner Candida shehatae. Curr Genet 12: 199-120
Hansen M, Roecken W, Emeis CC (1990) Construction of yeast strains for the production of
low-carbohydrate beer. J Inst Brew 96: 125-129
Hintz M (1987) Versuche zur somatischen Hybridisierung von Schwanniomyces und Sac-
charomyces mit dem Ziel der Ethanolgewinnung aus Starke. Dissertation, RWTH
Aachen
Hoffmann M, Zimmermann M, Emeis CC (1987) Orthogonal field alternation gel electro-
phoresis as a means for the analysis of somatic hybrids obtained by protoplast fusion of
different Saccharomyces strains. Curr Genet 11: 599-603
Johannsen E, Halland L, Opperman A (1984) Protoplast fusion within the genus
Kluyveromyces van der Walt emend. van der Walt. Can J Microbiol30: 540-552
Johannsen E, Eagle L, Bredenhann G (1985) Protoplast fusion used for the construction of
presumptive polyploids of the D-xylose fermenting yeast Candida shehatae. Curr Genet
9: 313-319
Kakar SN, Magee PT (1982) Genetic analysis of Candida albicans: identification of different
isoleucine-valine, methionine, and arginine alleles by complementation. J Bacteriol151:
1247-1252
Kaul W, Rossow U, Emeis CC (1993) Screening for microorganisms with cell wall lytic
activity to produce protoplast-forming enzymes. Appl Microbiol Biotechnol 39: 574-
576
Kavanagh K, Walsh M, Whittaker PA (1991) Enhanced intraspecific protoplast fusion in
yeast. FEMS Microbiol Lett 65: 283-266
Klinner U, Boettcher F (1984a) Hybridization of yeasts by protoplast fusion: early events
after fusion in Pichia guilliermondii. Z Allg Mikrobiol 24: 539-544
Klinner U, Boettcher F (1984b) Hybridization of yeasts by protoplast fusion: ploidy levels of
hybrids resulting from fusions in haploid strains of Pichia guilliermondii. Z Allg
Mikrobiol24: 533-537
Klinner U, Boettcher F (1985) Chromosomal rearrangements after protoplast fusion in the
yeast Candida maltosa. Curr Genet 9: 619-621
Klinner U, Samsonova lA, Boettcher F (1984) Genetic analysis of the yeast Candida maltosa
by means of induced parasexual processes. Curr Microbiol11: 241-246
Kobori H, Takata Y, Osumi M (1991) Interspecific protoplast fusion between Candida
tropicalis and Candida boidinii: characterization of the fusants. J Ferment Bioeng 72:
439-444
Lakhchev K, Penkova R, Ivanova V, Tuneva D (1992) Genetic analysis of methylotrophic
yeast Candida boidinii PLDl. Antonie Leeuwenhoek J Microbiol61: 185-194
Lin LF, Levin RE (1990) Relative effectiveness of yeast cell wall digesting enzymes on
Yarrowia lipolytica. Microbios 63: 109-115
Luckemann G, Sipiczki M, WolfK (1979) Transmission, segregation, and recombination of
mitochondrial genomes in zygote clones and protoplast fusion clones of yeast. Mol Gen
Genet 177: 185-187
Maraz A, Ferenczy L (1980) Selective transfer of fungal cytoplasmatic genetic elements by
protoplast fusion. Curr Microbiol 4: 343-345
Maraz A, Subik J(1981) Transmission and recombination of mitochondrial genes in Saccha-
romyces cerevisiae after protoplast fusion. Mol Gen Genet 181: 131-133
Maraz A, Kiss M, Ferenczy L (1978) Protoplast fusion in Saccharomyces cerevisiae strains of

identical and opposite mating types. FEMS Microbiol Lett 3: 319-322
Matsuoka M, Uchida K, Aiba S (1982) Cytoplasmic transfer of oligomycin resistance during
protoplast fusion of Saccharomycopsis lipolytica. J Bacteriol152: 530-533
Molnar M, Sipiczki M (1993) Polyploidy in the haplontic yeast Schizosaccharomyces pombe:
construction and analysis of strains. Curr Genet 24: 45-52
Perez C, Benitez J (1986) Defective karyogamy in meiotic segregants of a Candida utilis-
Saccharomyces cerevisiae hybrid. Curr Genet 10: 639-642
Perez C, Vallin C, Benitez J (1984) Hybridization of Saccharomyces cerevisiae with Candida
utilis through protoplast fusion. Curr Genet 8: 575-580
Pina A, Calderon IL, Benitez T (1986) Intergeneric hybrids of Saccharomyces cerevisiae and
Zygosaccharomyces Jermentati obtained by protoplast fusion. Appl Environ Microbiol
51: 995-1003
Poulter R, Jeffery K, Hubbard MJ, Shepherd MG, Sullivan PA (1981) Parasexual genetic
analysis of Candida albicans by spheroplast fusion. J Bacteriol 146: 833- 840
Provost A, Bourguignon C, Fournier P, Heslot H (1978) Intergeneric hybridization in yeasts
through protoplast fusion. FEMS Microbiol Lett 3: 309-312
Rocken W (1984) Ubertragung des Killerplasmids von einer Killerhefe auf eine untergarige
Bierhefe durch Protoplastenfusion. Monatsschr Brauwiss 9: 384-389
Sarachek A, Rhoads DD (1981) Production ofheterokaryons of Candida albicans by proto-
plast fusion: effects of differences in proportions and regenerative abilities of fusion
partners. Curr Genet 4: 221-222
Sarachek A, Weber DA (1984) Temperature-dependent internuclear transfer of genetic
material in heterokaryons of Candida albicans. Curr Genet 8: 181-187
Sarachek A, Weber DA (1986) Segregant-defective heterokaryons of Candida albicans. Curr
Genet 10: 685-693
Scherer S, Magee PT (1990) Genetics of Candida albicans. Microbiol Rev 54: 226-241
Selebano ET, Govinden R, Pillay D, Pillay B, Gupthar AS (1993) Genomic comparisons
among parental and fusant strains of Candida shehatae and Pichia stipitis. Curr Genet
23: 468-471
Sipiczki M (1979) Interspecific protoplast fusion in fission yeast. Curr Microbiol 3: 37-
40
Sipiczki M, Ferenczy L (1977a) Fusion of Rhodosporidium (Rhodotorula) protoplasts. FEMS
Microbiol Lett 2: 203-205
Sipiczki M, Ferenczy L (1977b) Protoplast fusion of Schizosaccharomyces pombe aux-
otrophic mutants of identical mating-type. Mol Gen Genet 151: 77-81
Sipiczki M, Ferenczy L (1978) Enzymatic methods for enrichment of fungal mutants. 1.
Enrichment of Schizosaccharomyces pombe mutants. Mutat Res 50: 163-173
Sipiczki M, Heyer WD, Kohli J (1985) Preparation and regeneration of protoplasts and
spheroplasts for fusion and transformation of Schizosaccharomyces pombe. Curr
Skala J, Luty J, Kotylak Z (1988) Interspecific protoplast fusion between the yeasts Saccha-
romyces cerevisiae and Saccharomyces Jermentati. Curr Genet 13: 101-104
Spencer JFT, Spencer DM (1981) The use of mitochondrial mutants in hybridizaton of
industrial yeasts III. Restoration of mitochondrial function in petites of industrial yeast
strains by fusion with respiratory-competent protoplasts of other yeast species. Curr
Genet 4: 177-180
Spencer JFT, Laud P, Spencer DM (1980) The use of mitochondrial mutants in the isolation
of hybrids involving industrial yeast strains II. Use in isolation of hybrids obtained by
protoplast fusion. Mol Gen Genet 178: 651-654
Spencer JFT, Spencer DM, Whittington-Vaughan P, Miller R (1983) Use of mitochondrial
mutants in the isolation of hybrids involving industrial yeast strains IV. Characterization
of an intergeneric hybrid, Saccharomyces diastaticus x Hansenula capsulata, obtained by
protoplast fusion. Curr Genet 7: 159-164
Spencer JFT, Spencer DM, Bizeau C, Vaughan-Martini A, Martini A (1985) The use of
mitochondrial mutants in hybridization of industrial yeast strains V. Relative parental
contribution to the genomes of interspecific and intergeneric yeast hybrids obtained by
protoplast fusion, as determined by DNA reassociation. Curr Genet 9: 623-625
Spencer JFT, Spencer DM, Reynolds N (1988) Genetical manipulation of non-conventional
yeasts by conventional and non-conventional methods. J Basic Microbiol28: 321-333
Spencer JFT, Spencer DM, Schiappacasse MC, Heluane H, Reynolds N, de Figueroa LI (1989)
Two new methods for recovery and genetic analysis of hybrids after fusion of yeast
protoplasts. Curr Microbiol18: 285-287
Stahl U (1978) Zygote formation and recombination between like mating types in the yeast
Saccharomycopsis lipolytica by protoplast fusion. Mol Gen Genet 160: 111-113
Stephen ER, Nasim A (1981) Production of protoplasts in different yeasts by mutanase. Can
J Microbiol 27: 550-553
Sugisaki Y, Gunge N, Sakaguchi K, Yamasaki M, Tamura G (1985) Transfer of DNA killer
plasmids from Kluyveromyces lactis to Kluyveromyces and Candida pseudotropicalis. J
Bacteriol 164: 1373-1375
Svoboda A (1978) Fusion of yeast protoplasts induced by polyethylene glycol. J Gen
Tamaki H (1986) Genetic analysis of intergeneric hybrids obtained by protoplast fusion in
yeast. Curr Genet 10: 491-494
Taya M, Honda H, Kobayashi T (1984) Lactose-utilizing hybrid strain derived from Saccha-
romyces cerevisiae and Kluyveromyces lactis by protoplast fusion. Agric BioI Chern 48:
2239-2243
Torres-Bauza LJ, Riggsby WS (1980) Protoplasts from yeast and mycelial forms of Candida
albicans. J Gen Microbiol119: 341-349
van de Broock MR, Sierra M, de Figueroa LC (1983) Ploidy reduction using p-
fluorophenylalanine of fusion products of Saccharomyces cerevisiae. Curr Microbiol 8:
13-16
van Solingen P, van der PlaatJB (1977) Fusion of yeast spheroplasts. J Bacteriol130: 946-947
Vaughan-Martini A, Sidenberg DG, Lachance MA (1987) Analysis of a hybrid between
Kluyveromyces marxianus and Kluyveromyces thermotolerans by physiological profile
comparison, isoenzyme electrophoresis, DNA reassociation, and restriction mapping of
ribosomal RNA. Can J Microbiol 33: 971-978
Vidoli R, Yamazaki H, Nasim A, Veliky IA (1982) A novel procedure for the recovery of
hybrid products from protoplast fusion. Biotechnol Lett 4: 781-784
Vondrejs V, Psenicka L, Kupcova L, Dostalova R, Janderova B, Bendova 0 (1982) The use of
a killer factor in the selection of hybrid yeast strains. Folia BioI (Praha) 29: 372-384
Weber H, Foerster W, Berg H, Jacob HE (1981) Parasexual hybridization of yeasts by electric
field stimulated fusion of protoplasts. Curr Genet 4: 165-166
Whelan WL, Kwom-Chung KJ (1987) Parasexual genetics of Torulopsis glabrata. J Bacteriol
169:4991-4994
Whelan WL, Partridge RM, Magee PT (1980) Heterozygosity and segregation in Candida
albicans. Mol Gen Genet 180: 107-113
Whittaker PA, Leach SM (1978) Interspecific hybrid production between the yeasts
Kluyveromyces lactis and Kluyveromyces fragilis by protoplast fusion. FEMS Microbiol
Lett 4: 31-34
Wilson JJ, Khachatourians GG, Ingledew WM (1982) Protoplast fusion in the yeast
Schwanniomyces alluvius. Mol Gen Genet 186: 95-100
Witte W, Grossmann B, Emeis CC (1989) Molecular probes for the detection of
Kluyveromyces marxianus chromosomal DNA in electrophoretic karyotypes of interge-
neric protoplast fusion products. Arch Microbiol152: 441-446
Zimmermann M, Hoffmann-Hintz M, Kolvenbach M, Emeis CC (1988) OFAGE banding
patterns of different yeast genera and of intergeneric hybrids. J Basic Microbiol 28:
241-247
CHAPTER 3
Electrophoretic Karyotyping of Yeasts

Martin Zimmermann l and Philippe Fournier2
1
Introduction and Theory
Electrophoretic karyotyping means the separation of intact chromosomal DNA

according to its size on an agarose gel. Depending on the number and size of the
chromosomes present in a strain, a specific banding pattern will be obtained. In
order to reach this goal, two demands must be met. First, it is important to prepare
the DNA without degradation by mechanical stress or by DNAses. Second, a
method for the electrophoretic separation of the extremely large molecules must
be developed. Conventional DNA electrophoresis is able to separate molecules of
up to 50 kilobases. Yeast chromosomes range from several hundred to several
thousand kilobases.
Since the mid-1980s, these problems have been solved by a number of groups.
The preparation of the DNA is usually carried out by lysing cells or protoplasts
which have been encapsulated in agarose, thus preventing mechanical stress.
DNAses are inhibited by a high concentration ofEDTA.
For electrophoretic separation, several pulsed-field devices have been devel-
oped. Since the theory of pulsed-field gel electrophoresis (PFGE) is rather complex,
a short, simplified explanation will be given. For a detailed description of PFGE
techniques and theory, see Gemmill (1991) and Chu (1991). The DNA is electro-
phoresed through an agarose gel, the driving forces are electrical fields which are
turned on alternatively. These fields are orientated towards each other under an
angle of more than 90°, so the DNA will be forced to reorientate after each change
of the field. Longer molecules will take more time to reorientate and therefore
move were slowly than shorter ones (Fig. 1). Schwartz and Koval (1989) were able
to observe the molecular dynamics of the DNA in PFGE after labeling the DNA
with fluorescent dyes.
The separation process is subject to many parameters. These include the type
and concentration of agarose, the temperature, the switching interval (also called
1 Institut rur Biologie IV (Mikrobiologie) der Rheinisch-Westfalischen Technischen
Hochschule Aachen, Worringer Weg, 52056 Aachen, Germany

2 Institut National de la Recherche Agronomique, Centre de Biotechnologies Agro-
Industrielles, Laboratoire de Gemhique Moleculaire et Cellulaire, 78850 Thiverval-Grignon,
France
102 M. Zimmermann and P. Fournier
a)OFAGE Electrodes Fields 1 and 2 alternate,

the arrows indicate
the movement of the DNA
Gel
Electrodes
b) FIGE Electrode
The polarity of the field

is alternated,
the forward pulse is longer
Gel than the backward pulse,
as indicated by the arrows
Electrode
c)TAFE Electrode Electrode

• •
>
The gel is orientated vertically,
a cross section is shown
Gel
• •
Electrode Electrode
d)RFE
Cathode Wells Cathode
Arrows indicate the
electric field direction
+ + Agarose
gel
Fig. la-d. Placement of electrodes in different PFGE devices. OPAGE Orthogonal Field
Alternation Gel Electrophoresis; FIGE Field-Inversion Gel Electrophoresis; TAPE Trans-
verse Alternating Field Electrophoresis; RPE Rotating Field Electrophoresis
3. Electrophoretic Karyotyping of Yeasts 103
pulse time), the field strength, the field geometry, the DNA concentration, and the
DNA topology. The influence of these parameters has been investigated systemati-
cally by Cantor et al. (1988), Mathew et al. (1988a,b,c) and Doggett et al. (1992).
During the past years, several different PFGE techniques have been published,
like Field-Inversion Gel Electrophoresis (FIGE; Carle et al. 1986); Contour-
Clamped Homogeneous Electric Field (CHEF; Chu et al. 1986); Transverse Alter-
nating Field Electrophoresis (TAFE; Gardiner and Patterson 1988); Rotating
System (RGE or RFE; for a review see Eby 1990); Secondary Pulsed Field Gel
Electrophoresis (Zhang et al. 1991) and Zero-Integrated-Field Electrophoresis
(ZIFE; Noolandi and Tunnel 1992). All these techniques have proven useful for
electrophoretic karyotyping of yeasts. They differ primarily in the geometry of the
electrodes and the mechanisms by which the change of the fields is accomplished
(see Fig. 1).
Some systems, i.e., CHEF or RGE, allow for a change of the angle between the
fields during the experiment. This can result in a faster separation (Chu and
Gunderson 1991).
The first electrophoretic karyotypes were obtained from Saccharomyces
cerevisiae (Carle and Olson 1984, 1985; Schwartz and Cantor 1984). The chromo-
somes were separated into 11 bands whereas with variations of the initial tech-
niques all 16 chromosomes can be visualized (Chu and Gunderson 1991). These
karyotypes agreed well with the data obtained from genetic investigations. It could
be shown that the DNA bands corresponded to intact chromosomes, and that
different chromosomes were separated into different bands. When using as probes
cloned genes whose map position was known, each band could be identified. Smith
et al. (1987), as well as Vollrath and Davies (1987), published karyotypes of
Schizosaccharomyces pombe, which proved that the separation range of PFGE
could be extended to molecules of more than 5 megabases.
2
Fields of Application
2.1
Yeast Taxonomy
Sor and Fukuhara (1989) investigated the genus Kluyveromyces. Data from electro-
phoretic karyotypes were correlated to restriction patterns of mitochondrial DNA.
The species K. lactis, K. fragilis, and K. marxianus could be differentiated. Within
K. marxianus two groups were found. A close relationship between K. marxianus
and its presumptive anamorph Candida macedoniensis was demonstrated. Here,
too, significant chromosome polymorphisms were detected. Steensma et al. (1988)
also showed that K. marxianus and K. lactis are different species, though they can
be hybridized by mating. The banding patterns of the parental K. marxianus and
K. lactis strains differed; the banding pattern of the hybrids was the sum of the
parental banding patterns. An exchange of genetic material during the meiosis of
the hybrids could not be demonstrated. Some degree of species-specific banding
patterns was also observed in the medically important species of Candida
tropicalis, Candida krusei, and Candida guilliermondii (Suzuki et al. 1988). Other
taxonomical studies involved species of the genera Saccharomyces, Hortaea,
Filobasidiella and Malazessia (Vaughan-Martini et al. 1993; Boekhout et al. 1993).
2.2
Study of Chromosome Polymorphisms
Strains belonging to the same species often show different banding patterns due to
chromosome length polymorphism. Examples for such polymorphism are Saccha-
romyces cerevisiae (Hoffmann et al. 1987), some Candida yeasts (Suzuki et al. 1988;
Lott et al. 1993), Yarrowia lipolytica (N aumova et al. 1993), Hansenula polymorpha
(Marri et al. 1993) and Torulaspora pretoriensis (Oda and Tonomura 1995). The
clinically important yeast Candida albicans was the subject of many studies, such
as Magee and Magee (1987), Merz et al. (1988), Rustchenko-Bulgac et al. (1990),
Rustchenko-Bulgac (1991), and Asakura et al. (1991). Here again, polymorphisms
were found which could be correlated with morphological mutations and used for
epidemiological studies. These polymorphisms could be correlated with alter-
ations in the size of the rDNA cistrons as, for instance, in chromosome XII of
Saccharomyces cerevisiae or chromosome III of Schizosaccharomyces pombe
(Pasero and Marilley 1993). Another reason might be chromosomal translocation
events that were observed in Candida albicans (Thrash-Bingham and Gorman
1992).
2.3
Typing of Yeast Strains
The chromosomal banding pattern of a strain is often specific enough to be used to

recognize a strain in fermentation processes or in epidemiological studies.
Examples are investigations concerning enological Saccharomyces strains
(Bakalinsky and Snow 1990; Vezinhet et al. 1990; Bidenne et al. 1992; Querol et al.
1992) and clinical Candida albicans strains (Merz et al. 1988). Several papers come
to the conclusion that the electrophoretic karyotype is superior in resolution to
RFLP or isozyme pattern, that is to say that strains could be differentiated by their
karyotype but not by their RFLP pattern (Merz et al. 1988; Carruba et al. 1991;
Vazquez et al. 1991, 1993; Magee et al. 1992; Lehmann et al. 1992).
2.4
Genome Mapping
After a gene has been cloned, it can be assigned to electrophoretically separated

chromosomes by Southern blotting and hybridization, even if a genetic map is not
available. This was done, for instance, with genes from Candida albicans (Magee et
al. 1988), DNA fragments containing potential centromeres from Kluyveromyces
lactis (Heus et al. 1990), or several genes from Yarrowia lipolytica (N aumova et al.
1993).
Physical mapping of the whole genome has been done for Saccharomyces
cerevisiae (Link and Olson 1991; Thierry and Dujon 1992) and for
Schizosaccharomyces pombe (Fan et al. 1991). These references give protocols for
the digestion of whole DNA preparations and of individual chromosomes with
rare cutting enzymes such as Not I and Sfi I. The genetic data were correlated to
data obtained by separation of intact chromosomes and of large restriction frag-
ments and subsequent Southern hybridization.
Chromosome fragmentation has been used for mapping and evidenced by
PFGE techniques (Vollrath et al. 1988), and this was used to show the presence of
centromeres on cloned DNA fragments (Fournier et al. 1993).
Chromosomal rearrangement (transposition, recombination) were also studied
with karyotyping (Chibana et al. 1994; Rustchenko et al. 1994; Suzuki et al. 1994),
as well as in DNA repair (Dardalhon and Averbeck, 1995; Contopoulou et al.
1987).
2.5
Characterization of Hybrids
Electrophoretic karyotypes have also been used to analyze yeast hybrids obtained
either by sexual or by somatic hybridization. In the case of Saccharomyces hybrids,
data from the electrophoretic karyotype could be compared with data from genetic
analysis. Both methods led to similar results (Hoffmann et al. 1987; Schillberg et al.
1991). Selebano et al. (1993) analyzed hybrids between Candida shehatae and
Pichia stipitis, and Kobori et al. (1991) characterized fusants between Candida
boidinii and Candida tropicalis. Intergeneric hybrids between Saccharomycopsis
fibuligera and Yarrowia lipolytica were analyzed by Nga et al. (1992). Hybrids
between Kluyveromyces marxianus and Candida macedoniensis, which are re-
garded as anamorphs (see above), and intergeneric hybrids between Saccharomy-
ces cerevisiae and Kluyveromyces marxianus were analyzed by Zimmermann et al.
(1988). These studies indicated that only small portions of DNA from one parent
were integrated into the other parents' DNA when strains from different species or
genera were fused.
2.6
Probe Preparation and Transformation
Chromosome bands can be isolated and used to prepare chromosome-specific
probes for Southern blots (Torok et al. 1992). Chromosome III from Saccharomy-
ces cerevisiae has been isolated by PFGE and used for transformation experiments
(Goto et al. 1990).
2.7
Miscellaneous
Many groups have investigated different yeasts by means of PFGE. In the follow-
ing, some yeast species and genera are listed for which electrophoretic karyotypes
have been determined.
De Jonge et al. (1986) used the OFAGE technique to determine the banding
patterns of yeasts from the genera Brettanomyces, Candida, Cryptococcus,
Filobasidiella, Geotrichum, Hansenula, Kluyveromyces, Pachysolen, Pichia,
Rhodosporidium, Rhodotorula, Saccharomyces, Saccharomycodes, Saccharo-
mycopsis, Schizosaccharomyces, and Zygosaccharomyces. Using conditions which
separated chromosomes of up to 1600 kb, they noticed considerable variations in
numbers and sizes of chromosomes, even within strains from the same species.
They found that Saccharomyces cerevisiae was quite exceptional for its high num-
ber ofrather small chromosomes (smaller than 500kb).
Candida maltosa was investigated by Tanaka et al. (1987), who found eight
chromosome bands. Johnston and Mortimer (1986) and Johnston et al. (1988)
analyzed Saccharomyces, Candida albicans, Candida utilis, Kluyveromyces lactis,
Pichia canadensis, Rhodosporidium toruloides, Saccharomycopsis fibuligera,
Schwanniomyces occidentalis, and Schizosaccharomyces pombe. Other yeasts for
which electrophoretic karyotypes have been determined include Candida
parapsilosis (Lott et al. 1993); Candida tropicalis and Candida boidinii (Kobori et
al. 1991); Candida utilis (Stoltenburg et al. 1992); Phaffia rhodozyma (Adrio et al.
1995; Nagy et al. 1994); Pichia stipitis and Candida shehatae (Passoth et al. 1992;
Selebano et al. 1993); Yarrowia lipolytica; and related yeasts from the genera
Saccharomycopsis, Endomycopsella, and Endomyces (Naumova et al. 1993).
This short survey of the literature shows that electrophoretic karyotyping is a
powerful means for the analysis of yeast genomes. Possible pitfalls of the method,
however, should not be neglected. One should bear in mind that the number of
bands may not be equal to the number of chromosomes. Different chromosomes
of similar size can comigrate. Chromosomes which are too large to be separated by
the experimental conditions choosen might escape detection. Size determinations
by PFGE are problematic as long as independent calibration methods are missing.
PFGE should therefore be used in conjunction with other methods.
3
Practical Recommendations
An excellent review has been written as a practical guide by Birren and Lai (1993),
so that only general remarks are provided here.
3.1
Sample Preparation
Many different procedures have been published concerning the preparation of

DNA suitable for PFGE. The following procedures have consistently worked well in
our laboratories for the last 6 years. They are derived from the procedures given by
Schwarz and Cantor (1984) and Carle and Olson (1985). In these procedures the
DNA is protected against mechanical stress by embedding the cells or protoplasts
in agarose, and high concentrations of EDT A are used to inhibit DNAses. In both
procedures the cells are protoplasted. In most cases, cells from the early log phase
can be protoplasted more easily than cells from the late log phase or from the
stationary phase. Sometimes the medium can be optimized in order to facilitate

the protoplasting step. The medium described by Svilha et al. (1961) was used to
improve the preparation of Yarrowia lipolytica plugs. It consists of 3% glucose,
0.5% yeast extract, 0.5% peptone, 0.0745% L-methionine, 0.0675% DL-
homocysteine thiolactone, 0.1% DL-methionine methyl sulfonium chloride. The
amount of DNA remaining in the well could be reduced significantly if the cells
were grown on this medium.
3.1.1
Procedure A: Protoplast Formation by Zymolyase
Many ascomyceteous yeast like Saccharomyes, Kluyveromyces, or some Candida

strains can be prepared by this procedure.
1. Grow the cells in rich medium such as YEPD to late logarithmic phase.
2. Centrifuge the cells from a 20-ml culture and wash the cells twice in 50mM
EDTA, pH 7.5.
3. Adjust the cell number to 2 x 109/ml and mix 1.5 ml suspension with 0.5 ml
Zymolyase (2 mg/ml), 50 J1l mercaptoethanol and 2.5 ml low-melting agarose
(l% in 0.125mM EDTA, pH 7.5).
4. Pour the mixture into small petri dishes or in insert (plug) moulds and let it
soldify.
5. Cut out the plugs according to the size of the wells and incubate them for 24h
at 37°C in 5ml LET-buffer (O.5M EDTA, O.OIM Tris, pH 7.5). Sometimes 2%
mercaptoethanol must be added to the buffer.
6. Replace the LET buffer with NDS solution (O.5M EDTA, O.OIM Tris, 1%
N-Iauroylsarcosinate, pH 9.5 with 0.5mg/ml Proteinase K) and incubate the
plugs for 24h at 50°C. In many cases, the plugs will become clear after this
treatment.
7. Rinse the plugs several times with LET buffer and incubate them in LET buffer
containing 500U Tl-RNAse at 37°C for 24h. The plugs can be stored in this
solution.
8. Prior to electrophoresis, incubate the plugs to be used in electrophoresis buffer
to equilibrate for some time.
The Zymolyase treatment can be shortened by starting the protoplasting in liquid

medium for 10 min in osmotically stabilized medium and subsequently producing
agarose plugs. The plugs are then incubated in stabilized medium containing 1 mgt
ml Zymolyase for 2h at 37°C. The stabilization can be accomplished by sucrose,
sorbitol, mannitol, or salts like KCI, MgCI, or MgS0 4, depending on the yeast
strain. The stabilization should be checked microscopically for protoplast-like
forms and for the absence of lysis.
3.1.2
Procedure B: Protoplast Formation by Novozym
Most strains that cannot be protoplasted by Zymolyase can be protoplasted by

Novozym, as is the case with many basidiomyceteous yeasts, but also with
Schizosaccharomyces pombe.
1. Prepare protoplasts according to your optimized procedure or grow cells to late
log phase.
2. Wash cells twice in 0.1 M citrate-phosphate buffer, pH 5.8 containing 0.6M
potassium chloride.
3. Protoplast cells with Novozym G 234, 20mgllO JO cells in stabilized buffer (see
step (1), check for protoplasts by microscopy. This step will take about 1 h.
4. Centrifuge the protoplasts and wash them in stabilized buffer.
5. Mix 1.5 ml of the suspension containing 3 to 5 X 109 protoplasts gently but
thoroughly with 2.5 ml LM-agarose and let the mixture solidify.
6. Cut out the plugs and proceed as in procedure A, step (6).
Recently, several groups have found that chromosome plugs can be produced
without the use of protoplasting enzymes (McClusky et al. 1990; Kwan et al. 1991;
Gardner et al. 1993; Ibeas and Jimenez 1993). As the electrophoretic behaviour of
the DNA depends on the DNA concentration in the plugs, it is important to use
similar amounts if banding patterns are to be compared.
3.1.3
Markers
Suitable size markers are bacteriophage lambda concatemeres, Saccharomyces

cerevisiae, Schizosaccharomyces pombe, and Hansenula wingei chromosomes,
which are all commercially available as agarose plugs or beads.
Recently, Zhang et al. (1993) found out that several other yeasts could serve as
size markers for the range from 0.7 to 3.3 megabases. However, it should be noted
that Pasero and Marilley (1993) detected significant variations in the sizes of
chromosomes bearing rDNA clusters, i.e., chromosome XII from Saccharomyces
cerevisiae and chromosome III from Schizosaccharomyces pombe. Isolates belong-
ing to one strain can differ by several hundred kilobases with regard to these
chromosomes. Several physical parameters influence the migration (Mathew et al.
1988a,b). Therefore care should be taken when chromosome or genome sizes are to
be deduced from PFGE data.
3.2
Electrophoresis Apparatus
Several manufacturers sell PFGE equipment. All these devices have a good record
for their performance, so no recommendation for a specific vendor will be given.
Many high-quality data are still obtained by groups who use home-made devices.
Carle and Olson (1984) and Schwartz et al. (1989) have published information on
the construction of PFGE units.
Some groups sterilize their electrophoresis unit before use. We did not find this
to be necessary, but it cannot be wrong to do it. However, before chemicals are
used to sterilize the unit, one must make sure that the material is resistent to the
chemicals. Most plastic ware is not resistent to ethanol!
3.3
Electrophoresis Conditions
The electrophoresis should not be carried out in the presence of ethidium bro-
mide, as this will influence the migration of the DNA. When unknown samples are
to be analyzed, it is advisable to start with conditions that will separate smaller
chromosomes, such as the ones of Saccharomyces cerevisiae. Such conditions are:
Buffer 0.4 x TBE
Gel 1% agarose (GTG agarose)
Temperature 13°C
Voltage 200V, or 10V per centimeter
Pulse time 100s
Run time 30h
These conditions will separate molecules from 50 to 1600kb.
Figure 2a shows the separation of Saccharomyces cerevisiae chromosomes as an
example. Chromosomes which are significantly larger than the ones from Saccha-
romyces cerevisiae should migrate as a single band at the top of the gel. If the
samples are not degraded, there should be no smear of DNA.
In order to separate larger chromosomes, the voltage should be reduced and the
pulse time and the run time should be increased.
We have observed that improved separation can be obtained by increasing
agarose concentration. This does not affect the migration, but must be compen-
sated by a proportional increase of the run time.
A next run could be as follows:
Buffer 0.4 x TBE
Gel 1% agarose
Temperature 13°C
Voltage 100V or 5Vcm-1
Pulse time 2,5, 10, 20 min for 24h each
These conditions should separate chromosomes from 1 to 3.5 megabases. Even
larger chromosomes can be separated as follows:
Buffer 0.4 x TBE
Gel 0.8% agarose
Temperature 13 °C
Voltage 40 V or 2 V cm-1
1 2 3 4 5 6
a b
Fig. 2. Separation of yeast chromosomes by PFGE. a Chromosomes of S. cerevisiae: size

range from 260 to 1600kb; b Chromosomes of Schizosaccharomyces pombe (lane 1),
Trichosporon beigelii (lanes 2-5), and Saccharomyces cerevisiae (lane 6): size range from 500
to 6000kb
Pulse time 60 min

Run time 6 days
Now the chromosomes from Schizosaccharomyces pombe should be separated,
giving a range from 3.5 to 5-6 megabases. Figure 2b shows the separation of
chromosomes from Schizosaccharomyces pombe, Trichosporon beigelii, and Sac-
charomyces cerevisiae.
The control of the temperature is very important if the results are to be
reproducible.
The conditions given here are rather simple examples which make no use of the
possibilities some sophisticated equipments offer, such as the generation of differ-
ent field geometries or of pulse-time ramps. For a fine tuning of the separation
these possibilities may be very helpful.
Starting with conditions separating smaller molecules will save time and
effort, especially if it is not clear whether the samples are good. The resolution of
the chromosomes can be further improved when different conditions are used
successively (Sor 1988; Tunnel and Lalande 1988; Brody and Carbon 1989). When
the voltage is increased, the pulse time should be decreased according to the
formula:
W=E1.4xTp,
where W is a window function affecting the size range that can be separated, E is
the field strength, and Tp the pulse time (Gunderson and Chu 1991).
One example is the separation of Yarrowia lipolytica chromosomes which could
be improved by the following scheme:
• 47.7h at 40V with 55-min pulse time
• 70 h at 43 V with 50-min pulse time
• 48h at 50V with 40-min pulse time
in a CHEF DR II system
or
• 90h at 20 rnA with 70-min pulse time
• 75h at 25 rnA with 50-min pulse time
in a TAFE system.
Some vendors sell agaroses specially designed for PFGE. They claim that sepa-
rations can be accomplished much faster. The choice of the agarose can be dictated
by the size of the chromosomes to be separated. The staining and photography of
the gels can be done by standard procedures, often a destaining in distilled water
improves the result.
3.4
Blotting of the Gels
Most groups use standard procedures for the blotting of the gels; the following
procedure from Nguyen et al. (1988) has proven to give good results reproducibly:
1. Stain, destain, and take a picture of the gel.
2. Soak the gel in 0.25 M HCI for 15 min, not longer, as that might lead to a bad
transfer. Alternatively, the gel can be exposed to UV-light, 5s, 3.5mW/cm2,
254nm.
3. Rinse the gel with water and than soak it in O.5MNaOH, I.5M NaClfor 20 min.
Repeat this step once.
4. Do capillary transfer overnight using the alkaline solution and a GeneScreen
membrane (NEN). The membrane should be prepared by first immersing it in
water, then in the NaOH solution.
5. After the transfer, rinse the membrane twice for 15 min in 50 mM NaPi, pH 6.5.
6. Expose the membrane to 0.2 m W/ cm2for 8 min at 254 nm UV light in order to
achieve crosslinking of the DNA to the membrane.
7. Strip the membrane in 2 mM EDT A, 0.1 % SDS at 85°C before the first and all
successive hybridizations.
8. Prehybridize the membrane in buffer for at least 2 h. The buffer is: 4 ml 20 x
SSPE, 2 ml 50 x Denhardt, 1 ml 10% SDS, 250 J1l salmon sperm DNA at 12 mg/
ml, water up to 25 ml.
9. Hybridize in the same buffer plus 10% Dextran sulfate at 65°C overnight.
10. The probe is labeled by random priming, boiled with the salmon sperm DNA,
and added to the hybridization mixture.
11. After hybridization, wash four times for 5 min at 65 °C in buffer A, then three
times in buffer B.
Buffer A 40mM NaPi, pH: 7.2, 1mM EDTA, 5% SDS.
Buffer B same as buffer A, but with 1% SDS.
12. Overnight exposure should be enough to detect a gene.
13. Stripping of the membrane is as described above.
14. The blots are kept in stripping buffer and should never be dried. We have
successfully rehybridized the same membrane ten times without significant
loss of signal.
Acknowledgments. We thank S. Casaregola for critical reading of the manuscript.
References
Adrio J, Lopez M, Casqueiro J, Fernandez C, Veiga M (1995) Electrophoretic karyotype of

the astaxanthin-producing yeast Phaffia rhodozyma. Curr Genet 27: 447-450
Asakura K, 1waguchi S1, Homma M, Sukai T, Higashide K, Tanaka K (1991) Electrophoretic
karyotypes of clinically isolated yeasts of Candida albicans and Candida glabrata. J Gen
Microbiol137: 2531-2538
Bakalinsky AT, Snow R (1990) The chromosomal constitution of wine strains of Saccharo-
myces cerevisiae. Yeast 6: 367-382
Bidenne C, Blondin B, Dequin S, Vezinhet F (1992) Analysis of the chromosomal DNA
polymorphism of wine strains of Saccharomyces cerevisiae. Curr Genet 22: 1-7
Birren B, Lai E (1993) Pulsed field gel electrophoresis: a practical guide. Academic Press,
London
Boekhout T, Renting M, Scheffers WA, Bosboom R (1993) The use ofkaryotyping in the
systematics of yeasts. Antonie Leeuwenhoek J Microbiol63: 157-163
Brody H, Carbon J (1989) Electrophoretic karyotype of Aspergillus nidlans. Proc Nat! Acad
Sci USA 86: 6260-6263
Cantor CR, Gaal A, Smith CL (1988) High-resolution separation and accurate size determi-
nation in pulsed-field gel electrophoresis of DNA. 3. Effect of electrical field shape.
Biochemistry 27: 9216-9221
Carle GF, Olson MV (1984) Separation of chromosomal DNA molecules from yeast by
orthogonal field alternation gel electrophoresis. Nucleic Acids Res 12: 5647-5664
Carle GF, Olson MV (1985) An electrophoretic karyotype for yeast. Proc Nat! Acad Sci USA
82: 3756-3760
Carle GF, Frank M, Olson MV (1986) Electrophoretic separation oflarge DNA molecules by
periodic inversion of the electric field. Science 232: 65-68
Carruba G, Pontieri E, De Bernardis F, Martino P, Cassone A (1991) DNA fingerprinting and
electrophoretic karyotype of environmental and clinical isolates of Candida parapsilosis.
J Clin Microbiol29: 916-922
Chibana H, lwaguchi SI, Homma M, Chindamporn A, Nakagawa Y, Tanaka K (1994)
Diversity of tandemly repetitive sequences due to short periodic repetitions in the
chromosomes of Candida albicans. J Bacteriol176: 3851-3858
Chu G (1991) Bag model for DNA migration during pulsed field electrophoresis. Proc Natl
Acad Sci USA 88: 11071-11075
Chu G, Gunderson K (1991) Separation oflarge DNA by a variable angle CHEF apparatus.
Anal Biochem 194: 439-446
Chu G, Vollrath D, Davies RW (1986) Separation of large DNA molecules by contour-
clamped homogeneous electric field. Science 234: 1582-1585
Contopoulou CR, Cook VE, Mortimer RK (1987) Analysis of DNA double strand breakage
and repair using orthogonal field alternation gel electrophoresis. Yeast 3: 71-76
Dardalhon M, Averbeck D (1995) Pulsed-field gel electrophoresis analysis of the rap air of
psoralen plus UVA induced DNA photoadducts in Saccharomyces cerevisiae. Mutat Res
336: 49-60
De Jonge P, De Jonge FCM, Meijers R, Steensma HY, Scheffers WA (1986) Orthogonal field
alternation gel electrophoresis banding patterns of DNA from yeasts. Yeast 2: 193-
204
Dogget NA, Smith CL, Cantor CR (1992) The effect of DNA concentration on mobility in
pulsed field gel electrophoresis. Nucleic Acids Res 20: 859-864
Eby MJ (1990) Pulsed field separations: continued evolution. Biotechnology 8: 243-245
Fan JB, Grothues D, Smith C (1991) Alignement of Sft I Sites with Not I restriction map of
Schizosaccharomyces pombe genome. Nucleic Acids Res 19: 6289-6294
Fournier P, Abbas A, Chasles M, Kudla B, Ogrydziak DM, Yaver D, Xuan JW, Peito A, Ribet
A-M, Feynerol C He F, Gaillardin C (1993) Colocalization of centromeric and replicative
functions on autonomously replicating sequences isolated from the yeast Yarrowia
lipolytica. Proc Natl Acad Sci USA 90: 4912-4916
Gardiner K, Patterson D (1988) Transverse alternating electrophoresis. Nature 331: 371-
372
Gardner DC}, Heale SM, Stateva LI, Oliver SG (1993) Treatment of yeast cells with wall lytic
enzymes is not required to prepare chromosomes for pulsed-field gel analysis. Yeast 9:
1053-1055
Gemmill RM (1991) Pulsed field gel electrophoresis. In: Chrambach A, Dunn MJ, Radola BJ
(eds) Advances in electrophoresis 4. Verlag Chemie, Weinheim
Goto K, Motoyoshi T, Tamura G, Obata T, Hara S (1990) Chromosomal transformation in
Saccharomyces cerevisiae with DNA isolated by pulsed field gel electrophoresis. Agric
BioI Chern 5: 1499-1504
Gunderson K, Chu G (1991) Pulsed field electrophoresis of megabase-sized DNA Mol Cell
Bioi 11: 3348-3354
Heus JJ, Zonneveld BJM, Steensma HY, van den Berg JA (1990) Centromeric DNA of
Hoffmann M, Zimmermann M, Emeis C-C (1987) Orthogonal field alternation gel electro-
phoresis (OFAGE) as a means for the analysis of somatic hybrids obtained by protoplast
fusion of different Saccharomyces strains. Curr Genet 11: 599-603
lbeas JI, Jimenez J (1993) Electrophoretic karyotype of budding yeasts with intact cell wall
Nucleic Acids Res 21: 3902
Johnston JR, Mortimer RK (1986) Electrophoretic karyotyping oflaboratory and commer-
cial strains of Saccharomyces and other yeasts. lnt J Syst Bacteriol36: 569-572
Johnston JR, Contopoulou CR, Mortimer RK (1988) Karyotyping of yeast strains of several
genera by field inversion gel electrophoresis. Yeast 4: 191-198
Kobori H, Takata Y, Osumi M (1991) Interspecific protoplast fusion between Candida

tropicalis and Candida boidinii: characterization of the fusants. J Ferment Bioeng 72:
439-444
Kwan HS, Li CC, Chiu SW, Cheng SC (1991) A simple method to prepare intact yeast
chromosomal DNA for pulsed field gel electrophoresis. Nucleic Acids Res 19: 1347
Lehmann PF, Khazan H, Wu LC, Wickes RI, Kwon-Chung KJ (1992) Karyotype and isozyme
profiles do not correlate in Kluyveromyces marxianus var. marxianus. Mycol Res 96:
637-642
Link AJ, Olson MY (1991) Physical map of the Saccharomyces cerevisiae genome at 110-
kilobase resolution. Genetics 127: 681-698
Lott TJ, Kuykendall RJ, Welbel SF, Pramanik A, Lasker BA (1993) Genomic heterogeneity in
the yeast Candida parapsilosis. Curr Genet 23: 463-467
Magee BB, Magee PT (1987) Electrophoretic karyotypes and chromosome numbers in
Candida species. J Gen Microbiol133: 425-430
Magee BB, Koltin Y, Gorman JA, Magee PT (1988) Assignement of cloned genes to the seven
electrophoreticallY separated Candida albicans chromosomes. Mol Cell BioI 8: 4721-
4726
Magee PT, Bowdin L, Staudinger J (1992) Comparison of molecular typing methods for
Candida albicans. J Clin Microbiol30: 2674-2679
Marri L, Rossolini GM, Satta G (1993) Chromosome polymorphisms among strains of
Hansenula polymorpha (syn. Pichia angusta). Appl Environ Microbiol 59: 939-941
Mathew KM, Smith CL, Cantor CR (1988a) High-resolution separation and accurate size
determination in pulsed-field gel electrophoresis of DNA. 1. DNA size standards and the
effect of agarose and temperature. Biochemistry 27: 9204-9210
Mathew KM, Smith CL, Cantor CR (1988b) High-resolution separation and accurate size
determination in pulsed-field gel electrophoresis of DNA. 2. Effect of pulse time and
electric field strength and implications for models of the separation process. Biochemis-
try 27: 9210-9216
Mathew KM, Hui CF, Smith CL, Cantor CR (1988c) High-resolution separation and accurate
size determination in pulsed-field gel electrophoresis of DNA. 4. Influence of DNA
Topology. Biochemistry 27: 9222-9226
McClusky K, Russel BW, Mills D (1990) Electrophoretic karyotyping without the need for
generating protoplasts. Curr Genet 18: 385-386
Merz WG, Connelly C, Hieter P (1988) Variation of electrophoretic karyotypes among
clinical isolates of Candida albicans. J Clin Microbiol26: 842-845
Nagy A, Garamszegi N, Vagvolgyi C, Ferenczy L (1994) Electrophoretic karyotypes of
Phaffia rhodozyma strains. FEMS Microbiol Lett 123: 315-318
Naumova E, Naumov G, Fournier P, Nguyen HV, Gaillardin C (1993) Chromosomal poly-
morphism of the yeast Yarrowia lipolytica and related species: electrophoretic karyotyp-
ing and hybridization with cloned genes. Curr Genet 23: 450-454
Nga BH, Abu Baker FD, Loh GH, Chiu LL, Harashima S, Oshima Y, Heslot H (1992)
Intergeneric hybrids between Saccharomycopsis fibuligera and Yarrowia lipolytica. J Gen
Nguyen C, Roux D, Mattei MG, Delapeyriere 0, Goldfarb M, Birnbaum D, Jordan BR (1988)
The FGF-related oncogenes hst and int.2, and the bcl.1 locus are contained within one
megabase in band q13 of chromosome 11, while the fgf.5 oncogene maps to 4q21.
Oncogene 3: 703-708
Noolandi J, Tunnel C (1992) Preparation, manipulation and pulse strategy for one-dimen-
sional pulsed-field gel electrophoresis (ODPFGE) Chap. 7. In: Burmeiter M, Ulanovsky L
(eds) Methods in molecular biology 12. Humana Press, Totowa
Oda Y, Tonomura K (1995) Molecular genetic properties of the yeast Torulaspora
pretoriensis: characterization of chromosomal DNA and genetic transformation by Sac-
charomyces cerevisiae - based plasmids. Curr Genet 27: 131-134
Pasero P, Marilley M (1993) Size variation of rDNA clusters in the yeasts Saccharomyces
cerevisiae and Schizosaccharomyces pombe. Mol Gen Genet 236: 448-452
Passoth V, Hansen M, Klinner U, Emeis CC (1992) The electrophoretic banding patterns of
the chromosomes of Pichia stipitis and Candida shehatae. Curr Genet 22: 429-431
Querol A, Barrio E, Ramon D (1992) A comparative study of yeast strain characterization.
Syst Appl Microbiol15: 439-446
Rustchenko-Bulgac EP (1991) Variation of Candida albicans electrophoretic karyotypes.
Rustchenko-Bulgac EP, Sherman F, Hicks JB (1990) Chromosomal rearrangements associ-
ated with morphological mutants provide a means for genetic variation of Candida
albicans. J Bacterioll72: 1276-1283
Rustchenko EP, Howard DH, Sherman F (1994) Chromosomal alternations of Candida
albicans are associated with the gain and loss of assimilating functions. J Bacteriol176:
3231-3241
Schillberg S, Zimmermann M, Emeis CC (1991) Analysis of hybrids obtained by rare-mating
of Saccharomyces strains. Appl Microbiol Biotechnol35: 242-246
Schwartz DC, Cantor CR (1984) Separation of yeast chromosome-sized DNA by pulsed field
gradient gel electrophoresis. Cell 37: 67-75
Schwartz DC, Koval M (1989) Conformational dynamics of individual DNA molecules
during gel electrophoresis. Nature 338: 520-522
Schwartz DC, Smith CL, Baker M, Hsu M (1989) Pulsed electrophoresis instrument. Nature
342: 575-576
Selebano ET, Govinden R, Pillay D, Pillay B, Gupthar AS (1993) Genomic comparisons
among parental and fusant strains of Candida shehatae and Pichia stipitis. CUIT Genet
23: 468-471
Smith CL, Matsumoto T, Niwa 0, Klco S, Fan J, Yanagida M, Cantor CR (1987) An electro-
phoretic karyotype for Schizosaccharomyces pombe by pulsed field gel electrophoresis.
Nucleic Acids Res 15: 4481-4489
Sor F (1988) A computer program allows the separation of a wide range of chromosome
sizes by pulsed field gel electrophoresis. Nucleic Acids Res 16: 4853-4863
Sor F, Fukuhara H (1989) Analysis of chromosomal DNA patterns of the genus
Kluyveromyces. Yeast 5: 1-10
Steensma HY, De Jongh FCM, Linnekamp M (1988) The use of electrophoretic karyotypes
in the classification of yeasts: Kluyveromyces marxianus and K. lactis. Curr Genet 14:
311-317
Stoltenburg R, Klinner U, Ritzerfeld P, Zimmermann M, Emeis CC (1992) Genetic diversity
of the yeast Candida utilis. CUIT Genet 22: 441-446
Suzuki T, Kobayashi I, Mizuguchi I, Banno T, Tanaka K (1988) Electrophoretic karyotypes
in medically important Candida species. J Gen Appl Microbiol34: 409-416
Suzuki T, Hitomi A, Magee PT, Sakaguchi S (1994) Correlation between polyploidy and
auxotrophic segregation in the imperfect yeast Candida albicans. J Bacteriol176: 3345-
3353
Svilha G, Schlenk F, Dainko JL (1961) Spheroplasts of Candida utilis. J Bacteriol82: 808-814
Tanaka H, Takagi M, Yano K (1987) Separation of chromosomal DNA of Candida maltosa
on agarose gels using the OFAGE Technique. Agric BioI Chem 51: 3161-3163
Thierry A, Dujon B (1992) Nested chromosomal fragmentation in yeast using the
meganuclease I-See I: a new method for physical mapping of eukaryotic genomes.
Thrash-Bingham C, Gorman JA (1992) DNA translocations contribute to chromosome
length polymorphisms in Candida albicans. Curr Genet 22: 93-100
Torok T, Royer C, Rockhold D, King D (1992) Electrophoretic karyotyping of yeasts and
Southern blotting using whole chromosomes as templates for the probe preparation.
116 M. Zimmermann and P. Fournier: Electrophoretic Karyotyping of Yeasts
Tunnel C, Lalande M (1988) Resolution of Schizosaccharomyces pombe chromosomes by

field inversion gel electrophoresis. Nucleic Acids Res 16: 4727
Vaughan-Martini A, Martini A, Cardinali G (1993) Electrophoretic karyotyping as a taxo-
nomic tool in the genus Saccharomyces. Antonie Leeuwenhoek J Microbio163: 157-163
Vazquez JA, Beckley A, Sobel JD, Zervos MJ (1991) Comparison of restriction enzyme
analysis and pulsed-field gradient gel electrophoresis as typing systems for Candida
albicans. J Clin Microbiol 29: 962-996
Vazquez JA, Beckley A, Donabedian S, Sobel J, Zervos MJ (1993) Comparison of restriction
enzyme analysis versus pulsed-field gradient gel electrophoresis as a typing system for
Torulopsis glabrata and Candida species other than C. albicans. J Clin Microbiol 31:
2021-2030
Vezinhet F, Blondin B, Hallet IN (1990) Chromosomal DNA patterns and mitochondrial
DNA polymorphisms as tools for identification of oenological strains of Saccharomyces
cerevisiae. Appl Microbiol Biotechno132: 568-571
Vollrath D, Davies RW (1987) Resolution of greater than 5 mega-basepair DNA by contour-
clamped homogenous electric fields. Nucleic Acids Res 15: 7865-7876
Vollrath D, Davies RW, Connelly C, Hieter P (1988) Physical mapping of large DNA by
chromosome fragmentation. Proc Natl Acad Sci USA 85: 6027-6032
Zhang TY, Smith CL, Cantor CR (1991) Secondary pulsed field gel electrophoresis: a new
method for faster separation oflarger DNA molecules. Nucleic Acids Res 19: 1291-1295
Zhang TY, Fan JB, Ringquist S, Smith CL, Cantor CR (1993) The 0.7 to 3.5 megabase
chromosomes from Candida, Kluyveromyces and Pichia provide accurate size standards
for pulsed field gel electrophoresis. Electrophoresis 14: 290-295
Zimmermann M, Hoffmann-Hintz M, Kolvenbach M, Emeis C-C (1988) Ofage banding
patterns of different yeast genera and of intergeneric hybrids. J Basic Microbio128: 241-
249
CHAPTER 4
Schwonniomyces occidentolis
R. Jiirgen Dohmen and Cornelis P. Hollenberg
1
History of Schwanniomyces occidentalis Research
The ascomycetous yeast Schwanniomyces occidentalis (Schw. occidentalis) was

first described by Kloecker in 1909, who isolated it from soil of the island of St.
Thomas in the West Indies, hence the species name. Subsequently, a variety of
other species, namely Schw. castellii, Schw. alluvius, an Schw. persoonii were ac-
cepted under the same genus name (Phaff 1970). These were distinguished from
Schw. occidentalis by their different fermentation properties. On the basis of mo-
lecular analysis involving DNA reassociation experiments, Price et al. (1978)
placed all four species under the same species name, Schw. occidentalis. The
former species Schw. occidentalis, Schw. castellii, and Schw. alluvius showed more
than 97% sequence homology and were therefore renamed Schw. occidentalis var.
occidentalis. The former species Schw. persoonii, however, had only about 80%
sequence complementarity with Schw. occidentalis and for that reason was named
Schw. occidentalis var. persoonii. Recent analysis of the long-chain fatty acid com-
positions (Cottrell et al. 1986) and of the nucleic acid sequences of the cytochrome
c gene, as well as of ribosomal RNAs, supports this view, the latter placing
Schwanniomyces in close proximity to Candida and especially to Debaryomyces
(Amegadzie et al. 1990; Kurtzmann and Robnett 1991). The high degree of identity
of the rRNA sequences prompted Kurtzman and Robnett to suggest the transfer of
Schw. occidentalis to the genus Debaryomyces (see Chap. 1, this Vol.). In this
chapter we retain the name Schw. occidentalis, since the high degree of
noncomplementarity of the DNA of Schwanniomyces and Debaryomyces species
found in reassociation experiments (Price et al. 1978) argues strongly in favor of a
discrimination of these two species.
This genus Schwanniomyces is a member of the family of Saccharomycetaceae
(order Endomycetalis). It belongs to the same subfamily (Saccharomycoideae) as
well-studied genera such as Saccharomyces, Kluyveromyces, and Hansenula
(Lodder 1984).
An important criterion in the diagnosis of the genus Schwanniomyces is the
Institut fur Mikrobiologie, Heinrich-Heine-Universitat Dusseldorf, Universitatsstr. 1,

Gebaude 26.12, 40225 Dusseldorf, Germany
118 R.J. Dohmen and C.P. Hollenberg
unique shape of its ascospores, which distinguishes it from other ascomycetous

yeasts (Phaff and Miller 1984; see also Sect. 5.1).
The number of research groups studying the properties of the yeast Schw.
occidentalis has increased significantly over the last 15 years as it has become clear
that this organism is equipped with an extremely powerful amylolytic system. The
degradation of starch is the basis for a variety of important industrial processes
like beer brewing and the production of potable spirits. Because starch-containing
raw materials are inexpensive and widely available, investigators have increased
their efforts to characterize the amylolytic system of Schw. occidentalis, as well as
the yeast itself. In this chapter we summarize the current knowledge on Schw.
occidentalis with emphasis on the available methodology for its genetic manipula-
tion and its application in biotechnological processes.
2
Physiology
Schw. occidentalis is capable of utilizing a wide variety of organic compounds as

carbon sources. These include, glucose, fructose, galactose, D-xylose (the latter
two cannot be assimilated by var. persoonii), sucrose, raffinose, cellobiose, treha-
lose, lactose (by some strains), succinate, citrate, ethanol, n-alkanes (with the
exception ofvar. persoonii), as well as maltose, iso-maltose, pullulan, dextrin, and
soluble and raw starch. Melibiose cannot be utilized. This yeast is unable to grow
on vitamin-free media or to assimilate nitrate (McCann and Barnett 1984; Phaff
and Miller 1984). Phytate (myo-inositol hexakiphosphate) can be utilized as a sole
phosphate source by Schw. occidentalis. This abundant plant seed constituent is
hydrolyzed into inorganic phosphate and inositol mono- to pentaphosphate by the
enzyme phytase. Schw. occidentalis showed the highest phytase activity of the yeast
species assayed (Lambrechts et al. 1992).
Schw. occidentalis is Crabtree-negative and shows a strong Pasteur effect,
meaning that oxidative metabolism is not repressed by high sugar concentration
and that there is little fermentation under aerobic conditions (Ingledew 1987;
Poinsot et al. 1987). Poinsot et al. (1987) isolated Schwanniomyces petite mutants,
one of which appeared to be deficient in cytochrome b. This mutant displayed
a greatly decreased Pasteur effect and a significant Crabtree effect, resulting
in increased fermentation rates under both aerobic and anaerobic conditions.
The analysis of these cytochrome-deficient mutants also resulted in the
discovery of alternative respiratory pathways in Schw. occidentalis (Dubreucq et al.
1990a,b).
The most remarkable property of Schw. occidentalis is its ability to efficiently
degrade starch as the result of the combined action of secreted a-amylase and
glucoamylase. The expression of both enzymes is inducible and repressed by
glucose (see Sect. 10).
4. Schwanniomyces occidentalis 119
3
Media
Schw. occidentalis can be grown on the same complete (YP) and synthetic minimal
(SD, if dextrose is the carbon source) media as S. cerevisiae (Sherman 1993). YP
media contain 10gl1 Bacto-yeast extract and 20g/1 Bacto-peptone (both from
Difco, Detroit, USA) plus usually 2% of one of the carbon sources listed above (see
Sect. 2). Synthetic minimal media contain 6.7 gil yeast nitrogen base without the
amino acids (Difco) plus required amino acids and carbon source. Synthetic mini-
mal media can be buffered with 0.2M NaP04 (pH 6.3) to maintain enzymatic
activity of the amylases (see Sect. 10).
Various media have been described for the induction of sporulation. Ferreira
and Phaff (1959) used yeast autolysate/glucose agar with incubation for 5 days at
room temperature. James and Zahab (1984) employed media containing 1.3%
yeast extract, 0.5% peptone, and 1.5% glucose (originally described by Kreger van
Rij 1977) with pH adjusted to 4.5. The plates were incubated at 19°C for 20 days.
Kurtzman et al. (1972) sporulated on yeast-malt extract agar. Wilson et al. (1982)
obtained asci on agar plates containing 0.5% yeast extract and 5% glucose.
4
Available Strains
The Schw. occidentalis type strains are available from the American type culture
collection (ATCC) in Rockville, MD, USA, or from the Centraalbureau voor
Schimmelcultures in Delft, Holland. A large number of auxotrophic mutants have
been produced in several laboratories (Johannsen and van der Walt 1980; Wilson
et al. 1982; James and Zahab 1984). Until now, only a few auxotrophic mutations
have been defined, mainly by their complementation with the respective genes.
Klein and Favreau (1988) isolated an ade2 mutant that could be complemented by
transformation with plasmids containing the Schw. occidentalis ADE2 gene.
Dohmen et al. (1989) described a strain carrying a mutation (trp5) in the tryp-
tophan synthetase gene which was complemented by the S. cerevisiae TRP5 gene.
The availability of an established transformation system (see Sect. 5) now enables
the generation of defined auxotrophic mutations via homologous recombination
using the sequences of cloned genes (see Sect. 6).
Mutants with defects in the carbon catabolite repression of amylase expression
have been isolated in a number oflaboratories (McCann and Barnett 1984; Sills et
al. 1984b; Ingledew 1987; Boze et al. 1989b). Respiration deficient mutants have
been mentioned above (see Sect. 2).
120 R.J. Dohmen and c.P. Hollenberg
5
Genetic Techniques
5.1
Description and Life Cycle
Schwanniomyces cells are ovoidal or egg-shaped (3.5-8.0 x 4.5-9.0 J.lm) and repro-
duce vegetatively by multilateral budding. Pseudomycelia are not formed or are at
least not characteristic (Phaff and Miller 1984). Cells are haploid and monotypic,
since intraspecies or interspecies crosses are not observed. Hybridization studies
carried out with a variety of auxotrophic mutants of different Schwanniomyces
strains failed to detect any recombinants, suggesting that mating between free-
occurring cells does not occur to any genetically detectable extent «1 in 108 mated
cells; Johannsen and van der Walt 1980). However, fusion between a mother and a
daughter cell does occur and precedes the formation of ascospores (Kreger-van Rij
1977). Since there is no detectable formation of recombinants in crosses, it is
assumed that this type of conjugation takes place before the detachment of the
daughter cell (Johannsen and van der Walt 1980). Electron microscopical studies
by Kreger-van Rij (1977) suggest that after fusion of the mother cell with a small
bud, from which it was first completely separated by a wall, and nuclear fusion,
meiosis takes place in the mother cell. Fused mother cells could be distinguished
from cells with a young bud by the presence of a dark ring in the wall at the site of
the fusion, and occasionally by the presence of remnants of the cross wall. Usually
one, or more rarely, two walnut-like ascospores are formed, which are character-
ized by a wide, flat equatorial ring and long protuberances (Kurtzman et al. 1972).
The spores from two different Schw. occidentalis var. persoonii strains differed
from those of var. occidentalis strains, as well as from each other, by the shape of
the equatorial ring and the presence or form of the protuberances (Kurtzman et al.
1972). Thus, based on the current knowledge, Schwanniomyces strains appear to be
genetically isolated (Johannsen and van der Walt 1980; Ingledew 1987). In the life
cycle, diploidization results from the fusion of sister nuclei such that meiosis does
not serve as a means for mixing of genetic information. Johannsen and van der
Walt (1980) pointed out that this rather rudimentary sexual cycle still entails the
advantage of resulting in the formation of ascospores, specialized cells which
enable the survival under unfavorable conditions.
5.2
Strain Construction
As described above, attempts to obtain intrageneric recombinants from crosses

have unfortunately been unsuccessful (Johanns on and van der Walt 1980). Wilson
et al. (1982), on the other hand, were able to generate prototrophic recombinants
by polyethylene glycol-induced protoplast fusion of auxotrophic mutants. In some
cases, these recombinants were unstable heterokaryons, in others, they were stable
diploids (or aneuploids) which gave rise to mitotic segregants with new combina-
tions of auxotrophies. The mitotic segregation frequency was increased by the
addition of p-fluorophenylalanine. The fusion products showed an increased fre-

quency of asci with two spores (11-18%) compared to the parental strains (0-4%).
Work by James and Zahab (1984), who studied hybrids generated by protoplast
fusion by diad analysis of two-spored asci, revealed that the spore clones retained
the ploidy of the hybrid. (The spores were freed for isolation by treating the asci
with Zymolyase.) These investigators concluded that the increased ploidy of the
hybrids is not recognized by the cells during the meiotic cycle. In summary, the
fusion of Schwanniomyces protoplasts appears to be a useful method for the
construction of polysomic or polyploid strains and could be used for the character-
ization of mutants in complementation tests and even for a genetic analysis by
meiotic segregation, the latter, however, being very much more complicated than
e.g., for S. cerevisiae. Protoplast fusion, however, seems not to provide a means to
generate haploid recombinants with new marker combinations.
Protoplasts of Schw. occidentalis cells can be generated with Zymolyase,
Helicase, Glusulase, /3-Glucuronidase or Mutanase (Stephen and Nasim 1981;
Wilson et al. 1982; James and Zahab 1984; Klein and Favreau 1988).
5.3
Mutagenesis
Standard mutagenesis protocols using UV irradiation, treatment with EMS or N-

methyl-N'-nitro-N-nitrosoguanidine have been employed (Johannsen and van der
Walt 1980; McCann and Barnett 1984; Klein and Favreau 1988; Boze et al. 1989b).
Since Schw. occidentalis cells are generally haploid, the generation and identifica-
tion of recessive mutations is comparably easy. Cytochrome-deficient mutants
were induced by treatment with ethidium bromide, manganese, or acriflavine
(Poinsot et al. 1987; Dubreucq et al. 1990a).
5.4
Transformation
Two different chemical protocols have been independently developed for the
transformation of Schw. occidentalis cells. Klein and Favreau (1988) used a modi-
fication of the procedure described by Beggs (1978), which employs the generation
of spheroplasts. Dohmen et al. (1989, 1991) developed an easier method, that is
based on the polyethylene glycol-induced transformation of whole cells described
by Klebe et al. (1983). The modified method (given below) enables the long-term
storage of competent cells and yields up to 1000 transformants per Jig plasmid
DNA. With slight modifications, this protocol has also proven useful in the trans-
formation of other yeast species such as S. cerevisiae, Schizosaccharomyces pombe,
Kluyveromyces lac tis and Hansenula polymorpha (Dohmen et al. 1991).
Protocol for the transformation of Schw. occidentalis:
Cells are grown in YPD (20 ml per transformation) to an OD 600 of 0.6, washed in 0.5
vol of 1.25M KC1!30mM/I0mM Bicin-NaOH (pH 8.35)/3% ethylene glyco1!5%
122 R.I. Dohmen and c.P. Hollenberg
DMSO, and resuspended in 0.01 vol of the same solution. Aliquots ofO.2ml of the
cell suspension are then frozen in dry-ice/acetone or by placing them in a <-70°C
freezer, where they can be stored for months before transformation.
Transformation of such competent cells is achieved by adding the DNA to the
frozen cells (transformation with highly purified DNAs can be increased by the
addition of sonicated and heat-denatured calf thymus DNA; Schiestl and Gietz
1989), followed by rapid agitation in an Eppendorf mixer at 37°C (mixing at room
temperature, which is often more convenient, results in slightly lower yields).
After addition of 1.4 ml of 40% polyethylene glycol 1000 (Roth, Karlsruhe, Ger-
many; available in the US through Atomergic Chemetals Corp., Farmingdale, NY)/
0.2M Bicin-NaOH (pH 8.3) the samples are mixed by gentle inversion and incu-
bated for 1 h at 30°C.
The cells are then pelleted by centrifugation at 3000 g for 5 min, washed once with
1.6ml ofO.15M NaCl/lOmM Bicin-NaOH (pH 8.35), resuspended in an appropri-
ate volume of the same buffer, and plated onto selective media. Transformant
colonies are generally obtained after 2-3 days incubation at 30°C.
More recently, a high-efficiency electrotransformation protocol for Schw.
occidentalis has been described by Costaglioli et al. (1994).
5.5
Gene Disruptions and Deletions
The availability of a transformation system enables the generation of null alleles of

cloned genes as well as the introduction of mutants alleles into the genome via
homologous recombination (for review of the strategies that have been worked out
in S. cerevisiae, see Stearns et al. 1990). These approaches are hampered in some
yeast species such as S. pombe and H. polymorpha by the frequent occurrence of
nonhomologous recombination (Moreno et al. 1991; Hansen and Hollenberg,
Chap. 9, this Vol.). Although no thorough quantitation has been carried out, the
results obtained thus far suggest that in Schw. occidentalis, as in S. cerevisiae,
homologous recombination appears to predominate. Dohmen et al. (1990) gener-
ated null alleles of the Schw. occidentalis glucoamylase (GAMl) gene by two differ-
ent approaches. In the first strategy (Shortle et al. 1982), the targeted integration of
a plasmid that contained an internal fragment of the glucoamylase into the wild-
type GAMl gene resulted in the generation of two inactive copies of the GAMl
gene, one being truncated at the 5' end, the other at the 3' end. In these experi-
ments about 70% of several hundred transformants displayed a gaml phenotype,
indicating that correct integration of the plasmid via homologous recombination
had taken place, which was confirmed by Southern analysis. The second approach
was a one-step gene transplacement (Rothstein 1983). In this case, the entire
sequence of the GAMl gene was stably replaced by the marker gene TRP5 (see Sect.
7). Four out of 30 stable Trp+ colonies displayed the desired gaml phenotype.
Similar results were obtained by Amegadzie et al. (1990), who generated an inser-
tion allele of the Schw. occidentalis CYCl gene by the one-step gene replacement
method. Three out of 23 analyzed transformants displayed the eyel phenotype.

Recently, we have generated a null mutant of the Sehw. oecidentalis LEU2 gene
using the two-step gene replacement strategy (K. Schuchart, R.J.D., A.W.M.
Strasser, and C.P.H., unpubl. results; Rothstein 1983). In conclusion, these tech-
niques now established for Sehw. oecidentalis enable both the generation of useful
laboratory strains with multiple stable marker mutations (see also Sect. 7) and the
functional analysis of cloned genes and their mutant alleles as well as the construc-
tion of strains with improved properties for industrial processes (see Sect. 11).
6
Chromosomal DNA
Sehw. oecidentalis is a haploid yeast (Ferreira and Phaff 1959) with a DNA content
of 5-6 x 10-14 glcell, which is about twice as much as present in S. eerevisiae cells
(Wilson et al. 1982; Leusch et al. 1985). This corresponds to a genome size of about
3 x 107 base pairs. The G + C content is 35.2-35.4% (Price et al. 1978). Johnston et
al. (1988) resolved at least five chromosomes by field inversion gel electrophoresis.
Del Pozo et al. (1993) detected a minimum of seven chromosomes by pulse field gel
electrophoresis (see also Chap. 3, this Vol.).
7
Genes and Genetic Markers
The cloning of 14 different Sehw. oecidentalis genes has been reported. Sequence
information is available for 8 of them (Table 1). With the exception of the
. glucoamylase (GAMl), all the cloned genes for which such assays have been pub-
Table 1. Cloned Schw. occidentalis genes
Gene Function Size Expression in Reference

(aa) S. cerevisiae
ADEI Adenine synthesis n.d. n.d. Prakash and Seligy (1988)

ADE2 Adenine synthesis n.d. Yes Klein and Favreau (1988)
ODCl Uracil synthesis n.d. Yes Klein and Roof (1988)
HIS4 Histidine synthesis n.d. Yes Dohmen et al. (1989)
EGI Unknown 158 n.d. Prakash and Seligy (1988)
INVI Invertase 533 n.d. Klein et al. (1989)
AMYl a-Amylase 512 Yes Strasser et al. (1989)
GAMI Glucoamylase 958 No Dohmen et al. (1990)
CYCI Cytochrome c 110 Yes Amegadzie et al. (1990)
GDHl Glutamate dehydrogenase 459 Yes De Zoysa et al. (1991)
SWA2 a-Amylase 507 Yes Claros et al. (1993)
SCRI Cycloheximide resistance n.d. Yes Del Pozo et al. (1993)
SCR2 Ribosomal protein 106 Yes Del Pozo et al. (1993)
LEU2 Leucine synthesis n.d. n.d. Schuchart et al. (unpubl.)
AMGl Subunit NADH: Q6 487 Yes Fabry et al. (unpubl.)
Oxidoreductase
124 R.J. Dohmen and c.P. Hollenberg
lished were found to be functionally expressed in S. cerevisiae (Table 1), suggesting

that the transcription, translation, and secretion signals are well conserved be-
tween these two yeasts. TATA-like elements were found in all sequenced promoter
regions of Schw. occidentalis genes.
Interestingly, some genes, when introduced into S. cerevisiae, are regulated in a
way similar to that in Schw. occidentalis, while others are not. For example, both
the AMYl and the SWA2 genes are glucose-repressed in Schw. occidentalis. How-
ever, only the SWA2 gene retains this regulation upon transformation into S.
cerevisiae (Dohmen et al. 1989; Abarca et al. 1991). Even more striking is the
following observation made by Amegadzie et al. (1990). The Schw. occidentalis
CYC1 gene is induced by oxygen but, unlike its counterpart in S. cerevisiae, it is not
subject to glucose repression. However, when introduced into S. cerevisiae, the
Schw. occidentalis gene is not only oxygen-induced but also glucose-repressed.
These observations demonstrate a strong conservation of both the cis- and trans-
acting elements of this regulation. An appealing model, when comparing these two
yeasts, is that the glucose-regulated form of the eyel gene was the evolutionary
predecessor of the glucose-independent form of this gene in the Crabtree-negative
Schw. occidentalis. The cis-acting element in the eyel promoter would have been
retained in Schw. occidentalis upon the loss of the Crabtree effect, whereas the
specific interaction of this element with trans-acting binding factors has been lost.
Alternatively, the trans-acting factors in S. cerevisiae could have evolved to recog-
nize preexisisting sequences present in the promoters of the eyel gene in both
yeasts.
The conservation of expression signals between genes of S. cerevisiae and Schw.
occidentalis has simplified the isolation of a number of Schw. occidentalis genes
through expression cloning or by complementation of well-defined S. cerevisiae
mutants. More such clonings are to be expected in the near future. Particularly
useful in the generation of systems for the genetic manipulation of Schw.
occidentalis has been the cloning of genes involved in amino acid and nucleotide
biosynthesis like ADEl, ADE2, ODel (the Schw. occidentalis equivalent of the S.
cerevisiae URA3 gene), HIS4, and LEU2 (Table 1). The ADE2 gene has been em-
ployed as a selectable marker in Schw. occidentalis transformations (Klein and
Favreau 1988). Schw. occidentalis ade2 mutants transformed with plasmids con-
taining the ADE2 gene were either integrated or maintained as extrachromosomal
elements without detectable mitotic loss. The latter are subject to rearrangements
yielding a variety of plasmids, including some of high molecular weight, which led
the authors to conclude that the fragment containing the ADE2 gene also contains
an autonomous replication sequence (Klein and Favreau 1988). Autonomous rep-
lication sequences, named SwARSl and SwARS2, were also identified, respectively,
on a 1.5-kb fragment isolated from a clone containing the Schw. occidentalis HIS4
gene (Dohmen et al. 1989) and in the 3' flanking region of the GAMl gene
(Dohmen et al. 1990). SwARS plasmids carrying the S. cerevisiae TRP5 gene as a
selectable marker (Fig. 1) replicate autonomously in both S. cerevisiae and Schw.
occidentalis and thus are convenient shuttle vectors in the analysis of gene expres-
sion and function in these two yeast species. Unlike the ADE2 plasmids described
EC E C E
I
~
~
::s
::s
E p o·
YRpJD2 pCJD5-1 pJD13
8.7kb 10.4 kb 12.9kb ~ ))lC I~8
Q
f'\
p
(B/Bg)
a:
III
::s
S'
~
B C
-pBR322
-A
t::::J S.occidentalls
_ S. cerevisiae
Fig. 1. Shuttle vectors for the transformation of Schw. occidentalis and S. cerevisiae. Plasmid YRpJD2 is pBR322-based and contains SwARSI, an
autonomous replication sequence that originated from the Schw. occidentalis HIS4 gene (Dohmen et al. 1989) and the S. cerevisiae TRPS gene
contained in a 3.2kb BamHI fragment from pYe(trp5)1-53 (Walz et al. 1953). This vector was the basis for a plasmid that lead to a fivefold
overexpression of a-amylase (Amyl) in Schw. occidentalis (Dohmen et al. 1989). The cosmid pCJD5-1 was obtained by inserting a 1.7-kb BglII
fragment isolated from pHC79 (Hohn and Collins 1980) into YRpJD2. This fragment containes the cos element of bacteriophage A, which allows
the in vitro packaging of such cosmids carrying inserts of about 40kb into )l particles (Hohn 1980). Such a cosmid pool of genomic Schw.
occidentalis DNA for the cloning of Schw. occidentalis genes in Schw. occidentalis through the complementation of appropriate mutants has been
constructed (A.W.M. Strasser, R.J. Dohmen, and C.P. Hollenberg, unpubl. results). As a first such example, it was successfully used in the cloning
of a gene, the expression of which is required for the expression of gluocamylase in Schw. occidentalis (P. Fabry, A.W.M Strasser, R.J. Dohmen,
N
and C.P. Hollenberg, unpubl. results). Plasmid pJD13 was derived from YRpJD2 by replacing its SwARSl-containing EcoRIIBamHI fragment with U1
a fragment containing the GAMl gene and in its 3' flanking region an autonomous replication sequence named SwARS2
-
-
a b c d e Fig. 2. Comparison of average copy numbers of
SwARS plasmids in Sehw. oecidentalis trans-
formants. DNAs were separated in a 0.8% agarose
gel, blotted onto Hybond N (Amersham), and
hybridized with radio-labeled pJD13 DNA. Lanes
kb kb a and e A DNA cut with, respectively, BeoRI and
HindIII, or HindIII. (Some bands are cross-hy-
-23.6 bridizing with the probe used. The positions of
21 .7- the marker bands indicated at the sides were de-
duced from the ethidium bromide stained gel)
Lanes b-d DNA prepared from Sehw. oecidentalis
-9.46 and cut with BeoRI; lane b untransformed strain
RJDll; lane e RJDll transformed with plasmid
~
YRpJD2 (see Fig. 1); lane d RJDll transformed
-664 with plasmid pJD13 (see Fig. 1). The position of
the wells of the gel is shown by an arrow. An
arrowhead indicates the position of an 8.3-kb
5.15-
5.00- fragment of the chromosomal GAM1 locus. The
-4.34 average copy number of the plasmids per cell was
4.27- estimated to be 5-10 by comparing the intensity
of the band of the chromosomal 8.3-kb fragment
3.48- with those of the 5.3-kb fragments of the two plas-
mids
-2.26
•
1.98- -1.98
1. go-
1.59-
1.37-
0.94-
0.83-
0.56- -0.56
by Klein and Favreau (1988), SwARS plasmids are mitotically unstable, with an
average of five to ten copies per cell (Fig. 2), resembling plasmids containing S.
cerevisiae ARS elements in S. cerevisiae transformants. In contrast to the versatility
of SwARS vectors, ARS plasmids are extremely unstable when introduced into
Schw. occidentalis, yielding an average of only one copy per cell under selective
conditions (Dohmen et al. 1989).
8
Vector Systems
Klein and Favreau (1988, 1991) have described vectors for the transformation of
Schw. occidentalis which were based on the ADE2 marker and a putative replica-
tion sequence (see also Sect. 7). The reason for their stable maintenance and their
engagement in recombination events is not understood.
We developed a series of vectors, which employ the S. cerevisiae TRP5 gene as
a selectable marker (Dohmen et al. 1989; R.J.D., A.W.M. Strasser, and C.P.H.,
unpubl. results). This set includes a plasmid for integrative transformation
(pATl53-TRP5, not shown), the plasmid YRpJD2 and a cosmid (pCJD5-1); these
latter two are maintained as extrachromosomal plasmids in Schw. occidentalis and
S. cerevisiae due to the presence of the SwARSl element (Fig. 1). They enable the
generation of gene deletions (Dohmen et al. 1990), the introduction of mutated
genes or of gene fusions, as well as of extra copies resulting in increased expression
of a gene of interest (Dohmen et al. 1989). Moreover, they provide the possibility
of cloning Schw. occidentalis genes through complementation of the respective
recessive mutations.
No CEN plasmids are as yet available for Schw. occidentalis.
9
Heterologous Gene Expression
The vector systems discussed above provide a basis for the utilization of Schw.
occidentalis as a host for heterologous gene expression. The different Schw.
occidentalis genes that have been cloned (Table 1) provide a source for promoters,
terminators, as well as for sequences encoding signal sequences for the secretion of
proteins in Schw. occidentalis. Of particular interest are the promoters of genes like
INVl, AMYl, SWA2, and GAMl, which are tightly regulated. These promoters
should even allow the expression of putatively growth-inhibitory genes. Schw.
occidentalis cells containing such genes, e.g., expressed from the tightly glucose-
repressed GAMI promoter, could be grown to high densities before the expression
of these genes is induced. It has been suggested that Schw. occidentalis might be
particularly attractive as a host for the expression of secretory proteins since,
unlike the situation in S. cerevisiae, hyperglycosylation of proteins was not ob-
served for certain proteins (Klein and Favreau 1991). However, there is as yet no
evidence available that the same protein would be hyperglycosylated in S.
cerevisiae and not in Schw. occidentalis. In fact, the only such studies available
demonstrate that the Amyl and the Gam1 proteins are modified similarly in S.
cerevisiae and Schw. occidentalis (Strasser et al. 1989; Dohmen et al. 1990). Reasons
that make Schw. occidentalis an attractive alternative eukaryotic expression system
will be discussed in Sect. 11.
10
The Amylolytic System
The main reason that Schw. occidentalis has gained such high attention in recent
years is its outstanding amylolytic system. It had been a goal for a number of years
to generate S. cerevisiae strains that secrete a-amylase and glucoamylase with
debranching activity (see below) since they would combine high fermentation
rates and ethanol tolerance with the ability to degrade starch completely (Sills and
Stewart 1982).
Because of their close relationship to S. cerevisiae, other yeast species are favor-
able candidates as donors for genes encoding amylolytic enzymes. A large number
of yeast strains have been described that are able to grow on starch (Lodder 1984).
However, only a very few degrade starch with high efficiency as a result of the
combined action of a-amylase (EC 3.2.11), glucoamylase (EC 3.2.13) and
debranching activity, i.e., hydrolysis of a-l,6 glucosidic bonds (Spencer-Martins
and van Uden 1979; Clementi et al. 1980; Sills and Stewart 1982; Touzi et al. 1982;
De Mot et al. 1984).
Of these strains, Schw. occidentalis expresses the most significant deb ranching
activity (Sills and Stewart 1982), which is a property of the glucoamylase enzyme of
this yeast (Wilson and Ingledew 1982; Sills et al. 1984a). Both the a-amylase and
the glucoamylase secreted by Schw. occidentalis moreover have the advantage of
being inactivated during the pasteurization conditions usually employed in brew-
ing (Sills et al. 1987). The expression of these enzymes and their biochemistry has
been studied extensively (Clementi et al. 1980; Oteng-Gyang et al. 1981; Moranelli
et al. 1987; Wilson et al. 1982; Calleja et al. 1984; Sills et al. 1984a; Simoes-Mendes
1984; Clementi and Rossi 1986; Boze et al. 1987; Dowhanick et al. 1990; Deibel et al.
1988; Boze et al. 1989a; Dowhanick et al. 1990).
a-Amylase is an endoenzyme that hydrolyzes a-l,4 glucosidic bonds in starch
releasing maltose, maltotriose, and higher oligo saccharides, and with very low
efficiency glucose (Ingledew 1987).
Glucoamylase is an exoenzyme releasing glucose from the nonreducing end of
a starch molecule by hydrolyzing a-l,4 glucosidic bonds. The Schw. occidentalis
glucoamylase, moreover, has the ability to bypass the a-l,6 branch points by virtue
of its deb ranching activity. This property of glucoamylase enzyme enables Schw.
occidentalis to utilize pullulan as a sole carbon source (Wilson and Ingledew 1982).
This polysaccharide is composed of maltotriose units linked through a-l,6 gluco-
sidic bonds.
The synergistic action of a-amylase and glucoamylase secreted by Schw.
occidentalis results in efficient and complete degradation of starch (Fuji and
Kawamura 1985; Boze et al. 1989a). Kinetic studies on the degradation of starch by
the two amylases revealed that a-amylase activity is especially important when
complex substrates like glycogen, potato, or barley starch are used (Boze et al.
1989a). Release of glucose from these substrates by glucoamylase is rather slow.
The role of the endoenzyme a-amylase is to generate free nonreducing ends, which
4. Schwanniomyces occidenta/is 129
are the substrates for the exoenzyme glucoamylase. The synergistic effect of these
two enzymes was also reflected by growth properties of S. cerevisiae cells express-
ing either or both of the two enzymes (Dohmen et al. 1990; Strasser et al. 1990,
1991). Growth of such strains secreting both enzymes on media containing crude
starch as a sole carbon source was significantly better than that of those which
secreted either of the enzymes (R.J.D., P.G. Seeboth, A.W.M. Strasser, and C.P.H.,
unpubl. results).
Contradictory reports have described the biochemical identification of one or
two glucoamylases and of one or two a-amylases produced by different Schw.
occidentalis strains (reviewed by Ingledew 1987). At present, it is unclear whether
some of the identified polypeptides represent different forms of the respective
proteins expressed from the same gene or whether they are products of separate
genes. The way to clearly resolve these issues will be to analyze the different genes
involved and to use them for the generation of null mutations in the different
strains.
Two different Schw. occidentalis a-amylase genes (AMYl and SWA2) have been
cloned and sequenced (Strasser et al. 1989; Abarca et al. 1991; Wu et al. 1991;
Claros et al. 1993). The two proteins display 66% identity and 77% similarity
(Claros et al. 1993). Both proteins share highly conserved regions found in all a-
amylases that have been analyzed (Strasser et al. 1989; Claros et al. 1993). Both are
about 54kDa in size and contain two potential N-glycosylation sites (Asn x Serf
Thr), only one of which appears to be modified by a core glycosylation (Strasser et
al. 1989). Gene deletions that would help to understand the roles of the two a-
amylase genes in Schw. occidentalis have not yet been described.
A single glucoamylase gene (GAMl) from Schw. occidentalis has been cloned
and sequenced (Dohmen et al. 1990). It encodes a 958-amino acid protein (includ-
ing signal sequence) which, without further posttranslational modification, has a
calculated molecular weight of 106.5kDa. Signal sequence processing after Ala22 ,
without any further modifications, would yield a protein of 104kDa that contains
ten potential N-glycosylation sites. Treatment ofthe native 145-kDa protein puri-
fied from medium of a Schw. occidentalis culture with endoglycosidase H revealed
that about 23 kDa of its molecular weight is contributed by N-linked sugars. Some,
if not all, of the other modifications that account for the difference between the
apparent and the calculated molecular weights are presumably due to 0-
glycosylations. A Schw. occidentalis strain that was completely deleted for the
sequence of the GAMl coding region was generated (Dohmen et al. 1990).
Glucoamylase in the culture supernatant or on the surface of intact cells of such
gamlA strains was in the range of the detection limit «1 % of the activity found in
cultures of congenic GAMl strains; Fig. 3B, and data not shown). The gamlA
strains were still able, though very poorly, to grow on media containing starch or
pullulan as a sole carbon source (Dohmen et al. 1990). This phenomenon could be
explained by either the presence of a second very weakly expressed glucoamylase
gene or by the ability of a-amylase together with a putative a-glucosidase to
release a small amount of glucose from these substrates. In any case, the GAMl
A I
(U~J) B I
(U~J)
J-'
400 400 <.;J
o
00000 00800
GAMl gaml L1
30
30 //a • • "'OD800 ~300 ~ 1-300
20 20
1
,
10
1
OD800
:1 ~200 :~ /. ~200
3
I \
2
100 100
----- . (':l
';-'
• • -AMY
tj
~
~
GAM 2.
0.11 0.1 I • Y. x'. y l' • (")
20 40 80 80 100 20 40 60 80 100 120
o
=::""..120 o
~
t (h) t (h) :=
o
Fig. 3A,B. Amylase activities secreted by Schw. occidentalis GAMI (strain RJD 11) and an isogenic gaml.1 strain. The cells were grown
in YP media with 2% soluble starch at 30 °e. a-Amylase (AMY, squares) and glucoamylase (GAM, triangles) activity in the medium was (b
~
determined as described in Dohmen et aI. (1990). The values are units per liter (Ull) culture supernatant. The optical density of the aa
culture at 600nm (circles) was plotted logarithmically. A "Wild-type" strain RJDl1. B gaml.1::TRPS strain derived from RJDl1. (Dohmen
et al,. 1990)
gene is clearly the main contributor to the glucoamylase activity of the strains
tested.
Expression of amylase genes is tightly regulated in Schw. occidentalis. The a-
amylase genes AMYl and SWA2, as well as the GAMl gene, are subject to glucose
repression (Clementi et al. 1980; McCann and Barnett 1984; Ingledew 1987;
Dohmen et al. 1989, 1990; Dowhanick et al. 1990; Abarca et al. 1991). The expres-
sion of a-amylase and glucoamylase is induced (in the absence of glucose) by
maltose, soluble starch, and melizitose (Clementi and Rossi 1986) and is repressed
at elevated temperatures (37 DC; Calleja et al. 1984). Both enzymes are inactivated
at pH values below 3.5 and by temperatures above 55 DC.
Schw. occidentalis displays a Kluyver effect on maltose and starch media.
Both compounds cannot be metabolized in anaerobiosis due to repression of
amylase and a-glucosidase expression (Calleja et al. 1982; De Mot et al. 1985;
Boze et al. 1987; Violla et al. 1992). Some time ago, mutants that were unable to
grow on starch were isolated (A. Nasim, pers. comm.). Recently, one of the
complementing genes, AMG1, was cloned and identified to be the gene encoding
the 51-kDa subunit of the NADH dehydrogenase (complex I) of the repiratory
chain (Fabry 1993; Fabry and Hollenberg, in prep.) previously sequenced from
Neurospora crassa (Weiss et al. 1991). The amgl mutant was in addition unable to
grow with maltose as sole carbon source. Apparently the deficiency in the respira-
tory chain leads to inability to express active glucoamylase and to inefficient
maltose takeup (Fabry 1993).
Although Schw. occidentalis expresses maltose permease and a-glucosidase,
glucoamylase activity, at least in the strains tested, appears to be rate-limiting in
the utilization of maltose, as gamL1 strains show significant reduction in growth
on maltose media (Dohmen et al. 1990).
Glucose, the product of glucoamylase activity, is at the same time a repressor of
its expression. This feedback regulation of glucoamylase expression is apparently
the reason why the highest expression of this enzyme is frequently observed in the
stationary phase of growth (e.g., Clementi et al. 1980, 1986). When the concentra-
tion of the glucoamylase substrate is sufficiently low (usually in the stationary
phase) such that substrate hydrolysis does not generate repressing concentrations
of glucose, glucoamylase expression can proceed uninhibited. This effect is even
more obvious when the copy number of the GAMl gene is increased (Fig. 4A). The
induction of glucoamylase from multiple gene copies, in a culture with 2% soluble
starch, results in a rapid increase in the glucose concentration in the medium. This
then results in a decrease of Gaml activity until the glucose concentration has
dropped sufficiently low to allow another round of induction. A similar but less
striking up and down of glucose concentration and Gaml activity is observed in
the culture without additional copies of the GAMl gene (Fig. 4B). As a result of this
feedback regulation, the increase in glucoamylase activity due to the additional five
to ten copies of the GAMl gene is not all that high. This is in contrast to a similar
experiment, in which additional copies of the AMYl gene were introduced into
Schw. occidentalis on a related SwARS plasmid yielding a fivefold overproduction
of a-amylase (Dohmen et al. 1989).
A B ....
A A ~
00600 {Ut!> 00600 (UtI)
RJ011: pJ013 RJ011 :YRpJ02 ~C
~) I (I'M)
20 20
15 00600
15 ODsoo t
10 10
5 5
4 200 4 200
3 ,, 3 GAM
, GAM r
2 2
,, ,,,,
,,
, ,
, • 100 -100
0.5
:.
... ,
...
...... ..,.0 AMY
-. ......... ~
....•0·" tj
o.·····CJo.·····o.···· ' .. ,
'''Glukosel
0.11 .......-=~ ... u 0
'
I I- e'" . 0···.o···..o..·[J"···
0.1 o
20 40 60 80 100 '
120 0 o 40 60 80 100 120
t(h)
f8-
t(h)
(j
Fig.4A,B. Amylase activities secreted by Schw. occidentalis cells carrying additional copies of the GAMl gene. The cells were grown in synthetic media ~
with 2% soluble starch, 0.2M sodium phosphate buffer pH 6.0, and an amino acid mix lacking tryptophan (see Sect. 3). For detection of amylase ::z::
activity (U/l culture supernatant) see legend to Fig. 3. Glucose concentration (given in ,umoUI, triangles) was determined with glucose dehydrogenasel
mutarotase (Merck) and NAD. The optical density of the culture at 600nm (circles) was plotted logarithmically. A Strain RJDll transformed with t
plasmid pJD13 containing the GAMl gene (see Figs. 1 and 2). B Strain RJDll transformed with plasmid YRp]D2 (see Figs. 1 and 2). Note the difference Ja
in amylase secretion when compared to cells grown in rich media (Fig. 3)
4. Schwanniomyces occidentalis l33
11
Industrial Applications
Schw. occidentalis has become a target for investigators concerned with biotechno-
logical processes because of its ability to degrade starch completely. Starch is one
of the most abundant renewable carbon sources (-1 x 109 tons/year) on planet
earth (Hollenberg and Wilhelm 1987). Starch conversion is by mass the most
important biotechnological process. The enzymes required for starch breakdown,
a-amylase, and glucoamylase, are among the biotechnologically most highly pro-
duced enzymes worldwide (Stewart 1987). Starch is used as a raw material in
biotechnological processes leading to high dextrose and high fructose corn syrups,
the latter being used in the food and soft drink industry, and in ethanol fermenta-
tion. The latter process includes the production of ethanol, which is used as an
octane booster in lead-free gasoline, and of alcoholic beverages (for review see
Finn 1987).
Commercial utilization of starch from corn or barley grain (for review see Tubb
1986) requires, after milling of the raw material, "gelatinization" (by cooking) and
"liquefaction" (partial hydrolysis with heat-stable bacterial a-amylases). Subse-
quently, starch "saccharification" results from treatment with a-amylase and
glucoamylase. For ethanol production, the resulting sugars are then usually fer-
mented by strains of S. cerevisiae. In processes like the brewing of beer or the
production of malt whiskey, saccharification by the amylolytic enzymes present in
barley malt is incomplete such that 25% of the starch material remains as
unfermentable dextrin (Tubb 1986). These dextrins are, besides ethanol, the main
contributors of calories in beer. In order to reduce the dextrin content of the
product, a variety of efforts involving Schw. occidentalis have been made to intro-
duce amylase activity, in particular glucoamylase with deb ranching activity, into
the fermentation step. These include the addition of amylases obtained from Schw.
occidentalis cultures (Sills et al. 1983) and the introduction of amylase genes into
S. cerevisiae. As discussed above (Sect. 10), the latter attempts have yielded S.
cerevisiae strains that are equipped with the Schw. occidentalis genes encoding a-
amylase and glucoamylase. Such strains are able to degrade starch completely
(Strasser et al. 1990). The future will show whether such strains will gain relevance
in industrial processes.
Another possible application for Schw. occidentalis strains is their direct utiliza-
tion in SCP production from inexpensive starchy raw materials (Touzi et al. 1982),
which could replace the more expensive molasses, or in ethanol fermentation
(Calleja et al. 1982). The latter process will require further strain improvement,
since the ethanol tolerance of those studied was not sufficiently high (Ingledew
1987; De Mot et al. 1985). Other problems, the resolution of which has already
begun (see Sect. 4), include the glucose repression of amylase expression and the
absence of a Crabtree effect, combined with the presence of a Kluyver effect.
Calleja et al. (1982) bypassed these problems by preceding the anaerobic fermen-
tation with a period of aerobic growth enabling amylase secretion. Now that the
respective genes have been cloned, strains with altered regulation and strength of
amylase gene expression can also be constructed by approaches employing gene

technology (e.g., Dohmen et al. 1989).
The ability of Schw. occidentalis to grow in inexpensive media might also con-
tribute to make it a choice as a host for the production of heterologous proteins.
The availability of vectors for its genetic manipulation and of tightly regulated
promoters (see Sects. 7, 8) make Schw. occidentalis an attractive system for this
purpose, as well as for more general studies.
Acknowledgments. Weare grateful to Christopher Byrd for his comments on the

manuscript.
References
Abarca D, Fernandez-Lobato M, del Pozo L, Jimenez A (1991) Isolation of a new gene

(SWA2) encoding an a-amylase from Schwanniomyces occidentalis and its expression in
Saccharomyces cerevisiae. FEBS Lett 279: 41-44
Amegadzie BY, Zitomer RS, Hollenberg CP (1990) Characterization of the cytochrome c
gene from the starch-fermenting yeast Schwanniomyces occidentalis and its expression
in baker's yeast. Yeast 6: 429-440
Beggs JD (1978) Transformation of yeast by a replicating hybrid plasmid. Nature 275: 104-
108
Boze H, Moulin G, Galzy P (1987) Influence of culture conditions on the yield and amylase
biosynthesis in continuous culture by Schwanniomyces castellii. Arch Microbiol 148:
162-166
Boze H, Guyot JB, Moulin G, Galzy P (1989a) Kinetics if the amyloglucosidase of
Schwanniomyces castellii. In: Martini A, Vaughan Martini A (eds) Yeast as a main
protagonist of biotechnology. Yeast 2: 117-121
Boze H, Moulin G, Galzy P (1989b) Isolation and characterization of a hexokinase mutant of
Schwanniomyces castellii: consequences on cell production in continous culture. Yeast 5:
469-476
Calleja GB, Levy-Rick S, Lusena CV, Moranelli F, Nasim A (1982) Direct and quantitative
conversion of starch to ethanol by the yeast Schwanniomyces alluvius. Biotechnol Lett 4:
543-547
Calleja GB, Levy-Rick S, Moranelli F, Nasim A (1984) Thermosensitive export of amylases in
the yeast Schwanniomyces alluvius. Plant Cell Physiol25: 757-761
Claros MG, Abarca D, Fernandez-Lobato M, Jimenez A (1993) Molecular structure of the
SWA2 gene encoding an AMYl-related a-amylase from Schwanniomyces occidentalis.
Clementi F, Rossi J (1986) a-Amylase and glucoamylase production by Schwanniomyces
castellii. Antonie Leeuwenhoek J Microbiol 52: 343-352
Clementi F, Rossi J, Costamagna L, Rosi J (1980) Production of amylases by Sch-
wanniomyces castellii and Endomycopsis fibuligera. Antonie Leeuwenhoek 46: 399-
406
Costaglioli P, Meilhoc E, Masson JM (1994) High-efficiency electrotransformation of the
yeast Schwanniomyces occidentalis. Curr Genet 27: 26-30
Cottrell M, Viljoen BC, Kock JLF, Lategan PM (1986) The longchain fatty acid compositions
of species representing the genera Saccharomyces, Schwanniomyces and Lipomyces.
J Gen Microbiol132: 2401-2403
Deibel MR, Hiebsch RR, Klein RD (1988) Secreted amylolytic enzymes from
Schwanniomyces occidentalis: purification by fast protein liquid chromatography
(FPLC) and preliminary characterization. Prep Biochem 18: 77-120
Del Pozo L, Abarca D, Hoenicka J, Jimenez A (1993) Two different genes from
Schwanniomyces occidentalis determine ribosomal resistance to cycloheximide. Eur J
Biochem 213: 849-857
De Mot R, Andries K, Verachtert H (1984) Comparative study of starch degradation
and amylase production by ascomycetous yeast species. Syst Appl Microbiol 5: 106-
118
De Mot R, van Dijck K, Donkers A, Verachtert H (1985) Potentialities ad limitations of
direct alcoholic fermentations of starchy material with amylolytic yeast. Appl Microbiol
De Zoysa PA, Connerton IF, Watson DC, Johnston JR (1991) Cloning, sequencing and
expression of the Schwanniomyces occidentalis NAPD-dependent glutamate dehydroge-
nase gene. Curr Genet 20: 219-224
Dohmen RJ, Strasser AWM, Zitomer RS, Hollenberg CP (1989) Regulated overproduction of
a-amylase by transformation of the amylolytic yeast Schwanniomyces occidentalis. Curr
Genet 15: 319-325
Dohmen RJ, Strasser AWM, Dahlems UM, Hollenberg CP (1990) Cloning of the
Schwanniomyces occidentalis glucoamylase gene (GAMl) and its expression in Saccha-
romyces cerevisiae. Gene 95: 111-121
Dohmen RJ, Strasser AWM, Honer CB, Hollenberg CP (1991) An efficient transformation
procedure enabling long-term storage of competent cells of various yeast genera. Yeast
7: 691-692
Dowhanick TM, Russell I, Scherer SW, Stewart GG, Seligy VL (1990) Expression and regu-
lation of glucoamylase from the yeast Schwanniomyces castellii. J Bacteriol 172: 2360-
2366
Dubreucq E, Boze H, Fouilhe M, Moulin G, Galzy P (1990a) Alternative respiration pathways
in Schwanniomyces castellii. 1. Isolation and characterization of cytochrome-deficient
mutants. Antonie Leeuwenhoek J Microbiol 57: 123-130
Dubreucq E, Boze H, Moulin G, Galzy P (1990b) Alternative respiration pathways in
Schwanniomyces castellii. II. Characterization of oxidation pathways. Antonie
Fabry P (1993) Analyse der Starkeverwertung der Hefe Schwanniomyces occidentalis. PhD
Thesis, Heinrich-Heine-Universitat, Dusseldorf
Ferreira JD, Phaff HJ (1959) Life cycle and nuclear behavior of a species of the yeast genus
Schwanniomyces. J Bacteriol 78: 352-361
Finn RK (1987) Conversion of starch to liquid sugar and ethanol. In: Biotec I: Microbial
genetic engineering and enzyme technology. Gustav Fischer, Stuttgart, pp 101-107
Fuji M, Kawamura Y (1985) Synergistic action of a-amylase and glucoamylase on hydrolysis
of starch. Biotechnol Bioeng 27: 260-265
Hohn B (1980) In vitro packaging of It and cosmids. In: Wu R (ed) Recombinant DNA.
Methods Enzymol 68: 299-309
Hohn B, Collins J (1980) A small cosmid for efficient cloning oflarge DNA fragments. Gene
11: 291-298
Hollenberg CP, Wilhelm M (1987) New substrates for old organisms. In: Biotec I: Microbial
genetic engineering and enzyme technology. Gustav Fischer, Stuttgart, pp 21-31
Ingledew WM (1987) Schwanniomyces: a potential superyeast? CRC Crit Rev Biotechnol5:
159-176
James AP, Zahab DM (1984) Genetic system of Schwanniomyces alluvius determined by
diad analysis of fusion products. J Bacteriol160: 1105-1108
Johannsen E, van der Walt JP (1980) Hybridization studies within the genus
Schwanniomyces Klocker. Can J Microbiol26: 1199-1203
Johnston JR, Contopoulou CR, Mortimer RK (1988) Karyotyping of yeasts strains of several
Klebe RJ, Harriss JV, Sharp D, Douglas MG (1983) A general method for polyethylene-
glycol-induced transformation of bacteria and yeast. Gene 25: 333-341
Klein RD, Favreau MA (1988) Transformation of Schwanniomyces occidentalis with an

ADE2 gene cloned from S. occidentalis. J Bacteriol170: 5572-5578
Klein RD, Favreau MA (1991) A DNA fragment containing the ADE2 gene from
Schwanniomyces occidentalis can be maintained as an extrachromosomal element. Gene
97: 183-189
Klein RD, RoofLL (1988) Cloning of the orotidine Sf-phosphate decarboxylase (ODC) gene
of Schwanniomyces occidentalis by complementation of the ura3 mutation of S.
cerevisiae. Curr Genet 13: 29-35
Klein RD, Poorman RA, Favreau MA, Shea MH, Hatzenbuhler NT, Nulf SC (1989) Cloning
and sequence analysis of the gene encoding invertase from the yeast Schwanniomyces
occidentalis. Curr Genet 16: 145-152
Klocker A (1909) Deux nouveaux genres de la famille des Saccharomycetes. CR Trav Lab
Carlsberg 7: 273-278
Kreger-van Rij NJW (1977) Electron microscopy of sporulation in Schwanniomyces
alluvius. Antonie Leeuwenhoek J Microbiol43: 55-64
Kurtzman CP, Robnett CJ (1991) Phylogentic relationships among species of Saccharomy-
ces, Schizosaccharomyces, Debaryomyces and Schwanniomyces determined from partial
ribosomal RNA sequences. Yeast 7: 61-72
Kurtzmann CP, Smiley MJ, Baker FL (1972) Scanning electron microscopy of ascospores of
Schwanniomyces. J Bacteriol112: 1380-1382
Lambrechts C, Boze H, Moulin G, Galzy P (1992) Utilization of phytate by some yeasts.
Biotechnol Lett 14: 61-66
Leusch HG, Hoffmann M, Emeis CC (1985) Fluorometric determination of the total DNA
content of different yeast species using 4',6-diamidino-2-phenyl-indol-dihydrochloride.
Can J Microbiol31: 1164-1166
Lodder J (1984) The yeasts: a taxonomic study. 3rd edn. North Holland Publishing,
Amsterdam
McCann AK, Barnett JA (1984) Starch utilization by yeasts: mutants resistant of carbon
catabolite repression. Curr Genet 8: 525-530
Moranelli F, Yaguchi M, Calleja GB, Nasim A (1987) Purification and characterization of the
extracellular a-amylase activity of the yeast Schwanniomyces alluvius. Biochem Cell BioI
65:899-908
Moreno S, Klar A, Nurse P (1991) Molecular genetic analysis of fission yeast
Schizosaccharomyces pombe. In: Guthrie C, Fink GR (eds) Guide to yeast genetics and
molecular biology. Methods Enzymol194: 795-823
Oteng-Gyang K, Moulin G, Galzy P (1981) A study of the amylolytic system of
Schwanniomyces castellii. Z Allg Mikrobiol21: 537-544
PhaffHJ (1970) Schwanniomyces Klocker. In: Lodder J (ed) The yeasts. A taxonomic study.
North-Holland Publishing, Amsterdam, pp 756-766
Phaff HJ, Miller MW (1984) Schwanniomyces Klocker. In: Lodder J (ed) The yeasts: a
taxonomic study. 3rd edition. North Holland Publishing, Amsterdam, pp 423-426
Poinsot C, Moulin G, Claisse M, Galzy P (1987) Isolation and characterization of a mutant
of Schwanniomyces castellii with altered respiration. Antonie Leeuwenhoek J Microbiol
53:65-75
Prakash K, Seligy VL (1988) A temporally expressed gene from Schwanniomyces alluvius
and detection of homologous sequences in other yeasts. Gene 73: 131-140
of species within the genera Schwannionyces, Saccharomyces, Debaryomyces and Pichia.
Microbiol Rev 42: 161-193
Rothstein RJ (1983) One-step gene disruption in yeast. In: Wu R, Grossman L, Moldave K
(eds) Methods Enzymol101: 202-211
Schiestl RH, Gietz RD (1989) High efficiency transformation of intact yeast cells using single
stranded nucleic acids as a carrier. Curr Genet 16: 339-346
Sherman F (1983) Getting started with yeast. In: Guthrie C, Fink GR (eds) Guide to yeast
genetics and molecular biology. Methods Enzymol194: 3-21
ShortIe D, Haber JE, Botstein D (1982) Lethal disruption of the yeast actin gene by integra-
tive DNA transformation. Science 217: 371-373
Sills AM, Stewart GG (1982) Production of amylolytic enzymes by several yeast species. J
Inst Brew 88: 313-316
Sills AM, Panchal CJ, Stewart GG (1983) The production and use of yeast amylases in the
brewing of low carbohydrate beer. Proceedings of the 19th European Brewery
Courention Congress, London, IRL Press, Oxford, pp 377-384
Sills AM, Sauder ME, Stewart GG (1984a) Isolation and characterization of the amylolytic
system of Schwanniomyces castellii. J Inst Brew 90: 311-314
Sills AM, lygora PSJ, Stewart GG (1984b) Characterization of Schwanniomyces castellii
mutants with increased productivity of amylases. Appl Microbiol Biotechnol20: 124-128
Sills AM, Panchal CJ, Russel I, Stewart GG (1987) Production of amylolytic enzymes by
yeasts and their utilization in brewing. CRC Crit Rev Biotechnol5: 105-115
Simoes-Mendes B (1984) Purification and characterization of the extracellular amylases of
the yeast Schwanniomyces alluvius. Can J Microbiol30: 1163-1170
Spencer-Martins I, van Uden N (1979) Extracellular amylolytic system of the yeast
Lipomyces kononenkoae. Eur J Appl Microbiol Biotechnol6: 241-250
Stearns T, Ma H, Botstein D (1990) Manipulating yeast genome using plasmid vectors.
Methods Enzymo1185: 280-297
Stephen ER, Nasim A (1981) Production of protoplasts in different yeasts by mutanase. Can
J Microbiol27: 550-553
Stewart GG (1987) The biotechnological relavance of starch-degrading enzymes. CRC Crit
Rev Biotechnol 5: 89-93
Strasser AWM, Selk R, Dohmen RJ, Niermann T, Bielefeld M, Seeboth P, Tu G, Hollenberg
CP (1989) Analysis of the a-amylase gene of Schwanniomyces occidentalis and secretion
of its gene product in transformants of different yeast genera. Eur J Biochem 184: 699-
706
Strasser AWM, Janowicz lA, Dohmen RJ, Roggenkamp RO, Hollenberg CP (1990) Pros-
pects of yeasts in biotechnology. Agro-Industry Hi-Tech 1: 21-24
Strasser AWM, Janowicz lA, Roggenkamp RO, Dahlems U, Weydemann U, Merckelbach A,
Gellissen G, Dohmen RJ, Piontek M, Melber K, Hollenberg CP (1991) Applications of
genetically manipulated yeasts. In: Peberdy JF, Caten CE, Ogden JE, Bennett JW (eds)
Applied molecular genetics of fungi. Cambridge University Press, Cambridge, pp 161-
169
Touzi A, Prebois JP, Moulin G, Deschamps F, Galzy P (1982) Production of food yeast from
starchy substrates. Eur J Appl Microbiol Biotechnol15: 232-236
Tubb RS (1986) Amylolytic yeasts for commercial applications. Trends Biotechnol4: 98-104
Twigg AJ, Sherrat D (1980) Trans-complementable copy number mutants of plasmid ColE!.
Nature 283: 216-218
Violla P, Boze H, Moulin G, Galzy P (1992) Transport and hydrolysis of maltose by
Schwanniomyces castellii. J Basic Microbiol32: 57-63
Walz A, Ratzkin B, Carbon J (1978) Control of expression of a cloned yeast (Saccharomyces
cerevisiae) gene (TRP5) by a bacterial insertion element (IS2) Proc Natl Acad Sci USA 75:
6172-6176
Weiss H, Friedrich T, Hofhaus G, Preiss D (1991) The respiratory chain NADH dehydroge-
nase (complex I) of mitochondria. Eur J Biochem 197: 563-576
Wilson JJ, Ingledew WM (1982) Isolation and characterization of Schwanniomyces alluvius
amylolytic enzymes. Appl Environ Microbiol44: 301-307
Wilson JJ, Khachatourians GG, Ingledew WM (1982) Protoplast fusion in the yeast
Schwanniomyces alluvius. Mol Gen Genet 186: 95-100
Wu FM, Wang TT, Hsu WH (1991) The nucleotide sequence of Schwanniomyces
occidentalis a-amylase gene. FEMS Micobiol Lett 82: 313-318
CHAPTER 5
Kluyveror,nyceslactis
Micheline Wesolowski-Louvel', Karin D. Breunig2, and Hiroshi Fukuhara 1
1
History of Kluyveromyces lactis Research
Genetic studies of Kluyveromyces lactis (Dombrowski) van der Walt began in the
early 1960s. Saccharomyces lactis was the name of the yeast at that time. Since then,
the genus Kluyveromyces has been the object of intensive taxonomical studies. The
position of Kluyveromyces lactis with respect to other members of the genus has
been discussed in detail bya number of authors (van der Walt 1970; Johannsen and
van der Walt 1978; Sidenberg and Lachance 1986; Lachance 1989; Fuson et al. 1987;
Vaughan-Martini and Martini 1987; see also Kurtzman and Phaffl989, for molecu-
lar taxonomy of yeasts). K. lactis had been thought to be closely related to the so-
called K. fragilis (K. marxianus), another lactose-assimilating yeast well known
in industry. On the basis of cellular hybridization studies, Johannsen (1980) and
van der Walt and Johannsen (1979) considered K. lactis as a variety of K.
marxianus (Hansen) van der Walt, but later taxonomic studies cited above showed
that they are distinct species, as judged by various molecular criteria. DNA
complementarity is less than 15-20% according to Fuson et al. (1987) and
Vaughan-Martini and Martini (1987); the electrophoretic karyotype and the mito-
chondrial DNA restriction pattern are also completely different between the two
yeasts (see below). At present, K. lactis is considered as a separate species from K.
marxianus. K. lactis now incorporates K. drosophilarum and K. vanudenii. To our
knowledge, the latest review on Kluyveromyces systematics is that of Lachance
(1993).
Since the pioneer work by Halvorson and collaborators on the genetics of
"Saccharomyces lactis" (Herman and Halvorson 1963a,b; Tingle et al. 1968; Tingle
1967; Herman 1963), several laboratories have developed genetically labeled
strains which formed the genetic background of the strains we are now using in
various genetic and biochemical studies. Stimulated by the recent biotechnological
interest, the research on K. lactis gained increasing attention. Because of its dis-
'Institut Curie, Section de Biologie, Bat. 110, Centre Universitaire Paris XI, Orsay 91405,
France
2Institut fur Mikrobiologie, Heinrich-Heine-Universitat Dusseldorf, 40225 Dusseldorf,
Germany
140 M. Wesolowski-Louvel et al.
tinctive physiological properties, K. lactis has become an important alternative to

the classical Saccharomyces cerevisiae. This chapter will consider, as often as pos-
sible, the question how K. lactis is similar to, or different from S. cerevisiae.
2
Physiology
K. lactis cells are spherical to oval, somewhat smaller than S. cerevisiae cells (Fig.
1). The natural habitat of this species is diverse, but many strains were originally
isolated from milk-derived products in which the major carbon source is lactose.
These strains indeed grow well on lactose, while S. cerevisiae does not. Also in
contrast to S. cerevisiae, in which the fermentative metabolism dominates, the
Fig. 1. Kluyveromyces lactis. A scanning electron micrograph of K. lactis strain CBS 2359.
(Courtesy of Professor Masako Osumi, Department of Biology, Japan Women's University,
Tokyo)
5. Kluyveromyces lactis 141
majority of yeast species, including K. lactis, seem to be essentially aerobic organ-

isms. K. lactis cultures, which smell fruity, suggesting the presence of organic
acid esters, are easily distinguishable from the familiar S. cerevisiae cultures. Un-
der strict anaerobic conditions, most K. lactis strains cannot grow even with added
sterols and fatty acids, although there is a report on anaerobic growth on glucose
and fructose (Entian and Barnett 1983). In aerobic conditions, K. lactis ferments
glucose, producing ethanol, but the respiratory system also functions throughout
the growth phase. Apparently, biogenesis of the respiratory system in K. lactis is
not sensitive to glucose repression. It has been described that many petite-negative
species, which are generally thought to be obligate aerobes, are not subject to
glucose repression (Bulder 1964a; de Deken 1966) with the known exception of
Schizasaccharamyces pambe (Reslot et al. 1970; Goffeau et al. 1975). K. lactis is
one of such petite-negative species. Indeed, it seems to be relatively insensitive to
glucose repression. In contrast, S. cerevisiae grows on glucose essentially by
alcoholic fermentation even in aerated conditions, and the respiratory pathway
is induced only when the glucose level approaches exhaustion. The so-called
glucose effect constitutes a major control mechanism of many metabolic processes
in S. cerevisiae, whilst the response of K. lactis to glucose is clearly different (see
Sect. 9).
3
Growth Media
K. lactis assimilates a wide variety of carbon sources. Table 1 lists selected sub-
strates that distinguish K. lactis from S. cerevisiae and Schizasaccharamyces
pam be. Compared to them, K. lactis can grow on a much wider range of substrates.
Table 2 shows the growth rates of K. lactis in liquid cultures with the carbon
sources commonly used in the laboratory. The growth rate on lactose is quite high,
and the respiratory substrates are excellent carbon sources for growth. Compre-
hensive reviews are available on the utilization of sugars by various yeasts (Barnett
1976, 1992).
For routine laboratory studies, the basic culture conditions are the same as
those generally used for S. cerevisiae. The complete medium contains 1% yeast
extract, 1% (sometimes 2%) peptone, supplemented with appropriate carbon
sources (2% glucose in the routine "complete glucose medium"). The basic mini-
mal medium is made of 0.67% Yeast Nitrogen Base without amino acids, Difco,
supplemented with carbon sources. As respiratory substrates, glycerol, DL-Iactate,
ethanol or succinate may be used. A specific medium is ME agar (5% malt extract
Difco, with 3% agar; Wickerham 1951) which is used for mating and sporulation
(see below). Various brands of microbiological grade agar were found satisfactory
for culture, but for plate assays of the killer toxin, Oxoid no.1 agar is preferred to
Difco Bacto agar, as the response is more sensitive, possibly due to reduced con-
tents of unkown inhibitors of the toxin.
K. lactis is usually grown at a temperature of 25-28°C. The upper limit is
approximately 40°C. At this critical temperature, S. cerevisiae appears to be more
Table 1. Growth of K. lactis on various carbon sources. (Barnett et al. 1990)
Substrate K. lactis S. cerevisiae Sch. pombe
D-Glucose + + +
D-Galactose + +,- -,D
L-Sorbose +
Sucrose + + +
Maltose + + +
Cellobiose +
Salicin +
Arbutin +
Melibiose +, - +, -
Lactose +,-
Raffinose + +,- +
Melezitose + +,-
D-Mannitol + -,D
Ethanol + +,-
Glycerol + +,-
Xylitol +,D
Butane-2,3-diol +
Citrate +,-
DL-Lactate + D
Succinate + -,D
Ethylamine + +,-
L-Lysine + +,-
Cadaverine + +,W
No niacin +
+0.1 % cycloheximide +
D: delayed growth; W: weak positive growth.
Table 2. Growth rates of K. lactis on common carbon sources
Carbon source Lactose Glucose Glycerol Galactose Ethanol
Doubling time, min 78 84 96 108 110

Final cell density 8.4 10.6 7.6 10.2 6.4
Strain 23591152 (a methionine-requiring clone of CBS 2359) was grown at 28°C in a 5-ml
medium containing yeast extract and peptone, 1% each, supplemented with the indicated
carbon source at 2%. The final cell density, expressed as cell number per ml (XlOB), was
taken after 48 h of shake culture.
resistant than K. lactis. A heat shock of 50°C, 10 min, kills a large fraction of K.
lactis cells (therefore, caution should be taken when plating with molten agar).
4
Available Strains
When we trace the origins of the current laboratory strains, we find that only a few
independent isolates had been used in early genetic crosses and mutant isolation.
5. K/uyveromyces /actis 143
0- Fe:
:~(:t.,
I
Fe•..• t Pulcherrimin
Fig. 2. Pulcherrimin. This red pigment is an iron complex of2: 5 diisobutyl-1 : 4-dihydroxy-
3: 6-dioxopiperazine (Cook and Slater 1956). The structure can be viewed as a leucine
dimer. It is produced by several species of yeast, including Kluyveromyces lactis, and is
reported to have antibiotic activity
Most K. lactis researchers took advantage of the known mating types of the strains
used by Halvorson and collaborators. Thus, the major genetic background seems
to come from three NRRL strains:
- NRRL Y-1140, mating type a (CBS 2359, ATCC 8585),
- NRRL Y-I118, mating type a (CBS 6315, ATCC 8563),
- NRRL Y-1205, mating type a (CBS 2360, ATCC 8651).
- NRRL Y-1140 (CBS 2359) is probably the most widely used strain. Several inves-
tigators have proposed that this strain be the reference material for genetic and
molecular studies (Annual Workshop Biology of Kluyveromyces II, Rome, 1989),
although the type strain of the species is NRRL Y-8279 (CBS 683). NRRL Y-1140
has the particularity that it carries the killer plasmids pGKLl and 2 (see later
sections).
The strain NRRL Y-1205 (CBS 2360) also has its characteristic traits. It is one of
the natural variant strains that have a recessive ragl allele, deficient in low-affinity
glucose transport (Goffrini et al. 1990). A similar allele was also found in several
other strains (CBS 141, CBS 5618, and CBS 8043) among the 30 independent
isolates examined (CBS collection). As the ragl strains show particular responses
to mitochondrial inhibitors and possibly to glucose repression (see below), care
should be taken as to the allelic status of the RAGI locus in certain areas of
research. Under normal conditions of culture, the ragl strains do not show any
obvious deficiency for growth.
Liquid cultures of K. lactis may be conserved for months in the refrigerator.
Old, large colonies on agar plates are sometimes surrounded by a pink-colored
ring due to the pigment pulcherrimin (Fig. 2). For long-term conservation, strains
are best maintained frozen at -70 to -80°C in complete liquid medium containing
30-40% glycerol.
5
Genetic Techniques
5.1
Life Cycle
K. lactis strains are usually heterothallic. The complementary mating types are
designated a and a. A gene coding for a protein highly homologous to the mating
factor a of S. cerevisiae has been identified (Brake et al. 1988). The life cycle of K.
lactis is essentially similar to that of S. cerevisiae. However, the diploid phase of K.
lactis is transitory for the majority of cells (Herman and Halvorson 1963a; Herman
and Roman 1966). Cultures of diploid cells tend to sporulate spontaneously. This
particular feature is taken into account in the protocols of genetic experiments
with K. lactis.
5.2
Sexual Crosses and Tetrad Analysis
The following procedure of genetic cross stems from the description given by
Herman and Halvorson (1963a).
Fig. 3. Asci of Kluyveromyces lactis. Optical microscopy of asci from a cross of two labora-
tory strains
5. Kluyveromyces loctis 145
Two strains of complementary genotypes are grown overnight in a liquid com-

plete medium. On a ME agar plate, a drop of one culture is superposed with a drop
of the partner culture. The plate is incubated for 2 days at 28°C. The diploid
colonies arising from the zygotes are selected by replica plating onto a minimal
plate. After 2 days of incubation at 28 °C, the diploid colonies are again replicated
onto a ME plate and left overnight at 28°C. The four-spored asci (Fig. 3) are easily
recognizable under the microscope. Massive sporulation can usually be obtained
in 2-3 days, but some crosses may need a much longer time, in which case the
plates are kept in the refrigerator for several days, then examined for the presence
of asci. For dissection of asci, a loopful mass of the asci-containing population is
mixed with 90 J1l of complete glucose medium and 15 J1l of Glusulase (Endo Labo-
ratories). The mixture is kept at room temperature for 6 min, then placed on ice to
stop digestion. The asci can be dissected by any type of micromanipulator. The
spores of K. lac tis are somewhat smaller than those of S. cerevisiae, but can be
micromanipulated in the same way. These asci are evanescent, that is, they tend to
release spores. Therefore, the asci should not be overdigested before dissection.
Generally, K. lactis strains are very sensitive to the cell wall-digesting enzymes as
compared to S. cerevisiae. For asci digestion or spheroplasting, the amount of
Glusulase or Zymolyase required may be roughly 10-20% of that used for S.
cerevisiae manipulation.
5.3
Mutagenesis
Chemical and radiation mutagenesis of K. lactis can be performed by the standard

methods used for S. cerevisiae (for example, Sherman et al. 1974). Under ultravio-
let light, 50% survival was observed around the dose of 25-30 J/m2 (250-300 ergl
cm2) with three strains tested. During test plating after mutagenesis, cells sus-
pended in water can be stored at 4°C for several days without loss of viability, but
die massively at room temperature.
6
Chromosomal DNA
6.1
Chromosomal DNAs and Genome Size
Pulsed field gel electrophoresis distinguishes six DNA bands (CBS 2359, CBS 2360,
CBS 683, CBS 141) (Steensma et al. 1988; Sor and Fukuhara 1989). They are
numbered I through VI, from the smallest of about 1 million base pairs (Mbp) to
the largest (about 3 Mbp). The bands IV and V often separate poorly, depending on
the strain. In addition, the band IV may appear sometimes diffuse due to the
presence of the repetitive ribosomal DNA. The sum of the molecular weights
suggests a genome size of about 12 Mbp, which may not be significantly different
from the 15-Mbp genome size of S. cerevisiae, considering the low accuracy of the
measurement. While the latter yeast has a completely different karyotype with 16
chromosomes of much smaller size, there are, however, some indications that the
local order of genes can often be similar in both species. Such a possibility may be
worth consideration in the search for genes in K. lactis chromosomes. Compara-
tive data are still very limited on this interesting point.
6.2
Chromosome Separation by Pulsed Field Gel Electrophoresis
(see also Chap. 3, this Vol.)
Early experiments (De Jonge et al. 1986; Johnston et al. 1988) have shown that K.
lactis chromosomes contained DNA molecules of relatively large sizes. Separation
of this size range of DNA can be achieved by the techniques recently developed by
several laboratories (Sor 1988; Steensma et al. 1988; Sor and Fukuhara 1989; Viovy
et al. 1992; Sor 1992). Figure 4 shows the electrophoretic karyotypes of various K.
lactis strains of independent origins. The patterns are remarkably homogeneous,
and some strains of K. drosophilarum show a similar pattern (Sor and Fukuhara
1989). For electrophoretic separation of chromosomal DNA, as shown in Fig. 4, an
experimental protocol was provided by Dr. F. Sor (Institut Curie, Orsay):
Yeast is grown overnight in 5 mlliquid medium (standard glucose complete me-
dium) to early stationary phase (about 2 X 108 cells/ml). Cells are collected by
centrifugation (5000rpm for 5min) and suspended in 50mM EDTA containing
50,ug/ml Zymolyase lOOT (Seikakagu Corp., Tokyo) at a density of2 x 109 cells/ml.
An equal volume of 1% low gelling temperature agarose (SeaPlaque, FMC Corp., or
equivalent, dissolved in 125 mM EDT A and held at 50°C) is added. The mixture is
poured in 100-,ul molds (Pharmacia, Uppsala, or equivalent, depending on the
electrophoresis apparatus used) and allowed to harden at 4°C.
The agarose blocks are removed from the moulds and placed in 5ml (for 10-12
blocks) of a solution containing 500mM EDTA, pH 8-9, 7.5% mercaptoethanol-2,
50mM Tris, pH8. These blocks are incubated at 37°C for at least 4h, usually
overnight.
Then the solution is withdrawn and replaced by 5 ml of a solution containing
500 mM EDT A, pH 8-9, 1% Sarkosyl, and Proteinase K (1 mg/ml). The incubation
is continued for 6-24h at 50°C, after which the blocks are stored at 4 °C in 500 mM
EDTA/l % Sarkosyl. They are stable for years.
The CHEF electrophoresis is performed on a 15-cm gel (Gene Navigator,
Pharmacia) using a standard low Mr agarose (Biorad, ref. 162-0102 or equivalent)
at gel concentrations depending on chromosome size. Usually 1% gels allow a
wide spread of the chromosomes on the gel (Fig. 4A). This gives a good resolution
for Southern blot analysis. To improve the separation between the chromosomes
IV and V, which migrate together in certain strains, 1.5% gel (Fig. 4B) may be
used.
5. K/uyveromyces /actis
--
147
,...
--
0) It) 0
:g :8
0)
i
CO') N
,... ~ ,...
It) 0) It) CD
CO') ~ CO CO') CD CO') CO')
N CD N N
A B (I)
III
U
(I)
III
U
(I)
III
U
(I)
III
U
en
III
U
(I)
III
U
(f)
III
U
(I)
III
U
(f)
III
U
en en
III
U
III
U
c
Fig.4A-C. Pulsed field gel electrophoresis of K. lactis DNA. CHEF migration of K. lactis
strains. A 1% agarose gel: left lane CBS 2359; right lane CBS 141. B 1.5% gel; both lanes
CBS 2359. C Various K. lactis strains: from left to right CBS 2359, CBS 141, CBS 683, CBS 739,
CBS 743, CBS 762, CBS 845, CBS 1065, CBS 1067, CBS 2359 (2x), CBS 2360. Electrophoresis
was run at 50 V for 190 h, and the pulse time varies from 1200 to 2500 s with a logarithmic
ramp
In a current protocol, electrophoresis is run at 130 V for 73 h. The temperature of

the buffer is maintained at 9-1O°C. For the first 16h the pulse time is 100s, then it
varies from 180 to 360 s with a linear ramp during the following 51 h, to be of 360 s
for the last 6h. The conditions should be adjusted as a function of the equipment
used, because the separation is very sensitive to the configuration of gels and
electrodes.
7
Auxotrophic mutations for various amino acids have become available from sev-
erallaboratories. Most of the strains in which these mutations were obtained seem
to have, at least in part, NRRL Y-1140-related background. To describe the genetic
loci, the basic rules used for S. cerevisiae have been spontaneously adopted by most
K. lactis workers: a locus is written by three letters followed by a locus number, all
in italics. In practice, however, the published names of mutations are often degen-
erate and redundant, because they have been isolated independently by different
Linkage groups (cM) Other K. lactis genes

Chrom.no. on the chromosome:
ade2* ilvA 1* plkl * tal1* Ips* qcr8*
II I /1II I I
#
II II RP28-1*, PRT1*, GAP2*,
GAL80*, HGT1*
--
10
hap 2* 13
lac4* lacl~ adh3* lysAl metAl 10gl*

II
II II /1 18 1 /1 I 30 I RP59* ,TUB1*,CPF1*,
PH05
adel
rag3* thrAl*argA11 MAT hisA2* apa2* qcr7*
III I I I I I II PYCA*, OLE1*, KARS2,
COC39
rag4 ragl * rag5* rag8* leu2*

IV I 31,5 I 32 I 20 I 42 bl ...
.,;::..._..:::t;:.
111 ....
ACT1*, rONA,TUB2*,
LAC9*
uraAl* zwf* let1* kexl*
rag2*, trpA 1"
--
FBP*, HAP3*, XYL1*
V 18 10 I // . .~. . .:;:III.. :;:::. . . . . . . .. POCA*, PRA1*, PRB1*,
PRC1", AOE2, OLD", AAC"
ipp" trpl" hht1* hht2*
adhl" gapl" PFK2", CYC1*, AOH4",
VI II AOH2", RHP1*, HISA1*,
RHP2*
Fig. 5. A linkage map of chromosomal genes. This map is a compilation of data assembled
from heterogeneous sources (see text). Chromosome sizes are not in proportion. The
numbers are the distances in centimorgans calculated from genetic crosses and the position
with respect to the centromeres is not known. Asterisks indicate that these genes have been
cloned and localized by hybridization with chromosome blots. The trp 1 marker on chromo-
some V is homologous to the trpl mutation of S. cerevisiae, and the adel mutation, which
is homologous to the adel mutation of S. cerevisiae (Zonneveld, unpubl. data) is allelic to
the adel mutation of the strains WM52 and W600B (Brunner et al. 1973; Tingle et al. 1968).
The ADE2 gene on chromosome V is homologous to the ADE2 gene of S. cerevisiae
(Zonneveld, unpubl. data) and corresponds to the adel-l mutation from Dickson's strains
(Sheetz and Dickson 1980), and WM12 strain (Tingle et al. 1968). The ade2 marker on
chromosome I is from W600B strain and is different from the former. The uraAl mutation
is allelic to the cloned K1URA3. The LEU2 gene is homologous to the LEU2 gene of S.
cerevisiae. Many of the K. lactis gene probes used for chromosomal hybridization in the
authors' laboratory were kindly provided by the colleagues who cloned them (as indicated
here in parentheses): K1ADHl (Saliola et al. 1990); PRA, PRB, PRC (Shuster 1990), and
KlURA3 (Shuster et al. 1987); LAC4, LAC9, and K1GAL80 (Breunig et al. 1984; Salmeron and
Johnston 1986; Zenke et al. 1993); K1ACTl and RP59 (Deshler et al. 1989; Larson and Rossi
1991); K1CYCl (Clark-Walker 1991; Freire Picos et al. 1993); K1TRPl (Stark and Milner
1989); K1PFKl and K1PFK2 (Heinisch et al. 1993); K1QCR8, K1QCR7, K1CPFl (Mulder et al.
1994a,c,d) and K1HAP3 (Mulder et al. 1994b); K1LEU2 (Zhang et al. 1992); RP28-1, PRTl,
GAP2, HGTl, PYCA, OLEl, XYLJ, and PDCA (Menart, unpubl. data); KLHAP2 (Nguyen et
al. 1995); K1FBP (Zaror et al. 1993); K1PH05 (Ferminan and Dominguez, unpubl. data).
Some of the data are personal communications from the authors: FOGl, and its genetic
linkage to the metAl marker (Goffrini and Ficarelli, unpubl. data); K1AAC (Viola and
Galeotti, unpubl. data); KlDLD (Lodi et al. 1994, and Lodi and Goffrini, pers. comm.),
K1TUBl, K1TUB2, KARS2, K1CDC39, ade1, and its genetic linkage to the argAl marker
(Zonneveld, unpubl. data)
laboratories. For example, there are two adel corresponding to different functions.
To avoid confusion with already described loci, some laboratories add a provi-
sional identification letter before the locus number (for example, lysAl). Another
problem concerns the genes whose functional equivalent is known in S. cerevisiae.
A trp 1 of K. lactis mayor may not correspond to trp 1 of S. cerevisiae, depending on
the laboratory who named it. There is some consensus that the loci of known
function be written, for example, KlTRPl or KlURA3 to show their equivalence to
S. cerevisiae TRP 1 or URA3, respectively. The genes cloned by functional comple-
mentation of known S. cerevisiae mutations tend to adopt this expression, al-
though, strictly speaking, they do not mean genetic loci. A unified nomenclature in
K. lactis genetics remains to be established. A compilation of early auxotrophic
mutations is in preparation.
The ade and leu markers from one of the classical strains, W600B, have been in
use in many laboratories. Unfortunately, the origin of this strain is not clear.
Despite our search, helped by Dr. c.P. Kurtzman and Dr. A. Herman (NRRL,
Peoria), the original record of this strain could not be recovered. However, W600B
and some of its meiotic progeny show a few characteristic traits: deletion and
duplication of specific chromosomal segments as well as its high sensitivity to
glucose repression. These traits are all found in the strain NRRL Y-1118, which had
been used by the Wisconsin group. It is therefore likely that W600B is a close
relative of Y-1118.
Compared to the impressive genetic map of S. cerevisiae, describing more than
800 loci, K. lactis map is still a desert. Only several genetic linkage groups have
been reported (Tingle et al. 1968; Sheetz and Dickson 1980; Wesolowski-Louvel et
al. 1992b) and some were physically mapped to the individual chromosomes of K.
lactis. Five of the six centromeres have recently been cloned (Heus et al. 1990).
Genes tightly linked to the centro meres of known chromosomes have not been
reported. Chromosomal telomere sequences have been reported by McEachern
and Blackburn (1994). These sequences show a complex pattern distinct from that
of S. cerevisiae, but conserve the TG-rich motif. Figure 5 is a sample oflinkage data
including unpublished results contributed by different laboratories.
8
K. lactis Genes vs. S. cerevisiae Genes
8.1
Sequence Homology of Gene Products
The question in most minds is the phylogenetic distance between K. lactis and S.
cerevisiae. The GC content of nuclear DNA is fairly similar in S. cerevisiae (39%)
and K. lactis (40%). Comparison of ribosomal DNA sequences (Verbeet et al. 1984;
Barns et al. 1991; Hendriks et al. 1992) indicates that K. lactis is much closer to S.
cerevisiae (0.0217 changes per nucleotide on average) and Torulopsis glabrata
(0.0155) than to Hansenula polymorpha (0.0340), Candida parapsilosis (0.0368), or
Candida krusei (0.0655), but that the nontranscribed spacer region is completely
divergent in all these species. We may obtain some idea of relatedness by compar-
ing the amino acid sequences of equivalent proteins from the two species. Some of
the available data are shown in Table 3.
We can note that abundantly produced proteins, such as those of glycolytic
enzymes, generally show a high degree of amino acid identity with S. cerevisiae
products. Also ribosomal protein sequences are particularly well conserved. Regu-
latory proteins sometimes have diverged considerably except for interspersed
conserved blocks (Salmeron and Johnston 1986; Jakobsen and Pelham 1991;
Oberye et al. 1993; Zenke et al. 1993). The cloning of K. lactis homologues is
therefore being used by an increasing number of yeast researchers to facilitate
assignment of functional domains.
The use of known S. cerevisiae gene probes to clone, by sequence homology, the
equivalent genes in K. lactis, or vice versa, is an obvious approach, but many S.
cerevisiae probes give rather weak hybridization signals on the Southern blots of K.
lactis genomic digests, because of dispersed homology of nucleotide sequences.
Table 3. Amino acid sequence identity of proteins between K. lactis and S. cerevisiae
Gene/product S. cerev. Function Amino and Reference

K.lactis identity, %
global/local>
KlACTl ACTl Actin 97 (31)

Kl533 533 Ribosomal protein 95 (28)
KIL25 L25 Ribosomal protein 93 (29)
KlL32 L32 Ribosomal protein 91 (30)
PR59 CRY 1 Ribosomal protein 95 (1)
KlADHl ADH1 Alcohol dehydrogenase 85 (35)
KlADH2 ADH1 Alcohol dehydrogenase 81 (2,35)
KlADH3 ADH3 Alcohol dehydrogenase 80 (35)
KlADH4 Alcohol dehydrogenase (34)
KlCYCl CYC1 Cytochrome c 89 (3,33)
KlAPA2 APA2 Bis 5(nucleosidyl)tetraphospatase 51 (38)
KlQCR7 QCR7 Respiratory complex III subunit 7 69 (38)
KlQCR8 QCR8 Respiratory complex III subunit 8 90 (4)
KlAAC2 AAC2 ADP/ATP translocator 89 (5)
KlLEU2 LEU2 IPM dehydrogenase 85 (6)
KlURA3 URA3 OMP decarboxylase 81 (7)
KlTUBl TUB1 Tubulin 78 (8)
KlTUB2 TUB2 Tubulin 77 (8)
KlPGK PGK Phosphoglycerate kinase 83 (9)
KlFP5 FP5 Farnesyl biphosphate synthase 74 (38)
KlGAP GAP Glyceraldehyde P dehydrogenase 82 (10)
KlIPP IPP Inorganic pyrophosphatase 83 (11)
KlPFK1 PFK1 Phosphofructokinase subunit 73 (12)
KlPFK2 PFK2 Phosphofructokinase subunit 70 (12)
KlTALl TAll Transaldolase 76 (41)
KlZWF ZWF Glucose-6-phosphate dehydrogenase 70 (40)
KlDLD DLD Dlactate-cytochrome c reductase 80 (13)
RAG2 PGI Phosphoglucose isomerase 86 (14)
RAG3 PDC2 Pyruvate decarboxylase regulator 50/70 (39)
Table 3 (contd.)
Gene/product S. cerev. Function Amino and Reference

K. lactis identity, %
globalllocaI"
RAGS HXK2 Hexokinase 73 (l5)

RAG1 LGTl Low-affinity glucose permease 68 (16)
KlMOL2 MOL2 Thiamine synthesis 60-65 (17)
KlHSP12 HSP12 Heat shock protein 59 (17)
KlTRPl TRP1 PRA isomerase 53 (11)
KEX1 KEX2 Processing protease 73 (18,32)
BiP KAR2 HSP family protein 77 (19)
KlHAP3 HAP3 Transcription factor 88 (21)
KlTFIIB TFIIB Transcription factor 67 (37)
KlGAL80 GAL80 Transcription factor 60/90 (25)
KlREBl REB1 DNA binding protein 40/82 (27)
KlGALIl GAL 11 Transcription factor 37 (26)
KlABF1 ABFl Transcription factor 28/75 (23)
LAC9 GAL4 Transcription factor 24/41-88 (22)
KlHAP2 HAP2 Transcription factor 19/94 (20)
KlSTE12 STE12 Transcription factor 10-20/78 (24)
"Conserved functionaI domain(s).

References: (l) Larson and Rossi 1991; (2) Shain et aI. 1992; (3) Clark-Walker 1991; (4)
Mulder et aI. 1994c; (5) Viola et aI. 1992; (6) Zhang et aI. 1992; (7) Shuster et aI. 1987; (8) B.
Zonneveld, pers. comm.; (9) Fournier et aI. 1990; (10) Shuster 1990; (11) Stark and Milner
1989; (l2) Heinisch et aI. 1993; (13) Lodi et aI. 1994; (l4) Wesolowski-Louvel et aI. 1988a;
(15) Prior et aI. 1993b; (16) Goffrini et aI. 1990 and Prior et aI. 1993a; (l7) D. WaIsh and P.
Meacock, pers. comm.; (I8) Tanguy-Rougeau et aI. 1988; (19) Lewis and Pelham 1990; (20)
Nguyen et aI. 1995; (21) Mulder et aI. 1994b; (22) SaImeron and Johnston 1986; (23)
Gons;alves et aI. 1992; (24) Yuan et aI. 1992; (25) Zenke et aI. 1993; (26) Mylin et aI. 1991; (27)
Morrow et aI. 1993; (28) Hoekstra et aI. 1992; (29) Bergkamp-Steffens et aI. 1992; (30) Eng
and Warner 1991; (31) Deshler et aI. 1989; (32) Tanguy-Rougeau 1991; (33) Freire Picos et
aI. 1993; (34) SaIiola et aI. 1991; (35) SaIiola et aI. 1990; (36) Chang and Dickson 1988; (37)
Na and Hampsey 1993; (38) Mulder et aI. 1994a; (39) Prior 1993; (40) Wesolowski-Louvel,
unpubl. data; (41) Jacoby et aI. 1993.
Such genes are expected to be better identified by colony hybridization of genomic

libraries in which specific DNA segments are amplified in individual colonies.
Alternatively, isolation of K. lactis homologues may be accomplished by
complementation of S. cerevisiae mutants. This strategy was successful even in
cases where interaction between homologous and heterologous protein compo-
nents was required for function (Eng and Warner 1991; Heinisch et al. 1993; Na
and Hampsey 1993). Several genes encoding transcriptional regulators also could
be cloned by complementation: GAL4 (Salmeron and Johnston 1986); REBl
(Morrow et al. 1993); CPFl (Mulder et al. 1994a); ABFl (Gon'falves et al. 1992;
Oberye et al. 1993); HSF (Jakobsen and Pelham 1991); GALll (Mylin et al. 1991);
HAP2 (Nguyen et al. 1995); HAP3 (Mulder et al. 1994b).
,.....
VI
o 2 3 4 o 2 3 4 o 2 3 4 o 2 3 4 N
I I I I I I I I
Phe UUU =-- Ser UCU ====:-- Tyr UAU=- Cys UGU ===-
UUC=- UCC=- UAC=- UGC=-
UCA= stop UAA= stop UGA ===-
Leu UUA ~~~~=-_
UUG :: UCG= stop UAG = - Tyr UGG
Leu CUU = Pro C C U = HisCAU= Arg CGU =

CUC= ccc~ CAC= CGC =-
CUA= CCA====- Gin CAA === CGA :::.
CUG=- CCG=- CAG= CGG ='
lie AUU ===- Thr ACU ===~ Asn AAU =- Ser AGU =-
AUC==- ACC=- AAC=- AGC=
AUA=- ACA~ Lys AAA =- Arg AGA =======--
Met AUG ACG= AAG=- AGG~
Val GUU ====- Ala GCU ====- Asp G A U = Gly GGU =====--
GUC=- GCC= GAC= GGC=-
GUA=- GCA= GluGAA===- GGA=
GUG= GCG=. GAG = GGG=.
Fig.6. Relative synonymous codon usage (RSCU) in K. lactis and S. cerevisiae. Adapted from the data by Lloyd and Sharp (1993). K. lactis and S.
cerevisiae are very similar in codon selection. The RSCU scale is shown at the top. Thick bars represents K. lactis and thin bars S. cerevisiae
~
~
(I),
e.
~
i5:
S
~
~
~
Table 4. Codon adaptation index (CAl) of K. lactis genes. (Based on data from Lloyd and
Sharp 1993)
Gene Product CAl
Ribosome RPL32 Ribosomal protein L32 0.90

RPL30 Ribosomal protein L30 0.87
CPY59 Ribosomal protein 59 0.78
RPS33 Ribosomal protein S33 0.63
Glycoslysis GAP1 Glyceraldehyde-phosphate dehydrogenase 0.77
ADH1 Alcohol dehydrogenase 0.74
PGK1 Phosphoglycerate kinase 0.73
RAG2 Phosphoglucose isomerase 0.54
RAG1 Glucose transporter 0.42
PFK1 Phosphofructokinase subunit a 0.33
FBP1 Fructose-1,6-bisphosphatase 0.32
PFK2 Phosphofructokinase subunit beta 0.30
Respiration CYC1 Cytochrome c 0.85
TAll Transaldolase 0.69
ZWF Glucose-6-phosphate dehydrogenase 0.22
GAL/LAC genes GAll ATP-galactose-1-phosphotransferase 0.30
GAllO UDP-galactose-4-epimerase 0.29
LAC12 Lactose permease 0.26
GAL7 Glactose-1-phosphate uridyltransferase 0.25
LAC4 beta-galactosidase 0.23
Regulation REB 1 DNA binding protein 0.21
SUA7 Transcription factor 0.17
GALlI Transcription Transcription factor 0.16
HSF Heat shock transcription factor 0.16
ABF1 ARS binding factor 0.15
RAG3 Pyruvate decarboxylase regulator 0.14
GAL80 Negative regulator of LAC9 0.11
LAC9 Positive regulator of LAC4/GAL genes 0.11
Others ACTl Actin 0.79
IPP Inorganic phosphatase 0.70
HHTl Histone H3 0.69
LEU2 beta-isopropylmalate dehydrogenase 0.47
KAR2 BiP/HSP70 homologue 0.45
URA3 Orotidine-5-phosphate decarboxylase 0.23
ERD2 ER protein retention receptor 0.22
TRP1 Anthranylate isomerase 0.19
KEX1 Serine protease 0.13
LETl Hydrogenase-like protein 0.10
Noncoding regions have widely diverged between S. cerevisiae and K. lactis;

only protein-binding sites seem to be conserved. At least there are potential bind-
ing sites for S. cerevisiae regulatory factors in a number of K. lactis genes: LEU2
(Zhang et al. 1992); CYCl (Freire Picos et al. 1993); GALl-GALlO (Webster and
Dickson 1988); GALBO (Zenke et al. 1993); QCR7 and QCRB (Mulder et al. 1994a,c);
PFK2 (Heinisch et al. 1993, and pers. comm.). In most cases, however, their nmc-
tional significance remains to be established.
The evidence that equivalent activators exist in K. lactis is supported by the fact
that most S. cerevisiae promoters that have been tested so far (see Table 6) also
proved to TImction in K. lactis. Among them are strong constitutive as well as
regulated ones, confirming the conservation of regulatory sequences. A case where
regulation of a S. cerevisiae gene was not maintained after transfer to K. lactis has
also been reported. The metal-inducible CUP 1 gene of S. cerevisiae is constitutively
expressed in K. lactis (Macreadie et al. 1991).
8.2
Codon Usage
Codon selection in K. lactis chromosomal genes has been reviewed by Lloyd and
Sharp (l993) on the basis of 47 available gene sequences. It appears that, in all
essential features, codon usage in K. lactis is very similar to that in S. cerevisiae
(Fig. 6). These authors concluded that mutational biases and abundances of par-
ticular tRNAs have not diverged between the two species. Highly expressed genes
have high codon usage bias (Table 4). We note that the single cytochrome c gene
of K.lactis has a very high codon usage bias (0.85), which might be related with the
aerobic nature of this species. In S. cerevisiae, the two cytochrome c (iso-l and iso-
2) genes have a CAl of 0.37 and 0.18 respectively (iso-l is usually about ten times
more abundant than iso-2).
9
Regulation of Carbon Metabolism
9.1
Lactose and Galactose Metabolism
One of the properties that distinguishes K. lactis from S. cerevisiae is the ability to
use lactose as a sole source of carbon and energy. Lactose degradation by cells or
purified enzymes has found a number of applications in the dairy industry. Large-
scale fermentation and enzyme preparation from K. lactis are therefore well-
established fields of activity.
Lactose metabolism is controlled by two linked genes, LAC4 and LACl2, encod-
ing f3-galactosidase (Dickson and Markin 1978; Dickson 1980; Poch et al. 1992) and
lactose permease (Chang and Dickson 1988), respectively. These genes, when
transferred to S. cerevisiae, were sufficient to allow growth on lactose (Sreekrishna
and Dickson 1985).
The lactose permease, which enables the cells to take up the chromogenic
glycoside S-bromo-4-chloro-3-indolyl-a-D-glucopyranoside (X-gal), allows an es-
timation of lacZ or LAC4 gene expression by plating on X-gal containing media.
Use of the E. coli lacZ reporter gene in gene expression studies, however, requires
lac4 mutant strains. lac4 point mutations, as well as disruption mutants, have been
reported (Sheetz and Dickson 1981; Das and Hollenberg 1982; Godecke et al. 1991).
The first genetic studies on lactose metabolism (Herman 1963; Herman and
Halvorson 1963a,b) identified two unlinked loci, LACl and LAC2, each of which
can exist as a recessive mutation in the natural population (Herman and
Halvorson 1963b). For example, NRRL Y-1l40 is lacl LAC2 and Y-l118 is LACI
lac2. Mating between such strains yielded meiotic lac1 lac2 segregants showing
reduced j3-galactosidase activity (Boze et al. 1987). It is not known to date how
these genes relate to the LAC genes that have been studied at the molecular level.
Major control of lactose metabolism occurs at the level of transcription of the
many genes involved in the process (Lacy and Dickson 1981). These genes include
LAC4 (Sheetz and Dickson 1981), LAC12 (Sreekrishna and Dickson 1985), LACS,
LAC8, LAC9 (Sheetz and Dickson 1980), LACIO (Dickson et al. 1981), and LACll
(Riley and Dickson 1984). LACS, LAC8, and LACll encode the enzymes of the
Leloir pathway of galactose metabolism and have been renamed GAL7, GALl 0, and
GALl, respectively, in accordance with the homologous S. cerevisiae genes (Riley
and Dickson 1984). These genes are coregulated with LAC4 and LAC12 at the
transcriptional level by the regulatory genes LAC9 and KIGAL80 (Webster and
Dickson 1988; Lacy and Dickson 1981; Wray et al. 1987; Zenke et al. 1993). LAC9 or
KIGAL4 encodes a transcriptional activator, the K. lactis equivalent of Gal4p (Witte
and Dickson 1990; Salmeron and Johnston 1986; Wray et al. 1987; Pan et al. 1990).
Lac9p function is regulated by the negative regulator Gal80p in essentially the
same way as Gal4p (Salmeron et al. 1989; Dickson et al. 1990; Zenke et al. 1993).
Mutant phenotypes suggested that KIGAL80 could be identical to the regulatory
gene LACIO (Dickson et al. 1981).
Lac9p-controlled promoters can be activated by Gal4p and vice versa (Salmeron
and Johnston 1986; Riley et al. 1987a), and both activators recognize the same
consensus sequence (Breunig and Kuger 1987). Thus, the widely used GALl-
GALl 0 promoter of S. cerevisiae is efficiently expressed and regulated in K. lactis.
Interestingly, the K. lactis genes GAL7, GALlO, and GALl are not only similarly
arranged, but the number and positioning of Lac9p binding sites in the
GALl-GALl 0 divergent promoter have also been conserved (Webster and Dickson
1988).
The regulon is induced by either lactose or galactose in the medium, resulting
in a So- to 2S0-fold activation of transcription (Dickson and Markin 1980; Dickson
and Barr 1983; Das et al. 1985; Webster and Dickson 1988; Breunig 1989b). Induc-
tion by lactose requires j3-galactosidase activity, indicating that activation ofLac9p
function requires galactose (Dickson and Barr 1983; Breunig, unpub.). Both sugars
can be taken up by the LAC12 gene product. Galactose, but not lactose, can also
enter the cells by (an)other carrier(s), but induction under these conditions is less
efficient (Riley et al. 1987b; Zachariae and Breunig, submitted). To inactivate the
156 M. Wesolowski-Louvel et aI.
Gal80p repressing function, the GALl gene product, galactokinase, is required

(Meyer et al. 1991; Meyer 1993; Zachariae and Breunig, submitted). By mutation, a
regulatory function is separable from the galactose phosphorylating activity and
some gall mutants are still inducible (Riley and Dickson 1984; Meyer et al. 1991;
Meyer 1993). In S. cerevisiae, the same regulatory function seems to be redun-
dantly contained within the GALl and GAB gene products (Meyer et al. 1991; Bhat
and Hopper 1992).
In contrast to S. cerevisiae, in which induction of the GALl-GALl 0 promoter
takes many hours when cells are shifted from glucose to galactose medium, induc-
tion in K. lactis is rapid, since glucose repression is not as tight (see below). In
addition, the promoter can be converted into a constitutive one, highly active even
on glucose, by disrupting the KlGAL80 gene (Zenke et al. 1993). In contrast, in a S.
cerevisiae gal80 mutant, this promoter is still largely repressed (Johnston and
Hopper 1982; Nehlin et al. 1991). There is some evidence that this difference is at
least partly due to the activator concentration, which, in glucose-grown cells of K.
lactis, seems to be higher than in S. cerevisiae (see below and discussion in Zenke
et al. 1993).
The LAC4-LAC12 divergent promoter is regulated in a similar way as the
GALl-GALlO promoter but its size of 2.6 kb pairs (Chang and Dickson 1988;
Godecke et al. 1991) makes it less suitable in cloning experiments. Truncated
versions have been used, but gave variable results possibly due to influences of
flanking sequences or genetic background (Das et al. 1985; Ruzzi et al. 1987; Fleer
et al. 1991b). In its chromosomal context, however, it was adopted for heterologous
gene expression and gave high-level production strains (Van den Berg et al. 1990).
By manipulating the expression of the LAC9 gene, the LAC4 promoter strength can
be varied (Kuger et al. 1990; Godecke et al. 1991; Zachariae and Breunig 1993;
Zachariae et al. 1993). This offers the possibility to adjust the rate of transcription
of heterologous genes according to their influence on cellular growth, alleviating
the need to change the promoter or growth conditions.
9.2
Glucose Repression of Lactose/Galactose Metabolism
Glucose repression on the lactose/galactose system in K. lac tis has already been
much discussed (for example, Tingle and Halvorson 1972; Ferrero et al. 1978). The
simultaneous presence of glucose and galactose in the medium can inhibit galac-
tose induction, but the preference for glucose over galactose utilization under
these conditions varies between strains (Breunig 1989b). In S. cerevisiae, this
phenomenon of glucose repression, which controls many metabolic processes, is
particularly pronounced and has been studied extensively. Experiments address-
ing the molecular basis of glucose repression of GAL gene expression in S.
cerevisiae suggested a complex regulation involving overlapping Gal4p-mediated
and Gal4p-independent mechanisms (Finley et al. 1990; Flick and Johnston 1990;
Lamphier and Ptashne 1992). The Gal4-dependent pathway seems to consist pri-
marily of a fivefold repression of GAL4 gene expression by glucose, mediated by
5. Kluyveromyces lartis 157
MIGl (Griggs a.nd Johnston 1991; NeWin et al. 1991). In K. lactis LAC9 gene
expression is controlled by autoregulation (Zachariae and Breunig 1993) and glu-
cose repression (Kuzhandaivelu et al. 1992; Zachariae et al. 1993), and thus Lac9p-
dependent and -independent mechanisms overlap already at the level of LAC9
gene expression.
Galactose induction and glucose repression are two counteracting processes,
and the efficiency of glucose repression crucially depends on the activity of Lac9p.
Any manipulations that increase Lac9p activity (like the ga180 mutation; Zenke et
al. 1993) or rate of synthesis (Zachariae et al. 1993) allow induction to overcome
the inhibitory effect of glucose. One cause for the differences in glucose repression
of LAC/GAL genes between strains is an allelic variation in the LAC9 promoter
which affects the rate of LAC9 expresson (Kuzhandaivelu et al. 1992; Zachariae et
al. 1993). When the stronger promoter variant was introduced into a glucose-
repressible strain, repression was alleviated (Kuzhandaivelu et al. 1992; Zachariae
et al. 1993).
However, even in the repressible strains, glucose repression is not very pro-
nounced. Genes that are tightly repressed by glucose in S. cerevisiae, like those
encoding invertase or respiratory functions, are only moderately affected in K.
lactis. A correlation between glucose sensitivity and glucose consumption exists
between different K. lactis strains and the rate of glucose consumption is generally
lower than in S. cerevisiae (Weirich 1992; Weirich et al. submitted), indicating
that the regulation of glucose uptake may be a crucial determinant of glucose
repression.
9.3
Regulation of Fermentation and Respiration
K. lactis is unable to grow anaerobically even on fermentable substrates. This

phenomenon has been attributed to a combination of different factors that result in
lowering of glycolytic flux under anaerobic conditions (or when respiration is
blocked by inhibitors; Barnett 1992). A major determinant that limits the glycolytic
flux seems to be the rate of sugar uptake. Some strains show a dependence on
respiration even for growth on glucose as indicated by the so-called Rag- pheno-
type (Rag means restistance to Antimycin A on glucose; Ferrero et a1. 1978; Goffrini
et al. 1989). A high variability with respect to glucose utilisation and ethanol
production rates between strains has been observed, and a correlation exists be-
tween low glucose consumption rates and the Rag- phenotype (Weirich 1992).
Natural Rag- variants have been identified as mutant alleles of an inducible
hexose transporter gene (RAGl) (Goffrini et a1. 1990; Chen et a1. 1992b; Wesolowsi-
Louvel et al. 1992a). Some 13 other complementation groups have been identified
by using the Rag- phenotype in screening for glycolysis mutants (Wesolowski-
Louvel et al. 1992b). One of these, RAG2, has been identified as the phosphoglucose
isomerase gene (Wesolowski-Louvel et al. 1988a; Goffrini et al. 1991). RAGS en-
codes a hexokinase which in K. lactis seems to be a unique enzyme that phospho-
rylates glucose and fructose (Prior et a1. 1993b). Some of these RAG genes interact
158 M. Wesolowski-Louvel et ai.
with each other. For example, the regulation of the expression of the RAGl gene
occurs at the level of transcription, and this transcription is under the control of
RAG4, RAGS, and RAG8 (Chen et al. 1992b; Wesolowski-Louvel et al. 1992b).
In contrast to S. cerevisiae, in which glycolysis mutants in general appear out of
condition, K. lactis mutants appear in much better shape, probably because the
cells can efficiently metabolize glucose through the pentose-phosphate pathway
(Heinisch et al. 1993). In line with this, growth on glucose of mutants lacking
phosphofructokinase activity was abolished when the transaldolase or the
transketolase genes were mutated (Jacoby et al. 1993). Most of the known glycoly-
sis mutants grow normally on respiratory substrates.
In contrast, respiratory-deficient mutants, isolated as small colonies on 2%
glycerol/O.l % glucose agar plates (Herman and Griffin 1968; Del Guidice and
Puglisi 1974) or obtained by gene disruption (Mulder et al. 1994c,d) often showed
reduced growth rates even on glucose media.
These findings emphasize the role of oxidative metabolism which in K. lactis
plays a more important role in glucose/fructose assimilation than in S. cerevisiae.
The molecular basis for this difference is not yet clear. However, the variability
between K. lactis strains with respect to this phenotype, which ranges from largely
fermentative to largely oxidative glucose metabolism, offers an experimental ap-
proach to address this point.
It was recently shown that JA6, a fermentative strain with high glucose con-
sumption and ethanol production rates, contains a hexose transporter gene,
KHT2, not present in other strains (Weirich et al., submitted). Like the low-affinity
transporter gene RAGl, it belongs to the family of HXT genes of S. cerevisiae.
(Bisson et al. 1993) and is located right downstream of RAGl. Southern analysis of
different strains using RAGl- and KHT2-specific probes revealed a high heteroge-
neity at that locus, but the rate of glucose consumption was not strictly correlated
with the absence or presence of the KHT2 gene (K. Breunig, unpubl. data).
Deletion of either one or both of these transporter genes leads to only a mar-
ginal reduction in the growth rate, indicating that at least one additional glucose
carrier exists. A gene for a potential high-affinity glucose carrier has been isolated
(Menart and M. Wesolowski-Louvel, unpubl.). However, the hexose transporter
mutant phenotypes in K. lactis indicate that there is a much lower redundancy in
transporter genes than in S. cerevisiae (reviewed by Bisson et al. 1993).
Interestingly, mutants with reduced sugar uptake have been obtained as sup-
pressors of a Klggsl mutant (Luyten et al. 1993). The GGSl gene of S. cerevisiae
encodes a subunit of the trehalose-6-phosphate synthase/phosphatase complex
(Bell et al. 1992; Van Aelst et al. 1993). Its mutant phenotype is similar to that of S.
cerevisiae, showing growth inhibition by glucose and fructose and absence of all
glucose-induced effects (Van Aelst et al. 1993). Thus, in both yeasts, trehalose
metabolism seems to be involved in the control of glucose effects.
As mentioned above, the respiratory system in K. lactis does not seem to be
glucose-repressed, at least not to the same extent as in S. cerevisiae, in line with its
role during growth on fermentable carbon sources. The same is true for alcohol
dehydrogenase. Four ADH genes (KIADHI to KIADH4; Saliola et al. 1990, 1991;
s. Kluyveromyces lactis 159
Shain et al. 1992) have been isolated, none of which was glucose-repressed to an
extent similar to the ADH2 gene of S. cerevisiae. Two of the enzymes, the products
of KlADH3 and KlADH4 genes, are probably associated with mitochondria. The
KlADH4 promoter has a new feature not yet found for S. cerevisiae genes: it is
induced by ethanol.
In S. cerevisiae, many enzymes of the respiratory system are under the control
of the HAP2/HAP3/HAP4 regulatory complex. K. lactis possesses all the compo-
nents of the complex which are capable of complementing the corresponding hap
mutations of S. cerevisiae. Nevertheless, mutations of these genes do not seem to
seriously affect the respiratory system of normal K. lactis strains, illustrating the
difference for major energetic metabolism between these two species (Mulder et al.
1994b; Nguyen et al. 1995) in regulatory circuitry.
The interaction between respiratory and fermentative pathways is perhaps one
of the key features that distinguishes K. lactis from S. cerevisiae. An explanation for
this at the molecular level is an interesting challenge.
10
Mitochondria
10.1
Mitochondrial Mutations
The well-known cytoplasmic petite colony mutants of S. cerevisiae are respiratory-

deficient. These mutants (also called rho- mutants) arise spontaneously, at an
extremely high frequency, as a result of large deletion or complete loss of mito-
chondrial DNA. It is not known why S. cerevisiae has such an unstable mitochon-
drial genome. Known as a "petite-negative yeast" (Bulder 1963, 1964a,b), K. lactis
does not produce rho- type deletions of mitochondrial DNA. Only recently, strains
producing rho- mutants have been isolated from K. lactis. These mutants were
obtained from strains which happened to contain a specific nuclear mutation
called mgi (Hardy et al. 1989; Maleszka and Clark-Walker 1989; Chen and
Clark-Walker 1993). It therefore appears that the petite negativeness is associated
with the allelic status of a few nuclear genes. A similar situation had been reported
for Schizosacharomyces pombe, another petite-negative yeast (Haffter and Fox
1992; Massardo et al. 1994). The nature of these nuclear genes is not known at
present.
K. lactis is sensitive to various mitochondria-specific inhibitors, typically,
erythromycin, chloramphenicol, oligomycin, and antimycin A. These antibiotics
efficiently inhibit the growth of K. lactis on respiratory substrates (Zennaro et al.
1977). Response to chloramphenicol seems to be somewhat variable, depending on
the strain, and tends to show clonal variation of sensitivity. K. lactis has been
reported to be much more resistant to antimycin A than is S. cerevisiae (Brunner
et al. 1987), but a concentration of 5-10 11M is still sufficient to block mitochondrial
complex III function. Several mitochondrial markers have been described which
confer resistance to erythromycin (Algeri et al. 1977; Del Giudice and Brunner
1977), oligomycin (Brunner et al. 1977; Brunner and Tuena de Cobos 1980) and
antimycin A (Brunner et al. 1987; Coria et al. 1989). Spontaneous clones resistant
to erythromycin (4mg/ml) or oligomycin (3.ug/ml) can be readily obtained after
prolonged culture on the drug-containing plates, but many of them are highly
unstable and revert when transferred to drug-free media. In a case of oligomycin
resistance, Ragnini and Fukuhara (1989) found that the unstable resistance was
due to the amplification of a specific segment of mitochondrial DNA, and that the
amplified segment can be maintained only in the presence of the drug.
Cycloheximide is a specific inhibitor of cytoplasmic protein synthesis in S.
cerevisiae, whilst erythromycin specifically blocks mitochondrial protein synthe-
sis. K. lactis, like many petite-negative yeasts, is resistant to cycloheximide (van
der Walt 1970). Thus there is a need for a specific inhibitor of cytoplasmic protein
synthesis when one wishes to distinguish mitochondrial from cytoplasmic protein
synthesis. Trichodermin (Leo Pharmaceuticals Co. Ltd.; reviewed by Vasquez
1979) has been reported to be an efficient inhibitor of cytoplasmic protein synthe-
sis in this yeast (Marmiroli et al. 1979). Unfortunately, this drug is not commer-
cially available. Trichodermin-resistant mutants are not known in K. lactis.
10.2
Mitochondrial DNA
Mitochondrial DNA amounts to almost 10% of the total cellular DNA, suggesting
an average copy number of about 30 per cell. The molecule is circular (Sanders et
al.1974), about 39kbp long (Wesolowski et al. 1981). Restriction sites and the map
positions of major genes are known (Fig. 7; Hardy et al. 1989; Wilson et al. 1989;
Skelly et al. 1991). Some polymorphic rearrangements of sequences have been
noted, including a large translocation of a segment in one strain (Brunner and
Coria 1989; Skelly et al. 1991).
The gene sequence data from K. lac tis mitochondrial DNA are still fragmentary.
Genes for cytochrome oxidase subunit 1 (Hardy et al. 1989), subunit 2 (Hardy and
Clark-Walker 1990), and apocytochrome b gene (Brunner and Coria 1989) have
been sequenced. According to these results and the tRNA gene analysis (Hardy and
Clark-Walker 1989; Wilson et al. 1989), the mitochondrial genetic code in K. lactis
appears to be very similar to that of S. cerevisiae. Neither the CUN codon nor its
corresponding tRNA gene (thr2 of S. cerevisiae) were found so far. CGN codons
were found only in the introns of the cytochrome oxidase subunit 1 gene, but their
corresponding tRNA gene (arg2 of S. cerevisiae) has not been identified. ATA
(supposed methionine codon) are rarely used, but, in the cytochrome oxidase
subunit 1 introns, it is much more frequent than ATG. Twenty-two tRNA genes out
of the probable 24 have been mapped and sequenced. On average, there are about
ten nucleotide changes per tRNA with respect to S. cerevisiae counterparts.
Mitochondrial coding sequences are generally well conserved in the yeast spe-
cies so far examined. The high adenine-thymine content (more than 80%) in these
mitochondrial DNAs is reflected by the exceedingly high frequency of A and T at
the third position of codons. Hybridization probes made of S. cerevisiae and K.
lactis mitochondrial genes have been conveniently used in the mapping studies of
o 5 10 15 20 25 30 35
I I I I I I I I
kbp
Sp
K
H
I Y I sa
As
I I
COXl ATP6+8 CYT1! ATP9 COX3 COX2 COXI
EJ Q 0 D c==J c=J c:::7
••
thr2 glu
•
Up cys pro
... ... ....
leu Iys gly asp his
.... -
tyr ala ser1
fmet phe gin .rg1 ser2 mmet asn ile
Fig. 7. Genetic and physical map of K. lactis mitochondrial DNA. The strain is 2360/7 (a
lysAI clone of CBS 2360). The map is circular, 39 kbp long. Restriction sites are Sp (Spe!), H
(HindIII), B (BglII), As (AsuIII), Sm (Sma!), K (KpnI). The hatched boxes indicate the limits
of the gene location. COXI, 2, and 3 are the genes for cytochrome oxidase subunits 1,2, and
3, respectively. ATP 6,8, and 9 code for the subunits 6, 8, and 9 of the mitochondrial ATPase.
CYTB is cytochrome b gene. tRNA genes (dots) are represented by corresponding single-
letter amino acid names. The major transfer RNA gene regions are enlarged to show the
detail. This map is based on the data by Ragnini and Fukuhara (1988), Wilson et al. (1989),
and Coria et al. (1990). The map ofWM37 (isomitochondrial to NRRL Y-1140; Coria et al.
1990) is very similar to NRRL Y-1205, except for the presence of an additional AvaI site. An
insertion of about 1250 bp to the right of the ATP9 gene was found in the strain W600B
(Coria et al. 1990). The map from WM27 (isomitochondrial to NRRL Y-1118) appears to
deviate considerably from the above map, with a translocation of ATP9 gene (Coria et al.
1990). All the genes so far known are transcribed from left to right
many other yeasts, including the species of Pichia, Williopsis, Kluyveromyces,

Yarrowia, and Candida, generally giving unambiguous hybridization signals
(Fukuhara et al. 1993), but some Candida species show considerable divergence of
gene sequences. Introns have been found in the large ribosomal subunit RNA gene
(homologous to the ill sequence of S. cerevisiae; Jacquier and Dujon 1983; Wilson
and Fukuhara 1991) and in the cytochrome oxidase subunit 1 gene (Hardy and
Clark-Walker 1991), but not in the apocytochrome b gene (Brunner and Coria
1989). The ribosomal ill intron of K. lactis does not carry the endonuclease gene
present in the S. cerevisiae ill element.
A nonanucleotide sequence, (AfT) TATAAGTA, or its variants, is present at the
head of the transcription units in S. cerevisiae mitochondrial DNA. This motif is
recognized by the unique RNA polymerase of the mitochondria. The last A of the
motif is the starting A of the primary transcript. This signal appears to be also used
by K. lactis mitochondrial transcription system (Osinga et al. 1982), as well as by
the mitochondria of several species from Williopsis and Pichia (Dinouel et al.
1993). Numerous GC-rich clusters that are potential recombinational hot spots are
characteristically present in both K. lac tis and S. cerevisiae mitochondrial DNAs
(Ragnini and Fukuhara 1988), but not in the mitochondrial DNA of K. marxianus
strains.
11
A Few Notes on Biochemical Procedures
11.1
Cell Mass Determination
The yeast cell density is most conveniently determined by absorbance in a spectro-

photometer. However, this "absorbance", including light dispersion, can vary
severalfold, depending on the internal geometry of each photometer. For a given
absorbance value, K. lactis represents about twice as many cells as S. cerevisiae,
reflecting the difference of cell size. As an indicative value, an absorbance of 1 at
600nm, in a Zeiss M4QIII spectrophotometer in the standard 4-mI cuvette with 1-
cm optical path, corresponds to a cell density of about 1.4 x 107 per mi. There exist
floculating strains, which are unpractical for density determination or quantitative
plating, but they are infrequent, as far as we know.
11.2
Cell Extracts for Preparation of Nucleic Acids
11.2.1
Nucleic Acids Prepared from Spheroplasts
Spheroplasting is the preferred procedure to prepare nucleic acids. As mentioned

above, K. lactis cells are more sensitive to Zymolyase or Glusulase than S. cerevisiae
cells. The amount of enzyme and the digestion time required for spheroplasting
vary considerably, depending on the strain, but care should be taken to avoid
spontaneous lysis due to overdigestion. Sorbitol is most often used as an osmotic
stabilizer at a concentration of 1.2 M. Some investigators prefer 1.5 M (Sreekrishna
et al. 1984). KCI at 0.6M has also been used (Gunge et al. 1981).
Basically, the spheroplasting techniques are similar to those used for S.
cerevisiae. Because of the fragility of spheroplasts, addition of 0.1 % bovin serum
albumin in the buffers is recommended to protect against traces of detergents. A
very dense suspension of aerobic yeast cells often quickly turns acidic during
spheroplasting and blocks the cell wall digestion. It is important to maintain the
initial pH with occasional addition of NaOH.
11.2.2
Nucleic Acids Prepared by Mechanical Extraction
Rapid mechanical procedures are sometimes convenient, for example, for the
preparation of RNA. Mechanical disruption of K. lactis cells raises no particular
problems with respect to S. cerevisiae. A Braun homogenizer (Melsungen,
Germany) at full setting releases about the same fraction (say 50%) of cellular
proteins under the conditions applied for S. cerevisiae. An example of mechanical
disruption, on a relatively large scale, is given below.
About 109 (wet weight) of a washed cell pellet (about 11 of early stationary
phase culture) are suspended in an appropriate buffer to a final volume of 40 ml in
a Braun bottle; 20g of glass beads (diameter O.5mm, Braun) are added, and the
mixture is cooled to ice-water temperature. Cells are disrupted for 30 s at the top
setting, and the bottle is immediately returned to the ice-water bath. The extract is
separated from beads by decantation. Examples of suggested disruption buffers
are (1) 50mM Tris-HCl, pH 8, 5mM EDTA for DNA preparation, (2) 50mM Tris-
HCl pH7.2/150mM NaCl/lOmM EDTA, optionally including 1% sodium
thioglycolate and 1/10 volume of boiled 1% macaloid suspension (Faye et al. 1974)
for RNA preparation.
11.3
Small-Scale Preparation of DNA
The procedure is based on that of Sherman et al. (1982) for S. cerevisiae.

1. Grow cells in 2 ml glucose complete medium. Collect cells by centrifugation and
suspend them in 0.25ml of 1M sorbitol plus 0.05ml of20mM EDTA, pH 7.5.
2. Transfer the cells to a 1.5-ml microfuge tube, add 0.01 ml of Zymolyase lOOT
(stock 2.5mg/ml) and incubate at 3]OC for 6Omin.
3. Spin the tube in a microfuge for 1 min, resuspend cells in 0.25 ml of 50 mM Tris
pH 7.4 120mM EDTA. Add 0.025ml of 10% sodium dodecylsulfate, mix well.
Incubate the mixture at 65°C for 30 min.
4. Add 0.1 ml of 5 M potassium acetate and place the tube in ice for 30 min. Spin for
5 min. Transfer the supernatant to a fresh tube and add 1 vol isopropanol at
room temperature. Mix and leave at room temperature for 5 min.
5. Spin lOs, pour off the supernatant, air dry the pellet.
6. Dissolve the pellet in 0.I5ml of TE (lOmM Tris, pH 8, ImM EDTA). Add
0.OI5ml of 3M sodium acetate, mix and precipitate DNA with O.Iml of
isopropanol. Spin briefly to pellet DNA. Pour off the supernatant, dry and
dissolve DNA in 40,ul ofTE, pH 8. Use 5,ul of the preparation for a restriction
digest.
11.4
Large-Scale Preparation of Nuclear and Mitochondrial DNA
The guanine-cytosine contents of nuclear and mitochondrial DNAs are close to

those of S.cerevisiae. These DNAs can be easily separated by density gradient
centrifugation in CsCl in the presence of intercalating dyes according to the vari-
ous protocols described for S. cerevisiae. The following is an example.
1. Phenol-treated, ethanol-precipitated total DNA (obtained either by pro-

top lasting or by mechanical disruption from 11 culture) is dissolved in 9 ml of
Tris-EDTA buffer (above) and mixed with 9.0 g of CsCl. 0.1 ml ofbisbenzimide
(Hoechst 33258, stock solution lOmglml water) is added. This fills just two
sealable tubes for the VTi65 vertical rotor of the Beckman centrifuge.
2. Spin overnight at 55000rpm, the upper band (mitochondrial DNA) and the
lower band (nuclear DNA), detected by lateral ultraviolet illumination,
are separately collected and diluted with a fresh CsCI-dye solution and recentri-
fuged.
3. The collected DNA is concentrated by dialysis against polyethyleneglycol pow-
der (Merck, PEG 6000). DNA is then dialyzed against 1 mM Tris-HCl pH 8/
0.1 mM EDTA. This dilute buffer allows reconcentration of the DNA solution by
evaporation in a vacuum centrifuge.
At this stage, each DNA is considered to be pure enough for restriction enzyme
analysis and for most hybridization studies, except that polysaccharides are often
visibly present. For DNA reassociation studies involving optical measurements,
DNA should be purified by published specific procedures involving hydroxyapa-
tite chromatography (Price et al. 1978; Kurtzman et al. 1980) which give more
fragmented, but optically purer material.
11.5
Cell Disruption for Enzyme Assays
11.5.1
Disruption by Braun Homogenizer
Cells from 100 ml culture (about 108 cells/ml, A600 of 6-10 in Zeiss photometer) are
pelleted and washed once with water and once with 0.1 M Tris-HCl pH 7.5. The
pellet is resuspended in 1 vol. of the same buffer and 1 vol. of glass beads.
Cells are disrupted for 1.5 min at top speed in a cooled Braun homogenizer
equipped with an adapter for 1.5-ml Eppendorf tubes. The supernatant is collected
by decantation, and the glass pellet is rinsed twice with 1/4 of the initial volume of
buffer.
The supernatant and washes are mixed and centrifuged at 3000 rpm for 10min at
4 cC. The pellet is washed with 1/2 volume of buffer.
The pooled supernatants give a protein concentration of about 30mg/ml.
11.5.2
Disruption by Vortexing
Alternatively, the cells, mixed with glass beads as above, can be disrupted by
vortexing four times 30 s at top speed, with periods of 1 min on ice in between.
Extraction efficiency appears to be comparable to the first method.
5. Ktuyveromyces tactis 165
11.5.3
Permeabilized Cells
Some enzymes such as fi-galactosidase or invertase can be directly assayed on

whole cells permeabilized with toluene. The case of fi-galactosidase measurement
is given as an example.
f3-galactosidase assay is performed according to the method described by Miller
(1972). The colorless substrate o-nitrophenyl-fi-D-galactoside (ONPG) is hydro-
lyzed into galactose and yellow O-nitrophenol absorbing at 420 nm.
1. Cells from 1 ml of culture are collected by centrifugation (5 min, 4000 rpm) at
room temperature. The pellet is suspended in 1 ml of Z buffer and 30 III of
toluene.
2. Vortex at top speed for 15 s. Then incubate the tubes, with the top open, for
30min at 37°C with shaking to allow toluene evaporation; 20-200,ul of
permeabilized cells are added to Z buffer (final volume of 1 ml).
3. After 5 min at 28°C to equilibrate temperature, the reaction is started by the
addition of 200,ul of ONPG.The reaction is stopped by adding 0.5ml of 1M
Na2C03 solution. Record the time of the reaction.
4. Remove cells by a 5-min centrifugation. The absorbance at 420 nm is deter-
mined on the yellow supernatant. The enzyme activity may be expressed as
nanomoles of o-nitrophenol produced per min per A600 unit of cells (roughly 108
cells). One nmol!ml of o-nitrophenol gives A420 of 0.0045 with a 1 cm light-path
cuvette.
In this fi-galactosidase assay, the use of chloroform (50 J.Ll) and sodium
dodecylsulfate (0.0025%), instead of toluene, avoids the evaporation step.
Reagents.
Z buffer: 0.06M Na2HPOi 0.04M NaH 2POi O.OIM KCl! O.OOIM MgSOi 0.05M
mercaptoethanol-2, pH 7.0.
ONPG stock solution: 4mg/ml in 0.1 M Na phosphate buffer, pH 7.0.
11.6
Gene Fusions
To study the transcriptional regulation of a gene, the E.coli f3-galactosidase gene

lacZ has been frequently used in S. cerevisiae. The upstream regulatory sequence of
a gene is fused with the lacZ coding sequence. This constitutes a convenient system
to monitor the response of the regulatory element(s) to various experimental
conditions. Since K. lac tis has its own fi-galactosidase, the lacZ system can only be
used in the fi-galactosidase-deficient mutant hosts such as the lac4 mutants de-
scribed before. As an alternative, another gene fusion system has been developed
that can be applied to K. lactis and S. cerevisiae. The kanamycin resistance gene
Km R from the bacterial transposon Tn903 confers resistance to the antibiotic G418
pSK-kan401 (phase 1)
EcoRI Sacl Kpnl BamHI (SallJXhol) 8th codon
GAATTCGAGCTCGGTACCCGGGGATCC TCTAGAGTCGAGGCCGCGATTAAATTCCAAC ATG GAT ••• KIn'
pSK-kan 1105 (phase 2)

EcoRI Sacl Kpnl BamHI (SallJXhol) 8th
GAATTCGAGCTCGGTACCCGGGGATCCTCGAGCGATccTCTAGAGTCGAGGCCGCGATTAAATTCCAAC ATG •••
pSK-kan 1238 (phase 3)

EcoRI Sacl Kpnl BamHI (SallJXhol) 8th
GAATTCGAGCTCGGTACCCGGGGATCCaCGATCCTCTAGAGTCGAGGCGCGATTAAATTCCAAC ATG •• ,
Fig. 8. KmR gene fusion as a reporter system. 3-'aminoglycoside phosphotransferase of the

transposon Tn903 confers resistance to Kanamycin in bacteria and resistance to G418 on
yeast. N-terminal amino acids of this enzyme are nonessential for activity, and the second
ATG, at 8th codon, can be used as initiator codon. Thus the gene can easily be fused to a
promoter-carrying sequence. Such a fusion system with dominant selection is of particular
interest for the gene studies in nonconventional species which often have no genetic mark-
ers. The three vectors allow fusing, in all three reading frames, of the promoter-less KmR
gene with a promoter-containing sequence of interest. The unique cloning sites before the
KmR sequence are BamHI, Sac!, and KpnI. The plasrnids contain the URA3 marker, as well
as both pKDl (SII fragment, 0.9 kbp) and 2-,u origins of replication to allow transformation
of K. lactis and S. cerevisiae. The sequences in bold type are common to all three vectors
on a wide range of yeast cells. Since several codons at the N-terminus of the KmR
gene are dispensable for the 3'-aminoglycoside phosphotransferase activity, this
part is deleted and replaced by cloning sites. Various transcriptional regulatory
elements can be introduced at these sites. Vectors carrying such cloning sites have
been constructed which allow KmR fusion in three reading frames (Fig. 8). Practical
information on the use of the KmR system is given at the end of Sect. 14.
11.7
DNA-Binding Studies
For the analysis of K. lactis DNA-binding proteins, protocols established for S.
cerevisiae are generally applicable. The following method (Breunig and Kuger
1987; Zachariae et al. 1993) worked well for the detection of Lac9 and other DNA-
binding factors.
1. 75 ~oo units of cells were harvested at 4°C, washed once with ice-cold TMEGA
buffer (0.2M Tris/HCl pH7.8, O.3M (NH4)2S04' IOmM EDTA, 1 mM DTT, 10%
glycerol), resuspended in OAml of the same buffer containing 1 mM PM SF,
4,uM Pepstatin, 4,uM Leupeptin, and 14,uglml Aprotinin, and broken with glass
beads as described above.
2. After centrifugation, 200,ul of the supernatant were centrifuged for 1 h at
100000 g in a Beckman TLA 45 rotor.
3. The supernatant (SIOO) with a protein concentration of 25 to 15mglml was
frozen in aliquots in liquid nitrogen and can be stored for a year or more.
5. Kluyveromyces locfis 167
4. The SlOO can either be used directly in electophoretic mobility shift assays or
subjected to heparin-Sepharose affinity chromatography according to standard
protocols.
The low-abundant transcription factor Lac9 was detectable in the SlOO when the
ratio of protein to nonspecific competitor DNA (sonicated calfthymus DNA
worked well for Lac9, but poly[dldC] may be preferable for other DNA-binding
proteins) was carefully titrated for each extract. Protease activity is certainly a
problem in these extracts as in S. cerevisiae. A protease A gene has been cloned
from K. lactis by Chiron Corp. but the difference in protease activity between a
wild-type and a disruption mutant was not as pronounced as for the S. cerevisiae
pep4 mutant.
12
Plasm ids
12.1
Circular Plasm ids
Vectors derived from the 2-/1 plasmid of S. cerevisiae can transform K. lactis
strains, but are very unstable, requiring a selective pressure to be maintained. A
replicating vector system specific for K. lactis has become available. This system
FormA
Pstl
Form B
PstI
Fig. 9. Isomeric forms of the plasmid pKDl. pKD1, 4757bp long, has three open reading
frames. A is a recombinase gene analogous to the FLP gene of 2-J1, mediating the inversion
of DNA segments between the two IRs. Band C are believed to be required for proper
partition of the plasmid. IRs are inverted repeats 346 base pairs long. ORI is the region
containing the autonomous replication function. A locus, cis-acting on ORI, and required
for stable maintenance of the plasmid is probably located near the BeoRI site. By conven-
tion, the nucleotide numbering begins at the BeoRI site and goes clockwise on the B form
(Chen et al. 1988; Wesolowski-Louvel at al. 1990) is based on the plasmid pKDl
isolated from the strain UCD 51-130 (CBS 2105); (Chen et al. 1986; Falcone et al.
1986). The latter strain was formerly called K. drosophilarum (hence the name
pKD1), but is now classified as K. lactis. pKDl (Fig. 9) belongs to the 2-/1 family
plasmids sharing the same type of gene organization, although there is little ho-
mology of nucleotide sequence. The host range is also quite different. By genetic
crosses, pKDl plasmid has been propagated to other strains of K. lactis, thus
creating a series of cir+ transformation host strains. Analysis of individual func-
tional elements of pKDl has been described by Bianchi et al. (1987, 1989, 1991) and
Bianchi (1992). The only other circular plasmid known among the strains of the
genus Kluyveromyces is pKWI (Chen et al. 1992a) found in Kluyveromyces waltii
CBS 6430. This plasmid does not replicate in K. lactis.
12.2
Linear DNA Plasm ids and the Killer System
This subject has been reviewed by Gunge (1986), Gunge and Kitada (1988), Volkert
et al. (1989), and Stark et al. (1990).
The linear DNA plasmids pGKLl and pGKL2 were first found in K. lactis IFO
1267 (NRRL Y-1l40, CBS 2359; Gunge et al. 1981). The two plasmids are present as
a pair in the cell and confer the killer phenotype. Very similar, if not identical,
plasmids were also present in four other K. lactis isolates (CBS 1065, pKL2A, and
2B; CBS 5618, pKL3A, and 3B; CBS 8043, pKL4A, and 4B; NRRL Y-l115, pKL5A,
and 5B). The gene organization of the pGKL plasmids is shown in Fig. 10.
pGKLl is a 8.8-kbp double-stranded DNA carrying the genes coding for the
killer toxin subunit proteins. The toxin kills sensitive cells of various yeast species.
When the killer strain is cured of the pGKLl plasmid, it loses the killer character
and becomes sensitive to the toxin. Most K. lactis strains are sensitive to the toxin,
but a few strains are resistant, due to the presence of Mendelian determinants. The
toxin, secreted into the medium, is a large protein made up of three subunits.
During the secretion process, the precursor proteins are shortened by endopepti-
dases into mature proteins. One of the processing proteases has been identified as
Kexl (Wesolowski-Louvel et al. 1988b; Tanguy-Rougeau et al. 1988), whose known
target is a lysine-arginine dipeptide sequence. Kexl is an equivalent of S. cerevisiae
Kex2 peptidase, which is required for the processing of the dsRNA-dependent
killer toxin and of the mating factor a. However, K. lactis kexl mutants of mating
type a are not defective for mating.
The N-terminal signal peptides from pGKLl ORF2 and ORF4 have been used to
direct the secretion of foreign proteins from K.lactis (Baldari et al. 1987; Tokunaga
et al. 1988).
pGKL2 has been sequenced by Tommasino et al. (1988). This plasmid, 13.4kbp
long, is necessary for the maintenance of pGKLl. Nonkiller mutants are available
in which pGKLl only or both plasmids had been lost. Both pGKLl and pGKL2 have
inverted terminal repeats (Sor et al. 1983) whose 5' ends have a covalently attached
o 5 10 kbp
I I I I
I
Toxin subunits n, ~, 'Y
IR DNA polymerase ~ a ) 13 ~~lm--m--un"'T.I-'Y""1 pGKL 1

ORFl ORF2 ORF3 ORF4 IR
TRFl
IR
[X DNA polymerase K I
Helicase ) ( ) RNA polymerase
"--_ _.L.- - - '
~IR pGKL2
ORFl ORF2 ORF3 ORF4 ORFS ORF6
ORF8 ORF10
Fig. 10. Structure of the killer plasmids pGKLl and pGKL2. This schematic representation
is based on the following sources: Wesolowski et al. 1982b; Stark et al. 1984; Sugisaki et al.
1985; Hishinuma et al. 1984, 1986; Stark and Boyd 1986; Sor and Fukuhara 1985; Jung et al.
1987; Fukuhara 1987; Tokunaga et al. 1987, 1989; Tommasino et al. 1988; Stark 1988; Wilson
and Meacock 1988; Gorbalenya et al. 1989; Tommasino 1991; McNeel and Tamaoki 1991;
Schaffrath et al. 1992; Soond and Meacock, pers. comm.; Wesolowski-Louvel et al. 1988b.
Known or putative functions of the plasmid elements are the following: pGKLl genes. ORFI
DNA polymerase; ORF2 a (chitinase) and f3 subunits of toxin; ORF3 determinant of immu-
nity to toxin; ORF4 toxin subunit y (G I-arrest toxin); IR left and right terminal inverted
repeats, 202 bp long; TP terminal protein, about 28 kDa. pGKL2 genes. ORFI Dispensable for
plasmid maintenance; ORF2 DNA polymerase; ORF4 DNA-dependent ATPase/helicase;
ORF6 RNA polymerase; ORFlO terminal region recognition factor (TRF1); IR left and right
terminal inverted repeats, 184 bp long; TP terminal protein, about 36 kDa
protein (Kikuchi et al. 1984; Starn et al. 1986). Replication is probably initiated by
these terminal proteins, very much as in the case of the bacteriophage $29 (Kikuchi
et al. 1985; Kitada and Gunge 1988; Wesolowski-Louvel and Fukuhara 1990). This
cytoplasmic killer system appears to function with its own transcription machin-
ery to express plasmid genes (Romanos and Boyd 1988). One of the pGKL2-borne
genes (ORF6) is thought to encode an RNA polymerase. Interestingly, host genes
cannot be expressed on these plasmids unless their promoters are replaced by the
plasmid-specific promoter signals. The killing mechanism is not known, but ap-
pears to be distinct from that of the dsRNA killer system of S. cerevisiae. A few
hypotheses have been proposed for the nature of the toxin (Sugisaki et al. 1983,
1984; White et al. 1989; Bradshaw 1990; Butler et al. 1991). The killer character does
not seem to be a barrier to mating with sensitive partners. In such crosses, practi-
cally all the progeny of the cross will have the killer plasmids, showing a typical
pattern of cytoplasmic inheritance.
Two point mutations are known which occurred in the ORF2 of pGKLl plasmid.
Existence of recombination between pGKLl DNAs has been demonstrated by the
use of these mutations (Wesolowski et al. 1982c). Two important questions, that is,
copy number control and mitotic partition mechanism of the linear plasmids, still
remain entirely open.
pGKL plasmids have been transferred to S. cerevisiae, in which they replicated

stably (Gunge and Sakaguchi 1981; Gunge et al. 1982; Fujimura et al. 1987; Gunge
et al. 1990). For unknown reasons, only the rho- strains of S. cerevisiae were found
to be compatible with this replication (Gunge and Yamane 1984). pGKL plasmids
have also been stably transferred to Kluyveromyces marxianus strains (previously
classified as K. fragilis and Candida pseudotropicalis; Sugisaki et al. 1985).
A DNA segment isolated from the killer plasmid was shown to contain an ARS
activity (Thompson and Oliver 1986; Trueman et al. 1990). This activity might be
fortuitous, but explains why the first K. lactis transformants obtained by pGKLl
derivatives (de Louvencourt et al. 1983) contained only circularized killer plas-
mids. Probably their replication relied on this ARS activity (see Sect. 14, Vector
Systems).
12.3
RNA Plasm ids
RNA plasmids have not been found so far in K. lactis strains. Among 150 strains
examined in the Kluyveromyces genus, only one strain of K. aestuarii and two
strains of K. waltii contained what appears to be a dsRNA plasmid (Fukuhara,
unpubl.). Killer phenotype was not associated with these plasmids when tested
against S. cerevisiae, Candida glabrata, and K. lactis.
12.4
Killer Assay
Killer activity can be tested against a few tester strains. Besides S. cerevisiae and K.
lactis 236017 (Wesolowski et al. 1982a), Candida glabrata CBS 138 may also be
used, because this strain is highly sensitive to a wide range of killer toxin types. A
practical procedure is as follows.
1. TenJII of a fresh culture of the sensitive tester strain are placed in the middle of
a plastic petri dish.
2. Tenml of molten glucose complete agar medium (1.5% Oxoid agar no. 1, kept
at 45°C) are poured and quickly mixed by swirling the dish.
3. On the solidified agar plate, colonies of the killer strain are streaked or replica-
plated and incubated at 20°C for 3 days. Killer activity is evaluated from the
diameter of the growth inhibition zone (Fig. 11).
Two percent galactose complete medium adjusted to pH 4.5 with 50 mM Na-

phosphate buffer was found to be optimal for killer tests on plates, but this me-
dium cannot be used for galactose-negative mutants or species such as K. waltii
and K. delphensis. The test can be done on glucose plates, but the sensitivity
appears to be lower (see also Gunge et al. 1981, for an alternative protocol).
CSS2359
CSS106S
CSSS618
CBS8043
Y-llS4 K.wall ii
PS-163
K. waltii
PS-227 C8S6448
Fig. 11. Plate assay of killer phenotype. The agar lawn contains Candida glabrata as a killer-
sensitive tester. The indicated killer and nonkiller strains were streaked on the agar surface
and incubated for 3 days. The tester cells cannot grow around the K. lactis colonies secreting
the killer toxin. K. waltii strains (provided by Dr. M.-A. Lachance, University of Western
Ontario) contained nonkiller RNA plasmids. CBS6448 is a strain of Endomycopsella
crataegensis, which contained also RNA plasmids
12.5
Detection of Plasm ids in Colony Lysates
Circular and linear plasmids and their derivatives can be quickly detected in many
individual colonies by electrophoresis of minilysates, as follows.
Solutions: 5 x TE (50mM Tris-HCl/5mM EDTA, pH 7.5). Zymolyase 20T (Kirin
Breweries, Tokyo; stock solution at 1 mg/ml, stored frozen in small fractions), 5%
SDS (sodium dodecylsulfate), proteinase K (Boehringer, 2mg/ml, stored in small
fractions).
1. Take a 1-2-mm-sized colony with a sterile toothpick, suspend in 20 J1l of 5 x TE
in an Eppendorf tube.
2. Add 3 J1l of Zymolyase, vortex 1 s and incubate for 1 h at 37°C.
3. During incubation, prepare 0.6% agarose gel for electrophoresis, with as many
sample wells as necessary.
4. Add 2J1l ofSDS, vortex, 5 J1l of Proteinase K, vortex, and incubate at 60-65 °C for
1h.
5. Add 5J1l of blue sauce (the standard mix for nucleic acid electrophoresis,
Maniatis et al. 1982) and microfuge for 1 min.
6. Take 10-20 J1l supernatant, avoiding the viscous pellet if any, and run the
electrophoresis until the blue dye moves a few cm. Stain the gel with ethidium
bromide (0.5 ,ug/ml water) for observation under UV. Figure 12 shows examples
12345678
Fig. 12. Analysis of colony lysates to detect plasmids. Mini-lysates of individual colonies
were electrophoresed on agarose gel. DNA was stained with ethidium bromide and photo-
graphed under ultraviolet light. pGKLl and pGKL2 migrate as sharp bands separated from
the mass of cellular DNA. Lane 1 Candida vacciniae CBS 7318 (contains RNA plasmids);
lane 2 id. with pancreatic RNase; lane 3 Pichia etchellsii CBS 2011 (contains two linear DNA
plasmids pPEIA and pPEIB; unpubl.); lane 4 id. with RNase; lane 5 Pichia scaptonizae CBS
8167 (contains uncharacterized plasmids); lane 6 id. with RNase; lane 7 Kluyveromyces
lac tis CBS 2359 (contains the linear plasmids pGKLl and 2; lane 8 Kluyveromyces lactis
MD211 (contains the circular plasmid pKDl)
of this analysis. Optionally, RNA (and RNA plasmids) may be removed by

adding 2,ul of pancreatic RNase (200,ug/ml) at the end of the Zymolyase step.
Compared with the circular pKDl-derived plasmids, the linear DNA plasmids
give characteristically sharp thin bands.
12.6
Preparation of Killer Plasmid DNAs
The isolation procedure for the linear plasmids must include a Proteinase K (or
pronase) treatment to remove the terminally attached proteins. Earlier procedures
have been improved by Starn et al. (1986) such that the plasmid DNAs, extremely
rich in AT bases, can be separated from other cellular DNAs by CsCI-bisbenzimide
centrifugation (see Sect. 12.2). The killer DNAs form a sharp band on top of the
mitochondrial DNA band. Separation between pGKLl and pGKL2 requires a pre-
parative agarose (0.5-0.6%) gel electrophoresis. pGKLl-less mutants (Niwa et al.
1981; Wesolowski et al. 1982a) can be conveniently used for the isolation of pGKL2
DNA.
13
Vector Systems
13.1
Transformation Markers
The standard S. cerevisiae markers such as TRP 1, URA3, and LEU2 genes have been
conveniently used in K. Zactis, because corresponding mutations in K. Zactis can be
complemented by these genes under their native promoter. K. Zactis genes corre-
sponding to these genes have now been cloned and sequenced (KZURA3, Shuster et
al. 1987; K1TRPl, Stark and Milner 1989; K1LEU2, Zhang et al. 1992). Besides
auxotrophic markers, G418 resistance can also be used (see below).
13.2
pKD 7 Plasmid-Derived Vectors
Since pKDl has a 2-Ji-type organization, recombinant vectors carrying the plasmid
replication origin can be constructed in the way similar to the 2-Ji-derived vectors.
KEp6 is one of the representative vectors (Fig. 13). It is composed of the integrative
vector YIpS (carrying URA3, and pBR322 sequence) and pKDl origin of replica-
tion. The maintenance of these vectors requires a cir+ host (carrying resident
pKD 1) and the stability of this simple form of vectors is high enough to be used for
construction of DNA libraries. However, a more stable form of vectors can be
obtained using the totality of the pKDl sequence. 2-Ji-family plasmids have a few
intergenic regions in which foreign sequences can be introduced without drasti-
cally affecting the plasmid stability (Chen et al. 1989; Chinery and Hinchcliffe
1989). pEl is an example of this type of stable autonomous vectors (Fig. 13B). Such
full-sequence vectors, which do not need cir+ hosts, have been successfully used in
the production of heterologous proteins (Fleer et al. 1991a,b; Ogawa et al. 1990).
The host range of pKD1-derived vectors extends to some other species of
Kluyveromyces including K. dobzhanskii, K. aestuarii, K. waltii, K. thermotolerans,
K. wickerhami, and some strains of K. marxianus (Chen et al. 1989). The host range
could only be tested by the use of a "full-sequence" vector, since the KEp6 type
plasmids require cir+ hosts for maintenance. In addition, the KmR marker has to be
used in such tests, because wild-type yeasts have no auxotrophic markers. Some
yeast species are G418-resistant and cannot be tested by this marker (see below).
13.3
ARS Vectors
Several autonomously replicating sequences (ARS) of chromosomal origin have

been isolated (Das and Hollenberg 1982; Sreekrishna et al. 1984; Fabiani et al.
1990). KARS is the name used by Hollenberg's group. A KARS whose sequence is
known was shown to contain an undecanucleotide closely related to the S.
cerevisiae ARS consensus core (Broach et al. 1982). Some KARSs can replicate in
both K. lactis and S. cerevisiae (Fabiani et al. 1990). KARS-based vectors have been
used in gene expression studies reported by several authors (Das et al. 1985;
Leonardo et al. 1987), although these vectors are usually much less stable than the
plasmid-derived vectors. High amounts of DNA seem to be required for transfor-
mation with KARS-based vectors.
13.4
Centromeric Vectors
As mentioned before, most of the K. lactis centromere sequences have been cloned.
When associated with these DNAs, the KEp6 type vectors can form highly stable
I-'
BamHl
Pvu I KEp6 pEl
Pst I 6463bp Pst! 10.3 kbp
Nco I
Stu I
Pvu II ~
A B ~
~'
Fig. 13A,B. Two typical pKDl-derived vectors. Left KEp6 is a standard multicopy vector obtained by introducing the replication origin of pKDl o
(a 914-bp fragment, S11) into the BeoRI site of the pBR322-derived plasmid YIpS. This vector requires cir hosts. Transformation marker is URA3 [
for K. laetis uraA hosts. Right pEl contains the total sequence of pKD1 which was opened at the unique BeoRI site where YIpS was introduced. i5:
This is an autonomous vector stable in ciro hosts. A similar full-sequence vector (pCXJ-kan1) is available with a KmR marker for transformant S
selection. The unique SphI site is another insertion point to construct a highly stable full-sequence vector analogous to pEl (Bianchi 1992). ~
I!..
~
r:-
low copy number plasmids (1-2 copies per cell). KCp491 is one such vector (Fig.
14A). Centromeric vectors have been used by Prior et al. (1993b) and Zachariae et
al. (1993).
13.5
K. lactis /5. cerevisiae Shuttle Vectors and Shuttle Libraries
pKD1-derived plasmids can replicate in S. cerevisiae, but the transformants are
extremely unstable. 2-,u-based vectors are also highly unstable in K. lactis. By
introducing the 2,u origin of replication into pKD1-derived vectors, one obtains
recombinant plasmids that can replicate stably in the two species. There appears to
be no incompatibility between the two origins. The shuttle vectors allow the ex-
ploitation of many mutations identified in S. cerevisiae for K. lactis studies and vice
versa. pSKI (Fig. 14B) is typical of such shuttle vectors on which K. lactis and S.
cerevisiae genomic libraries can be constructed (Prior et al. 1993a).
13.6
Expression and Secretion Vectors
pUCI9- or pBR322-derived plasmids carrying the pKDl origin of replication have

been constructed in which S. cerevisiae promoters and terminators (from ADHl,
PHOS, or PGK) were included together with a cloning site between them. Some of
these vectors have been modified so that a DNA sequence coding for a secretion
signal peptide (from a K. lactis killer toxin gene ORF2) was placed in front of the
cloning site. These constructions have been used to produce heterologous proteins
from K. lactis (Fleer et al. 1991a,b). Figure 15 shows a few examples of expression
and secretion vectors constructed by X.J. Chen (1987) in the authors' laboratory.
13.7
Killer Plasmid DNAs as a Possible Vector
The high copy number killer plasmids are obviously a possible source of gene
vectors. Particularly, it was expected that the killer toxin genes of pGKLl may be
replaced by heterologous DNA sequences. After an early attempt to explore this
possibility (de Louvencourt et al. 1983), two major problems have become appar-
ent. First, the fact that these DNAs are linear molecules with terminally attached
proteins makes it difficult to amplify them in conventional E. coli systems. Second,
the expression of genes on the linear plasmids requires the specific transcription
signals of the plasmids. A solution to the first problem was the direct introduction
of foreign DNA sequences into the plasmids by in vivo targeting through homolo-
gous recombination (Kamper et al. 1989a,b; Tanguy-Rougeau et al. 1990; Chen et
al. 1991).
To solve the second obstacle, there were two possibilities: (1) expression of the
foreign gene by its fusion with the dispensable toxin subunit gene, so that the
foreign gene is expressed under the toxin gene promoter (Kamper et al. 1989a), or
' -I
0\
-
Pvul
Pst! Pst I
Pst!
Nco I
~ Nco I
f:1 Stu I
52 KCp 491 pSKl ~
Stu I 8708 bp
8200bp
Sail
Hind III
Pvu II
Pst I ~
A Pst! B I~
tn,
Fig. 14A,B. Centromeric vector and K. lactis-S. cerevisiae shuttle vector. Left Centromeric vector KCp 491. The centromere fragment (KlCEN2) '"0
0'
comes from chromosome II (provided by Dr. B. Zonneveld, Clusius Laboratory, University of Lei den). The plasmid is otherwise identical to KEp6. ~
Right Shuttle vector pSK1. A 2-f.l origin of replication was added to KEp6 plasmid. pSKl can replicate in K. lactis and in S. cerevisiae cir hosts i5:
which are uraA and ura3, respectively t-<
0
~
tn
....
fl.
Bell !JI
2S
i
111
C3
3
~
~
Ci
"a-.
Pvu I
Pst!
Pvul
Pst I pEPHO pEPGK41

7000bp 7900bp
Sal I
Pst!
Pvu II
A Pvu II Sma I-Ava I
Fig.lSA-C. Expression and secretion vectors. A Expression vectors pEPRO, 7000bp and pEPGK41, 7900bp. PROS and PGK promoters from S.
cerevisiae are used. PH05 is repressible by inorganic phosphate. PGK is a strong constitutive promoter. B Secretion vectors pSPR04, 7500 bp and
pSPGKl, 7900 bp. Nucleotide sequence coding for the N-terminal signal peptide of pGKLl ORF2 was chemically synthesized and inserted behind
the promoter sequence. The inserted sequence is followed by an unique cloning site to allow fusion of a coding sequence. C BeaR! synthetic
fragment encoding the killer toxin secretion signal
' -l
'-l
-
' -l
Bell 00
-
Pvu I
Pst!
Pvu I
Pst I pSPH04 pSPGKl

7500bp 7900bp
Sal I
PstI
~
B
~
(1),
'"o
(EcoRI) Met Asn Ile Phe Tyr Ile Phe Leu Phe Leu Leu Ser Phe Val Gln Gly Lys Arg
[
AATT ATG AAT ATA TTT TAC ATA TTT TTG TTT TTG CTG TCA TTC GTT CAA GGT AAA AG i:T.
TAC TTA TAT AAA ATG TAT AAA AAC AAA AAC GAC AGT AAG CAA GTT CCA TTT TCT TAA S
c ~
EcoRI
~
Fig. 15B,C
~
(2) integration of the foreign gene which had been linked in vitro to an isolated
plasmid promoter (Tanguy-Rougeau et al. 1990). Both approaches have worked as
expected, showing that the linear plasmids can be modified to allow expression of
a desired gene. Some of the modified linear plasmids have been shown to be highly
stable. However, transcription under the control of the plasmid promoters does
not seem to be strong enough to support high level production of a protein. The
level of human interleukin 1{3 produced from the killer plasmids was low com-
pared to the results obtained with circular vectors (Cong 1994). In order to exploit
the linear killer plasmids as efficient expression vectors, it will be necessary to
develop strong promoters that would function on these cytoplasmic plasmids. A
mutant promoter of this kind has been described (Cong et al. 1994).
14
Transformation Procedures
14.1
Various Methods of Transformation
To introduce DNA into K. lactis cells, the three methods (spheroplasting, lithium
salt treatment, or electroporation) that are used for S. cerevisiae can be applied
with minor modifications. Although the transformation frequency of spheroplasts
is high, the overall yield of transformants is somewhat inferior to that of S.
cerevisiae, because of a lower regeneration rate of K. lactis spheroplasts (in the
order of 1%).
The efficiency of the lithium salt method seems to vary considerably with
strains. Use of lower concentrations of the Li salt improves the transformation
frequency in some cases (see below).
Electroporation generally gives high frequencies of transformation. When lin-
earized DNA is to be integrated into chromosomes, electroporation is suspected to
give increased proportions of nonhomologous integration as compared to the
spheroplast method. Still, gene replacement at the homologous sites can be ob-
tained, but at lower frequencies as compared to S. cerevisiae. A useful transforma-
tion procedure has been reported by Dohmen et al. (1991), which is an adaptation
to yeast of the general method originally described by Klebe et al. (1983). The
method does not require spheroplast formation and allows long-term storage of
competent cells at -70°C. This method is convenient for routine replicative trans-
formation as well as for integrative transformation. The electroporation method is
still preferred when high-frequency transformation is required, for example, gene
cloning by in vivo complementation using a genomic library, because lower
amounts of DNA are required.
In S. cerevisiae, disruption of an essential gene resulting in recessive lethals can
be performed on diploid hosts, so that the meiotic products prove to segregate 2 : O.
In K. lactis, this procedure is slightly complicated by the fact that the diploid state
is transitory. The diploids have to be maintained under prototrophic or other
selective pressure during the integration experiment.
Some protocols of transformation procedures are given below.
14.2
Transformation by Spheroplasting
The protocol is based on the procedure described by Bianchi et al. (1987) for pKD 1
-derived vectors, with a few modifications. All operations are at room temperature
if not indicated otherwise.
1. Grow yeast in 100 ml glucose complete medium from 2-3 fll of fresh overnight
culture. Cells are harvested at the exponential phase of culture. The cell density
should be less than 107 cells/ml.
2. Centrifuge cells (Smin, SOOOrpm), wash once in 10ml of 0.1 % BSA (or water).
3. Suspend cells in 10ml SEM, add 10fll of mercaptoethanol-2 (final 0.014M),
incubate at 30 DC for 10min. Wash cells twice with lOml of 1.2M sorbitol.
4. Suspend cells in lOml of SEC. Check absorbance by diluting 100-IS0fll of
suspension in 3 ml of water.
S. Add 0.1 ml of cytohelicase. Incubate at 30 DC for not more than 20 min. Check
absorbance at S-min intervals. Ideally, the absorbance should decrease to 10-
20% of the initial value.
6. Centrifuge spheroplasts at 2S00 rpm for S min, wash twice with 1.2 M of
sorbitol, once with SCa.
7. Suspend spheroplasts in 1 ml SCa. At this stage, the suspension may be stored
at 4 DC for a week.
8. 100-fll portions of suspension are placed in lO-ml sterile plastic tubes. Each
tube corresponds to one transformation test.
9. Add DNA (0.1-0.5Jig, plus lOJig of salmon sperm DNA) and let stand for
ISmin at 22 DC. DNA volume should not exceed 10fll. Two tubes without DNA
are kept for no DNA control and for regeneration test.
10. Add 1 ml of PEG and incubate for 20 min at 22 DC. Centrifuge for S min at
2S00 rpm. Discard the supernatant completely by decantation and suction
with a Pasteur pipette.
11. Add ISO Jil of SOS and incubate at 30 DC for 1 hour.
12. Add Sml of 0.6M KCI and centrifuge at SOOOrpm for Smin. Discard the
supernatant completely. Suspend spheroplasts in S ml of KCl.
13. SO Jil of suspension are mixed with S ml of molten top agar (48 DC) and im-
mediately poured onto a selective agar plate prewarmed at 37 DC. Incubate the
plates for S-7 days.
14. Regeneration test is done by plating the spheroplast suspension diluted 104-
105 times with addition of all the requirements. Regeneration rate, which is
highly dependent on the strain, can vary between 0.5 and 5%. A variable
fraction of spheroplasts undergoes lysis during PEG treatment. Just proceed
ahead.
With CsCl-purified DNA, a transformation frequency of about 3 X 103 per /1g DNA
can be obtained. Plating too many protoplasts on a plate may have adverse effects
on the regeneration rate.
Solutions: Cytohelicase (Industrie Biologique Fran<;:aise, Clichy, France), 100mgl
ml (roughly equivalent to Glusulase), filter-sterilized; BSA, bovine serum albumin
1 mg/ml, filter-sterilized; 1.2 M sorbitol, sorbitol 21.6 g/100 ml water; SEM, 1.2 M
sorbitol! 25mM EDTA 14 mM mercaptoethanol-2; SEC, 1.2M sorbitol! lOmM
EDTA/ O.lM Na citrate pH 5.8; SCa, 1.2M sorbitol/ 10mM CaC12; PEG, 20%w/v
polyethylene glycol 4000 (Merck) in 10mM Tris-HCl pH704/ 10mM CaC12; filter-
sterilized; SOS, 1.2M sorbitol!7mM CaCl/ 004 volume of glucose complete me-
dium, filter-sterilized; 0.6M KCl, 4.5 gllOOml water; sonicated salmon sperm DNA
10mglml. Top agar, 0.6M KCl! 0.8% Bacto agar/0.67% Yeast Nitrogen Base w/o
amino acids Difco/ 2% glucose supplemented with auxotrophic requirements as
necessary; agar plates, the same as the top agar except that concentration is 2%.
14.3
Transformation by Electroporation
The protocols derived from the procedure described by Meilhoc et al. (1990) seem
to have been adopted by many laboratories.
14.3.1
Transformation by the Electropulsateur
The apparatus used for electroporation in the authors' laboratory is the

Electropulsateur from S.A. Jouan (Rue Bobby Sands, C.P.3203, 44805
SaintHerblain, France; model TRX GHT 1287 ref. 51700100, electrode set ref.
51700150). A procedure for this apparatus has been communicated to us by Dr. R.
Fleer (Department of Biotechnology CRVA, Rhone-Poulenc Rorer, Vitry-sur-
Seine, France). A slightly modified protocol, as practised in the authors laboratory,
is given below.
1. Grow cells as in the preceding protocol.
2. Harvest cells by centrifugation and wash once with EP buffer.
3. Suspend cells in 1 ml of DTT medium and incubate at 28°C for 30 min.
4. Centrifuge and wash cells in EP; suspend cells in 1 ml EP (about 109 cells/ml).
5. Take 100/11 of suspension (about 108 cell) in a sterile Eppendorf tube, mix with
2-4 f1l of transforming DNA. Coolon ice.
6. Place the suspension between the electrodes (1 em wide, 4mm apart, alcohol-
washed). The drop is supported by the electrodes on the surface of a plastic
petri- dish which can be placed on ice. (This setting was found more convenient
than the use of a cuvette, especially when many samples are to be processed.)
7. Apply IkV for 20ms.
8. Transfer the drop into I ml of glucose complete medium, and incubate for I h at
30°C to allow regeneration.
9. Plate 0.1 to 0.3 ml on appropriate selective media, and incubate for 2-3 days.
Solutions EP buffer: lOmMTris-HCI, pH 7.5!270mM sucrose!lmM MgCI2,
autoclaved.
DTT medium: mix 100ml of glucose complete medium, 2.5ml of O.IM
dithiothreitol and 2.0 ml of 1M Hepes buffer, pH 8, sterilized by filtration.
In a typical case, 30 ng of DNA gave 1000 transformants; higher amounts of
DNA may reduce the transformation frequency. Cell viability is around 30-50%,
which is about 100 times higher than the spheroplast method.
14.3.2
Transformation by the Gene Pulser
The Gene Pulser!Pulse controller system from Biorad Laboratories (ref. 165-2077)
is also in use in different laboratories. Biorad and Jouan systems differ by the shape
of the electric pulse ("exponential" versus "square"). The following procedure has
been communicated to us by Dr. A. Dominguez (University of Salamanca, Spain).
A culture grown overnight is used as the inoculum. Grow cells overnight in 200 ml
ofYED (I % yeast extract Difco, 1% glucose) until early to mid-exponential phase
(a density of A600 0.8-1.4; 1.4-3 x 107 cells!ml). Centrifuge cells and wash with
water.
Cells are suspended in 20 ml of pretreatment buffer (I % glucose, I % yeast extract,
25mM dithiothreitol, 20mM HEPES, pH 8).
After incubation for 30 min at 30°C with shaking, cells are collected by centrifuga-
tion and resuspended in EB buffer (10mM TrisHCI, pH 7.51270mM sucrose! I mM
lithium acetate) at a concentration of 2-3 x 109 cells!ml.
50-.ul aliquots are mixed with DNA in an Eppendorf tube and kept on ice for
IS min. The final volume is 50-55.ul.
An electroporation cuvette of2mm path (ref. 165-2086) is used. Voltage 1000V,
capacitance 25 ).IF, and resistance 400 ohm. After the pulse, I ml of cold YED is
added to the suspension, mixed thoroughly, transferred to a sterile Eppendorf
tube, kept 15min on ice and 60 min at 30°C, then plated on appropriate media.
Various parameters in this protocol have been extensively studied by Sanchez et al.
(1993). They reported a transformation efficiency of 106-107 transformants per ).lg
DNA in using pKDI-derived circular vectors.
14.4
Transformation by a LiC! Method
The protocol was contributed by Dr. S. Menart and Dr. M. Bolotin-Fukuhara

(University of Paris XI, Orsay).
1. Grow cells in 10 ml of complete medium to A600 of 0.6-1.0. Collect cells by

centrifugation and suspend them in 400/11 TE plus 400/11 20 mM LiCl. Incubate
at 28°C with shaking.
2. For transformation, mix 100/11 of the above suspension with 0.2-1.0 Ilg of trans-
forming DNA in a volume not larger than 1OJ1l. Incubate for 30 min at 28°C.
3. Add 100 J1l of 70% polyethyleneglycol (PEG 4000) and incubate for 1 h. Heat
shock at 42°C for 5 min. Collect cells by 1 min centrifugation, rinse three times
with 100 J1l of water, suspend them in 100 III of water before plating on
appropriate agar plates.
14.5
Transformation of Frozen Competent Cells
This protocol was adapted from Dohmen et al. (l991)'s procedure above. It
employs polyethiyene glycol and dimethylsulfoxide (DMSO).
1. Cells grown in glucose complete medium (lOOml) to a density of about 107 /ml
(A6ooo about 0.6), are harvested and washed with water, then with a half-volume
ofbicine buffer. The pellet is suspended in 1/50 volume of the same buffer; 200-
J1l portions of the suspension are distributed in sterile Eppendorf tubes and
stored frozen at -70°C until use.
2. Transformation of the frozen cells is carried out at a temperature above 15°C.

To the top of the frozen competent cells, add 0.1-5Ilg of transforming DNA
plus 50llg of sonicated salmon sperm DNA. The volume of DNA must not
exceed 20 J1l.
3. Allow cells to thaw with vigorous agitation at 37°C for 5 min. Add slowly 1.4 ml
of 40% PEGI 0.2 M Bicine solution. Mix by gentle inversion of the tube, before
incubation for 1 h at 30°C.
4. Pellet the cells at 3000g for 5min (20°e). Wash the pellet with 1.5ml of 0.15M
NaCl/I0mM bicine. Finally, resuspend the cells in the same buffer before plat-
ing on appropriate selection medium.
Reagents: bicine buffer, 1 M Sorbitol/l0mM Bicine-NaOH (pH 8.35)/3% PEG 10001

5% DMSO, filter-sterilized and stored at 4°C.
40% PEG 10001 0.2M Bicine-NaOH (pH 8.35), filter-sterilized and stored at room
temperature.
14.6
Release of Plasm ids from K. lactis Transformants
Total yeast DNA is prepared from individual transformants and used to transform
competent E. coli cells to recover the yeast plasmid for further characterization.
1. Grow a 5-ml culture in selective medium to saturation at 28°C.
2. Collect the cells by centrifugation at 2500 rpm for 5 min in a refrigerated

centrifuge (4 0c).
3. Remove the supernatant and resuspend the cells in 200JIl of 50mM Tris-HCI
(pH 7.5), 60mM EDTA, 0.4% Triton X-100, 2.5 M LiCl. Transfer to a microfuge
tube (l.5 mI).
4. Add 0.3 g of acid-washed glass beads and 0.2 mI of phenol/chloroform:
isoamylalcohol (25: 24: 1, volume ratio).
5. Vortex for 5 min.
6. Centrifuge in a microfuge for 2 min (room temperature).
7. Transfer the aqueous layer to a fresh tube and add 1 ml of 96% ethanol. Mix by
inversion.
8. Centrifuge in a microfuge for 2 min. Discard the supernatant. Resuspend the
pellet in 50 JIl of 1 x TE pH 8.
9. Use 2JIl of the plasmid preparation to transform 100jil of competent E. coli
cells.
14.7
Use of G418 Resistance Marker in Transformation
Study of nonconventional yeasts often suffers from the absence of available aux-
otrophic mutants as transformation hosts. Sensitivity of many yeasts, including K.
lactis, to the antibiotic G418 allows the use of the kanamycin resistance gene
(coding for a 3' aminoglycoside-phosphotransferase) as a transformation marker.
A few comments on the use of this marker may be approriate. G418 is a ribosomal
inhibitor in many eukaryotic cells. It is equivalent to the antibacterial agents
kanamycin or neomycin. The kanamycin resistance gene, KmR, isolated from the
bacterial transposon Tn903 can be expressed in S. cerevisiae from its natural
promoter (Jimenez and Davies 1980) and this also applies to K.lactis (Sreekrishna
et al. 1984; Chen and Fukuhara 1988). K. lactis strains are clearly more sensitive to
G418 than is S. cerevisiae (Fig. 16A). However, when K. lactis cells are maintained
at low concentrations ofG418 (up to about 50jig/ml), resistant colonies tend to
appear spontaneously at relatively high frequencies (10-5 ). At 200 jig/mI, their
frequency is extremely low. This concentration of G418 (a stock solution of
Geneticin, Sigma ref. G5013, at 100mg/ml water, filter-sterilized and frozen) was
100
]
CO
:=.
~Q 50
~
j (A)
~
0
0 5 10 15 20 25
G418 concentration (~g/ml)
] 100 --0
no G418 G418 50 MImI
CO
:=. 80
~6b 60
II)
(B)
40
5
~ 20
0
0 0.1 0.2 0.3 0.4 0.5 0.6
KCl concentration [M]
Fig. 16A,B. Effect of G418 on the growth of K. lactis and S. cerevisiae. A Range of effective
G418 concentration. B Effect of salf concentration on the sensitivity to G418
adopted in the authors' laboratory for routine selection of G418 resistant

transformants. The KmR gene introduced into K. lactis by a multicopy vector can
confer resistance to G418 at the level of more than 2 mglml. In practice, G418
should not be used in high salt media (such as the standard Yeast Nitrogen Base
plates), because the yeast becomes insensitive to the drug at the salt concentrations
exceeding 0.1 M NaCI or KCI (see Fig. 16B). Sorbitol at high concentration does not
interfere with G418 action. The standard complete media (1 % yeast extract! 1%
peptone/ 2% glucose) can be used as such in combination with G418. It should be
noted that many yeast species are not sensitive to G418 (Table 5). Among the
Table 5. Examples of yeast species whose strains are generally resistant to G418. (200,ug/ml
in glucose complete agar medium, 20 0c)
Candida albicans Pichia anomala Williopsis saturnus

Candida glabrata Pichia farinosa Yarrowia lipolytica
Candida parapsilosis Pichia guilliermondii
Candida saitoana Pichia jadinii
Candida santamaria Pichia kluyveri
Candida shehatae Pichia membranaefaciens
Candida tropicalis Pichia stipis
Many yeast strains show a variable degree of resistance to the drug as a strain-specific and
not species-specific character. This list includes only those species in whi~h all the strains
tested gave homogeneously a resistant phenotype.
sensitive species, the sensitivity may vary greatly from strain to strain. The re-
sponse of various strains of K. lactis to G418 appears to be quite homogeneous.
When G418 resistance is the selection phenotype, the spheroplast transforma-
tion protocol described above should be modified because of the salt effects. The
following is a modification of the procedure described by Sreekrishna et al. (1984)
from which KCI was omitted.
After the 1 h incubation of spheroplasts in SOS (see the spheroplast transforma-
tion protocol described above), add 3ml of 1.2M sorbitol. Centrifuge the suspen-
sion at 4000 rpm for 5 min. Suspend the pellet in 0.8ml of 1.2M sorbitol (in 10ml
for the regeneration test); 50-100, and 200-,ul portions were diluted in 5-ml regen-
eration top agar (melted and kept at 46 °C). This modified top agar contains
glucose complete medium/l.2M sorbitol!2% agar. The mix is poured on a
prewarmed base plate of the same composition as this top agar. When solidified,
the plates are incubated at 28°C for 16 h. A second 5 ml of top agar containing
0.16ml ofG418 stock solution (50mg/ml) is spread on the surface, and incubation
is continued for a few days to allow colony development. If one omits the first 16-
h incubation in the absence of G418, the appearance of transformants is delayed
and their number is much lower.
In the case of transformation by electroporation, the transformants are first
plated on glucose complete medium, and incubated at 30°C for 15 h, then replica-
plated onto G418 medium.
15
K./actis for Industrial Application
K. lactis is known as a source of ,8-galactosidase, but attempts at large-scale use of

K. lac tis for protein production are relatively recent. As this yeast is present in
various milk products, it is accepted as "generally recognized as safe (GRAS)" for
industrial use. It can be grown to a high cell mass in a fed-batch fermenter up to a
yield of near 100g dry mass per liter in corn steep/glucose media (Fleer et al.
1991 b). The recent interest in K. lactis seems to come especially from its ability to
secrete high molecular weight proteins. The fact that the linear plasmid-encoded
toxin is secreted into culture media suggested that K. lactis was capable of excret-
ing very large proteins, even if such a capacity is not an exceptional characteristic
of this species. In order to achieve high production levels of secreted heterologous
proteins, such as human proteins, industrial firms have been trying to use yeasts in
place of bacteria (recently reviewed by Shuster 1991; Fleer 1992; Romanos et al.
1992). Although many such attempts had been made with the familiar S. cerevisiae,
K. lactis has become one of hopeful alternatives to achieve production of secreted
proteins (van den Berg et al. 1990; Fleer et al. 1991a,b). Table 6 shows a few
examples of heterologous proteins produced from S. cerevisiae and K. lactis.
It has been shown that the secretion offoreign proteins can be directed not only
by the K. lactis killer toxin signal peptide (Baldari et al. 1987; see Fig. lSc), but also
by various signal peptides from heterologous sources including the mating factor
ex of S. cerevisiae or even human serum albumin preprosequence. To our knowl-
edge, proteases that could interfere with secreted protein production have not
been detected in K. lactis culture supernatants.
For high-level production of heterologous proteins, two types of strategies are
considered: one is based on the expression of chromosomally integrated foreign
protein genes (which are highly stable through mitosis), and the other relies on
multicopy plasmid vectors carrying the foreign gene (maintained at a high gene
dosage). Both approaches have given successful examples: prochymosin was pro-
duced from chromosomally integrated genes (van den Berg et al. 1990), and hu-
man serumalbumin from p KD 1 plasmid-based vectors (Fleer et al. 1991 b; Yeh et al.
Table 6. Some examples of heterologous proteins produced by K. lactis and S. cerevisiae
Protein produced Vector Promoter Secretion Approx. yield/I

signal flask/fermenter
S. cerevisiae systems
HumanGRF 2f.1 MFa MFa 30mg/-
Human apoE 2f.1 PHOS MFa 40mg/-
Human IL-6 2f.1 GALl MFa 30mg/-
Human IL-l/3 2f.1 GPD Amylase 20mg/-
HumanPTH 2f.1 MFa MFa lOOmg/-
Human serumalbumin 2f.1 Diverse Diverse 40-1S0mg/-
Murine amylase 2f.1 GAL7 60 mga/370mga
Tick anticoagulant 2f.1 GALlO MFa 2S0mg/-
Tetanos toxin C 2f.1 GAL/ADH 90mga/>lga
K. lactis systems
Human IL-l/3 pKDl PHOS/PGK Killer 80mg
Human serumalbumin pKDl LAC4/PGK Native 400mg/a few grams
HBsAg Integ. LAC4 12mga/-
Bovin prochymosin Integ. LAC4 MFa -fa few grams
aIntracellular accumulation. The information is mostly based on the data compiled and
communicated to us by Dr. R. Fleer (Rhone-Poulenc Rorer; see review by Fleer 1992).
1992), both with a yield in the order of grams per liter. Multiple integration of a
plant a-galactosidase gene into ribosomal DNA produced also a high level of
secreted production of the enzyme (Bergkamp et al. 1992). Although strong tran-
scription of heterologous genes can be often obtained, many posttranscriptional
and posttranslational steps remain out of control, such as messenger RNA stabil-
ity, codon choice and glycosylation, and so on. As mentioned before, the codon
choice in K. lactis is very similar to that of S. cerevisiae, and differs much from the
mammalian genes. K. lactis can use the consensus N-glycosylation sites (Asn-X-
Tyr/Ser) which sometimes remain silent in human sequences. Recent reviews by
Romanos et al. (1992) and Fleer (1992) may serve as a starting point ofliterature
search on these subjects. Whatever the strategy, high level production requires not
only an efficient expression system, but also optimization of fermentation pro-
cesses which will only be achieved through a better knowledge of general and
specific physiological regulation in K. lactis.
Acknowledgments. Our colleagues, too many to enumerate, kindly contributed

unpublished information. We also thank Dr. Masako Osumi (Japan Women's
University, Tokyo), who kindly provided the electron micrograph of K. lactis cells.
The authors' own work was supported in part by the Commission of the European
Communities (BlOT -CT91-0267).
References
Algeri AA, Marmiroli N, Viola AM, Puglisi PP (1977) Dependence of cytoplasmic on mito-
chondrial protein synthesis in K. lactis CBS 2360. II. Genetic studies. Mol Gen Genet 150:
141-145
Baldari C, Murray JAH, Ghiara P, Cesareni G, Galeotti CL (1987) A novel leader peptide
which allows efficient secretion of a fragment of hum an interleukin 1/3 in Saccharomyces
cerevisiae. EMBO J 6: 229-234
Barnett JA (1976) The utilization of sugars by yeasts. Adv Carbohydr Chern Biochem 32:
125-234
Barnett JA (1992) Some controls on oligosaccharide utilization by yeasts: the physiological
basis of the Kluyver effect. FEMS Microbiol Lett 100: 371-378
Barnett JA, Payne RW, Yarrow D (1990) Yeast: characteristics and identification. 2nd edn.
Cambridge University Press, Cambridge
Barns SM, Lane DJ, Sogin ML, Bibeau C, Weisburg WG (1991) Evolutionary relationship
among pathogenic Candida species and relatives. J Bacteriol173: 2250-2255
Bell W, Klaassen P, Ohnacker M, Boller T, Herwijer M, Schopp ink P, van der Zee P,
Wiemken A (1992) Characterization of the 56-kDa subunit of trehalose-6-phosphate
synthase and cloning of its gene reveals identity with the product of CIFl, a regulator of
carbon catabolite inactivation. Eur J Biochem 209: 951-959
Bergkamp RJM, Kool 1M, Geerse RH, Planta RJ (1992) Multiple-copy integration of the (X-
galactosidase gene from Cyamopsis tetragonoloba into the ribosomal DNA of
Bergkamp-Steffens GK, Hoekstra R, Planta RJ (1992) Structural and putative regulatory
sequences of Kluyveromyces ribosomal protein genes. Yeast 8: 903-922
Bhat PJ, Hopper JE (1992) Overproduction of the GALl or GAL3 protein causes galactose-
independent activation of the GAL4 protein: evidence for a new model of induction for
the yeast GAL/MEL regulon. Mol Cell Bioi 12: 2701-2707
Bianchi MM (1992) Site-specific recombination of the circular 2.um-like plasmid pKDl

requires integrity of the recombinase A and of the partitioning genes Band C. J Bacteriol
174:6703-6706
Bianchi MM, Falcone C, Chen XJ, Wesolowski-Louvel M, Frontali L, Fukuhara H (1987)
Transformation of the yeast Kluyveromyces lactis by new vectors derived from the 1.6-
Jim circular plasmid pKD1. Curr Genet 12: 185-192
Bianchi MM, Frontali L, Fukuhara H (1989) Active recombination ofpKDl-derived vectors
with resident pKDl in Kluyveromyces lactis transformation. Curr Genet 15:253-260
Bianchi MM, Santarelli R, Frontali L (1991) Plasmid functions involved in the stable propa-
gation ofpKDl circular plasmid in Kluyveromyces lactis. Curr Genet 19: 155-161
Bisson LF, Coons DM, Kruckeberg AL, Lewis DA (1993) Yeast sugar transporters. CRC Crit
Rev Biochem Mol BioI 28: 259-308
Boze H, Nicol D, Moulin G, Galzy P (1987) The role of genes LACI and LAC2 in the
biosynthesis of lactose metabolism enzymes by Kluyveromyces lactis. Acta Microbiol
Hung 34: 73-83
Bradshaw HD (1990) Killer toxins. Nature 345: 299
Brake A, Irvine B, Masiarz F, Shultz K (1988) Structure of genes encoding precursors of two
Kluyveromyces lactis transported proteins. Yeast 4: S436
Breunig KD (1989a) Multicopy plasmids containing the gene of the transcriptional activator
LAC9 are not tolerated by K. lactis cells. Curr Genet 15: 143-148
Breunig KD (1989b) Glucose repression of LA C gene expression in yeast is mediated by the
transcriptional activator LAC9. Mol Gen Genet 216: 422-427
Breunig KD, Kuger P (1987) Functional homology between the yeast regulatory proteins
GAL4 and LAC9: LAC9-mediated transcriptional activation in Kluyveromyces lactis in-
volves protein binding to a regulatory sequence homologous to the GAL4 protein-
binding site. Mol Cell BioI 7: 4400-4406
Breunig KD, Dahlems U, Das S, Hollenberg CP (1984) Analysis of a eukaryotic ,B-galactosi-
dase gene: the N-terminal end of the yeast K. lactis protein shows homology to the E. coli
LacZ gene product. Nucleic Acids Res 12: 2327-2342
Broach JR, Li YY, Feldman J, Jarayam M, Abraham J, Nasmyth KA, Hicks JB (1982) Local-
ization and sequence analysis of yeast origin of replication. Cold Spring Harbor Symp
Quant BioI 47: 1165-1173
Brunner A, Coria R (1989) Cloning and sequencing of the gene for apocytochrome b of the
yeast Kluyveromyces lactis strain WM27 (NRRL Y-17066) and WM37 (NRRL Y-1140).
Yeast 5: 209-218
Brunner A, Tuena de Cobos A (1980) Extrachromosomal oligomycin-resistant mutants of
the petite-negative yeast Kluyveromyces lactis. Properties of mitochondrial ATPase and
cross-resistance to inhibitors of phosphoryl transfer reaction. Mol Gen Genet 178: 351-
355
Brunner AL, Mas J, Celis E, Matoon JR (1973) Cytoplasmic and nuclear inheritance of
resistance to alkylguanidines and ethidium bromide in a petite-negative yeast. Biochem
Biophys Res Commun 53: 638-644
Brunner A, Tuena de Cobos A, Griffith DE (1977) The isolation and genetic characterization
of extrachromosomal chloramphenicol- and oligomycin-resistant mutants from the pe-
tite-negative yeast Kluyveromyces lactis. Mol Gen Genet 152: 183-191
Brunner AL, Mendoza VR, Tuena de Cobos A (1987) Extrachromosomal genetics in the
yeast Kluyveromyces lactis. Isolation and characterization of antimycin-resistant mu-
tants. Curr Genet 11: 475-482
Bulder CJAE (1963) On respiratory deficiency in yeasts. PhD Thesis, Technische Hoge
school, Delft
Bulder CJAE (1964a) Induction of petite mutations and inhibition of synthesis of respira-
tory enzymes in various yeasts. Antonie Leeuwenhoek J Microbiol 30: 1-9
Bulder CJAE (1964b) Lethality of the petite mutation in petite-negative yeasts. Antonie
Leeuwenhoek J. Microbiol30: 442
Butler AR, O'Donnel RW, Martin VI, Gooday GW, Stark MJR (1991) Kluyveromyces lactis
toxin has an essential chitinase activity. Eur J Biochem 199: 483-488
Chang X-D, Dickson RC (1988) Primary structure of the lactose permease gene from the
yeast Kluyveromyces lactis. Presence of an unusual transcript structure. J BioI Chern 263:
16696-16703
Chen X-J (1987) Etude du plasmide pKD1 et developpement de systemes d'expression de
genes chez la levure Kluyveromyces lactis. PhD Thesis, University of Paris XI, Paris
Chen X-J, Clark-Walker GD (1993) Mutations in MGI genes convert Kluyveromyces lactis
into a petite-positive yeast. Genetics 133: 517-525
Chen X-J, Fukuhara H (1988) A gene fusion system using the aminoglycoside 3'-
phosphotransferase gene of the kanamycin-resistance transposon Tn903: use in the
yeast Kluyveromyces lactis and Saccharomyces cerevisiae. Gene 69: 181-192
Chen X-J, Saliola M, Falcone C, Bianchi MM, Fukuhara H (1986) Sequence organization of
the circular plasmid pKD1 from the yeast Kluyveromyces drosophilarum. Nucleic Acids
Res 14: 4471-4481
Chen X-J, Wesolowski-Louvel M, Tanguy-Rougeau C, Fukuhara H, Bianchi MM, Fabiani L,
Saliola M, Falcone C, Frontali L (1988) A gene cloning system for Kluyveromyces lactis
and isolation of a chromosomal gene required for killer toxin production. J Basic
Chen X-J, Bianchi MM, Suda K, Fukuhara H (1989) Host range of the pKDl derived plas-
mids in yeasts. Curr Genet 16: 95-98
Chen X-J, Wesolowski-Louvel M, Tanguy-Rougeau C, Fukuhara H (1991) Promoter activity
associated with the left inverted terminal repeat of the killer plasmid k1 from yeast.
Biochimie 73: 1195-1203
Chen X-J, Cong YS, Li YY, Wesolowski-Louvel M, Fukuhara H (1992a) Characterization
of a circular plasmid from the yeast Kluyveromyces waltii. J Gen Microbiol 138: 337-
345
Chen X-J, Wesolowski-Louvel M, Fukuhara H (1992b) Glucose transport in the yeast
Kluyveromyces lactis. II. Transcriptional regulation of the glucose transporter gene
RAG1. Mol Gen Genet 33: 97-105
Chinery SA, Hinchcliffe E (1989) A novel class of vector for yeast transformation. Curr
Genet 16: 21-25
Clark-Walker GD (1991) Contrasting mutation rates in mitochondrial and nuclear genes of
yeasts versus mammals. Curr Genet 20: 195-198
Cong YS (1994) Etude des plasmides circulaires et lineaires de levures. PhD Thesis, Univer-
sity of Paris XI, Paris
Cong YS, Wesolowski-Louvel M, Fukuhara H (1994) Creation of a functional promoter by
rearrangement in a Kluyveromyces lactis linear plasmid. Gene 147: 125-129
Cook AH, Slater CA (1956) The structure of pulcherrimin. J Chern Soc Part 1956: 4133-
4135
Coria RO, Garcia M, Brunner A (1989) Mitochondrial cytochrome b genes with a six-
nucleotide deletion or single-nucleotide substitutions confer resistance to antimycin A
in the yeast Kluyveromyces lactis. Mol Microbiol3: 1590-1604
Coria RO, Zalce ME, Mendoza VR, Brunner A (1990) Restriction site variation, length
polymorphism and changes in gene order in the mitochondrial DNA of the yeast
Kluveromyces lactis. Antonie Leeuvenhoek J Microbiol58: 227-234
Das S, Hollenberg CP (1982) A high frequency transformation system for the yeast
Das S, Breunig KD, Hollenberg CP (1985) A positive regulatory element is involved in the
induction of the {:I-galactosidase gene from Kluyveromyces lactis. EMBO J 4: 793-798
De Deken RH (1966) The Crabtree effect and its relation to the petite mutation in petite-
negative yeasts. J Gen Microbiol44: 157-165
De Jonge P, de Jongh FCM, Meijer SR, Steensma HY, Scheffers NA (1986) Orthogonal-field-
alteration gel electrophoresis banding patterns of DNA from yeasts. Yeast 2: 193-204
Del Giudice L, Brunner A (1977) Chromosomal and extrachromosomal inheritance of

erythromycin-resistance in the "petite-negative" yeast Kluyveromyces lactis. Mol Gen
Genet 152:325-329
Del Giudice L, Puglisi PP (1974) Induction ofRD mutants in K. lactis by nitrosoguanidine.
Biochem Biophys Res Commun 59: 565-571
De Louvencourt L, Fukuhara H, Heslot H, Wesolowski M (1983) Transformation of
Kluyveromyces lactis by killer plasmid DNA. J Bacteriol154: 737-742
Deshler JO, Larson GP, Rossi JJ (1989) Kluyveromyces lactis maintains Saccharomyces
cerevisiae intron-encoded splicing signals. Mol Cell BioI 9: 2208-2213
Dickson RC (1980) Expression of a foreign eukaryotic gene in Saccharomyces cerevisiae: ~
galactosidase from Kluyveromyces lactis. Gene 10: 347-356
Dickson RC, Barr K (1983) Characterization of lactose transport in Kluyveromyces lactis.
Dickson RC, Markin JS (l978) Molecular cloning and expression in E. coli of a yeast gene
coding for /3-galactosidase. Cell 15: 123-130
Dickson RC, Markin JS (1980) Physiological studies of ~galactosidase induction in
Kluyveromyces lactis. J Bacteriol142: 777-785
Dickson RC, Sheetz RM, Lacy LR (l981) Genetic regulation: yeast mutants constitutive for
f3-galactosidase activity have an increased level of ~galactosidase messenger ribonucleic
acid. Mol Cell BioI 1: 1048-1056
Dickson RC, Gerardot q, Martin AK (1990) Genetic evidence for similar negative regula-
tory domains in the yeast transcription activators GAL4 and LAC9. Nucleic Acids Res 18:
5213-5217
Dinouel N, Drissi R, Miyakawa I, Sor F, Rousset S, Fukuhara H (1993) Linear mitochondrial
DNAs of yeasts. Closed loop structure of the termini and possible linear-circular conver-
sion mechanisms. Mol Cell Bioi 13: 2315-2323
7: 691-692
Eng FJ, Warner JR (1991) Structural basis for the regulation of splicing of a yeast messenger
RNA. Cell 65: 797-804
Entian K-D, Barnett JA (1983) Some genetical and biochemical attempts to elucidate the
energetics of sugar uptake and explain the Kluyver effect in the yeast Kluyveromyces
lactis. Curr Genet 7: 323-325
Fabiani L, Aragona M, Frontali L (1990) Isolation and sequence analysis of a K. lactis
chromosomal DNA element able to autonomously replicate in S. cerevisiae and K. lactis.
Yeast 6: 69-76
Falcone C, Saliola M, Chen X-J, Bianchi MM, Frontali L, Fukuhara H (1986) Analysis of a
1.6-Jllll circular plasmid from the yeast Kluyveromyces drosophilarum. Structure and
molecular dimorphism. Plasmid 15: 248-252
Faye G, Kujawa C, Fukuhara H (l974) Physical and genetic organization of petite and
grande yeast mitochondrial DNA. IV. In vivo transcription products of mitochondrial
DNA and localization of 23S ribosomal RNA gene in petite mutants of Saccharomyces
cerevisiae. J Mol BioI 88: 185-203
Ferrero I, Rossi C, Landini MP, Puglisi PP (1978) Role of mitochondrial protein synthesis in
catabolite repression of the petite-negative yeast Kluyveromyces lactis. Biochem Biophys
Res Commun 80: 340-348
Finley RL Jr, Chen S, Ma J, Byrne P, West RW Jr (1990) Opposing regulatory functions of
positive and negative elements in USAG control transcription of the yeast GAL genes.
Mol Cell BioI 10: 5663-5670
Fleer R (1992) Engineering yeast for high level expression. Curr Opinion Biotechnol 3: 486-496
Fleer R, Chen XJ, Amellal N, Yeh P, Gault N, Faucher D, Folliard F, Fukuhara H, Mayaux
J-F (1991a) High-level secretion of correctly processed recombinant human interieukin-
1/3 in Kluyveromyces lactis. Gene 107: 285-295
Fleer R, Yeh P, Amellal N, Fournier A, Bacchetta F, Baduel P, lung G, L'H6te H, Becquart I,

Fukuhara H, Mayaux I-F (1991b) Stable multicopy vectors for high-level secretion of
recombinant human serumalbumin in Kluyveromyces yeasts. Bio/Technology 9: 968-
975
Flick IS, Iohnston M (1990) Two systems of glucose repression of the GALl promoter in
Saccharomyces cerevisiae. Mol Cell BioI 10: 4757-4769
Fournier A, Fleer R, Yeh P, Mayaux I-F (1990) The primary structure of the 3-phosphoglyc-
erate kinase (PGK) gene from Kluyveromyces lactis. Nucleic Acids Res 18: 365
Freire Picos MA, Rodriguez Torres AM, Rami! E, Cerdan ME, Breunig KD, Hollenberg CP,
Zitomer RS (1993) Sequence of a cytochrome c gene from Kluyveromyces lactis and its
upstream region. Yeast 9: 201-204
Fujimura H, Hishinuma F, Gunge N (1987) Terminal segment of Kluyveromyces lactis linear
DNA plasmid pGKL2 supports autonomous replication of hybrid plasmids in Saccharo-
myces cerevisiae. Curr Genet 12: 99-104
Fukuhara H (1987) The RFI gene of the killer DNA of yeast may encode a DNA polymerase.
Fukuhara H, Sor F, Drissi R, Dinouel N, Miyakawa I, Rousset S, Viola AM (1993) Linear
mitochondrial DNAs of yeasts. Frequency of occurrence and general features. Mol Cell
BioI 13: 2309-2314
Fuson GB, Presley HL, Phaff HI (1987) Deoxyribonucleic acid base sequence relatedness
among members of the yeast genus Kluyveromyces. Int I Syst Bacteriol37: 371-379
Godecke A, Zachariae W, Arvanitidis A, Breunig KD (1991) Coregulation of the
Kluyveromyces lactis lactose permease and ,a-galactosidase genes is achieved by interac-
tion of multiple LAC9 binding sites in a 2.6 kbp divergent promoter. Nucleic Acids Res
19: 5351-5358
Goffeau A, Briquet M, Colson AM, Delhez I, Foury F, Labaille F, Landry Y, Mohar 0, Moena
E (1975) Stable pleiotropic respiratory-deficient mutations of a "petite-negative" yeast.
In: Tzagoloff A (ed) Membrane biogenesis. Chap 3. Plenum Press, New York
Goffrini P, Algeri AA, Donnini C, Wesolowski-Louvel M, Ferrero I (1989) RAG1 and RAG2:
nuclear genes involved in the dependence/independence on mitochondrial respiratory
function for the growth on sugars. Yeast 5: 99-106
Goffrini P, Wesolowski-Louvel M, Ferrero I, Fukuhara H (1990) RAGI gene of the yeast
Kluyveromyces lactis codes for a sugar transporter. Nucleic Acids Res 18: 5294
Goffrini P, Wesolowski-Louvel M, Ferrero I (1991) A phosphoglucose isomerase gene is
involved in the Rag phenotype of the yeast Kluyveromyces lactis. Mol Gen Genet 228:
401-409
Gonc;:alves PM, Maurer K, Mager WH, Planta R (1992) Kluyveromyces contains a functional
ABF-l homologue. Nucleic Acids Res 20: 2211-2215
Gorbalenya AE, Koonin EV, Donchenko AP, Blinov VM (1989) Two related superfamilies of
putative helicases involved in replication, recombination, repair and expression of DNA
and RNA genomes. Nucleic Acids Res 17: 4713-4730
Griggs DW, Iohnston M (1991) Regulated expression of the GAL4 activator gene in yeast
provides a sensitive genetic switch for glucose repression. Proc Nat! Acad Sci USA 88:
8597-8601
Gunge N (1986) Linear DNA killer plasmids from the yeast Kluyveromyces. Yeast 2: 153-162
Gunge N, Kitada K (1988) Replication and maintenance of the Kluyveromyces linear pGKL
plasmids. Eur I Epidemiol 4: 409-414
Gunge N, Sakaguchi K (1981) Intergenic transfer of deoxyribonucleic acid killer plasmids,
pGKLl and pGKL2, from Kluyveromyces lactis into Saccharomyces cerevisiae by cell
fusion. I Bacteriol147: 155-160
Gunge N, Yamane C (1984) Incompatibility of linear DNA killer plasmids pGKLl and
pGKL2 from Kluyveromyces lactis with mitochondrial DNA from Saccharomyces
cerevisiae. I Bacteriol159: 533-539
5. Kluyveromyces ladis 193
Gunge N, Tamaru A, Ozawa F, Sakaguchi K (1981) Isolation and characterization of linear

deoxyribonucleic acid plasmids from Kluyveromyces lactis and the plasmid-associated
killer character. J Bacteriol151: 462-464
Gunge N, Murata K, Sakaguchi K (1982) Transformation of Saccharomyces cerevisiae with
linear DNA plasmids from Kluyveromyces lactis. J Bacterioll51: 462-464
Gunge N, Murakami K, Takesato T, Morijima H (1990) Mating type locus-dependent stabil-
ity of the Kluyveromyces lactis linear pGKL plasmids in Saccharomyces cerevisiae. Yeast
6: 417-427
Haffter P, Fox TD (1992) Nuclear mutations in the petite-negative yeast
Schizosaccharomyces pombe allow growth of cells lacking mitochondrial DNA. Genetics
131: 255-260
Hardy CM, Clark-Walker GD (1989) Nucleotide sequence of the structural genes for the
mitochondrial cys, lys, gIn, and leu tRNAs from the yeast Kluyveromyces lactis K8.
Hardy CM, Clark-Walker GD (1990) Nucleotide sequence of the cytochrome oxidase sub-
unit 2 and val tRNA genes and surrounding sequences from Kluyveromyces lactis K8
mitochondrial DNA. Yeast 6: 403-410
Hardy CM, Clark-Walker GD (1991) Nucleotide sequence of the COXI gene in
Kluyveromyces lactis mitochondrial DNA: evidence for recent horizontal transfer of a
group II intron. Curr Genet 20: 99-114
Hardy CM, Galeotti C, Clark-Walker GD (1989) Deletion and rearrangements in
Kluyveromyces lactis mitochondrial DNA. Curr Genet 16: 419-427
Heinisch J, Kirchrath L, Liesen T, Vogelsang K, Hollenberg CP (1993) Molecular genetics of
phosphofructokinase in the yeast Kluyveromyces lactis. Mol Microbiol 8: 559-570
Hendriks L, Goris A, Van de Peer Y, Neefs Y-M, Vancanneyt M, Kersters K, Berny J-F,
Hennebert GL, De Waechter R (1992) Phylogenetic relationships among ascomycetes
and ascomycetes-like yeasts as deduced from small ribosomal subunit RNA sequences.
Syst Appl Microbioll5: 98-104
Herman AI (1963) Genetic control of f3-glucosidase synthesis in yeast. PhD Thesis, Univer-
sity of Wisconsin, Madison
Berman AI, Griffin PS (1968) Respiratory-deficient mutants in Saccharomyces lactis, a
petite-negative yeast. J Bacteriol96: 457-461
Herman AI, Halvorson HO (1963a) Identification of the structural gene for f3-glucosidase in
Saccharomyces lactis. J Bacteriol 85: 895-900
Herman AI, Halvorson HO (1963b) Genetic control of f3-glucosidase in Saccharomyces
lactis. J Bacteriol85: 901-910
Herman A, Roman H (1966) Allele specific determinants ofhomothalism in Saccharomyces
lactis. Genetics 53: 727-740
Heslot H, Louis C, Goffeau A (1970) Segregational respiratory-deficient mutants of a
"petite-negative" yeast Schizosaccharomyces pombe 972 h-. J Bacteriol 104: 482-
491
Heus JJ, Zonneveld BJM, Steensma HY, Van den Berg JA (1990) Centromeric DNA of
Hishinuma F, Nakamura K, Hirai K, Nishizawa R, Gunge N, Maeda T (1984) Cloning and
nucleotide sequences of the linear killer plasmids from yeast. Nucleic Acids Res 12:
7581-7587
Hishinuma F, Tokunaga M, Wada N (1986) Expression of immunity gene of linear DNA
killer plasmid. Yeast 2: S158
Hoekstra R, Ferreira PM, Bootsman TC, Mager WH, Planta RJ (1992) Structure and expres-
sion of the ABFl-regulated ribosomal protein S33 gene in Kluyveromyces. Yeast 8: 949-
959
Jakobsen BK, Pelham HRB (1991) A conserved heptapetide restrains the activity of the yeast
heat shock transcription factor. EMBO J 10: 369-375
Jacoby J, Hollenberg CP, Heinisch J (1993) Transaldolase mutants in the yeast

Kluyveromyces lactis provide evidence that glucose can be metabolized through the
pentose phosphate pathway. Mol MicrobiollO: 867-876
Jacquier A, Dujon B (1983) The intron of the rnitochondrial21S rRNA gene: distribution in
different yeast species and sequence comparison between Kluyveromyces
thermotolerans and Saccharomyces cerevisiae. Mol Gen Genet 192:487-499
Jimenez A, Davies J (1980) Expression of a transposable antibiotic resistance element in
Saccharomyces. Nature 287: 869-881
Johannsen E (1980) Hybridization studies with the genus Kluyveromyces van der Walt
emend. van der Walt. Antonie Leeuwenhoek J Microbio146: 177-189
Johannsen E, van der Walt JP (1978) Interfertility as a basis for the delimitation of
Kluyveromyces marxianus. Arch Microbiol118: 45-48
Johnston JR, Contopoulou CR, Mortimer RK (1988) Karyotyping of yeast strains of several
Johnston M, Hopper JE (1982) Isolation of the yeast regulatory gene GAL4 and analysis of
its dosage effect on the galactose/melibiose regulon. Proc Natl Acad Sci USA 79: 6971-
6975
Jung G, Leavitt MC, Ito J (1987) Yeast killer plasmid pGKLl encodes a DNA polymerase
belonging to the family {3 DNA polymerases. Nucleic Acids Res 15: 9088
Kamper J, Meinhardt F, Gunge N, Esser K (1989a) New recombinant linear DNA-elements
derived from Kluyveromyces lactis killer plasmids. Nucleic Acids Res 17: 1781
Kamper J, Meinhardt F, Gunge N, Esser K (1989b) In vivo construction of linear vectors
based on killer plasmids from Kluyveromyces lactis: selection of a nuclear gene results in
attachment oftelomeres. Mol Cell Bioi 9: 3931-3937
Kikuchi Y, Hirai K, Hishinuma F (1984) The yeast linear DNA killer plasmids pGKLl
and pGKL2, possess terminally attached proteins. Nucleic Acids Res 12: 5685-
5692
Kikuchi Y, Hirai K, Gunge N, Hishinuma F (1985) Hairpin plasmid - a novel linear DNA of
perfect hairpin structure. EMBO J 4: 1881-1886
Kitada K, Gunge N (1988) Palindrome-hairpin linear plasmids possessing only a part of the
ORFI gene of the yeast killer plasmid pGKLI. Mol Gen Genet 215: 46-52
Klebe RJ, Harriss JV, Sharp D, Douglas MG (1983) A general method for polyethyleneglycol-
induced transformation of bacteria and yeast. Gene 25: 333-341
Kuger P, Godecke A, Breunig KD (1990) A mutation in the Zn-finger of the GAL4
homolog LAC9 results in glucose repression of its target genes. Nucleic Acids Res 18:
745-751
Kurtzman CP, Phaff HJ (1989) Molecular taxonomy In: Rose AH, Harrison JS (eds) The
yeasts, 2nd edn. Vol 1. Academic Press, London, pp 63-94
Kurtzman CP, Smiley MJ, Johnson q, Wickerham LJ, Fuson GB (1980) Two new and closely
related heterothallic species, Pichia amylophila and Pichia mississippiensis: characteriza-
tion by hybridization and deoxyribonucleic acid reassociation. Int J Syst Bacteriol 30:
208-216
Kuzhandaivelu N, Jones WK, Martin AK, Dickson RC (1992) The signal for glucose repres-
sion of the lactose-galactose regulon is amplified through subtle modulation of tran-
scription of the Kluyveromyces lactis Kl-GAL4 activator gene. Mol Cell BioI 12:
1924-1931
Lachance M-A (1989) Restriction mapping of rDNA and the taxonomy of Kluyveromyces
van der Walt Emend. van der Walt. Yeast 5: S579-S383
Lachance M-A (1993) Kluyveromyces systematics since 1970. Antonie Leeuwenhoek J
Microbio163: 95-104
Lacy LR, Dickson RC (1981) Transcriptional regulation of the Kluyveromyces lactis {3-
galactosidase gene. Mol Cell Bioi 1: 629-634
Lamphier MS, Ptashne M (1992) Multiple mechanisms mediate glucose repression of the
yeast GALl gene. Proc Natl Acad Sci USA 89: 5922-5926
Larson GP, Rossi JJ (1991) Altered response to growth rate change in Kluyveromyces lactis
versus Saccharomyces cerevisiae as demonstrated by heterologous expression of riboso-
mal protein 59 (CRY1). Nucleic Acids Res 19: 4701-4707
Leonardo JM, Bhairi SM, Dickson RC (1987) Identification of upstream activator sequences
that regulate induction of the f3-galactosidase gene in Kluyveromyces lactis. Mol Cell BioI
7:4369-4376
Lewis MJ, Pelham HRB (1990) The sequence of the Kluyveromyces lactis BiP gene. Nucleic
Acids Res 18: 6438
Lloyd AT, Sharp PM (1993) Synonymous codon usage in Kluyveromyces lactis. Yeast 9:
1219-1228
Lodi T, O'Connor D, Goffrini P, Ferrero I (1994) Carbon catabolite repression in
Kluyveromyces lactis: isolation and characterization of the KlDLD gene encoding the
mitochondrial enzyme D-Iactate ferricytochrome c oxidase. Mol Gen Genet 244: 622-
625
Luyten K, De Koning W, Tesseur I, Ruiz MC, Ramos J, Cobbaert P, Thevelein JM, Hohmann
S (1993) Disruption of the Kluyveromyces lactis GGSI gene causes inability to grow on
glucose and frutose and is suppressed by mutations that reduce sugar uptake. Eur J
Biochem 217: 701-713
Macreadie IG, Horaitis 0, Vaughan PR, Clark-Walker GD (1991) Constitutive expression of
the Saccharomyces cerevisiae CUPI gene in Kluyveromyces lactis. Yeast 7: 127-135
Maleszka R, Clark-Walker GD (1989) A petite positive strain of Kluyveromyces lactis has a
300kb deletion in the rDNA cluster. Curr Genet 16: 429-432
Maniatis T, Fritsch EF, Sambrook J (1982) Molecular cloning: a laboratory manual. Cold
Spring Harbor Laboratory, Cold Spring Harbor, New York
Marmiroli N, Ferrero I, Rossi C, Donini C, Puglisi PP, Parenti F (1979) In vivo differentiation
with trichodermin, axenomycin, emetine, anisomycin and erythromycin of cytoplasmic
and mitochondrial protein synthesis in the yeasts Saccharomyces cerevisiae,
Kluyveromyces lactis and Endomycopsis capsularis. Microbiologica 2: 149-165
Massardo DR, Manna F, Schafer B, Wolf K, Del Giudice L (1994) Complete absence of
mitochondrial DNA in the petite-negative yeast Schizosaccharomyces pombe leads to
resistance towards the alkaloid lycorine. Curr Genet 25: 80-83
McEachern MJ, Blackburn E (1994) A conserved sequence motif within the exceptionally
diverse te10meric sequences of budding yeasts. Proc Nat! Acad Sci USA 91: 3453-3457
McNeel DG, Tamaoki F (1991) TRFl, a novel DNA-binding protein recognizing the terminal
sequence of the pGKL linear DNA plasmids. Proc Nat! Acad Sci USA 88: 11398-11402
Meilhoc E, Masson JM, Teissie J (1990) High efficiency transformation of intact yeast cells
by electric field pulses. Bio/Technology 8: 223-227
Meyer J (1993) Galaktokinase - ein regulatorisches Protein des Laktose/Galaktose-
Metabolismus in Hefe. Heinrich-Heine-Universitat Diisseldorf, Dissertation
Meyer J, Walker-Jonah A, Hollenberg CP (1991) Galactokinase encoded by GALl is a
bifunctional protein required for induction of the GAL genes in Kluyveromyces lactis and
is able to suppress the gal3 phenotype in Saccharomyces cerevisiae. Mol Cell BioI 11:
5454-5461
Miller J (1972) In: Experiments in molecular biology. Cold Spring Harbor Laboratory, Cold
Spring Harbor, New York, pp 352-355
Morrow BE, Ju Q, Warner JR (1993) A bipartite DNA binding domain in Rebip of yeast. Mol
Cell BioI 13: 1173-1182
Mulder W, Scholten IRJM, van Roon H, Grivell LA (1994a) Isolation and characterisation of
the linked genes, APA2 and OCR7, coding for Ap4A phosphorylase II and the 14kDa
subunit VII of the mitochondrial bcl-complex of the yeast Kluyveromyces lactis.
Biochem Biophys Acta 1219: 719-723
Mulder W, Scholten IRJM, De Boer RW, Grivell LA (1994b) Sequence of the HAP3 tran-
scription factor of K. lactis predicts the presence of a novel4-cystein zinc-finger motif.
Mol Gen Genet 245: 96-106
Mulder W, Scholten IHJM, N agelkerken R, Grivell LA (1994c) Isolation and characterisation

of the linked genes, FPSl and QCR8, coding for farnesyl-diphosphate synthase and the
11 kDa subunit VII of the mitochondrial bel-complex of the yeast Kluyveromyces lactis.
Biochem Biophys Acta 1219: 713-718
Mulder W, Winkler RA, Scholten IHJM, Zonneveld BJM, De Winde GH, Steensma HY,
Grivell LA (1994d) Centromers Promotor Factors (CPFl) of the yeasts Saccharomyces
cerevisiae and Kluyveromyces lactis are functionally exchangeable despite low overall
homology. Curr Genet 26: 198-207
Mylin LM, Gerardot q, Hopper JE, Dickson RC (1991) Sequence conservation in the Sac-
charomyces and Kluyveromyces GAllI transcription activators suggest funcional do-
mains. Nucleic Acids Res 19: 5345-5350
Na JG, Hampsey M (1993) The Kluyveromyces gene encoding the general transcription
factor IIB: structural analysis and expression in Saccharomyces cerevisiae. Nucleic Acids
Res 21: 3413-3417
Nehlin JO, Carlberg M, Ronne H (199l) Control of yeast GAL genes by MIG1 repressor: a
transcriptional cascade in the glucose response. EMBO J 10: 3373-3377
Nguyen C, Bolotin-Fukuhara M, Wesolowski -Louvel M, Fukuhara H (1995) The respiratory
system of Kluyveromyces lactis escapes from HAP2 control. Gene 152: 113-115
Niwa 0, Sakaguchi K, Gunge N (198l) Curing of the killer deoxyribonucleic acid plasmids
of Kluyveromyces lactis. J Bacteriol148: 988-990
Oberye EHH, Maurer K, Mager WH, Planta RJ (1993) Structure of the ABF1-homologue
from Kluyveromyces marxianus. Biochim Biophys Acta 1173: 233-236
Ogawa Y, Tatsumi H, Murakami S, Ishida Y, Murakami K, Masaki A, Kawabe H, Arimura H,
Nakano E, Motai H, Toh-e A, (1990) Secretion of Aspergillus oryzae protease in an
osmophilic yeast, Zygosaccharomyces rouxii. Agric Bioi Chern (Tokyo) 54: 2521-2529
Osinga KA, De Haan M, Christianson T, Tabak HF (1982) A nonanucleotide sequence
involved in promotion of ribosomal RNA synthesis and RNA priming of DNA replica-
tion in yeast. Nucleic Acids Res 10: 7993-8006
Pan T, Halvorsen Y-D, Dickson RC, Coleman JE (1990) The transcription factor LAC9 from
Kluyveromyces lactis like GAL4 from Saccharomyces cerevisiae forms a Zn(II)2 Cys6
binuclear cluster. J BioI Chern 265: 21427-21429
Poch 0, L'Hote H, Dallery V, Debeaux F, Fleer R, Sodoyer R (1992) Sequence of the
Kluyveromyces lactis f3-galactosidase: comparison with prokaryotic enzymes and sec-
ondary structure analysis. Gene 118: 55-63
of species within the genera Schwanniomyces' Saccharomyces, Debaryomyces and
Pichia. Microbiol Rev 42: 162-193
Prior C (1993) Caracterisation genetique et moIeculaire de genes impliques dans Ie
metabolisme de glucose chez Kluyveromyces lactis. Identification d'un gene de
transporteur de glucose chez Saccharomyces cerevisiae. PhD Thesis, University of Paris
XI, Paris
Prior C, Fukuhara H, Blaisonneau J, Wesolowski-Louvel M (1993a) Low-affinity glucose
carrier gene LGT1 of Saccharomyces cerevisiae, a homolog of the Kluyveromyces lactis
RAG1 gene. Yeast 9: 1373-1377
Prior C, Mamessier P, Fukuhara H, Chen X-J, Wesolowski-Louvel M (1993b) The hexoki-
nase gene is required for the transcriptional regulation of the glucose transporter gene
RAGl in Kluyveromyces lactis. Mol Cell Bioi 13: 3882-3889
Ragnini A, Fukuhara H (1988) Mitochondrial DNA of the yeast Kluyveromyces: guanine-
cytosine-rich sequence clusters. Nucleic Acids Res 16: 8433-8442
Ragnini A, Fukuhara H (1989) Genetic instability of an oligomycin resistant mutation in
yeast is associated with an amplification of a mitochondrial DNA segment. Nucleic Acids
Res 17: 6927-6937
Riley MI, Dickson RC (1984) Genetic and biochemical characterization of the galactose gene
cluster in Kluyveromyces lactis. J Bacteriol158: 705-712
Riley MI, Hopper JE, Johnston SA, Dickson RC (1987a) GAL4 of Saccharomyces
cerevisiae activates the lactose-galactose regulon of Kluyveromyces lactis and
creates a new phenotype: glucose repression of the regulon. Mol Cell BioI 7: 780-
786
Riley MI, Sreekrishna K, Bhairi S, Dickson RC (1987b) Isolation and characterization of
mutants of Kluyveromyces lac tis defective in lactose transport. Mol Gen Genet 208: 145-
151
Romanos MA, Boyd A (1988) A transcriptional barrier to expression of cloned toxin genes
of the linear plasmid k1 of Kluyveromyces lactis: evidence that native k1 has novel
promoters. Nucleic Acids Res 16: 7333-7350
8: 423-488
Ruzzi M, Breunig KD, Ficca AG, Hollenberg CP (1987) Positive regulation of the yeast 13-
galactosidase gene from Kluyveromyces lactis is mediated by a UAS element showing
homology to the GAL upstream activation site of Saccharomyces cerevisiae. Mol Cell BioI
7:991-997
Saliola M, Falcone C, Shuster JR (1990) The alcohol dehydrogenase system in the yeast
Kluyveromyces lactis. Yeast 6: 193-204
Saliola M, Gonnella R, Mazzoni C, Falcone C (1991) Two genes encoding putative mitochon-
drial alcohol dehydrogenases are present in the yeast Kluyveromyces lactis. Yeast 7: 391-
400
Salmeron JM, Johnston SA (1986) Analysis of the Kluyveromyces lactis positive regulatory
gene LAC9 reveals functional homology to, but sequence divergence from the Saccharo-
myces cerevisiae GAL4 gene. Nucleic Acids Res 19: 7767-7781
Salmeron JM, Langdon SD, Johnston SA (1989) Interaction between Transcriptional
Activator Protein LAC9 and Negative Regulatory Protein GAL80. Mol Cell BioI 9: 2950-
2956
Sanchez M, Iglesias FJ, Santamaria C, Dominguez A (1993) Transformation of
Kluyveromyces lactis by electroporation. Appl Environ Microbiol59: 2087-2092
Sanders JPM, Weijers PJ, Groot GSP, BorstP (1974) Properties of mitochondrial DNA from
Kluyveromyces lactis. Biochim Biophys Acta 374: 136-144
Schaffrath K, Stark MJR, Gunge N, Meinhardt F (1992) Kluyveromyces lactis killer system:
ORFl of pGKL2 has no function in immunity expression and is dispensable for killer
plasmid replication and maintenance. Curr Genet 21: 357-363
Shain DH, Salvadore C, Denis CL (1992) Evolution of the alcohol dehydrogenase (ADH)
genes in yeast: characterization of a fourth ADH in Kluyveromyces lactis. Mol Gen Genet
232: 479-488
Sharp PM, Li W-H (1987) Codon adaptation index, a measure of directional synonymous
codon usage bias, and its potential application. Nucleic Acids Res 15: 1281-1295
Sheetz RM, Dickson RC (1980) Mutations affecting synthesis of f3-galactosidase activity in
the yeast Kluyveromyces lactis. Genetics 95: 877-890
Sheetz RM, Dickson RC (1981) LAC4 is the structural gene for J3-galactosidase in
Kluyveromyces lactis. Genetics 98: 729-745
Sherman F, Fink GR, Lawrence CW (1974) Methods in yeast genetics. Laboratory manual.
Cold Spring Harbor Laboratory, Cold Spring Harbor, New York
Sherman F, Fink GR, Hicks JB (1982) Methods in yeast genetics. Laboratory manual. Cold
Spring Harbour Laboratory, Cold Spring Harbor, New York
Shuster JR (1990) Kluyveromyces lactis glyceraldehyde-3-phosphate dehydrogenase and
alcohol dehydrogenase-l genes are linked and divergently transcribed. Nucleic Acids
Res 18: 4271
Shuster JR (1991) Gene expression in yeast: protein secretion. Curr Opinion Biotechnol2:
685-690
Shuster JR, Moyer D, Irvine B (1987) Sequence of the Kluyveromyces lactis URA3 gene.
Sidenberg DG, Lachance M-A (1986) Electrophoretic isoenzyme variation in Kluyveromyces

population and revision of Kluyveromyces marxianus (Hansen) van der Walt. Int J Syst
Bacteriol36: 94-102
Skelly PJ, Hardy CM, Clark-Walker GD (1991) A mobile group II intron of a naturally
occurring rearranged mitochondrial genome in Kluyveromyces lactis. Curr Genet 20:
115-120
Sor F (1988) A computer program allows the separation of a wide range of chromosome
sizes by pulsed field gel electrophoresis. Nucleic Acids Res 16: 4853-4863
Sor F (1992) Electrophoretic technique for chromosome separation. Methods Mol Cell BioI
3:65-70
Sor F, Fukuhara H (1985) Structure of a linear plasmid of the yeast Kluyveromyces lactis:
compact organization of the killer genome, Curr Genet 9: 147-155
Sor F, Fukuhara H (1989) Analysis of chromosome patterns of the genus Kluyveromyces.
Yeast 5: 1-10
Sor F, Wesolowski M, Fukuhara H (1983) Inverted terminal repetitions of the two linear
DNA associated with the killer character of the yeast Kluyveromyces lactis. Nucleic Acids
Res 11: 5037-5044
Sreekrishna K, Dickson RC (1985) Construction of strains of Saccharomyces cerevisiae that
grow on lactose. Proc Natl Acad Sci USA 82: 7909-7913
Sreekrishna K, Webster TD, Dickson RC (1984) Transformation of Kluyveromyces lactis
with the kanamycin (G418) resistance gene of Tn903. Gene 28: 73-81
Stam JC, Kwakrnan J, Meijer M, Stuitje AR (1986) Efficient isolation of the linear plasmid of
Kluyveromyces lactis: evidence for location and expression in the cytoplasm and charac-
terization of their terminally bound proteins. Nucleic Acids Res 14: 6871-6884
Stark MJR (1988) Resolution of sequence discrepancies in the ORF1 region of the
Kluyveromyces lactis plasmid kl. Nuclec Acids Res 16: 771
Stark MJR, Boyd A (1986) The killer toxin of Kluyveromyces lactis: characterization of the
toxin subunits and identification of the genes which encode them. EMBO J 5: 1995-2002
Stark MJR, Milner JS (1989) Cloning and analysis of the Kluyveromyces lactis TRPI gene: a
chromosomal locus flanked by genes encoding inorganic pyrophosphatase and histone
H3. Yeast 5: 35-50
Stark MJR, Mileham AJ, Romanos MA, Boyd A (1984) Nucleotide sequence and transcrip-
tion analysis of a linear DNA plasmid associated with the killer character of the yeast
Kluyveromyces lactis. Nucleic Acids Res 12: 6011-6030
Stark MJR, Boyd A, Mileham AJ, Romanos MA (1990) The plasmid-encoded killer system of
Kluyveromyces lactis: a review. Yeast 6: 1-29
Steensma HY, de Jongh FCM, Linnekamp M (1988) The use of electrophoretic karyotypes in
the classification of yeasts Kluyveromyces marxianus and K. lactis. Curr Genet 14: 311-
317
Sugisaki Y, Gunge N, Sakaguchi K, Tamasaki M, Tamaru G (1983) Kluyveromyces lactis
killer toxin inhibits adenylate cyclase of sensitive yeast. Nature 304: 464-466
Sugisaki Y, Gunge N, Sakaguchi K, Yamasaki M, Tamura G (1984) Characterization of a
novel killer toxin encoded by a double-stranded linear DNA plasmid of Kluyveromyces
lactis. Eur J Biochem 141: 241-245
Sugisaki Y, Gunge N, Sakaguchi K, Yamasaki M, Tamaru G (1985) Transfer of DNA killer
plasmids from Kluyveromyces lactis to Kluyveromyces jragilis and Candida
pseudotropicalis. J Bacteriol164: 1373-1375
Tanguy-Rougeau C (1991) Plasmides killer de la levure Kluyveromyces lactis: etude du gene
nucleaire KEXI implique dans la maturation de la toxine killer; etude fonctionnelle de
genes des plasmides killer par modification in vivo. PhD Thesis, University of Paris XI,
Paris
Tanguy-Rougeau C, Wesolowski-Louvel M, Fukuhara H (1988) The Kluyveromyces lactis
KEXI gene encodes a subtilisin-type serine proteinase. FEBS Lett 234: 464-470
Tanguy-Rougeau C, Chen C-J, Wesolowski-Louvel M, Fukuhara H (1990) Expression of a

foreign KmR gene in linear killer DNA plasmids in yeast. Gene 91: 43-50
Thompson A, Oliver SG (1986) Physical separation and functional interaction of
Kluyveromyces lactis and Saccharomyces cerevisiae ARS elements derived from killer
plasmid DNA. Yeast 2: 179-191
Tingle M (1967) Biochemical and genetic studies in Saccharomyces lactis. PhD Thesis,
University of Wisconsin Madison
Tingle M, Halvorson HO (1972) Mutants in Saccharomyces lactis controlling both f3-glucosi-
dase and J3-galactosidase activities. Genet Res 19: 27-32
Tingle M, Herman A, Halvorson HO (1968) Characterization and mapping of histidine
genes in Saccharomyces lactis. Genetics 58: 361-371
Tokunaga M, Wada N, Hishinuma F (1987) Expression and identification of immunity
determinants on linear DNA killer plamsids pGKLl and pGKL2 in Kluyveromyces lactis.
Tokunaga M, Wada N, Hishinuma F (1988) A novel yeast secretion signal isolated from 28K
killer precursor protein encoded on the linear DNA plasmid pGKLl. Nucleic Acids Res
16: 7499-7511
Tokunaga M, Kawamura A, Hishinuma F (1989) Expression of pGKL killer 28K subunit in
S. cerevisiae: identification of 28K subunit as a killer protein. Nucleic Acids Res 17: 3435-
3446
Tommasino M (1991) Killer system of Kluyveromyces lactis: the open reading frame 10 of
the pGKL2 plasmid encodes a putative DNA binding protein. Yeast 7: 245-252
Tommasino M, Ricci S, Galeotti CL (1988) Genome organization of the killer plasmid
pGKL2 from Kluyveromyces lactis. Nucleic Acids Res 16: 5863-5877
Trueman LJ, Astolfi S, Gardner DCJ, Oliver S (1990) Isolation and characterzation of au-
tonomously replicating sequences from the lactose-fermenting yeast, Kluyveromyces
lactis. Yeast 6: S592
Van Aelst L, Hohmann S, Bulaya B, De Koning W, Sierkstra L, Neves MJ, Luyten K, Alijo R,
Ramos J, Coccetti P, Martegani E, De Magalhaes-Rocha NM, Lopes Brandao R, Van Dijck
P, Vanhalewyn M, Durnez P, Jans AWH, Thevelein JM (1993) Molecular cloning of a
gene involved in glucose sensing in the yeast Saccharomyces cerevisiae. Mol Microbiol8:
927-943
Van den Berg JA, Van der Laken KJ, Van Ooyen AJJ, Renniers CHM, Rietveld K, Schaap A,
Brake AJ, Bishop RJ, Schultz K, Moyer D, Richman M, Shuster JR (1990) Kluyveromyces
as a host for heterologous gene expression: expression and secretion of prochymosin.
Bio/Technology 8: 135-139
Van der Walt JP (1970) Kluyveromyces lactis. In: Lodder J (ed) The yeasts: a taxonomical
study. North-Holland Publishing Co., Amsterdam, pp 316-378
Van der Walt JP, Johannsen E (1979) A comparison of interfertility and in vitro DNA-DNA
ressociation as criteria for speciation in the genus Kluyveromyces. Antonie Leeuwenhoek
Vasquez D (1979) Inhibitors of protein synthesis. Springer, Berlin Heidelberg New York,
p 312
Vaughan-Martini A, Martini A (1987) Taxonomic revision of the yeast genus Kluyveromyces
by nuclear deoxyribonucleic acid reassociation. Int J Syst Bacteriol37: 380-385
Verbeet MP, van Heerikhuizen H, Klootwijk J, Fontijn RD, Planta RJ (1984) Evolution of
yeast ribosomal DNA: molecular cloning of the rDNA units of Kluyveromyces lactis and
Hansenula wingeii and their comparison with the rDNA units of other
Saccharomycetoideae. Mol Gen Genet 195: 116-125
Viola AM, Ficarelli P, Goffrini P, Galeotti CL, Ferrero I (1992) A Kluyveromyces lactis gene
that complements the S. cerevisiae opl mutation. Yeast 8: S446
Viovy JL, Miomandre F, Miquel M-C, Caron F, Sor F (1992) Irreversible trapping of DNA
during crossed-field gel electrophoresis. Electrophoresis 13: 1-6
Volkert F, Wilson C, Broach JR (1989) Deoxyribonucleic acid plasmids in yeasts. Microbiol

Rev 53: 299-317
Webster TD, Dickson RC (1988) The organization and transcription of the galactose gene
cluster of Kluyveromyces lactis. Nucleic Acids Res 16: 8011-8028
Weirich J (1992) Isolierung und Charakterisierung des Glukose Transporters RAG1 aus
Kluyveromyces lactis und Untersuchungen zu dessen Rolle bei der Glukoserepression
der f3-Galaktosidase. PhD Thesis Heirich-Heine Universitat, Dusseldorf
Wesolowski M, Algeri A, Fukuhara H (1981) Gene organization of the mitochondrial DNA
of yeasts: Kluyveromyces lactis and Saccharomycopsis lipolytica. CUff Genet 3: 157-162
Wesolowski M, Algeri A, Goffrini P, Fukuhara H (1982a) Killer DNA plasmids of the yeast
Kluyveromyces lactis. I. Mutation affecting the killer phenotype. CUff Genet 5: 191-197
Wesolowski M, Dumazert P, Fukuhara H (1982b) Killer DNA plasmids of the yeast
Kluyveromyces lactis. II. Restriction endonuclease maps. Curr Genet 5: 199-203
Wesolowski M, Algeri A, Fukuhara H (1982c) Killer DNA plasmids of the yeast
Kluyveromyces lac tis. III. Plasmid recombination. Curr Genet 5: 205-208
Wesolowski-Louvel M, Fukuhara H (1990) A palindromic mutation of the linear killer
plasmid k2 of yeast. Nucleic Acids Res 18: 4877-4882
Wesolowski-Louvel M, Goffrini P, Ferrero I (1988a) The RAG2 gene of the yeast
Kluyveromyces lac tis codes for a putative phosphoglucose isomerase. Nucleic Acids Res
16: 8714
Wesolowski-Louvel M, Tanguy-Rougeau C, Fukuhara H (1988b) A nuclear gene required
for the expression of the linear DNA-associated killer system in the yeast Kluyveromyces
lactis. Yeast 4: 71-81
Wesolowski-Louvel M, Prior C, Mammesier P, Goffrini P, Ferrero I, Sor F, Fukuhara H
(1990) Kluyveromyces lactis and its plasmids. In: Heslot H, Davies J, Florent J, Bobichon
L, Durand G, Penesse L (eds) Proceedings of the 6th International Symposium on
Genetics of Industrial Microorganisms (GIM90). Societe Fran<;:aise de Microbiologie,
Paris, vol 1, pp 519-532
Wesolowski-Louvel M, Goffrini P, Ferrero I, Fukuhara H (1992a) Glucose transport in the
yeast Kluyveromyces lactis. I. Properties of an inducible low-affinity glucose transporter
gene. Mol Gen Genet 33: 89-96
Wesolowski-Louvel M, Prior C, Bornecque D, Fukuhara H (1992b) Rag- mutations involved
in glucose metabolism in yeast: isolation and genetic characterization. Yeast 8: 711-719
White JH, Butler AR, Stark MJR (1989) Kluyveromyces lactis toxin does not inhibit yeast
adenylate cyclase. Nature 341: 666-668
Wickerham LJ (1951) Taxonomy of yeasts. US Department of Agriculture Technical Bulle-
tin, Washington, No 1029
Wilson C, Fukuhara H (1991) Distribution of mitochondrial r1-type introns and the associ-
ated open reading frame in the yeast genus Kluyveromyces. Curr Genet 19: 163-167
Wilson C, Ragnini C, Fukuhara H (1989) Analysis of the regions coding for transfer RNA
genes in Kluyveromyces lactis mitochondrial DNA. Nucleic Acids Res 17: 4485-4491
Wilson DW, Meacock PA (1988) Extranuclear gene expression in yeast: evidence for a
plasmid-encoded RNA polymerase of unique structure. Nucleic Acids Res 16: 8097-8112
Witte MM, Dickson RC (1990) The C6 Zinc finger and adjacent amino acids determine
DNA-binding specificity and affinity in the yeast activator protein LAC9 and PPRl. Mol
Cell BioI 10: 5128-5137
Wray LV Jr, Witte MM, Dickson RC, Riley MI (1987) Characterization of a positive regula-
tory gene, LAC9, that controls induction of the lactose-galactose regulon of
Kluyveromyces lactis: structural and functional relationships to GAL4 of Saccharomyces
cerevisiae. Mol Cell BioI 7: 1111-1121
Yeh P, Landais D, Lemaitre M, Maury I, Crenne JY, Becquart J, Murry-Brelier A, Boucher F,
Montay G, Fleer R (1992) Design of yeast-secreted albumin derivatives for human
therapy-biological and antiviral properties of a serumalbumin-CD4 genetic conjugate.
Proc Natl Acad Sci USA 89: 1904-1908
Yuan YO, Stroke IL, Fields S (1992) STE12 and MAT al homologs from Kluyveromyces
lactis: implications for the role of STE12 in the activation of a-specific genes. Yeast 8:
S394
Zachariae W, Breunig KD (1993) Expression of the transcriptional activator LAC9
(K1GAL4) in Kluyveromyces lactis is controlled by autoregulation. Mol Cell BioI 13:
3058-3066
Zachariae W, Kuger P, Breunig KD (1993) Glucose repression oflactose/galactose metabo-
lism in Kluyveromyces lactis is determined by the concentration of the transcriptional
activator LAC9 (KIGAL4). Nucleic Acids Res 21: 69-77
Zaror I, Marcus F, Moyer DL, Tung J, Shuster J (1993) Fructose-1,6-bisphosphatase of the
yeast Kluyveromyces lactis. Eur J Biochem 212: 193-199
Zenke F, Zachariae W, Lunkes A, Breunig KD (1993) Gal80 proteins of Kluyveromyces lactis
and Saccharomyces cervisiae are highly conserved but contribute differently to glucose
repression of the galactose regulon. Mol Cell Bioi 13: 7566-7576
Zennaro E, Falcone F, Frontali L, Puglisi PP (1977) Dependence of cytoplasmic on mito-
chondrial protein synthesis in K. lactis CBS 2360. 1. Biochemical analysis. Mol Gen Genet
150: 137-140
Zhang Y-P, Chen X-J, Li Y-Y, Fukuhara H (1992) LEU2 gene homolog in Kluyveromyces
lactis. Yeast 8: 801-804
CHAPTER 6
Pichia pastoris
Koti Sreekrishna and Keith E. Kropp
1
History of Pichia pastoris
Interest in the study of nonconventional yeasts (yeasts other than Saccharomyces

cerevisiae and Schizosaccharomyces pombe) has increased dramatically in the past
few years (Reiser et al. 1990). One such category is methylotrophic yeasts (Wegner
and Harder 1986; Harder et al. 1986), e.g., Pichia pastoris, Hansanula polymorpha,
Candida boidinii, etc. Methylotrophic yeasts have the ability to use methanol as a
sole source of carbon and energy. Adaptation to growth on methanol is associated
with induction of methanol oxidase, MOX (also referred to as alcohol oxidase,
AOX), dihydroxy acetone synthase DAS, and several other enzymes involved in
methanol metabolism. The most spectacular increase, however, is seen with alco-
hol oxidase, which is virtually absent in glucose-grown cells, but can account for
over 30% of the cell protein in methanol-grown cells. Extensive proliferation of
peroxisomes, accounting for over 80% of the cell volume, is also observed in
methanol-grown cells (Veenhuis et al. 1983). Due to these characteristics,
methylotrophic yeasts have gained the attention of biochemists, molecular biolo-
gists, cell biologists, biotechnologists, microbiologists, and chemists in academics
and industry.
The present chapter focuses on one of the methylotrophic yeasts, namely P.
pastoris. This yeast was initially developed by Phillips Petroleum Company for the
production of single-cell protein for feed stock. A very efficient ultra-high cell
density (>130g dry cell weight per liter) fermentation process with high biomass
productivity (>lOgIliter-hour) was developed through meticulous fermentation
research (Wegner 1983). Unfortunately, the economics of this process, while im-
pressive from a fermentation standpoint (approximately $5 per pound of protein),
was clearly an order of magnitude higher in comparison to the cost of a pound of
soybean. Following this setback, Phillips Petroleum Company invested its efforts
in developing this yeast as an expression system for the production of recombinant
proteins, and this has proved to be a worthwhile endeavor (Wegner 1990;
Romanos et al. 1992; Cregg et al. 1993).
Hoechst Marion Roussel Inc., 2210 E. Galbraith Road, Cincinnati, Ohio 45215, USA
204 K. Sreekrishna and K.E. Kropp
Since 1988, several pharmaceutical and biotechnology companies have

licensed the P. pastoris expression technology. At least three products produced
with this technology (Hepatitis B surface antigen, human serum albumin, and
insulin-like growth factor-I) are being pursued for commercialization and
many more are in the pipeline. Since 1990, Phillips Petroleum Company has made
this technology available at no actual cost for research use to universities and
nonprofit organizations through a materials transfer agreement. More recently,
however, the system can be readily obtained for a nominal fee from Invitrogen
Corporation, San Diego, California, USA. However, for commercial purposes, this
technology can be licensed from Research Corporation Technologies, Tucson,
Arizona, USA.
In addition to its extensive use for the expression of heterologous proteins, P.
pastoris is also being developed as a model organism for molecular analysis of
peroxisome biogenesis (Gould et al. 1992; Liu et al. 1992).
The primary intent of this chapter is to introduce investigators to practical
techniques for manipulating P. pastoris with emphasis on its use for expression of
heterologous proteins.
2
Growth and Storage
2.1
Shake Flask, Shake Tube, Plate, and Slant Cultures
P. pastoris grows well both in liquid and on solid media, on a wide variety of simple
carbon sources including glucose, glycerol, fructose, sorbitol, ethanol, methanol,
alanine, lysine, succinate, ethyl amine, cadaverine, glucitol, mannitol, L-rhamnose,
and trehalose. The doubling time is dependent on the carbon source used and
is typically 90 min on glucose and approximately 6 h on methanol. In solid
media it forms white or cream-colored nonfilamentous colonies. Multilateral
buds are noticed under light microscopy. The natural habitats of P. pastoris are the
oak tree and packaged foods. The compositions of the various P. pastoris growth
media (MD, MDH, MGy, MGyH, MM, MMH, YPD) are given in Sects. 2.2.2 and
2.2.3.
The growth temperature is 30°C with shaking (250rpm) for liquid cultures
and with incubation for plates and slants. When minimal methanol (MM)
plates are used as growth medium, 100,ul of 100% methanol (filter-sterilized)
is added to the plate lid once every day to compensate for the methanol lost
due to evaporation (the plate is placed inverted in the incubator). When MM
liquid medium is used, methanol is added to a final concentration of 0.5% (v/v)
every 2 days to compensate for methanol lost due to evaporation. Because
P. pastoris grows well under a wide pH range of 3-6.5, buffering the growth
medium is generally unnecessary, except under some special circumstances, as
noted under Sect. 7.4. For large-scale, high cell-density cultivation of P. pastoris,
refer to Sect. 5.
6. Pichia pastoris 205
P. pastoris as such does not grow on galactose, arabinose, ribose, maltose,

sucrose, lactose, raffinose, melibiose, cellulose, or starch. However, it will grow on
autoclaved sucrose, due to breakdown of sucrose into glucose and fructose. Also,
P. pastoris strains transformed with the sucrase (invertase) gene SUC2 of Saccha-
romyces cerevisiae efficiently grow on sucrose with high growth yields
(Sreekrishna et al. 1987).
2.2
Media
2.2.1
Stock Solutions
Note. For filter sterilization of various solutions and liquids, filter wares (dispos-
able or reusable types) equipped with cellulose acetate or cellulose nitrate mem-
branes (pore size 0.2 to 0.22,urn) from one of the several manufacturers (N algene
Company, Rochester, New York, USA; Costar Corporation, Cambridge, Massachu-
setts, USA; Corning Glass Works, Corning, New York, USA) can be used. For filter
sterilization of methanol and methanol-containing media, only cellulose acetate
membranes (0.2-0.22.um) are suitable, because methanol does not filter through
cellulose nitrate membranes of pore size 0.2.um.
lOx YNB: Dissolve 13.4 g of yeast nitrogen base without amino acids (YNB, Difco
labs., Detroit, Michigan, USA) in 100 ml of water (heat if necessary) and filter-
sterilize. This solution can be stored for over a year at 4°C.
~OOx B: Dissolve 20 mg of d-biotin (Sigma Chemicals, St. Louis, Missouri, USA) in
100 ml of water and filter sterilize.
IOOx H: Dissolve 400 mg L-histidine in 100 ml of water (heat if necessary) and filter
sterilize.
lOx D: Dissolve 20 g of D-glucose in 100 ml water. Autoclave for 15 min or filter
sterilize. Stores well for years at room temperature.
lOx GY: Mix 10 ml of glycerol with 90 ml of water. Filter sterilize. Stores well for
years at room temperature.
lOx M: Mix 5ml of methanol (100%) with 95ml of water. Filter sterilize and store
at 4°C.
100% methanol: Filter sterilize pure methanol (100%). Store at room temperature
in a fireproof cabinet.
2.2.2
Minimal Media Compositions
MD: Mix 100ml of lOx YNB, 2ml of 500x B, and 100ml of lOx D with 800ml of
autoclaved water (include 15 g Bacto agar for plates).
MM: Mix lOOml of lOx YNB, 2ml of 500x B, and 100ml of lOx M with 800ml of
autoclaved water (include 15g Bacto agar for plates).
MGY: Mix lOOml of lOx YNB, 2ml of 500x B, and 100ml of lOx GY with 800ml
autoclaved water (include l5g Bacto agar for plates).
All these liquid media and plates store well for several weeks at 4°C.
Minimal media with other carbon sources (such as D-sorbitol, D,L-alanine) are
prepared by using the desired carbon source at 10 gil in place of glucose in MD.
Minimal media containing a mixture of carbon sources can also be prepared by
combining two or more desired substrates in the growth medium.
2.2.3
Supplemental Minimal Media Compositions
Minimal media are supplemented with necessary supplemental nutrients such

as amino acids, depending on the specific requirement of a given strain. For
example, P. pastoris strains GSl15 and KM71, commonly used in molecular genetic
manipulations, are auxotrophic for histidine. Such strains will grow in minimal
media only in the presence of supplemental histidine. However, once transformed
with HIS4 (histidinol dehydrogenase gene), they readily grow in the absence of
histidine.
The composition of supplemental minimal histidine media (suitable for histi-
dine auxotrophic strains such as GS1l5) is as follows. Other supplemental media
can be prepared depending on the need of a particular strain in use.
MDH: Mix 100mi of lOx YNB, 2ml of 500x B, 100ml of lOx D, and 10mi of 100x
H with 790ml of autoclaved water (include 15 g agar for plates).
MMH: Mix 100 ml of lOx YNB, 2 ml of 500x B, 100 ml of lOx M, and 10 ml of 100x
H with 790ml of autoclaved water (include 15 g agar for plates).
MGyH: Mix 100mi of lOx YNB, 2ml of 500x B, 100mi of lOx GY, 10ml of 100x H
with 790ml of autoclaved water (include 15 g agar for plates).
All of these liquid media and plates store well for several weeks at 4°C.
Supplemental minimal histidine media with other carbon sources is prepared
by adding a similar amount of histidine as above to the minimal media with the
desired carbon source.
2.2.4
Complex Medium Composition
YPD: Dissolve 109 of Bacto yeast extract, 20 g of peptone, and 20 g of glucose in

lOOOml of water (also include 15 g Bacto agar for slants and plates) and autoclave
for 20 min.
2.3
Storage
For medium-term storage, P. pastoris should be kept at 4°C in complex (YPD)

liquid medium or YPD agar slants. Cells are cultured initially on a desired
media (selective minimal methanol, dextrose, or glycerol media such as MM,
MD, or MGY for transformants) and then transferred to YPD. Most of the
commonly used strains can be stored in such media for over 1 year at 4°C.
However, the protease-deficient strains (SMD1163, SMD1165, and SMD1168)
should be restreaked or regrown every 2-4 weeks, because they do not keep
well.
For long-term storage, cells are suspended at an O.D60onm of 50-100 in YPD
containing 50% glycerol. The cells are frozen at -80°C or preferably kept in a liquid
nitrogen freezer. Cells stored in these ways have remained viable for several years.
3
Available Strains
NRRL Y-11430-SC5 (wild type; Sreekrishna et al. 1987)

GS115 (his4) - this strain is also known as GTS115 (Sreekrishna et al. 1987)
KM71 (his4, aoxl::ARG4; Cregg and Madden 1988)
PPFI (his4, arg4; J.M. Cregg, pers. comm.)
Protease-deficient strains (derived by protease A (PEP4) and/or Protease B
(PRB) gene disruption (M.A. Gleeson, pers. comm.):
SMD1163 (his4, pep4, prBl)
SMD1165 (his4, prBl)
SMD1168 (his4, pep4)
4
Genetic Techniques
4.1
Life Cycle
The members of the ascomycetous genus Pichia Hansen are distinguished from
most other yeasts by the occurrence of hat-shaped spores. Investigations of the
DNA/DNA reassociation demonstrated a narrow relatedness to members of
the genus Hansenula. Therefore, many of these yeasts are included now also in the
genus Pichia (Kurtzman 1984a,b; Barnett et al. 1990).
In most cases, the life cycle of the Pinus species is unknown. The protocols given
here are for the genetic analysis of P. pastoris (M.E. Digan, pers. comm.; see also
Digan and Lair 1986).
4.2
Mating and Sporulation
P. pastoris strains that are available are homothallic (switch mating types), thus it
is essential to use selection plates against both parents used in the genetic cross
prior to sporulation of mated cells. Appropriate minimal plates are used to select
against parents based on amino acid or nucleotide or carbon source requirements.
Cultures form four-spored asci, but the viability of the spores is low. Tetrad
analysis is possible with a few asci. However, the segregation frequencies do not fit
the expected 2+: 2- ratio. In most cases the spores are phenotypically wild type. The
low spore viability and the aberrant segregation ratios suggest that the establish-
ment of a mating system which can be used for genetic analysis requires further
research, including a backcrossing program with several strains and mutants and,
perhaps, the search for heterothallic strains.
4.2.1
Mating
1. Resuspend single colonies of each of the two parental strains in 100,u1 ofYPD.
Mix the parental strains thoroughly together, and spread on presporulation
plates (see below for composition). Incubate for 24h at 30°C.
2. Replica-plate onto sporulation plates (see below for composition). Incubate
for 24 h at 30°C.
3. Replica-plate onto plates which select against both parental types and allows
survival of only the progeny of cross-mated cells. Incubate at 30°C until
colonies appear.
YPD (see Sect. 2.2.4)
Presporulation medium: Mix 50 g glucose, 20 g peptone, 10 g yeast extract, 5 g
agar, and 23 g nutrient agar in 1000rnl water, and autoclave.
Sporulation medium: Mix 5 g NaOAc (anhydrous), 10 g KCI (anhydrous), and 20 g
agar in 1000 rnl water, and autoclave.
4.2.2
Sporulation
4. Disperse single colonies from step 3 in YPD. Plate on presporulation plates

and after 24h of incubation at 30°C, replica-plate onto sporulation plates.
Incubate at 30°C for 3-5 days. At this point, asci can be dissected directly, or
the mixture of cells and spores on the SPA plate can be digested extensively
with cell wall-degrading enzymes to kill the vegetative cells as described below.
4.2.3
Random Spore Preparation
5. Wash sporulation plates with sterile water to harvest tlle spores.

6. P;ch;a pastor;s 209
6. Wash the spore suspension twice with 0.1 M sodium phosphate buffer, pH 7.4.
7. Resuspend spores in 3m! ofo.lM phosphate buffer, pH 7.4. Add Zymolyase
lOOT, Glusulase, and j3-mercaptoethanol to final concentrations ofO.5mg/m!,
2%v/v, and O.I%v/v respectively. Incubate for 5h at 30 C with occasional
D
shaking.
8. Sonicate the spore suspension three times for 15 s and harvest by centrifuga-
tion at 3000 g for 10 min at room temperature.
Note. Spores can be quantified under a light microscope by counting an
aliquot of spore suspension placed in a counting chamber.
9. Examine spores microscopically for clumps. If clumping appears to be exces-
sive, repeat step 4.
10. Plate the spores on YPD plates at approximately 200 spores/plate or use a
micro-manipulator to separate single spores on YPD plates.
11. Let spores germinate at 30 DC on YPD and screen for the desired phenotype{ s)
by replica-plating onto two selective plates, each of which selects against one
or the other parent in the cross.
5
Fermentation Process
The following paragraphs describe general methods for production of biomass as

well as for the production of heterologous proteins using Mutt and Mut- cells in
both continuous and batch modes of fermentation. The process described here can
be scaled up (>1000 liters) or scaled down (0.2l) as desired. Fermentation can be
conducted over a wide pH range (3.0-5.9) at 30 D C (Wegener 1983).
Prolific growth at low pH (which reduces risk of microbial contamination) was
considered as one of the advantages of using this yeast for production of single-cell
protein. Interestingly, this has also been valuable in optimizing fermentation pa-
rameters for the production of recombinant proteins. For example, human serum
albumin (HSA) secretion yield is improved over threefold by using pH 5.85
compared to the generally used pH of 5.0 (Sreekrishna et al. 1990). In the case of
secretion of the VI domain of CD 4 (amino acid residues 1 to 106 of mature CD4 ),
intact product was seen only at acidic pH (2.5-3.5) (Buchholz et al. 1991). As high
as a two- to fourfold increase in secreted yields of human epidermal growth factor
and human insulin-like growth factor-l are observed at pH 3.0 (Siegel et al. 1990;
Brierley et al. 1992).
Other kinds of media and growth conditions are also known to improve the
production of specific proteins. Addition of yeast extract and peptone increased
the level of secretion ofHSA and tissue plasminogen activator (TPA) (Sreekrishna
et al. 1990; J.F. Tschopp, pers. comm.). Likewise, addition of 1% cas amino acids
improved the yield of mouse epidermal growth factor (Clare et al. 1991). In the case
of intracellular production of hepatitis B surface antigen, the addition of certain
trace metals (KI, NaMoO 4· 2HP, CoC12 • 6H 20 at 0.8, 0.2, and 0.5 g per liter, respec-
tively), plus allowing the cells to sit longer in the fermentor, improved the yield of
antigen particles (J.A. Cruze, pers. comm.). Thus, it is evident that some experi-
mentation with fermentation parameters may be necessary to establish product-
specific optimal conditions.
5.1
Continuous Culture of Mut+ and Mut- Strains on Methanol
Fermentation is carried out in two steps. First in the batch mode on glycerol or
glucose as the carbon source followed by continuous mode on methanol-contain-
ing medium. The process described here is typically with recombinant cells, where
it is preferable to use glycerol rather than glucose.
5.1.1
Inoculum for the Fermentor
Grow cells to an O.D6oonm of 2-10 in a 2-1 shake flask containing 11 of one

of the following growth media: MD, MGY, YPD (see Sect. 2.2.2 for composition),
YMPD, YMPGy, or MGyB (see Sect. 5.1.2 for compositions). This volume of
inoculum is adequate for inoculating a 20-1 fermentor with a 10-1 operating
volume.
5.1.2
Media
YMPD: Dissolve 3 g of yeast extract, 3 g of malt extract, 5 g of peptone, and 10 g of

glucose in 11 of water, and autoclave.
YMPGy: Same as YMPD with the exception that 10 ml of 100% glycerol is used
instead of 10 g of glucose.
MGyB: Dissolve 11.5g KH2P0 4, 2.66g K2HP0 4, 6.7g YNB, pH 6.0, and 20ml glyc-
erol in 11 water, and autoclave.
FM21 basal salt media
Composition is for 11 final volume in water
Phosphoric acid, H3P04 (85%) 3.5ml
Calcium sulfate, CaS0 4 • 2HP 0.15 g
Potassium sulfate, K2SO4 2.4 g
Magnesium sulfate, MgSO 4· 7H20 1.95 g
Potassium hydroxide, KOH 0.65 g
Biotin stock solution
Biotin 0.2 g per liter
PTMI trace salts

Composition is for II final volume in water
Cupric sulfate (CuSO 4' 5H zO) 6.0 g
Manganese sulfate (MnSO 4' HzO) 3.0 g
Ferrous sulfate (FeSO 4' 7H zO) 65.0 g
Zinc sulfate (ZnS04 • 7H zO) 20.0 g
Silfuric acid (H ZS0 4 ) 5.0ml
Cobalt chloride (CoClz ' 6H zO) 0.5 g
Boric acid (H 3B03) 0.02 g
Sodium molybdate (NaMo0 4 ·2HzO) 0.2g
Potassium iodide (KI) 0.1 g
BSM medium composition
Composition is for II final volume in water
Phosphoric acid, H3P0 4 (85%) 26.0ml
Calcium sulfate, CaS04 ·2HzO 0.9g
Potassium sulfate, K ZS04 18.0g
Magnesium sulfate, MgSO 4' 7HzO 14.0 g
Potassium hydroxide, KOH 4.0 g
5.1.3
Batch Phase
Sterilize a 20-1 fermentor with 91 of the basal salt medium FM21 (see Sect. 5.1.2 for
composition) containing 5% v/v glycerol (higher levels may be toxic to the cells) or
5-10% glucose. Allow the system to cool to the set temperature of 30 cC. The pH of
this medium will be <2. Adjust the pH to 5 with NH3 gas or with 50% NH 40H
solution. Add 4 ml of biotin stock solution and 11 ml of trace mineral mix PTMI
(see Sect. 5.1.2 for composition). Inoculate the fermentor with II of the shake flask
culture (see Sect. 5.1.1). Fermentation is conducted until all of the carbon source
(glucose or glycerol) is completely consumed. During the run, dissolved Oz is
maintained at >20%, with the agitator speed set between 500 to 1500rpm and a
vessel pressure of 2 to 3 psi. Foaming is controlled through the addition of a 5%
Struktol J673 (Strucktol Company of America, Stow, Ohio, USA) or Mazu DF 37C
(Mazer Chemicals, Inc., Gurnee, Illinois, USA). The cell yield expected for the
batch phase on 5% glycerol under these conditions is 20-25 g of washed dry cell
weight per liter.
5.1.4
Continuous Phase
Continuous fermentation is established by feeding FM21-methanol (15%v/v) for

Mut<- cells or FM21-methanol (1 %v/v) +15% glycerol, sorbitol, or alanine for Mut-
cells. The feed for continuous culture is also supplemented with PTMI (1.1 ml of
stock solution/I) and biotin (O.4ml of the stock solutionll). Feed sterilization is
carried out by filtration (Pall Ultipor disposable filter assembly DFA 4001 AR,
0.2J1m). Feed addition is achieved with a Milton-Roy positive displacement me-
tering pump (Model 2396 Duplex). Continuous culture is performed as a
chemostat under steady-state conditions where the dilution rate D is equal to the
growth rate of the population. The growth rate of cells can be controlled by
adjusting the flow rate of fresh medium into the fermentor. Typical D values range
from 0.056/h to O.ll/h. Dissolved oxygen is held in the 45-75% air saturation range
by varying air flow, vessel pressure, andlor agitator speed. The maximum cell mass
achievable under these conditions is around 80 g of washed dry cell weight per liter
with a cell productivity of approximately 10 g/llh. If a higher cell mass is desired,
the amount of carbon source in the feed can be raised (25% methanol for Mut+ and
1% methanol +25% glycerol, sorbitol, or alanine for Mul). This would also neces-
sitate a proportional increase in the amount of minerals, trace elements, and
biotin. As high as lIOg/l washed dry cell weight with 11.6g/llh. productivity are
achievable in this process.
Highest induction of the AOXI promoter occurs using methanol (Mut+ cells) or
methanol+sorbitol or alanine (Mul) as the carbon source in the feed. Intermediate
levels of induction are seen with methanol+glycerol feed.
5.1.5
Equipment
Typically, a bench top fermentor 2-20-1 capacity with a 1-10-1 operation volume
and equipped with monitors and controls for pH, dissolved oxygen (D.O), agitator
speed, temperature, air-flow, pressure, foam, and weight is used.
Note. Fermentors can be custom-built or purchased from one of the numerous
commercial sources such as: Biolaffitte, SA, France, New Brunswick Scientific,
Edison, New Jersey, USA, or Porton Instruments Inc., Hayward, California, USA.
More recently, a new class of fermentors called Sixfors were introduced by Infors,
UK Ltd., Crewe, Cheshire, Great Britain. Sixfors bridge the gap between shake
flasks and fermentor. They can be used for small-scale (typically 0.31) continuous,
batch, or cascade processes where the growth from one vessel is passed into
another.
5.1.6
Methods of Monitoring the Fermentation
Bio-Rad's portable fermentation monitoring analyzer can be used on the spot to

provide fast HPLC analysis of the concentration of methanol, glycerol, ethanol,
glucose, acetic acid, lactic acid, fructose, as well as maltotriose and maltose. The
equipment is compatible with automatic sampling, and computerized data
analysis.
Analysis takes only 10 min. The conditions used are as follows:
Instrument: Bio-Rad's fermentation monitoring analyzer (Catalog
No.125-0520)
Column: Fermentation monitoring column (150 x 7.8mm) (Catalog

No. 125-0115)
Sample: Extra cellular broth, prefiltered through a 0.22-Jlm syringe
filter
Sample volume: 10 to 20j1l
Injector: Rheodyne injector valve with a 1O-j1l injection loop
Solvent: 0.002NH2S04 in water at a flow rate ofO.8ml/min (isocratic,
so only one pump is required)
Temperature: 65°C
Detector: Refractive index detector
Wet weight of the culture is determined by pelleting 1 ml of the fermentor culture
in a microfuge (centrifuged for 4 min), decanting the supernatant, and weighing
the pellet. The washed dry cell weight of the culture is determined as follows.
Harvest the cells by centrifugation (3000 g for 10 min at room temperature) from a
known volume of the fermentor culture (typically 10 to SOml). Wash the cell pellet
twice with water (10-S0ml) and dry overnight at 100°C. Weigh the dried yeast
pellet and use the value to estimate the washed dry cell weight per liter of the
culture.
Mass transfer is determined by measuring the air flow to the fermentor and the
composition of both the inlet and outlet air with a Perkin-Elmer gas analyzer. The
O2 transfer rate (OTR) is calculated as follows:
OTR = f(C in - COUI)/V,
where f is flow rate lIh, Cm and COUI are the concentration in mmol of oxygen in the
inlet and outlet gases, and V is the ungassed broth volume.
OTR can also be established from yields using the equation:
OTR = )iX/Yx02 ,
where Jl is the specific growth rate or dilution rate (h- 1), X is cell the density (g/l)
and Yx0 2 is the yield on oxygen (g cells/mmol O2 )
Heat transfer rate and heat load can be determined by measuring the temperature
of the cooling water in and out of the fermentor heat exchanger.
Productivity P for the continuous culture is determined using P = DX, where D is
the dilution rate (h-1), and X is the cell density. An increase in D and/or X will result
in higher productivity. Since D also equals the specific growth rate J1, the dilution
rate is limited by the microorganism's intrinsic characteristics. Once 11max or Dmax,
maximum dilution rate, is achieved, P can only be increased by increasing the cell
density.
Extracellular protein concentration (for secreted proteins) can be estimated by
using a Lowry type of protein analysis on TCA precipitated material and analyzed
for specific product by SDS-PAGE and immunological methods.
Aliquots of cells are lysed to prepare cell extracts for protein analysis.
A set of parameters determined for the high-productivity process for P. pastoris on
methanol in a 1500-1 fermentor are as follows:
Substrate concentration (g/l) 263

Dilution rate (h-1) 0.11
pH 3.5
Temperature (0C) 30
Cell mass (g of cellsn) 105
Productivity (gIllh) 11.6
Yield (g of cells/g of methanol) 0.4
OTR (mmol Oil/h) 880
Oxygen consumption (g Oig cells) 2.42
Heat release
Kcal/llh 109
Kcal/mol02 123.9
5.2
Fed-Batch Fermentation of Mut + and Mut - Strains on Methanol
5.2.1
Inoculum for Fermentor
Inoculum (I 1) is prepared as described above for the continuous fermentation

protocol.
5.2.2
Batch Phase
Sterilize a 20-1 fermentor with 51 of the basal salt medium BSM (see Sect. 5.1.2)
containing 5%v/v glycerol (higher levels may be toxic to the cells) or 5-10%
glucose. Allow to cool to the set temperature of 30°C. The pH of this medium will
be <2. Adjust the pH to 5 with NH3 gas or with 50% NHPH solution. Add 40 ml of
biotin stock solution and 40ml ofPTMI (see Sect. 5.1.2). Inoculate the fermentor
with II of the shake flask culture (see Sect. 5.1.1). Fermentation is conducted until
all the carbon source (glucose or glycerol) is completely consumed as previously
described. This phase should take 18 to 24h.
5.2.3
Fed-Batch Phase on Glycerol
Initiate by starting with a 50%w/v glycerol feed (500ml of 100% glycerol+ 480ml
water; autoclave and add a filter sterilized mixture of 10ml each of PTMI and
biotin stock solution) at a feed rate of 18 ml/h/l initial fermentation volume with
the aid of a peristalic pump. Glycerol feeding is carried out for 4 h. The cell mass
doubles from the value in the batch phase (Sect. 5.2.2). The cell yield at this point
will be in the range of 180 to 220 gil of wet cells (equivalent to approximately 30-
55 g washed dry cell weight/I).
This phase can be manipulated by varying the concentration of glycerol and/or
the duration of fermentation to achieve optimal heterologous protein yield in the
fed-batch phase on methanol (Sect. 5.2.4). Some suggested cell yield ranges that
should be tested for are as follows:
MUL/intracellular expression: 50-100 gil dry weight or 200-400 gil wet weight
Mutt/intracellular expression: 30-80 gil dry weight or 140-320 gIl wet weight
MUL/secretion: 20-40 gil dry weight or 80-160 gil wet weight
Mut+/secretion: 12-80 gil dry weight or 50-300 gil wet weight
Note. It is obvious from the suggested ranges for cell density that in several
instances the fed-batch phase on glycerol (Sect. 5.2.3) is unnecessary.
5.2.4
Fed-Batch Phase on Methanol
Initiate by starting a methanol feed (980ml of 100% methanol +lOml of PTMI

+lOml of biotin stock solution and filter sterilized) at a rate of 6-24ml/h (i.e., 1-
4ml/l/h of the initial culture volume) with the aid of a master flex peristaltic
variable speed pump (Cole-Parmer Instrument Company, Chicago, Illinois, USA).
The methanol feed flow rate is adjusted so that with Mut- strains, the methanol
concentration in the fermentor is maintained in the 0.2 to 0.5% v/v level, whereas
with the Mutt strains, methanol levels in the fermentor approach zero and the
fermentor is run in a methanol limited fashion.
Dissolved oxygen in both cases is maintained at the 20-70% range. If dissolved
oxygen falls below 20%, the methanol feed is stopped and nothing should be done
to increase oxygen rates until an upward spike in the dissolved oxygen level is seen.
At this point, adjustments (rpm, aeration, vessel pressure, oxygen feed) can be
made. Maintaining the dissolved oxygen above 20% may be difficult, depending on
the oxygen transfer rate (OTR) of the fermentor.
With stainless steel vessels, the system can be pressurized up to 15-30psi to
increase OTR. Also the oxygen feed (air+oxygen mixture) at 0.1 to 0.3vvm can be
used to maintain adequate levels of dissolved oxygen. The methanol fed batch
phase generally lasts for 70 h. However, it may prolong to over 200 h if the feed rate
is slowed down due to the fall in dissolved oxygen levels. Another factor which may
also influence the fermentation time is the secretion rate of the heterologous
protein. Longer times may be necessary to allow for accumulation of high levels of
a slowly secreted protein in the broth.
Note. Depending on the product being produced, adjustments in the media
(addition of casamino acids) and pH will have to be made to increase product
yield. One technique that can be used to lower the pH is by setting the pH to the
desired lower value (pH 3) and then letting the culture pH decrease to the new set
point of pH 3.0 as a result of cellular metabolism (Siegel et al. 1990; Brierley et al.
1992).
6
Transformation
Introduction of recombinant DNA into P. pastoris can be accomplished by any

of the following procedures: the spheroplast method (Cregg et al. 1985;
Sreekrishna et al.1987); the lithium chloride method (Ito et al. 1983); the PEG-1000
method (Dohmen et al. 1991); and electroporation (Becker and Guartente 1992).
The introduced DNA can establish itself in two ways: integration into chromo-
somal DNA by homologous recombination or autonomous replication as a circu-
lar plasmid. Chromosomal integration requires homology of the introduced
DNA with a chromosomal locus. Although circular DNA can integrate, the pre-
ferred template is a linear DNA with free ends homologous to a genomic locus.
Autonomous replication of circular DNA plasmid requires the presence of an
autonomously replicating sequence (ARS) in the circular DNA used for transfor-
mation. A detailed protocol for various transformation methods is described in
this section.
6.1
Spheroplast Transformation Procedure
6.1.1
Composition of Reagents
Stock Solutions
100x HA: Dissolve 20g of histidine assay medium (Sect. 6.1.1.4) (Difco Laborato-
ries, Detroit, Michigan, USA) in 100mi of water. Heat to dissolve and filter sterilize
the solution. It stores at 4 DC for over a year.
Note. Lately, Difco has discontinued selling histidine assay medium. It may be
available from Invitrogen Corporation (San Diego, California, USA). In any case, it
can be readily prepared using the recipe given at the end of this section.
100x AA: Dissolve 500 mg each of the following amino acids glutamic acid, me-
thionine, lysine, leucine, and isoleucine in water. Heat to dissolve if necessary.
Filter sterilize. It stores at 4 DC for 1 year.
2M Sorbitol: Dissolve 364.4g of D-sorbitol in 1000mi of water. Autoclave and
store at room temperature.
0.5 M EDTA: Add 18.6 g of disodium ethylene diamine tetraacetate 2H 2 0 to 80 ml

of water. Stir vigorously on a magnetic stirrer and titrate with ION NaOH to pH 8.0.
Adjust the volume to 100mI with water. Sterilize by autoclaving and store the
solution at room temperature. (note: the disodium salt of EDT A will not dissolve
until the pH of the solution approaches 8.0 by the addition of NaOH).
1 M Sodium citrate buffer, pH 5.8: Dissolve 29.4 g of sodium citrate 2H20 in 100 ml
of water to give aiM solution (note: the 51/2 HP salt is not recommended).
Titrate with aiM citric acid solution in water (21.01 g in 100mI) to a pH of 5.8. The
titration should need approximately 10 ml of 1 M citric acid. Filter sterilize the
solution and store at room temperature.
1 M Tris-Hel, pH 7.5: Dissolve 121.4g of Tris (hydroxy methyl) amino methane in
500ml of water to make a 2M solution. Titrate the solution with 2M HCI to a pH
of 7.5 (this should take approximately 380ml) and add water to 1000ml final
volume. Autoclave and store at room temperature.
1 M CaCI2: Dissolve 14.7 g calcium chloride in 100ml of water. Autoclave and store
at room temperature.
1 M DTT: Dissolve 7.71 gin 50 ml water, filter sterilize, and store frozen at -20°C
in 0.5 ml aliquots.
10% SDS: Dissolve 10 g of electrophoresis grade SDS (sodium dodecyl sulfate, also
called sodium lauryl sulfate) in 100 ml of water. Heat to dissolve if necessary. Filter
sterilize (optional) and store at room temperature.
ZT-100: Suspend 3mg Zymolyase of specific activity 100000 units/g in Iml of
sterile water. Transfer 20-.u1 aliquots into microfuge tubes and store at -20°C. The
solution is stable for several years. Storage at temperatures much lower than -20 °C
is not recommended. If you are using Zymolyase of a different specific activity
(e.g., 60000 instead of100000 units/g), use the appropriate amounts so as to obtain
a solution of 300 units/ml. Some suggested sources of Zymolyase are: Seikagaku
America, Inc. (Rockville, Maryland, USA) and ICN Biomedicals.
For the other stock solutions used for making reagents for the spheroplast
transformation please refer to Sect. 2.2.1.
Spheroplasting and Transformation Reagents

1 M sorbitol: Mix 50 ml of 2 M sorbitol with 50 ml of sterile water.
SED: First make SE by mixing 50 ml of 2 M sorbitol,S ml of 0.5 M EDTA, pH 8.0,
and 45ml of sterile water. Just prior to use, convert SE to SED by adding O.5ml of
1 M DTT (frozen stock) per 9.5 ml of SE.
SCE: Mix 50 ml of2 M sorbitol,S ml of 1 M sodium citrate buffer, pH 5.8 with 0.2 ml
ofO.5M EDTA and dilute to 100ml with sterile water.
CaS: Mix 50ml of 2M sorbitol, 1 ml ofl M CaCI2, 1 ml ofl M Tris-HCI, pH 7.5, and
48 ml of sterile water.
PEG solution: Dissolve 20 g of PEG 3350 (Fisher CarbowaxR PEG 3350, Laboratory
grade, P-146, molecular weight 3000-3700; Fisher Scientific, Fair Lawn, New Jersey,
USA) in 98 ml of water. Add 1 ml each of 1 M CaCl2 and 1 M Tris-HCI buffer, pH 7.5.
Filter sterilize and store at room temperature. Discard the solution if pH falls
below 6.0.
SOS: Mix 25 ml of 2 M sorbitol, 16.6 ml of YPD medium, 0.5 ml of 1 M CaCI2, and
7.9ml of water. Filter sterilize and store the solution at room temperature.
Regeneration Media
RD: Dissolve 182.2 g of sorbitol (instead of sorbitol, 44.8 g of KCI can be used) in
700ml of water, add to it 109 of agar (or agarose) and autoclave. Cool to 45°C and
maintain at that temperature. To this add a prewarmed (to 45 DC) mixture of 100 ml
lOx D, 100 ml of lOx YNB, 2 ml of 500x B, 10 ml of 100x HA, 10 ml of 100x AA, and
7Sml of sterile water. Aliquot sml each into 15-ml tubes and maintain the tubes at
45°C.
Note. Using RD containing agarose in place of agar gives five- to tenfold more
transformants; however, the transformed colonies grow slower in agarose-con-
taining plates.
RDB: Same as RD, except use 20g of agar (or agarose). Maintain autoclaved
solution at 60°C prior to the addition of the prewarmed (to 60°C) mixture of stock
solutions. After mixing, pour the plates immediately.
RDH and RDHB: These are prepared as described for RD and RDB except that
10ml of 100x H is included in the stock solution mixture and the amount of water
is reduced by the same volume.
Histidine Assay Medium
Amino acid mix

Dissolve the following quantities of amino acids in 100ml of water (lOx) and filter
sterilize:
DL-Alanine O.Sg
L-Arginine hydrochloride 0.92g
Asparginine monohydrate O.Sg
L-Aspartic acid OAg
L-Cystine 0.2g
L-Glutamic acid 1.2g
Glycine OAg
D,L-Phenylalanine OAg
L-Proline OAg
D,L-Serine 0.2g
D,L-Threonine O.Sg
D,L-Tryptophan 0.16g
L-Tyrosine OAg
D,L-Valine O.lg
Nucleotide mix
Dissolve the following quantities of nucleotides in 100 ml of water (lOx) and filter
sterilize:
Adenine sulfate 40mg
Guanine hydrochloride 40mg
Uracil 40mg
Xanthine 40mg
Vitamin mix
Dissolve the following quantities of vitamins in 100mi of water (lOOx) and filter
sterilize:
Thiamine hydrochloride 20mg

Pyridoxine hydrochloride 40mg
Pyridoxamine hydrochloride 12mg
Pyridoxal hydrochloride 12mg
Calcium Pantothenate 20mg
Riboflavin 40mg
Nicotinic acid 40mg
Para amino benzoic acid 4mg
D-Biotin 40,ug
Folic acid 40Jlg
Mineral salt mix
Dissolve the following quantities of mineral salts in 100ml of water (lOx) and filter
sterilize:
Monopotassium phosphate 240mg
Dipotassium phosphate 240mg
Magnesium sulfate Bmg
Ferrous sulfate 40mg
Manganese sulfate BOmg
Sodium chloride 40mg
To make 100x HA medium, dissolve BO g of sodium acetate, 12 g of ammonium
chloride and 100 g of glucose in 690 ml of water. Add to this 10 ml of the vitamin
mix, 100ml of the amino acid mix, 100ml of the nucleotide mix, and 100ml of the
mineral salt mix. Filter-sterilize the solution. This step also removes any insoluble
material that may result from mixing the ingredients; store at 4 DC. The stock stores
well for several months.
6.1.2
Procedure
1. Inoculate 10ml ofYPD with a colony ofGSllS or any suitable strain and grow
to saturation at 30 DC. This should take less than 2 days. Store the saturated
culture at 4 DC.
2. Place 200 ml ofYPD in each of three SOO-ml culture flasks. Inoculate flasks with
5, 10, and 20 JlI of cells from step 1 and incubate overnight with shaking at
30 DC.
3. The next morning, check the O.D6oonm of the cells. Harvest the cells from the
culture which has an O.D6oonm of 0.2 to 0.3. Cells are harvested by centrifugation
at room temperature for 5 min at IS00g. Use these cells for the transformation.
Discard the other cells.
4. Wash the cells once with 20 ml of sterile water by centrifugation at 1500 g for
5 min at room temperature.
5. Wash the cells once with 20ml offresh sorbitol-EDTA-DTT solution (SED) as
described in step 4. Do not let the cells remain in SED for any longer than is
220 K Sreekrishna and KE. Kropp
necessary. Prolonged incubation in SED will affect the transformation fre-

quency due to decreased cell viability.
6. Wash cells once with 20 ml of 1 M sorbitol to remove residual SED by centrifu-
gation as in step 4.
7. Resuspend cells in 20 ml of sorbitol-citrate-EDTA (SCE) buffer and divide the
suspension into two tubes (lOml each).
8. Add 7.5 ,ul of Zymolyase ZT -100 stock to one tube, mix gently and incubate the
cells at 30°C. Do not shake the sample. The moment after the addition of
Zymolyase, the digestion of the yeast cell wall begins. Cells without cell walls
(spheroplasts or protoplasts) are extremely fragile. Handle the sample gently.
This procedure is used to establish the incubation time for optimal
spheroplasting as described in step 9. Reserve the second tube at room tem-
perature for the actual transformation.
9. Monitor spheroplast formation as follows: add 200,ul cells (from step 8) to
800,ul of 5% SDS at time t = 0,2,4,5,6,7,8,9, 10, 15,20, and 30min after
adding the Zymolyase and measure O.Dsoonm . Determine the percent of
spheroplasting for each time point using the equation:
% spheroplasting = 100 - O.Dsoonm at time t/O.Dsoonm at time 0) x 100.
Determine the time of Zymolyase treatment that results in approximately 70%
of spheroplasted cells. It should take approximately 6 min of Zymolyase treat-
ment with ZT -100. It is important to establish the minimum time required for
this to happen, because prolonged incubation in Zymolyase is deleterious and
hampers transformation efficiency. The optimal time of treatment determined
for a given combination of P. pastoris strain, cell density, and the Zymolyase
stock solution remains the same for subsequent uses over several years as long
as the enzyme is stored in aliquots at -20°C.
10. Add Zymolyase ZT-I00 stock (7.5,ul) to the second lO-ml sample from step 8
and incubate at 30°C for the time that was established in step 9 to obtain the
optimal level (70%) of spheroplasts. Note that the spheroplasting will continue
during centrifugation (step 11), and thus the final extent may actually exceed
70%.
11. Harvest the spheroplasts by gentle centrifugation at 750 g for 5 min at room
temperature.
12. Wash the spheroplasts once with 10 ml of 1 M sorbitol and gently disperse the
pellet by tapping the tube; do not vortex. Collect the spheroplasts by centrifu-
gation as in step 11.
13. Wash the spheroplasts once with lOml of calcium-sorbitol (CaS) as in step 12.
14. Resuspend the spheroplasts with 0.6ml of CaS.
Note. Spheroplasts can be left in CaS for several days at room temperature
before their use for transformation. However, their transformation efficiency
gradually decreases with time (probably due to decrease in viability). The best
transformation frequencies are obtained if the spheroplasts are used the same
day.
15. Dispense 100 jil of spheroplasts into sterile 6-ml snap top tubes (Falcon 2058
tubes from Becton Dickinson Labware, Lincoln Park, New Jersey, USA).
16. Add 1 to 10 jig of DNA in ::;10 jil final volume (1 jig in the case of supercoiled
plasmid DNA such as pHIL-AI, or 5-10jig in the case oflinearized DNA such
as Sal I or Bgi II digested pHIL-Dl (see Sect. 9.2.2), and incubate at room
temperature for lOmin. Use lOjil of buffer alone for a negative control.
17. Add 1 ml PEG-3350 solution, mix gently, and incubate for an additional10min
18. Centrifuge at 750 g for 5 min at room temperature and aspirate the PEG-3350
solution, invert the tubes, and then tap gently on a blotting paper to drain off
the excess PEG. Resuspend the pellet in 150 jil of sorbitol-YPD solution (SOS)
and incubate at room temperature for 20 min. Add 850 jil of 1 M sorbitol.
Note. Transformed spheroplasts in SOS can be left for several hours to days
prior to plating. However, the number of transformants that are obtained
decreases with time. Spheroplasts will not regenerate their cell wall under
these conditions even after several days in the complex medium, as they need
to be embedded in a solid support (agar, agarose) or alginate to regenerate
their cell walls.
6.1.3
Plating of Transformants
19. Add 100- to 250-jil aliquots of suspension from step 18 to 8 ml of regeneration-

dextrose medium (RD) held at 45 DC. Mix by inverting the tube back and forth.
Pour the contents on to RD base plate (RDB). Incubate plates at 30 DC.
Transformants (His+) should appear in 3-4 days for ARS vectors containing
the HIS4 gene (transformation frequency = 10 000-100 OOO/jig DNA) and 4-5
days for integrative vectors containing HIS4 gene (transformation frequency
= 100-10000/jig DNA). Negative controls will not form colonies.
6.1.4
Plating for Determination of Spheroplast Viability
20. Add a 100-jil aliquot from step 18 to 900jil of 1M sorbitol. Mix 100jil of the
diluted sample with 10 ml of RD supplemented with histidine (RDH) at 45 DC.
Mix and pour on a RDH-base plate (RDHB). Under these conditions, both the
viable spheroplasts and cells with intact cell walls (those which escaped
spheroplasting) will form colonies.
Also spread 100 jil of the diluted sample directly on to an MDH plate (see Sect.
2.2.3 for composition). Under these conditions, only cells which escaped
spheroplasting will form colonies. The % of viable spheroplasts is determined
by counting the number of colonies on RDHB and MDH. Generally, the num-
ber of colonies on RDHB should be 10 to 100 times greater than the number of
colonies on MDH.
% of viable spheroplasts = 100 (x - y)/x,
where x = number of colonies on RDHB and y = number of colonies on MDH.
6.1.5
Screening for AOX1 Gene Disruption
Transformation of GS 115 with a linearized DNA containing the HIS4 gene with the
ends homologous to the 5' and 3' regions of the AOXI chromosomal locus (e.g., Bgi
II-digested DNA of pHIL-Dl type plasmids or Not I-digested DNA of pHIL-D2
type plasmids; see Sect. 9 for plasmid diagrams) results in the site-specific eviction
of the AOXI structural gene as illustrated in Fig. 1. Eviction of the AOXI gene
occurs at a frequency of 1-5 per 20 His+ transformants. AOXl-deleted
transformants show a slower growth phenotype (Mur-) on MM plates as compared
to AOXI intact methanol-normal cells (Mut+). However, the His+ colonies from the
original transformation plate (see step 19) cannot be directly toothpick patched
onto MM plates to screen for the Mur- phenotype. If this is done, every colony
will score as Mut+ because colonies in the transformation plate contain a hetero
geneous population of cells due to differences in the mode, site, and extent of
integration of the transforming DNA (tDNA). Many type of cells can be present
within a given His+ colony.
5' AOXI 3' AOXI
B
"9~~
~IIIIIIIIIIIIIIIIIIIIIIIIIIIII AOXI
5' AOXI
~ ~
C ~ ~
~IIIIIIIIIIIIIIIIIIIIIIIIIIIIIGenexIAO-tH"""'--HI-S-4--,~
5' AOXI 3' AOXI
Fig. lA-C. Site-specific eviction of AOXI by gene replacement. A BgI II-digested DNA
derived from pHIL-Dl expression plasmid used for transformation. Gene X is the gene of
interest cloned at the Eco RI site of pHIL-Dl (see Sect. 9). B P. pastoris chromosomal AOXI
locus. C Chromosomal structure resulting from replacement of the entire AOXllocus by the
transforming DNA
Mut+, single copy of tDNA at AOXI locus

Mut+, multiple copy of tDNA at AOXllocus
Mut+, single copy of tDNA at his4 locus
Mut+, multiple copy of tDNA at his4 locus
Mur, single copy of tDNA at AOXllocus
Mur, multiple copy of tDNA at AOXI locus.
The following protocol involving the dispersion of cells from colonies is used
to overcome the problem of colony heterogeneity in screening for the Mur
phenotype.
The top-agar layer containing His+ colonies is transferred into a sterile 50-ml
disposable plastic centrifuge tube and mixed with 20 ml of sterile water. The sus-
pension is vortexed vigorously to disperse cells from agar and the suspension is
filtered through four layers of sterilized cheesecloth (USP type VII gauze, 20 x 12
mesh from Ultimed International, Inc., Glendale Hts., Illinois, USA).
The gel chunks retained on the cheese cloth are rinsed twice with 10 ml of water to
displace trapped cells. The filtrate is centrifuged at 1500 g for 5 min at room tem-
perature. Under these conditions, the cells form a tight pellet under a fluffy layer of
fine agar particles.
The agar layer is removed by gently shaking the tube to disperse the loose agar
layer into water followed by the careful decanting of the milky supernatant liquid
which contains most of the fine agar particles.
The cell pellet is suspended in 5 ml of water, sonicated for 10 s (optional) and serial
dilutions are then plated on MD plates so as to obtain plates with <1000 colonies.
To make dilutions, assume that each pooled colony will have contributed approxi-
mately 1 million cells.
Colonies that appear on the MD plate are replica-plated onto MM plate to screen
for Mur transformants. Generally 5 to 35% of the colonies replica-plated will be
Mur.
6.2
Lithium Chloride Transformation Method
The protocol described here was communicated by J. Cregg and it is based on a

procedure described for S. cerevisiae (Ito et al. 1983).
1. Grow a 50-ml shake flask culture of GTS115 in YPD at 30°C to an approximate
O.D6oonm of 1.0 (i.e., 5 x 107 cells/ml).
2. Wash cells once in 10 ml of sterile water and centrifuge (1500 g, for 10 min, at
room temperature).
3. Wash the cells in lOml of sterile TE buffer (IOmM Tris-HCI, pH 7.5, ImM
EDT A) and centrifuge as in step 2.
4. Resuspend cells in 20 ml of sterile LiCl + TE buffer (0.1 M LiCl, 10 mM Tris-

HCl, pH 7.4, 1mM EDTA) and incubate at 30 DC for 1h.
5. For each transformation sample, add the following to a sterile 12 x 75 mm

polypropylene snap top tube: 10,ug of Hae II-digested E. coli carrier DNA,
O.l,ug to 20,ug of transforming DNA, and 0.1 ml of GTS1l5 cells (step 4). The
volume of DNA added should not exceed 20,u1.
Note. Typically, vectors based on HIS4 selection marker (e.g., pHIL-AI, pHIL-
D1, pHIL-D2, see Sect. 9) are used for transformation of GTS1l5.
6. Incubate at 30 DC for 30 min.

7. Add 0.7 ml of 40% PEG-3350 in LiCl + TE buffer (step 4) and vortex briefly to
mix.
Note. Make sure that the pH of the PEG solution is above 6.5.
8. Incubate at 30 DC for 30 min.
9. Heat shock the cell at 37 DC for 5 min (longer duration will decrease cell
viability).
10. Centrifuge the samples and resuspend in 0.1 ml of sterile water.

11. Spread on selective plates such as MD. Transformants should appear within 3
days of incubation at 30 DC. Transformation frequency is rather low with
supercoiled ARS vectors (lO-lOO/,ug of DNA). Better transformation frequen-
cies are seen with linear DNA, especially for those involving a single crossover
event (e.g., Sac 1- or Sal I-digested pHIL-DO for integration (l00-1000
transformants/,ug of DNA).
12. Transformant colonies can be pooled from the surface of agar plates by adding
5 ml of sterile water to the plates and suspending cells with a spreader. As with
the spheroplast method, it is recommended that the transformant pool be
sonicated and single colonies isolated prior to screening for MUT- phenotype.
Note. Typically, LiCl method of transformation does not favor multicopy
integration of linear DNA as compared to the spheroplast method of transfor-
mation (Sreekrishna et al. 1988b).
6.3
Transformation Method Using Frozen Competent Cells
(PEG-IOOO Method)
6.3.1
Composition of Reagents
BDES: Mix50ml of 2M sorbitol, 1 ml of1 M Bicine-NaOH buffer (pH 8.35), 3ml of

ethylene glycol (Merck and Co., Inc., Rahway, New Jersey, USA), Sml of DMSO
(Sigma Chemicals, St. Louis, Missouri, USA), and 41 ml of water. Filter sterilize and
store at -20°C.
Note. Use DMSO from a new unopened bottle; old DMSO contains oxidized prod-
ucts which inhibit transformation. For convenience, store DMSO from a new bottle
in 5-ml aliquots at -70°C.
BP: Dissolve 40 g of PEG 1000 (Roth Labs., Karlsruhe, Germany: supplier in USA
is Mike Samuels, phone: 516-694-9000) in 80 ml of water and add 20 ml of 1 M
bicine-NaOH, buffer (pH 8.35).
Note. The source of PEG 1000 is important for efficient yield of transformants.
BS: Dissolve 876mg NaCI in 99ml of water (150mM NaCl) and add 1ml of 1M
bicine-NaOH buffer (pH 8.35).
6.3.2
Preparation and Freezing of Competent Cells
1. Inoculate 10ml ofYPD with a single colony of GTSl15 from a fresh YPD plate
and incubate overnight. Measure O.D6oonm '
2. Dilute the overnight culture into 100ml YPD to an O.D6oonm of 0.1 and then
grow to an O.D6oonm of 0.5 to 0.8.
3. Harvest the cells (1500g, 5min, room temperature) and wash in 50ml of
buffered sorbitol-dimethyl sulfoxide solution (BDES) by centrifugation.
4. Resuspend cell pellet in 4ml ofBDES and store in aliquots ofO.2ml at -70°C.
Cells will remain competent for over 6 months.
6.3.3
Transformation
5. Add plasmid DNA (1-lO,ug in :S;10,u1) and carrier DNA (40,ug of sonicated and
heat-denatured salmon sperm or calf thymus DNA in :S;1O,u1) to the top of the
frozen yeast cell suspension before it melts. For a negative control use only the
carrier DNA.
6. Incubate at 37°C for 5 min; mix the contents well by rapid agitation in a mixer.
Efficient mixing during thawing and after thawing of the cells with DNA is
essential for a high transformation frequency.
7. Add 1.4ml of buffered polyethylene glycol-WOO solution (BP), mix and incu-
bate for 1 h at 30°C.
8. Pellet the cells by centrifugation at 3000 g for 5 min at room temperature.
9. Wash once with 1.5 ml of buffered salt solution (BS) and resuspend in 0.2 ml of
the same buffer (BS).
10. Plate 50-100-,ul aliquots on to selective plates (such as MD plates) and incu-
bate at 30°C for 3-4 days. Also plate an appropriately diluted aliquot on
nonselective plates (such as MDH) to determine cell viability.
6.4
1. Grow GTS115 in 500rnl ofYPD placed in a 2-1 flask to an O.D60onm of 1.3 to 1.5.
Note. Use an overnight culture or a YPD-slant of GTS115 for the inoculation.
2. Centrifuge cells at 4°C (1500 g for 5 min). Wash the cell pellet with 500 rnl of
ice-cold, sterile-deionized water.
3. Centrifuge cells (as in step 2) and resuspend the cell pellet in 250ml of ice-cold,
sterile deionized water.
4. Centrifuge cells (as in step 2) and resuspend the cell pellet in 20rnl of ice-cold,
sterile 1 M sorbitol.
5. Centrifuge cells (as in step 2) and resuspend in 1 rnl of ice-cold, sterile 1M
sorbitol to give a final volume of 1.5 rnl.
6. Mix 40,ul of cells with 1 to 5,ul oflinearized DNA (0.1 to l,ug) and transfer
them to an ice-cold 0.2-cm disposable electroporation cuvette. Tap the cuvette
to force the suspension to the bottom of the cuvette, and ensure that no air
bubbles are trapped in the suspension (air bubbles will cause arcing when the
current is applied).
7. After 5 min on ice, pulse with a Bio-Rad gene pulser (or equivalent) equipped
with pulse controller set at 25 ,uF, 2.5kV, and between 200-600 ohms (generally
400 ohms).
8. Immediately add 1 ml of ice-cold 1 M sorbitol to the cuvette. Transfer the
contents to an ice-cold Eppendorf tube.
9. Spread aliquots of 200-500,ul on selection plates such as MD.
10. Incubate at 30°C until colonies appear. Colonies will appear within 2 days,
followed by a second wave of smaller colonies by 5 days. Transformants can be
colony-purified by restreaking on MD plates for further analysis.
The transformation frequency with electroporation is comparable, and at times
superior, to other whole-cell procedures (LiCl or PEG 1000). However, just as with
the other whole cell procedures, this method also fails to give multicopy integrants
at a high frequency (18). With the development of gene dosage-dependent selec-
tion schemes such as G418, antibiotic resistance (conferred by the kanamycin
resistance Tn903) (Scorer et al. 1994) or with the use of the LEU2d gene (comple-
ments leu2 defect in S. cerevisiae only when present in multiple copies; this may
also be true for leu2 strains of P. pastoris), it should be possible to select for
multicopy transformants even if they occur at a low frequency.
7
Induction of Protein Expression
Expression vectors (e.g., pHIL-Dl, pHIL-AI) used for heterologous expression in

P. pastoris are typically derived from AOXl regulatory sequences (Ellis et al. 1985).
One or more of the following methods can be used for activation of the promoter.
These protocols also work well for activation of other methanol regulated promot-
ers as well as for peroxisome proliferation. Refer to Sect. 5 for induction of expres-
sion in the fermentor.
7.1
Continuous Induction
The AOXl promoter can be maximally activated (derepression and/or induction)

by growing cells on methanol as the sole source of carbon and energy (e.g., MM or
MMH media) in shake flasks, shake tubes, or plates at 30°C. The doubling time on
methanol is =6 h as compared <2 h on glucose or glycerol medium. Even the cells
in which the AOXl gene has been evicted (Mut-) can grow on methanol. However,
the growth rate is slow (doubling time 18-24 h) because it is dependent solely on a
secondary alcohol oxidase, AOX2, which is expressed only at low levels (Cregg et
al. 1989). In such cases, the growth rate can be enhanced by supplementing the MM
medium with 1% sorbitol or 100 mM alanine. The advantage of using sorbitol or
alanine lies in the fact that these compounds do not interfere with the induction of
AOXl promoter.
7.2
Stepwise Induction
For liquid cultures, cells are initially grown to an O.D6oonm of 2-10 on a

nonactivating carbon source such as glycerol or glucose (MGY, MD) in shake
flasks or tubes at 30°C. The cells are then harvested by centrifugation and shifted
to MM and incubated with shaking at 30°C for 1-4 days.
Induction of expression on plates is carried out by streaking or plating cells on a
nitrocellulose or cellulose acetate membrane placed on a MD or MGY plate. Once
colonies appear, the filter is lifted and placed on a MM plate.
7.3
Evaluation of Product Toxicity
Sometimes the product being expressed is toxic. In such cases, a stepwise induc-
tion is suggested. Whether a particular product is toxic to P. pastoris can be
evaluated by comparing the growth of transformants in sorbitol or alanine
media to that on sorbitol+methanol or alanine+methanol media. If the expressed
protein is toxic, then the growth in the presence of methanol will be drastically
impaired.
7.4
Efficient Secretion of Proteins
The conditions described thus far work well for the intracellular accumulation of
heterologous proteins, but are rather inadequate for secreted proteins. The follow-
ing protocols work well for secreted proteins for both Mutt" and MUl cells (Barr et
al. 1992).
7.4.1
Secretion Media Composition
BMGY: Mix 100ml of 1M potassium phosphate buffer, pH 6.0, 100ml ofl0xYNB,

2ml of 50Ox B (refer to Sect. 2.2.1 for composition of stock solutions), and 10ml of
glycerol. Filter sterilize and add to an autoclaved solution of 109 yeast extract and
20g peptone in 788ml water (l5g Bacto agar is included for plates).
BMMY: Same as BMGY, with the exception that 5 ml of methanol is added in the
place of 10ml glycerol.
Note: Yeast extract and peptone in the above media can be replaced by 1%
cas amino acids. The pH 6 suggested here may not be optimal for every secreted
product. Experimentation with pH values in the range 2.5-8, (by using appropriate
buffers) is suggested to determine the optimal pH for a particular product. Some
suggested buffers are as follows:
- Phosphate buffer for pH range 5.7 to 8.0

- Alanine-HCI buffer for pH range 2.5 to 3.6
- Aconitic acid-NaOH buffer for pH range 2.5 to 5.7
- Citrate buffer for pH range 3.0 to 6.2
Avoid buffers such as succinate buffer, because succinate can serve as a carbon
source and will repress activation of the AOXI promoter.
7.4.2
Shake Tube Cultures
1. Grow cells to saturation in 10ml of BMGY (see Sect. 7.4.1 for composition)
placed in 50ml tube (2-3 days), the O.D6oonm of culture will be in the range ofl0-
20.
2. Harvest cells by centrifugation (l500g, 5min, room temperature) and resus-
pend the pellet with 2ml ofBMMY (see Sect. 7.4.1 for composition). Cover the
tube with a sterile gauze (four layers of cheese cloth: USP type VII gauze, 20 x
12 mesh, from Ultimed International Inc. Glendale Hts. Illinois, USA) instead of
the cap. If there are several tubes (generally the case), all the tubes can be
covered by spreading one piece of cheesecloth over them and securing the ends
with tape or a rubber band. Return the tube(s) to the 30°C shaker.
At the end of 2-3 days, pellet the cells and analyze the supernatant media for
the secreted protein. The pellets can be resuspended with 2 ml BMMY, covered
with cheesecloth and returned to the shaker for renewed secretion. With
P. pastorislhuman serum albumin (HSA) strain, 10¢ of media supernatant is
sufficient for analysis by SDS-PAGE followed by Coomassie brilliant blue R2S0 or
G2S0 staining.
Note. Evaporation of BMMY during incubation is commonly noticed; if this
happens, add BMMY as required and make sure that the cells are not allowed to go
dry.
7.4.3
Shake Flask Cultures
1. Grow the cells as described above in 11 of BMGY in a 2-1 flask.

2. Harvest the cells and resuspend them with SO-75ml ofBMMY in a 300-400-ml
low baffle flask and cover with four layers of cheesecloth as described above.
Return the flask to 30°C shaker and incubate for 2-4 days. Analyze the media
supernatant for product (see Sect. 8). Just as with shake tubes, secretion can be
renewed by rejuvenating the media.
7.4.4
Plates
Patch cells on to nitrocellulose filter (sterile) placed on a square or circular BMGY

plate and incubate at 30°C for 2-3 days. Once colonies have grown to =2 mm in
size, remove the filter, and place it over a BMMY plate. Cover the filter containing
colonies with a sterile nitrocellulose filter. If desired, a cellulose acetate filter can be
interfaced between the two nitrocellulose filters. Replace the lid and incubate at
30°C for 2-3 days. Make sure to add 100.ul of 100% methanol to the lid once every
day. Remove the nitrocellulose filter that was placed on top, wash, and analyze for
secreted protein.
8
Analysis of Protein Expression
This section deals with physical, chemical, and enzymatic disruption of cells for
the recovery and analysis of intracellular proteins. For a more detailed analysis of
the cell disruption methods, refer to Hopkins (1991).
8.1
Mechanical Lysis of Cells
1. Cells are washed once in breaking buffer composed of 50 mM sodium phos-

phate, pH 7.4, 1 mM EDT A, 5% glycerol, and 1 mM PMSF; a 100 mM stock
solution of PM SF in isopropanol stored at -20°C may be used to adjust the final
PMSF concentration. The cells are resuspended at an O.D6oonm of 50-100. An

equal volume of acid-washed glass beads are added (size 0045mm, Sigma
Chemicals, St. Louis, Missouri, USA). The mixture is vortexed vigorously for a
total of 4-Smin in increments of 30s, followed by 30s on ice (total time is S-
16min) using a Vortex Genie 2 mixer (Fisher Scientific, Bohemia, New York,
USA).
A Mini-Bead Beater can also be used instead of manually vortexing the
cells. Both single and multiple sample handling devices are available (BioSpec
Products, Bartlesville, Oklahoma, USA). Another source for small-
volume, shaking bead mill disrupters is Taiyo Scientific Industrial Co. (Tokyo,
Japan).
For samples of larger volumes (up to 250ml) it is desirable to use the Bead
Beater (BioSpec Products, Bartlesville, Oklahoma, USA). This equipment
agitates the beads with a rotor rather than by shaking and it also comes with an
outer cooling jacket. Very large volumes will require a Dyno-mill (Glen Mills
Inc., Clifton, New Jersey, USA: Willy A. Bachofen Maschinen-Fabrik, Basel,
Switzerland: Netzsch Incorporated, Exton, Pennsylvania, USA).
2. The sample is centrifuged at 12000 g for 10 min at 4°C.

3. The clear supernatant solution is transferred to a fresh tube and analyzed for
the desired product. The total Lowry protein concentration in this lysate will be
5-lOmglml.
4. The pellet fraction contains cell debris, unbroken cells, and proteins not solubi-
lized by the breaking buffer. This pellet can be extracted in the presence of
nonionic and ionic detergents, chaotropic salts, reducing agents, and general
denaturants available for protein extraction.
For a quick look at whether or not the protein in question is present in the
insoluble fraction, wash the pellet two times with breaking buffer and boil
the washed pellet for 5 min at 100°C with an appropriate aliquot of electro-
phoresis sample buffer (O.25M Tris-HCI, pH 6.S, 5% SDS, 0.025% bromophenol
blue, 10% glycerol, and 2.5% ,B-mercaptoethanol). Use 200}!1 of sample
buffer for an insoluble pellet resulting from 500 J.1l of original cell suspension
in the breaking buffer. Analyze the boiled material by SDS-PAGE. The
proteins separated on the gel can be subjected to chemical and immunological
analyses.
8.2
Alkaline Lysis of Cells
This procedure is useful for rapid preparation of cell extracts for analysis of
protein expression. The protein extracted by this procedure is not expected to
retain biological activity.
1. Use log phase (exponential) cells captured at an O.D6oonm of 004 to 4.0.
2. Suspend the cells at an O.D60onm of 2-10 in 200,uI of alkaline lysis solution

(50mM NaOH, pH 10.5, containing 2mM EDTA, ImM PMSF, 5% SDS, 10%
glycerol, and 5% ,B-mercaptoethanol).
3. Boil for 5 min at 100 DC. Cool and adjust the pH to 7.5 with 1M HCI or 0.5M
NaH 2P04 •
4. Centrifuge the sample for 4 min in a microfuge.
5. Analyze 1O-20,uI of clear supernatant by SDS-PAGE. The separated proteins
can also be electroblotted and subjected to NH 2-terminal amino acid sequence
and immunological analyses.
8.3
Acid Lysis of Cells
This method of lysis is generally independent of the growth phase of cells (expo-
nential or stationary cultures) as well as the cell density used. This is the method of
choice for determining incorporation of radioactive precursors into cellular mac-
romolecules.
1. A 500-,u1 aliquot of culture (O.D6oonm ofO.5-20) was mixed with an equal volume
of ice-cold 20% trichloroacetic acid (TCA) in a 1.5-ml microfuge tube and
incubated on ice for 60 min.
2. Harvest the pellet by centrifugation in a microfuge (12000g, 10min at 4 DC) and
discard the supernatant.
3. Resuspend the pellet in 1 ml of cold (-20 DC) ethanol and incubate on ice for
30 min.
4. Harvest the pellet as in step 2 and repeat step 3.
5. Harvest the pellet as above and dry it briefly under vacuum to remove most of
the residual ethanol.
6. Resuspend the dry pellet in SDS-PAGE sample buffer (O.25M Tris-HCI, pH
6.8, 5% SDS, 0.025% bromophenol blue, 10% glycerol, and 2.5% ,B-
mercaptoethanol). Again, use an appropriate volume of sample buffer depend-
ing on the cell density of the culture used for lysis. Generally, 20,uI of sample
buffer per 1 O.D600nm unit of the culture is appropriate. Incubate the sample in
a boiling water bath for 5 min, centrifuge for 2 min in a microfuge to pellet any
residual cell debris and analyze the clarified fraction by SDS-PAGE.
Note. Samples prepared by TCA generally take a longer time for
electroblotting.
8.4
Enzymatic Lysis of Cells
1. Harvest cells from a lO-ml culture by centrifugation {1500g, 5min at room
temperature} and wash once with 10ml of sterile water by resuspending and
centrifuging.
2. Resuspend the washed cell pellet with 0.5 ml of 50 roM sodium phosphate
buffer, pH 7.4, and transfer it to a microfuge tube.
3. Add DTT to a final concentration of 10mM (added from aIM frozen stock).
Note. DTT can be replaced by L-cysteine. If desired, protease inhibitors such as
1roM PMSF can also be included.
4. Add 30,u1 ofZymolyase ZT-lOO suspension (3mglml suspension in water). This

is equivalent to adding 9 units of the enzyme.
5. Incubate at 30°C for 30 min. At this stage, an aliquot of sample is boiled with
SDS sample buffer, clarified by centrifugation and analyzed by SDS-PAGE. This
should give the profile of the total cellular protein, with the exception of pro-
teins covalently held by the insoluble debris.
6. Mix the remaining sample vigorously in a vortex mixer. Centrifuge in a

microfuge at 12000 g for 5 min at 4°C. Most spheroplasts will lyse under these
conditions.
7. Analyze the supernatant and the solubilized pellet for protein expression by
boiling with SDS-PAGE sample buffer for 5 min.
9
Vectors
9.1
Compilation of Vectors and Their Origins
pHIL-AI: Autonomously replicating vector (K. Sreekrishna and K.A. Parker,

unpubl. observ.; Fig. 2).
pHIL-Dl: Integration vector with or without deletion of AOXI structural gene
(Cregg et al. 1987; Fig. 3).
pPIC3: pHIL-Dl type vector with multiple cloning sites (Clare et al. 1991b; Fig. 4).
pA0815: pHIL-DI type vectors for making multi-copy expression units in vitro
(Thill et al. 1990; Fig. 5).
pA0856: Similar to pA0815 for making multi-copy expression units in vitro (Thill
et al. 1990; Fig. 6).
pHIL-D2: Modified pHIL-DI with Not I site and f1 ori (Sreekrishna et al. 1990;
Fig. 7).
PHIL-D3: Derived from pHIL-D2 for making constructs with exact 5'UTR
(Sreekrishna et al. 1990; Fig. 8).
pHIL-D4: pHIL-DI with kanamycin resistance marker (K. Sreekrishna and S.
Hopkins, unpubl. observ.; Fig. 9).
EcoRI(337)
Bglll(l180)
pHIL-AI
6400 bp
NaeI(4295)
BamHI(3910)
SalI(2855)
Fig. 2. pHIL-AI. Plasmid pHIL-AI, is an E. coli - P.pastoris shuttle vector, with sequences
required for selection and autonomous replication in each host. The left half of the plasmid
is a modified portion of plasmid pBR322 containing the ampicillin resistance gene and the
origin of replication (CoLEl ori). The regions between nucleotides 1100 and 2485 of pBR322
and between Nae I sites 404 and 932 were deleted to climinate poison sequences and the Sal
I site, respectively.
The DNA elements comprising the rest of the plasmid are derived from the genome of P.
pastoris, except for short regions of pBR322 used to link the yeast elements. The yeast
elements are as follows, proceeding clockwise: AO-t, approximately 300-bp segment of AO
terminating sequence. 5' AOXl, approximately 750-bp segment of the alcohol oxidase
promoter. The alcohol oxidase coding sequences following the A of the ATG initiating
methionin-codon have been removed, and a synthetic linker used to generate a unique Eco
RI site, as described for pHIL-DI. PARSl, approximately 190-bp segment of a P. pastoris
autonomous replication sequence. HIS4, approximately 2.8-kb segment of P. pastoris
histidinol dehydrogenase gene to complement the defective his4 gene in GTS1I5.
pHIL-AI remains autonomous for several generations, and then integrates
spontaneously. Integration can be directed to the HIS410cus by using pHIL-AI linearized
with either Sal I or Stu I, which cut within the HIS4 gene.
Key restriction endonuclease sites are indicated on the plasmid map
pHIL-Dl
7749 bp
NdeI(5555)
Bglll(5319)
Asull(4822)
NaeI(4318)
Fig.3. pHIL-Dl. Plasmid pHIL-Dl, is an E. coli - P. pastoris shuttle vector, with sequences
required for selection in each host. The left half of the plasmid is a portion of pBR322, from
Cia I site through the Pvu II site (modified to a Bgl II site). This segment of pBR322 contains
the ampicillin resistance gene (Amp) and the origin of replication (ColEl ori). The Eco RI
site in this segment has been eliminated.
pastoris, except for short regions of pBR322 used to link the yeast elements. These elements
from pBR322 are Cia I to Bam HI (352-bp fragment), and Bam HI to Sal I (276-bp fragment).
Note that both Bam HI and SaIl sites are lost in linking with Bgl II and Xho I - ended Pichia
fragments. The portion of pBR322 from Sal I to Pvu II is absnet in pHIL-Dl.
The P. pastoris elements in the plasmid are as follows:
5' AOXl, approximately 1000-bp segment of the alcohol oxidase promoter. The alcohol
oxidase coding sequences following the A of the ATG initiating methionine codon have been
removed by Bal 31 digestion, and the synthetic linker 5'-GGAATTC added to generate a
unique Eco RI cloning site. AO-t, approximately 300-bp segment of the alcohol oxidase
terminating sequence. P. pastoris histidinol dehydrogenase gene. HIS4, containd on a 2.8-kb
fragment to complement the defective his4 gene in host GTSI15. Region of 3' AOXI DNA
approximately 650 bp in size, which, together with the 5' AOXI region, is necessary for site-
directed integration
AsuII(934)
BamHI(939)
SnaBI(960)
EcoRI(964)
AvrII(970)
NotI(977)
pPIC3
7765 bp
NdeI(5599)
BgIII(5363)
NaeI(4362)
Fig.4. pPIC3
BgIII(2)
SacI(209)
AsuII(934)
BamHI(1279)
pA0815
8173 bp
BgIII(5306)
Fig. 5. pA0815
pA0856
7709 bp
EcoRV
Fig. 6. pA0856
pHIL-D2
8210 bp
ClaI(5420)
NotI(5337)
Asull(4834)
Fig. 7. pHIL-D2. Plasmid pHIL-D2 is an E. coli-Po pastoris shurtle vector, with sequences
required for selection in each host. The left half of the plasmid is a portion of pBR322, from
CIa I site through the PvuII site (modified to Bgi II site). This segment of pBR322 contains
the ampicillin resistance gene (Amp) and the origin of replication (CoiEl ori). The Eco RI
site in this segment has been eliminated. The pBR322 portion also contains a 458 kb DNA
containing the fl-bacteriophage origin of replication at the Dra I sites at positions 3232 and
3251 of pBR322.
pastoris, except for short regions of pBR322 used to link the yeast elements as follows: CIa
NdeI(3856)
Asull(946)
pHIL-D3 ~ORI(956)
4088 bp
NaeI(2794)
Fig.8. pHIL-D3. pHIL-D3 is an intermediate vector helpful in making constructs in which

the 5' untranslated region (UTR) is completely devoid of extraneous sequences. In pHIL-D2
(as well as in the other Pichia expression vectors) the cloning site for expression is Eco RI.
The AOXI promoter was modified to generate the Eco RI cloning site in the consruction
of expression vectors (see below). This modification can have significant effect on the
expression level in some instances (e.g., HSA).
AOXI promoter: .................. TTCGAA ACG
AOXI promoter with the Eco RI site (e.g., as in pHIL-D2):
.................... TTCGAA ACGAGGAATTC
A construct 100% devoid of extraneous sequences in the 5'UTR should be:
.............. TTCGAA ACG atg ..... .
The Asu II site (TTCGAA) in the 5' AOXI can be usd to make 100% exact construct.
pHIL-D2 has two Asu II sites. One in the 5' AOXI and another in the 3' AOXI (0.65-kb
segment used for recombination). Thus we have made pHIL-D2 ~ CIa vector by deleting the
Cla I fragment containing HIS4 and 3' AOXI (see Fig. 7). This vector is named pHIL-D3.
pHIL-D3 has a unique Asu II site and serves as a useful intermediate vector in making 100%
exact constructs. Once the exact construct has been made in pHIL-D3, the Cla I fragment
that was excised previously can be returned to the Cla I site to complete the vector. We have
noticed that pHIL-D3 does not dimerize, thus giving virually no background during the re-
insertion of the Cla I fragment carrying HIS4 and 3' AOXI
I to Bam HI (352-bp fragment), and Bam HI to Sal I (276-bp fragment). Note that both Bam
HI and Sal I sites are lost in linking with Bgl II and Xho I - ended Pichia fragments. The
portion of pBR322 from Sal I to Pvu II is absent in pHIL-D2.
The P. pastoris elements in the plasmid are as follows:
5' AOXI approximately 100-bp segment of the alcohol oxidase promoter in which the Bgl
II site has been changed to Not I. 3' AO-t, approximately 300-bp segment of the alcohol
oxidase terminating sequence. P. pastoris histidinol dehydrogenase gene. HIS4, contained
on a 2.4-kb fragment to complement the defective his4 gene in Pichia host strains. Region of
3' AOXI DNA approximately 650 bp in size, in which the Bgl II site has been changed to
Not I site. This fragment together with the 5' AOXI region is necessary for site-directed
integration
pHIL-D4
9001 bp
BgIll(6571)
SalI(2875)
XhoI(5406)
ClaI(5315)
SmaI(5134)
Fig. 9. pHIL-D4. pHIL-D4 allows easy screening for Pichia transformants with multiple
copies of the transforming DNA. pHIL-D4 is a derivative of pHIL-Dl. Bacterial kanamycin
resistance gene from pUC-4K (PL Biochemicals) released as a Hinc II fragment is inserted at
the unique Nae I site in the pBR322 derive region between HIS4 and 3' AOXl of pHIL-DI
(refer to Fig. 3).
pHIL-D4 can be used to screen for Pichia transformants with multiple copies of the
expression cassette by screening for increased level of resistance to antibiotic G418 (sold as
genticin, Sigma). One of the ways of using pHIL-D4 vector is shown below.
Pichia was transformed with Bgl II-digested pHIL-D4 TNF (human TNF cNDA placed at
the Bco RI site of pHIL-D4). His+transformants were pooled and screened for methanol-slow
phenotype. Two hundred methanol-slow transformants were secreened for antibiotic G418
resistance on YPD plates containing G418 at levels ranging from 100 to 200.ug/ml. One
transformant was resistant to G418 even at 200,ug/ml. This highly resistant transformant
was shown to produce TNF at levels >30% of the total soluble protein. We used TNF as an
example, because its expression level in Pichia was known to be copy number-dependent.
This approach for screening is useful in identifying transformants with presumably
multicopy integrants. In several cases, it has been noted by us as well as others, that the gene
dosage has a profound effect on the expression level in Pichia (Sreekrishna 1993) (e.g., TNF,
EGF, salmon growth hormone, Clostridium tetani toxin fragment C, Bordetella pertussis p69
antigen. etc.)
pPIC3K: pPIC3 with kanamycin resistance gene (M.A. Romanos, pers. comm.; Fig.
10).
pHIL-DS: pHIL-D2 with kanamycin resistance gene (K. Sreekrishna and S.
Hopkins, unpubl. observ.; Fig. 11).
pHIL-D6: pHIL-DS with unique ASUII site and multiple cloning sites (R. Belagaje,
pers. comm.; Fig. 12).
pHIL-D7: pHIL-DS with unique ASUII site (K. Kropp, unpubl. result; Fig. 13).
pHIL-Sl: Secretion vector with P. pastoris acid phosphatase secretion signal; Fig.
14.
Signal sequence including cloning junction of pPIC9 and pPIC9K (Fig. 15).
pPIC9: Secretion vector with S. cerevisiae alpha mating factor pre-pro signal (Clare
et al. 1991b; Fig. 16).
pPIC9K: pPIC9 with kanamycin resistance gene (Scorer et al. 1994; Fig. 17).
AsuII(934)
BamHI(939)
SnaBI(960)
EcoRI(964)
AvrII(970)
Notl(977)
pPIC3K
9017 bp
BglII(6615)
XhoI(5450)
OaI(5359)
SmaI(5178)
Fig. 10. pPIC3K

pHIL-D5
9462 bp
SaII(2887)
Notl(6589)
Fig. 11. pHIL-DS
Asull(934)
EcoRI(944)
NdeI(951)
SpeI(961)
SmaI(969)
BamHI(971)
pHIL-D6
9474 bp
Bgill(6605) SalI(2907)
XhoI(5438)
CJaI(5347)
Fig. 12. pHIL-D6

pHIL-D7
9442 bp
BglII(6573) SaII(2875)
J
Fig. 13. pHIL-D7
AsuII(934)
XhoI(lOO6)
EcoRI(lOll)
SmaI(1019)
BamHI(I02I)
ClaI(!360)
sequence
NaeI(6693)
pHIL-Sl
8260 bp
NdeI(5629)
BglII(5393)
AsuII(4896)
NaeI(4392) A
Fig. 14. pHIL-SL Plasmid pHIL-S1 is a secretion vector and other features are similar to
pHIL-DL This vector also contains fl origin of replication, similar to that in pHIL-D2. The
junction sequence for making fusions to the acid phosphatase secretion signal sequence is
shown
--/l-S'AOXl---TIATICGAAACG ATG TTC TCT CCA ATT TTG TCC TTG

MFS P IL SL
<---PH01 Secretion Signal Sequence------
xho I
GAA ATT ATT TTA GCT TTG GCT ACT TIG CAA TCT GTC TIC GCT V
E I I LAL ATLQSVFA
-------------- Signal Sequence continued---------------><
Sienal peptide c1eavau site
EcoR I S11UZ J Bam HI
CQAGM'ITCCCCGGQATCCI'TAGA CAT......../I ....
REFPG I L
---- Multi Cloning Site---x----3' AO-t----/l---
Fig.l4B
.....•/! ....................•.• .5'AOXl ........................... TTCGAAGGATCCAAACG
ATG AGA TIT CCTTCAATI TIT ACI'GCAGTITIA TIC GCAGCATCCTeC

MR FPSIFTAVLFAASS
<----------------Mating Factor-a Pre Sequence-----------------
Pre Sequence c1eavau site
GCA TIA GCI'VGcr CCA GTC AAC ACI' ACA ACA GAA GAT GAA ACG GCA
ALA AP VRITTEDETA
------------> <------Mating factor-a Pro sequence ----------------
CAAATI CCG GCI' GAA GcrGTC ATC GGTTACTCA GATTIA GAA GGGGAT
QIP AEAVIGYSDLEGD
-------------------------Pro sequence continued-------------------------
TIC GAT GTI Gcr GTI TTG CCA TIT TeC AAC AGC ACA AAT AAC GGG TIA
F D V A V L P F S N S T NN G L
-------------------------Pro sequence continued--------------------------------
TIG TIT ATA AAT ACI' ACI' ATI GCC AGC ATT Gcr Gcr AAA GAA GAA GGG
LFINTTIASI AAKEE G
------------------ Pro sequence continued--------------------------
Xho 1 KED-Protease c1eavaae site Sna B1 Eco R1
GTA TCI' CTC GAG AAA AGA V GAG Gcr GAA Gcr TAC GTA
GAATIC
VSLEKR EAEAYVEF
-- Pro sequence continued--x--Multiple Cloning Sites-(Mcs)--------
AvrIl NotJ
ccr AGG GCG ace GCG .............. .11..
P R A A A
------MCS continued---x--3'AO-t---/l-
Fig. 15. The signal sequence including cloning junction, same for vectors pPIC9 (Fig. 16)
and pPIC9K (Fig. 17). Note: Xho I is an unique site only in pPIC9 but not in pPIC9K
BgllI(2)
j AsuII(934)
BamHI(939)
XhoI(1l93)
SnaBI(1219)
EcoRI(1223)
AvrII(l229)
NotI(1236)
ClaI(1589)
pPIC9
8024 bp
BgllI(5622)
SaII(3178)
NaeI(4621)
Fig. 16. pPIC9
SnaBI(1219)
EcoRI(1223)
A vrII(l229)
NotI(l236)
IXmating factor
signal sequence
pPIC9K
9276 bp
SaII(3178)
ClaI(5618)
SmaI(5437)
Fig. 17. pPIC9K

10
Optimization of Protein Expression
Numerous proteins have been expressed in P. pastoris with varying degrees of

success (see Table I for a partial list). Nearly every protein expression project has
given a new insight, and as a result the following list of factors should be consid-
ered for expression optimization.
10.1
Autonomous Replication or Integration?
Undoubtedly, the preferred mode for expression in P. pastoris is by integration.

Such constructs are stable, and methods are available for obtaining stable
multi-copy integrants (see next section below). Autonomous vectors such as
pHIL-AI (see Sect. 9) are low copy, unstable, and eventually integrate (at one or
more of the chromosomal loci, namely AOX1, HIS4, or ARSl) especially once
the promoter is activated. The constructs for LACZ, SUC2, and streptokinase
expressions were initially based on the pHIL-AI type autonomous vectors.
Most other reported expression work has used integration vectors, and this
trend will continue until stable, high-copy number autonomous vectors (of the
sort available for S. cerevisiae and Kluyveromyces lactis) are established for
P. pastoris.
Nevertheless, autonomous vectors, owing to their high frequency of transfor-
mation capability, are useful in mastering the spheroplast transformation proce-
dure and in the isolation of genes by complementation.
10.2
Gene Dosage
The effect of gene copy number on expression is unpredictable. In some cases one
copy, is sufficient, whereas in other cases 2 or more copies (>10) are necessary (see
Table 1). There are also instances where an increase in copy number has deleteri-
ous effect on expression (Thill et al. 1990). Thus, the expression level should be
examined over a wide range of copy numbers to arrive at the best production
strain.
In practical terms, this can be readily accomplished by analysis of several
individual transformants (24-100) obtained by using the spheroplast method of
transformation. Desired colonies can be preselected by colony or dot hybridiza-
tion with DNA probes prior to screening for expression. Only the spheroplast
method of transformation yields a wide range of multicopy integrants. Other
methods of transformation do not yield multicopy integrants at a high frequency,
and thus require high throughput assays for expression or efficient selection/
screening schemes for multicopy integrants. Recently, a scheme based on in-
creased level of resistance to antibiotic G418 as a function of gene dosage has been
developed by using electroporated transformants with pPIC3 or pPIC9 type vec-
tors (Scorer et al. 1994).
Table 1. Heterologous proteins expressed in P. pastoris
Protein Location Copy Amount Reference

number
E. coli f3-galactosidase I-s 20% of soluble

protein
HBsAg I-p 0.3 gil 2
Human TNF I-s >20 10.0 gil 3,4
10 4.0 gil 4
1 0.05 gIl 4
Salmon growth hormone I-i 18 0.3 gil 4
Streptokinase I-s 0.077 gIl 5
Tetanus toxin fragment C I-i 14 12.0 gil 6
Bordetella pertussus
Pertactin P69 I-i >lO 3.0 gil 7
Human Interleukin-2 I-i 1 0.5 gIl 8
Human Interleukin-2 I-i 4.0 gIl 9
Human Interleukin-2 S 1.0 gIl 9
B. sphaericus mosquitocidal
components:
BSP1 (42kDa) I-s 5% of soluble lO
protein
BSP1 (42kDa) I-s 10 5% of soluble lO
protein
BSP2 (51.4kDa) I-s <0.1 % of soluble lO
protein
BSP2 (51.4kDa) I-s >20 20% of soluble lO
protein
(BSP1 + BSP2) I-i Multicopy 14% oftotal protein lO
Superoxide dismutase I-s 1 0.33 gIl 11
I-s 2 0.74 gil 11
Aprotinin S 0.14gll 11
S 2 0.32 gIl 11
S 5 0.93 gIl 11
Bovine lysozyme S 1 0.46gfl 11
S 3 0.25 gIl 11
HumanEGF S Multicopy 0.50 gIl 12
Mouse EGF S 19 0.45 gIl 13
Kunitz protease inhibit S 1.0 gIl 14
Invertase S 2.5 gIl 15
Human TNF-analogues:
TNF 9 (aa 135-153 deleted) I-i >20 35% of total protein 16
TNF 16(aa 7-47 deleted) I-i >20 32% of total protein 16
TNF-Arg-(His-Ala)3-His tail I-i >20 33% of total protein 16
Human serum albumin S 1 4.0 gIl 17
I-i 0.02 gIl 17
Insulin-like growth factor-1 S 0.5 gIl 18
CD4-VI domain S 2 0.1 gIl 19
HIV gp120 I-i 12 1.25 gIl 20
A single chain antibody S >1 gil 21
IgE Receptor (a-subunit) S 0.02 gIl 22
Tick anticoagulant peptide S 1.7 gIl 23
Table 1 (contd.)
Protein Location Copy Amount Reference

number
Cathepsin E S 24
Bm 86 antigen S 1.5 gil 25
D-alanine carboxy peptidase S lor 100mg/i 26
multicopy
I-s = Intracellular soluble; I-i = Intracellular insoluble; I-p = Intracellular particle; Ss =

Secreted soluble; HBsAg = Hepatitis B viral surface antigen; TNF = Tumor Necrosis Factor-
a; EGF = Epidermal Growth Factor.
References: (1) Cregg and Madden (1988); (2) Cregg et al. (1987); (3) Sreekrishna et al.
(1989); (4) Hagenson et al. (1989); (5) K. Sreekrishna and K.A. Parker, unpubl. observ.; (6)
Clare et al. (1991a); (7) Romanos et al. (1991); (8) W.R. McCombie pers. comm.; (9) Cregg
et al. (1993); (10) Sreekrishna et al. (1993); (ll) Wagner et al. (1992); (12) Siegel et al. (1990);
(13) Clare et al. (1991); (14) Wagner et al. (1992); (15) Tschopp et al. (1987); (16) Sreekrishna
et al. (1988a); (17) Sreekrishna et al. (1990); (18) Brierley et al. (1992); (19) Buckholz et al.
(1991); (20) M.A. Romanos, pers. comm.; (21) P. Mezes, pers. comm.; (22) Basu et al. (1992);
(23) Laroche et al. (1994); (24) Yamada et al. (1994); (25) Rodriguoz et al. (1994); (26)
Despreaux and Manning (1993).
Alternatively, multicopy construction vectors such as pA0856 and pA0815

(Thill et al. 1990) can be used to make 1,2,4,6, or 8-copy constructs in vitro prior to
transformation. These constructs can be introduced by using anyone of the trans-
formation procedures to obtain strains having up to eight copies.
10.3
Mut + or Mut - Host?
For intracellular expression, it makes sense to use Mut- cells because of increased
specific yield of heterologous protein (lower levels of alcohol oxidase). For secre-
tion, it probably does not make much difference whether Mut" or MUl cells are
used, although some investigators have preferred to use Mut" cells for secretion.
Ideally, for any given product it is better to test expression in both Mut" and MUl
backgrounds.
10.4
Site of Integration
Both AOXI and HIS4 sites have been used successfully for expression of several
proteins. While it appears that AOXI site is the inevitable site for creating MUl
constructs, it does not have to be so because of the availability of inherently MUl
hosts such as strain KM71 (see Sect. 3). Thus an expression cassette can be inte-
grated at the his4 site by transforming the strain KM71 with the Sal I digested
pHIL-DI type plasmid (Sal I cleaves within the HIS4 of pHIL-Dl). Instability of the
integrated expression cassette due to gene conversion between chromosomal mu-

tant copy of the his4 and the good HIS4 gene of the expression cassette has been
noticed in only one instance, where the LACZ construct was integrated at the his4
locus.
10.5
mRNA 5' and 3' Un translated Sequences
The nucleotide sequence and the length of the 5' untranslated (leader) sequence
(5'-UTR) can be detrimental to high-level gene expression. The leader length of the
highly expressed AOX1 mRNA is 114nt and the sequence is A+U rich. For optimal
expression of heterologous products, it is essential to retain the 5'UTR of the
resulting constructs as closely as possible to that of the AOX1 mRNA. Ideally, it is
preferable to make it identical to that of the AOX1 mRNA (i.e., 100%-exact con-
struct). In fact, the expression level of human serum albumin (HSA) is increased
over 50-fold by adjusting the 5'-UTR to be identical to that of the AOX1-mRNA
(Sreekrishna et al. 1990; Sreekrishna 1993). Such a dramatic effect on expression
has not been observed by deleting the extraneous 3'-untranslated region. However,
it is desirable to trim the 3'-portion of the gene construct so as to have no or limited
extraneous 3'-UTR.
10.6
Translation Initiation Codon (AUG) Context
AUG sequence should be avoided in the 5'-UTR to ensure efficient translation of

mRNA from the actual translation initiation AUG. Also, the mRNA secondary
structure around the initiation AUG may be adjusted so that AUG is relatively free
of secondary structure as predicted by the RNA-fold analysis (PC/gene Software,
Intelligenetics, Mountain View, California, USA). This can be accomplished by
redesigning the initial portion of the coding region with alternate co dons
(Sreekrishna 1993).
10.7
A+T Composition
Genes with a high A+T nucleotide content are not transcribed efficiently due to
premature terminations (Romanos et al. 1992). One such sequence that has been
identified for P. pastoris is the ATTATTTTATAAA stretch present in HIV-gp120
(M.A. Romanos, pers. comm.). When this stretch is altered to TTTCTTCTACAAG,
the premature termination at this site is abolished. However, there are many yet
unidentified AT-rich stretches that act as transcription terminators. A general
strategy to overcome the transcriptional terminators in the coding region is by
redesigning the gene to have an A+T content in the range of 30-55%. The expres-
sion problem of several A+T rich genes has successfuly been overcome by using
this approach (Romanos et al. 1992; Clare et al. 1991a; Sreekrishna Sreekrishna et
al. 1993). P. pastoris preferred codons are given which can be used to redesign
genes. Genes with a high G+C content are efficiently transcribed (Romanos et al.
1991; Table 2)
10.8
Secretion Signal
Secretion is the preferred mode of expression for naturally secreted proteins. Most
native secretion signals efficiently direct secretion in P. pastoris. If a native secre-
Table 2. Frequency of codon usage in highly expressed P. pastoris genes' (G.P. Thill, pers.
comm.)
Amino Codon Number Fraction Amino Codon Number Fraction

acid acid
Gly GGG 0.00 0.00 Trp TGG 39.00 1.00

Gly GGA 59.00 0.22 End TGA 0.00 0.00
Gly GGT 197.00 0.74 Cys TGT 35.00 0.83
Gly GGC 9.00 0.03 Cys TGC 7.00 0.17
Glu GAG 112.00 0.58 End TAG 1.00 0.20
Glu GAA 80.00 0.42 End TAA 4.00 0.80
Asp GAT 56.00 0.32 Tyr TAT 18.00 0.12
Asp GAC 118.00 0.68 Tyr TAC 128.00 0.88
Val GTG lO.OO 0.05 Leu TTG 120.00 0.52
Val GTA 8.00 0.04 Leu TTA 21.00 0.09
Val GTT 107.00 0.50 Phe TTT 24.00 0.18
Val GTC 87.00 0.41 Phe TTC lO4.00 0.81
Ala GCG 1.00 0.00 Ser TCG 6.00 0.03
Ala GCA 25.00 0.10 Ser TCA 14.00 0.07
Ala GCT 147.00 0.60 Ser TCT 89.00 0.47
Ala GCC 71.00 0.29 Ser TCC 71.00 0.37
Arg AGG 2.00 O.oI Arg CGG 2.00 0.01
Arg AGA 111.00 0.79 Arg CGA 0.00 0.00
Ser AGT 8.00 0.04 Arg CGT 26.00 0.18
Ser AGC 3.00 0.02 Arg CGC 0.00 0.00
Lys AAG 145.00 0.79 GIn CAG 31.00 0.34
Lys AAA 38.00 0.21 GIn CAA 59.00 0.66
Asn AAT 18.00 0.13 His CAT 11.00 0.13
Asn AAC 119.00 0.87 His CAC 77.00 0.88
Met ATG 60.00 1.00 Leu CTG 35.00 0.15
Ile ATA 0.00 0.00 Leu CTA 7.00 0.03
lIe ATT 93.00 0.56 Leu CTT 43.00 0.18
lIe ATC 72.00 0.44 Leu CTC 7.00 0.03
Thr ACG 5.00 0.03 Pro CCG 0.00 0.00
Thr ACA 8.00 0.05 Pro CCA 97.00 0.57
Thr ACT 86.00 0.50 Pro CCT 66.00 0.39
Thr ACC 74.00 0.43 Pro CCC 7.00 0.04
aThe data were compiled based on the deduced sequence of the following P. pastoris genes:
alcohol oxidase genes AOXI and AOX2, dihydroxy acetone synthase genes DASI and DAS2,
and glyceraldehyde phosphate dehdrogenase gene GAP.
tion signal is not available, then signal sequences based on S. cerevisiae invertase
secretion signal or pre-pro mating factor a (AMF) (see pPIC9 in Sect. 9.1) can be
used. The AMF signal works very efficiently and is particularly valuable in secret-
ing smaller-sized products «lOkDa). In making protein fusions with the AMF-
secretion signal (see Sect. 9.1), it is preferable to retain the Glu-Ala spacers
adjacent to the Lys-Arg processing site (protease KEX2 type cleavage site) to
prevent potential processing problems due to steric factors contributed by the
fused protein (Thill et al. 1990).
10.9
Glycosylation
P. pastoris is capable of making both N-{aspargine) and O-{serine or threonine)-

linked carbohydrate additions to secreted proteins. As in the case of S. cerevisiae,
the N-linked oligosaccharide chain is of the high mannose (Kukuruzinska et al.
1987; Grinna and Tschopp 1989). However, two structural differences in the oli-
gosaccharide chain length and linkage have been noticed between P. pastoris and
S. cerevisiae-secreted invertases. In the invertase from P. pastoris, carbohydrate
moiety consists of predominantly 8-12 mannose residues with a small proportion
of chains containing up to 30 mannose residues. Compared to this bulk of
the carbohydrate in S. cerevisiae-secreted invertase, is composed of 50-150
mannose units (Grinna and Tschopp 1989). The differences in the oligosaccharide
chain length between the two yeasts do not appear to be a general phenomena,
because HIV -gp 120 secreted from P. pastoris is hyperglycosylated (Scorer
et al. 1992). In fact, even the invertase secreted from P. pastoris using the AMF-
secretion signal is hyperglycosylated (R.G. Buckholz, pers. comm.). Thus, the
oligosaccharide chain length of the P. pastoris-secreted glycoproteins tends to be
unpredictable.
Perhaps a more significant difference in the oligosaccharide structure of Pichia-
derived invertase is the absence of terminal a 1,3-linked mannose residues
(Trimble et al. 1991). This appears to be a general phenomenon for P. pastoris, as
it does not appear to have any a 1,3 mannosyl transferase activity (Cregg et al.
1993). In contrast to this, a 1,3-mannose linkage is present in S. cerevisiae inver-
tase and appears to be a characteristic feature ofN-linked oligo saccharides of this
yeast (Trimble et al. 1991). The a 1,3-mannose side chains are highly immunogenic
(Romanos et al. 1992) and thus may be unsuitable as therapeutics. Whether the
absence of the a 1,3-mannosyllinkage in P. pastoris-secreted glycoproteins is less
immunogenic remains to be tested.
10.10
Product Stability
Proteolytic stability can be improved by using protease-deficient host strains such

as SMD1168 (Sect. 3). Stability can also be improved by making fusions to other
stably expressed proteins such as human serum albumin. Changing the media pH
and growth conditions also can improve product yield, as already discussed in
Sect. 5.
10.11
Future Perspectives
10.11.1
Expression Without Methanol
There has been some hesitation in using methanol, which is absolutely essential for
activating the AOXl, DASl, and related promoters in P. pastoris. To overcome this
problem, mutant strains of P. pastoris that express the AOXI promoter activity in
glucose medium have recently been generated and are being improved (A. Sibirny,
pers. comm.). As ethanol can still repress the AOXI promoter in these mutants, the
expression can be turned off at will by using ethanol.
Alternatively, one can use the glyceraldehyde-3-phosphate dehydrogenase
(GAPDH) regulatory sequences for heterologous expression on glucose or glycerol
medium (Digan 1990).
10.11.2
Improved Posttranslational Modifications in Yeast
A major limitation of P. pastoris and other yeast expression systems in the produc-
tion of therapeutic proteins is that they are unable to carry out several posttrans-
lational protein modifications found in mammalian proteins. These include
mammalian-type protein glycosylation, vitamin K-dependent y-carboxylation of
glutamic acid, COOH-terminal amidation, etc. One would anticipate that there will
be some effort in the future to engineer yeasts with mammalian genes to enable
them to perform several of these post-translational modifications.
11
Miscellaneous Procedures
Readers are referred to the protocols available for S. cerevisiae (Rose et al. 1990;
Guthrie and Fink 1991), as they can be directly adapted to P. pastoris for a variety
of applications including, DNA isolation, RNA isolation, mutagenesis, colony hy-
bridization, etc. Readers are also encouraged to refer to published mutagenesis
protocols for P. pastoris (Gould et al. 1992; Liu et al. 1992).
Acknowledgments. We wish to thank all the investigators listed in the references
who shared unpublishd results, Alan D. Cardin for many valuable suggestions and
Robert Brankamp for a thorough perusal of the manuscript.
References
Barnett JA, Payne RW, Yarrow D (1990) Yeasts. Characteristics and identification. Cam-
6. P;ch;o postor;s 251
Barr KA, Hopkins SA, Sreekrishna K (1992) Protocol for efficient secretion of HSA devel-
oped from Pichia pastoris. Pharm Eng 12: 48-51
Basu M, Nettleton MY, Dharm E, Manning RF, Despreaux CW, Hakimi J, Kochan JP
(1992) Purification and characterization of a soluble form of the human IgE-receptor
(a-subunit) expressed in Pichia pastoris. American Society for Biochemistry and
Molecular Biology/Biophysical Society Joint meeting, Abstr #1507, February 9-13, Hous-
ton
Becker DM, Guarente L (1992) Protocol for high efficiency yeast transformation In: Chang
DC, Chassy BM, Saunders JA, Sowers AE (eds) Guide to electroporation and
electrofusion Academic Press, New York, pp 501-505
Brierley RA, Davis GR, Holtz GC, Gleeson MA, Howard BD (1992) Production of insulin-like
growth factor-1 in methylotrophic yeast cells. International Patent Application, No WO
92/04363
Buckholz RG, Brierley RE, Odiorne MS, Siegel RS, Wondrack LM (1991) CD. production in
Pichia pastoris. International Patent Application, No WO 91105057
Clare JJ, Rayment FB, Ballantine SP, Sreekrishna K, Romanos MA (1991a) High-level
expression of tetanus toxin fragment C in Pichia pastoris strains containing multiple
tandem integration of the gene. Bio/Technology 9: 455-460
Clare JJ, Romanos MA, Rayment FB, Rowedder JE, Smith MA, Payne MM, Sreekrishna K,
Henwood CA (1991b) Production of mouse epidermal growth factor in yeast: high-level
secretion using Pichia pastoris strains containing multiple gene copies. Gene 105: 205-
212
Cregg JM, Madden KR (1988) Development of the methylotrophic yeast, Pichia pastoris as
a host for the production of foreign proteins. Dev Ind Microbiol29: 33-41
Cregg JM, Barringer KJ, Hessler AY, Madden KR (1985) Pichia pastoris as a host system for
transformations. Mol Cell BioI 5: 3376-3385
Cregg JM, Tschopp JF, Stilman C, Siegel R, Akong M, Craig WS, Buckholz RG, Madden KR,
Kellaris PA, Davis GR, Smiley BL, Cruze J, Toregrossa R, Velicelebi G, Thill GP (1987)
High-level expression and efficient assembly of hepatitis B surface antigen in
methylotrophic yeast, Pichia pastoris. Bio/Technology 5: 479-485
Cregg JM, Madden KR, Barringer KJ, Thill GP, Stilton CA (1989) Functional characteriza-
tion of the two alcohol oxidase genes from the yeast Pichia pastoris. Mol Cell BioI 9:
1316-1323
Cregg JM, Vedvick TS, Raschke WC (1993) Recent advances in the expression of foreign
genes in Pichia pastoris. Bio/Technology 11: 905-910
Despreaux CW, Manning RF (1993) The dacA gene of Bacillus stearothermophilus coding
for D-alanine carboxy peptidase: cloning, structure and expression in E. Coli and Pichia
pastoris. Gene 131: 35-41
Digan ME (1990) Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase gene. Euro-
pean Patent Application, No 0374 913 Al
Digan ME, Lair SV (1986) Genetic methods for the methylotrophic yeast, Pichia pastoris. In:
von Borstel RC, Cooper TG (eds) Abstr 13th Int Conf on Yeast Genetics and Molecular
Biology Yeast 2 (1986): S89 (Spec Issue)
Dohmen JR, Strasser AWM, Honer CB, Hollenberg CP (1991) An efficient transformation
procedure enabling long term storage of competent cells of various yeast genera. Yeast
7:691-692
Ellis SB, Brust PF, Koutz PJ, Waters AF, Harpold MM, Gingeras TR (1985) Isolation of
alcohol oxidase and two other methanol-regulatable genes from the yeast Pichia pastoris.
Mol Cell BioI 5: 1111-1121
Gould SJ, McCollum D, Spong AP, Heyman JA, Subramani S (1992) Development of the
yease Pichia pastoris as a model organism for genetic and molecular analysis of peroxi-
somal assembly. Yeast 8: 613-628
Grinna LS, Tschopp JF (1989) Size distribution and general structural features ofN-linked
oligosaccharides from the methylotrophic yeast Pichia pastoris. Yeast 5: 107-115
Guthrie C, Fink GR (eds) (1991) Guide to yeast genetics and molecular biology. Methods in
Enzymology, vol 194. Academic Press, New York
Hagenson MJ, Holden KA, Parker KA, Wood PJ, Cruze JA, Fuke M, Hopkins TR, Stroman
DW (1989) Expression of streptokinase in Pichia pastoris yeast. Enzyme Microb Technol
11: 650-656
Harder W, Trotsenko YA, Bystrykh LV, Egli T (1986) Microbial growth on C1 compounds.
In: Van Verseveld HW, Duine JA (eds) Proceedings of the 5th International Symposium
Martinus Nijhoff, Dordrecht, pp 138-157
Hopkins TR (1991) Physical and chemical cell disruption for the recovery of intracellular
proteins. In: Seetharam R, Sharma SK (eds) Purification and analysis of recombinant
proteins Mercel Dekker, New York, pp 57-83
Ito H, Fukuda Y, Murata K, Kimura A (1983) Transformation of intact yeast cells treated
with alkali cations. J Bacteriol153: 161-168
Kukuruzinska MA, Bergh MLE, Jackson BJ (1987) Protein glycosylation in yeast. Annu Rev
Biochem 56: 915-944
Kurtzman CP (1984a) Pichia Hansen. In: Kreger-van Rij NJW (ed) The yeasts: a taxonomic
study. Elsevier Amsterdam, pp 295-378
Kurtzman CP (1984b) Synonomy of the yeast genera Hansenula and Pichia demonstrated
through comparisons of the deoxyribonucleic acid relatedness. Antonie Leeuwenhoek
50:209-217
Laroche Y, Storme V, Meutter JD, Messens J, Lauwerey SM (1994) High-level secretion and
very efficient isotopic labelling of tick anti-coagulant peptide (TAP) expressed in the
methylotrophic yeast, Pichia pastoris. Bio/Technology 12: 1119-1124
Liu H, Tan X, Veenhuis M, McCollum D, Cregg JM (1992) An efficient screen for peroxi-
some-deficient mutants of Pichia pastoris. J Bacteriol174: 4943-4951
Reiser J, GlumoffV, Kalin M, Urs 0 (1990) Transfer and expression of heterologous genes
in yeasts other than Saccharomyces cerevisiae. In: Fiechter A (ed) Advances in biochemi-
cal engineering/biotechnology, vol 43. Springer, Berlin Heidelberg New York, pp 76-97
Rodringuez M, Rubiera R, Penichet M, Montesinos R, Cremata J, Falcon V, Sanchez G,
Bringas R, Cordoves C, Valdes M, Lleonart R, Herrera L, dela Fuente J (1994) High level
expression of the f3 microplus Bm86 antigen in the yeast Pichia-pastoris forming highly
immunogenic particles for cattle. J Biotechnol33: 135-146
Romanos MA, Clare JJ, Beesley KM, Rayment FB, Ballantine SP, Makoff AJ, Dougan G,
Fairweather NF, Charles IG (1991) Recombinant Bordetella pertussis (P69) from the
yeast Pichia pastoris: high-level production and immunological properties. Vaccine 9:
901-906
8:423-488
Rose MD, Winston F, Hieter P (1990) Methods in yeast genetics: a laboratory course
manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York
Scorer CA, Buckholz RG, Sreekrishna K, Clare JJ, Romanos MA (1992) Expression of HIV
gp120 in Pichia pastoris: selection for multi-copy transformants using drug resistance.
16th Int Conf on Yeast Genetics and Molecular Biology, Vienna, Austria, Topic No 14-
49B
Scorer CA, Clare JJ, McCombie WR, Romanos MA, Sreekrishna K (1994) Rapid selection
using G418 of high copy number transformants of Pichia pastoris for high-level foreign
gene expression. Bio/Technology 12: 181-184
Siegel RS, Buckholz RG, Thill GP, Wondrack LM (1990) Production of epidermal growth
factor in methylortrophic yeasts. International Patent Application, No WO 90110697
Sreekrishna K (1993) Strategies for optimizing protein expression and secretion in the
methylotrophic yeast Pichia pastoris. In: Baltz RH, Hegeman GD, Skatrud PL (eds)
"Industrial microorganisms: basic and applied molecular genetics" American Society of
Microbiology, Washington DC, pp 119-126
6. Pich;o postor;s 253
Sreekrishna K, Prevatt WD, Thill GP, Davis GR, Koutz P, Barr KA, Hopkins SA (1993)
Production of Bacillus entomotoxins in methylotrophic yeast. European Patent Applica-
tion, Publication no. EP 0586 892 Al
Sreekrishna K, Tschopp JF, Fuke M (1987) Invertase gene (SUC2) of Saccharomyces
cerevisiae as a dominant marker for transformation of Pichia pastoris. Gene 59: 115-125
Sreekrishna K, McCombie WR, Potenz R, Parker KA, Mazzaferro PK, Maine GM, Lopez JL,
Divelbiss DK, Holden KA, Barr RD, Fuke M (1988a) Clonal variation in the expression of
human tumor necrosis factor (TNF) in the methylotrophic yeast Pichia pastoris,
Presented at the 5th Annual Biotech USA Industry Conference and Exhibition, San
Francisco
Sreekrishna K, Potenz R, Cruze JA, McCombie WR, Rarker KA, Nelles L, Mazzaferro PK,
Holden KA, Harrison RG, Wood PJ, Phelps DA, Hubbard CE, Fuke M (1988b) High level
expression of heterologous proteins in methylotrophic yeast Pichia pastoris. J Basic
Microbil 28: 265-278
Sreekrishna K, Nelles L, Potenz R, Cruze J, Mazzaferro P, Fish W, Fuke M, Holden K, Phelps
D, Wood P, Parker K (1989) High-level expression, purification, and characterization of
recombinant human tumor necrosis factor synthesized in the methylotrophic yeast
Pichia pastoris. Biochemistry 28: 4117-4125
Sreekrishna K, Barr KA, Hoard SA, Prevatt WD, Torregrosa RE, Levingston RE, Cruze JA,
Wegner GH (1990) Expression of human serum albumin in Pichia pastoris. 15th Int
Congr on Yeast Genetics and Molecular Biology, Hague, The Netherlands, Topic No 09-
37B
Thill GP, Davis GR, Stillman GR, Holtz C, Brierly R, Engel M, Buckholz R, Kinney J, Provo
S, Vedvick T, Siegel RS (1990) Positive and negative effects of multi-copy integrated
expression vectors on protein expression in Pichia pastoris. In: Proc 6th Int Symp on
Genetic ofIndustrial Microorganisms, Strasbourg, pp 477-490
Trimble RB, Atkinson PH, Tschopp JF, Townsend RR, Maley F (1991) Structure of oligosac-
charides on Saccharomyces SUC2 invertase secreted by the methylotrophic yeast Pichia
pastoris. J BioI Chern 266: 22807-22817
Tschopp JF, Svelow G, Kosson R, Craig W, Grinna L (1987) High-level secretion of
glycosylated invertase in the methylotrophic yeast, Pichia pastoris. Bio/Technology 5:
1305-1308
Veenhuis M, van Dijken JP, Harder W (1983) The significance of peroxisomes in the
metabolism of one-carbon compounds in yeasts. Adv Microb Physiol24: 1-82
Wagner SL, Siegel RS, Vedvick TS, Raschke WC, van Nostrand WE (1992) High-level
expression, purification and characterization of the Kunitz-type protease inhibitor do-
main of protease nexin-2/amyloid /3-protein precursor. Biochem Biophys Res Commun
186: 1138-1145
Wegner GH (1983) Biochemical conversions by yeast fermentation at high cell densities. US
Patent 4: 329,414
Wegner GH (1990) Emerging applications of the methylotrophic yeasts. FEMS Microb Rev
87:279-284
Wegner GH, Harder W (1986) Methylotrophic yeasts-1986. Microbial growth on C1 com-
pounds. In: Van Verseveld HW, Duine JA (eds) Proc 5th Int Symp Martinus Nijhoff
Publishers, Dordrecht, pp 139-149
Yamada M, Azuma T, Matsuba T, !ida H, Suzuki H, Yamamoto K, Kohli Y, Hori H (1994)
Secretion of human intracellular aspartic proteinase Cathepsine expressed in the
methylotrophic yeast, Pichia pastoris and characterization of produced recombinant
cathepsine. Bichom Biophy Acta 1206: 279-285
CHAPTER 7
Pichia guilliermondii
Andrei A. Sibirny
1
History of Pichia guilliermondii Research
Pichia guilliermondii Wickerham represents a collection of sporogenous strains

which formerly belonged to the asporogenous species Candida guilliermondii
(Cast.) Langeron a. Guerra (Wickerham and Burton 1954; Wickerham 1966;
Kreger van Rij 1970). This means that each strain of C. guilliermondii which is able
to hybridize with any strain of P. guilliermondii must be transferred to the latter
species. For example, even the strain type C. guilliermondii ATCC 9058 must now
be considered as P. guilliermondii (Sibirny et al. 1977b).
The genetics of P. guilliermondii was studied almost exclusively in the former
"socialist countries", i.e., the former USSR (mostly in Lviv and Kiev, Ukraine), and
the former GDR (in Greifswald). The interest in genetic studies of this species lies
firstly in its ability to utilize hydrocarbons as sole carbon and energy source
(Shchelokova et al. 1974) and especially as an industrial producer of single-cell
protein from hydrocarbons. Formerly erronously identified in the USSR as
Candida guilliermondii, it has now been reidentified as Candida maltosa (see
Bykov et al. 1987). The second reason is the remarkable ability of P. guilliermondii
strains to oversynthesize riboflavin (vitamin Bz) during growth in iron-deficient
media (Shavlovsky and Logvinenko 1988b). Such features are known to be charac-
teristics of a limited number of yeast species, and P. guilliermondii can be consid-
ered as the model organism for this group, due to its genetic qualities.
2
Physiology
Cells of P. guilliermondii are heterogenous, mostly elongate in shape (approx. 2 x

10,u), sometimes forming a pseudomycelium (Kreger van-Rij 1970). The natural
habitat of the species is diverse. A study of 140 strains of P. guilliermondii isolated
from natural habitats showed that the most frequent source of their isolation is oil-
Division of Regulatory Cell System, Institute of Biochemistry, Ukrainian Academy of Sci-

ences, Drahomanov Street, 14116, Lviv 290005, Ukraine
256 A.A. Sibirny
containing soil (123 strains); others were isolated from plant leaves, lake water,
and cow paunch (Zharova et al. 1977; Zharova 1980).
All known strains do not utilize lactose, starch, and inosite, whereas they
differ in their ability to utilize D-ribose, D-arabinose, D-cellobiose, D-melibiose,
salicin, L-rhamnose, L-sorbose, and dulcite. All known strains utilize hydrocar-
bons (natural mixtures or n-hexadecane) as sole source of carbon and energy
(Kreger van-Rij 1970; Zharova 1980). Growth on other respiratory substrates, such
as ethanol, glycerol, succinate, or citrate, is satisfactory. P. guilliermondii is a
typical representative of aerobic yeasts, and cannot grow under strictly anaerobic
conditions.
The standard growth temperature for P. guilliermondii is 30 DC. The upper limit
is near 42 DC.
Standard media for yeast cultivation can be used for laboratory cultivation of
P. guilliermondii (YEPD or YEPS in which glucose is substituted by sucrose, are
used as "complete" media). As minimal medium, modified Burkholder medium is
used (Burkholder 1943; Shavlovsky et al. 1978). Other standard media can also
be used in work with P. guilliermondii (Sibirny et al. 1977b).
The remarkable feature of almost all known strains of P. guilliermondii is their
ability to overproduce riboflavin during cultivation in iron-deficient media
(Demain 1972; Dikanskaya 1972; Shavlovsky et al. 1978; Shavlovsky and
Logvinenko 1988a). Thus, 146 strains out of 147 analyzed were able to excrete a
yellow pigment, identified as riboflavin, during cultivation in iron-deficient me-
dium (Shavlovsky et al. 1978). One strain, which did not synthesize elevated quan-
tities of riboflavin during iron starvation, apparently represents a species very
similar to but still distinct from P. guilliermondii. This strain is able to mate with
the type strain of this species but the resulting hybrids, in contrast to all other
hybrids in the P. guilliermondii species, were not able to sporulate (Sibirny 1986).
Thus, the ability to overproduce riboflavin and hence to accumulate yellow pig-
ment in the cultural liquid during cultivation in iron-deficient media, is a species
characteristic of P. guilliermondii.
3
Available Strains
The following strains have been used in genetic studies:

NRRL Y-2075, mating type mat+;
NRRL Y-2075, mating type mat-;
ATCC 9058 (indicated as C. guilliermondii) mating type mat+.
The last two strains were used for the isolation of a fertile genetic line of P.
guilliermondii (Sibirny et al. 1977c).
German authors also used the strains P. guilliermondii 799 and 809 (both
mat-) obtained from Dr. Zsolt (Hungary), a local strain H17 (mat~), and some
others (Prahl et al. 1980).
The strains can be stored on wort agar slants at 4 DC for months.
7. Pichia gui/liermondii 257
4
Genetic Techniques
4.1
Life Cycle
All known natural or collection strains of P. guilliermondii are heterothallic

(Wickerham and Burton 1954; Kreger van-Rij 1970; Shchelokova et al. 1974;
Zharova et al. 1977). The mating types were designated mat+ and mat- (Sibirny et
al. 1977b). Homothallic natural or collection strains are not described, though
some of meiotic segregants of the hybrids obtained by protoplast fusion manifest
a homothallic phenotype (Sibirny 1986). Such a phenotype was designated as
pseudohomothallic (mat+'-) as these strains segregate mat+ and mat- clones during
cultivation in complete synthetic medium. The pseudohomothallic phenotype was
completely eliminated in the meiotic pedigree of mat+,-, x mat+ or mat+'- x mat-
hybrids (Sibirny 1986). It was hypothesized that such pseudohomothallic mat+'-
strains are aneuploids.
4.2
Sexual Crosses
Cell conjugation between prototrophic strains of opposite mating types was ob-
served on wort agar (Zharova et al. 1977). Study of sexual hybridization between
auxotrophic mutants showed that most efficient matings occurred in solid media
with sodium acetate or tomato juice (Sibirny et al. 1977b). Hybridization was not
()bserved in complete media. Thus, optimal conditions for crossing of P.
guilliermondii appeared to be poor starvation media. Later, such a conclusion
found support during the investigation of hybridization conditions for other yeast
species. It was shown that yeast species found in natural habitats as haploids
(haplonts) efficiently cross in poor media, whereas diplontic species (found in
nature as diploids) hybridize predominantly in rich media (Naumov et al. 1980,
1981; Vustin 1981).
The following procedure of sexual hybridization is generally used for P.
guilliermondii (Sibirny et al. 1977b).
Auxotrophic strains of opposite mating types with complementary nutritional
requirements are grown as a streak on complete YEPD or YEPS media. The strains
are crossed on plates with acetate medium (sodium acetate, 1%; KCI, 0.5%), incu-
bated for 2-3 days, and then are replica-plated onto minimal medium. The pro-
totrophic hybrids are formed at the contact sites of the streak cross.
4.3
Protoplast Fusion
Hybridization can also be obtained by protoplast fusion (Klinner et al. 1980;

Sibirnyet al. 1982; Klinner and Bottcher 1984). In this case, hybrids were obtained
258 A.A. Sibirny
between auxotrophs belonging to opposite or to the same mating type. The maxi-
mal frequency of hybridization by protoplast fusion was near 2 x 10-2 (Sibirny et al.
1982).
The protocol for protoplast isolation and fusion in P. guilliermondii is given in
Sect. 4.4.
In addition to intraspecific P. guilliermondii hybrids, protoplast fusion was
used for isolation interspecific hybrids with Pichia kudriavzevii and Hansenula
polymorpha (Sibirny et al. 1982; Kashchenko et al. 1987).
Sexual or protoplast fusion hybrids of P. guilliermondii appeared to be very
stable mononuclear diploids during growth on synthetic or complete media, and
did not sporulate under such conditions (Zharova 1980; Klinner and Bottcher
1984; Sibirny 1986). It is interesting to note that ploidy of the protoplast fusion
hybrids never exceeded the diploid level (Klinner and Bottcher 1984; Buttner et al.
1985). It was suggested that protoplast fusion hybrids appeared to be aneuploids in
many cases.
Hybrids of P. guilliermondii were able to sporulate on acetate media. Most
hybrids produced only one to two spores after 5-6 days of incubation at room
temperature, but some pairs of strains gave diploids, which produced up to 40%
asci with spores (Sibirny et al. 1977b; Sibirny 1986). Incubation at 30°C depressed
sporulation. Five other media tested did not induce sporulation.
4.4
Protocol for Isolation and Fusion of Protoplasts
(see also Chap. 2, this Vol.)
Cells are cultivated in sugar-mineral medium containing yeast extract (0.5%), 0.05
potassium phosphate buffer, pH 6.0, and growth factors for auxotrophs (40 jig/mI).
Cultivation is run for 16-24h to middle exponential growth phase (cell mass 0.7-
1.0 mg dry weight/mI). Cells are sedimented by centrifugation and washed twice
with water.
Cells (50-100mg dry weight/ml) are incubated in the following mixture: 0.05M
Tris-HCI, pH 7.0; O.4M CaCI2; O.OIM dithiothreitol; Zymolyase 20000 (2mg/ml;
Seikagaku Corp.) or ,8-Glucuronidase (1O-15mg/ml; Sigma) for 30-40 min at 37°C
with periodic mixing. Control of protoplasting is monitored using phase contrast
microscopy. Yield of protoplasts usually reached 100%.
Protoplasts are separated from incubation medium by centrifugation at 2000 rpm
for 5min at 4°C, twice washed with cold (4°C) O.4M CaCI 2, and then are resus-
pended in the same solution at 7.5 mg dry weight/ml.
Suspensions of a pair of auxotrophic mutants containing 50 x 106 of protoplasts/

ml are mixed in a 1: 1 ratio, sedimented by centrifugation, and resuspended in
the medium inducing protoplast fusion (25% solution of polyethylene glycol
with molecular weight 6000, containing O.IM CaCl2 in 0.05M Tris-HCI buffer,
pH 8.6). Final concentration of the protoplasts of both strains is 50 x 106 /ml
7. Pichia guilliermondii 259
mixture. The obtained suspension is incubated for 20 min at 30°C with periodic
mixing.
The protoplast mixture is spread onto a surface of an agar medium containing an
osmotic stabilizer (1 M sucrose or 1 M sorbitol). Any additional pouring of top-
overlaid mild agar is not necessary for P. guilliermondii.
4.5
Analysis of Meiotic Segregants
Asci of hybrids contain as a rule two spores, sometimes one-spored asci appeared,
while three- or four-spored asci were seldom found. Asci have oval or elongate
forms, while spores are characterized by round or hat-shaped forms (Sibirny et al.
1977b). Preferential production of two-spored asci is the result of degeneration of
several nuclei formed during meiosis (Zharova 1980).
Meiotic segregants of sexual hybrids which produced abundant amounts of
spores frequently gave diploids characterized by low spore frequency. A genetic
line, i.e. haploid strains hybrids of which produced a large amount of spores, was
selected by inbreeding, using sister crosses between several consecutive pedigrees
of meiotic segregants (Sibirny et al. 1977c). The strains denied from this genetic
line easily crossed and sporulated, producing up to 60% of two-spored asci. Unfor-
tunately, strains which appeared to be capable of producing four-spored asci were
not isolated. Thus, tetrad analysis is impossible for P. guilliermondii. Electron
microscopic studies showed that, during meiosis, diploid cells formed three or
four nuclei but only part of them were surrounded by a spore envelope and formed
spores (Zharova 1980). Apparently the other nuclei degenerated.
Several methods of elimination of vegetative diploid cells for random spore
analysis were developed. The method, based on selective killing of diploid vegeta-
tive cells by elevated temperature (55 and 60°C), was unsuccessful. More appropri-
ate appeared to be the method based on eliminating vegetative cells by vaseline oil
or killing diploid cells by ethanol or diethyl ester (Sibirny et al. 1977b,c; Sibirny
1986). The most suitable method, which used 20% ethanol to eliminate non-
sporulated hybrid cells for random spore analysis, is given in Sect. 4.6.
Survival of spores of P. guilliermondii genetic line is equal to 86% (Sibirny et al.
1977c). Most frequently, UV-irradiation at a 1-10% survival rate was used for
mutation induction. Mutants were also selected using several chemical mutagens,
e.g., nitrosoguanidine (Sibirny 1986).
4.6
Protocol for Random Spore Analysis
A sporulating diploid cell suspension (2-2.5 mg dry weight/ml) is incubated at
30°C for 2h in Helicase (j3-Glucuronidase) solution (lO-15mg/ml) for digestion of
asci envelopes. Then the suspension is gently homogenized in a glass homogenizer
to separate the spores, diluted to a cell concentration of approx. 0.6 mg dry weight/
ml, and 1/5 part (by volume) of ethanol is added.
260 A.A. Sibirny
The suspension is incubated with permanent shaking for 10-12 min and, after
dilution with 20% ethanol, is spread onto YEPD medium.
5
Chromosomes, Genes, and Genetic Markers
5.1
Pulsed Field Electrophoresis
Pulsed field electrophoresis of P. guilliermondii chromosomes revealed six to

seven chromosomal bands, depending on the electrophoretic parameters (Fig. 1;
A.A. Sibirny and P. Philippsen, unpubl. observ.).
The sizes of chromosomes were estimated by calibrating the pulsed field gels
vdth accepted chromosome sizes of S. cerevisiae (Link and Olson 1991) and Ashbya
gossypii (K. Gaudenz, Diploma Thesis, Biocenter of Basel University, 1994). The
individual sizes of P. guilliermondii chromosomes are 590, 1140, 1220, 1450, 1800,
2050, and 2150kb.
Thus, the minimal calculated genome size of P. guilliermondii is 10400kb.
5.2
Genetic Mapping
Genetic mapping was conducted using random spore analysis and benomyl-in-
duced mitotic segregation. Auxotrophic mutants defective in synthesis of amino
acids, purines, and vitamins were used. Six linkage groups in P. guilliermondii
were identified (N. Prahl, pers. comm.). Centromeres or genes tightly linked to the
centromeres have not been reported. Together, 21 genetic markers were localized
on the genetic map of P. guilliermondii (N. Prahl, pers. comm.). Unfortunately, the
impossibility of conducting tetrad analysis has hampered genetic mapping in this
species.
6
DNA Isolation and Transformation
6.1
Isolation of Chromosomal DNA and Construction of a Gene Bank
An overnight culture of P. guilliermondii grown in YEPD medium is sedimented by

centrifugation, resuspended in the mixture of 20 ml 0.1 M Tris-sulfate buffer, pH
9.3; 2ml 0.5M EDTA, pH 9.0; 0.5m12-mercaptoethanol, and incubated for 15min
Cells are centrifuged, resuspended in 20ml 0.05M Tris-HC1 buffer, pH 7.8, con-
taining 0.15M NaCl and 0.05M EDTA; 20ml2% solution of sodium dodecylsulfate
and Proteinase K (50.ug/ml) are added to this suspension and incubated first for
10 min at 65°C and then for 30 min at 37°C.
f- 2150 kb
f- 2050 kb
f- 1800 kb
f- 1450 kb
f- 1220 kb
f- 1140kb
f- 590 kb
A 8
Fig. 1A,B. Pulsed-field gel electrophoretic separation of chromosomal DNA of P.

guilliermondii. The new procedure for accelerated DNA isolation (A.A. Sibirny and P.
Philippsen, unpubl.) was used. A stationary yeast culture after 2 days cultivation in YPD
medium (strain of genetic line L2) was washed with 50 mM EDTA, pH 8.0, and resuspended
for protoplasting in the following mixture (approx. 300mg dry weight per 3ml reaction
mixture): 0.05 M Tris-HCI, pH 7.0; OAM CaCI2; 0.01 M dithiothreitol; Zymolyase Seikagaku
Corp. 20000 (2 mg/ml). After 30-40 min of incubation at 37°C with periodic mixing, most
cells were converted to protoplasts. Protoplasts were mixed with 5 ml of 1% low-melting
agarose (42°C) in 0.125M EDTA, pH 8.0 and poured in to a 4-cm petri dish. After agarose
hardening, the following mixture was added onto the surface of agarose layer: 0.5 M EDT A,
pH 8.0; 0.01 M Tris; lauroylsarcosinate (10 mg/ml); proteinase K (2 mg/ml). The plate was
incubated at 52°C for 4 h. The conditions used for pulse-field gel electrophoresis in a
Rotaphor apparatus (Biometra) were as following. A Voltage: 185V (constant); angle: 110°
to 95° (logarithmic change); pulse time: 120 to 42 s (linear change); countdown: 24h; tem-
perature: 12°C; gel: 1% agarose; buffer: 0.025M Tris-borate-EDTA, pH 8.0. B Voltage: 150 to
120V (linear change); angle: 120°C (constant); pulse time: 210 to 190s (linear change);
countdown: 36h; temperature: 12°C; gel: 0.9% agarose; buffer: 0.025 M Tris-borate-EDTA,
pH 8.0
Proteins are extracted by adding an equal volume of phenolJchlorophorm/isoamyl

alcohol mixture, and DNA is precipitated from the water phase by addition of an
equal volume of isopropanol. The DNA precipitate is dissolved in 10 ml of 0.01 M
Tris-HCI buffer, pH 8.0, containing O.OOlM EDTA. The DNA solution is dialyzed
against the same buffer for 16h. DNA concentration in such preparation is near
O.lmg/ml.
262 A.A. Sibirny
Isolated DNA is partially digested with Sau3A endonuclease. The obtained frag-
ments are fractionated using preparative electrophoresis in 1% agarose. The frag-
ments of 6 to 15 kb in size are eluted from the gel by electro elution and ligated with
a BamHI digested pFL38 shuttle vector (see Fig. 2) treated with calf intestinal
alkaline phosphatase. The ligated DNA mixture is used for transformation of
E. coli C600. Approximately 104 independent recombinant pFL38 plasmids were
isolated as P. guilliermondii gene bank.
6.2
Transformation
P. guilliermondii does not contain its own plasmids. A gene bank of this species
was constructed using Sau3A-digested chromosomal DNA ligated into the BamHI
site of the shuttle vector pFL38 (Zakalsky et al. 1990; Logvinenko et al. 1993). The
protocol for chromosomal DNA isolation from P. guilliermondii cells is given
below. Together, 10000 independent recombinant plasmids were obtained after
transformation of Escherichia coli C600. Schemes for construction of recombinant
plasmids containing structural genes RIBl and RIB7 of P. guilliermondii are pre-
sented in Figs. 2 and 3.
Isolated recombinant plasmids were used for transformation of P.
guilliermondii by the lithium method (Ito et al. 1983). The genes RIBI and RIB7
coding GTP cyclohydrolase and riboflavin synthase, respectively, were used as
selective markers; recipient strains contained ribl or rib7 mutations (Logvinenko
et al. 1993; A. Voronovsky and G. Shavlovsky, unpubl. observ.). Other standard
selective markers for yeast transformation (amino acids, pyrimidine biosynthesis,
G418 resistance) were have not yet been used. The P. guilliermondii transforma-
tion yields 80-200 transformantsl,ug DNA. The fate of transforming DNA in the
cells is not known. Most RIBI transformants (70-80%) were stable, whereas a
minority was unstable and segregated after spreading on complete medium 44-
88% of auxotrophic ribl clones (A. Voronovsky and G. Shavlovsky, pers. comm.).
Stable transformants appeared to be integrants, while unstable cells possibly con-
tain autonomously replicating vectors. One may assume that some of the
Sacharomyces cerevisiae portion of the shuttle vector or the cloned fragment of P.
guilliermondii contain sites acting as replicator sequence in P. guilliermondii. The
plasmid copy number in unstable transformants is not known.
Transformation of P. guilliermondii adenine auxotrophs (ade2) by the circular
bireplicon vector pYE(ADE2)2 containing the ADE2 gene of S. cerevisiae was also
performed in another laboratory (Neistat et al. 1986), though the frequency of
transformation using the same method was very low (one to three transformants
per ,ug DNA) for unknown reasons. All transformants in this case were stable.
E B S P H
Chromosomal DNA
P. guilliermondii
Sau3
1. Ligation
2. Transformation E. coli rib A802-81
3. Selection ofRib+Amp' clones
B/Sa
H P S B Sc E pFRl
13.7 kb
pUC18 B/Sa E
2.7kb
1. EcoRI
2. Elution of EcoRI-fragment (4.0 kb)
EcoRI
1. Ligation
2. Transformation E. coli rib A802-81
3. Selection ofRib+ Amp' clones
E
S
S
pR
6.0kb Hc 1. SaiGI
2. Ligation
Sc
Fig. 2. Scheme showing the construction of recombinant plasmids containing the RIBl
gene of P. guilliermondii. Sites of restriction endonucleases: B BamHl; E EcoRI; H HindIII;
He HindI; P PstI; S SalGI; Sa Sau3A; Se Sad X XhoI
264 A.A. Sibirny
RI S K B Hc H
Chromosomal DNA
pFL38 Pichia guilliermondii
Amp' RV
4.7kb
BamIII Sau3A
Transformation ofE. coli ribB mutant

selection Rib', Amp'-clones
RV
Bg
g
pFR7 pFR7H RV
8.7kb
RV ,. Bg 6.1 kb
HindIII
Pv
HindIII
+
EcoRI
HHc B K SRI
HindIII
+ Ha
EcoRI
Ha RV
pUC18
2.7kb
Fig. 3. Scheme showing the construction of recombinant plasmids containing the RIBl
gene of P. guilliermondii. Sites of restriction endonucleases: B BamHI; Bg BgIII; RI EcoRI;
RV EcoRV; H HindIII; Ha HaeII; He HincH; K Kpnl; Pv PvuH; S Sad; Sa Sau3A
7
Biochemical Genetics
7.1
Hydrocarbon Utilization
Mutants unable to utilize hydrocarbons as sole source of carbon and energy were
isolated from the strains of a genetic line of P. guilliermondii. They were desig-
nated ale (aleane nonutilizable) mutants. Together, several tens of ale mutants
were selected, using nitrosoguanidine as mutagen. Approximately half of them
were unable to grow on glycerol, others lost the ability to utilize only hydrocarbons
(Zharova 1980; Zharova et al. 1980). Genetic analysis of 22 specific ale mutations
showed that they are all recessive and can be divided into at least three comple-
mentation groups (aIel, ale2, alc3). The biochemical lesions of the mutants were
not studied.
7.2
Riboflavin Biosynthesis
As mentioned before, P. guilliermondii is the only genetically studied eukaryote

able to regulate riboflavin biosynthesis. This organism was used for identification
of strutural and regulatory genes involved in flavinogenesis.
Using strains of opposite mating types of a P. guilliermondii genetic line, 114
riboflavin-deficient mutants were isolated after UV irradiation. Biochemical study
based on analysis of accumulated riboflavin intermediates divided them into five
biochemical groups. Complementation analysis of 106 mutants revealed 7 comple-
mentation classes or genes (RIBl to RIB7). The strains of the biochemical group,
accumulating no specific products, corresponded to complementation group ribl;
group II, accumulating 2,4,S-triaminopirimidine to complementation group rib2;
group III, accumulating 2,6-dihydroxy-4-ribitylaminopyrimidine, to complemen-
tation group rib3; the mutants of group IV, accumulating 2,6-dihydroxy-S-amino-
4-ribitylaminopyrimidine, were divied into three complementation groups, rib4,
ribS, and rib6; the mutants of group V, accumulating 6,7-dimethyl-8-ribityl
lumazine, corresponded to complementation group rib7 (Shavlovsky et al. 1979).
Biochemical and genetic studis of P. guilliermondii riboflavin auxotrophs showed
similarity in riboflavin biogenesis between this species and S. eerevisiae (Oltamnns
et al. 1969). P. guilliermondii appeared to be a much more convenient species for
study of riboflavin biosynthesis when compared with S. eerevisiae due to the ability
to overproduce riboflavin or its precursors in iron-deficient media (Sibirny 1986;
Shavlovsky and Logvinenko 1988a).
Later, detailed enzymological analysis of P. guilliermondii riboflavin auxotro-
phs was carried out. Such analysis, by the way, helped to identify new enzymes,
unknown at that time, that participate in riboflavin biosynthesis. It was found that
the gene RIBl encodes the enzyme of the first step of flavinogenesis, GTP
cyclohydrolase (Shavlovsky et al. 1976, 1980a); the gene RIB2 encodes the enzyme
266 A.A. Sibirny
of the second step, 2,5-diamino-6-hydroxy-4-ribosylaminopyrimidine-5'-phos-

phate reductase (Shavlovsky et al. 1981); the gene RIB3 encodes the enzyme of the
third reaction, 2,5-diamino-6-hydroxy-4-ribytilaminopyrimidine-5'-phosphate
deaminase (Nielsen and Bacher 1981). The gene RIBS encodes 6,7-dimethyl-8-
ribityllumazine synthase (Logvinenko et al. 1985, 1987) and the gene RIB6 encodes
the synthesis of the aliphatic precursor of the pteridine structure of 6,7 -dimethyl-
8-ribityllumazine, 3,4-dihydroxy-2-butanone-4-phosphate, which is produced
from ribulose-5-phosphate (Logvinenko et al. 1982, 1985, 1987; Yolk and Bacher
1988,1990; Bacher 1991). The gene RIB7 encodes riboflavin synthase (Logvinenko
et al. 1987). The exact role of the gene RIB4was not elucidated. A gene encoding the
enzyme dephosphorylating 2,4-dihydroxy-5-aminopyrimindine-5' -phosphate
(specific phosphatase?) has not yet been identified. Most structural genes involved
in riboflavin biosynthesis in P. guilliermondii are not linked (Shavlovsky et al.
1979). Thus, the study of riboflavin auxotrophs of P. guilliermondii allowed eluci-
dation of the biochemistry of a new metabolic pathway, i.e., the riboflavin biosyn-
thesis in microorganisms. A scheme of riboflavin biosynthesis is given in Fig. 4.
As mentioned above, the genes RIBI and RIB7 of P. guilliermondii were cloned
by complementation of the corresponding mutations of E. coli and used for trans-
formation of P. guilliermondii ribl and rib7 mutants (Zakalsky et al. 1990;
Logvinenko et al. 1993; A. Voronovsky, pers. comm.). Cloned RIBI and RIB7 genes
were also used for heterologous transformation of riboflavin-deficient mutants of
Candida Jamata (this asporogenous yeast species, similarly to P. guilliermondii, is
able to overproduce riboflavin in iron-deficient media).
The frequency of H. polymorpha rib7 mutant transformation was very low.
Maximal frequency was observed in the experiments with a linearized RIB7 gene
contained in the pR7 plasmid (up to 40 transformantsl,ug DNA). Riboflavin
synthase activity of transformants was very low. Mitotic stability of H. polymorpha
transformants was also rather low, and was eliminated in nonselective media with
riboflavin. Apparently, the cloned RIB7 gene is located in an autonomously repli-
cating plasmid dut to the fact that some fragments of the vector can be used as
replicator in H. polymorpha cells (A. Voronovsky, G. Shavlovsky, pers. comm.).
Frequency of transformation of the ribl mutant of C. Jamata with the cloned
RIBI gene of P. guilliermondii was from 50 (circular plasmid) to 600 (HindIlI-
EcoRI linearized fragments) transformantsl,ug DNA. All transformants of C.
Jamata appeared to be stable, and produced elevated amounts of riboflavin in
iron-deficient media (A. Voronovsky and G. Shavlovsky, pers. comm.).
Starvation by iron causes riboflavin oversynthesis and derepression of enzymes
coding by RIBl, RIB3, RIBS, RIB6, and RIB7 genes in P. guilliermondii, while the
RIB2 gene product, the enzyme reductase, is produced constitutively (Shavlovsky
and Logvinenko 1988b). The enzymes involved in biosynthesis of flavin coen-
zymes, riboflavin kinase and FAD synthetase, are also insensitive to regulation by
iron content in P. guilliermondii (Shavlovsky et al. 1975; Shavlovsky and
Fedorovich 1977).
Mutants affected in the regulation of flavinogenesis and of corresponding en-
zyme syntheses by iron ions were isolated in P. guilliermondii. Mutatios ribBa and
20:=i
H
NH3
RIB3
CD CHzOH
® 8) OH
I
C=O CH3
N~NH2
HolN~NH
I I
H-C-OH ~C=O
I I
H-C-OH CHOH I
I I CH2
CH2 o® CH2 o® I
(H-C-OHh
I
CH2o®
(j)
Fig. 4. Scheme of riboflavin biosynthesis in the yeast P. guilliermondii. I GTP; II

2,S-diamino-4-hydroxy-6-ribosylaminopyrimidine-S'-phosphate; III 2,S-diamino-4-hy-
droxy-6-ribitylaminopyrimidine-S'-phosphate; IV 2,4-dihydroxy-S-amino-6-ribitylamino-
pyrimidine-S'-phosphate; V 2,4-dihydroxy-S-amino-6-ribitylaminopyrimidine; VI 6,7-
dimethyl-8-ribityl-Iumazine; VII riboflavin; VIII ribulose-S-phosphate; IX 3,4-dihydroxy-2-
butanone-4-phosphate. RIB! to RIB7 strutural genes of riboflavin biosynthesis
268 A.A. Sibirny
rib81 appeared to be recessive, and caused oversynthesis of riboflavin and dere-

pression of the corresponding enzymes in iron-rich media (Shavlovsky et al. 1982,
1985a,b).
Several approaches were used for isolation of derepressed mutants. One of them
is based on selection of the mutants resistant to the riboflavin analogue, 7-methyl-
8-trifluoromethyl-1O-(l'-D-ribityl) isoalloxazine. Since wild-type strains of P.
guilliermondii are resistant to riboflavin analogues due to slow penetration into
the cell, mutants with multiple sensitivity to antibiotics and antimetabolites
(Sibirny et al. 1977d, 1978b) were used as initial strains for selection (Shavlovsky et
al. 1980b). Besides, it was found that high concentrations of sulfate or phosphate
anions induce increasing sensitivity to antibiotics and antimetabolites (including
riboflavin analogues) of wild-type strains of P. guilliermondii and of other yeast
species (Sibirny and Shavlovsky 1981); it was possible to isolate analogue-resistant
mutants directly from wild-type strains on high sulfate concentration (Shavlovsky
et al. 1985a). Additionally, derepressed mutants were isolated from previously
selected ts rib1 mutants unable to grow at the restrictive temperature in iron-rich
media without derepression of the thermolabile GTP cyclohydrolase, as in
pseudorevertants able to grow in such conditions (Shavlovsky et al. 1985a; Sibirny
1986). A third method for isolation of riboflavin-derepressed mutants uses spe-
cially constructed leaky rib2 auxotrophs as initial strains. Activity of the second
enzyme of flavinogenesis in the leaky rib2 strain was so low that they grew without
exogenous riboflavin only in iron-deficient media, where other enzymes were
derepressed. Selection of leaky rib2 mutants capable of growing in iron-rich me-
dium without riboflavin allowed the isolation of regulatory mutants (Shavlovsky et
al. 1982). As a result, the regulatory genes RIB80 and RIB81 were identified, which
appeared to be unlinked. Interallelic complementation was found in the RIB80
gene (Shavlovsky and Logvinenko 1988a). It was suggested that the RIB80 and
RIB81 genes together encode a heterooligomeric regulatory protein complex of
negative action (apoprotein) which is activated after binding of iron ions and
represses transcription of the corresponding structural genes (Shavlovsky et al.
1982; Sibirny 1986).
The regulatory mutants rib83 and rib84, unable to overproduce riboflavin in
iron-deficient medium, were also isolated (Shavlovsky et al. 1989). They were
selected as mutants which have lost the ability to excrete riboflavin in iron-defi-
cient medium. Apparently, the corresponding genes encode regulatory proteins of
positive control. Double ribBO rib83 and rib81 rib83 mutants were unable to over-
produce riboflavin, which suggests an epistasis of the RIB83 gene over the genes
RIB80 and RIB81. Possibly, genes of positive and negative types of regulation form
a cascade system for transmission of the regulatory signal. The molecular mecha-
nisms of the action of identified regulatory genes remain unknown. It is interesting
to note that rib80 mutants manifest simultaneously a derepression of the iron
transport system. One may assume that the regulatory gene RIB80 regulates the
expression of riboflavin biosynthesis structural genes and of gene(s) responsible
for uptake of the corepressor of riboflavin production, the iron ions (Shavlovsky et
al. 1985b; Shavlovsky and Logvinenko 1988b).
The cloned RIBl and RIB7 structural genes of P. guilliermondii were efficiently
expressed in the heterologous E. coli system, though iron did not regulate synthesis
of yeast enzymes in bacterial cells (Zakalsky et al. 1990; Logvinenko et al. 1993).
This means that P. guilliermondii promoters are functioning efficiently in E. coli
and the corresponding enzymes are properly folded in the bacteria. However,
bacterial regulatory iron-dependent proteins (e.g., involved in siderophore bio-
synthesis) do not recognize specific sites in yeast RIBl and RIB7 promoters. In
contrast to E. coli, heterologous expression of the RIB7 gene in H. polymorpha was
inefficient, and was not regulated by the iron ion content of the medium (A.
Voronovsky and G. Shavlovsky, pers. comm.). Heterologous expression of the
RIBl gene of P. guilliermondii in C. famata cells was efficient, and some
transformants possessed an up to threefold elevated riboflavin production com-
pared with the C. famata wild-type strain. Biosynthesis of riboflavin was regulated
by iron deficiency in C. famata transformants (A. Voronovsky and G. Shavlovsky,
pers. comm.). One may suggest that C. famata possesses regulatory sequences
homologous to P. guilliermondii which regulate riboflavin structural gene expres-
sion by iron ions.
7.3
Riboflavin Transport
Most of the wild-type strains and the riboflavin-deficient mutants of P.

guilliermondii are incapable of riboflavin-mediated transport from the medium
(Sibirny et al. 1977d; Shavlovskyet al. 1977). Such ability is inherent, however, to
some riboflavin-deficient mutants of this species able to grow in the media con-
taining very low (0.1 to 0.3,uglml) concentrations of riboflavin and to prototrophs
isolated from them. Various riboflavin-deficient mutants possessed riboflavin up-
take systems with different properties (riboflavin permeases I and II; Shavlovsky et
al. 1985b). The mechanism of evolution of these transport systems, which are
cryptic in the wild-type strains, is not known. It is worth mentioning that the
mutants capable of riboflavin permease activity have evolved during adaptation of
riboflavin-deficient mutants of P. guilliermondii to low concentration of riboflavin
in the medium; such mutants were never discovered after mutagenesis in nonse~
lective media. In addition to riboflavin permeases, P. guilliermondii possesses a
riboflavin-excreting system which is present also in the wild-type strains (Sibirny
et al. 1977d, 1978a).
Riboflavin permease II and riboflavin excretase are apparently synthesized
constitutively. Riboflavin permease I is characterized by peculiar properties. It
catalyzes riboflavin uptake against a concentration gradient and accumulation of
huge concentrations of vitamin (up to 20mglg dry cells) which is crystallized
inside the vacuoles. Synthesis of this transport system occurs only in the presence
of a-glucosides; induction is depressed by translation and transcription inhibitors
(Sibirny et al. 1977d, 1978a, 1979; Shavlovsky and Sibirny 1985).
Coordinate regulation of riboflavin permease I and a-glucosidase was found
(Sibirny et al. 1979). Mutants constitutively synthesizing riboflavin permease and
270 A.A. Sibirny
a-glucosidase were selected as riboflavin auxotrophs capable of growing at low

riboflavin concentrations in glucose medium (without a-glucosides). Genetic
analysis revealed three unlinked regulatory genes: RFPBO, RFPBl of negative action
(recessive mutations rfpBO, rfpBl), and the gene RFPB2 of positive action (domi-
nant mutations RFPB2c ). The recessive mutations rfpB2 were isolated as meiotic
segregants from an intragenic recombination between two RFPB2< alleles or as
mutants resistant to riboflavin analogues in a medium with the riboflavin
permease inducer sucrose. Interallelic complementation was found within the
RFPBO and RFPB2 loci, and the corresponding maps were constructed (Sibirny
and Shavlovsky 1984a; Sibirny 1986). The epistasis-hypostasis test showed that
the gene RFPB2 acts after the gene RFPBO. A model for the action of regulatory
products of the identified genes, which form a cascade system in expression of
riboflavin permease and a-glucosidase, was presented (Sibirny and Shavlovsky
1984a).
8
Biotechnological Applications
Even the most active mutants of P. guilliermondii produce much less riboflavin
than the fungi Eremothecium ashbyii and Ashbya gossypii or mutant strains of the
yeast C. Jamata or the bacterium Bacillus subtilis (Demain 1972; Shavlovskyand
Logvinenko 1988a; Heefner et al. 1988, 1993).
By combining the mutations which lead to riboflavin oversynthesis in iron-rich
media and the mutation which specifically impairs the riboflavin-excreting system,
mutant strains of P. guilliermondii were isolated that accumulated during growth
in synthetic or industrial media high amounts of riboflavin (up to 12mg/g dry
cells, i.e., 500 times more than the normal content of riboflavin in the yeast cells;
Sibirny and Shavlovsky 1984b; Sibirny 1986). Excretion of vitamin B2 into the
medium was negligible. Such mutants may be of interest for production of fodder
riboflavin preparations as dried yeast biomass, because drying of yeast pellets may
be cheaper than evaporation and drying of microbial biomass together with cul-
turalliquid (all known industrial producers of riboflavin excrete most of riboflavin
into the cultural medium).
The mutants of P. guilliermondii capable of active riboflavin transport
efficiently accumulate this vitamin from diluted solutions inside the cells. It is
possible to use such mutants for concentration of riboflavin from cultural liquids
of weak or moderate producers which accumulate up to 100 f..lg riboflavin/ml
in the medium (Sibirny et al. 1984). It is suggested that obtaining of riboflavin-
enriched yeast biomass as a source of riboflavin would be a much cheaper proce-
dure than other possible methods for concentration of this vitamin from diluted
solutions.
The availability of mutant strains capable of riboflavin uptake from the medium
and accumulation inside the cells allowed a new method of riboflavin kinase assay
to be developed (Kashchenko et al. 1991). It was found that riboflavin permease is
absolutely unable to catalyze flavin mononucleotide uptake (Sibirny et al. 1977d).

This observation was the basis for removing riboflavin which is not converted into
flavin mononucleotide by the riboflavin kinase reaction. After finishing the reac-
tion, the mixture is incubated for 1 h with washed cells possessing riboflavin
permease activity, and all the riboflavin is taken up by the cells. The concentration
of flavin mononucleotide is determined by direct fluorescent analysis of the reac-
tion mixture after cell removal by centrifugation or filtration. The method is much
simpler, cheaper, and more convenient than other methods used before.
The riboflavin-deficient mutant P. guilliermondii, 9i, which possesses riboflavin
permease activity and is able to grow at very low concentration of exogenous
riboflavin (growth at 0.005)1g of riboflavin/ml), allows the development of a new
auxonographic method of a microbiological assay of vitamin B2 • The sensitivity of
the method is similar to that known for Lactobacillus casei, but the yeast method
is more convenient due to the much simpler nutritional requirements of P.
guilliermondii (Sibirny 1986; A. Sibirny, unpubl. observ.). The immediate precur-
sor of riboflavin, 6,7-dimethyl-8-ribityllumazine, which is used for reasearch, has
not yet been produced commercially. The strain of P. guilliermondii which con-
tains mutations leading to riboflavin oversynthesis in iron-rich medium and leaky
rib7 (riboflavin synthase) deficiency, has been patented. This mutant is able to
grow in minimal medium without riboflavin and to accumulate nearly 100)1g of
6,7-dimethyl-8-ribityllumazine per ml in the cultural liquid. The produced
lumazine can be used as substrate of the riboflavin synthase reaction and for other
purposes (Sibirny and Shavlovsky 1984c).
9
Concluding Remarks
Today, P. guilliermondii seems to be an attractive model for studying the genetic

control of riboflavin biosynthesis and transport in yeasts. The main obstacles for
further investigations are (1) the impossibility of conducting tetrad analysis due to
production of two-spored asci and (2) the insufficiently known molecular genetics
of P. guilliermondii, including the absence of convenient vectors and even of
standard selective markers for transformation. Most difficult appears the isolation
of strains producing four-spored asci. Hybrids of some pairs of P. guilliermondii
natural strains rarely produce tetrads (A. Sibirny, unpubl. obser.). They may be
used for isolation of corresponding genetic lines.
Selection of more active P. guilliermondii riboflavin producers is possible, but
will demand a strong increase in specific activity of GTP cyclohydrolase, which
apparently limits flavinogenesis and the enhancement of this process by the purine
precursor, GTP.
Acknowledgments. The work on chromosome separation of P. guilliermondii was

supported by a grant from Swiss National Science Foundation (No. 5002-41029)
awarded to P. Philippsen.
272 A.A. Sibirny
References
Bacher A (1991) Biosynthesis of flavins. In: Miiller F (ed) Chemistry and biochemistry of
flavoenzymes. CRC Press, Boca Raton, vol 1, pp 215-259
Burkholder PR (1943) Influence of some environmental factors upon the production of
riboflavin by yeast. Arch Biochem 3: 121-130
Biittner M, Klinner U, Birnbaum D, Bottcher F (1985) Auswirkungen von Mutanten-
induktion und Protoplastenfusion auf den DNA-und Proteingehalt von Pichia
guilliermondii. J Basic Microbiol25: 13-19
Bykov VA, Manakov MN, Panfilov BI, Svitsov AA, Tarasova NV (1987) Production of
protein compounds. In: Yegorov NS, Samuilov VD (eds) Biotekhnologiya, vol 5.
Vysshaya Shkola, Moscow (in Russian)
Demain AL (1972) Riboflavin oversynthesis. Annu Rev Microbiol26: 369-388
Dikanskaya EM (1972) Flavin biosynthesis in microorganisms. In: Advances in science and
technology. Series Virology and microbiology. USSR Acad Sci 3: 5-55 (in Russian)
Heefner DL, Weaver CA, Yarus MJ, BurdzinskyLA, Gyure DC, Foster EW (1988) Riboflavin
producing strains of microorganisms, methods for selecting, and method for fermenta-
tion. International Patent, No W088/09822
Heefner DL, Boyts A, Burdzinsky L, Yams M (1993) Efficient riboflavin production with
yeast. United States Patent No 5231007
Kashchenko VE, Shavlovsky GM, Kutsiaba VI (1987) Interspecific and intergeneric hybrid-
ization of methylotrophic yeast Hansenula polymorpha by protoplast fusion. In: Abstr
XII Int Spec Symp on Yeasts. Genetics of Non-conventional Yeasts. Weimar, p 13
Kashchenko VE, Preobrazenskaya EN, Sibirny AA (1991) The method for determination of
riboflavin kinase. Soviet Patent (Author's Certificate) No 1631089 (in Russian)
Klinner U, Bottcher F (1984) Hybridization of yeasts by protoplast fusion: ploidy level of
hybrids resulting from fusions in haploid strains fo Pichia guilliermondii. Z Allg
Mikrobiol 24: 533-537
Klinner U, Bottcher F, Samsonova IA (1980) Hybridization of Pichia guilliermondii by
protoplast fusion. In: Ferenczi L, Farkas GL (eds) Advances in protoplast research.
Academiai Kiado, Budapest, pp 113-118
Kreger-van Rij NJW (1970) Genus 15. Pichia Hansen. In: Lodder J (ed) The yeasts. A
taxonomic study, 2nd edn. North-Holland Publ, Amsterdam, pp 455-458
Kvasnikov EI, Zharova VP, Shchelokova IF (1984) Taxonomic characteristics of the yeast
Pichia guilliermondii. Mikrobiologiya 53: 305-307 (in Russian)
Link AJ, Olson MV (1991) Physical map of the Saccharomyces cerevisiae genome at 110-
kilobase resolution. Genetics 127: 681-698
Logvinenko EM, Shavlovsky GM, Zakalsky AE, Zakhlodylo IV (1982) Biosynthesis of 6,7-
dimethyl-8-ribityllumazine in yeast extracts of Pichia guilliermondii. Biokhimiya 47:
931-936 (in Russian)
Logvinenko EM, Shavlosky GM, Tsarenko NY (1985) The proteins of 6,7-dimethyl-8-
ribityllumazine system of Pichia guilliermondii yeast and regulation of their biosynthe-
sis. Biokhimiya 50: 744-748 (in Russian)
Logvinenko EM, Shavlovsky GM, Kontorovskaya NY (1987) On biochemical functions of
the products of genes RIBS and RIB6 involved in riboflavin biosynthesis in the yeast
Pichia guilliermondii. Genetika 23: 1699-1701 (in Russian)
Logvinenko EM, Stasiv YZ, Zlochevsky ML, Voronovsky AY, Beburov MY, Shavlovsky GM
(1993) Cloning of the RIB7 gene encoding the riboflavin synthase of the yeast Pichia
guilliermondii. Genetika 29: 922-927 (in Russian)
Naumov GI, Vustin MM, Babieva IP (1980) Sexual divergence of yeast genera Williopsis
Zender, Zygowilliopsis Kudriavzev and Hansenula H. et P. Sydow. Dokl Akad Nauk SSSR
255: 468-471 (in Russian)
Naumov GI, Vustin MM, Naumova TI (1981) Hybridologic study of the yeast species
Zygowilliopsis californica, Williopsis saturnus, W. beierinckii comb. nov., W. mrakii
comb. nov. Dokl Akad Nauk SSSR 259: 718-722 (in Russian)
Neistat MA, Alenin VV, Tolstorukov II (1986) Transformation of Hansenula polymorpha,
Pichia guilliermondii, Williopsis saturnus yeasts with the plasmid-containing ADE2 gene
of Saccharomyces cerevisiae. Mol Genet Mikrobiol Virusolog 12: 19-23 (in Russian)
Nielsen P, Bacher A (1981) Biosynthesis of riboflavin. Characterization of the product of the
deaminase. Biochim Biophys Acta 662: 312-317
Oltmanns 0, Bacher A, Lingens F, Zimmermann FK (1969) Biochemical and genetic classi-
fication of riboflavine-deficient mutants of Saccharomyces cerevisiae. Mol Gen Genet
105: 306-313
Prahl N, Samsonova lA, Bottcher F (1980) Sexuelle Hybridisierung von Pichia
guilliermondii. Wiss Z E-M-Arndt-Universitat Greifswald. Math-Naturwiss Reihe 29:
63-64
Shavlovsky GM, Fedorovich DV (1977) The activity of enzymes involved in synthesis and
hydrolysis of flavin adenine dinucleotide in Pichia guilliermondii studied at different
level of flavinogenesis. Mikrobiologiya 46: 904-911 (in Russian)
Shavlovsky GM, Logvinenko EM (1988a) Flavin overproduction and its molecular mecha-
nisms is microorganisms. Prikl Biokhim Mikrobiol24: 435-447 (in Russian)
Shavlovsky GM, Logvinenko EM (1988b) The role of iron in the regulation of protein
synthesis by microorganisms. Usp Sovr Bioi 29: 108-133 (in Russian)
Shavlovsky GM, Sibirny AA (1985) Riboflavin transport in yeasts and its regualtion. In:
Kulaev IS, Dawes EA, Tempest DW (eds) Environmental regulation of microbial me-
tabolism. Academic Press, London, pp 385-392
Shavlovsky GM, Logvinenko EM, Strugovshchikova LP, Kashchenko VE (1975) Biosynthe-
sis of flavins and its regulation in the yeast Pichia guilliermondii. Ukr Biokhim Zh 47:
Shavlovsky GM, Logvinenko EM, Kashchenko VE, Koltun LV, Zakalsky AE (1976) Detection
of the enzyme of the first step of flavinogenesis, GTP cyclohydrolase, in the yeast Pichia
guilliermondii. Dokl Akad Nauk SSSR 230: 1485-1487 (in Russian)
Shavlovsky GM, Sibirny AA, Ksheminskaya GP (1977) Permease and "excretase" for ribofla-
vin in the mutants of Pichia guilliermondii yeast. Biochem Physiol Pflanz 171: 139-145
Shavlovsky GM, Zharova VP, Shchelokova IF, Trach VM, Sibirny AA, Ksheminskaya GP
(1978) Flavinogenic activity of natural strains of the yeast Pichia guilliermondii. Prikl
Biokhim Mikrobiol14: 184-189 (in Russian)
Shavlovsky GM, Sibirny AA, Kshanovskaya BV, Koltun LV, Logvinenko EM (1979) Genetic
classification of the riboflavin - deficient mutants of the yeast Pichia guilliermondii.
Genetika 15: 1561-1568 (in Russian)
Shavlovsky GM, Logvinenko EM, Benndorf R, Koltun LV, Kashchenko VE, Zakalsky AE,
Schlee D, Reinbothe H (1980a) First reaction of riboflavin biosynthesis - catalysis by a
guanosine triphosphate cyclohydrolase from yeast. Arch Microbiol 124: 255-259
Shavlovsky GM, Sibirny AA, Ksheminskaya GP, Pinchuk GE (1980b) Oversynthesis of
riboflavin in the mutants of the yeast Pichia guilliermondii resistant to 7-methyl-8-
trifluoromethyl-10-( l' -D-ribityl) isoalloxazine. Mikrobiologiya 49: 702-707 (in Russian)
Shavlovsky GM, Logvinenko EM, Sibirny AA, Fedorovich DV, Zakalsky AE (1981) The
activity of 2,5-diamino-6-hydroxy-4-ribosylaminopyrirnidine-5'-phosphate reductase,
an enzyme of the second step of flavinogenesis, studied in the yeast Pichia
guilliermondii. Mikrobiologiya 50: 1008-1011 (in Russian)
Shavlovsky GM, Sibirny AA, Fedorovich DV, Senyuta EZ (1982) Selection and properties of
the mutants of Pichia guilliermondii yeast with derepressed enzyme of the first step of
flavinogenesis, GTP cyclohydrolase. Mikrobiologiya 51: 96-101 (in Russian)
Shavlovsky GM, Babyak LY, Sibirny AA, Logvinenko EM (1985a) Genetic control of ribofla-
vin biosynthesis in yeast Pichia guilliermondii. Detection of the new regulatory gene
RIB81. Genetika 21: 368-374 (in Russian)
274 A.A. Sibirny
Shavlovsky GM, Fedorovich DV, Logvinenko EM, Koltun LV (1985b) Isolation and charac-
terization of flavinogenic strains Pichia guilliermondii manifesting regulatory mutation
rib80lribR. Mikrobiologiya 54: 919-926 (in Russian)
Shavlovsky GM, Koltun LV, Kshanovskaya BV, Logvinenko EM, Stenchuk MM (1989)
Regulation of biosynthesis of riboflavin by elements of the positive control in Pichia
guilliermondii yeast. Genetika 25: 250-258 (in Russian)
Shchelokova IF, Zharova VP, Kvasnikov EI (1974) Obtaining of the hybrids in haploid
strains of Pichia guilliermondii Wickerham assimilating oil hydrocarbons. Mikrobiol Zh
34: 275-278 (in Ukrainian)
Sibirny AA (1986) Genetic control of biosynthesis and transport of riboflavin in the yeast
Pichia guilliermondii. Doctor of Biological Sciences Thesis. Leningrad State University
(in Russian)
Sibirny AA, Shavlovsky GM (1981) Potentiation of sensitivity of yeasts and bacteria to some
inhibitors and riboflavin due to the action of a high sulfate and phosphate concentra-
tions. Mikrobiologiya 50: 242-248 (in Russian)
Sibirny AA, Shavlovsky GM (1984a) Identification of regulatory genes of riboflavin per-
mease and a-glucosidase in the yeast Pichia guilliermondii. Curr Genet 8: 107-144
Sibirny AA, Shavlovsky GM (1984b) Strain Pichia guilliermondii ss16-8 accumulating a
large amounts of riboflavin inside the cells. Soviet Patent (Authors Certificate) No
207914 (in Russian)
Sibirny AA, Shavlovsky GM (1984c) The method for preparing of 6,7-dimethyl-8-
ribithyllumazine. Soviet Patent (Authors Certificate) No 1092952 (in Russian)
Sibirny AA, Shavlovsky GM, Goloshchapova GV (1977a) The mutants of the yeast Pichia
guilliermondii with multiple sensivity to antibiotics and antimetabolites. Selection and
some properties of the mutants. Genetika 13: 872- 879 (in Russian)
Sibirny AA, Shavlovsky GM, Kshanovskaya BV, Naumov GI (1977a) Hybridization and
meiotic segregation in the paraffin-utilizing yeast Pichia guilliermondii Wickerham.
Sibirny AA, Shavlovsky GM, Ksheminskaya GP, Orlovskaya AG (1977d) Active riboflavin
transport in the yeast Pichia guilliermondii. Detection and properties of the cryptic
riboflavin permease. Biokhimiya 42: 1841-1851 (in Russian)
Sibirny AA, Zharova VP, Kshanovskaya BV, Shavlovsky GM (1977 c) Selection of genetic line
of the yeast Pichia guilliermondii capable of producing large amounts of spores.
Tsitologiya i Genetika 11: 330-333 (in Russian)
Sibirny AA, Ksheminskaya GP, Shavlovsky GM (1978a) The mutants of the yeast Pichia
guilliermondii impaired in permeability barrier. In: Molekularnaya Biologiya. Naukova
Dumka, Kiev 19: 42-46 (in Russian)
Sibirny AA, Shavlovsky GM, Ksheminskaya GP, Orlovskaya AG (1978b) The influence of
glucose and some its derivates on the systems for uptake and excretion of riboflavin in
yeast Pichia guilliermondii. Biokhimiya 43: 1414-1422 (in Russian)
Sibirny AA, Shavlovsky GM, Ksheminskaya GP, Orlovskaya AG (1979) Coordinate regula-
tion of riboflavin permease and a-glucosidase synthesis in the yeast Pichia
guilliermondii. Biokhimiya 44: 1558-1568 (in Russian)
Sibirny AA, Shavlovsky GM, Kshanovskaya BV, Kutsiaba VI (1982) Intraspecific and inter-
specific hybridization of yeasts by protoplast fusion. In: Molekularnaya Biologiya.
Naukova Dumka, Kiev 32: 16-24 (in Russian)
Sibirny AA, Trach VM, Shavlovsky GM (1984) The strain of the yeast Pichia guilliermondii
72-6 capable of efficient riboflavin accumulation from solutions. Soviet Patent (Authors
Certificate) No 209240 (in Russian)
Yolk R, Bacher A (1988) Biosynthesis of riboflavin. The structure of the four-carbon precur-
sor. J Am Chern Soc 110: 3651-3653
Yolk R, Bacher A (1990) Studies on the 4-carbon precursor in the biosynthesis of riboflavin.
Purification and properties ofL-3,4-dihydroxy-2-butanone-4-phosphate synthase. JBioI
Chern 265: 19479-19485
Vustin MM (1981) Taxonomic study of the soil yeasts with Saturn-like spores. PhD Thesis,
Moscow State University (in Russian)
Wickerham LJ (1966) Validation of the species Pichia guilliermondii. J Bacterol 92: 1269-
1273
Wickerham LJ, Burton KA (1954) A clarification of relationship of Candida guilliermondii
to other yeasts by a study of their mating types. J Bacteriol 68: 594-597
Zakalsky AE, Zlochevsky ML, Stasiv YZ, Logvinenko EM, Beburov MY, Shavlovsky GM
(1990) Cloning of gene RIBl encoding the enzyme of the first stage of the yeast Pichia
guilliermondii flavinogenesis, GTP cyclohydrolase, in Escherichia coli. Genetika 26: 614-
620 (in Russian)
Zharova VP (1980) Taxonomi and genetic study of hydrocarbon-utilizing yeast Pichia
guilliermondii Wickerham. PhD Thesis Institute of Genetics and Selection of Industrial
Microorganisms, Moscow (in Russian)
Zharova VP, Shchelokova IF, Kvasnikov EI (1977) Genetic study of the hydrocarbon-utiliz-
ing yeast Pichia guilliermondii Wickerham. Identification of haploid cultures by mating
types and hybrid selection. Genetika l3: 309-313 (in Russian)
Zharova VP, Kvasnikov EI, Naumov GI (1980) Obtaining and genetic analysis of Pichia
guilliermondii Wickerham mutants non-assimilating hexadecane. Mikrobiol Zh 42: 167-
17l (in Russian)
CHAPTERS
Pichia methanolica (Pichia pinus MH4)

Andrei A. Sibirny
1
History of Pichia methanolica Research
Pichia methanolica was first described by Kato and coworkers (Kato et al. 1974).
The yeast strain used in the laboratory of Dr. I.I. Tolstorukov (Moscow) for thor-
ough genetic study was isolated in the Institute of Biotechnology, Leipzig, Ger-
many, and was formerly identified by German scientists as Pichia pinus, strain
MH4 (Tolstorukov 1994; see below).
Three species of methylotrophic yeasts were used for genetic studies: Pichia
pastoris, Hansenula polymorpha, and P. methanolica (P. pinus MH4). The study of
the last species began in 1977 (Tolstorukovet al. 1977) and is being conducted
mainly in the laboratory of Dr. 1.1. Tolstorukov in the Scientific Center for Micro-
bial Genetics and Bioengineering in Moscow. Biochemical genetics of P.
methanolica is being studied mainly in the Lviv Division of the Institute of Bio-
chemistry and the St. Petersburg State University. Thus, the genetic study of P.
methanolica (P. pinus MH4) is almost exclusively carried out in the former Soviet
Union.
What is the need for genetic study of P. methanolica? This question is quite
reasonable, as the two other species above are used in molecular genetic investiga-
tions. The answer is as follows: only the P. methanolica system permits a conve-
nient and useful genetic analysis using the methods of classical genetics, including
gene mapping. As a result, P. methanolica today is the genetically best studied
species of methylotrophic yeasts, and its genetic map includes more than 20 mark-
ers localized at 4 chromosomes and 1 fragment.
2
Physiology
P. methanolica MH4 cells are spherical to oval. This organism, similar to other
methylotrophic yeast species, seems to be essentially aerobic. It assimilates metha-
nol as well as many polycarbon substrates. Optimal temperature for growth is
30°C. For routine laboratory studies, the basic culture conditions and media are
Division of Regulatory Cell Systems of the Institut of Biochemistry, Ukrainian Academy of

Sciences, Drahomanov Street, 14/16, Lviv 290005, Ukraine
278 A.A. Sibirny
the same as those generally used for Saccharomyces cerevisiae (see also
Tolstorukov et al. 1977).
3
Available Strains
Most available strains were isolated from the wild-type strain MH4 in the labora-
tory of Dr. 1.1. Tolstorukov. Most mutants defective in regulation of Cl-metabo-
lism were isolated in the laboratory of the author of this chapter.
A total of several hundreds of auxotrophic mutants (mono-, di- and
triauxotrophs) were isolated. Mutants defective in utilization ofC 2 compounds, as
well as those impaired in mating type switching, were selected (Tolstorukov 1988).
Nitrosoguanidine appeared to be the most efficient mutagen. Some mutants were
isolated using lTV irradiation and 8-hydroxylaminopurine as mutagens.
4
Genetic Techniques
P. methanolica is homothallic: haploid cells are able to perform self-diploidization

in minimal medium. Diploid cells are able to propagate for a long period in
minimal medium. After transfer into Rg medium, abundant sporulation (up to
90% asci, most of which contained four spores) occurs.
Diploid cells are seldom able to cross with haploid or diploid cells with produc-
tion of tri- and tetraploids. Vegetatively growing diploid cells can segregate chro-
mosomes due to spontaneous haploidization. This process is sufficiently induced
by y-irradiation and, under optimal conditions, up to 10% of cells appear to be
aneuploids (Tolstorukov and Benevolensky 1980, 1981, 1982). Segregating aneup-
loids form slow-growing colonies. This feature facilitates identification of aneup-
loids, and was used for localization of the markers on the chromosomes (see
below).
5
Chromosomes
Pulsed-field gel electrophoresis performed using a CHEF system (Countour

Clamped Homogenous Electrophoresis Field) clearly distinguishes four DNA
bands for strains P. methanolica (P. pinus) MH4 and for the type strain P.
methanolica NRRL Y-7685, whereas the type strain P. pinus NRRL Y-1l582 shows
up to nine chromosomal bands (Tolstorukov 1994). The chromosomal sizes of P.
methanolica MH4 and NRRL Y-7685 are identical and are equal to 6,4.2,3.6 and
3.1Mb (see also Chap. 3, this Vol.).
It was shown that the cloned ADEl, ADE5, and SUP2 genes of P. methanolica
MH4 used as probes yield positive Southern blot hybridization patterns with
separate DNA bands, identical for both P. methanolica MH4 and NRRL Y-7685
strains (Tolstorukov 1994).
8. Pichia methanolica (Pichia pinus MH4) 279
6
6.1
Meiosis
Auxotrophic mutants isolated from MH4 and NRRL Y-7685 strains freely crossed
and resulted in diploids sporulating on Rg medium, producing a high percentage
of four-spored asci. Tetrad analysis of several interstrain hybrids showed a regular
2+:2- segregation. Contrary to this, no hybrids between P. methanolica (P. pinus)
MH4 and the type strain P. pinus NRRL Y-1l582 were ever obtained. It was
concluded that strain MH4 represents the species P. methanolica (Tolstorukov
1994).
6.2
Nomenclature
The basic rules used for locus designation in S. cerevisiae have been adopted for P.
methanolica MH4: a locus is written by three letters followed by a locus number.
Locus numbers are provisory and are often different from corresponding equiva-
lents of S. cerevisiae.
6.3
Induced Haploidization
Linkage groups in P. methanolica MH4 were identified using two methods: in-
duced haploidization and tetrad analysis.
Mitotic loss of chromosomes was induced by y-rays. Aneuploids were picked as
slow-growing small colonies. It was found that the markers localized in different
linkage groups segregate independently, and those localized in the same linkage
group, even far one from another, show linkage (Tolstorukov et al. 1983).
6.4
Tetrad Analysis
Mapping by tetrad analysis was done for about 30 markers (auxotrophic muta-
tions, mating type locus mutations, mutations affecting C and C2 compound
j -
utilization). As a result, four centromeres (chromosomes) and one chromosomal

fragment (apparently the distal part of one of these linkage groups) were identified
(Tolstorukov and Efremov 1984; Tolstorukov 1988). The data of genetic mapping
are in good agreement with the results of pulsed-field gel electrophoresis, which
identified four DNA bands (see above). The genetic map of P. methanolica MH4 is
presented in Fig. 1.
280 A.A. Sibirny
CUT3 ARGl HIS2 PRO! CUTS

I 1 ell 1 1
ARG3 ADE2 MET2 LYS3 RIBI LEU! HIS 1 HIS4

II ~')(cr:: 1 ______ ..JIL-_ _ _ _..l...-_
MET6 ADES MATI lCLl LYS4 ADEI

Irr~-------~~J~(-LC:------------~--_
ADE4,7 ADE6 ADE8 CYS2 ADE3 HIS3 MET!

____~1 ________________ .
~1--'------L(_LL--------lL
IV
ARG2 ARG4 10 eM
F1 --1.1_ _----11_ 1 1
Fig. 1. Genetic map of the yeast P. methanolica MH4. Continuous lines indicate linkage
determined by tetrad analysis; dotted lines indicate linkage determined by induced
haploidization. Circles designate centromeres
7
Transformation
7.1
Transformation Procedure
As transformation markers, adel, ade2, and leul P. methanolica MH4 mutations

were used which correspond to ade2, ade1, and leu2 mutations of S. cerevisiae. S.
cerevisiae episomal vectors pYE (ADE2)2, pYE(ADEI) (Sasnauskas et al. 1987) and
the standard YEp13 vector, containing the LEU2 gene, were used as source of
selectable genes. Transformation was performed using the lithium method (Ito et
al. 1983). No transformants were obtained using genes of purine biosynthesis
(Neistat et ale 1987). When YEp13 was used as transforming vector, leul mutants
of P. methanolica MH4 were trnasformed, and leucine prototrophs appeared. It
was shown that the transformation frequency is increased when cells from early
exponential growth phase were used. Deproteinization and adding of carrier DNA
also stimulated transformation. Maximal frequency of transformation using the
intact YEp13 vector was near to 20 transformants per j1g of DNA (Tarutina and
Tolstorukov 1994). Linearization of the YEp13 plasmid at the unique BamHI or
XhoI sites increased the transformation frequency by more than one order. An
increase of two further orders of transformation frequency was achieved using
8. Pichia methano/ica (Pichia pinus MH4) 281
small linear fragments of the YEp 13 plasmid after digestion with BglII or a mixture
ofXhoI and SalGI (sizes of the fragments were 3.0 and 2.2kb, respectively). Circu-
larization of such fragments diminished the frequency of transformation by more
than one order (Tarutina and Tolstorukov 1994).
Two types of transformants were obtained: large colonies with stable Leu+
phenotype, and small or moderate colonies which were unstable and segregated
Leu- cells on complete medium. Stable transformants appeared to be integrants,
whereas unstable transformants contained sequences of smaller size than the
vector YEP13, which could replicate autonomously in P. methanolica. It was sug-
gested that the LEU2 gene of S. cerevisiae can fulfil replicator function in P.
methanolica cells similar to the situation postulated earlier for Hansenula
polymorpha Leu+ transformants (Berardi and Thomas 1991).
Very similar results were obtained using the previously cloned ADEI gene from
P. methanolica MH4 (homologous to the ADE2 gene of S. cerevisiae). In this case
the transformation frequency of adel mutants of P. methanolica MH4 was also
sufficiently increased after linearization of the vector (Hiep et al. 1992).
7.2
Molecular Cloning ofSUP2 and ADEl
Two P. methanolica MH4 structural genes were cloned by functional complemen-

tation of the corresponding S. cerevisiae mutations, SUP2 and ADEl.
SUP2 is an omnipotent suppressor, coding for an EF-1a-like protein factor
involved in translational accuracy (Surguchov et al. 1984). Cloning of the P.
methanolica SUP2 gene was based on the construction of a genomic library of P.
methanolica chromosomal DNA using partial digestion, with Sau3A insertion into
the YEp13 vector and selection of S. cerevisiae leu2 sup2 (ts) double revertants
growing in leucine-free medium at the restrictive (36°C) temperature (Kushnirov
et al. 1990). A similar approach was used for ADEI gene cloning of P. methanolica
MH4 (Hiep et al. 1991).
The complete nucleotide sequence of the P. methanolica MH4 SUP2 gene was
determined and compared with that of S. cerevisiae. The comparison of deduced
amino acid sequences of both proteins revealed high conservation (76%) of the C-
terminal part region homologous to EF-1a, and low conservation (36%) of the N-
terminal part (Kushnirov et al. 1990).
Codon usage of both SUP2 genes appeared to be similar. A single exception may
be leucine, for which codon TTA is more frequent in SUP2 of P. methanolica MH4,
whereas in SUP2 of S. cerevisiae TTG is preferred (Kushnirov et al. 1990).
8
Genetic Control of Mating
Although all cells of P. methanolica MH4 can be crossed in each combination, the
efficiency of copulation was higher in some combinations than in others. By this
criterion, all strains were divided into two groups or mating types designated a and
282 A.A. Sibirny
a or MA Tl a and MA Tl a. Tetrad analysis showed in all cases monogenic segrega-

tion 2a:2a (Tolstorukov and Benevolensky 1978). It was shown that unbudded
cells keep their initial mating type, while budding cells undergo mating type
switching. In contrast to S. cerevisiae, such switching has accidental character: this
means that daughter cells can possess either the parental or the opposite mating
type. The gene HTHI was identified by hthl mutation, which, similarly to the ho
allele of S. cerevisiae, decreases switching of mating type in P. methanolica MH4
(Benevolensky and Tolstorukov 1980). A similar phenotype is manifested in the
matla-46 mutation (Tolstorukov et al. 1981, 1982). It was suggested that MATl
locus consists of two regions interacting between each other, and with hypostatic
genes controlling mating, meiosis, and sporulation.
9
Biochemical Genetics of Purine Biosynthesis
A large collection of Ade- mutants of P. methanolica was isolated. Complementa-

tion analysis divided them into seven groups: adel, ade2 (pink), ade3 to ade7
(white). Tetrad analysis showed that most mutations are not linked, while the ade4
and ade7 mutations are mapped at the same locus designated ade4.7 and do not
recombine (Tolstorukov et al. 1987).
Among the pink Ade-mutants, most belonged to adel. Interallelic complemen-
tation was observed in the ADEl, but not in the ADE2locus. Mutants in ADEI were
devoid of AIR carboxylase and mutants in ADE2 were deficient in SAICAR syn-
thetase (Tolstorukov et al. 1987). Thus, the gene ADEI of P. methanolica MH4 is
homologous to the ADE2 gene of S. cerevisiae and vice versa.
10
Genetic Control of Methanol Metabolism
It appeares that P. methanolica (P. pinus) MH4 uses the same enzymes of methanol
oxidation and assimilation as the other species of methylotrophic yeasts (Veenhuis
et al. 1983; Sibirny et al. 1986a, 1988; Motruk et al. 1989; Titorenko et al. 1990a).
Methanol is oxidized by the air oxygen to formaldehyde; the reaction is cata-
lyzed by alcohol oxidase and leads to the formation of HP2' which is decomposed
by catalase. Formaldehyde is oxidized by the NAD- and glutathione-dependent
formaldehyde dehydrogenase to S-formylglutathione. The latter compound is
either oxidized by the NAD-dependent formate dehydrogenase, leading to the
formation of CO 2 and regeneration of free glutathione, or formaldehyde is hydro-
lyzed, first by the formylglutathione hydrolase to glutathione and formate, which
is then oxidized to CO 2 by the formate dehydrogenase. Formaldehyde is the sub-
strate of a specific transketolase, the dihydroxyacetone synthase, which catalyzes
the transfer of a glycolaldehyde moiety from xylulose-5-phosphate to formalde-
hyde with the formation of glyceraldehyde-3-phosphate and dihydroxyacetone.
The latter compound is phosphorylated by the corresponding kinase. After aldolic
condensation of the two triose phosphates molecules, fructose-I, 6-bisphosphate
is formed, which is converted into fructose-6-phosphate by a specific bis-

phosphatase. Three molecules of xylulose-5-phosphate are regenerated from
two molecules of fructose-6-phosphate and one molecule of triose phosphate, in
the reactions of the nonoxidative part of the pentose phosphate cycle, catalyzed by
trans aldolase, transketolase, ribose-5-phosphate isomerase, and ribulose-5-phos-
phate epimerase (rearrangement reactions). The formaldehyde-assimilating reac-
tions form the so-called xylulose monophosphate (dihydroxyacetone) cycle. As a
result, one molecule of triose phosphate is synthesized from three molecules of
formaldehyde and ATP. Formaldehyde is reduced to methanol in an NAD-depen-
dent formaldehyde reductase reaction (apparently the inverse reaction of alcohol
dehydrogenase). Alcohol oxidase, catalase, and dihydroxyacetone synthase are
localized in special microbodies, peroxisomes, which can occupy up to 80% of the
cellular volume during methylotrophic growth. Other enzymes of methanol me-
tabolism appear to be cytosolic (Veenhuis et al. 1983; Harder and Veenhuis 1989).
The scheme of methanol metabolism in yeasts is given in Fig. 2.
It is generally accepted that the energy supply of yeast methylotrophic growth
occurs exclusively in a direct pathway of formaldehyde oxidation to CO 2 (Veenhuis
et al. 1983). This view is not in agreement with some more recent observations, e.g.,
that 2-fluoroacetate inhibits growth of the wild-type strain P. methanolica MH4
and that malonate blocks growth of the icll mutant deficient in isocitrate lyase on
solid media with methanol (and also with glycerol or succinate), but not with
glucose (Sibirny et al. 1986a). It was found that the ability of malonate to inhibit
growth on methanol-containing medium correlates with the icll marker. This was
observed, when segregants of an JeLl x icll hybrid were analyzed (Sibirny et al.
1990). These, as well as other observations (including isolation of formaldehyde-
and formate dehydrogenase-deficient mutants), permitted an alternative hypoth-
esis, according to which the main role in energy supplying of yeast methylotrophic
growth belongs to the xylulose monophosphate pathway of formaldehyde assimi-
lation plus the tricarboxylic acid cycle (Sibirny 1987; Sibirny and Ubiyvovk 1988;
Sibirny 1990; Sibirny et al. 1990; Sibirny and Gonchar 1990).
Methanol metabolism is tightly regulated at the level of enzyme activities,
enzyme synthesis, and degradation (Sahm 1977; Veenhuis et al. 1983). In the
experiments with wild-type strains it became obvious that methanol, formalde-
hyde, and formate induce the synthesis of the enzymes involved in oxidation and
assimilation of methanol. Multicarbon substrates, especially glucose and ethanol,
strongly repress such induction. Similarly, one-carbon compounds induce biogen-
esis of peroxisomes, whereas glucose and ethanol repress this process (Veenhuis et
al. 1983; Harder and Veenhuis 1989).
Glucose and ethanol added to methanol-grown cells, in addition to repression,
cause degradative catabolite inactivation of peroxisomal enzymes (alcohol oxi-
dase, catalase, dihydroacetone synthase) and degradation of peroxisomes, appar-
ently due to vacuole fusion with peroxisomes and ensuing proteolysis of
peroxisomal constituents (Bormann and Sahm 1978; Veenhuis et al. 1983; Hill et
al. 1985; Tuttle et al. 1993). The genes involved in catabolite repression and catabo-
lite inactivation of methanol-metabolizing enzymes were not identified.
tv
'/' '\
'" ~
~
PEROXISOME NAD NADH CYTOSOL
CH,OH ... CH,OH ~

-\®2
H,O, NAD NADH
~CD NAD NADH \..0/
HCRO + HCHO - C - C H , O H ~ HeOOH - . co,
10
~O,+H,O
GSH t
rearrangemen
reactions
XuSP ~
~
ATP ADP
\..®;: .--.iGAP !
GAP DRA
-DHA DHAP~ ®
I ~ o FBP~F6P cell
Pi constituents
L GAP
l ~
Fig. 2. Methanol metabolism pathways and their compartmentation in methylotrophic yeasts. Designations: 1 alcohol oxi-
dase; 2 catalase; 3 formaldehyde dehydrogenase; 4 formate dehydrogenase; 5 dihydroxyacetone synthase; 6 dihydroxyacetone
kinase; 7 fructose-l,6-bisphosphate aldolase; 8 fructose-l,6-bisphosphatase; 9 formaldehyde reductase
>
?>
'"i?
~.
~
8. Pichia methano/ica (Pichia pinus MH4) 285
The model of P. methanolica MH4 was used for studying several aspects of
methylotrophic metabolism regulation. The following problems were studied:
• The nature of ethanol intermediate(s) causing catabolite repression and catabo-
lite inactivation of enzymes involved in methanol metabolism.
• Identification of the genes controlling catabolite repression.
10.1
Catabolite Repression and Catabolite Inactivation of Enzymes
Involved in Methanol Metabolism
Glucose is the "classic" compound which initiates catabolite repression and inac-
tivation in yeasts (Holzer 1976; Entian 1986; Sibirny and Titorenko 1990), whereas
an analogous action of ethanol occurs only in relation to enzymes of CJ-metabo-
lism in methylotrophic yeasts (Sibirny and Titorenko 1990; Bormann and Sahm
1978). The elucidation of the mechanisms of such a unique regulatory mechanism
is a very interesting problem. The possibility of isolating mutants of P. methanolica
blocked in subsequent steps of ethanol utilization can help to reveal the nature of
the effectors causing catabolite repression and inactivation in the medium with
ethanol.
P. methanolica mutants defective in particular steps of ethanol metabolism
were isolated. Some of them were isolated by selection of ethanol nonutilizing
mutants (Tolstorukov et al. 1989). All 24 such mutants were unable to grow on
ethanol or acetate, but retained the ability to grow on methanol and multicarbon
substrates. The mutations were recessive and were divided into four complemen-
tation groups. The specific activities of isocitrate lyase, malate synthase, phospho-
enolpyruvate carboxykinase, and "malic" enzyme were impaired in the mutants of
the corresponding groups. Mutant genes were designated icll, mlsl, pckl, and
mddl, respectively. In another series of experiments, 1062-fiuoroacetate-resistant
mutants unable to utilize ethanol or acetate were isolated. Among them, three
complementation groups were revealed. All mutants were devoid of acetyl-CoA
synthetase activity (designated acsl, acs2, and acs3). No linkage was found among
the identified mutations.
Among the mutants of P. methanolica MH4 resistant to allyl alcohol, a mutant
with a 30-40 times decreased alcohol dehydrogenase activity was isolated. The
mutation appeared to be recessive, monogenic, and was designated adhl
(Titorenko et al. 1990a). From this strain, the double mutant adhl adh2 was
isolated, which was characterized by the total absence of alcohol dehydrogenase
activity (Titorenko et al. 1990b). Additionally, a mutant was isolated, which grew
on a medium with acetate but not with ethanol as a sole carbon source. It is totally
devoid of acetaldehyde dehydrogenase activity and was designated aldX (V.
Titorenko and A. Sibirny, unpubl. observ.).
Electron microscopic study of P. methanolica MH4 mutants defective in differ-
ent steps ofCz-metabolism showed that acsl, acs2, acs3, icll, mlsl, pckl, and mddl
mutations severely (three- to fourfold) inhibited propagation of the glyoxysomal
286 A.A. Sibirny
type of microbodies, although they did not influence the specific activity of
gIyoxysomal enzymes, isocitrate lyase, or malate synthase (of course, with the
exception of iell or misl mutations, which block the corresponding enzymes
(Kulachkovsky et al. 1990)). Possibly, mutations affecting cell growth on
ethanol limit to some extent the propagation of microbodies in a medium with C2
compounds.
The effect of ethanol and acetate on repression and inactivation of alcohol
oxidase and catalase was studied. It was found that ethanol normally repressed
alcohol oxidase, and catalase in acsl, acs2, iell, mlsl, pckl, and mddl strains, and
does not repress their synthesis in adhl adh2 and aIdX mutants. On the other
hand, acetate normally repressed alcohol oxidase and catalase in all mutants
studied. It was suggested that acetate is the true effector (corepressor) which
evokes catabolite repression of C1-metabolizing enzymes in the medium with
ethanol (Sibirny 1990).
Studies of catabolite inactivation of alcohol oxidase and catalase in the isolated
mutants showed that such inactivation is impaired in acsl, acs2, iell, adhl adh2,
and aIdX mutants in a medium with ethanol, and only in acsl, acs2, and iell
mutants in a medium with acetate (Sibirnyet al. 1986a, 1988; Tolstorukov et al.
1989; Sibirny 1990). It was suggested that the immediate effector of ethanol-
induced catabolite inactivation of peroxisomal enzymes is glyoxylate, since pro-
duction of this compound is defective in mutants with impaired acetyl-CoA
synthetase and isocitrate lyase.
10.2
Identification of Genes Controlling Catabolite Repression
In another part of the work, mutants of P. methanolica MH4 defective in carbon

catabolite repression were isolated and studied. Mutants resistant to the
nonmetabolized glucose analogue 2-deoxyglucose during growth in a medium
with methanol were isolated (Alamyae et al. 1985; Sibirny et al. 1986b, 1987;
Titorenko et al. 1991b). Genetic analysis of the mutants divided them into four
classes: gcrl, gcr2 (both recessive) GCR3 c, and GCR4 (both dominant). The muta-
C
tions appeared to be monogenic and nonlinked. It was hypothesized that the genes
GCRI and GCR2 act as negative and the genes GCR3 and GCR4 as positive regula-
tors of the methanol-metabolizing enzymes. A part of these mutations affected
only catabolite repression and methanol was needed for enzyme synthesis, while
others, even some represented by the same gene (GCRl), manifested constitutive
synthesis of enzymes in glucose medium without methanol. Ethanol normally
repressed alcohol oxidase and catalase synthesis in all mutants studied. Catabolite
inactivation of alcohol oxidase and catalase in glucose medium was also quite
normal in the mutants.
For isolation of P. methanolica mutants defective in ethanol-induced catabolite
repression, the following approach was used. Ethanol normally represses alcohol
oxidase synthesis in iell mutants deficient in isocitrate lyase; hence such mutants
cannot grow on methanol/ethanol mixture. iell mutants able to grow on a mixture
of both alcohols contained a regulatory recessive monogenic mutation designated

eerl (Sibirny et al. 1986b, 1987). Glucose-induced catabolite repression was quite
normal in the eerl mutant. Catabolite inactivation of alcohol oxidase and catalase
in the medium with ethanol was also unaffected.
Ethanol-induced catabolite repression was also impaired in adhl mutants,
which are characterized by a 30-40-fold decrease of alcohol dehydrogenase activity
(Titorenko et al. 1990a). Glucose normally repressed alcohol oxidase synthesis in
the mutants.
Carbon compounds repressing alcohol oxidase synthesis in the wild-type strain
were divided into four groups, depending on their effect on ger 1 and eer1 mutants.
The hexoses and xylose form the first group: the repressive action of these com-
pounds is impaired only in the gcrl mutant (Sibirny et al. 1987). The second group
includes ethanol, acetate, and 2-oxoglutarate, whose action is impaired only in the
eerl mutant. Malate and dihydroxyacetone form the third group: their repressive
action is not eliminated in either eer1 and gcr 1 mutants. The fourth group consists
of compounds whose repressive effect is partly abolished in both mutant classes.
Thus, several independent mechanisms of catabolite repression, depending on the
nature of corepressor, exist in P. methanoliea MH4.
Mutants gcrl, ger2, GCR3c , and GCR4 are characterized by a significant de-
C
crease in phosphofructokinase activity, an increase in the intracellular pools of

hexose phosphates and a drop in fructose-I, 6-bisphosphate activity (Sibirny et al.
1987; Titorenko et al. 1991a). Mutant ecrl manifested a decrease in 2-oxoglutarate
dehydrogenase activity and an increase in the intracellular pool of 2-oxoglutarate.
It was suggested that phosphofructokinase and 2-oxoglutarate dehydrogenase par-
ticipate in glucose and ethanol catabolite repression, respectively (Sibirny et al.
1987). Data also indicate different genetic mechanisms of catabolite repression and
catabolite inactivation of methanol-metabolizing enzymes.
A detailed study of the properties of the P. methanoliea ecrl mutant quite
unexpectedly showed that in this mutant, contrary to the ECRI wild-type strain,
methanol causes an almost complete block of induction by ethanol of glyoxysomal
enzymes involved in C2 metabolism, isocitrate lyase, and malate synthase (A.
Sibirny and V. Titorenko 1988). During cultivation of the ECRI wild-type strain
and the eerl mutant on a methanol/ethanol-mixture, diauxic growth was observed.
The ECRI strain first utilized ethanol and then synthesized glyoxysomal enzymes,
whereas the eerl mutant first utilized methanol and then synthesized peroxisomal
enzymes (Sibirny et al. 1991). It was suggested that the succession of ethanol and
methanol utilization from a mixture is determined by the sequence development
of two different microbody types: in the wild-type strain, glyoxysomes are formed
first whereas in the ecrl mutant the development of peroxisomes is observed first.
It is possible that the ECRI gene plays a central regulatory role and determines the
type of microbody to be formed first. In the normal state, the ECRI gene directs
microbody biogenesis to the "glyoxysomal" type of development while in mutants
defective in this gene, biogenesis is guided to the "peroxisomal" type. Thus, the
ECRI gene may be formally compared with homeoboxes, which regulate the
succession of development in higher eukaryotes (Wright et al. 1989).
288 A.A. Sibirny
In contrast to ecrl, the adhl mutation allowed the simultaneous utilization of

ethanol and methanol by permitting joint synthesis of both glyoxysomal and
peroxisomal enzymes (Sibirny et al. 1991). Growth of the adhl mutant on an
ethanol/methanol mixture occurred without diauxy. Ethanol-growing cells of the
adhl mutant contained hybrid microbodies, glyoxyperoxisomes, possessing si-
multaneously alcohol oxidase and malate synthase activites (Sibirny et al. 1996).
Thus, the methylotrophic yeast P. methanolica MH4 possesses a very complex
system which regulates catabolite repression of the methanol-metabolizing
enzymes in media with various corepressors. Phosphofructokinase and
2-oxoglutarate dehydrogenase could be involved in catabolite repression.
The new phenomenon of methanol-induced catabolite inactivation of
glyoxysomal enzymes (isocitrate lyase, malate synthase), alcohol dehydrogenase,
and acetaldehyde dehydrogenase was found using P. methanolica MH4 as model
system (Sibirny 1990; V. Titorenko and A. Sibirny, unpubl. observ.). Addition of
methanol to ethanol-grown cells of a P. methanolica wild-type strain causes a rapid
decrease in specific activities of the above-mentioned enzymes of C2 metabolism.
Total inactivation of the enzymes was completed 5 to 7h after incubation with
methanol. Formaldehyde and formate also caused such inactivation. A methanol/
ethanol mixture did not inactivate isocitrate lyase and alcohol dehydrogenase in
the wild-type strain, but actively caused such inactivation in the ecrl mutant
defective in ethanol catabolite repression ofCI-metabolizing enzymes. Apparently,
metabolism of methanol is necessary to initiate inactivation of C2 -metabolizing
enzymes. The mechanism of this new phenomenon remains unknown.
11
Biotechnological Applications
A mutant AOS-3 was isolated which secretes alcohol oxidase into the culture
medium (Titorenko et al. 1992). Specific activity of alcohol oxidase was 0.09 U/mg
in cells and 0.08U/ml in the culture medium. This represents 2.9U/mg protein of
the culture medium, which comprises 45% of total alcohol oxidase activity of the
cells plus culture medium. Catalase activity in the culture medium was totally
absent. This strain may be of interest for alcohol oxidase production, since isola-
tion of the enzyme from the medium is a much easier procedure compared with
the procedure of intracellular enzyme isolation.
It was found that P. methanolica mutants defective in acetyl-CoA synthetase, in
contrast to the wild-type strain, efficiently acidify the medium after addition of
ethanol due to extrusion of acetic acid into the medium (Gonchar et al. 1990). It is
possible to immobilize intact washed cells of acs mutants of P. pinus on the gate of
pH-sensitive field effect transistors (pH SFET) which react on the local acidifica-
tion of the medium due to specific consumption of ethanol and extrusion of acetic
acid (Korpan et al. 1992, 1993). The assay time is a few minutes. Such cell bio-
sensors appeared to be more specific when compared with a similar cell sensor
which used Acetobacter aceti (Kitagawa et al. 1987) or an enzyme alcohol oxidase-
based sensor (Kitagawa et al. 1987).
References
Alamyae T, Teugyas K, Soom J, Simisker J (1985) A partly resistant to catabolite repression

mutant of the yeast Pichia pinus assimilating methanol. Mikrobiologiya 54: 634-640 (in
Russian)
Benevolensky SV, Tolstorukov II (1980) Study of the mechanisms of mating and self-
diploidization in the haploid yeast Pichia pinus. III. Study of heterothallic mutants.
Berardi E, Thomas DY (1991) An effective transformation method for Hansenula
polymorpha. Curr Genet 18: 169-170
Bormann C, Sahm H (1978) Degradation of microbodies in relation to activities of alcohol
oxidase and catalase in Candida boidinii. Arch Microbiol1l7: 67-72
Entian K-D (1986) Glucose repression: a complex regulatory system in yeast. Microbiol Sci
3: 366-371
Gonchar MV, Titorenko VI, Hladarevska NN, Sibirny AA (1990) The phenomenon of
medium acidification by the cells of methylotrophic yeast and its biochemical nature.
Biokhimia 55: 2148-2158 (in Russian)
Harder W, Veenhuis M (1989) Metabolism of one-carbon compounds. In: Rose AH,
Harrison JS (eds) The yeasts. Academic Press, London, 2nd edn, vol 3, pp 289-316
Hiep TT, Kulikov VN, Noskov VN, Pavlov YI (1991) The structure of the ADEl gene from
methylotrophic yeast Pichia pinus: comparison with the AIR-carboxylase genes from
other species. Abstr 15th Int Spec Symp on Yeasts, Riga, p 55
Hiep TT, Noskov VN, Pavlov YI (1992) Transformation system in the methylotrophic yeast
Pichia methanolica. In: Abst Int Workshop on Genetics and Mol BioI of Non-
convertional Yeasts, Basel
Hill DJ, Harm AC, Lloyd D (1985) Degradative inactivation of the peroxisomal enzyme,
alcohol oxidase, during adaptation of methanol-grown Candida boidinii to ethanol.
Biochem J 232: 743-750
Holzer H (1976) Catabolite inactivation in yeast. Trends Biochem Sci 1: 178-181
Kato K, Kurimura Y, Makiguchi N, Asai Y (1974) Determination of strongly methanol
assimilating yeasts. J Gen Appl Microbiol 20: 123-127
Kitagawa Y, Tamiya E, Karube I (1987) Microbial-FET alcohol sensor. Anal Lett 20: 81-
96
Korpan YI, Gonchar MV, Soldatkin AP, Starodub NF, Sandrovsky AK, Sibirny AA, Elskaya
AV (1992) Cellular microbiosensors on the base of pH-sensitive field effect transistors
for methanol and ethanol assay. Ukr Biokhim Zh 64(3): 96-100 (in Russian)
Korpan YI, Soldatkin AP, Starodub NF, Elskaya AV, Gonchar MV, Sibirny AA, Shulga AA
(1993) Methylotrophic yeast microbiosensor based on ion-selective field effect transis-
tors for methanol and ethanol determination. Anal Chim Acta 271: 203-208
Kulachkovsky AR, Titorenko VI, Sibirny AA (1990) Electron microscopic study of the
mutants of Pichia pinus yeast defective in various steps of ethanol metabolism.
Tsitologiya i Genetika 24(6): 17-20 (in Russian)
Kushnirov VV, Ter-Avanesyan MD, Didichenko SA, Smirnov VN, Chernoff YO, Derkach IL,
Novikova ON, Inge-Vechtomov SG, Neistat MA, Tolstorukov II (1990) Divergence and
conservation of SUP2 (SUP35) gene of yeasts Pinchia pinus and Saccharomyces
cerevisiae. Yeast 6: 461-472
Motruk OM, Tolstorukov II, Sibirny AA (1989) Selection of alcohol oxidase deficient mu-
tants of methylotrophic yeast Pichia pinus. Biotekhnologiya 5: 692-698 (in Russian)
Neistat MA, Benevolensky SV, Dutova TA, Tolstorukov II (1987) "Illegal" transformation of
red adenine-deficient mutants of the yeast Pichia pinus with pYE (ADE2)2 plasmid.
290 A.A. Sibirny
Sahm H (1977) Metabolism of methanol by yeast. Adv Biochem Eng 6: 77-103

Sasnauskas KV, Giadvilaite AA, Janulaitis AA (1987) Cloning of Saccharomyces cerevisiae
ADE2 gene and localization of ARS sequence. Genetika 23: 1141-1148 (in Russian)
Sibirny AA (1987) Some aspects of methanol metabolism regulation in yeast. In: Biokhimiya
Zhivotnykh i Cheloveka. Biotekhnologiya. Naukova Dumka, Kiev, vol 11, pp 63-75 (in
Russian)
Sibirny AA (1990) Genetic control of methanol and ethanol metabolism in the yeast Pichia
pinus. In: Heslot H (ed) Proc 6th Int Symp on Genetics ofInd Microorg Strasbourg. Soc
Franc Microbiol, vol 1, pp 545-554
Sibirny AA, Gonchar MV (1990) The influence of citrate and dihydroxyacetone on methanol
oxidation in yeast. Ukr Biokhim Zh 62: 112-115 (in Russian)
Sibirny AA, Titorenko VI (1988) The inhibition by methanol of isocitrate lyase and malate
synthase induction in the yeast Pichia pinus. Biotekhnologiya 4: 194-196 (in Russian)
Sibirny AA, Titorenko VI (1990) Molecular mechanisms of catabolite regulation in yeast. In:
Itogi Nauki i Tekhniki. Molekularnaya Biologiya, vol 33, pp 3-214 (in Russian)
Sibirny AA, Ubiyvovk VM (1988) Isolation of methylotrophic yeast Hansenula polymorpha
mutants deficient in formaldehyde dehydrogenase. Biotekhnologiya 4: 723-725 (in
Russian)
Sibirny AA, Titorenko VI, Benevolensky SV, Tolstorukov II (1986a) On the regulation of
methanol metabolism in the mutant of the yeast Pichia pinus defective in isocytrate
lyase. Biokhimiya 51: 16-22 (in Russian)
Sibirny AA, Titorenko VI, Benevolensky SV, Tolstorukov II (1986b) On the differencies in
the mechanisms of ethanol and glucose catabolite repression involved in enzymes of
methanol metabolism in the yeast Pichia pinus. Genetika 22: 584-592 (in Russian)
Sibirny AA, Titorenko VI, Efremov BD, Tolstorukov II (1987) Multiplicity of mechanisms of
carbon catabolite repression involved in the synthesis of alcohol oxidase in the
methylotrophic yeast Pichia pinus. Yeast 3: 233-241
Sibirny AA, Titorenko VI, Gonchar MV, Ubiyvovk VM, Ksheminskaya GP, Vitvitskaya OP
(1988) Genetic control of methanol utilization in yeasts. J Basic Microbiol 28: 293-
319
Sibirny AA, Ubiyvovk VM, Gonchar MV, Titorenko VI, Voronovsky AY, Kapultsevich YG,
Bliznik KM (1990) Reactions of direct formaldehyde oxidation to CO2 are non-essential
for energy supply of yeast methylotrophic growth. Arch Microbiol154: 566-575
Sibirny AA, Titorenko VI, Teslyar GE, Petrushko VI, Kucher MM (1991) Methanol and
ethanol utilization in methylotrophic yeast Pichia pinus wild-type and mutant strains.
Arch Microbiol 156: 455-462
Sibirny AA, Kulachkovsky AR, Moroz OM (1996) Appearance of hybrid microbodies,
glyoxyperoxisomes, containing alcohol oxidase and malate synthase in the regulatory
mutant of the methylotrophic yeast Pichia methanolica. Mikrobiologiya 65 (in press)
Surguchov AP, Smirnov VN, Ter-Avanesyan MD, Inge-Vechtomov SG (1984) Ribosomal
suppression in eukaryotes. Physicochem Biol Rev 4: 147-205
Tarutina M, Tolstorukov II (1994) Elaboration of the method for vector transformation of
methylotrophic yeast Pichia methanolica. Genetika 30: 783-790
Titorenko VI, Motruk OM, Efremov BD, Petrushko VI, Teslyar GE, Kulachkovsky AR,
Sibirny AA, Tolstorukov II (1990a) Selection and properties of the mutants of the
methylotrophic yeast Pichia pinus deficient in alcohol dehydrogenase and formaldehyde
reductase. Genetika 26: 1749-1759 (in Russian)
Titorenko VI, Petrushko VI, Kulachkovsky AR, Sibirny AA (1990b) Regulatory properties of
the mutants of Pichia pinus impaired in alcohol dehydrogenase. In: Abstr 6th Int Symp
on Genetics of Ind Microorg Strasbourg, p 151
Titorenko VI, Khodursky AB, Sibirny AA (1991a) The properties of new mutants of
the yeast Pichia pinus with defective catabolite repression. Genetika 27: 791-800 (in
Russian)
Titorenko VI, Khodursky AB, Teslyar GE, Sibirny AA (1991 b) Identification of new genes
controlling catabolite repression of alcohol oxidase and catalase synthesis in the
methylotrophic yeast Pichia pinus. Genetika 27: 625-635 (in Russian)
Titorenko VI, Sapozhenkova EY, Sibirny AA (1992) The strain of the yeast Pichia pinus,
producer of alcohol oxidase. Soviet Patent (Author's Certificate) No 1770357 (in
Russian)
Tolstorukov II (1988) Genetics of the methylotrophic yeast Pichia pinus. Doct BioI Sci
Thesis Moscow (in Russian)
Tolstorukov II (1994) Genome structure and reidentification of the taxonomic status of
Pichia pinus MH4 genetic lines. Genetika 30: 635-640 (in Russian)
Tolstorukov II, Benevolensky SV (1978) Study of the mechanisms of mating and self-
diploidization in the haploid yeast Pichia pinus. 1. Bipolarity of mating. Genetika 14:
Tolstorukov II, Benevolensky SV (1980) Study of the mechanisms of mating and self-
diploidization in the haploid yeast Pichia pinus. II. Study of heterothallic mutants.
Tolstorukov II, Efremov BD (1984) Construction of the genetic map of the yeast Pichia
pinus. II. Tetrad analysis mapping. Genetika 20: 1099-1107 (in Russian)
Tolstorukov II, Dutova TA, Benevolensky SV, Soom YO (1977) Hybridization and genetic
analysis of methanol-oxidizing yeast Pichia pinus MH4. Genetika 13: 322-329 (in
Russian)
Tolstorukov II, Benevolensky SV, Efremov BD (1981) Study of the mechanisms of mating
and self-diploidization in the haploid yeast Pichia pinus, Y1. Functional structure of the
mating type locus. Genetika 17: 1019-1028 (in Russian)
Tolstorukov II, Benevolensky SV, Efremov BD (1982) Genetic control of cell type and
complex organization of mating type locus in the yeast Pichia pinus. Curr Genet 5: 137-
142
Tolstorukov II, Bliznik KM, Efremov BD (1983) Construction of the genetic map of the yeast
Pichia pinus. 1. Identification of the linkage groups by using induced mitotic
haploidization. Genetika 19: 897-902 (in Russian)
Tolstorukov II, Dutova TA, Benevolensky SV, Efremov BD, Milgrom EM, Alenin VV,
Domkin VD (1987) Genetic control of purine biosynthesis in the yeast Pichia pinus. 1.
Genes controlling YI and YII steps. Genetika 23: 1399-1406 (in Russian)
Tolstorukov II, Efremov BD, Benevolensky SV, Titorenko VI, Sibirny AA (1989) Mutants of
the methylotrophic yeast Pichia pinus defective in C2 metabolism. Yeast 5: 179-186
Tuttle DL, Lewin AS, Dunn WA Jr (1993) Selective autophagy of peroxisomes in
methylotrophic yeasts. Eur J Cell BioI 60: 283-290
metabolism of one-carbon compounds in yeast. Adv Microb Physiol24: 1-82
Wright CVE, Cho KWY, Oliver G, de Robertis EM (1989) Vertebrate homeodomain pro-
teins: families of region-specific transcription factors. Trends Biochem Sci 14: 52-56
CHAPTER 9
Hansenu/a po/ymorpha (Pichia angusta)

Hans Hansen and Cornelis P. Hollenberg
1
History of Hansenula polymorpha Research
A small and closely related group of yeasts is capable of using methanol as sole
source of carbon and energy. Among these methylotrophic organisms, Hansenula
polymorpha in particular has gained increasing attention in recent years, in both
basic and applied sciences. This is mainly due to two physiological features that are
an integral part of the methanol-utilizing machinery of this yeast. One is the
expression of huge amounts of the key methanol-metabolizing enzymes, which
can, in the case of the methanol oxidase, amount to up to one third of the total
cellular protein. The expression is driven by very strong promoters that form the
basis for a highly competitive system to produce foreign proteins at industrial scale
(Gellissen et al. 1994). The other prominent characteristic of H. polymorpha is
that the expression is accompanied by a dramatic growth and proliferation of
microbodies, i.e., peroxisomes (Veenhuis and Harder 1987). H. polymorpha thus
served and, in addition to the recent introduction of other systems such as Saccha-
romyces cerevisiae, still continues to serve as a valuable model organism to study
the biogenesis of these organelles. Although we will briefly discuss the contribu-
tions of H. polymorpha to the field of peroxisome research, our main focus within
this chapter belongs to the practical aspects that are of importance in working with
this yeast.
As an as co sporogenous yeast that does not form a mycelium, H. polymorpha is
placed into the order of Endo- or Saccharomycetales (Lodder 1970). It is a member
of the family of Saccharomycetaceae because it propagates asexually by multilat-
eral budding on a narrow base, whereafter the vegetative cells become separated.
An important taxonomic feature, other than methylotrophy, which separates
Hansenula from other yeasts, with the exception of Pichia and Pachysolen, is the
production of extracellular phosphomannans. Phosphomannans are produced in
large amounts by the more primitive members of this genus, which gives them a
mucoid appearance (Wickerham 1970). The genera Hansenula and Pichia are
closely related, especially their methylotrophic members (Lee and Komagata
1980). The ability of H. polymorpha to assimilate nitrate places this species in the
Institut fur Mikrobiologie, Heinrich-Heine-Universitat Dusseldorf, Universitatsstr. 1,

Gebaude 26.l2, 40225 Dusseldorf, Germany
294 H. Hansen and c.P. Hollenberg
genus Hansenula H. et P. Sydow (Wickerman 1970). Some taxonomists (see Chap.

1, this Vol.) dispute the significance of this classification based on hybridization
studies, and propose to combine Pichia and Hansenula. In this context, H.
polymorpha has been renamed Pichia angusta according to the earlier description
of the genus Pichia Hansen (Kurtzman 1984).
2
Physiology
The capability to grow on media which contain methanol as sole source of carbon
and energy distinguishes methylotrophic from other yeasts. This feature is much
rarer among yeasts than among bacteria. Methylotrophic yeasts can be grouped
into four genera, Hansenula, Pichia, Candida, and Torulopsis, which are closely
related (Harder and Brooke 1990). All of them are facultative methylotrophs and
unable to grow on methane, methylamine, formaldehyde, or formate as a sole
carbon and energy source. However, methylated amines can be utilized as the
nitrogen source (Van Dijken and Bos 1981).
The first step in methanol utilization is shared by the assimilatory and
the dissimilatory pathways. A methanol oxidase that is located in the peroxisomal
matrix converts methanol to formaldehyde (Sahm and Wagner 1973a,b). The
enzyme is present as a homo-dimer with flavin adenine dinucleotide (FAD)
as the prosthetic group, bound to each subunit (Kato et al. 1976). When large
amounts of methanol oxidase are synthesized, it forms a crystalloid inside the
peroxisome (Vonck and van Bruggen 1990). No energy is provided for the cell
during the first step. Instead, oxygen is used as an electron acceptor, which results
in the formation of hydrogen peroxide. H2 0 2 is then removed by a peroxisomal
catalase (Sahm and Wagner 1973a,b; Roggenkamp et al. 1974, 1975; Fujii and
Tonomura 1975).
Formaledehyde is either assimilated enzymatically via a peroxisomal dihy-
droxyacetone synthase, or it leaks into the cytosol, where it reacts non-
enzymatically with glutathione (Uotila and Koivusalo 1974; Waites and Quayle
1981). The resulting S-hydroxymethylglutathione is dissimilated to carbon dioxide
in two energy-providing reactions (Schutte et al. 1976). A formaldehyde dehydro-
genase converts S-hydroxymethylglutathione to S-formylglutathione (Uotila and
Koivusalo 1974; Schutte et al. 1976), which in H. polymorpha is the substrate of a
formate dehydrogenase (Schutte et al. 1976; van Dijken et al. 1976a). In both steps,
nicotinamide adenine dinucleotide (NAD+) serves as the electron acceptor. The
role of the dissimilatory pathway as a major energy supply is controversial. Sibirny
et al. (1990) have demonstrated that both formaldehyde dehydrogenase and for-
mate dehydrogenase are not indispensable for growth on methanol, but the cells
become more sensitive to higher methanol concentrations. Metabolic labeling
studies have shown that only if the capacity of the assimilatory cycle to remove
formaldehyde is decreased, can significant amounts of formaldehyde enter the
oxidative pathway (Jones and Bellion 1991), suggesting a role in detoxification.
Formaldehyde is assimilated by the xylulose monophosphate pathway (van
Dijken et al. 1978). The initial step is catalyzed by a special transketolase that is
9. Hansenu/a po/ymorpha (Pichia angusta) 295
located in the peroxisomal matrix (Douma et al. 1985; Goodman 1985). This
enzyme, termed dihydroxyacetone synthase, transfers a glycolaldehyde group
from xylulose-5-phosphate onto formaldehyde, thereby generating dihydroxyac-
etone and glyceraldehyde-3-phosphate (Waites and Quayle 1981; Bystrykh et al.
1981; Kato et al. 1982). The former metabolite is phosphorylated by a cytoplasmic
dihydroxyacetone kinase (Douma et al. 1985), before it is condensed by a fructose-
1,6-bisphosphate aldolase with glyceraldehyde-3-phosphate to fructose-l ,6-
bisphosphate (FBP). During growth on methanol, increased amounts of FBPase,
an enzyme essential for the regeneration of xylulose-5-phosphate, are formed
(Harder and Brooke 1990). Methanol obviously represents a suboptimal carbon
source for the growth of methylotrophic yeasts. This is reflected in the fact that in
methanol-grown cells, trehalose, generally associated with poor growth rates, star-
vation, and differentiation, is the main assimilatory product {Jones and Bellion
1991).
3
Media
As for Saccharomyces cerevisiae, YEP (l % yeast extract, 2% Bacto peptone) is used

as rich medium for H. polymorpha. In general, for selective purposes the yeast is
grown in the presence of 0.67% Yeast Nitrogen Base supplemented with amino
acids or bases at 20,ug/ml if required; 2% glucose is commonly used as carbon
source. Since glucose and also ethanol are most effective in catabolite repression
(Egli et al. 1980; Harder and Brooke 1990), they have to be replaced if expression
from peroxisomal promoters is required. Whereas glycerol (usually 1-2%) is used
for derepression of peroxisomal enzymes, methanol has a strong inducing effect
(Eggeling and Sahm 1981). Methanol should be added at a concentration of 0.5-
1%. For most purposes the loss of methanol by evaporation poses no problem. On
the other hand, too high concentrations (over 2%) can lead to significant reduc-
tions in growth rate (Berry et al. 1987). In continuous culture, expression from the
methanol oxidase promoter can also be effectively induced by formaldehyde and
formic acid (Giuseppin et al. 1988). Mixed substrates have been used to induce
peroxisomal biogenesis under more favorable growth conditions, such as glucose
and methanol, or glucose and formaldehyde for carbon-limited cultivation of cells,
and glycerol and methanol, or sorbitol and methanol in batch culture (Egli et al.
1982; Veale et al. 1992).
Optimal peroxisomal proliferation and highest expression of alcohol oxidase
can be achieved in methanol-limited chemostat culture, where H. polymorpha is
grown in a mineral medium that consists of 0.25% ammonium sulfate, 0.1%
KH 2P04 , 0.02% MgS0 4·7H20, 0.05% yeast extract, trace elements, 0.5 mg/l thiamin,
and 50,ug/l biotin (van Dijken 1976). Under these conditions, a single cell may
harbor up to 20 peroxisomes which occupy up to 80% of the cell lumen (Veenhuis
et al. 1978, 1983), and the alcohol oxidase can constitute up to 35% of soluble cell
protein (Roggenkamp et al. 1984).
For mating and sporulation, H. polymorpha is plated onto 3% malt extract
(Gleeson and Sudbery 1988; see Sect. 5). Under these conditions, diploid cells
296 H. Hansen and C.P. Hollenberg
appear as colonies which become dark pink upon sporulation within 3 to 4 days.
The sporulation of haploids is visible after 8 days.
4
Available Strains
Although a variety of wild-type strains of H. polymorpha can be obtained via the
major culture collectors, only a few are routinely used for scientific or industrial
purposes. Strain CBS 4732 (Centraalbureau voor Schimmelcultures, Delft, The
Netherlands) or ATCC 34438 (American Type Culture Collection, Rockville, MD
USA) is historically the most widely employed strain. It is used in most studies of
peroxisomal biogenesis, and it served as the basis for the majority of available
mutant strains that are utilized for expression of recombinant proteins. Unfortu-
nately, the fertility of H. polymorpha laboratory strains varies considerably
(Gleeson and Sudbery 1988) and CBS 4732 has been shown to have an extremely
low mating efficiency. Therefore, it is not easily amenable to classical genetic
studies (see below). In contrast, strain NCYC 495 from the National Yeast Culture
Collection (Norwich, UK) has much better mating properties and has been used
extensively in genetic analyses, in particular by Gleeson and Sudbery (1988).
An increasing number of mutant strains with nutritional requirements compa-
rable to those of S. cerevisiae have been published. Essentially two types of aux-
otrophic strains are used presently for transformation purposes. Strains with
defects in the orotidine-5'-phosphate decarboxylase gene (odc1), such as LR9
derived from ATCC 34438 (Roggenkamp et al. 1986), can be complemented either
with the URA3 gene from S. cerevisiae or from H. polymorpha (Merckelbach et al.
1993). Strains which lack ,B-isopropyl malate dehydrogenase activity, termed A16
(from CBS 4732; Fellinger et al. 1991), leul-l (from NCYC 495; Gleeson 1986) or
DL-l (Tikhomirova et al. 1986), are available which are complementable with both
the S. cerevisiae LEU2 gene or its H. polymorpha homologue HLEU2 (Agaphonov
et al. 1994). For production purposes, special mutants such as RBI0 (Janowicz et al.
1991) have been selected.
Since a major focus in working with H. polymorpha is the peroxisome, the
development of genetic techniques has led to a steady expansion in the number of
strains with defects in methanol utilization. These so-called Mut- mutants are
frequently found and can be isolated based on their inability to grow on methanol.
They fall into three categories: (l) mutants defective in methanol utilization, (2)
regulatory mutants, (3) mutants with defects in peroxisome biogenesis. Methanol
oxidase mutants have been isolated by Sibirny et al. (l988) by selecting for growth
on allyl alcohol. Mutant strains lacking, for example, catalase, formaldehyde re-
ductase, or dihydroxyacetone kinase activity, or have defects in the tricarboxylic
acid cycle, have been generated by different groups (Eggeling and Sahm 1980; de
Koning et al. 1987; Sibirny et al. 1988; Hansen and Roggenkamp 1989). Gleeson
(1986) has analyzed 33 mutants, which he generated by mutagenizing strain CBS
4732. About half of them belong to five complementation groups, only one (MUT3)
lacks activity of one of the methanol-metabolizing enzymes, the dihydroxyacetone
synthase. The others do not show a specific enzymatic defect and are presumably
mutants of class (3). The second half of isolated mutants (acu mutants) are unable
to grow on methanol and a variety of other carbon sources, such as ethanol,
glycerol, maltose, or dihydroxyacetone, indicating defects in carbon catabolite
repression. Revertants, isolated on maltose medium, belong to two groups. One is
relieved of glucose repression independent of the carbon source, suggesting a
common regulatory element, the other is resistant to 2-deoxyglucose, albeit to
various degrees, which indicates the existence of regulatory mechanisms particular
to a specific carbon source (Sudbery and Gleeson 1989).
To date, relatively little is known about the biogenesis of peroxisomes. Informa-
tion about the participating genes can be obtained with a group of strains isolated
form Mut- mutants by electron microscopic examination of peroxisomal struc-
tures (Cregg et al. 1990; Titorenko et al. 1993a,b). Briefly, they have three distinct
phenotypes. No peroxisomes could be demonstrated in Per mutants, but peroxi-
somal matrix and aggregated membrane proteins are present in the cytosol (Sulter
et al. 1993a,b); Pim- mutants have small peroxisomes, but are unable to import
peroxisomal proteins; Pss- mutants show an aberrant substructure of the crystal-
line peroxisomal matrix (Titorenko et al. 1993a). All mutants can be divided into
12 complementation groups, designated Perl to Perl2. In many cases, primarily
combined with a cold-sensitive phenotype, diploids with wild-type and mutant
alleles are unable to grow on methanol, and still show defects in peroxisome
biogenesis (Titorenko et al. 1993). This so-called unlinked noncomplementation
suggests that at least five of the PER genes participate as essential components in
a protein complex controlling major steps in peroxisome formation (Titorenko et
al. 1993). The first two members of this set of genes have been isolated by func-
tional complementation of per I, a mutant with Pim- phenotype, and the Per- strain
per8 (Waterham et al. 1994; Tan et al. 1995; see Sect. 7).
5
Genetic Techniques
5.1
Life Cycle
Methylotrophic yeasts are commonly isolated from decaying plant material and
soil samples that are rich in organic matter. The species of Hansenula can be
haploid and/or diploid (Teunisson et al. 1960). H. polymorpha exists in nature
predominantly as haploid cells, but upon isolation frequently produces diploids
(Wickerham 1970). Haploid cells have an ellipsoidal shape with diameters of (1.0-
4.3) x (2.1-4.3).um, whereas diploids are more spherical, measuring from 3.4 to
5.2.um (Wickerham 1970). The latter maybe agglutinated. Diploid cells sporulate
faster than the haploids, which makes them easily distinguishable on sporulation
plates by the earlier formation of pink-colored colonies (Wickerham 1970). The
ascospores are small, hemispheroidal or hat-shaped with narrow brims, and con-
nected to each other by a thread-like structure. H. polymorpha can ferment glu-
cose, but not galactose, sucrose, maltose, lactose, or raffinose (Wickerham 1970).
The yeast does not ferment under aerobic conditions, that means it is Crabtree-
negative, and does not form petites (Verduyn et al. 1992). It is thermotolerant with
a temperature optimum of 37°C, which is unusual for methylotrophic yeasts
(Levine and Cooney 1973).
The life cycle of the homothallic yeast H. polymorpha is very similar to that of s.
cerevisiae and especially to the closely related Pichia pinus (Gleeson 1986), which
has been studied in detail by Tolstorukov and Benevolenskii (1978, 1980). Al-
though stable in rich medium, diploid cells start to sporulate when nutrients
become limited. They form four ascospores. The spores belong to two different
mating types, which segregate equally. Like the diploids, the resulting haploid cells
are maintained stably in rich medium (Sudbery and Gleeson 1989). Starvation,
such as nitrogen deprivation, triggers some cells to switch their mating type. In
contrast to S. cerevisiae, the switch is independent of the mating type of the mother
cell or the position of the cell in the last generation cycle. The switch is random and
can generate the same or a different mating type. In the latter caSe only, a conju-
gation tube is formed which initiates the mating between cells of opposite mating
types. During prolonged cultivation, some commonly used laboratory strains of H.
polymorpha (such as CBS 4732, syn. ATCC 34438), however, have become
semisterile (Gleeson 1986), presumably because they have lost the ability to switch
their mating type.
S.2
Induction of Mutants
H. polymorpha is in principle amenable to all classical techniques that were

originally developed for the genetic manipulation of S. cerevisiae. Since haploid
cells do not mate on rich medium, conventional mutagenesis can be used to
introduce mutations. In most reported cases, either nitrosoguanidine (NTG) or
ethylmethanesulfonate (EMS) have been employed successfully as mutagens,
sometimes followed by an enrichment step with nystatin (Sanchez and Demain
1977; Gleeson 1986; Roggenkamp et al. 1986; Cregg et al. 1990). ODCl mutants,
suitable for complementation with the URA3 gene, have been isolated using 5-
fluoro-orotic acid (Roggenkamp et al. 1986). Following mutagenesis, the aux-
otrophic phenotype, that is failure to grow on nutrient-deficient medium, is not
always immediately visible (Sudbery and Gleeson 1989; H. Hansen and R.
Roggenkamp, unpubl. results), which often makes it necessary to replate the colo-
nies. If a fertile strain of H. polymorpha such as NCYC 495 has been used, the
generated mutants can easily be analyzed for complementation groups. Mutants
grown on the poor nutrient malt extract undergo a switch of their mating type
which facilitates crossing of different mutants. On the other hand, diploids have to
be removed and cultivated on rich medium immediately after 2 days to prevent
initiation of meiosis and sporulation (Gleeson 1986). Tetrad analysis is possible,
but the dissection is hampered by the small size of the spores and thread-like
structures which link them together. Unfortunately, some laboratory strains, such
as the popular ATCC 34438, are semisterile and have to be backcrossed with a
fertile strain (Gleeson 1986).
6
Chromosomes
Little information is available about the genome of H. polymorpha. A recent study

used contour-clamped homogenous field electrophoresis to separate the chromo-
somes of different strains (Marri et al. 1993). Up to six H. polymorpha chromo-
somes could be separated by this technique. They range from around 650 to
2200 kb with the majority of bands running above 1000 kb. The strains employed
exhibited an extremely high degree of polymorphism of the electrophoretic pat-
tern. This holds true even in a comparison between strain LR9, which is an uracil
auxotrophic mutant, and its parental strain ATCC 34438 (Roggenkamp et al. 1986).
The cause of these changes is presently undetermined. It has been shown, however,
that in Candida albicans similar rearrangements involved recombinations be-
tween the ribosomal DNA (rDNA) genes (Marri et al. 1993).
7
The list of reported genes from H. polymorpha is still short (Table 1). The majority
of sequences encode enzymes that reside in peroxisomes. In 1985 the genes for the
two key enzymes in methanol metabolism were cloned, the methanol oxidase
(MOX) and the dihydroxyacetone synthase (DAS) gene (Ledeboer et al. 1985;
Janowicz et al. 1985). Both genes are highly expressed and tightly regulated. The
DAS mRNA for example amounts to 7% of the polyA+ RNA in methanol-induced
mid-log phase cells, but is undetectable under repressed conditions (Janowicz et al.
1985). Not surprisingly, MOX and DAS share common features in the 5' and 3'
regions, such as TATA box-like sequences around -55, some homologies to highly
expressed eukaryotic genes around the translation start, and regions of dyad
symmetry in the promoter and terminator regions (Janowicz et al. 1985; Ledeboer
et al. 1985). Interestingly, two putative stem-loop structures flank a UAS sequence
inside the MOX promoter that is also present in the coregulated catalase promoter
(Didion and Roggenkamp 1992; Godecke et al. 1994; see below). The similarities to
genes from S. cerevisiae are limited. Many features that are common for promoter
regions in S. cerevisiae (Dobson et al. 1982) are missing. The codon usage re-
sembles more that of E. coli genes and is less biased than in S. cerevisiae (Janowicz
et al. 1985; Ledeboer et al. 1985). Another major enzyme in cells grown in the
presence of methanol, the gene for formate dehydrogenase, has also been cloned
(Hollenberg and Janowicz 1989). Together with the MOX promoter, it is used for
the high-yield expression of heterologous proteins.
The first step in the oxidation of primary amines is catalyzed by a peroxisomal
enzyme, the amine oxidase (AMO). The AMO gene of H. polymorpha has been
cloned by Bruinenberg et al. (1989). The enzyme contains an unusual enzymatic
Table 1. Cloned genes of H. polymorpha
Gene Function ORF Compartment Reference

(amino
acids)
MOX Methanol oxidase 644 Peroxisome Ledeboer et al. (1985)

DAS Dihydroxyacetone 710" Peroxisome Janowicz et al. (1985)
synthase
FMD Formate dehydrogenase 360 Cytoplasm Hollenberg and Janowicz
(1989)
CATl Catalase 507 Peroxisome Didion and Roggenkamp
(1992)
AMO Amine oxidase 692 Peroxisome Bruinenberg et al. (1989)
MAS Malate synthase 555 Peroxisome Bruinenberg et al. (1990)
HSAl Heat-shock protein 645 Cytoplasm Diesel and Roggenkamp
(HSP70) (1994)b
PERl Peroxisomal matrix 650 Peroxisome Waterham et al. (1994)
protein
PERB Peroxisomal membrane 295 Peroxisome Tan et al. (1995)
protein
URA3 Orotidine-5'-phosphate 263 Cytoplasm Merckelbach et al. (1993)
decarboxylase
HLEU2 ~ Isopropylmalate 363 Cytoplasm Agaphonov et al. (1994)
dehydrogenase
-Updated in Hansen et al. (1992).

bUnpublished, submitted to the EMBL/GenBanklDDBJ databases.
redox cofactor, a topa quinone, that is derived from a tyrosine codon at the active
site (Mu et al. 1992). Recently, the H. polymorpha catalase gene (CATl) has been
isolated (Didion and Roggenkamp 1992). It is essential for growth on methanol
and cannot be replaced with a cytoplasmic catalase activity (Hansen and
Roggenkamp 1989; Didion and Roggenkamp 1992).
Two of the PER genes mentioned above have been cloned. PERl encodes a
protein that is located in the peroxisomal matrix and seems to have a role in
protein import into peroxisomes (Waterham et al. 1994). The product of the PERB
gene, called Per8p, is an integral protein of the peroxisomal membrane (Tan et al.
1995). Upon overexpression, the transformed cells show an enhanced increase in
peroxisome numbers, suggesting that Per8p is involved in peroxisome prolifera-
tion (Tan et al. 1995).
The sequences of two genes which allow plasmid selection in H. polymorpha
have been published. They encode the homologues for the URA3 and LEU2 mark-
ers from S. cerevisiae that are currently mainly used. Whereas the H. polymorpha
URA3 functions in S. cerevisiae (Merckelbach et al. 1993), the cloned sequence of
the LEU2 homologue, termed HLEU2, does not complement the mutation in S.
cerevisiae (Agaphonov et al. 1994).
8
Vector Systems
Successful transformation of H. polymorpha was independently reported in 1986

by three groups (Roggenkamp et al. 1986; Tikhomirova et al. 1986; Gleeson et al.
1986). In all protocols, strategies similar to those previously developed for the
transformation of S. cerevisiae have been employed. To allow for the selection of
transformed cells, mutations have been created in genes corresponding to those
which serve as selectable markers of S. cerevisiae. Roggenkamp et al. (1986) have
isolated mutants lacking orotidine-5'-phosphate, named odc1, that can be comple-
mented by the URA3 gene of S. cerevisiae. In the other studies, mutants deficient in
.a-isopropyl malate dehydrogenase and recombinant plasmids containing the
LEU2 gene of S. cerevisiae have been used (Tikhomirova et al. 1986; Gleeson et al.
1986). Different procedures have been developed to introduce the DNA into the
cells, all of which represent modifications of methods described for the transfor-
mation of S. cerevisae. The transformation efficiencies are strain-dependent.
Whereas ATCC 34438 shows only low transformation rates with spheroplasted
cells (Roggenkamp et al. 1986). DL-l is rather amenable to this method
(Tikhomirova et al. 1988), A relatively simple protocol using whole cells (Klebe
et al. 1983; Dohmen et al. 1991) has been employed with modifications by
Roggenkamp et al. (1986). In any case, the transformation rates range form 200
transformants per microgram DNA, with sequences for autonomous replication
(ARS) from S. cerevisiae, up to 3000 with ARS from H. polymorpha or Candida
utilis (Roggenkamp et al. 1986; Tikhomirova et al. 1986). Significantly higher
efficiencies (2 x 104 - 1.7 x 106 ) have recently been achieved with electroporation,
reaching maximum rates with linearized plasmids (Faber et al. 1994).
Sequences that confer autonomous vector replication in H. polymorpha can be
of homologous or heterologous origin. The ARSI element of S. cerevisiae allows
unstable plasmid replication with a loss of 99% of plasmids after growth for ten
generations without marker selection (Roggenkamp et al. 1986), as does the repli-
con-like sequence of the S. cerevisiae LEU2 marker (Berardi and Thomas 1990).
The origin of the 2-f.lm DNA of S. cerevisiae has no replicative function in H.
polymorpha (Roggenkamp et al. 1986). Roggenkamp et al. (1986) have cloned two
ARS (HARSI and HARS2) elements from H. polymorpha fragments which allow
autonomous replication with high copy numbers of 30 to 40 per cell, about 10
times higher than with ARS1. In a similar approach, Tikhomirova et al. (1986) have
isolated H. polymorpha ARS elements from mitochondrial (mt) DNA after they
had shown autonomous replication with mt DNA fragments from Candida utilis.
HARSI has been sequenced (Roggenkamp et al. 1986). It is an AT -rich fragment of
0.5 kb, which shows some general similarity to ARS elements of S. cerevisiae
(Broach et al. 1982; Kearsey 1984), but no ARS consensus. Consequently, it is not
surprising that, like HARS2, it does not function in S. cerevisiae. Using integrative
plasmids, Bogdanova et al. (1995) have captured recently several new HARS ele-
ments from the H. polymorpha genome. After transformation, the plasmids re-
combined spontaneously with different chromosomal regions and aquired an
increased mitotic stability. One of the new elements has been sequenced and shows
a HARSI-like composition including several blocks with similarity to the 5'-
ATAATAATA-3' core sequence described in Roggenkamp et al. (1986).
As is the case with ARS-containing plasmids of S. cerevisiae, all autonomously
replicating vectors segregate poorly in H. polymorpha. Therefore the transforma-
tion is very unstable under nonselective conditions (Roggenkamp et al. 1986;
Thikomirova et al. 1986). However, upon growth over several generations, these
plasmids tend to spontaneously form tandem polymers with up to 100 copies and
extremely high mitotic stability (Roggenkamp et al. 1986), a feature that is particu-
larly useful for high-level expression of foreign proteins (Gellissen et al. 1992).
Most probably, these plasmid multimers are integrated into the genome (Gatzke et
al. 1994). The underlying mechanism is poorly understood, although preliminary
data suggest that plasmid multimerization might occur via extrachomosomal in-
termediates of oligomerized plasmids (Tikhomirova et al. 1986; Gatzke et al. 1994).
Targeted vector integration into the genome of H. polymorpha is sequence-
dependent and difficult to achieve, due to a high percentage of nonhomologous
recombination (Hansen 1990; Faber et al. 1992). However, frequencies of 1-22%
could be reached with the methanol oxidase gene linearized within the homolo-
gous region (Faber et al. 1992).
9
Heterologous Gene Expression
The methanol oxidase (MOX) promoter, which is known as one of the most
powerful promoters in yeast (van Dijken et al. 1976b; van der Klei et al. 1991), is
currently almost exclusively employed to express heterologous genes in
H. polymorpha (Gellissen et al. 1992). Expression from this promoter can be
tightly regulated by changing the carbon source. Whereas glucose and ethanol
shut the promoter off completely (Egli et al. 1980), glycerol is routinely used to
obtain derepression. In contrast, methanol has a strong inducing effect (van
Dijken et al. 1976b; Veenhuis et al. 1983; Guiseppin et al. 1988). The expression
is regulated at the level of transcription (Roggenkamp et al. 1984). Only limited
data are available about the mechanisms of regulation. Wild-type cells do not
allow overexpression of methanol oxidase. Roggenkamp et al. (1989) have
generated mutants which are able to synthesize MOX protein at quantities of about
70% of the total cellular protein. The mutation is undefined, but is most likely at
the level of promoter regulation (Roggenkamp et al. 1989). Only recently, a de-
tailed functional analysis of the MOX promoter region has been performed by
measuring activity of a reporter protein expressed from different promoter dele-
tions and by DNA-binding studies (G6decke et al. 1994). The data suggest a
complex promoter structure with one upstream repression sequence CURS) and
two upstream activation sites (UAS), including one that is also present in the
catalase promoter (Didion and Roggenkamp 1992). A promoter region encom-
passing 1.5kb upstream of the MOX ATG is required for optimal expression of
foreign proteins.
9. Hansenula polymorpha (Pichia angusta) 303
Besides the methanol oxidase, two other genes from H. polymorpha are known
to be induced by methanol to comparably high levels, the dihydroxyacetone
synthase (DAS) and the formate dehydrogenase (FMD). Both genes have been
cloned (Janowicz et al. 1985; Hollenberg and Janowicz 1989), but so far only the
FMD promoter has been used in a systematic way for the expression of heterolo-
gous proteins. Recent results indicate that, using the FMD promoter, expression
levels can be reached which are even higher than those obtained with the MOX
promoter (Gellissen et al. 1992).
10
Peroxisomal Biogenesis
Peroxisomes are almost ubiquitous organelles that exhibit an astounding versatil-

ity with regard to metabolic function and morphology (Tolbert 1981). Yeasts are
ideal model organisms to study peroxisomes, because proliferation and enzymatic
composition of these organelles are dependent on the growth medium provided
and can thus easily be manipulatec. In this way, yeasts are able to metabolize
substrates that can range from reduced Ct-compounds such as methanol, to long-
chained fatty acids, n-alkanes, and alkylated amines (Veenhuis and Harder 1987).
Before the discovery that peroxisome proliferation can be induced in S. cerevisiae
by growth on oleate (Veenhuis et al. 1987; Kunau et al. 1987), methylotrophic
yeasts were the only organisms of choice for peroxisomal studies. Especially in H.
polymorpha, peroxisomes, just like the key methanol-metabolizing enzymes, can
be induced to impressive levels. For example, in methanol-limited chemostat
cultures they can occupy up to 80% of the cytoplasmic volume (Veenhuis et al.
1978; Roggenkamp et al. 1984).
Peroxisomes are surrounded by a single membrane, generally 0.5 to 1.5)lm
in diameter. For many years, it was suggested that they form by budding from
the endoplasmic reticulum (Tolbert 1981). More recently, however, biochemical
and molecular studies revealed that peroxisomes develop from preexisting or-
ganelles (Lazarow and Fujiki 1985). In H. polymorpha under repressing conditions,
that is if the cells are grown in the presence of glucose or ethanol, only one very
small peroxisome is present (Veenhuis et al. 1979). If the cells are shifted to
conditions which require peroxisomal enzymes, for example methanol, the or-
ganelle increases in size and subsequently new, small peroxisomes are formed by
division (Veenhuis et al. 1978). Interestingly, Waterham et al. (1993) could isolate
temperature-sensitive mutants of H. polymorpha, which completely lacked peroxi-
somes at the restrictive temperature. After a shift to the permissive temperature,
peroxisomes were formed. Apparently they did not incorporate matrix or
membrane proteins that were present in the cytosol. This raises the question
whether H. polymorpha might be able to form peroxisomes by a process other than
fission.
Peroxisomes have an important function in segregating the highly reactive
hydrogen peroxide from the cytosol. It has been demonstrated that a peroxisomal,
but not a cytoplasmic catalase can complement the inability of a catalase-negative
H. polymorpha mutant to grow on methanol (Hansen and Roggenkamp 1989).

This is in line with the finding that most of the catalase is located in a narrow zone
on the inner side of the peroxisomal membrane, likely to prevent leaking of HP2
into the cytosol (Keizer et al. 1992).
Peroxisomes do not contain nucleic acids and ribosomes. All peroxisomal pro-
teins are encoded in nuclear DNA. The proteins are synthesized on free ribosomes
inside the cytoplasm and imported into peroxisomes posttranslationally (Borst
1989). Veenhuis et al. (1989) have shown that not all peroxisomes incorporate
newly synthesized matrix proteins, but only those which are small and capable of
fission.
The import of peroxisomal proteins is a process which, in comparison to other
organelles, has only recently begun to be elucidated. The main reason for this is
that almost without exception these proteins do not undergo proteolytic process-
ing, which made the identification of a targeting signal a difficult task (Borst 1989).
In vitro studies have indicated that the import process requires ATP but no mem-
brane potential (Imanaka et al. 1987). The first peroxisomal targeting signal (PTS)
has been identified on the firefly luciferase by expression in mammalian cells
(Gould et al. 1989) and by import into peroxisomes in vitro (Myazawa et al. 1989).
It consists of a carboxyl terminal tripeptide with the sequence Ser-Lys-Leu-COOH
that is both necessary and sufficient to route cytosolic marker proteins into peroxi-
somes. The targeting function of this motif has been demonstrated to be highly
conserved in evolution (Gi:idecke et al. 1989; Hansen and Roggenkamp 1989;
Hansen et al. 1992; Gould et al. 1990). Recently, the topogenic signals of the key
enzymes in methanol metabolism of H. polymorpha, dihydroxyacetone synthase,
methanol oxidase, and catalase have been characterized (Hansen 1990; Hansen et
al. 1992; Didion and Roggenkamp 1992). They all reside at the extreme C-terminus
and exhibit certain similarities to the luciferase signal (DAS: Asn-Lys-Leu, MOX:
Ala-Arg-Phe, catalase: Ser-Lys-lle). There results and mutagenesis studies on the
firefly PTS (Gould et al. 1989) have shown that a functional signal can be degener-
ated to a certain extent, but that there should always be a basic amino acid at the
second position and a hydrophobic residue at the third (Roggenkamp 1992). Not
all proteins, however, have a carboxyl terminal signal. For example, the rat 3-
ketoacyl-CoA thiolase is synthesized as a larger precursor with an amino-terminal
pre-piece, that is cleaved upon translocation into peroxisomes (Swinkels et al.
1991). The pre-piece contains a targeting signal different from the luciferase con-
sensus, but similar to sequences at the N-termini of the watermelon glyoxysomal
malate dehydrogenase and the amine oxidase of H. polymorpha (Faber et al. 1993;
van der Klei et al. 1993). The signal of the malate dehydrogenase is functional in H.
polymorpha, but processing of the precursor does not occur (van der Klei et al.
1993). So far, proteolytic processing has been observed only in higher eukaryotes.
The amine oxidase of H. plymorpha does not contain a cleavable pre-piece (Faber
et al. 1993). Recently, a consensus sequence (Ser-Leu/lle-Xs-His-Leu) for the
amino-terminal to po genic signal has been determined by import studies in H.
polymorpha (Gietl et al. 1994). The import pathway for proteins containing an N-
terminal PTS is independent from the targeting machinery for proteins with C-
terminal signals, and both appear to be inducible by specific growth substrates
9. Hansenula polymorpha (Pichia angusfa) 305
(McCollum et al. 1993; Faber et al. 1994). Interestingly, AMO is not routed into
peroxisomes when expressed in the closely related S. cerevisiae, which shows that
the amino-terminal targeting sequence is not universal (de Hoop et al. 1992).
11
Applied Aspects
Since Ogata et al. reported the first methylotrophic yeast in 1969, these yeasts have
been the focus of constant attention from the biotechnological industry, albeit over
the years for different reasons. The initial interest in using methylotrophic yeasts
for the production of "single-cell protein" has decreased considerably, in part
caused by low protein prizes and higher costs for methanol (Berry et al. 1987).
Several processes have been described using H. polymorpha to produce metabo-
lites, involving amino acids, nucleotide coenzymes, methylketones, dihydroxyac-
etone, and glycerol (for review: Harder and Brooke 1990). In recent years, however,
with the cloning of the strong promoters of the methanol-metabolizing enzymes
and the development of a transformation system, H. polymorpha has become,
together with Pichia pastoris, a major focus for the high-yield expression of foreign
proteins. H. polymorpha offers several advantages over other expression systems.
H. polymorpha requires short fermentation times, and high levels of expression
can already be obtained in glycerol when using the appropriate promoters. It
is a Crabtree-negative yeast, yielding thus very high cell densities (>100 g dry
weight per liter), the media used are comparably cheap, and since the amount
of secreted proteins is low, it is possible to achieve purities of more than 90%
heterologous protein in the medium with little proteolysis (Gellis sen et al. 1992).
Another advantage is the formation of integrants in extremely high copy
number that are mitotically stable (Roggenkamp et al. 1986; Tikhomirova et al.
1986). Unlike S. cerevisiae, H. polymorpha rarely hyperglycosylates (Gellissen et al.
1992).
Highest productivities have been obtained in experiments which used fed-batch
fermentation or continuous cultures, expression from the methanol oxidase or the
formate dehydrogenase promoter, and multiple plasmid integration (Janowicz et
al. 1991; Gellisen et al. 1992; Giuseppin et al. 1988). Janowicz et al. (1991) have
produced Sand L surface antigens of the hepatitis B virus intracellular to up to 2-
8% of the total soluble cell protein. Expressed simultaneously in the same
transformants, Land S antigens still constituted about 0.6 and 3.0% of cellular
protein, respectively. The antigens sponstaneously assembled into particles that
are suitable for vaccine development. Expression levels of around 1.5 gil medium
have been reported for hirudin, when the S. cerevisiae alpha factor (MFa1) leader
sequence was used for protein secretion, and the Schwanniomyces occidentalis
glucoamylase (Gellissen et al. 1991). In continuous culture, productivities of
5.5mglg biomass x 1 x h have been reached, expressing the Cyamopsis
tetragonoloba (guar) a-galactosidase fused to the MFal leader (Giuseppin et al.
1988). Altogether, the protein yields of H. polymorpha are among the highest
reported for yeast systems, and the productivity seems to be even better than what
has been shown for Pichia sp. (Giuseppin et al. 1993).
12
Concluding Remarks
Within this chapter we have described briefly the system H. polymorpha with
emphasis on the genetic and the molecular-biological aspects. We have tried to put
it into a context with some of the major contributions to research and biotechnol-
ogy made by this yeast in recent years, to point out the areas where H. polymorpha
has particular advantages over other yeast systems. An increasing amount of
available mutants, together with constantly improving tools for genetic manipula-
tion, is expected to facilitate the difficult studies of peroxisomal biogenesis in the
future. Powerful vector systems already make it possible to produce heterologous
proteins at highest levels. During its relatively short scientific career, H.
polymorpha has become an extremely valuable supplement to S. cerevisiae.
References
Agaphonov MO, Poznyakovski AI, Bogdanova AI, Ter-Avanesyan MD (1994) Isolation and
characterization of the LEU2 gene of Hansenula polymorpha. Yeast 10: 509-513
Berardi E, Thomas DY (1990) An efficient transformation method for Hansenula
Berry DR, Russel I, Stewart GG (1987) Yeast biotechnology. Allen and Unwin, London
Bogdanova AI, Agaphonov MO, Ter-Avanesyan MD (1995) Plasmid reorganization during
integrative transformation in Hansenula polymorpha. Yeast 11: 343-353
Borst P (1989) Peroxisome biogenesis revisited. Biochim Biophys Acta 1008: 1-13
Broach JR, Li YY, Feldmann J, Jayaram M, Abraham J, Nasmyth KA, Hicks JB (1982)
Localizaton and sequence analysis of yeast origins of replication. Cold Spring Harbor
Symp Quant Bioi 47: 1165-1173
Bruinenberg PG, Evers M, Waterham HR, Kuipers J, Arnberg AC, AB G (1989) Cloning and
sequencing of the peroxisomal amine oxidase gene from Hansenula polymorpha.
Biochim Biophys Acta 1008: 157-167
Bruinenberg PG, Blaauw M, Kazemier B, AB G (1990) Cloning and sequencing of the malate
synthase gene from Hansenula polymorpha. Yeast 6: 245-254
Bystrykh LV, Sokolov AP, Trotsenko YA {1981} Purification and properties of dibydroxyac-
etone synthase from the methylotrophic yeast Candida boidinii. FEBS Lett 132: 324-
328
Cregg JM, van der Klei IJ, Suiter GJ, Veenhuis M, Harder W (1990) Peroxisome-deficient
mutants of Hansenula polymorpha. Yeast 6: 87-97
de Hoop MJ, Valkema R, Kienhuis CBM, Ab G (1992) The peroxisomal import signal of
amine oxidase from the yeast Hansenula polymorpha is not universal. Yeast 8: 243-
252
de Koning W, Gleeson MA, Harder W, Dijkhuizen L (1987) Regulation of methanol metabo-
lism in the yeast Hansenula polymorpha. Isolation and characterization of mutants
blocked in methanol assimilatory enzymes. Arch Microbiol17: 375-382
Didion T, Roggenkamp R (1992) Targeting signal of the peroxisomal catalase in the
methylotrophic yeast Hansenula polymorpha. FEBS Lett 303: 113-116
Dobson MJ, Tuite MF, Roberts NA, Kingsman AJ, Kingsman SM, Perkins RE, Conroy SC,
Fothergill LA (1982) Conservation of high efficiency promoter sequences in Saccharomy-
ces cerevisiae. Nucleic Acids Res 10: 2625-2637
7: 691-692
Douma AC, Veenhuis M, de Koning W, Evers M, Harder W (1985) Dihydroxyacetone

synthase is localized in the peroxisomal matrix of methanol-grown Hansenula
polymorpha. Arch Microbiol143: 237-243
Eggeling L, Sahm H (1980) Direct enzymatic assay for alcohol oxidase, alcohol dehydroge-
nase and formaldehyde dehydrogenase in colonies of Hansenula polymorpha. Appl
Environ Microbiol42: 268-275
Eggeling L, Sahm H (1981) Regulation of alcohol oxidase synthesis in Hansenula
polymorpha: oversynthesis during growth on mixed substrates and induction by metha-
nol. Arch Microbiol 127: 119-124
Egli H, van Dijken JP, Veenhuis M, Harder W, Fiechter A (1980) Methanol metabolism
in yeasts: regulation of the synthesis of catabolic enzymes. Arch Microbiol 124: 115-
121
Egli H, Kaeppeli 0, Fiechter A (1982) Regulatory flexibility of methylotrophic yeasts in
chemostat cultures; simultaneous assimilation of glucose and methanol at fixed dilution
rates. Arch Microbiol131: 1-7
Faber KN, SwaYing GJ, Faber F, AB G, Harder W, Veenhuis M, Haima P (1992) Chromo-
somal targeting of replicating plasrnids in the yeast Hansenula polymorpha. J Gen
Microbiol 138: 2405-2416
Faber KN, Haima P, de Hoop MJ, Harder W, Veenhuis M, AB G (1993) Peroxisomal amine
oxidase of Hansenula polymorpha does not require its SRL-containing C-terminal se-
quence for the targeting. Yeast 9: 331-338
Faber KN, Haima P, Harder W, Veenhuis M, AB G (1994a) Highly-efficient
electrotransformation of the yeast Hansenula polymorpha. Curr Genet 25: 305-310
Faber KN, Haima P, Gietl C, Harder W, AB G, Veenhuis M (1994b) The methylotrophic yeast
Hansenula polymorpha contains an inducible import pathway for peroxisomal matrix
proteins with an N-terminal targeting signal (PTS2 proteins). Proc Natl Acad Sci USA 91:
12985-12989
Fellinger AJ, VerbakelJMA, Veale RA, SudberryPE, Born II, Overbeke N, Verrips CT (1991)
Expression of a-galactosidase from Cyamposis tetragonobia (guar) by Hansenula
polymorpha. Yeast 7: 463-474
Fujii T, Tonomura K (1975) Purification and properties of catalase from a methanol-
utilizing yeast, Candida sp. N-16. Agric BioI Chern 39: 2325-2330
Gatzke R, Weydemann U, Janowicz ZA, Hollenberg CP (1995) Stable multiple integration of
vector sequences in Hansenula polymorpha (in press)
Gellissen G, Janowicz ZA, Merckelbach A, Piontek M, Keup P, Weydemann U, Hollenberg
CP, Strasser AWM (1991) Heterologous gene expression in Hansenula polymorpha:
efficient secretion of glucoamylase. Bio/Technology 9: 291-295
Gellissen G, Weydemann U, Strasser AWM, PiontekM, Janowicz ZA, Hollenberg CP (1992)
Progress in developing methylotrophic yeasts as expression systems. Trends Biotechnol
10: 413-417
Gellissen G, Hollenberg CP, Janowicz ZA (1994) Gene expression in methylotrophic yeasts.
In: Smith A (ed) Gene expression in recombinant micoroorganisms. Marcel Dekker,
New York, pp 195-239
Gietl C, Faber KN, van der Klei IJ, Veenhuis M (1994) Mutational analysis of the N-terminal
topogenic signal of watermelon glyoxysomal malate dehydrogenase using the heterolo-
gous host Hansenula polymorpha. Proc Natl Acad Sci USA 91: 3151-3155
Giuseppin MLF, van Eijk HML, Bes BCM (1988) Molecular regulation of alcohol oxidase in
Hansenula polymorpha in continuous cultures. Biotechnol Bioeng 32: 577-583
Gleeson MA (1986) The genetic analysis of the methylotrophic yeast Hansenula
polymorpha. PhD Thesis, University of Sheffield, Sheffield
Gleeson MA, Sudbery PE (1988) Genetic analysis in the methylotrophic yeast Hansenula
polymorpha. Yeast 4: 293-303
Gleeson MA, Ortori GS, Sudbery PE (1986) Transformation of the methylotrophic yeast
Hansenula polymorpha. J Gen Microbiol 132: 3459-3465
Godecke A, Veenhuis M, Roggenkamp R, Janowicz ZA, Hollenberg CP (1989) Biosynthesis

of the peroxisomal dihydroxyacetone synthase form Hansenula polymorpha in Saccha-
romyces cerevisiae induces growth but not proliferation of peroxisomes. Curr Genet 16:
13-20
Godecke S, Eckart M, Janowicz ZA, Hollenberg CP (1994) Identification of sequences re-
sponsible for transcriptional regulation of the strongly expressed methanol oxidase-
encoding gene in Hansenula polymorpha. Gene 139: 35-42
Goodman J (1985) Dihydroxyacetone synthase is an abundant constituent of the methanol-
induced peroxisome of Candida boidinii. J BioI Chern 260: 7l08-7114
Gould SJ, Keller G-A, Hosken N, Wilkinson J, Subramani S (1989) A conserved tripeptide
sorts proteins to peroxisomes. J Cell BioI 108: 1657-1664
Gould SJ, Keller G-A, Schneider M, Howell SH, Garrard LJ, Goodman JM, Distel B, Tabak H,
Subramani S (1990) Peroxisomal import is conserved between yeast, plants, insects and
mammals. EMBO J 9: 85-90
Hansen H (1990) Struktur und Funktion von peroxisomalen Importsignalen in der
methylotrophen Hefe Hansenula polymorpha. PhD Thesis, Heinrich-Heine-Universitat
Dusseldorf, Dusseldorf
Hansen H, Roggenkamp R (1989) Functional complementation of catalase-defective peroxi-
somes in a methylotrophic yeast by import of the catalase A from Saccharomyces
cerevisiae. Eur J Biochem 184: 173-179
Hansen H, Didion T, Thiemann A, Veenhuis M, Roggenkamp R (1992) Targeting sequences
of the two major peroxisomal proteins in the methylotrophic yeast Hansenula
polymorpha. Mol Gen Genet 235: 269-278
HarderW, Brooke AG (1990) Methylotrophic yeasts. In: Verachtert H, de Mot R (eds) Yeast
biotechnology and biocatalysis. Marcel Dekker, New York, pp 395-428
Hollenberg CP, Janowicz ZA (1989) DNA molecules coding for FMDH control region and
structured gene for a protein having FMDH-activity and their uses. European Patent, EP
0299108-Al
Imanaka T, Small GM, Lazarow PB (1987) Translocation of acyl-CoA-oxidase into peroxi-
somes requires ATP hydrolysis but not a membrane potential. J Cell BioI 105: 2915-
2922
Janowicz Z, Eckart M, Drewke C, Roggenkamp R, Hollenberg CP, Maat J, Ledeboer AM,
Visser C, Verrips CT (1985) Cloning and characterization of the DAS gene encoding the
major methanol assimilatory enzyme from the methylotrophic yeast Hansenula
polymorpha. Nucleic Acids Res 13: 3043-3062
Janowicz ZA, Melber K, Merckelbach A, Jacobs E, Harford N, Comberbach M, Hollenberg
CP (1991) Simultaneous expression of the Sand L surface antigen of hepatitis B, and
formation of mixed particles in the methylotrophic yeast Hansenula polymorpha. Yeast
7:431-443
Jones JG, Bellion E (1991) Methanol oxidation and assimilation in Hansenula polymorpha.
Biochem J 280: 475-481
Kato N, Omori Y, Tani Y, Ogata K (1976) Alcohol oxidase of Kloeckera sp. and Hansenula
polymorpha. Catalytic properties and subunit structures. Eur J Biochem 64: 341-350
Kato N, Higuchi T, Sakazawa C, Nishizawa T, Tani Y, Yamada H (1982) Purification and
properties of a transketolase responsible for formaldehyde fixation in a methanol-utiliz-
ing yeast, Candida boidinii (Kloeckera sp.) No 2201. Biochim Biophys Acta 7l5: 143-150
Kearsey S (1994) Structural requirements for the function of a yeast chromosomal
replicator. Cell 37: 299-307
Keizer I, Roggenkamp R, Harder W, Veenhuis M (1992) Location of catalase in crystalline
peroxisomes of methanol-grown Hansenula polymorpha. FEMS Mirobiol Lett 7l: 7-11
Klebe RJ, Harriss JV, Sharp ZD, Douglas MG (1983) A general method for polyethylene-
glycol-induced genetic transformation of bacteria and yeast. Gene 25: 333-341
Kunau WH, Kionka C, Ledebur A, Mateblowski M, Morena de la Garza M, Schultz-Borchard
U, Thieringer R, Veenhuis M (1987) ,a-Oxidation systems in eukaryotic microorganisms.
In: Fahimi HD, Sies H (eds) Peroxisomes in biology and medicine. Springer, Berlin
Heidelberg New York, pp 128-140
Kurtzman CP (1984) Synonomy of the yeast genera Hansenula and Pichia demonstrated
through comparisons of deoxyribonucleic acid relatedness. Antonie Leeuwenhoek
Lazarow PB, Fujiki Y (1985) Biogenesis of peroxisomes. Annu Rev Cell BioI 1: 489-530
Ledeboer AM, Edens L, Maat J, Visser C, Bos JW, Verrips CT, Janowicz Z, Eckart M,
Roggenkamp R, Hollenberg CP (1985) Molecular cloning and characterization of a gene
coding for methanol oxidase in Hansenula polymorpha. Nucleic Acids Res 13: 3063-3082
Lee J-D, Komagata K (1980) Taxonomic study of methanol-assimilating yeasts. J Gen Appl
Levine DW, Cooney CL (1973) Isolation and characterization of thermotolerant methanol-
utilizing yeasts. Appl Microbiol 26: 982-990
Lodder J (1970) The yeasts, a taxonomic study. North-Holland Publishing, Amsterdam
Marri L, Rossolini GM, Satta G (1993) Chromosome polymorphisms among strains of
Hansenula polymarpha (syn. Pichia angusta). Appl Environ Microbiol 59: 939-941
McCollum D, Monosov E, Subramani S (1993) The pas8 mutant of Pichia pastoris exhibits
the peroxisomal protein import deficiencies of Zellweger syndrome cells - the PAS8
protein binds to the COOH-terminal tripeptide peroxisomal targeting signal, and is a
member of the TPR protein family. J Cell BioI 121: 761-774
Merckelbach A, Godecke S, Janowicz ZA, Hollenberg CP (1993) Cloning and sequencing of
the URA3 locus of the methylotrophic yeast Hansenula polymorpha and its use for
the generation of a deletion by gene replacement. Appl Microbiol Biotechnol40: 361-
364
Mu D, Janes SM, Smith AJ, Brown DE, Dooley DM, Klinman JP (1992) Tyrosine codon
corresponds to top a quinone at the active site of copper amine oxidase. J BioI Chern 267:
7979-7982
Myazawa S, Osumi T, Hashimoto T, Ohno K, Miura S, Fujiki Y (1989) Peroxisome targeting
signal of rat liver acyl-coenzyme A oxidase resides at the carboxy terminus. Mol Cell BioI
9:83-91
Ogata K, Nishikawa H, Ohsugi M (1969) A yeast capable of utilizing methanol. Agric BioI
Chern 33: 1519-1520
Roggenkamp R (1992) Targeting signals for protein import into peroxisomes. Cell Biochem
Funct 10: 193-199
Roggenkamp R, Sahm H, Wagner F (1974) Microbial assimilation of methanol. Induction
and function of catalase in Candida boidinii. FEBS Lett 41: 283-286
Roggenkamp R, Sahm H, Hinkelmann W, Wagner F (1975) Alcohol oxidase and catalase in
peroxisomes of methanol-grown Candida boidinii. Eur J Biochem 59: 231-236
Roggenkamp R, Janowicz Z, Stanikowski B, Hollenberg CP (1984) Biosynthesis and regula-
tion of the peroxisomal methanol oxidase from the methylotrophic yeast Hansenula
polymorpha. Mol Gen Genet 194: 489-493
Roggenkamp R, Hansen H, Eckart M, Janowicz Z, Hollenberg CP (1986) Transformation of
the methylotrophic yeast Hansenula polymorpha by autonomous replication and inte-
gration vectors. Mol Gen Genet 202: 302-308
Roggenkamp R, Didion T, Kowallik KV (1989) Formation of irregular giant peroxisomes by
overproduction of the crystalloid core protein methanol oxidase in the methylotrophic
yeast Hansenula polymorpha. Mol Cell BioI 9: 988-994
Sahm H, Wagner F (1973a) Microbial assimilation of methanol. The ethanol- and methanol-
oxidizing enzymes of Candida boidinii. Eur J Biochem 36: 250-256
Sahm H, Wagner F (1973b) Microbial assimilation of methanol. Properties offormaldehyde
dehydrogenase and formate dehydrogenase from Candida boidinii. Arch Microbiol 90:
263-268
Sanchez S, Demain AL (1977) Enrichment of auxotrophic mutants of Hansenula
polymorpha. Eur J Appl Microbiol4: 45-49
SchUtte H, Flossdorf J, Sahm H, Kula MR (1976) Purification and properties of formalde-

hyde dehydrogenase and formate dehydrogenase from Candida boidinii. Eur J Biochem
62: 151-160
Sibirny AA, Titorenko VI, Gonchar MV, Ubiyvovk VM, Ksheminskaya GP, Vitvitskaya
OP (1988) Genetic control of methanol utilization in yeasts. J Basic Microbiol28: 293-
319
Sibirny AA, Ubiyvovk VM, Gonchar MV, Titorenko VI, Voronovsky AY, Kapultsevich JG,
Bliznik KM (1990) Reactions of direct formaldehyde oxidation to CO 2 are non-essential
for energy supply of yeast methylotrophic growth. Arch Microbiol154: 566-575
Sudbery PE, Gleeson MAG (1989) Genetic manipulation of methylotrophic yeasts. In:
Walton EF, Yarranton GT (eds) Molecular and cell biology of yeasts. Blackie, London, pp
304-329
Suiter GJ, Vrieling EG, Harder W, Veenhuis M (1993a) Synthesis and subcellular location of
peroxisomal membrane proteins in a peroxisome-deficient mutant of the yeast
Hansenula polymorpha. EMBO J 12: 2205-2210
SuIter GJ, Waterham HR, Vrieling EG, Goodman JM, Harder W, Veenhuis M (1993b)
Expression and targeting of a 47kDa integral peroxisomal membrane protein of Can-
dida boidinii in wild-type and a peroxisome-deficient mutant of Hansenula polymorpha.
FEBS Lett 315: 211-216
Swinkels BW, Gould SJ, Bodnar AG, Rachubinski RA, Subramani S (1991) A novel, cleavable
peroxisomal targeting signal at the amino-terminus of the rat 3-ketoacyl-CoA thiolase.
EMBO J 10: 3255-3262
Tan X, Waterham HR, Veenhuis M, CreggJM (1995) The Hansenula polymorpha PER8 gene
encodes a novel peroxisomal integral membrane protein involved in proliferation. J Cell
Bioi 128: 307-319
Teunisson DJ, Hall HH, Wickerham LJ (1960) Hansenula angusta, an excellent species for
the demonstration of the coexistence of haploid and diploid cells in homothallic yeast.
Mycologia 52: 184-188
Tikhomirova LP, Ikonomova RN, Kuznetsova EN (1986) Evidence for autonomous replica-
tion and stabilization of recombinant plasmids in the transformants of yeast Hansenula
Tikhomirova LP, Ikonomova RN, Kuznetsova EN, Fodor II, Bystrykh LV, Aminova LR,
Trotsenko YA (1988) Transformation of methylotrophic yeast Hansenula polymorpha:
Cloning and expression of genes. J Basic Microbiol28: 353-351
Titorenko VI, Waterham HR, Haima P, Harder W, Veenhuis M (1993a) Peroxisome biogen-
esis in Hansenula polymorpha: different mutations in genes, essential for peroxisome
biogenesis, cause different peroxisomal mutant phenotypes. FEMS Microbiol Lett 74:
143-148
Titorenko VI, Waterham HR, Cregg JM, Harder W, Veenhuis M (1993b) Peroxisome bio-
genesis in the yeast Hansenula polymorpha is controlled by a complex set of interacting
gene products. Proc Natl Acad Sci USA 90: 7470-7474
Tolbert NE (1981) Metabolic pathways in peroxisomes and glyoxysomes. Annu Rev
Biochem 50: 133-157
Tolstorukov II, Benevolenskii SV (1978) Study of the mechnism of mating and self-
diploidization in haploid yeasts of Pichia pinus. Communication 1. Bipolarity of mating.
Genetika 14: 519-526
Tolstorukov II, Benevolenskii SV (1980) Study of the mechanism of mating and self-
diploidization in haploid yeasts of Pichia pinus. Communication II. Mutations in the
mating type-locus. Genetika 16: 1335-1342
Uotila L, Koivusalo M (1974) Formaldehyde dehydrogenase from human liver. Purification,
properties and evidence for the formation of glutathione thioesters by the enzyme. J BioI
Chern 249: 7653-7663
van der Klei lJ, Harder W, Veenhuis M (1991) Biosynthesis and assembly of alcohol oxidase,
a peroxisomal matrix protein in methylotrophic yeasts: a review. Yeast 7: 195-209
van der Klei IJ, Faber KN, Keizer-Gunnink I; Gietl C, Harder W, Veenhuis M (1993) Water-
melon glyoxysomal malate dehydrogenase is sorted to peroxisomes of the
methylotrophic yeast Hansenula polymorpha. FEBS Lett 334: 128-132
van Dijken JP (1976) Oxidation of methanol by yeasts. PhD Thesis, University of Groningen,
Groningen
van Dijken JP, Bos P (1981) Utilization of amines by yeasts. Arch Microbiol128: 320-324
van Dijken JP, Oostra-Demkes GJ, Otto R, Harder W (1976a) S-Formylglutathione: the
substrate for formate dehydrogenase in methanol utilizing yeasts. Arch Microbiolll1:
77-83
van Dijken JP, Otto R, Harder W (1976b) Growth of Hansenula polymorpha in a methanol-
limited chemostat. Physiological responses due to the involvement of methanol oxidase
as a key enzyme in methanol metabolism. Arch Microbiol111: 137-144
van Dijken JP, Harder W, Beardsmore AJ, Quale RR (1978) Dihydroxyacetone: an interme-
diate in the assimilation of methanol by yeasts? FEMS Microbiol Lett 4: 97-102
Veale RA, Giuseppin LF, van Eijk HMJ, Sudbery PE, Verrips CT (1992) Development of a
strain of Hansenula polymorpha for the efficient expression of guar a-galactosidase.
Yeast 8: 361-372
Veenhuis M, Harder W. (1987) Metabolic significance and biogenesis of microbodies in
yeasts. In: Fahimi HD, Sies H (eds) Peroxisomes in biology and medicine. Springer,
Berlin Heidelberg New York, pp 436-457
Veenhuis M, van Dijken JP, Pilon SAF, Harder W (1978) Development of crystalline peroxi-
somes in methanol-grown cells of the yeast Hansenula polymorpha and its relation to
environmental conditions. Arch Microbiol117: 153-163
Veenhuis M, Keizer I, Harder W (1979) Characterization of peroxisomes in glucose-grown
Hansenula polymorpha and their development after transfer of cells into methanol-
containing media. Arch Microbiol120: 167-175
metabolism of one-carbon compounds in yeast. Adv Microbiol Physiol24: 1-82
Veenhuis M, Mateblowski M, Kunau WH, Harder W (1987) Proliferation of microbodies in
Saccharomyces cerevisiae. Yeast 3: 77-85
Veenhuis M, Suiter G, van der Klei I, Harder W (1989) Evidence for functional heterogeneity
among microbodies in yeasts. Arch Microbiol151: 105-110
Verduyn C, Postman E, Scheffers WA, van Dijken JP (1992) Effect of benzoic acid on
metabolic fluxes in yeasts: a continuous-culture study on the regulation of respiration
and alcoholic fermentation. Yeast 8: 501-517
Vonck J, van Bruggen EFJ (1990) Electron microscopy and image analysis of two-dimen-
sional crystals and single molecules of alcohol oxidase from Hansenula polymorpha.
Biochim Biophys Acta 1038: 74-79
Waites MJ, Quayle JR (1981) The interrelationship between transketolase and dihydroxyac-
etone synthase activities in the methylotrophic yeast Hansenula polymorpha. J Gen
Waterham HR, Titorenko VI, Swaving GJ, HarderW, Veenhuis M (1993) Peroxisomes in the
methylotrophic yeast Hansenula polymorpha do not necessarily derive from pre-existing
organelles. EMBO J 12: 4785-4794
Waterham HR, Titorenko VI, Haima P, Cregg JM, Harder W, Veenhuis M (1994) The
Hansenula polymorpha PERI gene is essential for peroxisome biogenesis and encodes a
peroxisomal matrix protein with both carboxy- and amino-terminal targeting signals.
J Cell Biol127: 737-749
Wickerham LJ (1970) Hansenula H. et P. Sydow. In: Lodder J (ed) The yeasts. North-
Holland Publishing, Amsterdam, pp 226-315
CHAPTER 10
Yarrowia lipolytica
Gerold Barth! and Claude Gaillardin2
1
History of Yarrowia lipolytica Research
Interest in Candida lipolytica (Harrison) Diddens et Lodder 1942 initially arose

from its rather uncommon physiological characteristics. Strains of this species
were more often isolated from lipid- or protein-containing substrates like cheese
or sausage than from sugar-containing substrates. Indeed, strains of Candida
lipolytica used few sugars (mainly glucose) as carbon source, but did readily
assimilate various polyakohols, organic acids, or normal paraffins. They were
noted in the late 1940s by dairy technologists (Peters and Nelson 1948a,b) for their
high extracellular protease and lipase activities, although these purified enzymes
were never put to work industrially.
With the emergence of single-cell protein projects in the mid 1960s, a strong
industrial interest stemmed from the fact that strains of this species were able to
use n-paraffins which were cheap and abundant at that time, as sole carbon source.
It was also observed that C. lipolytica was able to produce high amounts of organic
acids (2-ketoglutaric acid and citric acid) when grown on these substrates
(Tsugawa et al. 1969). Large-scale industrial production of citric acid or SCP using
Y. lipolytica thus permitted the accumulation of extensive data on its behavior in
very large fermentors.
The species was classified as a Candida at that time, since no sexual state had
been described. The perfect form of C. lipolytica was identified in the late 1960s by
Wickerham at the Northern Regional Research Laboratory of the USDA at Peoria.
A culture isolated in 1945 from a jar of fiber tailings in a corn processing plant was
found to form asci attached to hyphal elements when put on suitable media. One
to four spores of various size and shape could be isolated from these asci, but spore
viability was found to be very low. Two mating types, called A and B, were identi-
fied among the progeny. Nearly all other wild-type isolates from the species would
mate to one of these two types, albeit at very low frequency, suggesting that most
lInstitut fur Mikrobiologie, Technische Universitat Dresden, Mommsenstr. 13, 01062

Dresden, Germany
2 Laboratoire de Genetique Moleculaire et Cellulaire, Institut National de la Recherche
Agronomiques - Centre National de la Recherche Scientifique, Institut National

Agronomique Paris-Grignon, 78850 Thiverval-Grignon, France
314 G. Barth and C. Gaillardin
natural isolates are haploid (or near haploid). The perfect form was reclassified
first as Endomycopsis lipolytica (Wickerham et al. 1970), then as Saccharomycopsis
lipolytica (Yarrow 1972), and finally as Yarrowia lipolytica (van der Walt and von
Arx 1980). Further details on its taxonomic position will be discussed below.
Wickerham's strains were sent both to Mortimer's laboratory in Berkeley and to
Heslot's group in Paris, which independently started genetic studies on this spe-
cies. Initial studies were plagued by low mating frequencies, poor sporulation
ability, and low ascospore viability. These defects could be partially alleviated by
inbreeding programs, but no perfect set of strains could be obtained: mating
frequencies remained low, and spore viability plateaued at around 80% (Gaillardin
et al. 1973; Ogrydziak et al. 1978). Protoplast fusion was attempted to overcome
some of these difficulties (Esser and Stahl 1976; Weber et al. 1980). Later groups
joining the Y. lipolytica club initiated new and independent inbreeding programs,
starting with different strains, in Poland (Bojnanska 1977), East Germany
(Kurischko et al. 1983; Barth and Weber 1985), and in private companies (British
Petroleum or Pfizer USA). As a result, several inbred lines of Y. lipolytica exist
nowadays, and linkage groups were defined by tetrad dissection or chromosome
loss in several of these lines (Ogrydziak et al. 1978, 1982; Kurischko 1984, 1986; De
Zeeuw, pers. comm.). It is still unclear today how conserved these linkage groups
are across the different lines, which probably differ grossly at the level of chromo-
some structure (see below); clearly, the different lines are poorly interfertile; ge-
netic exchange between them is difficult and commonly requires several rounds of
backcrosses before acceptable behavior is restored.
Happily, however, these various groups entered Y. lipolytica genetics for differ-
ent reasons and focused on specific aspects of its biology: Krebs cycle (Akiyama et
al. 1973a,b; Finogenova et al. 1982; Barth 1985), lysine metabolism (Gaillardin et al.
1975), secretion of extracellular enzymes (Ogrydziak and Mortimer 1977), alkane
degradation (Bassel and Mortimer 1982), mating and parasexual processes (Weber
1979; Barth and Weber 1984; Kurischko 1986), mitochondrial genetics (Matsuoka
et al. 1982), virus-like particle (Groves et al. 1983; Treton et al. 1985), ribosomal
RNA genes (van Heerikhuizen et al. 1985). An exhaustive review on this early work
has been published (Heslot 1990).
A fair amount of data both on genetic and physiological aspects of this species
was thus accumulated in the mid 1980s, when finally a transformation system
became available (Davidow et al. 1985; Gaillardin et al. 1985). Gene cloning and
successful expression of heterologous proteins, which appeared to be efficiently
secreted to the growth medium, initiated a second wave of interest in this yeast (for
an early review, see Gaillardin and Heslot 1988). The availability of an amazingly
efficient and precise system for integrative transformation, the fine dissection of
the processing pathway of an abundantly secreted extracellular protease (Matoba
et al. 1988), the discovery of a signal recognition particle closely resembling that of
higher eukaryotes (Poritz et al. 1988), all seemed to pave the way for the rapid
development of Y. lipolytica as a model organism for studies on protein secretion.
Some tools were, however, still missing, and forcefully resisted availability: for
instance, and for reasons very unclear at that time, no replicative vector could be
10. Yarrowia lipolytica 315
built for Y. lipolytica, although their construction from chromosomal origins of

replication seemed straightforward in all other yeast species (Wing and Ogrydziak
1985). This problem was solved in a typical Y. lipolytica way, by looking for one
thing and finding another (Fournier et al. 1991); centromeric ARS were isolated
and filled one of the last gaps in the genetic tools required. With the recent
development of powerful gene amplification systems (Le Dall et al. 1994), the
identification of a retrotransposon (Schmid-Berger et al. 1994), and the character-
ization of strong regulated or constitutive promoters (Strick et al. 1992; Barth and
Scheuber 1993; Blanchin-Roland et al. 1994), the stage is now set for concentrating
on specific biological problems in this yeast.
Areas of current interest include mechanisms of gene expression and protein
secretion (contrary to most other yeast species, Y. lipolytica appears dedicated to
that function under certain conditions) which are obviously application-linked.
More fundamental topics concern the structure and functioning of the genome,
which in some aspects radically differ from what is seen in other yeasts: structure
and maintenance of polymorphic and dispersed rRNA genes, absolute require-
ment for a centromeric function for the maintenance of extrachromosomal plas-
mids, and genetic structure of natural populations which consist of widely
divergent haploid lines. Other aspects of Y. lipolytica biology have begun to be
explored, such as determinants of the mating type, control of the dimorphic
transition from yeast to hyphae, alkane and fatty acid metabolism, glyoxylic path-
way, peroxisome biogenesis, etc.
In several of these fields, Y. lipolytica proves to be a superb model organism,
both exquisitely original and generally meaningful, thus plainly rewarding the
often painful days needed to develop its genetic system. It was a common joke
among the few Y. lipolytica aficionados who struggled over 20 years or so to tame
the beast, that the yeast would never do anything as expected. The final message,
however, was never dull and becomes increasingly exciting as we now rapidly
proceed in deciphering it.
2
Physiology/Biochemistry/Cell Structure
2.1
Occurrence in Nature
Yarrowia lipolytica strains are readily isolated from dairy products such as cheese,
yoghurts, but also from kefir, shoyu, or from salads containing meat or shrimps.
This inability to survive under anaerobic conditions permits their easy elimination
from dairy products, in contrast to Kluyveromyces marxianus strains, for example
(Mc Kay 1992). Y. lipolytica is not considered as a pathogenic species, probably
(among other reasons) because its maximum growth temperature seldom exceeds
32-34°e. Intravenous injection of Y. lipolytica cells (Holzschu et al. 1979) into
normal or cortisone-stressed mice was not associated with any mortality (in con-
trast to Candida albicans or Candida tropicalis), and no viable cell could be
rescued 6 days after the injection (whereas occasional persistence was observed up
to 30 days with, e.g., C. utilis, C. maltosa, or K. fragilis).
2.2
Main Substrates and Biochemical Tests
The most common assimilated substrates (data from Kreger-van Rij 1984; Barnett
et al. 1990) are listed in Table l. Very few compounds may actually be used as
carbon or nitrogen sources. Numerical taxonomy was performed on the basis of
classical biochemical tests, and included C. lipolytica among a heterogeneous
subgroup of Candida nonfermenting species {Campbell 1975). Poncet and Arpin
(1965) devised a set of six substrates for rapid identification of C. lipolytica among
non-fermenting Candida which do not assimilate nitrates, whereas Barnett et al.
(1990) suggest a minimal set of 13 substrates, from which five rapid tests can be
derived to distinguish Yarrowia from any other yeast species. Some controversy
exists concerning urease production by Y. lipolytica strains: whereas Sen and
Komagata (1979) and Barnett et al. (1990) describe the species as urease-positive,
Booth and Vishniac (1987) have found no evidence for urease activity in Y.
lipolytica strains.
2.3
Phylogenetic Relationships
Several observations early suggested that Y. lipolytica may have diverged consid-
erably from other ascomycetous yeasts: high GC content (see Sect. 4.2.1), unusual
structure of rDNA genes (see Sect. 4.2.4), coupled with a lack of RNA polymerase
I consensus sequences found in other yeasts (van Heerikhuizen et al. 1985), higher
eukaryotic-like size of snRNA (Roiha et al. 1989) and of7S RNA (Poritz et al. 1988).
Homologous genes tend to display a low level of similarity (typically in the 50-60%
range at amino acid level) with their counterparts in S. cerevisiae, K. lactis, or C.
albicans, thus hindering in most cases attempts to clone homologues by hybridiza-
tion. Naumova et al. (1993) showed that Y. lipolytica genes did not hybridize
detectably with DNA from species of the genera Saccharomycopsis, Endomyces, or
Endomycopsella, some of which were formerly classified in the same genus as Y.
lipolytica. Similarly, few genes of Y. lipolytica seem to be directly expressed in S.
cerevisiae, suggesting that RNA polymerase II promoters and/or associated tran-
scriptional factors have diverged considerably. Recent data on 7S RNA genes (see
Sect. 4.2.4), on intron structure, or on ARS functioning (see Sect. 4.2.3) all con-
firmed that this species was quite peculiar when compared to most other yeasts.
Evolutionary trees based on sequence comparison of genes encoding well-con-
served functions (glycolytic genes, ribosomal RNA genes) locate Y.lipolytica on an
isolated branch, clearly separated from S. pombe on one hand, and from the bulk
of other ascomycetous yeasts on the other (Barns et al. 1991; Okuma et a1.l993). A
truly positive aspect of this divergence is that the observation of structural conser-
Table 1 I-
!='
Author Place Strain Origin Comment I~
::t0
Barth BaseVDresden B204-12C YB423-3 Inbreeding program see Table 2 !.
Q
B204-12D YB423-12
Chattoo Baroda B204 series From Barth ~
0
Dominguez Salamanca E129 series From Gaillardin i:
CX series From Ogrydziak S·
Gaillardin Grignon E129 series W29 (Paris, waste water) Inbreeding program see Table 2
E150 series YB423-12
Kohlwein Graz B204 series From Barth
Kurischko Jena K35-6 H222 (Leipzig, soil) Inbreeding program see Table 2
KF series CBS6124-2, CX series
Matsuoka Osaka ATCC44601
Nga Singapore MLl5-29 From Gaillardin and
21501-4 Ogrydziak series
Novotny Prag CCY29-26-3 Yeast collection (Bratislava)
CCY29-26-8
Ogrydziak Davis DX series YB423-3, YB423-12, YB421 Inbreeding program see Table 2
CX series
Paszewski Warsaw CLl, CL2 Isolates from Polish areas
A101,115
Rachubinski Edmonton E129 series From Gaillardin
Schweizer Erlangen B204 series From Barth
Strick Groton Inbreeding program (unpubl.)
Young Birmingham E129 series From Gaillardin
Y148
I#l
.....
""I
vation between Y. lipolytica and other yeast genes is much more likely to reflect
functional constraints than when it happens between closely related yeasts.
2.4
Dimorphism
Wild-type strains of Y. lipolytica exhibit various colony shapes, ranging from

smooth and glistening to heavily convoluted and mat. The colonial morphology is
determined both by the growth conditions (aeration, carbon and nitrogen sources,
pH, etc.) and by the genetic background of the strain. Wild-type isolates may give
rise to various colonial types, each giving rise to the other types: the basis for this
instability, which is not seen with laboratory strains, is unknown.
Y. lipolytica is a natural dimorphic fungus, which forms yeast cells,
pseudohyphae, and septate hyphae (van der Walt and von Arx 1980; Barnett et al.
1990). True mycelium consists of septate hyphae 3 to 5 f.1ID in width and up to
several mm in length. Apical cells often exceed 100.um, whereas articles are 50 to
70.um long. There is a single nucleus per article, and septa show a minute, asco-
mycete-type central pore, unusual for other filamentous yeasts, with endoplasmic
reticulum extending through it from one article to the next (Kreger van-Rij and
Veenhuis 1973).
The proportion of the different cell forms depends on the strain used, probably
accounting for the morphological differences observed at the colony level. Certain
conditions are known, however, which cause preferential formation of yeast cells,
or induce mycelial development (Ota et al. 1984; Rodriguez and Dominguez 1984;
Guevara-Olivera et al. 1993). Ota et al. (1984) observed that carbon sources such as
olive oil, oleic acid, oleyl alcohol, linoleic acid, or triolein, together with the nitro-
gen sources bovine milk casein, soybean fraction, or meat extract, strongly induce
formation of hyphae in several strains of Y. lipolytica. Mycelial development was
inhibited by a deficiency of magnesium sulfate and ferric chloride or by the addi-
tion of cysteine or reduced glutathione. Rodriguez and Dominguez (1984) could
induce a complete and reproducible yeast-mycelium transition in minimal me-
dium containing N-acetylglucosamine as sole carbon source, but this seems to be
strain-dependent. Guevara-Olvera et al. (1993) enhanced the yeast-mycelial transi-
tion by heat shocking the cells during the inoculation in medium containing N-
acetylglucosamine (see Sect. 2.4).
Some studies were done to detect physiological changes occurring during yeast-
hyphae transition (Vega and Dominguez 1986; Rodriguez et al. 1990; Guevara-
Olvera et al. 1993). Comparison of the composition of yeast and hyphal cells has
shown that hyphal walls exhibit a higher content of amino sugars and a reduced
content of protein (Vega and Dominguez 1986). Furthermore, ornithine decar-
boxylase activity and polyamine cell pools increased in hyphal cells grown on N-
acetylglucosamine-containing medium (Guevara-Olivera et al. 1993). Mutations in
the genes SEC14 (Lopez et al. 1994), GPRI (G. Barth, unpubl.), and deletion of
XPR6 (Enderlin and Ogrydziak 1994) have strong effects on the yeast to hyphae
transition. However, it is not known whether the proteins encoded by these genes
are directly involved in the regulation of this transition. Morphological mutants

completely unable to form hyphae can be easily selected after visual inspection of
the colonies (Fournier et al. 1991) and an analysis of the genes complementing
these mutations has been undertaken (A. Dominguez, pers. comm.).
2.S
Studied Metabolic Pathways
2.S.1
Utilization of Hydrocarbons as Carbon Source
It has long been known that Y. lipolytica can use n-alkanes and l-alkenes as carbon
sources (Bruyn 1954; Ishikura and Forster 1961; KIug and Markovetz 1967; Nyns et
al. 1967). Polymethylated and chlorinated alkanes are also assimilated by this
fungus (Hagihara et al. 1977; Murphy and Perry 1984). However, only few enzymes
are characterized, and no gene involved in the early steps of degradation of these
compounds has so far been cloned.
The first step in the assimilation is likely to be an emulsification at the cell
surface to form small droplets which can be internalized. A 27-kDa extracellular
emulsifier, called liposan, is induced in cells growing on n-alkanes (Cirigliano
and Carman 1984, 1985). Liposan contains 88% carbohydrate and 12% protein.
After entry into the cell, n-alkanes are hydroxylated by a cytochrome P-450
mono oxygenase system. Cytochrome P-450 was detected in several strains of Y.
lipolytica (Ilchenko et al. 1980; Mauersberger and Matyashova 1980; Delaisse et al.
1981). The synthesis of this enzyme is induced during growth on n -alkane, but not
on glucose, ethanol, or acetate. Differences in sensitivity to glucose repression
during growth on hexadecane and decane indicate the presence of different regu-
lated cytochrome P-450 genes in Y. lipolytica (Mauersberger et al. 1991). Cyto-
chrome P-450 is localized in the endoplasmic reticulum, as shown by subcellular
fractionation of alkane-grown cells of Y. lipolytica (Mauersberger et al. 1991). The
l-alkanol formed after the first step is further oxidized by a membrane-bound fatty
alcohol oxidase (Kemp et al. 1990; Mauersberger et al. 1992) and not by NAD(P)-
dependent alcohol dehydrogenases, which are also present in Y. lipolytica (Barth
and Kunkel 1979; see Sect. 2.5.3).
Several alkane-nonutilizing mutants have been isolated and characterized (Bassel
and Mortimer 1982, 1985; Mauersberger 1991; Kujau et al. 1992). Bassel et al. (1985)
defined five phenotypic classes of alkane-nonutilizing mutants (alkA to alkE), de-
pending on which intermediates of the alkane degradation pathway they could use.
They have also shown that the uptake of n-alkanes is inducible and due to active
transport. Mutations in 16 loci caused a significant reduction in n-alkane uptake
(Bassel and Mortimer 1985). Mauersberger (1991) characterized three subtypes of
alkA mutants, which were unable to utilize either all types of n-alkanes (alkAa), or
only short ones in the C8 to C12 range (alkAb), or only long alkanes in the C16 range
(alkAc). These data indicate that in Y. lipolytica there exist several length-specific
alkane-uptake systems, or specific cytochrome P-450 monooxygenases.
2.5.2
Fatty Acid Biosynthesis and Degradation
Fatty acid biosynthesis and degradation were initially investigated by Kamiryo et

al. (1979), and a few reports were issued on using Y. lipolytica for the stereospecific
conversion of hydroxylated long chain fatty acids into y-Iactones (Ercoli et al.
1992).
Kohlwein and Paltauf (1983) detected at least two fatty acid carrier systems in
Y. lipolytica, one being specific for fatty acids with 12 and 14C atoms, the other for
CI6 and CIS saturated or unsaturated fatty acids. Octanoic acid and decanoic
acid are not taken up by this yeast.
An anabolic acyl CoA synthetase I activity was found in peroxisomes, mito-
chondria, and cytoplasm, and was shown to be required for the incorporation of
exogenous fatty acids into cellular lipids. Mutants were reported as being deficient
in this activity (Kamiryo et al. 1979). The gene FASl, encoding the pentafunctional
f3-subunit of the fatty acid synthetase, was cloned and sequenced (Schweizer
et al. 1988; Kottig et al. 1991). Its overall structure was very similar to that of
S. cerevisiae. A catabolic acyl CoA synthetase II was found exclusively in peroxi-
somes, and was required for the f3-oxydation of fatty acids. A mutant initially
reported as affecting this activity was latter shown to affect another step (Kamiryo,
pers. comm.). Contrary to what happens in S. cerevisiae, an intracellular 100-kDa
fatty acid-binding protein is readily induced in Y. lipolytica when grown on palmi-
tate (Dell'Angelica et al. 1992).
Use of Y. lipolytica cells for the production of gamma-decalactone from alkyl
ricinoleate (a derivative of castor oil) has been patented by the BASF (DE4126997,
.1993; see also Cardillo et al. 1991; Ercoli et al. 1992). Other possible uses include
production of wax esters from fatty alcohols (Sekula 1991).
The POTl gene encoding a catabolic 3-oxoacyl-CoA-thiolase, which catalyzes
the thiolytic cleavage of 3-oxoacyl-CoA thioesthers during £ oxidation of fatty
acids, was cloned and characterized by Berninger et al. (1993). Disruption of POT1
inhibited the utilization of oleate, but not the elongation of externally added
tridecanoic acid to higher-chain-Iength homologues. Their data suggest that be-
side the catabolic 3-oxoacyl-CoA thiolase an additional biosynthetic 3-oxoacyl-
CoA thiolase must be present in Y. lipolytica.
2.5.3
Assimilation of Alcohols
Y. lipolytica does not produce ethanol, but uses ethanol as carbon source at
concentrations up to 3%. Higher concentrations of ethanol are toxic. Several
NAD+- and NADP+-dependent alcohol dehydrogenases were observed in Y.
lipolytica (Barth and Kunkel 1979). There probably exist two NAD+-dependent
alcohol dehydrogenases of a molecular weight of 240000 Da which differ in their
substrate specificity. Synthesis of both enzymes seems not to be repressible by
glucose or inducible by ethanol (Barth and Kunkel 1979). Three NADP+ -dependent
10. Yarrowia lipoiytica 321
alcohol dehydrogenases (ADHII, III, and IV) were detected which exhibited differ-
ent substrate specificities. Furthermore, the occurrence of these enzymes varies,
depending on growth phase and carbon source of the media (Barth and Kunkel
1979).
2.5.4
Assimilation of Acetate
Most strains of Y. lipolytica grow very efficiently on acetate as sole carbon source.
Concentrations up to 0.4% sodium acetate are well tolerated, higher concentra-
tions reduce the growth rate and concentrations above 1.0% inhibit the growth.
Several mutants have been isolated and characterized, which are blocked in the
utilization of acetate (Matsuoka et al. 1980, 1984; Bassel and Mortimer 1982; Barth
1985; Barth and Weber 1987; Kujau et al. 1992). Nothing is known about the uptake
of acetate by this yeast. Mutants blocked in the activity of acetyl-Coenzyme A
synthetase are characterized by Kujau et al. (1992) in more detail. Acetyl-Coen-
zyme A is needed for the induction of the glyoxylate cycle, which is not induced in
acetyl Coenzyme A-deficient mutants (Matsuoka et al. 1980; Kujau et al. 1992).
The induction of the glyoxylate pathway is necessary for the utilization of
alkanes, fatty acids, alcohols, and acetate. Isocitrate lyase, the key enzyme of this
cycle, and its encoding gene are well studied (Matsuoka et al. 1980, 1984; Barth
1985; Barth and Weber 1987; Hoenes et al. 1991; Kujau et al. 1992). The structural
gene has been cloned and sequenced (Barth and Scheuber 1993).
Dominant mutations in the gene GPRI (glyoxylate pathway regulator) (Kujau et
al. 1992) make the cells sensitive to low concentrations of acetate or ethanol also in
the presence of glucose (Barth et al., to be published).
2.6
Secretion of Metabolites
2.6.1
Citrate and Isocitrate
Wild-type strains of Y. lipolytica secrete a mixture of citric and isocitric acid when
grown on n-paraffins as carbon source: a total yield of 130% and a ratio of 60: 40
(citric to isocitric) was reported for strain ATCC 20114 by Akyiama et al. (1973a,b).
When the cells were supplied with monofiuoroacetate, this compound was trans-
formed into monofiuorocitrate, which competitively inhibited aconitase: this, in
turn, improved the ratio of citric to isocitric acid to 85: 15. In an effort to obtain a
strain with low aconitase activity, a mutant unable to use citrate as carbon source
was first isolated, and further mutagenized in order to obtain a fiuoroacetate-
sensitive strain: this last strain yielded citric and isocitric acids in a ratio of 97: 3,
with a yield of 145% (w/w).
Treton and Heslot (1978) observed that on glucose or glycerol medium, the
ratio of citrate to isocitrate was 92: 8 vs. 67: 33 on n-paraffin. The intracellular ratio
of the two acids was however roughly the same (90: 10) on all media. These authors
further showed that both acids were equally well secreted in the growth medium,
but that citric acid alone was reconsumed on paraffins, whereas neither was on
glucose.
Finogenova and Glasunova (1976), Finogenova et al. (1982) made a detailed
analysis of enzymes from the citrate and glyoxylate cycles in strains grown on
hexadecane. They studied both a wild-type strain and two mutants with respec-
tively increased or decreased ratios of secreted citrate to isocitrate. They concluded
that the ratio of two key enzymes, isocitrate lyase and aconitate hydratase, was
controlling the ratio of the two acids in the growth medium. No data are available,
unfortunately, on the genes which had been mutated in the strains studied. Further
details on isocitrate lyase control and the glyoxylic cycle were discussed in Sect.
2.6.1. Use of mutants unable to use acetate or citrate as carbon sources has been
evaluated by Wojatatowicz et al. (1991); direct selection of citrate overproducing
strains has been described by McKay et al. (1990).
Processes have been described for producing citric acid from glucose or n-
paraffins in liquid cultures (for a review see Mattey 1992) or with immobilized cells
(Kautola et al. 1991), but also from date coats (Abou-Zeid and Khoja 1993), tapioca
starch hydrolyzates (Shah and Chattoo 1993), and glucose hydrol (W ojatatowicz et
al. 1991).
2.6.2
a-Ketoglutarate and Other Organic Acids
Y. lipolytica strains grown on n-alkanes in the presence of a limited thiamine

supply (a vitamin not synthesized by this yeast and required for a-keto-
glutarate dehydrogenase activity) secrete large amounts of a-ketoglutarate. Use of
a diploid strain for a-ketoglutarate production has been patented (Maldonado
and Gaillardin 1972). Furthermore, a haploid strain selected as a suppressor
mutant of a mutation in the methionine biosynthesis secretes very large amounts
of this organic acid during growth on glucose (patented by WeiBbrodt et al.
1988).
Production of 2-hydroxyglutaric and 2-ketoglutaric acids from glucose has
been described by Oogaki et al. (1983). A process for very high yield production of
isopropylmalic acid using a leucine auxotroph has been patented (De Zeeuw and
Stasko 1983).
2.6.3
Lysine
Mutations affecting all eleven biosynthetic steps but one have been identified.
A single locus LYSI controls the first step, homo citrate synthase (Gaillardin
et al. 1976a; Gaillardin and Heslot 1979), whereas the existence of isoenzymes has
up to now prevented characterization of such mutants in S. cerevisiae. Data on
intragenic complementation among lysi mutants suggested that homo citrate
10. Yorrowio lipolytico 323
synthase might be an oligomer. Semidominant mutations of LYSllead to desensi-

tization to lysine feedback inhibition (LYSl.5 mutation), and to lysine accumula-
tion in the cell, identifying homocitrate synthase as a major check point of the
pathway. Whereas homo citrate synthase activity is strongly inhibited by lysine, its
rate of synthesis is not controlled by the lysine content of the cell, but by interme-
diates of the pathway, probably aminoadipate semialdehyde. Mutations at the
LYSll locus, unlinked to LYSl, were initially isolated as suppressors of Lyel
mutations (Gaillardin et al. 1979). They completely abolish homocitrate synthase
activity. It is unknown at present if LYSll defines a regulator of LYSl, or a second
subunit of homocitrate synthase. The LYSl gene has recently been cloned and
sequenced; it corresponds to only one of the two domains described for bacterial
homo citrate synthases (A. Dominguez, to be published).
No mutant affecting homoaconitate hydratase has been identified up to now.
This activity could not be purified away from aconitate hydratase (Gaillardin,
unpubl.). LYS6 and LYS7 mutations are defective in the third step of the pathway
(homoaconitase), thermo sensitive mutants at the LYS6locus identified it as the
homoaconitase structural gene (unpubl.). Homoisocitrate dehydrogenase was pu-
rified to homogeneity; two tightly linked loci, LYS9 and LYSlO, actually define the
same structural gene encoding a bifunctional protein involved in successive dehy-
drogenation and decarboxylation ofhomoisocitrate (Gaillardin et al. 1982). LYSB
mutants are unable to convert a-keto adipic acid into a-aminoadipic acid
(unpubl.), suggesting that a single enzyme catalyzes this step in Y. lipolytica vs.
probably two isoenzymes in S. cerevisiae. LYS2 and LYS3 are two closely linked loci
(less than 2% recombination), which control adenylylation of a-aminoadipic acid,
a rate-limiting step in vivo, and the only one in the pathway which is insensitive to
the general control of amino acid biosynthesis (Gaillardin et al. 1979). The last two
steps of the pathway are controlled by LYS4 and LYS5, respectively. The latter gene,
encoding saccharopine dehydrogenase, has been cloned and sequenced (Xuan et
al. 1988, 1990). Saccharopine dehydrogenase levels are depressed in cells grown on
lysine-containing medium, except in strains deficient in the lysine catabolic path-
way (lye- mutants). Experiments with LYS5:1acZ fusions evidenced a slight repres-
sive effect oflysine, but failed to demonstrate an effect of the Lye context (Xuan,
unpubl.). Whether lysine repression of saccharopine dehydrogenase involves
"catabolic inactivation" by a complex between lysine-forming and -degrading
activities (as in the arginine pathway of S. cerevisiae) or another posttranscrip-
tional mechanism, remains thus an open question.
Y. lipolytica uses lysine as both a nitrogen and a carbon source, via the N-6-
acetyllysine-S aminovalerate pathway, like Hansenula saturnus (Rothstein et al.
1962; Gaillardin et al. 1976b). The Lyel gene encoding the first step of the pathway,
N-6-lysine acetyl transferase (LAT), was cloned and sequenced (Beckerich et al.
1994), and shown to be induced by lysine.
Combining mutations desensitizing homo citrate synthase (LYS1.5), as well as
mutations simultaneously preventing lysine catabolism and relieving the lysine
effect on saccharopine dehydrogenase (lyc1.5), yielded strains accumulating 40
times more lysine than the wild-type strain (Heslot et al. 1979). No lysine secretion
in the growth medium was observed, indicating that very efficient systems existed
for uptake and/or retention within the cell.
Both a high and a low affinity transport system have been described for lysine
uptake (Beckerich and Heslot 1978), and mutants affecting either or both systems
were identified. Intracellular lysine is stored in the vacuole (Sawnor-Korszynska et
al. 1977). Mutants affecting vacuolar storage of lysine were identified among
strains selected for reduced content of polyphosphates in the vacuole (Beckerich et
al. 1981, 1986), although no direct relationship could be established between lysine
and polyphosphate pools. A direct selection of mutations preventing lysine reten-
tion within the cell was carried out, starting with a LYS1.5, lycl.5 strain: mutants
displayed a complex phenotype including reversion of the lyc1.5 mutation, mat-
ing-type switch, and mating-type context-dependent phenotype (Beckerich et al.
1984).
2.7
Secretion of Proteins
2.7.1
Extracellular Alkaline Protease (AEP)
Y. lipolytica strains grown on rich (YPD-type) medium at pH 6.8 secrete large

amounts (1-2 g!1) of an alkaline extracellular protease (AEP). As excellent reviews
on this protease have been recently published (Ogrydziak 1988b, 1993), only the
main results will be recorded here. AEP is encoded by the XPR2 gene, which was
identified among at least 11 genes controlling AEP synthesis, secretion and/or
activity (Ogrydziak and Mortimer 1977; Simms and Ogrydziak 1981). The gene has
been cloned and sequenced from three different strains (Davidow et al. 1987;
Matoba et al. 1988; Nicaud et al. 1989a). AEP is a 32-kDa protease ofthe subtilisin
family, which is intracellularly processed from a 55-kDa glycosylated precursor
(Matoba and Ogrydziak 1989; Matoba et al. 1988). Processing includes cleavage of
a 15 amino acid presequence and glycosylation of a unique site on the propeptide
(both occurring cotranslationally during translocation into the endoplasmic
reticulum), processive hydrolysis of a row of nine N-terminal dipeptides (X-Ala or
X-Pro) by a Golgi dipeptidyl aminopeptidase, followed by the cleavage of the
propeptide at a Lys-Argjunction in front of the mature part. The endopeptidase is
encoded by the XPR6 gene, a KEX2 homologue which has recently been cloned and
sequenced (Enderlin and Ogrydziak 1994). The propeptide has been shown to be
required for folding, transit, and activation of the mature part (Fabre et al. 1991,
1992), a finding which has since been extended to various proezymes in S.
cerevisiae.
Regulation of AEP synthesis is complex and reflects the carbon, nitrogen, sul-
fur, and pH status of the cell, among others. A study of the promoter has been
initated; internal deletions and in vivo footprints demonstrate there are two main
UASs located 700bp (UASl) and 40bp (UAS2) upstream from the TATA box
(Blanchin-Roland et al. 1994). Each UAS seems to contain targets for general
10. Yarrow;a I;polyt;ca 325
transcription factors (RAP1- and possibly ABF1-like). These VAS are able to acti-
vate a minimal promoter consisting of the LEU2 TAT A box and initiation site
(Madzak et al., to be published). Mutations affecting transcriptional control of
XPR2 have been selected and identify at least four unlinked loci (Lambert et al., to
be published).
2.7.2
Extracellular RNase
A secreted RNase activity is detected in Y. lipolytica cultures grown under condi-

tions leading to alkaline protease secretion, the major 45-kDa species being par-
tially degraded by AEP into 43-kDa and 34-kDa species (Cheng and Ogrydziak
1986). RNase is probably synthesized as a 73-kDa glycosylated precursor (Cheng
and Ogrydziak 1987), but definite confirmation of the maturation process awaits
determination of the sequence of the gene.
2.7.3
Acid Extracellular Protease
On rich YPD medium at pH 4.0, an acid protease activity is detected in the growth
medium. Three protein species were initially described, of 28, 32, and 36kDa
(Yamada and Ogrydziak 1983). More recent data suggest that there is only one acid
protease, which may undergo partial proteolysis in some strains and/or under
certain growth conditions (T. Young, to be published). Interestingly, induction of
the acid protease occurs under conditions very similar to those used for inducing
AEP, except for the pH of the medium. The gene-encoding acid protease has been
cloned and sequenced (T. Young, to be published), and its disruption abolishes
acid protease activity. It encodes a preproenzyme with an unusually large 5' up-
stream region. Interestingly, some conservation of the promoter elements of both
acid and alkaline protease seems to exist. Comparing the determinants of the
regulation of these two genes might thus be quite revealing.
2.7.4
Extracellular Phosphatases
A cell wall-bound acid phosphatase activity is induced when Y. lipolytica is grown

on media depleted for inorganic phosphate sources. A glycosylated protein of
90000-200000Da has been purified, which is converted into a 60000-Da species
upon endoglycosidase H treatment. Antibodies directed against it cross-react with
S. cerevisiae major acid phosphatase (Lopez and Dominguez 1988). A kinetic study
of this enzyme has been published (Moran et al. 1989).
Treton et al. (1992) tried to clone its structural gene by functional complemen-
tation of a pho5, pho3 mutant of S. cerevisiae. This approach failed to identify the
gene searched for, but yielded PH02, the gene of a secreted minor phosphatase.
The PH02 gene product has no homology to other acid phosphatases; it corre-
sponds to an acid phosphatase activity with a narrow substrate spectrum, the

synthesis of which is induced in cells starved for inorganic phosphate.
2.7.5
Extracellular Lipase and Esterase
Y. lipolytica strains display a lipase activity which acts preferentially on oleyl

residues at positions 1 and 3 of the glyceride. Lipase activities were examined by
different investigators on different strains, and it is unclear whether the reported
discrepancies reflect differences in the methodologies used, or the existence of
different types of strains. Peters and Nelson (1948a,b) described a single glucose-
repressible activity with a pH optimum around pH 6.2-6.5. Zviagintzeva et al.
(1980) also reported on a single cell wall anchored lipase, wherease Kalle et al.
(1972) described two cell bound activities: a constitutive, glucose-insensitive li-
pase, and a second activity induced by sorbitan monooleate. Ota et al. (1978)
described both an extracellular activity in cultures supplemented with a protein-
like fraction derived from soybean, and cell bound lipases. The extracellular lipase
required oleic acid as a stabilizer/activator, whereas the cell bound lipases did not,
and differed by several properties from the extracellular enzyme. Sugiura et al.
(1976) and Ota et al. (1982) solubilized two cell bound, monomeric lipases of 39
and 44kDa, which differed in their pH optima. Gomi et al. (1986) showed that the
lipase(s) exist in the cell wall as an activator bound complex, which is rapidly
dissociated upon enzyme purification. The extracellular, activator-dependent ac-
tivity may thus reflect release of (up to 50% of) the cell bound acivity, perhaps
under conditions leading to extracellular protease(s) induction. Further details on
Y. lipolytica lipase(s) can be found in a recent review (Hadeball 1991). Mutants
unable to use tributyrin as a carbon source were isolated after nystatin enrichment
(Nga et al. 1988), and were shown to define three complementation groups (Nga et
al. 1989). A gene encoding a secretory protein highly homologous to fungallipases
has been recently cloned in an independent approach (A. Dominguez, pers.
comm.): this should rapidly permit assessing if there is more than one lipase
activity in Y. lipolytica.
Y. lipolytica lipase may be of interest for synthesis of 2,4-dimethylglutaric acid
mono esters (Ozegowski et al. 1993), transesterification of meso-cyclopertane diols
(Theil et al. 1991), or use in the leather inductry or in cheese manufacturing
(German patent DD-272867).
An extracellular thermostable esterase of low molecular weight (10000Da),
specific for the I-position of triglycerides has recently been described (Matteyand
Adoga 1991).
2.7.6
a-Mannosidase
A cell wall bound a-mannosidase, sensitive to catabolite repression, can be solubi-

lized by digitonine treatment from the cell wall of Y. lipolytica. A kinetic study of
the enzyme has been published (Vega and Dominguez 1988).
2.7.7
Genes and Mutations of the Secretory Pathway
Screening of thermosensitive mutants identified a few strains possibly affected in

the secretion pathway (D. Ogrydziak, pers. comm.), but these were not character-
ized further. Enrichment for hyperdense cells on velocity gradients (as done in S.
cerevisiae for sec mutants) is not practicable in Y. lipolytica due to large variations
of cell size and shape in a wild-type culture (J.M. Beckerich, pers. comm.). Thus,
genes affecting protein secretion have so far been isolated on the basis of func-
tional/structural similarity with known SEC genes. Mutated versions of these genes
were then created, which in turn served to isolate secondary mutations (suppres-
sors, colethal mutations).
An essential gene called R YLl has been isolated by hybridization (Pertuiset et
al. 1994) and may represent a homologue of SEC4, which encodes a small G protein
involved in the control of secretory vesicle fusion with the plasma membrane. A
homologue of S. cerevisiae SEC14 was identified both by PCR and by functional
complementation of as. cerevisiae sec14 mutant using a cDNA expression library
of Y. lipolytica mRNA made in a S. cerevisiae expression vector (Lopez et ai. 1994):
unexpectedly, the deletion of this gene in Y. lipolytica proved to be viable and did
not affect protein secretion, although recent electron microscopy data suggest that
(derivatives of) the Golgi apparatus look abnormal (Rambourg et aI., unpubI.).
This deletion, however, prevented the yeast-mycelium transition characteristic of
this species, suggesting the existence of some link between Golgi function(s) and
cellular differentiation.
Several genes controlling early steps of the pathway have been characterized. A
homologue of SEC61 (one of the subunits of the translocation pore into the endo-
plasmic reticulum) was cloned by PCR and shown to be highly conserved between
S. cerevisiae and Y. lipolytica (68% identity at amino acid level). A homologue of
SEC62 was isolated using the cDNA expression library to complement a sec62
thermosensitive mutant of S. cerevisiae. Its predicted product shows only 37%
identity with its S. cerevisiae counterpart (D. Swennen, to be published).
Rather close homologues of a signal recognition particle (SRP), involved in the
targeting of secretory polypeptides to the endoplasmic reticulum, have been ob-
served in Y. lipolytica and in S. pombe (Poritz et al. 1988). On the contrary, S.
cerevisiae SRP seems to have diverged considerably and was identified later (Hann
and Walter 1991). Y. lipolytica SRP contains a typical 7S RNA, which can be
immunoprecipitated from whole cell extracts by human anti SRP antibodies (He et
al. 1992). This RNA is encoded by two unlinked genes, SCRI and SCR2, whose
products share 94% identity (He et al. 1989). Either gene can be deleted, but the
double deletion is lethal (He et ai. 1990), indicating that essential secretory pro-
teins strictly require the SRP-dependent pathway for secretion. This also seems to
be the case for AEP, synthesis and secretion of which are severely depressed under
nonpermissive conditions in conditional mutants of SCRI or SCR2 (Yaver et al.
1992, He et al. 1992). Such mutants were created by site-directed mutagenesis of
conserved nucleotides in a loop binding Srpl9p, one of the six polypeptides asso-
ciated to mammalian 7S RNA. The genes encoding two of these polypeptides,
Srp19 (SEC65) and Srp54, have been cloned and sequenced recently (M. Sanchez et
al., unpubl.; D. Ogrydziak, unpubl.).
In an attempt to identify new genes whose product may (directly or not) inter-
act with the SRP, mutations displaying colethality with conditional mutations
within SCR2 were selected (Boisrame et al., to be published). One of these muta-
tions identifies a gene (tentatively named 226) whose product is predicted to be a
resident protein in the lumen of the endoplasmic reticulum (ER). Interestingly,
deletion of this gene gives a thermosensitive phenotype, which is further exagger-
ated in the presence of a 7S RNA thermo sensitive mutation, and results in a
dramatic decrease of the amount of AEP precursor synthesis: this suggests that
226p may facilitate SRP-dependent translocation of secretory precursors from the
lumenal side of the ER membrane.
2.8
Peroxisome Biosynthesis
Y. lipolytica grows well on oleic acid, and this is accompanied by an extensive

proliferation of peroxisomes. Antibodies directed against the targeting signal Ser-
Lys-Leu COOH (anti-SKL) of peroxisomal proteins of several yeasts, react strongly
with three peroxisomal proteins of Y. lipolytica (Atchinson et al. 1992). Using these
two features, studies on peroxisome biosynthesis have recently begun with the
identification of 17 oleic acid nonutilizer mutants. Three of them were shown to
affect peroxisomal assembly (pay mutants) by a rapid immunofluorescence assay,
using anti-SKL antibodies (Nuttley et al. 1993). The punctate labeling pattern
observed with anti-SKL in wild-type cells was lost in the mutants, no peroxisomal
structures could be observed, and two peroxisomal marker enzymes ({3-
hydroxyacyl-CoA dehydrogenase and catalase) failed to localize to the particulate
fraction in mutant cells. Genes complementing two pay mutations (pay2 and pay4)
were isolated by complementation, using a genomic library made in a replicating
vector. The PAY4 gene has been sequenced (Nuttley et al. 1994). It encodes a 112-
kDa hydrophilic protein, presumably localized in the cytoplasm, which is ex-
pressed at low levels on glucose-containing medium and strongly induced upon
shifting to oleic acid. Pay4p exhibits an ATP-binding site and appears closely
related to Pas5p of Pichia pastoris (59% identity) and less to Pasl p of S. cerevisiae,
both involved in peroxisome assembly in their respective hosts.
3
Life Cycle
3.1
Heterothallism and Mating Type Alleles
All natural isolates of Y. lipolytica so far tested are heterothal1ic. However, it was
reported that mating type switching occurred in conjunction with reversion of the
lyc1.5 mutation in haploid and diploid strains (Beckerich et al. 1984). It must be
investigated whether such mating type switching takes place in nature to create
homothallic strains.
The mating type is determined by the two alleles MATA and MA TB (Bassel et al.
1971). The MA TA allele has been already cloned (Kurischko et al. 1992). Similarly
to heterothallic strains of S. cerevisiae, haploid and diploid cells are vegetatively
stable with some exceptions (see Sect. 3.5). Extensive overviews on the life cycle,
including mating processes and sporulation, are given by Weber and Barth (1988),
Weber et al. (1988), and Heslot (1990).
3.2
Mating Frequency
Mating frequencies of natural isolates are always very low (I % viable zygotes/cell
or less). Attempts to increase the mating response by inbreeding (Gaillardin et al.
1973; Ogrydziak et al. 1978; Kurischko et al. 1983; Barth and Weber 1985) failed to
raise mating frequency above 15% viable zygotes/cell (see also Sect. 4.1). Mating
frequency is dependent on several parameters besides the genetic background of
strains: medium, cell density, growth phase, and temperature (Gaillardin et al.
1973; Barth and Weber 1984). Several media were tested for induction of conjuga-
tion. High values of mating were obtained using McClary medium (Gaillardin et al.
1973), restricted growth medium (RG; Ogrydziak et al. 1978), or a yeast extract-
malt medium (YM; Barth and Weber 1984). A slight increase in mating was ob-
served by adding 0.05% sodium citrate to YM (Weber et al. 1988). Cell densities of
about 107 cells/ml resulted in highest mating frequencies for most strains
(Gaillardin et al. 1973; Weber et al. 1988) but some strains need higher cell densi-
ties (about 108 cells/ml; Weber et al. 1988).
Temperatures below 20°C and above 28 °C reduce mating dramatically
(Gaillardin et al. 1973). The age ofthe preculture before mixing in or on conjuga-
tion medium is important for the mating frequency. Highest values were observed
with cells taken from the late logarithmic growth phase (Barth and Weber
1984).
3.3
Sporulation
Y. lipolytica does not require nitrogen limitation for induction of sporulation in

contrast to S.cerevisiae and some other yeasts. Diploid strains sporulate on solid or
in liquid complete medium when glucose is exhausted. Highest sporulation fre-
quencies were obtained with many strains when 1.5% sodium citrate was used as
a carbon source (Barth and Weber 1985) at temperatures between 20 and 30°C.
High sporulation frequencies can also be obtained in liquid or on solid YM and V8
media (Gaillardin et al. 1973).
Some natural isolates of Y. lipolytica sporulate after mating quite well, but only
inbred strains form a high proportion of complete tetrads and have a satisfactory
level of germinating spores (see Sect. 3.4).
U>
U>
Table 2 o
Gaillardin's series
(Grignon group)
YB423-121ys1.13 W29 his. 1
I I
4 rounds of brother- Selection for 4-spored
sister matings asci and mating frequency
G. Barth's series
~ (Basel group)
D2801
YB423-3 YB423-12
6 rounds of backcross
against 2801-7 ~4-8 (ilvA) HI9s-4(ar
gA
'1'-'(~", '",om I Bl~
H194-10 (met6-1) - - - BIO -BI-8
I
W29 D80S1
I
BIO-7-B26 -HI9S-49 (adeA)
"" "-..ril14
~ 8051-12 I I
H194-10 - - - - Bf2- B26-2
(MatA, LYSl-S,lycl-S,lysll-23,lybl)
6 rounds of backcross
9 against 8051-12 H1l94-7 (hisA) - - B83 --£72-9
I
DlS210 H194-20 (leu3-4)-- BlS7--B83-16
Tetrad dissection 1 ~ 2 cycles of brother-sister mating

~ (round spores)
, - - - - - - - - - - - - - - Pa (MatB, his-I); Pc (MatA,lysll-23)
Transformati~ AHa (MatA, his-I); AHd (MatB,lysll-23) l
pINA302 t B204
EI0S (MatA, his-I, ura3-302) ~ I
E1l9 (MatA,lysll-23, ura3-302) B204-12C B204-12D o
MatA, met6-1, spol-l MatB,leu3-4, spol-l I:1:l
TranSformation~
with pINA270
then pop-out ~
§
p..
(~.. hl'-;~:;',"" '"'_""' "n '"'"' ""'-1 ~"', ',~-,ro, o
Transformation
~~-----
1 with pINA322
then pop-out
mm m~
~
el
(MatA,lysll-23, ura3-302, (MatA,lysll-23, ura3-302,
leu2-270, xpr2-322) leu2-270, xpr2-322) e:
::l
C. Kurischko's serles ...
(jena group) ?
D. Ogrydziak's series H222 YB423-12
(Davis group) ~
3 bad. crosses
YB423-12 YB421 with H222 mutants o::"!
I I 6 rounds of inbreeding, selecting
~.
Brother sister matings, 10 rounds of selection for 4-spored asci and spore viability
intraascus matings for spore viability
.f
~ K283 to K356 series ParisxDavis e.
ex series (improved conjugation frequency) hybrid ~.
I (leuZ-) S
K297 - - - - - - , - - - - - - -
5 backcrosses to Kseries to
restore fertility
1
I
t .
KF seIles
U>
U>
.....
3.4
Inbred Strains
The origin of the strains currently used by different groups working on Y.

lipolytica is given in Table 2, and a tentative genealogy of the major inbred lines is
summarized in Table 3.
Mating frequencies within these lines varies between 3 and 15% (viable zygotes/
number of cells), which allows complementation analysis. The proportion of
complete tetrads is high, and the spore germination of these strains reaches 80-
90%, which makes tetrad analysis possible. There exists one inbred line which
forms spherical spores in contrast to the normally formed helmet-shaped spores
(Barth and Weber 1985). These strains turn out to be more suitable for asci
dissection.
As stated before, the main difficulty is the poor interfertility between these
inbred lines. Unfortunately, there is currently no consensus on the reference
strains to be used. Since genetic data are mainly gathered currently on the E129-
E150 series, it might be advisable to localize new genes on this map (see Sect. 4.2.2).
In any case, the existence of excellent methodologies for gene transfer/replace-
ment, and for retrieval of chromosomal mutations once the gene has been cloned,
make it likely that exchange of markers between different inbred lines will be much
easier than in the past.
3.5
Spontaneous Haploidization and Stability of Diploid Strains
.Kurischko and Weber (1986) reported spontaneous haploidization of some diploid

cells after formation of zygotes. Furthermore, it was observed in severallaborato-
ries that diploid strains spontaneously sporulate during prolonged storage on
complete media. Therefore, it is recommended to prepare fresh diploid strains for
genetic analysis.
4
Genetic and Molecular Data
4.1
Mutagenesis and Mutants
Several commonly used chemical and physical mutagens have been tested to
induce mutations in wild-type and inbred strains of Y. lipolytica, and many differ-
ent mutants have been isolated and characterized. This is not the place to describe
all these mutants, but some main classes and general aspects will be discussed.
Results of extensive studies on cell inactivation, frequency of mutants or of certain
classes of mutants, spontaneous mutability, and frequency of reversions in differ-
ent strains of Y. lipolytica have been published by Bassel et al. (1971), Gaillardin
and Heslot (1971), Bassel and Mortimer (1973), Gaillardin et al. (1973), Ogrydziak
et al. (1978), and Barth and Weber (1983). Mutants defective in the utilization of
certain carbon sources or modified for the secretion of metabolites and proteins
are described in Sects. 2.4 to 2.6 of this chapter.
Many mutants have been described which exhihit nutritional requirements for
most of the amino aicds, adenine, and uracil, and the vitamins biotin, nicotinic
acid, pantothenic acid, riboflavin, and thiamine (Bassel et al. 1971; Gaillardin et al.
1973; Mortimer and Bassel 1973; Ogrydziak et al. 1978; Barth and Weber 1983;
Heslot 1990). The data on thiamine requirement are conflicting. Most, if not all,
natural isolates of Y. lipolytica need thiamine for normal growth but, nevertheless,
they can continue to grow for some generations after exhaustion of thiamine. The
isolation of complete thiamine-dependent and vice versa of thiamine prototrophic
mutants (Barth and Weber 1983) indicates that thiamine can be synthesized by this
yeast, but its synthesis seems to be restricted at a low level.
There are several color mutants described which turn the colonies green,
brown, or red (Mortimer and Bassell973; Bassel et al. 1975; Barth and Weber 1983)
but no red adenine-requiring mutants have been published.
Several mutants have been described which are resistant to antifungal agents or
different analogues of amino acids and carbon sources (Barth and Weber 1983;
Morzycka et al. 1976; Gaillardin et al. 1976a, 1976b). Analysis of mutants resistant
to the antifungal agent nystatin resulted in the detection of recessive, semidomi-
nant, and dominant mutations in different genes which cause this phenotype
(Barth and Weber 1983). Dominant and recessive mutations have also been de-
tected in mutants resistant to D(+)-glucosamine and 2-deoxyglucose (Barth and
Weber 1983). Some ethionine-resistant mutants exhibited a 1.5 to 18 times en-
hanced pool of free methionine in the cells (Morzycka et al. 1976). Canavanine-
resistant mutants have been used for random spore analysis (Bassel et al. 1971) and
determination of spontaneous reversion frequencies (Barth and Weber 1983).
Lysine analogues such as transdehydrolysine or amino-ethykysteine have been
used to isolate mutants deregulated for lysine biosynthesis and uptake (Gaillardin
et al. 1976a; Beckerich and Heslot 1978).
Copper resistance varies widely among natural isolates of Y. lipolytica. Two
tightly linked metallothionein genes, transcribed by a bidirectional promoter, have
been cloned and sequenced (Dominguez et al., to be published).
Most of the isolated mutants reverted at the expected frequency of 10-7 to 10-8
or less. However, some of the mutants reverted at much higher frequencies
(Barth and Weber 1983; Beckerich et al.1984; Kujau et al. 1992). The reason for this
high revertibility has not been clarified in most cases. The cloning and sequencing
of one of such a highly revertible allele (GPRl-112) resulted in the detection
of a retrotransposon (see Sect. 4.3) which is involved in the reversion process
(Barth, to be published).
The nystatin method for enrichment of mutants (Moat et al. 1959; Snow 1966)
has been successfully adapted to concentrate auxotrophic and citrate-nonutilizing
mutants of Y. lipolytica (Gaillardin et al. 1973; Barth and Weber 1983).
4.2
Genome and Gene Structure
4.2.1
Genome Structure
A G+C content of 49.6-51.7% has been reported for Y. lipolytica (Nakase and
Komagata 1971; Kurtzman and Phaff 1987; Klick et al. 1980). Determination of
deoxyadenosine content of exponentially growing haploid cells yielded and esti-
mated genome size of 4 x 109 Da or about 11Mb (Gaillardin et al. 1973), which
would be smaller than that of S. cerevisiae. It was later reported that different
haploid strains of Y. lipolytica exhibit wide variations in their DNA content esti-
mated by this method (Shah et al. 1982), but no absolute values were given.
Chromosome separation by pulsed field electrophoresis yielded much larger
genome estimates in the range of 12.7 to 22.1 Mb for wild-type or laboratory strains
(Naumova et al. 1993). A pronounced chromosome length polymorphism was
observed between different isolates, as well as a variation of the number of chro-
mosomal bands detected (four to six), which may reflect both gel artifacts (chro-
mosome comigration) and aneuploidy (evidence for a duplication of the URA3
marker on separate chromosomes was observed in a strain displaying six bands).
Natural isolates of Y. lipolytica appeared to have widely divergent genetic struc-
ture, which may account for the low spore viability observed in the initial inbreed-
ing programs: interestingly, Wickerham's first monosporic isolates from the
diploid-type strain displayed chromosomes of completely different sizes; one
looked like an aneuploid, and genetic markers were distributed differently in the
two clones, as shown by hybridization.
4.2.2
Genetic Linkage Groups and Chromosome Maps
Based on tetrad dissection and random spore analysis, a genetic map encompass-
ing more than 60 markers was established for the American lines (Ogrydziak et al.
1978, 1982). Linkage was observed eight to ten times more frequently between
random markers than in S. cerevisiae, suggesting that the average recombination
per kb was lower than in S. cerevisiae. Five linkage groups were defined at that
time, but linkage studies have proceeded at a slow pace since then (Ogrydziak
1988a). Linkage groups were also defined for former East German lines (Kurischko
1984) and for industrial strains (De Zeeuw, pers. comm.), but since marker ex-
change between the different lines is difficult, no pooled set of data is available so
far. No centromere-linked marker has been conclusively identified, but strains
carrying centro meres tagged with a marker have been recently built (Fournier et al.
1993) and should help in this regard.
Inbred strains of Y. lipolytica tend to display five chromosomes in the range of
2 to 5Mb (P. Fournier, S. Casaregola, unpubl.). It should be cautioned that at this
stage, five is still an estimate for the chromosome number of the species:
co migration may occur in this size range; that some bands are fuzzy may be due to
the presence of rDNA repeats, so that specific chromosome breakage will be re-
quired in order to obtain definite results. As expected from the study of the initial
isolates from which the inbred lines were derived (see Sect. 4.2.1), each line shows
a completely different chromosome pattern. An average size of 15 to 18 Mb has
been estimated for inbred lines (Fournier and Nguyen, unpubl.). A highly inbred
strain (EI50) consistently giving five well-resolved chromosomal bands has been
selected to assign 36 cloned genes by hybridization. Ribosomal RNA genes were
found on four of the five chromosomes. The linkage groups appear not to be
conserved among the different lines. Whether this reflects exchanges between
rDNA repeats present on nonhomologous chromosomes has to be assessed, but it
clearly questions the very existence of a consensus genetic map for this species (S.
Casaregola et al., to be published).
4.2.3
ARS and Centromeres
Initial attempts at isolating chromosomal origins of replication were based on a

strategy well established for several other yeast species: a genomic library was
made in an integrating vector. Since origins of replication are supposed to be
abundant (one for every 5 to lO plasmids in the library) and to confer high
frequency of transformation (100 to lOOO times above the frequency obtained with
the uncut integrative vector), most of transformants obtained with such a library
should reflect cloning of an origin. Beside abundance and aptitude to confer high
transformation frequency, ARS plasmids were supposed to be highly unstable,
being virtually lost from the transformed clones after a few generations on nonse-
lective medium. Among these three properties, only the second was true for Y.
lipolytica, which rendered identification of ARS quite difficult. We know now that
an origin of replication alone is unable to maintain a plasmid extrachromosomally
in this species, and that in addition to it, a centromeric sequence is absolutely
required (Fournier et al. 1991, 1993).
Three different ARS have been isolated up to now (Fournier et al. 1991;
Matsuoka et al. 1993), each carrying a centromere (CEN) and a nearby chromo-
somal origin of replication (OR!): ORI30181CEN3, ORI1068ICENl, ORI40021CEN4. 3
ORIl 068 and ORI30 18 have been shown by two-dimensional gel electrophoresis to
be included in regions of initiation of replication in the chromosome (Fournier
and Vernis, to be published), whereas all three CEN sequences are able to induce
chromosome breakage when integrated at the LEU2 locus. CENI and CEN3 were
shown additionally to be closely linked genetically to a chromosomal centromere,
3 Nomenclature of OR! and CEN. The CEN number refers to the chromosome number in
strain E150 map. Four digits are used to define ORIs: the first refers to the chromosome
number in strain E150 map, the three following are specific of each ORI. For ORIs which are
repeated in the genome, the first digit is replaced by an X.
and to correspond to a strong pausing site of the polymerase. ORI and CEN
functions are carried by two independent regions of the original ARS inserts, and
can be exchanged between different ARS: a given CEN sequence can thus appar-
ently confer ARS function to any chromosomal ORI, thus opening the way to the
cloning of many OR!. Several new ORIs were recently isolated from a DNA library
made in a CEN nontransforming vector (Chasles and Fournier, to be published).
One of them (ORIX009) was shown to be repeated at several places in the genome,
another originated from rDNA spacer.
OR! and CEN sequences of Y. lipolytica show no homology to corresponding S.
cerevisiae or K. lactis sequences (or to S. pombe), and the existence of a clear
functional consensus for these sequences in Y. lipolytica has still to be assessed.
4.2.4
Ribosomal RNA and Other RNA Genes
Genetic data and hybridization of separated chromosomes showed that most, if

not all, wild-type isolates of Y. lipolytica contained several clusters of rDNA units
located on one to four chromosomes (van Heerikhuizen et al. 1985; Fournier et al.
1986). Up to five types of repeated units were identified in a single strain, differing
by the length and the structure of the nontranscribed spacer DNA. All isolates so
far tested showed this polymorphic rDNA structure, but one strain (ATCC 18944)
was reported to contain a single type of unit (Clare et al. 1986). Genetic recombi-
nation inside the clusters occurs during meiosis, leading to expansion or reduction
of individual clusters. Thus, whereas independent wild-type isolates differ by the
number and types of rDNA units they carry, crossing individual strains within a
given Y. lipolytica inbred line results in the progeny in a strain-specific reshuffling
of rDNA genes supplied by each parent (Fournier et al. 1986). Strain typing can
thus be done by simple inspection of hyper dense bands on digests of total chromo-
somal DNA.
The total number of repeated units varies around a mean value of 50-60 (M.T.
Le Dall, unpubl.; Clare et al. 1986). The possible contribution of rDNA repeats to
interchromosome exchange has been discussed in Sect. 4.2.2. The 5S RNA genes
are not part of the rDNA clusters as in most other Saccharomycetoideae, but are
dispersed throughout the genome as in S. pombe (van Heerikhuizen et al. 1985;
Clare et al. 1986).
Small nuclear RNAs Ul, U2, U4, US, and U6 were analyzed by Roiha et al.
(1989): their sizes appeared much closer to that of human snRNA than to those of
S. cerevisiae. No gene has been cloned so far.
Two genes encoding an abundant 7S RNA molecule, which forms part of signal
recognition particle, have been identified (He et al. 1989). Both genes share 94%
identity, both are expressed, and lie on different chromosomes. Their product is
structurally much closer to higher eukaryotic 7S RNA than is the homologous lIS
RNA in S. cerevisiae. The deletion of either gene is viable, but the double deletion
is not, suggesting that the SRP-dependent pathway of protein secretion is essential
in Y. lipolytica.
10. Yarrowia lipolyticQ 337
No other genes encoding small RNA have so far been identified; in particular,
no suppressor tRNA is known in this yeast.
4.2.5
Features of Structural Genes
A tentative list of cloned genes is given on the following table (Table 3). Several
motifs similar to consensus sequences for transcriptional factor binding sites in S.
cerevisiae can be observed in Y. lipolytica promoters, including TATA boxes, CT-
rich blocks, TUF/RPG- or ABF1-binding sites, or UAS GCN and UASLEU ' The function
of these sequences has not been assessed in most cases (see, however, Blanchin-
Roland et al. 1994), and the corresponding transcription factors have not been
isolated. Three genes encoding a transcription factor have recently become avail-
able: CRF1, HOY1, and RIM1 (see Table 3).
Transcription starts have been mapped in a few cases, and often occur within a
CCAAA type of structure, 20-30bp downstream from the TATA box.
Introns are relatively rare in Y. lipolytica genes (six intron-containing genes
among 49 known sequences, see Table 3). Two genes show two introns (CDC42 and
SEC14) separated by a short exon. The 5' end of the intron (donor site) is
GTGAGTPu in all cases. The 3' internal consensus (branch site) is TACTAAC in all
cases but one (cgCTAAC in the first intron of SEC14), and is separated by one or
two nucleotides only from the 3' end of intron: CAG.
Most Y. lipolytica genes show a typical signal for transcription termination
TAG ... TA(T)GT ... TTT, which is located upstream from the site of poly A
addition (Lopez et al. 1994).
Positions-1 and -3 are strongly conserved upstream from the initiator ATG: an
A is observed in 12/15 cases at position-1 and in 11/15 cases at position -3. An A is
found at both positions in strongly expressed genes such as XPR2, PGK1, TPIl,
PYK1, lCLl, and LEU2.
Codon usage appears to be different from that of S. cerevisiae (Gaillardin and
Heslot 1988), and similar to that of Aspergillus (A. Dominguez, to be published).
4.3
Transposon
A retrotransposon, called Yin, was detected in the genome of Y. lipolytica

(Schmid-Berger et al. 1994). It is 9.4kb long and can transpose in the genome. This
retrotransposon is bounded by a long terminal repeat (LTR), the zeta element,
which is 714 bp long, highly conserved, and can exist also as a solo element. YIn
and solo zeta elements are flanked by a 4-bp directly repeated genomic sequence.
The copy numbers of YIn and solo zeta are dependent on the strain examined, but
at least 35 copies of YIn and more than 30 copies of the solo zeta element per
haploid genome have been observed (Schmid-Berger et al. 1994).
YIn belongs to the Ty3/gypsy group of retrotransposons and contains two
overlapping large open reading frames (YltA and YltB). The predicted YltA gene
Table 3. List of cloned genes (July 95)
I~
Gene Function Homologues Sequenced EMBL Reference
nuclear genes accession
number
ADE1 Glycinamide ribotide synthetase; ADE1 S. pombe

aminoimidazole ribotide synthetase ADE5,7 S. cerevisiae Yes C. Strick, pers. comm.
ASR1 Acidic serin rich protein Yes G. Barth, unpubl.
AXP1 Acid extracellular protease Yes T. Young, pers. comm.
BIO-6 Biotin synthesis No
CRF1 Transcriptional activator of MTPs CUP2 S. cerevisiae Yes Z2326S A. Dominguez, pers. comm.
FAS1 Fatty acid synthetase FAS 1 S. cerevisiae Yes X59690 Ktittig et al. (1991)
FBA1 Fructose biphosphate aldolase FBA1 S. cerevisiae Partial D. Swennen, pers. comm.
FUN34 S. cerevisiae
GPR1 Glyoxylate pathway regulator YCR10C S. cerevisiae Yes X74146 G. Barth, unpubl.
HIS1 ATP PR-transferase HIS1 S. cerevisiae Yes C. Strick, pers. comm.
HIS3 Imidazoleglycerol-P dehydratase HIS3 S. cerevisiae No Prodromou et al. (1991)
ICLl (1) Isocitrate lyase ICLl S. cerevisiae Yes X72848 Barth and Scheuber (1993)
LEU2 Isopropyl malate dehydrogenase LEU2 S. cerevisiae Yes M35579 Davidowet al. (1987)
LYC1 Lysine N6 acetyltransferase Yes X63548 Beckerich et al. (1994)
LYS1 Homocitrate synthetase Yes Dominguez, pers. comm.
LYS5 Saccharopine dehydrogenase LYS 1 S. cerevisiae Yes M43929 Xuan et al. (1990)
MTP1 Metallothionein Yes Z23264 A. Dominguez, pers. comm.
MTP2 Metallothionein Yes Z23264 A. Dominguez, pers. comm. 0
PAS2 S. cerevisiae Yes Rachubinski, pers. comm. b:1
PAY2 Peroxisome assembly I»
PAS1 S. cerevisiae ~
PAY4 Peroxisome assembly PASS P. pastoris Yes L23858 Nuttley et al. (1993) §
PGK1 Phosphoglycerate kinase PGK1 S. cerevisiae Yes M91598 B. Treton, pers. comm. p..
PH02 Secreted phosphatase Yes X65225 Treton et al. (1992) 0
G)
pon Peroxisomal oxoacyl-CoA thiolase pon S. cerevisiae Yes X69988 Berninger et al. (1993) I»
PYK1 (1) Pyruvate kinase PYK1-cdcl9 S. cerevisiae Yes M86863 Strick et al. (1992) s
I»
~
-0
RYL1 Small G protein SEC4 S. cerevisiae Yes L06969 Beckerich et al., submitted
RYL2 Small G protein Rab2 & Rab5 from rat Yes L06970 Beckerich et al., submitted ?
RYL3 (l) Small G protein CDC42 S. cerevisiae Yes Beckerich et al., submitted Q<
RYL4 Small G protein Rho family Yes Beckerich et al., submitted :::0
SEC14 (l)a Phospholipid transporter SEC14 S. cerevisiae Yes L20972 Lopez et al. (l994) !l
Q'
SEC61 ER translocation pore SEC61 S. cerevisiae Yes D. Swennen, pers. comm.
SEC62 ER translocation apparatus SEC62 S. cerevisiae Yes D. Swennen, pers. comm. -i
0
SEC65 SRP subunit SEC65 S. cerevisiae Yes Z22570 A. Dominguez, pers. comm. i"
SCR1 7S RNA gene scr1 S. pombe Yes M20837 Poritz et al. (1988) S'
SCR2 7S RNA gene scr1 S. pombe Yes X51658 He et al. (l989)
SRP54 SRP subunit SRP54 S. cerevisiae Yes D. Ogrydziak, pers. comm.
TPIl (1) Triose phosphate isomerase TPIl S. cerevisiae Yes C. Strick, pers. comm.
URA3 OMP decarboxylase URA3 S. cerevisiae Yes L. Davidow, pers. comm.
URA5 oro tate PR transferase URA5 S. cerevisiae Yes Z22571 A. Dominguez, pers. comm.
XPR2 Alkaline extracellular protease Subtilisine Yes Ml7741 Davidowet al. (1987)
XPR6 Dibasic endoprotease KEX2 S. cerevisiae Yes L15238 Enderlin and Ogrydziak (l994)
XRN1 Extracellular RNase Partial D. Ogrydziak, pers. comm.
YltA Gag-protein (retrotransposon) GAG of retrotransposons Yes G. Barth, to be published
YltB Polyprotein (retrotransposon) POL of retrotransposons Yes G. Barth, to be published
Mitochondrial genes
tRNA-Trp, tRNA-Thr, tRNA-Pro Yes L15359 Matsuoka et al. unpubl.
atp9 ATP synthase subunit 6,8,9 olil, oli2 S. cerevisiae Yes L15359 Matsuoka et al., unpubl.
cox3 Cytochrome oxydase subunit 3 oxi2 Partial L15359 Matsuoka et aI., unpubl.
NADH oxidoreductase subunit 4 Yes L15359 Matsuoka et aI., unpubl.
a(l) = intron containing gene.
...,
...,
\0
product showes high similarity to retroviral Gag-encoded proteins. YltB encodes

protein domains with some similarity to retroviral gene products encoded by the
pol gene. In the YltB gene, these predicted products occur in the order protease,
reverse transcriptase, RNase H, and integrase (Barth et al., in prep.).
4.4
Plasm ids and VLPs
No DNA plasmid was detected in a systematic survey of 24 wild-type isolates (B.

Treton, unpubl.), but a linear dsRNA of 4.9 kb was observed in several strains
(Groves et al. 1983; Treton et al. 1985). This RNA is encapsidated within a 50-nm
virus-like particles (VLP). The capsid seems to be composed of two major polypep-
tides of 83 and 77kDa (Treton et al. 1985; El-Sherbeini et al. 1987). Based on
hybridization data, there seem to exist at least two types of dsRNAs in different
strains, which show little homology with one another (Treton et al. 1985). An
additional linear dsRNA molecule of about 6kb was detected in some strains
besides the smaller 4.9-kb-long dsRNA (Barth, unpubl.) similar to the situation in
killer strains of S. cerevisiae. No homology was found with genomic DNA of Y.
lipolytica, nor with ds-RNAs from S. cerevisiae. No killer phenotype associated
with these VLPs could be evidenced, and curing after UV treatment (Treton et al.
1987) did not lead to any phenotypic change.
4.5
Mitochondrial Genome
The mitochondrial genome of Y. lipolytica has a buoyant density of 1.687 g/cm3

and a GC content of 24.9% (Klick et al. 1980). It consists of circular molecule of
14.5.um and its restriction map was established by Wesolowski et al. (1981) on
strain W29. The arrangement of genes for ATPase subunits, rRNA, and 4S RNA is
conserved with respect to S. cerevisiae and K. lactis. Several mitochondrial genes,
including ATPase subunit 6, 8, and 9, cytochrome oxidase subunit 3, NADH oxi-
doreductase (ubiquinone) subunit 4 and tRNA genes, have been sequenced
(Matsuoka et al., unpubl.; see Table 1). The restriction map of mitDNA seems to be
well conserved among different isolates, as judged from the mobility of the corre-
sponding hyperdense bands observed on digests of total genomic DNA stained
with ethidium bromide (unpubl.).
A single mitochondrial mutation leading to oligomycin resistance was de-
scribed by Matsuoka et al. (1982). It has been used in protoplast fusion experi-
ments (Treton et al. 1987).
5
Transformation, Vectors, and Expression Systems
The development of integrative and replicative vectors has been previously re-
viewed (Gaillardin and Heslot 1988; Heslot 1990; see also Fig. 1A and B). Marker
A
EcoRI(l)
EcoRI(6680)
B9111(2060)
Pstl
EcoRI(l)
indlll(29)
Xhol 1III"'-IO.:B;.,:a:.::.
mHI(375)
... ~ Sphl(566)
EcoRI(7000)
Xhol
Apal(6437)
Apal (2070)
pINA237
(8 Kb) 69111(5731)
BamHIIBglII(S720)
Hlndlll(4995)
Sphl(4S56)
BamHI/BglII(4430)
EcoRI(4360)
Fig. IA,B. Integrative (A) and replicative (B) vectors. All vectors are based on a pBR322
backbone (black line). Known coding sequences of Y. lipolytica genes are depicted as thick
arrows indicating the direction of transcription. Noncoding sequences of yeast DNA are
indicated by boxes
genes are usually Y.lipolytica wild-type biosynthetic genes, which complement the
corresponding chromosomal mutation (for these and other available markers, see
Sect. 5.4).
5.1
Integrative Transformation
5.1.1
Single-Copy Integration
Integrative vectors require a homologous region with chromosomal DNA. Integra-

tive transformation is best achieved by the lithium acetate procedure (see below)
and at a lower level by electroporation (Barth, unpubl.).
Integration occurs almost exclusively by homologous recombination. Integra-

tion is stimulated by linearizing the vector within the homology region (100 to
more than 1000fold enhancement over the frequency obtained with uncut vectors),
and results in very high transformation frequencies (up to 106 transformants per
J1g of DNA, Xuan et al. 1988). Homology should extend a few hundred bp on each
side of the cut (preferably more than 300bp). Gaps of up to 500bp within the
homology region still direct efficient integration and are efficiently repaired on the
chromosome.
With such a linearized vector, transformation results in more than 80% of the
cases from integration of a single copy of the vector at the chosen site. A low level
of double integrants at the site is observed (about 10%). Remaining events include
conversion of the chromosomal marker or out of site integrations: these last events
may, however, represent the major outcome when low frequency transformation is
observed (for instance, if homology is imperfect or extends over less than 300 bp).
Gene Disruption by Double Crossover

Gene disruption can be achieved easily by inserting a selective cassette within the
target gene cloned on a plasmid: integration then occurs by a double crossover.
Trimming of the ends is highly efficient, and the presence of vector sequences
(without homology to the target) does not affect the efficiency of targeting. A
possible drawback to this mechanism is that short regions of homology to the
target might become lost: transformants in that case will result mainly from con-
version of the chromosomal allele by the cassette marker. We recommend flanking
regions of 500 bp or more to reduce the frequency of these events. We observed,
however, that very efficient gene disruption could be obtained as long as one of the
flanking region was large (500 to 1000bp), the second being as short as 150bp.
Checking the structure of the transformants by Southern analysis or PCR is
strongly advised. In order to minimize conversion events, strains carrying chro-
mosomal deletions of commonly used marker genes have been constructed (see
Sect. 5.3). Gene disruption of possibly essential genes is best achieved in a diploid
context, which is subsequently sporulated and dissected, or in a strain carrying a
second copy of the target gene on a replicative vector (He et al. 1990; Lopez et al.
1994). In this last case, either the plasmidic or the chromosomal copy can act as a
target for the disruption cassette; we observed between 10 and 80% disruption of
the plasmid copy, depending on the gene considered.
Gene Conversion and Retrieval of Chromosomal Mutations

Since trimming of the free ends is likely to occur even when a linearized plasmid is
targeted by a simple cut, eventual incorporation of chromosomal mutations(s) in
the plasmid-borne copy is likely to occur during repair. This was checked directly
with a plasmid carrying both a LEU2 and a LYS5 marker, which could be targeted
at either locus depending on the cut made. The plasmid was cut at different
positions within the LYS5 gene, and the transformants were selected (e.g.) for the
Leu+ phenotype (Fig. 2). The frequency of Leu+Lys- transformants varied between
Plasmid/Restriction Integration site Selection for Leu+ Selection for Lys+
Transfo %of Transfo % of

Freq. Lys+ Freq. Lys+
pINA128/NotI leu2 2105 98% 2.510 5 99%
pINA128/KpnI lyss 6104 48% 2105 99%
pINAI28/BamHI lysS 3104 7% 4.110 5 54%
pINA128/ApaI leu2 9.410 5 98% 2.310 5 79%
Sall(2900)
pINA128
Sall(11000)
15kb Kpnl(4000)
Sall(4300)
BamHI(4500)
Sall(4800)
Xhol(9800) Xhol(4900)
Sphl(5800)
Sall(5900)
Apal(8792)
BglIl(8500)
Fig. 2. Transformation efficiency of pINA128 (below) carrying the two selective markers
LEU2 and LYSS. The plasmid was targeted to the genome of a lysS, leu2 recipient strain,
either at the LEU2 or at the LYSS locus, selecting for one marker and then checking
complementation for the second one. See text for details
93 and 6%, depending on the position of the cut relative to the lys5-12 chromo-
somal mutation (which is near the BamHI site), indicating that transfer of the
chromosomallys5.12 allele to the plasmid copy was still detectable when the cut
was made some 3 kb away from the mutated site. Similar results were observed at
the LEU2 site (Ribet and Gaillardin, unpubl.). This observation obviously permits
recovery of chromosomal mutations, by digesting the DNA of Lys- transformants,
religating it on itself and transforming an E. coli recipient. The xpr2-7 mutation
which directs the synthesis of a thermo sensitive alkaline protease has been rescued
in this way (unpubl.). One should also be aware of this fact when a vector is
targeted to a mutated gene, and when integration is selected by another marker of
the plasmid: integrants at the site may contain two identical copies of the chromo-
somal allele, particularly if the cut is made close to the mutated site.
Allele Substitution
Several in vitro-generated mutations can be substituted for a wild-type allele in a
given cell line by the following procedure (Beckerich et al. 1994). The wild-type
copy is first disrupted by a URA3 cassette. Mutated copies of the gene of interest
are then supplied as linear fragments which will recombine with the disrupted
copy, thus excising the URA3 cassette, an event which is easily selected on 5FOA
containing plates. Allele exchange can also be obtained by the two-step "pop out
method" (see Sect. 5.3).
5.1.2
Multiple-Copy Integration
Defective versions of the URA3 gene have been constructed by deleting most of its
promoter sequence and/or by creating mutations within the coding sequence (Le
Dall et al. 1994). Single copies of the most defective constructs are apparently
unable to confer a Ura+ phenotype to a strain carrying the ura3.302 allele (this is a
nonreverting ura3 mutation).
Three targets of integration have been tested: tandemly repeated sequences of
rDNA, single-copy genes like XPR2, or dispersed repeated sequences like the Yltl
transposon. Transformants were obtained in all cases, albeit at a much reduced
frequency and with a long delay in appearance as compared to transformants
obtained with nondefective markers: 1 to 2 weeks vs. 4 days, 1 to 10 transformants
per Jig of plasmid vs. more than 104 • A plasmid carrying a defective URA3 gene, a
piece of rDNA coding sequence, and the XPR2 gene was targeted either at the
rDNA loci, or at XPR2. Amplification levels varied between 5 and more than 40,
depending on how defective the marker used was, when the plasmid was targeted
to the rDNA; several clusters of tandemly integrated plasmids were present in
different rDNA units in some transformants. Targeting to the XPR2 locus also
yielded transformants, albeit at a lower frequency, but most of them eventually
turned out to result from integration into the rDNA loci; a single integrant at the
XPR210cus was observed which carried about 30 copies. Another plasmid carrying
the defective URA3 marker and a piece of Yltl was targeted to the transposon(s).
Amplification levels of 5 to 15 were observed; here again, a given transformant may
contain plasmids tandemly integrated in several Yltl transposons.
Stability of the integrated plasm ids was high, except when XPR2 transcription
was turned on: in this case, high copy number transformants (more than 30 copies)
appeared very sick, and rapidly threw off cells with less copies. No stability prob-
lem was observed with transform ants carrying 10 copies or less of XPR2, but this
may, of course, depend on the "toxicity" of the protein expressed.
5.2
Replicative Transformation
Replicative vectors carry both an origin of replication (ORI) and a centromeric
region (see Sect. 4.2.3) and are thus usually relatively stable under nonselective
conditions (about 1% loss per cell division) and present at 1-3 copies per cell.
Some strains, particularly W29 derivatives (like POla or POld, see below) seem to
missegregate these plasmids at elevated frequency, thus yielding more unstable
transformants (10-20% loss/cell division), and accordingly contain more plasmids
per transformed cell (up to 13, Fournier, unpubl.).
Transformation of replicative vectors can be done either by the lithium acetate
procedure or by electroporation. Both methods yield transformation frequencies
in the range of 103-104 transformants/,ug of DNA, or significantly less than integra-
tive transformation.
Using the lithium acetate procedure, this frequency can be significantly in-
creased by linearizing the plasmid, whereas this treatment nearly abolishes trans-
formation by the electro po ration method. The cut can be made either in a region
of homology with the genome (and is then apparently cleanly repaired), or in
regions without homology with the genome: no precise repair is then possible and
a delection of variable extent is observed in surviving plasmids. This has been used
to generate in vivo a set of nested deletions: a Bluescript based vector carrying
LEU2 and ARS3018 was linearized within the polylinker, and deletions extending
in the adjacent LEU2 or ARS sequence were recovered from yeast transformants
(B. Kudla, unpubl.).
Replicative plasmids carrying repeated sequences as short as 31 bp may suffer
recombination between these sequences when transformed by the lithium acetate
procedure, and thus excise the intervening sequences. Longer repeats have a
higher propensity for recombination: up to 70% deletions were observed with
750-bp-Iong repeats. Recombination apparently takes place during or just after
transformation, since undeleted plasmids are perfectly stable during subse-
quent mitotic divisions. This type of rearrangement was never seen with (cut)
integrative plasmids using the lithium acetate method, or with uncut replicative
plasmids transformed by electroporation. We thus advise the use of the lithium
acetate method for integrative plasmids, and electroporation for uncut replicative
plasmids.
Replicative plasmids provide a limited amplification and/or another genomic
context which may result in strong phenotypic effects: the scr2-Ill3 allele is lethal
as a single copy integrated in the genome, but viable, although thermo sensitive
when plasmid-borne. Several multicopy suppressor genes could be cloned by
using a replicative library to complement chromosomal mutations as diverse as
morphogenesis mutations (Dominguez, unpubl.), regulatory mutations of XPR2
(M. Lambert, unpubl.), suppressor mutations of a 7S RNA defect (Choukri,
unpubl.), or mutations showing colethality with a 7S RNA defect (Boisrame, to be
published).
Replicative plasmids are also useful for the study of essential genes by "plasmid
shuffling" (He et al. 1992). In Y. lipolytica, this procedure is plagued by the frequent
occurence of recombination events between the incoming and the resident plasmid,
resulting in stable cointegrates (Fournier et al. 1993). In order to reduce the level of
recombination, we developed ARS plasmids based on pACYCI84; whereas
cointegrates were present in 1-5% of the transformants when pBR322-based ARS
plasmids were used, this frequency dropped to less than 0.05% when plasmids based
on pINA443 and pINA894 were used (A. Boisrame, to be published).
'-"
~
Pst!
Sail
Xbal
Smal
Xbal(7583) BamHI(1500)
5all(1883) Sall(18oo)
Apal(7181) ,Pst!
Hlndlll
BamHI Notl(2800)
Mlul(6279)
(1900)
EcoRI
Sacl 5all(6300)
Pstl(5492) Smal
BamHI
Xbal
Sall(4300) (2700)
EcoRVINrul(3700)
Mlul(3680)
Fig. 3. Disruption and deletion vectors for creating nonrevertible mutations in the LEU2, URA3, and XPR2 gene
o
I;Q
~
§
Q..
('
Cl
S
~
5.3
Creation of a Set of Nonreverting Markers
In order to create in any genetic background a set of markers suitable for selecting
transformants and devoid of the major secreted protease (AEP), a set of plasmids
has been developed (Fig. 3).
The procedure outlined below has been tested on an industrial strain of Y.
lipolytica (W29, ATCC24060) and on inbred derivatives (Kurischko et ale 1992). A
disruption cassette was first used to replace the wild-type URA3 gene by an XPR2-
SUC2 gene fusion (Sal! fragment of the disruption plasmid pINA302; Fig. 3);
transformants were selected for sucrose utilization (Suc+ phenotype, Nicaud et ale
1989b). All of the wild-type Y. lipolytica strains so far tested are Sue. The Suc+
transformants (l000-2000/pg of fragment) were then screened for the Ura- pheno-
type; 10 to 20% were indeed Ura-, and the presence of the disrupted URA3 copy
(ura3-302) was checked by Southern hybridization.
In order to generate further derivatives of the Ura-Suc+ strains, pINA270 and
pINA322 were constructed: they carry URA3 and either a deleted LEU2 or a deleted
XPR2 gene (Fig. 3). The deletions were successively substituted to the resident
wild-type copies of LEU2 or XPR2 by the following two-step procedure. Ura+
transformants (lOs/mg of plasmid) were obtained with pINA270 cleaved at the
unique Notl site located next to the LEU2 gene. Five transformants were plated (l06
cells per plate) on YNB containing 15mgll uracil, 100mg/lleucine, and 1.25g1l
fluoroorotic acid (5-FOA) to counterselect Ura+ cells. 5-FOAR clones appeared at a
frequency of lO-4/cell plated and were shown by Southern analysis to result from
reexcision of the integrated plasmid; 2% of the 5-FOARclones were simultaneously
Leu- and carried the deleted LEU2 gene (Southern analysis). These strains (Ura-,
Suc+, Leu-) were again transformed to Ura+ using pINA322 cleaved at the unique
MluI site. Reexcision of the plasmid was selected as above, and AEP- derivatives
(33 to 42% by plate assay) were isolated and checked for both LEU2 and XPR2
deletions (Southern analysis).
Using the same procedure, we derived isogenic strains from the industrial
strain W29: P01a (MatA, ura3.302, leu2.270) and P01d (MatA, ura3.302, leu2.270,
xpr2.322). This strain has superior growth capacities and gave better yields of
heterelogous proteins (Nicaud and Tharaud, unpubl.).
A similar procedure can obviously be developed for the creation of other markers.
5.4
Marker Genes and Vectors
5.4.1
Biosynthetic Genes
Cloning of the LEU2 gene of Y. lipolytica in pINA62 has been reported previously
(Gaillardin and Ribet 1987). pINA62 can be targeted to the genome of a Y.
lipolytica leu2 recipient strain at a very high frequency (>10s transformantlpg of
plasmid DNA with a lithium acetate procedure, see Xuan et al. 1988) after linear-
ization by either ApaI, BglII or NotI which are unique in the vector (Fig. lA).
URA3-based vectors were derived from pLD55 (Davidow et al. 1987; see pINA300
in Fig. lA). The LYS5 and ADEl genes/have been occasionally used to disrupt
cloned genes (He et al. 1990; Nicaud et al. 1989a).
A genomic library has been constructed in pINA62 by inserting a Sau3A partial
digest into the BamHI site of pINA62 (Xuan et al. 1988). Linearization of the library
by NotI avoids cutting in the inserts and should generally facilitate use of this
library. Several genes could be isolated from this library, including LYS5 (Xuan et
al. 1988), LYSl (Dominguez, unpubl.), LYCl (Beckerich et al. 1994), and mating
type (Kurischko et al. 1992), and XPR6 (Enderlin and Ogrydziak 1994).
Smaller derivatives of pINA62 carry the 2.2-kb EcoRI fragment encompassing
the whole LEU2 gene (Davidow et al. 1987) and preserve ability to confer resistance
to both ampicillin and tetracyclin; these vectors have been modified to include a
NotI-SfiI linker at the Pvull site of pBR322 (see pINA214 in Fig. lA). This facilitates
targeting to a "landing platform" consisting of a pBR322 plasmid inserted into the
genome of the recipient strain (Davidow et al. 1987; Blanchin-Roland et al. 1994).
Following identification of ARS sequences in Y. lipolytica (Fournier et al. 1991),
vectors carrying ARS3018 or ARSl 068 together with LEU2 or URA3 were developed
(Fig. IB). A gene library in pINA240 was constructed by inserting a Sau3A partial
digest of genomic DNA (size-selected in the 5-kb range) in the BamHI site (Chasles
and Fournier unpubl.). Similar libraries have been built by G. Barth and R.
Rachubinski. Reisolation of complementing plasmids from the yeast trans-
formants can be simply achieved by shuttling back to E. coli (Fournier et al. 1991).
This library is best transformed by electroporation, to avoid deletion in the
plasmids by recombination between direct repeats.
5.4.2
Heterologous Markers and Reporter Genes
Expression of the bleomycin resistance gene from Tn5 under the control of the
LEU2 promoter has been reported (Gaillardin and Ribet 1987): direct selection of
resistant clones was possible on YPD +15mg/1 phleomycin, although only half of
the resistant clones resulted from integration of the vector (remaining clones were
spontaneous resistants). The gene encoding hygromycin resistance gene from
Streptomyces hygroscopus was fused downstream from the XPR2 promoter on both
integrative and replicative plasmids (Fig. 4; Cordero-Otero, unpubl.).
Untransformed control cells yielded less than one hygromycin resistant clone for
108 plated cells (on YPD pH 6.8 containing 100mg/1 hygromycin). Following either
integrative or replicative transformation, resistant clones appeared at a frequency
of 50-100/}1g of input DNA; all expressed a second control marker present on the
plasmid (to be published).
The invertase-encoding gene of S. cerevisiae (SUC2) has been used as a selective
marker (Nicaud et al. 1989b): the SUC2 gene was put under the control of the XPR2
promoter, and directed periplasmic accumulation of invertase, thus allowing Y.
lipolytica to grow on sucrose. Although this selection could be used to select gene
EcoRI(8131)
...?
,Clal(23) Clal(1)
EcoRf(48) EcoRI(25)
pnl(465) pnl(442) ~
(BamHI-BglIl)(565) ~ l~amHI(542) o::::
Sall(577}
,. Pstl(1359)
Clal(975) ~.
BamHI(1686)
~'\ Ndel(1427) EcoRI(1693)
""~ , Hlndlll(1677} Apal(1741) -a:o
Sall(8399) Nsfl(2368)
BamHI/1687 1
EcoR I Mlul EcoRI1694 Nhel(2579) i"
Apal(1742) EcoRI(7949) Mlul(2676)
Cia I Ndel(2360) Sphl(2842)
S·
BamHI NslI(2389)
fiJ'. EcoRI Nhel(2580)
is~Apa I Mlul(2645)
(Sma I) (EcoR V)
Mlu I (BamR I) Sphl(2843)
Sphl
5011(2606)
Pst1(2868)
Hlndl ll(2810)
pR EBS3 BamHl(3236)
(12.5 kb) 5phl(3336)
S. l1(8766) 5al1(3516)
Fig.4. Heterologous marker genes and expression vectors based on either the XPR2 promoter (above), or the LEU2 promoter (below)
VJ
~
disruptions in several wild-type contexts (see Sect. 5.1.3), a frequent problem is

that wild-type strains grow slowly on (impurities of) sucrose plates.
Several bacterial genes have been used as reporter genes: E. coli f3-galactosidase
(Gaillardin and Ribet 1987; Xuan et al. 1990; Blanchin Roland et al. 1994) or {3-
glucuronidase (Bauer et al. 1993; Hamsa and Chattoo 1994), and catechol oxydase
(R. Coredero-Otero, unpubl.). No interfering activity was detected in untrans-
formed Y. lipolytiea extracts, and plate tests exist in all cases to detect expression
at the colony level. Very low levels of the gusA gene product can be detected by a
fluorescence assay, making it suitable for most applications.
5.4.3
Expression and Secretion Vedors
The XPR2 promoter and signal sequence have been used to express and secrete
several proteins (Buckholz and Gleeson 1991). AEP is initially synthesized as a
precursor with a 157 amino acid preproregion, ending with dibasic cleavage site
(LyslS6Arg157; Matoba et al. 1988). Two types of expression vectors were con-
structed, permitting either expression of a cytosolic protein or secretion to the
outside of the cell.
An EeoRI and a BamHI site were created by site-directed mutagenesis just
downstream from the ATG thus generating the structure:
.... ATG.GAA.TTC. AAG.GAT. CCT.. ...
A BamHI deletion was made to remove most of XPR2-coding sequence. The final
expression cassette consists of the XPR2 upstream promoter region from the Mlul
site down to the BamHI site, thus conserving transcription and translation initia-
tion sites, and a 3' region from the BamHI site down to the EeoRI site, thus
encompassing transcription termination signals. This cassette was inserted into a
pBR322 vector carrying a NotI-SjiI linker destroying the Pvull site, a MluI linker
destroying the BamHI site, and the LEU2 marker (see pINA404 in Fig. 4 and
Blanchin-Roland et al. 1994). Derivatives of this construct carry the URA3 gene or
an ARS sequence (Fig. 4). Foreign genes can be spliced in as BamHI fragments.
Genes succesfully expressed include xylE, laeZ, and hph. Integrative vectors can be
targeted either to the XPR2, LEU2, or URA3 loci if unique sites remain in these
sequences, or by NotI/SjiI digestion to a pBR322 landing platform previously
inserted into the recipient strain (Blanchin-Roland et al. 1994).
In order to direct secretion of foreign proteins, vectors carrying convenient
restriction sites downstream from the prepro-sequence of the XPR2 gene were
constructed (Tharaud et al. 1992; Fig. 5). The XPR2 coding sequence was deleted
between the A val site (overlapping the Pro codon, 11 amino acids before the pro-
mature junction) and the KpnI site (overlapping the Gly80 codon of the mature
enzyme) and replaced by the following oligonucleotide:
(C)CG. GA GATT .CCg.GCe. TCT. TCg.gee.GCC.AAG.CGAI.eeegggtggacgtetagaGG-

TAC(C).
EeoRI(1) ....
BamHI p
~
EcoRI(66SS) PslI(6220)
o~
~.
-e=
o
i'
Sail s·
pINA375 pINA376
(7.6 kb) (6.9 kb) PslI
Hindlll(16SO)
EcoRI
Kpnl(4266)
Xbal
Smal
Sfll
Aval(4210)
Fig.5. Vectors for the expression of secreted proteins. The XPR2 promotor and terminator sequences are depicted by black boxes. The region
encoding the AEP preprosequences and C-terminal amibnoacids is indicated by a thick black arrow, interrupted by the polylinker sequence
located at the Xpr6p cleavage site (see text)
'-"
Ul
.....
The polylinker introduces Aval, Sfil, Smal, Xbal, and Kpnl sites (underlined).
In spite of the numerous changes made (indicated by lower letters in the above
sequence), the pro-sequence is conserved up to the Lys-Arg cleavage site (indi-
cated by A/in the above sequence), but for one substitution (Asn to Ala). A mini-
mal terminator sequence was synthesized by PCR from the XPR2 3'-flanking
region: this synthetic fragment carried a Kpnl site just in front of the XPR2 stop-
codon and the first 100 nucleotides of the XPR2 terminator sequence, followed by
a Sal! site. In the final vector (see plNA375 and plNA 376), foreign coding se-
quences can be spliced in between the Smal and Xbal or Kpnl sites, although this
will add one or more extra amino acids after the dibasic cleavage site. Preferably,
target sequences can be spliced into the Sfil site using an adaptor sequence with a
(Sfil compatible) 3' AAG overhang and restoring the correct AEP prosequence up
to the dibasic cleavage site: (TCT.AAT.GCC.AAG.CGA/etc). Integrative plasmids
can be targeted to the host strain XPR210cus by Mlul digestion. The heterologous
products should at best be secreted as mature proteins, after proteolytic removal of
the AEP prodomain by the host dibasic endoproteinase Xpr6p. These construc-
tions have been used to drive secretion of porcine a-interferon (Nicaud et al. 1991)
and of human coagulation factor XIIIa (Tharaud et al. 1992). Similar constructs
were used to express bovine prochymosin and human tissue plasminogen activa-
tor (Buckholz and Gleeson 1991). Except for the case of human coagulation factor
XIIIa (a protein which is not normally secreted by a signal peptide-dependent
pathway and which was retained intracellularly and degraded), all other proteins
were correctly matured and efficiently secreted. Hepatitis B virus middle surface
antigen has been expressed using a fusion to the AEP signal peptide and part of
pro-sequence (Hamsa and Chattoo 1994): expression was growth-regulated and
directed intracellular accumulation (presumably in the lumen of the endoplasmic
reticulum) of preS2-HBsAg assembled into Dane particles (up to 2.35% of total
soluble intracellular protein).
A LEU2-based expression vector has been constructed by Bauer et al. (1993). An
A to C mutation was created at position -1 from the ATG to create an Neol site (the
effect of this mutation has not been evaluated, but see Sect. 4.2.6) and the EeoRI
site upstream from the LEU2 promoter was replaced by a HindlII site, so as to
create a portable LEU2 promoter on a HindIIl-Neol fragment. Similarly, the Apal
site downstream from the coding sequence was replaced by a BamHI site, an Neol
site normally present within the 3' polyadenylation signal was destroyed, and the
EcoRI site located further downstream was replaced by a HindlII site, so as to yield
a portable LEU2 terminator on a BamHI-HindlII fragment (Bauer et al. 1993; Fig.
4).
5.4.4
Vectors for Multicopy Integration
Plasmids like plNA774 or plNA970 (Fig. 6) carry a defective URA3 marker from
which the entire promoter sequence has been deleted except for 6 bp upstream
from the ATG. Transcription is driven from unknown adjacent sequences, and is
...?
~
o~
~.
'S.
Safl(1400) o
Mtul(6270)
pINA774
-i"
Smal(1770) S·
6.9 kb pINA970 Pstt(1990)
' Hindttt(2000)
Pstl(5550) 7.7kb
Pvutt(4644)
Fig.6. Vectors for multicopy integration. They carry a defective URA3 marker and a fragment of repeated DNA, originating either from rDNA (left)
or from the yltl transponson (right)
V.l
V1
V.l
probably very dependent on the vector context: whereas single-copy Ura+

transformants have never been observed with either vector, copy numbers ob-
served are in the range of 40-60 with pINA774 (a pINA773 derivative carrying the
XPR2 gene) and of 5-15 with pINA970 (Le Dall et aI. 1994, and unpubl. results).
Less defective URA3 promoters are available, which give a lower amplification (Le
Dall et aI. 1994).
A nonleaky, nonreverting ura3 strain is required, such as strains from the E129
series or similarly derived strains (see Sect. 5.3). Vectors like pINA774 have to be
linearized by SadI to target the plasmids to the rDNA units. Transformants appear
after 5 to 20 days at a frequency of 1O-50/f.lg of input DNA (vs. 104 for a
nondefective plasmid). Vectors like pINA970 can be linearized by NotI to be
targeted to zeta sequences. Transformants appear at a frequency of 50-100 after 5
to 15 days in this case. There is apparently no correlation between the delay of
transformant appearance and copy number.
Stability of the transformants is likely to depend on the nature of genes inserted
into these vectors: introduction in rDNA-based vectors of an expression cassette
under the control of the XPR2 promoter rapidly destabilized high copy number
transformants under induction conditions (Le Dall et aI. 1994). It may be advisable
to use rDNA-based vectors for amplification of poorly expressed gens, and zeta-
based vectors (or rDNA-based vectors with less defective URA3 promoters) for
highly expressed genes.
The structure of the integrants and their copy number are determined by peR
or Southern hybridization (Le Dall et aI. 1994).
6
Media and Culture Conditions
6.1
Media
6.1.1
Complete Media
Yeast Extract - Peptone - Glucose - Medium (YPD)

Yeast extrace 10 gil
Bacto peptone 20 gil
Glucose 20 gil
Yeast Extract - Malt Extract - Peptone - Glucose - Medium (YMG)

Yeast extract 3 gil
Malt extract 3 gil
Bacto peptone 5 gil
Glucose 10 gil
10. Yarrawia lipolytica 355
6.1.2
Synthetic Minimal Media
Yeast - Nitrogen - Base - Medium (YNB) (DIFCO)

YNB 6.7g1l
Different concentrations of carbon sources are recommended:
Glucose 1O-20gl1 (up to 100 gil can be used)

Sodium acetate 4 gil (higher concentrations reduce growth,
toxic above 10 gil), addition of 0.05 M
phosphate buffer of pH 5 is recommended
Ethanol up to 3% (higher concentrations are toxic)
n-Alkanes, fats, and fatty acids have no toxic effects and can therefore be also used
at high concentrations. Emulsifiers like Brij 58 or Tween can be added but are not
necessary because Y. lipolytica secretes very efficient bioemulsifiers.
Minimal - Medium with Thiamine (MMT)

Some strains of Y. lipolytica grow slowly in YNB, therefore this medium is recom-
mended to obtainlhigher growth rates.
NH4H 2P04 5 gil
KH2P04 2.5 gIl
MgS04 X 7H20 1 gil
Thiamine x HCI O.3mgll
Solution of trace elemets Iml
Solution of trace elements (mg in 100 ml):
Ca(N0 3 )2 x 4H 2O 2000
FeCl3 x 6H 2O 200
H 3B03 50
CuS0 4 X 5H2O 10
MnS04 x 4H2 0 40
ZnS04 x 7H 2 O 40
NazMo0 4 20
CoCl2 10
KI 10
Addition of carbon sources as recommended for YNB.
The pH value should be adjusted at 6 for most carbon sources, but at pH 4 for
acetate or fatty acids (or strongly buffered at pH 6 with phosphate buffer).
Sometimes, problems occur with strains harboring multiple amino
acid auxotrophies: use of 0.1% glutamine as N-source is recommended in such
cases.
6.1.3
Conjugation Media
Highest conjugation frequencies are obtained in liquid or on solid YM without

glucose (Barth and Weber 1984). Addition of 0.05% sodium citrate increases
slightly the conjugation frequency (Weber et al. 1988).
Yeast extract - malt medium (YM)

Bacto-peptone 5 gIl
Bacto-yeast extract 3 gIl
Malt extract 3 gIl
Bacto-agar 20 gil
6.1.4
Sporulation Media
Sporulation can be induced in a variety of liquid and solid media. However, the
medium of choice for induction of high frequency of sporulation depends on the
strains used.
Sporulation of diploid cells can be induced on commercially available V8 me-
dium or on YM (Gaillardin et al. 1973).
High sporulation frequency is induced by YNB or MMT containing 1.5% so-
dium citrate (citrate sporulation medium = CSM). Lower or higher concentrations
of sodium citrate reduce the sporulation frequency dramatically (Barth and Weber
1985).
Reduced aeration or temperatures above 30 DC decrease sporulation frequency.
6.1.5
Special Media
Liquid Medium for Protease Induction

Strains are grown in late exponential phase with good aeration at 23 DC on YPDm:
Proteose peptone 50 gIl
Yeast extract 10 gil
Glucose 1 gil
Na citrate buffer 0.2M pH 4.0 for acid protease
Na2HP0 4, KH 2P04 50mM pH 6.8 for alkaline protease
Induction starts around 2-3 OD 600nm. Maximum levels are reached after 24h
(around 18 OD 600nm).
Skim-Milk Complete Medium (Alkaline Protease)

Dissolve 109 Difco skim milk in 60rnl Na phosphate buffer O.IM pH 6.8. Heat for
lOmin in a boiling water bath and repeat after waiting 24h at room temperature.
Dilute this solution ten times in the following sterile medium kept at 4S DC: to
480 ml of YNB solution (1. 7 gil YNB without amino acids and without ammonium
sulfate, 20g/1 agar, amino acids as required for auxotrophies), add solution A and
60 ml O.S M phosphate buffer pH 6.8.
Positive clones form clear halos on a white background.
This medium can also be used to quantitate AEP activity from supernatants:
omit YNB in this case, add 2 mM final sodium azide and pour into petri dishes.
Take care to have all plates contain the same volume of medium (IS ml).
Punch holes in the agar either with a Pasteur pipette (large end) or with a 200.u1
micropipette tip. Make 20 holes in a 90 mm dish.
Put 1O-20.u1 of (diluted) supernatant in the holes. Examine after 12 and 24h.
Bovine Serum Albumin Medium (Acid Protease)

Same as skim milk, except for buffer (use sodium citrate pH 4.0 in this case and for
protein source use 2% BSA).
a-Naphthyl Phosphate Medium (Acid Phosphatase)

Use phosphate-depleted YPD medium (Rubin 1974) or YNB-glucose with 30mg
(LP 30 ) or 10mg (LP IO ) KH 2POil. The major acid phosphatase is fully derepressed
on LP IO , whereas Ph02p is significantly derepressed on LP 30 •
Colonies grown on these media can be stained for APase activity as follows.
Make patches on LP 10; when grown up, gently pour S ml of an overlay of soft agar
(1%) containing (per ml) 0.2mg of a-naphtylphosphate and 2mg of Fast Garnett
GBC salts (Sigma) in O.OS M acetate buffer pH4.0.
Colonies stain yellowish to dark brown, depending on the activity.
RNase Medium
Plate tests:
Glucose 10g/1
Difco proteose peptone 4 gil
Sigma type V yeast RNA 2g/1
KH 2P0 4 l4Smgli
MgS0 4,7HP 400mg/1
CaCI2,2H20 lSOmg/1
NaCI 100mg!1
Thiamine lmg/l
Agar lSg!1
Citrate-phosphate buffer pH s.o SOmM
RNA is solubilized by adding 1 M NaOH until the pH is between S and 6. Plates are
inoculated with a toothpick and incubated 48 h at 2S dc. They are then overlaid
with 0.1% toluidine blue. RNase-positive colonies are surrounded by a pink halo
on a blue background.
Liquid medium for RNase production:

Same as for protease induction (see Cheng and Ogrydziak 1986)
Lipase Induction Media
Lipase-positive clones are able to grow and form clear halos on YNB medium with
tributyrin (lOrol/l) as sole carbon source (Nga et al. 1988). Faster growth is ob-
served if 10 gIl glucose is present, lipase-positive clones are distinguished from
negative ones by the presence of halos.
Liquid media containing olive oil as inducer have been used for production and
purification of lipase (Gomi et al. 1986).
Mycelial Induction Medium

Cells of Y. lipolytica are harvested by centrifugation from a glucose containing
medium (YNB or MMT + 1% glucose) during the logarithmic phase of growth
at 28°C (about 10 to 14h of growth), resuspended in water and cooled down to
4°C for at least 15min. The cells are then heat-shocked by inoculating 1-5 x
106 cells/ml into prewarmed (30°C) YNB containing 50mM sodium citrate pH 6.0
as buffer and 1% N-acetyl-glucosamine as carbon source. The culture is then
incubated at 30°C.
5-Fluoroorotic Acid-Containing Medium (5FOA Medium)

Ura-clones are positively selected on YNB medium containing
Uracil 15mgll
5-Fluoroorotic acid 1.25 gIl
Leaky Ura- clones are killed on such a medium. For an unknown reason, direct
selection of spontaneous ura3 mutants could not be achieved on this medium
from various wild-type strains, but it worked well for selecting ura3 disruption
or deletions in the same strains following transformation (see Sect. 9.1). A maxi-
mum of 106 - 107 cells have to be plated on 9cm 5-FOA plates, higher densities
result in high background growth. If background growth occurs, replica plating
on a fresh 5-FOA plate can be done to rescue the Ura- clones. The selection does
not work well at temperatures below 20°C, although raising the pH to 6.8 helps
somewhat.
6.2
Temperature
Most strains of Y. lipolytica grow only up to 34°C, but there are some strains which
are adapted to higher temperatures (Blagodatskaya and Kockova-Kratochvilova
1973; Barnett et al. 1990). The recommended temperature for growth is 25 to 30°C.
Induction of sporulation is highest at 23 °C. Conjugation and sporulation frequen-
cies are highest at 23 to 28°C, but decrease strongly above 30°C.
AEP productivity is highest at 23°C and decreases when temperature is in-

creased (Dedeoglu and Ogrydziak., unpubl.).
6.3
pH Values of the Growth Media
Most strains of Y. lipolytica tolerate well low pH values down to pH 3, but growth
is reduced above pH 7 and stops above pH 8. Therefore, addition of buffer with a
pH lower than pH 7 or low pH values (pH 3.5 to 4) of the medium at the beginning
of the cultivation are recommended for utilization of carbon sources such as
acetate.
6.4
Aeration
Y. lipolytica is an obligatory aerobe and cannot grow or ferment without oxygen.

Low oxygen pressure reduces the growth rate strongly. Therefore vigorous shaking
of batch cultures or high oxygen supply in fermentors is recommended. However,
development of foam may occur, especially during cultivation in complete media
like YEPD. This has to be inhibited, because cells of Y. lipolytica migrate rapidly
into the foam, thus reducing the yield. Addition of small amounts of oil efficiently
reduces the formation of foam.
6.5
Conservation of Strains
Cells of Y. lipolytica die without oxygen. Therefore strains of this fungus cannot be
stored for a longer period under paraffin-closed tubes, or on plates which are
closed by parafilm, or in closed plastic bags. However, strains of Y. lipolytica can be
sent out in sealed tubes because they survive for short periods (up to 1 month)
quite well.
6.5.1
Conservation with Glycerol
A culture of Y. lipolytica cells from the mid logarithmic growth phase is mixed with
sterilized glycerol at a final concentration of 25 to 50% in a plastic tube. Tubes are
stored at -70 to -80°C.
6.5.2
Liquid Nitrogen and Freeze-Drying Preservation
Culture. After subcloning on solid YPD, one colony is pregrown in 2 ml ofYM liquid
medium for 24h at 28°C under aeration (Cl culture); 25ml of fresh YM medium are
inoculated with O.5ml ofCl culture, and grown at 28°C under aeration for 24h. Cells
from this culture (C2) will be preserved by freezing and freeze-drying.
Freezing (following Daggett and Simione 1987). Ten ml of the C2 culture are
mixed with 2.5 ml of fresh YM medium containing 50% of glycerol (final glycerol
concentration 10%).
The mixture is dispensed in ten cryotubes and chilled at 4 DC for 1h. The tubes
are frozen in the Nalgene cryobox at -80 DC in order to obtain a temperature
decrease of -1 DC per min. The tubes are then preserved in liquid nitrogen at -
150 DC.
Freeze-drying (following Berny and Hennebert 1991). Eight ml of the C2 culture
are centrifuged at 4000 rpm for 5 min and cells are suspended in 2 ml of the follow-
ing mixture: 10% skim milk, 5% honey, and monosodium glutamate 5%.
The suspension is chilled at 4 DC for 1 hand 0.1 to 0.15 ml of cell suspension are
dispensed in glass tubes.
After being capped with cotton, the tubes are frozen at -80 DC for 1 h. Freeze-
drying is performed in a Virtis 12 EL freeze-dryer for 5 h. The temperature at the
begining is about -40 DC and rises to 20 DC at the end. Tubes are sealed under
vacuum and stored at 4 DC in the dark.
7
Genetic Techniques
7.1
Mutagenesis
7.1.1
UV-Light Mutagenesis
Cells are grown for 22 h in YPD, 1 ml harvested by centrifugation (6000 g, 5 min),

washed once with water, and resuspended in water at a cell density of about 5 x
103 cells/ ml.
Ten ml of this suspension are given in a Petri dish and are exposed to UV light in
the dark. Normally, UV light of 80 to 120 J/m2 inactivate about 50% of the cells of
a haploid strain; 30 to 40% inactivation is recommended for efficient selection of
single-site mutants.
After irradiation, cells are plated onto YEPD plates (100 and 10 J1l per plate) and
incubated for 2 days at 28 DC in the dark. Colonies should be not too big before
replica plating otherwise it is more difficult to transfer them.
YEPD plates are replica-plated onto selective media and incubated at 28 DC or 32-
34 DC (for selection of its mutants).
7.1.2
N-Methyl-N'-Nitro-N-Nitroso-Guanidine (MNNG) Mutagenesis
Cells of Y. lipolytica are harvested by centrifugation after cultivation in YPD

overnight, washed once with water, and resuspended in 0.9% sodium chloride
soultion at about 2 x 107 cells/ml.
MNNG is added at a final concentration of 125 jig/mI.
The suspension is shaken at 28°C for 40 min.
Cells are harvested by centrifugation, washed once with water, resuspended in the
same volume of water, and diluted 10 and 100 times.
One hundred jil of the diluted suspensions are spread on YPD plates. Plates
are replica-plated onto selective media after 2 days of incubation at 28°C. The
frequency of survival cells is about 1-5%.
7.1.3
Enrichment of Mutants by Nystatin
This method can be used for enrichment of spontaneous mutants or concentration

of mutants after mutagenesis.
Cells are cultivated overnight in YPD (for 16h), harvested by centrifugation,

washed, and transferred into nitrogen-free MMT + 1% glucose. For enrichment
of mutants defective in utilization of certain carbon sources, glucose has to be
replaced in the minimal medium by the corresponding carbon source.
The culture is shaken at 28°C for 8 h to deplete metabolic pools. After 8 h, a

sterile solution of ammonium sulfate is added at a final concentration of 5 gil.
Cultivation is continued until growth has resumed (about one doubling), which
normally takes 4 to 10 h. Alternatively, we found it convenient to let the culture sit on
the bench at room temperature overnight and to shake it for 2h at 28°C before
nystatin addition.
Nystatin is added to a final concentration of 15 jig/mI from a stock solution (1 mg/

ml in ethanol).
The length of the nystatin treatment (usually 1.5 h on MMT -type media) has to be
adjusted to the growth rate of the strain on the selective medium: optimal results
are obtained if the treatment is carried out for about one doubling of the culture.
Survival should be lower than 10-4 after this step.
If required, the whole treatment can be repeated to further enrich for mutants.
Serial dilutions of the washed suspensions are made in 0.8% NaCI-20% glycerol
and plated on YPD plates. Dilutions can be stored at -80°C until colonies on the
YPD plates can be counted; additional samples of the frozen suspension can then
be plated (we routinely observe about 90% survival in the frozen samples).
In order to select independent mutants, we usually treat 10-20 cultures in parallel.

Five mI of cells can be conveniently grown in 25 ml Corex tubes, slanted to facilitate
washing, which are rotated at 28°C.
7.2
Mating and Sporulation
7.2.1
Conjugation on Solid Medium
Strains of opposite mating type and complementary auxotrophic requirements are

streaked onto YPD plates. These plates will be incubated for 1 day at 28 DC.
A loop of cells is transferred onto a fresh YPD plate, so as to form a line across the
plate. Strains of identical mating type are streaked on parallel lines across the same
plate. A maximum of five strains can be put on one plate. The plates are incubated
for 18 to 21 h (important for high conjugation frequency) at 28 DC.
Two YPD plates containing strains of opposite mating type are replica-plated
crosswise onto one YM (without glucose) plate. This YM plates do not longer
incubate than 24h, as zygotes of some strains die fast after 24h of incubation on
YM. The YM plate is replica-plated onto a plate of selective minimal medium.
Diploid colonies can be harvested from the cross points of the strains from these
plates after 3 days of incubation at 28 DC.
7.2.2
Conjugation in Liquid Medium
Strains of opposite mating type are separately inoculated into 10 ml of YPD and
shaken at 28 DC for 1 day.
Of these cultures 0.1 ml is transferred into 10 ml ofYPD and shaken at 28 DC for 18
to 21 h. This time is strain-dependent and has to be checked carefully to obtain
high frequency of conjugation.
One ml of each culture is taken, centrifuged (6000g, 3min) and resuspended in
1 ml YM without glucose (about 1-2 x 107 cells/ml). However, weakly conjugating
strains should be mixed at higher cell densities (up to 1 x 108 cells/ml). One ml of
each strain of opposite mating type is mixed together with 8 ml YM without
glucose in a flask and shaken at 28 DC.
Zygotes can be selected after about 16h. High numbers of diploid cells can be
isolated by plating the conjugation mixture onto selective medium until24h after
mixing the strains. After this time, the number of colony forming zygotes de-
creases in some strains.
7.2.3
Sporulation
Sporulation of many diploid strains can be efficiently induced by transferring the

cells onto solid CSM or into liquid CSM. The percentage is higher and sporulation
occurs more rapidly at 23 DC than at 28 DC. Cells can be precultivated in YPD or in
synthetic media until the beginning of the stationary growth phase. Cells grow only
slowly in CSM, therefore inoculation of about 2 to 5 x 107 cells/ml is recommended.
Well-sporulated cultures can be easily detected by a brownish color, which is
different from the white or cream-like color of unsporulated cultures. Asci con-
taining up to four spores occur after 3 days. After 4 days the cultures should
be stored at 4°C, otherwise the asci start to disrupt and the spores are relased
spontaneously.
For an unknown reason, some diploids fail to sporulate on CSM; sporulation in
this case can be obtained on V8 or (to a lesser extent) on YM. Asci take more time
to develop on V8 (usually 1 week or more).
7.3
Isolation of Ascospores
In the case where analysis of meiotic recombination is the aim, it is best to induce
sporulation immediately after isolating the diploid, because some diploid strains
are unstable during storage.
7.3.1
Random Spore Selection Using Nystatin
Sporulated strains are transferred into 10ml offresh YPD medium. In the case of
cells taken from solid sporulation medium, sterile glass beads should be added to
disperse cell aggregates, or the suspension may be briefly sonicated. The YPD
culture is shaken for 2 h at 28°C to activate vegetative cells without inducing
germination of spores. Some drops of 0.1 M HCl are added to adjust the pH to 4.5
to 5.0. 0.25 ml of the nystatin stock solution (I mg/1 ml ethanol) is added and the
incubation at 28°C is continued for another 1.5 h.
Cells and spores are harvested by centrifugation (6000 g, 5 min), washed twice with
water and resuspended in the Helicase solution (200mg/7ml water). This suspen-
sion is shaken for 1 h at 28°C. Cells and spores are collected by centrifugation
(6000g, 5 min), washed twice with water, and resuspended in 5ml MMT or YNB.
The suspension is sonicated (4 x lOs) and then plated onto YPD plates (dilutions
from 10-1 to 10-4, depending on the sporulation frequency and germination of
spores).
After 2 days' incubation at 28°C, the YPD plates are replica-plated onto selective
medium to check the genotype of the spores. Surviving diploid cells can be de-
tected by replica plating of the YPD plates onto CSM plates. Diploid cells with form
brownish colonies after 3 days at 23°C.
7.3.2
Micromanipulation
Dissection of ascospores can be done as described for S. cerevisiae. Pretreatment of

the sporulated culture with glusulase or zymolyase lOOT (Miles) to break up the
walls of the asci is strongly recommended. Note that some strains (E129 series) do
not require enzymatic pretreatment (which actually rapidly kills cells and spores),
since asic break up easily. For some strains, asci are easier to dissect after storage
of the sporulated cultures in the cold for one day at least. Some strains form
spherical spores and are easier to dissect than helmet-shaped spores (Barth and
Weber 1985).
Spore viability in highly inbred lines is in the range of 75-80% (Ogrydziak 1988a).
For a still unknown reason, maybe the presence of several clusters of ribosomal
RNA genes (see above), this frequency could not be increased until now.
7.4
Use of Dimethylformamide to Induce Chromosome Loss
(This procedure was kindly communicated by Dr. J. De Zeeuw.) Initial attempts

were made to adapt to Y. lipolytica the benzimidazole-2yl-carbamate (MBC) pro-
cedure used to induce chromosome loss in S. cerevisiae. It became apparent that
dimethylsulfoxide (DMSO), used for solubilization ofMBC, itselfinduced chromo-
some loss. Since Y. lipoiytica metabolizes DMSO and generates a bad odor, other
solvents were surveyed. Dimethylformamide (DMF) which is not metabolized, has
a high boiling point, and is freely miscible with water, was selected.
A single colony of the diploid is inoculated in 10m1 of YPD medium and grown
overnight. The cell pellet is resuspended in YPD at a density of 10 Klett Units. Ten
m1 ofthis suspension is shaken until the Klett reading reaches 50 (about 5h), then
250 ml of DMF are added. Shaking is resumed for an additional 20 h. About 50 to
95% of the cells die during the treatment. Cells are centrifuged, washed, resus-
pended in 1Om1 offresh YPD, and allowed to grow for 24h.
Suitable dilutions are plated on minimal supplemented medium or on YPD con-
taining phloxine B (25 mgtl) and incubated for 3-5 days. Strains having suffered
chromosome loss (10-60% depending on the diploid and markers) yield small,
smooth, deep red colonies among a background of rough, large, and pink-white
colonies of the parent. Candidates are tested for uncovering of parental markers.
Mitotic conversions (l-3%) are eliminated by determining the mating-type status
of the putative segregants.
8
Methods of Cell Biology (Structural Studies>
8.1
Available Antibodies
Below follows a list of antibodies which have been successfully used to detect
proteins of Y.lipolytica on Western blots or to label cellular structures. Antibodies
are listed in Table 4 according to the main cellular compartment where their target
protein is (supposedly) localized.
Table 4. Antibodies used in Western blots or the label cellular structures of Y. lipolytica
Compartment Antigen Origin of Reference

of the cell antigen
Cytoplasm Phosphoglycerate S. cerevisiae Unpubl.

kinase
Peroxisomes Isocitrate lyase Y. lipolytica Barth,unpubl.
Thiolase S. cerevisiae Berninger et aI. (1993);
Barth, unpubl.
Pay4p Y. lipolytica Nuttleyet aI. (1993)
anti-SKL Synthetic NuttIey et aI. (1993)
Mitochondria Glycerolphosphate
acyltransferase Unpubl.
Endoplasmic 226p Y. lipolytica Boisrame, unpubl.
reticulum Kar2p S. cerevisiae Unpubl.
AEP Y. lipolytica Matoba et aI. (1988);
Fabre et al. (1991)
Golgi Secl4p S. cerevisiae Lopez et aI. (1994)
Kex2p S. cerevisiae Lopez et al. (l994)
Cell wall AEP Y. lipolytica See above
Acid phosphatase Y. lipolytica Lopez et aI. (1988)
Nucleus Asr1p-IacZ Hybrid prot. Barth, unpubl.
8.2
Immunofluorescence
1. Grow cells in 20ml medium until a density of 1-2 x 107 cells/ml.

2. Add 2.5 ml of 1 M phosphate buffer (pH 6.5) and 2.5 ml formaldehyde (37%).
Incubate at room temperature for 2h (shake gently).
3. Cetrifuge at 3000g (5 min). Wash pellet 3x with 10ml SP. Resuspend in Iml
SP/3.
4. Add 25.uI of freshly dissolved Zymolyase 20T (15 mg/ml SP /3) and 50 jlJ
Glusulase. Incubate at 37°C for 1 to 1.5h (shake gently).
5. Harvest cells by centrifugation (2000g, 10min). Wash pellet with 3ml SP and
resuspend in 0.5 ml SP.
6. Transfer 10,111 of fixed cells onto glass slides (multiwell slides are recom-
mended). Slides have to be covered before with poly-L-lysine in the following
way. Wash slides with absolute ethanol. Add lOml poly-L-lysine (1 % in water)
to each well, wait lOs, aspirate, and let dry. Wash 3x with water, let dry
completely.
7. Let cells settle down and adhere for 15-30 min. Slides should be kept in a
humid chamber at room temperature during this time and for following steps.
8. Rinse 3x with PBS (do not let the cells dry).
Cover cells with 10 ml PBT and incubate for 5 min at room temperature.
9. Remove PBT and add 10 JII primary antibody diluted in PBT (check
suitable dilution). Incubate for 30-60 min at room temperature.
Rinse lOx with PBT.
10. Cover cells with 10 JII fluorochrome-conjugated secondary antibody diluted in
PBT [a 1 :200 dilution of rhodamine conjugated F(ab)2 fragment goat anti-
mouse IgG is often used]. Incubate for 30-60 min in the dark.
11. Aspirate the secondary antiserum and rinse lOx with PBS.
12. Place 5 JII mounting solution (1% n-propyl gallate) protect against
photobleaching and cover with coverslip. Seal with clear nail polish. Slides can
now be stored at -20°C in the dark for months.
View with fluorescence microscope equipped with proper filters.
Solutions
1 M phosphate buffer 46.6mll M K zHP0 4
53.4mllM KH zP0 4
SP 1.2 M sorbitol
0.1 M phosphate buffer
SPf3 SP + 20mM f3-mercaptoethanol
PBS 53mM Na2HP0 4
13mM NaHzP0 4
75mM NaCI
PBT PBS
1% bovine serum albumine
0.1% Triton X-IOO
0.1% NaN~
8.3
Embedding, Thin Sectioning, and Immunogold Labeling
We have obtained best results for immunogold labeling by using LR white resin
with the method of R. Wright (Univ. of California, Berkeley).
Embedding
1. Transfer cells into microfuge tubes. Resuspend for fixation in PBS containing
formaldehyde (3%) and glutaraldehyde (0.2%). Incubate 2h at RT or over-
night at 4°C.
2. Wash 3x with 1 ml PBS at RT. Resuspend in 1 ml PBS containing 1% sodium
metaperiodate. Incubate 30 min at RT.
3. Wash 3x with PBS. Resuspend cells in 1ml PBS with 50 mM NH4Cl.

4. Wash 3x with PBS.
5. Embed in 3% low gelling agarose + 100,ul/ml beads. Mix well with a tooth pick.
Let solidify on ice and cut in small pieces.
6. Transfer pieces into a glass vial, add 50% ethanol, cap vial, and place it on a
rotating drum for 30 min. Continue dehydration as follows.
7. Replace liquid by 75% ethanol for 60 min.
8. Replace by 90% ethanol for 60 min.
9. Replace by 100% ethanol for 60 min two times.
10. Replace by a 2: 1 mixture of ethanol/LR white resin for 60 min.
11. Replace by a 1 : 1 mixture of ethanollLR white resin for 60 min.
12. Replace by a 1 : 1 mixture of ethanollLR white resin. Remove the cap of the vial
and leave it overnight on the rotating drum to evaporate the ethanol.
13. Replace by LR white resin for 60 min.
14. Replace by fresh resin and let stand under vacuum for 15min and without
vacuum for 60 min.
15. Replace the resin and let stand for 1-2h under vacuum.
16. Transfer the pieces into gelatine capsules containing some resin. Let stand
under vacuum for 15 min. Cover samples with an aluminum foil and let
polymeri for 2 days at 45-S0°C.
Preparation of grids (nickel grids are recommended), sectioning, and section
mounting are done with standard procedures.
Immunolabeling should be done with affinity-purified antibodies. Depletion of the

serum with the cell extract of a "null" -mutant sometimes gives satisfactory results;
however, very often causes severe problems in interpretation. Background staining
of the cell wall, vacuole, and nucleus are especially problematic. Therefore, special
care has to be taken to include proper controls (labeling sections in the absence of
primary antibody; labeling of a "null" -mutant; using preimmune serum in the
primary incubations; reproducibility of results).
Use a petri dish of sufficient size to contain all the grids and all the solution
droplets. Place a padding of paper towels into the bottom of the dish and thor-
oughly wet to maintain humidity throughout the labeling steps. The surface should
be fairly fiat.
Onto the wet pad, a length of Parafilm is positioned. Across the top of the Parafilm,
four sticky dots are also positioned. The first and third represent the position
where droplets of blocker will be placed. The second is the position is the position
of the primary antibody (10) and the fourth is the position of the gold-conjugated
secondary antiserum (2°). It is good practice to do duplicates of each incubation,
so that a backup is available if technical problems occur.
Solutions
PBST: 140mM NaCI, 3mM KCI, 8mM Na2 HP0 4 , 1.5mM KH 2P0 4 , and 0.05%
Tween-20.
Blocker. PBST containing 2% ovalbumin. Solution can be prepared, filtered,
aliquoted, and stored frozen at -20°C. If the blocking solution has been frozen, it
has to be refiltered before use.
Glass-distilled water of high purity has to be used and solutions are filtered
through a 0.22,um filter before use. Both 1° and 2° are diluted into blocker. The
dilution factor for the 1° must be empirically determined, using a dilution series.
The gold-conjugated 2° should be adjusted to A525 = 0.3 for 15nm particles and to
A525 = 0.13 for 5-lOnm particles.
Labeling
Blocking. Place 20,u1 droplets of 2% ovalbumin in PBST in the appropriate position
on the parafilm sheet. Submerge the appropriate grid into the solution and allow to
incubate for 15 min at RT. Submerging is preferable to floating since it will allow
labeling of exposed antigen on both sides of the section.
Incubation in primary antiserum. Remove the grid from the blocker, touched to a
Kimwipe to removed excess fluid. For this and subsequent blottings, the forceps
tip and grid should be held sideways on the tissue surface, so that fluid between the
forceps tips is also removed. This step should be done rapidly, not allowing the
sections to dry.
Submerge the grid in a 20-,u1 droplet of diluted 1° antiserum. Length of incubation
is probably a matter of convenience; 2-h incubations at RT or overnight incuba-
tions at RT or 4°C have been successful.
Washes. Perform in the wells of porcelain or glass spot plates. The wells
are marked and filled with PBST, and the spot plate is placed in an orbital shaker.
Submerge the grid in the appropriate will. The shaker is adjusted so that the
solution moves as rapidly as possible without spilling out of the well (5 min).
Remove the grid, blot, and transfer to the next well. A total of3 washes (each 5 min)
are performed and the grid is blotted and transferred to a second droplet of
blocker (IS min).
Incubation in secondary (gold-conjugated) antiserum (2°). Blot the grid and trans-
fer to the diluted 2°. Incubate the grid for 1 hat RT and then wash as above.
After the final PBST wash, wash the grid in distilled water by dipping 10 times with
rapid up and down motion in a 5-ml beaker of water. This wash removes salts that
would crystallize on the section. The grid is blotted on a Kimwipe, transferred to a
labeled silicon mat, and allowed to air-dry.
View in the electron microscope.
9
Methods of Molecular Biology/Gene Technology
9.1
Transformation Systems
The protoplast method, initially used for transformation (Gaillardin et al. 1985)
has been superseded by the following methods.
9.1.1
LiAc/LiCI Method
Competent Cells
1. Inoculate in the morning one loop of cells in 5 ml ofYPD pH 4 in a 100-ml flask
(YPD pH 4.0 is 1% yeast extract, 1% bactopeptone, 1% glucose, 50 mM citric
acid-Na citrate pH 4.0). Shake at 28°C. Count the preculture in the evening and
inoculate 10ml of culture on YPD pH 4.0 at lOscells/ml from the preculture in
a 250-ml flask. Grow overnight at 28°C.
2. Harvest the culture between 9 x 107 and 1.5 x 108 cells/ml. This density is critical!
When proceeding with a new strain, it is best to inoculate three overnight
cultures at 5 x 104, 1 x 105, and 2 x lOscells/ml, and to take the best one in the
morning.
3. Spin and wash twice the cells in 10 ml TE. Resuspend the cells at 5 x 107 cells/ml
in 0.1 M Li-acetate pH 6.0 (adjusted with acetic acid) and incubate 1 h with
gentle shaking at 28°C. Spin and resuspend in one tenth of the volume or
around 5 x 10Bcells/ml in LiAc buffer.
Storing of Competent Cells

Competent cells can be stored for a week at 4°C, spin and resuspend them before
use. Long-term conservation of competent cells is achieved by adding 25% glycerol
(final cone.) to cells in LiAc buffer and freezing at -80°C. Thaw on ice when
needed, and wash once in LiAc before use.
Transformation
On ice:
1. Put 5 f.ll of carrier DNA at the bottom of a 5-ml test tube (carrier DNA is salmon
sperm DNA, 5mg/ml in 50mM Tris, 5mM EDTA, pH 8.0, sonicated in the 500-
bp range). Put 200 ng of transforming DNA in 1-5 J1l (restriction enzyme buffer
does not hurt). Add 100 f.ll of competent cells, gently mix cells and DNA, and
incubate at 28°C for 15 min.
2. Add 0.7 ml of 40% PEG4000 (solution done in 0.1 M lithium acetate, adjusted to
pH 6.0 with acetic acid).
3. Incubate for 1 hat 28°C, with shaking (we use a rotary shaker set at 250 rpm).
4. Heat shock the mix at 39°C for 10min.

5. Add 1.2 ml of 0.1 M lithium acetate buffer pH 6.0.
6. Platce very gently 200.uI on selective medium.
7. Transformants appear after 2 days and can be counted after 4 days.
Comments
Effect of the pH of the culture. We have tested from pH 6.8 to 3.9 and found
increasing values of transformation frequencies with decreasing pH.
Transformation frequency is ten times higher with a cell density of 5 x 107 cells/
ml during treatment with LiAc than at 5 x 108 cells/ml. The number of
transformants increases in a linear way according to the number of cells mixed
with the transforming DNA, up to 108 cells, where an abrupt drop is observed. We
therefore chose to mix 5 x 107 cells with the DNA.
Effect of carrier DNA. Transformation frequency increases with time of sonica-
tion, showing a maximum for a DNA size below 1 kb. The amount of carrier should
be at least 25 Jig, but it can be increased without inconvenience. PEG should be at
a concentration of 40%, as 10,20, or 30% give poor results. Agitation during the
PEG treatment produces a two- to fourfold increase of transformation frequency.
Heat shock is critical, as absence of heat shock results in at least a 50-fold decrease
in efficiency. Temperature above 3rc (lOmin at 39°C or 5min at 42°C) are
preferable, and 10 min at 39°C corresponds to a maximal efficiency.
9.1.2
Electroporation
Competent Cells
1. Pregrow the strain for about 5 hat 28°C in YPD. Inoculate in the evening 200 ml
of the same medium in a 1-1 flask with about 103 -104 cells/ml.
2. Grow overnight at 28°C with shaking. Density in the morning should be around
1 x 107 cells. Centrifuge the culture at 6,000 x g for 2 min at 4°C.
3. Wash cells once in one culture volume of ice cold water, spin at 6,000 x g for
2 min at 4°C. Repeat washings in half this volume.
4. Resuspend in 1125 vol of 1 M sorbitol at 4°C (8 ml for 200 ml); spin as before.
Resuspend the pellet in 111000 volume of sorbitol 1 M at 4°C (200 Jil).
Starting from 200 ml, this should make about 400.uI, or enough for 8
transformations.
Keeping Competent Cells

1. Add 7% DMSO (vv).
2. Distribute 40.uI of this suspension in Eppendorf tubes.
3. Place for a few min in a mixture of dry ice and ethanol.
4. Store the cells at -80°C.

s. Before use, thaw one tube at 4°C.
6. Spin at 4 °C for 1 min.
7. Resuspend the pellet gently in 40,ul of cold 1 M sorbitol (spinning down and
washing of the cells can be avoided).
Eledroporation and Plating

1. Mix 40,ul of competent cells with 10-40ng of DNA in a maximum volume of
5,ul, keeping everything on ice.
2. Place the mix between the electrodes (1.5mm spacing, Jouan electroporator
GHT 1287), apply one pulse of 900 V for 15 ms.
3. Place the mix back into an Eppendorf tube and dilute immediately with 1 ml of
1 M sorbitol at 4°C.
4. Place one or more samples of 50 to 400,ul on selective medium.
S. Place gently, or try to spread the cells by tilting the plate.
Comments
The amount of DNA used in the transformation is rapidly inhibitory: a two times
effect is observed with 25ng versus lOng. Presence of carrier DNA (5j1g) gives a
three- to nine-times inhibitory effect. Presence of sorbitol in the plates has been
tested and does not give better results. A time pulse of 15 s is better than 10 or 5 ms
at all voltages tested, and a lower voltage than 900V (at ISms) results in a twofold
decrease in the efficiency. A slight increase in transformation frequency seems to
be obtained if buffering the sorbitol with 10mM Tris at pH 8, but a detailed study
of conditions has not been performed. We have also observed a slight increase in
the number of transformants when plating the cells on the so-called T medium (E.
Meilhoc, pers. comm.) prepared as follows: Autoclave 11 of the basal mixture
containing: 20g glucose, 2g Na glutamate, 9g lysine-HCI, 3g KH2HP04, 3g
Na2HPO 412H20. Add 1 ml of the following (filter sterilized) solutions: CaCl2(0.25 gl
ml), MgS04 (0.25 g/ml), FeS04(1.Smglml), (NH4)2S04H20 (1.5 mglml), ZnS04
(Smglml), biotine (2mg in 100ml of 50% ethanol), Ca pantothenate (I mglml),
inositol (5mg/ml), nicotinic acid (5mg/ml), p-aminobenzoate (O.3mglml), pyri-
doxine-HCI (Img/ml), riboflavin (0.2mglml), and thiamine-HCI (Imglml). Vita-
mins solutions can be prepared separately, then mixed, aliquoted (8ml for 11
medium) and kept frozen.
9.1.3
Single Colony Method
This method is useful if many strains have to be transformed simultaneously, e.g.,

when one looks for highly transformable strains among the progeny of a cross.
1. Streak strains overnight on YPD plates in the morning.

2. In the evening make 1-cm2 patches on YMC. YMC is YM medium buffered
with SOmM citric acid-Na citrate, pH 4.0.
3. Resuspend cells in the morning in 1 ml TE (one loop).
4. Spin and resuspend in 600 pI LiAc buffer 0.1 MpH 6.0 (about 5 x 107 cells/ml).
Try to adjust turbidity of all samples by visual inspection.
5. Take 600 pI of this suspension into a new Eppendorf tube. Incubate for 1 h at
28°C (no shaking necessary).
6. Spin and resuspend in one tenth of the volume (60 pl) of LiAc buffer pH 6.0.
7. For reversion controls, take 20 pl to a new tube. For transformation, take 40 pI
of cells, add 2.5 pl of carrier DNA (see Sect. 4.1.1.), and 200ng of digested DNA
(in 1.5 pl).
8. Incubate 15 min at 28°C.
9. Add 3S0pl of PEG 4000 (see Sect. 4.1.1.).
10. Incubate 1 h at 28°C.
11. Heat shock 10 min at 39 0c.
12. Add 600 pI of LiAc buffer 0.1 MpH 6.0.
13. Plate 200 pl on selective medium.
14. Treat the control identically but do not add DNA.
This procedure gives between 100 and 1000 transformants per plate; although not
overefficient, it permits comparison of transformability of different strains.
9.2
Preparation of Protoplasts
The formation of protoplasts depends mainly on the age of the cells and the kind
of enzymes used for digestion of the cell wall. The rille is that the younger the cells,
the better the yield of protoplasts. In our hands, a combination of Glusillase and
Zymolyase works most efficiently for digestion of cell walls of Y. lipolytica.
1. Collect the cells of 200 ml cillture by centrifugation at 6000 g (5 min).
2. Wash the cells once with 100 ml sterile water and centrifuge again.
3. Resuspend the pellet in 20ml SP/3 (1.2M sorbitol, 0.1 M KP0 4 , pH 6.5, 20mM /3-
mercaptoethanol).
4. Add O.5ml Zymolyase lOOT (Miles) or 20T (Seikagaku Kogyo) (stock solution of
lSmg/ml) and 0.2ml Glusulase (Dupont Comp.).
5. Incubate at 37°C, protoplasts should occur after 30 min, more than 90% of the
cells shoilld be converted to protoplasts after 60 min.
Formation of protoplasts can be checked by microcopy or by lysis test (100,ul

suspension + 800,ul water + 100,ul 10% SDS solution - turbid solution should
become clear when protoplast formation has taken place).
Protoplasts can be collected by centrifugation at 2,000 g (10 min) and resuspended
in a buffer of choice, depending on the following procedure.
9.3
Isolation of Genomic DNA
9.3.1
Minipreparation
This method is derived from Hoffman and Winston (1987).

1. Grow the strain in 10 ml YPD or YNB until stationary phase.
2. Spin and resuspend the pellet in 0.5 ml of water.
3. Transfer to an Eppendorf tube.
4. Spin 5 s and pour off supernatant.
5. Spin 1 s and resuspend the pellet in whatever supernatant is left.
6. Add 200,ul of the following mix:
2% Triton X-I00
1% SDS
100mM NaCl
lOmM Tris-HCl pH 8.0
ImM EDTA
7. Add 200,ul of phenol-chloroform and 0.3 g of glass beads (acid-washed,

45,um).
8. Vortex 3-4 min, then add 200,ul TE.
9. Spin 5 min, and save the aqueous phase in a new tube.
10. Add 1 ml 100% ethanol, mix by inverting the tube, spin 2 min, discard the
supernatant. Do not dry at this step.
11. Resuspend the pellet in 400,ul of TE with 30,ug of RNase I (boiled).
12. Incubate for 5 min at 37°C.
13. Add 10 ,ul of 4 M ammonium acetate, then 1ml of 100% ethanol. Mix by invert-
ing the tube, spin 2 min, discard the supernatant.
14. Dry under vacuum, then resuspend in 50,ul of TE.

Use 5-10,ul for one digestion.
One should obtain about 21lg of DNA; this is the method of choice for analyzing
transformants by Southern hybridization. Bands up to 12 kb are detectable, higher
ones might be sheared. Probably because of the presence of impurities, this
method does not reproducibly yield transformants in E. coli.
9.3.2
Maxipreparation
Several methods have been used. Here is one which has been found suitable for
library preparation.
1. Pregrow the strain on 100 ml YPD for 24 h.
2. Grow the strain for 24h in 21 ofYPD (11 in 5-1 jars, or strong aeration).
3. Harvest the cell by centrifugation, wash twice in 100ml TEll.
4. Resuspend in 100ml of PTP buffer (100mM Tris-HCl pH 8.0, 10mM EDTA,
1 M sorbitol).
5. Add DTT (20mM final concentration), incubate lOmin at 30 DC.
6. Centrifuge the cells and wash in 100 ml PAPS buffer (10 mM AP adjusted to pH
6.8 with dry PIPES, 1 M sorbitol; AP is 2-amino 2-methyl1,3-propanediol).
7. Resuspend in 100ml PAPS buffer.
8. Add 100ml of PAPS buffer containing 20mg of Zymolyase lOOT (Miles).
9. Incubate at 37 DC and check protoplasting (under the microscope or following
the turbidity of 1/1000 dilution in water): it should take 20-30min before
osmosensitive cells are obtained.
10. Spin at low speed 10 min in a preweighed tube, pour off the supernatant gently,
the pellet may be loose.
11. Weigh the protoplasts, add 1.5 ml PAPS bufferlg of protoplasts.
12. Slowly add the lysis buffer (3.5ml/g of cells). We usually put the cells in a
siliconized beaker with low magnetic stirring. Lysis buffer is 3% Sarkosyl,
0.5M Tris pH 9.0, 200mM EDTA.
13. Incubate 15 min at 65 DC.
14. Add one volume of phenol-chloroform, mix gently, and spin 10 min at 5,000 x
g. Repeat phenol extraction twice, then extract with chloroform, let coolon ice.
15. Add ice-cold 3 M sodium acetate pH 5.0 up to 0.3 M final concentration.
16. Add cold isopropanol, 3/4 of the former volume.
17. A clump of DNA should form; spool it on a glass rod, dip it into 70% ethanol
to remove the salts, dry it partially (do not overdry) and resuspend in TE
(5ml).
RNase treatments are optional.
9.3.3
Isolation of Yeast Plasmid DNA for E. coli Transformation
This procedure is derived from Ausubel et al. (1989).
1. Grow the yeast transformant overnight in 5 mlliquid YPD.

2. Spin and resuspend in 500 III of sorbitol solution (0.9 M sorbitol, 0.1 M Tris-HCI
pH 8.0,0.1 M EDTA) Add 20 JlI of 3 mg/ml Zymolyase lOOT in sorbitol solution
and 50 JlI of 0.28 M {3-mercaptoethanol. Incubate for 1 h at 37°C.
3. Spin and resuspend the cells in 500JlI of Tris-EDTA solution (50mM Tris,
20mM EDTA, pH 8.0) by pipetting up and down repeatedly.
4. Add 50 JlI of 10% SDS at 65°C and invert the tube several times to mix. The
solution should be very viscous at this point.
5. Add 200 volumes of 5 M potassium acetate. Mix well. Let stand on ice for at least
30 min. The content may be semisolid at this stage.
6. Centrifuge 3 min at room temperature in a table top centrifuge. Pour the super-
natant into a new Eppendorf tube and fill the tube with 100% ethanol (about
1 ml). Centrifuge 10 s at room temperature. Discard the supernatant and par-
tially dry the pellet under vacuum. Add 300 JlI TE. It may take overnight to
dissolve, heating at 65°C will speed it up, or gentle vortexing.
7. Add 5JlI of 10mglml RNasel. Incubate 1h at 3rc.
8. Add 500 JlI of 100% isopropanol. Mix content gently until the DNA precipitates
in a single clump. Recover this clump with a 200-JlI pipettor tip, squeeze dry
against the wall of the tube, and transfer to a new tube containing 125 JlI ofTE.
If DNA does not make a single clump, spin for 10 s, wash the pellet with 70%
ethanol, dry and resuspend in 125 JlI of TE. Transform highly competent E. coli
cells (10 7 transformantslJlg of control DNA). In our hands, 1 to 4JlI of this DNA
solution will give 10 to 60 E. coli transformants.
9.4
Separation of Chromosomes (see also Chap. 3, this Vol.)
9.4.1
Plug Preparation
1. 50 ml of the following medium are inoculated and incubated overnight, to

obtain about 107 cells/ml in the morning (see Sect. 4.1.2.):
3% glucose
0.5% yeast extract
0.5% peptone
0.0745% L-Methionine
0.0675% DL-Homocysteine thiolactone
0.1% DL-Methionine methyl sulfonium chloride
(the addition of the last three compounds is optional).
2. Spin and wash in 100mM Tris-HCl pH 7.5, 100mM EDTA.
3. Resuspend at a cell density of 2 x 109 cells/ml in TESorb buffer (0.9 M sorbitol,

0.1 M Tris-HCl pH 8.0, O.IM EDTA). Add 1/10 of the volume of a stock solution
of Zymolyase lOOT at 3 mg/rnl and ,6-mercaptoethanol to a final concentration
ofO.02M. Incubate 5-10 min at 37°C.
4. Prepare 1% low melting agarose in 0.25 M EDTA pH 8.0.
5. Mix one volume of cells and one volume of molten agarose.
6. Distribute the mix in the molds (or in a small petri dish), let it solidify at 3 °C for
at least 20 min.
7. Take out the plugs (or cut to the size of the wells) and incubate them in 2ml of
TE-Sorb buffer containing Zymolyase and ,6-mercaptoethanol for 2 h at 37°C
(as above).
8. Rinse the plugs in 0.5M EDTA, and incubate in lysis buffer (0.5M EDTA,
0.01 M Tris-HCl pH 8.0, 1% Sarkosyl, 1 mg/ml proteinase K) at 50°C for 24h;
change lysis buffer and repeat (addition of RNaseI is optional at this step).
Use 5 vol lysis buffer for 1 volume plug. Plugs should become clearer upon
this treatment.
9. Store the plugs in 0.5M EDTA pH 8.0 at 4°C (storage for several months is
possible).
Before use, dialyze them extensively against TE (change bath 3 times).
9.4.2
Chromosome Separation
Using Beckman's Geneline. Gel is 0.8% agarose in Ix TAFE buffer (20x TAFE is
2.42% Trisbase, 0.29% EDTA, 0.5% glacial acetic acid). Plugs are sealed with
agarose in the gel slots. Run conditions are: 20 mA, 70 min pulse time, for 90 h; then
25 mA, 50 min pulse time for 75 h, at 10 °C.
Using Biorad's CHEF DRII. Gel is 1% agarose in 0.5x TAE buffer. Plugs are
sealed with agarose in the gel slots. Run conditions are: 40 V, 55 min pulse time for
47.7h; then 43 V, 50 min pulse time for 70h; and finally 50V, 40min pulse time for
48h, at 12°C.
9.5
Isolation of RNA
It is not easy to obtain high-quality preparations of RNA from cells of Y. lipolytica.

Several methods were checked for isolation of RNA. Best results were obtained
with the methods described by Chomczynski and Sacchi (1987), Domdey et al.
(1984), or the commercially available RNA extraction kit of Pharmacia LKB
Biotechnology.
9.5.1
The Procedure Described by Chomczynski and Sacchi (1987)
1. One hundred ml of an overnight culture are centrifuged for a few min at 5,000 x
g, washed with 10 ml of 1 M sorbitol, and resuspended in 10 ml of 1 M sorbitol.
2. Add 200 III of Zymolyase lOOT (stock solution at 50 mg/ml) and incubate 1 h at
3rC.
3. Centrifuge 2 min at 3,000 x g and resuspend in 0.5 ml sorbitol (1 M).
4. Add this protoplast suspension to 10 ml of denaturating mix, which is pre-

pared as follows:
To avoid manipulation of toxic products, we directly dissolve in the supplier
flask at 65°C the 250 g of guanidium thiocyanate in 293 ml water + 17.6 ml
0.75M Na-citrate pH 7.0 + 26.4ml Sarkosyl10%. This solution can be stored
for 3 months at room temperature. To 50 ml of solution, add before use 0.36 ml
of f3-mercaptoethanol. This mix can be stored for 1 month at 4°C.
5. Add 20 III DEPC, vortex and add 1 m12 M Na-acetate, pH 4.0.
6. Vortex and add 10ml phenol (saturated with water).
7. Vortex and add 2ml chloroform-isoamyl-alcohol. Vortex and put on ice for
15 min.
8. Centrifuge 20 min at 9,000 x g and dispense the aqueous phase in Eppendorf

tubes with 750 III per tube. Add 750 III isopropanol and store 1 h at -20°C.
9. Centrifuge 20min in the cold in a table top centrifuge at maximum speed, and
resuspend the pellets in 0.5ml of the same guanidium-f3-mercaptoethanol-
DEPC solution as above.
10. Add 0.5 ml isopropanol and store overnight at -20°C (or at least 1 h).
11. Centrifuge 10 min at 4°C, wash pellets in 600 III 75% ethanol (prepared with
DEPC-treated water), centrifuge again, dry the pellet, and resuspend in 50 III of
DEPC-treated water. Vortex and do not heat to dissolve. Store the RNA prep at
-80°C.
9.5.2
The Procedure Described by Domdey et al. (1984)
1. Twenty five ml of the culture (5-8 x 107 cells/ml; if less concentrated increase
the amount of culture) are centrifuged or filtrated over a Millipore filter
(1.2.um pore size). Cells are resuspended in 15ml of MMT or YNB without
carbon source and transferred to a 2.2-ml microfuge tube. After centrifugation
the supernatant is carefully removed and the cells are frozen in a dry ice-
ethanol bath. The tubes can be stored at -80°C for about 2 months. The quality
of RNA decreases when cells are stored longer.
2. Add 0.7ml AE buffer, 100mllO% SDS solution and Iml fresh phenol (equili-
brated with AE buffer) to the frozen cells. Vortex vigorously until the pellet is
dissolved completely.
3. Incubate at 65°C for 4 min.
4. Rapidly chill the tubes in a dry ice-ethanol bath until phenol crystals
appear.
5. Centrifuge the frozen mixture in a microfuge at maximum speed for 10 min.
6. Remove the phenol phase but leave the interphase intact intact!
7. Add a second aliquot of phenol and repeat the extraction step.
8. Transfer the aqueous phase into a new tube (without the interphase!).
9. Add an equal volume of phenol: chloroform (1: 1 mixture), mix, and centri-
fuge again. Transfer the aqueous phase into a new tube.
10. Adjust the salt concentration to OAM LiCI and add 2.5 vol ethanol. This
preparation can be stored at -80°C. At this step a small aliquot could be
pelleted separately and the quality and amount of RNA could be checked on an
EtBr-containing agarose gel.
11. To pellet the RNA, the tubes are centrifuged in a microfuge (at highest speed)
for 10 min. Wash the pellet once with 75% ethanol.
12. Dry the pellet at room temperature, resuspend in 50/-11 sterile water (pre-
treated with DEPC).
Materials
AE buffer 50mM sodium acetate (pH 5.3)
10mM EDTA
LiCI stock solution 4M, pH 5.3
9.6
Available Gene Libraries
Genomic and cDNA libraries of Y. lipolytica are described in Table 5.

...
0
Table 5 I'
~
Recommended Vector Source of inserts and library construction Features of the library Reference
hosts for I~~.
screening Strain Type of insert Insert size Nb. of clones % hybrids Representation' Notes
-e:0
E. coli pBR322 H222 BcoRI or BamHI 3-7kb 20,000 SO% 0.S3 Barth and Scheuber (1993)
E. coli pHC79 15901-4 Sau3AI partial 40kb 5,000 75% 0.999 C. Gaillardin (unpubl.)
Ii
E. coli A. Charon 4A CX-161-1B HaeIlI + Alul partial 15-20kb 65,000 89% 0.999 Matoba et al. (1988)
Y. lipolytica leu2 pINA62 W29 Sau3AI partial 7-15kb 6,500 89% 0.99 Xuan et al. (1988)
Y. lipolytica leu2 pINA240 W29 Sau3AI partial 3-6kb 21,000 80% 0.83 M. Chasles and P. Fournier
(unpubl.)
Y. lipolytica leu2 pINA237 B204-12C-1l2 Sau3AI partial 4-8kb 50,000 82% 0.999 Schmid-Berger et al. (1994)
Y. lipolytica leu2 pINA445 B122 Sau3AI partial 5-7kb 23,000 83% 0.999 Nuttley et al. (1993)
S. cerevisiae ura3 pFL61 W29 cDNA 0.8-4kb 18,000 85% YPD grown cells Lopez et al. (1994)
S. cerevisiae trp 1 YRp7 W29 Sau3AI partial 12-1Skb 3,780 100% 0.98 Treton et aI. (1992)
• Probability of covering one genome equivalent, evaluated by the Clarke and Carbon formula (see Xuan et aI. 1988); except for the cDNA library where the growth conditions used for
mRNA preparation are indicated.
I Cosmids available as phage particles.
2 Available as 5 pools of 1,500 clones.
3 Available as 5 pools of 4,200 clones.
'Made on 2/.l plasmid, cDNA are expressed under PGK promoter.

S Available as 14 pools of 270 clones.
U>
"'-'I
\0
Acknowledgments. The authors wish to thank colleagues from the Y. lipolytica

community for their friendly sharing of unpublished results and procedures.
Particular thanks are due to D.M. Ogrydziak, P. Fournier, J.M. Nicaud, and M.T. Le
Dall for reviewing all or part of the manuscript. We are grateful to D.M. Ogrydziak
for critical comments on the manuscript. Part of the work presented here was
supported by a grant from the European Community (BIOT-CT91-0267DSCN).
References
Abou-Zeid AA, Khoja SM (1993) Utilization of dates in the fermentative formation of citric
acid by Yarrowia lipolytica. Zentralbl Mikrobiol148: 213-221
Akiyama SI, Suzuki T, Sumino Y, Fukada H (1973a) Induction and citric acid productivity
of fluoroactetate-sensitive mutant strains of Candida lipolytica. Agric BioI Chern 37:
879-884
Akiyama SI, Suzuki T, Sumino Y, Nakao Y, Fukada H (1973b) Relationship between
aconitate hydratase activity and citric acid productivity in fluoroacetate-sensitive mu-
tant strains of Y. lipolytica. Agric BioI Chern 37: 885-888
Atchinson ]D, Szilard RK, Nutley WM, Rachubinski RA (1992) Antibodies directed against
a yeast carboxyl terminal peroxisomal targeting signal specifically recognize peroxiso-
mal proteins from various yeasts. Yeast 8: 721-734
Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman ]G, Smith ]A, Struhl K (1989) In:
Current protocols in molecular biology, vol 2. chpt. 13.11.3. ] Wiley, New York
Barnett ]A, Payne RW, Yarrow D (1990) Yeasts: characteristics and identification. Cam-
Barns SM, Lane D], Sogin ML, Bibeau C, Weisburg WG (1991) Evolutionary relationships
among pathogenic Candida species and relatives. ] Bacteriol173: 2250-2255
Barth G (1985) Genetic regulation of isocitrate lyase in the yeast Yarrowia lipolytica. Curr
Genet 10: 119--124
Barth G, Kunkel W (1979) Alcohol dehydrogenases (ADH) in yeast. II. NAD+- and NADP+-
dependent alcohol dehydrogenases in Saccharomycopsis lipolytica. Z Allg Mikrobiol19:
381-390
Barth G, Scheuber T (1993) Cloning of the isocitrate lyase gene (JCLI) from Yarrowia
lipolytica and characterization of the deduced protein. Mol Gen Genet 241: 422-430
Barth, G, Weber H (1983) Genetic studies on the yeast Saccharomycopsis lipolytica. Inacti-
vation and mutagenesis. Z AUg Mikrobiol23: 147-157
Barth G, Weber H (1984) Improved conditions for mating of the yeast Saccharomycopsis
lipolytica. Z Allg Mikrobiol24: 403-405
Barth G, Weber H (1985) Improvement of sporulation in the yeast Yarrowia lipolytica.
Antonie Leeuwenhoek] Microbiol51: 167-177
Barth G, Weber H (1987) Genetic analysis of the gene JCLl of the yeast Yarrowia lipolytica.
Yeast 3: 255-262
Bassel ], Mortimer RK (1973) Genetic analysis of mating-type and alkane utilization in
Saccharomycopsis lipolytica. ] Bacteriol114: 894-896
Bassel ], Warfel ], Mortimer RK (1971) Complementation and genetic recombination in
Candida lipolytica. ] Bacteriol108: 609-611
Bassel ], Hambright P, Mortimer RK, Bearden A] (1975) Mutants of the yeast
Saccharomycopsis lipolytica that accumulates and excretes protoporphyrin IX.
] Bacteriol123: 118-122
Bassel ]B, Mortimer RK (1982) Genetic and biochemical studies on n-alkane non-utilizing
mutants of Saccharomycopsis lipolytica. Curr Genet 5: 77-88
Bassel ]B, Mortimer RK (1985) Identification of mutations preventing n-hexadecande up-
take among 26 n-alkane non-utilizing mutants of Yarrowia (Saccharomycopsis)
lipolytica. Curr Genet 9: 579-586
Bauer R, Paltauf F, Kohlwein SD (1993) Functional expression of bacterial J3-glucuronidase

and its use as a reporter system in the yeast Yarrowia lipolytica. Yeast 9: 7l-75
Beckerich JM, Heslot H (1978) Physiology of lysine permease in Saccharomycopsis
lipolytica. J Bacteriol 133: 492-498
Beckerich JM, Lambert M, Heslot H (1981) Mutations affecting the lysine and
polyphosphate pools in the yeast Saccharomycopsis lipolytica. Biochem Biophys Res
Commun 100: 1292-1298
Beckerich JM, Colonna Ceccaldi B, Lambert M, Heslot H (1984) Evidence for the control of
a mutation in lysine catabolism by the mating-type in Yarrowia lipolytica. Curr Genet 8:
531-536
Beckerich JM, Pommies E, Faivre C, Lambert M, Heslot H (1986) Estimation of com-
partmentation oflysine inside the cells of Yarrowia lipolytica. Biochimie 68: 517-529
Beckerich JM, Lambert M, Gaillardin C (1994) LYCI is the structural gene ofN-acetyl-lysine
transferase in yeast. Curr Genet 25: 24-29
Berninger G, Schmidtchen R, Casel G, Knorr A, Rautenstrauss K, Kunau W-H, Schweizer E
(1993) Structure and metabolic control of the Yarrowia lipolytica peroxisomal 3-
oxoacyl-CoA-thiolase gene. Eur J Biochem 216: 607-613
Berny J-F, Hennebert GL (1991) Viability and stability of yeast cells ands filamentous fungus
spores during freeze-drying; effect of protectant and cooling rates. Mycologica 83: 805-
815
Blagodatskaya VM, Kockova-Kratochvilova A (1973) The heterogeneity of the species
Candida lipolytica, Candida pseudolipolytica n. sp. and Candida lipolytica var.
thermotolerans n. var. Biologia (Bratislava) 28: 709-716
Blanchin-Roland S, Cordero Otero R, Gaillardin C (1994) Two upstream UAS control ex-
pression of the XPR2 gene encoding an extracellular alkaline protease in the yeast
Yarrowia lipolytica. Mol Cell BioI 14: 327-338
Bojnanska A (1977) Determination of mating-types and frequency of zygotes in strains of
the species Candida lipolytica. Acta Facultatis Rerum Naturalium Universitalis
Conenianae. Genetica VIII: 55-65
Booth JL, Vishniac HS (1987) Urease testing and yeast taxonomy. Can J Microbiol33: 396-
404
Bruyn J (1954) An intermediate product in the oxidation of hexadecene-l by Candida
lipolytica. K Ned Acad Wet Proc Ser C 57: 41-44
Buckholz RG, Gleeson MAG (1991) Yeast systems for the commercial production ofheter-
ologous proteins. Bio/technology 9: 1067-1072
Campbell I (1975) Numerical analysis and computerized identification of the yeast genera
Candida and Torulopsis. J Gen Microbiol 90: l25-132
Cardillo R, Fronza G, Fuganti C, Grasseli P, Mele A, Pizzi D (1991) Stereochemistry of the
microbial generation of delta-decanolide, gamma-dodecanolide and gamma-
nonanolide from C18 13-hydroxy, C18 10-hydroxy, and C19 14-hydroxy unsaturated
fatty acids. J Org Chern 56: 5237-5239
Cheng SC, Ogrydziak DM (1986) Extracellular RNase produced by Yarrowia lipolytica. J
Bacteriol168: 581-589
Cheng SC, Ogrydziak DM (1987) Processing and secretion of the Yarrowia lipolytica RNase.
Chomczynski P, Sacchi N (1987) Single-step method of RNA isolation by acid guanidium
thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156-159
Cirigliano MC, Carman GM (1984) Isolation of a bioemulsifier from Candida lipolytica.
Appl Environ Microbiol48: 1154-1155
Cirigliano MC, Carman GM (1985) Purification and characterization of liposan, a
bioemulsifier from Candida lipolytica. Appl Environ Microbiol50: 846-850
Clare JJ, Davidow LS, Gardner DC}, Oliver SG (1986) Cloning and characterization of the
ribosomal RNA genes of the dimorphic yeast, Yarrowia lipolytica. Curr Genet 10: 449-452
Dagett P-M, Simione FP (1987) Cryopreservation manual. ATCC & Nalge Company,
Rochester
Davidow LS, Apostolakos D, O'Donnell MM, Proctor AR, Ogrydziak DM, Wing RA, Stasko
I, De Zeeuw JR (1985) Integrative transformation of the yeast Yarrowia lipolytica. Curr
Genet 10: 39-48
Davidow LS, O'Donnell MM, Kaczmarek FS, Pereira DA, De Zeeuw JR, Franke AE (1987)
Cloning and sequencing of the alkaline extracellular protease gene of Yarrowia
lipolytica. J Bacteriol169: 4621-4629
Delaisse JM, Martin P, Verheyen-Bouvy MF, Nyn EJ (1981) Subcellular distribution
of enzymes in the yeast Saccharomycopsis lipolytica, grown on n-hexadecane,
with special reference to the omega-hydroxylase. Biochim Biophys Acta 676: 77-
90
Dell' Angelica EC, Stella CA, Ermacora MR, Ramos EH, Santone JA (1992) Study of fatty acid
binding by proteins in yeast. Dissimilar results in Saccharomyces cerevisiae and
Yarrowia lipolytica. Comp Biochem Physioll02B: 261-265
De Zeeuw J, Stasko I (1983) Fermentation process for the production of alpha-isopropyl
malic acid. US patent US4407853
Domdey H, Apostol B, Lin R-J, Newman A, Brody E, Abelson J (1984) Lariat structures are
in vivo intermediates in yeast pre-mRNA splicing. Cell 39: 611-621
EI-Sherbeini M, Bostian KA, Levitre J, Mitchell DJ (1987) Gene-protein assignments within
the yeast Yarrowia lipolytica dsRNA viral genome. Curr Genet 11: 483-490
Enderlin CS, Ogrydziak DM (1994) Cloning, nucleotide sequence and functions of XPR6,
which codes for a dibasic processing endoprotease from the yeast Yarrowia lipolytica.
Yeast 10: 67-79
Ercoli B, Fuganti C, Graselli P, Servi S, Allegrano G, Barbeni M, Pisciotta A (1992) Stere-
ochemistry of the biogeneration of C-1O and C-12 gamma-Iactones in Yarrowia
lipolytica and Pichia ohmeri. Biotechnol Lett 14: 665-668
Esser K, Stahl U (1976) Cytological and genetic studies of the life cycle of Saccharomycopsis
lipolytica. Mol Gen Genet 146: 101-106
Fabre E, Nicaud JM, Lopez MC, Gaillardin C (1991) Role of the proregion in the production
and secretion of the Yarrowia lipolytica alkaline extracellular protease. J BioI Chern 266:
3782-3790
Fabre E, Tharaud C, Gaillardin C (1992) Intracellular transit of a yeast protease is rescued by
trans-complementation with its pro domain. J BioI Chern 267: 15049-15055
Finogenova TV, Glazunova LM (1976) Activity of enzymes of the citrate and glyoxylate
cycles in the synthesis of citric and isocitric by various strains of Candida lipolytica.
Finogenova TV, Shishkanova IT, Kataeva IA (1982) Properties of Candida lipolytica mu-
tants with the modified glyoxylate cycle and their ability to produce citric and isocitric
acid. Appl Microbiol Biotechnol23: 378-383
Fournier P, Gaillardin C, Persuy MA, Klootwijk J, van Heerikuizen H (1986) Heterogeneity
in the ribosomal family of the yeast Yarrowia lipolytica: genomic organization and
segregation studies. Gene 42: 273-282
Fournier P, Guyaneux L, Chasles M, Gaillardin C (1991) Scarcity of ars sequences isolated in
a morphogenesis mutant of the yeast Yarrowia lipolytica. Yeast 7: 25-36
Fournier P, Abbas A, Chasles M, Kudla B, Ogrydziak DM, Yaver D, Xuan J-W, Peito A, Ribet
A-M, Feynerol C, He F, Gaillardin C (1993) Colocalization of centromeric and replicative
functions on autonomously replicating sequences isolated from the yeast Yarrowia
lipolytica. Proc Nat! Acad Sci USA 90: 4912-4916
Gaillardin C, Heslot H (1971) Physiological and genetical studies on yeasts of the genus
Candida. in Radiation and radioisotopes for industrial microorganisms. International
Atomic Energy Agency, Vienna, pp 93-111
Gaillardin C, Heslot H (1979) Evidence for mutations in the structural gene for homo citrate
synthetase in Saccharomycopsis lipolyica. Mol Gen Genet 172: 185-192
Gaillardin C, Heslot H (1988) Genetic engineering in Yarrowia lipolytica. J Basic Microbiol
28: 161-174
Gaillardin C, Ribet AM (1987) LEU2 directed expression of ,B-galactosidase activity and

pbleomycin resistance in Yarrowia lipolytica. Curr Genet 11: 369-375
Gaillardin C, Charoy V, Heslot H (1973) A study of copulation, sporulation and meiotic
segregation in Candida lipolytica. Arch Microbiol92: 69-83
Gaillardin C, Poirier L, Heslot H (1975) Studies on an unstable phenotype induced by UV
irradiation: the lysine-excreting (lex-) phenotype of the yeast Saccharomycopsis
lipolityca. Arch Mikrobiol 104: 89-94
Gaillardin C, Poirier L, Heslot H (1976a) A kinetic study of homo citrate synthase activity in
the yeast Saccharomycopsis lipolytica. Biochim Biophys Acta 422: 340-406
Gaillardin C, Fournier P, Sylvestre G, Heslot H (1976b) Mutants of Saccharomycopsis
lipolytica defective in lysine catabolism. J Bacteriol125: 48-57
Gaillardin C, Poirier L, Ribet AM, Heslot H (1979) General and lysine specific control of
saccharopine dehydrogenase levels in the yeast Saccharomycopsis lipolytica. Biochimie
61: 173-182
Gaillardin C, Ribet AM, Heslot H (1982) Wild-type and mutant forms of homoisocitric
dehydrogenase in the yeast Saccharomycopsis lipolytica. Eur J Biochem 128: 489-494
Gaillardin C, Ribet AM, Heslot H (1985) Integrative transformation of the yeast Yarrowia
Gomi K, Ota Y, Minoda Y (1986) Role of lipase activators produced by Saccharomycopsis
lipolytica and calcium ions in its lipase reaction. Agric BioI Chern 50: 2531-2536
Groves P, Clare JJ, Oliver SG (1983) Isolation and characterization of a double stranded RNA
virus-like particle from the yeast Yarrowia lipolytica. Curr Genet 7: 185-190
Guevara-Olivera L, Calco-Mendez C, Ruiz-Herrera J (1993) The role of polyamine metabo-
lism in dimorphism of Yarrowia lipolytica. J Gen Microbiol193: 485-493
Hadeball W (1991) Production of lipase by Yarrowia lipolytica. Acta Biotechnol11: 159-167
Hagihara T, Mishina M, Tanaka A, Fukui S (1977) Utilization of tristane by the yeast Candida
lipolytica. Fatty acid composition of pristane-grown cells. Agric BioI Chern 41: 1745-1748
Hamsa PH, Chatto BB (1994) Cloning and growth-regulated expression of the gene encod-
ing the hepatitis B virus middle surface antigen in Yarrowia lipolytica. Gene 143: 165-170
Hann BC, Walter P (1991) The signal recognition particle in S. cerevisiae. Cell 67: 131-144
He F, Beckerich JM, Ribes V, Tollervey D, Gaillardin C (1989) Two genes encode 7SL RNAs
in the yeast Yarrowia lipolytica. Curr Genet 16: 347-350
He F, Yaver D, Beckerich JM, Ogrydziak D, Gaillardin C (1990) The yeast Y. lipolytica has
two, functional signal recognition particle 7S RNA genes. Curr Genet 17: 289-292
He F, Beckerich JM, Gaillardin C (1992) A mutant of 7SL RNA in Yarrowia lipolytica
affecting the synthesis of a secreted protein. J BioI Chern 267: 1932-1937
Herman AI (1971) Mating responses in Candida lipolytica. J Bacteriol107: 371
Heslot H (1990) Genetics and genetic engineering of the industrial yeast Yarrowia lipolytica.
Adv Biochem Eng Biotechnol43: 43-73
Heslot H, Gaillardin C, Beckerich JM, Fournier P (1979) Control oflysine metabolism in the
petroleum yeast Saccharomycopsis lipolytica. In: Sebek 0, Laskin A (eds) Genetics of
industrial microorganisms. American Society for Microbiology, Washington DC, pp 54-
60
Hoenes I, Simon M, Weber H (1991) Characterization of isocitrate lyase from the yeast
Yarrowia lipolytica. J Basic Microbiol31: 251-258
Hoffmann CS, Winston F (1987) A ten-minute DNA preparation from yeast efficiently
releases autonomous plasmids for transformation of Escherichia coli. Gene 57: 267-272
Holzschu DL, Chandler FW, Ajello L, Ahearn, DG (1979) Evaluation of industrial yeasts for
pathogenicity. Sabouraudia 17: 71-78
Ilchenko AP, Mauersberger S, Matyashova RN, Lozinov AB (1980) Induction of cytochrome
P-450 in the course of yeast growth on different substrates. Mikrobiologija 49: 452-
458
Ishikura T, Forster JW (1961) Incorporation of molecular oxygen during microbial utiliza-
tion of olefins. Nature 192: 892-893
Kalle GP, Gadkari SV, Deshpande Y (1972) Inducibility of lipase in Candida lipolytica.
Indian I Biochem Biophys 9: 171-175
Kamiryo T, Nishikawa Y, Mishina M, Terao M, Numa S (1979) Involvement oflong-chain
acyl coenzyme A for lipid synthesis in repression of acettylcoenzyme A carboxylase in
Candida lipolytica. Proc Natl Acd Sci USA 76: 4390-4394
Kautola H, Rymowicz W, Linko Y¥, Linko P (1991) Production of citric acid with immobi-
lized Yarrowia lipolytica. Appl Microbiol Biotechnol35: 447-449
Kemp GD, Dickinson FM, Ratledge C (1990)Light sensitivity of the n-alkane-induced fatty
alcohol oxidase from Candida tropicalis and Yarrowia lipolytica. Appl Microbiol
Biotechnol32: 461-464
Klug MI, Markovetz AI (1967) Degradation of hydrocarbons by members of the genus
Candida. II. Oxidation of n-alkanes and l-alkenes by Candida lipolytica. I Bacteriol 93:
1847-1852
Kohlwein SD, Paltauf F (1983) Uptake of fatty acids by the yeasts, Saccharomyces uvarum
and Saccharomycopsis lipolytica. Biochim Biophys Acta 792: 310-317
Kottig H, Rottner G, Beck KF, Schweizer M, Schweizer E (1991) The pentafunctional PAS1
genes of Saccharomyces cerevisiae and Yarrowia lipolytica are co-linear considerably
longer than previously estimated. Mol Gen Genet 226: 310-314
Kreger-van Rij NIW (1984) The yeasts, a taxonomic study. Elsevier Amsterdam
Kreger-van Rij NIW, Veenhuis M (1973) Electron microscopy of septa in ascomycetous
yeasts. Mol Gen Genet 146: 10 1-106
Klick V, Stahl U, Lhermitte A, Esser K (1980) Isolation and characterization of mitochon-
drial DAN from the alkane yeast Yarrowia lipolytica. Curr Genet 2: 97-101
Kujau M, Weber H, Barth G (1992) Characterization of mutants of the yeast Yarrowia
lipolytica defective in acetyl-Coenzyme A synthetase. Yeast 8: 193-203
Kurischko C (1984) Analysis of genetic markers in new breeding stocks of the yeast
Saccharomycopsis lipolytica. Z Allg Mikrobiol 24: 545-550
Kurischko C (1986) Parasexual process in the yeast Yarrowia lipolytica. I Basic Microbiol26:
33-41
Kurischko C, Weber H (1986) Temporal relationship of diploidization and haploidization in
the yeast Yarrowia lipolytica. I Basic Microbiol3: 137-144
Kurischko C, Inge-Vechtonov SG, Weber H (1983) Development of breeding stocks of the
yeast Saccharomycopsis lipolytica by methods of moderate inbreeding. Z Allg Mikrobiol
23: 513-515
Kurischko C, Fournier P, Chasles M, Weber H, Gailardin C (1992) Cloning of the mating-
type gene MatA of the yeast Yarrowia lipolytica. Mol Gen Genet 232: 423-426
Kurtzman CP, Phaff HI (1987) Molecular taxonomy. In: Rose AH, Harrisson IS (eds) The
Yeasts, vol 1. Biology of yeasts. Academic Press, London, pp 63-94
Le Dall M-T, Nicaud I-M, Gaillardin C (1994) Multiple-copy integration in the yeast
Yarrowia lipolytica. Curr Genet 26: 38-44
Lopez MC, Dominguez A (1988) Purification and properties of a glycoprotein acid
phosphatase from the yeast form of Yarrowia lipolytica. I Basic Microbiol 28: 249-263
Lopez MC, Nicaud 1M, Skinner H, Vergnolles C, Kader IC, Bankaitis V, Gaillardin C (1994)
A phosphatidylinositol/phosphatdylcholine transfer protein is required for differentia-
tion of the dimorphic yeast Yarrowia lipolytica from the yeast to the mycelial form. I Cell
BioI 124: 113-127
Maldonado P, and Gaillardin C (1972) Pro cede d'obtention de souches diploides de Can-
dida lipolytica et utilisation de ces souches dans un pro cede de Preparation d'acide alpha
cetoglutarique. French patent 72/41913
Matoba S, Ogrydziak DM (1989) A novel location for dipeptidyl aminopeptidase processing
sites in the alkaline extracellular protease of Yarrowia lipolytica. I BioI Chern 264: 6037-
6043
Matoba S, Fukuyama I, Wing RA, Ogrydziak DM (1988) Intracellular precursors and secre-
tion of alkaline extracellular protease of Yarrowia lipolytica. Mol Cell BioI 8: 4904-4916
Matsuoka M, Ueda Y, Aiba S (1980) Role and control of isocitrate lyase in Candida
lipolytica. J Bacterioll44: 692-697
Matsuoka M, Uchida K, Aiba S (1982) Cytoplasmic transfer of oligenycin resistance during
protoplast fusion of Saccharomycopsis lipolytica. J Bacteriol 152: 530-533
Matsuoka M, Matsubara M, Daidoh H, Imanaka T, Uchida K, Aiba S (1993) Analysis of
regions essential for the function of chromosomal replicator sequences from Yarrowia
lipolytica. Mol Gen Genet 237: 327-333
Matsuoka M, Himoeno T, Aiba S (1984) Characterization of Saccharomycopsis lipolytica
mutants that express temperature-sensitive synthesis of isocitrate lyase. J Bacteriol157:
899-908
Mattey M (1992) The production of organic acids. Crit Rev Biotechnol12: 87-132
Mattey M, Adoga G (1991) Low molecular weight thermostable enzymes. Enzyme Microb
Technol13: 525
Mauersberger S (1991) Mutants of alkane oxidation in the yeasts Yarrowia lipolytica and
Candida maltosa. In: Finogenova TV, Sharyshev AA (eds) Alkane metabolism and
oversynthesis of metabolites by microorganisms. Centre for Biological Research USSR
Academy of Sciences, Push chino
Mauersberger S, Matyashova RN (1980) The content of cytochrome P-450 in yeast cells
growing on hexadecane. Mikrobiologija 49: 57l-577
Mauersberger S, Boehmer A, Schunck W-H, Muller H-G (1991) Cytochrome P-450 of the
yeast Yarrowia lipolytica. Abstr Int Symp on Cytochrome P-450 of Microorganisms,
Berlin, p 63
Mauersberger S, Drechsler H, Oehme G, Muller H-G (1992) Substrate specificity and
stereo selectivity of fatty alcohol oxidase from the yeast Candida maltosa. Appl Microbiol
Biotechnol37: 66-73
May R, Barth G (1977) Tubulare Einschlusse in Microbodies von. Saccharomycopsis (Can-
dida) lipolytica Protoplasten. Protoplasma 91: 83-91
McKay IA (1992) Growth offermentative and non fermentative yeasts in natural yoghurt,
stored in polystyrene cartons. Int J Food Microbiol15: 383-388
McKay lA, Maddox IS, Brooks JB (1990) Citrate production by yeast. Ferment Technol Ind
Appl 285-291
Moat AG, Peters N, Srb AM (1959) Selection and isolation of auxotrophic yeast mutants with
the aid of antibiotics. J Bacteriol 77: 673-677
Moran A, Burguillo FJ, Lopez MC, Dominguez A (1989) Kinetic properties of derepressible
acid phosphatase from the yeast form of Yarrowia lipolytica. Biochim Biophys Acta 990:
288-296
Morzycka E, Sawnor-Korszynska D, Pasjewski A, Grabsky J, Raczynska-Bojanowska K
(1976) Methionine overproduction in Saccharomycopsis lipolytica. Appl Environ
Mortimer RK, Bassel BB (1973) Genetic studies of Saccharomycopsis lipolytica. Proc of the
conference on genetics of industrial microorganisms, USSR. 1-6
Murphy GL, Perry JJ (1984) Assimilation of chlorinated alkanes by hydrocarbon-utilizing
fungi. J Bacteriol160: 1171-1174
Nakase T, Komagata K (1971) Signification of DNA base composition in the classification of
yeast genes Candida. J Gen Appl Microbiol Tokyo 17: 259-279
Naumova E, Naumov G, Fournier P, Nguyen HV, Gaillardin C (1993) Chromosomal
polymorphism of the yeast Yarrowia lipolytica and related species:
electrophoretic karyotyping and hybridization with cloned genes. Curr Genet 23: 450-
454
Nga B-H, Heslot H, Gailardin CM, Fournier P, Chan K, Chan YN, Lim EW, Nai PC (1988)
Use of nystatin for selection of tributyrin non-utilizing mutants in Yarrowia lipolytica. J
Biotechnol 7: 83-86
Nga B-H, Gaillardin GM, Fournier P, Heslot H (1989) Genetic analysis oflipase low-produc-
ing mutants of Yarrowia lipolytica. J Gen Microbiol135: 2439-2443
Nicaud JM, Fabre E, Beckerich JM, Fournier P, Gaillardin C (1989a) Cloning, sequencing
and amplification of the alkaline extracellular protease gene of Yarrowia lipolytica J
Nicaud J-M, Fabre E, Gailardin C (1989b) Expression of invertase activity in Yarrowia
lipolytica and its use as a selective marker. Curr Genet 16: 253-260
Nicaud JM, Fournier P, La Bonnardiere C, Chasles M, Gaillardin C (1991) Use of ARS18
based vectors to increase protein production in Yarrowia lipolytica. J Biotechnol 19:
259-270
NuttIey WM, Brade AM, Gaillardin C, Eitzen GA, Glover JR, Aitchinson JD, Rachubinski RA
(1993) Rapid identification and characterization of peroxisomal assembly mutants in
Yarrowia lipolytica. Yeast 9: 507-517
NuttIey WM, Brade AM, Eitzen GA, Veenhuis M, Aitchinson JD, Szilard RK, Glover JR,
Rachubinski RA (1994) PAY4, a gene required for peroxysome assembly in the yeast
Yarrowia lipolytica, encodes a novel member of a family of putative ATPases. J BioI
Chem 269: 556-566
Nyns EJ, Auquiere JP, Chiang N, Wiaux AL (1967) Comparative growth of Candida
lipolytica on glucose and n-hexadecane. Nature 215: 177-178
Ogrydziak DM (1988a) Development of genetic maps of non-conventional yeasts. J Basic
Ogrydziak DM (1988b) Production of alkaline extracellular protease by Yarrowia lipolytica.
CRC Crit Rev Biotechnol8: 177-187
Ogrydziak DM (1993) Yeast extracellular proteases. Crit Rev Biotechnol13: 1-55
Ogrydziak DM, Mortimer RK (1977) Genetics of extracellular protease production in
Saccharomycopsis lipolytica. Genetics 87: 621-632
Ogrydziak DM, Demain AI, Tannenbaum SR (1977) Regulation of extracellular protease
production in Candida lipolytica. Biochim Biophys Acta 497: 525-538
Ogrydziak D, Bassel J, Contopoulou R, Mortimer RK (1978) Development of genetic tech-
niques and the genetic map of the yeast Saccharomycopsis lipolytica. Mol Gen Genet 163:
229-239
Ogrydziak DM, Cheng S-C, Scharf SJ (1982) Characterization of Saccharomycopsis lipolytica
mutants producing lowered levels of alkaline extracellular protease. J Gen Microbiol128:
2271-2280
Okuma M, Hwang CW, Masuda Y, Nishida H, Sugiyama J, Ohta A, Takagi M (1993) Evolu-
tionary position of n-alkane-assimilating yeast Candida maltosa shown by nucleotide
sequence of small-subunit ribosomal RNA gene. Biosci Biotechnol Biochem 57: 1793-
1794
Oogaki M, Nakahara T, Uchiyama H, Tabuchi T (1983) Extracellular production ofD-(+)-2-
hydroxyglutaric acid by Yarrowia lipolytica from glucose under aerobic thiamine-defi-
cient conditions. Agric BioI Chem 47: 2619-2624
Ota Y, Morimoto Y, Sugiura T, Minoda Y (1987) Soybean fraction increasing the extracellu-
lar lipase production by Saccharomycopsis lipolytica. Agric BioI Chem 42: 1937-1938
Ota Y, Gomi TK, Kato S, Sugiura T, Mindoa Y (1982) Purification and some properties of
cell-bound lipase from Saccharromycopsis lipolytica. Agric BioI Chem 46: 2885-2893
Ota Y, Oikawa S, Morimoto Y, Minida Y (1984) Nutritional factors causing mycelial devel-
opment of Saccharomycopsis lipolytica. Agric BioI Chem 48: 1933-1939
Ozegowski R, Kunath A, Schick H (1993) Tetrahedron-Asymmetry 4: 695-698
Pertuiset B, Beckerich Gaillardin C (1994) Molecular cloning of Rab-related genes in the
yeast Yarrowia lipolytica. Analysis of RYLl, an essential gene encoding a SEC4 homo-
logue. Curr Genet 27: 123-130
Peters II, Nelson FE (1948a) Factors influencing the production of lipase by Mycotorula
Peters II, Nelson FE (1948b) Preliminary characterization of the lipase of Mycotorula
Poncet S, Arpin M (1965) Les Candida sans pouvoir fermentaire (Cryptococcacees).
Antonie Leeuwenhoek J Microbiol31: 433-464
10. Yarrowia /ipolytica 387
Poritz MA, Siegel V, Hansen W, Walter P (1988) Small ribonucleoproteins in

Schizosaccharomyces pombe and Yarrowia lipolytica homologous to signal recognition
particle. Proc Natl Acad Sci USA 85: 4315-4319
Prodromou C, Wright IP, Evans IH, Bevan EA (1991) Cloning of the HIS3 gene of Yarrowia
lipolytica. Antonie Leeuwenhoek 60: 95-99
Rodriguez C, Dominguez A (1984) The growth characteristics of Saccharomycopsis
lipolytica: morphology and induction of mycelium formation. Can J Microbiol 30: 605-
612
Rodriguez C, Lopez MC, Dominguez A (1990) Macromolecular synthesis during the yeast-
mycelium transition in Yarrowia lipolytica. Exp Mycol14: 310-321
Roiha H, Shuster EO, Brow DA, Guthrie C (1989) sn RNAs from budding yeasts: phyloge-
netic comparisons reveal extensive size variation. Gene 82: 113-124
Rothstein M, Cooksey KE, Greenberg DM (1962) Metabolic conversion of pipecolic acid into
a-amino adipic acid. J BioI Chern 237: 2828-2830
Rubin GM (1974) Three forms of the 5.8-S ribosomal RNA species in Saccharomyces
cerevisiae. Eur J Biochem 41: 197-202
Sawnor-Korszynska D, Morzycka E, Zaborowska-Bojanowska K (1977) Compartmentation
of the amino acid pool in Saccharomycopsis lipolytica. Acta Biochim Pol 24: 75-85
Schmid-Berger N, Schmid B, Barth G (1994) YItl, a highly repetitive retrotransposon in the
genome of the dimorphic fungus Yarrowia lipolytica. J Bacteriol176: 2477-2482
Schweizer E, Kotting H, RegIer R, Rottner G (1988) Genetic control of Yarrowia lipolytica
fatty acid synthetase synthesis and function. J Basic Microbiol28: 283-292
Sekula BC (1991) Wax esters production by yeast. Biotechnol. Plant Fats Oils: 162-176
Sen K, Komagata K (1979) Distribution of urease and extracellular DNase in yeast species.
Shah DN, Chattoo BB (1993) Starch hydrolyzate, an optimal and economical source of
carbon for the secretion of citric acid by Yarrowia lipolytica. Starch 45: 104-109
Shah DN, Purohit AP, Sriprakash KS (1982) Preliminary genetic studies on a citric
acid-producing strain of Saccharomycopsis lipolytica. Enzyme Microb Technol 4: 116-
117
Simms PC, Ogrydziak DM (1981) Structural gene for the alkaline extracellular protease of
Saccharomycopsis lipolytica. J Bacteriol145: 404-409
Snow R (1966) An enrichment method for auxotrophic yeast mutants using the antibiotic
nystatin. Nature 211: 206-207
Stahl U (1978) Zygote formation and recombination between like mating types in the yeast
Saccharomyces lipolytica by protoplast fusion. Mol Gen Genet 160: 111-113
Strick CA, James LC, O'Donnell MM, Gollaher MG, Franke AE (1992) The isolation and
characterization of the pyruvate encoding gene from the yeast Yarrowia lipolytica. Gene
118: 65-72
Sugiura-M, Isobe-M, Oikawa-T, Oono-H (1976) Sterol ester hydrolytic activity of
lipoprotein lipase from Pseudomonas fluorescens. Chem Pharm Bull (Tokyo) 24: 1202-
1208
Tharaud C, Ribet A-M, Costes C, Gailardin C (1992) Secretion of human blood coagulation
factor XIIIa by the yeast Yarrowia lipolytica. Gene 121: 111-119
Theil F, Schick H, Winter G (1991) Transesterification of meso-cyclopentane diols. Tetrahe-
dron 47: 7569-7582
Treton BY, Heslot H (1978) Etude de quelques proprietes de l'aconitase de la levure
Saccharomycopsis lipolytica. Agric BioI Chem 42: 1201-1206
Treton BY, Le Dall MT, Heslot H (1985) Virus like particles from the yeast Yarrowia
Treton BY, Le Dall MT, Heslot H (1987) UV-induced curing of the double-stranded RNA
virus of the yeast Yarrowia lipolytica. Curr Genet 12: 37-39
Treton BY, Le Dall MT, Gaillardin CM (1992) Complementation of Saccharomyces cerevisiae
acid phosphatase mutation by a genomic sequence from the yeast Yarrowia lipolytica
identifies a new sequence. Curr Genet 22: 345-355
388 G. Barth and C. Gaillardin: Yarrowia lipolytica
Tsugawa R, Nakase T, Koyabashi T, Yamashita K, Okumura S (1969) Fermentation of n-

paraffins by yeast. Part III. alpha-ketoglutarate productivity of various yeast. Agric BioI
Chern 33: 929-938
van der Walt JP, von Arx JA (1980) The yeast Yarrowia gen. nov. Antonie Leeuwenhoek J
van Heerikhuizen H, Ykema A, Klootwijk J, Gaillardin C, Ballas C, Fournier P (1985)
Heterogeneity in the ribosomal RNA genes of the yeast Yarrowia lipolytica; cloning and
analysis of two size classes of repeats. Gene 39: 213-222
Vega R, Dominguez A (1986) Cell wall composition of the yeast and mycelial forms of
Yarrowia lipolytica. Arch Mikrobiol144: 124-130
Vega R, Dominguez A (1988) Partial characterization of alpha-mannosidase from Yarrowia
lipolytica. J Basic Microbiol28: 371-379
Weber H (1979) Substructural studies on sporulation of Saccharomycopsis lipolytica. Z Allg
Weber H, Barth G (1988) Nonconventional yeasts: their genetics and biotechnological
applications. CRC Crit Rev Biotechnol 7: 281-337
Weber H, Forster W, Jacob HE, Berg H (1980) Enhancement of yeast protoplast fusion by
electric field effects. Adv in Biotech: Proceedings of the 6th Int Symp/5th Int Symp on
Yeasts, London, Canada, pp 219-224
Weber H, Kurischko C, Barth G (1988) Mating in the alkane-utilizing yeast Yarrowia
lipolytica. J Basic Microbiol28: 229-240
Weissbrodt E, Gey M, Barth G, Weber H, Stottmeister U, Duresch R, Richter H-P (1988)
Verfahren zur Herstellung von 2-0xoglutarsaure durch Hefen. DD Patent no. 267999
AI.
Wesolowski M, Algeri A, Fukuhara H (1981) Gene organization of the mitochondrial DNA
of yeasts: Kluyveromyces lactis and Yarrowia lipolytica. Curr Genet 3: 157-162
Wickerham LJ, Kurtzman CP, Herman AI (1970) Sexual reproduction in Candida lipolytica.
Science 167: 1141
Wing RA, Ogrydziak DM (1985) Development of the genetics of the dimorphic yeast
Yarrowia lipolytica. In: Timberlake WE (ed) Molecular genetics of filamentous fungi.
A.R. Liss New York, pp 367-381
Wojatatowicz M, Rymowicz W, Kautola H (1991) Comparison of different strains of
Yarrowia lipolytica for citric acid production from glucose hydrol. Appl Microbiol
Xuan JW, Fournier P, Gaillardin C (1988) Cloning of the LYS5 gene encoding saccharopine
dehydrogenase from the yeast Yarrowia lipolytica by target integration. Curr Genet 14:
15-21
Xuan JW, Fournier P, Declerck N, Chasles M, Gaillardin C (1990) Overlapping reading
frames at the LYS5locus in the yeast Yarrowia lipolytica. Mol Cell BioI 10: 4795-4805
Yamada T, Ogrydziak DM (1983) Extracellular acid proteases produced by
Saccharomycopsis lipolytica. J Bacteriol154: 23-31
Yamada Y, Nojiri M, Matsuyama M, Kondo K (1976) Goenzyme Q systems in the classifica-
tion of the ascosporogenous yeast genera Debaryomyces, Saccharomyces, Kluyveromyces
and Endomycopsis. J Gen Appl Microbiol Tokyo 22: 325-337
Yarrow D (1972) Four new combinations in yeasts. Antonie Leeuwenhoek J Microbiol38:
357-360
Yaver DS, Matoba S, Ogrydziak DM (1992) A mutation in the signal recognition particle
7SRNA of the yeast Yarrowia lipolytica preferentially affects synthesis of the alkaline
extracellular protease: in vivo evidence for translational arrest. J Cell BioI 116: 605-616
Zviagintzeva IS, Dmitriev VV, Ripan EL, Fichte BA (1980) Localization of an extracellular
lipase of the yeast Candida paralipolytica. Microbiology (USSR) 49: 417-420 (in Russian)
CHAPTER 11
Arxula adeninivorans
Gotthard Kunze and Irene Kunze
1
History of Arxula adeninivorans Research
In 1984, Middelhoven et al. described a yeast species which was isolated from soil
by the enrichment culture method. The yeast was known as Trichosporon
adeninovorans at that time. This strain (CBS 8244T) displays unusual biochemical
activities. It was shown to assimilate adenine and several other purine compounds
as sole source of carbon and energy. Moreover, it grows at the expense of several
amines.
A second strain of this species, Ls3 (PAR-4), originated from Siberia
(Kapultsevich, Institute of Genetics and Selection of Industrial Microorganisms,
Moscow, Russia). It was isolated during production of single-cell protein from
wood hydrolysates.
In 1990, three further Tr. adeninovorans strains were isolated from chopped
maize herbage ensiled at 25 or 30 D C in The Netherlands. Four strains of the same
species were also found in humus-rich soil in south Africa (Van der Walt et al.
1990). A new genus, Arxula Van der Walt, M.T. Smith & Yamada (Candidaceae)
was proposed for the classification of all these strains, which are xerotolerant,
ascomycetous, anamorphic, arthroconidial, and nitrate-positive yeasts (Van der
Walt et al. 1990). The genus Arxula accommodates two species, viz. Arxula
terrestre (Van der Walt and Johanssen) Van der Walt, M.T. Smith & Yamada, nov.
comb., which is the type species of the genus, and Arxula adeninivorans
(Middelhoven, Hoogkamerte Niet and Kregervan Rij) Van der Walt, M.T. Smith
and Yamada, nov. comb.
2
Physiology and Biochemical Procedures
2.1
Physiology
A. adeninivorans and A. terrestre are conspicuous because of the utilization of

nitrate. They can grow on adenine (very slowly), uric acid, butylamine,
Institut fur Pfianzengenetik und Kulturpfianzenforschung, Corrensstr. 3, 06466

Gatersleben, Germany
390 G. Kunze and I. Kunze
pentylamine, and putrescine as sole source of carbon and nitrogen. However, A.

terrestre, in contrast to A. adeninivorans, has no fermentative ability and does not
assimilate soluble starch, melibiose and melizitose, propylamine and hexylamine
(Middelhoven et al. 1984).
Middelhoven et al. (1991) published a detailed description of the yeast species
A. adeninivorans. It assimilates all the sugars, polyalcohols, and organic acids used
in the conventional carbon compound assimilation test rapidly, except for L-
rhamnose, inulin, lactose, lactate, and methanol. All conventionally used com-
pounds except creatine and creatinine were suitable as nitrogen sources. Several
nitrogenous compounds, e.g., amino acids, purine derivatives, served as sole
Table 1. Properties of secretory enzymes of the strain A. adeninivorans Ls3 (BUttner et al.
1987, 1988, 1989a, 1990b,c, 1991a,b, 1992a,b; BUttner and Bode 1992)
Enzyme Optimum Molecular

weight
Temperature pH Km value
Glucoamylase 60 to 70°C 4.0-5.0 1.2 gIl for starch 225000

(1.4-a-D-glucan 11.1 mM for maltose
glucohydrolase,
EC 3.2.1.3)
Acid phosphatases I
and II (orthophosphoric-
monoester
phosphohydrolase,
EC 3.1.3.2)
I 50 to 55°C 5.2-5.5 3.5mM for p-nitro- 320000
phenylphosphate
II " 250000
Trehalase (a,a- 45 to 55°C 4.5-4.9 0.8-1.0 mM for 250000
Trehalose- trehalose
Glucohydrolase,
EC 3.2.1.28)
Cellobiase I and II (fJ-D-
glucosidase, EC 3.2.1.21)
I 60 to 63°C 4.5 4.1 mM for cellobiose 570000
II 3.0 mM for cellobiose 525000
Invertase (fJ-D- 60 to 70°C 5.0 71-83mM for sucrose 650000
fructofuranoside
fructohydrolase,
EC 3.2.1.26)
fj-D-xylosidase (l,4-fJ-D- 60°C 5.0 0.23-0.33 mM for 60000
xylan xylohydrolase, p-nitrophenyl-
EC 3.2.1.37) fj-xylopyranoside
11. Arxula adeninivorans 391
source of carbon, nitrogen, and energy. This was also true of many primary
n-alkylamines and terminal diamines, but of nitrogen-less analogous compounds
such as alcohols, dialcohols, carboxylic acids, and dicarboxylic acids only
intermediates of general metabolism were assimilated (Middelhoven et al.
1991).
The growth on some industrially available substrates is combined with a rela-
tively high thermotolerance. Surprisingly, the strain Ls3 can grow at temperatures
higher than 45°C without an adaptation phase (Bottcher et al. 1988).
Arxula adeninivorans can not only grow on many different carbon sources but
produces and secretes also several extracellular enzymes into the culture medium
during growth. Besides RNase and some proteases, various glucosidases, such as
glucoamylase, ,B-glucosidases, pectinases, xylosidase, and invertase could be de-
tected. Table 1 summarizes important secretory enzymes and some of their prop-
erties, analyzed from A. adeninivorans Ls3.
Kunze and Kunze (l993b) compared the properties of secretory invertase and
glucoamylase of the strain Ls3 with those of six further A. adeninivorans strains
(CSIR 1136, CSIR 1138, CSIR 1147, CSIR 1148, CSIR 1149, CBS 8244T). All strains
show similar activities within a pH and temperature range of 3.5 to 6.5 and 20 to
80°C, respectively.
Further investigations were done concerning the secretion of invertase and
glucoamylase during the cultivation of the seven A. adeninivorans strains (Kunze
and Kunze 1993b). With the exception of CSIR 1147, which secretes invertase
activities up to 5 nkat/ml, the secreted invertase of all the other strains varied
between 1 and 2 nkat/ml. The highest activity of the constitutive expressed inver-
tase could be found after about 40 h of cultivation in minimal medium, with 1%
maltose as sole source of carbon.
For glucoamylase secretion it could be observed that especially the strain CSIR
1138 secretes the highest enzyme activities (4.5 nkat/ml). In the culture medium of
the other A. adeninivorans strains, 1-2nkat/ml activity of glucoamylase could be
estimated. The highest activity of the inducible expressed glucoamylase was
reached after about 60 h of cultivation in minimal medium with 1% maltose
(Wartmann et al. 1995).
2.2
Biochemical Procedures
2.2.1
Cell Mass Determination
The yeast cell density can be determined by absorbance in a spectrophotometer.

An absorbance value of 1.2 at 600 nm corresponds to a cell density of about 1 x 108
cells/ml. However, the conditions for cultivation can influence the morphology of
the strains. Some of them tend to form mycelia (for example CSIR 1138), which
affects this method of cell mass determination immensely.
392 G. Kunze and 1. Kunze
2.2.2
Preparation of DNA
Chromosomal DNA
The chromosomal DNA is prepared from A. adeninivorans with a modified
method described by Ledeboer et al. (1985).
Cells cultivated in 200-400 ml YE medium or SD medium at 37°C are harvested,
washed, disrupted mechanically by liquid nitrogen, and extracted with about 10 ml
2mM Tris/pH 8.0; 50mM EDTA, 2.5% SDS.
The suspensions are centrifuged at 15000gfor 20 min. Ethanol (1.5 vol) is added to
the supernatant, followed by incubation for 30 min at -20°C.
Subsequently, the pellet is collected by centrifugation and resuspended in 4ml TE
buffer (10mM Tris/pH 8.0; ImM EDTA).
Three hundred,ug RNase A is added and the suspension is incubated for 30 min at
37°C.
Then 5mg pronase N (Serva) is mixed into the suspension, which is incubated for
30 min at 30°C.
The DNA is treated with phenol, phenol/chloroform, and chloroform, and subse-
quently the DNA is precipitated, centrifuged, and suspended in a small volume of
TE buffer.
Chromosomal DNA is prepared from the other nucleic acids by means of density
gradient centrifugation described by Ledeboer et al. (1985).
Mitochondrial DNA
The method for isolation of mitochondrial DNA is described by Pich and Kunze
(1992).
2.2.3
Preparation of Probes for Enzyme Activity
Assay for Extracellular Enzymes

The activity of secretory enzymes can determined directly from the culture me-
dium after induction of the respective enzyme during growth of the strains in the
presence of the appropriate substrate. For most of the secretory enzymes like
glucoamylase, invertase, trehalase, and fi-glucosidase, the release of glucose from
the carbon source used can be determined with glucoseoxydase/ peroxydase
reagent.
Methods for preparation of secretory enzymes were described by Buttner et al.
for glucoamylase (1987), invertase (I 990b), trehalase (1992a), fi-glucosidase
(1991a), and acid phosphatase (1991b).
Cell Disruption for Assays of Intracellular Enzymes

The activity of most of the intracellular enzymes can be determined after disrup-
tion of the cells by vortexing with glass beads, by X-pressure cell, or by
permeabilization of the cells by means of 0.1 % Triton x100 in 100 mM Tris/HCI,
pH 8.4, combined with freezing.
3
Growth Media
For routine laboratory studies, the basic culture conditions are similar to those
generally used for S. cerevisiae. The YE medium contains 0.5% yeast extract, 0.5%
peptone, and 1% of the carbon source. The minimal medium (SD medium) is
made as described by Tanaka et al. (1967) supplemented with appropriate carbon
sources to 1% and a vitamin mix containing pantothenic acid, thiamine, pyrid-
oxine, nicotinic acid, and biotin.
4
Available Strains and Preservation Methods
4.1
Strains
Strains of the genus Arxula have been isolated from different continents of the
earth. A general view of available wild-type strains is given in Table 2.
Most of the available Arxula adeninivorans strains were compared concerning
their colony morphology on YE medium after growth on SD medium with 1%
maltose as sole source for carbon (Kunze and Kunze 1993a). Figure 1 shows typical
single colonies of the strains, which differ in size and surface structure.
Diverse auxotrophic mutants of the strain A. adeninivorans Ls3 were induced
and biochemically characterized by Samsonova et al. (1989). After N-methyl-N'-
Table 2. Available wild-type strains of Arxula adeninivorans
Strain Source
Ls3 = PAR-4 Wood hydrolysates (Siberia)

CBS 8244T = CSIR 577 Soil (The Netherlands)
CBS 7370 = CSIR 1117 Soil (South Africa)
CBS 7377 = CSIR 1118 Soil (South Africa)
CSIR 1136 Maize silage (The Netherlands)
CSIR 1138 Maize silage (The Netherlands)
CSIR 1147 Soil (South Africa)
Fig. la-g. Single colonies of A. adeninivorans CSIR 1136 (a), CSIR 1138 (b), CSIR 1147 (c),
CSIR 1148 (d), CSIR 1149 (e), CBS 8244T (f), 1s3 (g) cultivated on YE medium at 30°C for
2 days. 1.5x
nitro-N-nitrosoguanidine (NG) and UV mutagenesis 3-4% auxotrophic mutants,

could be found at a survival rate of 10-3 •
The markers are especially requirements for amino acids, inositol, nicotinic
acid, and pyridoxine. They provide suitable chromosomal markers, an essential
basis for further genetic study of this yeast.
BUttner et al. (l989b) isolated and characterized carbon catabolite derepression
mutants from Ls3 using 2-deoxy-D-glucose. These mutants are especially charac-
terized by a high synthesis of some extracellular enzymes in the presence of
different carbon sources.
Auxothrophic mutants could also be selected from the other CBS and CSIR
wild-type strains. After NG and UV mutagenesis they were induced by similar
frequencies compared with Ls3 (Samsonova, unpubl.).
4.2
Preservation Methods
All strains of A. adeninivorans can be preserved by freezing or on YE agar (Kirsop

1988). To cryopreserve, the strains are cultivated in YE medium with 1% glucose
and frozen with 10% glycerol. Before the yeasts are frozen to -80°C, the cells are
cooled to -20°C for 2h. Similar cryocultures have been stored in our laboratory
since 1986. By the second method all strains are transferred at 2-yearly intervals on
YE agar. Therefore, cultures must be covered by a layer of paraffin oil and stored
at 4°C.
5
Parasexual Genetics
5.1
Protoplast Fusion (see also Chap. 2, this VoL)
A useful technique for the asexual and haploid yeast species A. adeninivorans is the
polyethyleneglycol (PEG)-induced fusion of protoplasts followed by mitotic
haploidization. According to a method developed by Klinner and Bottcher (1984)
protoplasts can be stabilized by 1 M sorbitol and regeneration of the fusion prod-
ucts takes place on the surface of agar. Up to now, many fusions between most of
the wild-type strains, listed in Table 2, could be achieved (Samsonova, unpubl.).
Spontaneous or induced haploidization has been developed as a gene mapping
tool also for other yeast species, such as Schizosaccharomyces pombe (Gutz 1966),
Rhodosporidium toruloides (Samsonova and Bottcher 1978), Pichia guilliermondii
(Samsonova and Bottcher 1978), Saccharomyces cerevisiae (Wood 1982), Pichia
pinus (Tolstorukov et al. 1983), and Yarrowia lipolytica (Kurischko 1986).
5.2
Mitotic Haploidization
Mitotic haploidization can be achieved by benomyl. Benomyl is known to induce

haploidization in yeast species without mitotic recombination processes (Wood
1982; Bottcher and Samsonova 1983). Therefore this technique is useful for the
location of a given marker. A method suitable for the analysis of A. adeninivorans
was developed by Samsonova and Bottcher (1980). They used 5 mgtl benomyl and
cultivated the strains at 17-20°C. By using benomyl-induced haploidization, four
linkage groups could be found for the Arxula strain Ls3 (Buttner et al. 1990b;
Samsonova, unpubl.). These findings agree with physical analyses using pulsed
field gel electrophoresis (Sect. 6). By both methods 26 genes could be mapped. The
gene of the extracellular glucoamylase from Ls3 could be located on linkage group
II (Buttner et al. 1990). They assume that the organization of the linkage group in
CBS 8244T differs from that in Ls3.
6
Chromosomal DNA
DNA reassociation, pulse field gel electrophoresis (PFG) and DNA fingerprinting
have been chosen to characterize the genomic structure of some A. adeninivorans
strains (Gienow et al. 1990; Kunze and Kunze 1993a).
6.1
DNA Reassociation
With the help of DNA reassociation, genome complexities have been analyzed. The
Arxula strain Ls3 possesses genome complexity of 16.1 x 109 Da and strain CBS
8244T of 16.9 X 109 Da. In comparison to the complexity of S. cerevisiae (9.2 x 109
Da) these are relatively high values. Both tested Arxula strains could be identified
as haploid strains after the total DNA concentration per cell and the mitochondrial
DNA contents were measured (Table 3).
6.2
Pulsed Field Gel Electrophoresis
Chromosomes of seven A. adeninivorans strains (CSIR 1136, CSIR 1138, CSIR

1147, CSIR 1148, CSIR 1149, CBS 8244T, and Ls3) were separated by PFG electro-
phoresis and compared with those of the laboratory strains S. cerevisiae S288C and
Schizosaccharomyces pombe 296R (Fig. 2; Table 4). Four chromosomes were iden-
tified in each Arxula strain. The molecular weights of these chromosomes were
estimated between 4.6Mbp (chromosome 1) and 1.6Mbp (chromosome 4).
Based on these chromosomal patterns, the tested strains can be divided into
four groups. The Arxula strain CSIR 1136 and CSIR 1138 (lanes 2 and 3) were
classified into the first group. Both strains show clear differences in the chromo-
some pattern in comparison to the Arxula strains CSIR 1147 and Ls3 belonging to
the second and the third group, respectively (lanes 4 and 8). Chromosomes 2 and
3 of both strains, respectively, differ in their molecular weight from the corre-
sponding chromosomes of the strains belonging to the first group. In contrast to
the strains of the first three groups, strains in the fourth group, including CSIR
Table 3. The degree of ploidy of Arxula adeninivorans Ls3
S. cerevisiae A. adeninivorans A. adeninivorans

DI0 CBS 8244T Ls3
Haploid genome size of the 1.6 x 10-14 2.7 X 10-14 2.5 X 10-14
chromosomal DNA (g)
Total DNA concentration 4.1 x 10-14 2.6 X 10-14 2.9 X 10-14
per cell (g)
Portion of mtDNA 8.0 4.3 8.0
of the total DNA (%)
Portion of pDNA on the 3.0 0 0
total DNA (%)
Final concentration of 3.6 x 10-14 2.5 X 10-14 2.7 X 10-14
chromosomal DNA (g)
Ploidy 2n In In
Table 4. PFG electrophoresis running conditions. Using 0.8%

agarose, 11 DC, modified 0.25 x TBE (0.025 M Tris/HCI; 0.025 M
boric acid; 0.05mM Na2 EDTA) and 46V
Run time (h) Pulse time (s) Electrode configuration
72 3000-1000 (linear) 120 (constant)

0
24 1000 (constant) 120 (constant)

0
1 2 3 4 5 6 7 8
4.6
3.0
1.6
Fig. 2. PFG electrophoretic separation of chromosomes from seven A. adeninivorans

strains. 1 S. cerevisiae S288C; 2 A. adeninivorans CSIR 1136; 3 A. adeninivorans CSIR 1138;
4 A. adeninivorans CSIR 1147; 5 A. adeninivorans CSIR 1148; 6 A. adeninivorans CSIR 1149;
7 A. adeninivorans CBS 8244T; 8 A. adeninivorans Ls3. Molecular weight markers (Mbp) are
shown on the left
1148, CSIR 1149, and CBS 8244T (lanes 5-7), are very similar in their chromosomal
patterns.
All tested Arxula strains (lanes 2-8) differ in their chromosome patterns in
comparison to S. cerevisiae strain S288C (lane O. Only the latter yeast strain
contains the additional 2-J.lm plasmid DNA band. Naturally existing DNA and
RNA plasmids could not be identified in any of the described A. adeninivorans
strains.
6.3
DNA Fingerprinting
Different combinations of DNA probes and restriction enzymes were tested to

obtain fingerprints of DNA from several A. adeninivorans strains.
1 2 3 4 5 6 7 8 9 10 11 12 13 14
6.7
2.0 -
0.6
Fig. 3. Hybridization of BeoRI (lanes 1-7) and BamHI (lanes 8-14) digested chromosomal
DNA of several Arxula strains with (GT)\O' 1 and 8 A. adeninivorans CSIR 1136; 2 and 9 A.
adeninivorans CSIR 1138; 3 and 10 A. adeninivorans CSIR 1147; 4 and 11 A. adeninivorans
CSIR 1148; 5 and 12 A. adeninivorans CSIR 1149; 6 and 13 A. adeninivorans CBS 8244T; 7
and 14 A. adeninivorans Ls3. Molecular weight markers (kb) are shown on the left
Oligonucleotides (CT)lO' (GACA)4' and (CT)lO were found to be suitable probes

for fingerprints. EcoRI and BamHI-digested DNA gives rise to a more appropriate
restriction pattern than HinfI digests.
Figure 3 shows results of the analyses after EcoRI and BamHI digestions and of
(GT)lO hybridization. On the basis of these results, Arxula strains can be classified
into two distinguishable groups. The first group contains the strains CSIR 1136,
CSIR 1138, and CBS 8244T (lanes 1,2,6, and lanes 8, 9,14). Within this group, only
very small differences were visible in DNA pattern after digestions with EcoRI and
BamHI. The second group comprises the Arxula strains CSIR 1147, CSIR 1148,
CSIR 1149, and Ls3 (lanes 3-5, 6, and lanes 10-12 and 14). Also these four strains
show very similar hybridization patterns.
Analyses of EcoRI and BamHI digested chromosomal DNA fragments, which
were hybridized with the oligonucleotides (GACA)4 and (CT)lO (data not shown),
give the same classification which is in accordance to that obtained by (GT)lO
hybridization experiments.
7
Mitochondrial DNA
Mitochondrial DNA from the strain A. adeninivorans Ls3 was characterized (Pich
and Kunze 1992). It is circular and may amount to some 8% of the total cellular
DNA. The average copy number is about 50 per cell, and the GC content was
determined as 30.3 mol%. It seems to be a particularly GC-rich genome compared
to the mtDNA of S. cerevisiae (20.2mol%).
8gl11 Hind III

EcoRV
Hind III
Hind III mtDNA

33.5 kbp
Hind III
Hind III
8gl11
EcoRV 8gl11
Fig. 4. Circular restriction and genetic map of mtDNA from A. adeninivorans. Abbrevia-
tions: cob apocytochrome b; olil ATPase subunit 9; oli2 ATPase subunit 6; coxl cytochrome
c oxidase subunit 1; cox2 cytochrome c oxidase subunit 2; lrRNA 21S rRNA
The size, as estimated by restriction analysis performed with nine endonu-

cleases, is 35.5 kbp. The map comprises all restriction sites of Hind III, BglII, and
BcoRV (Fig. 4). Compared to other yeasts, Arxula harbors a relatively small mito-
chondrial genome, which is similar to those of Candida rhagii (30.0kbp, Kovac et
al. 1984) and Kluyveromyces lactis (37.0kbp, Wilson et al. 1989).
Using mt gene probes from S. cerevisiae, six structural genes (cob, coxl, cox2,
olii, oli2, and 21S rRNA) were located on the mitochondrial genome of A.
adeninivorans. The genetic map shows differences in the genome organization to
other yeast mtDNAs.
The restriction patterns of mtDNAs of other strains differ to the data obtained
with the strain Ls3. This points to polymorphic rearrangments inside the Arxula
strains.
8
Transformation System
8.1
Genetic Markers and Isolation of Genes
Mutants of A. adeninivorans can be isolated at relatively high frequency after NG

and UV mutagenesis. About 600 auxotrophic mutants (see below), such as lys2
mutants, are available for the strain A. adeninivorans Ls3.
Kunze et al. (1990) describe the isolation of genes from A. adeninivorans by

means of DNA hybridization and the complementation test of the corresponding
E. coli mutations.
Thus, for example, the restricted Arxula DNA hybridize with the S. cerevisiae
DNA fragments containing the LYS2, AROM, CUPI, STE6, TEFl genes and the
regions of CEN5, CEN6 (Table 5). With the help of radiolabeled DNA probes from
the DNA of the S. cerevisiae LYS2 gene the Arxula LYS2 gene could be isolated from
a Charon 4A gene library inserted 1O-15kbp DNA fragments of the chromosomal
DNA from Arxula (Fig. 5).
Another screening test was the complementation of the respective E. coli mu-
tants. Thus the IL VI gene was isolated by means of complementation of the E. coli
ilvA mutation. Therefore, a plasmid gene library of the S. cerevisiae Yep 13 plasmid
was used which contains 5-8kbp DNA fragments from Arxula (Fig. 6).
With the help of pulsed field gelelectrophoresis the LYS2 gene and the IL VI
gene were identified on the largest chromosome (chromosome 1) and on the
chomosome with the lowest molecular weight (chromosome 4), respectively (Fig.
7A,B).
Table 5. Hybridization of different genes, centromere regions

and promoter-terminator sequences from various organisms
Organism Gene Hybridization
s. eerevisiae LYS2 +
LEU2
ARG4
URA3
TRPl
HIS3
AROM +
CEN6 +
CENS +
CUPl +
SUP4
STE6 +
TEFl +
TY96
GALl promoter
GAP promoter
ADHl promoter/terminator -
PHOS promoter/terminator -
CYCl promoter/terminator
N. erassa Bml-
HIS4 +
TUB2 +
Bae. maeerans bglM
E. coli aroA +
11. Arxu/a adeninivorans 401
J: J:
E E iii
aI aI en
!D !D
a:0 1= a:0
~17
()
I Q..iii
00- ()
w en w
II I I
LYS2
f---------11.0 kbp
Fig. 5. Restriction map of the LYS2 gene from A. adeninivorans
Bam HI
Hpal
01
o
o
0-
"0
Hindlll
CIa I
I-----Pstl
Pst I
Ace I
Bell
Bam HI
Xhol
EeoRV
I----Ndel
Hindlll
Spel
Fig. 6. Restriction map of the IL Vi gene from A.

Bell adeninivorans
1 2 2
4.6 4.6
3.0 3.0
1.6 1.6
A B
Fig. 7A,B. Pulsed field gel electrophoresis of A. adeninivorans Ls3 (All and BIl) and
hybridization with the LYS2 gene (Al2) and the ILVl gene (B/2) from Arxula
8.2
Transformation Markers
The S. cerevisiae marker LYS2 has been conveniently used in A. adeninivorans Ls3,
because the corresponding mutation in A. adeninivorans can be complemented by
these genes under their own promoter (Kunze et al. 1990). Additionally, the corre-
sponding Arxula gene was isolated from a genomic library and used as a trans-
formation marker. The product of this gene - the 2-aminoadipate reductase -
complements the lys2 mutation from Arxula strain Ls3 as well as from S. cerevisiae.
8.3
Various Methods of Transformation
As a rule, our laboratory transforms plasmids containing the LYS2 gene from S.
cerevisiae or from A. adeninivorans as selective markers into the corresponding
yeast strains with a lys2 mutation, for example the strain G704 (lys2 cys; Fig. 8).
DNA fragments or plasmids could not be transformed into other Arxula wild-type
strains or mutants from these strains (CBS 8244T, CSIR 1136, CSIR 1138, CSIR
1147, CSIR 1148, CSIR 1149).
Three methods (lithium salt treatment, frozen competent cells, or
electroporation) can be used to transform DNA into A. adeninivorans Ls3. These
ilv 1
pilv 1/3
4.3kbp
pLYS2
9.15 kbp
pilv1(LYS2) pDP 12
9.1 kbp 10.6 kbp
Fig. 8. Plasmids used to transform A. adeninivorans. The plasmids contain sequences from
following sources: pBluescript bla and ori region thin line; S. cerevisiae sequences thick line
and open box; A. adeninivorans sequences dark box
methods were also described for the transformation of S. cerevisiae and can also be
applied with minor modifications for Arxula. The efficiencies of these methods are
lower in comparison to the transformation frequencies obtained for S. cerevisiae
(Table 6).
The highest frequencies of transformants were obtained using electroporation.
Linearized DNA, as well as circularized DNA, can be integrated into the Arxula
chromosome 1 containing the LYS2 gene. Differences in the integration mecha-
nisms using either of these DNA types cannot be determined. Most of the yeast
transformants contain additional modified plasmid DNA of the originally trans-
formed DNA plasmid or fragment.
For routine transformations, it is possible to use the lithium salt treatment (Ito
et al. 1983). The obtained transformation frequencies are low and depend on the
strains and the plasmids used. Lower concentrations of PEG 4000 (50%) advanced
the efficiency of this method in some cases.
Recently, we have optimized the procedure described by Dohmen et al. (1991)
for using frozen competent yeast cells. By using this method, plasmid DNA and
DNA fragments were transformed and integrated into the genome. The transfor-
mation frequencies are higher compared with those of the lithium salt method, but
cannot achieve the frequencies obtained by electroporation. However, a relatively
high number of revertants were selected by this transformation procedure.
The transformed DNA plasmids or DNA fragments were integrated into chro-
mosome 1 as well as replicated autonomously as plasmid with an altered restric-
tion pattern. All transformants are mitotically stable during cultivation under
selective and nonselective conditions. The presence of the plasmid DNA was de-
Table 6. Transformation frequencies of A. adeninivorans

G704 (lys2 cys) with different plasmids
Plasmid Transformation Number of

frequency transformants
per J.l£ DNA
pDP12 (1) 1.8 X 10-6 18

pDP13 (1) 7.0 X 10-7 7
pLYS2 (1) 2.0 X 10-7 2
pTALa2 (1) 9.0 X 10-7 9
pBaol (1) 2.0 X 10-7 2
pilvl (LYS2) (1) 3.0 X 10-7 3
pilv1l3 (1) o o
pLYS2 (2) 497
pDP12 (2) 875
pTALa2 (2) 547
The yeast cells were transformed by lithium salt treatment (1),

and by electroporation (2)
tected by hybridization of the transform ant DNA preparations to fragments of the

original plasmid DNA. After transformation of these DNAs in E. coli, we were able
to select ampicillin-resistant colonies. The isolated plasmids of these colonies
show differences in the restriction pattern to the original plasmids. On the basis of
these results, we suggest that transformation proceeds integratively.
8.4
Transformation Protocols
8.4.1
Transformation by Lithium Salt Treatment
This procedure is a modification of the method developed by Ito et al. (1983).

All steps described are carried out at room temperature unless indicated
otherwise.
1. Arxula cells are grown in 100mi YE-medium at 37 D C for about 18h to a density
of lOB cells/ml.
2. lOB cells/ml are harvested by centrifugation of 8000 gat 20 DC, and washed in TE
buffer (lOmM Tris/pH 8.0; 1 mM EDTA).
3. After repeated centrifugation, the cells are suspended in 1.0 ml TE buffer, 0.1 M
LiCI, and incubated for 1 h at 30 DC.
4. 100-,ul portions of this suspension containing 107 competent cells are pipetted
into sterile Eppendorf tubes containing 1-3 jig plasmid DNA. Each tube is
mixed carefully and incubated for 30 min at 30 DC.
5. After addition of 0.1 rnI70% PEG 4000 to the suspension, the cells are incubated
for Ih at 30°C and for 5 min at 37°C.
6. The yeast cells are washed twice in water and plated on SD medium with the
required amino acids.
7. The transformed cells can be selected 2-5 days later.
The A. adeninivorans Ls3 strain can be transformed with a frequency of 2-20
transformantsl,ug DNA by this method. Although the obtained transformation
frequencies are relatively small, the method is easy, applicable for all known
Arxula strains containing the equivalent mutation and reproducible. The applica-
tion of other lithium salts reduces the transformation frequency.
8.4.2
Transformation of Frozen Competent Cells
This procedure developed by Dohmen et al. (1991) has been modified.

1. Cells are cultivated in YE medium at 37°C for about 18 h to a density of 108 cellsl
ml.
2. After harvesting and washing with water, the yeast cells are suspended in a half-
volume of Bicin buffer (1 M sorbitol; 10 mM Bicin-NaOH/pH 8.35; 3% PEG 1000;
5% DMSO), centrifuged, and suspended in 1/50 volume of the same buffer; 200-
,ul portions of this suspension containing competent cells are transferred into
sterile Eppendorf tubes and frozen at -80°C. At this temperature the cells can be
stored for about 6 months.
3. One to three-,ug plasmid DNA (about 5,u1) are applied on top of the frozen
competent cells, which are thawed with vigorous agitation at 37°C for 5 min.
4. After addition of Im140% PEG 1000-0.2M Bicin-NaOH/pH 8.35 and careful
mixing, the cells are incubated at 37°C for 1 h.
5. The cells are centrifuged at 3000 gat 20°C for 5 min, washed with 1.5 rnl 0.15 M
NaCI-lOmM Bicin-NaOHlpH 8.35 and suspended in a small volume (about
100,ul) of the same buffer.
6. All the yeast cells are plated on SD medium containing the required amino acids
and cultivated at 37°C for 3-5 days.
By this method, about 10 to 100 transform ants per ,ug DNA are obtained. This
frequency depends on the DNA plasmid and the yeast strain used.
8.4.3
The Gene Pulser system from BioRad/FRG is used for the transformation in A.
adeninivorans Ls3. The following protocol is based on the procedure described by
Delmore (1989).
1. Cells are cultivated in YE medium from 1/50 volume of fresh overnight culture
at 37°C. The cells are harvested at the late exponential phase of the overnight
culture (about 108 cells/ml) by centrifugation of 8000 g at 4°C.
2. Cells are washed twice with distilled water, and subsequently twice with 1M
sorbitol at 4°C.
3. Cells are suspended in 1 M sorbitol (about 109 cells/ml) at 4°C. The following
steps are carried out at 4 dc.
4. 40 Jil of suspension are placed in a sterile Eppendorf tube, mixed with 2-5 pJ
DNA (about SOOng), and incubated for 5 min.
5. The suspension is placed in sterile Gene Pulser Cuvettes (0.2-cm electrode gap).
6. The following parameters of the poration apparature are used:
25 j1F, 200n, 1.8kV for about 4.5ms.
7. Subsequently 50-100Jil of the porated suspension is plated on appropriate
selective media, containing 1 M sorbitol, and incubated at 37°C for 3-5 days.
For most Arxula strains, a transformation frequency of about 5 x 102 per j1g DNA
can be reached. Particular strains, however, can not be transformed by
electroporation.
9
Expression of Heterologous Genes in A. adeninivorans
To express heterologous genes in Arxula, the transcription promoter of the IL VI

gene was identified, isolated, and characterized (Fig. 6). After construction of an
Xba I
BamH I
Xho
Sail
EcoRI
11-X6
,\pr 10.5kbp
Fig. 9. Restriction map of the plasmid Il-X6

Table 7. Specific activity (pkat per mg protein) of catechoI2,3-dioxygenase in mutants and

transformants of S. cerevisiae and A. adeninivorans
Strain Specific activity
Intracellular Extracellular
S. cerevisiae SHY2 o o
S. cerevisiae SHY2/Bsc-T-X-Io8 o o
S. cerevisiae SHY2/Bsc-T-X-Io12 o o
S. cerevisiae SHY2/Bsc-T-X-Iu6 0.15 0.46
S. cerevisiae SHY2/Bsc-T-X-IuI2 o o
A. adeninivorans G704 o o
A. adeninivorans G704/pLYS2 o o
A. adeninivorans G704/1l-X6 0.38 o
expression cassette containing the IL Vl promoter and XylE gene from Pseudomo-
nas putida as a heterologous gene encoding catechol-2,3-dioxygenase, this cassette
was cloned into a plasmid containing the LYS2 gene as a selectable marker. This
plasmid Il-X6 (Fig. 9) was transformed into A. adeninivorans G704 (lys2 cys)
and S. cerevisiae SHY2-1ys2 (ura3 trpl his31eu21ys2). Characterization of obtained
Arxula transformants shows that the plasmid Il-X6 is integrated within the chro-
mosomal DNA. In all transform ants, an intracellular catechol-2,3-dioxygenase
activity expressed by the XylE gene from Pseudomonas putida has been detected.
In contrast to these results, in the S. cerevisiae transformants the catechol-2,3-
dioxygenase activity has been localized intracellularly as well as extracellularly.
Acknowledgments. We are grateful to Prof. R. Bode, Prof. F. Bottcher, and Dr. LA.
Samsonova for helpful discussions, and to Dr. J. Phillipps and Prof. K. Muntz for
critical reading ofthe manuscript. We also thank Dr. J.P. van der Walt and Prof.
Kapultsevich for the generous gift of the yeast strains. The experimental work
described in this chapter was supported by the Bundesminister fUr Forschung und
Technologie, Bonn, FRG, Grant No. 0319691A, Grant No. 0310135A and the
Minister fUr Wissenschaft und Forschung - SachsenlAnhalt, Magdeburg, FRG,
Grant No. 236A0731.
References
Bottcher F, Samsonova IA (1983) Zur fungiziden und genetischen Wirkung von Benomyl.
In: Lyr H, Polter C (eds) Systemische Fungizide und antifungale Verbindungen.
Akademie-Verlag, Berlin, pp 255-258
Bottcher F, Klinner U, Kohler M, Sarnsonova lA, Kapultsevich J, BliznikX (1988) Verfahren
zur Futterhefeproduktion in zuckerhaltigen Medien. DD-Patentschrift 278354 Al
Buttner R, Bode R (1992) Purification and characterization of j3-xylosidase activities from
the yeast Arxula adeninivorans. J Basic Microbiol32: 159-166
Buttner R, Bode R, Birnbaum D (1987) Purification and characterization of the extracellular
glucoamylase from the yeast Trichosporon adeninovorans. J Basic Microbiol 27: 299-
308
Biittner R, Bode R, Scheidt A, Birnbaum D (1988) Isolation and some properties of two
extracellular f3-glucosidases from Trichosporon adeninovorans. Acta Biotechnol8: 517-
525
Biittner R, Bode R, Birnbaum D (1989a) Purification and characterization of the extracellu-
lar glucoamylase from the yeast Trichosporon adeninovorans. J Basic Microbiol27: 299-
308
Biittner R, Scheit A, Bode R, Birnbaum D (1989b) Isolation and characterization of mutants
of Trichosporon adeninovorans resistant to 2-deoxy-D-glucose. J Basic Microbiol29: 67-
72
Biittner R, Bode R, Samsonova lA, Birnbaum D (1990a) Mapping of the glucoamylase gene
of Trichosporon adeninovorans by mitotic haploidization using hybrids from protoplast
fusions. J Basic Microbiol30: 227-231
Biittner R, Schubert U, Bode R, Birnbaum D (1990b) Purification and partial characteriza-
tion of external and internal invertases from two strains of Trichosporon adeninovorans.
Acta Biotechnol10: 361-370
Buttner R, Bode R, Birnbaum D (1990c) Extracellular enzymes from the yeast Trichosporon
adeninovorans. Wiss Z Ernst-Moritz-Arndt-Univ Greifswald, Math Naturwiss Reihe 39:
20-22
Buttner R, Bode R, Birnbaum D (1991a) Comparative study of external and internal 13-
glucosidases and glucoamylase of Arxula adeninivorans. J Basic Microbiol31: 423-428
Biittner R, Bode R, Birnbaum D (1991b) Characterization of extracellular acid phosphatases
from the yeast Arxula adeninivorans. Zentralbl Mikrobiol146: 399-406
Biittner R, Bode R, Birnbaum D (1992a) Purification and characterization of trehalase from
the yeast Arxula adeninivorans. Zentralbl Mikrobiol147: 291-296
Biittner R, Bode R, Birnbaum D (1992b) Alcoholic fermentation of starch by Arxula
adeninivorans. Zentralbl Mikrobiol147: 237-242
Delmore E (1989) Transformation of S. cerevisiae by electroporation. Appl Environ
Microbiol 55: 2242-2246
Dohmen RJ, Strasser AM, Honer CB, Hollenberg CP (1991) An efficient transformation
7: 691-692
Gienow U, Kunze G, Schauer F, Bode R, Hofemeister J (1990) The yeast genus Trichosporon
spec. Ls3; molecular characterization of genomic complexity. Zentralbl Mikrobiol145: 3-
12
Gutz H (1966) Induction of mitotic segregation with p-fluorophenylalanine in
Schizosaccharomyces pombe. J Bacteriol 92: 1567-1568
Ito U, Fukada Y, Murata K, Kimura A (1983) Transformation of intact yeast cells treated
Kirsop BE (1988) Culture and preservation. In: Kirsop BE, Kurtzman CP (eds) Yeasts
Cambridge University Press, Cambridge, pp 74-98
Klinner U, Bottcher F (1984) Hybridization of yeast by protoplast fusion: ploidy level of
hybrids resulting from fusions in haploid strains of Pichia guilliermondii. Z Allg
Kovac L, Lazowska J, Slonimski PP (1984) A yeast with linear molecules of mitochondrial
DNA. Mol Gen Genet 197: 420-424
Kunze G, Kunze I (1993a) Characterization of Arxula adeninivorans strains originated from
different sources. Antonie Leeuwenhoek J Microbiol 65: 29-34
Kunze I, Kunze G (1993b) Comparative study of Arxula adeninivorans strains concerning
morphological characteristics and activities of secretory invertase. J Eur Microbiol212:
24-28
Kunze G, Pich U, Lietz K, Barner A, Biittner R, Bode R, Conrad U, Samsonova I, Schmidt H
(1990) Wirts-Vektor-System und Verfahren zu seiner Herstellung. DD-Patentschrift 298
821 A5
Kurischko C (1986) Spontaneous haploidization in early zygote progeny and its use for
mapping in the yeast Yarrowia lipolytica. Curr Genet 10: 709-711
Ledeboer AM, Edens L, Maat J, Visser C, Bos JW, Verrips CT, Janowicz Z, Eckart M,
Roggenkamp R, Hollenberg CP (1985) Molecular cloning and characterization for
methanol oxidase in Hansenula polymorpha. Nucleic Acids Res 13: 3063-3082
Middelhoven WJ, Hoogkamer-Te Niet MC, Kreger van Rij NJW (1984) Trichosporon
adeninovorans sp. nov., a yeast species utilizing adenine, xanthine, uric acids, putrescine
and primary n-alkylamines as the sole source of carbon, nitrogen and energy. Antonie
Middelhoven WJ, de Jong 1M, de Winter (1991) Arxula adeninivorans, a yeast assimilating
many nitrogenous and aromatic compounds. Antonie Leeuwenhoek J Microbiol59: 129-
137
Middelhoven WJ, Coenen A, Kraakman B, Gelpke MDS (1992) Degradation of some phenols
and hydroxybenzoates by the imperfect ascomycetous yeast Candida parapsilosis and
Arxula adeninivorans: evidence for an operative gentisate pathway. Antonie
Pich U, Kunze G (1992) Genome organization of mitochondrial DNA from the non-
saccharomycete yeast Arxula adeninivorans LS3. Curr Genet 22: 505-506
Samsonova lA, Bottcher F (1978) Acriflavine-induced mitotic segregation in
Rhodosporidium toruloides and Candida quilliermondii. Abstr XIVth Int Congr Genet-
ics, Moscow, p 89
Samsonova lA, Bottcher F (1980) Mitotische Segregation durch antimikrotubulare
Agenzien bei Pichia guilliermondii und Rhodosporidium toruloides. Wiss Z Ernst-
Moritz-Arndt-Univ Greifswald, Math Naturwiss Reihe 29: 71-72
Samsonova lA, Bottcher F, Werner C, Bode R (1989) Auxotrophic mutants of the yeast
Trichosporon adeninovorans. J Basic Microbiol29: 675-683
Tanaka A, Ohishi N, Fukui S (1967) Studies on the formation of vitamins and their function
in hydrocarbon fermentation. Production of vitamin B6 by Candida albicans in hydro-
carbon medium. J Ferment Technol45: 617-623
Tolstorukov II, Efremov BD, Bliznik KM (1983) Genetic mapping of the yeast Pichia pinus.
I. Identification of linkage groups using induced mitotic haploidization. Genetika 19:
897-902
Van der Walt JP, Smith MT, Yamada Y (1990) Arxula gen. nov. (Candidaceae), a new
anamorphic, arthroconidial yeast genus. Antonie Leeuwenhoek J Microbiol57: 59-61
Wartmann T, Kunze I, Bui MD, Manteuffel R, Kunze G (1995) Comparative biochemical,
genetical and immunological studies of glucoamylase producing Arxula adeninivovans
yeast strains. Microbiol Res 150: 113-120
Wilson C, Raguini A, Fukuhara H (1989) Analysis of the regions coding for transfer RNAs
in Kluyveromyces lactis mitochondrial DNA. Nucleic Acids Res 17: 4485-4491
Wood JS (1982) Genetic effects of methyl benzimidazole-2-yl-carbamate on Saccharomyces
cerevisiae. Mol Cell BioI 2: 1064-1079
CHAPTER 12
Candida rna/tosa
Stephan Mauersberger1, Moriya Ohkuma2,3, Wolf-Hagen Schunck1,
and Masamichi TakagP
More than 30 years have passed since the first description of the yeast species
Candida (C.) maltosa by Komagata et al. (l964a,b). Since then, C. maltosa has
become of considerable academic and commercial interest. Now, together with
some related Candida species and Yarrowia (Y.) lipolytica (cf. Barth and
Gaillardin, Chap. 10, this Vol.), it is best known for its ability to grow on a wide
variety of substrates including n-alkanes, fatty acids, or carbohydrates, and is
therefore intensively investigated in its physiology, biochemistry, and molecular
genetics. More recent investigations also use these yeast species for the study of
fundamental cellular processes such as protein targeting, organelle biosynthesis,
and drug resistance.
In this chapter we intend to summarize the present knowledge on the alkane-
assimilating yeast C. maltosa according to the following main topics:
• History of research on C. maltosa and its taxonomic position
• Physiology, biochemistry, and cytology with special emphasis to the analysis of
metabolic pathways like hydrocarbon and phenol degradation
• Cytochrome P450 systems and their regulation
• Methods of genetic analysis and available mutants
• Cloning and characterization of genes
• Development of host-vector systems and expression of foreign genes in C.
maltosa
• Potential practical application of C. maltosa
Other reviews on these topics have been published on Candida yeasts, containing
information mainly on C. albicans, and including also some data on C. tropicalis,
C. utilis, and C. maltosa (Magee et al. 1988; Tanaka and Fukui 1989; Kirsch et al.
1990; Rachubinski 1990; Reiser et al. 1990; Takagi 1992; Miiller et al. 1991a; Su and
Meyer 1991; Romanos et al. 1992; Sudbery 1994).
Each section is supplied with detailed descriptions of selected methods cur-
rently used in the authors' laboratories to investigate the biology of C. maltosa.
1 Laboratory of Membrane Proteins, Cell Biology Department, Max-Delbriick-Center for
Molecular Medicine, Robert-Rossle-Str. 10, 13125 Berlin-Buch, Germany

2Cellular Genetics Laboratory, Department of Biotechnology, The University of Tokyo,
Bunkyo-ku, Tokyo 113, Japan
3 Present address: Laboratory of Microbiology, Institute of Physical and Chemical Research
(RlKEN), Wako-shi, Saitama 351-01, Japan
412 S. Mauersberger et al.
Generally, most methods developed and described in the literature for other
yeasts, especially for Saccharomyces (5.) cerevisiae, can also be applied to C.
maltosa and other yeasts (cf. other chapters, this Vol.). Therefore the reader is
referred also to the recent literature on methods for biochemical, genetic, and
molecular biological investigations in yeast, mostly developed for s. cerevisiae
(Campbell and Duffus 1988; Sambrook et al. 1989; Goeddel1990; Rose et al. 1990;
Guthrie and Fink 1991; Ausubel et al. 1994).
Abbreviations
aa Amino acid(s)
AASA a-aminoadipate-8-semialdehyde
ACO Acyl-CoA oxidase
alk Alkane nonutilizing mutants
APA Auxotrophy-prototrophy-auxotrophyalteration (APA change)
ARS Autonomously replicating sequence
bp base pair(s)
C. Candida
CEN Centromere region
CDOG Catechol-1,2-dioxygenase or pyrocatechase
CHEF Electrophoresis with a contour-clamped homogeneous electric field
Cm1 P450Cm1 = P450 52A3, as for P450Cm2 = P450 52A4
CoA Coenzyme A
DAPA Sodium-p-dimethylaminobenzene-diazosulfonate
DCA Dicarboxylic (fatty) acid
EMS Ethylmethanesulfonic acid
ER Endoplasmic reticulum
FA Fatty acids
FADH Fatty alcohol dehydrogenase
FALDH Fatty aldehyde dehydrogenase
FAOD Fatty alcohol oxidase
5FOA 5-fiuoro-orotic acid
HAP 6-N-hydroxy-aminopurine
HMG-CoA 3-hydroxy-3-methyglutaryl-CoA
ICR-170 2-methyl-6-chloro- [3-( ethyl-2-chloroethyl)amino 1acridine
hydrochlorid
IPM Isopropylmalate
kb Kilo base pairs
MNNG N-methyl-N'-nitro-N-nitrosoguanidine
mtDNA Mitochondrial DNA
NA Nitrous acid
NCCR NADPH-P450 (cytochrome c) reductase
NQO 4N-nitroquinoline oxide
OFAGE Orthogonal field alternation gel electrophoresis
ORF Open reading frame
P450 Cytochrome P450
P450 14DM I4a-demethylase P450 (P450 5IAl)
PAH Polycyclic aromatic hydrocarbons
Paprin Paraffin-based single-cell protein from C. maltosa
PEG Polyethylene glycol
PHM Pseudohyphal morphology (mutant)
PPM Proteophosphomannan complexes
12. Candida rna/tosa 413
SCP Sin~e-cell protein

SDS-PAGE Polyacrylamide gelelectrophoresis with sodium dodecyl sulfate
UV Ultraviolet light
UFA Uneven fatty acids
Y. Yarrowia
TRA Transformation ability region
For further abbreviations used see Figs. 3 and 4, for abbreviations used for culture collec-
tions and strain designations see Table 1, for proteins and enzymes see Tables 4 and 5, for
designation of genes see Table 11.
1
History and Taxonomy of Candida maltosa
1.1
History of Research on Candida maltosa
and on Its Taxonomic Position
The development of research on most nonconventional yeasts was closely con-

nected with increasing interest in the biotechnological application of these yeasts.
This is particularly obvious for research on alkane-assimilating yeasts like C.
tropicalis, C. maltosa, Pichia guilliermondii, and Yarrowia lipolytica (cf. other
chapters, this Vol.), especially stimulated due to the fact that in the early 1960s
hydrocarbon biochemistry became a theme of industrial research, when mainly
petroleum companies became interested in the application of microorganisms for
the production of single-cell protein (SCP) as foodstuff (animal fodder) on the
basis of n-alkanes as well as for biochemical synthesis of amino acids, fatty acids,
sterols, vitamins, and other substances of commercial interest (for reviews see
Shennan and Levi 1974; Levi et al. 1979; Fukui and Tanaka 1981a,b; Rehm and Reiff
1981; Einsele 1983; Boulton and Ratledge 1984; BUhler and Schindler 1984;
Shennan 1984; Tanaka and Fukui 1989, cf. Sect. 6).
Thus, the asporogenous yeast species Candida maltosa Komagata, Nakase et
Katsuya was first isolated and described in 1964 in a study on hydrocarbon-
assimilating yeasts in connection with its ability to grow on n-alkanes as the only
source of carbon and energy, made by the Research Laboratories of the Ajinomoto
Co. at Kawasaki, Japan (Komagata et al. 1964a,b). The name was originally chosen
because this yeast strongly fermented maltose, although in later studies this was
not confirmed (Meyer et al. 1975). This first isolate of C. maltosa was obtained
from adhesives of neutralizing tanks in the monosodium glutamate manufacturing
process. The first data on C. maltosa were published together with the description
of a nearly related new species named Candida cloacae Komagata, Nakase et
Katsuya, isolated from mud as a kerosene-enrichment culture (Komagata et al.
1964a,b; Table 1). These two strains, C. maltosa (later becoming the type strain
CBS5611) and C. cloacae (type strain CBS5612), together with C. tropicalis, belong
to the best hydrocarbon-assimilating yeasts (Bos and de Bruyn 1973) and have
similar fermentation and assimilation patterns (van Uden and Buckley 1970). The
yeasts C. maltosa and C. cloacae were first considered to be separate species by
414 S. Mauersberger et aI.
Table 1. Wild-type strains of Candida maltosa available from culture collections and used
in different laboratories and institutions. Other species names formerly used in the
literature for different C. maltosa strains are given with the respective references.
Additionally, in some cases publications are given since the strains were renamed into C.
maltosa
Candida maltosa strains Formerly designated Reference

in Culture Collections strains of
or Institutions (isolated from, by)
Candida maltosa Candida maltosa Y-2-3 Komagata et al. (1964a,b, 1979)

CBS 5611 (Type strain Cm) (industrial equipment) Shiio and Uchio (197l)
= ATCC 28140 = AJ 4718 Candida sake Celrna Calarnita et al. (197l)
= lAM 12247 = JCM 1504 Van Uden and Buckley (1970)
= CCY 29-88-1 = VKM 1506 Candida maltosa Meyer et al. (1975)
= FERM P733 = SBUG 542 Kaneko et al. (1977)
= DBVPG 6143 = IFO 1977
Candida maltosa Candida cloacae YO-140 Komagata et al. (1964a,b, 1979)
CBS 5612 (Type strain Cc) (original isolate from Scheda (1966)
= ATCC 20184 = AJ 4719 mud by Komagata) Van Uden and Buckley (1970)
= lAM 12248 =JCM 1505 Candida sake Nakase and Komagata (1971)
= CCY 29-88-2 = VKM 1441 Candida maltosa Meyer et al. (1975)
=DBVPG 6136 = IFO 1978 Kaneko et al. (1977)
Candida maltosa 310 Candida cloacae 310 Shiio and Uchio (197l)
AJ 5463 = FERM P736, (from oil-soaked soil Uchio and Shiio (1972a,b,c)
AJ 5341 =FERM P410 by T. Nakase) Uchio and Shiio (1974)
Ajinomoto Co., Ltd, Uchio (1978)
Central Research Fukui and Tanaka (1981b)
Laboratory, Casey et al. (1990)
Kawasaki, Japan Candida maltosa Kaneko et al. (1977)
Candida maltosa Candida subtropicalis N akase et al. (1972)
CBS 6465 (Type strain Cst) (from air, by Nakase Fukuzawa et al. (1975)
= ATCC 28241 = IFO 1975 strain YO-146) Hirata and Ishitani (1978)
= AJ 4476 = JCM 1511 Candida maltosa Meyer et al. (1975)
Smith et al. (1976)
Kaneko et al. (1977)
Candida maltosa Candida subtropicalis Nakase et al. (1972)
CBS 6680 (from soil, by Nakase) Meyer et al. (1975)
=AJ 4480 = IFO 1976 Su and Meyer (1991)
= ATCC 28284 Umemura et al. (1992)
Candida maltosa GSU 42 Candida subtropicalis Meyer et al. (1975)
Department Biology (from oil slick) Smith et al. (1976)
Georgia State University Crow et al. (1980)
Atlanta, USA Cerniglia and Crow (1981)
Candida maltosa Candida sp. 36 Watanabe et al. (1973a,b,c, 1975)
CBS 6658 Candida novellus 36 Watanabe (1974)
= ATCC 20275 = FERM 705 (from soil) Shennan and Levi (1974)
= DBVPG 60211 Candida maltosa 36 Meyer et al. (1975)
Kanegafuchi Chemical Kaneko et al. (1977)
Ind., Co., Ltd., Hyogo, Komagata (1979)
Japan
Candida maltosa EH15 D Candida guilliermondii Schunck et al. (1978a,b)
EH 15 Millier et aJ. (1979)
Institute of Technical Riege et al. (1980)
Chemistry, Leipzig, Candida sp. EH 15 Bauch et al. (1978)
later the MillIer et al. (1980)
Institute Biotechnology, Bode et al. (1983)
Table 1. (Contd.)

Leipzig, Germany Bode and Casper (1983)

and Kunze et al. (1984a)
Institute of Molecular Lodderomyces Bley et al. (1980)
Biology, Berlin-Buch, elongisporus EH 15 D Heinritz et al. (1981, 1983a,b)
Germany (or IMET H128) Miiller and Voigt (1981,1984)
and Schneider and Triems (1981)
Petrochemical Enterprise Stichel et al. (1981, 1982)
(PCK) Schwedt, Germany Sattler and Wiinsche (1981, 1983)
Wiinsche et al. (1981)
Mauersberger et al. (1981, 1984)
Riege et al. (1981)
Glombitza (1982)
Gradova et al. (1983)
Schneider et al. (1983)
Honeck et al. (1982, 1985)
Miiller et al. (1982, 1983a)
Brendler et al. (1983)
Schunck et al. (1983a,b)
Voigt et al. (1984a,b, 1985)
Blasig et al. (1984)
Bayer et al. (1985)
Heinritz et al. (1985)
Candida maltosa Bode and Birnbaum (1984)
Golubev et al. (1986)
Candida maltosa H or H62 Candida Metz and Reuter (1977)
University Jena guilliermondii H Rademacher and Reuter (1978)
Biology section Heinritz and Bley (1979)
and Candida spec. H Rober and Reuter (1979)
Institute of Biotechnology (or H62) Popov et al. (1980)
Leipzig, Germany Triebel et al. (1980)
Grirnmecke and Reuter (1980)
Briickner and Troger (1981a,b)
Kolblin and Birkenbeil (1981)
Grirnrnecke and Reuter (1981a,b,c,d)
Grirnmecke et al. (1981)
Kolblin and Troger (1982)
Fischer and Reuter (1982)
Fischer et al. (1982)
Niiske et al. (1982)
Rober and Reuter (1982, 1984c)
Candida maltosa H Rober and Reuter (1984a)
Candida maltosa 14 Candida maltosa L4 Kunze et al. (1984b)
= SBUG 700 = G217 (closely related with Kunze et al. (1985a)
University Greifswald, Cm EHI5, from IBT Hofmann and Schauer (1988)
Section of Biology Leipzig) Schauer (1988)
Candida maltosa Candida maltosa T420 Kunze et al. (1984b)
SBUG 420 = CBS 7327 (from waste water Hofmann and Schauer (1988)
University Greifswald, of industrial plant)
Section of Biology
Candida maltosa Candida guilliermondii Maxirnova et al. (1972)
VSB NP4 VSB NP4 Kasanzev et al. (1975)
and other Ilchenko et al. (1980)
strains: Mauersberger et al. (1980)
1, NP2, NP4/1113, Mauersberger and
143,243, N540, Matyashova (1980)
542B,569, Candida maltosa NP4 Krauzova et al. (1986)
Table 1. (Contd.)

Candida maltosa Candida salmonicola Golubev et al. (1986)

VSB 779 Ioffe et al. (1990)
Candida maltosa Candida sake Golubev et al. (1986)
VSB 777 and 778
Candida maltosa Candida parapsilosis Golubev et al. (1986)
VSB 899, Sasnauskas et al. (1991,
and other strains 1992)
NP4-111,542 Jomantiene et al. (1991)
900,906,907,908
Candida maltosa Saccharomyces Soom (1973)
ATCC 38040, 38041 cerevisiae mutants, Rabinovich et al. (1974)
ATCC 38042 C. maltosa Basse! et al. (1978)
Candida maltosa Candida maltosa Slavikova and Grabinska-
CYY 29-88-3, 29-88-4 M6.D7, M18.D7 Loniewska (1990)
(from denitrifying
sludge of laboratory
unit)
Candida maltosa JCM 1504 Umemura et al. (1992)
Tanabe Seiyaku Co., Ltd.
Osaka, Japan
Candida maltosa strains from Culture Collections mentioned in the literature. In parentheses the
former designation of the strains in the collections are shown as Cc - C.
cloacae, Cst - C. subtropicalis, Cn - C. novellus, Cs - C. sake, Csa - C. salmonicola, Cp - C. parapsilosis,
Le - L. elongisporus; nothing shown when initially described as C. maltosa.
AJ 4476,4480,4718,4719 (Cc) from 1983, 5341 (Cc), 5463 (Cc)
ATCC 20184 (Cc = CBS5612), 20275 (Cn = CBS6658), 28140 (= CBS5611), 28241 (= CBS6465), 28284
(= CBS6680), 38040, 38041, 38042; compare Meyer et al. (1975) and Yoshida and Hashimoto
(1986a,b)
CBS 5611,5612 (Cc), 6465 (Cst), 6658, 6680 (Cst), 7327
CCY 29-88-1,29-88-2 (Cc or Cs), 29-88-3, 29-88-4
DBVPG 6136,6143,60211
FERM P-410 (Cc =AJ 5341), 705 (Cn), P-733, P-736 (Cc =AJ 5463)
IFO 1975, 1976, 1978
JCM 1504 (Umemura et al. 1992), 1505 (Cc)
SBUG 388,420,434,443, 700 (L4), 701 (Hofmann and Schauer 1988)
VKM 1441 (Cc), 1506 (Cm) (1976), Y2359 (1986)
VSB 1, NP2, NP4, NP4/1l13, 143,249, N-540, 542B, 569, 640,774 (formerly, all Cg); EH15 (Cg-Cp-
Le); 777 and 778 (formerly Cs), 779 (Csa); 875 (Cm), NP4-111, 542, 899, 900, 906, 907, 908
(formerly all Cp), (Data taken from Golubev et al. 1986).
Abbreviations used for Culture Collections, Institutes or Laboratories.
AJ Central Research Laboratory, Ajinomoto Co., Inc., Kawasaki, Japan
ATCC American Type Culture Collection, Rockville, Maryland, USA
CBS Centralbureau voor Schimmelcultures, Delft and Baarn, The Netherlands
CYY Czechoslovak Collection of Yeasts, Institute of Chemistry, Bratislava, Slovak Republic
GSU Georgia State University, USA
FERM Fermentation Research Institute, Chiba, Japan
lAM Institute of Applied Microbiology, University of Tokyo, Japan
IBT Institute of Biotechnology (formerly Institute of Technical Chemistry), Leipzig, Germany
IBPM Institute of Biochemistry and Physiology of Microorganisms, Pushchino, Russia
IFO Institute of Fermentation, Osaka, Japan
JCM Japan Collection of Microorganisms, Wako, Japan
SBUG Section of Biology, University Greifswald, Germany
VSB Allunion Institute of Protein Biosynthesis, Moscow, Russia
VKM Allunion Culture Collection, Moscow, Russia.
Nakase and Komagata (1971) and Bos and de Bruyn (1973) because they grow at
higher maximal temperature (40-42 DC) than C. sake (32-34 DC), in contrast to the
view of van Uden and Buckley (1970), who discussed these yeast strains as mem-
bers of the heterogeneous species C. sake (Saito et Ota) van Uden et Buckley.
Independently, two other C. cloacae strains were isolated in the Ajinomoto
Central Research Laboratory (Shiio and Uchio 1971; Table 1). With mutants of the
strain C. cloacae 310, a technology for production of dicarboxylic acids from n-
alkanes was developed (see Sect. 6).
At the same time, the closely related alkane-assimilating strains of Candida
subtropicalis Nagase, Fukazawa et Tsuichiya (Nakase et al. 1972; Hirata and
Ishitani 1978) and Candida sp 36, named Candida novellus nom. nud. (Watanabe
et al. 1973) were described (Table 1), and processes for industrial application of the
latter strain for SCP production were developed (Watanabe et al. 1973a,b;
Watanabe 1974a,b,c; Kaneko et al. 1977).
The taxonomic status of C. maltosa, C. cloacae, C. novellus, and C. subtropicalis
was thus not very clear for many years. Their almost identical biochemical charac-
teristics, the very narrow range of distribution (35.6-36.6%) of the GC content,
high degree of DNA relatedness (at least 86%, Table 2) concluded from DNA
hybridization experiments (Meyer et al. 1975), and the same agglutination factors
and PMR spectra of cell wall polysaccharides (Fukazawa et al. 1975) suggested a
very close relationship among these species. Fukazawa et al. (1975) and Meyer et al.
(l975) thus concluded from their studies that these strains are very similar to each
other and should form an independent species different from C. sake. Later,
Kaneko et al. (l977) confirmed these results and added the strain C. novellus 36 to
this group of yeasts. All these authors proposed that C. cloacae, C. subtropicalis,
and C. novellus are synonyms for Candida maltosa, and chose the latter to name
this species, which is now mostly accepted in the literature (cf. Table 1). These
cultures fermented maltose weakly, failed to utilize soluble starch, and had maxi-
mal growth temperatures of 40-42 DC (Table 3). These results were later supported
by Montrocher (1980), who performed serological analysis of these strains using
the immunoprecipitation method in addition to morphological and physiological
observations.
Today, C. maltosa is recognized as a species separate from C. sake van Uden et
Buckley, C. tropicalis (Castellani) Berkhout, C. albicans, and C. parapsilosis
(Ashford) Langeron et Talice on the basis of their physiological, morphological,
and immunological properties and their DNA relatedness (Meyer et al. 1975;
Kaneko et al. 1977; Kunze et al. 1984a,b; Table 2), although their near relationship
is obvious according to most physiological parameters (cf. Sect. 1.2).
Additionally, the literature on C. maltosa was in the past even more confused by
the fact that, especially until the middle of the 1980s, results on different strains
later identified as C. maltosa were published, in addition to the taxa mentioned
above (Table lA), as belonging to other Candida species, such as C. guilliermondii,
C. parapsilosis, C. salmonicola, or Candida sp., as well as to 1. elongisporus or even
as mutants of Saccharomyces cerevisiae. These investigations, after their relation to
C. maltosa had been clearly shown later, have been therefore included in Table
Table 2. DNA relatedness of Candida maltosa with other yeasts
Source of Homology as relative binding (%) of DNA from (source oflabeled DNA)
unlabeled DNA
C. maltosa S. cerevisiae 1. elongisporus C. sake C. tropicalis
aATCC28241 ATCCl4478 ATCC750
ATCC20275
bL4, T420 010 CBS2605 CCY29-7-23
CBS5611
Yeast DNA
C. maltosa '86-100 11-17 11-32
C. maltosa d87-100 53 15-24
C. sake '7-20 99-100 12-21
C. tropicalis '21-26 14 88-100
C. tropicalis d14-33 100
P. guilliermondii d34 18 22
1. elongisporus d54 100
S. cerevisiae d60 100 50
Nonspecific controls
E. coli '3-7 6 5
Calf thymus dl-3 2
Abbreviations: - not determined; C. maltosa - Candida maltosa; C. tropicalis - Candida tropica-

lis; P. guilliermondii - Pichia guilliermondii; 1. elongisporus - Lodderomyces elongisporus; S.
cerevisiae - Saccharomyces cerevisiae. Homology between chromosomal DNA (unlabeled) from
different sources and the 32P-labeled (Kunze) or 3H-labeled (Meyer) DNA from different yeast
species: determined from DNA reassociation experiments using a Cot-value of 100 and a reasso-
ciation temperature of 60°C or 65 °C in 0.12 M sodium phosphate buffer pH 6.8 (Kunze) or 2 x
SSC (Meyer), respectively.
a"Data taken from Meyer et al. (1975): C. maltosa strains used - ATCC 28241, 28284, 20184, 20275,
28140, GSU42; C. sake - ATCC 14478,28141,28722,28138,28136,28723,28137,28139,28721; C.
tropicalis - ATCC 750, 188807,28142.
b,dData taken from Kunze et al. (1984b): C. maltosa strains used - L4 (SBUG700), T420 (SBUG420
= CBS7327), CBS5611 = ATCC28140; C. tropicalis CCY29-7-23; 1. elongisporus CBS2605; Pichia
guilliermondii fpl-61; S. cerevisiae D10.
IB/C and the following sections, as they substantially extended the knowledge of C.
maltosa.
Detailed reexaminations of the yeast species used for the production of single-
cell protein (SCP) on n-alkanes in the former Soviet Union and GDR (cf. Sect. 6),
made on the basis of progress and changes in yeast taxonomy, revealed that most
of these strains belong to the species C. maltosa and C. tropicalis (Kunze et al.
1984a,b; Golubev et al. 1986; Table IB/C). Golubev et al. (1986) found that more
than 90% of the strains used for the large-scale production of alkane-based fodder
yeast (Paprin, more than 1 million t per year in 1985) in the former USSR were
reclassified as belonging to C. maltosa. Therefore it might be supposed that most
data published earlier in these countries on alkane-utilizing C. guilliermondii, C.
parapsilosis, C. salmonicola, and C. sake strains (without reference to strain num-
bers or culture collections, for example Gradova and Kovalsky 1978; Davidov et al.
12. Candida ma/tosa 419
1980, 1981a,b, 1982) should also be regarded as data on C. maltosa. For example,
the strain C. maltosa VSB NP4 was formerly designated C. guilliermondii VSB NP4
(Maximova et al. 1972; Kasanzev et al. 1975; Table 1). Later, it was reclassified as
belonging to C. maltosa (Golubev et al. 1986; Krauzova et al. 1986; Sharyshevand
Krauzova 1988; Table lB/C).
The yeast C. maltosa EH15 was the production strain for the SCP process
developed in the former GDR in cooperation with the USSR, and applied at the
Petrochemical Enterprise (PCK) Schwedt, GDR (Bauch et al. 1978; Brendler et al.
1983; cf. Sect. 6). The strain, selected at the Institute of Technical Chemistry (ITC)
in Leipzig, was first designated C. guilliermondii (Michaleva et al. 1973a,b) or C.
parapsilosis according to Gradova et al. (1983), and later Candida sp. EH15 (Table
1). In 1981, this strain was renamed as belonging to the species Lodderomyces
elongisporus (Recca et Mrak) Van der Walt, due to ascospores allegedly detected
(Wiinsche et al. 1981), which was not confirmed by the results of Kunze et al.
(1984a) and Golubev et al. (1986). Therefore this strain was later again reclassified
as a strain of C. maltosa (Golubev et al. 1986).
This could be stated also for C. maltosa H, another strain intensively investi-
gated at the Schiller University Jena, Germany (Table 1), formerly designated C.
guilliermondii H or Candida sp. H62. In 1982, it was reclassified by D. Yarrow, CBS
Delft, as C. maltosa (Rober et al. 1984a; Rober and Reuter 1985).
Kunze et al. (1984b) concluded from DNA reassociation experiments and from
morphological-physiological criteria of classic yeast taxonomy (Barnett et al. 1979)
made in comparison with the type strain C. maltosa CBS 5611 that the two alkane-
assimilating yeast strains L4 (SBUG 700) and T420 (SBUG 420), investigated by
some groups at the University of Greifswald, belong to the species C. maltosa and
not to L. elongisporus, P. guilliermondii, or C. tropicalis. It should be noted that the
C. maltosa strains L4 and EH15 are probably closely related, if not identical,
although this was not shown in the literature.
In the early 1970s, the group ofInge-Vechtomov at the Leningrad State Univer-
sity reported the isolation of mutants of Saccharomyces cerevisiae that were ca-
pable of utilizing hydrocarbons as growth substrate (Soom 1973; Rabinovich et al.
1974). Later, Bassel et al. (1978) were unable to confirm these results and identified
these strains as members of C. maltosa (Table 1).
There is no evidence for the formation of ascospores in C. maltosa and therefore
this yeast has been considered to be a strictly imperfect one up till now. Neverthe-
less Viljoen et al. (1988) first proposed a possible relationship between C. maltosa
(CBS 5611) as the anamorphic form and Pichia etchelsii (CBS 2011 T) as the
teleomorphic form of this yeast, as also as for C. cacaoi and P. farinosa, respec-
tively, on the basis of the long-chain fatty acid compositions compared with other
phenotypic criteria (i.e., assimilation of carbon sources, coenzyme Q type, G + C
content, and proton magnetic resonance spectra). Although their G + C content
was discussed by these authors as being similar, the mentioned values of
36.6 mol% for C. maltosa and of 38.5 mol% for P. etchelsii are not very convincing
in comparison with other yeasts with known anamorph/teleomorph relationships
like C. shehatae and P. stipitis or P. guilliermondii and C. guilliermondii.
420 s. Mauersberger et al.
1.2
Phylogenetic Relation of Candida maltosa to Other Yeasts
The progress made in molecular cloning and sequencing of comparable genes
from different yeast species is the basis for a better understanding of their natural
relationships. This is especially important for the genus Candida, a heterologous
assemblage unified mainly by the absence of any sexual state (teleomorph). The
phenotypic character-based classification has created a confusing taxonomy and a
great heterogeneity within this genus.
The evolutionary relationships among several Candida species and their rela-
tives have been described recently on the basis of small-subunit ribosomal RNA
(srRNA) sequences (Barns et al. 1991; Hendriks et al. 1991). The srRNA sequences
are now commonly used for phylogenetic analysis of yeast and fungi (for reviews
see Kurtzman 1992, 1994; Barns et al. 1991; Bruns et al. 1992).
Recently, Ohkuma et al. (I 993b) investigated the evolutionary position of the
nonpathogenic n-alkane-assimilating yeast C. maltosa after cloning and sequenc-
ing the small-subunit (18S) ribosomal RNA gene (SSRR, cf. Table 11) The phyloge-
netic tree (Fig. 1) constructed by the neighbor-joining method shows that
c. maltosa
C. tropicaJis
C. viswanathii
C. albicans
C. parapsilosis
C. guilliermondii
K lactis
C. glabrata
, - - - - H. polymorpha
~-------- C. krusei
' - - - - - - - - C. lusitaniae
Y. Jipolytica
0.05
Fig. 1. Evolutionary tree based on the srRNA nucleotide sequences of different yeasts.
Evolutionary position of Candida maltosa among different yeast species. The sequences for
the srRNA genes were taken from the DDBJ, EMBL, and GenBank Nucleotide Sequence
Databases for C. maltosa (Ohkuma et al. 1993b), C. tropicalis, C. viswanathii, C. albicans, C.
parapsilosis, C. guilliermondii, C. kefyr, C. glabrata, C. krusei, C. lusitaniae, Hansenula
polymorpha, Kluyveromyces lactis, Saccharomyces cerevisiae, and Yarrowia lipolytica. Bar
under the tree indicates the distance corresponding to five changes per 100 nucleotides.
C. maltosa forms a subgroup lineage with C. tropicalis, C. viswanathii, C. albicans,

C. parapsilosis, and C. guilliermondii in this genus, a cluster of relatively closely
related organisms. Saccharomyces cerevisiae, C. kefyr, Kluyveromyces lactis, C.
glabrata, Hansenula polymorpha, and C. krusei form another subgroup, and being
more distantly related to C. maltosa, C. lusitaniae, and Yarrowia (C.) lipolytica, are
excluded from these two subgroups. Consistent with the results of 5S RNA com-
parison, Yarrowia (C.) lipolytica was among the more divergent species.
The results are in accordance with the conclusions made from taxonomic stud-
ies using other parameters. Thus, C. maltosa was originally identified as a species
closely related to C. parapsilosis and C. tropicalis, showing the same morphological
characteristics and sharing many biochemical properties.
Candida maltosa was distinguished from C. sake (11-17%) and from C.
tropicalis (27-32%) by insignificant DNA reassociation (Meyer et al. 1975; Table 2).
In addition, C. maltosa was distinguished from C. sake by its growth on octane, its
higher maximal growth temperature (40-42 0 to 30-34°C) and lower GC content of
its DNA (35.6-36.8% to 37.8-41%) and from C. tropicalis by its failure to utilize
soluble starch for growth and its resistance to cycloheximide (Meyer et al. 1975). It
should be mentioned that, according to DNA reassociation data (Meyer et al. 1975)
and serological characteristics (Montrocher 1980), C. maltosa is obviously more
closely related to C. tropicalis (DNA relatedness of 27-32% or 21-26%) than to
C. sake (11-17% or 7-20%; Table 2). Candida maltosa is also distinguished from
C. tropicalis, other Candida species, and Lodderomyces elongisporus by its high
molecular weight of mitochondrial DNA (52kb) and the low GC content (21-22%)
of the mtDNA in comparison with data (25-30kb and 27-37 GC%) obtained for
these yeasts (Kunze et al. 1984a, 1986b; Su and Meyer 1991; cf. Sect. 4.3.3).
The close relationship between C. maltosa and members of its subgroup is also
supported by the comparison of other macromolecular sequence data. A compari-
son of the sequences ofL41 ribosomal protein (gene RIM-C or L41Q; cf. Table 11)
shows an amino acid identity of99.1 % between C. maltosa and C. tropicalis. Those
between C. maltosa and C. guilliermondii or S. cerevisiae are 85.4 and 84.9%,
respectively.
A comparison of the amino acid sequences of the orotidine 5' -phosphate de-
carboxylase (encoded by the URA3 gene) also shows good correlation with the
srRNA tree. Amino acid identities between C. maltosa and C. albicans, K. lactis,
or S. cerevisiae are 84, 77, and 72%, respectively (Ohkuma et al. 1993a).
The distribution of the hydrocarbon assimilation ability (Barnett et al. 1983;
Schauer and Schauer 1986) is well correlated with the phylogenetic tree. Members
of the C. maltosa-containing subfamily can assimilate hydrocarbons, except for C.
viswanathii. Candida lusitaniae and Y. lipolytica can also assimilate hydrocar-
bons, but members of the subfamily belonging to S. cerevisiae cannot. Probably, a
deleterious event for the assimilation of hydrocarbon occurred in the subgroup
belonging to S. cerevisiae when the two subgroups were separated from each other.
The different yeast subgroups probably also differ in the codon usage (cf. Sect.
4.4.3).
1.3
Handling of Candida maltosa Strains
Available Wild-Type Strains and Mutant Collections

The wild-type strains of C. maltosa used in different laboratories are shown in
Table 1. Characterized mutants obtained from these strains are summarized in
Table 6.
Handling of C. maltosa strains is comparable with that for other yeasts. Storing
and conservation is possible as
• slant cultures at 4°C with YPD or minimal medium agar,
• deep freeze cultures with 20-30% glycerol in YPD or minimal medium in liquid
nitrogen or at -70 to -80°C for a longer time, or as
• freeze dried cells as well.
2
Physiology and Biochemistry of Candida maltosa
Among alkane-utilizing yeasts, Candida maltosa, with Candida tropicalis and

Yarrowia lipolytica, stands out as the organism which has been most thoroughly
studied concerning its physiology, biochemistry, and molecular biology.
2.1
Occurrence in Nature
Strains of C. maltosa have been isolated from air, soil, and water, particularly if
enriched with hydrocarbons, but normally not from humans (Meyer et al. 1975;
Golubevet al. 1986; Table 1).
Seeding of hydrocarbonoclastic yeasts into estuarine environment has also
been tested (Cook et al. 1973). Out of six or eight yeasts used in seeding oil in
estuarine or in freshwater environment, two hydrocarbon-assimilating yeasts per-
sisted for the longest period of time. Yarrowia (C.) lipolytica disappeared 3 to 5
months after seeding, while C. (subtropicalis) maltosa persisted for over 1 year in
freshwater and 7 months in estuarine environments. No adverse ecological side
effects were observed as a result of seeding the nonpathogenic Candida yeasts.
Berner et al. (1975) also investigated the survival of C. maltosa (C. subtropicalis) in
freshwater and estuarine habitats. They found that this species maintained itself in
oil-enriched sites, but did not spread to adjacent hydrocarbon-free areas (Ahearn
et al. 1976).
More recently, Gradova et al. (1991) investigated the interactions of the indus-
trial produced alkane-grown C. maltosa as a technogenic factor of pollution with
the surrounding ecosystems (air, plants, soil) of the SCP plants in field tests and in
model test systems under laboratory conditions. These data showed a 100- to 1000-
fold decrease in C. maltosa content in soil during the first 100 days of the experi-
ments, then reaching the normal yeast content in soil of 103_104 cells per g. A high
self-purifying ability of soil leading to homeostasis stability in the natural ecosys-
tems was observed in these experiments. The authors concluded that the pollution
of the environment with C. maltosa produced in SCP plant equipped with special
cleaning systems of the air exhaust may be regarded as a nonhazardous burden for
the ecological balance.
2.2
The Problem of Pathogenicity and Toxicity for Candida maltosa
and Its SCP
Due to the development of the SCP technologies based on alkanes or alcohols in

the 1970s (Tannenbaum and Wang 1975; Shennan 1984; cf. Sect. 6), different
Candida, Pichia, and Yarrowia species had to be evaluated for safety. The proper-
ties of food yeasts most often examined were nutritive value and toxicity (Smith
and Palmer 1976). Since strains of unknown disease potential were candidates for
SCP, they had also to be studied for pathogenicity.
Since some strains of the genus Candida are known to be opportunistic patho-
gens (Odds 1987), it has been pointed out that the possible pathogenicity of yeast
used for the production of single-cell protein (SCP) should be carefully checked
beforehand. SCP as a feedstuff is properly heat-treated and not living, so that the
product has a priori no pathogenicity, regardless of the pathogenic ability of the
living cells.
The possible pollution of the environment around a factory producing SCP
through leakage of the living cells from the factory or through infection of employ-
ees of the factory has been discussed. Therefore, animal models and procedures for
evaluating the potential for human pathogenicity had to be developed to compare
the pathogenic potential of medically important yeasts, e.g., C. albicans and Cryp-
tococcus neoformans, with industrially important yeasts. Although industrial use
of fungi has not been documented as a health hazard, certain species of commer-
cially used genera such as Candida and Saccharomyces, Aspergillus, and Fusarium
have been implicated in human disease. Since members of such complex genera
as Candida may vary in their pathogenic potential, new yeast strains being con-
sidered for industrial use should be tested individually, as has repeatedly been
pointed out (Holzschu et al. 1979; Yoshida and Hashimoto 1986a,b).
Except for the opportunistic pathogen C. tropicalis, the particularly industrially
important yeasts C. maltosa, C. guilliermondii, C. utilis, and Y. (C.) lipolytica, used
mostly for the production of fodder yeast (SCP) on different substrates (hydrocar-
bons or carbohydrates) or of metabolites of commercial interest (citrate), are
regarded as nonpathogenic organisms, which has been shown repeatedly by sev-
eral authors. In contrast to C. albicans and C. tropicalis, these yeast strains showed
no pathogenic evolution in human cell cultures or in tested laboratory animals
(mice, guinea pigs, and rabbits) for every manner of injection (Gargani et al. 1978,
1979; Gargani 1979; Ahearn et al. 1979; Holzschu et al. 1979; Faggi and Mennini
1985; Yoshida and Hashimoto 1986a,b). Therefore most of these strains have been
approved in several countries for use in industrial processes.
In Japan, a long-term research project was performed in the Ministry of
Agriculture, Forestry, and Fisheries to establish a procedure for assessing the
safety of single-cell protein, including a procedure for assessing the potential
pathogenicity of yeasts (expressed as scores for the remaining living cells in organs
of tested mice and histopathological examinations), not previously known to be
an opportunistic pathogen, and expected to be useful for production of single-
cell protein (Yoshida and Hashimoto 1986a,b). Interestingly, among the 42 yeast
strains tested in these studies, most of which were Candida species, the C. maltosa
strain IAM12248, repeatedly revealed as belonging to C. maltosa, was found to
show a high possibility of being pathogenic. This strain belonged to the Group I,
which contained almost all the strains known to be opportunistic pathogens (c.
albicans and c. tropicalis). Therefore C. maltosa IAM12248 was strongly suspected
to exhibit potential pathogenicity, although its pathogenicity was not known and
not expected, and no information was available indicating that this strain causes
disease in certain host animals. In contrast, none of the strains known to exhibit
pathogenicity is included in the Group II containing all other additionally tested
strains of C. maltosa (nine including IAM12247 and eight ATCC strains; cf. Table
1) together with C. utilis, C. rugosa, C. lipolytica, and C. guilliermondii, showing a
low possibility of being potential pathogens. It should be mentioned that not all
strains of C. maltosa exhibit pathogenicity, only strain IAM12248 as one of ten
strains tested. Pathogenicity is therefore specific to a strain, not to a species
(Yoshida and Hashimoto 1986b). These authors discriminate therefore between
strains which could be used and handled as usual in the traditional fermentation
industry and others which should not be used, or should at least be handled very
carefully, or should be carefully reexamined before use (Yoshida and Hashimoto
1986a).
It should also be mentioned that in some recent publications the occurrence of
C. maltosa in immunocompromised patients or animals, in addition to other
pathogenic yeasts like C. albicans, C. tropicalis, C. glabrata, C. parapsilosis, and
Trichosporon cutaneum, was demonstrated (Kitamura et al. 1990; Silva et al. 1990).
Whether the action of C. maltosa itself would be pathogenic for these organisms
remains to be clarified.
Hypersensitivity (Hypersensitive Reactions). The large-scale production of SCP in

the industrial biotechnology plants can, however give rise to some serious
problems for employees and for the population in the environment, as was
reported in the past few years by authors from the former Soviet Union, where the
production of alkane-based SCP with C. maltosa and other strains is being
continued (for ref. see Gradova et al. 1991; cf. Sects. 1 and 6). Thus, Litovskaya
(1988) reported hypersensitive reactions among workers in plants producing
SCP using C. guilliermondii, C. sake, or C. maltosa. Immediate and cellular
hypersensitive reactions, with disturbances in T-dependent and humoral
immunity, were frequent. Workers who had been in contact with living cells,
rather than the protein concentrate (Paprin), tended to show allergic symptoms of
the skin, or bronchial asthma. These phenomena were studied by several authors
using laboratory animals (Ermolaev et al. 1987, 1991; Ilyina et al. 1988; Pekelis et al.
1989; Spivak et al. 1988, 1989; Gukasyan et al. 1990; Litovskaya and Mokeeva 1990;
Dalin et al. 1991; Kravtsov et al. 1991; Artamonova and Svitina 1991; Artamonova
et al. 1993).
Furthermore, Pogorelskaia et al. (I 991) reported that the appearance of fungal
contaminations of the upper respiratory ways due to the production strains in
workers and residents in the near environment of the SCP plants is very dependent
on the use of stable, satisfactory air exhaust purification equipment (Sect. 2.1).
Therefore, it seems to be that health or ecological hazard arising from SCP produc-
tion plants is more a problem of technology, and thus of economics, than of the
pathogenic potential, or toxicological or ecological action of the yeast strains used,
especially for C. maltosa.
Toxicity of SCPo Because the yeasts grown on paraffins represent a suitable

food for farm animals, in view of the unusual nature of this material, it appeared
worthwhile to determine the effects of long-term feeding to animals with a
diet containing varying amounts of single-cell protein (SCP) produced by growing
C. maltosa or other yeasts on alkanes. These protein concentrates produced
in several countries were named Liquipron (Italy), Paprin (ex-USSR), Fermosin
(ex-GDR) when obtained from C. maltosa, or Toprina (Italy, France) when from
Y. lipolytica.
Experimental data on the effect of long-term feeding of laboratory animals
(rats, mice, dogs) and domestic animals (chicken, swine) with diets containing SCP
obtained from alkane-grown yeast (c. maltosa, Y. lipolytica, or other yeasts) dem-
onstrated no significant adverse effects of the protein concentrate diets on the
physiological and biochemical parameters of the animals, on pathological pat-
terns, on genetic material, or on reproductive function (Bizzi et al. 1980; Perri et al.
1981; Muramatsu et al. 1982; Nunziata et al. 1982; Lusky et al. 1988, 1989; Heinz et
al. 1989; Ioffe et al. 1990). Especially the protein concentrates Liquipron, Toprina,
and Fermosin obtained from alkane-grown yeast biomass were investigated to
ascertain the biological significance and possible toxicological implications of
their high content of uneven fatty acids (UFA). It was confirmed that the extent to
which UFA (especially Cl7-fatty acids) accumulate in fat and tissues of the animals
tested (rats, swine) fed with SCP products only partially reflects their UFA con-
tents. The presence of UF A in rat or pig tissues does not appear to alter interme-
diate metabolism. In nature, odd-numbered fatty acids are ubiquitous. Uptake and
storage of the UFA suggest that the organism reacts to an increased offer of C17-
fatty acids with an accelerated decomposition of these fatty acids and/or with
inhibition of their endogenous synthesis (Bizzi et al. 1980; Lusky et al. 1988, 1989).
A study on a denucleinized protein product obtained from Paprin suggested that
the product can be used as a fodder protein and even as a protein source for the
food industry (Ioffe et al. 1990).
2.3
Physiology of Growth
Due to its application in biotechnology (cf. Sects. 1,2, and 6) C. maltosa has been
intensively studied concerning its growth physiology and biomass composition.
The following physiological parameters were included in these investigations:
temperature and pH for growth, growth rate (Ji) and yield (biological carbon
source conversion into microbial biomass), thermodynamic considerations in-
cluding the auxiliary substrate concept, and biomass composition.
2.3.1
Temperature and pH
Candida maltosa belongs to the mesophilic yeasts having an optimal temperature

for growth of about 32-34°C, but it still grows at 37 C, and weak growth is ob-
D
served up to 40-41 DC (Nakase et al. 1972; Meyer et al. 1975; Golubev et al. 1986).
With increasing temperature, the yield and protein content decrease, but the
degree of decrease is strain-dependent (Gradova et al. 1983). In contrast to C.
tropicalis and other thermo tolerant yeast (C. albicans, C. rugosa, C. blankii), it
cannot grow at 43 DC and higher temperatures (Gradova et al. 1983, 1990; Golubev
et al. 1986). In comparison with the psychrotolerant yeast Y. (C.) lipolytica, it is less
active at low temperatures of 5-lO oC (Crow et al. 1980). The yeast C. maltosa can
grow in a broad range of pH from 2.5 to 6.5. The best pH range for growth is
between 3.5 and 5.5 (Gradova and Kovalsky 1978; Gradova et al. 1983; Zentgraf
1991b). For cultivation on alkanes in fermenters, the optimal pH is about 4.2-4.6.
For optimal growth in minimal media C. maltosa needs vitamins, biotin in
particular. The biotin dependence is higher for growth on hydrocarbons than
on carbohydrates; it is especially important for the utilization of short-chain n-
alkanes (Gradova et al. 1983; Schauer 1988; cf. Sect. 2.4.2).
2.3.2
Growth Rate and Yield Coefficients
In mineral salt media C. maltosa NP4 is able to grow under optimal conditions
without any limitation in batch cultures in the laboratory with comparable maxi-
mal specific growth rates (Ji) of 0.55 to 0.6h-l on glucose (as the only source of
carbon and energy) and 0.45 to 0.5 h-1 on hexadecane, respectively (Mauersberger
et al. 1980; Mauersberger 1985). A similar relation, but with lower Ji values, was
reported by Bruckner and Troger (1981b) using glucose and an alkane mixture
(Parex) for the C. maltosa strain H. Under conditions of decreased oxygen content
in the medium, Ji (or corresponding growth parameters) declined strongly, but the
degree of oxygen limitation is very dependent on the substrate used (Mauersberger
1985; Schunck et al. 1987a).
In continuous culture, C. maltosa strains can be cultivated on carbohydrates or
alkanes at dilution rates D from 0.05 to 0.5h-1 (Gradova et al. 1983; Buttner et al.
1985). The optimal dilution rates for obtaining high yield in biomass production
are between 0.2 and 0.3h-1• These values were reached only in high-performance
industrial reactors that guarantee high mass and heat transfer, whereas in other
industrial fermenters D is normally below these values. The best mass transfer
conditions are obtained with recycle reactors, where the culture broth is continu-
ously repumped in a range of one to several minutes, giving rise to areas of
high and low turbulence. The produced oxygen-, pH-, and nutrient gradients
affect microbial growth and cause an increase in specific material consumption
coefficients.
With the aim of better understanding and improving the economy of the bio-
technological process of biomass production, the dependence of physiological
parameters (yield coefficients Y or substrate conversion rates) on milieu condi-
tions (concentrations of carbon source and oxygen) and cell states has been inves-
tigated with C. maitosa (formerly designated C. guilliermondii or 1. elongisporus;
Table 1) cultures aerobically growing on carbohydrates, n-alkanes, or crude oil
fractions. These studies for the analysis of the named physiological parameters
were performed including calorimetric measurements and thermodynamic
considerations:
• under normal conditions in discontinuous (batch) cultures on carbohydrates or
alkanes or in continuous (chemostat) cultures (Glombitza and Heinritz 1979;
Bley et al. 1980; Stichel et al. 1982; Heinritz et al. 1983a; Buttner et al. 1985;
Minkevich et al. 1988; Zentgraf 1991a,b,c);
• under the influence of perturbations, like substrate or oxygen limitations, which
occur in industrial recirculation reactors used for SCP production on alkanes, as
well as under the influence of alternating milieu changes as substrate (glucose,
sucrose, or n-alkanes) and oxygen supply during cultivation in laboratory or
industrial fermenters (Glombitza and Heinritz 1979; Heinritz and Bley 1979;
Heinritz et al. 1981, 1985; Glombitza 1982; Riege et al. 1989; Zentgraf 1991a,b,c,
1993);
• for the phenomenological description of the microbial substrate conversion by
connecting energy and material balance equations (Heinritz et al. 1982, 1983a)
proving the auxiliary substrate concept of Babel (Babel 1979, 1980, 1986; Muller
and Babel 1988, 1989) for mixed substrate utilization;
• by using the dynamic process control conception during continuous cultivation
(Heinritz et al. 1983b, 1985).
The results of the influence of alternating milieu changes, like the oxygen concen-
trations in the medium, on physiological parameters of C. maltosa cultures, are of
importance for applying microorganisms in high-performance fermenters with
changing gradients of dissolved oxygen tension in particular. It has been demon-
strated that nonhomogeneity of the oxygen concentration in the culture medium
during continuous cultivation on crude oil fractions or n-alkanes diminished the
biomass production efficiency of C. maltosa (Heinritz et al. 1985; Riege et al. 1989).
Strong oxygen limitation decreased protein formation and carbon incorporation
into the biomass with a simultaneous increase in CO formation, whereas periodic
2
changes of oxygen supply caused a decrease only in carbon incorporation into the
biomass and an increase in CO formation, but not the incorporation into the
2
nitrogen-containing biomass (protein), probably due to the presence of different

regulation sites in the cell. For the industrial SCP production from crude oil
fractions in recycle reactors, these results show that periodic oxygen gradients can
cause lower yield coefficients (g biomass/g substrate) and higher CO formation,
2
whereas the protein formation per g utilized substrate might remain constant
(Riege et al. 1989).
Included in these investigations for optimizing biomass production with C.
maltosa was the concept of using mixed substrates or auxiliary substrate concept
(Babel 1979, 1980). According to this concept, the right combinations of energy-
deficient (glucose, sucrose, acetate, formate) and energy-rich substrates (n-al-
kanes, fatty acids, ethanol) should lead to an improvement of specific yield
coefficients linked to a reduction of the specific heat production, and an increase
in the growth rate and velocity of the substrate utilization for biomass production
by microoganisms able to consume simultaneously both types of substrates with-
out inhibition or (catabolite) repression effects. It was demonstrated that the
auxiliary substrate concept is appropriate to improve the yield both for SCP- and
product synthesis with different microorganisms and substrates (Babel 1986).
Thus, this concept was proved also with C. maltosa (L. elongisporus) utilizing
simultaneously sucrose and hexadecane (using a mixing ratio of 85% w/w sucrose/
15% w/w paraffin) as substrates in batch cultures (Heinritz et al. 1982) and
hexadecane and formate, hexadecane and isopropanol, or ethanol and formate in
chemostat cultures as well (Millier and Babel 1988, 1989).
Besides the energetic efficiency, the binding state of the substrate is important
in the search for optimal substrate mixing ratios. Thus, the fermentation systems
sucrose/yeast, paraffin/yeast, and sucrose/paraffin/yeast were studied using syn-
chronous populations produced by the method of phased cultures. The theoreti-
cally optimal mixing conditions (85% w/w sucrose/15% w/w paraffin) for optimal
growth rate, carbon and oxygen utilization coefficients, and specific heat forma-
tion were proved by experimental data. Under other mixing conditions, simulta-
neous utilization of both substrates was not observed (Heinritz et al. 1982).
Additionally, several studies were also performed with C. maltosa at the bio-
chemical level, showing regulation by the oxygen supply not only on the growth
rate but also on biomass yield, biomass composition, and the content of enzymes
involved in alkane degradation (Davidov and Gololobov 1980a,b; Mauersberger et
al. 1980, 1984; Mauersberger 1985; Wiedmann et al. 1987, 1988a; Schunck et al.
1987a,b; Riege et al. 1989; Ilchenko et al. 1989; Shilova et al. 1989; cf. also Sects.
2.3.3. and 2.5).
2.3.3
Biomass Composition
The biomass composition of C. maltosa varies depending on the growth conditions

used. Normally, different strains contain about 50-60% crude protein (total nitro-
gen N x 6.25) or 40-45% of true protein according to Lowry on a dry weight basis
(Bruckner and Troger 1981a,b; Kolblin and Birkenbeil 1981; Kolblin and Troger
1982; Gradova et al. 1983, 1990, our own data). This biomass of alkane-grown cells
contains further about 25-30% total carbohydrates (polysaccharides as 8-10%
high molecular mannan, 3-4% low molecular mannan, 11-15% glucan, mainly
localized in the cell walls, 1.5-2% glucogen, and 0.7% trehalose), 6-7% total
nucleic acids and 15-18% lipids. In contrast, in glucose-grown cells, the total
carbohydrate content is significantly higher (43-46%, including 11 % mannan, 12-
13% glucan, 3% trehalose, and 4-6% glucogen), whereas the lipid content (13-
14%) and the protein content (35-37%) are lower, without changed nucleic acid
content (Bruckner and Troger 1981b; Blasig et al. 1984, 1989).
After selection of the best hydrocarbon utilizing strains, the crude protein
content was in the range of 55-62%. Interestingly, this value did not vary signifi-
cantlywhen using glucose or alkanes as carbon sources (Gradova et al. 1983, 1990).
Under nitrogen limitation conditions, the crude protein content (up to 17-23%)
and the nucleic acid (3-4%) content of alkane-grown cells decreased strongly,
connected with an increase of both lipid (28-30%) and total carbohydrate (38-
44%) contents (Bruckner and Troger 1981a,b; Gradova et al. 1983). Comparable
results were obtained to some extent also under oxygen limitation conditions
(Riege et al. 1989). These data for C. maltosa are in agreement with results obtained
with other hydrocarbon-utilizing Candida yeasts (Nabeshima et al. 1970; Kiippeli
et al.1975; see Bruckner and Troger 1981b) and with the protein content known for
S. cerevisiae (Gradova et al. 1983). The biomass of C. maltosa contains about 4-5%
lysine, 0.8-1.5% sulfur-containing amino acids, and a total of 23.5-26.0% of essen-
tial amino acids (Gradova et al. 1983).
The content of neutral lipids varied between 12 and 32% of the total lipid
content without a recognizable relationship to the n-alkane chain length or other
experimental conditions. The polar lipid fractions contained phosphatidylcholine
and phosphatidylinositol as the major components (20% of total phosphate con-
tent, each), phosphatidylethanolamine (15%), phosphatidylserine and cardiolipin
(6% each), and some further unidentified phosphate-containing lipids (Blasig et al.
1989). The fatty acid content in glycerol-grown cells was lower than in alkane-
grown cells, and the total lipid content in glucose cells was about 50% (6-9%) of
that (12-17%) of alkane-grown cells (Blasig et al. 1984, 1989).
2.3.4
Media
Complete (Complex) Medium: YPD (YEPD) composition as used for other yeasts
(Rose et al. 1990), 1% yeast extract, 2% Bacto peptone, 2% Dextrose (glucose).
Synthetic Mineral Salt (Minima/) Media: YNB - Yeast nitrogen base without amino
acids (Difco): Candida maltosa grows well in YNB with addition of a
carbon source (1-2%) as glucose, glycerol, ethanol, or n-alkanes. YNB is often
designated SD (0.67% YNB and 2% Dextrose (glucose) or SG (0.67% YNB and 2%
Galactose).
Other Mineral Salt Media: Two mineral salt media were mainly used for
investigation of C. maltosa EH15 in the authors' laboratory in Berlin-Buch
(Mauersberger et al. 1981, 1984; Huth et al. 1990a). Medium 1 is composed
according to Reader (Biochem J 21, 1927), whereas medium 2 is modified mainly
for the production of higher biomass concentration on alkanes. These two media
contain, in 1000ml bidistilled water:
Components Medium 1 (gil) Medium 2 (gil)
(NH4)2S04 3.0 12.75

KH2P04 1.0 1.56
K2HP04 x 3H zO 0.16 0.33
MgS0 4 x7HP 0.70 0.41
Ca(N0 3)2 x 4H 2O 0.40 0.40
NaCI 0.50 0.50
KCI 0.08
FeCl3 x 6H zO 0.01
Trace element solution 0.2ml 0.45ml
The trace element solution containes in 1000 ml aqua bidest.:

10.0g FeS04 x 7HP, 80.0g ZnS0 4 x 7H20, 64.0g MnS0 4 x 4HP, 8.0g CuS0 4 x
5H20, 10 ml conc. HCI
Vitamins: Only biotin (10 j.lg/l or up to 1 mgll) is necessary for growth of C.
maltosa, especially when grown on short-chain n-alkanes (Schauer 1988; cf. Sect.
2.4). Bacto Yeast extract (Difco) in a concentration of 0.1% is often used as
complex vitamin and amino acid source.
Good growth of C. maltosa is also observed in the minimal salt medium accord-
ing to Tanaka et al. (1967), supplemented with biotin (1 mg/l) and with the re-
quired vitamins, amino acids, and organic bases, when using auxotrophic mutants
(Bode et al. 1983; Bode and Casper 1983; Schmidt et al. 1985, 1989a,b, Becher et al.
1991).
2.3.5
Cultivation Conditions
• pH: stop of growth near pH 8, tolerates low pH values to 2.5.

• Temperature: up to 40-41 ec, not at 43 ec (mesophilic yeast).
• Cultivation in shaking flasks at 100-240rpm using rotary shakers (100ml me-
dium in 500-ml shaking flasks) or in fermenters.
• Ventilation (oxygen consumption): high oxygen supply necessary for good
growth on hydrocarbon substrates.
• Method for monitoring growth and substrate utilization (see Sect. 2.4.3).
2.4
Substrate Utilization Spectrum of Candida maltosa
Due to its ability to grow on a variety of carbon sources including n-alkanes and
fatty acids, the yeast C. maltosa has been studied since its discovery as an organism
useful for industrial purposes, mainly for the production of single-cell protein
(SCP) on alkanes and for obtaining commercially interesting oxidation products
of these substrates (Levi et al. 1979; Einsele 1983; Shennan 1984; Biihler and
Schindler 1984; cf. also Sects. 1 and 6). Therefore, mainly the alkane and fatty acid
metabolic pathways have been intensively studied in this yeast.
Besides their application in taxonomic studies, the metabolism of carbohy-
drates was mainly studied in comparison with the n-alkanes as carbon sources,
and in connection with cell wall biosynthesis. Recently, the metabolism of ethanol
was also studied (Sect. 2.4.2).
Data obtained for these main studied pathways in C. maltosa are mostly compa-
rable with the results obtained for the other thoroughly studied alkane-assimilat-
ing yeasts such as C. tropicalis, P. guilliermondii, and Y. lipolytica (Barth and
Gaillardin, Chap. lO, this Vol.).
2.4.1
Nitrogen Sources and Amino Acid Catabolism
In spite of the fact that the Candida yeasts have been widely used for a long period
of time for obtaining SCP from different kinds of raw material, the nitrogen
metabolism of the yeast involved has been insufficiently studied until recently. The
yeast C. maltosa is not able to utilize nitrate (N0 3-) or nitrite (N0 2-), but it can use
ammonium ions (NHt), urea, or amino acids as sole source of nitrogen for growth
(Metz and Reuter 1977; Casper et al. 1985a,b; Guselnikova et al. 1989, 1991;
Gradova et al. 1990; Huth et al. 1990a,b,c; Table 3).
Ammonium and Urea Assimilation

Ammonium assimilation. The ammonium assimilation and its regulation in C.
maltosa was studied by Popov et al. (1980), Casper et al. (1985a), Huth et al.
(1990a,b,c), Gradova et al. (1990), and Guselnikova et al. (1991). Data on the
kinetics of ammonium transport into the cell using methylamine as an analogous
material nonmetabolizable by the cells were published by Gradova et al. (1990) and
Guselnikova et al. (1991). After cultivation on ammonium-containing medium, C.
maltosa possesses a constitutive and active system for methylamine transport
having a Km of2 x lO-4M (low affinity permease) not significantly influenced by the
carbon source (glucose or octadecane). Cultivation of the yeast under conditions of
ammonium deficiency (100,uM) resulted in expression of a second active system
for methylamine transport, having a Km of 2 x lO-5 M. This high affinity permease
has no analogy with the two or three permeases of S. cerevisiae (Magasanik 1992),
and occurs during cultivation with amino acids or yeast autolysate as the sole
nitrogen source. At physiological ammonium concentration in medium (10

100 mM) the high affinity methylamine transport system was irreversibly inhibited.
Ammonium assimilation in C. maltosa is mainly connected with the glutamatel
glutamine formation as reported for other yeast and fungi (Magasanik 1992). The
synthesis of these two primary products involves three enzymes, the glutamate
dehydrogenase (GDH NADP and GDH NAD), glutamine synthetase (GS), and
glutamate synthase (GOGAT NAD/NADP). In C. maltosa the regulation of these
enzymes is somewhat different from that known for bakers yeast (Casper et al.
1985a). The GDH exists in C. maltosa in two forms, the catabolic GDH (NAD) and
the biosynthetic GDH (NADP). The GS is derepressed during growth on low
ammonium or on a variety of alternative mitrogen sources, whereas the catabolic
GDH (NAD) is repressed under these conditions. Due to its low Km value for
ammonium, the GS is obviously the most active enzyme during growth on low
ammonium concentrations, whereas ammonium limitation did not significantly
affect the biosynthetic GDH (NADP) or the GOGAT. The latter is present in
amounts higher in C. maltosa than are normally found in S. cerevisiae. Casper et al.
(1985a) concluded that under N-limitation ammonium assimilation is achieved
via GS/GOGAT and under N-excess via GS/GDH(NADP) in C. maltosa. The char-
acterization of a GOGAT mutant (glul) supported the role of this enzyme in
ammonium assimilation (Casper et al. 1985b).
During assimilation of ammonium as the only nitrogen source, yeasts like C.
maltosa exhibit a strong correlated proton extrusion leading to an acidification of
the medium. The proton extrusion of growing yeast cultures, measured from the
alkali consumption to maintain a constant pH of the culture, was shown to be an
exact and reliable on-line parameter for the description of biomass production and
consumption of the nitrogen (with an NH/IH+ exchange ratio of exactly 1.0) and
carbon sources quantitatively in batch and fed-batch fermentation processes. The
biochemical basis of this proton extrusion was shown to be connected with the
nitrogen metabolism of growing yeasts (Schunck et al. 1987a; Riege et al. 1989;
Huth et al. 1990a,b,c, see Sect. 2.4.3).
Regulation of Ammonium Catabolism by Nitrogen Catabolite Repression. Changes
in ammonium concentration in the medium influence both the ammonium
transport system and the entry of other N-containing components into the cells
and vice versa. These regulation phenomena, named nitrogen catabolite
repression in yeast (Cooper 1982; Wiame et al. 1985), were also detected in C.
maltosa. Thus, ammonium assimilation by C. maltosa is repressed by the presence
of high amounts (>2mg/ml) of asparagine (Popov et al. 1980). Otherwise,
mechanisms for regulating nitrogen metabolism probably exist in this yeast which
are different from the mechanism of nitrogen catabolite repression, as concluded
from experimental data on peptide and amino acid utilization from yeast
autolysate by C. maltosa (Gradova et al. 1990).
Urea assimilation. During growth of C. maltosa on glucose or n-alkane with urea as
nitrogen source, no urease activity (urease negative yeast) and no accumulation of
ammonia in the medium were detectable (Metz and Reuter 1977). Urea was obvi-
ously utilized via a urea-amydolase (UALase, forming CO 2 and NH 3, consisting of
urea carboxylase, EC 6.3.4.6, and allophanate hydrolase, EC 3.4.1.13) activity, de-

tected in cell-free extracts in the presence of ATP, biotin, and cations. This enzyme
complex ATP: urea-amidolyase (ADP) is induced by urea and arginine and re-
pressed by catabolite ammonia, as reported for other yeasts, including S. cerevisiae
(Metz and Reuter 1977).
Amino Acid and Peptide Catabolism
The catabolism of amino acids in C. maltosa has been studied mainly in the
laboratory of Dr. R. Bode at the University of Greifswald, Germany, including their
enzymology and the use of respective mutants, and in connection with the ana-
bolic pathways.
Several amino acids (glutamate, aspartate, asparagine, proline, arginine, orni-
thine, lysine, acetyl lysine, serine, leucine, isoleucine, valine, alanine) are used by
C. maltosa as the only nitrogen source (Casper et al. 1985b; Umemura et al. 1992).
Among several compounds tested, C. maltosa utilizes also phospho no alanine as
the sole nitrogen source (Bode and Birnbaum 1989). Most of the amino acids are
also used as carbon sources, except the aromatic amino acids, leucine, isoleucine,
valine, and glutamine, the latter because C. maltosa has no glutaminase activity
(Casper et al. 1985b). Obviously, C. maltosa (strain JCM1504) assimilates the L-
isomers of racemic amino acids such as alanine, arginine, asparagine, glutamate,
proline, and serine with high stereoselectivity as the only source of carbon and
nitrogen (Umemura et al. 1990, 1992; cf. Sect. 6).
Amino acids are transported into C. maltosa cells by a suggested nonspecific or
general amino acid permease, which is able to catalyze the transport of several
amino acids and probably other compounds like glyphosate (Bode et al. 1985b).
The main amino acid degradation pathways studied for C. maltosa are:
Glutamate, glutamine, aspartate, and asparagine degradation is included in
their general metabolism due to their important role in nitrogen metabolism in C.
maltosa, as discussed above (Casper et al. 1985a,b). No glutaminase was detected
in this yeast. Asparagine is degraded via aspartate (asparaginase) to fumarate
(aspartate lyase with catabolic function only), and aspartate is also converted by its
aminotransferase to glutamate (Casper et aL 1985b).
Lysine catabolism occurs in C. maltosa via N-acetylated intermediates. The first
two enzymes of this pathway, the novel acetyl-CoA:L-lysine N-acetyltransferase
(EC 2.3.1, Schmidt et al. 1988; Hammer et al. 1991) and the W-acetyl-L-lysine:2-
oxoglutarate aminotransferase (AcL-AT, Schmidt and Bode 1992) were first de-
tected in yeast in C. maltosa. The two enzymes were characterized after partial and
total purification, respectively. Further degradation of the 2-keto-acetamido-
caproate and 5-aminovalerate to glutarate has been described in this yeast as in Y.
lipolytica, whereas P. guilliermondii and C. albicans use the oxidative transamina-
tion as the first step (Hammer et al. 1991).
Aromatic amino acids are used as sole nitrogen source but not as carbon source
by C. maltosa (Casper et al. 1985b). This yeast possesses three L-aromatic ami-
notransferase (EC 2.6.l.57) activities (ArAT I-III), one of which was inducible
by aromatic amino acids (Bode and Birnbaum 1984, 1987). This manner of
degradation of L-aromatic amino acids results in phenylpyruvate, p-hydroxy-
phenylpyruvate, and indolepyruvate, which are converted into the corresponding
aromatic acetates, catalyzed by aromatic lactate dehydrogenases (ArLDH), present
in C. maltosa in high activities. This enzyme (EC 1.1.1.110) was first reported in
yeast and characterized after purification (Lippoldt et al. 1986; Bode et al. 1986a).
D-aromatic amino acids are degraded in an initial deamination step by aD-amino
oxidase (DAO, EC 1.4.3.2), widely distributed in yeasts, although to a lower extent
in C. maltosa (Lippoldt et al. 1986). The possibility of biotechnological application
of these enzyme activities from C. maltosa has been tested (Bode and Birnbaum
1987, 1991a; see Sect. 6).
Alanine catabolism in C. maltosa JCM1504 is initiated by the enzyme alanine
aminotransferase (AlaAT, EC 2.6.1.2) intensively studied by Umemura et al. (l991,
1994) after purification (Table 4). The AlaAT isolated from cells grown on L-
alanine as the only source of carbon and nitrogen is stereospecific towards L-
alanine, leaving the D-alanine untouched. This enantioselectivity of the AlaA T of
C. maltosa, connected with a very low D-amino acid oxidase activity under the
conditions used, was applied to produce D-alanine from a racemic D,L-alanine
substrate mixture with C. maltosa cells (Umemura et al. 1990, 1992; cf. Sect. 6).
Leucine, isoleucine, valine are used not as carbon, but as nitrogen sources. The
first step of degradation is probably catalyzed by two branched aminotransferases
AT -I and AT -II (EC 2.6.1.42), detected in cytosol only and purified from C. maltosa
(Bode and Birnbaum 1988).
Threonine is further used in isoleucine biosynthesis, whose first specific enzyme
threonine dehydratase catalyzing its deamination was studied (Bode et al. 1986b;
Bode and Birnbaum 1988).
Arginine is used as nitrogen source via arginase (endogenous urea formation
from arginine during arginine catabolism) as in S. cerevisiae. The synthesis of
arginase is regulated by arginine and ammonium as described for other yeasts.
From the lower level of arginase in relation to ornithine carbamyl-transferase it
was concluded that, especially in alkane-growing C. maltosa, the arginine catabo-
lism is not very intensive (Metz and Reuter 1977).
Peptide utilization from yeast autolysate by C. maltosa was studied by Belov and
Guselnikova (1988), Guselnikova et al. (1989), Gradova et al. (1990), and Belov et
al. (1991). The peptide transport is independent of that of amino acids. Autolysate
addition to the growth medium of C. maltosa decreases the intracellular pool of
free amino acids and accelerates phosphatidyl inositol metabolism. The peptide
components of the autolysate are presumed to act as biologically active compounds
by exerting an essential effect on the phosphatidyl inositol system of C. maltosa.
2.4.2
Carbon Sources
The yeast C. maltosa is characterized by its ability to grow on a wide range of

substrates as the only source of carbon and energy including long-chain alkanes
and fatty acids, ethanol, acetate, and carbohydrates (Table 3).
Table 3. Substrate utilization spectrum and other physiological properties of Candida

maltosa
Substrates and properties Utilization as carbon and

energy source or nitrogen
source (or cooxidation
demonstrated)
Fermentation of
Glucose, galactose, maltose, sucrose, trehalose +
Lactose, raffinose, melibiose, cellobiose
Soluble starch, a-methyl-glucoside
Assimilation of
Carbohydrates
Glucose, galactose, maltose, sucrose, trehalose +
L-Sorbose, cellobiose, melezitose, D-xylose +
Lactose, melibiose, raffinose, soluble starch
Inulin, arabinose, D-ribose, L-rhamnose
Alcohols and organic acids
Ribitol, sorbitol (D-glucitol), D-mannitol +
Erythritol, arabitol, galactitol (dulcitol)
Ethanol, glycerol, acetate, lactate +
Succinate, pyruvate, citrate, 2-ketogluconate +
Methanol
Other substrates
Salicin, a-methyl-glucoside (glycosides) +
Glucosamine, amino acids +
Hydrocarbons (hc)
n-Alkanes (C6-C40 ), alkenes, fatty alcohols, fatty acids +
Single branched hc (e.g., 2-methyl-pentadecane) + (+)
Multiple branched hc (e.g., pristane) - (+)
Cycloalkanes - (+)
Aromatic hc (biphenyl, naphthalene, benzo(a)pyrene) - (+)
Selected steroids - (+)
Phenol, catechol, cresol +
Nitrogen sources
Ammonia, urea, amino acids +
Nitrate, nitrite
Other properties
Growth at 30-40 DC +
at 43 DC
Acid formation weak
Cycloheximide or formaldehyde resistance +
Fat splitting +
Urease
Vitamin (biotin) dependent +
Growth on 50% glucose
Sporulation
Pseudomycel formation +
Coenzyme Q type 9
G + C content 36-37%
Data taken mostly from Barnett et al. (1983) and Kreger-van Rij (1984), and from other
references mentioned in the text (see Sect. 2.4); (-) negative; (+) positive.
Utilization of Carbohydrates
C. maltosa assimilates a broad range of carbohydrates which are used for taxo-
nomic classification (Barnett et al. 1979, 1983; Kreger van Rij 1984; cf. Table 3).
Carbohydrate transport and metabolism in C. maltosa were studied also for com-
parison (growth kinetics, thermodynamics, biomass composition; see Sect. 2.3)
with other noncarbohydrate substrates, and to investigate the biosynthesis of
polysaccharides and the regulation of catabolic and anabolic pathways (see Sects.
2.5 and 3.2).
Glucose Transport. Two different glucose transport systems were detected in C.

maltosa which differed only three-fold in the magnitude of their affinity constants
(Km of 0.l3 and 0.35 mM) measured with labeled glucose. The capacity of the
carriers (V ma,J was higher in the presence of glucose in the medium. The
expression of further uptake systems under other environmental conditions was
not excluded (Hofmann and Polnisch 1990c).
Metabolism of Glucose and Other Hexoses. Carbohydrate metabolism in C. maltosa

was intensively studied in the 1980s in the laboratory of Dr. G. Reuter at the
Schiller University Jena, Germany, in the course of investigations made on
structure and regulation of biosynthesis of the polysaccharides, especially of the
cell wall of this yeast (see also Sects. 2.5 and 3.2). The yeast C. maltosa exhibits
some peculiarities in the metabolism of carbohydrates compared with the
thoroughly studied S. cerevisiae. When oxygen is not limiting and glucose is in
excess, glucose uptake is obviously controlled and no ethanol production was
observed in C. maltosa during monophasic growth on glucose. Under oxygen
limitation, however, mostly occurring at the end of the exponential growth in
shake flasks, ethanol formation from the excess of glucose or other hexoses was
observed (Rober and Reuter 1979, 1984a; Popov et al. 1980; Rober 1985; Schauer
1988). In contrast to S. cerevisiae and other true fermenting yeasts, C. maltosa
showed no true Crabtree effect, e.g., no glucose fermentation to ethanol at high
glucose concentrations of 1-10% under aerobic conditions was observed (Schauer
1988), although under oxygen limitation the formation of ethanol occurred. For
resting cells, glucose utilization was accompanied by formation of small amounts
of glycerol (Schauer 1988). In this respect, C. maltosa is obviously similar to C.
tropicalis classified as glucose-insensitive and 02-sensitive yeast. In contrast,
obligatory oxidative yeasts like Y. lipolytica and Trichosporon cutaneum produce
no or low amounts of ethanol during growth on glucose (Fiechter et al. 1987;
Fiechter and Gmiinder 1989).
The oxidation of glucose and other hexoses (mannose, fructose) by C. maltosa
under aerobic conditions via tricarboxylic acid cycle is relatively low, suggesting
its repression. Glucose degradation occurs mainly via the pentose phosphate path-
way (PPP, oxidative and recyclic), some steps of glycolysis, and simultaneously by
operation of the tricarboxylic acid cycle and pyruvate decarboxylation, as con-
cluded from experiments with specifically labeled hexoses (Rober and Reuter 1979,
1984a; Rober 1985). In agreement with these results, the specific activity of the
phosphofructokinase (PFK) was very low. The glyceroaldehyde-3-phosphate aris-

ing from the PPP is catabolized via the last steps of glycolysis into pyruvate, further
decarboxylized to acetyl-CoA to yield energy, or transformed partially into etha-
nol. These steps of glycolysis were found to be increased in activity during oxygen
limitation of the culture growing on hexoses, reflected in a higher glucose con-
sumption rate under these conditions (Rober and Reuter 1984a; Rober 1985).
Glucose (hexose) degradation is initiated by formation of glucose-6-phosphate
in the hexokinase reaction. The two hexokinase isoenzymes purified from C.
maltosa (Table 4) are a target for effective control of glucose-6-phosphate forma-
tion by energy charge of the cell or by the intracellular level of ATP, ADP, and
glucose instead of allosteric interconversion of the enzymes (Rober et al. 1984a).
The glucose-6-phosphate dehydrogenase (G6PDH), initiating and controlling the
pentose phosphate cycle by its metabolic regulation, was also purified and charac-
terized in its kinetic regulation (Rober et al. 1984b).
The functioning of the pentose phosphate cycle is in glucose-growing C.
maltosa the prerequisite for the synthesis of the cell wall polysaccharides (glucan
and mannan) and of other energy reserve compounds (glycogen and trehalose), all
having fructose-6-phosphate as common precursor intermediate for their biosyn-
thesis (Rober and Reuter 1979, 1984b,c,d, 1985). The hexose utilization and these
biosynthetic pathways in C. maltosa were studied in comparison with two mutants
(H3 and H5) partially desensibilized in the catabolite repression by glucose (Rober
and Reuter 1982, 1984a,b; Rober 1985).
The presence of glucose in the medium generally generates in C. maltosa a
catabolite repression and/or catabolite inactivation of different metabolic path-
ways like the catabolism of hydrocarbons (alkanes, phenol - Mauersberger et al.
1980, 1981, 1984; Mauersberger 1991; Hofmann and Kruger 1985; Hofmann and
Vogt 1987, 1988; see Sects. 2.4.2, 2.5), and the catabolism of ethanol or acetate,
including the glyoxylate cycle and gluconeogenesis (Polnish and Hofmann 1989;
Hofmann and Polnisch 1990a,b,c). Aerobic growth on glucose resulted also in
repression of the tricarboxylic acid cycle. The degree of catabolite repression was
shown to depend on the carbon sources (nature of hexoses) used and on the
oxygen concentration in the medium (Rober and Reuter 1984a, 1985).
The utilization of carbohydrates mixtures as occurring in wood hydrolysates
(hemicellulose beech and others) by Candida yeast including C. maltosa was
studied by Manakov and Prishepov (l986) and Kostov et al. (1991).
Hydrocarbon and Phenol Assimilation

The yeast C. maltosa belongs, in addition to C. tropicalis, C. intermedia, Pichia(C.)
guilliermondii, and Y. (C.) lipolytica, to the best-investigated alkane-assimilating
yeasts due to its application in the industrial production of alkane-based SCP and
oxidation products (see Sects. 1 and 6). The knowledge of alkane-assimilating
yeasts was repeatedly reviewed, especially in the golden age of petroleum microbi-
ology and biochemistry until the end of the 1970s (for earlier references see Levi et
al. 1979; Fukui and Tanaka 1981a,b; Rehm and Reiff 1981, 1982; Buhler and
Schindler 1984; Tanaka and Fukui 1989).
Table 4. Proteins purified and characterized from the yeast Candida maltosa
I~
Protein Strain and Function Gene Antibodies Reference
carbon source isolated obtained
AlaAT JCM1504 Alanine catabolism Umemura et al. (1991, 1994)

ArLDH L4 Catabolism of Bode et aI. (1986a)
aromatic aa
ASG' L4 Tryptophan Bode et aI. (1985a)
biosynthesis
ASN' L4 Tryptophan Bode et aI. (1985a)
biosynthesis
BAAT L4 Branched aa Bode and Birnbaum (1988)
metabolism
CDO ATCC20184 Catechol Gomi and Horiguchi (1988)
degradation
Cell wail Alkane uptake + Belov et al. (1983)
glycoprotein
CM' L4 Aromatic aa Bode et aI. (1985d)
biosynthesis
Co-binding Belov and Toneva-Davidova (1983)
protein
Cytbs VSB779 Avetisova (1991)
Avetisova et aI. (1993)
Cytochromes P450
P450Cm1 EH15 a Alkane + + Riege et al. (1981) CIl
(52A3) n-alkanes hydroxylation Schunck et aI. (1983a,b)
P450alk IAM2247 + Takagi et aI. (1989)
s::
~
n>
(52A3) n-alkanes ...
VSB779 (+)d Mauersberger et al. (1992a) '"n>C"
Decane adn>
P450Cm2 Fatty acid (+)d + Scheller et aI. (1992, 1996) ...
n>
.....
(52A4) hydroxylation
~
P450Cm3 VSB779 Alkane and (+)d Mauersberger et aI. (1992a)
..
!"
(52A5) Decane fatty acid
hydroxylation ~
:s
NADPH-P450 EH15 Reduction + + Honeck et aI. (1982) e-o:
reductase ofP450 Vogel et aI. (1992) Q
Kargel et aI. (1996) :I

Q
DAHP-S< L4 Bode et aI. (1984a, 1985c) ::;-
EPSP-S< L4 Shikimate Bode et aI. (1984d) ~
pathway
FAOD VSB779 Fatty alcohol Sokolov et aI. (1991, unpubl.)
Decane oxidation
Mauersberger et aI. (1992b)
Fl,6BPase< L4 Hofmann and Polnisch (1990b)
G6PDH H(H62) Rober et aI. (1984b)
HK 1111< H Rober et al. (1984a)
a-IPM-S< L4 Leucine Bode and Birnbaum (1991c)
biosynthesis Becher et aI. (1991)
IPMDHT< L4 Leucine Bode and Birnbaum (1991c)
biosynthesis Becher et aI. (1991)
,B-IPMDH< L4 Leucine + Bode (1991); Bode and
biosynthesis Birnbaum (1991c)
Becher et al. (1991)
LAcT< L4 Lysine metabolism Schmidt et aI. (1988)
Schmidt and Bode (1992)
P-DHT< L4 Aromatic aa Bode et al. (1985d)
biosynthesis
P-DH< L4 Aromatic aa Bode et al. (1985d)
biosynthesis
PRAI< L4 Tryptophan Bode et aI. (1985a)
biosynthesis
PRT< L4 Tryptophan Bode et aI. (1985a)
biosynthesis
SOD VSB779 Avetisova (1991) It;
\0
Table 4. (Contd.)
Protein Strain and Function Gene Antibodies Reference £

carbon source isolated obtained
ThrDHT L4 Isoleucine Bode et al. (1986b)

biosynthesis
TS' L4 Tryptophan Bode et al. (1985a)
biosynthesis
a,bProteins were additional aor only bpurified after heterologous expression in the yeast S. cerevisiae GRF18 (Schunck et al. 1991; Scheller et al.
1992, 1994, 1996; Kargel et al. 1996).
'Partially purified proteins.
d Genes isolated from other C. maltosa strains.
Abbreviations.
ArL-DH - D-aromatic lactate dehydrogenase (EC 1.1.1.110)
Ala-AT - Alanine aminotransferase (EC 2.6.1.2)
ASG - Glutamine-dependent anthranilate synthase (EC 4.1.3.27) in complex with the
- indole-3-glycerol-phosphate synthase (InGPS, EC 4.1.1.48)
ASN - Ammonia dependent anthranilate synthase (EC 4.1.3.27)
BAAT - Branched amino acid aminotransferase (EC 2.6.1.42) forms I and II, for leu, ile, val
CDO - Catechol-l,2-dioxygenase (pyrocatechase)
CM - Chorismate mutase (EC 5.4.99.5)
DAHP-S - 3-Deoxy-D-arabinoheptulosonic acid 7- phosphate (DAHP) synthase, two isoenzymes
EPSP-S - 5-Enolpyruvylshikimate 3-phosphate (EPSP) synthase (EC 2.5.1.19)
Fl,6BPase - Fructose-I,6-bisphosphatase
G6PDH - Glucose-6-phosphate dehydrogenase (EC 1.1.1.49)
HK 1111 - Hexokinase I and II (EC 2.7.1.1)
LAcT - Lysine acetyltransferase [N6-acetyl-L-Iysine: 2-oxoglutarate aminotransferase] (EC 2.3.1.-)
V'
a-IPM-S - a-Isopropylmalate (IMP) synthase (EC 4.1.3.12, coded by LEU4 gene)
IPMDHT - IPM-dehydratase (EC 4.2.1.33, LEUl gene) s:::
P-IPMDH - /3-lsopropylmalate dehydrogenase (EC 1.1.1.85, LEU2 gene)
§
P-DHT - Prephenate dehydratase (EC 4.2.1.51) ~
P-DH - Prephenate dehydrogenase (EC 1.3.1.12) (1)
PRAI - Phosphoribosylanthranilate isomerase (EC 5.3.1.16) ~....

PRT - Anthranilate phosphoribosyltransferase (EC 2.4.2.18)
SOD Superoxide dismutase ~
ThrDHT - Threonine dehydratase t='--
TS - Tryptophan synthase (EC 5.3.1.16).
The Metabolism of n-Alkanes and Alkenes. Approximately 20% of the nearly 500
yeast species, mainly belonging to the genera Candida, Pichia, and Yarrowia, are
able to grow aIternatively either on carbohydrates or on middle- or long-chain n-
alkanes as the only source of carbon and energy (Schauer and Schauer 1986; Miiller
et aI. 1991a,b). Frequently, comparable growth rates can be achieved with both
substrates (cf. Sect. 2.3.2). The different properties of both groups of compounds-
the former rich in oxygen and, therefore, hydrophilic, the latter, without oxygen
and strongly apolar - require different pathways for uptake and metabolism.
Additionally to the data given here on the catabolic pathways of hydrocarbons in
C. maltosa, an overview on the enzymology of the monoterminaI and diterminal
alkane oxidation pathway, including the role of cytochromes P450 and its
regulation, will be given in Sect. 2.5. The aspects of the intracellular localization
and the subcellular organization of this pathway will be discussed below in Section
3 (cf. Fig. 3). For the other hydrocarbons utilized by C. maltosa, the available data
concerning enzymes participating in their oxidation will be discussed here.
In comparison with other alkane-assimilating yeasts C. maltosa shows a broad
substrate specificity towards hydrocarbons. It utilizes n-alkanes of a broad chain-
length spectrum from short-chain liquid n-alkanes (C 6 to C9 ), via middle- or long-
chain liquid alkanes (C IO to CIS) to long-chain solid alkanes (C 19 to C32 ), or even up
to 40 carbon atoms (Celma Calamita et aI. 1971; MichaIeva et aI. 1973a; Demanova
et aI. 1980a,b,c; Mauersberger et aI. 1981; Davidov et al. 1980, 1982; Gradova et aI.
1983; Schunck et al. 1987a; Huth 1987; Schauer 1988; Blasig et al. 1989; Huth et aI.
1990a,b,c).
The short-chain alkanes «C9 ) are not assimilated by yeasts when they are added
as a liquid to the mineral medium. However for C. maltosa, C. tropicalis, C.
parapsilosis, and C. sake it was found that these yeast species can assimilate these
volatile hydrocarbons when they are supplied in vapor phase to the submerse or
emerse culture, when the substrate concentration is diminished to a nontoxic level
(Celma CaIamita et aI. 1971; Meyer et aI. 1975; Huth 1987; Hofmann and Schauer
1988; Schauer 1988; Huth et aI. 1990b; Mauersberger 1991). In contrast, C. rugosa,
C. albicans, P. guilliermondii, 1. elongisporus, or Y. lipolytica are not able to
assimilate these short alkane chain lengths, aIthough they are able to oxidize these
substrates (Schauer 1988). When supplied in small amounts in the presence of an
inert hydrocarbon phase (1.2% of pristane), utilization of these short-chain n-
alkanes was demonstrated also in a fermenter culture of C. maltosa (Schunck et aI.
1987a; Huth et aI. 1990a,b). Interestingly, there is an obvious correlation between
alkane (especially short-chain) and phenol assimilation phenotypes among yeasts
(Hofmann and Schauer 1988). Among ascomycetous and imperfect yeasts with
ascomycetous cell wall structure (DBB-), all hydrocarbon utilizers have the
coenzyme Q9 type (Bos and deBruyn 1973; Hofmann and Schauer 1988).
For optimal growth on n-alkanes, especially on shorter-chain n-alkanes «C lO ),
c. maltosa needs the vitamin biotin. This stimulating effect of biotin on utilization
of short-chain alkanes is connected with the presence of carbon dioxide in the
medium (Gradova et aI. 1983; Schauer 1988), reflecting the activity of the acetyl-
CoA carboxylase, the key enzyme in fatty acid de novo biosynthesis. Mutants with
biotin auxotrophic growth were obtained (Gradova et al. 1976, 1983). When C.
maltosa was cultivated on long-chain alkanes (>C I4 ) the biotin dependence was not
very strong, which is obviously connected with the direct incorporation of the fatty
acids, derived from the alkane, into cell lipids, therefore omitting biotin dependent
fatty acid synthesis (Gradova et al. 1983; Schauer 1988). Substrates containing
mixtures of n -alkanes (crude oil fractions, diesel oil, petroleum, kerosene, alkane
mixtures - Parex, Mepasin) are good carbon sources for C. maltosa.
The growth of C. maltosa on hexadecane is not very strongly influenced or
inhibited by the presence of the chlorinated hydrocarbon pesticide heptachlor
(velsicol) dissolved in the alkane phase, which itself is probably degraded by the
yeast to form I-hydroxychlordene (Smith et al. 1976).
The substrate n-alkanes generate an excess in energy and reduction equivalents,
if the p-oxidation results in generation of NADPH with ammonium as the nitro-
gen source and comparable PlO-quotients of > 1.85. Theoretically, a yield for
hexadecane of about 1.26 gIg should be obtained. In experiments during growth on
hexadecanelammonium, yields of only 0.94 gIg could be reached; but in the pres-
ence of formate (or isopropanol) an improvement up to 1.26g/g (or 1.13) was
possible, which corresponds to the maximum carbon conversion efficiency (Babel
1986; Miiller and Babel 1988, 1989). The behavior of C. maltosa on both alkane and
ethanol as substrates shows that the energy conversion must be the limiting factor
because, due to the growth yields on both substrates, the P/O-quotient is approxi-
mately 1.4. This means that with this species an excess energy situation is not
established (Muller and Babel 1988), although for other substrates and organisms
this could be clearly demonstrated (Muller et al. 1983b; for references see Babel
1986).
For C. maltosa, as for most other alkane-assimilating yeasts (Rehm and Reiff
1981), mainly the monoterminal oxidation pathway of n-alkanes was observed.
With intact cells the first detectable intermediates were fatty acids of the same
chain length as the alkane substrate (Blasig et al. 1984, 1988, 1989; Schauer 1988;
Fig. 3, for alkane oxidizing enzymes see Sect. 2.5). The formed fatty acids are after
activation to acyl-CoA degraded in the J3-oxidation yielding acetyl-CoA or
propionyl-CoA used in the intermediate metabolism for energy production and
synthesis of all cellular components. The fatty acid composition of C. maltosa cells
grown on different chain lengths of alkanes was found to be changed in compari-
son with the normal fatty acid composition of glucose- or glycerol-grown cells,
where predominantly C16:0 (30-40%), CIS:I (35-55%), and to a lesser extent CI6:!> CIS:O
and CIS:2 fatty acids were present (Bruckner and Tr6ger 1981b; Gradova et al. 1983;
Schauer 1988; Blasig et al. 1984, 1989). If n-alkanes up to dodecane were used as
growth substrates, the main portion of fatty acids of substrate chain length was
degraded via p-oxidation, and the fatty acids required for lipids were synthesized
de novo, thus having the same fatty acid composition as glucose- or glycerol-
grown cells. With increasing chain lengths of the n-alkane substrate (from CI4 up
to CIS)' the proportion of de novo synthesis of fatty acids decreased while the
incorporation of fatty acids of substrate chain length into lipids directly, or after
desaturation, chain elongation or chain shortening, gained more importance.
Thus, cells precultured on C16- or Cl7 -alkanes contained mostly (96-99%) even-
chain and odd-chain fatty acids (saturated and desaturated), respectively (Blasig et
al. 1984, 1989). Using solid n-alkanes up to C28 as substrates, fatty acids in the range
CI6 to CIS were predominant, independent of the n-alkane chain length (Blasig et al.
1989). In this case, after monoterminal oxidation the resulting long-chain fatty
acids with substrate chain length were obviously chain-shortened by C2 units down
to an optimal range of chain length from CI6 to CIS and again incorporated into
cellular lipids directly or after desaturation. The de novo fatty acid synthesis was
negligible under these conditions.
Additionally to mono terminal, diterminal alkane oxidation was also demon-
strated to occur in yeast leading to the formation of dicarboxylic acids, further
degraded in the J3-oxidation to succinate. The formed dicarboxylic acids of shorter
chain lengths are partially excreted into the medium (Schauer 1988; Blasig et al.
1984, 1988).
In contrast to various filamentous fungi, no subterminal alkane oxidation was
observed in C. maltosa cells cultivated on n-alkanes (Schauer 1988; Blasig et al.
1984, 1988, 1989). However, l-alkenes are degraded by C. maltosa via secondary
alcohols, methylketones, and, resulting in a two-carbon atoms shortened primary
alcohol, oxidized further by the terminal oxidation pathway. Therefore, after cul-
tivation on l-alkenes, the capacity of cells to oxidize secondary alcohols and
ketones is enhanced. Moreover, these subterminal oxidation products could
be identified in the cultivation medium (Schauer et al. 1986; Schauer 1988).
Zinchenko et al. (1990) reported the occurrence of m-l fatty acids derived from n-
alkenes incorporated in all lipid classes. These fatty acids are preferably incorpo-
rated in phospholipids in contrast to fatty acids derived from n-alkanes, which
seems to be associated with higher affinity of the phospholipid acyltransferases to
unsaturated fatty acids.
Normally, C. maltosa also grows well on the terminal and diterminal oxidation
products of alkanes, such as l-alkanols (fatty alcohols), fatty aldehydes, fatty acids,
m-hydroxy fatty acids, and dicarboxylic acids of the chain length spectrum such as
that of the hydrocarbons (Mauersberger et al. 1981; Schunck et al. 1987a,b; Schauer
1988; Casey et al. 1990; Mauersberger 1991). Shorter chain lengths «C IO ) of these
substrates are found to be toxic for yeast cells, or showing inhibitory effects for
growth on alkanes.
Utilization of Branched Hydrocarbons. Davidov et al. (1981a,b, 1982) investigated

the simultaneous utilization of single-branched alkanes, 2- or 3-(14C) methyl
hexadecane, together with octadecane as carbon sources by C. (guilliermondii)
maltosa, when both substrates were dissolved in pristane (2,6,10,14-tetra-
methylpentadecane). The branched alkanes were partially incorporated into lipids
as 15- or 14-methyl hexadecanoic acids, converted into water-soluble parts of
the cells (proteins, amino acids) and other intermediate metabolites (DCA with
methyl groups in /3-position) and partially oxidized to CO 2 , Multiple-branched
hydrocarbons like pristane are not used as sole carbon and energy source by C.
maltosa, in contrast to some Y. (C.) lipolytica strains growing well on these
substrates (Hagihara et al. 1977; Crow et al. 1979, 1980). However, C. maltosa was
shown also to be capable of uptake of the branched-chain hydrocarbons from a
broth containing growth-supporting n-alkanes (Crow et al. 1979; Schunck et al.

1987a,b). Furthermore, slow oxidation ofpristane to pristanoic acid by C. maltosa
was observed (Blasig et al. 1989), and pristane induced cytochrome P450 in C.
maltosa (Mauersberger et al. 1981; Mauersberger 1985; Schunck et al. 1987b). It is
suggested that the same enzymes as known for n-alkanes (see Sect. 2.5) are
participating in the oxidation of branched alkanes.
Cooxidation of Cyc/oalkanes. Cyclopentane to cyclododecane and derivatives are

not utilized as growth substrates by C. maltosa, but partial oxidation of these
compounds to cycloalkanols and cycloalkanones by alkane- or glucose-grown cells
was observed, when supplied in nontoxic concentrations (Mauersberger et al.
1981; Schauer 1988). A further oxidation of the cycloalkanols and cycloalkanones
formed by unknown mechanisms of cooxidation to CO 2 in the presence of glucose
was observed (Schauer 1988). However the oxidation rates of cycloalkanes or their
first oxidation products are only 5-10% that of n-alkanes. The enzymes for
cycloalkane oxidation in C. maltosa were not characterized, cytochrome P450 was
not induced by the cycloalkanes tested, and the cycloalkane oxidation was not
enhanced in alkane-grown cells (Mauersberger 1985; Schauer 1988).
Utilization of Phenylalkanes. Phenylalkanes (alkylbenzenes) with n-alkyl chains

longer than nine carbon atoms were utilized as carbon sources for growth by C.
(guilliermondii) maltosa, although also shorter alkyl chains were oxidized rapidly,
as checked by growth-dependent proton extrusion (Huth 1987; Huth et al. 1990b),
by growth experiments on plates, by oxygen consumption measurements (Schauer
1988), or by measuring CO 2 generation using labeled substrates (Sokolov et al.
1981; Davidov et al. 1982). The oxidation of phenylalkanes occurred mainly via
phenylalkanols and phenylalkanoic acids, and after ,B-oxidation finally resulting in
phenylacetic acid for even-numbered and benzoic acids for odd-numbered alkyl
chains, respectively. No products of a-oxidation (phenylpropionic acid or
cinnamic acid) were detected (Schauer 1988). These compounds were accumulated
and excreted into the medium, although their slow further oxidation by alkane-
grown cells was observed when supplied at low concentrations «0.06%).
Additionally, they showed inhibitory effects on growth and respiration of C.
maltosa (Schauer 1988; Huth et al. 1990b).
The primary oxidation of the alkyl chain is presumed to occur by the same
enzyme systems as shown for alkane or fatty acids (see Sect. 2.5). This is supported
by the facts that alkanes and phenylalkanes were utilized by C. maltosa simulta-
neously, that phenylalkanes, especially octyl-benzene, were strong inducers for
P450 in C. maltosa (Mauersberger 1985, and unpubl. results), and their utilization
was inhibited by low concentration of CO in the medium (Schunck et al. 1987a).
Additionally, some short-chain I-phenylalkan-l-ols were good substrates for the
alkane-induced fatty alcohol oxidase activity in C. maltosa (Mauersberger et al.
1992b).
Assimilation of Phenols. Candida maltosa, like several other n-alkane assimilating

yeasts (c. albicans, C. tropicalis, P. guilliermondii, Y. lipolytica, for review see
Neujahr 1990), is capable of using phenol as a source of carbon and energy

(Hofmann and Kruger 1985; Hofmann and Vogt 1987,1988; Gomi and Horiguchi
1988; Hofmann and Schauer 1988; Polnisch et al. 1992). Interestingly, there is good
correlation between the alkane and phenol utilization phenotypes among a
group of yeasts with ascomycetous cell wall structure. Especially all n-octane-
utilizing yeasts of this group also assimilate phenol. Furthermore, it could be
shown that the phenotypes hydrocarbon and phenol utilization are strongly corre-
lated with the coenzyme Q9 structure (COQ9) of these yeasts (Hofmann and
Schauer 1988).
Yeasts assimilate phenol and other phenolic compounds (resorcinol, catechol,
quinol, hydroxyquinol) via the fJ-ketoadipate pathway. As studied in detail for
Trichosporon cutaneum and C. tropicalis (Krug et al. 1985; Krug and Straube 1986;
Neujahr 1990; Kalin et al. 1992), the initial step in the assimilation of phenol is
catalyzed by a phenol hydroxylase (EC 1.14.13.7) leading to catechol. Catechol is
then further converted by an intradiol cleavage (ortho-fission) to cis,cis-muconate
using the enzyme catechol-l,2-dioxygenase (or pyrocatechase, EC 1.13.1.1). The
muconic acid is converted by means of lactonizing, isomerizing, and hydrolytic
enzymes to f3-ketoadipate. A coenzyme A derivative of f3-ketoadipate undergoes
thiolytic cleavage to acetyl-CoA and succinate, used in the central metabolism of
the cell.
The inducible enzymes of the f3-ketoadipate pathway have been found also in C.
maltosa when growing on phenol (up to 0.1 %) or catechol. Whereas the phenol
hydroxylase of C. maltosa (strain L4) has been characterized only in cell-free
extracts so far (Hofmann and Kruger 1985; Polnisch et al. 1992), the catechol-l,2-
dioxygenase was purified and characterized (dimer of 33 kDa subunits) from
catechol-grown C. maltosa ATCC 20184 cells, a strain useful for muconic acid
production from catechol in a bioprocess (Gomi and Horiguchi 1988; Table 4).
These first enzymes of the pathway, phenol hydroxylase and catechol-l,2-
dioxygenase, are strongly regulated by the carbon source present in the medium.
No activites were found in cells grown on glucose, glycerol, succinate, or
hexadecane. Glucose repressed the induction of both enzymes by phenol, suggest-
ing that the phenol metabolism in C. maltosa is controlled by induction-repression
of these enzymes rather than by derepression-repression (Hofmann and Kruger
1985; Hofmann and Vogt 1987, 1988; Gomi and Horiguchi 1988). The phenol
hydroxylase in preinduced C. maltosa cells is obviously regulated by a strong
catabolite inactivation under conditions of carbon and energy excess (Hofmann
and Kruger 1985). In carbon-limited (chemostat) cultures, C. maltosa assimilated
phenol besides glucose (Hofmann and Vogt 1987), as was shown also for
hexadecane in combination with sucrose, formate, or isopropanol (Heinritz et al.
1982; Muller and Babel 1988, 1989). Interestingly, Hofmann and Vogt (1988) later
described a delayed degradation of phenol by C. maltosa L4 in comparison with C.
tropicalis or Trichosporon cutaneum in the presence ofhexadecane, obviously due
to repression of the synthesis of phenol hydroxylase and catechol-l,2-dioxygenase.
This is the first report on a metabolic repression by n-alkanes, which were de-
graded before phenol. The delayed phenol degradation could be connected with
changes of the phenol uptake caused by the adaptation of the yeast cell to n-alkane
as carbon source.
For the yeasts C. tropicalis and C. maltosa, the observed oxidation rates of
phenol (0.5g1l in 5 to 10h) in fermenter systems are under the same conditions
significantly higher than observed for the T. cutaneum (80 to 85 h, Hofmann and
Vogt 1988), a strain mostly discussed besides bacteria for the application in bio-
logical phenol degradation processes (Prave et al. 1982).
Phenol-assimilating C. maltosa cells are able to degrade 2-, 3- or 4-
monochlorophenols (Polnisch et al. 1992), which have been classified as priority
pollutants, but cannot grow on these substrates as sole carbon source, as was
earlier demonstrated for phenol-grown Rhodotorula glutinis, C. tropicalis, and T.
cutaneum (Hasegawa et al. 1990; Neujahr 1990). Especially 3- and 4-chlorophenols
were broken down very rapidly by phenol-grown C. maltosa cells under formation
of several oxidation products (of the ortho-fission pathway of phenol degradation,
chlorocatechols and chloropyrogallos, and 4-carboxymethylenebut-2-en-4-olide)
with concomitant release of chloride, providing the first evidence of
dehalogenation activity in yeasts. However 2-chlorophenol was only partially con-
verted into cis, cis-2-chloromuconic acid (Polnisch et al. 1992).
Cooxidation of Polycyclic Aromatic Hydrocarbons. The fate of polycyclic aromatic

hydrocarbons (P AH) has received attention since benzo{ a)pyrene and similar
compounds were shown to be toxic, carcinogenic, andlor mutagenic. The yeast C.
maltosa, like other alkane-assimilating species (c. tropicalis, Y. lipolytica, C.
guilliermondii), is not able to utilize most PAH as the sole sources of carbon and
energy, but is able to cooxidize such PAH as naphthalene, biphenyl, and
benzo{a)pyrene by means of the monooxygenase pathway (Crow et al. 1980;
Cerniglia and Crow 1981). This pathway is characteristic for eukaryotic microor-
ganisms (fungi and yeast) and higher eukaryotes, and results in the transformation
of aromatic hydrocarbons (benzene) and PAH into hydrophobic (primary hy-
droxylated products) and more hydrophilic compounds (formed after glucuronide
and sulfate conjugation at the primary appearing hydroxy groups), contrary to the
dioxygenase pathway present in several genera of bacteria such as Pseudomonas,
where the PAH are oxidized into cis-dihydrodiol and catechol forms, which
are further metabolized to ring cleavage products, and utilized as carbon sources
for growth of the bacteria (Cerniglia 1981). In the eukaryotic monooxygenase
pathway, the aromatic hydrocarbons are oxidized to reactive arene oxides that
can isomerize to phenols or undergo enzymatic hydration to yield trans-
dihydrodiols. In the case of naphthalene as substrate, I-naphthol (the major me-
tabolite), 2-naphthol, 4-hydroxy-1-tetralone, and trans-1,2-dihydroxy-1,2
dihydronaphthalene were detected as products with the yeasts C. maltosa and C.
lipolytica (Cerniglia and Crow 1981).
The cooxidation pathway of PAH in yeasts is obviously not directly connected
with the alkane-induced cytochrome P450-dependent monooxygenase systems of
these yeasts, because C. utilis and S. cerevisiae, yeasts not able to grow on alkanes,
also transform naphthalene into I-naphthol and other oxidation products
12. Candida maltosa 447
(Hofmann 1986a,b). Therefore, fungi and yeast oxidize PAH via cytochrome P450
monooxygenase systems, which are expressed even in the absence of alkanes, and
are different from their alkane-inducible hydroxylase systems.
Fatty Acid, Acetate, and Ethanol Metabolism
The metabolism of fatty acids, dicarboxylic acids, acetate, and ethanol in C.

maltosa results in the formation of acetyl-CoA, further utilized in the glyoxylate
cycle, tricarboxylicacid cycle, and gluconeogenesis. The metabolism of these sub-
strates can be regarded mainly as a part of the alkane metabolism (Fig. 3, cf. Sect.
2.5). Some aspects of the ethanol metabolism in C. maltosa were reported in
connection with the thermodynamics of growth (Minkevich et al. 1988; Miiller and
Babel 1988), and with the regulation of glyoxylate cycle and gluconeogenesis
(Polnisch and Hofmann 1989; Hofmann and Polnisch 1990a; see Sect. 2.5).
Ethanol is metabolized without fermentative metabolism in yeasts. It is an
energy excess substrate with ammonium as nitrogen source if a P/O > 1.85 is
realized. Theoretically, a yield of about 0.77 gig can be obtained. In chemostat
cultivation experiments with C. maltosa on ethanol/ammonium, submaximal
growth yields of only 0.61 gig were attained. Addition of formate improved this
value to 0.76g1g, according to the auxiliary substrate concept (Miiller and Babel
1988). In the case of acetate, no excess in energy or reduction equivalents can be
reached, and only if a P/O = 3 is taken into account is a balanced carbonlenergy
ratio approximated for nitrogen source ammonium. Theoretically a growth yield
of about 0.49 gig can be obtained with ammonium as nitrogen source (Muller and
Babel 1988).
2.4.3
Miniaturized Fermenter System for Physiological and Biochemical Studies
Note on Method. The proton extrusion of C. maltosa and other yeast cultures
growing on different nitrogen-free carbon sources in a medium containing
ammonium salts as the only nitrogen source was shown to be an exact and reliable
on-line parameter for the description of biomass production, consumption of the
nitrogen (with an NH/IH+ exchange ratio of exactly 1.0) and carbon sources
quantitatively in fermentation processes (Schunck et al. 1987a,b; Riege et al. 1989;
Huth et al. 1990a,b,c; cf. Sect. 2.4.0. This proton extrusion of a growing yeast in
batch cultures, leading to an acidification of the medium and measured as alkali
consumption required to maintain a constant pH value, was used to develop a
miniaturized fermentation system to describe the growth of yeasts, and the
growth-related substrate consumption (different carbon sources and NH4 as N
source) in batch or fed-batch cultures on-line, and more exactly than by
determining these values with usual off-line methods (dry weight, optical density,
and protein content). The miniaturized fermentation system (working volume
about 90 ml) was applied to study various physiological regulation phenomena in
yeasts like the regulation of growth rate and of cytochrome P450 and other enzyme
contents in C. maltosa and other yeasts (Y. lipolytica, Debaryomyces jormicarius, s.
cerevisiae) by oxygen concentrations in the medium (Schunck et al. 1987a,b;
Mauersberger 1985, and unpubl. results), and to test the potential for utilization of
various substrates as carbon sources for growth of yeasts (Schunck et al. 1987a;
Huth et al. 1990b).
The proton extrusion can be registered in a simple way and with high accuracy
as an on-line parameter in the miniaturized fermentation system (Fig. 2). The
small working volume (50-100ml) permits the description of growth from sub-
strate amounts of 5 to 50 mg quantitatively in fed-batch fermentation processes
(H uth et al. 1990b). Application of the practically inert hydrocarbon phase pristane
(1-2%) was used for testing the growth of yeasts on substrates (short-chain al-
kanes, I-alcohols, aldehydes, fatty acids, and others) exhibiting potential toxic or
inhibitory effects at the yeast culture, or to dissolve solid hydrocarbon substrates
(long-chain alkanes, fatty alcohols, fatty acids, and others) in the pristane phase.
Procedure. The miniaturized fermentation apparatus (shown in principle in Fig. 2)
was especially developed for these experiments and was in the main composed of
simple laboratory equipment. A mantled cylindrical glass vessel (total volume
200mI) served as the fermenter. An oxygen electrode (Clark type) was in-
corporated into this vessel from the side 2 cm above the bottom. The plastic cover
contained drill holes for the pH electrode, the supply of the culture with air (and
other gases like nitrogen or carbon monoxide), NaOH, and HCl to maintain a
constant pH, for addition of substrates as well as for taking samples manually. This
instrumentation was anchored in a piatherm plate, located on the cover, and the
whole structure was fixed to the fermenter vessel by steel springs. A larger drill-
hole in the center of the cover served as an entry for the stirrer, as well as an outlet
for the air stream. The experiments were performed under protected but not sterile
conditions.
Yeast biomass was produced in shaking flasks or in a fermenter before using
the substrates n-alkanes, glycerol, or glucose (Huth et al. 1990a). The yeast biomass
can be used directly from the preculture after dilution with fresh medium (without
yeast extract) or after harvesting the preculture by centrifugation. Approximately
1 to 3 g wet weight biomass was used for short-term substrate utilization experi-
ments, whereas for longer-term cultivation experiments, the starting biomass
was lower. The mineral salt media 1 and 2 (see Sect. 2.3.4) were used in these
experiments and the cultivation conditions were as described (Huth et al. 1990a)
below.
The fermentation conditions were as follows:
• Working volume 90ml at the beginning of the experiments containing maxi-
mally about 3 g yeast wet weight biomass.
• Temperature 32 DC maintained by an ultrathermostat.
• Agitation 1800 rpm, six-blade-stirrer, driven by a laboratory stirrer.
• Aeration through a gas nozzle with 0.2-4 vvm (maximally 25I/h), or streaming
with nitrogen to regulate the p02 of the medium, or with CO to make inhibition
studies for cytochromes P450 or a3"
::J:
a
z'"
stirrer z
o
auto-
pH-statl--~~ burette
4.60
recorder
Fig. 2. Schematic representation of the miniaturized fermentation system used for testing
substrate utilization, inhibition, and regulation experiments with Candida maltosa and
other yeasts. E pH-electrode, and pOz-electrode; 5 Manual substrate supply to and with-
drawal of samples from the fermenter
• pH maintenance up scale at pH 4.6 with 0.1 N NaOH (for substrate utilization test
in short time experiments) or with 0.5 N NaOH (for longer-term experiments)
using an autotitrator (Radiometer, Copenhagen, Denmark) which registers al-
kali consumption over time .
• Substrate supply manually, after reaching carbon limitation, or after supplying a
distinct amount of alkali.
Experimental data obtained with this miniaturized fermentation equipment using

C. maltosa or other yeast strains and hydrocarbons, their primary oxidation prod-
ucts (fatty alcohols, fatty acids), glycerol or carbohydrates as carbon sources have
been published (Mauersberger 1985; Schunck et al. 1987a,b; Blasig et al. 1989;
Riege et al. 1989; Huth et al. 1990a,b,c).
2.5
The Enzymology of the Alkane Catabolic Pathway
and Its Regulation in Candida maltosa
An important characteristic of alkane assimilation by yeasts is the flow of carbon

from alkane substrates to syntheses of all cellular carbohydrates via fatty acids,
which is quite different from the case of conventional substrates like carbohy-
drates. The alkane assimilation by yeasts was found to occur mainly via the
monoterminal and diterminal oxidation pathways (cf. Sect. 2.4.2). It can be divided
into several steps (cf. Fig. 3):
1. Transport of alkanes into the cell (Sect. 2.5.2).
2. Primary oxidation of alkanes to corresponding fatty acids (Sect. 2.5.3).
3. Activation of fatty acids to their CoA esters and subsequent metabolism of fatty
acyl-CoA, degradation to acetyl-CoA and propionyl-CoA (in ,B-oxidation) or
incorporation of fatty-acyl moieties into cellular lipids (Sect. 2.5.4).
4. Synthesis of tricarboxylic acid cycle intermediates from acetyl-CoA via the
glyoxylate cycle (Sect. 2.5.5).
5. Gluconeogenesis and synthesis of polysaccharides (Sects. 2.5.5, 2.6).
6. Synthesis of amino acids, nucleic acids and other constituents, including a
portion of the cellular fatty acids and lipids (Sect. 2.6).
Steps 1 and 2 are the most specific processes of the microbial alkane utilization.
Steps 3 and 4 are as in fatty acid metabolism. Steps 4 and 5 are as in gluconeogenic
substrates such as ethanol and acetate (cf. Sects. 2.5.5 and 2.6), and step 6 is as in
various other carbon sources including carbohydrates (for reviews see Fukui and
Tanaka 1981a; Tanaka and Fukui 1989; Miiller et al. 1991a). This section deals with
an overview on the enzymology and its regulation of the alkane catabolic pathway
in the yeast C. maltosa, with special emphasis on the metabolic function of cyto-
chrome P450 systems and the further enzymes involved in the primary oxidation
of the alkanes to fatty acids and dicarboxylic acids. Some aspects of the intracellu-
lar localization and the subcellular organization of these pathways will be dis-
cussed below in Sect. 3. Especially the further metabolic pathways and the function
of peroxisomes in them have been very intensively investigated in C. tropicalis and
Y. lipolytica (for reviews see Tanaka and Fukui 1989; Barth and Gaillardin, Chap.
10, this Vol.). Therefore some results obtained with these yeast species will also be
discussed shortly here.
2.S.1
Alteration in Yeast Cells During Growth on n-Alkanes
Genetic analysis indicates that the function of more than 80 genes may be required
to bring about the phenotype of alkane assimilation. Among them, at least 26 genes
are linked to alkane uptake and oxidation to fatty acids, as concluded from studies
with y. lipolytica (Bassel and Mortimer 1982, 1985). The development of the alkane
utilization phenotype during transition from glucose to alkane as carbon source
produces alterations and characteristic modifications in the yeast cell both at the
biochemical (this section) and morphological levels (cf. Sect. 3):
• Chemical and structural alterations at the cell surface which are related to hydro-
carbon transport (Osumi et al. 1975a; Meissel et al. 1976; Kiippeli and Fiechter
1976, 1977; Kiippeli et al. 1978, 1984; Dmitriev et al. 1980; Fischer et al. 1982;
Belovet al. 1983; Bode and Kohler 1984 unpubl., Egorenkova and Belov 1984;
Rober and Reuter 1984a,b,c,d; Schauer 1988) .
• Induction of alkane-hydroxylating cytochrome P450(s) and NADPH-cyto-
chrome c (P450) reductase (Mauersberger et al. 1980, 1984; Loper et al. 1985;
Schunck et al. 1987a,b).
12. Candida rnaltosa 451
n-Alkane
Untake
, -YEAST CELL
ENDOPLASMIC RETICULUM -.
n-Alkane II, III, IV Lipid
~a
1-AJi8~OI +..!.- +18
Fatty acid .-!... Acyl.;.coA
,--PEROXISOMF
~ r--MITOCHONDRION_
IV I, III
1-Alkanol
2 t=:~ 6 1
1
202~H20+202
4.
A~h~
Fatty acid 6
5.
~Acyl-CoA
FAXH202
78
~FADH2 ~ Pro,CoA
15
7b lr--NAD+::tG3P ~3P 17 FAD
7c
7d ~NADH+H+ DHAP DHAP'XFADH2
~
~ Pro-CoA !l.. Pro-Car P,..Ca_ "wMCA
Ac-CoA
)--!...MA
• Ac-Car
)~5
Ac·Co~ Ac-CoA
12
I
GA RC Ac;CoA OAA- A ,
11j ,13 Methyl.
-
8~SA... MA TCC iCA citrate
iCA 141, cycle
10 t SA KG
Kj
-r
Fig. 3. The monoterminal n-alkane oxidation and its subcellular localization in yeasts.
Enzymes: la cytochrome P450 alkane monooxygenase, with Ib NADPH-P450 reductase; 2
fatty alcohol oxidase (FAOD); 3 fatty alcohol dehydrogenase (NAD-dependent, FADH); 4
fatty aldehyde dehydrogenase (NAD-dependent, FALDH); 5 acyl-CoA synthetases (Sa ACSI
in ER; 5b ACSII peroxisomal); 6 catalase; 7 f3-oxidation system; 7a fatty acyl-CoA oxidase
(AOX); 7b enoyl-CoA hydratase; 7c 3-hydroxyacyl-CoA dehydrogenase; 7d hydroxyacyl
epimerase; 7e 3-oxoacyl-CoA thiolase; 8 isocitrate lyase (ICL); 9 malate synthase (MS); 10
NADP-isocitrate dehydrogenase; 11 malate dehydrogenase; 12 citrate synthase; 13
aconitase; 14 NAD-isocitrate dehydrogenase; 15 carnitine acetyltransferase (CAT); 16NAD-
glycerol-3-phosphate dehydrogenase; 17 FAD-glycerol-3-phosphate dehydrogenase; 18
glycerol-phosphate acyl transferase; 19 methylcitrate synthase. Abbreviations and sub-
strates: n-Alkanes, l-alkanol fatty alcohol; Aldehyde fatty aldehyde; Fatty acid, Acyl-CoA
fatty acyl-CoA; Ac-CoA acetyl-CoA; Pro-CoA propionyl-CoA; Ac-Car acetyl carnitine; Pra-
Car propionyl carnitine; Car carnitine; GA glyoxylate; iCA isocitrate; CA citrate; MA malate;
OAA oxalacetate; SA succinate; KG a-ketoglutarate; G3P glycerol-3-phosphate; DHAP dihy-
droxyacetone phosphate; MCA methylcitrate; TCC tricarbxylic acid cycle. The Roman num-
bers symbolize other transformations of fatty acids as key intermediates; I elongation of
fatty acids; II desaturation of fatty acids (ER); IIIlipid biosynthesis (ER or mitochondria); IV
co-hydroxylation (P450-dependent), and further diterminal oxidation of the co-hydroxy
fatty acids by FAOD, FADH, and FALDH to dicarboxylic acids, which, after activation by
ACSII, are degraded in the ,6-oxidation (7)
• Induction of fatty alcohol and fatty aldehyde-oxidizing enzymes (Mauersberger
et al. 1984, 1987, 1992b; Krauzova et al. 1986) .
• Increased formation of peroxisomes (Osumi et al. 1975b) and induction of per-

oxisomal /3-oxidation, of the enzymes of glyoxylate cycle, and of gluconeogenesis
(Tanaka et al. 1982; Tanaka and Fukui 1989).
2.5.2
Uptake of n-Alkanes
Microbial n-alkane utilization starts with the uptake of the apolar substrate by the
cell. Despite many efforts, the basic principle of this process has not yet been
identified. Most findings agree with the suggestion that the uptake of n-alkanes by
the yeast cell is a passive process, which is facilitated by special hydrophobic
properties and structures of the yeast cell (for details see Davidova and Rachinskii
1979; Buhler and Schindler 1984; Tanaka and Fukui 1989).
The chemical composition, structure, and biosynthesis of C. maltosa cell wall
components mannan (proteophosphomannan - outer layer) and glucan fibrils
(forming the inner layer together with chitin, mann an, and protein) were inten-
sively studied by several authors (Bos 1975; Hirata and Ishitani 1978; Rademacher
and Reuter 1978; Grimmecke and Reuter 1980, 1981a,b,c,d; Grimmecke et al. 1981;
Fischer and Reuter 1982, Nuske et al. 1982; Belov et al. 1983; Egorenkova and Belov
1984; Rober and Reuter 1984a,b,c,d; Bovina et al. 1986, 1988). The structure of
these cell wall polysaccharides in yeasts is strain- and species-specific, and there-
fore used as taxonomic characteristics using the proton magnetic resonance spec-
troscopy (Hirata and Ishitani 1978; cf. Sect. 1.2).
Significant differences in the chemical composition of the cell wall between
glucose- and alkane-grown cells of C. maltosa were established. The cell wall of
alkane-grown yeast cells is more hydrophobic compared with glucose-grown cells
(Rober and Reuter 1984d; cf. Sects. 2.3.3 and 3). The lipid content in the cell wall of
alkane-grown cells increased twofold (Bos 1975).
The lipopolysaccharides of the cell wall, obviously responsible for adhering
micro emulsions of alkanes (as reported by Kappeli and Fiechter 1976, 1977;
Kappeli et al. 1978, 1984 for C. tropicalis), whose formation is induced by alkanes,
have been isolated and characterized as proteophosphomannan complexes (PPM)
for C. maltosa (for C. tropicalis as fatty acid-proteomannan complexes) containing
covalently linked lipids in form of threonine-bound phosphoacyl-glycerides
(Grimmecke and Reuter 1980; Lerche and Kretzschmar 1980, 1986; Rober and
Reuter 1984d for C. maltosa; Kappeli et al. 1978).
Belov et al. (1983) isolated from the culture liquid of alkane-grown C.
(guilliermondii) maltosa two glycoproteins of 95 and 105 kDa molecular weight
and a fraction of proteo mann an fragments. Immunocytochemically, with ferritin-
labeled antibodies against the two fractions, both proteins were shown to be
localized in the outer part of the cell wall channels only with alkane-grown yeast
cells, whereas the mannan was found distributed diffusely over the cell wall surface
of alkane- and glucose-grown cells. With these antibodies obtained, Davidov and
Belov (pers. comm.) were able to inhibit alkane utilization by this yeast.
Egorenkova and Belov (1984) reported a looser cell wall structure of alkane cells
compared with glucose cells, containing more high molecular mannan.
The regulation phenomena of the biosynthesis of the cell wall components were
studied by Rober and Reuter (1984a,b,c, 1985) and Rober et al. (1984a,b) in the
strain C. maltosa H. Cell wall hydrophobicity is obviously regulated by changes in
the proteophosphomannan complexes, especially by a decrease in the saccharide-
phosphates (Grimmecke and Reuter 1981a,b,c; Grimmecke et al. 1981) and an
increase in the threonyl-phosphoglyceride components (Grimmecke and Reuter
1980) in alkane-, ethanol- or acetate-grown cells (Rober and Reuter 1984d).
Interestingly, the hydrophobicity of the C. maltosa cell wall is already increased
after consumption of the glucose or in resting cells, probably connected with the
derepression of the gluconeogenesis and the glyoxylate cycle (Rober and Reuter
1984d; Schauer 1988).
These chemical alterations of the cell wall are obviously related to hydrocarbon
transport, and closely connected with peculiarities and rearrangements of the cell
wall structures (such as formation of special channels, accompanied by slime-like
outgrowths or also called protrusions on the cell surface, increased plasma mem-
brane invaginations and membrane vesicles) discussed in detail in Sect. 3. The
slime-like outgrowths reach the cell membrane through the electron-dense chan-
nels, and endoplasmic reticulum (ER) is arranged regularly beneath each channel.
This observation has led to the hypothesis that alkanes attached to the protrusions
or hydrophobic outgrowths may migrate through the channels via plasma mem-
brane to the ER, the site of alkane hydroxylation by cytochrome P450 mono-
oxygenase systems (Tanaka and Fukui 1989; cf. Sects. 2.5.3 and 3.4).
The role of mainly neutral lipids containing membrane vesicles (lipid granules,
lipid vacuoles, or lipid inclusions) in the alkane transport from the plasma mem-
brane to the ER or in the intracellular lipid transport was often discussed
(Kasanzev et al. 1975; Belov et al. 1976; Davidova et al. 1977a,b; Davidova and
Rachinskii 1979; Davidova et al. 1979), but there is still a lack of clear evidence for
their transport function of n-alkanes.
2.5.3
The Enzymes of Primary Alkane Oxidation to Fatty Acids
and Their Regulation in Candida ma/tosa
The enzymology of the alkane degradation pathway in yeasts and its regulation by
external factors like carbon source and oxygen concentration in the medium were
intensively studied in connection with the application of Candida and Yarrowia
lipolytica strains for production of SCP and of useful oxidation products (cf. Sects.
1, 2.4, and 6).
The Role of Cytochrome P4S0 and Fatty Alcohol Oxidase

in Alkane Oxidation
The enzymes catalyzing the first steps of the n-alkane assimilation in C. maltosa up
to the fatty acid have been identified and characterized.
Cytochrome P450 Dependent Alkane Monooxygenase Systems. As already
mentioned, the first enzymatic step of hydrocarbon assimilation by yeasts is the
terminal hydroxylation of the n-alkane by a cytochrome P450 enzyme system (Fig.
3) leading to the fatty alcohol as the first intermediate of alkane catabolism. The
enzyme system is ER membrane-bound and consists of a NADPH-cytochrome
P450 reductase transferring electrons, and a cytochrome P450 acting as
hydroxylase in a typical monooxygenase reaction. Both enzymes (P450Cml in this
case) were first obtained in a highly purified state from alkane-grown C. maltosa
EH15 (Riege et al. 1981; Honeck et al. 1982; Schunck et al. 1983a,b), and later
from other C. maltosa strains (Avetisova et al. 1985; Sokolov et al. 1986a,b; Takagi
et al. 1989; Mauersberger et al. 1992a; cf. Table 4). Successful reconstitution
experiments with the highly purified enzymes (Honeck et al. 1982; Schunck et al.
1983a,b; Mauersberger et al. 1992a) and the selective inhibition by carbon
monoxide of the first step of alkane degradation under in vivo conditions
(Schunck et al. 1987a,b) provided strong evidence that the initiating reaction is
catalyzed by cytochrome P450. A second P450 system is involved in the co-
hydroxylation of fatty acids as the first step of the diterminal oxidation pathway
occurring in yeast during alkane degradation (Fig. 3). This P450Cm2 protein
has been characterized only after cDNA cloning and heterologous expression in
S. cerevisiae (Schunck et al. 1991), which is the general approach for the
characterization of individual P450 forms from C. maltosa (Schunck et al. 1991;
Scheller et al. 1992, 1994, 1996; Zimmer et al. 1995). Additionally, Mauersberger et
al. (1992a) purified a third P450Cm3, additionally to the P450Cml, from
decane-grown C. maltosa VSB779 (Table 4) with activities towards both substrate
classes (alkanes and fatty acids). Today, eight alkane-inducible cytochrome
P450 genes are known in C. maltosa (Ohkuma et al. 1995a). Their functions
are currently under investigation (Zimmer and Schunck 1995; Zimmer et al. 1995;
see also Sect. 4.4.2 for their characteristics and molecular biology data).
Fatty Alcohol Oxidase (FAOD) and Fatty Aldehyde Dehydrogenase (FADH). The next
step in the alkane catabolic pathway, the oxidation of the n-alkan-l-ol to the
corresponding fatty aldehyde (Fig. 3), is catalyzed mainly by a FAOD enzyme
instead of a NAD(P}-dependent dehydrogenase (FADH) activity, as assumed
earlier in the literature (see Mauersberger et al. 1987, 1992b). Since the middle of
the 1980s, a growing body of evidence has indicated that molecular oxygen instead
of NAD is the essential electron acceptor of fatty alcohol oxidation and that
simultaneously H 20 2 arises. Consequently, the enzyme responsible for fatty
alcohol oxidation is a H2 0 2-forming oxidase (FAOD). Ilchenko and Tsfasman
(1988) have isolated this enzyme from alkane-grown C. famata (formerly
Torulopsis candida). Studies with C. maltosa (Krauzova et al. 1986; Mauersberger
et al. 1987, 1992b; Blasig et al. 1988; Shilova et al. 1989), P. guilliermondii, C.
tropicalis, and Y. lipolytica (for references see Mauersberger et al. 1992b) support
the assumption of a wide distribution of FAODs in alkane-assimilating yeasts. The
alkane-induced FAOD of C. maltosa, obviously localized in peroxisomes (see Sect.
3.4), was characterized in its broad substrate specificity and stereoselectivity
(oxidation of primary and secondary alcohols, 1,m-diols, m-hydroxy fatty acids,

phenylalkanols, and terpene alcohols, see also below) in the membrane-bound
state (Mauersberger et al. 1992b) and after purification (Sokolov and
Mauersberger, unpubl. results; Table 4).
Fatty Aldehyde Dehydrogenase (FALDH). The subsequent step, the oxidation of
fatty aldehydes into fatty acids, was clearly demonstrated as a membrane-bound,
NAD-dependent dehydrogenase (FALDH) reaction by its detection in C. maltosa
(Mauersberger et al. 1984, 1987; Krauzova et al. 1986) and other yeasts, and finally
by its purficiation from C. (T. candida) tamata (Ilchenko and Tsfasman 1987).
Besides the inducible membrane-bound FAOD and FALDH activities, there
exist also cytosolic NAD- or NADP-dependent alcohol and aldehyde dehydrogena-
ses (FADH and FALDH) in alkane-assimilating yeasts. For C. maltosa, two such
soluble FADH activities have been demonstrated (Sharyshev 1989, unpubl. results;
Mauersberger et al. 1992b). Therefore, the conclusion that only oxidase-type en-
zymes are involved in fatty alcohol oxidation in yeast should be considered with
caution. Additionally, there are hints for the presence of different FAOD activities
in Y. lipolytica (Ilchenko et al. 1994).
Regulation of Enzymes Oxidizing Alkanes to Fatty Acids
The formation of the alkane-induced P450 system, FAOD and FALDH in C.

maltosa cells was investigated under the influence of such extracellular factors as
carbon source and oxygen due to their key position as the rate-limiting step in the
alkane oxidation by yeast cells (Mauersberger et al. 1980; Schunck et al. 1987a,b),
especially under the oxygen limitation conditions often occurring in the industrial
SCP fermentation processes (Riege et al. 1989).
Regulation of Cytochrome P450 Biosynthesis in C. maltosa. As outlined above and in
Sect. 4.2.2. (see also Fig. 6), multiple alkane-inducible P450 forms may occur in C.
maltosa which differ in physiological functions and regulation of expression.
Therefore, the unequivocal identification of the induced P450 form(s) and the
availability of specific probes have become the most crucial points of regulation
studies. Based on recent progress in DNA cloning, first details have been reported
concerning regulation mechanisms of alkane-inducible P450 forms of C. maltosa
(Ohkuma et al. 1995a; cf. Sect. 4.4.2), C. tropicalis (Seghezzi et al. 1991, 1992) and
of the lanosterol 14a-demethylating P450 in yeast (see Muller et al. 1991a).
On the other hand, a number of earlier studies cannot be clearly interpreted
with respect to the P450 form{s) actually occurring under the applied cultivation
conditions. However, they will be included in this chapter because they might
stimulate future experiments to elucidate the regulation of individual P450 forms
in yeasts.
Induction by Long-Chain n-Alkanes. Following the initial reports in the 1970s for C.
tropicalis, induction of P450 by long-chain n-alkanes has been reported for a large
number of yeast species being able to utilize these unconventional substrates
(reviewed by Muller et al. 1991a). Various compounds having chemical structures
Table s. Regulation of the enzyme content in Candida maltosa by the carbon source and by
the oxygen concentration in the medium. Content of some constituents in the cell free
extract (S3) obtained from spheroplasts of C. maltosa cells harvested from the exponential
growth phase of batch cultures on the carbon sources glucose (1.5%, in shaking flasks),
glycerol (3%), and n-alkanes (Parex 3%, in a fermenter) under oxygen non-limited (1.2 vvm
air supply) and oxygen limited conditions (0.2 vvm air supply, for details see Mauersberger
et al. 1984; Mauersberger 1985)
Constituent Glucose Glycerol Alkanes, Alkanes,

content or (n=2) (n=3) oxygen not oxygen
activity limited limited
(n=6) (n = 3)
Cytochrome P450 0' 10 62 156b

NADPH-cyt c reductase 61 67 213 239
AHA 10 30 95< 52<
Cytochrome b s 46 101 108 141
NADH-cyt c reductase 52 81 61 78
FAOD 3 20 98 96
FADH 38 56 268 307
FALDH 46 167 290 256
Catalase 76 280 597 1201
Isocitrate lyase 10 n.d. d 190 n.d.
Cytochrome (a + a3) 109 48 58 146
Cytochrome oxidase 261 105 135 374
Protoheme 905 439 594 1127
Values are means of indicated (n) preparations; cytochrome and heme content: pmollmg
protein; enzyme activities: nmollmin x mg protein (mU/mg), excepting catalase activity-
mU x 10- 3 and AHA with hexadecane as substrate - pmollmin x mg protein.
Abbreviations: AHA - Alkane hydroxylase activity determined with '4C-C16
FAOD - Fatty alcohol oxidase, determined with I-decanol
FADH - Fatty alcohol dehydrogenase, NAD+ dependent, with I-decanol
FALDH - Fatty aldehyde dehydrogenase, NAD+ dependent, with tridecanol.
• Small amounts ofP450 were detected in glucose-grown cells by RIA (3 pmollmg microsom-
al protein), Kargel et al. (1984, 1985), Schunck et al. (1987b).
bValues up to 250 pmollmg protein during long-term oxygen limitation on alkanes (hexade-
cane or tetradecane), Schunck et al. (1987b).
<Values are not representative due to different residual alkane content in the cell extracts.
dn.d. - not determined.
related to n-alkanes were found to induce the formation of P450 and its
corresponding NADPH-P450 reductase in C. maltosa (Table 5; Mauersberger and
Matyashova 1980; Ilchenko et al. 1980; Mauersberger et al. 1980, 1981;
Mauersberger 1985; Schunck et al. 1987b). Among these, long-chain n-alkanes
(C 12-C 14), alkenes, and some phenyl alkanes turned out to be the most potent
inducers. A remarkable induction effect has been also described for long-chain
secondary alcohols. A three to four times lower P450 content was detected in fatty
alcohol- and fatty acid-grown cells when compared with the values reached during
cultivation on n-alkanes, which has now been verified by Northern blot analysis
for the expression of the individual P450 genes ALKl to ALK7 (Ohkuma et al.
1995a). The expression of these individual P450 genes of the CYP52 family is
differently induced using the substrates alkanes, alkanols, alkanals, or fatty acids.
Nevertheless, the spectral P450 content of alkane-grown cells can be almost
completely attributed to P450 forms involved in terminal alkane and fatty acid
hydroxylation. However, the possibility that several other alkane-inducible P450
forms with unknown substrate specificities exist has to be considered (see Sect. 4).
Tetradecane- and hexadecane-mediated P450 induction can be almost com-
pletely repressed by the simultaneous addition of glucose (above 0.5%) to the
culture medium (Takagi et al. 1980a,b; Mauersberger et al. 1981). Interestingly,
induction of P450 in C. maltosa and Y. lipolytica by hexadecane was more sensitive
to glucose repression than the induction by decane, which could be a result of the
presence of differently regulated P450 genes in these yeasts (Mauersberger 1991).
Glycerol and galactose were found to be no or less repressive substrates (Table 5;
Mauersberger et al. 1981; Mauersberger 1985).
Alkane-mediated P450 induction requires protein and lipid de novo synthesis,
as suggested by inhibition with cycloheximide and cerulenin (Takagi et al. 1980;
Mauersberger et al. 1981). Using a radioimmunoassay based on antibodies against
the highly purified alkane hydroxylating P450Cm1, Kiirgel et al. (1984) demon-
strated that micro somes of alkane-grown C. maltosa cells have a 100-300-fold
higher specific content of the corresponding protein than detectable after cultiva-
tion on glucose (Table 5). The relative amounts ofP450-specific mRNA were found
to parallel the changes in the spectrally and immunologically determined P450
content (Wiedmann et al. 1986). These results indicate that the formation of the
alkane-inducible P450 forms is mainly regulated at the transcriptional level. Cells
cultivated on glucose and n-alkanes can be considered to represent the repressed
and induced state, respectively. Glycerol-grown cells may represent a derepressed
state. Microsomes isolated from glycerol-grown C. maltosa cells are active in
alkane hydroxylation and contain significant amounts ofP450 (Mauersberger et al.
1984), which is immunologically indistinguishable from that of alkane-grown cells
(Kiirgel et al. 1984; Schunck et al. 1987b). Moreover, the occurrence ofP450 during
cultivation on glucose upon transition to the stationary phase may indicate dere-
pression of alkane-inducible P450 forms and/or induction by fatty acids due to
activation of lipid turnover (Ilchenko et al. 1980).
During batch cultivation of C. maltosa on n-hexadecane, P450 formation and
growth curve correlate in a characteristic manner (Mauersberger and Matyashova
1980). The cellular P450 content is strongly increased in the lag phase of growth
upon transition from glucose to n-alkane utilization, reaches a nearly constant
level in the exponential phase, and declines rapidly after consumption of the
carbon source in the stationary phase. The time course of P450 induction in C.
maltosa growing on n-decane revealed two steps, a first maximum in the middle of
the exponential phase of growth, and the higher second maximum in the station-
ary phase (Avetisova et al. 1985, 1990; Sokolov et al. 1986a,b). It was supposed that
the high P450 content found in the stationary phase on decane may be a result of
the induction of more than one P450 form. This was demonstrated finally by
purification of the P450Cm3 besides P450Cml from decane-grown cells
(Mauersberger et al. 1992a).
Influence of Oxygen on Alkane-Mediated P450 Expression. In particular, under

oxygen limitation conditions, P450-catalyzed alkane hydroxylation appears to
represent the rate-limiting step of the whole pathway (Schunck et al. 1987a). In
fact, significant differences were found in the p02 dependence of utilization rates
of n-alkanes, fatty alcohols, fatty acids, and glucose. It was concluded that the P450
system is distinguished by the lowest oxygen affinity among the O2 activating
enzymes involved in alkane assimilation (Schunck et al. 1987a). As studied in
detail with C. maltosa (Table 5; Mauersberger et al. 1980, 1984; Schunck et al.
1987b; Ilchenko et al. 1989, 1991) and with other yeasts (c. tropicalis,
Debaryomyces formicarius, Y. lipolytica, Mauersberger et al. 1991; see also Miiller
et al. 199Ia), the cellular P450 content is strongly increased by transition to
oxygen-limited growth during cultivation on long-chain n-alkanes. Enhanced
P450 formation was also observed maintaining oxygen saturation but inhibiting
more selectively the alkane hydroxylation reaction by introducing low
concentrations of carbon monoxide into the culture medium (Mauersberger 1985;
Schunck et al. 1987a,b). However, this effect did not occur when, instead of n-
alkanes, fatty alcohols were used as the carbon source. In conclusion, enhanced
P450 formation appears to depend on two factors, a decrease in the enzymatic
activity of the alkane-hydroxylating P450 system (02-deficiency or CO inhibition)
and the presence of n-alkanes, which act both as substrate and as inducer of P450.
The most simply interpretation of these findings may be that the P450 formation is
mainly regulated by the intracellular inducer concentration which depends on the
relative rates of alkane transport into the cell and the actual alkane hydroxylating
activity of the enzyme system (Schunck et al. 1987b). According to this, oxygen
limitation results in enhanced substrate induction by inducer accumulation.
Immunological studies revealed that it is indeed the alkane hydroxylating P450
which increases during oxygen limitation (Schunck et al. 1987b). In fact,
Wiedmann et al. (I988a) found a parallel increase of the P450 encoding mRNA.
However, to qualify the simple scheme of inducer accumulation, it must be
considered that oxygen limitation does not only affect the synthesis of the alkane-
inducible P450. Moreover, in different degrees, catalase, cytochrome oxidase, cyto-
chrome c peroxidase, and other hemoproteins respond to oxygen limitation (Table
5; Mauersberger et al. 1984; Ilchenko et al. 1989, 1991). Therefore, it may be
assumed that derepression of heme biosynthesis plays an important role. It re-
mains for further studies on promoter functions to distinguish between enhanced
substrate induction, heme control, and the not completely excluded possibility of
a more direct oxygen effect, shown for other yeast proteins like catalase, as dis-
cussed by Miiller et al. (I99la,b).
All our results indicate that the main conclusions about the physiological func-
tion and the regulation of alkane-induced P450 forms of C. maltosa also apply to
other yeast species like C. tropicalis, Debaryomyces formicarius, and Y. lipolytica
(Mauersberger et al. 1991).
Regulation of the FAOD and FALDH in C. maltosa. Like the alkane-hydroxylating

P450 system, the two other enzymes, membrane-bound FAOD and FALDH,
involved in the oxidation of hydrocarbons to the corresponding fatty acids were
also induced by growth of C. maltosa on n-alkanes in comparison with the carbon
source glycerol (Table 5; Mauersberger et al. 1984, 1992a; Shilova et al. 1989). All
these enzymes were found to be repressed significantly using glucose as growth
substrate, although to a different degree. The regulation of the cytosolic FADH or
ADH activities present in C. maltosa (Sharyshev 1991, unpubl.; Mauersberger et al.
1992b) remains to be clarified.
In contrast to the alkane-induced P450, the content of these two enzymes
was not significantly influenced by oxygen limitation of the cells (Table 5). A
further increase in FAOD activity during prolonged strict oxygen-limited growth
on alkanes was also observed, although this oxygen-mediated effect was not so
strong as seen in P450 (Shilova et al. 1989; Mauersberger et al. 1992b).
Spectral Determination of P450 in Whole Yeast Cells

Spectral determination of P450 using the CO-difference spectrum can be per-
formed using whole cells. This method has been widely used to characterize P450
formation in yeast cells under the influence of such extracellular factors as carbon
source and oxygen. Dithionite-reduced CO-difference spectra yield a reliable
quantitation of the total P450 content, provided that there is no severe spectral
interference with mitochondrial cytochrome a3• To avoid this problem, a simple
method was found to improve the estimation of low P450 content in whole cells
(Sharyshev et al. 1983; Schunck et al. 1987b; Ilchenko et al. 1989). It involves
omitting dithionite and adding antimycin A, potassium cyanide (1-2mM in the
assay), or oxidizing the cells in advance by streaming with air, to avoid interference
with cytochrome a3 by blocking its reduction. This modified method was success-
fully applied to detect small amounts of P450 in whole cells of C. maltosa (Schunck
et al. 1987b) and other yeasts like S. cerevisiae (Yekhvalova et al. 1989) and Y.
lipolytica, where the interference problem is more striking due to higher cyto-
chrome oxidase content (Mauersberger 1991; Mauersberger et al. 1991). The cyto-
chrome P450 content can be calculated from CO-difference spectra using an
extinction coefficient of 91mM- I x cm-I • It should be mentioned that by this
method it is not possible to discriminate between different forms of cytochrome
P450 with different substrate specificities or between enzymatically active and
inactive, but spectral detectable forms of cytochromes P450.
Induction of P450 in yeasts by Different Hydrophobic Compounds

The induction experiments can be performed as described by Mauersberger et al.
(1981) in shaking flasks or in a (miniaturized) fermenter by incubating glucose-
pre cultured yeast cells (0.5-1 g wet weight cells) for at least 4 h at 30°C in 100 ml
mineral salt medium containing 0.05% (w/v) yeast extract and the hydrophobic
compound to be tested (like 0.5% v/v decane or hexadecane) or no carbon source
as control (Mauersberger and Matyashova 1980; Mauersberger et al. 1980, 1981;
Takagi et al. 1980a; Mauersberger 1991). Glycerol and galactose as nonrepressive

substrates are suitable substrates when the induction potential of nondegradable
hydrocarbons is to be tested for P450 induction (Mauersberger et al. 1981;
Mauersberger 1985).
Heterologous Expression of P450 Genes of Candida ma/tosa

in Saccharomyces cerevisiae
To test the function of individual alkane-inducible P450 forms of C. maltosa, their
heterologous expression in S. cerevisiae under the control of the GALl 0 promoter
using the vector YEp51 (Schunck et al. 1991; Scheller et al. 1994; Zimmer and
Schunck 1995; Zimmer et al. 1995), or in C. maltosa under control of the homolo-
gous GALlO promoter (Ohkuma et al. 1995b) was performed. For expression of the
authentic P450 forms in S. cerevisiae, recombinant PCR was used to exchange the
CTG co dons in the genes or cDNAs of cytochrome P450s by the triplet TCT
(Zimmer and Schunck 1995, see also Sect. 4.4.3). Both the unchanged and modified
cDNAs were ligated into the SalI/BamHI sites of the expression vector YEp51. The
recipient strain S. cerevisiae GRF18 (leu2 his3) was transformed according to
Keszenman-Pereyra and Hieda (1988) and cultivated in yeast minimal medium
(0.67% YNB without amino acids), 50mgll L-histidine, and 2% raffinose as the
carbon source to a cell density of 0.7-1.0 x 108 cells/mI. P450 induction was
performed by adding 2% galactose to the cultivation medium. The amount ofP450
expressed was determined by CO-difference spectra with whole cells or with cell-
free extracts. The P450 expression is maximal after 8 to 15 h cultivation in the
presence of galactose.
Purification of Proteins from Candida ma/tosa

A number of proteins from C. maltosa have been purified and characterized (see
Table 4). Among them, interest was mostly concentrated on enzymes systems
(P450 systems and FAOD) involved in the oxidation of n-alkanes to the corre-
sponding primary oxidation products fatty alcohols and fatty acids, obtained from
alkane-grown C. maltosa (Riege et al. 1981; Honeck et al. 1982; Schunck et al.
1983a,b; Sokolov et al. 1986a,b; Takagi et al. 1989; Mauersberger et al. 1992a,b).
Furthermore, a complex method for the simultaneous large-scale purification of
P450s, NADPH-P450 reductase, cytochrome bs' and FAOD from decane-grown C.
maltosa VSB779 by ultrafiltration, phase partition, and one-step chromatography
was developed, and superoxide dismutase, epoxide hydrase and catalase were
purified from this strain (Avetisova 1991; Avetisova and Davidov 1993; Avetisova
et al. 1993).
Additionally, P450Cml (P450 52A3, or its modified variant), P450Cm2 (P450
52A4), and the NADPH-P450 reductase of C. maltosa have also been purified after
high-level heterologous expression of their genes in S. cerevisiae (Scheller et al.
1992, 1994, 1996; Kargel et al. 1996; Schunck et al. 1996).
Purification ofCytochromes P450 from C. maltosa Grown on n-Alkanes. Isolation of
P450 was mostly started from cells cultivated on n-alkanes under strong oxygen
limitation, thus strongly increasing the specific content of alkane-induced P4S0 in

the biomass by the factor 4 to 6 (Mauersberger et al. 1980, 1981, 1984; Schunck et
al. 1987a,b). Up to now, only the P4S0Cml (P450 52A3) and Cm3 (P4S0 52A5) have
been purified from different strains of C. maltosa. P450Cml was first isolated and
characterized from C. maltosa EH1S grown on an n-alkane mixture from Cll to CI9
(Parex) under oxygen limitation (Riege et al. 1981; Schunck et al. 1983a,b). Similar
results were obtained later by Takagi et al. (1989) for the purification of the
P4S0AlkI (P450 52A3) protein from the strain IAM12247 grown on tetradecane.
From C. maltosa VSB779 grown on decane under strong oxygen limitation, both
P450Cml and P450Cm3 were isolated by a modified method (Avetisova 1991;
Mauersberger et al. 1992a) using chromatography on octyl-Sepharose.
Purification of NADPH-Cytochrome P-450 Reductase. A modified method according

to Honeck et al. (1982) is described, which can be applied for the purification of
reductases from C. maltosa and also after its heterologous expression in S.
cerevisiae (Kargel et al. 1996; Scheller et al. 1996). The reductase purified by this
method is active in reconstitution experiments with homologous yeast and
heterologous mammalian P450s (Shkumatov 1993; Scheller et al. 1994, 1996),
respectively.
Procedure
1. Microsomal membrane fractions containing the NADPH-cytochrome P450
reductase were prepared from the yeast C. maltosa EH15 as described (Riege et
al. 1981; Schunck et al. 1978, 1983a,b).
2. Microsomes (4-5 g of protein) were diluted to a final concentration of 10 mg/ml

in 100mM Tris/HCI buffer, pH 7.7, containing 30% glycerol, ImM EDTA, ImM
DTT, 0.5mM PMSF, and 5f.1M FAD/FMN. A solution of 10% (w/v) CHAPS was
added to give a final concentration of 1.5% (w/v).
3. After stirring for 30 min at 4°C, the solubilized microsomes were centrifuged at
75000 g for 60 min.
4. The supernatant was diluted to a protein concentration of 3 mg/ml with 25 mM
potassium phosphate buffer, pH 7.7, containing 0.3% Prawozell WON-I00,
0.1% sodium cholate, O.lmM EDTA, O.lmM DTT, O.5mM PMSF, If.1M FAD/
FMN (buffer B), and applied to a DEAE-Toyopearl 650 column (1 x IOcm)
previously equilibrated with buffer B.
S. Ion-exchange chromatography and the following purification step on hydroxy-
lapatite were carried out as described by Honeck et al. (1982), with the excep-
tion that Prawozell WON-100 was omitted from the equilibration and elution
buffers for chromatography on hydroxylapatite.
6. Finally, the NADPH-cytochrome P450 reductase was purified by affinity chro-
matography on 2,5-ADP-Sepharose. Conditions used for loading, washing, and
elution of the affinity resin were identical to those described by Ardies et al.
(1987), with the exception that CHAPS, Lubrol PX and BHT were omitted from
all buffers.
The estimated NADPH -cytochrome P450 reductase activity of the preparation was
68.2,umol cytochrome c reduced/min x mg protein when assayed at 25°C in 50 mM
Tris/HCI buffer, pH 7.7, 0.05mM cyt c, 3.3mM KCN, O.lmM NADPH, using an
extinction coefficient of 21 mM- I x cm-I at 550 nm. The reductase prepared by this
method was free of other constituents of the microsomal electron transfer systems,
e.g., P450, cytochrome bs, and NADH-cytochrome bs reductase. A single band in
the SDS-PAGE shows a homogenous protein with an apparent molecular weight of
79kDa (Honeck et al. 1982).
Fatty Alcohol Oxidase and Its Stereoselectivity in 2-Alkanol Oxidation
Note on Method. Fatty alcohol oxidase (FAOD) of C. maltosa can be used to

perform stereoselective oxidation of secondary alcohols to obtain enantiomeric
pure S( t} secondary alcohols. The enzyme is present in a crude membrane fraction
obtained from cells grown on alkanes (Mauersberger et al. 1992b, cf. Sect. 6).
Preparation of the Crude Membrane Fraction. Candida maltosa cells of the late
(linear) growth phase were harvested by centrifugation and the preparation of the
crude membrane fraction after mechanical cell disintegration with glass beads in a
Dyno mill was performed according to earlier publications using the method of
calcium precipitation of membranes at 6000 g or high-speed centrifugation
(100000g, 1 h) from the 6000g supernatant (Riege et al. 1981; Mauersberger et al.
1987) .
.Enzyme Assays. Fatty alcohol oxidase (FAOD) activity was assayed measuring the
substrate-dependent oxygen consumption or hydrogen peroxide formation in
presence of sodium azide to inhibit catalase activity as described earlier in detail
(Mauersberger et al. 1987; Blasig et al. 1988).
The enzyme activity was determined at 30°C under magnetic stirring in 2.5 or 3 mI
100mM Tris-HCI buffer, pH 8.8, in an open chamber equipped with a hydrogen
peroxide electrode or in a closed chamber using an oxygen electrode.
After addition of the FAOD-containing protein sample, the reaction was started
with substrates dissolved in up to 150 jd acetone. The amount of protein sample
added was varied from 0.1 to 1 mg protein for determination of initial rates to up
to 5 mg for determination of total amounts of the cosubstrate oxygen used or
hydrogen peroxide formed during the reaction per substrate concentration added
(measurements of stoichiometry). Saturation of the buffer with air resulted in an
O2 concentration of 240 pM under the conditions used. For H20 2 measurement, the
electrode was calibrated with hydrogen peroxide solutions defined by spectral
determination at 240 nm.
Product Identification. To identify the products of the alkanol oxidation, the
volume of the above-described buffered reaction mixture was increased up to
10 mI, containing 25 to 50 mg protein of the crude membrane fraction.
The reaction was started by adding about lO.umol substrate (1-alkanols or 2-

alkanols) dissolved in 250-500,ul acetone. The incubations were continued until
no further O2 consumption in a parallel 3-ml analytical assay was observed, and
stopped with 5ml 8% H2S04 , Control assays were stopped before addition of
substrates.
Both the stopped reaction and control mixtures were extracted according to the
procedure of Dole and Meinerts (1960). The heptane extracts were analyzed by
TLC and GLC as described by Blasig et al. (1988).
Further analysis of enantiomeric 2-alkanols was carried out by GLC (Hewlett
Packard 5890; isotherm at 125 or 150°C) after derivatization with iso-
propylisocyanate on a 30-m fused silica capillary coated with an XE-60 bonded
tertiary butylvalinamide phase (Konig 1987). Peaks of the racemic mixture could
be resolved to about 80%. However, the reproducibility was measured better than
±2% and the accuracy was estimated better than ±3% in the range of small
amounts of the R( - )-enantiomers.
2.5.4
Fatty Acid Oxidation
The first three steps of n-alkane oxidation up to the fatty acid outlined above (Fig.
3; Sect. 2.5.3) proceed without variation in the chain length. The arising fatty acids
are intermediates with a central position in the metabolism which can be used
directly for the biosynthesis oflipids or for obtaining acetyl-CoA. For lipid biosyn-
thesis, desaturation and elongation or chain shortening of the fatty acids origin at -
ing from n-alkanes are necessary. However, de novo synthesis of fatty acids is
without importance in cells of C. maltosa growing on long-chain n-alkanes (Blasig
et al. 1984, 1989, cf. Sect. 2.4.2).
The enzymology of the further oxidation of the fatty acid was not investigated
in detail for C. maltosa, as had been done for C. tropicalis and Y. lipolytica (for a
review see Tanaka and Fukui 1989). There are some results (cloned gene POX for
the acyl-CoA oxidase, ACO, see Sect. 4.4.2; induced ACO activity in oleic acid-
grown cells, Kamiryo et al. 1989) that allow the assumption that the enzymology
could be comparable with the results obtained for these two yeasts. As shown for
Y. lipolytica, two different acyl-CoA-synthetases (ACSI and II) introduce the fatty
acids into the lipid biosynthesis (normally the minor part) or into the ,B-oxidation
(Mishina et al. 1978). In alkane-utilizing yeasts, f3-oxidation is inducible and exclu-
sively localized in peroxisomes, in contrast to in animal cells, where both mito-
chondrial and peroxisomal f3-oxidation systems exist. In most yeasts and fungi,
f3-oxidation is introduced by a hydrogen peroxide-generating fatty acyl-CoA oxi-
dase converting acyl-CoA to the 2-enoyl-CoA. The following reactions are cata-
lyzed by a trifunctional protein displaying the activities of enoyl-CoA hydratase
and 3-hydroxyacyl-CoA dehydrogenase and of 3-hydroxyacyl-CoA epimerase.
This three-functional protein has been found in all fungi, including S. cerevisiae
(Kunau et al. 1988; Kunau and Hartig 1992). In the final reaction, 3-oxoacyl-CoA is
cleaved by 3-oxoacyl-CoA thiolase to acetyl-CoA and a saturated acyl-CoA having
two carbons less than the original fatty acyl-CoA (for references see Fukui and
Tanaka 1981a,b; Tanaka and Fukui 1989; Miiller et al. 1991a).
Additionally, fatty acids are ro-hydroxylated by alkane-inducible P450 systems
for initiating diterminal oxidation (Fig. 3; Schunck et al. 1991), although this
pathway is not achieved to any remarkable extent in growing cells (Blasig et al.
1984,1988; Schauer 1988). However, in mutants, diterminal oxidation can become
the main pathway allowing the industrial production of long-chain dicarboxylic
acids (Uemura et al. 1988; Casey et al. 1990; cf. Sects. 4.2,6). At least the P450Cm2,
characterized after cloning and heterologous expression in S. cerevisiae (Schunck
et al. 1991; Zimmer et al. 1995), is involved in the ro-hydroxylation of fatty acids
(see Sect. 2.4.2). Furthermore, Mauersberger et al. (1992a) purified a third
P450Cm3, also active in ro-hydroxylation from decane-grown C. maltosa VSB779
(Table 4). Today, eight alkane-induced cytochrome P450 genes are known in C.
maltosa. Their characteristics and molecular biology data will be discussed in
Section 4.
The cellular fatty acid composition of alkane-grown yeasts is quite stable. For C.
maltosa it was shown that 96 to 98% of the fatty acids have a chain length of 16-18C
atoms and the relation saturated/unsaturated is about 35/65 (Blasig et al. 1984,
1989), independent of the chain length of the n-alkane utilized. The content of
odd-numbered fatty acids, mainly Cm is increased in cells grown on odd-num-
bered n-alkanes or a distillation fraction of long-chain n-alkanes (e.g., C14-C 1S )'
demonstrating the direct incorporation of fatty acids arising from alkane oxida-
tion into lipids. As experiments with odd-numbered n-alkanes as carbon source
show, even a high percentage of fatty acids with this unusual chain length does not
impair the yeast cell (Blasig et al. 1989, cf. Sect. 2.4.2).
2.5.5
Intermediate Metabolism and Gluconeogenesis
In the catabolism of alkanes and fatty acids, the final product of the j3-oxidation
acetyl-CoA is used in the intermediate metabolism in the same way as during
utilization of ethanol or acetate. Thus, the prevailing acetyl-CoA is the starting
point for gaining energy and for all anabolic pathways needed in the alkane-
utilizing yeast cell. The acetyl-CoA is consumed in the inducible glyoxylate cycle to
produce gluconeogenic intermediates and TCA cycle intermediates used in bio-
synthetic processes. Catabolizing an odd-numbered n-alkane, the concluding cycle
of j3-oxidation supplies propionyl-CoA, which is further metabolized via the me-
thyl citrate cycle in yeasts (Fig. 3; Tanaka et al. 1982; Tanaka and Fukui 1989;
MUller et al. 1991a). Thus, alkane or fatty acid utilization does not supply C3 -units
which are needed, e.g., for the gluconeogenesis and the biosynthesis of the pyru-
vate family of amino acids. This bottleneck is overcome by the glyoxylate cycle.
After the condensation of oxaloacetate with acetyl-CoA to citric acid and its con-
version to isocitric acid, the latter is cleaved by the inducible isocitrate lyase (ICL),
forming succinate and glyoxylate (Table 5; Davidov and Gololobov 1980a,b;
Krauzova and Sharyshev 1987). Malate synthetase catalyzes the condensation of
glyoxylate and acetyl-CoA to malate which is dehydrogenated to oxaloacetate.

With this, the acceptor compound for acetyl-CoA is recycled. Malate and oxaloac-
etate are sources for pyruvate and phosphoenolpyruvate, the C3 key intermediates
(Tanaka and Fukui 1989; Fig. 3; cf. also Barth and Gaillardin, Chap. 10, this Vol.).
Catabolite Repression and Catabolite Inactivation by Glucose. During growth on n-

alkanes, phenol, fatty acids, acetate, or ethanol, gluconeogenesis is a necessary
anabolic sequence for cell substance synthesis on these substrates. In the presence
of glucose and other substrates metabolized via glycolytic sequences, the so-called
glucose effect leads in yeast to a strong reduction of the activities of intermediate
metabolic sequences such as citrate and glyoxylate cycles, respiration, and
gluconeogenesis by the catabolite repression and/or catabolite inactivation
mechanisms.
During discontinuous growth of C. maltosa on ethanol or glucose, the differ-
ences in the activities of cytoplasmic and mitochondrial malate dehydrogenases
(cMDH and mMDH), phosphoenolpyruvate carboxykinase (PEPCK), and fruc-
tose-l,6-bisphosphatase (F-l,6-bPase) were found to be much smaller (factor 2 to
5) than in S. cerevisiae and other yeasts (factor 15 to 50) under similar conditions.
Therefore, it was concluded that catabolite repression does not play an essential
role in the control of gluconeogenesis in C. maltosa (Hofmann and Polnisch
1990a,b).
On the other hand, these and other gluconeogenic enzymes (isocitrate lyase,
ICL) underlie a fast catabolite inactivation in the presence of glucose. Addition of
glucose to derepressed (or starved) cells of C. maltosa causes a rapid increase
within 30 s of the concentration of cyclic AMP and fructose-2,6-bisphosphate
(F-2,6-bP) followed by phosphorylation of at least 12 different proteins and
inactivation of gluconeogenic enzymes as the ICL, cMDH, PEPCK, and F-l,6-bPase
. activities (Polnisch and Hofmann 1989; Hofmann and Polnisch 1990a,b,c). The F-
1,6-bPase was demonstrated to be phosphorylated in the course of inactivation; no
phosphorylation of the cMDH could be detected, showing that cAMP-dependent
phosphorylation plays an important role in the catabolite inactivation of F-l,6-
bPase in C. maltosa, as described for S. cerevisiae and other yeasts (Hofmann and
Polnisch 1990b).
A spontaneous mutant (PHM, stands for pseudohyphal morphology) of C.
maltosa was isolated, being defective in catabolite inactivation of gluconeogenic
enzymes (Hofmann and Polnisch 1990c). This mutant was selected due to its
different colony and cell (pseudohyphal) morphology under all growth conditions
tested (see Sect. 3.1), although the mutation was without significant influence on
growth velocity on both glucose or hexadecane. The cAMP-linked signaling path-
way is therefore connected with the morphological transition from mycelium to
yeast in C. maltosa, as was previously demonstrated for other yeasts and fungi (for
literature see Hofmann and Polnisch 1990c).
The weak reaction of the gluconeogenic enzymes to the glucose effect is obvi-
ously connected with the mentioned metabolic peculiarities of carbohydrate utili-
zation in C. maltosa, as the increased part of the pentose phosphate pathway
compared with the glycolysis (Rober and Reuter 1979, cf. Sect. 2.4.2). This might be
connected also with the fact that C. maltosa strains occur mainly in hydrocarbon-
containing habitats, where the functioning of gluconeogenic metabolic sequences
is almost essential (cf. Sect. 2.1).
The enzymes of primary alkane oxidation in C. maltosa (P450, FAOD, FALDH)
are repressed in the presence of glucose (Mauersberger et al. 1980, 1981, 1984),
although a derepression of these enzymes occurred already in the beginning of the
stationary phase of growth on glucose (Mauersberger et al. 1984; Kiirgel et al. 1985;
Schauer 1988). In this respect, it was of interest that P450 induction in C. maltosa
(and Y. lipolytica) by hexadecane was more sensitive to glucose repression than
induction by decane, which could be a result of the presence of differently regu-
lated P450 genes in this yeast (Mauersberger 1991).
2.6
Biosynthetic Pathways
2.6.1
Amino Acid Biosynthesis
The anabolism (this Sect.) and catabolism (see Sect. 2.4.1) of amino acids in C.
maltosa have been studied mostly in the laboratories of yeast genetics and molecu-
lar biology at the Biology Section of the University of Greifswald, Germany, includ-
ing its enzymology, the characterization of several auxotrophic mutants (for genes
and their functions as auxotrophic markers, cf. Sect. 4.4.2), and its connection with
the respective catabolic pathways (see Sect. 2.4.1). Amino acid biosynthesis in C.
maltosa was found to be mostly comparable with the main results obtained for the
intensively studied yeast S. cerevisiae, and the alkane-utilizing yeasts C. tropicalis
and Y. lipolytica in particular. Therefore, mainly the peculiarities found for C.
maltosa will be discussed here in detail.
The isopropylmalate (IPM) pathway for L-leucine biosynthesis in C. maltosa
shows general similarity to that of other lower eukaryotes, but there are individual
differences in the numbers of genes responsible for single enzymatic steps and in
the properties of the enzyme proteins itself. The four enzymatic steps in the
conversion of a-ketoisovalerate to leucine, including 2-IPM synthase (EC 4.1.3.12,
coded by the LEU4 gene), IPM dehydratase (EC 4.2.1.33, LEUl gene), 3-IPM dehy-
drogenase (EC 1.1.1.85, LEU2 gene) and L-Ieucine (branched-chain) aminotrans-
ferase (EC 2.6.1.42), were examined in the wild-type and leucine auxotrophic
strains of C. maltosa (Takagi et al. 1986a; Bode and Birnbaum 1988, 1991c; Wedler
et al. 1990; Bode 1991; Bode et al. 1991; Becher et al. 1991; see also Table 6 and Sects.
4.2 and 4.4). The enzymes could be purified at least partially (Table 4) and their
catalytic properties were determined, showing some differences to the enzymes of
other yeast and fungi (Bode and Birnbaum 1988, 1991c; Becher et al. 1991; Bode
1991). The pathway is metabolically controlled mainly by feedback inhibition of
the first enzyme 2-IPM synthase by leucine. An additional novel control step exists,
the inhibition of 3-IPM dehydrogenase by L-valine (Bode 1991; Bode and
Birnbaum 1991c). The enzyme biosynthesis is regulated by at least three different

control mechanisms of gene regulation - leucine repression, valine induced dere-
pression, and general control of amino acid biosynthesis (Becher et al. 1991; Bode
1991; Bode et al. 1991). The isolated leu2 mutants were used to establish host-
vector systems for C. maltosa using the cloned LEU2 gene (Takagi et al. 1988a;
Wedler et al. 1990; Becher et al. 1991; cf. Tables 14 and 15). The potential applica-
tion of leul and leu2 mutants of C. maltosa for the production of2-IPM and 3-IPM,
respectively, was recently reported (Bode et al. 1991; see Sect. 6).
Threonine dehydratase (ThrDHT - EC 4.2.1.16), the first specific enzyme of
isoleucine biosynthesis, was purified from C. maltosa (Table 4) and studied in its
metabolic regulation (Bode and Birnbaum 1986; Bode et al. 1986b). Its activity is
inhibited by isoleucine, stimulated by valine, and strongly increased, probably
allosterically, by the presence of phosphate ions, as is the enzyme from Y. lipolytica
and P. guilliermondii, but not from S. cerevisiae, C. utilis and Hansenula spp.
(Bode and Birnbaum 1986). The biosynthesis of the ThrDHT is regulated under the
general control of amino acid biosynthesis (Bode 1991).
Lysine is synthesized via the a-aminoadipate pathway in C. maltosa as in other
yeasts and fungi (Schmidt et al. 1985, 1989a,b; Kunze et al. 1987a,b). Four enzymes
of the lysine biosynthetic pathway of C. maltosa, homocitrate synthase (EC
4.1.3.21, first enzyme in the pathway, having low feedback inhibition), a-
aminoadipate reductase (AAAR, EC 1.2.1.31, Mr 160000, LYS2 and LYS5 genes),
saccharopine reductase (SaR, EC 1.5.1.9, Mr 90000, LYS9 gene), and saccharopine
dehydrogenase (SaDH, EC 1.5.1.7, Mr 45000, LYSl gene) were investigated in their
metabolic and biosynthetic regulatory pattern. The formation of saccharopine
reductase was constitutive, whereas the synthesis of homocitrate synthase, a-
aminoadipate reductase, and saccharopine dehydrogenase were regulated by the
general control of amino acid biosynthesis. Contrary to in S. cerevisiae, in C.
maltosa the four enzymes were not repressed by the presence of lysine in the
medium (Schmidt et al. 1985). Mutants of C. maltosa lacking saccharopine reduc-
tase (lys9) and saccharopine dehydrogenase (lysl, see Table 6; Sect. 4.2) were found
to accumulate and excrete a-aminoadipate-8-semialdehyde (AASA, 80-90mg/1
within 48 h using the lysl mutant G285) into the medium when growing on glucose
and supplemented with 50-100mgll L-Iysine (Schmidt et al. 1989a,b), being the
first report of lysine-requiring yeast mutants that accumulate and excrete AASA.
The AASA accumulation by C. maltosa mutants may be explained by the low
feedback regulation of their homocitrate synthase and the equilibrium of the
enzyme reactions involved in the lysine biosynthesis (Schmidt et al. 1989a,b).
The glutamate/aspartate anabolism is coupled with the role of these amino
acids in ammonium metabolism (see Sect. 2.4.1). From the analysis of mutants
(asnl, aspl) it was concluded that asparate is synthesized in C. maltosa only from
glutamate via transamination (aspartate aminotransferase) as in S. cerevisiae,
while the synthesis of asparagine from aspartate is catalyzed by one asparagine
synthetase, and not by isoenzymes as in S. cerevisiae (Casper et al. 1985b).
Arginine is synthesized from ornithine and carbamylphosphate via citrullin, as
in most other yeasts.
Biosynthesis of aromatic amino acids (Bode and Birnbaum 1984, 1991c; Bode et
al. 1984a,c, 1985a,c,d; Lippoldt et al. 1986). Candida maltosa synthesizes phenyla-
lanine and tyrosine only via phenylpyruvate and p-hydroxyphenylpyruvate, re-
spectively, using the enzymes chorismate mutase (EC 5.4.99.5), prephenate
dehydratase (EC 4.2.1.51), and prephenate dehydrogenase (EC 1.3.1.12 or 13),
whereas the arogenate pathway is not active in this yeast (Bode and Birnbaum
1984; Bode et al. 1984c, 1985d). In C. maltosa, a new type of regulation of phenyla-
lanine and tyrosine biosynthetic enzymes was discovered. The biosynthetic path-
way is inhibited by the end product tyrosine at the level of chorismate mutase,
which converts chorismate (the main branch point in the biosynthesis of all three
amino acids) into prephenate, the common intermediate of the phenylalanine-
tyrosine biosynthesis. Additionally, tryptophan is absolutely necessary for the
enzymatic reaction of the cytosolic enzymes chorismate mutase and prep hen ate
dehydrogenase, activating these enzymes (Bode et al. 1984c, 1985d). Amont vari-
ous different yeasts studied, chorismate mutase of C. maltosa showed the highest
degree of activation by tryptophan (Bode and Birnbaum 1991b). The amount of
aromatic amino acids in the free amino acid pool of C. maltosa cells (Bode and
Casper 1983) indicates that the biosynthesis of phenylalanine and tyrosine can be
regulated only by tryptophan. The regulation of tryptophan concentration is
affected by the inhibition of anthranilate synthase by tryptophan, whereas the
common branch of the biosynthesis of aromatic compounds is controlled by
two isozymic tyrosine-sensitive and a phenylalanine-sensitive 3-deoxy-D-
arabinoheptulosonic acid 7-phosphate (DAHP) synthases, constitutive enzymes
catalyzing the first step in the biosynthesis of aromatic amino acids (Bode et al.
1984a, 1985c).
The enzymes of tryptophan biosynthesis (ammonia-dependent anthranilate
synthase - ASN, anthranilate phosphoribosyltransferase - PRT, phosphoribosyl-
anthranilate isomerase - PRAI, tryptophan synthase - TS, and the complex of
glutamine-dependent anthranilate synthase with indole-3-glycerol-phosphate
synthase - ASG-InGPS) were partially purified from C. maltosa and the regulation
patterns were established. The formation of three enzymes ASN, PRT, ASG-InGPS
is regulated by the general control of amino acid biosynthesis, whereas synthesis of
PRAI and TS is constitutive (Bode et al. 1985a).
Three differently regulated aromatic aminotransferases (ArAT I-III) have been
found and characterized in C. maltosa, leading to the conclusion that only the
ArAT II has a biosynthetic function (Bode and Birnbaum 1984).
Glyphosate Action in C. maltosa (Bode et al. 1984a,b,d, 1985b; Bode and
Birnbaum 1989). The broad-spectrum herbicide glyphosate (N [posphono-
methyl]-glycine) was studied as an inhibitor of enzymes involved in the shikimate
pathway, representing the first steps, finally leading to chorismate, in biosynthesis
of aromatic amino acids in C. maltosa. These studies, being the first reports on
glyphosate action in yeasts, showed the inhibition of only one isoenzyme DAHP
synthase, namely the tyrosine-sensitive one, of the dehydroquinate synthase (EC
4.6.1.3), and of the 5-enolpyruvyl-shikimate 3-phosphate (EPSP) synthase (EC
2.5.1.19), the sixth step in the shikimate pathway being the main target of
glyphosate action in this yeast (Bode et al. 1984a,b,d; Bode and Birnbaum 1989).
Glyphosate is obviously transported into C. maltosa cells by a non-specific or
general amino acid permease (Bode et al. 1985b). The glyphosate inhibition of
growth causes accumulation of shikimic acid and shikimate-3-phosphate and
leads to increased synthesis of several enzymes of unrelated pathways, which are
regulated by the general control of amino acid biosynthesis, which is also known in
other fungi. An identical derepression of enzymes could be obtained in C. maltosa
by use of other amino acid antimetabolites (amitrol), amino acid mutants strains,
or under conditions of external amino acid imbalance (Bode et al. 1983, 1990; Bode
and Casper 1983). The general control of amino acid biosynthesis is characterized
in C. maltosa as in other yeasts by a noncoordinated, parallel increase in the level
of enzymes of several unrelated amino acid pathways in response to starvation for
one of these amino acids. Thus, the presence of amitrol (3-amino-l,2,4-triazol), as
a very efficient histidine antimetabolite leading to histidine depletion, leads to a
two- to threefold derepression of the effected biosynthetic enzymes of lysine
(Schmidt et al. 1985), leucine, isoleucine and valine (Bode 1991), and several
other enzymes involved in different pathways (Bode et al. 1983). The activities of
three amino acid biosynthetic enzymes, threonine dehydratase, tyrosine
aminotransferase, and saccharopine dehydrogenase, increased about two- to
fourfold (in response to conditions of histidine, tryptophan, or lysine limitation)
as a result of action of the general control of amino acid biosynthesis in several
yeasts, including C. maltosa, Hansenula polymorpha, S. cerevisiae, and Y.
lipolytica, whereas no evidence for the existence of this general control was found
in C. brumptii, C. utilis, Pichia guilliermondii, Trichosporon adeninovorans, and
other yeasts (Bode et al. 1990).
Adenine and uracil biosynthesis of C. maltosa was investigated in connection
with the isolation of respective mutants and genes (see Sects. 4.2.2 and 4.4.2).
2.6.2
Biosynthesis of Lipids
The lipid biosynthesis of C. maltosa was investigated by Dr. A. Belov and cowork-
ers in Moscow under several aspects, including the role of lipid granules as
the compartment oflipid synthesis in the yeast cell, phosphatidylinositol metabo-
lism (Belov and Guselnikova 1988), the substrate specificity of acyltransferases
from lipid granules (Davidova et al. 1989), the effects of n-alkenes and the derived
w-l fatty acids on the lipid metabolism (Zinchenko et al. 1990), and the localiza-
tion and specificity of enzymes of acylglycerol biosynthesis in lipid granules
and micro somes (Zinchenko and Belov (1990). Additionally to the data of
Kasanzev et al. (1975) and Maksimova et al. (1988) on the dynamics of lipid
inclusions during cultivation on paraffins, some aspects of fatty acid and lipid
biosynthesis in C. maltosa were discussed already in Sections 2.4, 2.5, and will be
discussed for the ergosterol biosynthesis in Section 4.2.2. Like in other yeasts, the
presence of a cytochrome P450 system involved in 14a-demethylation of
lanosterol in C. maltosa was demonstrated by immunological methods (Kargel et
al. 1990).
2.6.3
Biosynthesis of Polysaccharides
Some aspects of polysaccharide biosynthesis in C. maltosa were discussed in Sects.

2.4.2, 2.5.2 and 3.2, and in connection with the regulation of gluconeogenesis (see
Sect. 2.5.5). The structure (see also Sect. 2.5.2), biosynthesis, and its regulation of
polysaccharides used as cell wall material (mannan and glucan, chitin) and as
energy reserve compounds (glycogen and trehalose) in C. maltosa cells were inten-
sively studied in vivo and in vitro, as reported in a set of publications from the
University of Jena (Rademacher and Reuter 1978; Rober and Reuter 1979, 1982,
1984a,b,c,d, 1985; Grimmecke and Reuter 1980, 1981a,b,c,d; Lerche and
Kretzschmar 1980, 1986; Popov et al. 1980; Triebel et al. 1980; Bruckner and Troger
1981b; Grimmecke et al. 1981; Nuske et al. 1982). The functioning of the pentose
phosphate cycle in glucose-growing C. maltosa is the prerequisite for the synthesis
of the cell wall polysaccharides glucan and mannan and of the energy reserve
compounds glycogen and trehalose, all having fructose-6-phosphate as common
precursor intermediate for their biosynthesis (Rober and Reuter 1979, 1984b,c,d,
1985). The hexose utilization and polysaccharide biosynthetic pathways in C.
maltosa were studied in comparison with two mutants (H3 and H5) partially
desensibilized in the catabolite repression by glucose (Rober and Reuter 1982,
1984a,b; Rober 1985).
2.7
Protein Transport and In Vitro Translation System
2.7.1
Protein Transport Studies with Candida ma/tosa
The yeast C. maltosa was used to study protein targeting to and translocation
across the endoplasmic reticulum (ER) in lower eukaryotes in comparison with the
mammalian system (Wiedmann et al. 1988b; Musch 1993). Using this yeast, an in
vitro translation/translocation system was established. Microsomal membranes of
C. maltosa were isolated active in the translocation and core glycosylation of
proteins synthesized in cell-free systems derived from C. maltosa (for details see
Sect. 2.7.2), S. cerevisiae, or wheat germ.
As is well documented for S. cerevisiae (Hann and Walter 1991; Larriba 1993),
both co- and posttranslational protein transport into the ER was observed also in
C. maltosa. Translocation and core glycosylation of a heterologous secretory pro-
tein (prepro-a-factor of S. cerevisiae) were observed with c. maltosa micro somes
added during or after translation. The signal peptide is cleaved off. The homolo-
gous integral ER-protein cytochrome P450Cml is also inserted both co- and
posttranslationally into the microsomal membranes from C. maltosa. In contrast,
its insertion into canine microsomes occurs efficiently only in a cotranslational

SRP-dependent manner (Wiedmann et al. 1988b), showing the generality of the
posttranslational mode of protein translocation in yeast in addition to the
cotranslational mode.
Investigating the relationship of the eukaryotic translocation apparatus of the
ER with cross-linking experiments during transport of the model secretory protein
prepro-a-factor into yeast (c. maltosa and S. cerevisiae) and dog pancreas mi-
crosomes, Musch (1993) identified the Sec61p and aSSR (34kDa) proteins as
cross-linked in S. cerevisiae as well as in the mammalian system, respectively. The
participation of homologous proteins in translocation machinery of C. maltosa
was demonstrated.
Recent in vivo ER targeting studies, using the cloned C. maltosa ER proteins
cytochrome P450Cml (P450 52A3), P450Cm2 (P450 52A4), and NADPH-P450
reductase were performed in a model system druing their high-level heterologous
expression in S. cerevisiae under the control of the GALl 0 promoter (Menzel et al.
1994,1996). In these experiments, different parts of the membrane anchor region
of the P450 proteins (hydrophobic segments HSI and HS2 at the N terminus) were
used to construct several fusions with the cytoplasmic form of yeast invertase
(SUC2 gene) as reporter protein, to analyze the topogenic sequences in the P450
primary structure. It was shown that the same sequences, that confer the correct
targeting to and retention within the ER membrane of the P450 and the fusion
proteins, were found to induce also ER proliferation (cf. Sect. 3.2). The first hydro-
phobic segment HSI proved to be sufficient for ER targeting and insertion,
whereas the HSI and the following hydrophilic sequence (first 44 amino acids) of
P450 52A3 protein are required for a correct retention in the ER.
Kamiryo et al. (1989) demonstrated the in vivo transport of the subunits PXP-
2 and PXP-4 (genes POX2 and POX4) of peroxisomal fatty acyl-coenzyme A oxi-
dase of C. tropicalis into peroxisomes of C. maltosa. Additionally to the results
mentioned here, C. maltosa can be used to study ultrastructural changes such as
the proliferation of ER and peroxisomes during adaptation of the yeast cell to
assimilation of n-alkanes (cf. Sect. 3).
2.7.2
In Vitro Translation System Using Cell-Free Extracts Isolated
from Candido rna/tosa
Preparation of Cell Lysates from Candido rna/tosa Active

in In Vitro Translation
Note on Method. Active in vitro protein translating cell-free extracts can be

obtained from C. maltosa as described in detail by Wiedmann (1987), Wiedmann
et al. (1988b), and Zimmer and Schunck (1995). The method is adapted to that
described by Erickson and Blobel (1983) and Waters and Blobel (1986) for S.
cerevisiae. A detailed methodology for bakers yeast is described also by Feinberg
and McLaughlin (1988).
Procedure
1. Grow C. maltosa EH15 cells in YPD (up to 3 1) in shaking flasks at 30°C and
240rpm to an optical density (OD 600 ) of about 5 to 10. Harvest the cells by
centrifugation and wash with 1120 volume of fresh YPD medium at room
temperature.
Comment Cells should be taken from the exponential growth phase. Lower
OD 600 of about 1 give more active extracts but lower yield.
2. Resuspend the cells (20-50 g wet weight) to a final concentration of 0.3 g/ml
in YPD medium containing 1.2 M sorbitol (YPDS) and l3 mM DTE, adjust the
pH to 7.0 with ION NaOH, and incubate lOmin at 30°C under shaking at
80rpm. Add Zymolyase lOOT (Seikagaku, Kugyo Co., Ltd, Japan) to a final
concentration of 1 mg/g wet weight cells and incubate the mixture with shaking
at 80 rpm for up to 60 min at 30°C to form spheroplasts. Control spheroplasting
microscopically.
3. Sediment the spheroplasts at 2000rpm for 10min, wash the spheroplasts in
YPDS and incubate in 60 ml YPDS per g wet weight cells for further 30 min at
30°C under slightly shaking at 80 rpm for reactivation of the cells.
All following steps are performed at 4 dc.
4. Sediment at 2000rpm (3000g) for 10min, wash the spheroplasts with 80ml
1.2M sorbitol, resuspend them in O.Sml buffer A (see below) per g cells and
homogenize in a tightly fitting Potter homogenizer for 20 strokes.
5. Centrifuge the homogenate at 15000 g for 25 min. Remove the supernatant
thoroughly, and centrifuge for 30 min at 100000g.
6. Gently remove the clear supernatant and pass it through a Sephadex G-25 (or
G50, fine) column of 2 x 50cm equilibrated with buffer A. The column size
should be adapted to the cell amount to be extracted.
7. Collect the eluates with OD 260 higher than 60 (maximally OD 260 is approx. 150)
and mix these fractions. Freeze obtained lysate dropwise in liquid nitrogen and
store until used for in vitro translation experiments. This material is referred to
as the cell-free extract or cell lysate (S100).
8. Continue with steps 8 to 10 for preparation of a microsomal membrane fraction
active in translocation (see below).
In Vitro Translation Experiments Using Cell Lysate

from Candida ma/tosa
Note on Method. Preparation of the C. maltosa lysate was carried out as described
above. In vitro translation experiments are performed according to Wiedmann et
al. (1988b) by a modified method used for S. cerevisiae by Waters and Blobel
(1986). The reader is also referred to the detailed discussion of the in vitro
translation methodology given by Feinberg and McLaughlin (1988).
Procedure
1. Treat 100.u1 cell-free extract with l.ul micrococcal nuclease (Oo4U/.uI,
Boehringer Mannheim) for 6min at 21°C in the presence of 1.0mM CaClz
followed by addition of EGTA to 2.0 mM to stop the nuclease.
Comment The yeast lysates contain high amounts of endogenous RNA (inter-
fering with the translation of exogenous RNA) to be eliminated by
nuclease treatment. This step should be optimized for each lysate
obtained. Normally, the conditions described are enough to reduce
the endogenous synthesis and to promote the initiation of protein
synthesis stimulated by heterologous mRNA.
2. Perform translation experiments in 0.5-ml reaction tubes with a 12.5.u1 (or
25.u1) mixture containing lOmM Hepes/KOH, pH 704, 1.2mM ATP, O.lmM
GTP, 2.0 mM dithiothreitol, 9.5 mM creatine phosphate, 0.9.ug creatine phos-
phokinase (Boehringer Mannheim), 30.uM L-amino acids expect the CH)-la-
beled compounds (Amersham), 5.u1 cell-free extract (S100) and 1-2.uI of
CH)leucine (1.33 TBq/mmol, l.uCi/.ul; or eH)serine, 1.33 TBq/mmol, l.uCi/.ul;
or eH)isoleucine, 3.66TBq/mmol, l.uCi/.ul; or C5S) methionine), Mg(OAc)z (2-
3 mM), KOAc (130-160 mM) and the mRNA sample (approx. 10 Jig, the effective
RNA amount should be tested).
Comments: In principle, C. maltosa lysates function with noncapped RNA
preparations, but usually capping increases the efficiency of trans-
lation. Therefore, in vitro transcriptions were performed using
0.5mM of cap analog PI-5'-(7-methyl)-guanosine-P3-guanosine
triphosphate (m7GpppG, Boehringer Mannheim; Zimmer and
Schunck 1995). For each of the RNAs and lysates used the optimal
concentrations of Mg(OAc)z and KOAc should be adjusted as
shown by Erickson and Blobel (1983) or Wiedmann (1987) using
an active standard mRNA (globin RNA, TMV RNA or total C.
maltosa RNA). The concentration ofK+ and Mgz+ should be opti-
mized for the RNA preparation to be tested.
Pipette all components on ice before starting the reaction at 21°C.
3. Incubate the reaction tubes at 21 °C for 30-90min (c. maltosa system) or at
30°C for 60 min (wheat germ system).
4. Finally, take samples:
- for the determination of total radioactivity (2.ul) in the protein by counting
the hot trichloroacetic acid-insoluble material in a scintillation counter;
- for SDS-PAGE of the total proteins (5.u1); and
- for the immunoprecipitation (rest of the mixture, see below).
The translation activity of the C. maltosa extract is mostly comparable with a wheat
germ extract purchased or prepared according to Wiedmann (1987), but shows up
to seven times higher activity when compared with a S. cerevisiae lysate
(Wiedmann 1987; Feinberg and McLaughlin 1988).
In contrast to the system obtained from S. cerevisiae, active for globin-,

phaseolin- and pre-prolactin-mRNAs, the C. maltosa system is more selective
towards the mRNA, where mostly yeast mRNA species (a-factor transcripts, total
mRNA from C. maltosa including P450-specific mRNA) were effectively translated
(Wiedmann 1987). The described method was recently successfully applied to
investigate codon usage in C. maltosa (Zimmer and Schunck 1995). In these ex-
periments artificial mRNAs were translated.
Immunoisolation of In Vitro Translation Products

Immunoprecipitation can be performed according to Wiedmann et al. (1986,
1988b) using rabbit antisera obtained after immunization of rabbits with purified
proteins, or using purified polyclonal antibodies against cytochrome P450 (Kargel
et al. 1984, 1985) or other proteins to be analyzed. Affinity purification of antibod-
ies was performed according to Pringle et al. (1991) using purified P450 protein
bound to nitrocellulose.
Preparation of Yeast Microsomal Membranes Active in Protein Transport

Procedure
1. to 7. These steps were the same as for obtaining cell-free extracts (shown
above).
8. The pellet of the last centrifugation step consists of a tightly packed ribosome
sediment and a flocculent membrane sediment above it. Remove the latter and
resuspend it with a Dounce homogenizer (five strokes) in buffer B.
9. Centrifuge the membranes through a 14% glycerol cushion in a Ti50.2
Beckman rotor for 60 min at 41 000 rpm.
10. Resuspend the membranes finally in buffer B at a OD 26o of about 100 and freeze
in liquid nitrogen.
To perform in vitro translation/translocation experiments with C. maltosa mem-
branes, add the obtained microsomal preparation to the in vitro translation mix-
ture at a final concentration of 0.4 OD 260 units per 25/11 assay (for details see
Wiedmann 1987; Wiedmann et al. 1988b).
Buffers
Buffer A: 20mM HEPES-KOH, pH 7.4, 100mM KOAc, 2mM Mg(OAc)2' 2mM
DTT (column buffer)
Buffer B: 50mM HEPES-KOH, pH 7.4, 1 mM DTT
2.8
Some Peculiarities of Candida maltosa
For the yeast C. maltosa, some additional peculiarities have been demonstrated
and studied at biochemical and molecular biological levels. These are the appear-
ance of
• Cycloheximide resistance (Takagi et al. 1986b; Sasnauskas et al. 1992c; see Sect.
4.4.2).
• Formaldehyde resistance genes, applicable as marker genes for the transforma-
tion of other yeasts (Sasnauskas et al. 1992a; for details see Sects. 4.4.2 and 5.2).
• Cyanide-insensitive respiration (Schauer 1988; Ilchenko et al. 1991).
• Growth at high cobalt concentrations in connection with cobalt-binding pro-
teins and cobalt accumulation (Belov and Toneva-Davidova 1983; Belov et al.
1985).
• Intracellular and extracellular proteases (Dolgikh et al. 1990; Sinanyan et al.
1990).
• Thermal shock proteins in C. maltosa and investigation of its thermotolerant
mutants (Sinanyan et al. 1989, 1990).
As described for many eukaryotic microorganisms, C. maltosa has an alternative

respiratory pathway which is not inhibited by cyanide. The biochemical nature
of this pathway and of the alternative oxidases in particular are poorly
understood at present (for literature see Claisse et al. 1991; Sakajo et al. 1993). The
development of probably two cyanide-insensitive respiration pathways in C.
maltosa was induced by the presence of respiratory inhibitors like KCN or in
dependence on the physiological state of glucose- and alkane-growing cells
(Greiner 1985 and Schubert 1987, both cited by Schauer 1988; Ilchenko et al.
1991).
The accumulation of proteinases in the culture media of industrial C. maltosa,
C. rugosa, and C. tropicalis strains was investigated by Dolgikh et al. (1990). It
was found that these yeasts exhibit proteolytic activity, and therefore were able to
use proteins as the only source of nitrogen. The regulation of the proteolytic
activity of C. maltosa and its thermotolerant mutants was studied by Sinanyan et
al. (1990).
Growth of C. maltosa cells at rather high concentrations of cobalt in the me-
dium was demonstrated. Belov and Toneva-Davidova (1983) isolated a Co-binding
protein, mostly located in the vacuoles, with a molecular mass of 5000 Da contain-
ing 4 g-atoms of cobalt/mole protein from the yeast C. maltosa grown on glucose
in the presence of 3 mg/l C02+. This protein was supposed to be involved in reduc-
ing the intracellular cobalt concentration. Later, Belov et al. (1985) reported the
distribution of different chemical forms of intracellular C02+ between the vacuolar
and cytoplasmic compartments studied in cells of C. maltosa.
Additionally to the properties shown in Table 3, some other peculiarities of C.
maltosa discussed in other Sections should be mentioned here. This yeast is re-
garded as:
• a dimorphic yeast showing pseudomycelium formation under certain circum-

stances (see Sect. 3.1);
• a petite-negative yeast, showing no ability to form respiratory-deficient mutants
on treatment with acriflavine (Bos and deBoer 1968);
• an asporogenous (imperfect) yeast without sexuality (see Sect. 4).
3
Cytology and Morphology of Candida rna/tosa
3.1
Morphology
The imperfect yeast C. maltosa exists mostly in the true yeast form. Cells are
normally round, nearly round to short oval cells of about (2.5-7) x (3-8) j1m after
growth in rich medium (malt extract), and they reproduce by multilateral budding
on a narrow base. Sometimes, the cells are prolonged to 10 to 13 j1m. In slide
culture on potato dextrose agar (Difco), corn meal agar, or under certain condi-
tions of growth limitation in submerse cultures, the occurrence of a
pseudomycelial form (pseudohyphae or pseudomycelium) with blastospores, but
no chlamydospores or true mycelium were observed (Komagata et al. 1964b;
Kaneko et al. 1977; Kunze et al. 1984a,b; Golubev et al. 1986; Huth et al. 1990a),
characterizing this yeast as a dimorphic one.
C. maltosa is characterized by the absence of true hyphae, chlamidospores,
ballistospores, chlamydoconidia, and arthroconidia. Teleospores and ascospores
were not observed in individual or mixed cultures (possible anamorphl
teleomorph relationship discussed in Sects. 1.1 and 1.2). A spontaneous mutant of
C. maltosa SBUG700 was isolated showing pseudohyphal morphology (PHM) un-
der all growth conditions tested. On solid malt extract medium the mutant formed
dark yellow colonies and rough brim, in contrast to the round, cream or yellow-
colored colonies with an entire margin and a smooth and shiny surface of the wild-
type strain. This PHM mutant was shown to be defective in cAMP-dependent
catabolite inactivation of gluconeogenic enzymes. The cAMP-linked signaling
pathway is therefore connected with the morphological transition from mycelium
to yeast (dimorphism) also in C. maltosa, as was previously demonstrated for
other yeasts and fungi (for literature see Hofmann and Polnisch 1990c).
3.2
Ultrastructure of Glucose- and Alkane-Grown Candida maltosa Cells
During transition from growth on carbohydrates (glucose) to n-alkanes in cells of

C. maltosa, as in other alkane-assimilating yeasts, in addition to the above-dis-
cussed physiological-biochemical changes (alterations in the biomass composition
and enzyme induction, cf. Sects. 2.3 and 2.5), various ultrastructural alterations
also occur, such as an increase in intracellular membranes (organelles) like the ER
and peroxisomes.
Adaptation to alkane utilization also leads to several morphological and chemi-
cal alterations of the cell wall and of the plasma membrane of C. maltosa strains.
The cell wall of hydrocarbon-grown C. (cloacae) maltosa cells has a lipophilic
(lipoid surface layer) character, which is reflected in transmission electron micro-
graphs of sections of glutaraldehyde-Os04-fixed whole cells as a dark edge, missing
in glucose-grown cells (Bos and deBoer 1968; Bos 1975). In scanning electron
micrographs, the surface of glucose-grown C. maltosa cells appeared smooth, but

rough on alkane-grown cells (Schauer 1988). In transmission electron micro-
graphs the changes in the cell wall appeared as hydrocarbon deposits, and forma-
tion of special ultramicroscopic channels, accompanied by slime-like outgrowths
or protrusions (up to 100 per cell) on the cell surface (Fischer et al. 1982; Belov et
al. 1983; Egorenkova and Belov 1984; Bode and Kohler 1984, unpubl. results cited
by Schauer 1988), as was repeatedly described for other alkane-assimilating yeasts
(Ludvik et al. 1968; Rylkin et al. 1974; Osumi et al. 1974, 1975b; Meissel et al. 1976;
Kappeli et al. 1978, 1984; Dmitriev et al. 1980; for further references see Fischer et
al. 1982; Miiller et al. 1991a). These structural peculiarities are closely connected
with the alterations in the chemical composition of the cell wall, directed to sup-
port the transport of the hydrophobic substrates into the cell (Fischer et al. 1982;
Rober and Reuter 1984c; Egorenkova and Belov 1984; cf. Sect. 2.5.3).
The basic morphological structures of the yeast cell, such as the nucleus, vacu-
oles, mitochondria, plasma membrane, and cell wall, are distinctly visible in
ultrathin sections of resin (Epon) embedded (Mauersberger et al. 1987) or in
cryosections (Vogel et al. 1991, 1992) of alkane- and glucose-grown C. maltosa cells
(Fig. 4). Whereas glycogen granules (not contrasted while solubilized under these
conditions) were visible only in glucose-grown cells, alkane-grown cells contained
in addition to vacuoles more lipid granules (spherosomes), surrounded by a single
membrane as reported previously for C. maltosa (Davidova et al. 1989; Zinchenko
et al. 1990) and other alkane-utilizing yeasts (Ludvik et al. 1968; Kasanzev et al.
1975; Meissel et al. 1976; Davidova et al. 1977a,b, 1979; Davidova and Rachinskii
1981; Belov and Davidova 1982).
A very striking feature of C. maltosa cells is a strong proliferation of permd-
somes (microbodies) and of the endoplasmic reticulum (ER) observed during
transition from growth on glucose to n-alkanes, as has been described repeatedly
for other alkane-assimilating Candida yeasts and Yarrowia lipolytica (Ludvik et al.
1968; Osumi et al. 1974, 1975a; Meissel et al. 1976; Fukui and Tanaka 1981a,b;
Stepanjuk 1981). Proliferation ofER resulted in the formation oflargely extended
membrane tubules surrounding the increased amount of peroxisomes, in addition
to ER membranes being in close vicinity of the plasma membrane (Mauersberger
et al. 1987; Vogel et al. 1991, 1992; Fig. 4). The ER became more extensive, espe-
cially under oxygen limitation of the alkane-assimilating cells, when the P450
content increased strongly (Mauersberger et al. 1980, 1984; Schunck et al. 1987b).
In the ultrathin sections of C. maltosa cells it has not yet been possible to distin-
guish between smooth and rough ER membranes on a morphological basis only.
Additionally, no direct transitions can be found between the ER membranes,
where the P450 system is located (Mauersberger et al. 1987; Vogel et al. 1992; cf.
Sect. 3.4), and the plasma membrane or peroxisomes themselves. Furthermore, the
number of plasma membrane invaginations is increased.
A strong proliferation of ER was also observed in C. maltosa cells growing on
galactose instead of on alkanes, when its P450 ALK genes were overexpressed
under the control of host-own GAll promoter from the multicopy vector pNGH2
(Ohkuma et al. 1995b; see Sect. 5.3). This phenomenon of increased formation of
H>o
Ocl
ER
*
O.S.,m
a V'
Fig.4a-e. Immunocytochemical localization of cytochrome P450 52A3 and its NADPH-dependent P450 reductase in cryosections
f§.
n-alkane-grown Candida maltosa cells (Vogel et al. 1992). Immunolabeling with two distinct particle sizes of colloidal gold for the ~
P450 52A3 protein (5nm) and the NADPH-P450 reductase protein (9nm) after maximum P450 induction by n-alkanes and
additional oxygen limitation. The specific labeling for both proteins over ER in the whole cells (a), in particular over ER forming ~
~
the nuclear envelope (b), ER associated with peroxisomes (c) and with the plasma membrane (d) was achieved. Control section
where the specific antibodies were omitted exhibit no immul10label (e). Abbreviations: CW cell wall; PM plasma membrane; N r:.
nucleus; M mitochondrion; V vacuole; Gly glycogen; P peroxisome; ER endoplasmic reticulum. Bars 0.5 11m (a) and 0.1 /1ffi (b-e)
ER membranes was already observed in S. cerevisiae in response to high-level

homologous or heterologous expression of certain ER-resident membrane pro-
teins such as the 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) reductase (Wright
et al. 1988, 1990), cytochromes P450Cml (P450 52A3), P450Cm2 (P450 52A4),
P45014DM (P450 51Al) or chimeric proteins consisting of an N-terminal membrane
anchor sequence of P450Cml or P450Cm2 and the reporter protein invertase
(Schunck et al. 1991; Wiedmann et al. 1993; Menzel et al. 1992, 1994, 1996; Zimmer
et al. 1995), cytochrome b s (Vergeres et al. 1993) and the NADPH-P450 reductase
(Menzel et al. 1994; Kargel et al. 1996). Depending on the protein expressed in S.
cerevisiae, distinctly organized stacks of paired membranes and tubular mem-
branes appeared and occupied considerable areas of the cytoplasm (for a recent
review see Wright 1993). Overexpression of the NADPH-P450 reductase of C.
maltosa in S. cerevisiae caused a proliferation of "karmellae" -like structures
(Menzel et al. 1994; Kargel et al. 1996), as initially reported for the HMG-CoA
reductase (Wright et al. 1988). The cytochrome P450-mediated ER membrane
proliferation in S. cerevisiae is accompanied by coinduction of the ER proteins
KAR2p and SEC61p and accumulation of precursor forms of proteins (KAR2p, a
factor) that have to translate across the ER membrane. Cytosolic proteins (SSAlp
and 2p) and mitochondrial proteins (CYTc1p and F1!3p) are not affected
(Wiedmann et al. 1993; Menzel et al. 1994). Interestingly, the heterologous
overexpression of other (not ER) membrane proteins in S. cerevisiae also induces
strong ER-membrane or nuclear-membrane proliferation in the yeast cell, as
shown for the plant plasma membrane H+-ATPase (Villalba et al. 1992) and for the
Drosophila copia gag precursor (Yoshioka et al. 1992).
Another system of proliferating membranes in yeasts was described for
Hansenula polymorpha as a response during adaptation of the cells to oleic acid-
containing media (Veenhuis et al. 1990). Although this organism cannot grow on
oleic acid, induction of peroxisomal f3-oxidation enzymes and increased phospho-
lipid content connected with a rapid proliferation of membranes, consisting of a
variable number of membranous layers which were continuous with the peroxiso-
mal membrane, was observed during incubation with this fatty acid.
The discussed phenomena of inducible membranes (reviewed by Wright 1993)
may provide a suitable model to study the so far largely unknown mechanisms
coordinating the synthesis and assembly of protein and lipid components during
ER biogenesis. For this purpose, a system would be of particular interest that
allows a direct comparison between physiological forms of ER proliferation and
those elicited by experimental overexpression of individual membrane proteins.
The alkane-assimilating yeast C. maltosa may offer such a possibility.
3.3
Electron Microscopy Methods
For electron microscopic examination of whole C. maltosa cells and organelle

preparations, conventional methods using resin embedding, thin sectioning and
staining of specimens (Mauersberger et al. 1987; Sharyshev and Krauzova 1988), as
well as an especially for yeast cells developed method of immunoelectron micros-

copy with high resolution of membrane structures (Vogel et al. 1991, 1992;
Ohkuma et al. 1995b) have been successfully used.
3.3.1
Electron Microscopy of Cells and Cell Fractions Using Resin Embedding
A method for obtaining electron micrographs of C. maltosa cells with good pre-
served intracellular membrane structures (Mauersberger et al. 1987) is given.
1. Fix spheroplasts of C. maltosa cells grown on n-alkanes or glucose, prepared as
described by Mauersberger et al. (1984), in 3% glutaraldehyde in 50 mM sodium
potassium phosphate buffer, pH 7.0, containing 0.6M sorbitol for 30min at
room temperature.
2. Continue with staining in a buffered solution of 1% osmium tetroxide and 0.8%
ferricyanide for 2h according to Hepler (1981) for preservation of membrane
staining.
3. Contrast in 0.5% uranylacetate for 18h and dehydrate in an acetone series.
4. Embed the cells in Epon 812 (Serva, Heidelberg, FRG).
5. Grid stain the thin sections obtained with an Ultrotome II (LKB, Sweden) with
1% uranyl acetate for 15 min and with Reynolds lead citrate.
6. View all specimens on an electron microscope at 80kV.
Treatment of the particulate cell fractions for electron microscopy was performed
as described by Mauersberger et al. (1987). A comparable method was used by
Sharyshev and Krauzova (1988).
1. Fix the particulate fractions immediately after pelleting for 30 min with 3%
glutaraldehyde in a 50 mM potassium phosphate buffer, pH 7.0, containing 5%
sucrose and 10 mM MgCl2 and wash with buffer.
2. Postfix the pellets in 1% buffered osmium tetroxide for 2 h and wash with
buffer.
3. Embed in 2% agar. Dehydrate these agar blocks in an acetone series.
4. Embed the specimens in Mikropal (Ferak, Berlin, FRG).
5. Proceed with 5 and 6 as shown above.
3.3.2
Immunoelectron Microscopy
Note on Method. Because it has been very difficult to preserve both antigenicity
and ultrastructure of the yeast cell embedded even in Lowicryl K4M and related
resins at low temperature, a new strategy for cryosectioning of yeast cells (c.
maltosa and S. cerevisiae) and subsequent immunolabeling was introduced in Dr.
Frank Vogel's Laboratory of Electron Microscopy at the Max-Delbruck-Center for
Molecular Medicine (MDC) in Berlin-Buch. Based on the cryosection technique of
Tokuyasu, some modifications were introduced to produce suitable croysections
of yeast cells. The main modifications are the fixation of the yeast cells at the
temperature of 30 DC and the pH of 4.7-4.9 used for growth, as well as the sucrose
infiltration performed at 30 DC for 2 h. The frozen-thawed sections obtained by this
new strategy for the preparation of yeast cells exhibit both an excellently preserved
and highly resolved ultrastructure and a conserved antigenicity of membrane
proteins to be localized in'the yeast cell (Vogel et al. 1991, 1992) as well (Fig. 4). All
membranes of the well-known yeast compartments (envelop of the nucleus,
mitochondria, ER, vacuole and plasma membrane, peroxisomes) are clearly
visible. The method makes it possible to examine the biogenesis of ER membranes
and to assess the subcellular distribution of cytochrome P450, the NADPH-P450
reductase, and other antigens in the yeast cells.
Procedure. Fixation and processing for electron microscopy of C. maltosa cells are
done by a modified cryosectioning method as descried by Vogel et al. (1992) and
Ohkuma et al. (1995b):
1. Harvest the yeast cells cultivated in a fermenter under defined conditions and
wash in 0.1 M Na-citrate buffer, pH 4.7, at 30 DC. Subsequently fix the cells in a
mixture of 0.5% glutaraldehyde and freshly prepared 4% paraformaldehyde in
O.IM Na-citrate buffer, pH 4.7, for Ih at 30 DC, to preserve the growth condi-
tions during fixation.
2. Wash the cells three times with phosphate-buffered saline (PBS: O.IM phos-
phate buffer, 150mM NaCl), add 1% sodium metaperiodate (Sigma-Aldrich,
Deisenhofen, Germany) to promote the cryoprotectants sucrose and PVP to
penetrate the cell wall (Van Tuinen and Riezman 1987) and incubate for 1h at
4 DC.
3. Wash the cells with PBS and immerse the specimens in a mixture of 25%
polyvinylpyrrolidone (PVP) K15 (MW 10 000, Fluka, Buchs, Switzerland) and
1.6M sucrose (Analytical grade, Serva, Heidelberg, FRG) for 2h at 30 DC accord-
ing to Tokuyasu (1989) and freeze in liquid nitrogen.
4. Mount the samples on specimen holders, freeze in liquid nitrogen, and prepare
ultrathin thawed-cryosections (approximately 50-100nm) according to
Tokuyasu (1986, 1989) at -115 DC with glass knives using an ultracryotome
(Leica, Vienna, Austria). Place the thawed cryosections on Formvar/carbon-
coated copper grids (200 mesh, hexagonal).
5. Label the specimens with primary antibodies and protein A-gold (5 or lOnm)
complexes according to Griffiths et al. (1984) and Griffiths and Hoppeler (1986)
using IgG fractions (20 jlglml) containing antibodies against P450, P450 reduc-
tase, invertase, or other antigens.
6. Stain (contrast) and stabilize finally the frozen-thawed sections using a mixture
of 0.3% uranyl acetate (A grade, Serva, Heidelberg, FRG) and 2% methyl cellu-
lose (25cps, Sigma-Aldrich, Deisenhofen, FRG) as described by Griffiths et al.

(1982).
7. View all specimens on an electron microscope at 8okV.
As controls, the sections were incubated directly with protein A-gold omitting
reaction with primary antibodies, or cells not expressing the antigen were used to
check the specificity of pr-imary antibody reaction. Polyclonal antibodies against
SDS-denaturated P450Cml and P450Cm2 were raised in rabbits. The IgG fraction
was prepared as described by Kargel et al. (1984, 1985). All polyclonal antisera used
were incubated with washed C. maltosa cells to remove antibodies binding to cell
wall carbohydrates (Brada and Schekman 1988) for 1 h at room temperature. The
cells were removed by centrifugation and the procedure was repeated with fresh
cells, if necessary. Affinity purification of antibodies was performed according to
Pringle et al. (1991) using purified P450 protein bound to nitrocellulose.
3.4
Subcellular Organization of the Alkane Metabolism
The subcelluar distribution of enzymes involved in the primary oxidation steps of

alkanes and fatty acids (Fig. 3, reviewed for yeasts by Tanaka and Fukui 1989;
MUller et al. 1991a) in C. maltosa cells has been studied by differential and sucrose
and Percoll gradient centrifugation (Mauersberger et al. 1984, 1987; Krauzova and
Sharyshev 1987; Sharyshev and Krauzova 1988; Kamiryo et al. 1989).
Already in the early 1970s, first studies on alkane-hydroxylating cytochrome
P450 of yeasts suggested its occurrence in the endoplasmic reticulum by compari-
son of the yeast with the well-investigated mammalian liver cell. In both cases,
after cell disruption, cytochrome P450 sediments with the microsomal fraction.
The components of alkane monooxygenase (cytochrome P450 and NADPH-cyto-
chrome c reductase) have been shown to be located mainly in the light membrane
fractions (microsomes) of yeast cells. This yeast microsomal fraction (when ob-
tained after enzymatic cell wall lysis, followed by careful osmotic cell disruption
and differential centrifugation) consists mainly of vesicles of the plasma mem-
brane and of intracellular membranes. Furthermore, fragments of mitochondria
and peroxisomes occur in small quantities. Separation of the microsomal fraction
by sucrose gradient centrifugation was performed, resulting in an increased con-
tent of P450 and its reductase in the purified ER fractions, thus separated from the
impurities of plasma membrane fragments present (Mauersberger et al. 1987).
More recently, an immunocytochemical method was applied to localize the P450
and the corresponding NADPH-cytochrome P-450 reductase in the ER of C.
maltosa cells grown on n-alkanes (Vogel et al. 1991, 1992) or on galactose during
expression under the control of the GALl promoter (Ohkuma et al. 1995b). For this
purpose, a special immunogold method on cryosections of yeast cells was devel-
oped for conserving both the high resolution in ultrastructure and the antigenicity
of membrane proteins to localize in the yeast cell (Sect. 3.3.2). Using this tech-
nique, P450 was found to be concentrated in the nuclear envelope during the early
phase of the induction process. After maximal induction, the highest labeling was
observed in membranes of the ER closely associated with peroxisomes and the
plasma membrane. Double-labeling experiments revealed that P450 and its
NADPH-dependent reductase were distributed in the same regions of the ER (Fig.
4; Vogel et al. 1992; cf. Mauersberger et al. 1987).
The enzymatic systems for the oxidation of higher alcohols and aldehydes
(membrane-bound FAOD, FADH, and FALDH) occur predominantly in peroxi-
somes, accompanied, e.g., by catalase and isocitrate lyase, but not in the mitochon-
drial fraction, although their (or of isoenzymes) activity in the ER membranes
could not be excluded (Fig. 3; Krauzova and Sharyshev 1987; Mauersberger et al.
1987). As known from the studies of Tanaka's group, mainly on alkane-grown C.
tropicalis and Y. lipolytica (latest review Tanaka and Fukui 1989), this organelle is
characterized by a high level of various oxidases, including the fJ-oxidation en-
zyme acyl CoA oxidase and catalase, and the glyoxylate cycle enzymes isocitrate
lyase and malate synthase, which is suggested to be the case also in C. maltosa (Fig.
3; Krauzova and Sharyshev 1987; Mauersberger et al.1987; Hill et al.1988; Kamiryo
et al. 1989).
Considering the different intracellular localization of the reactions, alkane
hydroxylation in ER and alkanol and aldehyde oxidation in peroxisomes, the
fatty alcohol must be an essential transport form for long alkyl chains in the
alkane-assimilating yeast cell (Fig. 3), as proposed by Fukui and Tanaka (1981a,b)
for other alkane-assimilating yeasts. Due to the fact that fatty acids are also sub-
strates for the ER resident P450s forms active in m-hydroxylation, fatty acids
derived from fatty alcohols in peroxisomes should also be at least retransported
into ER from peroxisomes, to form dicarboxylic acids (DCA). This suggests a
direct functional importance of the proliferation of ER membranes and of their
tight association with peroxisomes during growth on n-alkanes (Fig. 4), which was
supported by first in vitro studies with organelle preparations (Mauersberger et al.
1987).
3.5
Cell Fractionation and Preparation of Organelles
Cell fractionation protocols applied for alkane-grown C. maltosa are comparable

to those described for other yeasts. Several methods for the preparation of subcel-
lular organelles from C. maltosa cells were described in the literature. Only refer-
ences for C. maltosa are given here, although methods described for other
yeasts such as C. tropicalis, Y. lipolytica, or S. cerevisiae should also be applicable
(for further references see Davidova et al. 1975; Krauzova and Sharyshev 1987;
Mauersberger et al. 1987; Sharyshev and Krauzova 1988; Tanaka and Fukui
1989).
Cell walls - from alkane-grown cells (Maximova et al. 1972; Fischer and Reuter
1982; Niiske et al. 1982; Belov et al. 1985; Maksimova et al. 1988); and cell wall
components (Rober and Reuter 1984a,b,c,d): mann an (Rademacher and Reuter
1978; Bovina et al. 1986, 1988), proteophosphomannan (PPM, Grimmecke and
Reuter 1980, 1981a,b,c; Grimmecke et al. 1981), glucan (Grimmecke et al. 1981d;
Nuske et al. 1982).
Plasma membranes - from alkane-grown cells after gradient centrifugation of the

microsomal fraction (Mauersberger et al. 1987).
Vacuoles - from glucose-grown cells by Belov et al. (1985) according to Belov

et al. (1976) using a technique of flotation in a Ficol gradient applied to C.
tropicalis.
Peroxisomes - from alkane-grown (Krauzova and Sharyshev 1987; Sharyshevand

Krauzova 1988) or oleic acid-grown cells (Kamiryo et al. 1989).
Mitochondria - from alkane-grown cells (Krauzova and Sharyshev 1987;

Sharyshev and Krauzova 1988).
Microsomes (ER) - from glucose-, glycerol-, or alkane-grown cells by differential

centrifugation after mechanical cell disintegration (resulting in crude mem-
brane preparations) or after spheroplast lysis (Mauersberger et al. 1981, 1984;
Rober and Reuter 1984c; Mauersberger 1985; Krauzova and Sharyshev 1987;
Sharyshev and Krauzova 1988) or by sucrose gradient centrifugation of the
microsomal fraction (Mauersberger et al. 1987) or Percoll gradient centrifuga-
tion of cell-free homogenates (Krauzova and Sharyshev 1987; Sharyshev and
Krauzova 1988).
Lipid vesicles (inclusions or granules) - from protoplasts by a technique of flotation

in a Ficoll gradient developed for C. tropicalis by Belov et al. (1976), Davidova
et al. (1977a,b, 1989), and Zinchenko et al. (1990).
For the preparation of pure fractions of organelles, like ER or peroxisomes,

several subcellular fractionation steps followed by density gradient centrifugation
using sucrose or Percoll as gradient material were applied (Krauzova and
Sharyshev 1987; Mauersberger et al. 1987; Sharyshev and Krauzova 1988). A
method for fractionating subcellular membrane structures, especially for separa-
tion of mitochondria and peroxisomes, of C. maltosa grown on n-alkane has been
developed (Krauzova and Sharyshev 1987; Sharyshev and Krauzova 1988). It
involves the consecutive two-stage centrifugation of membrane organelles
under isoosmotic conditions in self-generating Percoll gradients. The method
is applicable for a rapid and effective purification of mitochondria and peroxi-
somes which retain their biochemical and morphological integrity as shown by
analysis of the distribution of marker enzyme activities in different subcellular
membranes as well as by electron microscopy examination of Percoll gradient
fractions.
Further separation of the microsomal (ER-containing) fraction by sucrose gra-
dient centrifugation resulted in an increased content of P450 and its reductase in
the purified ER fractions separated from impurities of plasma membrane frag-
ments present in the microsomal preparations (Mauersberger et al. 1987).
4
Genetics and Molecular Biology of Candida maltosa
4.1
Strains Used in Different Laboratories
The wild-type strains of C. maltosa mainly used in the past and currently applied
for genetic and molecular biological studies in different laboratories are the fol-
lowing (cf. Sect. I, and Tables 1,6,8, 10, 11, and 14):
IAM12247 (=CBS5611) - Department of Biotechnology (Prof. M. Takagi) at the
University of Tokyo, Japan.
SBUG700 (L4) - Department of Biology, Institutes of Genetics, Biochemistry, and
Applied Microbiology, at the University of Greifswald, Germany.
EH15 - Department of Cell Biology, Laboratory of Membrane Proteins (Dr. W.-H.
Schunck) at the Max-Delbriick-Center for Molecular Medicine (formerly at the
Institute of Molecular Biology), Berlin-Buch, Germany.
VSB899 - Institute of Biotechnology, formerly Applied Enzymology (Dr. K.
Sasnauskas), Vilnius, Lithuanian Republic.
From these strains, several gene libraries have been constructed (Table 1O) and all
C. maltosa genes have been cloned so far (Table 11), with the exception of the POX4
gene cloned from C. maltosa ATCC20184 (Hill et al. 1988). The characterized
mutants derived from these strains are listed in Table 6 and are described below in
Sect.4.2}.
Recommended Strains and Plasm ids of E. coli. The molecular cloning procedures
and recombinant DNA methods applied for C. maltosa mostly followed standard
protocols (Sambrook et al. 1989). Therefore, the experimental work with C.
maltosa DNA does not require special plasmids and E. coli strains. Commonly
used strains of E. coli (HB1OI, JM103, DH5ac, SURE, and others) and plasmids
derived from pBR322, pUC118/119, or pUCBM20121 were successfully applied to
construct genomic libraries of C. maltosa DNA or cDNA (cf. Table 10).
4.2
Mutagenesis and Mutants
4.2.1
Mutagenesis of Candida ma/tosa
Mutagens. Different mutants of C. maltosa were isolated after physical (ultraviolet

or gamma radiation) or chemical (MNNG, EMS, NA, and other classical mutagenic
agents) mutagenesis in several laboratories (Yano et al. 1981; Bode and Casper
1983; Bode et al. 1983; Chang et al. 1984; Klinner et al. 1984; Durasova et al. 1986,
1989; Mikhailova et al. 1987, 1991; Samsonova et al. 1987; Schwarz et al. 1987; Casey
et al. 1990; Becher et al. 1991; Jomantiene et al. 1991; Sasnauskas et al. 1992c; cf.
Table 6). Contrary to other organisms, UV -induced inactivation curves in all tested
C. maltosa strains derived from L4 showed more or less linearity without a
shoulder at low dose area, suggesting a one-hit kinetics, as known from mutants
with a defective repair system (Samsonova et al. 1987). Among the chemical
mutagens N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), 6-N-hydroxy-
aminopurine (HAP), 4-N-nitroquinoline oxide (NQO), ethylmethanesulfonic
acid (EMS), nitrous acid (NA), sodium-p-dimethylaminobenzene-diazosulfonate
(DAP A), and 2-methyl-6-chloro-[3-( ethyl-2-chloroethyl)amino ]acridine hydro-
chloride (ICR-170) were tested alone and in combination with UV light, and
compared in their effectiveness to induce mutants in C. maltosa by Chang et al.
(1984), Mikhailova et al. (1987), and Durasova et al. (1989).
Frequency of Mutants. Generally, the frequency of mutants is relatively low in C.

maltosa due to its diploid or aneuploid nature (Chang et al. 1984; Kunze et al.
1984a,b), when compared with haploid strains of Y. lipolytica, P. guilliermondii, or
S. cerevisiae. Under comparable experimental conditions, the total mutant
frequency obtained after MNNG treatment in C. maltosa EH15 was about 0.2-0.3%
(at 0.5-1 % survivings from 1Q7 cells/ml with 500)1g MNNG/ml), being considerably
lower than for the haploid Y. lipolytica strains, when mutant frequencies of up to
8-12% (at 0.5-5% survivings from 107 cells/ml with 250)1g MNNG/ml) were
reached (Mauersberger and Barth 1985, unpubl. results; Mauersberger 1991). In
the Laboratory of Yeast Genetics at Greifswald University numerous auxotrophic,
amino acid catabolic and alkane nonutilizing (alk) mutants were obtained from
the C. maltosa strain!? L4 or EH15 on exposure to UV or MNNG using the same
conditions as described by Bottcher and Samsonova (1978) for Rhodosporidium
Banno. The total mutant frequencies were 0.05 and 0.4% with UV or MNNG,
respectively (Bode et al. 1983; Klinner et al. 1984; Samsonova et al. 1987; Schwarz
et al. 1987). The highest frequencies of mutants resistant to nystatin were obtained
with MNNG and NQO (about 0.04% at 0.1-1 % surviving cells). Interestingly, other
mutagens active in S. cerevisiae, including diepoxioctane (DEO), showed no
mutagenic activity in C. maltosa VSB589 in these experiments (Durasova et al.
1989).
Stability of C. maltosa Mutants. The mutants obtained in the primary screening

from C. maltosa were sometimes very instable. However, selected stable
auxotrophic or alk mutants showed reversion rates between 10-6 and 10-8 (Chang
et al. 1984; Schwarz et al. 1987; Samsonova et al. 1987; Mauersberger, unpubl.
results; Mauersberger 1991). A relatively high instability of some auxotrophic
mutants of C. maltosa L4 was observed and analyzed in more detail (APA-change,
Schult et al. 1987; Becher et al. 1994; see Sect. 4.2.2).
Enrichment Procedures of Mutants. Due to the relatively low mutant frequencies

observed for the diploid or aneuploid Candida yeasts (c. maltosa, C. tropicalis, C.
albicans), several authors tried to apply mutant enrichment techniques with
polyene antibiotics (nystatin, amphotericin B, pyrrolnitrin) to enhance the
frequency of mutants. Mainly the nystatin-treatment method according to Snow
(1966), widely used for isolation of auxotrophic mutants in yeasts, has been
modified and applied to enrich mutants after MNNG or UV mutagenesis of C.
maltosa and C. tropicalis deficient in assimilation of alkanes (Yano et al. 1981), and
of C. (cloacae) maltosa more recently by Casey et al. (1990), as well as auxotrophic
mutants of C. maltosa (Chang et al. 1984). It appeared that the growing Candida
cells were not efficiently killed by nystatin. Only for the combination nystatin and
pyrrolnitrin (an antifungal antibiotic like nystatin) were enrichment ratios after
three cycles observed, resulting in increased alk mutant frequencies from 0.9 to 3%
(Yano et al. 1981). Although the frequency of auxotrophs increased to 2-14% after
nystatin treatment, they were limited only to ade and his (Chang et al. 1984). Casey
et al. (1990) reported an optimized nystatin enrichment procedure for alk mutants
of C. (cloacae) maltosa (strain P41O), showing that besides other factors the key to
antibiotic sensitivity of Candida yeast cells is the nutrient status of the cells,
particularly the nitrogen level. The experiments showed that the essence of
achieving a high differential killing ratio was to starve the cells for nitrogen (the
cells became insensitive to nystatin) and then resuspend them in a nitrogen-
containing medium with alkane as carbon source, where only wild-type cells
became nystatin-sensitive due to reestablished cellular nitrogen levels. Using this
procedure, the frequency of alk mutants after MNNG mutagenesis increased to
1.15% in only one round of enrichment, tlms minimizing the opportunity for
mutant cloning.
Positive Selection of Mutants. The alternative to the mainly used negative selection
approach followed. by biochemical characterization for isolation of specific
(auxotrophic or carbon assimilation) mutants is the use of methods which permit
the positive (direct) selection of mutants with particular enzyme lesions. Positive
selection can be achieved by using substrate analogs (antimetabolites with toxic or
growth inhibiting effects when converted) or antibiotics for selection of resistant
mutants, or after gene disruption experiments with an established host/vector
system. A combination of these two approaches was recently applied for the
isolation of ura3 mutants in C. maltosa resistant to the substrate analog 5-fluoro-
orotic acid (5FOA) by Ohkuma et al. (1993a) after cloning the URA3 gene of C.
maltosa by complementation of the ura3 mutation of S. cerevisiae. To construct a
useful host for genetic engineering of C. maltosa using URA3 as a marker, one
allele of URA3 in a double auxotroph (hisS ade1) was disrupted by the homologous
ADEI gene, and subsequently two kinds of ura3 mutants were isolated by selecting
for spontaneous 5FOA resistance. One of the mutants was homozygous for the
disruption (ura3::ADEl/ura3::ADEl); the other was heterozygous (ura3::ADEl/
ura3). The ura3::ADEl allele in the latter strain was resubstituted by URA3 to
rescue the adenine auxotroph (hisS adel URA3/ura3). Finally, by selecting a 5FOA-
resistant mutant, a triple auxotroph (hisS adel ura3/ura3) was isolated (Table 6).
Adenine auxotrophic mutations occur frequently in C. maltosa and are easy to
screen for red mutants, which may correspond to adel or ade2 mutants, as in S.
cerevisiae (Jomantiene et al. 1987; Kawai et al. 1991; Sasnauskas et al. 1992b). A
direct selection procedure for increased polyene antibiotic (nystatin, levolin,
amphothericin) resistance in C. maltosa was used for the isolation of mutants with
defects in ergosterol biosynthesis (Durasova et al. 1989).
4.2.2
Mutant Phenotypes
The main phenotype classes of mutants obtained in C. maltosa are the following:
• Auxotrophic (aux) mutants, including amino acid, purine, pyrimidine, and vita-
min auxotrophs (Chang et al. 1984; Klinner et al. 1984; Kunze et al. 1987a,b;
Samsonova et al. 1987; Schwarz et al. 1987; Sasnauskas et al. 1992c; further
references see below and Table 6).
• Mutants in amino acid degradation pathways (Casper et al. 1985b; Umemura et
al. 1991).
• Alkane nonutilizing (alk) mutants (Yano et al. 1981; Samsonova et al. 1987;
Schwarz et al. 1987; Sunairi et al. 1988; Casey et al. 1990; Mauersberger 1991;
Mauersberger and Barth 1985, unpubl. results; see Table 7).
Table 6. Characterized mutants of Candida maltosa available from different laboratories
Strain Genotype Enzyme defect Reference
Mutants obtained from the wild-type strain lAM 12247"

J288 leu2, Alk leakyb 3-IPMDH Chang et aL (1984)
Takagi et al. (1986a)
CHI hisS AJk+b HPAT Hikiji et al. (1989)
CHAI hisS, ade1 HPAT, SAICAR-S Kawai et al. (1991)
CHUl hisS, ade1, HPAT,OPDCase Ohkuma et al. (1993a)
ura3::ADEI!
ura3::ADEl
CHAUI hisS, ade1, HPAT, SAICAR-S, Ohkuma et al. (1993a)
ura31ura3 OPDCase
CHSI hisS, cys2 HPAT, SerAT Ohkuma (unpubl. results)
CHSAI hisS, cys2, ade1 HPAT, SerAT, Ohkuma (unpubl. results)
SAICAR-S
G630 leu4, arg 2-IPMS Becher et al. (1991)
Bode et al. (1991)
N-07 AlaAT Umemura et al. (1991)
Mutants obtained from wild-type strain L4'
G374 ade1 SAICAR-S Kasuske et al. (1992)
asp1-1 APAT Casper et al. (1985b)
asn1-1 AS Casper et al. (1985b)
G344 arg4-18 ASL Kunze et al. (1985a,b, 1986a)
glu1-1 GOGAT Casper et al. (1985b)
ilv1-1 TDA Schult et al. (1987)
G381, G321 leu1 2-IPMDHT Bode et al. (1991)
G367, G368 leu1 2-IPMDHT Bode et al. (1991)
G383, G746 leu1 2-IPMDHT Becher et al. (1991)
G727, G735 leu1, thi 2-IPMDHT Becher et al. (1991)
Table 6. (Contd.)
Strain Genotype Enzyme defect Reference
G773 leul ade 2-IPMDHT Becher et al. (1991)

G587, G785 leu2 3-IPMDH Becher et al. (1991, 1994)
G946 leu2 3-IPMDH Bode et al. (1991)
G755 leu2, ura 3-IPMDH Becher et al. (1991, 1994)
G285; G358 lysl-14; lysl-16 SAPDH Schult et al. (1987)
Schmidt et al. (1989a,b)
G457 lys2-21, ino-3 2-AAR Schmidt et al. (1985)
Kunze et al. (1987a,b)
G107; G112 lysS-5; lysS-l, arg-5 2-ARR Schmidt et al. (1985)
G329; G376 lysS-19; lysS-20 2-AAR Kunze et al. (1987a,b)
G108 lys9 SAPR Schmidt et al. (1989a,b)
Mutant obtained from wild-type strain VSB899
adel adel SAICAR-S Jomantiene et al. (1987)
Sasnauskas et al. (1992b)
'Strains obtained mainly by UV mutagenesis, except J288 leu2 obtained after a second
MNNG mutagenesis, and the spontaneous ura3 mutations in CHAUl. These strains are
used for the host-vector system. Mutants G630 and N-07 were obtained from the wild-type
strains CBS5611 and JCM1504, respectively, both strains are regarded as being the same as
IAM12247 (see Table 1).
bJ288 strain has serious growth defect on alkanes, whereas CHI and the mutants derived
from it show normal growth on alkanes (Hikiji et al. 1989).
'G - Strain collection at the Greifwald University, Biology Section (in some publications also
Institute of Genetics [IGG] - Becher et al. 1991; Most of these strains are included in the
SBUG strain collection). The wild-type strain SBUG700 (L4) is similar if not identical to the
C. maltosa strain EHI5.
Mutant designation. When shown as lys2 - genetically defined mutant; when lys-2 - allele of
mutation phenotype, genotype not characterized; lys2-2 and lys2-5 are two alleles of muta-
tions in the same gene.
Abbreviations for substrates and enzymes.
2-AA - 2-Aminoadipate
2-AAR - 2-Aminoadipate reductase (EC 1.2.1.31), LYS2 and LYSS genes
AlaAT - Alanine aminotransferase (EC 2.6.1.2)
AS - Asparagine synthetase (EC 6.3.1.1), ASNI gene
ASL - Argininosuccinate lyase, ARG4 gene
APAT - Aspartate aminotransferase (EC 2.6.1.1), ASPI gene
GOGAT - Glutamate synthetase (EC 2.6.1.53), GLUI gene
HPAT - Histidinol-phosphate aminotransferase (EC 2.6.1.9), HISS gene
IPM - Isopropylmalate
2-IPMDHT - 2-IPM dehydratase (EC 4.2.1.33), LEUl gene
3-IPMDH - 3-IPM dehydrogenase (EC 1.1.1.85), LEU2 gene
2-IPMS - 2-IPM synthase (EC 4.1.3.12), LEU4 gene
OPDCase - Orotidine-5 '-phosphate decarboxylase (EC 4.1.1.23), URA3 gene
SAICAR-S - Phosphoribosylamidoimidazol succinocarboxamide synthetase or
SAICAR synthetase (EC 6.3.2.6), ADEI gene
SAPDH - Saccharopine dehydrogenase (EC 1.5.1.7), LYSI gene
SAPR - Saccharopine reductase (EC 1.5.1.9), LYS9 gene
TDA - Threonine deaminase, (EC4.2.1.16), ILVI gene
SerAT - Serine O-acetyltransferase (EC 2.3.1.30), CYS2, CYSI genes.
12. Candido ma/tosa 491
• Polyene antibiotic-resistant mutants, mostly having defects in ergosterol biosyn-

thesis (Durasova et al. 1986, 1989, 1991; Mikhailova et al. 1987, 1991; Volchek et
al. 1988; Ogorodnikova et al. 1991).
• Catabolite repression mutants H3, H5, H6 (Rober and Reuter 1982, 1984a,d,
1985), and the spontaneous catabolite inactivation mutant PHM (Hofmann and
Polnisch 1990c).
• Morphology mutants obtained from C. maltosa H, having differences in mannan
content (UV and MNNG mutants, Bruckner and Troger 1981a; Kolblin and
Birkenbeill981; Kolblin and Troger 1982).
Several of these mutants obtained from C. maltosa were characterized in detail at
biochemical and molecular genetic levels, as shown below and in the Table 6.
Auxotrophic Mutants. Numerous aux mutants of C. maltosa have been isolated
mainly from the two wild-type strains, IAM12247 (CBS5611) and SBUG700 (L4), in
the Department of Agricultural Chemistry at the University ofTokyo (Chang et al.
1984; Hikiji et al. 1989; Kawai et al. 1991; Ohkuma et al. 1993a) and in the Labora-
tory of Yeast Genetics at the Greifswald University since the beginning of the 1980s
(Bode and Casper 1983; Bode et al. 1983; Klinner et al. 1984; Schwarz et al. 1987;
Becher et al. 1991, 1994; cf. Table 6).
Among the approximately 300 auxotrophic mutants obtained in C. maltosa 14,
some double auxotrophs were isolated (ade leul, ade-26 pro-I, arg leu4, arg-21ys5-
1, arg-51ys5-1, arg-2 his-41ys5-1, his-ll met-6, his-23 met-6, leu2 ura, leul thi,lys2-
21 ino-3, met-13 ino-3), as partially shown in Table 6 (Klinner et al. 1984; Schmidt
et al. 1985; Kunze et al. 1987a,b; Samsonova et al. 1987; Schwarz et al. 1987; Becher
et al. 1991). Some of the auxotrophic mutants were characterized biochemically in
detail in their genetic defects (Table 6) and used in host-vector systems (Table 14).
The most frequent and easiest available auxotrophic mutants in C. maltosa are the
ade (14%) and his (18%) phenotypes, which is in accordance with the above
mentioned data obtained by Chang et al. (1984).
Mutants of the ADEl or ADE2 genes in C. maltosa, as in the majority of yeast
species, accumulate a red or pink intracellular pigment (amino-imidazole ribotide,
or carboxyamino-imidazole ribotide, which is then converted by oxidation into a
polymeric derivative which is colored and relatively nontoxic to the cells in which
it accumulates) when grown on limiting adenine. These stable red mutants of C.
maltosa showing low «1 %) activity of phosphoribosyl-aminoimidazole-
succinocarboxamide-synthetase (SAl CAR-synthetase, EC 6.3.2.6), coded by the
ADEl gene (Jomantiene et al.1987; Kawai et al.1991; Sasnauskas et al.1992b), were
easily selectable and therefore included in the construction lines of multiple aux-
otrophic recipient strains derived from the isolated hisS mutant CHI (CHAI from
CHI, CHSAI from CHS1) used in host-vector systems (Hikiji et al. 1989; Kawai et
al. 1991; Ohkuma, unpubl. results; Tables 6, 14, cf. Sect. 5). Ohkuma et al. (1993a)
constructed two further recipient strains, CHUI and CHUAl, in this line using
gene disruption technique to create an ura3 defect. More recently, the mutants
CHSI and CHSAI were obtained by a second mutagenesis of the strains CHI and
CHAI. The cys2 mutants were hard to obtain from the wild-type strain, but easier
from the CHI mutant, which may have already some defect (Ohkuma, unpubl.
results).
Leucine auxotrophs (4.5% leu from L4) occurred with relatively low frequency,
which might be related with the presence of silent gene copies in C. maltosa, as
demonstrated recently for the LEU2 gene (Becher et al. 1991, 1994). The first C.
maltosa leu2 host, J288. later used for transformation (see Sect. 5.3), was one of
three leu mutants (J183, J288, J316) isolated after a second round of mutagenesis of
the only leu mutant found in 30000 survivors after the first round ofUV mutagen-
esis. The original leu mutant was very unstable and reverted at high frequency
(Chang et al.1984). More recently, the four enzymatic steps in the conversion of2-
ketoisovalerate to leucine were examined in the wild-type and in 13 leucine-
auxotrophic strains of C. maltosa 14 (Wedler et al. 1990; Becher et al. 1991; cf. Sect.
2.6.1). The genetic lesions in the auxotrophs involve at least five different loci
(complementation groups) and are correlated with three enzymatic steps (coded
by the LEUl, LEU2, and LEU4 genes), which was confirmed by gene cloning,
protoplast fusion, and enzyme assays. In analogy to S. cerevisiae, the correspond-
ing leu mutants of C. maltosa were designated leu1, leu2, and leu4. In 4 out of 13
leucine-auxotrophic mutants, a defect in the 3-isopropylmalate dehydrogenase
(coded by the LEU2 gene) was shown (Table 6). The potential application of leu1
and leu2 mutants of C. maltosa for the production of 2-IPM and 3-IPM, respec-
tively, was reported (Bode et al. 1991; see Sect. 6).
Five selected C. maltosa lys mutants (8% lys from L4) showed two complemen-
tation groups on, the basis of complementation analysis using protoplast
fusion, which might represent the two genes LYS2 and LYS5 coding for two differ-
ent subunits of the 2-aminoadipate reductase, in analogy to the results known
for S. cerevisiae. Only one of these two groups of mutants (G457 lys2) could be
transformed by plasmids containing the LYS2 gene of S. cerevisiae (Schmidt et al.
1985; Kunze et al. 1987a,b; Table 16). Further lys mutants defective in the
saccharopine dehydrogenase (1ys1) and in the saccharopine reductase (1ys9)
have been characterized by Schmidt et al. (I989a,b; cf. Table 6) and tested for
their potential application in production of useful compounds, such as a-
aminoadipate-c5-semialdehyde (AASA; cf. Sect. 6).
The mutant C. maltosa arg4-18 (G344, 9% are arg mutants) was characterized
by its transformation with the ARG4 gene coding for the argininosuccinate lyase of
S. cerevisiae (Kunze et al. 1985a,b, 1986a, 1987a,b).
It is remarkable and still without explanation that no tyr, phe or trp auxotrophs
have been found in C. maltosa (Kunze et al. 1987a,b; Schwarz et al. 1987), a result
similar to that obtained for C. albicans (Poulter 1990).
Several of the auxotrophic mutants of C. maltosa induced by UV or MNNG
show an unusual behavior (Schult et al. 1987; Becher et al. 1994). After reversion to
prototrophy (nearly one revertant per lOS cells) they mutated to the original
auxotrophy, and these auxotrophy-prototrophy-auxotrophy alterations (APA
change) took place successively many times in a cell line. The gen'etic stability
of clones originating from AP A mutations varied considerably. Spontaneous
mutation frequencies of different clones covered the range between 10-9 and 10-1•
AP A mutations are not restricted to particular types of auxotrophic mutants,

since they were observed in mutants with a blocked biosynthesis of arginine,
isoleucine, leucine, aspartic acid, asparagine, histidine, lysine, methionine, ad-
enine, or uracil.
A lineage of at least four types of spontaneous AP A changes starting with the
leu2 mutant GS87 derived from the wild-type C. maltosa strain L4, including even
segregation of an arg marker, was recently demonstrated by Becher et al. (1994).
Data obtained from investigations of the enzymes encoded by the unstable LYSI
and lL VI genes (saccharophine dehydrogenase and threonine deaminase) indicate
that the AP A mutations are allelic and create novel enzymes species with altered
catalytic and regulatory properties. Therefore a mechanism involving repeated
site-specific insertions and excisions of DNA elements (insertion mutagenesis),
probably by the action of mobile (transposon -like) genetic elements, was proposed
by Bottcher and Samsonova (Schult 1987; Schult et al. 1987). An interpretation of
the AP A change based at experimental data on the occurrence of probably silent
copies of LEU2 genes in the genome of the C. maltosa leu2 mutant GS87 was
recently presented by Becher et al. (1994; cf. Sect. 4.4.2). These authors propose
further that the whole chromosome on which these alleles reside might be silent,
controlled by at least two chromosome-silencing points on each chromosome arm.
Assuming such a genome organization, the APA changes (see Sect. 4.2.2) can be
easily interpreted as mitotic cross-over events between active and inactive wild-
type and mutant alleles. The activation of the silent wild-type alleles requires their
transposition into an active chromosome, which can be accomplished by a double
cross-over event. As for the high frequency morphology switching in C. albicans
(SolI 1990), the possible molecular basis of these phenomena in Candida yeast
remains elusive, although several switching systems in other organisms have been
elucidated at the molecular level and therefore provide models for experiments on
Candida systems.
Alkane Nonutilizing (alk) Mutants. Mutants deficient in the alkane degradation

pathway (alk), as well as being of scientific importance in studies of this pathway,
are also of commercial interest because several of the degradative intermediates
(fatty alcohols or dicarboxylic acids) are of value to the chemical industry.
Therefore, these mutants are of interest for possible application to produce useful
oxidation products directly derived from the n-alkane substrate (cf. Sect. 6). Thus,
first alk mutants (M-l and M-12) in C. maltosa were already obtained in the
beginning of the 1970s from the strain C. cloacae 310 and applied for the
production of dicarboxylic acids (Uchio and Shiio 1972b,c, for details see Sect. 6).
In several laboratories, alk mutants were obtained from different C. maltosa
strains (Yano et al. 1981; Samsonova et al. 1987; Schwarz et al. 1987; Bottcher 1987;
Sunairi et al. 1988; Casey et al. 1990; Mauersberger 1991; see Table 7). For C.
maltosa, the frequency of alk mutants was about the same as that of auxotrophic
mutants, being maximally approximately 0.1-0.2% after MNNG mutagenesis with-
out special enrichment techniques for each type of mutants (Schwarz et al. 1987;
Mauersberger, unpubl. results). Recently, techniques have been described which
allow mutated populations of C. maltosa to be enriched efficiently for the isolation
Table 7. Phenotypes of Candida maltosa valk mutants
~
Strain Alk phenotypes" Reference
Survivals
A' B C D E Othersb (mutagens used)
Frequency of
a1k mutants
Comments
C. maltosa 119 2 8 (CID)" n.d. n.d. . Yano et al. (1981)

IAM12247 14900 (EMS)
129 alk (0.86%)
nystatin enrichment
C. maltosa L4 32 29 (B/C)" 24 59 13b Schwarz et al. (1987)
Several (Aa 9/Ab 23/Ac 0)' 100000 (MNNG)
auxotrophic 157 alk (0.157%)
mutants d without enrichment
C. maltosa J288 64 (AIB/C/D)" 9 2 glu Sunairi et al. (1988)

(leu2, alk leaky) (154 aux) 10000 (UV)
73 alk (0.73%)
C. cloacae P410 80 (AlBIC)" 84 124E, glu or Casey et al. (1990)
(c. maltosa) respiratory 25000 (MNNG)
deficientb 288 alk (1.15%)
nystatin enrichment
~
"For several alk mutants no differentiation into the alkA to alkD phenotypes was given by the authors. Mostly, no clear alkB phenotype occurred,
~
mutants are alkane leaky or alcohol leaky and not very stable.
bNo clear classification into alkA to alkE phenotypes possible, or other phenotypes observed like glu.
'alkA mutants show subtypes alkAa, Ab or Ac in alkane chain length utilization. 1
dSeveral auxotrophic mutants of C. maltosa L4 were used for obtaining alk mutants - G284 (met2-6), G347 (met6-21), G589 (his-2), L4 (thi-2).
~
~
~
12. Candida maitosa 495
of alk mutants, thus increasing their frequency up to 1.15% (Casey et al. 1990).
After mutagenesis (UV-, EMS- or MNNG-treatment) alkane-nonutilizing C.
maltosa mutants were isolated by negative selection due to their inability to grow
on n-alkanes. On the basis of the main alkane oxidation pathways (Fig. 3), these alk
mutants can be classified according to Bassel and Mortimer (1982, 1985) into the
phenotypes atkA to alkE by substrate utilization tests on agar plates with different
alkane oxidation intermediates (alkanes, fatty alcohols, fatty aldehydes, fatty ac-
ids), acetate or ethanol, and glucose as carbon sources (see Sect. 4.2.3 and Table 7).
The phenotypes alkA, D, and E were found frequently, whereas the phenotypes
alkB and alkC occurred with low frequency, depending on the number of genes
involved in these metabolic steps (cf. Sect. 2.5 and Fig. 3). Comparable distribution
patterns of the alk phenotype classes have been found for Y. lipolytica (Basse! and
Mortimer 1982, 1985; Mauersberger 1991), C. tropicalis (Yano et al. 1981), and
Pichia guilliermondii (Schauer et al. 1987) after chemical or UV -induced mutagen-
esis. According to Bassel and Mortimer (1982, 1985), about 84 genes are involved
in the phenotype of alkane utilization in Y. lipolytica, as calculated from the
frequencies of alk mutants in comparison with those of auxotrophic mutants.
From genetic data these authors concluded that at least 26 genes control the
substrate uptake and the oxidation of n-alkanes to the corresponding fatty acid.
About 16 of these genes should be connected with the alkane uptake. A comparable
genetic background should also apply for C. maltosa.
Mutants of Phenotype alkA. The alkA mutants are found with high frequency in C.
maltosa (Table 7), because this phenotype occurs as a result of possible defects in
genes connected with the n-alkane uptake, the activity of the cytochrome P450
alkane monooxygenase systems or with the transport to and from these enzyme
systems to the fatty alcohol oxidizing enzyme(s), e.g., in the transport to and from
endoplasmic reticulum to peroxisomes (Fig. 3). A striking feature is the occurrence
of different subtypes of the phenotype alkA, which are based on changes in the
utilization of different n-alkane chain lengths. Whereas A]k+ strains utilize middle-
and long-chain n-alkanes as growth substrates, starting with the chain length C6
for C. maltosa, one can divide the alkA mutants obtained into three subtypes
(Schwarz et al. 1987; Mauersberger 1991; Table 7):
alkAa - no alkane utilization at all: Cs-' CIO-, Cl2-, CI6-, Cl2 -ol+
alkAb - no utilization of shorter n-alkanes, but utilization of longer n-alkanes:
Cs-' CIO-, Cl2±, C1/ , Cl2 -ol+
alkAc - utilization of shorter n-alkanes, but no utilization oflonger chain lengths:
Cs+' CIO+, Cl2±, CI6-, Cl2 -ol+
Interestingly, the phenotypes alkAa and alkAb were frequently obtained directly
after mutagenesis of C. maltosa, whereas the phenotype alkAc was obtained with
very low frequency and stability (Table 7; Schwarz et al. 1987; Mauersberger 1991).
Different alkA mutants were found not only directly after mutagenesis but also as
spontaneous or induced revertants from alkE mutants. Especially alkAc mutants
have been described up to now only for C. maltosa as revertants from a distinct
alkE mutant G988 (alk2154 met) or as recombinants (spontaneous or UV -induced

mitotic segregation) of the fusion product fp306-14 for which alkD and alkE
mutants (including G988 alk2154) were used as parent strains (Schwarz et al. 1987;
Mauersberger 1991). Taken together, all these results were hints for genetically
determined differences between the metabolism of short- and long-chain alkanes,
including the presence of multiple alkane-induced P450 forms with different
chain-length specificities for the substrate n-alkane (Mauersberger 1991). This is
now studied in detail on the basis of cloned alkane-inducible P450 genes in the
authors' laboratories (Ohkuma et al. 1991a,b, 1995a,d; Schunck et al. 1991; Scheller
et al. 1992, 1996; Zimmer and Schunck 1995; Zimmer et al. 1995; Table 11).
Phenotypes alkB, alkD, and alkE. For some C. maltosa mutants the conditions for
the accumulation of fatty alcohols (alkB) and dicarboxylic acids (alkD) from the
substrate n-alkane were investigated (Uchio and Shiio 1972b,c; Casey et al. 1990;
Mauersberger 1991; see Sect. 6). The low frequency alkB mutants could be useful as
potential fatty alcohol- or diol-producing strains directly from n-alkane. Out of 80
C. maltosa mutants characterized by Casey et al. (1990) as alkA to alkC (Table 7),
16 produced small amounts ofhexadecanol, as shown also for the first described
alkB mutant of Y. lipolytica (Mauersberger 1991). Mutants of alkD phenotype are
frequently found in agreement with the numerous genes involved in the activation
and degradation of fatty acids to acetyl-CoA (Fig. 3, see Sect. 2.5), including the
genes for the acyl-CoA synthetases I and II (ACSIIII) and for the fJ-oxidation
enzymes. Yeast alkD mutants are of special interest for practical use to produce
dicarboxylic acids (DCA), o>-hydroxy-fatty acids and fatty acids directly from n-
alkanes (Uemura et al. 1988; Schindler et al. 1990; Atomi et al. 1994; cf. Sect. 6). The
results of Casey et al. (1990) with C. maltosa mutants showed that of the 84 alkD
(Alk- PA- Ace+) mutants, most could accumulate dicarboxylic acids from
hexadecane and palmitic acid and at least one mutant also produced 3-hydroxy-
hexadecanedioic acid. Mutants of the alkE phenotype were obtained with high
frequency (Table 7), reflecting the considerable amount of possible defects in the
intermediate metabolism leading to this phenotype. Among them there should be
mutants with defective enzyme activities of the glyoxylate cycle, e.g., isocitrate
lyase (ICL) or malate synthase (MS) or of gluconeogenesis. Probably defects in the
peroxisome formation (Per) can also result in this phenotype.
Catabolite Repression and Catabolite Inactivation Mutants. Mutants of C. maltosa

H obtained after treatment with MNNG were selected in the presence of 2-
deoxyglucose. These mutants, H3, H5, and H6, were characterized as partially
desensibilized in catabolite repression. They showed several changes in
carbohydrate metabolism, especially in the biosynthesis of polysaccharide
components (mannan and glucan) of the cell walls (Rober and Reuter 1982,
1984a,d, 1985). More recently, a spontaneous mutant of C. maltosa SBUG700 was
isolated showing pseudohyphal morphology under all growth conditions tested
(see Sect. 3.1). This PHM (stands for pseudohyphal morphology) mutant was
shown to be defective in catabolite inactivation of gluconeogenic enzymes
(Hofmann and Polnisch 1990c).
Colony Morphology Mutants. Several mutants obtained by UV and MNNG

mutagenesis from C. maltosa H were described as having differences in high
molecular mannan content, but not in glucan or low molecular weight mannan
content (Kolbin and Birkenbeil 1981; Kolblin and Troger 1982). Another UV
mutant H13 was isolated showing mainly filamentous growth (Bruckner and
Troger 1981a).
Mutants in Ergosterol Biosynthesis. The biosynthesis of sterols in Candida yeasts
has a number of distinctive features as compared with the biosynthesis of
ergosterol in S. cerevisiae, well studied in this respect. This is apparently due to the
physiological and metabolic peculiarities of Candida species. A simple procedure
has been developed to isolate C. maltosa mutants defective in ergosterol
biosynthesis. A series of mutants of the C. maltosa strain VSB569 were selected for
their resistance to polyene antibiotic nystatin (>15 mg/rnl) after UV or chemical
(NA, MNNG, NQO, or HAP) mutagenesis (Durasova et al. 1986, 1989; Mikhailova
et al. 1987; Volchek et al. 1988). The composition of sterol fractions of 192 nystatin-
resistant mutants was studied by UV spectrometry, TLC, and GLC-MS. The data
obtained suggest that resistance of C. maltosa mutants to polyene antibiotics
like nystatin is associated mainly with changes in the composition of the
membrane sterols due to defects in ergosterol biosynthesis. Comparative analysis
of sterols from C. maltosa and S. cerevisiae mutants allows determining blocks
at different stages of ergosterol biosynthesis in some C. maltosa mutants, C24-
transmethylation, the formation of the double bond during C22 and Ll8 => Ll7
isomerization, 14a-demethylation, C-5(6)-dehydrogenation, or reduction of C-
14(15) and C-24(28) double bonds (Volchek et al. 1988; Durasova et al. 1991;
Mikhailova et al. 1991; Ogorodnikova et al. 1991).
4.2.3
Mutant Isolation in Candida maltosa
MNNG Mutagenesis
Note on Method. Methods for UV light or chemical mutagenesis of C. maltosa

strains have been published (Chang et al. 1984; Klinner et al. 1984; Casey et al.
1990). The elements of various mutagenesis protocols are similar to those
described in the laboratory manuals for S. cerevisiae (Campbell an Duffus 1988;
Goeddel1990; Rose et al. 1990; Guthrie and Fink 1991) and Candida yeasts (Kirsch
et al. 1990). Although these protocols for obtaining yeast mutants are applicable,
for the diploid/aneuploid yeast C. maltosa the total mutant yield (0.1-0.3% for UV
or MNNG, respectively) is considerably lower than that observed for haploid
yeasts like Y. lipolytica or S. cerevisiae, being in the range of 5-10% for MNNG.
Therefore enrichment procedures were applied to increase the mutant frequency
in C. maltosa (cf. Sect. 4.2.1).
Procedure for MNNG Mutagenesis
Take all necessary care for the work with the mutagen MNNG. Carry out
inactivation of MNNG solutions in 10% H2S0 4 for at least 24h.
1. Grow C. maltosa EH15 cells in 10ml YPD for 20-24h to a density of5 x 107 to 108
cells per ml (late exponential growth phase).
2. Wash with sterile 50mM phosphate buffer, pH 7, count the cell number, and
dilute with buffer to 4 x 107 cells/ml. Make samples of 0.5 ml of the diluted cell
suspensions.
3. Add 0.5 ml of freshly prepared MNNG (125-500,ug/ml) solutions in phosphate
buffer pH 7 to reach final concentrations of 62-250,ug MNNG/ml and starting
cell concentration of 2 x 107/ml.
4. Incubate at 30°C with slight shaking for 15 to 120 min, for determination of the
inactivation curves, to reach at least 90 to 99.9% of inactivation (10 to 0.1%
surviving cells).
5. Dilute the samples to the appropriate dilution with sterile 0.9% NaCI and plate
onto YPD agar. The dilution rate should be between 10-1 and 10-5 to have an
appropriate number (50 to 200) of surviving clones on one YPD plate.
6. Incubate 2-3 days at 30°C and count the surviving cells.
Select the desired mutants by replica plating onto minimal medium agar (see
below).
Selection and Classification of alk Mutants

Note on Method. The alk mutants are differentiated from the auxotrophic mutants
by testing their growth on minimal medium with n-alkanes (C IO ' C12, C16 ) or glucose
as carbon sources in comparison with the rich medium YPD using the replica-
plating technique. On the basis of the main alkane oxidation pathways (Fig. 3) alk
mutants can be classified according to Bassel and Mortimer (1982, 1985) into the
phenotypes atkA to alkE by substrate utilization tests on agar plates with different
alkane oxidation intermediates as carbon sources as follows:
Phenotype Growth on carbon source (chain lengths)
Alkanes Alcohols Aldehydes Fatty Acetate Glucose

acids or
(Cs, CIO) (C!2-ol) (C!2-al) (C!200H) ethanol
(C!2' C16 ) (C I6 -0l) (C I6 OOH)
Alk+ + + + + + +
alkA + + + + +
alkB + + + +
alke + + +
alkD + +
alkE +
Procedure
I. Prepare master plates of the cells after mutagenesis on YPD agar (100 clones per
plate).
2. Use these plates as templates for velvet pad replications onto YNB plates con-
taining as carbon sources either glucose (2%), octane, decane, dodecane, or
hexadecane (supplied in· the vapor phase by adding 150-300.u1 alkane to a filter
paper placed in the lid of the Petri dish), and onto YPD plates as the control for
the first selection.
3. After 4-5 days growth on YNB and 2 days on YPD plates, identify the alk and the
auxotrophic or glu mutants by comparison of the three plates.
4. Pick the mutants of with a needle and stab inoculate onto fresh YPD plates (50-
100 per plate).
5. After overnight growth, use these new master plates for replica plating onto a
range of YNB plates containing glucose, acetate, ethanol, fatty acids, fatty alde-
hydes, fatty alcohols, or n-alkanes (chain length see above) as carbon sources.
For a sufficient and comparable growth on all substrates in the agar plate
experiments at 30°C, the alkanes, dodecane" 1-01 and dodecanal are fed via the
gas phase. For other water-insoluble substrates, such as hexadecane-l-ol and
fatty acid$, the growth is supported by adding 1% Brij 35 together with 0.1 %
substrate to the minimal medium agar.
6. After 3-5 days growth classify the mutants into the alkA to alkE phenotypes in
this second selection. This selection should be repeated several times to isolate
stable mutants.
The determination of the spectrum of auxotrophic mutants showed a distribution
based on the length of biosynthetic pathways (but no phe, tyr, trp mutants oc-
curred at all), and a low percentage of double mutations, indicating also mainly
monogenic defects in the alk mutants. For more detailed characterization, alkA to
alkE mutants were selected, which showed high stability of the alk phenotype
(reversion rates to Alk+ smaller than 10-6 or 10-7) and of the auxotrophic markers
(Mauersberger 1991).
4.2.4
Classical Genetic Techniques for Candida ma/tosa
Because of the imperfect status of C. maltosa, the main classical genetic methods
requiring sporulation and mating, and successfully used for the genetic investiga-
tion of other yeasts (S. cerevisiae, Y. lipolytica, or P. guilliermondii, cf. other
chapters, this Vol.) are not applicable in C. maltosa. Thus, for C. maltosa, genetic
results can be obtained only by means of parasexual procedures. The establish-
ment of protoplast fusion technique for C. maltosa (Chang et al. 1984; Klinner et al.
1984; see Sect. 4.2.5) provided all prerequisites for a parasexual analysis. After
protoplast fusion, the following events may occur: immediate karyogamy, long-
lasting heterokaryosis, chromosomal rearrangements, enhanced mitotic recombi-

nation, or deletions. Mitotically stable fusion hybrids were obtained with frequen-
cies between 5 x 10-5 and 10-7 (Klinner et al. 1984; Klinner and Bottcher 1985;
Samsonova et al. 1987; Becher et al. 1991). Chang et al. (1984) reported even higher
fusant frequencies of 5 x 10-3 between ade and his mutants, but these hybrids were
very unstable. Complementation tests in C. maltosa were performed by protoplast
fusion for two nonallelic his mutations (Klinner et al. 1984). Later, Kunze et al.
(l987a,b) analyzed the complementation groups of 6 lys mutations in C. maltosa
by means of protoplast fusion. More recently, this method was applied to classify
the 13 leucine-auxotrophic mutants into five complementation groups (Becher et
al. 1991).
The frequency of spontaneous mitotic segregants in stable hybrids was insuffi-
cient for genetic analysis. Substances that are known to induce frequent mitotic
segregation in other yeast species such as benomyl (a benzimidazole derivative), p-
fluorophenylalanine, and griseofulvin were ineffective in C. maltosa. Acriflavin
enhanced the segregation frequency only slightly. Irradiation by UV induced mi-
totic segregation significantly up to 10%, mainly occurring as mitotic crossing over
(without chromosomal losses) in C. maltosa.1t is noteworthy that even the chemi-
cal mutagen MNNG induced mitotic segregation in C. maltosa L4 (Klinner et al.
1984; Bottcher 1987). The usefulness of hybridization by protoplast fusion and UV-
induced mitotic segregation for the genetic analysis of C. maltosa was tested. Based
on these methods, the construction of the linkage group I in C. maltosa with the
sequence CEN-ade-26-pro-1 was performed (Klinner et al. 1984; Samsonova et al.
1987).
Klinner and Bottcher (l985) demonstrated that in C. maltosa even chromo-
somal rearrangements can arise during hybrid formation after protoplast fusion,
resulting in differences in the mitotic segregation pattern between fusion hybrids
of one and the same fusion combination. The authors suggested that this process
was caused by transposable DNA elements which had been mobilized by proto-
plast fusion.
Whereas intraspecies fusion hybrids could be obtained in any case, interspecies
hybridization did not occur using C. maltosa, C. utilis, C. tropicalis, and P.
guilliermondii (Klinner and Bottcher 1987). The intergeneric fusion hybrids be-
tween C. maltosa and S. cerevisiae reported by Chang et al. (1984) were unstable,
probably existing only as an intermediate heterokaryonic state, as frequently ob-
served for other yeasts (Weber and Barth 1988). Attempts to polyploidize C.
maltosa or P. guilliermondii by protoplast fusion were not successful due to chro-
mosome loss immediately after fusion (Klinner and Bottcher 1987).
4.2.5
Method of Protoplast Fusion
Note on Method. Due to the lack of a sexual cycle in C. maltosa this yeast can only
be manipulated by parasexual processes. The method of protoplast fusion is a
useful tool for genetic analysis in C. maltosa, and was performed for
complementation analysis of auxotrophic mutants (Chang et al. 1984; Klinner et al.

1984; Kunze et al. 1987a; Becher et al. 1991; see also Chap. 2, this Vol.).
Procedure
1. Preparation of Protoplasts. Preparation of protoplasts of C. maltosa cells is
easily performed by using snail gut juice from Helix pomatia according to a
method described (Maraz et al. 1978). Sorbitol (1 M) is used as an osmotic
stabilizer. Freeze-dried snail gut juice is added to a final concentration of
100 mg/ml per 109 cells. Rates of 95% conversion to protoplasts are usually
obtained within 1 h of incubation at 30°C (Becher et al. 1991).
2. Protoplast Fusion. Fusion experiments in PEG solutions can be performed as
described by Becher and Bottcher (1983), Klinner et al. (1984), or Chang et al.
(1984): 5 x 107 protoplasts of each of the corresponding mutants are used for the
fusion experiments. The hybrid character of fusion products of several fusion
combinations can be confirmed by UV irradiation-induced mitotic segregation
according to Klinner et al. (1984).
4.3
Characterization of the Candida maltosa Genome
Compared to the situation of S. cerevisiae, the molecular biology of Candida yeast

including C. albicans, C. maltosa, and C. tropicalis has not been so intensively
investigated, although, especially during the past decade, several efforts have been
made and new successful results have been obtained. These alkane-utilizing yeast
species represent an interesting model for studies on imperfect yeasts (Kirsch et al.
1990).
4.3.1
Genome Characteristics and Ploidy
The first molecular biological characterization of the C. maltosa genome was done
in the beginning of the 1980s (Meyer et al. 1975; Kunze 1982; Chang et al. 1984;
Kunze et al. 1984a,b; Tables 8, 9). For the strain C. maltosa EH15, the molecular
mass of the haploid genome was experimentally determined from DNA
reassociation kinetics. The value for kinetic complexity of DNA was with approxi-
mately 8.1 x 109 Da relatively low in comparison with other yeasts. According to
these data, the C. maltosa DNA contains a high degree (19.9%) of repetitive se-
quences. The determined total DNA amount per cell was approximately 52 x 10-15 g
or 13 x 1O-15 g per haploid nuclear genome (Kunze et al. 1984a; Table 8). Addition-
ally, C. maltosa contains with 35% an extremely high amount of circular mitochon-
drial DNA (see Sect. 4.3.4). Its G + C content is with 22% lower than in several other
yeasts, whereas for the chromosomal DNA it is in the range (36-37%) obtained for
other Candida yeasts (c. tropicalis and C. albicans), but considerably lower than in
C. sake strains with 38-40% (Meyer et al. 1975; Su and Meyer 1991). Recent data on
Table 8. Genome characteristics of Candida maltosa
Characteristic DNA content Haploid size Reference

per cell" ofgenomeb
(relative)
Total DNA 52fg (100%) 8.1 x 109 Da Kunze et al. (1984a)

(= 13fg)
Chromosomal DNA
Content 34 fg (65%) 13fg Kunze et al. (1984a)
Size 14-20Mb Tanaka et al. (1987)
15.5fg Becher et al. (1991, 1994)
Chromosome 8-10 (11) Ohkuma et al. (1993c,
number 1995a)
GC% 36-37% Meyer et al. (1975)
Su and Meyer (1991)
Mitochondrial DNA
Content 18fg (35%) 2.8 x 109 Da Kunze et al. (1984a)
Size 51-52kb (total) Kunze et al. (1986a)
Molecular mass Su and Meyer (1991)
3.5 x 107 Da
Copies 80 per cell
GC% 21-22%
Plasmid DNA 0(0%) Kunze et al. (1984a)
DNA concentration 2.6 (for Kunze et al. (1984a)
(fg) per haploid nuclear DNA)
genome size of
chromosomal
DNA (fg)
Ploidy level 2n-3n, aneuploid Kunze et al. (1984a)
Transposons Not found, but suggested Becher et al. (1994)
Cloned genes
Sequenced See Table 11
Not sequenced ADE2,ARG4 Jomantiene et al. (1987)
ARS (two different fragments) Polumienko
and Grigorieva (1985)
ARSI and ARS2 Becher et al. (1991)
Kasiiske et al. (1992)
CYS2 (SerAT) Ohkuma (unpubl.)
Abbreviations: ADE2 - Posphoribosylaminoimidazole carboxylase (EC 4.1.1.21)

ARG4 - Argininosuccinate lyase (ASL)
ARS - Autonomously replicating sequence
CYS2 - Serine O-acetyItransferase (SerAT, EC 2.3.1.30), coded by CYSI and
CYS2 genes.
fg - femtogram (10-15 g).
Data obtained mainly for the C. maltosa strains EH15, L4, and IAM12247 (CBS5611)
a DNA content per cell determined experimentally.
bHaploid genome size determined as kinetical complexity of the chromosomal DNA per
haploid genome from DNA reassociation kinetics (Kunze et al. 1984a).
Table 9. Electrophoretic karyotype and chromosomal localization of several cloned genes

in Candida maltosa strain IAM12247 (CBS5611). Chromosomes were separated by pulsed
field gel electrophoresis (CHEF or OFAGE). The molecular sizes were estimated using the
chromosomes of S. cerevisiae as a standard, and genes were assigned by Southern blot
analysis (see Sects. 4.3.2-3, 4.4.4, and Fig. 5)
Chromosome no." Size (Mbp) Genes localized at the chromosome
VIII 2.20 CYP52A3-5, 9-11 (ALKl-3, 5, 7-8); POX5

VII 1.85 POX2, POX4
VI 1.47
V 1.28 HISS, ARS
IV 1.20 CYP52C2 (ALK6)b, LEU2b
III 1.15 LEU2b
II 1.10 CYP52C2 (ALK6)b, TRA (ARS, CEN)
I 0.88 CYP52D1 (ALK4)
For gene designation (see Table 11):

CYP52 (ALK): Alkane-induced P450 genes, Ohkuma et al. (1993c, 1995a).
POX genes: Peroxisomal acyl-CoA oxidases, Masuda (unpubl. results).
HISS, LEU2, TRA: Data of Tanaka et al. (1987).
"At least 8-10 chromosomal bands were separated in the C. maltosa strains L4 (Becher et al.
1991) and IAM12247 (Tanaka et al. 1987; Becher et al. 1994; Ohkuma et al. 1995a) using
OFAGE and CHEF techniques, respectively.
bBecher et al. (1991) demonstrated that at least two LEU2 genes situated on chromosomes
of different size (probably bands III and IV) occur in the genome of C. maltosa CBS5611
(IAMI2247), whereas LEU2 was located only on band III (1.15Mbp) in the strain L4. A
comparable feature was observed for CYP52C2 (ALK6) located at the two chromosomes II
and IV.
cloned genes from C. maltosa are in agreement with this. Other circular plasmids
were not detected in C. maltosa (Kunze et aI. 1984a, 1986b).
It is discussed that C. maltosa has a diploid or probably an aneuploid karyotype
with the average ploidy being approximately 2. Several molecular data give evi-
dence that this yeast has a highly aneuploid genome, suggesting that some chro-
mosomes are present in one copy, whereas others are present in more than one
copy, as proposed by different authors (Chang et aI. 1984; Bottcher 1987;
Samsonova et aI. 1987; Tanaka et aI. 1987; Becher et aI. 1991, 1994; Kawai et aI.
1991). Chang et aI. (1984) concluded from measurements of nuclear DNA content
by fluorescent microscope photometry and from UV -light inactivation curves that
C. maltosa IAM12247 should contain the same ploidy level as a diploid strain of S.
cerevisiae. The molecular data of Kunze et aI. (1 984a,b ) argue more strongly for the
aneuploid nature of C. maltosa EH1S than for a diploid state, for which a ploidy
level of 2.6 was calculated. Additionally, the results of both mutagenesis and
recombination suggest that C. maltosa is an extremely aneuploid yeast. Thus,
the mutant frequency in C. maltosa (0.1% auxotrophic mutants after chemical
mutagenesis; cf. Sect. 4.2) is generally less than expected for a haploid strain,
but still too high to be explained by mitotic recombination (mitotic crossing-
over, gene conversion, or nondisjunction and a corresponding segregational
homozygotization) in a diploid strain (Bottcher 1987; Samsonova et al. 1987;

Becher et al. 1991, 1994). The suggestion of an aneuploid genome for C. maltosa is
in good agreement with the view of the genome provided by the electrophoretic
karyotype analysis (Sect. 4.3.2). As discussed by Becher et al. (1994), the calculated
haploid genome size of at least 14Mbp (15.5 x 10-15 g) argues for a roughly triploid
status, even taking into account the high proportion of mtDNA (Kunze et al.
1984a) in C. maltosa. The aneuploid genome structure is supported by recent
sequence data for multiple alleles of the LEU2 gene and CYP52 genes and the
respective chromosome assignments of these genes (Ohkuma et al. 1993c, 1995a;
Becher et al. 1994; Table 9).
4.3.2
Electrophoretic Karyotype
Recently, alternating field electrophoresis using the methods of orthogonal field

alternation gel electrophoresis (OFAGE, according to Carle and Olson 1984) and
1 2
VI
v
IV
III
II Fig. 5. Electrophoretic karyotype of Candida
maltosa. Chromosomal patterns of C. maltosa
IAM12247 (lane 2) and S. cerevisiae AB1380 (lane
1) analyzed by CHEF as described in Sect. 4.3.3.
Chromosome bands I to VIII of C. maltosa are
shown on the right side (see also Table 9)
electrophoresis with a contour-clamped homogeneous electric field (CHEF, ac-

cording to Chu et al. 1986) have been applied for electrophoretic karyotyping of
the C. maltosa strains SBUG700 (L4), IAM12247 (CBS5611) and VSB899 (Tanaka et
al. 1987; Wedler et al. 1990; Becher et al. 1991, 1994, 1995; Ohkuma et al. 1993c,
1995a; see Sect. 4.3.3).
The genomic DNA of C. maltosa has been tentatively divided into 8 to 10 or 11
chromosomes (Table 9 and Fig. 5) using different conditions for the OFAGE and
CHEF techniques applied in different laboratories, compared with 13-16 chromo-
somes in S. cerevisiae. Some chromosomes were larger than the largest S. cerevisiae
chromosomes (1.6 Mbp). This is in agreement with data obtained for other Candida
yeasts, where the average sizes of chromosomes are higher while the numbers are
lower than in S. cerevisiae (Magee and Magee 1987; Kamiryo et al. 1991). The simple
addition of differently sized chromosomal bands of C. maltosa allowed an esti-
mated total haploid genome size of at least 14Mbp to the determined, calculated
according to size markers from S. cerevisiae chromosomes (Tanaka et al. 1987;
Becher et al. 1994). Taking into account the differences in the intensity of band
staining and the data mentioned above supporting aneuploidy, the total haploid
genomic size has been calculated to be between 17 and 19.9 Mbp (Tanaka et al. 1987;
Becher et al. 1994; Ohkuma et al. 1995a), which is approximately the same as the
haploid genome sizes of S. cerevisiae or C. tropicalis (Kamiryo et al. 1991).
The three C. maltosa wild-type strains so far analyzed, CBS5611 (IAMI2247),
L4, and VSB899, can be differentiated by their individual electrophoretic karyo-
type pattern (Becher et al. 1991, 1994). Under the same experimental conditions,
differences in size, number, and staining intensity of the chromosome bands were
detected among these strains and the leu2 mutant G587 derived from L4, indicat-
ing a high variability in the C. maltosa karyotype. Such polymorphism in chromo-
some band size was observed for C. albicans strains (Magee and Magee 1987).
Certain chromosomes of the strain C. maltosa L4 undergo frequent mitotic recom-
binations, which lead to changes in the number and size of chromosomal bands in
the electrophoretic karyotype (Becher et al. 1994).
4.3.3
Separation of Chromosomes by Pulsed Field Gel Electrophoresis
Note on Method. A method for separation of C. maltosa chromosomes by gel

electrophoresis with a contour-clamped homogeneous electric field (CHEF,
according to Chu et al. 1986) as applied in the authors' laboratory is given below
(Ohkuma et al. 1995a; Fig. 5). Recently, chromosome separation of different C.
maltosa strains by CHEF gel electrophoresis was also reported by Becher et al.
(1994, 1995). Alternatively, the method of orthogonal field alternation gel
electrophoresis (OFAGE) as described by Carle and Olson (1984) was applied for
electrophoretic karyotyping of different C. maltosa strains (Wedler et al. 1990;
Becher et al. 1991). Standard conditions in these reports were running times of48h
at 200V and pulse times of 180s. Separation of smaller chromosomes was more
efficient at a gel temperature of 13 °C, whereas the larger chromosomes were
separated better at 18°C (see also Chap. 3, this Vol.).
Procedure
1. Make a sample from a late exponential phase C. maltosa culture grown in YPD
medium.
2. Harvest the cells of 1.5 ml culture in an microcentrifuge tube and wash with
distilled water. Resuspend the cells in 21O,ul SCE buffer.
3. Add to the cell suspension 150.u1 of 25mglml Zymolyase 20T (Seikagaku
Kogyo Co.) in 1 M sorbitol and 50mM Tris-HCI (pH 8.0) solution and place at
42°C.
4. Add 1% low-melting agarose (FMC BioProducts) kept at 42°C and mix gently
but thoroughly.
5. Put this mixture into the chambers of the Bio-Rad CHEF sample mould and
allow to set at 4 dc.
6. Incubate the sample plugs in SCE buffer at 37°C for 5 h.
7. Incubate the plugs in 0.45M EDTA, O.OIM Tris-HCI (pH 8.0), 1% sodium
N-Iauroyl sarcosine, O.5mg/ml proteinase K (Seikagaku Kogyo) at 50°C
overnight.
8. Finally wash the agar plugs in 0.05M EDTA (pH 8.0), 0.01 M Tris-HCI (pH 8.0)
for 1 h and store at 4°C in this buffer.
9. Prepare CHEF gels from 1% agarose (SIGMA) in 0.5 x TBE buffer.
10. Load sample plugs into wells and seal with 0.5 x TBE solution containing
1% low-melting agarose and allow to set for 1 h in 0.5 x TBE buffer before
electrophoresis.
11. Run the gel with a Bio-Rad CHEF-DRII Megabase DNA Electrophoresis Sys-
tem. Carry out the electrophoresis in two steps at 14°C, with a 120-s pulse time
at 150V for 36h and a 180-s pulse time at 150V for 18h.
12. At the end of the run, stain the gel with 0.5.ug/ml ethidium bromide in 0.5 x
TBE solution for 30 min and destain for 1-3h in distilled water.
13. After photographing, subject the gel to irradiation of a UV transilluminator
(254nm) for 15 min, then depurinate by soaking in 0.25M HCI for 15min at
room temperture prior to a standard Southern transfer.
14. Carry out Southern blots of the CHEF gel using Hybond-W membrane
(Amersham) according to the instructions of supplier. The procedure of hy-
bridization and DNA probes used were the same as in the case of Southern
blots of genomic DNA of C. maltosa.
Buffers
SCE: 1M sorbitol, O.IM sodium citrate, 0.06M EDTA (pH 7.0),
0.1 M fJ-mercaptoethanol
1 x TBE: 90 mM Tris, 90 mM boric acid, 2 mM EDT A
4.3.4
Mitochondrial DNA
Mitochondrial (mt) DNA of C. maltosa EH15 was first isolated and further charac-
terized by Kunze et al. (1984a, 1986b), in order to develop an extrachromosomal
genetic system for this yeast. The mtDNA is circular, and the size estimated from
restriction analysis is approximately 52kb or 3.5 x lWDa. The total mass of
mtDNA in a single cell is about 2.8 x 109 Da (or 18 fg), with 35% representing a high
portion of total C. maltosa NDA. Thus, a copy number of about 80 per haploid
genome was calculated (Kunze et al. 1984a, 1986b; Su and Meyer 1991; Table 8).
The mitochondrial genome organization (size, restriction patterns, and gene
mapping) of several yeasts is different from that of C. maltosa. By its high molecu-
lar weight of mtDNA and its low GC content (21-22%), C. maltosa is distinguished
from C. tropicalis, other Candida species, and Lodderomyces elongisporus, for
which values of 25-30kb and 27-37 GC% were determined (Kunze et al. 1984a,
1986b; Su and Meyer 1991; cf. Sect. 1.1). Two C. maltosa strains analyzed by Su and
Meyer (1991) showed slight differences in restriction patterns of mtDNA. A restric-
tion map of the mtDNA from the strain U was constructed. Six structural genes
LrRNA, CYTB (COB), COXl, COX2, ATP6 (OL12), and ATP9 (OLll), encoding large
rRNA, apocytochrome b, cytochrome c oxidase subunits I and II, mitochondrial
ATPase subunits 6 and 9, respectively, were located on the C. maltosa chondriome
by cross-hybridization experiments with the corresponding genes of S. cerevisiae
(Kunze et al. 1986b). As known for most Candida species (Riggsby 1990), C.
maltosa also is a petite-negative yeast, without the ability to form respiratory-
deficient mutants on treatment with acriflavine (Bos and deBoer 1968).
4.4
Genes of Candida maltosa
4.4.1
Gene Cloning Strategies and Gene Libraries
Cloning Procedures. The strategies, their limitations, and problems ansmg in

cloning Candida genes, as discussed in detail by Kurtz et al. (1990) for C. albicans,
apply also to C. maltosa. The following main strategies were used for cloning of C.
maltosa genes:
Cloning via Gene Expression. This approach includes the isolation of genes through
the expression of a phenotype such as the complementation of a selectable
auxotrophic marker or the selection of a dominant resistance marker. The
complementation strategy can be realized by functional expression of the desired
C. maltosa gene in corresponding mutants of S. cerevisiae or/and E. coli, as shown
first for the LEU2 gene (Kawamura et al. 1983; Takagi et al. 1987; Becher et al.
1991), and later for ADEI and URA3 genes (Jomantiene et al. 1987, 1991;
Sasnauskas et al. 1991; Ohkuma et al. 1993a, cf. Table 15). Alternatively, a selection
of dominant selectable resistance marker genes (RIM-C, CYHR, FDHl) in wild-type

Saccharomyces strains was performed (Takagi et al. 1986b; Sasnauskas et al.
1992a,c). Additionally, gene expression cloning can be performed by detection of
protein products with an antibody. In this way, cytochrome P450 (CYPS2) or its
reductase (CPR) cDNA clones were obtained by immunoscreening in E. coli with
antibodies against purified proteins (Schunck et al. 1989a,b, 1991; Kargel et al.
1996).
As was recently demonstrated, serious problems for cloning and functional
expression of C. maltosa genes in heterologous systems may arise due to the
observed deviation from the universal genetic code in some Candida species
(Sugiyama et al. 1995; Zimmer and Schunck 1995; for details see Sect. 4.4.3). Now
the available host-vector systems for C. maltosa (Table 14, cf. Sect. 5) enable self-
cloning via gene expression in the homologous host and overcome the problems of
codon usage. So far, this method has been successfully applied to isolate HISS and
ADEI genes of C. maltosa IAM12247 (HOOji et al. 1989; Kawai et al. 1991) and is, on
the other hand, limited by restricted availability of characterized mutants in C.
maltosa. However, despite all uncertainties mentioned, there are compelling rea-
sons to choose expression strategies in heterologous and homologous systems for
cloning C. maltosa genes.
Cloning via Cross-Hybridization. As there are limitations to cloning genes via

expression (lack of mutants, and certain genes being toxic in yeast, when
overexpressed), this strategy becomes an important alternative. It includes
screening of either plasmid or bacteriophage A gene libraries with homologous or
heterologous DNA (genomic DNA fragments, cDNA, or oligonucleotides) probes
mainly by colony hybridization techniques. In this manner the C. maltosa genes
POX4, CYPS2, and PGKI were isolated (Hill et al. 1988; Takagi et al. 1989; Ohkuma
et al. 1991a,b, 1993c, 1994a; Masuda et al. 1994). The nucleic acid hybridization
strategies (including PCR-based methods) are probably the most commonly
employed techniques for isolation of genes coding for structurally well-conserved
protein or RNAs, or at least for enzymes, for which sufficient evolutionary
conservation is expected. Nevertheless, this methodology in no way assures the
experimentalist that the cloned sequence will encode the desired function.
Pseudo genes and related sequences are readily isolated by this method in addition
to the desired sequence.
Gene Libraries. For cloning of C. maltosa genes, several genomic DNA and cDNA
libraries, listed in Table 10, have been established. These libraries were constructed
mostly as partially Sau3AI digested genomic DNA fragments in both E. coli
(pBR322, pUC) and S. cerevisiaelE. coli shuttle vectors (YEpl3, YEp24, pL3, and
others). These shuttle vectors, e.g., YEpI3, contain origins of replication for both
species, the bla (AmpR) gene for selection in E. coli and the LEU2 gene for selection
in S. cerevisiae. Recently, gene banks were constructed in vectors (pTRAll,
pBTHI0B, pRA7) containing functional autonomously replicating sequences
(TRA fragment with ARS-CEN or ARS only) and homologous auxotrophic marker
Table 10. Gene libraries of Candida maltosa obtained in different laboratories
Donor Vectorsb DNA (G or C): No. of clones Reference

strain" (cloning restricted by (average insert
site) (c or p)c size) E. coli host
Genomic libraries
IAM12247 pBR322 G: BamHI, 6000-50000 Kawamura et al.
(BamHI, HindIII, (>1 kb) (1983)
HindIII, or Sal! (c) in C600
or Sal!)
IAM12247 YEp 13 G: Sau3AI (p) 20000 Takagi et al.
(BamHI) (5-6kb) (1986a)
in MC1061
lAM 12247 pTRAll G: Sau3AI (p) 16000 Sunairi et al. (1988)
(BamHI) (5-lOkb) Hikiji et al. (1989)
in JA221 Kawai et al. (1991)
IAM12247 pBTHlOB G: Sau3AI (p) 60000 Takagi et al. (1989)
(BglII) (5-10kb) Hwang et al. (1991)
in MC1061
IAM12247 pBTHlOBd G: Sau3AI (p) 2000 alkane Takagi et al. (1989)
(BglII) -induced clones Hwang et al. (1991)
from 60000d
IAM12247 AEMBL3 G: Sau3AI (p) 4 X 105 plaques Ohkuma et al.
(BamHI) (9-20kb) (1991b)
in LE392
IAM12247 YEp 13 G: Sau3AI (p) 20000 Ohkuma et al.
(BamHI) (3-9kb) (1993a)
in MC1061
VSB899 pUC19 G: Sau3AI (p) No data given Jomantiene et al.
(BamHI) (3.3-10kb) (1987)
VSB899 pL3 G: Sau3AI (p) No data given Sasnauskas et al.
(BamHI) (4-lOkb) (1991)
Jomantiene et al.
(1987, 1991)
VSB899 pRA7 G: Sau3AI (p) No data given Sasnauskas et al.
(BamHI) in HB101 (1992b)
L4 pUC9-TRPlI G: EeoRI (c) No data given Wedler et al.
ARSI (EeoRI) in HB101 e (1990)
L4 pEMBLYe31 G: Sau3AI (p) No data given Wedler et al.
(BamHI) in HB1Dl< (1990)
L4 YEp24 G: BamHI (c) No data given Wedler et al.
(BamHl) in HB101 e (1990)
L4 YEp24 G: Sau3AI (p) 11 000 clones Becher et al. (1991)
(BamHI) (5kb) in HB101
Table 10. (Contd.)
Donor Vectorsb DNA (G or C): No. of clones Reference

strain' (cloning restricted by (average insert
site) (c or p)C size) E. coli host
G587 (leu2)f pUC19 G: EeoR! (c) 10 000 clones Becher et aI. (1991)
(EeoRI) (5kb) in HB101 Becher et aI. (1994)
G587 (leu2)f pUC18 G: Sau3AI (p) 20000 (7kb) in Becher et aI. (1994)
(BamHI) XL#I-Blue
L4 CipLl G: EeoR! (c) 500 clones Becher et aI. (1991)
(EeoRI) in HB101
cDNA library
EH15 pUC119 C: Alkane- 100000 Schunck et aI.
(HindU) grown cells (0.3-3.0kb) (1989a,b)
in DH5ac
a For the donor (wild-type) strains cf. Table 1.

bShuttle vectors for C. maltosa and E. coli: pTRAll, pBTH1OB, pRA7, CipLl (Candida
integrative plasmid LEU2) CrLp 1 (Candida replicative LEU2 plasmid); for vectors see Table
14. Shuttle vectors for S. eerevisiae and E. coli: YEp13, YEp24, pL3 (high copy yeast shuttle
vector), pEMBLYe31, pUC9-TRPlfARSl.
C Abbreviations: G - Genomic (chromosomaI) DNA of C. maltosa,
C - cDNA obtained from mRNA of C. maltosa,
c - complete digestion,
p - partiaI digestion.
d Alkane-induced clones obtained after differential screening of the genomic library in
. pBTH10B with cDNA probes obtained from alkane-grown and glucose-grown cells, respec-
tively (Takagi et aI. 1989; Hwang et aI. 1991).
"Two of three libraries constructed contained the whole C. maltosa genome with 99%
confidence.
fLibrary constructed to clone the leu2 mutant gene (Becher et aI. 1991), and to clone silent
allelic variants of LEU2 (Becher et aI. 1994).
genes (CmADEl, CmHIS5, CmLEU2, or ScLEU2) suitable for self-cloning in C.

maltosa (Tables 10, 14). For cloning of alkane-induced genes, a cDNA library using
mRNA from alkane-grown cells was constructed (Schunck et al. 1989a,b).
Alternatively, such clones were isolated after differential screening of a genomic
library constructed with pBTHlOB with two kinds of cDNA population as probes,
obtained from glucose- or tetradecane-grown cells (Takagi et al. 1989; Hwang et al.
1991). Some of the C. maltosa gene libraries shown in Table 10 were not described
in detail, although the authors were able to isolate genes from them successfully. It
is therefore possible that some of these libraries do not contain a complete
representation of the C. maltosa genome.
4.4.2
Cloned Genes and Regulation of Their Expression
The isolated genes of C. maltosa are listed in Tables 8 and 11. For the designation
of C. maltosa genes, the nomenclature rules developed for S. cerevisiae and applied
to other Candida yeasts were followed. To discriminate between Candida
(maltosa) and Saccharomyces (cerevisiae), the gene names in literature and data
bases sometimes start with Cm, Cor C-, e.g., CmLEU2 or C-LEU2 for the LEU2 gene
of C. maltosa, instead of LEU2 for the S. cerevisiae gene. For most of these cloned
genes (Table 11) the nucleotide and amino acid sequences are available from data
bases (EMBL, Genbank, DDBJ Nucleotide Sequence Databases, or SwissProt), ex-
cluding the cloned genes ADE2, ARG4 (Jomantiene et al. 1987), several ARS frag-
ments (Polumienko and Grigorieva 1985; Becher et al. 1991; Kasiiske et al. 1992),
and CYS2 (Ohkuma, unpubl. data), for which no sequences have been published
yet (see Table 8).
Genes of Biosynthetic Enzymes

The auxotrophic marker genes ADEl, ADE2,ARG4, CYS2, HISS, LEU2 and URA3
coding for biosynthetic enzymes in the intermediary metabolism have been cloned
from C. maltosa, and are now available as markers in transformation (Tables 11,
15). Additionally, some heterologous marker genes from S. cerevisiae and C.
albicans are functioning in C. maltosa and vice versa (Table 16, cf. Sect. 5).
Table 11. Genes isolated and sequenced from the yeast Candida rnaltosa. For sequences
that have not been published their appearance in the data bases with the remark
(unpublished) was used as reference.
Gene Trivial Accession Isolated Reference

symbol' name or no.b from strain
function' (length) (as G or C),
ADEI SAICAR M58322 VSB899 (G) Sasnauskas et aI. (1991)

synthetase (2540bp) Jomantiene et aI. (1991)
DOO855 IAM12247 (G) Kawai et aI. (1991)
(1820bp)
X74785-88 SBUG700 (L4) Becher et aI. (1995)
(4 variants) G374 (adeI)
ALII Ubiquinone M61102 IAM12247 (G) Hwang et aI. (1991)
oxidoreductase (2689bp) Souza et aI. (1993)
subunit with POXlll"
ARS ARS (196bp) D00l36 IAM12247 (G) Kawai et aI. (1987)
fragment (196bp pt)
ARS ARS (150bp) M58330 VSB899 (G) Sasnauskas et aI. (I 992b)
andORpd (1331 bp) Jomantiene et aI. (1987)
CEN Centromere D29758 IAM12247 (G) Ohkuma (1994, unpubl.)
(ARS and GEN) (1489bp) Ohkuma et aI. (1995e)
GHSI Chitin D29760 IAM12247 (G) Ohkuma et aI. (1994,
synthase (603 bp pt) unpubl.)
GHS2 Chitin D29761 IAM12247 (G) Ohkuma et al. (1994,
synthase (597bp pt) unpubl.)
Table 11. (Contd.)

function' (length) (as G or C),
CHS3 Chitin D29762 IAMI2247(G) Ohkuma et aI. (1994,

syntbase (355bp pt) unpubl.)
CPR NCCR X76226 EH15 (C) Kargel et aI. (1993,
(2230bp) unpubl., 1996)
CPR NCCR D25327 IAM12247 (G) Ohkuma et aI. (1993,
(2827bp) unpubl., 1995c)
CYW CYHR protein M64932 VSB899 (G) Sasnauskas et aI. (1992c)
(deduced) (2384bp)
CYP52A subfamily" Alkane and fatty acid hydroxylation
CYP52A3 P4S0Cm1 XS1931 EH1S (C) Schunck et aI. (l989b,

(1667bp) 1991)
ALKI-A DOO481 IAM12247 (G) Takagi et aI. (1989)
(2803bp)
ALKI-B D12475 IAM12247 (G) Ohkuma et aI. (l991a)
(2047bp)
CYP52A4 P4S0Cm2 XS1932 EH1S (C) Schunck et aI. (1991)
(1787bp)
ALK3-A XS5881 IAM12247 (G) Ohkuma et aI. (l991b)
ALK3-B DI271S IAM12247 (G) Ohkuma (1992, unpubl.)
(609bp pt) Ohkuma et aI. (l995a)
CYP52A5 ALK2-A X55881 IAM12247 (G) Ohkuma et aI. (l991b)
ALK2-B D12714 IAM12247 (G) Ohkuma (1992, unpubl.)
(342bp pt) Ohkuma et aI. (l995a)
CYP52A9 ALK5-A DI2717 IAM12247 (G) Ohkuma (1992, unpubl.)
(2499bp) Ohkuma et aI. (1995a)
(283 bp pt) Ohkuma et aI. (l995a)
CYP52AlO ALK7 D12719 IAM12247 (G) Ohkuma (1992, unpubl.)
(5525 bp) Ohkuma et aI. (l995a)
CYP52All ALK8-A DI2719 IAM12247 (G) Ohkuma (1992, unpubl.)
(5525bp) Ohkuma et aI. (1995a)
(81Sbp pt) Ohkuma et aI. (l99Sa)
CYP52C subfamily" Unknown function
CYP52C2 ALK6-A Dl2718 IAM12247 (G) Ohkuma (1992, unpubl.)

(2196bp) Ohkuma et aI. (l995a)
CYP52D subfamily" Unknown function
CYP52Dl ALK4 D12716 IAM12247 (G) Ohkuma (1992, unpubl.)

(2393 bp) Ohkuma et aI. (l995a)
FDHI FAHR MS8332 VSB899 (G) Sasnauskas et al. (1992a)
(2258 bp)
GALl/GALlO Galactokinase D297S9 IAM12247 (G) Park et al. (1994,
Gal epimerase (2034bp) unpubl.)
(promoter region) Park et aI. (1996)
HIS5 HPAT X17310 IAM12247 (G) Hikiji et aI. (1989)
(second ORF) (1923 bp)
LEU2 3-IPMDH X05459 IAM12247 (G) Takagi et aI. (1987)
(2193 bp)
X72939 1.4 (G) Becher et aI. (1991)
4 allelic (2200bp) Becher et aI. (1994)
variants X72937 G587 (G) Becher et al. (1994)
of LEU2 (2225bp)
(one mutant) X72938 GS87 (G) Becher et aI. (1991)
(2199bp) (mutant allele) Becher et aI. (1994)
X72940 GS87 (G) Becher et al. (1994)
(2193 bp)
Table 11. (Contd.)

function' (length) (as G or C)'
PGKl PGK Dl2474 IAM12247 (G) Masuda et al. (1994)

(2594bp)
POX2 Acyl-CoA D21228 lAM12247 (G) Masuda and Takagi
oxidase (2723bp) (1993, unpub!.)
POX4 Acyl-CoA X06721 ATCC20184 (G) Hill et al. (1988)
oxidase (2975bp)
POXl8 Oleate inducible M61102 IAM12247 (G) Hwang et al. (1991)
peroxisomal (2689bp)
protein with ALIld
RIM-C Ribosomal D90488 IAM12247 (G) Takagi et al. (1986b)
(L4lQ) protein L41 (1141 bp) Kawai et al. (1992)
(L41Q-type) D43686 Mutoh et al. (1995)
(LEL4l) (L41P-type) M62396 lAM12247 (G) Kawai et al. (1992,
(L4lP) D43686/87 unpub!.) Mutoh et al.
(1995)
SSRR Small subunit D14593 IAM12247 (G) Ohkuma et al. (1993b)
rRNA (ml4bp)
SETR tRNAS.'CAG D26074 IAM12247 (G) Sugiyama et al. (1995)
gene (312bp)
URA3 OPDCase D12720 IAM12247 (G) Ohkuma et al. (1993a)
(1274 bp)
'Abbreviations for gene names in the date bases mostly start with Cm, Cor C-, e.g., CmLEU2 or C-LEU2 for the LEU2
gene of C. maltosa, to discriminate between Candida (maltosa) and Saccharomyces (cerevisiae) genes.
Abbreviations and designations for the genes and the corresponding gene products
ADEl - Genes for the phosphoribosyl-aminoirnidazole-succinocarboxamide-synthetase or SAl CAR synthetase (EC
6.3.2.6), obviously existing in allelic variants (Becher et al. 1995)
ALIl - Alkane inducible protein, with high homology to NADH ubiquinone oxidoreductase subunit (EC 1.6.5.31
1.6.99.3) precursor (30.4 kDa), Souza et a!. (1993)
ALK - Alkane-inducible genes for cytochrome P450
ARS - Autonomously replicating sequence
CEN - Centromere region: TRA Pstl-EcoRI fragment containing ARS and CEN (see Fig. 7)
CHS - Chitin synthase, different genes CHSl, CHS2, CHS3
CPR - Gene for the NADPH cytochrome P450 (cytochrome c) reductase (NCCR, EC 1.6.2.4)
CY1fR - Gene for the cycloheximide resistance (CYHR) protein
FDHl - Formaldehyde resistance (FADR) gene, coding for a glutathione dependent formaldehyde dehydrogenase
(EC 1.2.1.1), with high homology to mammalian ADHIII class genes
HISS - Gene for histidinol-phosphate amino transferase (HPAT, EC 2.6.1.9)
LEU2 - Gene for 3-isopropylmalate dehydrogenase (3-IPMDH, EC 1.1.1.85)
PGKl - Gene coding for phosphoglycerate kinase (PGK)
POX - POX2 and POX4 genes coding for peroxisomal acyl-CoA oxidase (AOX, EC 1.3.99.3) forms (PXP2 and
PXP4)
RIM-C - Ribosome modification by cycloheximide, coding for the L41Q-type protein (resistant); in contrast to
LEL4l coding for the L41P-type protein (sensitive to cycloheximide)
SSRR - Gene for small subunit ribosomal RNA (CmSSRR)
SETR - tRNA'''CAG gene - responsible for translation of the CUG codon as serine
URA3 - Gene for the orotidine-5' -phosphate decarboxylase (OPDCase, EC 4.1.1.23).
b The nucleotide sequence data appeared in the EMBL, Genbank and DDB) Nucleotide Sequence Databases; Sequence
lengths given in bp, pt - partial sequence.

'Genes isolated from genomic DNA (G) or eDNA (C) libraries, respectively. For donor strains cf. Tables 1 and 6.
d ALIl and POXl8 are located together at the same cloned fragment (Hwang et al. 1991) The ARS sequence is located
in the neighborhood with an ORF encoding a polypeptide with high homology (70%) to the small ribosomal subunit
protein No. 15 (RSI5) of Brugia pagangi and contains an intron with canonical sites for correct splicing (Sasnauskas
et al. 1992b).
'CYPS2 family in the CYP gene superfamily: alkane-inducible cytochrome P450 genes (P450alk genes) of yeast. Gene
symbols are given according to the recommended nomenclature system for P450 genes (Nelson et al. 1993). A and B
represent the allelic variants found for the genes ALKl, ALK2, ALK3, ALKS, and ALK8, respectively. Other members
of the subfamily CYPS2 have been isolated from Candida tropicalis (Seghezzi et al. 1991, 1992) and Candida apicola
(Lottermoser et al. 1994).
LEUl (3-lsopropylmalate Dehydrogenase). Several allelic variants of the LEU2 gene

coding for 3-IPM dehydrogenase (EC 1.1.1.85, ORF of 373 aa) have been isolated
from wild-type and mutant strains of C. maltosa (Kawamura et al. 1983; Takagi et
al. 1987; Becher et al. 1991, 1994; Table 11). The LEU2 gene was first cloned form C.
maltosa lAM 12247 by complementation of the corresponding mutations leuB in E.
coli (C600) and leu2 in S. cerevisiae strains AH22 or SHY3 (Kawamura et al. 1983;
Takagi et al. 1987; cf. Table 15). This and the LEU2 gene (CipLA) recently cloned by
expression in E. coli (Becher et al. 1991, 1994) from the strain L4 have 99.9%
homology over 2213 bp. The clone CipLA has been successfully used for
complementation of the leu2 mutation in the strain G587, a leu2 mutant derived
from L4. Additionally, three different alleles of the LEU2 gene were cloned by
colony hybridization from C. maltosa G587, among them two functionally active
LEU2 genes (CipLEa and CipLS) and the leu2 mutant allele CipLEb (Becher et al.
1991, 1994; Table 11). Sequence comparison of the four alleles revealed about 2-
2.5% interallelic divergence in the coding and noncoding nucleotide sequences,
leading also to ten amino acid changes in the individual ORF for 3-IPM
dehydrogenase. Polymorphism of the LEU2 genes with at least two alleles was
demonstrated also for the wild-type strain L4. These data argue strongly for an
aneuploid genome with multiple LEU2 alleles. The cloning of two functionally
intact wild-type LEU2 genes from the leu2 mutant strain G587 let the authors
suggest the presence of silent gene copies in C. maltosa L4 (Becher et al. 1994),
which might be one possibility to explain the occurrence of AP A changes (see Sect.
4.2.2). The LEU2 gene of C. maltosa, like that of C. utilis and C. tropicalis, is
considerably identical at both the nucleotide (72%) and amino acid (76%) levels
with the LEU2 gene of S. cerevisiae (Takagi et al. 1987; Becher et al. 1991}.
Interestingly, this homology might not be enough to ensure cross-hybridization
cloning using high stringent conditions, as demonstrated for the C. albicans LEU2
gene, although it can complement the corresponding mutations of S. cerevisiae
and E. coli (Kurtz et al. 1990).
ADEl (Phosphoribosyl-Aminoimidazole-Succinocarboxamide-Synthetase). The

genes ADEl encoding SAICAR synthetase (EC 6.3.2.6) and ADE2 (phosphoribosyl-
aminoimidazole-carboxylase, EC 4.1.1.21} of C. maltosa VSB899 were first cloned
by complementation of the corresponding mutations in S. cerevisiae (Jomantiene
et al. 1987), although sequence data were published only for ADE1 (Jomantiene et
al. 1991; Sasnauskas et al. 1991). At the same time the ADE1 gene of the strain
IAM12247 was cloned by complementation of adel mutation (self-cloning) in C.
maltosa (Kawai et al. 1991}. These two sequences for the ADE1 coding regions are
100% identical over 1668bp but differ in the 5'-upstream regions. Recent
sequencing data (Becher et al. 1995; Table 11) give evidence that the ADEl gene
exists in allelic variants in C. maltosa L4, as previously reported for LEU2. Four
different ADEl alleles (with up to 8% divergence) have been sequenced from one
prototrophic strain, which show some differences to the mentioned identical genes
at both nucleotide and deduced amino acid leves. The C. maltosa ADE1 genes are
used in the host-vector systems for this yeast in different laboratories (cf. Sect. 5
and Table 14).
HISS (Histidinol-Phosphate Amino Transferase). The C-HISS (HPAT, EC 2.6.1.9) was
the first gene obtained by self-cloning via complementation of the hisS mutation in
C. maltosa strain CHI using a previously established host-vector system for this
yeast, and was then used for its further improvement by constructing the pBTH
vectors series (Hikiji et al.1989; cf. Sect. 5 and Table 14). The HISS gene contains
downstream a second noncharacterized ORF, and it complements also the
corresponding hisS mutation in S. cerevisiae, although the amino acid homology
(389 aa) is relatively low with 51% (cf. Table 15).
URA3 (Orotidine-S'-Phosphate Decarboxylase). The C-URA3 gene coding for the
OPDCase (EC 4.1.1.23) has been cloned by complementation in the corresponding
ura3 mutant of S. cerevisiae (Ohkuma et al. 1993a). The URA3 or C. maltosa has the
highest homology to the corresponding C. albicans gene, 76% for the nucleotide,
and 84% for the deduced aa sequences. The S. cerevisiae URA3 gene is with 65 and
72%, respectively, more distantly related. The isolated URA3 gene was used to
construct a triple auxotroph (hisS adel ura3) as a useful host for genetic
engineering of C. maltosa (Ohkuma et al. 1993a; cf. Tables 6, 14).
CYS2 (Serine O-Acetyltransferase). More recently CYS2, one of the two genes CYSI
and CYS2 coding for the serine O-acetyltransferase (SerAT, EC 2.3.1.30), has been
cloned and applied for the development of the host-vector system in C. maltosa
(Ohkuma 1993, unpubl.; cf. Tables 6, 8, 14).
The auxotrophic marker gene ARG4 of C. maltosa VSB899 was cloned by
complementation of the corresponding mutations in S. cerevisiae (Jomantiene et
al. 1987), but no sequence data have been published yet.
CHS (Chitin Synthase Genes). The genes CHSl, CHS2, and CHS3 involved in
the biosynthesis of the cell wall component chitin in yeast have been cloned
recently by homology screening from C. maltosa IAM12247, and partial sequences
were obtained (Ohkuma 1993, unpubl.). These three different CHS genes coding
for chitin synthease 1-3 (chitin synthetase-chitin-UDP acetylglucosaminyl-
transferase) in yeast, the enzymatic activity responsible for polymerizing N-
acetylglucosamine into the structural cell wall polysaccharide, chitin, have been
described already for S. cerevisiae and C. albicans. They probably play an essential
role in the determination of yeast cell morphology, in particular in yeast-hyphal
transition (Sudoh et al. 1993).
Genes of Carbon Source Catabolism: Alkane Metabolism

The Cytochrome P4S0 Gene Subfamily CYPS2 and Its Reductase Gene CPR. The key
role of P450s in the degradation pathway of alkanes and fatty acids has been
discussed already in Sects. 2.5.3 and 3.4 (cf. Fig. 3). Alkane-inducible P450 genes
(P450alk, ALK, or CYPS2) in C. maltosa were first cloned from alkane-induced
cDNA and genomic DNA libraries of the strains EH15 (Schunck et al. 1989a,b) and
IAM12247 (Takagi et al. 1989) by immunoscreening and colony hybridization,
respectively. These two nearly identical GYP53A3 clones (first named P450Cml
and ALKl, with 98% aa identity) exhibit high homology to the P450 alk genes of C.
tropicalis (57% aa identity to P450 alkl; Sanglard and Loper 1989), but quite low
homology to the GYP5l (P450 14DM ) of S. cerevisiae or C. tropicalis (17-18%).
First evidence for thE; presence of a multigene family (GYP52) of P450alk genes
in yeasts has been provided by Sanglard and Fiecher (1989) for C. tropicalis
(GYP52Al, GYP52A2) and in our laboratories for C. maltosa (Schunck et al. 1991)
after the expression of two cloned P450alk genes (cDNAs named P450Cml and
P450Cm2) in S. cerevisiae and after gene disruption of both alleles of the first
cloned P450alk (ALKl) gene (Ohkuma et al. 1991a). Further cloning revealed the
presence of additional alkane-inducible P450 genes in C. maltosa (Ohkuma et al.
1991b, 1993c, 1995a,b,d). Resembling the situation in C. tropicalis (Seghezzi et al.
1991, 1992), the GYP52 family of C. maltosa consists of 14 P450alk-related se-
quences, representing eight genes and five of their alleles (Table 11, Fig. 6). Accord-
ing to the recommended nomenclature system, these P450 genes are members of
the GYP52 family in the GYP gene superfamily, containing more than 300 indi-
vidual P450 genes in 36 families (Nelson et al. 1993). Trivial names introduced by
us relate to the nomenclature system of the CYP52 family as follows: P450Cml and
ALKl (GYP52A3), P450Cm3 and ALK2 (GYP52A5), P450Cm2 and ALK3
P450CM1
(58%)
P450CM2
,--
---1 (66%)
P450CM3
'-- (61%)
P450ALK5
(65%)
r---
-
P450ALK7
(94%)
P450ALK8
(55%)
P450ALK4
(38%)
P450ALK6
Fig.6. Members of the cytochrome P450 family CYPS2 in Candida rnaltosa. Dendrogram of
the alignment of the amino acid sequences derived from the cloned CYPS2 genes. Alignment
performed with the PCgene program. The values in parentheses show the homology
percentage of the both neighboring P450 proteins. Trivial gene or protein names relate to
the recommended nomenclature system of the CYPS2 family (Nelson et al. 1993); P450CM1
and ALKl (CYPS2A3), ALK2 or P450CM3 (CYPS2AS), P450CM2 and ALK3 (CYPS2A4),
ALK4 (CYPS2D1), ALKS (CYPS2A9), ALK6 (CYPS2C2), ALK7 (CYPS2AlO), ALKS
(CYPS2All)
(CYPS2A4), ALK4 (CYPS2D1), ALKS (CYPS2A9), ALK6 (CYPS2C2), ALK7

{CYPS2AlO),ALK8 (CYPS2All). Allelic variants (designatedALKI-A andALKI-B)
were found for the CYPS2 genes ALKl, ALK2, ALK3, ALKS, and ALK8, respectively
(Ohkurna et al. 1991b, 1993c, 1995a). These allelic P450 protein sequences showed
94-98% homology. Interestingly, an additinal cDNA clone encoding the same
P450Cml protein with several nucleotide exchanges in the third codon position
only was detected (Schunck et al., unpubl.). Two sets, each consisting of two genes
(both alleles of ALK2 and 3, and ALK7 and 8-A), were tandemly arranged in the
genome (cf. Sect. 4.4.4). Thus, the CYPS2 family probably reflects an adaptation to
the utilization of different hydrocarbons and is assumed to be a result of gene
duplications and divergent evolution from an ancestral gene. The homologies of
the encoded nonallelic P450 poteins are mostly in the range of 55 to 65% (Fig. 6),
except for the higher values with P450 pairs encoded by the tandemly arranged
genes ALK2/ALK3 (66%) and ALK7/ALK8 (94%), and for the lower homology
values of ALK4 (48-55%) and ALK6 (38-41%) being therefore classified to sub-
families CYPS2D and CYPS2C, respectively. The six genes (ALKl-3 and ALKS, 7, 8)
showing relatively higher similarities to each other than to ALK4 and ALK6 were
thus classified in the subfamily CYPS2A. All CYPS2A genes were assigned to the
same chromosome (cf. Table 9, and Sect. 4.4.4).
Other members of the family CYPS2 have been isolated from C. tropicalis (seven
nonallelic genes, Seghezzi et al. 1992) and C. apicola (two CYPS2E genes,
Lottermoser et al. 1994). The presence of such an extended P450 family as dis-
closed in alkane-assimilating yeast species resembles the situation in higher eu-
karyotes but is a so far unique example among microorganisms. A distinct
relationship of several members of CYPS2 with that of the CYP4 and CYP102
families (mammalian and bacterial fatty acid hydroxylating P450 forms) was
observed (Ohkuma et al. 1991b; Schunck et al. 1991).
The enzymatic functions attributed so far to individual C. maltosa P450 forms
are the primary hydroxylation of alkanes and the co-hydroxylation of fatty acids
(see Sect. 2.5). First attempts to investigate the substrate specificity of individual
P450 forms have been done by means of their heterologous expression is S.
cerevisiae (Schunck et al. 1991; Scheller et al. 1992, 1994). Recently, an efficient
P450/reductase co expression system could be established which allowed the high-
level coproduction of authentic P450 forms and the homologous redox partner and
led to the characterization offour C. maltosa P450 forms (Cm1 or ALKl, Cm2 or
ALK3, ALK2 or Cm3, and ALKS) with respect to their substrate specificities toward
various alkanes and fatty acids. Each of these P450 forms seems to have its own
individual substrate specificity with respect to the preferred type (n-alkane or fatty
acid) and chain length of the substrate (Zimmer et al. 1995; Scheller et al. 1996; cf.
also Sect. 2.5). A problem that complicates these studies, however, is the fact that
C. maltosa exhibits a deviation from the universal genetic code: the codon CUG is
read as serine instead ofleucine (Sugiyama et al. 1995; Zimmer and Schunck 1995;
see Sect. 4.4.3). Therefore, C. maltosa genes containing the corresponding triplet
have to be corrected according to the universal genetic code in order to produce
the authentic P450 proteins in S. cerevisiae.
The P450 forms mainly involved in alkane degradation are ALKl-3 and ALK5,
as demonstrated by their high alkane inducibility (Ohkuma et al. 1993c, 1995a) and
by recent stepwise disruption of these genes and their alleles in the genome, an
independent approach applied to reveal the in vivo function of C. maltosa P450
forms. A strain DA1235 in which all of these four genes were disrupted could not
assimilate n-alkanes of any chain length (Ohkuma 1993; Ohkuma et al. 1993c,
1995d). This strain has been used recently to identify the role of individual P450
forms after their plasmid-based expression for growth of C. maltosa on different
alkanes (Ohkuma and Zimmer, unpubl.). The function of the P450 genes ALK4 (a
probable pseudogene) and ALK6 to ALK8 is completely unknown yet. It may be
speculated that these P450 forms are involved in the oxidation of other alkane-
related compounds or even of aromatic substrates.
Although all P450alk genes, except for ALK4, are more or less induced by
n-alkanes, but repressed by glucose and not by glycerol, their inducibilities by
some other aliphatic carbon sources (fatty alcohols, aldehydes, and acids) showed
variabilities. The main regulatory step is the transcriptional level (Schunck
et al. 1987b; Ohkuma et al. 1991b, 1995a). Oxygen limitation during cultivation
on alkane caused a superinduction of P450alk (cf. Sect. 2.5). Several cis-acting
elements probably regulated by carbon sources were found in the promoter
region of ALKI and ALK3 genes. Two upstream activation sequences (UAS), re-
sponsible for induction by alkanes, and one upstream repression sequence (URS),
responsible for repression by glucose, were defined (Muraoka et al. 1993; Takagi
1993).
CPR genes for the NADPH-P450 (cytochrome c) reductase (NCCR, EC 1.6.2.4)
were recently cloned from alkane-induced cDNA and genomic DNA libraries of
the C. maltosa strains EH15 (Kiirgel et al. 1996) and IAM12247 (Ohkuma et al.
1995c), respectively. The two nearly identical clones (99% aa identity) exhibit high
sequence homology to the CPR gene of C. tropicalis (86%), but quite low homology
to the CPR of S. cerevisiae (49%). The CPR, and also the POX genes, are, as well as
the P450 genes, inducible by growth of C. maltosa on alkanes.
Homologous or heterologous expression of individual CYP52A or CPR genes in
C. maltosa or in S. cerevisiae under the control of the corresponding GALl-GALl 0
promoters led to a dramatic proliferation of ER structures (Schunck et al. 1991;
Wiedmann et al. 1993; Menzel et al. 1994, 1996; Kiirgel et al. 1996; Ohkuma et al.
1995b). The molecular mechanisms of these membrane proliferation processes are
very interesting for future study (see Sects. 3 and 5.3).
POX - Peroxisomal Protein (PXP) Genes. Hill et al. (1988) first cloned the POX4 gene,
encoding one form of alkane- or fatty acid-inducible fatty acyl-CoA oxidases
(AOX, EC 1.3.99.3), the first enzyme in peroxisomal ,B-oxidation in yeast (see Fig.
3), from C. maltosa ATCC20184 by cross-hybridization with a cDNA probe coding
for the C-terminus of the C. tropicalis AOX gene Ct-POX4. The deduced protein
(PXP-4, 709 aa) exhibited 83 and 59% aa similarities to the POX4 and POX5 genes
of C. tropicalis, respectively. Later, POX2 coding for a different peroxisomal AOX
form (protein PXP-2) were cloned and the presence of a third gene POX5 was
demonstrated by DNA hybridization techniques (Masuda and Takagi 1993,
unpubl.; cf. Tables 9, 11), resembling the situation observed for C. tropicalis
(Kamiryo et al. 1989; Rachubinski 1990).
Another peroxisomal gene POX18 is located together with the ALIl gene (see
below) at a fragment of an alkane-inducible, highly expressed clone TIG 1, found in
a genomic library by differential colony hybridization with eDNA (alkane/glucose)
probes (Hwang et al. 1990. This Cm-POX18 gene is transcribed in alkane-, fatty
alcohol- and fatty acid-grown cells and encodes a deduced protein (127 aa) with
very high homology of 94.5% to the small oleate-inducible peroxisomal protein
PXP-18 of C. tropicalis, that was demonstrated to be a peroxisomal nonspecific
lipid-transfer protein (Tan et al. 1990).
ALI1 (NADH Ubiquinone Oxidoreductase Subunit). The gene ALIl was first
designated as coding for an alkane-inducible protein due to its tandemly location
together with POX18 (see above) at the same fragment of an alkane-inducible,
highly expressed clone TIGI (Hwang et al. 1991). From gene disruption
experiments, it was concluded that ALIl was essential for alkane assimilation by C.
maltosa, although it was not induced by alkanes. Recently, it was shown that the
gene product of ALIl (276 aa) has extensive homology to a 30kDa subunit
precursor of respiratory complex I (NADH ubiquinone oxidoreductase, EC 1.6.5.31
EC 1.6.99.3) known from other organisms (Souza et al. 1993). The deduced protein
contains an N-terminal sequence that suggests a mitochondrial localization and
indicates its role as being essential for mitochondrial respiration in alkane
assimilation.
Genes of Carbon Source Catabolism: Carbohydrate Metabolism

GAL 7 (Galactokinase}IGAL 70 (UDP-Galactose Epimerase). These two highly
inducible genes of the yeast galactose metabolism were recently cloned from C.
maltosa in order to isolate their promoter region (Park et al. 1996). The galactose-
inducible and glucose-repressible promoter region GALl-GALlO was used to
construct the high-copy expression vector pNGH2 for C. maltosa (Ohkuma et al.
1995b; Sugiyama et al. 1995; see Sect. 5.3), thus creating a plasmid which works in
analogy to the highly efficient expression vector YEp51 for S. cerevisiae (Schunck
et al. 1991; Scheller et al. 1994; Zimmer and Schunck 1995).
PGKl (Phosphoglycerate Kinase). A PGKI gene coding for the glycolytic enzyme
phosphoglycerate kinase (PGK, EC 2.7.2.3), a 47kDa protein of 417 as a residues,
was isolated form a C. maltosa genomic library by cross-hybridization with a PGK
fragment of S. cerevisiae (Masuda et al. 1994). The gene exhibits the codon bias of
highly expressed genes in yeast. Expression of this gene assayed by Northern blot
analysis was significantly induced in cells grown on glucose but not in cells grown
on alkane, alkanol, or fatty acid. The promoter region of PGKI was applied for
construction of an expression vector (pMEA1) for C. maltosa (Masuda et al. 1994;
cf. Sect. 5.3, Table 16).
Cycloheximide and Formaldehyde Resistance

The alkane-assimilating yeast C. maltosa possesses native resistance to different
growth inhibitors (formaldehyde and other aldehydes) or antibiotics (cycloheximide).
RIM-C (L41Q) - Cycloheximide (CYH) Resistance. Whereas numerous yeasts,

including S. cerevisiae, are highly sensitive to low concentrations «0.5 pg/ml) of
the antibiotic cycloheximide, C. maltosa and some other yeast species are resistant
to this antibiotic at rather high concentrations (100 pg/ml or more). The resistance
of C. maltosa to cycloheximide was demonstrated to be inducible (Takagi et al.
1985).
Two different genes related with this phenomenon have been cloned from C.
maltosa, first the RIM-C (Ribosome modification by cycloheximide) gene (Takagi
et al. 1986b), and later the CYHR (Cycloheximide resistance) gene (Sasnauskas et al.
1992c; Table 11). Both genes were cloned in S. cerevisiae by selecting cyclohexim-
ide-resistant clones using a cycloheximide sensitive wild-type strain as a host and
a YEp-type plasmid as vector. It was proved that the RIM-C gene provides a
convenient dominant vector marker for recombinant DNA technology in other
yeast without genetic markers (Hino et al. 1992). Southern blot analysis with RIM-
C as a probe indicated that there are at least three copies of RIM-C-related se-
quences in the genome of C. maltosa, in comparison with two copies in S.
cerevisiae (Kawai et al. 1992). The nucleotide sequence of RIM-C gene contains a
putative ORF (106 aa) interrupted by an intron (Table 12), coding for a protein
homologous to the L41 ribosomal protein of the large subunit of S. cerevisiae. This
protein obviously determines the sensitivity of the cells to cycloheximide. The 56th
amino acid residue of the L41 protein in the sensitive ribosome is proline (L41P-
type), while it is glutamine in the resistant ribosome (L41Q-type). The RIM-C (or
L41Q, alleles la, 1b) genes of C. maltosa encoding L41Q-type protein are inducible
in the presence of cycloheximide, while the L41P protein-encoding genes (LEL41
or L41P, alleles la, 1b) are constitutively expressed. Further analysis revealed that
the induction of L41Q was caused by inhibition of protein synthesis, a specific
phenomenon of L41 Q, not of other ribosomal protein genes examined Mutoh et al.
(1995).
Similar genes with introns at the same position coding for P-type proteins were
cloned from C. tropicalis, Kluyveromyces fragilis, Pichia sp. (M63395, Kawai,
unpubl.) and Schwanniomyces occidentalis, whereas S. cerevisiae (L41a and L41b)
or mammalia contain the Q-type proteins (Kawai et al. 1992, unpubl.; Delpozo et
al. 1993). The highest amino acid homology was determined for the L41Q of C.
tropicalis (99.1 %), compared with 84-85% homology for the other yeasts (Kf and
Sc), and 68-70% homology for the L41P proteins of rat and human.
CYHR - Cycloheximide Resistance (CYHR) Protein. The second cloned C. maltosa

gene, CYHR, conferring resistance to cycloheximide in S. cerevisiae, has no
homology to the previously cloned RIM-C gene and has no corresponding gene in
the bakers yeast genome. The gene CYHR is present in a single copy and the
deduced gene product is a highly hydrophobic, probably membrane protein of
61 kDa without significant homology to any known proteins from databases
(Jomantiene et al. 1992; Sasnauskas et al. 1992c). The gene CYHR (as RIM-C)
transforms S. cerevisiae at a frequency similar to auxotrophic markers (cf. Table
15) and can be used as dominant positive selectable marker for introducing
Table 12. Canonical intron splicing signals in yeasts
5'splice Distance Branch Distance 3'splice Genes investigated

site (n) point (n) site Reference
Saccharomyces cerevisiae
R/GTATGT 30-946 TACTAAC 5-77 YAG/N 54 different genes
(aver. 40) Rymond and Rosbach (1992)
Schizosaccharomyces pombe
G/GTAWGT TRCTAAC 9-16 TAG/N 55 introns from 28 genes
Rymond and Rosbach (1992)
Candida maltosa
A/GTATGT 214 TACTAAC 6 CAG/C FDHl gene
Sasnauskas et al. (1992a)
C/GTATGT 356 TACTAAC 17 TAG/G SR15p gene (M58330)
Sasnauskas et al. (1992b)
G/GTAYGT 35-277 TGCTAAC 7-16 TAG/T L4lQ and L4lP genes
Kawai et al. (1992)
Mutoh et al. (1995)
Candida tropicalis
G/GTATGT 35 TGCTAAC 7 TAG/T L4lQ gene
Kawai et al. (1992)
Candida albicans
N/GTATGT TACTAAC TAG/N ACTl, TUB2
Kurtz et al. (1990)
Yarrowia lipolytica
N/GTGAGT 342-509 TACTAAC 1-2 (Y,A) CAG/N PYK: Strick et al (1992)
SECl4: Lopez et al. (1994)
lCLl: Mauersberger and
Barth (1994, unpubl.)
N = A, C, G or T; R = A or G; W = A or T; Y = C or T.
recombinant plasmids into wild-type strains of S. cerevisiae and possibly for other
eukaryotic organisms, as well as for gene disruption experiments. The first
experiments with Nicotiana tabacum showed that the CYHR gene can be used as a
dominant selectable marker gene for introducing recombinant plasmids into
plants (Jomantiene et al. 1992).
FDH7 - Formaldehyde Resistance. Additionally, C. maltosa is resistant to high
concentrations of formaldehyde (8-10mM MIC - minimum inhibitory
concentration), in contrast to 1-4mM MIC for other yeasts. Sasnauskas et al.
(1992a) described a C. maltosa gene, FDH1, which confers resistance to
formaldehyde in S. cerevisiae. The codon usage of the cloned gene corresponds to
that of highly expressed yeast genes. The deduced 381 aa sequence (40kDa) of the
cloned gene FDHl showed high homology (66.5%) to mammalian alcohol
dehydrogenases (ADH), especially to human ADH class III (gene ADH5, chi
subunit) and only 24.9% similarity to S. cerevisiae ADH1. Recetly, it was shown
that human and rat class III ADH and glutathione-dependent formaldehyde
dehydrogenase (EC 1.2.1.1) are practically identical enzymes. Therefore, the
predicted mechanism of resistance probably is glutathione-dependent oxidation
of formaldehyde (Lebediene et al. 1992). The FDHI gene (at the plasmid pRAF1)
was also successfully employed as a dominant selectable marker in transformation
of wild-type S. cerevisiae (Sasnauskas et al. 1992a; cf. Table 15). The FDH 1 gene has
a single intron in its coding sequence (see Table 12).
Further Ribosomal and Other Genes
SSRR Gene for Small Subunit Ribosomal RNA. This C. maltosa gene was detected in
the highly expressed clone TIG2, isolated from a genomic library by differential
screening with cDNA (alkane/glucose) probes in order to find alkane-inducible
genes. In contrast to the clone TIG1 containing the genes ALIl and POX18 (see
above), TIG2 had homology to genomic DNA of S. cerevisiae (Hwang et al. 1991).
The sequence of this clone disclosed high homology to srRNA from other
organisms and allowed to establish the position of C. maltosa in the evolutionary
tree of yeasts (Ohkuma et al. 1993b; cf. Sect. 1.2 and Fig. 1).
Ribosomal Protein RS15p Gene. Despite the above-mentioned ribosomal proteins

L41, connected with the cycloheximide resistance in C. maltosa, an assumed
ribosomal protein gene of C. maltosa was found in the neighborhood with an ARS
sequence, indicated by one intron containing ORF and encoding a deduced
polypeptide with high homology (70%) to the small ribosomal subunit protein No.
15 (RS15, 17.4kDa)of Brugia pagangi (Sasnauskas et al. 1992b), suggesting that it
belongs to the S15P family of ribosomal proteins.
SETR - tRNNerCAG Gene. This tRNA gene, responsible for translation of the CUG
codon as serine, was recently cloned using PCR and primers derived from the
corresponding C. albicans gene, to prove the unusual amino acid assignment of the
CUG codon C. maltosa (Sugiyama et al. 1995; cf. Sect. 4.4.3). This unusual tRNA
shows high similarity in its sequence and secondary structure to the corresponding
gene products of C. albicans and related Candida yeast (Yokogawa et al. 1992;
Suzuki et al. 1993; Ohama et al. 1993).
Transposons have not been detected in C. maltosa up till now, although the
instability of auxotrophic mutations (APA changes, see Sect. 4.2.2) suggests that
comparable mechanisms may also exist in this yeast. The structures of ARS and
CEN sequences isolated from C. maltosa will be discussed below in Sect. 5.1 (see
also Tables 8, 11, 15).
General Features of Candida ma/tosa Genes
The general structure of C. maltosa genes and the main motifs in 5' -upstream
and 3' -downstream regions (TAT A-box, consensus for translation initiation,
polyadenylation signals, consensus for transcription termination) are comparable
with those of C. albicans and C. tropicalis (Kurtz et al. 1990; Rachubinski 1990) or
other yeast genes (Jones et al. 1991, 1992) and will not be discussed in detail here.
The peculiarities of condon usage and condon bias in C. maltosa will be discussed
below in Sect. 4.4.3.
Homology Between Structural Genes of Different Yeasts. Information on severaI
common genes in C. maltosa and other yeasts including Candida and
Saccharomyces is available. Comparison of the deduced amino acid sequences of
several C. maltosa genes discussed above (CYP52, CPR, URA3, POX, L41Q) with
those of other yeasts shows the closest taxonomic relationship between C. maltosa
and the alkane-assimilating and pathogenic C. tropicalis and C. albicans. This close
relationship is in agreement with the results of a comparison of the sequences of
the 18S (SSRR genes) rDNA of C. maltosa and other Candida yeasts, as discussed
in Sect. 1.2 (Barns et aI. 1991; Ohkuma et aI. 1993b).
The amino acid sequence of the Cm-URA3 gene product shares 84 and
72% identity with that of the URA3 gene product of C. albicans and S. cerevisiae,
respectively. For the Cm-CPR the homology ranges from that of C. tropicalis
(86%) to S. cerevisiae (49%), and rat (31%). This relation is obvious also for the
POX4 and POX18 gene products showing 83 and 94.5% amino acid homology to
the deduced C. tropicalis proteins. The deduced amino acid sequences of L41
ribosomal protein genes (L41Q or L41P) of C. tropicalis, S. cerevisiae, and rat share
99.1,84.9, and 70.4% identities, respectively, indicating the expected high sequence
conservation (Kawai et aI. 1992). The sequence homology of Cm-LEU2 and Sc-
LEU2 is 76% (Takagi et aI. 1987), whereas the corresponding sequences of the
ADEI (Kawai et al. 1991; Sasnauskas et al. 1991), HIS5 (Hikiji et aI. 1989), and PGKI
(Masuda et al. 1994) genes share considerably lower homologies, with 66, 51, and
59% identitites, respectively. This may reflect the divergence in the evolutionary
rates of each gene.
Interallelic Divergence Between Strains of the Same Species. The recent sequencing
data for different C. maltosa genes gave evidence and hints that certain alleles of
quite different genes concerned with nucleic acid biosynthesis (ADEl), amino acid
biosynthesis (LEU2), and hydrocarbon utilization (CYP52, POX), are highly
conserved in different strains of C. maltosa. On the other hand, an unexpected high
sequence divergence or restriction fragment polymorphism between the multiple
alleles of a single gene is tolerated within the genome of different strains. This may
support the chromosome inactivation theory proposed recently by Becher et aI.
(1994,1995; d. Sect. 4.2.2). Whereas the nucleotide sequences of cloned ADEI and
LEU2 genes are 100 and 99.9% identical in different strains (VSB899, IAM12247,
and L4, respectively), the LEU2 genes cloned from one strain L4 are more divergent
(2.5%) than the two copies from different strains. This is even more evident for
P450 genes of the CYP52A subfamily, where 6.2% base deviations were detected in
the coding region of two allelic variants of CYP52A3 (ALKI-A and ALKI-B) cloned
from strain IAM12247 (Ohkuma et aI.1991b). However, the cDNA sequence of the
CYP52A3 (P450Cml) from C. maltosa EH15 has only 2.2% base deviations from the
CYP52A3 (ALKI-A) allele from IAM12247 (Schunck et aI. 1989a,b; Takagi et aI.
1989). The inter-allelic divergence between the alleles of genes of even one C.
maltosa strain is therefore several times higher than the allelic differences between
different S. cerevisiae strains, which were reported to reach 0.6% for chromosome
III (Oliver et al. 1992).
Introns. First evidence on introns present in the assumed structural gene FDH1, in
the ribosomal protein genes L41Q (RIM-C) or L41P and in the gene for the deduced
ribosomal protein S15 of C. maltosa have been reported by Sasnauskas et al.
(1992a,b) and Kawai et al. (1992). The canonical intron splicing signals were
similar to that of S. cerevisiae, S. pombe (Rymond and Rosbach 1992),
Kluyveromyces lactis (Deshler et al. 1989), C. tropicalis (Kawai et al. 1992), or C.
albicans (Kurtz et al. 1990) genes, but different from that found in Y. lipolytica
(Table 12; Barth and Gaillardin, Chap. 10, this Vol.).
A single intron was found in the coding sequence of FDH1 (see above) with
highly conserved sites (5'-GTATGT ... TACTAAC ... YAG-3') for correct splic-
ing. It was shown that splicing of the FDH1-derived mRNA occurs identically in
both C. maltosa and S. cerevisiae, demonstrating that S. cerevisiae accurately pro-
cesses C. maltosa pre-mRNA (Sasnauskas et al. 1992a). The nucleotide sequences
of the L41Q (RIM-C) and L41P (LEL41) genes of C. maltosa, coding for ribosomal
proteins L41 of the large subunit, contain an intron at the same position of the
putative ORF of 106 amino acids (Table 12, Mutoh et al. 1995). This intron position
in L41P genes is highly conserved in the phyiogenetic tree due to its presence in the
different, not closely related, yeast species C. maltosa, C. tropicalis, Kluyveromyces
fragilis, Pichia sp., Schwanniomyces occidentalis, and S. cerevisiae (Kawai et al.
1992, and unpubl. results; Delpozo et al. 1993). An intron was also found in a
sequence which is located in the neighborhood of an ARS, and encodes an ORF for
an assumed polypeptide with high homology (70%) to the small ribosomal subunit
protein No. 15 (RSI5) of Brugia pagangi (Sasnauskas et al. 1992b).
Sugiyama et al. (1995) recently reported an intron in the tRNNerCAG gene.
Interestingly, these tRNA genes of C. albicans, C. parapsilosis, C. rugosa, and C.
zeylanoides, which show relatively high sequence homology to that of C. maltosa,
have no intron, but those of C. maltosa, C. melibiosa, and C. cylindracea have one
intron (Ohama et al. 1993; Sugiyama et al. 1995). Up till now no introns were
observed in numerous sequenced auxotrophic marker genes ADE1 (6), LEU2 (5),
HISS, and URA3, as well in the CYPS2 (15 P450 sequences including allelic vari-
ants), CPR (2) and POX (4) structural genes of C. maltosa (cf. Table 11).
4.4.3
Codon Usage
Codon usage in most genes of C. maltosa is comparable with that analyzed for S.
cerevisiae, C. tropicalis, or C. albicans (Table 13; Rachubinski 1990; Kurtz et al.
1990). The most frequent co dons calculated from several sequenced C. maltosa
genes are in good agreement with the codon preference of S. cerevisiae (except
lysine), according to Frohlich et al. (1985). A total number of 60 different co dons
is found in these sequences. In most analyzed genes 63-85% of the amino acids
were coded by only a restricted number of 24 co dons (codon selectivity, % of most
Table 13. Codon usage of Candida maltosa. Preferred codons in C. maltosa are shown in
bold. Preferred codons in S. cerevisiae according to Frohlich et al. (1985) are indicated by a
star (*)
Amino acid Codon Number" Amino acid Codon Number"
Ala GCT* 245 Lys AAA 312

GCC* 73 AAG* 71
GCA 35 Met ATG 91
GCG 11 Phe TTT 124
Arg CGT 18 TTC* 141
CGC 1 Pro CCT 41
CGA 2 CCC 0
CGG 1 CCA* 180
AGA* 198 CCG 6
AGG 5 Ser TCT* 114
Asn AAT 113 TCC* 64
AAC* 116 TCA 38
Asp GAT* 201 TCG 12
GAC* 81 AGT 38
Cys TGT* 51 AGC 6
TGC 1 CTGb 5
Gly GGT* 275 Thr ACT* 210
GGC 10 ACC* 88
GGA 31 ACA 32
GGG 21 ACG 7
GIn CAA* 168 Tyr TAT* 79
CAG 8 TAC* 107
Glu GAA* 331 Trp TGG 51
GAG 3 Val GTT* 239
His CAT 55 GTC* 83
CAC* 45 GTA 17
He ATT* 179 GTG 28
ATC* 93
ATA 14 Sumaa 5064
Leu CTT 42
CTC 11 Stop TAA 8
CTA 1 TAG 5
TTA 175 TGA 0
TTG* 270
aTotal number of times each codon is used in the C. maltosa genes: LEU2, HISS, URA3,
ADE1, ALK1A, ALK1B, ALK2A, ALK3A, L41Q, ALIl, POX4, POX18, PGK (for references see
Table 11).
bNonuniversal decoding of the codon CTG for serine instead of leucine in C. maltosa
(Sugiyama et al. 1995; Zimmer and Schunck 1995).
frequent aa). The highest values (above 82%) were obtained for ALKl-3, POX4, and
PGK genes (Ohkuma 1994, unpubl.), as for the highly expressed peroxisomal genes
(POX, CAT, HDE) of C. tropicalis (Rachubinski 1990).
Codon Bias Index (CBI). In general, a codon bias index (eBI) correlates with the
level of protein production, and highly expressed yeast genes have strong codon
bias (on a scale from 0 to 1), as judged by the number of codons found compared
to the 61 possible codons (Bennetzen and Hall 1982). Compared with other genes
(Hwang et al. 1991) of C. maltosa the PGKI and FDHI genes were also found to
have a strong codon bias, suggesting that they are highly expressed in C. maltosa
(Sasnauskas et al. 1992a; Masuda et al. 1994), whereas ADEI is with a CBI of 0.68
assumed to be a moderately highly expressed gene (Sasnauskas et al. 1991). The
CyI[R (Sasnauskas et al; 1992c) is suggested to be a low level expressed gene.
On the other hand, it has been reported that the codon CUG, a universal leucine
codon, is read as serine in some Candida species which are phylogenetically
related to C. maltosa. This deviation from the universal genetic code was found in
C. cylindracea (Kawaguchi et al. 1989; Yokogawa et al. 1992) and some related
yeast species like C. albicans and C. parapsilosis (Ohama et al. 1993). Based on
phylogenetic considerations, the same nonuniversal decoding of CUG was pro-
posed to occur also in C. maltosa (Ohkuma et al. 1993b), because its evolutionary
position is close to C. albicans and C. parapsilosis (cf. Sect. 1.2, Fig. 1).
Recently, in both our laboratories it was conclusively evidenced by in vitro
translation experiments (Zimmer and Schunck 1995) and by in vivo studies
(Sugiyama et al. 1995) that serine instead ofleucine is specified by the CUG codon
in the yeast C. maltosa. Depending on the cell-free system used, either serine, in the
C. maltosa-derived in vitro translation system, or leucine, in the control with the
conventional wheat germ system, was found to be incorporated in the translation
products of artificial CUG-containing mRNAs. Moreover, it was possible to trans-
fer the nonuniversal decoding of CUG to the wheat germ system by adding a tRNA
fraction isolated from C. maltosa. This unusual amino acid assignment of the CUG
codon read as serine, is obviously based on the presence of an unusual tRNA in C.
maltosa, proved by cloning and sequencing of its gene (SETR - tRNNerCAG gene;
Sugiyama et al. 1995) from this yeast with a structure almost identical to the
corresponding gene of C. albicans and related Candida yeasts (Y okogawa et al.
1992; Ohama et al. 1993; Suzuki et al. 1993). Additionally, the comparison of the N-
terminal amino acid sequences of the P450 52A3 protein overproduced in C.
maltosa with a corresponding newly constructed mutant protein of P450 52A3,
whose one triplet ATT (isoleucine) in this region of the CYP52A3 gene has been
changed to the CTG codon, demonstrates the use of CUG as a serine codon in vivo
in C. maltosa (Sugiyama et al. 1995). This is supported by the result that the S.
cerevisiae URA3 gene, which has one CTG codon, could not complement ura3
mutation of C. maltosa, but when its CTG codon was changed to another codon,
CTC, the codon-changed URA3 did complement the mutation in C. maltosa
(Sugiyama et al. 1995). These results clearly indicate for the first time that the
functional expression of a heterologous gene is possible only by changing the CTG
codon to another leucine codon and that the deviation of the codon CUG from the
universal genetic code is responsible for the defect of heterologous gene expression
in C. maltosa (cf. Sect. 5.3). As a consequence of this alteration in the usage of the
CUG codon in C. maltosa, heterologous expression in S. cerevisiae of some C.
maltosa genes is expected to produce mutant proteins that have serine to leucine
substitutions at each position coded by CUG. Therefore, an exchange of the CTG
triplets of these structural genes by TCT encoding serine is required in order to

produce the authentic proteins in S. cerevisiae. This was recently demonstrated for
the heterologous expression in S. cerevisiae of the C. maltosa P450 genes CYPS2A4
and CYPS2AS (Zimmer and Schunck 1995). In contrast, heterologous expression
of the original C. maltosa P450 genes in S. cerevisiae resulted in the formation of
still active but unstable enzymes probably subject to selective proteolysis in the
endoplasmic reticulum of the host cells.
In C. maltosa, the codon CTG is a rare codon (Table 13) as it is in C. albicans
(Brown et al. 1991). Except for the P450alk genes, the codon CTG can be found only
in HISS and URA3 among C. maltosa genes sequenced so far. However, both genes
can function in S. cerevisiae (Table 15; Sugiyama et al. 1995). In general, the
frequency of codon usage positively correlates with the amount of is 0 acceptor
tRNA present in the cells and an isoacceptor tRNA corresponding to the preferred
codon is transcribed from multiple genes in the genome (Sharp et al. 1986; Lloyd
and Sharp 1992). So it is reasonable that there are only one or two copies of the
tRNA SERCAG gene in the genome of C. maltosa, as shown by genomic Southern blot
analysis (Sugiyama et al. 1995).
4.4.4
Gene Mapping
Genetic Mapping in C. maltosa. Classical genetic mapping techniques developed

mainly for S. cerevisiae and applied to other nonconventional yeasts (Ogrydziak
1988) are mostly not useful to study the genome organization of C. maltosa due to
the lack of sexuality in it. Mapping of C. maltosa genes is only possible by
parasexual methods (see Sect. 4.2.4). Such a parasexual cycle based on protoplast
fusion and mitotic segregation demonstrated a linkage group with the sequence
CEN-ade-26-pro-l (Klinner et al. 1984). Some special organization features in the
genome were elucidated after gene cloning and sequencing larger DNA fragments
of C. maltosa (see below).
Physical Mapping in C. maltosa. The progress in recombinant DNA technology, an

increasing number of cloned genes from C. maltosa (Table 11), and developed
methods for electrophoretic separation of large DNA molecules (Pulsed or
alternating field gel electrophoresis; see Sect. 4.3) made new approaches possible.
Electrophoretic fractionation of intact yeast chromosomes represents an
alternative to classical karyotyping, and largely overcomes the difficulties of
cytogenetic analysis with imperfect yeast. Southern blots of chromosomes
separated by these alternating field electrophoresis techniques (OF AGE or CHEF)
are probed with labeled fragments of genes to determine to which of the
chromosomes the gene hybridizes. In this way, the chromosomal assignments of
several cloned C. maltosa genes were revealed (Tanaka et al. 1987; Becher et al.
1991,1994; Ohkuma et al. 1993c, 1995a; Table 9, Fig. 5). All six genes of the CYPS2A
subfamily in C. maltosa, the alkane-inducible P450 genes ALKl-3, ALKS, ALK7-8
(and their alleles), were assigned on the same chromosome VIII, which is the
largest chromosome under the separation conditions applied. This is in contrast to
results obtained for C. tropicalis, where the five members of the CYPS2A subfamily
are located on four different chromosomes (Seghezzi et al. 1992). Two other known
ALK genes (ALK4 = CYPS2D1 and ALK6 = CYPS2C2) are located on different
chromosomes, indicating a close relationship between sequence homology and
chromosomal localization of these members of the CYPS2 gene family.
Interestingly, the CYP52C2 was found on two different chromosomes II and IV
(Ohkuma et al. 1993c, 1995a). The POX2, 4, and S genes coding for peroxisomal
acyl-CoA oxidases were located at chromosomes VII and VIII. For the ARS
sequence (TRA fragment) isolated from C. maltosa (Takagi et al. 1986a) the
strongest signal of hybridization was observed for chromosomal band II, but there
is another signal for band V, probably for a highly homologous sequence (Tanaka
et al. 1987). The HISS and LEU2 genes were mainly localized at the chromosome
bands V and III, respectively (Tanaka et al. 1987; Wedler et al. 1990; Becher et al.
1991, see Table 9). Additionally, for the LEU2 gene, present in at least three allelic
variants in C. maltosa (Table 11), a disomic state of the chromosomes carrying this
and probably LEU4 gene was elucidated (Becher et al. 1991, 1994). At least two
LEU2 genes situated on chromosomes of different size (probably bands III and IV)
occur in the genome of C. maltosa CBS561 1. Three differently sized chromosomes
were found to carry ADEI genes in C. maltosa L4 (Becher et al. 1995). The diffuse
nature of the chromosomal bands carrying ADEI specific sequences is probably
associated with frequnent chromosomal rearrangements occurring in C. maltosa
strains as discussed by Becher et al. (1995).
Cloning of C. maltosa genes revealed some close linkages of them in the genome
(cf. Sect. 4.4.2). There are three pairs of tandem ( >=» arrangements of
CYPS2A (P450alk) genes, for both alleles of ALK2-ALK3 and for ALK7-ALK8-A as
well (Ohkuma et al. 1991b, 1993c, 1995a), as it is also found for the closely related
alkl and alk2 genes in C. tropicalis (Seghezzi et al. 1991, 1992), probably reflecting
that the CYPS2 family arose by duplications of an ancestral gene. Similar tandem
arrangements were found for the L41 ribosomal genes L41P and L41Ql (Kawai et
al. 1992; Mutoh et al. 1995), and for the genes POX18 and ALIl in the clone TIGI
(Hwang et al. 1991). The distances of the genes are 0.7 to 1.2kb. There are two
examples of nontandem clusters, for the peroxisomal acyl-CoA oxidase genes
POX2-POX4 ( ><=) and the galactose utilization genes GALl-GALlO «=
». Analyzing the clustering of CYPS2A genes by replacing each gene with the
restriction site of NotI and pulsed-field gel electrophoresis, ALKl, ALKS, ALK7-
ALK8were found to be clustered in a 160-kb region on chromosome VIII (Ohkuma
1993, unpubl.). In the TRA region the ARS sequence and the CEN (centromere)
sequences are colocalized (cf. Sect. 5.1).
4.5
Preparation of DNA From Candida maltosa Cells
Note on Method. The methods described by Cryer et al. (1975) and Davis et al.
(1980) for other species have been successfully applied to prepare total or genomic
DNA from C. maltosa cells in the laboratories of Takagi (Tokyo) and Sasnauskas
(Vilnius), respectively. Here a method will be given for miniscale isolation of
total DNA used in Takagi's laboratory. The method is valid for preparation
of chromosomal and plasmid DNA of the yeast for restriction analysis, Southern
blotting, and for E. coli transformation to rescue a plasmid from C. maltosa cells.
Procedure
1. Grow the cells in 10 ml YPD or YNB-glucose (or other carbon source) at 30°C
to S X 107 - 1 X 108 cells/ml (late log phase). Harvest by centrifugation and
resuspend the cells in 1 ml of ST buffer.
2. Spin down the cells in a micro centrifuge tube (1.S ml) and resuspend in O.S ml
ofTS buffer.
3. Add lO,ul f3-mercaptoethanol and mix.
4. Add 0.1 ml Zymolyase (S mg/ml), incubate with occasional shaking at 30°C for
40-60 min.
5. Harvest the cells by centrifugation (SOOO rpm, 1 min) and resuspend com-
pletely in SE buffer.
6. Incubate for IS min at 70°C.
7. Cool down the tube to room temperature, add 30,ul proteinase K (O.Smg/ml)
and lO,ul RNase A (10 mg/mI) , mix, and incubate 30-60 min at 37°C.
S. Add IS0,ul of S M ,potassium acetate solution, mix, and stand in ice for 30 min.
9. Centrifuge (SOOOrpm, 1 min), transfer supernatant to a fresh micro centrifuge
tube and add 0.5 ml phenol (TE buffer saturated) with vortexing.
10. Centrifuge (12000 rpm, S min), and with the supernatant, perform three or
more phenol-chloroform (1 : 1) extractions.
11. Transfer the final supernatant to a fresh micro centrifuge tube and add equal
volume of 2-propanol with mixing.
12. Centrifuge for 12 000 rpm 5 min, drain off liquid, wash with 70% ethanol, and
vacuum-dry briefly.
13. Dissolve the DNA in 100-IS0,ul TE buffer, mix, and resolve completely.
14. Add equal volume of SM ammonium acetate, vortex, and stand on ice for
30min-lh.
IS. Centrifuge (12000 rpm, S min), and transfer the supernatant to a fresh
microcentrifuge tube and precipitate DNA with ethanol.
16. Centrifuge, wash with 70% ethanol, and dry. Dissolve the DNA in appropriate
volume of TE buffer.
17. Prepared DNA will be sufficient for restriction analysis, for Southern blot
analysis, and for transformation of E. coli (recovery of plasmids from C.
maltosa cells).
Buffers
ST buffer: 1.2M sorbitol, 50mM Tris-HCl, pH 7.5
SE buffer: 0.2% SDS, 50mM EDTA, pH 8.0
TE buffer: IOmM Tris-HCl, pH 7.4, ImM EDTA
4.6
Preparation of RNA
The RNA preparation methods described for S. cerevisiae (in Campbell and Duffus
1988; Rose et al. 1990) can be generally applied also for C. maltosa (Ohkuma et al.
1995a). Essentially all special conditions commonly used for work with and prepa-
ration of RNA should be applied (DEPC treated RNase free solutions and equip-
ment),
4.6.1
Isolation of Translatable mRNA
Note on Method. The method described here for C. maltosa was used for the
isolation of mRNA highly active in subsequent in vitro translation experimep.ts
and immunoprecipitation with polyclortal antibodies against cytochrome
P4S0Cml (Wiedmann et al. 1986, 1988a; cf. Sect. 2.7.2). Using these preparations,
the mRNA coding for P450Cml in C. maltosa was quantified in dependence on
growth conditions (regulation by carbon source and oxygen), and a cDNA library
of n-alkane induced clones was constructed (Schunck et al. 1989a,b; see Table 10).
Procedure
1. Grow C. maltosa in a fermenter under defined conditions or in shaking flasks.
Harvest about 200 ml culture containing approx. 5 g wet weight cells by centrifu-
gation (6000 g for 10 min at 4°C) and wash the cells with cold distilled water.
2. Freeze the cells in liquid nitrogen (and store at -70°C before use) and disinte-
grate by grinding with a mortar in liquid nitrogen.
3. Isolate total RNA by the phenol-chloroform-method according to Palmiter
(1974).
4. Prepare the poly(A) RNA from the total RNA fraction using poly(U) Sepharose
chromatography according to Adesnik and Darnell (1972).
The eluted mRNA preparations can be used for in vitro translation experiments in
the homologous C. maltosa system or in a wheat germ system (see Sect. 2.7.2), and
as the template for cDNA synthesis.
4.6.2
Isolation of Total tRNA
Note on Method. Preparation of the total tRNA fraction from C. maltosa can be
performed as described by Zimmer and Schunck (1995) on the basis of a standard
method according to Holley (1967).
Procedure
1. Cultivate a 250-mI culture of C. maltosa at 30°C in YPD to a density of 7 x 107
cells/mI and harvest by centrifugation (3000 gat 4°C for 10 min).
2. After washing the cells with ice-cold distilled water, add 1.5 ml ice-cold extrac-
tion buffer (O.OIM Tris/HCI, pH 7.4, O.IM LiCI, O.OIMEDTA and 0.2% SDS), 6g
of glass beads (0.45-0.50 mm), and 1.5 mI of phenol pre-equilibrated in extrac-
tion buffer to the cell pellet.
3. Vortex the mixture for 30 s and chill on ice for about 1 min. Repeat this step four
times in order to break at least 90% of the cells.
4. Centrifuge the sample after adding 2.5 mI extraction buffer (8000 g at 4°C for
5min), and purify the supernatant by five phenol-chloroform (1: 1) and two
chloroform extractions followed by ethanol precipitation.
5. Load the resolved RNA onto a DEAE-cellulose (Pharmacia) column according
to a standard method of total tRNA isolation (Holley 1967), wash with 0.1 M
Tris-HCI, pH 7.5, and elute with the same buffer containing 1 M NaCl. Monitor
the nucleic acid elution by A260 measurements, and precipitate the fractions
containing total tRNA with ethanol.
6. Resolve the pellet in RNase-free water and store at-70°C after freezing in liquid
nitrogen.
Additionally, methods for RNA isolation from C. maltosa and its successful use in
Northern blotting experiments and for cDNA synthesis have been described
(Sunairi et al. 1984, 1988; Ohkuma et al. 1991b, 1995a; Sugiyama et al. 1995).
5
Host-Vector Systems for Candida maltosa
The development of convenient host-vector systems for C. maltosa by genetic

engineering techniques represents a significant step towards its more widespread
use in biotechnology, and will also increase the usefulness of this yeast for funda-
mental research. Because C. maltosa belongs to the fungi imperfecti and, therefore,
conventional yeast genetic techniques are not applicable for this type of nonsexual
yeast, recombinant DNA technology represents the only efficient way to analyze
genomeits at the molecular level. On the other hand, due to its special properties
as an alkane-utilizing yeast, C. maltosa might be a useful host for the functional
expression of heterologous proteins and their application in biotransformation
reactions (see Sects. 2.5 and 5.3).
For the development of host-vector systems for C. maltosa, all necessary steps
of genetic engineering work were made during the past decade, mainly with the
C. maltosa strain IAM12247 (at Tokyo University), as well as with strains L4 (at
Greifswald University) and VSB788 (in Dr. Sasnauskas' group in Vilnius):
1. Autonomously replicating (ARS) and centromere (CEN) sequences have been
isolated from the genome of this yeast and used for the construction of vectors
with independent replication within the transformed cells (YRp-type vectors;

see Sect. 5.1).
2. Several auxotrophic mutants and the corresponding genes which complement
these mutations have been isolated and used as markers for transformation of
C. maltosa (Tables 6, 14; see Sect. 5.2).
3. Different expression vectors have been constructed using promoters of highly
expressed homologous genes, such as the phosphoglycerate kinase (PGKl) gene
(Masuda et al. 1994), the GALl gene (Ohkuma et al. 1995b; Park et al. 1996), and
the P450 gene ALKl (Ohkuma 1993; Muraoka et al. 1993; Ohkuma unpubl.).
These vectors were applied for heterologous and homologous gene expression
in C. maltosa (see Sect. 5.3).
5.1
ARS and (EN Regions of Candida maltosa
The construction of the host-vector system for C. maltosa by application of genetic

engineering requires a vector to introduce any DNA sequences into the host cell.
This vector should have at first a stable maintenance (integrated or autonomously
replicating) in the host cell, should contain a selective marker (homologous or
heterologous auxotrophic marker genes like LEU2) for transformation, and be
available for recombinant DNA technology (appropriate cloning sites and ampli-
fication in E. coli, like the commonly used pBR or pUC plasmids).
Since C. maltosa does not have any plasmids like 2/1m DNA of S. cerevisiae, and
neither the 2/1m OR! (YEp-type vectors containing this replication origin) nor the
ARSl of S. cerevisiae are functional in C. maltosa (Takagi et al. 1986a), it was
necessary to isolate an autonomously replicating sequence (ARS) for vector con-
struction. Although integrative transformation is applicable for C. maltosa, it is at
considerably low frequency. Because of the high transformation frequency in
general, transformation with an ARS is favorable. Moreover, the transformed
plasmid should exist extrachromosomally, and should thus be easily rescued in
E. coli. In many fungal species, ARS elements have been identified (Oliver 1988).
Vectors carrying such sequences will facilitate cloning of nuclear genes by mutant
complementation.
Chromosomal DNA fragments containing functional ARS have been isolated
and characterized from several C. maltosa strains and applied for the construction
of host-vector systems independently in several laboratories (cf. Fig. 7, Tables 8,
11, 14, 15). First attempts to clone ARS sequences from C. maltosa by screening for
replicative function in S. cerevisiae failed to isolate any sequences which were
active in the donor organism (Kawamura et al. 1983). Moreover, plasmids contain-
ing S. cerevisiae 2/1 OR! or ARSl sequences failed to replicate in C. maltosa (Takagi
et al. 1986a), as in C. albicans (Kurtz et al. 1990). Screening for ARS function in C.
maltosa itself has been far more successful, and two groups (Takagi et al. 1986a;
Jomantiene et al. 1987) have isolated sequences which promote high frequency
transformation. The cloning procedure of the best characterized ARS from C.
maltosa IAM12247 and its application for the construction of a host-vector system
A B
- -
CM
1 AGTTGTATTTA (9/11)
p
. H
I
H
I
E
I
B
I 2 ATTTAAGTTGA (9/11)
3 AATTAAATTTA (9/11)
ARS CEN 4 TTTTTTATGTA (9/11)
"
5 TTTTATGTACA (9/11)
1-----1 SC
/ ATTTATGTTTA
T A T
unstable stable
multi-copy low-copy
c
CDEI CDEII CDEIII
CM
ATCACATG
GTCACATG ~~: ~~ - AATTTATTTTAGTGCACAAAATTAATTT
ATCACGTG
SC
78-86 bp
RTCACRTG -87-95% AT- TGTTTTGATTTCCGAAAATNAAAAA
R: A or G
D
* * * *
(a) 5'-ATATCACATAGATTA TCCATTAC-3' (20/24)
(b) 5 '-ATATCAGATAGATTATTCAATGAC-3 ,
Fig.7A-D. Autonomously replicating sequences (ARS) and centromere region (CEN) of
Candida ma/tosa. A - Restriction map of the TRA (transforming ability) region. B - Con-
sensus sequences found in ARS of C. maltosa (CM) and of S. cerevisiae (SC), taken from
Kawai et al. (1987). C - Consensus sequences found in CEN. D - A further homology region
in ARS sequences from two different Candida maltosa strains. (a) Strain IAM12247 (Kawai
et al. 1987), (b) Strain VSB899 (Sasnauskas et al, 1992b). Stars indicate nonhomologous base
pairs
has been reviewed recently (Takagi 1992, 1993; Ohkuma et al, 1994a). The C.
maltosa mutant J288 (leu2) was transformed with the gene library of C. maltosa
(20000 clones) constructed in the plasmid YEp13 (S. cerevisiae vector, LEU2 as
selectable marker, see Table 10). From the resulting highly frequent Leu+
transform ants, a plasmid peSl was isolated, which carried an ARS fragment of
C. maltosa, because of its ability for efficient transformation and its recovery in E.
coli. The sub cloned 3.8kb BamHI fragment which contained the ARS was desig-
nated as TRA (TRansformation Ability) region. The ARS in the TRA region was
finally sub cloned into a 0.2 kb HindlII -Sau3AI fragment. This minimal 196 bp DNA
fragment from C. maltosa lAM 12247 was essential for the transformation ability. It
exhibited ARS activity in both C. maltosa and S. cerevisiae (Takagi et al. 1986a;
Kawai et al. 1987; cf. Table 15), as did the mentioned ARS isolated from C. albicans
(Kurtz et al. 1990). The C. maltosa ARS contains five 11 bp sequences that were
homologous to the ARS core consensus sequence of S. cerevisiae in 9 out of 11
nucleotides (Fig. 7; Marahrens and Stillman 1992). A similar consensus is also
present in the C. albicans ARS (Kurtz et al. 1990).
Later, it was shown that the TRA region contained a centromere (CEN) of
C. maltosa (Ohkuma et al.1995e; Fig. 7, Tables 11, 14). Using the 3.8kb TRA region,
the stability of the plasmid under nonselective condition was very high (approxi-
mately 80% after ten generations) and the copy number of the plasmid is low (one
or two copies per genome), sharing the properties of YCp-type vectors of S.
cerevisiae. Using only the 0.2kb ARS region, the stability was dramatically de-
creased (below 10% after ten generations) and the copy number is increased (more
than 20), sharing the properties of YRp-type vectors of S. cerevisiae. The CEN
region was subcloned into the 0.3kb HindIII-SpeI fragment (Fig. 7). This CEN
region was homologous to CEN of S. cerevisiae. The CEN of S. cerevisiae consists of
three motifs, CDEl, CDEll, and CDEllI. The CDEl is an 8 bp consensus, the CDEIIl
is 25 bp consensus showing partial dyad symmetry. Located between CDEl and
CDElll is a 78-86bp stretch containing more than 90% AT. In the case of C.
maltosa CEN, there are three sequences completely conserved with CDEl of S.
cerevisiae, and a 124 bp long stretch of 88% AT, a little longer than the CDEll of S.
cerevisiae. Following CDEll, a partial dyad symmetry in the CEN of C. maltosa was
found , but it had no sequence homology with CDEIII of S. cerevisiae (Fig. 7C;
Ohkuma et al. 1995e). The isolated TRA (CEN-ARS) was used for the construction
of different plasmids containing several auxotrophic marker genes (like pTRAl,
pBTH lOB, pUT AI, pUTCl) applied in the development of new host -vector systems
of C. maltosa (cf. Sect. 5.2 and Table 14). Additionally, ARS elements of C. maltosa,
isolated by comparable strategies, were described from the strains VSB747 (two
fragments, no sequence data, Polumienko and Grigorieva 1985), VSB899 (one
fragment, Jomantiene et al. 1987; Sasnauskas et al. 1992b), and L4 (ARSI andARS2,
no sequence data; Becher et al. 1991, 1994; Kasuske et al. 1992), which differ in
their functioning in S. cerevisiae (Table 15). Interestingly, the ARSI and ARS2
from C. maltosa strain 14 as the ARS from strain VSB899 (in the vector pRJl
with C-ADEl, Sasnauskas et al. 1992b) showed no ARS activity in S. cerevisiae,
although the C-ADEI gene of C. maltosa functions in S. cerevisiae, whereas the ARS
isolated from strains IAM12247 and VSB747 were active. The noncentromeric
plasmids containing homologous ARS (or replicators) from C. maltosa are main-
tained with the same frequency in both wild-type and mutant strains of S.
cerevisiae (Karpova et al. 1987). On the other hand, there are several earlier reports
indicating at ARSl, the 2/1 ORl, and the CEN6 regions of S. cerevisiae were not
functionally active in C. maltosa (cf. Sect. 5.3, Table 16; Takagi et al. 1986a; Kunze
et al. 1987a,b).
In general, the C. maltosa ARS elements (at least 150-200bp) produce an in-
creased transformation rate and mitotically unstable transformants, typical for
autonomously replicating plasmids. The stability of transformants was, with about
60-65% after ten generations under selective growth conditions (Sasnauskas et al.
1992b), or with less than 10% under nonselective conditions (Kawai et al. 1987;
Hikiji et al. 1989) strikingly lower than the stability of the above mentioned TRA
(CEN-ARS) containing plasmids (about 80% after ten generations even under
nonseletive conditions). The ARS without CEN containing plasmids showed a high
copy number of the recombinant plasmids in transformants of about 10-20 copies
per cell (Takagi et al. 1986a; Kawai et al. 1987; Hikiji et al. 1989; Sasnauskas et al.
1992b). Comparison of the nucleotide sequences of two sequenced ARS elements
(Kawai et al. 1987; Sasnauskas et al. 1992b) revealed an additional 24bp homolo-
gous sequence (20124) specific for the C. maltosa ARS element (Fig. 7D). The
function of these sequences still remains unclear. This consensus sequence of
C. maltosa ARS has no similarity to the S. cerevisiae ARS consensus sequence. The
ARS sequence cloned from C. maltosa VSB899 is located in the neighborhood with
an ORF encoding a polypeptide with high homology (70%) to the small ribosomal
subunit protein No. 15 (RSI5) of Brugia pagangi, and containing an intron with
canonical sites for correct splicing (Sasnauskas et al. 1992b).
5.2
Development of Host-Vector Systems
The progress made in transformation and the development of host-vector systems

for C. maltosa during the past decade are partially described in some reviews on
nonconventional yeast (Oliver 1988; Weber and Barth 1988; Rachubinski 1990;
Reiser et al. 1990; Sudbery 1994) and were reviewed more recently by Takagi (1992,
1993) and Ohkuma et al. (l994b).
5.2.1
Transformation Systems, Marker Genes, and Vectors
Transformation systems of C. maltosa have been developed using homologous or

heterologous auxotrophic (nutritional) markers selectable by complementation
(Tables 11, 14, 16 and references therein). At first, plasmids that had been devel-
oped for S. cerevisiae were tested for transformation of C. maltosa, and then
homologous selectable phenotypic genes and ARS elements were isolated in an
attempt to obtain more efficient and more stable transformation of C. rnaltosa
cells. Thus, first transformation systems for C. rnaltosa had been developed using
S. cerevisiae ARG4 (Kunze et al. 1985a,b), LEU2 (Kawamura et al. 1983; Takagi et al.
1986a), and LYS2 (Kunze et al. 1987a,b, obviously integrative transformation oc-
curred) genes to complement the corresponding mutations in C. maltosa (Tables
6, 14, 16). Difficulties in isolating appropriate host mutations and in strain con-
struction were the limiting factors in the development of host-vector systems for
this organism (Chang et al. 1984; Hikiji et al. 1989; cf. Sect. 4.2, Table 6). Other
marker genes (HISS, URA3, TRPl) of S. cerevisiae were obviously not functionally
active in C. maltosa (Table 16). Thereafter, the homologous genes ADEl, ADE2,
and ARG4 (Jomantiene et al. 1987, 1991; Kawai et al. 1991; Sasnauskas et al. 1991,
1992c) and LEU2 (Takagi et al. 1987; Becher et al. 1991, 1994) have been cloned
from C. maltosa and tested as transformation markers (Tables 11, 14) for host-
vector systems. A breakthrough in the development of cloning systems for the
alkane-utilizing yeast C. .maltosa was the isolation of ARS and CEN fragments in
TRA (Takagi et al. 1986a; cf. Sect. 5.1), stimulating the more recent isolation of
additional homologous auxotrophic marker genes (HISS, URA3, CYS2) and their
application in transformation and gene disruption techniques (Tables 8, 11, 14, 15;
see Sect. 4.4.2).
Thus, an improved host-vector system for C. maltosa using the homologous
HISS gene together with the TRA region was described. The HISS gene was isolated
from the genomic library of C. maltosa constructed in pTRAl1 by self-cloning
(HOOji et al. 1989). The host-vector systems which were constructed before
(Kawamura et al. 1983; Takagi et al. 1986a; Kawai et al. 1987), utilized C. maltosa
J288 (leu2) as a host. As this recipient strain had a serious growth defect on n-
alkanes, for the new host-vector system a newly isolated C. maltosa mutant, CHI
(hisS, Alk+), was used as host, which showed growth on alkanes close to the wild-
type strain (HOOji et al. 1989; Table 6). Five vectors for C. maltosa CHI, each of
which contains the 2.3kb HISS gene, the pBR322 sequence, and either the 3.8kb
TRA region (pBTHI0B) or the O.2kb fragment (pBTH20A) of the TRA region were
constructed (Table 14, for vector designation). Furthermore, to improve the host-
vector ~ystems for C. maltosa, a hisS adel double-mutant (CHA1) was obtained
after mutagenesis of the CHI (hisS) mutant, and the ADEI gene which comple-
ments the adenine auxotrophic mutation was cloned (Kawai et al. 1991). This host
Table 14. Available host-vector systems for Candida maltosa. For the vector composition
genes were designated for example as LEU2-Cm, when the homologous Candida maltosa
gene, and LEU2-Sc when genes from Saccharomyces cerevisiae were used for the vector
construction.
Host Vector Composition Mode of Reference
strain of the vectors maintenance
i: integrative
a: autonomously
J288' pCMK3 LEU2-Cm, pBR322 Kawamura et at. (1983)

pCMK3I LEU2-Cm, TRPI-Sc, pRC3
pCMK32 LEU2-Cm, TRPI-Sc, pRC3
(in both orientations)
J288' pTRAI ARS-Cm, CEN-Cm (TRA 3.8kb) a Takagi et al. (1986a)
pTRAll LEU2-Sc, pBR322 a
(in both orientations)
J288' pTRA2 ARS-Cm (TRA 0.2 kb) a Kawai et al. (1987)
pTRAI2 LEU2-Sc, pBR322 a
CHI pBTHIOA ARS-Cm, CEN-Cm (TRA 3.8 kb) a Hikiji et al. (1989)
CHAI pBTHIOB HISS-Cm, pBR322 a
CHUI pBTHllOA all plasmids a
Table 14. (Contd.)
Host Vector Composition Mode of Reference

strain of the vectors maintenance
i: integrative
a: autonomously
CHAUI pBTH110B a
pBTH20A ARS-Cm, (TRA 0.2kb) a Hikiji et ai. (1989)
HISS-Cm, pBR322
pUTH18 ARS-Cm, CEN-Cm (TRA 3.8kb) a Okhuma (unpub!.)
HISS-Cm, pUC18 Sugiyama et ai. (1995)
CHAI pUTAl ARS-Cm, CEN-Cm (TRA 1.8kb) a Kawai et ai. (1991)
CHAUl ADEl-Cm, pBR322 Ohkuma (unpub!')
CHUI pTHUl ARS-Cm, CEN-Cm (TRA 3.8kb) a Ohkuma et ai. (1993a)
CHAUl HISS-Cm, URA3-Cm, pUC18
pUTUl ARS-Cm, CEN-Cm (TRA 1.8 kb) a Ohkuma (1994,
URA3-Cm, pUC19 unpub!.)
CHSI pUTCl ARS-Cm, CEN-Cm (TRA 3.8 kb) a Ohkuma (1994,
CHSAI CYS2-Cm, pUC18 unpub!.)
G344 pYe(ARG4) ARG4-Sc, pBR322 a Kunze et aI. (1985a,b)
(arg4) 411 ARS-Sc
G457 pDP12 LYS2-Sc, pBR322 Kunze et a!. (1987a,b)
(lys2) TRPI-Sc, ARSI-Sc (not active)
pDP 13 as pDP12, additional
CEN6-Sc (not active)
VSB899 pRA7-1 ARS-Cm, ADEl-Cm, pUC19 a Jomantiene et a!. (1987)
(adel) pRJ! ARS-Cm, ADEl-Cm a Sasnauskas et a!. (1992c)
.pICEM-19H
G587 Not named ARS-Cm (from VSB899)b a Wedler et ai. (1990)
(leu2) LEU2-Cm
G587 CipLl LEU2-Cm, pUC18 Becher et ai. (1991, 1994)
(leu2) CrLpl ARSI-Cm (1.8kb) a Becher et ai. (1991, 1994)
LEU2-Cm, pUCl8
G374 CrAp2 ARSI-Cm,ADEI-Cm a Kasiiske et ai. (1992)
(adel) pBR32S
CipA1S ADEl-Cm, pACYCI77 Kasiiske et aI. (1992)
pCCDS ARS2-Cm (weak) ali Kasiiske et a!. (1992)
CYPS3A3::ADEI-Cm
pACYC117
, J288 strain has serious growth defect on alkanes, whereas CHI and the mutants derived from it show normal
growth on alkanes (Hikiji et aI. 1989).
bARS from VSB899 (Jomantiene et a!. 1987).
Host strains used and their genotypes (cf. Table 6):
A) Derived from the wild-type strain C. maltosa IAM12247
J288 - leu2 (Takagi et aI. 1986a); CHI - hisS (Hikiji et ai. 1989)
CHAI - hisS, adel (Kawai et a!. 1991)
CHUl - hisS, ura3::ADElIura3::ADEl, and CHAUI - hisS, ade1, ura3 (Ohkuma et ai. 1993a)
CHSI - hisS, cys2, and CHSAI - hisS, cys2, adel (Ohkuma, unpub!.)
B) Derived from the wild-type strain C. maltosa 14
G344 - arg4-18 (Kunze et ai. 1985a,b); G4S7 -lys2-21, ino-3 (Kunze et ai. 1987a,b)
GS87 -leu2 (Becher et aI. 1991, 1994; Kasiiske et ai. 1992)
G374 - adel (Kasiiske et aI. 1992).
Abbreviations: TRA - transforming ability region
CipLl - Candida integrative plasmid LEU2
CrLp 1 - Candida replicative LEU2 plasmid.
is convenient, especially for gene disruption experiments. Using two kinds of

marker genes, one can disrupt both alleles of distinct gene present in C. maltosa, as
demonstrated for ALIl and CYPS3A3 genes (Hwang et al. 1991; Ohkuma et al.
1991a).
More recently, the triple auxotrophic mutants CHAU1 (hisS adel ura3) and
CHSA1 (hisS cys2 adel) were obtained (Ohkuma 1993; Ohkuma et al. 1993a; for
details see Table 6 and Sect. 4.2.2) and the corresponding vectors, like pTHUl and
pUTC1, for transformation of these convenient recipient strains were constructed
(Table 14). These hosts are more useful because, after disruption of both alleles of
a gene, the remaining auxotrophic mutation is available for complementation with
a next selective marker gene in a further transformation step (Ohkuma 1993).
Other host-vector systems for C. maltosa were developed in other laboratories
based on independently isolated recipient strains (Table 6), the newly cloned ARS
and marker genes ADEI (Sasnauskas et al. 1992c) and both LEU2 and ADEI
(Wedler et al. 1990; Becher et al. 1991, 1994; Kasiiske et al. 1992) using autono-
mously replicating and integrative plasmids as well (Table 14).
Dominant (positive selectable) marker genes were up till now not used in
transformation of C. maltosa. Contrary, several dominant marker genes isolated
from C. maltosa (RIM-C, CYIfR, FDHl; see Sect. 4.4.2) are applicable for transfor-
mation of wild-type strains of S. cerevisiae, other yeasts and plants, if they
Table 15. Functional expression of genes isolated from Candida maltosa in the yeast
Saccharomyces cerevisiae and in E. coli
Gene" Complementation of mutation Reference

or functioning in
ARS two fragments C Functions in Sc Polumienko and Grigorieva

(strain VSB747) (1985)
ARS Functions in Sc and Cm Takagi et al. (1986a)
(strain IAM12247) Kawai et al. (1987)
ARS Not functioning in Sc, Jomantiene et al. (1987)
(strain VSB899) functions in Cm Sasnauskas et al. (1992b)
ARSI and ARS2 Not functioning in Sc, Becher et al. (1991, 1994)
(strain L4) functions in Cm Kasusk et al. (1992)
Selectable auxotrophic markersb
ADEI adel in Sc Jomantiene et al. (1987, 1991)
Sasnauskas et al. (1991)
Kawai et al. (1991)
ADE2 ade2 in Sc Jomantiene et al. (1987)
ARG4 arg4 in Sc Jomantiene et al. (1987)
CYS2 cys2 in Sc Ohkuma (unpubl.)
HIS5 his5 in Sc Hikiji et al. (1989)
LEU2 leuB in E. coli Kawamura et al. (1983)
leu2 in Sc Takagi et al. (1987)
Wedler et al. (1990)
URA3 ura3 in Sc Ohkuma et al. (1993b)
Table 15. (Contd.)
Gene" Complementation of mutation Reference

or functioning in
Functional expression of other enzymesd

CYP52A3 (Cm1) In E. coli (not active) Schunck et al. (1989b)
Sc
in GRF18 Schunck et al. (1991)
Scheller et al. (1992, 1994, 1996)
CYP52A4 (Cm2) In Sc GRF18 Schunck et al. (1991)
Scheller et al. (1992, 1996)
Zimmer and Schunck (1995)
CYP52A5 (ALK2-A) In Sc GRF18 Zimmer (1995, unpubl.)
CYP52A9 (ALK5-A) In Sc GRF18 Zimmer (1995, unpubl.)
CPR In E. coli (not active) Kiirgel et al. (1996)
in Sc GRF18
CYP52A3 to A5 In Sc GRF18 Zimmer (1995, unpubl.)
and CPR (coexpression) Zimmer et al. (1995)
Dominant selectable markers
RIM-C (L41Q) Selectable in Sc and other yeasts Takagi et al. (1986b)
for cycloheximide resistance Kawai et al. (1992)
Hino et al. (1992)
CYIfR Selectable in Sc Sasnauskas et al. (1992c)
for cycloheximide resistance
FDHl Selectable in Sc Sasnauskas et al. (l992a)
for formaldehyde resistance
Abbreviations: Cm - Candida maltosa

Sc - Saccharomyces cerevisiae.
a In the literature Candida (maltosa, tropicalis, or albicans) genes are mostly designated C-
ADEI or Ca-ADEI to distinguish them from S. cerevisiae genes (ADEl).
bThe genes ADEl, ADE2, HIS3, LEU2, TRPl, and URA3 from C. albicans also complement
the respective mutants in S. cerevisiae (Ohkuma 1994, unpubl.; for references see Kurtz et
al. 1990).
cTwo ARS fragments not sequenced. Their function in C. maltosa itself was not tested.
dFunctional expression of P450 and NADPH-P450 reductase in the ER of S. cerevisiae
GRF18 under control of the GALlO (Sc) promoter by using the vector YEp51. Nonfunction-
al expression of partial protein sequences in E. coli detected with antibodies.
are expressed in the recipient organism, as shown for the RIM-C-directed transfor-
mation of a freeze-tolerant yeast Kluyveromyces thermotolerans (Hino et al. 1992)
and for the transformation of the plant Nicotiana tabacum using CY!P as a domi-
nant selectable marker gene (Jomantiene et al. 1992). Unfortunately, many
nonconventional yeasts are cycloheximide-resistant themselves.
5.2.2
Transformation Methods
Note on Methods. Although it was shown that C. maltosa could be transformed by

the conventional spheroplast method with high frequency, this method is
complicated and time-consuming. Therefore the more convenient lithium acetate
and recently electroporation methods were applied for transformation of C.
maltosa (Takagi et al. 1986a; Kasiiske et al. 1992; Sasnauskas et al. 1992; Takagi
1992,1993; Becher et al. 1994; Ohkuma et al. 1994a,b; Becher and Oeiver 1995). The
procedures used in our laboratories are given below. For the quantitative
determination of the transformation frequency, each plasmid multiplied in E. coli
was gently purified before transformation into a C. maltosa recipient strain.
Transformation by the Spheroplast Method

Procedure
1. Grow the yeast culture with shaking in 100 ml YPD medium at 30°C to 2-5 X
107 cells/ml.
2. Harvest by centrifugation and wash in distilled water.
3. Resuspend in 10ml of 1.2M sorbitol solution, add 25 J1l of j3-mercaptoethanol
and incubate 10min at 30°C.
4. Centrifuge, wash in 10 ml of 1.2 M sorbitol, and resuspend in 1.2 M sorbitol.
5. Add O.lml Zymolyase 60000 (O.5mg/ml), incubate at 30°C with gentle or
occasional shaking for 1 h.
6. Centrifuge at 2500 g for 3 min, wash twice in 10 mll.2 M sorbitol and wash once
in SCT buffer (2M sorbitol, 10mM CaCI2, IOmM Tris-HCI, pH 7.5).
7. Resuspend in 5ml SCT buffer, divide into O.lml aliquots in sterile
micro centrifuge tubes and add O.I-lOllg DNA solution.
S. Place at room temperature for 10 min, add 1 ml of 10% PEG 4000 and mix
gently.
9. Place at room temperature for 15 min.
10. Add transformation mixture to 7-lOml of regeneration agar (1.2M sorbitol,
0.67% YNB without amino acids, 2% glucose, 3% agar) in plastic tubes held at
45-50°C in a water bath. Mix briefly and immediately pour over plates of
selective media (the SD plates).
11. Incubate plates for 2-5 days.
Transformation by a Modified Lithium Acetate Method

Note on Method. Transformation of C. maltosa was performed by a slightly
modified lithium acetate procedure according to Ito et al. (1983). For optimization
of the frequency of transformation, the concentration of the lithium acetate and
the pre-incubation time were changed and their effects on the frequency of
transformation were assessed using the vector pTRAl and strain J288 (leu2) as a
host (see Tables 6 and 14). The frequency was raised as high as that of the
spheroplast method, about 1BOO colonies per Jig DNA, when the cells were
suspended in 0.05 M instead of 0.1 M lithium acetate and shaken at 30°C for 90 min
instead of for 60 min. Using 1Jig of the vector pBTHlOB, a few hundred of
transformants could be obtained by this method using the host strain C. maltosa
CHA1 (hisS adell.
Procedure
1. Inoculate a single colony from a YPD plate into 2ml YPD. Grow the yeast
culture with shaking overnight at 30°C (preculture or seed culture).
2. Inoculate 10ml of YPD medium with appropriate number of these freshly
grown cells (0.2--0.5 ml of preculture), and incubate with shaking at 30°C for 3
to 6h.
3. Harvest the cells at 2-5 x 107 cells/ml (late log phase) by centrifugation, and
wash the cells twice in 5ml of TE buffer (10mM Tris-HCl, pH B.O, 20mM
EDTA).
4. Resuspend the cells in 1 ml of the solution of 0.05 M lithium acetate in TE buffer,
pH B.O, and incubate at 30°C for 1.5 h with gentle shaking.
5. Dispense 0.1 ml aliquots into sterile microcentrifuge tubes and add appropriate
amount of plasmid DNA (O.l-lOJig), mix, and incubate 30 min at 30°C.
6. Resuspend the cells completely (otherwise cells could not suspend in PEG
solution), then add 0.1 m170% PEG 4000 solution in TE buffer, mix byvortexing
tubes, and incubate at 30°C for 1 h.
7. Transfer the tubes to a 42°C waterbath for 5 min (heat shock).
B. Wash the cells with 1 ml sterile distilled water, harvest, and spread onto selec-
tive agar (YNB-glucose agar without the marker amino acid to select for, e.g.,
Leu- plates for plasmid pTRAl).
9. Incubate the plates for 2-5 days at 30°C.
Note on Method. Electroporation has recently become the preferred method for
gene transfer due to its ease and efficiency of operation in comparison to
alternative methods. Although electroporation has been used successfully for
other yeasts and fungi (for references see Kasuske et al. 1992, and other chapters,
this VoL) the optimal conditions vary significantly between different yeast strains.
Therefore, it was necessary to optimize the conditions (cell growth and density,
field strength, pulse duration, and DNA concentration) for the used C. maltosa
strains (Kasuske et al. 1992; Becher and Oliver 1995; Ohkuma et al., unpub1.; Fig. B).
A maximum of 7000 transformants per 100 ng of plasmid DNA was reached under
optimal conditions described by Kasuske et a1. (1992), demonstrating that
electropulse transformation is more efficient than other standard methodologies
used with C. maltosa and perhaps other yeasts. It has the advantages of permitting
very low concentrations of DNA to the used and of promoting the
cotransformation events which may be essential to produce disruption or
replacement mutants in this imperfect yeast.
Procedure
1. Grow the C. maltosacells as described above in 10 ml YPD to a cell density of
about 5 x 107 cells/ml.
2. Chill on ice and harvest by centrifugation at 0-4°C.
3. Wash the cells with 5 ml sterile ice-cold 1 M sorbitol.
4. Resuspend the cells with 0.2 ml sterile ice-cold 1 M sorbitol (50-fold concentra-
tion of the cells).
5. Pipette 50-,uI aliquots into a micro centrifuge tube on ice, add an appropriate
amount of plasmid DNA (lOO-lOOOng), mix, and transfer into a prechilled
sterile electroporation cuvette.
6. Perform electroporation using the following conditions:
Equipment - Genepulser and Pulse Controller (BioRad)
Cuvettes - 0.2 em (OAcm also applicable, but increase voltage)
Capacitor - 25 J.lF
120 3
;;(
100 2.5 z
0
Ol
~
~ 80 2 0
0
!!2 0
Qi
u 60 1.5 c-
-
Ol LL
c:
.;; t-
.~ 40 0
::l >-
rn U
c:
20 0.5 Q)
:J
0-
...
Q)
LL
0 0
0 0.5 1.5 2 2.5

Voltage (kV)
Fig. 8. Effect of initial voltage on frequency of Candida maltosa transformation. Host
strain: Candida maltosa CHAl. Plasmid: pBTHIOB (200ng DNA). Conditions:
Electroporation cuvettes 0.2 cm. Symbols: • Frequency of transformants per J.Lg DNA
(xlOOO); ... Surviving cells (%)
Parallel resistor - 200 ohm

Initial voltage - varied from 1.4 to 2.5kV (optimal 1.8 to 2.0kV)
7. Plate out onto selective agar (YNB-glucose), and incubate at 30°C for 2-4 dyas.
5.3
Heterologous Gene Expression in Candida maltosa
The construction of expression vectors for C. maltosa is interesting for several

reasons. First, by using an expression vector, it may be possible to induce a gene of
interest under conditions where the gene is otherwise uninduced to analyze the
function of the gene product. Second, there is interest in the expression of heter-
ologous genes in the n-alkane assimilating yeast C. maltosa, because this yeast,
especially when grown on alkanes or fatty acids, has the ability to develop intra-
cellular membrane structures such as ER and peroxisomes (see Sect. 3.2). Conse-
quently, C. maltosa may have an advantage when used as a host for the synthesis
of heterologous proteins targeting to these organelles. Especially, the ER might be
utilized as a residence for enzymes (like P450 systems), catalyzing the biotransfor-
mation of many kinds of mostly hydrophobic organic compounds. For this pur-
pose, it should be advantageous to express heterologous genes in C. maltosa to
confer new metabolic functions.
In this way, it will be possible to use the specific peculiarities of the alkane-
assimilating yeast cell for optimization of special biotransformation reactions, as
there are the facilitated transport of hydrophobic substrates into the cell, the high
activity of cofactor supplying and electron transfer systems (NADPH-P450 reduc-
tase, cytochrome b s and its NADH-dependent reductase) supporting the extremely
high in vivo turnover rate of the host's own alkane- and fatty acid-oxidizing P450
enzyme systems, and the optimized intracellular transport of hydrophobic sub-
Table 16. Expression of heterologous genes in Candida maltosa
Gene' Complementation of a Plasmid nature Reference

mutation or expression (i: integrative)
of a functional protein (a: autonomously)
Heterologous auxotrophic markers genes

ADEI Cab adel (a) Ohkuma et al. (1994,
ADEI Sc Not tested unpubl.)
ARG4Sc arg4 (a) Kunze et al. (1985a,b)
LEU2 Sc leu2 (a) Kawamura et al. (1983)
Takagi et al. (1986a, 1988)
LYS2 Sc lys2 (weakly expressed) (i) Kunze et al. (1987a,b)
URA3 Sc ura3C (a) Sugiyama et al. (1995)
URA3 Cab ura3 (a) Ohkuma et al. (1994,
unpubl.)
HISS Sc Not functioning< (a) Sugiyama et al. (1995)
TRPI Sc Not expressed" (i) Kunze et al. (1987a)
Table 16. (Contd.)
Gene' Complementation of a Plasmid nature Reference

mutation or expression (i: integrative)
of a functional protein (a: autonomously)
Dominant markers: not tested

ARS/CEN function
ARS SCd Functioning in Cm Kunze et al. (1986a,b)
ARSI Sc Not functioning in Cm Takagi et al. (1986a)
2J1 ORI Sc Not functioning in Cm Takagi et al. (1986a)
CEN6 Sc Not active in Cm Kunze et al. (1987a,b)
Heterologous genes
AmpR Ec j3-Lactamase (a) Kunze et al. (1985a,b)
(bla) (i) Kunze et al. (1987a)
POX2 Ct Subunits of peroxisomal (a) Kamiryo et al. (1989)
POX4 Ct acyl-CoA oxidase
LAC4KI j3-Galactosidase, as
reporter gene for
promoter testing of:
PGKI (a) Masuda et al. (1994)
CYP52A3 or CYP52A4 (a) Muraokaet al. (1993)
Several other No functional Sugiyama et al. (1995)
genes: expression c Ohkuma et al.
lacZ Ec, gusA (unpubl.)
Ec, P450
and others
Abbreviations: Cm - C. maltosa, Ca - C. albicans

Ct - C. tropiealis, Ke - Kluyveromyces lactis
Se - S. eerevisiae, Ee - E. coli.
a In the literature Candida (albicans, maltosa, or tropiealis) genes are mostly designated C-
ADEI or Ca-ADEI to distinguish them from S. eerevisiae genes (ADEl).

b Candida albieans genes ADEI and URA3 also complement the respective mutants in S.
cerevisiae (Ohkuma et al. 1994, unpubl. results).
c HIS5 Se - no functional expression in Cm. For the URA3 Se firstly no expression in Cm was
observed, which was probably due to the codon usage problems in this host. After changing
its CTG co dons in other leucine codons functioning in Cm, complementation of the corre-
sponding ura3 mutations in Cm by the modified genes of Se was observed. The different
codon usage might be the reason for the failure in functional expression of several other
heterologous genes (lacZ and gusA genes of E. coli coding for j3-galactosidase and 13-
glucuronidase, respectively, the 2,3-dihydroxybiphenyl dioxygenase gene of Pseudomonas
sp., the catechol-2,3-dioxygenase gene of P. putida, mammalian P450 genes, e.g., P450C21)
in Cm (Sugiyama et al. 1995, see Sects. 4.4.3 and 5.3).
dThe vector pYe(ARG4)411 used in the experiments contained an ARS of Sc (Tschumper
and Carbon 1982; Kunze et al. 1985a,b).
e Only insignificant increase in the activity of phosphoribosylanthranilate (PRA) isomerase
(coded by TRPl) after transformation of C. maltosa G457 (lys2) mutant with the plasmid
pDP13, containing additionally the TRPI gene of S. cerevisiae, due to lack of trpl mutants in
C. maltosa (Kunze et al. 1987a).
strates and products due to the subcellular organization of the alkane oxidation
pathway (cf. Sects. 2.5 and 3.4).
Based on recent progress in the development of host-vector systems in C.
maltosa, first-expression vectors were constructed to test several isolated promot-
ers of strongly expressed C. maltosa genes for heterologous and homologous
protein expression as well (Table 16).
Using the promoter and terminator regions of the newly isolated regulated
PGKl (phosphoglycerate kinase) gene of C. maltosa in the low-copy expression
vector pMEAl (ARS-CEN, ADE1), Masuda et al. (1994) demonstrated the func-
tional expression of an endogenous P450 gene (CYP52A3) and a heterologous gene
(LAC4-KI encoding fi-galactosidase of Kluyveromyces lactis) in glucose-grown
cells, but not in cells grown on alkane, alkanol, or fatty acid (Table 16). Addition-
ally, the ALKl (CYP52A3) and ALK3 (CYP52A4) P450 promoters were fused with
this reporter gene KI-LAC4 in the low-copy vector pPLl (ADE1, CEN-ARS) and
expressed in C. maltosa, as reported by Muraoka et al. (1993, 1994). Using this
system, first n-alkane responsive regions in the promoter of P450alk genes were
identified by deletion analysis. More recently, a similar host-vector system (vector
pUTUl - URA3, CEN-ARS) was used to express P450alk genes in C. maltosa
DAl235 (ura, alk) and related strains (obtained from strain CHAiJl by stepwise
gene disruption of the P450 genes ALKl-3 and 5) to study the function of indi-
vidual alkane-inducible P450 forms in C. maltosa in vivo (Ohkuma et al. 1993c;
Ohkuma et al. 1995d; and unpubl. results).
The LAC4-KI gene is therefore useful as a reporter gene in C. maltosa and other
Candida species, in which some other commonly used reporter genes for promoter
testing in yeast, such as the lacZ or gusA genes of E. coli, could not be expressed,
probably due to codon usage problems, as it was also reported for expression of
these reporter genes in C. albicans and C. tropicalis (Leuker et al. 1992).
The strongly regulated, galactose-inducible and glucose-repressible GALl
(galactokinase) promoter in the high-copy (>20) vector pNGH2 (ARS, HIS5) was
recently used to overexpress the homologous P450 genes ALK1-A, its mutant
forms, andALK-3A in C. maltosa CHAl or CHUI (Ohkuma et al. 1995b; Sugiyama
et al. 1995). Immunoelectron microscopy revealed that, upon overexpression, a
dramatic proliferation of ER occurred, in which the overproduced P450alk pro-
teins accumulated. The artificially proliferated ER membranes were mainly tubu-
lar forms, and stacks of paired membranes were also observed after prolonged
expression. The tubular forms were morphologically very similar to the physi-
ologically proliferated forms of ER present in alkane-induced C. maltosa cells (cf.
Sect. 3, Fig. 4). The observed proliferation ofER membranes by overproduction of
homologous P450alk will provide a unique opportunity for investigating the
mechanisms by which cells regulate ER biogenesis, in comparison with the intrin-
sic form of ER proliferation. Thus, using C. maltosa as a host, it is now possible to
compare physiologically proliferated forms of ER with those induced artificially.
Additionally, the POX2 and POX4 genes encoding the peroxisomal acyl-CoA
oxidase proteins PXP-2 and PXP-4, respectively, of the peroxisomal ACO of C.
tropicalis were expressed from vectors based on pTRA3 (multicopy vector with
O.6kb TRA, Sc-LEU), introduced into C. maltosa J288 (Kamiryo et al. 1989). The
fact that C. tropicalis promoters were recognized and the gene products were
targeted into the C. maltosa peroxisomes indicates that gene expression and tar-
geting signals and mechanisms in these two yeasts are similar.
Functional expression of ,B-lactamase (AmpR gene) of E. coli in addition to
heterologous marker genes in transformed c. maltosa cells, using the expression
vector pYe(ARG4)411, which carried the ARG4 gene of S. cerevisiae (Kunze et al.
1985a,b), or using the vectors pDP12 or pDP13, which carried the LYS2 gene of S.
cerevisiae (Kunze et al. 1987a), was reported (Table 16). The expression of this
prokaryotic gene in yeasts after previous selection using a selective marker is a
potentially useful tool for finding transformants.
By taking advantage of the recently developed host-vector system for C.
maltosa, it was possible to test the expression of several other heterologous genes,
such as lacZ and gusA genes of E. coli coding for fJ-galactosidase and ,B-glucu-
ronidase, respectively, the 2,3-dihydroxybiphenyl dioxygenase gene of Pseudomo-
nas sp., the catechol-2,3-dioxygenase gene of P. putida, and the mammalian
P450e21 gene in C. maltosa (Sugiyama et aI. 1995; Ohkuma et aI., unpubI.). The
expression of these genes has failed, although in some cases synthesis of a tran-
script of the genes was confirmed, suggesting difficulties in expressing heterolo-
gous genes at the posttranscriptional level, which might be connected with the
alteration in codon usage in this yeast, as discussed in Sect. 4.4.3.
As shown in Sect. 5.2.1, several auxotrophic marker genes of S. cerevisiae (Sc)
and C. albicans (Ca) were tested to be expressed under the control of their own
promoter in C. maltosa with different results (Table 16). Expression of Ca-ADEI
and Ca-URA3, as well as expression of Sc-ARG4, Sc-LEU2, and Sc-LYS2 was dem-
onstrated due to complementation of the corresponding mutations in C. maltosa.
In contrast, several other heterologous marker genes including Sc-HIS5, Sc-URA3,
and probably Sc-TRPI cannot be functionally expressed in C. maltosa (Table 16).
Only an insignificant increase in the activity of phosphoribosyl-anthranilate
isomerase (coded by TRP 1) after transformation of C. maltosa G457 (lys2) mutant
with the plasmid pDP 13, containing additionally to Sc-LYS2 the Sc-TRPI gene, was
observed (Kunze et aI. 1987a).
As mentioned above, the eTG codon usage alteration may be a primary cause of
occurring difficulties in expressing a heterologous gene in C. maltosa (cf. Sect.
4.4.3). This was clearly demonstrated recently for the URA3 gene of S. cerevisiae.
After changing the only one eTG codon of the Sc-URA3 gene, which could not
complement the ura3 mutation of C. maltosa, by the eTe leucine codon, the
modified Sc-URA3 gene was functionally expressed in C. maltosa (Sugiyama et al.
1995). This result is the first example of succeeding in functional expression of a
heterologous gene in Candida species having an altered codon usage by changing
the eTG codon in the gene to another. On the other hand, S. cerevisiae LEU2 (with
its own promoter) and K. lactis LA C4 (under control of the host's own promoters,
Masuda et al. 1994; Muraoka et al. 1993, 1994; Table 16) genes were shown to be
expressed functionally in C. maltosa, although they have one or two eTG co dons,
respectively. In these genes, the position of the eTG codon may not affect the
function of the encoded proteins.
12. Candida malfosa 547
Therefore, it is possible to Qvercome problems occurring in heterologous gene

expression by changing the codons CTG (used for serine) in the gene to express
into another codon for leucine. However, it may be a laborious task to change CTG
codons, because there are many CTG codons in other genes from bacteria and
mammals. The construction of a suppressor tRNA which translates the CUG codon
as leucine in C. maltosa shquld be tested to avoid the labor of changing all the CTG
codons in any gene to be expressed. Thus, as a consequence of the altered codon
usage (Sect. 4.4.3) in C. maltosa, the application of the developed host-vector
systems for heterologous expression of different genes in C. maltosa is at present
still limited, when the presence of CUG codons in the genes to be expressed has
serious consequences for the functioning of the respective gene product.
On the other hand, the C. maltosa host-vector system should be very useful for
the expression of genes isolated from related Candida yeasts such as C. albicans,
C. cylindracea, C. melibiosa, C. rugosa, C. zeylanoides, and C. parapsilosis
(Kawaguchi et al. 1989; Ohama et al. 1993; Ohkuma et al.1993b), where the unusual
CUG codon usage also occurs. This might be true also for C. tropicalis and other
Candida yeast related to C. maltosa.
6
Potential Biotechnological Application of Candida rna/tosa
In several Sections of this Chapter the particular industrial importance of alkane-

utilizing yeasts like C. maltosa, C. tropicalis, and Y. lipolytica has been mentioned
already. As will be shown below, several possibilities exist for potential biotechno-
logical application of C. maltosa, although there are only few examples for a
current realization directly in industry, or the industrial production has been
stopped, as for the most SCP processes. This seems, for different reasons, to be a
general feature in the application of nonconventional yeast today.
In the context of data obtained for alkane-assimilating yeasts in general (re-
viewed by Levi et al. 1979; Rehm and Reiff 1981,1992; Fukui and Tanaka 1981a,b;
BUhler and Schindler 1984), and based on progress made in the past decade as
given in this chapter, some of the potential practical applications of C. maltosa in
particular can be discussed as follows:
• Production of alkane-based SCP (Liquipron, Paprin, Fermosin, see Shennan

1984; Senez 1986), carbohydrate-based SCP, and different by-products of these
processes, like biolipid extract and some of its components (ergosterol,
ubiquinon), glutamic acid, and RNA (see below).
• Production of some hydrophobic intermediates of the alkane oxidation pathway,
like fatty alcohols, fatty acids, and especially dicarboxylic acids (DCA), of com-
mercial interest with C. maltosa alk mutants (Shiio and Uchio 1971; Uchio and
Shiio 1972a,b,c; Caseyet al. 1990; see below).
• Use of C. maltosa enzymes as biocatalysts. The production of homologous en-
zyme proteins directly from C. maltosa grown on alkanes and other substrates
(P450s, NADPH-P450 reductase, cytochrome b s, FAOD, SOD, catalase; Avetisova
1991; Mauersberger et al. 1992b; Avetisova and Davidov 1993; Avetisova et al.
548 s. Mauersberger et a1.
1993; cf. Fukui and Tanaka 1981b) or after heterologous expression of their
genes in S. cerevisiae (P4S0alk genes, Schunck et al. 1991; Scheller et al. 1992,
1994, 1996; Kiirgel et al. 1996) and application of these enzymes in biotransfor-
mation reactions (see Sect. 2.5.3) was tested. The alkane-induced FAOD of C.
maltosa can be applied for stereoselective oxidation of secondary alcohols to
gain enantiomeric pure S(t) secondary alkanols of potential interest by using a
crude membrane fraction or the purified enzyme obtained from cells grown on
alkanes (Mauersberger et al. 1992b; see Sect. 2.5.3). Recently, Zimmer et al.
(1995) described an efficient biotransformation system of lauric acid to
dodecanoic acid with intact recombinant cells of S. cerevisiae, coexpressing the
NADPH-P450 reductase and CYP52A4 P450 genes from C. maltosa (see below).
Bode and Birnbaum (1991a) investigated the enzymatic production of
indolepyruvate, and of analogs of indolepyruvate from tryptophan and methyl-
and fluoro-derivatives of tryptophan using the tryptophan aminotransferase of
C. maltosa.
• Application of C. maltosa as a potential host for the production of heterologous
proteins. The potential application of alkane-utilizing yeast as a host for the
functional expression of enzymes like P450 systems and the use of recombinant
C. maltosa cells as biocatalysts in biotransformation reaction was discussed in
Sect. 5.3.
• Production of muconic acid from catechol in a bioprocess using catechol-grown
C. maltosa ATCC 20184 cells (Gomi and Horiguchi 1988).
• Enantioselective production of D-amino acids from racemic substrates DL-
amino adds, demonstrated for alanine (Umemura et al. 1990, 1992, Tanabe
Seiyaku Company, Ltd., Osaka, Japan, see below).
• Production of 3- and 2-isopropylmalate with leu2 and leul mutants of C. maltosa
(Bode et al. 1991, see below).
• Production of a-aminoadipate-<5-semialdehyde (AASA) with lysl and lys9 mu-
tants of C. maltosa (Schmidt et al. 1989a,b, see below).
• Mannan isolated from C. maltosa and its sulfated derivatives introduced into the
intercellular space of tobacco and cucumber leaves promoted an increase of their
resistance to the viral (tobacco mosaic virus) and bacterial (pathogenic strain
Pseudomonas syringae pv.lachrimans) infections, respectively (Kovalenko et al.
1992).
Single Cell Protein (SCP) Production. The nonpathogenic yeast C. maltosa and other
alkane-utilizing yeasts, like Y. (C.) lipolytica and C. tropicalis, have in the last 30
years been of particular interest for industrial application mainly because of their
ability to produce single-cell protein (SCP) based on alkanes on an industrial scale
(reviewed by Levi et al. 1979; Einsele 1983; Shennan 1984; cf. Sects. 1 and 2).
However due to the rise in price of petroleum derivatives and the competition with
conventional feed protein, the development of SCP processes in Western industrial
countries and in Japan was stopped for economical and political reasons in the mid
1970s. Nevertheless, the long-term perspectives of SCP are sometimes discussed
more positively (Rehm 1986; Senez 1986).
Mainly C. maltosa and C. tropicalis have been used for the production of SCP as
a by-product of the oil-refining process in the former Soviet Union, GDR, and in
the East European countries Bulgaria and Romania (Shennan 1984; Senez 1986). In
several plants in the former Soviet Union mainly n-alkane fractions (paraffins)
were used to produce fodder yeast (Paprin - hydrocarbon-based single-cell pro-
tein) with C. maltosa strains (Golubev et al. 1986; cf. Sect. 1). In the mid 1980s, this
production reached about 1 million tons per year, and is still being continued in
the countries of the former Soviet Union (Russia, Belarus, Ukraina), although on a
lower production level. The SCP products and production-related problems were
intensively investigated for their biological action (Ioffe et al. 1990), their antige-
nicity (Gukasyan et al. 1990), and in ecological studies (Gradova et al. 1991; see
Sect. 2.2). The SCP product Paprin was recommended and used as new fodder
protein for animals (Ioffe et al. 1990). In the former GDR at the oil processing plant
at Schwedt/Oder (PCK Schwedt), a technology of combined utilization of oil distil-
lates (gas-oil) by microbial deparaffinization to fodder yeasts (Fermosin),
deparaffinized oil distillate, and microbial lipids was elaborated using a C. maltosa
strain (Bauch et al. 1978; Bohlmann et al. 1979, 1982; Wunsche et al. 1981; Brendler
et al. 1983; Ringpfeil1983; Kozlova and Meshchankin 1991; see Sects. 1.1 and 2.2).
The production of this plant was stopped at the beginning of the 1990s.
The microbial lipid (biolipid) extract occurred as a special by-product of this
particular fermentation process using fuel-oil distillates as substrate. This biolipid
extract contained mainly hydrocarbons, fats, phospholipids, free fatty acids, glyc-
erides, sterols, ubiquinones, and vitamins (Muller and Voigt 1981), and was inves-
tigated for production of ergosterol and ubiquinones and for its direct application
(Voigt et al. 1979, 1984a,b, 1985; MUller and Voigt 1984; Vier and Voigt 1984;
Bergmann et al. 1987; Schuster et al. 1990). In the 1980s and more recently, there
were several attempts to develop more complex industrial technologies for the
isolation of additional useful by-products from the biomass or the cultural fluid of
industrial SCP processes using alkane-assimilating C. maltosa strains (for earlier
reviews on yeasts see Levi et al. 1979; Fukui and Tanaka 1981b). Such products are
glutamic acid, RNA, and derived components (ribonucleosides, ribonucleotides),
and their production was scaled up to a laboratory-sized pilot plant in Schwedt!
GDR (Eckart et al. 1988) or are directly produced on an industrial scale addition-
ally to the alkane-based SCP Paprin in Belarus (Baraji et al. 1990; Truchatshova et
al. 1991. Shkumatov 1993, pers. comm.). Like other yeasts, C. maltosa can be used
to produce SCP biomass also on sugars (glucose, galactose, xylose, mannose,
arabinose, rhamnose) of hemicellulose beech wood hydrolysates obtained by
phosphoric acid treatment (Kostov et al. 1991).
Production of Fine Chemicals Derived From n-Alkanes. Although initial interest

focused mainly on the production of SCP from n-alkanes, later, as a result of
detailed investigations into the metabolism of alkane-utilizing yeasts, and as an
answer to the problems arising from oil price increase, attention turned toward the
production of primary oxidation products and other metabolites directly from
alkanes {as reviewed for yeast by Rehm and Reiff 1981; Fukui and Tanaka 1981b;
Biihler and Schindler 1984; Schindler et al. 1990). The aim was to exploit mutants
or even wild-type strains of alkane-assimilating yeast by causing accumulation of
commercially valuable intermediates. Several primary oxidation products (fatty
alcohols, fatty acids, hydroxy fatty acids, and especially dicarboxylic acids) oflong-
and middle-chain alkanes are of industrial importance in the production of
surfactants, lubricants, detergents, and cosmetics (Uchio and Shiio 1974; Uemura
et al. 1988; Schindler et al. 1990).
In this case, C. maltosa was one of the first alkane-utilizing yeast for which the
production of such hydrophobic metabolic intermediates, like dicarboxylic acids
(DCA), was investigated up to pilot plant scale in the Ajinomoto Company in
Japan. Shiio and Uchio (1971) tried to produce longer-chain DCAs, such as DCA-
16, a precursor of synthetic muscone, from hexadecane. They selected the strain C.
(maltosa) cloacae 310 (cf. Sect. 1 and Table 1) as a potent DCA producer among
other hydrocarbon-utilizing yeasts. While growing in a medium containing both
yeast extract and n-alkane, it oxidized the alkane to mainly shorter-chain DCAs
(about 0.3 g per liter) containing the same or lesser number of carbon atoms. To
increase the productivity of DCA formation, a mutant M-1 from the strain 310 was
obtained by MNNG treatment which could not assimilate DCAs (Uchio and Shiio
1972a,b). Resting cells grown on a medium containing acetate and n-alkane pro-
duced significant quantities of dicarboxylic acid homologous to the alkane
cosubstrate. The highest yield of DCA produced was with n-hexadecane as sub-
strate (29.3g ofhexadecanedioic acid per liter). Since strain M-l did not grow well
on n-alkanes compared with the parent strain 310; the addition of other carbon
sources which supported the growth of strain M-l was necessary for the conver-
sion of n-alkane to DCA by the growing cells. Later, Uchio and Shiio (1972c)
derived a mutant of C. cloacae strain M-l which was completely unable to assimi-
late n-alkanes and accumulated the homologous DCA when an n-alkane was
present as cosubstrate with a substrate that would support growth of the mutant.
This mutant strain M-12 cooxidized significant quantities of n-alkane (C IO to C16)
to the homologous DCA (up to 61 gil DCA-16 in shaking flasks and 100g/l DCA-16
under optimized condition in a fermenter during 100h cultivation) during growth
on acetate. These results suggest that the alkane-oxidizing pathway up to the DCA
is intact in these mutants, but the ability to utilize the oxygenated product in the /3-
oxidation is not. The scale-up of the process to a 300-1 tank has been performed
(Uchio and Shiio 1974; Uchio 1978). However, for unknown reasons, this process
was not introduced into industry by the Ajinomoto Co. It might be that the
productivity was not high enough due to the reduced alkane oxidation rate of 10%
in the mutants compared with the wild-type strain (Schindler et al. 1990). More
recently, accumulation of DCA-16 (up to 7g per 1) from hexadecane and palmitic
acid was demonstrated in 75 out of 84 isolated alkD mutants of C. (cloacae)
maltosa (Casey et al. 1990; Table 7). At least one mutant also produced 3-
hydroxyhexadecanedioic acid (up to 2.5 gil). Of the 80 mutants characterized as
alkA -C (Alk-, PN), 16 produced small amounts (82 mgn) ofhexadecanol (cf. Sect.
4.2.2). Additionally, C. maltosa was tested together with C. albicans to produce
long-chain alcohols from glucose as carbon source (White et al. 1989). Obviously,
these strains converted the excess fatty acyl residues (C 14-C 18 ) under certain condi-
tions (aerobic glucose utilization under nitrogen limitation, or anaerobic glucose

utilization), into low amounts of fatty alcohols (60 or 120/lg/g dry weight).
Numerous investigations have been performed to produce DCA with other
yeasts including C. tropicalis and Y. lipolytica (references see Rehm and Reiff 1981;
Biihler and Schindler 1984; Schindler et al. 1990). The first industrial process for
production of DCA from n-alkane was developed in the Nippon Mining Company,
Japan, using mutants of C. tropicalis (Uemura 1985; Taoka 1986; Uemura et al.
1988). Since its introduction in 1987, this industrial-scale production line at
Nippon Mining (now Japan Energy Co.) is able to produce approximately 150t
brassylic acid (DCA-l3) per year from n-tridecane, which represents the world
demand for this acid, used in the perfume industry to produce macro cyclic musk
compounds (Okino et al. 1986; Uemura et al. 1988). A recent biochemical investi-
gation of this very productive mutant M2030 revealed that it has mutations leading
to the absence of the two acyl-CoA oxidases and 3-ketoacyl-CoA thiolase, the first
and the fourth enzymes involved in the peroxisomal f3-oxidation system (Atomi et
al. 1994). Furthermore, it was confirmed that the activity of the second and third
enzyme of the f3-oxidation system, the bifunctional enzyme (enoyl-CoA hydratase/
3-hydroxyacyl-CoA dehydrogenase), drastically decreased in the mutant cells. The
site of mutation causing the absence of the f3-oxidation enzymes in connection
with a decrease in the amount of peroxisomes is not clear.
Recently, several attempts were made to improve the DCA production with C.
tropicalis by gene disruption experiments of two (POX4 and POX5) of the three
genes (POX2, POX4, POX5) coding for the acyl CoA-oxidase or of thiolase genes
and by amplification of genes coding for enzymes of rate-limiting steps (CYP52
and CPR for the P450 enzyme system) of the alkane oxidation pathway in yeasts
(Schindler et al. 1990; Picataggio et al. 1991, 1992).
Another example is the efficient biotransformation oflauric acid to m-hydroxy
lauric acid and dodecanoic acid with intact cells of S. cerevisiae, in which the
NADPH-P450 reductase from C. maltosa was coexpressed at high level with the
CYP52A4 P450 gene of this yeast (Zimmer et al. 1995). For this purpose, a
multicopy plasmid was constructed that contained two independent expression
units controlled by the galactose-inducible GALlO promoter. The recombinant S.
cerevisiae cells within 100 min converted the applied lauric acid nearly completely
to dodecanedioic acid, which is found in the cell-free supernatant.
Production of D-Amino Acids. The strain C. maltosa JCM1504 was applied to

produce D-amino acids from a racemic DL-amino acid substrate (Umemura et al.
1990, 1991, 1992, 1994). After screening 253 yeast strains for their stereospecific
degradation activity against DL-alanine C. maltosa JCM1504 was selected as the
most favorable strain. This strain assimilates the L-isomers of racemic amino acids
such as alanine, arginine, asparagine, glutamate, proline, and serine with high
selectivity as the only source of carbon and nitrogen (Umemura et al. 1990, 1992).
This property of C. maltosa JCM 1504 is connected with the stereoselectivity of its
respective amino acid aminotransferases (shown for the alanine aminotransferase
AlaAT, EC 2.6.1.2) and its relatively low D-amino acid oxidase activity under the
conditions used. The conditions for enantioselective L-alanine degradation,
leaving D-alanine mostly untouched, were established with this C. maltosa strain.
The L-isomer from 200 gIl DL-alanine was nearly completely degraded within 40 h,
and 90 g D-alanine remained in the reaction mixture. The chemical and optical
purity of the D-isomer product thus obtained was 99 and 99.9% enantiomeric
excess, respectively (Umemura 1990, 1992).
Production of3- and 2-lsopropylmalate (IPM). The potential application of leul and
leu2 mutant strains of C. maltosa for the production of 2-IPM and 3-IPM was
demonstrated by Bode et al. (1991). These mutant strains, isolated from C. maltosa
L4 lacking 3-isopropylmalate (3-IPM) dehydrogenase (leu2 mutant GS87) or 2-
IPM dehydratase (leu I mutant G368), were able to excrete 3-IPM and 2-IPM,
respectively, into the culture medium. The optimal conditions for the production
of 3-IPM with the mutant GS87 were determined. In the presence of 20 g glucose/
1,5 g NH 4H 2POil and 75 mg L-leucine!1 in a minimal salt medium, C. maltosa GS87
produced about 900mg 3-IPM/l during 72h of growth. Bya simple procedure,
both chromatographically pure dicarboxylic acids, 90 mg of 2-IPM and 1.4 g 3-IPM
with 50% yield, were isolated from 31 medium. The 2-IPM and 3-IPM, which are
not available commercially, are useful for assays for both IPM dehydratase and 3-
IPM dehydrogenase in the laboratory. Generally, they may be prepared by
microbial production (for literature see Bode et al. 1991). The yield of3-IPM using
the C. maltosa leu2 mutant is more than ten times higher than the amounts
obtained by the above-mentioned methods.
Production of a-Aminoadipate-8-Semialdehyde (AASA). Mutants of C. maltosa
lacking saccharopine reductase (lys9) and saccharopine dehydrogenase (lysl;
Table 6, see Sect. 4.2.2) were found to accumulate and excrete AASA (80-90mg/l
within 48 h using the lysl mutant G28S) into the medium when growing on glucose
and supplemented with SO-lOOmg/l L-lysine (Schmidt et al. 1989a,b), being the
first report of lysine-requiring yeast mutants that accumulate and excrete AASA.
In contrast, P. guilliermondii lys9 mutants lacked this AASA overproduction. The
AASA accumulation by C. maltosa mutants may be explained by the low feedback
regulation of their homocitrate synthase and the equilibrium of the enzyme
reactions involved in the lysine biosynthesis (Schmidt et al. 1989a,b).
Acknowledgments. Part of the authors' work with Candida maltosa was supported
by grants from the Bundesministerium flir Bildung und Forschung of the FRG
(BMBF 03102S7A) and by the Deutsche Forschungsgemeinschaft (DFG) for SM
and WS, and by Grants-in-Aid for Scientific Research from the Ministry of
Education, Science, and Culture of Japan for MO and MT. MO was aided by JSPS
Fellowships for Japanese Junior Scientists. The authors would like to thank Martin
Griebenow for English corrections and support in the final preparation of the
manuscript.
References
Adesnik M, Darnell JE (1972) Biogenesis and characterization of histone messenger RNA in

HeLa cells. J Mol Biol67: 397-406
Ahearn DG, Crow SA, Berner NH, Meyers SP (1976) Microbiological cycling of oil in
estuarine marshlands. In: Wiley M (ed) Estuarine processes, vol 1 USES, Stresses and
adaptation to the estuary. Academic Press, New York, pp 483-492
Ahearn DG, Holzschu D, Crow SA, Ibrahim AN (1979) Comparative studies on the potential
pathogenicity of Candida tropicalis and Candida ma/tosa. In: Garattini S, Paglialunga S,
Scrimshaw NS (eds) Single cell protein: safety for animals and human feeding. Pergamon
Press, Oxford, pp 44-46
Ardies CM, Lasker JM, Bloswick BP, Lieber CS (1987) Purification ofNADPH: cytochrome
c (cytochrome P-450) reductase from hamster liver microsomes by detergent extraction
and affinitiy chromatography. Anal Biochem 162: 39-46
Artamonova VG, Svitina NN (199I) On the current issues of bronchopulmonary diseases
prevention among the workers engaged in industrial biotechnology (Russ). Gig Tr Prof
ZaboI3:31-33
Artamonova VG, Kuznetsov NF, Shleikin AG (1993) Experimental justification of the ap-
proach of medical genetics to individual prophylaxis of occupational diseases of respira-
tory organs. Cent Eur J Public Health 1: 16-18
Atomi H, Yu C, Hara A, Matsui T, Naito N, Kamasawa N, Osumi M, Ueda M, Tanaka A
(1994) Characterization of a dicarboxylic acid-producing mutant of the yeast Candida
tropicalis. J Ferment Bioeng 77: 205-207
Asubel FM et al. (eds) (1994) Current protocols in molecular biology. Current protocols,
Green Publishing, John Wiley, New York, vol 2, chap 13
Avetisova SM (1991) Foundation of the purification method and biochemical characteriza-
tion of cytochrome P450 of alkane-oxidizing yeast Candida ma/tosa. Dissertation,
Moscow
Avetisova SM, Davidov ER (1993) Yeast cytochrome P450 substrate specificity and confor-
mation of alkanes with different structure. 2nd Int Symp Cytochrome P450 Microorgan-
isms Plants, Tokyo, June 13-17, 1993, Abstr, p 17
Avetisova SM, Sokolov YI, Kozlov VI, Davydov RM, Davidov ER (1985) The induction of
cytochrome P-450 two' forms in Candida yeast by n-alkanes of different chain length. In:
Vereczky L, Magyar K (eds) Cytochrome P-450 - biochemistry, biophysics and induc-
tion. Akademiai Kiado, Budapest, pp 455-458
Avetisova SM, Popova LA, Davidov ER (1990) Two step induction of cytochrome P-450 in
Candida ma/tosa yeast. Biocatalysis 4: 61
Avetisova SM, Popova LA, Davydov RM, Davidov ER (1993) Cytochrome b s from Candida
ma/tosa: physico-chemical properties. 2nd Int Symp Cytochrome P450 Microorganisms
Plants, Tokyo, June 13-17, 1993, Abstr, p 40
Babel W (1979) Bewertung von Substraten rur das mikrobielle Wachstum auf der Grundlage
ihres Kohlenstoff/Energie-Verhaltnisses. Z Al1g Mikrobiol19: 671-677
Babel W (1980) Mischsubstratfermentationen - ein energetisch begrundetes Konzept. Acta
Biotechnol 0: 61-64
Babel W (1986) Theoretische Grundlagen des Auxiliarsubstratkonzeptes und seine prak-
tischen Konsequenzen in biotechnischen Prozessen. Acta Biotechnol6: 313-323
Baraji VN, Logatshova lA, Tsvigun IV, Truchatshova TV, Zinchenko AI, Shkumatov VM
(1990) Patent Application USSR N1708845
Barnett JA, Payne RW, Yarrow D (1979) A guide to identifying and classifying yeasts.
Cambridge University Press, Cambridge
Barnett JA, Payne RW, Yarrow D (1983) Yeasts: characteristics and identification. Cam-
Barns SM, Lane DJ, Sogin ML, Bibeau C, Weisburg WG (199I) Evolutionary relationships
among pathogenic Candida species and relatives. J Bacterioll73: 2250-2255
Bassel J, Phaff HJ, Mortimer RK, Miranda M (1978) Examination of hydrocarbon utilizing
mutants of Saccharomyces cerevisiae. Int J Syst Bacteriol28: 427-432
Bassel JB, Mortimer RK (1982) Genetic and biochemical studies on n-alkane non-utilizing
mutants of Saccharomycopsis /ipo/ytica. Curr Genet 5: 77-88
Basse1 JB, Mortimer RK (1985) Identification of mutations preventing n-hexadecane uptake

among 26 n-alkane non-utilizing mutants of Yarrowia (Saccharornycopsis) lipolytica.
Bauch J, Koslova LI, Sobek K, Triems K, Meschtschankin GI, Roschkova MI (1978)
Verfahren zur Gewinnung von "fermosin" -Futterhefe aus Erdoldestillaten. Chern Techn
30: 284-287
Bayer C, Iske U, Glombitza F, Nagel B (1985) Spektralphotometrische in-situ-Messungen
der diffusen Refiexion bei der mikrobiellen Kohlenwasserstoffwandlung. Acta
Biotechnol5: 197-202 .
Becher D, Bottcher F (1983) The cell type of Rhodosporidiurn toruloides after protoplast
fusion between strains of identical and opposite mating type. Curr Microbiol9: 297-300
Becher D, Oliver SG (1995) Transformation of Candida rnaltosa by e1ectroporation. Meth-
ods Mol BioI 47: 291-302
Becher D, Wedler H, Schulze H, Bode R, Kasuske A, Samsonova I (1991) Correlation of
biochemical blocks and genetic lesions in leucine auxotrophic strains of the imperfect
yeast Candida rnaltosa. Mol Gen Genet 227: 361-368
Becher D, Schulze S, Kasuske A, Schulze H, Samsonova lA, Oliver SG (1994) Molecular
analysis of a leu2(-) mutant of Candida rnaltosa demonstrates the presence of multiple
alleles. Curr Genet 26: 208-216
Becher D, Schulze S, Kasuske A, Stoll R, Wedler H, Oliver SG (1995) Chromosome polymor-
phism close to the Crn-ADEllocus of Candida rnaltosa. Mol Gen Genet 247: 591-602
Belov AP, Davidova EG (1982) Lipid granules as a compartment of lipid synthesis in the
yeast cell (Russ). Mikrobiologiya 51: 302-307
Belov AP, Guselnikova TV (1988) The effect of peptides on phosphatidylinositol metabo-
lism in Candida (Russ). Mikrobiologiya 57: 1042-1043
Belov AP, Toneva-Davidova EG (1983) C02+ accumulation and intracellular distribution
during yeast growth. In: Environmental regulation of microbial metabolism. FEMS Sym-
posium, Pushchino, USSR, 1983, Abstr, p 202
Belov AP, Davidova EG, Rachinskii VV (1976) Isolation of vacuoles from Candida tropicalis.
Belov AP, Loginova TM, Tyurin VS, Gololobov AD (1983) The composition and localization
on the cell wall of substances secreted by the Candida guillierrnondii yeast cultivated on
a hydrocarbon-containing medium. Prikl Biokhim Mikrobiol19: 98-103
Belov AP, Davidova EG, Rachinskii VV (1985) Cobalt distribution studied in the cells of
Candida rnaltosa. Mikrobiologiya 54: 970-973
Belov AP, Guselnikova TV, Gradova NB (1991) Adaptive changes in the nitrogen metabo-
lism of yeasts due to consumption of peptides of a yeast autolysate (in Russian with
English Translation). Appl Biochem Microbiol (Prikl Biokhim Mikrobiol) 26: 560-565
Bennetzen JL, Hall BD (1982) Codon selection in yeast. J BioI Chern 257: 3026-3031
Bergmann H, Voigt B, Seidel H, Meisgeier G (1987) Einfiug von Lipidfraktionen
mikrobieller Herkunft auf die Wasserausnutzung in der biologischen Stoffproduktion
von Kulturpfianzen. Acta Biotechnol 7: 201-206
Berner NH, Ahearn DG, Cook WL (1975) Effects of hydro carbo no clastic yeasts on pollutant
oil and the environment. In: Bourquin AW, Ahearn DG, Meyers SP (eds) Ecol Res Ser
EPA-660/3-75001. US Environmental Protection Agency, Corvallis, pp 199-219
Bizzi A, Veneroni E, Tacconi MT, Codegoni AM, Pagani R, Cini M, Garattini S (1980)
Accumulation and metabolism of uneven fatty acids present in single cell protein.
Toxicol Lett 5: 227-240
Blasig R, Schunck W-H, Jockisch W, Franke P, Muller H -G (1984) Degradation oflong-chain
n-alkanes by the yeast Lodderornyces elongisporus I. Products of alkane oxidation in
whole cells. Appl Microbiol Biotechnol19: 241-246
Blasig R, Mauersberger S, Riege P, Schunck W-H, Jockisch W, Franke P, Miiller H-G (1988)
Degradation oflong-chain n-alkanes by the yeast Candida rnaltosa. II. In vitro oxidation
of n-alkanes and intermediates using microsomal membrane fractions. J Appl Microbiol
Blasig R, Huth J, Franke P, Borneleit P, Schunck W-H, Miiller H-G (1989) Degradation of
long-chain n-alkanes by the yeast Candida maltosa III. Effect of solid n-alkanes on
cellular fatty acid composition. J Appl Microbiol Biotechnol31: 57l-576
Bley T, Heinritz B, Steudel A, Stichel E, Glombitza F, Babel W (1980) Yield coefficients in
dependence on milieu conditions and cell states. 1. Synchronized batch growth of a yeast.
Z Allg Mikrobio120: 283-286
Bode R (1991 ) Valine inhibition of beta-isopropylmalate dehydrogenase takes part in the
regulation of leucine biosynthesis in Candida maltosa. Antonie Leeuwenhoek J
Microbio160: 125-130
Bode R, Birnbaum D (1981) Aggregation and separability of the shikimate pathway enzymes
in yeasts (Germ). Z Allg Mikrobio121: 417-422
Bode R, Birnbaum D (1984) Characterization of three aromatic amino transferases from
Candida maltosa (Germ). Z Allg Mikrobio124: 67-75
Bode R, Birnbaum D (1986) Threonine dehydratase activity from several yeast species is
activated and affected by phosphate. FEMS Microbiol Lett 37: 369-377
Bode R, Birnbaum D (1987) D-amino acid oxidase, aromatic L-amino aminotransferase,
and aromatic lactate dehydrogenase from several yeast species: comparison of enzyme
activities and enzyme specificities. Acta Biotechnol 7: 221-225
Bode R, Birnbaum D (1988) Purification and properties of two branched-chain amino acid
aminotransferases from the yeast Candida maltosa. Biochem Physiol Pflanz 183: 417-
424
Bode R, Birnbaum D (1989) Specificity of glyphosate action in Candida maltosa. Biochem
Physiol Pflanz 184: 163-170
Bode R, Birnbaum D (1991a) Enzymatic production of indolepyruvate and some of its
methyl and fluoro-derivatives. Acta Biotechnolll: 387-393
Bode R, Birnbaum D (1991b) Regulation of chorismate mutase activity of various yeast
species by aromatic amino acids. Antonie Leeuwenhoek J Microbio159: 9-13
Bode R, Birnbaum D (1991c) Some properties of the leucine-biosynthesizing enzymes from
Candida maltosa. J Basic Microbio131: 21-26
Bode R, Casper P (1983) Allgemeine Kontrolle der Aminosaurebiosynthese in Mutanten von
Candida sp. EH15/D. Z Allg Mikrobio123: 419-427
Bode R, Casper P, Kunze G (1983) AuslOsung einer allgemeinen Kontrolle der
Aminosaurebiosynthese bei Candida sp. EHI5/D durch Amitrol. Biochem Physiol Pflanz
178: 457-468
Bode R, Melo C, Birnbaum D (1984a) Inhibition of tyrosine-sensitive 3-deoxy-D-arabinose-
heptulosonate 7-phosphate synthase by glyphosate in Candida maltosa. FEMS Microbiol
Lett 23: 7-10
Bode R, Melo C, Birnbaum D (1984b) Enzymological basis for glyphosate action in Candida
maltosa. Biochem Physiol Pflanz 179: 775-783
Bode R, Melo C, Birnbaum D (1984c) Absolute dependence of phenylalanine and tyrosine
biosynthetic enzyme on tryptophan in Candida maltosa. Hoppe-Seyler's Z Physiol Chern
365: 799- 803
Bode R, Melo C, Birnbaum D (1984d) Mode of action of glyphosate in Candida maltosa.
Arch Microbioll40: 83-85
Bode R, Melo C, Birnbaum D (1985a) Regulation of tryptophan biosynthesis in the n-
alkane-utilizing yeast Candida maltosa. Biochem Physiol Pflanz 180: 301-308
Bode R, Kunze G, Birnbaum D (1985b) Reversal of glyphosate-induced growth inhibition of
Candida maltosa by several amino acids and pyruvate. Biochem Physiol Pflanz 180: 613-619
Bode R, Melo C, Birnbaum D (1985c) Regulatory properties of 3-deoxy-D-arabinose-
heptulosonate-7-phosphate synthase isoenzymes from Candida maltosa. J Basic
Microbiol 25: 3-11
Bode R, Melo C, Birnbaum D (1985d) Regulation of chorismate mutase, prephenate de-
hydrogenase and prephenate dehydratase of Candida maltosa. JBasic Microbio125: 291-
298
Bode R, Lippoldt A, Birnbaum D (1986a) Purification and properties ofD-aromatic lactate
dehydrogenase, an enzyme involved in the catabolism of aromatic amino acids of Can-

dida maltosa. Biochem Physiol Pflanz 181: 189-198
Bode R, Schult I, Birnbaum D (1986b) Purification and some properties of threonine
dehydratase from Candida maltosa. J Basic Microbiol26: 443-451
Bode R, Schussler K, Schmidt H, Hammer T, Birnbaum D (1990) Occurrence of the general
control of amino acid biosynthesis in yeasts. J Basic Microbiol30: 31-35
Bode R, Samsonova lA, Birnbaum D (1991) Production of a- and j3-isopropylmalate by a
mutant from Candida maltosa. Zentralbl Mikrobiol146: 35-39
Bohlmann D, Bauch J, Kozlova LI, Meshankin GI, Roshkova MI, Triens K, Ringpfeil M,
Sobek K (1979) Process for the production of "FermosinR" - fodder yeast from petro-
leum distillates. In: Dechema Monogr, vol 83, Microbiology applied to biotechnology.
Verlag Chemie, Weinheim, pp 147-156
Bohlmann D, Bauch J, Gentzsch H, Dzingel G, Katrusch R, Kozlowa L, Roshkova M,
Meschankin G (1982) Biosynthese von Eiweillstoffen durch mikrobiologische
Entparaffinierung und Qualitat der erhaltenen Produkte. Abh Akad Wiss DDR Abt Math
Naturwiss Tech 2: 323-329
Bos P (1975) Some aspects of hydrocarbon assimilation by yeasts. Dissertation, Technical
High School, Delft
Bos P, de Boer WE (1968) Some aspects of the utilization of hydrocarbons by yeasts. Antonie
Bos P, de Bruyn JC (1973) The significance of hydrocarbon assimilation in yeast identifica-
tion. Antonie Leeuwenhoek J Microbiol39: 99-107
Bottcher F (1987) Genetics of imperfect yeasts. 12th Int Spec Symp Yeast, Genet of Non-
conventional Yeasts, Weimar, 1987, Abstr, p 3
Bottcher F, Samsonova IA (1978) Rhodosporidium BANNO: Dosiseffektbeziehungen,
Mutageneffektivitat und Mutantenspektrum bei der Induktion Auxotrophie-
verursachender Mutationen durch ultraviolettes Licht und N-Methyl-N'-nitro-N-
nitrosoguanidin. Z Allg Mikrobiol18: 637-646
Boulton CA, Ratledge C (1984) The physiology of hydrocarbon-utilizing microorganisms.
In: Wiseman A (ed) Introduction to topics in enzyme and fermentation biotechnology,
vol 9, Ellis Horwood, Chichester, pp 11-77
Bovina EV, Deriabin VV, Lange AV, Yarotsky SV (1986) Structure of mannan from the yeast
Candida maltosa (Russ). Prikl Biokhim Mikrobiol22: 679-683
Bovina EV, Deriabin VV, Gagloev VN, Serebriakov NG (1988) Study of the structure of
mannans from Candida maltosa and Candida tropicalis using 13C-NMR spectroscopy
(Russ). Prikl Biokhim Mikrobiol24: 218-225
Brada D, Schekman R (1988) Coincident localization of secretory and plasma membrane
proteins in organelles of the yeast secretory pathway. J Bacteriol170: 2775-2783
Brendler W, Bauch J, Lubbert GA, Wunsche L, Hedlich R, Triems K, Shdannikowa EN
(1983) Spezielle Aspekte der nichtsterilen Hefeproduktion auf der Basis von
Kohlenwasserstoffen. Acta Biotechnol3: 351-356
Brown AJP, Bertram G, Feldmann PJF, Peggie MW, Swoboda RK (1991) Codon utilization in
the pathogenic yeast, Candida albicans. Nucleic Acids Res 19: 4298
Bruckner B, Troger R (l981a) Vergleichende physiologische Untersuchungen zwischen
Candida sp. H und der Mutante H 13 unter Stickstoffrnangelbedingungen. Z Allg
Mikrobio121: 19-26
Bruckner B, Troger R (1981 b) EinfluB der Kohlenstoffquelle auf die Reservestoftbildung von
Candida sp. H. Z Allg Mikrobiol21: 77-84
Bruns TD, Vilgalys R, Barns SM, Gonzalez D, Hibbett DS, Lane DJ, Simon L, Stickel S, Szaro
TM, Weisburg WG (1992) Evolutionary relationship within the fungi: analyses of nuclear
small subunit rRNA sequences. Mol Phylogenet Evol1: 231-241
Biihler M, Schindler J (1984) Aliphatic hydrocarbons. In: Rehm HJ, Reed G (eds) Biotech-
nology, vol 6a, Biotransformations (Kieslich K, vol ed), Verlag Chemie, Weinheim, pp
329-385
Buttner R, Uebel B, Genz I-L, Kohler M (1985) Wachstumsuntersuchungen im

substratlimitierten pH-Auxostaten I. Bistabiles Wachstumsverhalten unter
kaliumlimitierten Bedingungen. J Basic Microbiol25: 227-232
Campbell I, Duffus JH (eds) (1988) Yeast, a practical approach. IRL Press, Oxford
Carle GF, Olson MV (1984) Separation of chromosomal DNA molecules from yeast by
orthogonal-field-alternation gel electrophoresis. Nucleic Acid Res 12: 5647-5664
Casey J, Dobb R, Mycock G (1990) An effective technique for enrichment and isolation of
Candida cloacae mutants defective in alkane catabolism. J Gen Microbiol136: 1197-1202
Casper P, Bode R, Birnbaum D (1985a) Regulation of ammonia assimilation in Candida
maltosa (Germ). J Basic Microbiol25: 95-101
Casper P, Bode R, Samsonova lA, Birnbaum D (1985b) Glutamate/aspartate metabolism of
Candida maltosa (Germ). J Basic Microbiol25: 637-643
Celma Calamita E, Arntz P, Bos P (1971) Obtaining protein concentrates using Candida
maltosa cultivated in gaseous n-octane (Ital). An Inst Nac Invest Agrar Ser Gen N 1: 165-
177
Cerniglia CE (1981) Aromatic hydrocarbons: metabolism by bacteria, fungi and algae. Rev
Biochem Toxicol3: 321-360
Cerniglia CE, Crow SA (1981) Metabolism of aromatic hydrocarbons by yeast. Arch
Microbiol 129: 9-13
Chang MC, Jung HD, Suzuki T, Takagi M, Yano K (1984) Ploidy in the asporogenous yeast
Candida maltosa, isolation of its auxotrophic mutants and their cell fusion. J Gen Appl
Chu G, Vollrath D, Davis RW (1986) Separation of large DNA molecules by contour-
clamped homogeneous electric fields. Science 234: 1582-1585
Claisse ML, Boze H, Dubreucq E, Segueilha L, Moulin G, Galzy P (1991) Characterization of
alternative respiratory pathways in the yeast Schwanniomyces castellii by the study of
mutants deficient in cytochromes a + a3 and/or b. Acta Biochim Pol 38: 365-392
Cook WL, Massey JK, Ahearn DG (1973) The degradation of crude oil by yeasts and its effect
on Lesbistes reticulatus. In: Ahearn DG, Meyer SP (eds) The microbial degradation of oil
pollutants. Louisiana State University, Center for Wetland Resources, Baton Rouge, pp
279-283
Cooper TG (1982) In: Strathern IN, Jones EW, Broach JB (eds) The molecular biology of the
yeast Saccharomyces: metabolism and gene expression, vol 2, Cold Spring Harbor Labo-
ratory Press, Cold Spring Harbor, pp 39-99
Crow SA, Bell SL, Ahearn DG (1979) Uptake of aromatic and branched chain hydrocarbons
by yeasts. Bot Mar 22: 406
Crow SA, Bell SL, Ahearn DG (1980) Uptake of aromatic and branched chain hydrocarbons
by yeasts. Bot Mar 23: 117-120
Cryer DR, Eccleshall R, Marmur J (1975) Isolation of yeast DNA. Methods Cell BioI 12: 39-44
Dalin MV, Gukasian lA, Spivak SM, Fish NG, Kravtsov EG, Ermolaev AV (1991) Approaches
to development of diagnostic allergens for observation of workers engaged in the pro-
duction of microbial fodder biomass and population of development zones and regions
of microbiological plants (Russ). Gig Tr Prof Zabol5: 31-33
Davidov ER, Gololobov AD (1980a) Regulation of metabolism in yeast during growth on n-
alkanes. Proc jt. US/USSR Conf Mech Kinet Growth on Various Substr, Contr Simul
Optim Microbiol Proc, Proj I-II. PB81.219131, pp 46-65. Natl Sci Found Res Appl Natl
Needs, [Rep] NSF/RA (US) 1980, NSF/RA-800527
Davidov ER, Gololobov AD (1980b) Effect of p02 on the regulation of metabolism in yeasts
during cultivation on n-alkanes. Proc jt. US/USSR Conf Mech Kinet Growth on Various
Substr, Contr Simul Optim Microbiol Proc, Proj I-II. PB81.219131, pp 94-103. Natl Sci
Found Res Appl Natl Needs, [Rep] NSF/RA (US) 1980, NSF/RA-800527
Davidov ER, Demanova NF, Sokolov YI, Gololobov AD (1980) Oxidation of individual
isoalkanes and alkylaromatic hydrocarbons by yeasts of the genus Candida (Russ). Prikl
Biokhim Mikrobiol16: 775-781
Davidov ER, Sokolov YI, Demanova NF, Gololobov AD (1981a) Utilization of 2-methyl
hexadecane by the yeast Candida guilliermondii (Russ). Prikl Biokhlm Mikrobiol17:
328-341
Davidov ER, Sokolov YI, Demanova NF, Gololobov AD (1981b) Utilization of 3-methyl
hexadecane by the yeast Candida guilliermondii (Russ) Prikl Biokhim Mikrobiol 17:
523-532
Davidov ER, Demanova NF, Sokolov YI, Gololobov AD (1982) Kinetics of hydrocarbon
assimilation by yeast of the genus Candida (Russ). Acta Biotechnol2: 213-225
Davidova EG, Rachinskii Vir (1979) Uptake of n-alkanes by yeast cells (Review, in Russian).
Uspechi Sovremennoi Biologii 88: 198-209
Davidova EG, Rachinskii VV (1981) Transport ofliquid n-alkanes into the yeast cell deter-
mined by gas-liquid radiogaschromatography (Russ). Mikrobiologiya 50: 349-352
Davidova EG, Demanova NF, Gololobov AD, Rachinskii VV (1975) Isolation and character-
ization of the cell structures of Candida tropicalis (Russ). Mikrobiologiya 44: 621- 624
Davidova EG, Belov AP, Rachinskii VV (1977a) Study of the role of lipid granules of a yeast
cell in the assimilation of n-alkanes (Russ). Dokl Akad Nauk SSSR 235: 1189-1192
Davidova EG, Belov AP, Rachinskii VV (1977b) Isolation and characteristics of lipid gran-
ules from Candida tropicalis (Russ). Mikrobiologiya 46: 1044-1049
Davidova EG, Belov AP, Rachinskii VV (1979) Electrophoretic characteristics of the protein
from yeast lipid granules (Russ). Mikrobiologiya 48: 803-808
Davidova EG, Zinchenko GA, Belov AP (1989) Substrate specificity of acyltransferases from
lipid granules of mesophilic yeasts (Russ). Biokhimiya 54: 587-592
Davis R, Thomas M, Cameron J, John TS, Scherer. S, Padgeff R (1980) Rapid DNA isolation
for enzymatic and hybridization analysis. Methods Enzymol 65: 404-411
Delpozo L, Abarca D, Hoenicka J, Jimenez A (1993) Two different genes from
Schwanniomyces occidentalis determine ribosomal resistance to cycloheximide. Eur J
Biochem 213: 849-857
Demanova NF, Davidov ER, Gololobov AD (1980a) Oxidation of n-alkanes with different
carbon chain lengths (in the range ofCu -C25) by the Candida yeast (Russ). Prikl Biokhim
Mikrobiol16: 5-12
Demanova NF, Davidov ER, Gololobov AD (1980b) Oxidation of n-alkanes with different
carbon chain lengths by Candida yeast (Russ). Prikl Biokhim Mikrobiol16: 149-155
Demanova NF, Davidov ER, Gololobov AD (1 980c) Yeast growth on mixture of n-docosane
and n-octadecane during continuous cultivation (Russ). Prikl Biokhim Mikrobiol16:
883-889
Deshler JO, Larson GP, Rossi JJ (1989) Kluyveromyces lactis maintains Saccharomyces
cerevisiae intron-encoded splicing signals. Mol Cell Bioi 9: 2208-2213
Dmitriev VV, Tsiomenko AB, Kulaev IS, Fikhte BA (1980) A cytochemical study of the
"canal" formation in the yeast cell wall. Eur J Appl Microbiol Biotechnol9: 211-216
Dole VP, Meinertz H (1960) Microdetermination of long-chain fatty acids in plasma and
tissues. J BioI Chem 235: 2595-2599
Dolgikh MS, Kravtsov EG, Ermolaev AV (1990) Proteolytic activity of protein-producing
yeast-like Candida fungi. Mikol Fitopatol24: 229-235
Durasova EN, Mikhailova NP, Vyunov KA, Bakulev VM, Sokolov VN, Makhrosenkova MO,
Khromov-Borisov NN (1986) The resistance of Candida guilliermondii to polyene anti-
biotics (Russ). Mikrobiologiya 55: 607-611
Durasova EN, Mikhailova NP, Sorokoletova EF, Vyunov KA (1989) The use of various
mutagens for the induction of nystatin-resistant mutants in Candida maltosa (Russ).
Mikrobiologiya 58: 760-763, Microbiology (NY) 58: 610-614 (English Translation)
Durasova EN, Mikhailova NP, Zhakovskaya ZA, Vyunov KA (1991) Sterol content of Can-
dida maltosa strains with high resistance to nystatin (Russ). Mikol Fitopatol25: 487-492
Eckart V, Cech D, Kammel K, Bauch J (1988) Die Gewinnung von Labor-, Fein- und
Biochemikalien im VEB Petrolchemisches Kombinat Schwedt. Teil III: Ribonucleinsaure
und RNA-Bausteine. Chern Techn 40: 432-434
Egorenkova GN, Belov AP (1984) Structural organization of the cell walls in yeasts of the
genus Candida (Russ). Mikrobiologiya 53: 300-304, Microbiology (NY) 53: 241-245
(English Translation)
Einsele A (1983) Biomass from higher n-alkanes. In: Rehm H-J, Reed G (eds) Biotechnology,
vol 3. Verlag Chemie, Weinheim, pp 43-81
Erickson AH, Blobel G (1983) Cell-free translation of messenger RNA in a wheat germ
system. Meth Enzymol96: 38-50
Ermolaev AV, Gukasyan lA, Ogarkov VI (1987) Isolation of surface antigens of Candida
maltosa responsible for Candida sensitization and their immunochemical characteris-
tics (Russ). Vopr Med Khim 33: 42-46
Ermolaev AV, Gukasyan lA, Parfenova EV, Spivak SM, Kravtsov EG (1991) Obtaining the
allergens from yeast-like fungi of the genus Candida, producers of fodder protein, for
hygienic standardization of the strains. Gig Tr Prof Zabol8: 19-20
Faggi E, Mennini S (1985) Comparative studies of the pathogenicity of Candida albicans,
Candida utilis and Candida maltosa in laboratory animals. Ann Microbiol Enzimol 35:
111-122
Feinberg B, McLaughlin CS (1988) Isolation of yeast mRNA and in vitro translation in a
yeast cell-free system. In: Campbell I, Duffus JH (eds) Yeast, a practical approach, IRL
Press, Oxford, pp 147-162
Fiechter A, Gmiinder FK (1989) Metabolic control of glucose degradation in yeast and
tumor cells. In: Fiechter A (ed) Advances in biochemical engineeringlbiotechnology, vol
39, Springer-Verlag Berlin Heidelberg, pp 2-28
Fiechter A, Kiippeli 0, Meussdoerffer F (1987) Batch and continuous culture. In: Rose AH,
Harrison JS (eds) The Yeasts, vol 2, 2nd edn, Yeasts and the environment. Academic
Press, London, pp 99-129
Fischer W, Reuter G (1982) Mannan-Lokalisation durch Concanavalin A im
Zusammenhang mit elektronenmikroskopischen und chemisch-analytischen
Untersuchungen an rinterschiedlich priiparierten Zellwiinden der FuttereiweiBhefe
Candida sp. H. Z Allg Mikrobiol 22: 29-40
Fischer W, Bruckner B, Meyer HW (1982) Ultrastructural alterations at the cell wall and the
plasma membrane of Candida sp. H induced by n-alkane. Z Allg Mikrobiol 22: 227-
236
Frohlich K-U, Entian K-D, Mecke D (1985) The primary structure of the yeast hexokinase
PH (HXK2) which is responsible for glucose repression. Gene 36: 105-111
Fukazawa Y, Nakase T, Shinoda T, Nishikawa A, Kagaya K, Tsuchiya T (1975) Significance
of cell wall structures on yeast classification: proton magnetic resonance and serological
and deoxyribonucleic acid characterization of Candida sake and related species. Int J
Syst Bacteriol25: 304-314
Fukui S, Tanaka A (1981a) Metabolism of alkanes by yeasts. Adv Biochem Eng 19: 217-237
Fukui S, Tanaka A (1981b) Production of useful compounds from alkane media in Japan. In:
Fiechter A (ed) Products from alkanes, celluloses and other feedstocks. Akademie
Verlag, Berlin, pp 1-36 (Fukui S, Tanaka A (1980) Adv Biochem Eng 17: 1-35)
Gargani G (1979) Models of pathogenicity for yeasts of the genus Candida. In: Garattini S,
Paglialunga S, Scrimshaw NS (eds) Single cell protein: safety for animals and human
feeding, Pergamon Press, Oxford, (1980) pp 30-38
Gargani G, Campisi E, Faggi E (1978) The problem of Candida virulence (Ital). Riv Ital Ig 38:
266-285
Gargani G, Campisi E, Faggi E (1979) Cross reactions between several species of the genus
Candida demonstrated by intradermal inoculation of the guinea pig. Bull Soc Fr Mycol
Med 8: 17-20
Glombitza F (1982) Der EinfiuB der Flockenbildung auf die Versorgung der Hefezellen mit
Sauerstoff bei der Fermentation fiussiger Kohlenwasserstoffe. Acta Biotechnol 2: 43-50
Glombitza F, Heinritz B (1979) Thermodynamik mikrobieller Prozesse. Z Allg Mikrobiol19:
171-179
Goeddel D (ed) (1990) Methods enzymology vol 185, Gene expression technology, Section
IV. Expression in yeast, Academic Press, London, pp 230-482
Golubev VI, Naumov GI, Bibikova II, Blagodatskaya VM, Voustin MM, Nikitina TN,
Buzurg-Zade DL, Gradova NB (1986) A novel species assignment of the hydrocarbon
digesting strains of the Candida genus yeast (Russ). Biotekhnologiya 0(5}: 17-21
Gomi K, Horiguchi S (1988) Purification and characterization of pyrocatechase from the
catechol assimilating yeast Candida maltosa. Agric BioI Chern 52: 585-587
Gradova NB, Kovalsky YV (1978) Production of fodder yeast cultures on media containing
hydrocarbons (Russ). Mikrobiologiya 47: 259-264
Gradova NB, Osipova VG, Davidova EG, Chunaev AS, Kvitko KV (1976) Populational and
phenogenetic analysis of variability of Candida yeast for the character of protein content
in biomass (Russ). Genetics (USSR) 12: 80-88
Gradova NB, Dikanskaya EM, Robysheva ZN, Rodionova GS, Butteyeva MB, Zaikina AI
(1983) Characterization of hydrocarbon oxidizing yeasts. Peculiarities of their growth
and biosynthetical processes (Russ). Acta Biotechnol3: 241-249
Gradova NB, Belov AP, Guselnikova TV (1990) Some aspects of the regulation of nitrogen
metabolism in the yeast genus Candida. Study of the kinetics of ammonium transport to
the cells of hydrocarbon-oxidizing yeast of the genus Candida with a change in nitrogen
nutrition. Acta Biotechnol1O: 169-177
Gradova NB, Zaitsev SA, Gadzhieva VI (1991) Ecological monitoring of hydrocarbon-oxi-
dizing Candida yeasts as a technogenic factor (Russ). Biotekhnologiya (Moscow) 0(2}:
57-60
Griffiths G, Hoppeler H (1986) Quantitation in immunocytochemistry: correlation of
immunogold labeling to absolute number of membrane antigens. J Histochem
Cytochem 34: 1389-1398
Griffiths G, Brands R, Burke B, Louvard D, Warren G (1982) Viral membrane proteins
acquire galactose in trans Golgi cisternae during intracellular transport. J Cell BioI 95:
781-792
Griffiths G, McDowall A, Back R, Dubochet J (1984) On the preparation of cryosections for
immunocytochemistry. J Ultrastruct Res 89: 65-78
Grimmecke HD, Reuter G (1980) Struktur der Zellwandpolysaccharide in der FuttereiweiB-
Hefe Candida sp. H. 5. Die komplexe Struktur des Proteophosphomannans. Biochem
Physiol Pflanz 175: 781-788
Grimmecke HD, Reuter G (1981a) Struktur der Zellwandpolysaccharide in der
FuttereiweiB-Hefe Candida sp. H. 1. Struktur des alkalistabilen Mannan-Proteins. Z Allg
Mikrobiol21: 95-107
Grimmecke HD, Reuter G (1981b) Struktur der Zellwandpolysaccharide in der
FuttereiweiB-Hefe Candida sp. H. 2. Charakterisierung der Bindung des Phosphats am
Mannan-Protein-Phosphat-Komplex und Identifizierung der als Phospho diester
gebundenen Mono- und Oligosaccharide. Z AUg Mikrobiol21: 109-116
Grimmecke HD, Reuter G (1981c) Struktur der Zellwandpolysaccharide in der
FuttereiweiB-Hefe Candida sp. H. 4. Struktur der alkalilabilen Oligosaccharide im Man-
nan-Protein-Phosphat-Komplex. Z Allg Mikrobiol21: 211-218
Grimmecke HD, Reuter G (1981d) Struktur der Zellwandpolysaccharide in der
FuttereiweiB-Hefe Candida sp. H. 6. Isolierung und StrukturaufkHirung der Glucane. Z
AUg Mikrobiol21: 643-650
Grimmecke HD, Meyer H, Scheller D, Reuter G (1981) Struktur der Zellwandpolysaccharide
in der FuttereiweiB-Hefe Candida sp. H. 3. Charakterisierung unterschiedlicher
Phosphatbindungen im Mannan-Protein-Phosphat-Komplex. Z AUg Mikrobiol21: 201-
210
Gukasyan lA, Ermolaev AV, Kravtsov EG, Kacharmina VA (1990) The level of antigenic
relationship of surface conjugates of the hydrocarbon-assimilating strains of yeast-like
Candida fungi used in fodder protein production. Mikol Fitopatol24: 420-424
Guselnikova TV, Pavlov AA, Bezrukov MG, Gradova NB (1988) Effect of thermal treatment
on the fraction composition of yeast proteins (Russ). Biotekhnologiya 4: 509-511
Guselnikova TV, Belov AP, Gradova NB (1989) The effect of yeast autolysates on the level
and distribution of free amino acids in yeast cells of the genus Candida (Russ).
Guselnikova TV, Gromov YA, Belov AP (1991) Influence of trophic cultivation conditions
on the kinetics of methylamine transport in the yeast Candida maltosa (Russ).
Guthrie C, Fink GR (eds) (199U Methods Enzymology, vol 194, Guide to yeast genetics and
molecular biology. Academic Press, New York
Hagihara R, Mishina M, Tanaka A, Fukui S (1977) Utilization of pristane by a yeast Candida
lipolytica. Fatty acid composition of pristane-grown cells. Agr BioI Chern 41: 1745-1748
Hammer T, Bode R, Schmidt H, Birnbaum D (1991) Distribution of three lysine-cataboliz-
ing enzymes in various yeast species. J Basic Microbiol31: 43-49
Hann BC, Walter P (1991) The signal recognition particle in S. cerevisiae. Cell 67: 131-144
Hasegawa Y, Okamoto T, Obata H, Tokuyama T (1990) Utilization of aromatic compounds
by Trichosporon cutaneum KUY-6A. J Ferment Bioeng 69: 122-124
Heinritz B, Bley T (1979) EinfluB alternierender St5rungen auf die Verbrauchskennziffern
beim Wachstum von Mikroorganismen. Z Allg Mikrobiol19: 247-252
Heinritz B, Stichel E, Bley T, Rogge G, Glombitza F (1981) Yield coefficients in dependence
on milieu conditions and cell states. II. Influence of perturbations on continuous culti-
vation of the yeast Lodderomyces elongisporus on hydrocarbons. Z Allg Mikrobiol 21:
581-586
Heinritz B, Stichel E, Rogge G, Bley T, Glombitza F (1982) Theoretische Bestimmung
energetischer Wirkungsgrade der mikrobiellen Kohlenstoffsubstratwandlung und
Vergleich mit experimentellen Werten an Phasenkulturen. Z Allg Mikrobiol 22: 534-
544
Heinritz B, Stoll P, Glombitza F (1983a) Heat flow measurements in aerobic microbial
growth processes with a nonisothermal calorimeter operating directly in the fermenter.
Acta Biotechnol 3: 83-':87
Heinritz B, Rogge G, Stichel E, Bley T (1983b) Use of biorhythmic processes for increasing
the efficiency of carbon-compound conversion by microorganisms. Acta Biotechnol 3:
125-131
Heinritz B, Bley T, Ringpfeil M (1985) Einsatz von Hochleistungsreaktoren zur
mikrobiologischen Stoffwandlung. Chern Technol37: 514-516
Heinz T, Henning U, Wiinsche J, Henk G (1989) The prececal and total intestinal nutrient
digestibility and amino acid absorption of food yeasts in swine (Germ). Arch
Tierernaehr 39: 1007-1019
Hendriks L, Goris A, Van de Peer Y, Neefs JM, Vancanneyt M (1991) Phylogenetic analysis
of five medically important Candida species as deduced on the basis of small ribosomal
subunit RNA sequences. J Gen Microbiol137: 1223-1230
Hepler PK (1981) The structure of endoplasmic reticulum revealed by osmium tetroxide-
potassium ferricyanide staining. Eur J Cell BioI 26: 102-110
Hikiji T, Ohkuma M, Takagi M, Yano K (1989) An improved host -vector system for Candida
maltosa using a gene isolated from its genome that complements the hisS mutation of
Saccharomyces cerevisiae. Curr Genet 16: 261-266
Hill DE, Boulay R, Rogers D (1988) Complete nucleotide sequence of the peroxisomal acyl
CoA oxidase from the alkane-utilizing yeast Candida maltosa. Nucleic Acids Res 16:
365-366
Hino A, Wongkhalaung C, Kawai S, Murao S, Yano K, Takano H, Takagi M (1992) Con-
struction of a transformation system for a freeze-tolerant yeast Kluyveromyces
thermotolerans. Agric BioI Chern 56: 228-232
Hirata T, Ishitani T (1978) Studies on the discrimination of SCP-related yeast by proton
magnetic resonance spectroscopy: structural changes in cell wall mannan of Candida
subtropicalis grown in different media. Agric BioI Chern 42: 775-780
Hofmann KH (1986a) Microbial transformation of polycyclic aromatic hydrocarbons
(Germ). Wiss Z EMA Univ Greifswald, Math Nat Reihe 35: 23-26
Hofmann KH (1986b) Oxidation of naphthalene by Saccharomyces cerevisiae and Candida

utilis. J Basic Microbiol 26: 109-111
Hofmann KH, KrUger AK (1985) Induction and inactivation of phenol hydroxylase and
catechol oxygenase in Candida maltosa L4 in dependence on the carbon source. J Basic
Hofmann KH, Polnisch E (1990a) Activities of gluconeogenic enzymes in the yeast Candida
maltosa during growth on glucose or ethanol (Germ). J Basic Microbiol30: 333-336
Hofmann KH, Polnisch E {l990b) Cyclic AMP-dependent phosphorylation of fructose-l,6-
bisphosphate and other proteins in the yeast Candida maltosa. JBasic Microbiol30: 555-
559
Hofmann KH, Polnisch E (1990c) Characterization of a mutant of the yeast Candida maltosa
defective in catabolite inactivation of gluconeogenic enzymes. Arch Microbiol154: 514-
517
Hofmann KH, Schauer F (1988) Utilization of phenol by hydrocarbon assimilating yeasts.
Hofmann KH, Vogt U (1987) Induction of phenol assimilation in chemostat cultures of
Candida maltosa 14. J Basic Microbiol27: 441-447
Hofmann KH, Vogt U (1988) Degradation of phenol by yeasts in the presence of n-
hexadecane under growth conditions in a stirred reactor (Germ). Zentralbl Mikrobiol
143: 87-91
Holley RW (1967) Isolation of sRNA from intact yeast cells. Methods Enzymol 12: 596-
598
Holzschu DL, Chandler FW, Ajello L, Ahearn DG (1979) Evaluation of industrial yeasts for
pathogenicity. Sabouraudia 17: 71-78
Honeck H, Schunck W-H, Riege P, Milller H-G (1982) The cytochrome P-450 alkane
monooxygenase system of the yeast Lodderomyces elongisporus: purification and some
properties of the NADPH-cytochrome P-450 reductase. Biochem Biophys Res Commun
106: 1318-1324
Honeck H, Schunck W-H, Milller H-G (1985) The function of cytochrome P-450 in fungi and
prospects of application. Pharmazie 40: 221-227
Huth J (1987) Uber die Verwertung von n-Alkanen durch Candida maltosa EH15D unter
besonderer Beriicksichtigung der festen n-Alkane mit 20 und mehr C-Atomen. Disserta-
tion, Akademie der Wissenschaften der DDR, Berlin
Huth J, Blasig R, Werner S, Milller H-G (1990a) The proton extrusion of growing yeast
cultures as an on-line parameter in fermentation processes: determination of biomass
production and substrate consumption in batch experiments with Candida maltosa
EH15 D. J Basic Microbiol30: 481-488
Huth J, Werner S, Milller H-G (1990b) The proton extrusion of growing yeast cultures as an
on-line parameter in fermentation processes: quantitative determination of growth from
milligram amounts of substrate in a minimized fed-batch fermentation apparatus. J
Basic Microbiol 30: 489-497
Huth J, Werner S, Milller H-G (1990c) The proton extrusion of growing yeast cultures as an
on-line parameter in fermentation processes: ammonia assimilation and proton extru-
sion are correlated by an 1: 1 stoichiometry in nitrogen-limited fed-batch fermentations.
J Basic Microbiol30: 561-567
Hwang CW, Yano K, Takagi M (199l) Sequences of two tandem genes regulated by carbon
sources, one being essential for n-alkane assimilation in Candida maltosa. Gene 106: 61-
69
Ilchenko AP, Tsfasman 1M (1987) Isolation and characterization of aldehyde dehydroge-
nase from Torulopsis candida yeast grown on hexadecane (Russ). Biokhimiya 52: 58-
65
Ilchenko AP, Tsfasman 1M (1988) Isolation and characterization of alcohol oxidase for
higher alcohols of the yeast Torulopsis candida grown on hexadecane (Russ).
Biokhimiya 53: 263-271
Ilchenko AP, Mauersberger S, Matyashova RN, Losinov AB (1980) Induction of cytochrome

P-450 in the course of yeast growth on different substrates (Russ). Mikrobiologiya 49:
452-458
Ilchenko AP, Shilova NK, Matyashova RN, Galynkin VA (1989) Effect exerted by the con-
centration of oxygen dissolved in the medium on the biosynthesis of cytochromes by
Candida maltosa cells in the course of their growth on paraffins (Russ). Mikrobiologiya
58: 716-722
Ilchenko AP, Vasilkova NN'-Matyashova RN (1991) Changes in the activity of enzymes
utilizing H20 2 under different conditions of yeast cultivation (Russ). Mikrobiologiya 60:
55-64
Ilchenko AP, Morgunov IG, Honeck H, Mauersberger S, Vasilkova NN, Miiller H-G (1994)
Purification and some properties of alcohol oxidase from the yeast Yarrowia lipolytica
H222 (Russ). Biokhimiya (Moscow) 59: 1312-1319
Ilyina VI, Dalin MV, Gukasyan lA, Tikhomirov YG, Mokeeva NV (1988) Testing the useful-
ness of an erythrocyte immunoglobulin diagnostic agent for assessing the levels of the
protein paprin in the air (Russ). Gig Sanit 3: 38-40
Ioffe ML, Maksimova GN, Tsygankova NY, Zhutchkov VN (1990) Investigation on biologi-
cal action of denucleinized product obtained from paprin. Biotekhnologiya (Soviet Bio-
technology) 0(6): 70-72
Jomantiene R, Januska A, Sasnauskas K, Janulaitis A (1987) Cloning of ADEl, ADE2, ARG4
genes and ARS sequence of the yeast Candida maltosa. 12th Int Spec Symp Genet of Non-
conventional Yeasts, Weimar, GDR, 1987, Abstr, p 41
Jomantiene R, Geneviciute E, Januska A, Lebedys J, Sasnauskas K (1991) ADEI gene of the
yeast Candida maltosa. Eksp BioI 0(3): 19-29 (published 1992)
Jomantiene R, Lebediene E, Proscevicius J, Meskauskiene R, Sasnauskas K (1992) Molecular
analysis of the Candida maltosa gene, conferring resistance to cycloheximide in Saccha-
romyces cerevisiae. Int Spec Symp Genet Mol BioI Non-conventional Yeasts, Leuenberg
near Basel, Switzerland 1992, Abstr
Jones EW, Pringle JR, Broach JR (eds) The molecular and cellular biology of the yeast
Saccharomyces, vol 1 - Genome dynamics, protein synthesis, and energetics (1991), vol
2 - Gene expression (1992), vol 3 - Cell cycle and cell biology (1993), Cold Spring Harbor
Laboratory Press, Cold Spring Harbor
Kalin M, Neujahr HY, Weissmahr RN, Sejlitz T, JoW R, Fiechter A, Reiser J (1992) Phenol
hydroxylase from Trichosporon cutaneum: gene cloning, sequence analysis, and func-
tional expression in Escherichia coli. J Bacteriol174: 7112-7120
Kamiryo T, Sakasegawa Y, Tan H (1989) Expression and transport of Candida tropicalis
peroxisomal acyl-coenzyme A oxidase in the yeast Candida maltosa. Agric BioI Chern 53:
179-186
Kamiryo T, Mito N, Nike T, Suzuki T (1991) Assignment of most genes encoding major
peroxisomal polypeptides to chromosomal band V of the asporogenic yeast Candida
tropicalis. Yeast 7: 503-511
Kaneko T, Ishii K, Kawaharada H, Kagotani K, Shimada Y, Watanabe K (1977) Taxonomic
studies on a hydrocarbon-assimilating Candida strain. Agric BioI Chern 41: 2269-2276
Kappeli 0, Fiechter A (1976) The mode of interaction between the substrate and cell surface
of hydrocarbon-utilizing yeast Candida tropicalis. Biotechnol Bioeng 18: 967-974
Kappeli 0, Fiechter A (1977) Component from the cell surface of the hydrocarbon-utilizing
yeast Candida tropicalis with possible relation to hydrocarbon transport. J Bacteriol131:
917-921
Kappeli 0, Aeschbach H, Schneider AH, Fiechter A (1975) A comparative study of carbon
energy reserve metabolism of Candida tropicalis growing on glucose and on hydrocar-
bons. Eur J Appl Microbiol1: 199-211
Kappeli 0, Miiller M, Fiechter A (1978) Chemical and structural alterations at the cell
surface of Candida tropicalis, induced by hydrocarbon substrate. J Bacteriol 133: 952-

958
Klippeli 0, Walther P, Miiller M, Fiechter A (1984) Structure of the cell surface of the yeast
Candida tropicalis and its relation to hydrocarbon transport. Arch Microbiol 138: 279-
282
Klirgel E, Schmidt HE, Schunck W-H, Riege P, Mauersberger S, Miiller H-G (1984) A solid-
phase radioimmunoassay for yeast cytochrome P-450. Anal Lett 17 B18: 2011-2024
Klirgel E, Schunck W-H, Riege P, Honeck E, Claus R, Kleber H-P, Miiller H-G (1985) A
comparative immunological investigation of the alkane-hydroxylating cytochrome P-
450 from the yeast Candida maltosa. Biochem Biophys Res Commun 128: 1261-1267
Klirgel E, Aoyama Y, Schunck W-H, Miiller H-G, Yoshida Y (1990) Comparative study on
cytochrome P-450 of yeasts using specific antibodies to cytochromes P-450alk and P-
45014DM. Yeast 6: 61-67
Klirgel E, Menzel R, Honeck H, Vogel F, Bohmer A, Schunck W-H (1996) Candida maltosa
NADPH-cytochrome P450 reductase: Cloning of a full-length cDNA, heterologous ex-
pression in Saccharomyces cerevisiae and function of the N-terminal region for mem-
brane anchoring and proliferation of the endoplasmic reticulum. Yeast 12 (in press)
Karpova TS, Zhuravleva TS, Pashina OB, Nikolaishvili NT, Larionov VL (1987) Chromo-
some stability in Saccharomyces yeasts (Russ). Genetika 23: 2148-2156
Kasanzev EN, Maximova GN, Shekina EV, Vorobyeva GI (1975) Determination of the
relative volumes of lipid inclusions of the yeast Candida guilliermondii NP4 grown on
hydrocarbons (Russ). Appl Biokhim Mikrobiol11: 640-648
Kasiiske A, Wedler H, Schulze S, Becher D (1992) Efficient electropulse transformation of
intact Candida maltosa cells by different homologous vector plasmids. Yeast 8: 691-697
Kawaguchi Y, Honda H, Taniguchi-Morimura H, Iwasaki S (1989) The codon CUG is read
as serine in an asporogenic yeast Candida cylindracea. Nature 341: 164-166
Kawai S, Hwang CW, Sugimoto M, Takagi M, Yano K (1987) Subcloning and nucleotide
sequencing of an ARS site of Candida maltosa which also functions in Saccharomyces
cerevisiae. Agric BioI Chern 51: 1587-1591
Kawai S, Hikiji T, Murao S, Takagi M, Yano K (1991) Isolation and sequencing of a gene, C-
ADEl, and its use for a host-vector system in Candida maltosa with two genetic markers.
Agric BioI Chern 55: 59-66
Kawai S, Murao S, Mochizuki M, Shibuya I, Yano K, Takagi M (1992) Drastic alteration of
cycloheximide sensitivity by substitution of one amino acid in the L41 ribosomal protein
of yeasts. J Bacteriol174: 254-262
Kawamura M, Takagi M, Yano K (1983) Cloning of a LEU gene and an ARS site of Candida
maltosa. Gene 24: 157-162
Keszenman-Pereyra D, Hieda K (1988) A colony procedure for transformation of Saccharo-
myces cerevisiae. Curr Genet 13: 21-23
Kirsch DR, Kelly R, Kurtz MB (eds) (1990) The genetics of Candida. CRC Press, Boca Raton
Kitamura H, Anri A, Fuse K, Seo M, Itakura C (1990) Chronic mastitis caused by Candida
maltosa in a cow. Vet Pathol27: 465-466
Klinner U, Bottcher F (1985) Chromosomal rearrangements after protoplast fusion in the
yeast Candida maltosa. Curr Genet 9: 619-621
Klinner U, Bottcher F (1987) Protoplast fusion as tool for genetic analysis and manipulation.
12th Int Spec Symp Genet of Non-conventional Yeasts, Weimar, 1987, Abstr, p 4
Klinner U, Samsonova lA, Bottcher F (1984) Genetic analysis of the yeast Candida maltosa
by means of induced parasexual processes. Curr Microbiol11: 241-246
Kolblin R, Birkenbeil S (1981) Zusammenhang zwischen Koloniemorphologie und
Polysaccharidgehalt in zellwandmodifizierten Mutanten von Candida sp. "H". Z Alig
Kolblin R, Troger R (1982) Zusammenhang zwischen Protein- und Polysaccharidgehalt in
zellwandmodifizierten Mutanten von Candida sp. H. Z Alig Mikrobiol22: 63-68
Komagata K (1979) Characteristics of Candida maltosa. In: Garattini S, Paglialunga S,
Scrimshaw NS (eds) Single-cell protein: safety for animal and human feeding. Proc
protein-calorie advisory group of the United Nations System Symp, Milan, Italy, March
31-Aprill, 1977. Pergamon Press, Oxford, pp 39-43
Komagata K, Nakase T, Katsuya N (1964a) Assimilation of hydrocarbons by yeast. I. Pre-
liminary screening. J Gen Appl Microbiol1O: 313-321
Komagata K, Nakase T, Katsuya N (1964b) Assimilation of hydrocarbons by yeast. II.
Determination of hydrocarbon-assimilating yeast. J Gen Appl Microbioll0: 323-333
Konig WA (1987) The practice of enantiomer separation by capillary gas chromatography.
Hiithig-Verlag, Heidelberg, p 42
Kostov V, Ratchev R, Lazarova G, Russeva L, Krasteva J, Ivanova V, Vassileva M, Sokolov T,
Jelev S (1991) Yeast assimilation of sugars from hemicellulose beech wood hydrolysates.
Acta Microbiol Bulg 28: 51-61
Kovalenko OG, Korobko OP, Korbelainen ES, Barkalova AO, Telegeeva TA, Papp VT
(1992) Effect of mannan from Candida maltosa and its sulphated derivatives on plant
susceptibility to viral and bacterial infections (Russ). Mikrobiol Zh (Kiev) 54: 63-69
Kozlova 11, Meshchankin GI (1991) Production technology of fodder yeasts on oil distil-
lates. Biotekhnologiya 0(6): 60-63
Krauzova VI, Sharyshev AA (1987) Study on subcellular distribution of the enzymes of n-
alkane oxidation primary steps in the yeast Candida maltosa (Russ). Biokhimiya 52:
599-606
Krauzova VI, Kuvichkina TN, Sharyshev AA, Romanova lB, Lozinov AB (1986) Lauric
acid and NADH synthesis during dodecanol and dodecanal oxidation by membrane
fractions ofthe yeast Candida maltosa grown on hexadecane (Russ). Biokhimiya 51: 23-
27
Kravtsov EG, Gukasyan lA, Dolgikh MS, Ermolaev AV, Spivak SM (1991) Isolation of
antigen-active biopolymers from Candida maltosa culture fluid for obtaining allergens
of diagnostic value for examination of industrial microbiology workers (Russ). Gig Tr
Prof Zabol3: 33-34
Kreger-van Rij NJW (1984) The yeasts, a taxonomic study. Elsevier, Amsterdam
Krug M, Straube G (1986) Degradation of phenolic compounds by the yeast Candida
tropicalis HP15 II. Some properties of the first two enzymes of the degradation pathway.
J Basic Microbiol26: 271-281
Krug M, Ziegler H, Straube G (1985) Degradation of phenolic compounds by the yeast
Candida tropicalis HP15 I. Physiology of growth and substrate utilization. J Basic
Kunau W-H, Hartig A (1992) Peroxisome biogenesis in Saccharomyces cerevisiae. Antonie
Kunau W-H, Biihne S, Moreno de la Garza M, Kionka C, Mateblowski M, Schultz-Borchard
U, Thieringer R (1988) Comparative enzymology of fJ-oxidation. Biochem Soc Trans 16:
418-420
Kunze G (1982) Molekularbiologischlbiochemische Charakterisierung der Genome von
Candida sp. EHI5, Lodderomyces elongisporus CBS 2605, Saccharomyces cerevisiae DI0,
Pichia guilliermondii S0809, Pichia guilliermondii S0799 und Pichia guilliermondii fp 1-
61. Universitat Greifswald, Math Nat Dissertation A, Greifswald
Kunze G, Hecker M, Birnbaum D (1984a) Molecularbiological characterization of genomes
from Candida sp. EH 15, Lodderomyces elongisporus CBS 2605, Pichia guilliermondii
S0809 and Pichia guilliermondii fpl-61 (Germ). Z Allg Mikrobiol24: 33-40
Kunze G, Schauer F, Samsonova I, Klinner U, Bode R, Hecker M, Birnbaum D (1984b)
Identifizierung zweier Candida maltosa-Stamme mittels DNA-Reassoziation. Z Allg
Kunze G, Petzoldt C, Bode R, Samsonova I, Hecker M, Birnbaum D (1985a) Transformation
of Candida maltosa and Pichia guilliermondii by a plasmid containing Saccharomyces
cerevisiae ARG4 DNA. Curr Genet 9: 205-209
Kunze G, Petzoldt C, Bode R, Samsonova lA, Bottcher F, Birnbaum D (1985b) Transforma-
tion of the industrially important yeasts Candida maltosa and Pichia guilliermondii. J
Basic Microbiol25: 141-144
Kunze G, Petzoldt G, Bode R, Samsonova JA, Hecker M, Birnbaum D (1986a) Transforma-
tions of the industrially important yeasts Candida maltosa and Pichia guilliermondii.
Acta Biotechnol 6: 28
Kunze G, Bode R, Birnbaum D (l986b) Physical mapping and genome organization of
mitochondrial DNA from Candida maltosa. Curr Genet 10: 527-530
Kunze G, Bode R, Schmidt H, Samsonova lA, Birnbaum D (l987a) Identification of a lys2
mutant of Candida maltosa by means of transformation. Curr Genet 11: 385-391
Kunze G, Bode R, Schmidt H, Samsonova lA, Birnbaum D (1987b) Identification of a lys2
mutant of Candida maltosa by means of tranformation. 12th Int Spec Symp Yeast Genet
of Non-conventional Yeasts, Weimar, 1987, Abstr p 81
Kurtz MB, Kelly R, Kirsch DR (l990) The molecular genetics of Candida albicans. In: Kirsch
DR, KellyR, Kurtz MB (eds) The genetics of Candida. CRC Press, Boca Raton, pp 21-73
Kurtzman CP (1992) rRNA sequence comparison for assessing phylogenetic relationship
among yeasts (Minireview). Int J Syst Bacteriol42: 1-6
Kurtzman CP (1994) Molecular taxonomy of the yeasts. Yeast 10: 1727-1740
Larriba G (1993) Translocation of proteins across the membrane of the endoplasmic reticu-
lum: a place for Saccharomyces cerevisiae. Yeast 9: 441-463
Lebediene E, Jomantiene R, Sasnauskas K (l992) Cloning and sequence analysis of a Can-
dida maltosa gene conferring resistance to formaldehyde. Int Spec Symp Genet Mol BioI
Non-conventional Yeasts, Leuenberg near Basel, 1992, Abstr
Lerche K-H, Kretzschmar G (1980) Zellelektrophoretische Charakterisierung der
Oberfiache von Candida guilliermondii. Z Allg Mikrobiol20: 641-652
Lerche K-H, Kretzschmar G (l986) Partikelelektrophoretische Charakterisierung der
Oberfiacheneigenschafien von alkanutilisierenden Hefezellen: chemische
Zusammensetzung und Tensidadsorption. Acta Biotechnol6: 221-231
Leuker CE, Hahn H-M, Ernst JF (1992) ,B-Galactosidase of Kluyveromyces lactis (Lac4p) as
a reporter of the gene expression in Candida albicans and Candida tropicalis. Mol Gen
Genet 235: 235-241
Levi JD, Shennan L, Ebbon GP (1979) Biomass from liquid n-alkanes. In: Rose AH (ed)
Microbial biomass. Academic Press, London, pp 361-419
Lippoldt A, Bode R, Birnbaum D (1986) Degradation of aromatic amino acids in Candida
maltosa. J Basic Microbiol26: 145-154
Litovskaya AV (l988) Immune response of persons exposed to protein-synthesizing fungi
(Russ). Z Mikrobiol Epidemiol Immunobiol2: 71-75
Litovskaya AV, Mokeeva NV (l990) Comparative evaluation of efficiency of various immu-
nologic reactions with Candida antigens in detecting immediate hypersensitivity (Russ).
Z Mikrobiol Epidemiol Immunobiol 9: 89-93
Lloyd AT, Sharp PM (l992) Evolution of codon usage patterns: the extent and nature of
divergence between Candida albicans and Saccharomyces cerevisiae. Nucleic Acids Res
20:5289-5291
Loper JC, Chen C, Dey CR (l985) Gene engineering of yeast for biodegradation: immuno-
logical cross-reactivity among cytochrome P450 systems proteins of Saccharomyces
cerevisiae and Candida tropicalis. Hazardous Waste Hazardous Mat 2: 131-141
Lopez MC, Nicaud JM, Skinner H, Vergnolles C, Kader JC, Bankaitis V, Gaillardin C (1994)
A phosphatidylinositollphosphatidylcholine transfer protein is required for differentia-
tion of the dimorphic yeast Yarrowia lipolytica from the yeast to the mycelial form. J Cell
BioI 124: 113-127
Lottermoser K, Asperger 0, Schunck W-H (l994) Polymerase chain reaction mediated
detection of cytochrome P450 gene in the yeast Candida apicola. In: Lechner MC (ed)
Cytochrome P450. Biochemistry, biophysics and molecular biology. John Libbey
Eurotext, Paris, pp 643-646
Ludvik J, Munk V, Dostalek M (1968) Ultrastructural changes in the yeast Candida
lipolytica caused by penetration of hydrocarbons into the cell. Experentia 24: 1066-1068
Lusky K, Stoyke M, Gobel R, Busch A, Ackermann H (1988) The effect of microbial protein,
obtained on a hydrocarbon base (fermosin), with a defined fatty acid composition on fat
metabolism and fat composition in slaughter animals. 1. The effect of fermosin on the
composition of broiler depot fat (Germ). Nahrung 32: 627-633
Lusky K, Stoyke M, Gobel R, Doberschutz KD, Macholz R (1989) The effect of microbial
protein from a hydrocarbon base (fermosin) with a defined fatty acid composition on fat
metabolism and fat composition in slaughter animals. 2. The effect of "fermosin" on the
composition of back fat iil hogs (Germ). Nahrung 33: 203-212
Magasanik B (1992) Regulation of nitrogen utilization. In: Jones EW, Pringle JR, Broach JB
(eds) The molecular and cellular biology of the yeast Saccharomyces: gene expression,
vol II. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, pp 283-317
Magee BB, Magee PT (1987) Electrophoretic karyotypes and chromosome numbers in
Candida species. J Gen Microbiol 133: 425-430
Magee PT, Rikkerink EH, Magee BB (1988) Methods for the genetics and molecular biology
of Candida albicans. Anal Biochem 175: 361-372
Maksimova GN, Berestennikova ND, Antokhina VI, Levandovskaya YB, Pozmogova IN
(1988) Content oflipid inclusions, free and bound lipids in the Candida maltosa cells at
different paraffin concentrations in the culture medium. Appl Biochem Microbiol (Mos-
cow) 24: 549-553
Manakov MN, Prishepov FA (1986) The kinetics of monosaccharide digestion by the yeast
of the genus Candida (Russ). Biotekhnologiya 0(2): 13-18
Marahrens Y, Stillman B (1992) A yeast chromosomal origin of DNA replication defined by
multiple functional elements. Science 255: 817-823
Maraz A, Kiss M, Ferency L (1978) Protoplast fusion in Saccharomyces cerevisiae strains of
identical and opposite mating type. FEMS Microbiol Lett 3: 319-322
Masuda Y, Park SM, Ohkuma M, Ohta A, Takagi M (1994) Expression of an endogenous and
a heterologous gene in Candida maltosa by using a promoter of a newly isolated phos-
phoglycerate kinase (PGK) gene. Curr Genet 25: 412-417
1vIauersberger S (1985) Regulation und subzelluHire Verteilung des Cytochrom P-450
Monooxygenasesystems und anderer am Alkanmetabolismus beteiligter Enzyme in
Candida Hefen. Dissertation, Akademie der Wissenschaften der DDR, Berlin
Mauersberger S (1991) Mutants of alkane oxidation in the yeasts Yarrowia lipolytica and
Candida maltosa. In: Finogenova TV, Sharyshev AA (eds) Alkane metabolism and
oversynthesis of metabolites by microorganisms. Center for Biological Research USSR
Academy of Sciences, Push chino, pp 59-78
Mauersberger S, Matyashova RN (1980) The content of cytochrome P-450 in yeast cells
growing on hexadecane (Russ). Mikrobiologiya 49: 571-577
Mauersberger S, Matyashova RN, Miiller H-G, Losinov AB (1980) Influence of the growth
substrate and the oxygen concentration in the medium on the cytochrome P-450 content
in Candida guilliermondii. Eur J Appl Microbiol Biotechnol 9: 285-294
Mauersberger S, Schunck W-H, Miiller H-G (1981) The induction of cytochrome P-450 in
Lodderomyces elongisporus. Z Allg Mikrobiol21: 313-321
Mauersberger S, Schunck W-H, Miiller H-G (1984) The induction of cytochrome P-450 in
the alkane-utilizing yeast Lodderomyces elongisporus: alterations in the microsomal
membrane fraction. Appl Microbiol Biotechnol19: 29-35
Mauersberger S, Kargel E, Matyashova RN, Miiller H-G (1987) Subcellular organization of
alkane oxidation in the yeast Candida maltosa. J Basic Microbiol 27: 565-582
Mauersberger S, Bohmer A, Schunck W-H, Muller H-G (1991) Cytochrome P-450 of the
yeast Yarrowia lipolytica. Int Conf Biochemistry, Biophysics of Cytochrome P-450:
Structure, Function, Biotechnological and Ecological Aspects, Moscow 1991, Abstr
Mauersberger S, Persiyanova TB, Avetisova SM, Sokolov YI, Kargel E, Kraft R, Schunck W-
H, Davidov ER, Miiller H-G (1992a) Characterization of two cytochrome P-450 forms
purified from the yeast Candida maltosa. In: Archakov AI, Bachmanova GI (eds) Cyto-
chrome P-450: biochemistry and biophsics. INCO - TNC, Joint Stock Company Moscow,
pp 651-653
Mauersberger S, Drechsler H, Oehme G, MUller H-G (1992b) Substrate specificity and

stereo selectivity of the fatty alcohol oxidase from the yeast Candida maltosa. Appl
Microbiol Biotechnol37: 66-73
Maximova GN, Vorobyova GI, Grigoryeva SP (1972) The question of hydrocarbon localiza-
tion in the yeast cells of Candida guilliermondii NP-4 grown in media with paraffins
Meissel MN, Medvedeva GA, Kozlova TM (1976) Cytological mechanisms of alkane assimi-
lation by yeast (Russ). Mikrobiologiya 45: 844-851
Menzel R, Scheller U, Schunck W-H, MUller H-G (1992) Inducible high-level expression of
cytochromes P-450 CYP52A3 and CYP52A4 from Candida maltosa in Saccharomyces
cerevisiae. In: Archakov AI, Bachmanova GI (eds) Cytochrome P-450: biochemistry and
biophysics, INCO - TNC, Joint Stock Company, Moscow, pp 654-656
Menzel R, Kiirgel E, WolffC, Vogel F, Schunck W-H (1994) High level expression of integral
membrane proteins induces proliferation of the endoplasmic reticulum. In: Lechner MC
(ed) Cytochrome P450. Biochemistry, biophysics and molecular biology, John Libbey
Eurotext, Paris, pp 307-310
Menzel R, Kiirgel E, Vogel F, Bottcher C,Schunck W-H (1996) Membrane integration of
cytochrome P450 and ER-proliferation are related processes. (submitted)
Metz W, Reuter G (1977) Anabole und katabole Enzyme des Harnstoffmetabolismus in
einem kohlenwasserstoffverwertenden Stamm von Candida guilliermondii. Z Allg
Meyer SA, Anderson K, Brown RE, Smith MT, Yarrow D, Mitchell G, Ahearn DG (1975)
Physiological and DNA characterization of Candida maltosa, a hydrocarbon-utilizing
yeast. Arch Microbiol104: 225-231
Michaleva VV, Garbalinsky VA, Botnikova TA, Karnoz GV, Melnik RA (1973a) Utilization
of n-paraffins of different molecular weight by Candida guilliermondii (Russ). Prikl
Biokhim Mikrobiol 10: 35-41
Michaleva VV, Gradova NB, Koslova LJ, Roschkova MI, Shdannikova IN, Welikoslavinskaja
01, Triems K, PohIand D, Glombitza F, Wunsche L, Kersten D-C, Schneider I (1973b)
Verfahren zur Gewinnung von Futterhefe. GDR patent, DD WP 105.825
Mikhailova NP, Durasova EN, Vyunov KA (1987) Analysis of sterol mutants of Candida
maltosa: genetic and biochemical aspects. 12th Int Spec Symp on Yeast, Weimar, Abstr,
p 79
Mikhailova NP, Sorokoletova EF, Durasova EN, Vyunov KA, Shapovalov 01 (1991) Sterol
composition of nystatin-resistant Candida maltosa mutants. Folia Microbio136: 148-152
Minkevich IG, Baumann F, Rogge G, Heinritz B (1988) Ratio of heat production to oxygen
consumption during the cell cycle of Candida maltosa EH 15 grown on ethanol. Acta
Mishina M, Kamiryo T, Tashiro S, Hagihara T, Tanaka A, Fukui S, Osumi M, Numa S (1978)
Subcellular localization of two long-chain acyl-coenzyme-A-synthetases in Candida
lipolytica. Eur J Biochem 89: 321-328
Montrocher R (1980) Significance of immunoprecipitation in yeast taxonomy: Antigenic
analyses of some species within the genus Candida. Cell Mol BioI 26: 293-302
MUller H, Voigt B (1981) Untersuchungen zur chemischen Zusammensetzung der
Lipidfraktion von Lodderomyces elongisporus EH 15. Acta Biotechnol 1: 279-284
MUller H, Voigt B (1984) Bestimmung von freiem und gebundenem Ergosterol in
Mikroorganismen. Z Al1g Mikrobiol24: 61-64
MUller H-G, Schunck W-H, Riege P, Honeck H (1979) The alkane-hydroxylating enzyme
system of the yeast Candida guilliermondii. Acta BioI Med Ger 38: 345-349
Muller H-G, Mauersberger S, Schunck W-H, Riege P, Honeck H, Huth J (1980) The alkane-
hydroxylating cytochrome P-450 system of yeast: regulation in vivo and progress in
isolation. In: Gustafsson J-A et al. (eds) Biochemistry, biophysics and regulation of
cytochrome P-450. Elsevier, Amsterdam, pp 251-254
MUller H-G, Schunck W-H, Riege P, Honeck H (1982) The alkane monooxygenase system of
the yeast Lodderomyces elongisporus: Purification of the cytochrome P-450 and the
NADPH-cytochrome P-450 reductase and reconstitution experiments. In: Hietanen E et
al. (eds) Cytochrome P-450 - biochemistry, biophysics and environmental implications.
Elsevier, Amsterdam, pp 445-448
Miiller H-G, Mauersberger S, Schunck W-H, Wiedmann B (1983a) Enzyminduktion in der
Hefe Lodderomyces elongisporus in Gegenwart von n-Alkanen. Z Allg Mikrobiol23: 589-
593
Miiller H-G, Schunck W-H, Kiirgel E (1991a) Cytochromes P-450 of alkane-utilizing yeasts
(Review). In: Ruckpaul K, Rein H (eds) Frontiers in biotransformation vol 4. Akademie
Verlag, Berlin, pp 87-126
Miiller H-G, Kiirgel E, Mauersberger S, Schunck W-H, Wiedmann B (1991b) Alkane catabo-
lism in yeast - new results of the 1980s. In: Finogenova TV, Sharyshev AA (eds) Alkane
metabolism and oversynthesis of metabolites by microorganisms. Center for Biological
Research USSR Academy of Sciences, Pushchino, pp 3-16
Miiller R, Markuske KD, Babel W (1983b) Verbesserung der Y-Werte bei Wachstum von
Hansenula polymorpha auf Methanol durch simultane Verwertung von Glucose. Z AUg
Miiller RH, Babel W (1988) Energy and reducing equivalent potential of C2-compounds for
microbial growth. Acta Biotechnol 8: 249-258
Muller RH, Babel W (1989) Kontinuierliche nicht-fermentative Synthese von Aceton. Wiss
Z Karl Marx Univ Leipz Math-Naturwiss Reihe 38: 269-302
Muramatsu S, Hanada H, Nirasawa K, Yoshida M (1982) Mutagenicity tests for mice bred
under the condition oflong-continued feeding of single-cell protein diets. Bull Nat! Inst
Anim Ind 38: 23-32
Muraoka S, Ohkuma M, Ohta A, Takagi M (1993) Regulation of gene expression on n-
alkane-inducible cytochrome P450s in Candida maltosa. 2nd Int Symp Cytochrome
P450 Microorganisms Plants, Tokyo, June l3-17, 1993, Abstr, p 2
Muraoka S, Ohkuma M, Takagi M (1994) Recent advances on regulation of gene expression
by hydrophobic compounds using yeast systems (Japanese). Tanpakushitsu-Kakusan-
Koso 39: 521-529
Musch A (1993) Die molekulare Umgebung einer naszierenden Polypeptid-Kette wiihrend
ihrer Translokation in Hefe-Mikrosomen. Dissertation, Humboldt Universitiit, Berlin
Mutoh H, Mochizuki M, Ohta A, Takagi M (1995) Inducible expression of a gene encoding
a L41 ribosomal protein responsible for the cycloheximide-resistant phenotype in the
yeast Candida maltosa. J Bacterioll77: 5383-5386
Nabeshima S, Tanaka S, Fukui S (1970) Studies on the hydrocarbon utilization by microor-
ganisms XII. Comparison of the polysaccharide contents of yeast cells grown on hydro-
carbons and glucose. J Ferment Technol4: 556-562
Nakase T, Komagata K (197l) Significance of DNA base composition in the classification of
the genus Candida. J Gen Appl Microbioll7: 259-279
Nakase T, Fukazawa Y, Tsuchiya T (1972) A comparative study on two forms of Candida
tropicalis (Cast.) Berkhout. J Gen Appl Microbioll8: 349-363
Nelson DR, Kamataki T, Waxman DJ, Guengerich FP, Estabrook RW, Feyereisen R,
Gonzalez FJ, Coon MJ, Gunsalus IC, Gotoh 0, Okuda K, Nebert D (1993) The P450
superfamily: update on new sequences, gene mapping, accession numbers, early trivial
names of enzymes, and nomenclature. DNA Cell Biol12: 1-51
Neujahr HY (1990) Yeast in biodegradation and biodeterioration processes. In: Verachtert
H, De Mot R (eds) Yeast biotechnology and biocatalysis. Marcel Dekker, New York, pp
321-348
Nunziata A, Argentino-Storino A, Mercatelli P, Salerno RO (1982) Two year toxicity in
beagle dogs fed a new protein source. Arch Toxicol Suppl5: 378-381
Nuske J, Grimmecke HD, Reuter G (1982) Polysaccharid-Strukturen von Zellwand-
Priiparaten aus der FuttereiweiE-Hefe Candida sp. H. Z AUg Mikrobiol22: 477-486
Odds FC (1987) Candida infections: an overview. CRC Crit Rev Microbioll5: 1-5
Ogorodnikova TE, Durasova EN, Sinitskaya NA, Orlov AI, Mikbailova NP, Vyunov KA
(1991) Biochemical basis of different nystatin resistance of Saccharomyces cerevisiae and
Candida maltosa yeast mutants (Russ). Mikrobiologiya 60: 26-33 (Microbiology, New
York 60: 680-686, English Translation 1992)
Ogrydziak DM (1988) Development of genetic maps of nonconventional yeasts. J Basic
Ohama T, Suzuki T, Mori M, Osawa S, Ueda T, Watanabe K, Nakase T (1993) Non-universal
decoding of the leucine codon CUG in several Candida species. Nucleic Acids Res 21:
4039-4045
Ohkuma M (1993) Study on n-alkane-inducible cytochrome P-450 gene family in Candida
maltosa (Japanese). PhD Thesis, Tokyo University
Ohkuma M, Hikiji T, Tanimoto T, Schunck W-H, Miiller H-G, Yano K, Takagi M (1991a)
Evidence that more than one gene encodes n-alkane-inducible cytochrome P-450s in
Candida maltosa, found by two-step gene disruption. Agric BioI Chern 55: 1757-1764
Ohkuma M, Tanimoto T, Yano K, Takagi M (1991b) CYPS2 (cytochrome P450alk)
multigene family in Candida maltosa: molecular cloning and nucleotide sequence of the
two tandemly arranged genes. DNA Cell BioI 10: 27l-82
Ohkuma M, Muraoka S, Hwang CW, Ohta A, Takagi M (1993a) Cloning of the C-URA3 gene
and construction of a triple auxotroph (hisS, adel, ura3) as a useful host for the genetic
engineering of Candida maltosa. Curr Genet 23: 205-210
Ohkuma M, Hwang CW, Masuda Y, Nishida H, Sugiyama J, Ohta A, Takagi M (1993b)
Evolutionary position of n-alkane-assimilating yeast Candida maltosa shown by nucle-
otide sequence of small-subunit ribosomal-RNA gene. Biosci Biotech Biochem 57: 1793-
1794
Ohkuma M, Muraoka S, Ohta A, Takagi M (1993c) A cytochrome P450alk gene family in
Candida maltosa: chromosomal mapping and gene disruption. 2nd Int Symp Cyto-
chrome P450 Microorganisms Plants, Tokyo, June 13-17, 1993, Abstr, p 3
Ohkuma M, Kawai S, Takagi M (1994a) Subject 1. Isolation and characterization of an ARS
for Candida maltosa. In: Maresca B, Kobayashi GS (eds) Molecular biology of patho-
genic fungi, a laboratory manual. Telos Press, New York, pp 213-220
Ohkuma M, Muraoka S, Takagi M (1994b) Subject 2. Construction of host-vector systems in
Candida maltosa. In: Maresca B, Kobayashi GS (eds) Molecular biology of pathogenic
fungi, a laboratory manual. Telos Press, New York, pp 221-226
Ohkuma M, Muraoka S, Tanimoto T, Fujii M, Ohta A, Takagi M (1995a) CYPS2 (cytochrome
P450alk) multigene family in Candida maltosa: identification and characterization of
eight members. DNA Cell Bioi 14: 163-173
Ohkuma M, Park S-M, Zimmer T, Menzel R, Vogel F, Schunck W-H, Ohta A, Takagi M
(1995b) Proliferation of intracellular membrane structures upon homologous over-
production of cytochrome P-450 in Candida maltosa. Biochim Biophys Acta
(Biomembranes) 1236: 163-169
Ohkuma M, Masuda Y, Park S-M, Ohtomo R, Ohta A, Takagi M (1995c) Evidence that the
expression of the gene for NADPH -cytochrome P-450 reductase is n-alkane-inducible in
Candida maltosa. Biosci Biotech Biochem 59: 1328-1330
Ohkuma M, Zimmer T, !ida T, Schunck W-H, Ohta A, Takagi M (1995d) Isozyme function
of n-alkane-inducible cytochrome P450 in Candida maltosa by sequential gene disrup-
tion (in preparation)
Ohkuma M, Kobayashi K, Kawai S, Hwang CW, Ohta A, Takagi M (1995e) Identification of
a centromeric activity in the autonomously replicating TRA region allows improvement
of the host -vector system of Candida maltosa. Mol Gen Genet 249: 447-455
Okino H, Taoka A, Uemura N (1986) Production of macro cyclic musk compounds,
via alkanedioic acids produced from n-alkanes. In: Lawrence BM, Mookherjee BD, Willis
BJ (eds) Flavors and fragrances: a world perspective. Elsevier, Amsterdam, pp 753-760
Oliver SG (1988) Replication and recombination in gene establishment in non-Saccharomy-
ces yeasts. J Basic Microbiol28: 197-208
Oliver SG et al. (1992) The complete DNA sequence of yeast chromosome III. Nature 357:
38-46
Osumi M, Miwa N, Teranishi Y, Tanaka A, Fukui S (1974) Ultrastructure of Candida yeasts
grown on n-alkanes. Appearance of microbodies and its relationship to high catalase
activity. Arch Microbiol99: 181-201
Osumi M, Fukuzumi F, Teranishi Y, Tanaka A, Fukui S (1975a) Development of
microbodies in Candida tropicalis during incubation in a n-alkane medium. Arch
Microbioll03: 1-11
Osumi M, Fukuzumi F, Yamada N, Nagatani T, Teranishi Y, Tanaka A, Fukui S (1975b)
Surface structure of some Candida yeast cells grown on n-alkanes. J Ferment Technol53:
244-248
Palmiter RD (1974) Magnesium precipitation of ribonucleoprotein complexes. Expedient
techniques for the isolation of undegraded polysomes and messenger ribonucleic acid.
Biochem 13: 3606-3614
Park SM, Ohkuma M, Masuda Y, Ohta A, Takagi M (1996) Galactose-inducible expression
systems in Candida maltosa using promoters of newly-isolated GALl and GALl 0 genes.
(submitted)
Pekelis MV, Ermolaev AV, Ushomirskaya MS, Orlova LM, Gukasyan IA (1989) Immu-
nochemical study of surface glycoconjugates of yeast-like fungi of the Candida genus
Perri GC, Nunziata A, Argentino-Storino A, Salerno RO, Mercatelli P (1981) Long-term
toxicity and carcinogenicity of a new protein source in rats. Toxicol EurRes 3: 305-310
Picataggio S, Deanda K, Mielenz J (1991) Determination of Candida tropicalis acyl coen-
zyme A oxidase isozyme function by sequential gene disruption. Mol Cell Bioi 11: 4333-
4339
Picataggio S, Rohrer T, Deanda K, Lanning D, Reynolds R, Mielenz J, Eirich LD (1992)
Metabolic engineering of Candida tropicalis for the production oflong-chain dicarboxy-
lic acids. Bio/Technology 10: 849-898
Pogorelskaia SA, Mokeeva NV, Makarova IB (1991) The rate of isolation of fungi in the
genus Candida from the nasopharyngal mucosa of those in contact with the products
from microbial protein manufacture (Russ). Zh Mikrobiol Epidemiol Immunobiol3: 24-
26
Polnisch E, Hofmann KH (1989) Cyclic AMP, fructose-2,6-bisphosphate and catabolite
inactivation of enzymes in the hydrocarbon-assimilating yeast Candida maltosa. Arch
Polnisch E, Kneifel H, Franzke H, Hofmann KH (1992) Degradation and dehalogenation of
monochlorophenols by the phenol-assimilating yeast Candida maltosa. Biodegradation
2: 193-199
Polumienko AL, Grigorieva SP (1985) New yeast vectors containing autonomously replicat-
ing sequences from Candida maltosa genome (Russ). Molek Genet Mikrobiol Vir 7: 26-
31
Popov B, Reuter G, Meyer HW (1980) Cell wall regeneration of Candida spec. protoplasts. Z
Allg Mikrobiol20: 47-62
Poulter R (1990) Classical methods for the genetic analysis of Candida albicans. In: Kirsch
DR, KellyR, Kurtz MB (eds) The genetics of Candida. CRC Press, Boca Raton, pp 75-123
Prave P, Faust U, Sittig W, Sukatsch DA (1982) Handbuch der Biotechnologie. Akademische
Verlagsgesellschaft Wiesbaden
Pringle JR, Adams AEM, Drubin DG, Haarer BK (1991) Immunofluorescence methods for
yeast. Methods Enzymo1194: 565-602
Rabinovich EG, Yegorova VN, Smirnova OY, Inge-Vechtomov SG (1974) Hydrocarbon-
utilizing mutants of Saccharomyces cerevisiae. Part II to VI. Suppression of sporulation,
copulation, and mitotic recombination in HycO and Hyc+ mutants (Russ). Genetika 10:
93-99 and related papers of the series in this issue.
Rachubinski RA (1990) Genetic methods for and gene structure in other Candida species.
In: Kirsch DR, KellyR, Kurtz MB (eds) The genetics of Candida. CRC Press, Boca Raton,
pp 177-186
Rademacher K-H, Reuter G (1978) Zur Struktur des Mannans von Candida guilliermondii
H. Z Allg Mikrobiol18: 63-66
Rehm HJ (1986) Single cell protein production from petroleum derivatives and its utiliza-
tion as food and feed. In: Alani Dr, Moo-Young M (eds) Perspectives in biotechnology
and applied microbiology. Elsevier, New York, pp 1-16
Rehm HJ, Reiff I (1981) Mechanisms and occurrence of microbial oxidation of long-chain
alkanes. Adv Biochem Eng 19: 175-215
Rehm HJ, Reiff I (1982) Regulation der mikrobiellen Alkanoxidation mit Hinblick auf die
Produktsynthese. Acta Biotechnol2: 127-138
Reiser J, Glumoff V, Killin M, Ochsner U (1990) Transfer and expression of heterologous
genes in yeast other than Saccharomyces cerevisiae. In: Fiechter A (ed) Advances in
biochemistry engineering/biotechnol vol 43. Springer, Berlin Heidelberg New York, pp
76-102
Riege P, Schunck W-H, Honeck H, Miiller H-G (1980) Eigenschaften des Cytochrom P-450-
abhangigen alkanhydroxylierenden Enzymsystems aus Candida guilliermondii. Wiss Z
Ernst Moritz Arndt Univ Greifswald 29: 125-126
Riege P, Schunck W-H, Honeck H, Miiller, H-G (1981) Cytochrome P-450 from
Lodderomyces elongisporus: its purification and some properties of the highly purified
protein. Biochem Biophys Res Commun 98: 527-534
Riege P, Blasig R, Miiller H-G, Heidenreich G, Bauch J (1989) Influence of oxygen and
substrate supply on the metabolism of Candida maltosa during cultivation on n-alkanes.
Appl Microbiol Biotechnol32: 101-107
Riggsby WS (1990) Physical characterization of the Candida albicans genome. In: Kirsch
DR, Kelly R, Kurtz MB (eds) The genetics of Candida. CRC Press, Boca Raton, pp 125-
145
Ringpfeil M (1983) SCP-Produktion auf der Basis von Kohlenwasserstoffen. Acta Biotechnol
3:227-240
Rober B (1985) Katabole Repression bei aeroben und 02-limitiertem Wachstum -
energetische und stoffliche Bilanz des Kohlenhydratmetabolismus bei Hefen. J Basic
Rober B, Reuter G (1979) Biosynthese der Zellwand-Polysaccharide Mannan und Glucan als
Spiegelbild unterschiedlicher Abbauwege der Glucose durch Candida sp. H. Z Allg
Rober B, Reuter G (1982) In vitro-Einbau von 14C-Hexose-6-Phosphat in Mannan, j3-Glucan
und Glycogen bei Candida sp. H und ihren Mutanten. Z Allg Mikrobiol22: 671-673
Rober B, Reuter G (1984a) Control of catabolic and anabolic sequences of carbohydrate
utilization in the scp yeast Candida maltosa H and its mutants H3 and H5 (Germ). Z Allg
Mikrobiol24: 41-55
Rober B, Reuter G (1984b) Regulation of the glucopolysaccharide biosynthesis in the scp
yeast Candida sp. H by precursor preparation (Germ). Z Allg Mikrobiol24: 167-177
Rober B, Reuter G (1984c) Mannan-biosynthesis in microsome fractions from protoplast-
lysates of Candida maltosa H (Germ). Z Allg Mikrobiol24: 179-188
Rober B, Reuter G (1984d) Regulation of proteophosphomannan biosynthesis in the scp
yeast Candida maltosa H by precursor preparation (Germ). Z Allg Mikrobiol24: 317-328
Rober B, Reuter G (1985) Effector- and precursor-function of mannose-6-phosphate,
mannose-1-phosphate, UDP-n-acetylglucosamine and dolichylphosphate in the
proteophosphomannan biosynthesis of the scp yeast Candida maltosa H (Germ). J Basic
Rober B, Stolle J, Reuter G (1984a) Properties of hexokinase from Candida maltosa H, a SCP
yeast (Germ). Z AUg Mikrobiol24: 619-627
Rober B, Stolle J, Reuter G (1984b) Properties of the glucose-6-phosphate dehydrogenase
from Candida maltosa H, a SCP yeast (Germ). Z Allg Mikrobiol24: 629-636
8: 423-488
Rose MD, Winston F, Hieter P (eds) (1990) Methods in yeast genetics. A laboratory course
manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor
Rylkin SS, BerezovTB, Gurina LV, Belova LA, Shulga AV, Orlova VS, Saubenova MG (1974)
Composition of cell wall of Candida tropicalis during growth on glucose and n-alkanes
(Russ). Mikrobiologiya 43: 551-552
Rymond BC, Rosbach M (1992) Yeast pre-mRNA splicing. In: Jones EW, Pringle JR, Broach
JR (eds) The molecular and cellular biology of the yeast Saccharomyces, vol 2, Gene
expression. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, pp 143-192
Sakajo S, Minagawa N, Yoshimoto A (1993) Characterization of the alternative oxidase
protein in the yeast Hansenula anomala. FEBS Lett 8: 310-312
Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a laboratory manual. Cold
Spring Harbor Laboratory Press, Cold Spring Harbor
Samsonova I, Klinner U, Bottcher F (1987) Genetic studies on Candida maltosa. 12th Int
Spec Symp Genet Non-conventional Yeasts, Weimar, 1987, Abstr, p21
Sanglard D, Fiechter A (1989) Heterogeneity within the alkane-inducible cytochrome P450
gene family of the yeast Candida tropicalis. FEBS Lett 256: 128 -133
Sanglard D, Loper JC (1989) Characterization of the alkane-inducile cytochrome P450
(P450alk) gene from the yeast Candida tropical is: identification of a new P450 gene
family. Gene 76: 121-136
Sasnauskas K, Jomantiene R, Geneviciute E, Januska A, Lebedys J (1991) Molecular cloning
of the Candida maltosaADEl gene. Gene 107: 161-164
Sasnauskas K, Jomantiene R, Januska A, Lebediene E, Lebedys J, Janulaitis A (1992a)
Cloning and analysis of a Candida maltosa gene which confers resistance to formalde-
hyde in Saccharomyces cerevisiae. Gene 122: 207-211
Sasnauskas K, Jomantiene R, Lebediene E, Lebedys J, Januska A, Janulaitis A (1992b)
Molecular cloning and analysis of autonomous replicating sequence of Candida maltosa.
Yeast 8: 253-259
Sasnauskas K, Jomantiene R, Lebediene E, Lebedys J, Januska A, Janulaitis A (1992c) Clon-
ing and sequence analysis of a Candida maltosa gene which confers resistance to cyclo-
heximide. Gene 116: 105-108
Sattler K, Wunsche L (1981) Aufnahme von Kohlenwasserstoffen durch Hefen (Teil I). Acta
BiotechnolO: 15-20
Sattler K, Wunsche L (1983) Moglichkeiten der Gewinnung von Koppelprodukten der
mikrobiellen EiweiBsynthese auf der Basis von Kohlenwasserstoffen. Acta Biotechnol3:
345-350
Schauer F (1988) Zur Physiologie des Kohlenwasserstoffabbaus in Candida maltosa.
Universitat Greifswald, Math-Nat, Dissertation B
Schauer F, Schauer M (1986) Alkanassimilierende Hefen. Systematische Stellung und
Erfassung einiger Leistungsgrenzen. Wiss Z EMA Univ Greifswald Math Naturwiss Reihe
35: 14-23
Schauer F, Hofmann KH, Kohler M (1986) The subterminal oxidation of aliphatic hydrocar-
bons in Candida maltosa. In: Microbe 86, 14th Int Congr Microbiol, Manchester, Abstr,
p 255
Schauer F, Lindow S, Schauer M, Samsonova I, Bottcher F (1987) Oxidation of n-alkanes by
Pichia guilliermondii and induction of mutants. 12th Int Spec Symp Genet of Non-
conventional Yeasts, Weimar, 1987, Abstr, p 57
Scheda R (1966) Kohlenwasserstoffe zehrende Hefen. Die Branntweinwirtschaft 106: 373-
376
Scheller U, Schunck W-H, Muller H-G (1992) Characterization of two different alkane-
inducible P-450 forms from Candida maltosa by means of heterologous expression in
Saccharomyces cerevisiae. In: Archakov AI, Bachmanova GI (eds) Cytochrome P-450:
biochemistry and biophysics. INCa - TNC, Joint Stock Company, Moscow, pp 662-664
Scheller U, Kraft R, Schroder K-L, Schunck W-H (1994) Generation of the soluble and
functional cytosolic domain of microsomal cytochrome P450 52A3. J BioI Chern 269:
12779-12783
Scheller U, Zimmer T, Kargel E, Schunck W-H (1996) Characterization of the n-alkane
and fatty acid hydroxylating cytochrome P450 forms 52A3 and 52A4. Arch Biochem (in
press)
Schindler J, Meusdoerffer F, Giesel-Biihler H (1990) Microbial production in industrial
chemicals: Basic features of dicarboxylic acid production by yeasts (Germ). Forum
Mikrobiol5: 274-281
Schmidt H (1988) Lysinmetabolismus der Hefen Candida maltosa und Pichia
guilliermondii. Univ Greifswald, Math-Nat Dissertation A
Schmidt H, Bode R (1992) Characterization of a novel enzyme, W-acetyl-L-Iysine: 2-
oxoglutarate aminotransferase, which catalyzes the second step of lysine catabolism in
Candida maltosa. Antonie Leeuwenhoek J Microbiol62: 285-290
Schmidt H, Bode R, Lindner M, Birnbaum D (1985) Lysine biosynthesis in the yeast Candida
maltosa: properties of some enzymes and regulation of the biosynthetic pathway. J Basic
Schmidt H, Bode R, Birnbaum D (1988) Lysine degradation in Candida maltosa: occurrence
of a novel enzyme, acetyl-CoA:L-lysine N-acetyltransferase. Arch Microbiol 150: 215-
218
Schmidt H, Bode R, Samsonova lA, Birnbaum D (1989a) Isolation and characterization of
alpha-aminoadipate-delta-semialdehyde overproducing mutants from yeasts. FEMS
Microbiol Lett 60: 201-204
Schmidt H, Bode R, Samsonova lA, Birnbaum D (1989b) Production of alpha-
aminoadipate-delta-semialdehyde by a mutant from Candida maltosa. Appi Microbiol
Schneider JD, Triems K (1981) EinfiuB extracellularer Kaliumionenkonzentrationen auf die
cellulare Natriumkonzentration von Lodderomyces elongisporus D. Acta Biotechnol 1:
197-199 .
Schneider JD, Hansel R, Hedlich R, Jechorek M (1983) Growth characteristics of a
thermotolerant strain of Lodderomyces elongisporus grown on sucrose. Acta Biotechnol
3: 13-19
Schult I (1987) Enzymologische Studien fiber mutabile Gene bei Candida maltosa. Ernst-
Moritz-Arndt-Universitat Greifswald, DDR, Sektion Biologie, Dissertation A
Schult I, Samsonova I, Bottcher F (1987) Induction of unstable genes in Candida maltosa.
12th Int Spec Symp Non-conventional Yeast, Weimar, 1987, Abstr, p 22
Schunck W-H, Riege P, Blasig R, Honeck H, Miiller H-G (1978a) Cytochrome P-450 and
alkane hydroxylase in Candida guilliermondii. Acta BioI Med Ger 37: K3-K7
Schunck W-H, Riege P, Kuhl R (1978b) Cytochrome P-450 of eukaryotic microorganisms.
Pharmazie 33: 410-415
Schunck W-H, Riege P, Miiller H-G, Scheler W (1983a) Isolation and some molecular
properties of cytochrome P-450 from the alkane assimilating yeast Lodderomyces
elongisporus (Russ.) Biokhimiya (Moscow) 48: 518-526
Schunck W-H, Riege P, Honeck H, Miiller H-G (1983b) Isolierung und Rekonstitution des
Alkan-Monooxygenase-Systems der Hefe Lodderomyces elongisporus. Z Allg Mikrobiol
23: 653-660
Schunck W-H, Mauersberger S, Huth J, Riege P, Miiller H-G (1987a) Function and regula-
tion of cytochrome P-450 in alkane-assimilating yeast I. Selective inhibition with carbon
monoxide in growing cells. Arch Micrio1147: 240-244
Schunck W-H, Mauersberger S, Kargel E, Huth J, Miiller H-G (1987b) Function and regula-
tion of cytochrome P-450 in alkane-assimilating yeast II. Effect of oxygen-limitation.
Arch Microbiol147: 245-248
Schunck W-H, KieSling U, Strauss M, Kiirgel E, Wiedmann B, Mauersberger S, Gaestel M,
Gross B, Miiller H-G (1989a) Cloning of a cDNA for the alkane hydroxylating P-450 from
12. Candida ma/rosa 575
Candida maltosa. In: Schuster I (ed) Biochemistry and biophysics of cytochrome P-450.
Taylor & Francis, London, pp 656-659
Schunck W-H, Kiirgel E, Gross B, Wiedmann B, Mauersberger S, Kopke K, KieBling U,
Strauss M, Gaestel M, MUller H -G (1989b) Molecular cloning and characterization of the
primary structure of the alkane hydroxylating cytochrome P-450 from the yeast Candida
maltosa. Biochem Biophys Res Commun 181: 843-850
Schunck WH, Vogel F, Gross B, Kiirgel E, Mauersberger S, Kopke K, Gengnagel C, MUller
HG (1991) Comparison of two cytochromes P-450 from Candida maltosa: primary
structures, substrate specificities and effects of their expression in Saccharomyces
cerevisiae on the proliferation of the endoplasmic reticulum. Eur J Cell BioI 55: 336-345
Schunck W-H, Scheller U, Juretzek T (1996) Generation of the cytosolic domain of microso-
mal P450 52A3 after high-level expression in Saccharomyces cerevisiae. Methods Enzym
(in press)
Schuster G, Voigt B, MUller H (1990) The influence of combined treatments with 2,4-
dioxohexahydro-l,3,5-triazine (DHT) and lipophilic fractions from the yeast Candida
maltosa IMET H128 on virus symptoms and tuber mass of identical potato eye cutting
plants. Z Pflanzenkr Pflanzenschutz 97: 84-86
Schwarz E, MUlling K, Samsonova I, Schauer F, Bottcher F (1987) Genetic studies of n-
alkane uitilization of Candida maltosa. 12th Int Spec Symp Genet of Non-conventional
Yeasts, Weimar, 1987, Abstr, p 75
Seghezzi W, Sanglard D, Fiechter A (1991) Characterization of a second alkane-inducible
cytochrome P450-encoding gene, CYPS2A2, from Candida tropicalis. Gene 106: 51-60
Seghezzi W, Meili C, Ruffiner R, Kuenzi R, Sanglard D, Fiechter A (1992) Identification and
characterization of additional members of the cytochrome P450 multigene family CYPS2
of Candida tropicalis. DNA Cell BioI 11: 767-780
Senez JC (1986) The economical aspects of single cell protein production from petroleum
derivatives. In: Alani DI, Moo-Young M (eds) Perspectives in biotechnology and applied
microbiology. Elsevier, New York, pp 33-48
Sharp PM, Touhy TM, Mosurski KR (1986) Codon usage in yeast: cluster analysis clearly
differentiates highly and lowly expressed genes. Nucleic Acid Res 14: 5125-5143
Sharyshev AA, Krauzova VI (1988) Fractionation of subcellular membrane organelles of the
yeast Candida maltosa in Percoll gradients (Russ). Biologicheskie Membrany (Biological
Membranes) 5: 187-197
Sharyshev AA, Matyashova RN, Komarova GN (1983) Cytochrome P-450 assay in Candida
and Saccharomyces cells under various growth conditions. Int Symp Environ Regulation
Microbial Metabolism, Pushchino 1983, Abstr, pp 33-34
Shennan JL (1984) Hydrocarbons as substrates in industrial fermentations. In: Atlas PR (ed)
Petroleum microbiology. Macmillan, New York, pp 643-683
Shennan J1, Levi JD (1974) The growth of yeasts on hydrocarbons. In: Hockenhull DJD
(ed) Progress in industrial microbiology, vol 13. Churchill Livingstone Edinburgh, pp 1-57
Shiio I, Uchio R (1971) Microbial production of long-chain dicarboxylic acids from n-
alkanes. Part I. Screening and properties of microorganisms producing dicarboxylic
acids. Agric BioI Chern 35: 2033-2042
Shilova NK, Matyashova RN, llchenko AP (1989) The effect of aeration on the activity of
alcohol oxidase and enzymes utilizing hydrogen peroxide in the course Candida maltosa
growth on paraffin (Russ). Mikrobiologiya 58: 430-435
Shkumatov VM (1993) Heterologous reconstitution of monooxygenases. 2nd Int Symp
Cytochrome P450 Microorganisms Plants, Tokyo, June 13-17, 1993, Abstr, P 28
Silva J, Laborda RR, Almendro G, Salim R (1990) Detection of opportunistic yeast pathogens
in hospitalized immunocompromised patients. Rev Latinoam Microbiol32: 261-264
Sinanyan ES, Davidova EG, Davtyan MA, Davidov ER (1989) Synthesis of thermal shock
proteins in the mesophilic strain of the yeast Candida maltosa and in its thermotolerant
mutant (Russ). Izv Timiryazev Skh Akad 0(2): 195-199
Sinanyan ES, Davtyan MA, Davidov ER (1990) Proteolytic activity of mesophilic and
thermophilic yeast Candida maltosa in thermal and ethanol shock (Russ). BioI Zh Arm 43:
96-100
Slavikova E, Grabinska-Loniewska A (1990) Taxonomical study of yeasts and yeast-like
microorganisms isolated from the denitrification unit Biocenosis. Acta Mycol (Warsaw)
23: 81-88 (1987, published 1990)
Smith NG, Bourquin AW, Crow SA, Ahearn DG (1976) Effect of heptachlor on hexadecane
utilization by selected fungi. Dev Ind Microbiol17: 331-336
Smith RH, Palmer R (1976). A chemical and nutritional evaluation of yeast and bacteria as
dietary protein sources for rats and pigs. J Sci Food Agric 27: 763-770
Snow R (1966) An enrichment method for auxotrophic yeast mutants using the antibiotic
nystatin. Nature 211: 206-207
Sokolov YI, Davidov ER, Demanova NF, Gololobov AD (1981) Utilization of alkyl aromatic
hydrocarbons by the yeast Candida guilliermondii (Russ). Prikl Biokhim Mikrobiol17:
660-668
Sokolov YI, Avetisova SM, Davidov ER (1986a) Isolation, purification, and porperties of
cytochrome P-450 from yeast of the genus Candida grown on n-alkanes (Russ).
Biokhimiya 51: 1649-1654
Sokolov YI, Avetisova SM, Davydov RM, Davidov ER (1986b) Detection of two cytochrome
P450 forms participating in the alkane oxidation of Candida yeast (Russ). Dokl Akad
Nauk SSSR 286: 1506-1511
SolI DR (1990) Dimorphism and high-frequency switching in Candida albicans. In: Kirsch
DR, Kelly R, Kurtz MB (eds) The genetics of Candida. CRC Press, Boca Raton, pp 148-
176
Soom YO (1973) Mutants of Saccharomyces cerevisiae utilizing n-alkanes. 1. Isolation and
characterization of mutants (Russ). Genetika 9: 95-101
Souza AE, Myler PJ, Stuart KD (1993) The alkane-inducible Candida maltosa ALIl gene
product is an NADH: ubiquinone oxidoreductase subunit homologue. Gene 137: 349-
350
Spivak SM, Gukasyan lA, Ogarkov VI (1988) Effect of non -pathogenic yeast -like fungi of the
genus Candida on the process of forming immediate hypersensitivity to heterologous
protein in guinea pigs (Russ). Gig Sanit 9: 75-76
Spivak SM, Gukasyan lA, Ermolaev AV, Ustinenko AN, Antonovicha LA (1989) Study of
sensitizing properties of yeast-like fungi of the genus Candida in the production of
dietary proteins (Russ). Gig Sanit 6: 77-79
Stepanjuk VV (1981) On the nuclear origin of peroxisomes as possible precursors of mito-
chondria in hydrocarbon-oxidizing yeasts of the genus Candida (Russ). Zitologiya 23:
369-377
Stichel E, Glombitza F, Iske U (1981) Paraffiniibergang aus der Kohlenwasserstoffphase zur
Hefezelle. Acta Biotechnoll: 9-15
Stichel E, Rogge G, Bley T, Heinritz B (1982) Yield coefficients in dependence on milieu
conditions and cell states. III. Induction of synchrony in continuous yeast cell cultiva-
tion by milieu changes (Lodderomyces elongisporus). Z AHg Mikrobiol22: 717-722
Strick CA, James LC, O'Donnell MM, Gollaher MG, Franke AE (1992) The isolation and
characterization of the pyruvate kinase encoding gene from the yeast Yarrowia
lipolytica. Gene ll8: 65-72 (and correction in Gene 140: 141-143)
Su CS, Meyer SA (1991) Characterization of mitochondrial DNA in various Candida species:
isolation, restriction endonuclease analysis, size, and base composition. Int J Syst
Bacteriol41: 6-14
Sudbery PE (1994) The non-Saccharomyces yeasts. Yeast 10: 1707-1726
Sudoh M, Nagahashi S, Doi M, Ohta A, Takagi M, Arisawa M (1993) Cloning of the chitin
synthase 3 gene from Candida albicans and its expression during yeast-hyphal transi-
tion. Mol Gen Genet 241: 351-358
Sugiyama H, OhkumaM, Masuda Y, ParkS-M, OhtaA, Takagi M (1995) In vivo evidence for
non-universal usage of the codon CUG in Candida maltosa. Yeast ll: 43-52
12. Candido rna/tosa 577
Sunairi M, Watabe K, Takagi M, Yano K (1984) Increase of translatable mRNA for major
microsomal proteins in n -alkane-grown Candida maltosa. J Bacteriol 160: 1037-1040
Sunairi M, Suzuki R, Takagi M, Yano K (1988) Self-cloning of genes for n-alkane assimila-
tion from Candida maltosa. Agric BioI Chern 52: 577-579
Suzuki T, Ueda T, Ohama T, Osawa S. Watanabe K (1993) The gene for serine tRNA having
anticodon sequence CAG in a pathogenic yeast, Candida albicans. Nucleic Acid Res 21:
356
Takagi M (1992) Host-vector system and reverse genetics in a non-conventional yeast,
Candida maltosa. In: Mongkolsuk SP, Lovett PS, Trempy JE (eds) Biotechnology and
environmental science: molecular approaches. Plenum Press, New York, pp 13-22
Takagi M (1993) Reverse genetics in a non-conventional yeast, Candida maltosa. In:
Maresca E, Kobayashi GS, Yamaguchi H (eds), Molecular biology and its application ot
medical mycology. NATO ASI Series, vol H 69. Springer, Berlin Heidelberg New York, pp
13-22
Takagi M, Moriya K, Yano K (1980a) Induction of cytochrome P450 in petroleum-assimilat-
ing yeast. 1. Selection of a strain and basic characterization of cytochrome P450 induc-
tion in the strain. Cell Mol BioI 25: 363-369
Takagi M, Moriya K, Yano K (1980b) Induction of cytochrome P450 in petroleum-assimilat-
ing yeast. II. Comparison of protein synthesizing activity in cells grown on glucose and
n-tetradecane. Cell Mol BioI 25: 371-375
Takagi M, Kawai S, Takata Y, Tanaka N, Sunairi M, Miyazaki M, Yano K (1985) Induction
of cycloheximide resistance in Candida maltosa by modifying the ribosomes. J Gen Appl
Takagi M, Kawai S, Chang MC, Shibuya I, Yano K (1986a) Construction of a host-vector
system in Candida maltosa by using an ARS site isolated from its genome. J Bacteriol
167: 551-555
Takagi M, Kawai S, Shibuya I, Miyazaki M, Yano K (1986b) Cloning in Saccharomyces
cerevisiae of a cycloheximide resistance gene from the Candida maltosa genome which
modifies ribosomes. J Bacteriol168: 417-419
Takagi M, Kobayashi N, Sugimoto M, Fujii T, Watari J, Yano K (1987) Nucleotide sequenc-
ing analysis of a LEU gene of Candida maltosa which complements leuB mutation of
Escherichia coli and leu2 mutation of Saccharomyces cerevisiae. CUrT Genet 11: 451-457
Takagi M, Uchino S, Sugimoto M, Kawai S, Hikiji T, Yano K (1988) Construction of pro-
moter-probe vectors for Candida maltosa, a n-alkane-assimilating yeast, using the LEU2
gene of Saccharomyces cerevisiae. J Basic Microbiol28: 335-342
Takagi M, Ohkuma M, Kobayashi N, Watanabe M, Yano K (1989) Purification of cyto-
chrome P-450alk from n-alkane-grown cells of Candida ma/tosa, and cloning and nucle-
otide sequencing of the encoding gene. Agric BioI Chern 53: 2217-2226
Tan H, Okazaki K, Kubota I, Kamiryo T, Utiyama H (1990) A novel peroxisomal nonspecific
lipid-transfer protein from Candida tropicalis. Gene structure, purification and possible
role in f3-oxidation. Eur J Biochem 190: 107-112
Tanaka A, Fukui S (1989) Metabolism of n-alkanes In: Rose AH, Harrison JS (eds) The
yeasts, vol 3, 2nd edn, Metabolism and physiology of yeasts. Academic Press, London, pp
261-287
Tanaka A, Ohishi N, Fukui S (1967) Studies on the formation of vitamins and their function
in hydrocarbon fermentation. Production of vitamin B6 by Candida albicans in hydro-
carbon medium. J Ferment Technol45: 617-623
Tanaka A, Osumi M, Fukui S (1982) Peroxisomes of alkane-grown yeast: fundamental and
practical aspects. Ann NY Acad Sci 386: 183-199
Tanaka H, Takagi M, Yano K (1987) Separation of chromosomal DNA molecules of Candida
maltosa on agarose gels using the OFAGE technique. Agric BioI Chern 51: 3161-3163
Tannenbaum SR, Wang DIC (1975) Single cell protein II. MIT Press, Cambridge
Tokuyasu KT (1986) Application of cryoultramicrotomy to immunocytochemistry.
Microsc 143: 139-149
Tokuyasu KT (1989) Use of poly(vinylpyrrolidone) and poly(vinyl alcohol) for

cryoultramicrotomy. Histochem J 21: 163-17l
Taoka A (1986) Production ofbrassylic acid by fermentation. BioIndustry 3: 867-874
Triebel H, Grimmecke HD, Kretzschmer K, Bar H (1980) Molecular weight determination
on a mannan-protein-phosphate complex from the cell wall of the yeast Candida sp. H.
Stud Biophys 82: 47-54
Truchatshova TV, Ermolenko TM, Gubina LP, Radyuk VG, Shkumatov VM (1991) Analysis,
fractionation and industrial technology of hydrocarbon-assimilating Candida maltosa.
15th Int Spec Symp on Yeast, Riga, Latvia 1991, pp 180-181
Tschumper G, Carbon J (1982) Delta sequences and double symmetry in a yeast chromo-
somal replicator region. J Mol BioI 156: 239-307
Uchio R (1978) Microbial production of long-chain dicarboxylic acids from n-alkanes.
Petrol Microorg 20: 13-16
Uchio R, Shiio I (1972a) Microbial production of long-chain dicarboxylic acids from n-
alkanes Part II. Production by Candida cloacae mutant unable to assimilate dicarboxylic
acid. Agric BioI Chern 36: 426-433
Uchio R, Shiio I (1972b) Production of dicarboxylic acids by Candida cloacae mutants
unable to assimilate n-alkane. Agric BioI Chern 36: 1169-1175
Uchio R, Shiio I (1972c) Tetradecane-1,14-dicarboxylic acid production from n-hexadecane
by Candida cloacae. Agric BioI Chern 36: 1389-1397
Uchio R, Shiio I (1974) Microbial production of long-chain dicarboxylic acids from n-
alkanes. Petrol Microorg 11: 14-23
Uemura N (1985) Industrialization of the production of dibasic acids from paraffins using
microoganisms (Japanese). Hakko to Kogyo 43: 436-441
Uemura N, Taoka A, Takagi M (1988) Production of dicarboxylic acids by fermentation. In:
Applewhite TH (ed) World conference on biotechnologyoffats and oil industry. Ameri-
can Oil Chemist's Society, pp 148-152
Umemura I, Yanagiya K, Komatsubara S, Sato T, Tosa T (1990) D-alanine production by
using asymmetric degrading activity of Candida maltosa. Ann NY Acad Sci 613: 659- 662
Umemura I, Yanagiya K, Komatsubara S, Sato T, Tosa T (1991) Characteristics of alanine
aminotransferase from Candida maltosa. In: Fukui T, Kagamiyama K, Soda K, Wada H
(eds) Enzymes dependent on pyridoxal phosphate and other carbonyl compounds as
cofactors. Pergamon Press, Oxford, pp 229-231
Umemura I, Yanagiya K, Komatsubara S, Sato T, Tosa T (1992) D-alanine production from
D,L-alanine by Candida maltosa with asymmetric degrading activity. Appl Microbiol
Umemura I, Yanagiya K, Komatsubara S, Sato T, Tosa T (1994) Purification and some
properties of alanine aminotransferase from Candida maltosa. Biosci Biotech Biochem
58:283-287
Van Tuinen E, Riezman H (1987) Immunolocalization of glyceraldehyde-3-phosphate dehy-
drogenase, hexokinase, and carboxypeptidase Y in yeast cells at the ultrastructural level.
J Histochem Cytochem 35: 327-333
Van Uden N, Buckley H (1970) Genus Candida Berkhout. In: Lodder J (ed) The yeasts, a
taxonomic study. North-Holland Publ, Amsterdam, pp 893-1087
Veenhuis M, Kram AM, Kunau WH, Harder W (1990) Excessive membrane development
following exposure of the methylothrophic yeast Hansenula polymorpha to oleic acid-
containing media. Yeast 6: 511-519
Vergeres G, Yen TSB, Aggeler J, Lausier J, Waskell L (1993) A model system for studying
membrane biogenesis. Overexpression of cytochrome bs in yeast results in marked
proliferation of the intracellular membrane. J Cell Sci 106: 249-259
Vier B, Voigt B (1984) Untersuchungen zur Anreicherung von Ergosterol und Ubichinon
aus Lipid-Kohlenwasserstoff-Fraktionen. Acta Biotechnol4: 377-379
Viljoen BC, Kock JLF, Britz TJ (1988) The significance oflong-chain fatty acid composition
and other phenotypic characteristics in determining relationships among some Pichia
and Candida species. Gen Microbiol134: 1893-1900

Villalba JM, Palmgren MG, Berberian GE, Ferguson C, Serrano R (1992) Functional expres-
sion of plant plasma membrane H+-ATPase in yeast endoplasmic reticulum. J BioI Chern
267: 12341-12349
Vogel F, Kiirgel E, Schunck W-H (1991) In situ localization of cytochrome P-450, the first
enzyme involved in aliphatic hydrocarbon degradation in the yeast Candida maltosa.
Progr Histochem Cytochem 23: 383-389
Vogel F, Gengnagel C, Kiirgel E, Miiller H-G, Schunck W-H (1992) Immunocytochemical
localization of alkane-inducible cytochrome P450 and its NADPH-dependent reductase
in the yeast Candida maltosa. Eur J Cell BioI 57: 285-291
Voigt B, Seidel H, Muller H, Beck D, Ringpfeil M, Riedel M, Bauch J, Gentzsch H, Bohlmann
D (1979) Biolipidextrakt - ein neuer Rohstoff aus der Produktion von "Fermosin"-
Futterhefe auf Basis Erdoldestillat. Chern Techn 31: 409-411
Voigt B, Reutgen H, Worbs M, Sesser I (1984a) Untersuchungen zur Anreicherung von
Ubichinon-9 aus Lipid-Kohlenwasserstoff-Fraktionen mittels Sephadex LH-20. Acta
Voigt B, Miiller H, Worbs M, Winkler F, Kohler U (1984b) Untersuchungen zur
Anreicherung von Ubichinon-9 aus Lipid-Kohlenwasserstoff-Fraktionen mittels
Kurzwegdestillation. Acta Biotechnol4: 293-296
Voigt B, Miiller H, Schuster G (1985) Antiphytovirale Aktivitat von lipophilen Fraktionen
aus der Hefe Lodderomyces elongisporus IMET H 128. Acta Biotechnol5: 313-317
Volchek EA, Durasova EN, Mukhlenov AG, Mikhailova NP, Vyunov KA (1988) Sterol
composition of nystatin-resistant Candida maltosa strains (Russ). Izv AN SSSR Ser BioI
0(6): 915-921
Watanabe K (1974) Production of SCP with hydrocarbon-assimilating yeasts (Japanese). J
Ferm Assoc Japan (Hakko-Kyokai-Shi) 32: 239-248
Watanabe K, Shimada Y, Kawaharada K, Suzuki K, Tanaka F (1973a) Kanegafuchi Chemical
Industry Co, Ltd, Japan, Japan Patent 48-43877
Watanabe K, Shimada Y, Kawaharada K, Suzuki K, Tanaka F (1973b) Kanegafuchi Chemical
Industry Co, Ltd, Japan, US Patent 3725 200
Watanabe K, Shimada Y, Kawaharada K, Suzuki K, Tanaka F (1973c) Kanegafuchi Chemical
Industry Co, Ltd, Japan, British Patent 1307434
Watanabe K, Shimada Y, Kawaharada K, Suzuki K, Tanaka F (1975) Kanegafuchi Chemical
Industry Co, Ltd, Japan, German Patent 2454 048
Waters MG, Blobel G (1986) Secretory protein translocation in a yeast cell-free system can
occur posttranslationally and requires ATP hydrolysis. J Cell BioI 102: 1543
Weber H, Barth G (1988) Nonconventional yeasts: their genetics and biotechnological
applications. CRC Crit Rev Biotechnol 7: 281-337
Wedler H, Schulze S, Budahn H, Januschka A, Sasnauskas K, Bottcher F, Becher D (1990)
Gentechnische Bearbeitung von Hefearten mit biotechnologischer Bedeutung. Wiss Z
Ernst Moritz Arndt Univ Greifswald, Math Naturwiss Reihe 39: 27-30
White MJ, Hodgson LF, Rose AH, Hammond RC (1989) Long-chain alcohol production by
yeasts. Yeast Apr 5 Spec Issue S456-470
Wiame J-M, Grenson M, Arst HN (1985) Nitrogen catabolite repression in yeasts and
filamentous fungi. Adv Microb Physiol26: 1-88
Wiedmann B (1987) Untersuchungen zur Biosynthese des Cytochrom P450 aus Candida
maltosa. Akademie der Wissenschaften der DDR, Dissertation, Berlin
Wiedmann B, Wiedmann M, Kiirgel E, Schunck W-H, Miiller H-G (1986) n-Alkanes induce
the synthesis of cytochrome P-450 mRNA in Candida maltosa. Biochem Biophys Res
Commun 36: 1148-1154
Wiedmann B, Wiedmann M, Schunck W-H, Mauersberger S, Kargel E, Miiller H-G (1987)
Regulation of cytochrome P-450 biosynthesis in alkane assimilating yeasts. In: Zelinka J,
Balan J (eds) Proc 6th Int Symp Metabol Enzymol Nucleic Acids Includ Gene Manipul,
Bratislava 1987, pp 383-393
580 S. Mauersberger et al.: Candida maltosa
Wiedman B, Wiedmann M, Mauersberger S, Schunck W-H, Miiller H-G (1988a) Oxygen

limitation induced indirectly the synthesis of cytochrome P-450 mRNA in alkane-grow-
ing Candida maltosa. Biochem Biophys Res Commun 150: 859- 865
Wiedmann M, Wiedmann B, Voigt S, Wachter E, Miiller HG, Rapoport TA (1988b) Post-
translational transport of proteins into microsomal membranes of Candida maltosa.
EMBO J 7: 1763-1768
Wiedmann B, Silver P, Schunck W-H, Wiedmann M (1993) Overexpression of the ER-
membrane protein P-450 CYP52A3 mimics sec mutant characteristics in Saccharomyces
cerevisiae. Biochim Biophys Acta 1153: 267-276
Wright R (1993) Insights from inducible membranes. Curr BioI 3: 870-873
Wright R, Basson M, D'Ari L, Rine J (1988) Increased amounts of HMG-CoA reductase
induce "Karmellae": A proliferation of stacked membrane pairs surrounding the
nucleus. J Cell BioI 107: 101-114
Wright R, Keller G, Gould SJ, Subramani S, Rine J (1990) Cell-type control of membrane
biogenesis induced by HMG-CoA reductase. New BioI 2: 915-921
Wiinsche L, Sattler K, Gradova NB, Meinhold I, Hedlich R, Brendler W, Uhlig H, Rodionova
GS, Saikina AI (1981) Composition of the microorganism population in an unprotected
fermentation process (Germ). Z Allg Mikrobiol21: 469-474
Yano K, Kanamuri M, Takagi M (1981) Enrichment of n-alkane assimilation-deficient
mutants of Candida yeasts by synergistic effect of nystatin and pyrrolnitrin. Agric BioI
Chern 45: 1017-1018
Yekhvalova TV, Sharyshev AA, Mikhailova NP, Vyunov KA (1989) Cytochrome P450 con-
tent in yeast Saccharomyces cerevisiae with alterations of different stages of sterol syn-
thesis (Russ). Biokhimiya 54: 1344-1347
Yokogawa T, Suzuki T, Ueda T, Mori M, Ohama T, Kuchino Y, Yoshinari S, Motoki I,
Nishikawa K, Osawa S, Watanabe K (1992) Serine tRNA complementary to the
nonuniversal serine codon CUG in Candida cylindracea: evolutionary implications. Proc
Natl Acad Sci USA 89: 7408-7411
Yoshida M, Hashimoto K (1986a) Assessment of the pathogenicity of yeast used in the
production of single cell protein. Agric BioI Chern 50: 2117-2118
Yoshida M, Hashimoto K (1986b) Potential pathogenicity of Candida maltosa lAM 12248.
Agric BioI Chern 50: 2119-2120
Yoshioka K, Fujita A, Kondo S, Miyake T, Sakaki Y, Shiba T (1992) Production of a unique
multi-lamella structure in the nuclei of yeast expressing Drosophila copia gag precursor.
FEBS Lett 302: 5-7
Zentgraf B (1991a) Microcalorimetric studies of aerobic growth of Candida maltosa I.
Chemostat cultures. Thermochim Acta 187: 1-8
Zentgraf B (1991b) Microcalorimetric studies of aerobic growth of Candida maltosa II.
Batch cultures. Thermochim Acta 187: 9-14
Zentgraf B (1991c) Bench-scale calorimetry in biotechnology. Thermochim Acta 193: 243-
252
ZentgrafB (1993) Calorimetric studies for optimization of high-performance reactors. Pure
Appl Chern 65: 1915-1920
Zimmer T, Schunck W-H (1995) A deviation from the universal genetic code in Candida
maltosa and consequenses for heterologous expression of cytochromes P450 52A4 and
52A5 in Saccharomyces cerevisiae. Yeast 11: 33-41
Zimmer T, Kaminski K, Scheller U, Vogel F, Schunck W-H (1995) In vivo reconstitution of
highly active Candida maltosa cytochrome P450 monooxygenase systems in inducible
membranes of Saccharomyces cerevisiae. DNA Cell BioI 14: 619-628
Zinchenko GA, Belov AP (1990) Topography of enzymes of acylglycerol biosynthesis in
yeast membranes (Russ). Izv Timiryazev Skh Akad 0(1) 1990: 123-129
Zinchenko GA, Belov AP, Balashova LD, Davidova EG (1990) Specific features of the lipid
metabolism in Candida yeasts during assimilation of n-alkenes (Russ). Appl Biochem
Microbiol (Moscow) 26: 237-241 (English Translation)
CHAPTER 13
Trichosporon
Jakob Reiser, Urs A. Ochsner, Markus Kalin, Virpi Glumoff, and Armin Fiechter
1
History of Trichosporon Research
The yeast Trichosporon cutaneum belongs to the genus Trichosporon Behrend,

which was described as early as 1890 (Behrend 1890). This genus includes yeasts
which are characterized by budding cells of various shapes, a more or less devel-
oped pseudomycelium, or a true mycelium and arthrospores (Fig. 1). Trichosporon
yeasts may form asexual endospores, but sexual reproduction has not been dem-
onstrated so far (Do Carmo-Sousa 1970). Biochemical characteristics such as hy-
drolysis of urea, utilization of mono-, di-, tri-, or polysaccharides, etc., as well as
studies concerning DNA base composition and DNA relatedness, led Gueho et al.
(1984) to propose that Trichosporon yeasts should be classified into two separate
groups. The first group, which appears to be related to the Ascomycetes, includes
13 species with a G+C content lower than 50% (34.7-48.8%) and lacks urease, with
T. margaritiferum being an exception. The second group appears to be related to
the Basidiomycetes and contains 15 species with a G+C content higher than 50%
(57-64%) including T. cutaneum, T. beigelii, and T. pullulans, and has the ability
to hydrolyze urea. The basidiomycetous nature of some of the Trichosporon yeasts
is demonstrated by the lamellar structure of the cell walls (Kreger-Van Rij and
Veenhuis 1971) and the presence of xylose (Weijman 1979). Furthermore, the
diazonium blue B test (van der Walt and Hopsu-Havu 1976) has been applied to a
number of T. beigelii strains (Kemker et al. 1991). The positive test results are in
agreement with the described basidiomycetous affinity of these strains. The phylo-
genetic relationships of various basidiomycetous yeasts as deduced from riboso-
mal RNA sequences have been described (Gueho et al. 1989; van de Peer et al.
1992). From these studies it appears that T. beigelii and T. cutaneum are related to
the family Filobasidiaceae. Hara et al. (1989) have grouped 44 different strains of T.
beigelii and related organisms based on differences in the ubiquinones and assimi-
lation of melibiose and raffinose. These initial findings suggested that T. beigelii is
a heterogeneous group of yeasts consisting of at least four different types of
organisms.
Institut fUr Biotechnologie, ETH-H6nggerberg, 8093 Zurich, Switzerland

582 J. Reiser et al.
A B
Fig. lA-F. Cell morphologies of different Trichosporon strains. Nuclei were detected by
fluorescent microscopy after staining the cells with mithramycin. A T. cutaneum DSM
70698. B T. cutaneum ATCC 58094. C and D T. cutaneum ATCC 46490. E T. beigelii CBS
5790. F T. pullulans ATCC 10677
T. cutaneum has been isolated from a number of sources including soil, indus-
trial waste water, wood pulp, sludge, and clinical specimens. T. beigelii has been
found to be the causative agent of white piedra, which is a relatively inconsequen-
tial infection of the hair. However, this organism does not appear to be part of the
skin flora in healthy subjects (see, e.g., McBride et al. 1988). Certain strains have
also been found as opportunistic pathogens causing deep-seated and disseminated
infections in immunocompromised patients (reviewed in Hoy et al. 1986). Kemker
et al. (1991) have analyzed 15 clinical and environmental strains of T. beigelii for
similarities by using morphological features, biochemical profiles based on carbon
compound assimilation and uric acid utilization, isoenzyme electrophoresis, and
restriction fragment length polymorphisms in rRNA genes. The findings suggested
that strains that cause invasive disease are distinct from the superficial and
non clinical isolates and that isolates from the skin and mucosae represent a num-
13. Trichosporon 583
ber of different organisms, including some environmental forms. The study also
revealed that T. beigelii is a complex of genetically distinct organisms and that
more than one type is found in clinical samples. Only recently, the genus
Trichosporon was revised once more based on a number of characteristics such as
morphology, ultrastructure of septal pores, coenzyme Q system, G+C content of
DNA, DNA/DNA reassociation, and 26S ribosomal RNA partial sequences (Gueho
et al. 1992a,b; Fig. 2). This work separates the Trichosporon isolates from soil into
three species: T. pullulans, a psychrophilic species which is clearly different from
all other Trichosporon species, T. dulcitum, a mesophilic species, and T.
moniliiforme. T. cutaneum seems to be a rare species never isolated from soil
(Gueho et al. 1992b). A preliminary inspection of the T. cutaneum ATCC 46490 and
DSM 70698 strains using culture studies and biochemical characteristics, classifies
them into the T. moniliiforme group (Gueho et al. 1992b; E. Gueho, pers. comm.).
Recently, a thermotolerant T. adeninovorans strain was described
(Middelhoven et al. 1984; Gienowet al. 1990). This yeast is able to grow at 45°C and
T. moniliitorrne
~
I
T. mucoides
T. cutaneum
I
: T. jirovecii
S T. ovoides
; L T.inkin
I
I
I
T. dulcitum
I
I ' - - - - T. gracile
r-- J
I I T. laibachii
I I
I I T. multisporum
I I
I I L -_ _ T. loubieri
I I I
I I I
' - - - - - T. sporotrichoides
I -~
: ~ T. montevideense
~ T. brassicae
T. taecale
T. coremiitorme
T. asteroides
T. filamenta
' - - - - - T. aquatile
T. pullulans
Fig. 2. Classification of Trichosporon yeasts based on 26S ribosomal RNA sequences. (After
Gueho et al. 1992b)
its cell wall structure was found to be ascomycete-like. T. adeninovorans is able to

use a variety of carbon sources including mono- and disaccharides, starch and n-
alkanes. This group of organisms has recently been reclassified and now belongs to
the genus Arxula (Middelhoven et al. 1991).
Like T. cutaneum, T. pullulans has a wide substrate spectrum. The maximum
temperature of growth for T. pullulans is around 23-27 °C (Do Carmo-Sousa 1970)
but growth of T. pullulans was observed even at 5°C (Berg et al. 1987).
2
Available Strains and Mutant Collections
A number of different Trichosporon strains have been used in diverse applications

(Table 1). These strains are all available from the DSM, ATCC, or CBS collections,
respectively. Ochsner et al. (1991) have prepared a collection ofUV-induced aux-
otrophic mutants based on the T. cutaneum DSM 70698 strain as presented in
Table 2. Auxotrophic mutants were also induced in other T. cutaneum strains by
using nitrosoguanidine mutagenesis (Ykema et al. 1989; Sienko et al. 1992).
3
Media for Different Purposes
For maintenance and cultivation of T. cutaneum, a number of different media are

being used. Yeast extract peptone dextrose medium (YEPD: 1% Bacto-yeast ex-
tract, 2% Bacto-peptone, 2% glucose); synthetic minimal medium (0.67% Bacto-
yeast nitrogen base without amino acids (Difco), 2% glucose); minimal medium D
Table 1. Trichosporon strains and their applications
Strain Collection Use Reference

number
T. cutaneum DSM 70698 Bioreactor studies Kappeli and Fiechter (1981)

Molecular genetics
T. cutaneum ATCC 46490 Phenol degradation Neujahr and Varga (1970)
Phenol biosensor
T. cutaneum ATCC 58094 Degradation of Sze and Dagley (1984)
aromatic compounds
T. cutaneum ATCC 20509- Lipid production West et al. (1990)
from whey
T. cutaneum ATCC 62975 Peroxisome Veenhuis et al. (1986)
biogenesis
T. beigelii CBS 5790 Production Zimmermann and Emeis
of polysaccharidases (1989)
T. pullulans ATCC 10677 Production of De Mot and Verachtert (1986)
amylases, cellulase, Stevens and Payne (1977)
and xylanase
-Originally designated Apiotrichum curvatum.

Table 2. Auxotrophic mutants of T. cutanuem DSM 70698. (After Ochsner et al. 1991)
Mutant Auxotrophic Mutant Remarks

number requirement stability"
8.1 Adenine 20 Brown colonies

13 Adenine Leaky White colonies
31 Adenine 13 Brown colonies
38 Adenine 2 Brown colonies
41b Adenine <1 Brown colonies
13.1 Arginine 18
30.1 Arginine Leaky
30.2 Arginine 10
33.1 Arginine <10
33.2 Arginine <10
70 Arginine 12
71 Arginine 70
72 Arginine <10
21.2 Histidine <1 Sweet smell
21.5 Histidine <1 Sweet smell
17 Histidine >100
18 Histidine 1.5
37 Histidine 15
29 (Iso )leucinec 70
61 Isoleucine 8
1.1 Leucine 15
25.4 Leucine Leaky
15 Leucine. 20
16 Leucine Leaky
59 Leucine 45
6 Lysine <10
24 Lysine <1
32 Lysine 12
49 Lysine 5
8 Methionine 2400
22 Methionine 10
1.2 Tryptophan 20
30.4 Tryptophan Leaky
43.1 Tryptophan Leaky
57 Tryptophan 4
62 Tryptophan 2
4 Uracil 200
7 Uracil <1 Resistant to 5-fluoro orotate (5-FOA)
16.2 Uracil <1 Resistant to 5-FOA
35.1 Uracil Leaky
46 Uracil 6 Resistant to 5-FOA
aThe genetic stability of the mutants was determined by plating 108 mutant cells on minimal
medium and counting the number of revertants after 5 days of incubation at 30°C.
bThis mutant was derived from strain ATCC 46490.
cThis mutant was growing on minimal medium supplemented with either leucine or
isoleucine.
(Table 3), and buffered minimal medium D (Table 4). Solid medium is made by
adding 2% Bacto-agar (Difco). In supplemented minimal media, the appropriate
amino acids are added at a final concentration of 5 to 50 mg rnl- 1•
Table 3. Minimal medium D, gl-l. (Hug et al. 1974)
Glucose 10
(NH4)2S04 2.0
(NH4)2HP04 0.64
KCI 0.29
MgS0 4·7H20 0.15
CaCI2 ·2H20 0.09
FeCI3 ·6H20 4.8
MnS0 4·H20 3.5
ZnS0 4·7H2 0 3.0
CuS0 4·5H20 0.78
Biotin 0.Ql
m-Inositol 20.0
Ca-Pantothenat 10.0
Thiamine (Vitamin B1) 2.0
Pyridoxine (Vitamin Bo) 0.5
The medium components are dissolved in tap water and the

pH of the medium adjusted to around 5 to 5.5 using 2 M HCI
before sterilization. Salts, trace elements, vitamins, and glu-
cose are sterilized separately.
Table 4. Buffered minimal medium D. (Hug et al. 1974; Varga

and Neujahr 1970)
Glucose 20 gl-l
or phenol 0.5
NH4N0 3 4.0
KH 2P04 1.5
NaHP04 1.5
MgS0 4·7H20 200mgl-1
CaCI2 ·2H20 10
FeS04·7Hp 50.0
MnS04·H20 2.0
ZnS0 4·7H2 0 3.5
CuS0 4·5H20 0.78
Biotin 0.Ql
m-Inositol 20.0
Ca-Pantothenate 10.0
Thiamine (Vitamin B1) 2.0
Pyridoxine (Vitamin Bo) 0.5
The medium components are dissolved in tap water and the

pH of the medium adjusted to 6.7 before sterilization. Salts,
trace elements, vitamins, and glucose are sterilized separately.
Phenol is added as a unsterilized 6% solution and glucose as a
50% solution after sterilization.
4
Stock cultures of the strains are maintained at -70°C in YEPD medium containing
15% glycerol. Alternatively, they are lyophilized and kept at ambient temperature.
Working cultures can be stored on YEPD plates or liquid medium at 4°C. On
plates, the colonies stay viable for 4 to 6 weeks, whereas in liquid medium the cells
can be kept viable for at least 8 weeks.
5
Genetic Techniques
5.1
Mutant Induction
5.1.1
UV Mutagenesis
To obtain auxotrophic mutants of the T. cutaneum DSM 70698 strain, a UV

mutagenesis protocol was used. The ATCC 46490 and ATCC 58094 strains turned
out to be different in their UV sensitivity (Fig. 3) and the mutant yield was lower
as far as the ATCC 46490 strain is concerned.
1. Grow overnight culture in YEPD medium. Remove a O.l-ml aliquot and centri-
fuge briefly to pellet the cells. Resuspend cells in 1 ml of sterile water.
100~~~~------------------------~
~ 10
!!
iii
u
CI
c
~
c:
:::J
I/)
-0- DSM70698
-.- ATCC46490
~ ATCC5B094
.1
0 20 40 60 80 100 120 140
UV treatment (8)
Fig.3. UV sensitivity of the T. cutaneum DSM 70698, ATCC 46490, and ATCC 58094 strains.
The curves show the survival of the cells as a function of the length of time of irradiation
2. Separate cell aggregates by an ultrasonic treatment (3 s) and determine the cell

density by using a hemacytomoter.
3. Dilute cells into 5 ml sterile water in a sterile glass petri dish to give a final
concentration of 105 cells ml-1•
4. Rotate open petri dish with cell suspension at about 50 rpm min- 1 using a labo-
ratory shaker to mix the cells.
S. Turn on UV lamp (Philips-TUV lamp, 15 W) which is located 40 cm above the
surface of the liquid. Keep dish rotating and remove O.l-ml aliquots of the cell
suspension every 20 to 30 s for 3 min. Dilute cell aliquots into 1.9 ml of sterile
water and plate O.l-ml samples onto YEPD agar plates. Incubate plates for lor
2 days at 30 DC, and count colonies.
For the isolation of mutants scale up the above procedure, choosing the conditions
under which the percentage of survivors is between 10 to 20%. Auxotrophic mu-
tants are identified by replica plating colonies from YEPD agar plate onto minimal
medium D agar plates. AbQut 100 to 200 colonies per petri dish can be
conveniently screened in this way.
5.1.2
Nitrosoguanidine Mutagenesis
This procedure was initially applied for the isolation of fatty acid auxotrophic
.mutants of the oleaginous yeast Apiotrichum curvatum (Ykema et al. 1989). This
strain has recently been reclassified as T. cutaneum ATCC 20509 (West et al. 1990).
Thus, the same method is likely to be applicable to other Trichosporon strains as
well.
1. Harvest cells from an overnight culture (exponential phase) in YEPD medium
and resuspended pellet in 0.1 M phosphate buffer (pH 7.0) to give a final OD 600
of 10.
2. Add N-methyl-N'-nitro-N'-nitrosoguanidine (MNNG) from a 20mgml-1 stock
solution in acetone to give a final concentration of 0.5 to 1 mg ml-l.
3. Incubate cells at 30 DC with shaking in the dark for various lengths of time.
4. Harvest cells and wash four times with 0.1 M phosphate buffer, pH 7.0.
Resuspend cells in the same original volume of phosphate buffer.
S. Determine the percentage of survivors by plating small aliquots onto an appro-
priate medium (e.g., YEPD agar). The treated cells are viable at 4 DC for 1 to 2
days.
5.2
Preparation of Protoplasts and Protoplast Fusion
1. Grow mutant strains to be fused in 10 ml ofYEPD medium to a density of 5 x 107

cells ml-l.
2. Harvest cells and wash twice with sterile water and resuspend pellets in 2 ml of
protoplasting solution containing 1% protoplast forming enzyme (Boehringer
Mannheim, Germany), 2% Novozym 234 (Novo Industri A/S, Bagsvaerd,
Denmark), and 0.6 M KCl.
3. Check kinetics of protoplast formation in a microscope and harvest protoplasts
by centrifugation (3000 rpm, 5 min) as soon as 90% of the cells are protoplasted.
Wash protoplasts twice with 2 ml of 0.6 M KCI and resuspend in 0.1 ml of 0.35 M
CaCI2•
4. Mix 25-pl aliquots of the protoplasts of the two strains to be fused, centrifuge as
above, and resuspend in the liquid remaining in the tube. Add 1 ml of fusion
solution (35% PEG 4000, 50 mM CaCI2) and incubate mixture for 10 min at room
temperature.
S. Mix 0.2-ml aliquots of the PEG/protoplast suspension with 7 ml of protoplast
regeneration agar (minimal medium D containing 0.35 M CaCl2 and 2% Bacto
agar) at 48 DC and pour onto prewarmed protoplast regeneration agar plates.
Incubate plates for 4 to 5 days at 30 DC.
The frequency of protoplast regeneration is measured by plating aliquots of the
protoplast suspension onto protoplast regeneration agar plates supplemented with
the appropriate amino acids.
6
Biochemical Techniques
6.1
Preparing Trichosporon Chromosomal DNA
6.1.1
Large-Scale Procedure 1
This is modification of a procedure which had initially been designed for the
isolation of DNA from white-rot fungi (Raeder and Broda 1988).
1. Grow cells in YEPD or minimal medium D with shaking at 30 DC.
2. Harvest cells by centrifugation and freeze cell pellet at -20 DC.
3. Grind 10 g of the frozen cell pellet in liquid nitrogen using a mortar. Continue
until the cell pellet is finely powdered.
4. Transfer ground material to a 50-ml centrifuge tube with a cap and resuspend
in 20ml of extraction buffer (200mM Tris-HCI, pH 8.5, 250mM NaCI, 25mM
EDTA, 0.5% SDS). Add 50pl of RNase A (20mgml- l ) and incubate at 37 DC for
45 min.
5. Add an equal volume of a 1: 1 mixture of salt-saturated phenol and chloro-
form. Close tube and seal well and mix gently overnight at room temperature
using a rotating device.
6. Centrifuge tube at 10 000 rpm for 45 min (4°C).

7. Transfer aqueous phase to a new tube and extract with an equal volume of
chloroform. Centrifuge tube at 10 000 rpm for 30 min (4 DC).
8. Transfer aqueous phase to a 30-ml Corex tube. Add 0.54 vol isopropanol. Mix
and store tube for 60 min at -20°e.
9. Spin DNA at 10 000 rpm for 30 min at 4°C.
10. Redissolve pellet in 1-2ml TNE (10mM Tris-HCI, pH. 8.0, 0.15 NaCl, 1mM
EDTA), and extract with an equal volume of chloroform. Spin, transfer aque-
ous phase, and add 2.5 vol ethanol.
11. Spool DNA using the tip of a Pasteur pipette and let dissolve in 1 to 2ml TE
buffer (10mM Tris-HCI, pH. 8.0, 1mM EDTA) overnight.
12. Read the OD z6O"
This DNA may contain residual amounts of RNA. It can be used for restriction
digestion and Southern blotting (see Fig. 4).
6.1.2
Large-Scale Procedure 2
This method is a modification of the one described by Rodriguez and Tait (1983)
for the isolation of high molecular weight DNA from Saccharomyces cerevisiae.
1. Grow cells overnight in YEPD medium.
2. Harvest cells at 3000rpm for 5min and resuspend in sterile water. Spin as
before.
3. Add 1 ml spheroplast buffer (SB buffer: 0.2M Tris-HCI, pH 7.5, 1 M sorbitol,
0.1 M EDTA, 0.1 M ,B-mercaptoethanol) per g cell pellet, and resuspend cells.
4. Add 1 ml filter-sterilized Novozym 234 (12 mgml- l in spheroplast buffer) per g
of cells. Mix well and incubate for 60 min at 30°e. Shake tube gently at 60 to
100 rpm.
5. Centrifuge spheroplasts at 3000 rpm for 5 min at 4°C and resuspend in 2 ml of
SB buffer.
6. Add an equal volume of TEN buffer (10mM Tris-HCI, pH 7.5, 1 mM EDTA,
10 mM NaCl) and SDS to a final concentration of 1%.
7. Add 0.5ml RNase (10mgml-1 RNase A in O.lM Na acetate, pH 4.8, O.3mM
EDTA), mix gently and incubate for 2h at 37°e.
8. Add 1 ml pronase (2mgml-1 in TEN buffer) and incubate for another 2h at
37°C. Swirl mixture periodically.
9. Heat mixture at 65 °C for 30 min and cool to room temperature.
1 234 5 678 1 234 5 678
A 8
Fig. 4A,B. Southern blot analysis of Trichosporon DNAs. A Ethidium bromide-stained

agarose gel. B Southern blot analysis using the Neurospora crassa f3-tubulin gene (Orbach et
al. 1986) as a probe. The DNAs from T. cutaneum ATCC 62975 (lane 1), ATCC 20509 (lane
2), DSM 70698 (lane 3), ATCC 58094 (lane 6), and ATCC 46490 (lane 7), and from T.
pullulans ATCC 10677 (lane 4), T. beigelii CBS 5790 (lane 5), and Cryptococcus elinovii (lane
8) were cut with Pvull. The fragments were separated in a 0.8% agarose gel, transferred to
a Gene Screen Plus membrane (Du Pont), which was then hybridized with a 32P-Iabeled, 3.1-
kb long HindIII fragment containing the f3-tubulin gene. Hybridization was performed in
50% formamide in the presence of 10% dextran sulfate at 42°C overnight. The filters were
washed in 2x SSC/0.1% SDS twice for 15min at room temperature and then in O.lx SSCI
0.1 % SDS for 30 min at 42°C
10. Add an equal volume of phenol-chloroform-isoamyl alcohol (25: 24: 1, vlvlv)

and mix gently. Centrifuge for 5min at 3000 rpm (4°C).
11. Transfer aqueous phase to a fresh tube using a wide-bore pipette.
12. Add an equal volume of chloroform-isoamyl alcohol (24: 1, vlv), mix gently
and centrifuge as in step 10.
13. Add 1/25 vol5M NaCI and 2 vol ethanol. Store for I5min on ice.
14. Centrifuge for I5min at 10 000 rpm (4 0e). Dry pellet and redissolve in lOrnl of
TEN buffer.
15. Add O.lml RNase A (lOmgml-1 RNase A in O.IM Na-acetate, pH 4.8, O.3mM
EDTA), mix gently and incubate for 1 h at 37°C.
16. Repeat steps 10 to l3 and centrifuge for 30min at 10 000 rpm (4°C). Wash
pellet with 80% ethanol and dry.
17. Dissolve pellet in 1 to 3ml ofTEN buffer.
18. Measure OD 26o '
This DNA can be used for restriction digestion and Southern blotting and for the
construction of genomic libraries (see Ochsner et al. 1991). RNase A and pronase
should be pretreated as described by Maniatis et al. (1982).
6.1.3
Small-Scale Procedure
This procedure was originally designed for the isolation of DNA from S. cerevisiae
(Hoffman and Winston 1987).
1. Grow a 10-ml culture in minimal medium D to stationary phase (1 to 2 days).
2. Collect cells by centrifugation at 4000 rpm for 5 min using a table top centrifuge
and resuspend cell pellet in 0.5 ml of water.
3. Transfer cell suspension to an Eppendorf tube and spin for 5 s at l3 000 rpm.
Decant supernatant and resuspend cells in the residual liquid by brief
vortexing.
4. Add 0.2ml of a buffer containing 2% Triton X-lOO, 1% SDS, 100mM NaCI,
10mM Tris-HCI, pH 8.0, ImM EDTA. Add 0.2ml phenol/chloroform/isoamyl
alcohol (25: 24: 1, v/v/v) and 0.3 g of acid-washed glass beads (0.45-0.5 mm
diameter).
5. Vortex for 3 to 4min at full speed. Add 0.2ml TE buffer (10mM Tris-HCI, pH
8.0, 1 mM EDTA).
6. Spin for 5 min at l3 000 rpm. Transfer aqueous layer to a new tube. Add 1 ml of
ethanol. Invert the tube to mix.
7. Spin for 2 min at l3000rpm. Resuspend pellet in O.4ml TE buffer containing
50 pg RNase A. Incubate for 5 min at 37°C. Add 10 pIS M potassium acetate and
1 ml of ethanol. Invert the tube to mix.
8. Spin for 2 min at l3000rpm. Dry DNA pellet under reduced pressure. Resus-
pend DNA in 50 J.1l of TE-buffer.
This DNA can be used for restriction digestion and Southern blotting.
6.2
Preparing Trichosporon Total RNA
This method was initially set up for the isolation of RNA from fungal mycelia
(Teeri et al. 1987).
1. Grow cells in desired medium and collect by centrifugation at 5000 rpm

for 5 min at 4°C. Wash once in 4 ml of water and transfer to a plastic capped
tube.
2. Spin down at 5000 rpm for 10 min at room temperature and thoroughly drain
the pellet. Freeze tube in liquid nitrogen.
3. Grind frozen cell pellet to a fine powder using a mortar under liquid nitrogen.
4. Transfer frozen cell powder to a beaker containing 1 ml of a guanidine thiocy-
anate solution (4M guanidine thiocyanate (Fluka), 0.5% sodium N-
lauroylsarcosine (Fluka), 0.1 M ,B--mercaptoethanol, 25 mM Na-citrate, pH 7.0)
per g of wet cells. Briefly warm beaker at 37°C to thaw the cells and remove cell
debris by centrifugation at 6000 rpm for 10 min at 4°C.
5. To the supernatant add solid CsCI (1 g per 2.5 ml of supernatant) and mix to
dissolve the CsCl.
6. To a Beckman SW41 polyallomer ultracentrifuge tube add 1.2ml of a solution
containing 5.7 M CsCI and 0.1 M EDTA, pH 7.0. Carefully layer supernatant on
top and centrifuge tube using a Beckman SW41 ultracentrifuge rotor at
33 000 rpm for 20-24h at 15°C.
7. Remove liquid phase above the tightly packed interphase on top of the
CsCI cushion using a Pasteur pipette. Carefully remove interphase and esCI
cushion and cut off the bottom of the tube using a scalpel. The RNA pellet
should now be visible as a gelatinous, transparent layer at the bottom of the
tube.
8. Rinse RNA pellet briefly with 50 J1l of RNase-free water. Homogenize pellet in 50
to 500 J1l of RNase-free water and transfer to a sterile Eppendorf microfuge tube,
making sure that no RNA remains attached to the bottom of the ultracentrifuge
tube.
9. Dissolve the RNA by mixing the contents of the tube every now and then on ice
for at least 4 h. Spin tube at 13 000 rpm for 5 min at 4 dc. Transfer supernatant to
a fresh tube and determine concentration by measuring the OD26O"
This RNA can be used for Northern blots and nuclease protection assays. For
the subsequent isolation of poly(A)+ RNA the protocol of Maniatis et al. (1982)
was followed. The procedure as described above failed when the isolation of
RNA from cells grown on xylan was attempted. To circumvent this problem
the cells were powdered as described in step 3 above and the RNA processed by
using a Pharmacia QuickPrep Micro mRNA Purification kit (1 ml of extraction
buffer per 2.5 g of powdered cells). This yielded poly(A)+ RNA which was useful for
the synthesis of cDNA. The cell pellet as described in step 2 above can either be
kept in this form at -70°C or processed immediately. Pretreat CsCI solution, water,
pipette tips and tubes with diethyl pyrocarbonate and autoclave (Maniatis et al.
1982). The polyallomer ultracentrifuge tubes are soaked for at least 30 min in 0.5%
diethyl pyrocarbonate in ethanol and then rinsed thoroughly with autoclaved
water.
6.3
Preparing Trichosporon Protein Extracts
6.3.1
Large-Scale Extracts
This procedure is used when it is necessary to make an extract from 100g of cell
paste or more.
1. Thaw frozen cell pellet in buffer P containing 50 mM potassium phosphate,
pH 7.6, ImM ,B-mercaptoethanol, O.lmM EDTA, and ImM phenyl-
methanesulfonyl fluoride (PMSF) to create a thick slurry.
2. Disrupt cells mechanically in a Dyno Mill (Bachofen AG, Basel, Switzerland)
using glass beads (Oo4Smm diameter).
3. Remove cell debris by centrifugation (25000 g, 30 min, 4°C).
Extracts of T. cutaneum cells have also been produced by sonication (see Sejlitz
and Neujahr 1987).
6.3.2
Small-Scale Extracts
This method was first described by Lehmann et al. (1989) and Kemker et al. (1991).
1. Harvest 3 ml of a fresh culture by centrifuging and wash pellet once with ice-
cold SOmM Tris-HCI, pH 8.0.
2. Break cells by vortexing with 0.3 g of acid washed glass beads (diameter 004-
O.Smm) in the presence of200,ul of yeast lysis buffer (SOmM Tris-HCI, pH 8.0,
0.1% Triton X-IOO, 0.5% SDS).
3. Centrifuge extract at 13 000 rpm for 2 min at room temperature.
For SDS PAGE analysis mix 30,ul of the supernatant with an equal volume of 2x
concentrated SDS PAGE sample buffer (Laemmli 1970) and heat for Smin at
100°C. For the isolation of enzymatically active proteins, the same procedure is
used, with the exception that the yeast lysis buffer is replaced with 100mM Tris-
HCI, pH 8.0. A protocol for measuring enzymatic activity in situ has been pre-
sented by M6rtberg and Neujahr (1985).
7
Molecular Techniques
7.1
Transformation Systems Based on Dominant Markers
I. One hundred ml of YEPD medium are inoculated with 5 ml of an overnight

culture of T. cutaneum and the culture is grown at 30°C (ISOrpm) until the
OD600 is between 1.1 and 1.3, corresponding to approximately 2 x 107 cells

ml- l •
2. The cells are centrifuged for 5 min at 3000 rpm and the pellet washed twice
with 5ml of buffer I (0.65M sorbitol, O.lmM EDTA, 0.1 mM DTT, 10mM Tris-
HCl, pH 7.5).
3. One ml of buffer II (2.0M sorbitol, O.lmM EDTA, O.lmM DTT, 10mM Tris-
HCl, pH 7.5) is added per g of cells and the cells are resuspended.
4. To the cells, an equal volume of a sterilized solution of Novozym 234
(l2mgml-1 in buffer II) is added and the cell suspension incubated at 30°C
without shaking. Spheroplast formation is tested by diluting a 50-,ul cell ali-
quot into 1 ml of buffer II and by measuring the 0 D600; 100,ul of 10% SDS are
then added and the OD600 is determined again. After 15 to 20 min the ratio of
the OD600 values of the SDS-treated sample and the untreated sample is usually
less than 10%.
5. The suspension is centrifuged for 3 min at 3000 rpm and washed gently with
5ml of buffer III (l.5M sorbitol, 0.1 mM EDTA, O.lmM DTT, 10mM Tris-HCl,
pH 7.5) twice.
6. The washed spheroplasts are suspended in 10ml SY (1.0M sorbitol, 67%
YEPD) and incubated for Ih at 30°C without shaking.
7. The spheroplasts are pelleted as decribed above and finally resuspended in
Iml of SYTC (0.9M sorbitol, 67% YEPD, 10mM Tris-HCl, pH 7.5, 10mM
CaC12)·
8. For transformation, 1 to 10 f.1g plasmid DNA (previously purified using a
Quiagen column) are added to 0.1 ml of the spheroplast suspension in SYTC in
a Falcon 2059 tube.
9. After a IS-min incubation at room temperature, 1 ml of a PEG solution (20%
PEG 4000 (Merck), 10mM Tris-HCI, pH 7.5, 10mM CaC12 ) are added and the
suspension is mixed gently and incubated at 30°C for 20-30min without
shaking.
10. Five ml of top agar (YEPD, 0.9 M sorbitol, 2% agar) kept at 48-50 °C containing
the desired antibiotic is added to 0.2-1.1 ml of the transformation suspension
and the mixture is poured onto a regeneration agar plate (YEPD, 0.9 M sorbi-
tol, 2% agar) containing the appropriate antibiotic (100 f.1g ml-1 of hygromycin
B, Boehringer-Mannheim, Germany, or 10 f.1g ml-1 of pbleomycin, Cayla,
Toulouse, France).
All steps are carried out at room temperature unless noted otherwise. The
transformants are counted after 3 to 6 days of incubation at 30°C. For determining
the regeneration frequencies, spheroplasts are treated as decribed above, except
that no DNA is added, and then diluted with a buffer containing 0.9 M sorbitol and
10mM Tris-HCl, pH 7.5, and plated with or without the addition of top agar onto
regeneration agar plates. The Novozym 234 solution is sterilized by passing it

through a 0.45-.u filter. The purity of the plasmid DNA is critical for high efficiency
transformation, although less purified DNA preparations can also been used (see
Ochsner et al. 1991).
The Aspergillus nidulans plasmid, pAN7-1 (Punt et al. 1987), which carries the
Escherichia coli hygromycin B phosphotransferase (hph) gene (Gritz and Davies
1983) was used successfully for transforming the T. cutaneum DSM 70698, ATCC
46490 and ATCC 58094 strains, whereas the A. nidulans plasmid pAN8-1 (Mattern
and Punt 1988), carrying the Streptoalloteichus hindustanus phleomycin resistance
(ble) gene (Drocourt et al. 1990) was useful in the T. cutaneum DSM 70698 and the
ATCC 58094 strains.
7.2
Transformation Systems Based on Cloned Biosynthetic Genes
In the transformation experiments dealing with auxotrophic mutants, the trans-

formed spheroplasts are collected by centrifugation (4000 rpm, 3 min, room tem-
perature) after the PEG treatment and resuspended in 2 ml of 0.9 M sorbitol, 10 mM
Tris-HCl, pH 7.5, mixed with 2ml of 2% alginate (Sigma, low viscosity) in 0.9M
sorbitol, lOmM Tris-HCl, pH 7.5, and poured onto SRA plates (minimal medium
D, 0.9M sorbitol, 20mM CaCl2, 2% Bacto agar) and incubated at 30°C. Note that
the alginate procedure cannot be used in conjunction with hygromycin B or
phleomycin selection.
7.3
Genes from Trichosporon cutaneum
With a view toward designing transformation and expression vectors for

Trichosporon yeasts, a number of genes have been isolated. A cosmid clone capable
of complementing the arginine auxotrophic arg70 mutant strain (Table 2) was
isolated by using a sib-selection strategy (Ochsner et al. 1991). The cosmid clone
was subsequently subcloned and the sequence of a complementing 4.5-kb DNA
fragment determined (Glumoff 1992; Reiser et al. 1994). The DNA sequence re-
vealed the presence of a gene encoding the large subunit of the mitochondrial
carbamoyl phosphate synthetase (CPSA). The T. cutaneum CPSA gene has the
capacity to encode a protein of 1170 amino acids, and its coding region is inter-
rupted by a short intron. The derived amino acid sequence is 62% identical and
77% similar to the sequence of the corresponding protein of Saccharomyces
cerevisiae. The codon usage in the CPSA gene (Table 5) was found to be similar to
the one in filamentous fungi.
For the design of expression vectors, the strongly expressed phenol hydroxylase
(PHY) gene has been isolated (Kalin et al. 1992; Kalin 1993). The comparison of the
codon usage in the two genes reveals a high similarity, with the exception of the
codons for arginine and glycine. In the case of arginine, the preferred codon in
PHY is CGC (79%) compared to CGT (50%) in CPSA. In the case of CPSA, the
Table 5. Comparison of the codon usages in the phenol hydroxylase (PHY) and the carbamoyl phosphate synthetase A (CPSA) genes from T.
cutaneum. (Glumoff 1992; Kiilin et al. 1992) I~
::;t
PHY CPSA PHY CPSA PHY CPSA PHY CPSA IS:
()
~
Phe TTT 23 13 Ser TCT 11 8 Tyr TAT 8 8 Cys TGT 11 18
TTC 77 87 TCC 21 16 TAC 92 92 TGC 89 82 I~
Leu TTA 0 1 TCA 11 2 End TAA 100 0 End TGA 0 100
TTG 2 4 TCG 44 66 End TAG 0 0 Trp TGG 100 100
CTT 12 21 Pro CCT 4 15 His CAT 4 0 Arg CGT 12 50
CTC 81 70 CCC 68 67 CAC 96 100 CGC 79 32
CTA 5 1 CCA 7 5 GIn CAA 13 0 CGA 2 0
CTG 0 3 CCG 21 13 CAG 87 100 CGG 5 5
lIe ATT 29 30 Thr ACT 20 29 Asn AAT 15 0 Ser AGT 4 0
ATC 71 69 ACC 70 69 AAC 85 100 AGC 9 8
ATA 0 1 ACA 0 Lys AAA 2 0 Arg AGA 0 3
Met ATG 100 100 ACG 10 1 AAG 98 100 AGG 2 10
Val GTT 18 19 Ala GCT 17 22 Asp GAT 10 0 Gly GGT 23 46
GTC 62 75 GCC 60 64 GAC 90 100 GGC 65 45
GTA 2 1 GCA 17 2 Glu GAA 2 0 GGA 7 6
GTG 18 5 GCG 6 12 GAG 98 100 GGG 5 3
The numbers refer to the occurrence (in percent) of a given codon.
U1
\0
"-l
598 J. Reiser et aI.
percentage of G and C in the third position of the glycine codon is unusually low
(48%) compared to the other amino acids and to PHY (70%; Table 5). A cDNA
encoding a cis, cis-muconate lactonizing enzyme from the T. cutaneum ATCC
58094 strain was isolated and sequenced. The deduced amino acid sequence exhib-
ited moderate sequence similarity with 3-carboxy-cis, cis muconate lactonizing
enzyme from Neurospora crassa (Mazur et al. 1994).
It has recently been found that the leucine codon CUG is read as leucine in
T. cutaneum JCM 1533 (Ohama et al. 1993). This is in contrast to Candida
cylindraceae and related species, in which CUG is read as serine.
8
Specific Biochemical Properties of Trichosporon Yeasts
8.1
Physiology of Trichosporon Yeasts
Trichosporon yeasts have the potential to use a very large variety of carbon sources
(Laaser et al. 1989) and T. cutaneum, T. beigelii, and T. pullulans have been shown
to grow on various monosaccharides including pentoses and hexoses, on disaccha-
rides, such as cellobiose, maltose, lactose, sucrose, melibiose, and trehalose
(M6rtberg and Neujahr 1986) and on polysaccharides including xylans (Hrmovci et
al. 1984), ball-milled filter paper (Stevens and Payne 1977), starch (De Mot and
Verachtert 1986), and on pectic acid, carboxymethylcellulose, and locust-bean
gum (Zimmermann and Emeis 1989). Other carbon sources include ethylamine
(Veenhuis et al. 1986), uric acid (Middelhoven et al. 1983), propionate, D-alanine,
D-methionine, and oleic acid (M. Veenhuis, pers. comm.), all of which lead to the
formation of peroxisomes (Veenhuis et al. 1985, 1986). D-glucarate, galactarate
and L-tartarate (Schneider et al. 1990), and cyclohexanecarboxylic acid (Hasegawa
et al. 1982) have also been found to serve as carbon sources for certain strains of
Trichosporon. Furthermore, T. cutaneum and T. beigelii are capable of using vari-
ous aromatic compounds as sole carbon and energy sources. The biochemistry and
physiology of phenol, cresol, salicylate, benzoate and anthranilate degradation and
the metabolism of aromatic amino acids have been the subjects of extensive re-
search (see Fig. 5; reviewed in Dagley 1985; Neujahr 1990). These properties indi-
cate the extraordinary potential of T. cutaneum for the efficient conversion of
various carbon sources into biomass. T. cutaneum has a purely oxidative metabo-
lism and does not form ethanol even under oxygen limitation (Kappeli and
Fiechter 1982) and it shows a high biomass yield of around 50 to 55% on glucose
(Fiechter et al. 1987). Hess (1988) has worked out the conditions for high density
cultivation of T. cutaneum. Biomass concentrations as high as 200 g (dry weight)
per liter could be harvested in a continuous cultivation process using a cell recy-
cling system. The highest productivity, 22 g per liter per h, was obtained at a cell
density of 120 g per liter. Thus, the broad substrate range in conjunction with the
bioreactor technology developed for T. cutaneum is an attractive feature in view of
the synthesis of valuable foreign proteins.
CH~OOH CH1(:OOH
@
@OH
c$J
OH
4-HYDROXYPHENYLACETA TE PHENYLACETATE
•
BEN~OATE
COOH
t
CH;!COOH CH;!COOH
~ HO~ OH
HO;9J
4-HYDROXYBENZOATE I ~HYDROXYPHENYLACETATE
• •
HOMOPROTOCATECHUATE
COOH
+
CH2COOH CH2COOH
~OH
OH
HO
J8r0H
OH
HO
,@r0H
PROTOCATECHUA TE HOMOGENTISA TE
A ~
•
i§i
CO2 OH CH~OOH CH2COOH
0
OH
/ .~ ,(;COOH '(;OOH
HO OH HO .& HO ~
OH OH
GENTISATE
l
HYDROXYOUINOL MALEYLACETOACETATE
•
o
CCOOH
COOH
I
9=0
CH2.
•
COOH
SALICYLATE 2.~DIHYDROXY - MALEYLACET ATE
eooH
OXALOACETATE MALEYLPYRUVATE
'\..C02...jBENZOATE •
(gr
' " OH ~
o ---.
0H COOH--'6
0
('''''''eOOH COOH
C:H~H
I
CH2
I •
I
CH
V COOH
c=o
CH3
CH
eaoH
CATECHOL ~. £!§,- MUCONATE ~KETOADIPATE
~ ACETOACETATE 'UMA'AT<
KREBS CYCLE ... I-----~.J~____________'.J

Fig.5. Metabolism of aromatic compounds by T. cutaneum. (After Rochkind-Dubinsky et
al. 1987)
Trichosporon yeasts have the capacity to accumulate lipids and thus they belong
to the oleaginous yeasts (Ratledge 1988; West et al. 1990). The process of lipid
accumulation occurs when an oleaginous yeast is grown in a medium with a high
carbon to nitrogen ratio (usually about 30: 1), so that the excess carbon is assimi-
lated without conversion to protein or nucleic acids. T. pullulans has been found to
accumulate more than 65% of its biomass as lipid. The order of abundance of the
fatty acyl groups of the lipids was oleate> palmitate> linoleate > stearate (Ratledge
1988).
8.2
Biochemistry of Trichosporon Yeasts
T. cutaneum cells can be grown in the presence of 0.05% phenol as a carbon
source and the growth rates were found to be equal on both phenol and glucose
(Spanning and Neujahr 1987). The first three enzymes involved in phenol metabo-
lism including phenol hydroxylase (Neujahr and Gaal 1973), catechol 1,2-
oxygenase (Varga and Neujahr 1970) and cis, cis-muconate cyclase (Gaal and
Neujahr 1980) have been isolated and characterized in detail. The levels of the
enzymes involved in phenol degradation were found to be some 50-400 times
higher in phenol-grown than in glucose-grown cells (Gaal and Neujahr 1981) and
phenol hydroxylase comprises 2-5% of the total cell protein in fully induced cells
(Neujahr and GaalI973). In addition to phenol, resorcinol, catechol, cresols, and
fluorophenols can induce phenol hydroxylase (Gaal and Neujahr 1981). A full-
length phenol hydroxylase cDNA has recently been sequenced and overexpressed
in an enzymatically active form in E. coli (Kalin et al. 1992), and the recombinant
enzyme was purified to homogeneity (Waters and Neujahr 1994). The E. coli-
derived enzyme was crystallized and a preliminary X-ray analysis was reported
(Enroth et al. 1994).
Similarly to Kluyveromyces lactis, T. cutaneum contains an inducible f3-galac-
tosidase (Mortberg and Neujahr 1986; West et al. 1990). The T. cutaneum ATCC
46490 strain studied by Mortberg and Neujahr revealed a cell-wall-bound extracel-
lular enzyme, whereas the protein of the ATCC 20509 strain studied by West et al.
(1990) was intracellular. A four- to sevenfold induction of f3-galactosidase
was detected in cultures grown on lactose, lactulose, or galactose and the enzyme-
hydrolyzed lactose, lactulose, and nitrophenyl-f3-D-galactoside (West et al. 1990).
A second intracellular lactose hydrolase, a f3-glycosidase, was described by West
et al. (1990). It had a wider substrate spectrum and hydrolyzed lactose,
nitrophenyl-f3-D-galactosides, 4-nitrophenyl-13- D-glucoside, cellobiose, lam-
inaribiose, laminaritriose, and sophorose efficiently. This enzyme was induced by
lactose, lactulose, or galactose and also by cellobiose. Hrmova et al. (1984) had
earlier detected an intracellular f3-glucosidase capable of hydrolyzing cellobiose.
The best inducer of this f3-glucosidase was thiocellobiose.
Using ball-milled filter paper as a growth substrate, T. cutaneum and T.
pullulans were found to produce appreciable amounts of cellulase activity (Stevens
and Payne 1977). The main products of cellulose degradation were cellobiose and
glucose. Xylanase activity was also present in the same culture filtrates.
A xylan- and xylose-inducible endo-l,4-J3-D-xylanase has been purified from

the culture supernatant of the T. cutaneum DSM 70698 strain grown on xylan
(Stuttgen and Sahm 1982). This enzyme comprised about 27% of the secreted
proteins at levels around 50 mg per liter. When the cells were grown on glucose or
cellobiose, no J3-xylanase activity could be detected. Hrmova et al. (1984) described
a different strain of T. cutaneum which produced a xylan-inducible J3-xylanase.
The enzyme could not be induced by xylose, but the activity was increased 200-fold
by xylan, about 700-fold by methyl-J3-xyloside, but only slightly by cellobiose.
Zimmermann and Emeis (1989) have isolated and characterized a number of
polysaccharidases from the culture supernatant of T. beigelii, strain CBS 5790. An
amylase was present when the cells were grown on starch, and pectinases were
found in starch, carboxymethyl cellulose (CMC), xylan, or locust-bean gum-grown
cells. The production of these enzymes was strongly repressed by glucose.
The T. pullulans ATCC 10677 strain produced a-amylase and glucoamylase
activities in a medium containing corn steep liquor and corn starch or soluble
starch (De Mot and Verachtert 1986). For both amylases, the maximum concentra-
tions were found in stationary phase cultures. In addition, pullulanase activity was
found in the glucoamylase fraction and cyclodextrinase activity was present in the
a-amylase fraction. The electrophoretic analysis revealed that the a-amylase activ-
ity was due to a single protein. The glucoamylase, however, occurred in multiple
forms. The four glucoamylases and the a-amylase were found to be glycosylated.
Buttner et al. (1987) have isolated an inducible amylase from T. adeninovorans
which hydrolyzed starch by cleaving single glucose units, thus showing that it is a
glucoamylase. Maltose was found to be a better inducer than soluble starch. To
relieve carbon catabolite repression, mutants of T. adeninovorans resistant of 2-
deoxy-D-glucose were selected (Buttner et al. 1989). Relative to wild-type cells, a
100-fold derepression of glucoamylase activity was detected in such mutant cells
grown on glucose.
9
Trichosporon Cell Biology: Staining of Nuclei
Trichosporon cutaneum nuclei can be stained either using DAPI (4'-6-diamidino-

2-phenylindole) as described by Williamson and Fennell (1975) or by using
mithramycin A (Slater 1976; see Fig. 1).
1. Collect 1 ml of a cell culture and wash cells with water.
2. Sonicate cells briefly and adjust concentration to lOB cells ml-I.
3. Mix SOj.Ll of the cell suspension with SOj.Ll of a 0.4mgml-1 solution of

mithramycin in 50% aqueous ethanol, 30 mM MgCI2• Alternatively use 50 j.Ll of
a 3 j1gml- 1 solution of DAPI instead of mithramycin.
4. Examine cells under a fluorescence microscope using a SIS-nm suppression

filter for mithramycin stained nuclei and a 420-nm suppression filter for DAPI-
stained nuclei.
10
Applications of Trichosporon Yeasts
Trichosporon yeasts are currently being used in a number of applications (Table 1).
Due to its robustness, T. cutaneum has been used for many years as a model
organism in different bioreactor systems (Kappeli and Fiechter 1981; Jaramillo
1985; Hess 1988; Kung and Moser 1986; Yonsel and Deckwer 1990). During the
cultivation of T. cutaneum, no by-products like ethanol or acetate are detected and
96 to 100% of the carbon source used are recovered as biomass and CO 2 (Janshekar
1979).
T. cutaneum has been used as a microbial sensor for determining the biological
oxygen demand (BOD) in waste water (Riedel et al. 1990), for carbohydrate analy-
sis (Riedel et al. 1990), for amperometric determination of ammonium ions in
mixed cultures with Bacillus subtilis and Pseudomonas aeruginosa (Riedel et al.
1990) and for phenol determination (Neujahr and Kjellen 1979). For BOD determi-
nation, T. cutaneum E4 cells were immobilized by mixing them with 10% polyvinyl
alcohol and pouring them on a glass plate to form a membrane. A modified oxygen
electrode was coated with the immobilized cell membrane and a dialysis mem-
brane. This biosensor had an operational stability of 48 days. Phenol hydroxylase
and catechol-1,2-oxygenase isolated from T. cutaneum have also been used for the
construction of biosensors (Kjellen and Neujahr 1979; Neujahr 1980) to detect
phenol and catechol, respectively.
References
Behrend G (1890) Ueber Trichomycosis nodosa. Ber Klin Wochenschr 21: 464-467
Berg GR, Inniss WE, Heikkila JJ (1987) Stress proteins and thermotolerance in
psychotrophic yeasts from arctic environments. Can J Microb 33: 383-389
Biittner R, Bode R, Birnbaum D (1987) Purification and characterization of extracellular
glucoamylase from the yeast Trichosporon adeninovorans. J Basic Microbiol 27: 299-
308
Biittner R, Scheit A, Bode R, Birnbaum D (1989) Isolation and characterization of mutants
of Trichosporon adeninovorans resistant to 2-deoxy-D-glucose. J Basic Microbiol29: 67-
72
Dagley S (1985) Microbial metabolism of aromatic compounds. In: Moo-Young M, Bull AT,
Dalton H (eds) Comprehensive biotechnology, voll. Pergamon Press, Oxford, pp 483-
505
De Mot H, Verachtert H (1986) Secretion of a-amylase and multiple forms of glucoamylase
by the yeast Trichosporon puilulans. Can J Microbiol32: 47-51
Do Carmo-Sousa L (1970) Trichosporon Behrend. In: Lodder J (ed) The yeasts. A taxonomic
study. 2nd edn North-Holland Publ, Amsterdam, pp 1309-1352
Drocourt D, Calmels T, Reynes J-p, Baron M, Tiraby G (1990) Cassettes of the
Streptoalloteichus hindustanus ble gene for transformation oflower and higher eukary-
otes to phleomycin resistance. Nucleic Acids Res 18: 4009
Enroth C, Huang W, Waters S, Neujahr H, Lindqvist Y, Schneider G (1994) Crystallization
and preliminary X-ray analysis of phenol hydroxylase from Trichosporon cutaneum.
J Mol Bioi 238: 128-130
Fiechter A, Kiippeli 0, Meussdoerffer F (1987) Batch and continuous culture. In: Rose AH,
Harrison JS (eds) The yeasts, vol 2. Academic Press, London, pp 99-129
Gaal A, Neujahr HY (1980) cis, cis-muconate cyclase from Trichosporon cutaneum. Biochem
J 191: 37-43
Gaal A, Neujahr HY (1981) Induction of phenol-metabolizing enzymes in Trichosporon
cutaneum. Arch Microbiol 130: 54-58
Gienow U, Kunze G, Schauer F, Bode R, Hofemeister J (1990) The yeast genus Trichosporon
spec. LS3; Molecular characterization of genomic complexity. Zentralbl Mikrobiol145:
3-12
Glumoff V (1992) Heterologous gene expression in the soil yeast Trichosporon cutaneum.
Doct Thesis, Swiss Federal Institute of Technology, Zurich
GlumoffV, Kiippeli 0, Fiechter A, Reiser J (1989) Genetic transformation of the filamentous
yeast, Trichosporon cutaneum, using dominant selection markers. Gene 84: 311-318
Gritz L, Davies J (1983) Plasmid-encoded hygromycin B resistance: the sequence of
hygromycin B phosphotransferase gene and its expression in Escherichia coli and Sac-
charomyces cerevisiae. Gene 25: 179-188
Gueho E, Tredick J, Phaff HJ (1984) DNA base composition and DNA relatedness among
species of Trichosporon Behrend. Antonie Leeuwenhoek J Microbiol50: 17-32
Gueho E, Kurtzman CP, Peterson SW (1989) Evolutionary affinities of
heterobasidiomycetous yeasts estimated from 18S and 25S ribosomal RNA sequence
divergence. Syst Appl Microbiol12: 230-236
Gueho E, de Hoog GS, Smith MT (1992a) Neotypification of the genus Trichosporon.
Gueho E, Smith MT, de Hoog GS, Billon-Grand G, Christen R, Batenburg-van der Vegte WH
(1992b) Contributions to a revision of the genus Trichosporon. Antonie Leeuwenhoek J
Hara N, Tubota Y, Saito K, Suto T (1989) Biochemical characteristics and ubiquinone of 44
strains of Trichosporon beigelii and related organisms J Gen Appl Microbiol 35: 1-10
Hasegawa Y, Higuchi K, Obata H, Tokuyama T, Kaneda T (1982) A cyclohexanecarboxylic
acid utilizing yeast:' isolation, identification, and nutritional characteristics. Can J
Hess PN (1988) Untersuchungen zur Leistungsfahigkeit aerober Suspensionskulturen in
geruhrten Bioreaktoren. Doct Thesis, Swiss Federal Institute of Technology, Zurich
Hoffman CS, Winston F (1987) A ten-minute DNA preparation from yeast efficiently
releases autonomous plasmids for transformation of Escherichia coli. Gene 57: 267-
272
Hoy J, Hsu K-C, Rolston K, Hopfer RL, Luna M, Bodey GP (1986) Trichosporon beigelii
infection: a review. Rev Infect Dis 8: 959-967
Hrmova M, Biely P, Vrsanska M, Petrakova E (1984) Induction of cellulose- and xylan-
degrading enzyme complex in the yeast Trichosporon cutaneum. Arch Microbiol 138:
371-376
Hug H, Blanch HW, Fiechter A (1974) The functional role of lipids in hydrocarbon assimi-
lation. Biotechnol Bioeng 16: 965-985
Janshekar H (1979) Studies on continuous production of fodder yeast from molasses. Doct
Thesis, Swiss Federal Institute of Technology, Zurich
Jaramillo A (1985) Fluid dynamics and oxygen transfer during the cultivation of
Trichosporon cutaneum in jet loop bioreactors. Doct Thesis, Swiss Federal Institute of
Technology, Zurich
Kalin M (1993) Isolation and characterization of the Trichosporon cutaneum phenol hy-
droxylase gene and its application for heterologous protein production. Doct Thesis,
Swiss Federal Institute of Technology, Zurich
Kalin M, Neujahr HY, Weissmahr R, Sejlitz T, Johl R, Fiechter A, Reiser J (1992) Phenol
hydroxylase from Trichosporon cutaneum. Gene cloning, sequence analysis and func-
tional expression in Escherichia coli. J Bacterial 174: 7112-7120
Kiippeli 0, Fiechter A (1981) On the methodology of oxygen transfer coefficient measure-
ments. Biotechnol Lett 3: 541-546
Kappeli 0, Fiechter A (1982) Growth of Trichosporon cutaneum under oxygen limitation:

kinetics of oxygen uptake. Biotechnol Bioeng 24: 2519-2526
Kemker BJ, Lehmann PF, Lee JW, Walsh TJ (1991) Distinction of deep versus superficial
clinical and non clinical isolates of Trichosporon beigelii by isoenzymes and restriction
fragment length polymorphisms of rDNA generated by polymerase chain reaction. J Clin
Kjellen KG, Neujahr HY (1979) Immobilization of phenol hydroxylase. Biotechnol Bioeng
21: 715-719
Kreger-van Rij NJW, Veenhuis M (1971) A comparative study of the cell wall structure of
basidiomycetous and related yeasts. J Gen Microbiol68: 87-95
Kung W, Moser A (1986) Bioprocess engineering characteristics of the horizontal stirred
tank. Bioproc Engin 1: 23-28
Laaser G, Moller E, Jahnke K-D, Bahnweg G, Prillinger H, Prell HH (1989) Ribosomal DNA
restriction fragment analysis as a taxonomic tool in separating physiologically similar
basidiomycetous yeasts. Syst Appl Microbiolll: 170-175
Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of
bacteriophage T4. Nature 227: 680-685
Lehman PF, Hsiao C-B, Salkin IF (1989) Protein and enzyme electrophoresis profiles of
selected Candida species. J Clin Microbiol27: 400-404
Maniatis T, Fritsch EF, Sambrook J (1982) Molecular cloning. A Laboratory Manual. Cold
Spring Harbor Laboratory, Cold Spring Harbor
Mattern IE, Punt P (1988) A vector of Aspergillus transformation conferring phleomycin
resistance. Fungal Genet Newslett 35: 25 .
Mazur P, Pieken WA, Budihas SR, Williams SE, Wong S, Kozarich JW (1994) Cis-cis-
muconate lactonizing enzyme from Trichosporon cutaneum. Biochemistry 33: 1961-
1970
McBride ME, Kalter DC, WolfJE Jr (1988) Antifungal susceptibility testing of Trichosporon
beigelii to imidazole compounds. Can J Microbiol34: 850-854
Middelhoven WJ, van den Brink JA, Veenhuis M (1983) Growth of Candida famata and
Trichosporon cutaneum on uric acid as the sole source of carbon and energy, a hitherto
unknown property of yeasts. Antonie Leeuwenhoek J Microbiol49: 361-368
Middelhoven WJ, Hoogkramer-Te Niet MC, Kreger-Van Rij NJW (1984) Trichosporon
adeninovorans sp. nov., a yeast species utilizing adenine, xanthine, uric acid, putrescine
and primary n-alkylamines as the sole source of carbon, nitrogen and energy. Antonie
Middelhoven WJ, de Jong 1M, de Winter M (1991) Arxula adeninivorans, a yeast assimilat-
ing many nitrogenous and aromatic compounds. Antonie Leeuwenhoek J Microbiol 59:
129-l37
Mortberg M, Neujahr HY (1985) Uptake of phenol by Trichosporon cutaneum. J Bacteriol
161:615-619
Mortberg M, Neujahr HY (1986) Transport and hydrolysis of disaccharides by Trichosporon
cutaneum. J Bacteriol168: 734-738
Neujahr HY (1980) Enzyme probe for catechol. Biotechnol Bioeng 22: 9l3-918
Neujahr HY (1990) Yeasts in biodegradation and biodeterioration processes. In: Verachtert
H, De Mot R (eds) Yeasts: biotechnology and biocatalysis. M Dekker, New York, pp 322-
348
Neujahr HY, Gaal A (1973) Phenol hydroxylase from yeast. Purification and properties of
the enzyme from Trichosporon cutaneum. Eur J Biochem 35: 386-400
Neujahr HY, Kjellen KG (1979) Bioprobe electrode for phenol. Biotechnol Bioeng 21: 671-
678
Neujahr HY, Varga JM (1970) Degradation of phenols by intact cells and cell-free prepara-
tions of Trichosporon cutaneum. Eur J Biochem l3: 37-44
Ochsner UA, GlumoffV, Kalin M, Fiechter A, Reiser J (1991) Genetic transformation of the
filamentous yeast Trichosporon cutaneum using homologous and heterologous marker
genes. Yeast 7: 5l3-521
Ohama T, Suzuki T, Mori M, Osawa S, Ueda T, Watanabe K, Nakase T (1993) Non-universal

decoding of the leucine codon CUG in several Candida species. Nucleic Acids Res 21:
4039-4045
Orbach MJ, Porro EB, Yanofsky C (1986) Cloning and characterization of the gene for ~
tubulin from a benomyl-resistant mutant of Neurospora crassa and its use as a dominant
selectable marker. Mol Cell BioI 6: 2452-2461
Punt PJ, Oliver RP, Dingemanse MA, Pouwels PH, van den Hondel CAMJJ (1987) Transfor-
mation of Aspergillus based on the hygromycin B resistance marker from Escherichia
coli. Gene 56: 117-124
Raeder U, Broda P (1988) Preparation and characterization of DNA from lignin-degrading
fungi. Methods Enzymol161: 211-220
Reiser J, GlumoffV, Ochsner UO, Fiechter A (1994) Molecular analysis of the Trichosporon
cutaneum DSM 70698 argA gene and its use for DNA-mediated transformations. J
Bacteriol176: 3021-3032
Ratledge C (1988) Yeasts for lipid production. Biochem Soc Trans 16: 1088-1091
Riedel K, Lange KP, Stein HJ, Huehn M, Ott P, Scheller F (1990) A microbial sensor for BOD
- Trichosporon cutaneum microbial electrode used for waster-water BOD determina-
tion. Waste Res 24: 883-887
Rochkind-Dubinsky M, Sayler GS, Blackburn JW (1987) Metabolism of nonchlorinated
aromatic compounds. In: Microbiological decomposition of chlorinated aromatic com-
pounds. Marcel Dekker, New York, pp 48-72
Rodriguez RL, Tait RC (1983) Recombinant DNA techniques: an introduction. Addison-
Wesley, Reading, pp 167-168
Schneider H, Biely P, Latta R, Lee H, Dorscheid D, Levy-Rick S (1990) Utilization by yeasts
of D-glucarate, galactarate, and L-tartarate is uncommon and occurs in strains of Cryp-
tococcus and Trichosporon. Can J Microbiol 36: 856-858
Sejlitz T, Neujahr HY (1987) Phenol hydroxylase from yeast. A model for phenol binding
and an improved purification procedure. Eur J Biochem 170: 343-349
Sienko M, Stepien PP, Paszewski A (1992) Generation of genetic recombinants in
Trichosporon cutaneum by spontaneous segregation of protoplast fusants. J Gen
Microbiol138: 1409-1412
Slater ML (1976) Rapid nuclear staining method for Saccharomyces cerevisiae. J Bacteriol
126: 1339-1341
Spanning A, Neujahr HY (1987) Growth and enzyme synthesis during continuous culture of
Trichosporon cutaneum on phenol. Biotechnol Bioeng 29: 464-468
Stevens BJH, Payne J (1977) Cellulase and xylanase production by yeasts of the genus
Trichosporon. J Gen Microbioll00: 381-393
Stiittgen E, Sahm H (1982) Purification and properties of endo-l ,4-/3-xylanase from
Trichosporon cutaneum. Eur J Appl Microbiol Biotechnol 15: 93-99
Sze IS, Dagley S (1984) Properties of salicylate hydroxylase and hydroxyquinol 1,2-
dioxygenase purified from Trichosporon cutaneum. J Bacteriol159: 353-359
Teeri T, Kumar V, Lehtovaara P, Knowles JKC (1987) Construction of cDNA libraries by
blut-end ligation: high frequency cloning of long cDNAs from filamentous fungi. Anal
Biochem 164: 60-67
Van de Peer Y, Hendriks L, Goris A, Neefs J-M, Vancanneyt M, Kersters K, Berny J-F,
Hennebert GL, de Wachter R (1992) Evolution of basidiomycetous yeasts as deduced
from small ribosomal subunit RNA sequences. Syst Appl Microbiol15: 250-258
Van der Walt JP, Hopsu-Havu VK (1976) A colour reaction for the differentiation of
ascomycetous and hemibasidiomycetous yeasts. Antonie Leeuwenhoek J Microbiol 42:
157-163
Varga JM, Neujahr HY (1990) Purification and properties of catecholl,2-oxygenase from
Trichosporon cutaneum. Eur J Biochem 12: 427-434
Veenhuis M, Hoogkamer-Te Niet MC, Middelhoven WJ (1985) Biogenesis and metabolic
significance of microbodies in urate-utilizing yeasts. Antonie Leeuwenhoek J Microbiol
51: 33-43
606 J. Reiser et al.: Trichosporon
Veenhuis M, van der Klei IJ, Harder W (1986) Physiological role of microbodies in the yeast
Trichosporon cutaneum during growth on ethylamine as the source of energy, carbon
and nitrogen. Arch Microbiol145: 39-50
Waters S, Neujahr HY (1994) A fermentor culture for production of recombinant phenol
hydroxylase. Prot Express Purif 5: 534-540
Weijman ACM (1979) Carbohydrate composition and taxonomy of Geotrichum,
Trichosporon and allied genera. Antonie Leeuwenhoek 45: 119-127
West M, Emerson GW, Sullivan PA (1990) Purification and properties of two lactose hydro-
lases from Trichosporon cutaneum. J Gen Microbiol136: 1483-1490
Williamson DH, Fennell DJ (1975) The use of fluorescent DNA binding agents for detecting
and separating yeast mitochondrial DNA. Methods Cell Bioi 17: 335-351
Ykema A, Verbree EC, Nijkamp HJ, Smit H (1989) Isolation and characterization of fatty
acid auxotrophs from the oleaginous yeast Apiotrichum curvatum. Appl Microbiol
Biotechnol32: 76-84
Yonsel S, Deckwer W-D (1990) MaBstabvergroBerung pneumatisch betriebener Reaktoren
(Airlift/Blasensaule) fUr 02-limitierte Fermentationen. BioEngineering 6: 12-23
Zimmermann M, Emeis CC (1989) Extracellular polysaccharidases from Trichosporon
beigelii. In: Martini A, Vaughan Martini A (eds) Proc 7th Int Symp on Yeasts, Wiley,
Chichester, S131
Subject Index
A+T composition 247 alkane utilization phenotype 450

a-l,3-glucan 89 allelic variants 514
a-l,3-mannosyl transferase activity 249 Ambrosiozyma spp. 5, 36, 42
a-aminoadipate-8-semialdehyde amine oxidase 299,304,317
production 552 amino acid 305
a-amylase 118, 128, 129, 133, 601 assignment 522
a-glucosidase 269 biosynthesis 466
a-mating factor pre-pro signal 239 catabolism 433
a-naphthylphosphate 239 permease 433
AASA production, see a-aminoadipate-8- amrtlOnium assimilation 431
semialdehyde production ammonium transport 431
acetate 321 AMO, see amino oxidase
acetic acid 21 amylase 39,43,46,130,131,132
acetyl-CoA synthetase 320 amylolytic system 118, 128
acetyl-Coenzyme A 447 anaerobic conditions 141
deficient mutants 321 anamorph 419
synthetase 321 aneuploid karyotype 503
Aciculiconidium spp. 51 aneuploidy 505
acid cell lysis 231 annelations 11
acid phosphatases 390 antibodies 364
acid phosphatase secretion signal 239 AOX, see alcohol oxidase
acid protease 325 AOXI gene disruption 222
aconitate hydratase 322 AP A, see auxotrophy-prototrophy-
ADEI gene 281 auxotrophy alterations
ADH genes, see alcohol dehydrogenase Apiotrichum spp. 58
genes curvatum 584
alcohol dehydrogenase genes 158,319 aprotinin 245
alcohol oxidase 203,286,295,319 aromatic amino acid biosynthesis 468
alcohol oxidase promoter 233 ARS, see autonomously replicating
alcoholic fermentation 141 sequences
alginate encapsulation 94 Arthroascus spp. 37,47
alkaline cell lysis 230 arthroconidia 12
alkaline extracellular protease 324 Arxiozyma spp. 37
alkane Arxula spp. 12,51,53
assimilation 411 adeninivorans 389
catalytic pathway 449 terrestre 389
degradation pathway 453 asci 14, 15, 145
hydroxylation 457 Ascoidea spp. 16, 37
alkane oxidation pathway ascomycetes 14, 22
diterminal 441 ascospore 16
monoterminal 441 formation 419
608 Subject Index
Ashbya spp. 37,38,41,44 multilateral 10

assimilation multipolar 10, 11
carbon assimilation 19, 20 Bullera spp. 11, 12, 53, 58
nitrogen assimilation 20 Bulleromyces spp. 5,17, 18,53,58
tests 19 buoyant density 28
autonomously replicating sequence 173,
244,301,532,534 Cl-metabolism 278
autoregulation 157 Candida spp. 2,9, 13,51,52,62, 106, 107,
auxiliary substrate concept' 428, 447 117,411
auxotrophic markers 88,147,173,278, albicans 13,32,34,85,87, 104, 106,316
298,399,585 blankii 52, 85
auxotrophy-proto trophy-auxotrophy boidinii 87, 89, 105, 106, 203
alterations 493 cloacae 414
guilliermondii 104, 255, 414
f3-D-xylosidase 390 kefyr 43
f3-galactosidase 154, 165,350,545,600 krusei 104
f3-glucuronidase 121 lipolytica 49,313
f3-isopropylmalate dehydrogenase 317 macedoniensis 89, 92, 105
f3-ketoadipate pathway 445 maltosa 52,85, 106,411,414
f3-oxidation 442,451,463 novellus 414
Bacillus sphaericus mosquitocidal parapsilosis 27, 106,416
components 245 pintolopesii 37
ball-milled filter paper 598 pseudotropicalis 84, 88
ballistoconidia 10, 11, 12 sake 414,416
basidia 17,22 salmonicola 416
basidiomyceteous yeasts 17,22,581 shehatae 46,85,88,105,106
batch fermentation 209 subtropicalis 414
Bensingtonia spp. 58 tropicalis 87, 89, 104, 105, 106
benzo(a)pyrene 446 utilis 52, 87, 106
Betula spp. 58 carbohydrate metabolism 436
biochemical genetics 277 carbon conversion efficiency 442
biological oxygen demand 602 carboxymethylcellulose 598
biomass 209 carrier 370
composition 428 catabolite
concentration 598 inactivation 283, 437, 465
production 426, 427 repression 285,437, 465
biosensors 602 catalase 286,300,304,317
biotechnological application 270, 288, catechol 1,2-oxygenase 600
547 catechol 2,3-dioxygenase 407
biotransformation 543 catechol oxidase 350
Blastobotrys spp. 48,51 cathepsin E 245
blotting of gels III cDNA library 510
Bm 86 antigen 245 cell disruption 164, 393
BOD, see biological oxygen demand cell surface protrusions 453, 477
Botryascus spp. 38, 47 cell wall 4, 5, 9, 10, 484
bovine lysozyme 245 composition 452
branched hydrocarbons 443 hydophobicity 453
Brettanomyces spp. 39,51, 106 polysaccharides 437
brewing of beer 133 cellobiase 390
brewing yeasts 84 centromere 335, 534
budding 476 centromeric vector 173,176
enteroblastic 4, 10 Cephaloascus spp. 38
holoblastic 4, 10 Chionosphaera spp. 53
monopolar 10 chlamydospores 12, 13, 17
Subject Index 609
chromosome 101,299 CYP52 family 457

assignment 503, 504, 527 Cystofilobasidium spp. 13,17,54
band size polymorphism 104, 505 cytochrome c gene 154
DNA 123, 260, 392, 502 cytochrome P450 441,454, 515
fragmentation 105 alkane-inducible forms 455
map 334 heterologous expression 460
polymorphism 334 immunochemicallocalization 478
rearrangements 105, 528, induction 457,459
cis,cis-muconate cyclase 600 large scale purification 460
Citeromyces spp. 38 regulation of biosynthesis 455
citrate 322 spectral determination 459
citric acid 313 cytochrome-deficient mutants 118, 121
clamp connections 10,17,22 cytoplasmic inheritance 169
Clavispora spp. 38
clinical Candida albicans strains 104 2,5-diamino-6-hydroxy-4-
CO-difference spectra 460 ribitylaminopyrimidine-5'-phosphate
cobalt-binding proteins 475 deaminase 266
Coccidiascus spp. 39 2,5-diamino-6-hydroxy-4-
codon ribosylaminopyrimidine-5'-phosphate
adaptation index 153 reductase 266
bias 525 2-deoxy-D-glucose 90
usage 152,154,248,474,524,596 D-alanine carboxy peptidase 245
coenzyme Q 5, 9 D-amino acids 551
coexpression system 517 DAPI, see 4'-6'-diamino-2-phenolindole
colony hybridization 250, 508 DAS, see dihydroxyacetone synthase
competent cells 369 DCA production, see dicarboxylic acid
complementation 151,266,507 production
groups 296,297,492 Debaryomyces spp. 9,14,39,45,117
test 501 debranching activity 128
complex media 206 degradation
conidiogenesis 10 anthranilate 598
conjugation 329 aromatic compounds 584
contour-clamped homogeneous electric benzoate 598
field 505 cresol 598
co oxidation 435 phenol 598
core-glycosylation 129 dehalogenation activity 446
Crabtree Dekkera spp. 39,51
effect 118,133,305,436 density gradient centifugation 163, 485
negativity 124 desaturation offatty acids 451
cryopreservation 394 deviation from the universal genetic code
cryosections 482 517
Cryptococcus spp. 11, 13, 54, 57, 58, 63, 4'-6'-diamino-2-phenylindole 23,91,601
106 dicarboxylic acid production 417,550,
culture 551
batch 426 dihydroxyacetone 305
collections 416 dihydroxyacetone synthase 203, 303, 304,
conditions 448 317
continuous 426, 427 3,4-dihydroxy-2-butanone-4-phosphate
cyanide-insensitive respiration 475 266
cybrids 84 dilution rate 213
cycloalkanes 444 6,7 -dimethyl-8-ribityllumazine 266
cycloheximide 21, 160 dimorphism 13
resistance 421,520 dipeptidyl aminopeptidase 324
Cyniclomyces spp. 39 diploid state 179
610 Subject Index
Dipodascus spp. 14,16,40 binding protein 320

diterminal oxidation 464 biosynthesis 320
DNA carrier 320
binding 166,302 composition 6, 442, 464
DNA-reassociation 88 de novo biosynthesis 441
fingerprinting 397 degradation 320
hybridization 7 odd-numbered 425
isolation 25, 27, 163, 250, 260 oxidation 463
killer plasmids 84 synthetase 320
preparation 528 uneven 425
reassociation 395,418,419,421 fatty acyl-CoA oxidases 518
relatedness 417 fatty alcohol oxidase 454, 455, 462
DOX, see dihydroxy acetone synthase fatty aldehyde dehydrogenase 454
Drosophila spp. 39, 44, 50 feedback
DsRNA killer plasmid 84 inhibition 466
regulation 131
Eeniella spec. 51 Fellomyces spp. 12, 59
electron micrographs 481 fermentation 18, 157,209,210,448
electrophoresis apparatus 108 Feulgen 23
electrophoretic karyotype 32, 85, 139, field-inversion gel electrophoresis 102
503, 505 FIGE, see field-inversion gel
electroporation 122, 181,345,403 electrophoresis
enantioselectivity 434 Filobasidiella spp. 5, 17,18,54, 104, 106
in D-amino acid production 548 neoformans 2,22,33,54
endo-1,4-J3-D-xylanase 601 Filobasidium spp. 17,54,55
endoglycosidase H 129 filter hybridization 30
Endomyces spp. 40, 47, 106 fission 12
Endomycopsella spp. 47, 106 fluorescence 366
Endomycopsis lipolytica 314 fluorescent dyes 91
endopeptidases 168 5-fluoroorotic acid 358
endoplasmic reticulum 327, 477 FMD, see formate dehydrogenase
membrane proliferation 480 5FOA, see 5-fluoroorotic acid
endospores 12, 13 formaldehyde 294
enological Saccharomyces strains 104 resistance 521
enzymatic cell lysis 231 formate dehydrogenase 303,317
ER, see endoplasmic reticulum free-solution hybridization
Eremothecium spp. 38,40,41, 42, 44, 45 hydroxylapatite method 29
Erythrobasidium spp. 54 Sl nuclease method 29
Escherichia coli ,B-galactosidase 245 spectrophotometric method 29
esterase 326 fusants
ethanol metabolism 285 intergeneric 83
ethanolic fermentation 45 interspecific 83
ethidium bromide 24, 506 intraspecific 83
Eucalyptus 54
evolutionary relationship 420 G+C content 501
expression vector 177,532 G418 resistance 157, 173, 184
extracellular GALl promoter 155,519
enzymes 392 GALlO promoter 155,460,519
starch production 22 Galactomyces spp. 14,41
galactose
facultative methylotrophs 294 induction 156
FADH, see fatty aldehyde dehydrogenase metabolism 154, 156,519
FAOD, see fatty alcohol oxidase gametangia 14
fatty acid gene
Subject Index 611
bank 260 haploidizing agents 84

conversion 342 HARS, see autonomously replicating
deletion 122 sequence in Hansenula polymorpha
disruption 122, 179,342,516,536 Hasegawaea spp. 47
dosage 244 helicase 121
duplication 517 Hepatitis B surface antigen 204, 305
expression cloning 508 heterokaryons 85
fusion 165 heterologous gene expression 127,204,
libraries 348,400,486,509,533 302,406,440,471,480,543
mapping 527 heterologous products 187, 352
genealogy 332 heterothallism 144,257
general control of amino acid biosynthesis hexokinase 157
467,469 isoenzymes 437
genes 123,299 high cell-density cultivation 204, 598
genetic high-copy vector 545
map 161,260,280,399 high performance liquid chromatography
markers 123,299,399 28
genome HIV gp120 245
mapping 104 Hoechst Marion Roussel Inc. 203
size 334 Holleya spp. 38, 41, 42, 44
genomic library 510 homoaconitate hydratase 322
Geotrichum spp. 12,40, 41, 106 homocitrate synthase 322
Giemsa 24 homoisocitrate dehydrogenase 322
glucoamylase 118, 122, 128, 129, 131, 133, homologous recombination 175
390,601 homothallism 298
gluconeogenesis 447, 465 Hormoascus spp. 42
glucose Hortea spp. 104
growth on 50% 21 host-vector systems 531, 534, 535
repression 124, 157 hph, see hygromycin B phosphotransferase
transport 436 gene
glucuronidase 350 HPLC, see high performance liquid
glusulase 121, 145, 162, 363 chromatography
glycerol 305 human
glycolytic enzymes 150 epidermal growth factor 209
glycosylation interleukin-2 204
a-1,3-linked mannose residues 249 serum albumin 204
N-(asparagine) and O-(serine or TNF 245
threonine)-linked carbohydrate TNF-analogues 245
additions 249 hybridization 28
glyoxylate cycle 447,464 intergeneric 89
glyoxysomal enzymes 288 interspecific 89
glyphosate 468 hybrids 105
growth interspecific 258
rate 426 intraspecific 258
yield 205 hydrocarbon
GTP cyclohydrolase 262 assimilating yeasts 422
Guilliermondella spp. 41,47 assimilation 421
transport 450
Hanseniaspora spp. 10, 41, 49, 52 utilization 256, 265
Hansenula spp. 45, 106 hydrogen peroxide 303
capsulata 88 hydroxylapatite 25
polymorpha 46, 104, 203, 293 hydroxylation
wingei 34,88,108 of alkanes 517
haploidization 279, 332 offatty acids 517
612 Subject Index
Hygromycin B 348, 595 drosophilarum 146

Hygromycin B phosphotransferase gene fragilis 87,88
596 lactis 33,84,87,88, 104, 106,316
hyperglycosylation 305 marxianus 33, 43, 89, 92, 105, 172
hypersensitive reactions 424 thermotolerans 89, 172
hyphae 12, 13 waltii 172
Hyphopichia spp. 46 wickerhami 172
KmR fusion 166
IgE receptor (a-subunit) 245 Kockovaella spp. 12, 59
IL Vi gene 401 Kondoa spp. 55
immunoelectron microscopy 481 Kunitz protease inhibitor 245
immunolabeling 367,481 Kurtzmanomyces spp. 12, 59, 60
immunoprecipitation 474
in vitro translation 471, 472 L-Ieucine biosynthesis 466
inbred lines 335 LAC4 gene 155
industrial application 133, 186 LAC9 gene 155
industrially important yeasts 423 lactose
inhibitors 159 metabolism 154, 156
insulin-like growth factor-l 204 permease 154
integration 244, 344 Leucosporidium spp. 13, 17,55,63
integrative transformation 341, 535 life cycle 207, 297
interallelic linkage
complementation 270 groups 149,500
divergence 523 map 148
intermediate metabolism 464 lipase
intracellular enzymes 393 activator-dependent 326
introns 337 cell wall bound 326
splicing signals 524 extracellular 326
inulinase activity 43 lipid
invertase 348 biosynthesis 463, 469
inverted terminal repeats 168 content 429
Invitrogen Corporation 204 granules 453,477
iron-deficient media 256 production from whey 584
isocitrate lyase 321, 464 vesicles 485
isopropylmalic acid 322 Lipomyces spp. 9, 16, 43, 52
isozyme patterns 7 Liposan 319
Issatchenkia spp. 42 locust-bean gum 598
scutulata 30 Lodderomyces spp. 4
scutulata var. exigua 9 elongisporus 415
scutulata var. scutulata 9 low copy number plasmids 175
Itersonilia spp. 3, 5, 59 LYS2 gene 401
2-ketoglutaric acid 313 Malassezia spp. 10, 60, 63, 104

kex2-protease cleavage site 242 furfur 3
killer pachydermatis 7, 32, 34
assay 170 malate synthase 317
plasmid 169, 172 malt whiskey production 133
plasmids as vectors 175 maltose fermentation 417
toxin 141, 168 maltose permease 131
Kloeckera spp. 41, 52 mannosidase 326
Kluyver effect 131, 133 marker genes 511,512,513,536
Kluyveromyces spp. 10, 42, 106, 107 mating 22, 208, 295, 296
aestuarii 172 factor 144
dobshanskii 172 frequency 329
Subject Index 613
response 329 Mrakia spp. 3, 55, 63

type 85,257,281,329 mtDNA, see mitochondrial DNA
mechanical cell lysis 229 muconic acid production 548
medium 429 multigene family 516
membrane fraction 462 multiple integration 188
mesophilic yeast 426, 430 mutagenesis 145, 250, 298, 394, 486
metabolism mutants
acetate 447 alkane not utilizing 493, 494, 495, 496
ethanol 447 auxotrophic 491
fatty acids 447 catabolite repression 119,491,496
methanol 203, 282, 284 colour 333
methanol oxidase 203,294,302,304,317 defective 333
methanol utilization dominant 333
assimilatory pathway 294 enrichment 333, 487
dissimilatory pathway 294 frequency 487
methanol utilization mutants induction by ultraviolet irradiation 487
defective in methanol utilization 296 MNNG 497
mut+ strains 214 morphology 491, 497
mUl strains 214 polyene antibiotic resistant 491
respiratory mutants 296 resistant 333
with defects in peroxisome biogenesis selection 488
296 stability 487
methylketones 305 mycelia 391
methylotrophic yeast 203, 293 Myxozyma spp. 9, 52
Metschnikowia spp. 9, 43
microbial lipid extract 549 n-alkane 319,441
microbodies 477 metabolism 441
Micrococcus luteus 28, oxidation 451
microsomes 485 n-alkenes 319
microsomal fraction 483 N-glycosylation 129, 188
microsomal membrane fraction 461 NADPH-cytochrome P-450 reductase 461
miniprep method 30 Nadsonia spp. 10,14,44,49
Mithramycin A 24,601 Nematospora spp. 38, 41, 44
mitochondria 84, 159 neutral lipids 429
mitochondrial nitrate assimilation 293
carbamoyl phosphate synthetase 596 nitrogen catabolite repression 432
DNA 8, 139, 160, 392, 398, 502, 507 nitrogen source 431
gene recombination 84 nomenclature 149,279
gene transmission 84 nonhomologous integration 179
genes 87 Notl 105
genome organization 507 Novozym 89,108,589
membranes 474 nuclear staining 23
mitotic nucleotide coenzymes 305
apparatus 4 null mutant 123
haploidization 395 Nystatin 361
segregation 501
mobile genetic elements 493 Octosporomyces spp. 47
mol% G + C 7,8,27,28 OFAGE, see orthogonal field alternation
monochlorophenol 446 gel electrophoresis
monooxygenase pathway 446 oleaginous yeasts 43, 61
morphology 9 oleic acid 598
mother cell-bud conjugation 14 omega intron 161
mouse EGF 245 omega-hydroxylation 464
MOX, see methanol oxidase one-step gene replacement 122
614 Subject Index
Oosporidium spp. 52 hydroxylase 445, 596, 600

organelle preparation 484 utilization 445
organelles 83 phenylalkanes 444
organic acid esters 141 Phillips Petroleum Company 203
orotidine-5'-phosphate decarboxylase Phleomycin 348,595
317 phosphatase
orthogonal field alternation gel major acid 325
electrophoresis 102, 504 minor acid 325
osmotic pressure 90 phosphofructokinase 287
osmotolerant yeasts 90 phosphoglycerate kinase 519
OTR, see oxygen transfer rate phylogenetic
oversynthesis of riboflavin 268 analysis 8, 420
oxidation distance 149
diterminal 443, 454 tree 420
monoterminal 442 physical map 105,161
3-oxoacyl-CoA phytate utilization 118
thioester 320 Pichia spp. 9, 10, 15, 45, 46, 105
thiolase 320 americana 9
2-oxoglutarate dehydrogenase 287 amylophila 9
oxygen angusta 46, 293
limitation 427 bimundalis 9
transfer rate 213 canadensis 34, 106
carsonii 39
p-fluorophenylalanine 84, 95 etchellsii 39
Pachysolen spp. 10, 45, 106 guilliermondii 46, 85, 255
tannophilus 33 methanolica 46, 277
Pachytichospora spp. 45 mississippiensis 9
pararosaniline 23 pastoris 46, 203
parasexual genetics 87,499 pastoris autonomous replicating
parenthesome 5 sequence 233
PARS, see Pichia pastoris autonomous pinus 46
replicating sequence pinus MH4 277
Pasteur-effect 118 stipitis 46,85,87,88, 105, 106
pathogenic potential 423, 424 pigments 143
PCR, see polymerase chain reaction plasma membrane 485
pectic acid 598 invaginations 477
PEG, see polyethylene glycol plasmids 263, 264, 347
pentose phosphate cycle 158, 436, 470 copy number 535
peptide utilization 434 2f.1m plasmid 84, 167
peroxisomes 293,296,477,483,485,598 promoter 179
biogenesis 204, 297, 303, 328, 584 ploidy 396
matrix protein 300 polsaccharides 598
membrane protein 300 polycyclic aromatic hydrocarbons 446
protein import 304 polyene antibiotic 488
targeting signal 304 polyethylene glycol 83
Pertactin P 69 polymerase chain reaction 8,25,27,30,
petite mutants 118 32
petite-negative yeast 141, 159 asymmetrical amplification 31
PFGE, see pulsed-field gel electrophoresis symmetrical amplification 31
Phaffia spp. 60 polymorphism of genes 514
rhodozyma 57, 85, 106 polyphosphate 324
phenol polyploid strains 121
biosensor 584 polyploidization 85
degradation 584 polysaccharide
Subject Index 615
biosynthesis 470 regulatory

production 584 mutants 268
polysomic strains 121 sequences 154
posttranslational modifications 250 replication origin 335
pre-sequence cleavage site 242 reporter gene 545
presporulation medium 208 Research Corporation Technologies 204
Pristane 443 resistance
proascus 14 to antimycin A on glucose 157
product stability 249 to G418 157
productivity 213, 305 respiration 157
promoter 124,302,354,518 deficiency 84
propidium iodide 23 restriction fragment polymorphism 523
protease 167 retrotransposon (Yin) 337
protein concentrates from biomass 425 RFE, see rotating field electrophoresis
protein expression 229, 244 Rhodosporidium spp. 17,55,56,85, 106
continuous induction 227 toruloides 2, 85, 106
product toxicity 227 Rhodotorula spp. 11, 52, 54, 56, 60, 61,
stepwise induction 227 106
protein targeting 470 riboflavin 255
protein translocation across the biosynthesis 267
endoplasmic reticulum 470 deficient mutants 265
protein transport excretase 269
cotranslational 470 kinase assay 270
posttranslational 470 permeases 269
proteolysis 305 synthase 262
proteophosphomannan 452 transport 269
proton extrusion 432, 447 ribosomal
protoplasts 35, 36, 121, 372 DNA 8, 9, 145, 336
forming enzyme 589 RNA 9,522
fusion 257, 395, 499, 588 ribulose-5-phosphate 266
pseudohyphae 12,13,318 RNA
pseudomycelium 476 preparation 162,250, 530
Pseudozyma spp. 63 7S RNA 327
Pulcherrimin 143 RNAse 325
Pullulanase 601 rotating electrophoresis systems 102, 103
pulsed-field electrophoretic techniques 7, rRNA, see ribosomal RNA
101,123,146,147,260,278,396
purine biosynthesis 282 Saccharomyces spp. 9, 10, 45, 46, 49, 50,
104, 106, 107
RAG, see resistance to antimycin A on bayanus 9, 88
glucose cerevisiae 9, 14, 33, 34, 35, 46, 84, 85,
random amplification of polymorphic 87,88,92, 104, 105, 106, 108, 1l0, 316
DNA 7,8 diastaticus 88
random spore fermentati 89
analysis 259 kluyveri 88
preparation 208 lactis 139
RAPD, see random amplification of pastorianus 9
polymorphic DNA rouxii 88
rDNA, see ribosomal DNA Saccharomycodes spp. 46, 49, 106
reassociation kinetics 501 ludwigii 15
reconstitution experiments 454,461 Saccharomycopsis spp. 14,37,38,41,46,
regeneration 47, 106
of protoplasts 91,217 fibuligera 47, 105, 106
rate 179 lipolytica 84,85,89,314
616 Subject Index
saccharopine dehydrogenase 322 phenetic 2

Saitoella spp. 52 phylogenetic 3
salmon growth hormone 245 spheroplasts 162, 180
Sarcinosporon spp. 62 methodology 215
Satumispora spp. 45,47,49 viability 221
scars 11 spindle pole body 5
Schizoblastosporion spp. 53 Sporidiobolus spp. 17,56
Schizosaccharomyces spp. .9, 12,47 Sporobolomyces spp. 11, 12,56,61,63
octosporus 88 Sporopachydermia spp. 47
pombe 33, 34, 83, 84, 85, 88, 104, 105, sporulation 119, 208, 295, 329
106, 108, 110,316 SRP, see signal recognition particle
Schwanniomyces staining of cells
alluvius 117 fluoresceine isothiocyanate 95
castellii 88, 117 rhodamine isothiocyanate 95
occidentalis 39, 92, 106 starch 598
occidentalis var. occidentalis 120 degradation 118, 133
occidentalis var. persoonii 120 utilization 417
persoonii 117 Stephanoascus spp. 48,51
SCP, see single cell protein stereoselectivity 454, 455, 462
secondary pulsed field gel electrophoresis stereoselective oxidation 548
103 Sterigmatomyces spp. 12, 59, 61
secretion 327 Sterigmatosporidium spp. 57
media 228 storage of strains 207
signals 248 strain
vectors 177, 178 conservation 422
segregant-defective variants 85 improvement 84
selective markers 262 streptokinase 245
self-cloning 508,515 structural genes 266
self-diploidization 278 subcellular localization of n-alkane
septate hyphae 318 oxidation 451
sequence homology 150, 151 substrate
sexual assimilation 316
barriers 87 mixing ratios 428
crosses 257 specificity towards hydrocarbons 441
cycles 3 utilization 431
reproduction 13 utilization spectrum 435
SfiI 105 Suc2 gene of Saccharomyces cerevisiae
shuttle libraries 175 205
shuttle vectors 125, 175,233,234 sugar uptake 158
signal SUP2 gene 281
peptides 187 superoxide dismutase 245
peptide cleavage site 242 supplemental minimal media 206
recognition particle 317 SwARS plasmids 124
silent Sympodiomyces spp. 51,53
allele activation 493 Sympodiomycopsis spp. 61
gene copies 514
single cell protein 133,305,413,417,418, TAFE, see transverse alternating field
424,425,428,548 electrophoresis
single chain antibody 245 Taphrina spp. 52
Sirobasidium spp. 57 targeted vector integration 302
species concept taxonomy 139, 413
biological 2 teleomorph 419
evolutionary 3 teliospores 17,22,23
Subject Index 617
telomeres 149 ubiquinone oxidoreductase 519

terminal proteins 169 ultrastructure 5, 9, 10,476
termination 337 Undeniomyces spp. 58
terminator 352 universal genetic code 526
Tetanus toxin fragment C from Bordetella upstream
pertussis 245 activation sequence 518
tetrad analysis 144,279 repression sequence 518
thalloconidia 12 urea assimilation 432
thiamine 322 urease activity 21
tick anticoagulant peptide 245 uric acid 598
Tilletaria anomala 17
Tilletiaria spp. 57 VI-domain of CD4 209
Tilletiopsis spp. 61 vacuoles 477, 485
tissue plasminogen activator 209 Vanrija spp. 63
Torulaspora spp. 9, 48, 49, 50 vector systems 127, 172, 174,232,301,
pretoriensis 104 345
Torulopsis glabrata 87, 88 virus-like particles 240
TPA, see tissue plasminogen activator vitamin
TRA, see transformation ability region B2 255
transcriptional regulator 151 requirements 21
transformation 39, 63, 119, 121, 183, 184,
215,221,260,280,301,402,404,405, Waltomyces lipofer 43
406,594,596 wheat germ extract 473
ability region 534 white piedra 582
by e1ectroporation method 226, 541 Wickerhamia spp. 49
by lithium acetate method 540 Wickerhamiella spp. 49
by lithium chloride method 223 Williopsis spp. 45, 47, 49
by PEG method 224. Wingea robertsii 39
by spheroplast method 540
markers 172 Xanthophyllomyces spp. 57
rates 535 xylulose monophosphate pathway 294
transketolase 294
translation initiation codon context 247 Yamadazyma spp. 45, 46
transposons 502 Yarrowia lipolytica 50,84,85, 104, 105,
transverse alternating field electrophoresis 106,107,111,411,477
102 Yarrowia spp. 49
trehalase 390 yeast taxonomy 90,418,419
Tremella spec. 57 yeast-hyphae transition 318,515
Trichosporon spp. 12, 13, 62, 63
adeninivorans 389,583 zero-integrated field electrophoresis 103
beigelii 110, 581 ZIFE, see zero-integrated field
cutaneum 581 electrophoresis
pullulans 583 Zygoascus spp. 15, 50
Trigonopsis spp. 53 Zygosaccharomyces fermentati 87
tRNA genes 160 Zygosaccharomyces spp. 9, 15, 49, 50, 106
Tsuchiyaea spp. 12, 59, 63 Zygozyma spp. 50
two-step gene replacement 123 zymolyase 89, 107, 121, 145, 162,217,
typing of yeast strains 104 363,472,506
Spri nger-Verlag
and the Environment
We at Springer-Verlag firmly believe that an

international science publisher has a special
obligation to the environment, and our corpo-
rate policies consistently reflect th is conviction.
We also expect our busi-

ness partners - paper mills, printers, packag-
ing manufacturers, etc. - to commit themselves
to using environmentally friendly materials and
production processes.
The paper in this book is made from

Iow- or no-chlorine pulp and is acid free, in
conformance with international standards for
paper permanency.

(Prof. Dr. Klaus Wolf (Auth.) ) Nonconventional Yea (B-Ok - Xyz)

Uploaded by

Copyright:

Available Formats

(Prof. Dr. Klaus Wolf (Auth.) ) Nonconventional Yea (B-Ok - Xyz)

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

(Prof. Dr. Klaus Wolf (Auth.) ) Nonconventional Yea (B-Ok - Xyz)

Uploaded by

Copyright:

Available Formats

Nonconventional Yeasts in Biotechnology

With 94 Figures and 45 Tables

Cover Illustration: Kluyveromyces lactis. A scanning electron micrograph of K.

ISBN-13: 978-3-642-79858-0 e-ISBN-13: 978-3-642-79856-6

Library of Congress Cataloging-in-Publication Data. Nonconventional yeasts in biotechnology: a handbook!

Press, New York

Aachen Klaus Wolf

6.2 Anamorphic Ascomycetous Genera ........................... 51

3.1 Sample Preparation ......................................... 106

6.2 Chromosome Separation by Pulsed Field Gel Electrophoresis ..... 146

14.3.2 Transformation by the Gene Pulser . . . . . . . . . . . . . . . . . . .. 182

6.1.2 Procedure ........................................... 219

7.2 Molecular Cloning of SUP2 and ADEI . . . . . . . . . . . . . . . . . . . . . . . .. 281

2.6 Secretion of Metabolites ..................................... 321

6.1.3 Conjugation Media. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 356

9.6 Available Gene Libraries 378

1.2 Phylogenetic Relation of Candida maltosa to Other Yeasts ........ 420

4 Genetics and Molecular Biology of Candida maltosa ................. 486

5.2 Preparation of Protoplasts and Protoplast Fusion ...... ........ 588

Subject Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 607

Barth, G. 313 Kunze, I. 389

Principles and Methods Used in Yeast

Identifying, naming, and placing organisms in their proper evolutionary frame-

A third species concept is the evolutionary or phylogenetic species concept

The first period of yeast systematics (until approximately 1960) is characterized by

have electron-transparent cell walls, mainly made up of J3-glucans, and a thin

Fig. 3. Micropore in Sporothrix guttuliformis (CBS 437.76, x27000)

Table 1. Distribution of mol% G+C among ascomycetous

Mol% Percentage of Percentage of

Morphological characteristics are still of great taxonomic importance. Generic

morphology of asci, ascospores, teliospores, basidia, etc. Some morphological

Yeasts show different modes of vegetative reproduction (sometimes referred to as

Blastoconidia (Bud Formation)

Fig. 7. Monopolar budding in Malassezia pachydermatis (CBS 1879, 3d YPGA)

Fig. 8. Bipolar budding in Nadsonia fulvescens (CBS 2596, 10d YMA)

Fig.9. Multipolar budding in Saccharomyces cerevisiae (CBS 1171, 3d YPGA)

tion of annellidic scars (annellations). In multipolar budding, young cells usually

be stimulated by growth on malt extract agar, cornmeal agar, or yeast morphology

Young cells originate after disarticulation of differentiated hyphae. Young

Hyphae, Pseudohyphae, Chlamydospores, and Endospores

Fig. 10. Fission in Schizosaccharomyces pombe (CBS 356, 3d YPGA)

Dimorphism, the alternate occurrence of unicellular and hyphal and/or

Ascospore morphology is often used for genus delimitation. For most

like, or elongate-fusiform with thread-like appendages. The spore surface may be

Bulleromyces they are longitudinally or obliquely septate (Tremellales type, Fig.

Sugars are tested at a concentration of 2% (w/v) (or 4% for raffinose) in a basal

Fig. 17. Phragmobasidia and hy-

Sugars are filter-sterilized at a 3x concentration and added aseptically to the

Assimilation of carbon compounds can be tested by the auxanographic method or

• Hexoses: (D-glucose, D-galactose, L-rhamnose, L-sorbose).

• Alcohols: (erythritol, ribitol (adonitol), D-mannitol, m-inositol, methanol,

• Organic acids: (succinate, citrate, DL-Iactate, D-gluconate, D-glucuronate, D-

• Glycosides: (a-methyl-D-glucoside, arbutin, salicin).

Carbon Assimilation by Auxanogram

Nitrogen-containing agar: 0.5% w/v (NH4)2S04' 0.1% KH 2P04, 0.05% MgS04' 2%

An inoculum of the strain to be tested is suspended in 5 ml sterile distilled water,

Assimilation of Carbon Compounds in Liquid Medium

Nitrogen Assimilation by Auxanogram

Vitamin requirements are tested by slightly inoculating a test tube containing 5 ml