Veterinary Parasitology 223 (2016) 210–213

Contents lists available at ScienceDirect

Veterinary Parasitology
journal homepage: www.elsevier.com/locate/vetpar

Short communication

Aberrant Ancylostoma sp. in the brain of a dog

Amie Perry ∗ , Sriveny Dangoudoubiyam, Melanie Bolling, Aline Rodrigues-Hoffmann
Department of Veterinary Pathobiology, College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, TX 77843, USA

a r t i c l e i n f o a b s t r a c t

Article history: A 14-month-old, male American Bulldog presented to Texas A&M University Veterinary Medical Teach-
Received 4 November 2015 ing Hospital in August of 2012 for anorexia, hydrophobia and gradually worsening neurologic signs.
Received in revised form 1 April 2016 Grossly hemorrhage on the left side of the caudal cerebrum and cerebellum was observed and histolog-
Accepted 18 April 2016
ically corresponded with necrohemorrhagic and lymphoplasmacytic encephalitis associated with adult
nematodes. Based on morphology and molecular analysis, these were identified as Ancylostoma sp.
Keywords:
© 2016 Elsevier B.V. All rights reserved.
Aberrant
Ancylostoma
Canine
Encephalitis

A 14-month-old, male American Bulldog presented to the Texas Due to neurologic signs, including apparent hydrophobia, and
A&M University Veterinary Medical Teaching Hospital in August of lack of vaccination, rabies was suspected. No diagnostic imaging
2012 for a two-day history of anorexia, one-day history of apparent was performed. The patient was euthanized and the body submit-
hydrophobia or dysphagia (staring at the water bowl but refusing ted for limited post mortem examination, which only requested
to drink) and gradually worsening lethargy and depressed men- brain examination and submission for rabies testing.
tation. Approximately ten days prior to presentation right pelvic On postmortem examination, there was extensive hemorrhage
limb lameness was observed and two days later the owner reported of the left side of the brainstem from the caudal colliculi to the
that the left eye was “bloodshot.” The patient lived in a suburban caudal cerebellar peduncles (Fig. 1). The appropriate sample was
environment indoors with one other dog but was allowed out- collected and submitted for rabies testing at the Texas Depart-
doors including wooded areas and an adjacent city park for several ment of State Health Services and the remaining brain was fixed
hours each day. The patient had received no vaccinations and par- in 10% neutral buffered formalin for histologic evaluation. A neg-
asite control and treatment history was not provided in the clinical ative result was reported for rabies testing. The fixed sections of
history. On presentation, the patient was approximately 8% dehy- cerebrum, brainstem and cerebellum were routinely processed,
drated, quiet, dull, and depressed with generalized ataxia, head paraffin embedded, sectioned at 5um, and stained with hema-
pressing, and photophobia. Temperature, heart rate, and respira- toxylin and eosin. Sections of the cerebrum were unremarkable
tory rate were within normal limits. Serum chemistry analysis, on microscopic examination. In the cerebellum and brainstem
complete blood count, and urinalysis were within normal limits. there was marked local necrosis and loss of gray and white mat-
Differential diagnoses for neurologic signs in a young adult, ter. The sections had extensive hemorrhage mixed with gitter
unvaccinated dog include trauma or congenital disease, as well as cells, fibrin, edema, lymphocytes, plasma cells, fewer neutrophils,
infectious agents including rabies virus and canine distemper virus, rare eosinophils and multinucleate giant macrophages surround-
protozoa such as Neospora caninum or Toxoplasma gondii, fungi such ing cross and tangential sections of adult nematodes (Figs. 2–4
as Aspergillus spp., or Cryptococcus neoformans, and migration of ). Throughout the remaining parenchyma there was significant
larval helminths. Another possible cause for neurologic signs in a edema and wide perivascular cuffs of lymphocytes and plasma
dog is metabolic disease, such as hepatic encephalopathy. cells with scattered eosinophils with similar inflammatory infil-
trates extending into the meninges. Occasionally vascular walls
were brightly eosinophilic and hyaline (fibrinoid necrosis). There
were scattered spheroids and neurons with central chromatoly-
sis. Nematodes were approximately 500 ␮m in diameter with an
∗ Corresponding author at: Department of Veterinary Pathobiology, College of Vet- approximately 15 ␮m smooth, eosinophilic hyaline cuticle, vac-
erinary Medicine and Biomedical Sciences, Texas A&M University, MS 4467 TAMU, uolated low lateral cords divided into sublaterals, pseudocoelom,
College Station, TX 77843-4467, USA. bulbous internal cuticular ridges, platymyarian musculature, ovary,
E-mail address: aperry@cvm.tamu.edu (A. Perry).

http://dx.doi.org/10.1016/j.vetpar.2016.04.023
0304-4017/© 2016 Elsevier B.V. All rights reserved.
 A. Perry et al. / Veterinary Parasitology 223 (2016) 210–213 211

Fig. 1. Brainstem at the level of the mesencephalon. Multifocal hemorrhage and Fig. 4. Brainstem. 400× magnification photomicrograph. Hematoxylin and eosin.
necrosis. Lesions in the brainstem were characterized by necrosis and hemorrhage with
numerous gitter cells.

Fig. 2. Brainstem. 20× magnification photomicrograph. Hematoxylin and eosin.

Necrohemorrhagic encephalitis with intralesional adult Ancylostoma spp.

Fig. 5. Agarose gel electrophoresis showing amplification of the rRNA gene

sequence. Genomic DNA from formalin fixed tissue curls of brain (patient) and intes-
tine (positive control) sections showing hookworm like nematodes was used as
template. L: 100 bp molecular ruler, N: negative control, C: patient case, P: positive
control.

Generic primers were custom designed to amplify the riboso-

mal RNA sequence of hookworm species (Table 1). Genomic DNA
isolated from formalin-fixed paraffin embedded tissue curls of the
brain from the patient, and positive control tissue that showed
presence of nematode sections on the intestine was used as tem-
plate for polymerase chain reaction (PCR). Conventional PCR was
performed using Phusion high-fidelity (NEB, Ipswich, MA) poly-
merase and amplifications were performed on T100 Thermal Cycler
(Bio-Rad, Hercules, CA). Amplified PCR products were sequenced,
and a blast search against sequences in GenBank was performed to
confirm the identity of the nematode in the brain of this patient.
Fig. 3. Brainstem. 200× magnification photomicrograph of an adult Ancylostoma
Both primer pairs were tested on the patient sample and posi-
spp. from the same section as Fig. 2. Cuticle, lateral cord, and intestine containing tive control. Successful amplification of 366 bp product with primer
host erythrocytes indicated by arrow, arrowhead, and star, respectively. pair-1 was achieved only using positive control tissue as template.
The 293 bp product using primer pair-2 was successfully amplified
using the patient sample as template (Fig. 5). Since both primers
and a large central intestine composed of multinucleate cells with target the ribosomal RNA gene, no further attempts were made to
a prominent brush border whose lumen contained a moderate amplify the alternate targets. Blast search of the sequence of both
amount of host blood (Fig. 3). Based on these morphologic features, PCR products indicated that the nematode seen in the brain tissue
the nematode was identified as an adult female Ancylostoma sp. sections was Ancylostoma caninum.
212 A. Perry et al. / Veterinary Parasitology 223 (2016) 210–213

Table 1
Generic primer sequences custom designed using the published hookworm ribosomal RNA gene sequences available in GenBank. The table shows primer sequences, annealing
temperature, anticipated product sizes, and the rRNA gene region amplified by respective primer pairs.

Primer combination Primer sequence Annealing temperature Product size (bp) Region of rRNA
used (◦ C) gene amplified

Pair-1 5 - ttgatcctgagaaaccaacg-3 56 366 18S and ITS1

HW-Fw-1 HW-Rv-1 5 -accgatccatcgctgaag-3
Pair-2 5 -tggtgaaattttgaacgcata-3 54 293 5.8S and ITS2
HW-Fw-2 HW-Rv-2 5 - ggttgcattgcaaataacag −3

To the authors’ knowledge this is the first report of an adult portal vein (Katchanov and Nawa, 2010). Nematode larval migra-
hookworm in the central nervous system of any animal. Although tion through central nervous system tissues may result in various
the mechanism for introduction of adult Ancylostoma sp. into neurologic signs, depending on the location of the main lesions.
the brain cannot be explained, the hemorrhage and inflamma- These signs include depression, ataxia, seizures, paresis, hyperes-
tory reaction surrounding the nematodes favors their presence at thesia, abnormal reflex responses, and blindness. Gross lesions are
this location as the cause of the neurologic signs in this dog. This variable, ranging from inapparent (Snook et al., 2009) to large areas
nematode was determined to be from the order Strongylida based of parenchymal necrosis, loss, and hemorrhage (Denk et al., 2009).
upon its intestine, which is composed of few multinucleated cells Microscopic lesions are often more severe than gross lesions, and
with a prominent brush border and further classified into family frequently include sections of the larvae, facilitating diagnosis of
Ancylostomidae based on the lack of longitudinal cuticular ridges a specific cause for the central nervous system clinical signs and
characteristic of Trichostrongyles, and lack of the coelomyarian lesions. In the case of the patient reported here, gross and histologic
musculature and accessory hypodermal cords of Metastrongyles. lesions were evident, including hemorrhage in the brainstem, and
Based on the division of the lateral cords into sublaterals, the bul- cross sections of adult nematodes within the areas of inflammation
bous appearance of the internal cuticular ridge, and the presence and hemorrhage but confirmation of the causative organism was
of multiple sections of ovary it was determined that the nematode made utilizing polymerase chain reaction.
was an adult female Ancylostoma sp.
Cerebrospinal nematodiasis involving adult parasites is uncom- Conflicts of interest
monly reported in the central nervous system of veterinary species.
Among the most commonly reported are Halicephalobus gingivalis The author(s) declared no potential conflicts of interest with
in horses (Eydal et al., 2012; Hermosilla et al., 2011) and Pare- respect to the research, authorship, and/or publication of this arti-
laphostrongylus tenuis predominantly in camelids. In reports from cle.
Chile, adult Gurltia paralysans have been found in the spinal cord
of cats and infection is associated with chronic pelvic limb para- Funding
paresis (Moroni et al., 2012). Horses with central nervous system
halicephalobiasis commonly show neurologic signs depending on The author(s) received no financial support for the research,
the site of infection including ataxia, recumbency, hypermetria, and authorship, and/or publication of this article.
hyperesthesia (Eydal et al., 2012; Hermosilla et al., 2011). These
neurologic signs are associated with rapid proliferation of the para-
References
site within the central nervous system and the resultant destruction
and granulomatous inflammation induced by the parasites. P. tenuis Denk, D., Matiasek, K., Just, F.T., Hermanns, W., Baiker, K., Herbach, N., Steinberg, T.,
has also been reported to cause meningomyelitis or encephalitis in Fischer, A., 2009. Disseminated angiostrongylosis with fatal cerebral
haemorrhages in two dogs in Germany: a clinical case study. Vet. Parasitol.
other wild ruminants (Nagy, 2004), and domestic animals includ-
160, 100–108.
ing cattle (Mitchell et al., 2011), horses (Tanabe et al., 2010; Tanabe Du Plessis, C.J., Keller, N., Millward, I.R., 2007. Aberrant extradural spinal migration
et al., 2007), and guinea pigs (Southard et al., 2013), and rarely of Spirocerca lupi: four dogs. J. Small Anim. Pract. 48, 275–278.
is found in other locations (Reinstein et al., 2010). In its defini- Dvir, E., Perl, S., Loeb, E., Shklar-Hirsch, S., Chai, O., Mazaki-Tovi, M., Aroch, I.,
Shamir, M.H., 2007. Spinal intramedullary aberrant Spirocerca lupi migration in
tive host, the white-tailed deer (Odocoileus virginianus), larvae of 3 dogs. J. Vet. Intern. Med. 21, 860–864.
P. tenuis enter the dorsal horn of the spinal cord, mature to adults, Eydal, M., Bambir, S.H., Sigurdarson, S., Gunnarsson, E., Svansson, V., Fridriksson, S.,
and migrate into the subarachnoid space. In animals other than Benediktsson, E.T., Sigurdardottir, O.G., 2012. Fatal infection in two Icelandic
stallions caused by Halicephalobus gingivalis (Nematoda: Rhabditida). Vet.
the definitive host, the larvae aberrantly migrate in the spinal cord, Parasitol. 186, 523–527.
resulting in inflammation and disease (Nagy, 2004). In halicephalo- Hermosilla, C., Coumbe, K.M., Habershon-Butcher, J., Schoniger, S., 2011. Fatal
biasis and parelaphostrongyliasis gross lesions may range from equine meningoencephalitis in the United Kingdom caused by the
panagrolaimid nematode Halicephalobus gingivalis: case report and review of
inapparent (Hermosilla et al., 2011) to varying degrees of edema the literature. Equine Vet. J. 43, 759–763.
and hemorrhage in affected tissues (Eydal et al., 2012; Tanabe et al., Katchanov, J., Nawa, Y., 2010. Helminthic invasion of the central nervous system:
2007) and in some cases of parelaphostrongyliasis, discrete nodules many roads lead to Rome. Parasitol. Int. 59, 491–496.
Lunn, J.A., Lee, R., Smaller, J., MacKay, B.M., King, T., Hunt, G.B., Martin, P.,
in the meninges (Mitchell et al., 2011).
Krockenberger, M.B., Spielman, D., Malik, R., 2012. Twenty two cases of canine
The majority of reports of central nervous system nematodiasis neural angiostronglyosis in eastern Australia (2002–2005) and a review of the
in animals are of larval migration. Organisms reported in the central literature. Parasites Vectors 5, 70.
Mitchell, K.J., Peters-Kennedy, J., Stokol, T., Gerhold, R.W., Beckstead, R.B., Divers,
nervous system of dogs include Baylisascaris procyonis (Rudmann
T.J., 2011. Diagnosis of Parelaphostrongylus spp. infection as a cause of
et al., 1996), Angiostrongylus vasorum (Denk et al., 2009; Negrin meningomyelitis in calves. J. Vet. Diagn. Invest. 23, 1097–1103.
et al., 2008), Angiostrongylus cantonensis in Australia (Lunn et al., Moroni, M., Munoz, P., Gomez, M., Mieres, M., Rojas, M., Lillo, C., Aguirre, F.,
2012), Dirofilaria immitis, Spirocerca lupi (Du Plessis et al., 2007; Dvir Acosta-Jamett, G., Kaiser, M., Lindsay, D.S., 2012. Gurltia paralysans
(Wolffhugel, 1933): description of adults and additional case reports of
et al., 2007), and Strongyloides sp. (Snook et al., 2009). A common neurological diseases in three domestic cats from southern Chile. Vet.
route of migration into the central nervous system by larval nema- Parasitol. 184, 377–380.
todes and cestodes is hematogenous spread after penetration of the Nagy, D.W., 2004. Parelaphostrongylus tenuis and other parasitic diseases of the
ruminant nervous system. Vet. Clin. North Am. Food Anim. Pract. 20, 393–412,
intestinal tract and entrance into the systemic circulation via the viii.
 A. Perry et al. / Veterinary Parasitology 223 (2016) 210–213 213

Negrin, A., Cherubini, G.B., Steeves, E., 2008. Angiostrongylus vasorum causing Southard, T., Bender, H., Wade, S.E., Grunenwald, C., Gerhold, R.W., 2013. Naturally
meningitis and detection of parasite larvae in the cerebrospinal fluid of a pug occurring Parelaphostrongylus tenuis-associated choriomeningitis in a guinea
dog. J. Small Anim. Pract. 49, 468–471. pig with neurologic signs. Vet. Pathol. 50, 560–562.
Reinstein, S.L., Lucio-Forster, A., Bowman, D.D., Eberhard, M.L., Hoberg, E.P., Pot, Tanabe, M., Gerhold, R.W., Beckstead, R.B., de Lahunta, A., Wade, S.E., 2010.
S.A., Miller, P.E., 2010. Surgical extraction of an intraocular infection of Molecular confirmation of Parelaphostrongylus tenuis infection in a horse with
Parelaphostrongylus tenuis in a horse. J. Am. Vet. Med. Assoc. 237, verminous encephalitis. Vet. Pathol. 47, 759.
196–199. Tanabe, M., Kelly, R., de Lahunta, A., Duffy, M.S., Wade, S.E., Divers, T.J., 2007.
Rudmann, D.G., Kazacos, K.R., Storandt, S.T., Harris, D.L., Janovitz, E.B., 1996. Verminous encephalitis in a horse produced by nematodes in the family
Baylisascaris procyonis larva migrans in a puppy: a case report and update for protostrongylidae. Vet. Pathol. 44, 119–122.
the veterinarian. J. Am. Anim. Hosp. Assoc. 32, 73–76.
Snook, E.R., Baker, D.G., Bauer, R.W., 2009. Verminous myelitis in a pit bull puppy. J.
Vet. Diagn. Invest. 21, 400–402.