Cat.

#3360_3364
Cold Shock Expression System pCold™ DNA v1103Da

Table of contents
I. Description..............................................................................................................2

II. Components...........................................................................................................2

III. Vector map..............................................................................................................3

IV. Storage.....................................................................................................................4

V. Protocols..................................................................................................................4

VI. Multiple cloning site...........................................................................................4

VII. Application..............................................................................................................6

VIII. Q&A............................................................................................................................8

IX. Appendix.................................................................................................................9

X. Related Products................................................................................................ 13

XI. References............................................................................................................ 13

Purchaser's Agreement
Customer's order of pCold™ DNAs will be accepted only when the Purchaser's Agreement is signed
by a customer and is attached with an order.
- pCold™ DNAs (hereinafter "PRODUCTS") are covered by U.S. Patents No. 6479260, which are
owned by TAKARA BIO, and the U.S. Patents, 5981280, 6686174, 6333191, which are owned by
University of Medicine & Dentistry of New Jersey and are exclusively licensed to TAKARA BIO.
- HisTag sequences contained in pCold™ I, II and TF DNA are covered by U.S. Patents No. 5284933
and 5310663 which are owned by Hoffmann-La Roche Inc. and are licensed to TAKARA BIO.
- PRODUCTS are for research or laboratory use only. PURCHASER understands and agrees that
PRODUCTS shall not be administered to humans or animals, and shall not be used for pharmaceu-
tical, in vitro diagnostic, or any commercial purposes other than internal research.
- PURCHASER shall not modify pCold™ Vector DNA sequences located between and including the
CspA 3'UTR and Csp A Promoter. The adjacent multicloning site (MCS) is exempt from this restric-
tion.
- PURCHASER shall not utilize any partial sequences from PRODUCTS for the purpose of new plas-
mid construction using the Cold Shock Expression System.
- PURCHASER shall not transfer or sell copies of PRODUCTS, components of PRODUCTS, derivatives
of PRODUCTS, and/or products obtained through the use of PRODUCTS (collectively “DERIVATIVES”)
to any third parties.
Notwithstanding foregoing, PURCHASER may transfer DERIVATIVES solely to a third party which
has already been granted a license to use PRODUCTS for research purpose through purchase of
PRODUCTS from TAKARA BIO, its subsidiaries or its local distributors, provided that PURCHASER
shall enter into a prior separate agreement with TAKARA BIO for the transfer of DERIVATIVES to
said third party.
For this Agreement, please contact to TAKARA BIO's subsidiaries or local distributors.

URL:http://www.takara-bio.com 1
 Cat. #3360_3364
Cold Shock Expression System pCold™ DNA v1103Da

I．Description
Elucidation of protein structure and function is an important subject for post-genome study
and an efficient protein production system is an indispensable fundamental technology
to study these subjects. Expression systems with E. coli as host are extensively used in the
production of recombinant proteins. E. coli expression systems have advantages of ease to
use and low cost. For some genes, however, expression is difficult and expressed proteins are
insoluble.

In order to solve these problems, TaKaRa conducted a joint research with Professor Masayori
Inouye (University of Medicine and Dentistry of New Jersey, USA) to develop an efficient pro-
tein expression vector based on the low-temperature expression gene (cold-shock gene) of E.
coli. This product, pCold™ DNA Series has the above advantages and provides an important
tool for functional and structural analyses as well as other areas in protein research.

＜ Product overview and features ＞

When the culture temperature of E. coli is reduced sufficiently, the growth is temporarily halt-
ed and almost of protein expression decrease, while expression of a group of proteins called
"cold-shock proteins" is specifically induced.
Cold-shock expression vectors, pCold™ DNA I-IV, are designed to perform efficient protein
expression utilizing the promoter derived from cspA gene, which is one of the cold-shock
genes. At the downstream of the cspA promoter, lac operator is inserted so that the expres-
sion is strictly controlled. In addition, 5' untranslated region (5' UTR), translation enhancing
element(TEE), His-Tag sequence, Factor Xa cleavage site, and multicloning site(MCS) are lo-
cated at the downstream of the cspA promoter. As this product utilizes the promoter derived
from E. coli , most E. coli strains can be utilized as an expression host. There are four kinds of
pCold™ vectors, whose arrangements vary in the existence of TEE, His Tag Sequence and Fac-
tor Xa clevage site.

II．Components

Product Name Code Size

pCold™ Vector Set 3360 1 Set
1) pCold™ I DNA 5 μg
2) pCold™ II DNA 5 μg
3) pCold™ III DNA 5 μg
4) pCold™ IV DNA 5 μg
pCold™ I DNA 3361 25 μg
pCold™ II DNA 3362 25 μg
pCold™ III DNA 3363 25 μg
pCold™ IV DNA 3364 25 μg

<Available E. coli host strains>

Most E. coli strains can be used as an expression host for pCold™ DNA series, because
these vectors utilize the promoter of a cold-shock gene, cspA , derived form E. coli .

2 URL:http://www.takara-bio.com
 Cat. #3360_3364
Cold Shock Expression System pCold™ DNA v1103Da

III．Vector map
cspA 3’ UTR
multiple cloning site cspA 3’ UTR
Factor Xa site multiple cloning site
His ・Tag His ・Tag
TEE TEE
cspA 5’ UTR cspA 5’ UTR
lac operator lac operator
cspA promoter cspA promoter
IG IG
13 13
M M

pCold I DNA pCold II DNA

lac I
Amp

Amp
（4,407 bp） （4,392 bp）
la c I

ColE1 ori ColE1 ori

cspA 3’ UTR
multiple cloning site cspA 3’ UTR
TEE multiple cloning site
cspA 5’ UTR cspA 5’ UTR
lac operator lac operator
cspA promoter cspA promoter
IG IG
13 M
13
M

pCold III DNA pCold IV DNA

lac I

lac I
Amp

Amp

（4,377 bp） （4,359 bp）

C o lE 1 o ri ColE1 ori

Fig. 1 pCold™ Vector Map

TEE His Tag Factor Xa Cleavage Site GenBank Accession No.

pCold™ I DNA ＋ ＋ ＋ AB186388
pCold™ II DNA ＋ ＋ ー AB186389
pCold™ III DNA ＋ ー ー AB186390
pCold™ IV DNA ー ー ー AB186391

URL:http://www.takara-bio.com 3
 Cat. #3360_3364
Cold Shock Expression System pCold™ DNA v1103Da

IV．Storage － 20℃ (for shipping and storage)

V．Protocol
How to express the target gene;
The cultivation / induction conditions (culture medium, culture temperature, aeration, timing
of induction, concentration of an inducer, cultivation time after induction) should be exam-
ined for each target protein.
The example of general method is shown below.

1) Insert the target gene to the multicloning site of pCold™ DNA to construct the plasmid for
expression.
2) Transform the E. coli host strain (e.g. BL21) with the plasmid of expression, and select the
transformants on the selection plate including ampicillin.
3) Inoculate the transformant in the medium including 50 - 100 μg/ml of ampicillin, and
culture at 37℃ with shaking.
4) At OD600= 0.4 - 0.5, refrigerate the culture solution at 15℃ and leave to stand for 30 minutes.
5) Add IPTG at the final concentration of 0.1 - 1.0 mM, and continue the culture with shaking
at 15℃ for 24 hours.
6) Collect the cells, and confirm the expression of target protein with SDS-PAGE in soluble
and insoluble fractions or activity assay.

By selection of the E. coli host strains for expression and optimization of cultivation / induc-
tion conditions (culture medium, culture temperature, aeration, timing of induction, concen-
tration of an inducer, cultivation time after induction), the expression level and the degree of
soluble expression are improvable. Moreover, when the expressed protein is insoluble, the
combined use with Chaperone Plasmid Set (Cat. #3340) is effective.

VI．Multiple cloning site

pCold™ I DNA (Cat. #3361)

pCold-F Primer
5' TAACGCTTCAAAATCTGTAAAGCACGCCATATCGCCGAAAGG

TEE His・Tag Factor Xa

CACACTTAATTATTAAGAGGTAATACACCATGAATCACAAAGTG CATCATCATCATCATCAT ATCGAAGGTAGG
SD Met Asn His Lys Val His His His His His His Ile Glu Gly Arg

Nde I Sac I Kpn I Xho I Bam H I Eco R I Hin d III Sal I Pst I Xba I
CATATG GAGCTC GGTACC CTCGAG GGATCC GAATTC AAGCTT GTCGAC CTGCAG TCTAGA TAGGTAATCTCTGCT
His Met Glu Leu Gly Thr Leu Glu Gly Ser Glu Phe Lys Leu Val Asp Leu Gln Ser Arg End

pCold-R Primer
TAAAAGCACAGAATCTAAGATCCCTGCCATTTGGCGGGGATTTTTTTATTTGTTTTCAGGAAATAAATAATCGAT 3'
transcription terminator

4 URL:http://www.takara-bio.com
 Cat. #3360_3364
Cold Shock Expression System pCold™ DNA v1103Da

pCold™ II DNA (Cat. #3362)

5' TAACGCTTCAAAATCTGTAAAGC
pCold-F Primer TEE His・Tag
ACGCCATATCGCCGAAAGGCACACTTAATTATTAAGAGGTAATACACCATGAATCACAAAGTG CATCATCATCATCAT
SD Met Asn His Lys Val His His His His His

Nde I Sac I Kpn I Xho I Bam H I Eco R I Hin d III Sal I Pst I Xba I
CATATG GAGCTC GGTACC CTCGAG GGATCC GAATTC AAGCTT GTCGAC CTGCAG TCTAGA TAGGTAATCTCTGCT
His Met Glu Leu Gly Thr Leu Glu Gly Ser Glu Phe Lys Leu Val Asp Leu Gln Ser Arg End

pCold-R Primer
TAAAAGCACAGAATCTAAGATCCCTGCCATTTGGCGGGGATTTTTTTATTTGTTTTCAGGAAATAAATAATCGAT 3'
transcription terminator

pCold™ III DNA (Cat. #3363)

pCold-F Primer
TEE
5' AAAATCTGTAAAGCACGCCATATCGCCGAAAGGCACACTTAATTATTAAGAGGTAATACACCATGAATCACAAAGTG
SD Met Asn His Lys Val

Nde I Sac I Kpn I Xho I Bam H I Eco R I Hin d III Sal I Pst I Xba I
CATATG GAGCTC GGTACC CTCGAG GGATCC GAATTC AAGCTT GTCGAC CTGCAG TCTAGA TAGGTAATCTCTGCT
His Met Glu Leu Gly Thr Leu Glu Gly Ser Glu Phe Lys Leu Val Asp Leu Gln Ser Arg End

pCold-R Primer
TAAAAGCACAGAATCTAAGATCCCTGCCATTTGGCGGGGATTTTTTTATTTGTTTTCAGGAAATAAATAATCGAT 3'
transcription terminator

pCold™ IV DNA (Cat. #3364)

pCold-F Primer
5' AAAATCTGTAAAGCACGCCATATCGCCGAAAGGCACACTTAATTATTAAGAGGTAATAC
SD

Nde I Sac I Kpn I Xho I Bam H I Eco R I Hin d III Sal I Pst I Xba I
CATATG GAGCTC GGTACC CTCGAG GGATCC GAATTC AAGCTT GTCGAC CTGCAG TCTAGA TAGGTAATCTCTGCT
His Met Glu Leu Gly Thr Leu Glu Gly Ser Glu Phe Lys Leu Val Asp Leu Gln Ser Arg End

pCold-R Primer
TAAAAGCACAGAATCTAAGATCCCTGCCATTTGGCGGGGATTTTTTTATTTGTTTTCAGGAAATAAATAATCGAT 3'
transcription terminator

URL:http://www.takara-bio.com 5
 Cat. #3360_3364
Cold Shock Expression System pCold™ DNA v1103Da

VII．Application
As described below, expression of genes that showed poor expression level or poor solubility
in T7 promoter expression system were attempted with the cold-shock expression system.
The pCold™ I DNA was used as a cold-shock vector and E. coli BL21 strain was used as a host
for expression. Expression from T7 promoter-driven vectors was conducted with the com-
mon procedure of adding IPTG and culturing at 37℃.

(1) The expression became possible.

For human gene A (estimated molecular weight: 31 kDa), expression was not ob-
served in the T7 expression system, but was observed in the cold-shock expression
system (Fig.2).

1 2 3

(kDa) 1 : Negative control

2 : T7 Vector
3 : pCold™ Vector
97.4
66.2

45

31 The target protein

21.5

14.4 Fig. 2 Expression of human gene A was compared using

pCold™ and T7 Vector followed by CBB staining.

(2)The expression level increased.

For thermophile gene B (estimated molecular weight: 30 kDa), solubility was improved
and expression level was increased compared to the T7 expression system (Fig. 3).

T7 pCold™
T S T S
(kDa)
T : total protein
S : soluble protein

97.4
66.2

45

31 Expression level and solubility was improved.

21.5 Fig. 3 Expression of thermophile gene B was compared

with total protein and soluble protein using pCold™
14.4
and T7 Vector followed by CBB staining.

6 URL:http://www.takara-bio.com
 Cat. #3360_3364
Cold Shock Expression System pCold™ DNA v1103Da

(3) The soluble expression level was increased.

For human gene C (estimated molecular weight: 80 kDa), expression was mostly
insoluble in the T7 expression system. In the cold-shock expression system, however,
the expression level of soluble fraction was increased remarkably (Fig. 4).
Cold-shock expression systems are expected to improve the expression level and solu-
bility of the target protein compared to the T7 expression system.

T7 pCold™

(kDa) T S T S
T : total protein
S : soluble protein

97.4
Soluble expression level increased.
66.2

45

31

21.5

14.4 Fig. 4 Expression of human gene C was compared using

pCold™ and T7 Vector in soluble or insoluble
fraction.

(4) Comparative study with pulse-labeling experiment

Human gene D (estimated molecular weight: 12 kDa) was pulse-labeled to compare
both expression systems (Fig. 5). In the T7 expression system, E. coli proteins other
than the target protein were also labeled. In contrast, most of labeled proteins in the
cold-shock expression system were the expression product of the target gene, indicat-
ing that the expression of the target gene was
specifically induced.

T7 pCold™
0 24 0 24 Time after Induction (hrs)

Most of the labeled proteins were

desired from the target gene.

Fig. 5 Pulse labeling of human gene D

URL:http://www.takara-bio.com 7
 Cat. #3360_3364
Cold Shock Expression System pCold™ DNA v1103Da

VIII．Q&A

Q1 Why does pCold™ DNA allow efficient expression of proteins at low temperatures?
A1 pCold™ DNA, which was developed based on a cspA gene that encodes a cold shock
protein, contains the cspA promoter, 5’ UTR, and the N-terminus region of CspA.
It is possible to achieve transcription from the cspA promoter at 37℃; however,
translation is not efficient because of the extreme instability of the downstream 5’ UTR
at 37℃. By lowering the temperature from 37℃ to 15℃, the structure of 5’ UTR becomes
highly stable. This results in improved translation efficiency, allowing extremely efficient
protein synthesis at a low temperature (15℃)1).
Moreover, when the mRNA that encodes some of the N-terminus of CspA is formed by
transcription, ribosomes are preferentially used for translation of the formed mRNA and
rarely supplied for translation of other mRNAs (ribosome trapping)2).
As described above, pCold™ DNA enables extremely efficient protein expression at low
temperatures by virtue of a cspA promoter that does not cause decrease in transcriptional
activity at low temperatures, structural stability of 5’ UTR at low temperatures, and
ribosome trapping. Although protein expression at low temperatures has been performed
before, innovative features of pCold™ DNA provide a suitable, unique expression vector
for protein expression at low temperatures.
1) Mitta, M., et al. (1997) Mol. Microbiol ., 26, 321-335.
2) Xia, B., et al. (2001) J. Biol. Chem., 276, 35581-35588.

Q2 What should be considered if no expression is observed?

A2 Consider the type of vector, host, culture, and induction conditions.
・ Change the type of vector (pCold™ I to IV DNA). In some cases, proteins can be
expressed by attaching the TEE or His-Tag sequence to the N-terminus.
・ Examine the frequency of codon usage. Some genes are influenced by the frequency
of codon usage. In some cases, the expression level can be improved by using
commercially available strains of E. coli that support rare codons (such as Rosetta™2).
・ Expression may be influenced by pre-culture and storage conditions of expression
clones (see Q8).
・ Consider the timing for cold-shock induction. The expression level sometimes decreases
if induction is late. In this case, early induction may improve the expression level.
・ The cooling process prior to addition of IPTG should be sufficient (normally 30 min
or longer at 15℃). The culture process following addition of IPTG should also be
performed at 15℃.

8 URL:http://www.takara-bio.com
 Cat. #3360_3364
Cold Shock Expression System pCold™ DNA v1103Da

Q3 What should be considered if expressed proteins are insolubilized?

A3 Appropriate culture and induction conditions are different for each target protein.
Consider culture and induction conditions, and the strain of E. coli used as a host and the
extraction method in reference to the following recommendations:
・ Change the timing for induction (examine between early and late logarithmic phases).
・ Change the concentration of the inducer (IPTG) (0.1 to 1 mM).
・ Consider the temperature and duration of culture following induction (15℃ for 24 hours
is usually appropriate).
・ Consider the strain of host E. coli and use of chaperone. Try chaperone co-expression
using the Chaperone Plasmid Set or commercially available strains of host E. coli (such
as Origami™) that facilitate solubilization of expressed proteins.
・ Change the extraction method. Some proteins are not sufficiently solubilized with
commercially available E. coli -lysis agent. It is also effective to perform sonication with
0.1 to 1% of detergent (octylglycoside, NP-40, or Triton X-100).

Q4 What molecular weight range of proteins can be expressed?

A4 We have expressed proteins from several kDa to 100 kDa.

Q5 Which species of genes have been expressed so far?

A5 We have expressed genes of E. coli , thermophiles, hyperthermophiles, human, mouse,
and plants.

Q6 What are the criteria for selecting pCold™ vectors?

A6 The TEE sequence, which is contained in pCold™ I, II, and III DNA, facilitates translation of
the target gene. Proteins expressed using vectors with the His-Tag sequence (pCold™ I, II
DNA) can be purified with Ni columns. If you do not desire to attach excess amino acids
sequences to the N-terminus of the target protein, it is recommended to use pCold™ I
DNA that allows cleavage of the Tag sequence with Factor Xa, or pCold™ IV DNA that does
not possess the TEE and Taq sequences.

Q7 What is the expression level for 1 L of medium?

A7 The expression level usually ranges from several mg to several tens of mg/L, although it is
different for each target gene. An approximately 3-L culture can recover purified proteins
in the mg scale, if expression of the target protein can be detected by SDS-PAGE followed
by CBB staining.

Q8 Is it possible to store E. coli that was transformed with the pCold™ vector containing a
target gene on a plate at 4℃?
A8 It is not recommended to store E. coli on a plate at 4℃. If E. coli that was transformed with
the pCold™ vector into which a target gene was inserted is stored on a plate at 4℃, the
target protein may leak and the pCold™ vector cannot be maintained. It is recommended
to remove the bacterium from the plate as soon as possible to prepare a glycerol stock
and store the stock at -80℃.

URL:http://www.takara-bio.com 9
 Cat. #3360_3364
Cold Shock Expression System pCold™ DNA v1103Da

Q9 How should one select from among the 5 chaperone plasmids to perform coexpression
with the Chaperone Plasmid Set?
A9 Expression systems based on pCold™ vectors tend to produce better results by
coexpression with chaperone teams containing the tig sequence. It is recommended to
start by studying coexpression with pG-Tf2 or pTf16.

Q10 To what extent does OD600 increase in the case of culture at 15℃ for 24 hours after
induction?
A10 OD600 of culture using this system is different for each strain of host E. coli and each type
of inserted target genes. OD600 is around 1.2 using BL21 as a host.

Q11 Which strains of host E. coli have been used so far?

A11 We have expressed many protein using BL21 as a host. Origami™ and Rosetta™ from
Novagen are also available. It is recommended to start with BL21, while most of E. coli
strains can be used as hosts for pCold™ vectors that use the cspA promoter derived from
E. coli .

Q12 The pCold™ vector expression system induces expression of target proteins by culturing
at low temperatures. Why is IPTG added prior to induction?
A12 Since pCold™ vectors use the promoter of a cold-shock protein, they hardly express
target proteins at 37℃ intrinsically. However, some inserts induce a small amount
of leakage. Therefore, we employed a regulatory system based on the lac operon
supplementary.
In the case of pET vectors that turn expression on and off only on the addition of
IPTG, whether expression is regulated or not without addition of IPTG is an important
question. In the case of pCold™ vectors that control induction by changing temperature,
whether expression is regulated by the lac operon or not after the temperature is
lowered is not important. Nevertheless, it is necessary to add IPTG, since any regulation
may cause inconvenience.
The strength of regulation by the lac operon is different for each type of host E. coli . It
is considered that those that have lac Iq (such as JM109) and those that are regulated
only with lac I (such as BL21) inherent to E. coli have different strengths of regulation.
However, it may not necessary to select bacterial strains with lac Iq, since the strength of
regulation after lowering the temperature is not important.

10 URL:http://www.takara-bio.com
 Cat. #3360_3364
Cold Shock Expression System pCold™ DNA v1103Da

IX．Appendix
Expression Plasmid Construction - Example using the thioredoxin gene
1) Overview of pCold™ expression vector construction
a) Select a restriction enzyme site such that the DNA fragment to be inserted will have
the sequence of its target gene positioned in a continuous reading frame with that
of the pCold™ Vector.
b) Prepare the DNA fragment to be inserted into the vector.
c) Cut the vector with the desired restriction enzymes.
d) After ligating the digested vector with the insert DNA, transform it into an appropri-
ate E. coli strain.
e) Prepare purified plasmid from the appropriate colonies containing the target insert.
f) Purified plasmid may be used for protein expression experiments.
There are several ways in which the insert DNA may be prepared, including PCR ampli-
fication, excision of a cloned gene by restriction enzyme digestion, and gene synthe-
sis. Alternatively, In-Fusion™ HD PCR Cloning Kit (Clontech Lab., Inc.) is available for
directional cloning easily and rapidly, in case without proper restriction enzyme site in
a target gene also.
Presented below is an example experiment which uses PCR amplification as the insert
DNA preparation method.

2) Example Plasmid preparation for expression of the E. coli thioredoxin gene

a) Guidelines for primer design
Protocol and points to consider when designing primers:
i) Select two restriction enzymes whose sites are contained within the MCS of pCold™
that have additionally been verified not to cut the insert DNA sequence.
ii) Construct a primer for the target sequence, adding the selected restriction sites
from Step 2a) i) to the 5' terminus of each primer. Adjust the base number between
the insert DNA sequence and N-terminal restriction sites such that the frame of
the insert matches the reading frame of pCold™. "Either a restriction site or a stop
codon can be directly added to the C-terminus if required.").
iii) Add four or more bases to sequences directly flanking the restriction sites. Most
restriction enzymes require that several bases lie outside of the recognition site for
efficient digestion to occur. Without the presence of this extra sequence, digestion
efficiency will be lowered.

[Example - Primer Design]

Insertion of the thioredoxin gene into the pCold™ Nde I/Xho I MCS restriction en-
zyme cloning sites
Nde I site: Primer 1 (normal direction primer)
Nde I
――――――
5'-GCCGCATATGAGCGATAAAATTATTCAC
thioredoxin derived sequence＊1
Xho I site: Primer 2 (reverse direction primer)
Xho I
――――――
5'- GCCGCTCGAGTTAGGCCAGGTTAGCGTC
thioredoxin derived sequence＊2
＊ 1 : When using Nde I site, adjust the position of the thioredoxin gene start co-
don (ATG) to correspond with the ATG site of Nde I
＊ 2 : Complementary Thioredoxin sequence with stop codons

URL:http://www.takara-bio.com 11
 Cat. #3360_3364
Cold Shock Expression System pCold™ DNA v1103Da

b) Insert DNA Preparation

[Example - PCR amplification of the thioredoxin gene (- 350 bp)]

i) PCR amplification of the insert DNA.
Prepare the reaction mixture by combing the following reagents. (use of a PCR
Enzyme, such as PrimeSTAR® HS DNA Polymerase (Cat. #R010A) is recommended).

Template DNA (5 ng)＊1 1 μl

5X PrimeSTAR® Buffer＊2 10 μl
dNTP Mixture (2.5 mM each)＊2 4 μl
Primer 1 (10 - 50 pmol/μl) 1 μl
Primer 2 (10 - 50 pmol/μl) 1 μl
PrimeSTAR® HS DNA Polymerase (5 units/μl) 0.5 μl
Sterilized distilled water 32.5 μl
Total 50 μl
＊ 1 : For plasmid DNA, use 1 - 10 ng; for cDNA or genomic DNA, use 50 -
500 ng.
＊ 2 : 5X PrimeSTAR® Buffer and dNTP Mixture is supplied with Prime-
STAR® HS DNA Polymerase (Cat. #R010A).

Amplify the insert DNA using the following PCR cycling parameters (30 cycles):
When using Takara Thermal Cycler Dice (Cat. #TP600)

98℃, 10 sec.
55℃, 30 sec. 30 cycle
72℃, 1 min.

ii) Verification of amplified product

Verify that the amplified insert DNA fragment is a single band of the correct
expected size by performing agarose gel electrophorsis using 5 μl of the PCR
product.

iii) PCR product purification

For DNA which is amplified and appears as a single band, phenol/chloroform
extraction is suggested to remove PrimeSTAR® HS DNA Polymerase. When
multiple PCR products are generated, first isolate the band of interest from the
agarose gel and then further purify using or TaKaRa RECOCHIP (Cat. #9039) or
other similar method.

iv) Restriction enzyme digestion of amplified products

Digest the purified insert DNA with Nde I and Xho I restriction enzymes.
1) Prepare the following restriction enzyme digest mixture:
Insert DNA 0.5 - 1 μg
10X K Buffer 3 μl
Nde I (10 units/μl) 1μl
Xho I (10 units/μl) 1 μl
Sterilized distilled water up to 30 μl
Total 30 μl
2) Incubate at 37℃ for 1 hour.
3) Ethanol precipitate the digested DNA to purify it.*

12 URL:http://www.takara-bio.com
 Cat. #3360_3364
Cold Shock Expression System pCold™ DNA v1103Da

4) Verify fragment purity using agarose gel electrophoresis or by measur-

ing absorbance (OD260).

＊ : Both Nde I and Xho I can be inactivated by ethanol precipitation.

However, when restriction enzymes which are not completely
inactivated by ethanol precipitation are used, the digestion reac-
tion should be treated with phenol. In addition, further purification
and recovery of digested DNA by agarose gel electrophoresis can
completely remove all short fragments generated by the digestion.

[Ethanol precipitation protocol]

1) Add 3 M sodium acetate, pH 5.2, to the restriction enzyme digest mix-
ture in a 1:10 ratio
(e.g. 3 μl 3M sodium acetate added to 30 μl digest mixture), and mix
well.
2) Add 2 - 2.5 times the volume of 100% cold ethanol to the above solu-
tion (e.g. add 66 μl 100% cold ethanol to 33 μl sodium acetate-digest
mixture), and mix well. Chill at -20℃ for 30 minutes.
3) Centrifuge at 4℃, 12,000 rpm, for 10 -15 minutes. Discard the supernatant.
4) Add 70% cold ethanol and centrifuge again at 4℃, 12,000 rpm, for 5
minutes.
5) Discard the supernatant and air dry.
6) Dissolve the precipitate in 10 - 50 μl of TE buffer.

c) Restriction Enzyme Digestion of pCold™ DNA

Digest pCold™ with the same restriction enzymes that were used for the diges-
tion of amplified insert DNA, and purify. Dissolve the purified DNA in TE buffer,
and measure the DNA concentration by measuring absorbance.

i) Prepare the following reaction mixture:

pCold™ Vector 1 μg
10 X K Buffer 3 μl
Nde I (10 units/μl) 1 μl
Xho I (10 units/μl) 1 μl
Sterilized distilled water up to 30μl
Total 30 μl
ii) Incubate at 37℃ for 1 - 2 hours.
iii) Ethanol precipitate the digested vector DNA to purify.
iv) Dissolve the precipitated vector DNA pellet in TE buffer.
v) Measure the absorbance (OD260) and calculate the DNA concentration. For
dsDNA (double-stranded DNA), calculate the DNA concentration assuming
1 OD260 = 50 μg/ml.
vi) Adjust the DNA concentration to100 ng/μl.

＊ After digestion with restriction enzymes, the vector DNA may be de-phos-
phorylated with E. coli Alkaline Phosphatase (BAP)(Cat. # 2120A), or Calf
Intestinal Alkaline Phosphase (CIAP (Cat. #2250A). Note that de-phosphory-
lation is essential if only a single restriction enzyme was used for digestion.
In addition, complete removal of short fragments generated by restriction
enzyme digestion is recommended. Purify the vector from any resulting
short fragments using agarose gel electrophoresis, then further isolate and
purify the vector from the gel.

URL:http://www.takara-bio.com 13
 Cat. #3360_3364
Cold Shock Expression System pCold™ DNA v1103Da

d) Ligation of the DNA fragment and pCold™ DNA vector and transformation

i) Ligation reaction
Mix together the digested pCold™ and the insert DNA fragment, and use
this mixture for performing a ligation reaction using Takara's DNA Ligation
Kit <Mighty Mix> Cat. # 6023). A 1:3-1:10 molar ratio of vector:insert DNA is
recommended.

Prepare the following ligation reaction mixture on ice:

Digested pCold™ DNA ; 100 ng (- 0.03 pmol) 1 μl
Insert DNA fragment (0.1 - 0.3 pmol) 4 μl
Ligation Mix (from DNA Ligation Kit <MightyMix>) 5 μl
Total 10 μl
Incubate at 16℃ for 1 hour.

ii) Transformation
Transform 100 μl E. coli JM109 Competent Cells (Cat. # 9052) with 10 μl
ligated DNA mixture. Plate transformed cells on LB-ampicillin agar (100 μg/ml
ampicilin) and grow at 37℃ overnight.

1) Thaw E. coli JM109 competent cells on ice just before use.

2) Add 10 μl ligated DNA mixture to 100 μl competent cells, and mix gently.
3) Chill on ice for 30 minutes.
4) Incubate at 42℃ for 45 seconds.
5) Chill on ice for 1-2 minutes.
6) Add warm (37℃) SOC medium to a final volume of 1 ml.
7) Shake at 37℃ for 1 hour.
8) Plate on LB-ampicillin agar (100μg/ml ampicilin) and incubate at 37℃
overnight.

e) Plasmid preparation and verification

Inoculate a colony obtained in Step 4 ii) above into LB-ampicillin broth (100μg/ml
ampicilin) and incubate with gentle shaking at 37℃ overnight. Use the result-
ing culture for plasmid maxi- or mini-preps.
After obtaining isolated plasmid DNA, digest the plasmid with the restric-
tion enzymes Nde I and Xho I. Verify insertion of the correct DNA fragment by
checking insert DNA fragment size using agarose gel electrophoresis.
When the vector construct has been verified, confirm the sequence of the
inserted DNA fragment by sequencing analysis. This plasmid can be used as
an expression plasmid for subsequent experiments. The following primers'
sequence can be used for sequencing.

Upstream primer : pCold™-F 5'-ACGCCATATCGCCGAAAGG

Downstream primer : pCold™-R 5'-GGCAGGGATCTTAGATTCTG

This primer pair cannot be used as PCR primers. When it is used in PCR reac-
tion, the extra band of approximacely 500 bp appears.

14 URL:http://www.takara-bio.com
 Cat. #3360_3364
Cold Shock Expression System pCold™ DNA v1103Da

X．Related Products

< For soluble expression of recombinant protein >

Chaperone Competent Cells BL21 Set (Cat. #9120)
Chaperone Competent Cell pG-KJE8/BL21 (Cat. #9121)
Chaperone Competent Cell pGro7/BL21 (Cat. #9122)
Chaperone Competent Cell pKJE7/BL21 (Cat. #9123)
Chaperone Competent Cell pG-Tf2/BL21 (Cat. #9124)
Chaperone Competent Cell pTf16/BL21 (Cat. #9125)
TaKaRa Competent Cell BL21 (Cat. #9126)
Chaperon Plasmid Set (Cat. #3340)

< E. coli Competent Cells >

E. coli HST08 Premium Competent Cells (Cat. #9128)
E. coli DH5α Competent Cells (Cat. #9057)
E. coli JM109 Competent Cells (Cat. #9052)
E. coli HST08 Premium Electro-Cells (Cat. #9028)
E. coli DH5α Electro-Cells (Cat. #9027)
E. coli JM109 Electro-Cells (Cat. #9022)

< Other >

IPTG (Isopropyl-β-D-thiogalactopyranoside) (Cat. #9030)
pCold™ TF DNA (Cat. #3365)
pCold™ ProS2 DNA (Cat. #3371)

XI. References

1) Masayori Inouye et. al . (2004) Nature Biotechnology 22, 7, 877-882.

2) Xia B, Etchegaray JP and Masayori Inouye (2001) J. Biol. Chem . 276, 38, 35581-35588.
3) Kunitoshi Yamanaka, Masanori Mitta and Masayori Inouye (1999) J. Bacteriology
181, 20, 6284-6291.
4) Li Fang,Yan Hou and Masayori Inouye (1998) J. Bacteriology 180, 1, 90-95.
5) Li Fang,Weining Jiang, Weonhye Bae and Masayori Inouye (1997) Molecular Micro-
biology 23(2), 355-364.
6) Weining Jiang,Li Fang and Masayori Inouye (1996) J. Bacteriology 178, 16, 4919-4925.
7) Hiroyuki Tanabe, Joel Goldstein, Maozhou Yang and Masayori Inouye (1992) J. Bac-
teriology 174, 12, 3867-3873.

URL:http://www.takara-bio.com 15
 Cat. #3360_3364
Cold Shock Expression System pCold™ DNA v1103Da

NOTICE TO PURCHASER: LIMITED LICENSE

[L13a] pCold™ vectors

This product is covered by the claims of U.S. Patent No.5,981,280, 6,686,174 and their foreign
counterpart patent claims, assigned to the UMDNJ.

[L16] His-Tag Sequence

This product is covered by the claims of U.S. Patent No. 5,284,933, 5,310,663 and their foreign
counterpart patent claims.
Protein Purification Technology of His-Tag used in some of pCold vectors is licensed from
Hoffmann-La Roche, Inc., Nutley, NJ and/or Hoffmann-La Roche Ltd., Basel, Switzerland and is
provided only for the use in resaerch. Information about licenses for commercial use is available
from QIAGEN GmbH, Qiagen Strasse 1, D-40724 Hilden, Germany.

[M9] pCold™ vectors

This product is covered by the claims of U.S. Patent No. 6,479,260 and its foreign counterpart pat-
ent claims.

NOTE : This product is for research use only. It is not intended for use in therapeutic or diagnostic
procedures for humans or animals. Also, do not use this product as food, cosmetic, or
household item, etc.
Takara products may not be resold or transferred, modified for resale or transfer, or used
to manufacture commercial products without written approval from TAKARA BIO INC.
If you require licenses for other use, please contact us by phone at +81 77 543 7247 or
from our website at www.takara-bio.com.

16 URL:http://www.takara-bio.com