1411

Open Access
Asian Australas. J. Anim. Sci.
Vol. 27, No. 10 : 1411-1416 October 2014
http://dx.doi.org/10.5713/ajas.2014.14223

www.ajas.info
pISSN 1011-2367 eISSN 1976-5517

Determination of Sperm Sex Ratio in Bovine Semen Using

Multiplex Real-time Polymerase Chain Reaction

Trisadee Khamlor1,2, Petai Pongpiachan2, Siwat Sangsritavong1, and Nipa Chokesajjawatee1,*

1
National Center for Genetic Engineering and Biotechnology,
National Science and Technology Development Agency, Pathum Thani 12120, Thailand

ABSTRACT: Gender selection is important in livestock industries; for example, female calves are required in the dairy industry. Sex-
sorted semen is commonly used for the production of calves of the desired gender. However, assessment of the sex ratio of the sorted
semen is tedious and expensive. In this study, a rapid, cost effective and reliable method for determining the sex ratio was developed
using a multiplex real-time polymerase chain reaction (PCR) assay. In this assay, the X and Y chromosome-specific markers, i.e., bovine
proteolipid protein (PLP) gene and sex-determining region Y (SRY) were simultaneously quantified in a single tube. The multiplex real-
time PCR assay was shown to have high amplification efficiencies (97% to 99%) comparable to the separated-tube simplex real-time
PCR assay. The results obtained from both assays were not significantly different (p>0.05). The multiplex assay was validated using
reference DNA of known X ratio (10%, 50%, and 90%) as templates. The measured %X in semen samples were the same within 95%
confidence intervals as the expected values, i.e., >90% in X-sorted semen, <10% in Y-sorted semen and close to 50% in the unsorted
semen. The multiplex real-time PCR assay as shown in this study can thus be used to assess purity of sex-sorted semen. (Key Words:
Sperm Sex Ratio, Sex Determination, Sexed Semen, Multiplex Real-time polymerase chain reaction)

INTRODUCTION albumin gradients (Wolf et al., 2008; Machado et al., 2009).

Currently, separation of X- and Y- bearing spermatozoa
Sexual pre-selection plays an important economic role based on differences in their chromosomal content by flow
in animal production industries. For example, female cattle cytometry is considered to be the most reliable and effective
are required for the dairy industry while males are preferred method, in which spermatozoa of the desired sex can be
in the beef cattle industry (Seidel Jr, 2007). Sorting of X obtained in greater than 90% purity (Morrell et al., 1988;
(female) or Y (male) chromosome-bearing spermatozoa in Garner and Seidel Jr, 2003). In order to quantify the purity
semen is a popular method for sex-selection. Several of sorted semen, flow cytometry reanalysis is usually
techniques for sperm sorting technology have been carried out. However, the accuracy of the estimate of purity
developed; for example, based on different immunological is compromised by the systematic error inherent in the
properties of the sperm (Hendriksen et al., 1993; Blecher et technique. Therefore, a different technique should be used
al., 1999; Sang et al., 2011), different swimming ability to confirm the sex ratio of the flow-sorted semen to reduce
(Madrid-Bury et al., 2003), differential separation in percoll the error. Multicolor fluorescent in situ hybridization is
(Machado et al., 2009) and differential separation in considered to be highly reliable method for identifying sex
of the spermatozoa, and this method can be used to evaluate
* Corresponding Author: Nipa Chokesajjawatee. Tel: +66-2564-
the sex ratio of sorted semen (Piumi et al., 2001; Rens et al.,
6700, Fax: +66-2564-6707, E-mail: nipa.cho@biotec.or.th
2 2001; Lee et al., 2004; Habermann et al., 2005). However,
Department of Animal and Aquatic Science, Faculty of
Agriculture, Chiang Mai University, Muang District, Chiang Mai this technique is complicated, laborious, time-consuming,
50200, Thailand. and requires highly skilled technicians, which limits its use.
Submitted Mar. 27, 2014; Revised May 19, 2014; Accepted Jun. 1, 2014 Polymerase chain reaction (PCR) techniques for detecting

Copyright © 2014 by Asian-Australasian Journal of Animal Sciences

This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/),
which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
1412 Khamlor et al. (2014) Asian Australas. J. Anim. Sci. 27:1411-1416

DNA sequences on sex chromosomes have been reported the same fluorophore, FAM. BHQ-1 quencher was
which can be used to identify the sex of individual incorporated at the 3′ end of all probes to permit fluorescent
spermatozoa and sex ratios of spermatozoa in semen detection of specific product. All primers and probes were
(Colley et al., 2008; Wang et al., 2011). However, accurate synthesized from Biosearch Technologies, Inc., Novato, CA,
determination of the sex ratio by single-sperm PCR requires USA.
analysis of a large number of individual sperm, which is
laborious and expensive. In contrast, the sex ratio of semen Construction of reference DNA
can be determined accurately and more simply by Two recombinant plasmids containing the amplified
quantitative real-time PCR (Parati et al., 2006). In this section of the PLP gene (p-PLP) and SRY sequence (p-
technique, fluorescent labeled-Taqman probes are used to SRY) were constructed and used as reference templates for
detect DNA sequences on each sex chromosome in two quantification of the sex-related DNA sequences. Each
separate reaction tubes, one specific for bovine proteolipid DNA fragment was amplified using primers as described in
protein (PLP) gene located on the X chromosome and Table 1. The fragments were then purified and cloned into
another for sex-determining region Y (SRY) located on the pDrive cloning vector using a QIAGEN PCR Cloning
Plus
Y chromosome. The result obtained from the real-time PCR Kit (Qiagen GmbH, Hilden, Germany) according to the
was proven to be not significantly different from that manufacturer’s instruction. The recombinant plasmids were
obtained by flow cytometry reanalysis. However, since the extracted using a QIAprep Spin Miniprep Kit (Qiagen
quantification of both genes was done in separate tubes, GmbH, Germany). Plasmid concentrations were quantified
imprecision in dispensing a small amount of the DNA spectrophotometrically at 260 nm using NanoDrop1000
template into each reaction tube may compound error in spectrophotometer (Thermo Fisher Scientific, Inc.,
estimation of the sex ratio in the sample. Therefore, in this Wilmington, DE, USA). Both plasmids were mixed at a
study, we aimed to develop a multiplex real-time PCR ratio of 1:1, and ten-fold serial dilutions ranging from 10 pg
technique to simultaneously quantify both genes in a single to 1 fg (approximately 2.33E+06 to 2.33E+02 plasmid
tube to eliminate bias due to pipetting error and thus copies) were used to construct a standard curve for
provide better estimation of the sperm sex ratio. quantification. Different ratios of p-PLP and p-SRY, i.e., 1:9
Furthermore, combining the reaction into one tube is also (X10), 1:1 (X50), and 9:1 (X90) at a final concentration of
more efficient in terms of the reagent used, and time and 100 fg were used as known ratio templates to validate the
labor needed to conduct the test. method.

MATERIALS AND METHODS Reaction conditions for real-time polymerase chain

reaction
Primers and probes The real-time PCR reaction condition was carried out as
Primer and probe sequences for amplification and described by Parati et al. (2006). The 25 μL reaction
detection of the X chromosome-specific (PLP) and Y mixture of both simplex and multiplex real-time PCR
chromosome-specific (SRY) regions were as previously contained 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 0.4 mM
reported (Parati et al., 2006) (Table 1). The X- and Y- dNTPs, 6 mM MgCl2 and 0.625 U Platinum Taq DNA
Taqman probes used in the multiplex PCR assay were Polymerase (Life Technologies Co., Sao Paulo, Brazil). For
labeled at the 5′ end with different fluorophores, i.e., CAL the simplex PCR, a final concentration of 900 nM of the
Fluor Orange 560 (Orange 560) for the X-specific probe primers and 200 nM of the corresponding probes were
and 6-Carboxyfluorescein (FAM) for the Y-specific probe. added into two separate reaction tubes, one for PLP and one
For the simplex PCR assay both probes were labeled with for SRY detection. For the multiplex PCR, both set of

Table 1. Primer and probe sequences

Primer/probe Sequence (5' → 3') Product size (bp)
X chromosome-specific primers and probe
PLP-Forward GTTGTGTTAGTTTCTGCTGTACAATAAAGTG 96
PLP-Reverse GATGGCAGGTGAGGGTAGGA
PLP-Probe TGTATACACATAGCCCCTCCCTCTTGGA CC
Y chromosome-specific primers and probe
SRY-Forward CCACGTCAAGCGACCCAT 66
SRY-Reverse AGAGCCACCTTTCGTCTTCG
SRY-Probe AACGCCTTCATTGTGTGGTCTCGTGA
PLP, bovine proteolipid protein gene; SRY, sex-determining region Y.
 Khamlor et al. (2014) Asian Australas. J. Anim. Sci. 27:1411-1416 1413

primers were added into the same reaction tube at a final estimated using the assumption that the sum of X and Y
concentration of 400 nM each, and 200 nM of each probe contents in each sample equals 100%.
(labeled with different fluorophores) were added into the
same tube. An iCycler iQ real-time PCR detection system Determination of sperm sex ratio by multiplex real-time
(Bio-Rad Laboratories, Inc., Hercules, CA, USA) was used polymerase chain reaction
for real-time PCR. The amplification conditions consisted For the multiplex real-time PCR, two fluorescent
of initial denaturation and enzyme activation at 95°C for 10 signals were generated from each reaction tube, namely the
min, followed by 40 cycles of 95°C for 15 s and 60°C for Orange 560 signal from X amplification and the FAM
60 s. The fluorescent signals were measured at the end of signal from Y amplification. A standard curve was
each amplification cycle. Analysis of the signals for constructed from each fluorescent channel and a threshold
determination of the threshold cycles (Ct) was done using line of each fluorescent channel was defined using the same
CFX manager software version 1.1 (Bio-Rad Laboratories, criteria as the simplex PCR. Quantification of X and Y
Inc., USA). contents as well as the sperm sex ratio were calculated in a
similar fashion to those from the simplex PCR.
Semen samples and DNA extraction
The samples used in this study comprised two X-sorted Validation of the multiplex real-time polymerase chain
semen samples, one Y-sorted semen sample, and three reaction assay
unsorted semen samples. The sorted semen samples Sperm sex ratios presented as percentage of X
containing spermatozoa of one sex at greater than 90% chromosome-bearing spermatozoa (%X) obtained from the
purity was purchased from Accelerated Genetics, Inc., multiplex real-time PCR were compared with those
Baraboo, WI, USA. Three unsorted semen were purchased obtained from the simplex real-time PCR. A total of nine
from the Dairy Farming Promotion Organization of samples used in this experiment included three samples of
Thailand. known %X reference plasmids (X10%, X50%, and X90%),
Each frozen semen sample was thawed and centrifuged two X-sorted semen samples, one Y-sorted semen sample,
at 500×g for 10 min to collect the sperm pellet. The pellet and three unsorted semen samples. Each sample was tested
was then washed with 500 μL phosphate buffered saline, in triplicate independent PCRs. For each PCR, the samples
centrifuged at 500×g for 5 min, and the supernatant was were tested in duplicate reaction tubes and the average
discarded. Then, 10 μL of 1 M dithiothreitol, 10 μL of 1 M values were used to calculate the mean, standard deviation
proteinase K and 100 μL of 5% w/v chelex 100 resin (Bio- (SD), and 95% confidence interval (95% CI) of the
Rad Laboratories, Inc., USA) were added to the sperm triplicate experiments. Validity of the multiplex real-time
pellet. All reagents were mixed and incubated overnight at PCR assay was assessed by comparing the expected values
56°C. The cell debris was removed by centrifugation at (from the reference plasmids) to those obtained from the
1,000×g for 5 min. Then, the crude DNA extract was further measurement. The assay was considered valid when all
purified using a Wizard genomic DNA purification Kit expected values fell within 95% CI of the measured values.
(Promega, USA) following the manufacturer’s protocol. Agreement between the sex ratio estimated from the
The DNA concentration was measured multiplex real-time PCR and the simplex real-time PCR
spectrophotometrically at 260 nm. assay was assessed using a two-tailed paired t-test with
significance level of p<0.05. The equality of variances
Determination of sperm sex ratio by simplex real-time between the methods was tested using Levene’s test.
polymerase chain reaction
For the simplex real-time PCR, the fluorescent signals RESULTS
from both X and Y amplifications were measured from the
same channel (FAM). A single threshold line for Standard curves and amplification efficiency
determination of the Ct can be defined for both X and Y Standard curves showing relationship between the
amplification. The threshold was set approximately in the amount of template (copy number, logC) and Ct for each
middle of the exponential increase of the signal from sex-related DNA from the simplex and multiplex assays are
positive samples. A standard curve showing relationship shown in Figure 1 and 2, respectively. All curves fitted to
between Ct and copy number of the template for each sex- linear regression models with correlation coefficient
specific DNA was constructed using the reference plasmid (r)>0.99. For the simplex PCR, the general linear equations
DNA. Each sex-specific DNA from the test samples was obtained from the three runs can be represented as: Ct_X =
then quantified using the corresponding standard curves, i.e., 35.40–3.34 logC for X amplification and Ct_Y = 36.12–
X from X-standard curve and Y from Y-standard curve. The 3.39 logC for Y amplification. For the multiplex PCR, the
percentage of X content (%X) and Y content (%Y) were equations for X and Y were: Ct_X = 40.56.16–3.39 logC
1414 Khamlor et al. (2014) Asian Australas. J. Anim. Sci. 27:1411-1416

(A) (A)

(B) (B)
Figure 1. Standard curves and linear equations obtained from the Figure 2. Standard curves and linear equations obtained from the
simplex real-time polymerase chain reaction assay showing multiplex real-time polymerase chain reaction assay showing
relationship between threshold cycle (Ct) and DNA copy number relationship between threshold cycle (Ct) and DNA copy number
(logC) from triplicate experiments. (A) X chromosome-specific (logC) from triplicate experiments. (A) X chromosome-specific
amplification, (B) Y chromosome-specific amplification. amplification, (B) Y chromosome-specific amplification.

and Ct_Y = 41.01–3.35 logC, respectively. the assays in all test ranges indicating validity of the assays
The mean and SD of the slope from the simplex PCR for accurately assessing the sex ratio of the semen samples.
assay were –3.34±0.11 and –3.39±0.03 which corresponded Statistical analysis showed that the variances and mean of
to the PCR amplification efficiency of 99% and 97% for X the sex ratio estimates obtained from the simplex and
and Y amplification respectively; and from the multiplex multiplex assays were not significantly different (p>0.05)
PCR, the slopes were –3.39±0.05 and –3.35±0.03 which (Table 2).
corresponded to efficiencies of 97% and 99% for X and Y
amplification, respectively. DISCUSSION

Estimation of %X in samples and comparison between In this study, we developed a multiplex real-time PCR
the simplex and multiplex real-time polymerase chain technique as an alternative method for determination of
reaction assay sperm sex ratio in bovine semen samples. Analysis of the
The simplex PCR and multiplex PCR assays were used sperm sex ratio is important for selective reproduction of
to measure ratios of the sex-specific sequences in the livestock by artificial insemination. This rapid and cost
reference plasmids and semen samples. The results effective assay can also facilitate development of new
expressed as %X in the samples are shown in Table 2. The sperm sex-sorting technologies. The assay simultaneously
expected values from the reference plasmid samples fell detects both X- and Y-specific determinants in a single
within the 95% CI of the measured values obtained from reaction tube. Quantification of each sex-specific DNA was
 Khamlor et al. (2014) Asian Australas. J. Anim. Sci. 27:1411-1416 1415

Table 2. Results of %X quantified from the simplex real-time PCR and the multiplex real-time PCR
Simplex assay Multiplex assay
No. Sample p-value
Mean±SD (95% CI) Mean±SD (95% CI)
Reference plasmid
1 X10% 11.70±1.89 (9.56-13.83) 11.85±1.25 (10.44-13.27) 0.79
2 X50% 50.61±1.43 (48.99-52.22) 51.48±1.53 (49.74-53.21) 0.28
3 X90% 90.15±1.21 (88.78-91.52) 91.67±1.83 (89.60-93.74) 0.14
Semen sample
4 X-sorted1 92.28±2.27 (89.72-94.84) 93.03±2.13 (90.63-95.44) 0.42
5 X-sorted2 91.91±2.23 (89.39-94.43) 90.47±2.83 (87.27-93.67) 0.42
6 Y-sorted1 2.71±0.18 (2.50-2.92) 2.57±0.35 (2.17-2.96) 0.20
7 Unsorted1 50.34±2.44 (47.58-53.11) 49.44±2.17 (46.99-51.89) 0.20
8 Unsorted2 50.81±0.86 (49.83-51.79) 50.44±2.69 (47.40-53.48) 0.72
9 Unsorted3 50.23±1.97 (48.00-52.45) 49.44±1.76 (47.44-51.43) 0.40
PCR, polymerase chain reaction; SD, standard deviation; CI, confidence interval.

done by the use of differently labeled Taqman probe, and bovine semen.
comparing the Ct obtained from the sample to that obtained
from the corresponding standard curve. The standard curve ACKNOWLEDGMENTS
in this multiplex assay was also done in multiplex format,
i.e., both X- and Y- specific recombinant plasmids were This work was funded by National Science and
mixed at the ratio of 1:1 and a series of ten-fold dilutions of Technology Development Agency (NSTDA), Thailand. The
the known-quantity reference DNA was used to construct first author was supported by Thailand Graduate Institute of
the standard curve for each sex-specific DNA. In addition, Science and Technology scholarship (TG-22-10-51-005D)
for reference DNA, genomic DNA may be used to construct granted from NSTDA. We thank Dr. Philip Shaw for
the standard curve (Yun et al., 2006). Although the primers manuscript proofreading.
used in this multiplex assay were only half of the
concentration used in the simplex assay, the amplification REFERENCES
efficiencies were the same, i.e., they fell in the range
between 97% to 99% efficiency for both assays. The Blecher, S. R., R. Howie, S. Li, J. Detmar, and L. M. Blahut. 1999.
multiplex assay was also proven to be as effective as the A new approach to immunological sexing of sperm.
simplex assay in determination of the sperm sex ratio in Theriogenology 52:1309-1321.
Colley, A., M. Buhr, and S. P. Golovan. 2008. Single bovine sperm
both known-ratio reference plasmids and actual semen
sex typing by amelogenin nested PCR. Theriogenology
samples. For the sorted semen samples, the assay showed 70:978-983.
that they contained greater than 90% of the declared sex- Garner, D. L., K. M. Evans, and G. E. Seidel. 2013. Sex-sorting
specific DNA, which was in agreement with the semen sperm using flow cytometry/cell sorting. Methods Mol. Biol.
specification guaranteed from the manufacturer (>90% 927:279-295.
purity). For the unsorted semen in which the ratio of 1:1 Garner, D. L. and G. E. Seidel Jr. 2003. Past, present and future
was expected, the multiplex real-time PCR assay yielded perspectives on sexing sperm. Can. J. Anim. Sci. 83:375-384.
approximately 50% of each sex-specific DNA, which is in Habermann, F. A., A. Winter, I. Olsaker, P. Reichert, and R. Fries.
2005. Validation of sperm sexing in the cattle (Bos taurus) by
agreement with the expected value. The multiplex real-time
dual colour fluorescence in situ hybridization. J. Anim. Breed.
PCR technique as developed in this study yielded accurate Genet. 122:22-27.
assessment of the sperm sex ratio in both sorted and Hendriksen, P. J. M., M. Tieman, T. Van Der Lende, and L. A.
unsorted semen. Although the accurate assessment of the Johnson. 1993. Binding of anti-• H-Y monoclonal antibodies
ratio can be obtained with other techniques such as flow to separated X and Y chromosome bearing porcine and bovine
cytometry analysis (Garner et al., 2013), individual sperm- sperm. Mol. Reprod. Dev. 35:189-196.
PCR (Colley et al., 2008; Wang et al., 2011), simplex real- Lee, J. H., J. H. Park, S.-H. Lee, C. S. Park, and D. I. Jin. 2004.
time PCR (Parati et al., 2006), the multiplex method as Sexing using single blastomere derived from IVF bovine
embryos by fluorescence in situ hybridization (FISH).
reported in this study is simpler, faster, and more cost-
Theriogenology 62:1452-1458.
effective to perform with only a single reaction tube
Machado, G. M., J. O. Carvalho, E. S. Filho, E. S. Caixeta, M. M.
required for each semen sample. In conclusion, the Franco, R. Rumpf, and M. A. N. Dode. 2009. Effect of Percoll
multiplex real-time PCR assay could be used as an volume, duration and force of centrifugation, on in vitro
alternative method to identify the sex ratio of the sperm in production and sex ratio of bovine embryos. Theriogenology
1416 Khamlor et al. (2014) Asian Australas. J. Anim. Sci. 27:1411-1416

71:1289-1297. Sang, L., W. C. Yang, L. Han, A. X. Liang, G. H. Hua, J. J. Xiong,

Madrid-Bury, N., R. Fernández, A. Jiménez, S. Pérez-Garnelo, P. L. J. Huo, and L. G. Yang. 2011. An immunological method to
Nuno Moreira, B. Pintado, J. de la Fuente, and A. Gutiérrez- screen sex-specific proteins of bovine sperm. J. Dairy Sci.
Adán. 2003. Effect of ejaculate, bull, and a double swim-up 94:2060-2070.
sperm processing method on sperm sex ratio. Zygote 11:229- Seidel Jr, G. E. 2007. Overview of sexing sperm. Theriogenology
235. 68:443-446.
Morrell, J. M., K. D. Keeler, D. E. Noakes, N. M. Mackenzie, and Wang, D., H. Zhu, J. Guo, B. Lin, L. Zhang, H. Hao, W. Du, and X.
D. W. Dresser. 1988. Sexing of sperm by flow cytometry. Vet. Zhao. 2011. A study of a method to assess the purity of sorted
Rec. 122:322-324. bovine semen using rapid single-sperm sexing PCR. J. Anim.
Parati, K., G. Bongioni, R. Aleandri, and A. Galli. 2006. Sex ratio Vet. Adv. 10:750-756.
determination in bovine semen: A new approach by Wolf, C. A., K. E. Brass, M. I. B. Rubin, S. E. Pozzobon, F. D.
quantitative real time PCR. Theriogenology 66:2202-2209. Mozzaquatro, and F. D. De La Corte. 2008. The effect of
Piumi, F., D. Vaiman, E.-P. Cribiu, B. Guerin, and P. Humblot. sperm selection by Percoll or swim-up on the sex ratio of in
2001. Specific cytogenetic labeling of bovine spermatozoa vitro produced bovine embryos. Anim. Reprod. 5:110-115.
bearing X or Y chromosomes using fluorescent in situ Yun, J. J., L. E. Heisler, I. I. L. Hwang, O. Wilkins, S. K. Lau, M.
hybridization (FISH). Genet. Sel. Evol. 33:89-98. Hyrcza, B. Jayabalasingham, J. Jin, J. McLaurin, M.-S. Tsao,
Rens, W., F. Yang, G. Welch, S. Revell, P. C. O'Brien, N. Solanky, and S. D. Der. 2006. Genomic DNA functions as a universal
L. A. Johnson, and M. A. F. Smith. 2001. An XY paint set and external standard in quantitative real-time PCR. Nucl. Acids
sperm FISH protocol that can be used for validation of cattle Res. 34:e85.
sperm separation procedures. Reproduction 121:541-546.