Bok:978 3 642 37922 2

Lecture Notes in Electrical Engineering 250
Tong-Cun Zhang
Pingkai Ouyang
Samuel Kaplan
Bill Skarnes Editors
Proceedings of
the 2012 International
Conference on Applied
Biotechnology
(ICAB 2012)
Volume 2
Lecture Notes in Electrical Engineering
Volume 250
For further volumes:

http://www.springer.com/series/7818
Tong-Cun Zhang Pingkai Ouyang
•
Samuel Kaplan Bill Skarnes

•
Editors
Proceedings of the 2012

International Conference
on Applied Biotechnology
(ICAB 2012)
Volume 2
123
Editors
Tong-Cun Zhang Samuel Kaplan
College of Bioengineering Department of Microbiology, Houston
Tianjin University of Science Medical School
and Technology University of Texas
Tianjin Texas, TX
People’s Republic of China USA
Pingkai Ouyang Bill Skarnes

Nanjing University of Technology Wellcome Trust Sanger Institute
Nanjing Cambridge
People’s Republic of China UK
ISSN 1876-1100 ISSN 1876-1119 (electronic)

ISBN 978-3-642-37921-5 ISBN 978-3-642-37922-2 (eBook)
DOI 10.1007/978-3-642-37922-2
Springer Heidelberg New York Dordrecht London
Library of Congress Control Number: 2013945796
Springer-Verlag Berlin Heidelberg 2014

This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of
the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations,
recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or
information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar
methodology now known or hereafter developed. Exempted from this legal reservation are brief
excerpts in connection with reviews or scholarly analysis or material supplied specifically for the
purpose of being entered and executed on a computer system, for exclusive use by the purchaser of the
work. Duplication of this publication or parts thereof is permitted only under the provisions of
the Copyright Law of the Publisher’s location, in its current version, and permission for use must
always be obtained from Springer. Permissions for use may be obtained through RightsLink at the
Copyright Clearance Center. Violations are liable to prosecution under the respective Copyright Law.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this
publication does not imply, even in the absence of a specific statement, that such names are exempt
from the relevant protective laws and regulations and therefore free for general use.
While the advice and information in this book are believed to be true and accurate at the date of
publication, neither the authors nor the editors nor the publisher can accept any legal responsibility for
any errors or omissions that may be made. The publisher makes no warranty, express or implied, with
respect to the material contained herein.
Printed on acid-free paper
Springer is part of Springer Science+Business Media (www.springer.com)

Preface
2012 International Conference on Applied Biotechnology (ICAB2012) was

organized by Tianjin University of Science and Technology, Tianjin Institute of
Industrial Biotechnology, Chinese Academy of Sciences was held from October
18th to 19th, 2012 in Tianjin, China.
The conference served as a forum for exchange and dissemination of ideas and
the latest findings among all parties involved in any aspects of applied biotech-
nology. The following distinguished professors gave keynote speeches: Hassan
Ashktorab (Howard University, U.S.A), William Carl Skarnes (The Wellcome
Trust Sanger Institute, U.K), Hiroyuki Takenaka (Kyushu Kyoritsu University,
Japan) and Xueli Zhang (Tianjin Institute of Industrial Biotechnology, Chinese
Academy of Sciences, China). The conference was complemented by talks given
by other 51 professors and investigates.
More than 200 authors from 44 different universities, institutes and companies
submitted conference papers. A lot of fields have been covered, ranging from
fermentation engineering, cell engineering, genetic engineering, enzyme engi-
neering and protein engineering.
Special thanks are given to Academic Committee, Organizing Committee and
Secretary Staff of the conference for the commitment to the conference organi-
zation. We would like also to thank all the authors who contributed with their
papers to the success of the conference.
This Book gathers a selection of the papers presented at the conference; it
contains contributions from both academic and industrial researchers providing a
unique perspective on the research and development of applied biotechnology
from all over the world. The scientific value of the papers also helps the
researchers in this field to get more valuable results.
Tianjin, China Tong-Cun Zhang

Pingkai Ouyang
Samuel Kaplan
Bill Skarnes
v
Committees
Sponsor
Chinese Society of Biotechnology
Organizers
Tianjin University of Science and Technology

Key Lab of Industrial Fermentation Microbiology, Ministry of Education
Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences
Co-organizers
Tianjin Society for Microbiology

Tianjin International Joint Academy of Biotechnology and Medicine
College of Biotechnology and Pharmaceutical Engineering, Nanjing University of
Technology
College of Life Science, Nankai University
School of Biotechnology, Jiangnan University
College of Life Science and Technology, Beijing University of Chemical
Technology
School of Bioscience and Bioengineering, South China University of Technology
College of Biotechnology, Chongqing University
State Key Laboratory of Bioreactor Engineering, East China University of Science
and Technology
School of Biological Engineering, Dalian Polytechnic University
School of Food and Bioengineering, Shandong Polytechnic University
vii
viii Committees
Academic Committee
Chairman
Pingkai Ouyang, Academician, Nanjing University of Technology, China
Executive Chairman
Zixin Deng, Academician, Shanghai Jiaotong University, China

Baoguo Sun, Academician, Beijing Technology and Business University, China
Tianwei Tan, Academician, Beijing University of Chemical Technology, China
Prof. George Fu Gao, Institute of Microbiology of Chinese Academy of Sciences,
China
Prof. Xiaohong Cao, Tianjin University of Science and Technology, China
Prof. Jian Chen, Jiangnan University, China
Prof. Yanhe Ma, Tianjin Institute of Industrial Biotechnology, Chinese Academy
of Sciences, China
Members
Prof. Baishan Fang, Xiamen University, China

Prof. Cheng Yang, Tianjin International Joint Academy of Biotechnology and
Medicine, China
Prof. Cunjiang Song, Nankai University (Tianjin Society for Microbiology), China
Prof. Danqun Huo, Chongqing University, China
Prof. Fang Liu, Nankai University, China
Prof. Fuping Lu, Tianjin University of Science and Technology, China
Prof. Guocheng Du, Jiangnan University, China
Prof. He Huang, Nanjing University of Technology, China
Prof. Hongzhang Chen, Institute of Process Engineering, Chinese Academy of
Sciences, China
Prof. Jianhe Xu, East China University of Science and Technology, China
Prof. Jianjiang Zhong, Shanghai Jiaotong University, China
Prof. Jianjun Liu, Shandong Academy of Food and Fermentation Industries, China
Prof. Jibin Sun, Tianjin Institute of Industrial Biotechnology, Chinese Academy of
Sciences, China
Prof. Lirong Yang, Zhejiang University, China
Prof. Longjiang Yu, Huazhong University of Science and Technology, China
Prof. Min Wang, Tianjin University of Science and Technology, China
Prof. Muyi Cai, China National Research Institute of Food and Fermentation
Industries, China
Committees ix
Prof. Ning Chen, Tianjin University of Science and Technology, China

Prof. Qipeng Yuan, Beijing University of Chemical Technology, China
Prof. Ruiming Wang, Shandong Polytechnic University, China
Prof. Shiru Jia, Tianjin University of Science and Technology, China
Prof. Shuyi Qiu, Guizhou University, China
Prof. Shuangjiang Liu, Institute of Microbiology of Chinese Academy of Sciences,
China
Prof. Youshu Xia, Sichuan Academy of Food and Fermentation Industries, China
Prof. Siliang Zhang, East China University of Science and Technology, China
Prof. Tong-Cun Zhang, Tianjin University of Science and Technology, China
Prof. Xianzhen Li, Dalian University of Technology, China
Prof. Xiaolei Wu, Beijing University, China
Prof. Xinhui Xing, Tsinghua University, China
Prof. Xueming Zhao, Tianjin University, China
Prof. Yin Li, Institute of Microbiology of Chinese Academy of Sciences, China
Prof. Yinbo Qu, Shandong University, China
Prof. Ying Lin, South China University of Technology, China
Organizing Committee
Chairman
Prof. George Fu Gao, Vice Dean, Beijing Institutes of Life Science, Chinese
Academy of Sciences, China
Executive Chairman
Prof. Shuheng Ma, Vice Dean, Tianjin Institute of Industrial Biotechnology,

Chinese Academy of Sciences, China
Prof. Dongguang Xiao, Dean, Tianjin University of Science and Technology,
China
Members
Yinhua Wan, Deputy Secretary General, Chinese Society of Biotechnology, China

Lei Ma, Director, President’s Office, Tianjin University of Science and Technol-
ogy, China
Feng Wen, Secretary of the Party Committee, College of Bioengineering, Tianjin
University of Science and Technology, China
x Committees
Dingcheng Liu, Vice Dean, Division of Science and Technology, Tianjin

University of Science and Technology, China
Cunjiang Song, Secretary General, Tianjin Society of Microbiology, China
Cheng Yang, Vice Dean, Tianjin International Joint Academy of Biotechnology
and Medicine, China
Secretariat
Secretary General
Prof. Shuheng Ma, Vice Dean, Tianjin Institute of Industrial Biotechnology,

Chinese Academy of Sciences, China
Deputy Secretary General
Prof. He Huang, Dean, Division of Science and Technology, Nanjing University of

Technology, China
Prof. Cunjiang Song, Secretary General, Tianjin Society of Microbiology, China
Prof. Tong-Cun Zhang, Director, Key Laboratory of Industrial Fermentation
Microbiology (Tianjin University of Science and Technology), Ministry of
Education, China
Members
Yue Wang, Juke Wang, Hongling Wang, Jiaming Wang, Yanbing Shen, Yihan
Liu, Jian Zhang, Chaozheng Zhang, Kui Lu, Hao Zhou, Xuegang Luo, Cheng
Zhong, Qingyang Xu, Bin Jia,Xuewu Guo, Zhilei Tan
Contents
Part III Pharmaceutical Biotechnology
66 Promising Biomarkers: MicroRNAs at Diagnosis,

Therapy and Prognostic Evaluation of Breast Cancer . . . . . . . . 649
Dalin Lu, Nan Wang, Xinghua Liao, Xuan Huang, Jianhua Zhang,
Zhenyu Wang, Lian Duan, Jiajie Liu, Baoshu Jin,
Yue Wang and Tong-Cun Zhang
67 Dimerization of Chemokine Receptors and its Novel Roles

in Drug Discovery. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 657
Mingqing Wang, Baosheng Ge and Fang Huang
68 The Mechanism of Apoptosis in Adenocarcinoma

of Lung Cancer A549 Cells Induced by Albumin-Derived
from Peanut . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 669
Minhui Long, Yuejun Sun, Ni Chen, Zimin Zhang, Wen Chu,
Yue Ma, Shenheng Luo, Zhongpeng Zhao and Aipo Diao
69 Serum miR-124 and TNF-a are Biomarkers

of Ischemic Cerebrovascular Disease . . . . . . . . . . . . . . . . . . . . . 681
Jiajie Liu, Xinghua Liao, Nan Wang, Jun Zhou, Lian Duan,
Dalin Lu, Zhipeng Liu, Tingbao Yan, Deyun Ma,
Xiumei Dong, Xueguang Sun and Tong-Cun Zhang
70 A New Process for Preparation of Hydroxytyrosol . . . . . . . . . . . 689

Yinghao Gao, Xijuan Liang, Yuanmou Chen, Fei Hu, Weizhu Liu,
Peng Yu and Erbing Hua
71 Design and Synthesis of 2-Arylbenzimidazole Analogues

as Novel SIRT1 Activators for the Treatment
of Type II Diabetes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 697
Fei Hu, Yuanmou Chen, Yinghao Gao, Shaolong Jia, Weizhu Liu,
xi
xii Contents
72 Design and Synthesis of SRT1 Activators for Potential

Lead Compounds of Treatment of Diabetes . . . . . . . . . . . . . . . . 705
Weizhu Liu, Qiuyue Wang, Fei Hu, Yinghao Gao, Yingying Wang,
73 Synthesis of 1,3-benzodioxol-5-ethanol and Its Derivatives . . . . . 715

Na Ji, Yinghao Gao, Yuanmou Chen, Shaolong Jia, Fei Hu,
74 Tetrandrine Inhibits Proteasomal Chymotrypsin-Like Activity

and Induces Apoptosis in Human PC-3 Cells . . . . . . . . . . . . . . . 723
Li Zhang, Wanxin Shi, Weihua Cao, Xiangru Liang, Yufu Hu,
Mo Chen and Guoqing Shi
75 The Purifying Effect of Apocynum Venetum Seedlings

on Estuarine Water . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 733
Yangcang Xu, Tao Yu, Yunshan Zhong and Xiaoyan Wang
76 Expression, Purification, and Activity Assay

of Chicken Interferon-Alpha . . . . . . . . . . . . . . . . . . . . . . . . . . . 741
Yue Ma, Minhui Long and Aipo Diao
77 Synthesis and Controlled Release of 5-Fluorouracil

from Hydroxyethylchitosan: Based Polymer Prodrug . . . . . . . . . 749
Yanfei Peng, Wanshun Liu, Baoqin Han and Ruixue Zhou
78 Telomerase is Significant as an Early Diagnostic Marker

and Therapeutic Target . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 757
Lian Duan, Nan Wang, Xinghua Liao, Jun Zhou, Dalin lu,
Jiajie Liu, Xueguang Sun and Tong-Cun Zhang
79 Isolation, Identification, Antibacterial Effects of Antibiotic

Drugs, and Chinese Herbal Extracts to the Pathogenic
Bacteria of Swollen Abdomen from Scophthalmus maximus
in Vitro . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 765
Xuan Wu, Dongqing Bai, Guoxia Zhu, Yanbin Ji,
Zhichao Jia and Peng Zhou
80 Lichen: A Potential Anticancer Officinal Resource . . . . . . . . . . . 773

Meirong Ren, Feng Xu and Xinli Wei
Contents xiii
81 Clinical Significance of Screening Impaired Glucose

Tolerance in Essential Hypertension Patients . . . . . . . . . . . . . . . 783
Jun Zhu, Peiqing Feng, Shu Guo, Xinghua Liao, Jiajie Liu,
Junfang Zhang, Tingbao Yan, Yue Wang and Tong-Cun Zhang
82 Cardiac Hypertrophy-Specific Genes are Synergistic

Activated by Myocardin and CREB-binding
protein (CBP) p300. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 789
Zhenyu Wang, Xuehua Zhao, Mingzhe Li, Dongsun Cao
and Tong-Cun Zhang
83 Design, Synthesis, and Biological Evaluation of the Novel

Antitumor Agent 2-benzyl-3, 4-dihydroisoquinolin-1(2H)-one
and Its Derivatives . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 797
Jian Lv, Lei Lv, Xiaomin Zhang, Yao Zhou, Kui Lu, Yifei lu,
Yuou Teng, Hua Sun and Peng Yu
84 Using Water Miscible Ionic Liquid to Improve the Efficiency

of 15a-hydroxylation of 13-ethyl-gon-4-en-3,17-dione
by Penicillium raistrickii . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 805
Shuhong Mao, Na Wang, Zhijiang Ge, Boyuan Hua,
Yanqing Li and Fuping Lu
85 Nuclear Receptor Property of E2F1 for Novel Anticancer

Drug Discovery. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 811
Ning Zhang, Jin Li and Aimin Meng
86 MRTF-A Promotes Migration of MCF-7 Breast Cancer

Cells via Transactivation of CYR61. . . . . . . . . . . . . . . . . . . . . . 821
Xuegang Luo, Chunling Zhang, Wenwen Zhao, Lei Liu,
Shu Guo, Zhipeng Liu, Jing Wang and Tong-Cun Zhang
87 The Analysis of the Inhibition Effect of Cholic Acid

Derivatives on the Proliferation of Breast Cancer Cells . . . . . . . 827
Xuegang Luo, Jing Wang, Xiangchao Gu, Chunling Zhang,
Xiangzheng Hu and Tong-Cun Zhang
88 Design, Synthesis and Biological Evaluation of the Novel

Antitumor Agent 5-Bromobenzofuran-3(2H)-One
and its Derivatives . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 835
Lei Lv, Xiaomin Zhang, Jian Lv, Yao Zhou, Weiguo Hu,
Peng Yu and Yuou Teng
xiv Contents
89 Preliminary Study on the Mechanism of Cartilage

Polysaccharide Inducing H22 Cell to Engender
Immunogenicity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 843
Guoqiang Zheng, Pan Li, Anguo Teng, Jie Zheng,
Wenhang Wang and Anjun Liu
90 Design and Synthesis of Novel 20-Substituted

Hydroxycamptothecin Derivatives . . . . . . . . . . . . . . . . . . . . . . . 853
Shaopeng Wen, Dewu Quan, Yao Zhou, Haiyong Jia, Peng Yu,
Hua Sun and Na Guo
91 Design and Synthesis of 5-Azacytidine Analogs . . . . . . . . . . . . . 861

Jianbo Xing, Hua Sun, Xijuan Liang, Yuou Teng,
Peng Yu and Kui Lu
92 Stigmasterol from the Flowers of Trollius chinensis . . . . . . . . . . 867

Mengmeng Zhou, Min Wang, Daoqing Xu and Qin Pan
93 Design, Synthesis and Primary Biological Evaluation

of the Novel Antitumor Agent Indoline-3-One
and Its Derivatives . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 875
Haiyong Jia, Guojun Pan, Yiqian Wang, Shaopeng Wen,
Qiannan Guo, Weiguo Hu, Peng Yu, Hua Sun and Yuou Teng
94 Research Progress on the Anti-Rheumatoid Arthritis Drugs . . . . 883

Peng Wang, Xuegang Luo, Chongxi Wang, Xinjia Wang,
Guang Hu and Tong-Cun Zhang
95 Design and Synthesis of 1H-2,3-Dihydro-1-Pyrrolizinones

Derivatives . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 893
Changhai Sun and Jing Cao
96 Inhibition of iNOS to Protect Intermittent Hypoxia-Induced

Hippocampal Neurons Impairment by Astragalus
Extract in Rat . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 899
Qiang Zhang, Wenyuan Gao, Shuli Man, Yun Zhang
and Baoyun Chen
97 Prepared and Characterization of 12b,15a-Dihydroxy-

16a,17-Epoxyprogesterone . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 907
Yibo Wang, Yanbing Shen, Jiajia Ren,
Jianmei Luo and Min Wang
Contents xv
Part IV Agriculture, Environmental, Marin Biotechnology

and Bio-energy Technology
98 Structure Elucidation of Two Triterpenoid Saponins

from Leaves of Schima superba Gardn. et Champ . . . . . . . . . . . 915
Guanghua Huo, Changling Zhang and Yingjun Zhang
99 Study on Extraction of Xylan from Bamboo Shoot Shell . . . . . . 923

Nengfu Yu, Nengliang Wu, Yu Wang and Yegou Tu
100 Study on Preparation of Low Alcoholic Wine from Tomato . . . . 931

Kai-ye Deng and Er-na Li
101 Effects of Glucose Assimilation on Lutein and Chlorophyll

Biosyntheses in the Green Alga Chlorella pyrenoidosa . . . . . . . . 943
Tao Li, Yi-han Liu, Fu-ping Lu and Yue Jiang
102 RNA Interference and Applications in Plants. . . . . . . . . . . . . . . 955

Yunrong An, Zhongyou Pei, Nan Xin and Haifeng Wang
103 Isolation, Identification and Degradation Characteristics

of Three Thick Oil Degrading Bacteria Strains . . . . . . . . . . . . . 963
Chan Tian, Shengyan Tian, Xianbin Liu and Lulu Qin
104 Effect of Anti-Nematode Preparations on Physiological

Traits of Cucumber Leaves Affected by Root-Knot
Nematode . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 973
Shuchang Lu
105 Enzymolysis and Microbial Transformation of Geniposide

in Gardenia Jasminoides into Genipin by Aspergillus niger. . . . . 981
Yu Li, Wenbin Jin, Wei Jing, Mengcheng Yao,
Yanyang Tang and Fuping Lu
106 Study on the Application of a Thermotolerant

Saccharomyces cerevisiae in the Production of Bio-ethanol . . . . . 993
Yueqiang Li, Yefu Chen, Jian Dong, Xinxin Zhang,
Tong Shen and Dongguang Xiao
107 Different Chemicals Stimulate Diapause Termination

of Artemia Embryos . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1003
Yuqing Chen and Bo Zhang
xvi Contents
108 Dominant Bacteria TCCC15005 Used for Treatment

of Alkaline Wastewater from Oil Refinery in a SBR . . . . . . . . 1011
Jing Yang, Hua Zhao, Xi Wang, Xin Feng and Xinhua Wang
109 Isolation and Characterization of a New Moderately

Halophilic Bacterium Strain SM. 200-5 from Solar
Saltern Ponds . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1023
Gaochao Xu, Yuangao Deng, Donghui Song and Liying Sui
110 Preparation of Wetting Powder for Biocontrol

Bacillus subtilis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1033
Fang Chen, Shangjing Guo, Haiying Shi, Deduo Han,
Yuanjun Kang, Yu Zheng and Min Wang
111 Isolation and Characterization of s-Butanol Tolerant

Microorganisms . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1041
Litao Shi, Hongjiang Yang, Qian Li and Xuying Qin
112 Application of Support Vector Machine in Base Liquor

Classification . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1051
Junsen Lu, Liping Du, Haimei Ding, Ziping Du
and Dongguang Xiao
113 Isolation and Characterization of n-Butanol Tolerant

Microorganisms . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1057
Yue Yu, Hongjiang Yang, Qun Li and Xuying Qin
114 Effects of Dual-Frequency Ultrasound with a-amylase

on the Properties and Structure of Mung Bean Starch . . . . . . . 1067
Aijun Hu, Jing Lu, Jie Zheng, Xiaoqing Zhang, Ying Zhang,
Tong Zhang, Qian Li and Lin Yang
115 Relationship Between Diet and Stable Carbon

and Nitrogen Isotope Composition in Beef Tissues . . . . . . . . . . 1075
Fengmei Sun, Guangyu Shi, Huiwen Wang and Shuming Yang
116 Expression and Sequence Analysis of ChRpS3, a Ribosomal

Protein S3 cDNA, and its Potential Role in Ovary
Development of Cymbidium hybridium . . . . . . . . . . . . . . . . . . 1083
Xiaoqiang Chen, Xiulan Li, Ning Sun and Wenqin Song
Contents xvii
117 Lichen Flora on the Genera Alectoria, Pseudephebe,

and Sulcaria (Lichenized Ascomycota, Parmeliaceae)
from the Hengduan Mountains in China (4) . . . . . . . . . . . . . . 1095
Xinyu Wang, Dong Liu, Jianwen Li, Hiroshi Harada
and Lisong Wang
118 Discussion on the New and the Old Country Mark

in Detecting the Coliform Bacteria . . . . . . . . . . . . . . . . . . . . . 1107
Lin Huang, Chunxia Wang, Ying Zhang, Fan Mei, Yan Huang,
Jinpeng Wang and Bo Zheng
119 Screening Autotetraploid Plantlets of Glycyrrhiza uralnesis

Fisch by Colchicine-Treated Bud Culture . . . . . . . . . . . . . . . . 1117
Xinglin Li, Junting Lu, Xuefei Cao, Na Zhao, Yang Han,
Aijia Cao, Jie Ding and Jun Zhao
120 Screening of Antimicrobial Marine Microorganisms

and Purifying of Its Bioactive Substances . . . . . . . . . . . . . . . . 1125
Zhiwen Liu, Qiankun Ruan, Sirigulen Qian and Lina Cong
121 Determination of Dichloromethane in Waste Water

Using Headspace Gas Chromatography . . . . . . . . . . . . . . . . . . 1137
Chaozheng Zhang, Huijing Xu, Yutao Li and Fuhai Wang
122 Simulation of Bio-syngas Production from Biomass

Gasification via Pressurized Interconnected Fluidized Beds . . . 1145
Fei Feng, Guohui Song, Laihong Shen and Jun Xiao
123 Research on Salt-tolerant Gene GPD1

in Zygosaccharomyces rouxii . . . . . . . . . . . . . . . . . . . . . . . . . . 1157
Lihua Hou, Yanfei Yu, Cong Wang and Chunling Wang
124 Mutagenic Research on Ciliary Neurotrophic Factor (CNTF)

in Escherichia coli After Heavy Ions Irradiation . . . . . . . . . . . 1165
Xiaodong Jin, Qingfeng Wu, Xinguo Liu, Yan Liu, Yong Chen,
Jian Lu and Lin Jiang
125 Molecular Characterization and Expression of Ribosomal

Protein L15 Gene (RPL15) From Arachis hypogaea . . . . . . . . . 1171
Qi Wu, Xiuzhen Wang, Hongtao Yu, Yufei Ding, Fenggao Cui,
Jiancheng Zhang, Yueyi Tang and Chuantang Wang
126 Optimization of Extraction Conditions for Glycosaminoglycan

from Urechis unicinctus by Response Surface Methodology . . . 1183
Chunying Yuan, Xu Han, Qingman Cui and Ping Liu
xviii Contents
127 Quantitative Trait Loci Mapping of Unstripped Germ Rate

in Milled Rice. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1191
Shengbin Liu, Fang Wang, Zetian Hua, Meng Meng,
Fei Zhao and Xin Liu
128 The Application of the GSI in the Preservation

and Quality Control of Oat Beverage . . . . . . . . . . . . . . . . . . . 1197
Yuzhu Liu and Min Zhang
129 The Effect of Carbon Nanotubes on Rice Seed Germination

and Root Growth . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1207
Yumei Jiang, Zetian Hua, Yiqing Zhao, Qindai Liu,
Fang Wang and Qin Zhang
130 Study on the Accumulation Laws of Protein in Japonica

Rice Seed During Development . . . . . . . . . . . . . . . . . . . . . . . . 1213
Fang Wang, Bolian Sun, Chunkai Gu, Jiajia Mi,
Qin Zhang and Zetian Hua
131 Prevalence Investigation of Tetracycline Resistant Bacteria

in Raw Milk . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1219
Xiaomei Zhang and Hongjiang Yang
132 Study on Biological Denitrification Removal Technologies

Treating Eutrophication Water . . . . . . . . . . . . . . . . . . . . . . . . 1229
Zongzheng Yang, Huan Zhang, Deqiang Zhang and Jinzhao Pang
133 Study on Decolorization Effect of Biological Strengthening

the Activated Carbon with White Rot Fungi . . . . . . . . . . . . . . 1237
Zongzheng Yang, Junxia Xu, Peng Yu and Jinzhao Pang
134 The Removal of Crude Oil in Waste Drilling Muds

by a Constructed Microbial Consortium . . . . . . . . . . . . . . . . . 1245
Yunkang Chang, Xingbiao Wang, Yifan Han, Manman Wang,
Chenggang Zheng, Yongli Wang and Zhiyong Huang
135 Isolation and Identification of Saline Tolerance

Phosphate-Solubilizing Bacteria Derived from Salt-affected
Soils and Their Mechanisms of P-solubilizing . . . . . . . . . . . . . 1259
Yang Han, Chunmei Wang, Xinglin Li, Xuefei Cao, Aijia Cao
and Na Zhao
136 Isolation and Characterization of a Bacillus Strain

for Alkaline Wastewater Treatment . . . . . . . . . . . . . . . . . . . . 1267
Kun Chen, Wenyu Shi, Jing Yang, Tong Zhang and Hua Zhao
Part III
Pharmaceutical Biotechnology
Chapter 66
Promising Biomarkers: MicroRNAs
at Diagnosis, Therapy and Prognostic
Evaluation of Breast Cancer
Dalin Lu, Nan Wang, Xinghua Liao, Xuan Huang, Jianhua Zhang,
Zhenyu Wang, Lian Duan, Jiajie Liu, Baoshu Jin, Yue Wang
and Tong-Cun Zhang
Abstract MicroRNAs (miRNAs) are small noncoding RNAs with regulatory

functions, which play an important role in malignancies. An increasing amount of
experimental evidence has shown that many miRNAs are aberrantly expressed in
breast cancer and influence breast cancer behavior and progression. Furthermore,
miRNAs can act either as tumor suppressors or as oncogenes, depending on the
targets they regulate, and measurements of miRNAs expression in breast cancer
have diagnostic and prognostic implications. Thus, this implies that miRNAs have
huge potential as biomarkers. In addition, their extreme stability and ease of
detection further support the idea that miRNAs have great potential to evolve into
effective biomarkers in the clinic. The objective of this review is to update current
realization regarding that miRNAs are promising candidates at diagnostic, thera-
peutic and prognostic evaluation aspects of clinical application.
Keywords Breast cancer miRNAs Diagnosis Therapy Prognosis
D. Lu, X. Liao, and X. Huang contributed equally to this work and are nominated as the first
author.
D. Lu (&) X. Liao Z. Wang L. Duan J. Liu T.-C. Zhang (&)

Medical school, Wuhan University of Science and Technology, Wuhan 430000,
People’s Republic of China
e-mail: tony@tust.edu.cn
D. Lu N. Wang X. Liao Y. Wang T.-C. Zhang
Key Laboratory of Industrial Fermentation Microbiology, Ministry of Education
and Tianjin, College of Biotechnology, Tianjin University of Science and Technology,
Tianjin 300457, People’s Republic of China
D. Lu J. Zhang B. Jin
The Second Artillery General Hospital PLA, Beijing 100000, People’s Republic of China
X. Huang
Medical School, Nanchang University, Nanchang 330006, People’s Republic of China
T.-C. Zhang et al. (eds.), Proceedings of the 2012 International Conference 649
on Applied Biotechnology (ICAB 2012), Lecture Notes in Electrical Engineering 250,
DOI: 10.1007/978-3-642-37922-2_66, Springer-Verlag Berlin Heidelberg 2014
650 D. Lu et al.
66.1 A Brief Introduction to MicroRNAs
‘Noncoding’ or ‘non-messenger’ RNAs are various molecules with structural,

enzymatic, and regulatory functions. Among these RNAs with regulatory activity
are miRNAs, which are about 22 nucleotides in length [1]. The majority of animal
miRNAs are imprecisely matching to their target mRNAs, and then they hinder
protein synthesis by unknown mechanisms. Some studies even suggest that the
translationally repressed target mRNAs remain related with ribosomes [2–4]. In
addition, computational algorithms have estimated that miRNAs could target more
than 30 % of the human genome [5]. Significantly, a single miRNAs can regulate
more than one gene, and equally a particular gene can be regulated by compound
miRNAs. Thus, miRNAs, can regulate diverse biological processes, for example,
development, angiogenesis, differentiation, immune cell function, proliferation,
apoptosis and wound healing, and so on [6].
An increasing number of deregulated miRNAs has been detected in breast
cancer, and many of them are closely associated with cancer metastasis and poor
prognosis, and reduce survival time of breast cancer patients. For example, the
high-expressed miRNA, miR-21, has been reported to be associated with advanced
stage, node positivity. Meanwhile, miRNA-21 knock-down in cell-line models
have been related to increased sensitivity to topotecan and taxol. All of them
suggest an important role of miRNAs in oncogenesis, diagnosis, therapy, and
prognosis of breast cancer [7–11].
In this review, we discuss miRNAs as potential biomarkers used in breast
cancer, emphasizing that miRNAs can be effectively used in these aspects of
diagnosis, therapy, and prognostic valuation in the clinical setting. Our efforts are
to research and recommend more effective methods to improve the quality of life
and survival time.
66.2 Potential Use of miRNAs as Biomarkers for Breast

Cancer
miRNAs expression profiles derived from large-scale analyses of tumor samples

have been shown to serve as phenotypic signatures of particular cancer types. For
example, seven independent studies have analyzed the miRNA profile of breast
cancer tissues or cell lines, compared to normal tissues or cell-lines. These studies
described a general down-regulation of miRNAs in breast cancer tissues or cell
lines compared to normal breast cancer tissues or cell-lines [7, 12–17].
Up to now, most profiling studies have paid attention to deregulated miRNAs
either in the primary breast cancer tissue or in breast cancer cell lines. miRNAs
expression profile analyses from all kind of breast cancer or cell lines analyzed by
66 Promising Biomarkers: MicroRNAs at Diagnosis 651
miRNAs profiling have revealed considerably different miRNA profiles (for

mature or precursor miRNAs) compared with normal cells from the same tissue. A
review of the published large-scale miRNA profiles reveals that several constantly
deregulated miRNAs in tumors from breast cancer patients together with their
clinical correlations are listed in Table 66.1. Undeniably, many of these miRNAs,
such as let-7a, miR-10b, miR-21, miR-31, miR-145, and miR-155 are deregulated
in various types of cancer, including breast, prostate, colon, lung, liver cancers,
and melanoma [17–21]. In addition, the overexpression of several miRNAs such as
miR-21 and so on in human breast cancer is associated with advanced clinical
stage, lymph node metastasis, and patient poor prognosis [14]. Furthermore, Zhao
et al. have demonstrated that circulating miRNAs in plasma could potentially serve
as novel minimally invasive biomarkers for early detection of breast cancer [22].
Heneghan and his colleagues surveyed a panel of 7 candidate miRNAs in whole
blood RNAs from 148 breast cancer patients and 44 specific miRNA, miR-195,
only high-expressed in breast cancer. Additionally, they observed a significant
reduction of miR-195 in postoperative whole blood compared with the preoper-
ative samples of the same patients [17]. Thus, it could be applied not only to
directly detect breast tumors, but also perceive breast cancer relapse.
Besides, due to their resistance to degradation, blood miRNAs appear to be very
stable, and there is budding interest in profiling circulating miRNAs either as
diagnostic noninvasive agent markers or as therapeutic measures. Circulating
miRNAs have been widely reported to be drastically elevated in the blood of
cancer patients compared with healthy controls, and levels of these miRNAs are
associated with the primary tumors. The elimination of the primary tumor leads to
the recover of deregulated circulating miRNAs, implying that many of these
elevated circulating miRNAs are ‘tumor-derived’ and cancer-specific [6]. The
current belief is that these ‘tumor-derived’ circulating miRNAs are released from
the primary tumor via exosome vesicles and apoptotic bodies although the exact
mechanisms of release are still emerging [23–25]. Although there will be technical
difficulties, all these miRNAs’ properties imply that miRNAs as clinical bio-
markers will have a promising prospect.
66.3 miRNAs Profiling to Advance Development

of Diagnosis, Therapy, and Prognostic Evaluation
There is increasing evidence to support that miRNAs are closely associated with a
huge proportion of breast cancer heterogeneity. Many miRNAs have been shown
to be deregulated in breast cancer [7, 13, 26, 27] and specific miRNAs functioning
as regulators of tumorigenicity, invasion, and metastasis have been documented
[8, 9, 28, 29]. In addition, miRNAs that can regulate ER, PR, and HER2/neu,
652
Table 1 Commonly regulated miRNAs, their targets, and pathway in breast cancer
miRNA Tumor expression level References Validated targets Pathways References
miR-21 : [7] HER2, BCL2, TPM1, TIMP3, PDCD4, PTEN, Apoptosis, invasion, metastasis [14, 28, 34–38]
MASPIN, RHOB, MMP3
miR-155 : [7] Caspase3, FOXO3A, SOCS1, RHOA Proliferation, TGF-b, signaling [39–42]
miR-191 : [7, 43]
miR-196a : [7, 43] ANXA1 Proliferation, apoptosis [44]
miR-10b ; [7] RHOC, TIAM, HOXD10 Migration, invasion, metastasis [8, 45, 46]
miR-302b : [47] p21 Invasion, Migration [47]
miR-425 : [9] DICER1 [47]
miR-100 ; [48]
miR-125b ; [7, 43, 48] HER2, HER3, CRAF, MUC1, BAK, ERA, Proliferation, apoptosis, [26, 30, 49, 50]
RTKN migration
miR-145 ; [7, 48] TP53, PUMA, c-Myc,MUC1, ERa, RTKN Proliferation, apoptosis, invasion [51–54]
miR-205 ; [26] HER3, VEGF-A, EMT Proliferation, invasion [7, 55, 56]
This table represents miRNAs whose expressions are notably regulated in clinical samples (tumors of human patients)
D. Lu et al.
known to be of diagnostic value, therapeutic worth, and prognostic significance in

breast cancer, has been demonstrated [30, 31].
At present, miRNAs expression profiling can be used to evaluate clinicopath-
ological variables to categorize breast tumors. To predict disease progression and
prognosis using miRNAs expression profiling analysis is of particular interest.
First of all, profiling features the potential to identify novel prognostic indicators,
which may contribute to improve patients for adjuvant therapy. This approach has
already shown promise with genomic signatures, and miRNA profiles appear to
have superior accuracy to mRNA profiling [32]. Besides, the measurement of
miRNAs with regulatory roles, distinct breast tumor samples could identify novel
targets for therapeutic manipulation. For example, miRNA-221 and 222 are neg-
atively correlated with ERa protein expression and the knockdown of miRNA-
221/222 can effectively restore ERa protein expression [33]. Of course, there are
more miRNAs associated with PR and HER2. Here, we do not list all of them.
In conclusion, all these findings discussed in this report suggest that miRNAs
detected are promising as novel biomarkers and useful for the elimination of false
positives, false negatives of conventional various classifiers, and prognostic
evaluation. Moreover, clinician could apply gene therapies to change expression of
miRNAs to remedy breast cancer.
Acknowledgments This work was financially supported by National Natural Science Foundation
of China (No. 30970615, 31071126) and Program for Changjiang Scholars and Innovative
Research Team in University of Ministry of Education of China (IRT1166) and the Key Project of
Chinese Ministry of Education (212010) and Hubei key project of Science and Technology
Research (No. D20111102) and Hubei Natural Science Foundation (No.2010CDB03506).
References
1. Bartel DP (2004) MicroRNAs: genomics, biogenesis, mechanism and function. Cell

116:281–297
2. Olsen PH, Ambros V (1999) The lin-4 regulatory RNA controls developmental timing in
Caenorhabditis elegans by blocking LIN-14 protein synthesis after the initiation of
translation. Dev Biol 216:671–680
3. Seggerson K, Tang L, Moss EG (2002) Two genetic circuits repress the Caenorhabditis
elegans heterochronic gene lin-28 after translation initiation. Dev Biol 243: 215–225
4. Griffiths-Jones S, Saini HK, van Dongen S et al (2008) miRBase: tools for microRNA
genomics. Nucl Acids Res 36:154–158
5. Lewis BP, Burge CB, Bartel DP (2005) Conserved seed pairing, often flanked by adenosines,
indicates that thousands of human genes are microRNA targets. Cell 120:15–20
6. Andorfer CA, Necela BM, Thompson EA et al (2011) MicroRNA signatures: clinical
biomarkers for the diagnosis and treatment of breast cancer. Trends in Molecular Medicine
17(6):313–319
7. Iorio MV, Ferracin M, Liu CG et al (2005) MicroRNA gene expression deregulation in
human breast cancer. Cancer Res 65:7065–7070
8. Ma L, Teruya-Feldstein J, Weinberg RA (2007) Tumour invasion and metastasis initiated by
microRNA-10b in breast cancer. Nature 449:682–688
654 D. Lu et al.
9. Tavazoie SF, Alarcón C, Oskarsson T et al (2008) Endogenous human microRNAs that

suppress breast cancer metastasis. Nature 451:147–152
10. Silveri L, Tilly G, Vilotte JL et al (2006) MicroRNA involvement in mammary gland
development and breast cancer. Reprod Nutr Dev 46:549–556
11. Corcoran C, Friel AM, Duffy MJ et al (2011) Intracellular and Extracellular MicroRNAs in
Breast Cancer. Clin Chem 57(1):18–32
12. Sempere LF, Christensen M, Silahtaroglu A et al (2007) Altered MicroRNA expression
confined to specific epithelial cell subpopulations in breast cancer. Cancer Res
67:11612–11620
13. Volinia S, Calin GA, Liu CG et al (2006) A microRNA expression signature of human solid
tumors defines cancer gene targets. PNAS 103:2257–2261
14. Yan LX, Huang XF, Shao Q et al (2008) MicroRNA miR-21 over-expression in human breast
cancer is associated with advanced clinical stage, lymph node metastasis and patient poor
prognosis. RNA 14:2348–2360
15. Fassan M, Baffa R, Palazzo JP et al (2009) MicroRNA expression profiling of male breast
cancer. Breast Cancer Res 11:R58
16. Lehmann U, Streichert T, Otto B et al (2010) Identification of differentially expressed
microRNAs in human male breast cancer. BMC Cancer 10:109
17. Heneghan HM, Miller N, Lowery AJ et al (2010) Circulating microRNAs as novel minimally
invasive biomarkers for breast cancer. Ann Surg 251:499–505
18. Selcuklu SD, Donoghue MT, Spillane C (2009) miR-21 as a key regulator of oncogenic
processes. Biochem Soc Trans 37:918–925
19. Faraoni I, Antonetti FR, Cardone J et al (2009) miR-155 gene: a typical multifunctional
microRNA. Biochim Biophys Acta 1792(6):497–505
20. Wang Y, Lee CG (2009) MicroRNA and cancer: focus on apoptosis. Cell Mol Med 13:12–23
21. Valastyan S, Reinhardt F, Benaich N et al (2009) A pleiotropically acting microRNA, miR-
31, inhibits breast cancer metastasis. Cell 137(6):1032–1046
22. Zhao H, Shen J, Medico L et al (2010) A pilot study of circulating miRNAs as potential
biomarkers of early stage breast cancer. PLoS ONE 5(10):e13735
23. Iguchi H, Kosaka N, Ochiya T (2010) Secretory microRNAs as a versatile communication
tool. Commun Integr Biol 3:478–481
24. Kosaka N, Iguchi H, Ochiya T (2010) Circulating microRNA in body fluid: a new potential
biomarker for cancer diagnosis and prognosis. Cancer Sci 101:2087–2092
25. Kosaka N, Iguchi H, Yoshioka Y et al (2010) Secretory mechanisms and intercellular transfer
of microRNAs in living cells. J Biol Chem 285:17442–17452
26. Mattie MD, Benz CC, Bowers J et al (2006) Optimized high-throughput microRNA
expression profiling provides novel biomarker assessment of clinical prostate and breast
cancer biopsies. Mol Cancer 5:24
27. Blenkiron C, Goldstein LD, Thorne NP et al (2007) MicroRNA expression profiling of
human breast cancer identifies new markers of tumor subtype. Genome Biol 8:R214
28. Zhu S, Wu H, Wu F et al (2008) MicroRNA-21 targets tumor suppressor genes in invasion
and metastasis. Cell Res 18:350–359
29. Bhaumik D, Scott GK, Schokrpur S et al (2008) Expression of microRNA-146 suppresses
NF-jB activity with reduction of metastatic potential in breast cancer cells. Oncogene
27:5643–5647
30. Scott GK, Goga A, Bhaumik D et al (2007) Coordinate suppression of ERBB2 and ERBB3
by enforced expression of micro-RNA miR-125a or miR-125b. J Biol Chem 282:1479–1486
31. Adams BD, Furneaux H, White BA (2007) The micro-ribonucleic acid (miRNA) miR-206
targets the human estrogen receptor-alpha(ERa) and represses ERa messenger RNA and
protein expression in breast cancer cell lines. Mol Endocrinol 21:1132–1147
32. Lu J, Getz G, Miska EA et al (2005) MicroRNA expression profiles classify human cancers.
Nature 435:834–838
33. Zhao JJ, Lin J, Yan H et al (2008) miRNA-221/222 negatively regulates estrogen receptor
and is associated with tamoxifen resistance in breast cancer. J Biol Chem
283(45):31079–31086
34. Qi L, Bart J, Tan LP et al (2009) Expression of miR-21 and its targets (PTEN, PDCD4, TM1)
in flat epithelial atypia of the breast in relation to ductal carcinoma in situ and invasive
carcinoma.BMC Cancer 9:163
35. Huang GL, Zhang XH, Guo GL et al (2008) Expression of microRNA-21 in invasive ductal
carcinoma of the breast and its association with phosphatase and tensin homolog deleted from
chromosome expression and clinicopathologic features. Zhonghua Yi Xue Za Zhi
88:2833–2837
36. Qian B, Katsaros D, Lu L et al (2009) High miR-21 expression in breast cancer associated
with poor disease-free survival in early stage disease and high TGF-beta1. Breast Cancer Res
Treat 117:131–140
37. Song B, Wang C, Liu J et al (2010) MicroRNA-21 regulates breast cancer invasion partly by
targeting tissue inhibitor of metalloproteinase 3 expression. J Exp Clin Cancer Res 29:29
38. Huang TH, Wu F, Loeb GB et al (2009) Up-regulation of mir-21 by her2/neu signaling
promotes cell invasion. J Biol Chem 284:18515–18524
39. Kong W, He L, Coppola M et al (2010) MicroRNA-155 regulates cell survival, growth, and
chemo-sensitivity by targeting FOXO3a in breast cancer. J Biol Chem 285:17869–17879
40. Jiang S, Zhang HW, Lu MH et al (2010) MicroRNA-155 functions as an OncomiR in breast
cancer by targeting the suppressor of cytokine signaling 1 gene. Cancer Res 70:3119–3127
41. Kong W, Yang H, He L et al (2008) MicroRNA-155 is regulated by the transforming growth
factor beta/Smad pathway and contributes to epithelial cell plasticity by targeting RhoA. Mol
Cell Biol 28:6773–6784
42. Ovcharenko D, Kelnar K, Johnson C et al (2007) Genome-scale microRNA and small
interfering RNA screens identify small RNA modulators of trail-induced apoptosis pathway.
Cancer Res 67:10782–10788
43. Hui AB, Shi W, Boutros PC et al (2009) Robust global micro-RNA profiling with formalin-
fixed paraffin-embedded breast cancer tissues. Lab Invest 89:597–606
44. Luthra R, Singh RR, Luthra MG et al (2008) MicroRNA-196a targets annexin A1: a
microRNA-mediated mechanism of annexin A1 down-regulation in cancers. Oncogene
27:6667–6678
45. Ma L, Reinhardt F, Pan E et al (2010) Therapeutic silencing of miR-10b inhibits metastasis in
a mouse mammary tumor model. Nat Biotechnol 28:341–347
46. Moriarty CH, Pursell B, Mercurio AM (2010) miR-10b targets Tiam1: implications for Rac
activation and carcinoma migration. J Biol Chem 285:20541–20546
47. Esquela-Kerscher A, Slack FJ (2006) Oncomirs-microRNAs with a role in cancer. Nat Rev
Cancer 6:259–269
48. Navon R, Wang H, Steinfeld I et al (2009) Novel rank-based statistical methods reveal
microRNAs with differential expression in multiple cancer types. PLoS ONE 4(11):e8003
49. Zhou M, Liu Z, Zhao Y et al (2010) MicroRNA-125b confers the resistance of breast cancer
cells to paclitaxel through suppression of pro-apoptotic Bcl-2 antagonist killer 1 (Bak1)
expression. J Biol Chem 285:21496–21507
50. Hofmann MH, Heinrich J, Radziwill G et al (2009) A short hairpin DNA analogous to miR-
125b inhibits C-Raf expression, proliferation, and survival of breast cancer cells. Mol Cancer
Res 7:1635–1644
51. Spizzo R, Nicoloso MS, Lupini L et al (2010) miR-145 participates with TP53 in a death-
promoting regulatory loop and targets estrogen receptor-a in human breast cancer cells. Cell
Death Differ 17:246–254
52. Sachdeva M, Zhu S, Wu F et al (2009) p53 represses c-Myc through induction of the tumor
suppressor miR-145. PNAS 106(9):3207–3212
53. Sachdeva M, Mo YY (2010) MicroRNA-145 suppresses cell invasion and metastasis by
directly targeting mucin 1. Cancer Res 70:378–387
656 D. Lu et al.
54. Wang S, Bian C, Yang Z et al (2009) miR-145 inhibits breast cancer cell growth through
RTKN. Int J Oncol 34:1461–1466
55. Wu H, Zhu S, Mo YY (2009) Suppression of cell growth and invasion by miR-205 in breast
cancer. Cell Res 19:439–448
56. Gregory PA, Bert AG, Paterson EL et al (2008) The miR-200 family and miR-205 regulate
epithelial to mesenchymal transition by targeting ZEB1 and SIP1. Nat Cell Biol 10:593–601
Chapter 67
Dimerization of Chemokine Receptors
and its Novel Roles in Drug Discovery
Mingqing Wang, Baosheng Ge and Fang Huang
Abstract G-protein-coupled receptors (GPCRs) comprise the largest family of

integral membrane proteins and mediate most of the transmembrane signal
transduction. Approximately 50 % of all marketed drugs target GPCRs, which
makes this protein family the most important drug targets. Chemokine receptors
belong to GPCRs, which were perceived as monomers decades ago. However,
recently there are growing evidences indicating that most of GPCRs can form
dimers or higher order oligomers. Some chemokine receptors are also found
existing as homodimers or heterodimers. A large number of studies have suggested
that homodimers or heterodimers may exhibit specific functions, which are dif-
ferent from their monomeric counterparts. Meanwhile, the appearance of dimers
with new signaling properties gives new chance in the search for novel drug
targets. In this review, we will mainly summarize the current knowledge of the
dimerization of chemmokine receptors and its potential roles in drug discovery.
Keywords Chemokine receptor Dimerization Drug discovery GPCRs
67.1 Introduction
G-protein-coupled receptors (GPCRs) comprise the largest family of integral

membrane proteins and mediate most of the transmembrane signal transduction [1].
GPCRs are important drug targets and account for about 50 % of all the drugs on
the market [2]. Chemokine receptors are a subgroup of the GPCRs superfamily. To
date, totally 22 chemokine receptors have been discovered in human genome [3].
Chemokine receptors and their chemokines play an important role in the immune
M. Wang B. Ge F. Huang (&)

Center for Bioengineering and Biotechnology, China University of Petroleum (East China),
Qingdao 266580, People’s Republic of China
e-mail: fhuang@upc.edu.cn
658 M. Wang et al.
defense by directing the migration of leukocytes. In addition to their normal roles,

chemokine receptors are involved in many diseases, including inflammatory dis-
eases, cancer, AIDS, and so on [4]. Hence chemokine and receptors are deemed as
important drug targets. The first small molecule successfully targeting the che-
mokine receptor was the CCR5 antagonist, for the prevention of HIV infection,
approved by the Federal Drug Administration (FDA) in 2007. Besides, a CXCR4
antagonist was approved by the FDA in 2008 for hematopoietic stem cell mobili-
zation [5]. The existence of dimers or oligomers of GPCRs has been confirmed in
the past decades. The structure of chemokine receptor dimers is different from the
monomeric form, so it is possible that the dimers function in specific signaling
pathways. Moreover, the dimers may take part in ligand binding and distinct signal
transduction. The specificity of dimerization may give new opportunity to find
novel drugs [6, 7]. Chemokine receptor dimerization and its role in drug discovery
are reviewed in this paper.
67.2 Chemokines and Chemokine Receptors
Chemokines are small proteins, which mediate cell migration during inflammation
and development. Based on the cysteine (Cys) in the N-terminal domain, che-
mokines are divided into four classes (CC, CXC, CX3C, XC) [8]. The nomen-
clature of chemokine is characterized by combination of ‘‘L’’ and an Arabic
number, such as CCL1. In the CC class, the two Cys residues are adjacent, and
there are 28 known members in human genome. In the CXC class, there is an
additional amino acid between the two Cys residues and 17 known CXC che-
mokines have been discovered till now. The CX3C chemokine has only one known
member, with three additional amino acids between the two Cys residues. XC class
contains only one cysteine and there are two known members [9, 10].
There are totally 22 known chemokine receptors in human genome [3], and 19
of which works as signaling receptors. The classification of chemokine receptors is
based on the ligands which they bind. For example, CC receptors bind CC ligands.
The other three chemokine receptors (D6, CCX-CKR, DARC) are atypical
receptors, which are unable to directly mediate leukocyte migration. They are
thought to regulate chemokine distribution or abundance to control chemokine-
derived leukocyte migration. Many chemokines bind multiple receptors and most
receptors bind multiple chemokines (Table 67.1). Despite of the pivotal roles in
the immune system, chemokine receptors are associated with many diseases, such
as atherosclerosis, rheumatoid arthritis, asthma, and cancer (Table 67.1). In
addition, CXCR4 and CCR5 are the primary co-receptor for X4 and R5 HIV-1
isolates.
67 Dimerization of Chemokine Receptors and its Novel Roles in Drug Discovery 659
Table 67.1 Chemokine receptor binding their ligands and related to diseases
Chemokine receptor Binding chemokine Related to diseases
CXCR1 CXCL6,7,8 Sepsis, atherosclerosis [48]
CXCR2 CXCL1,2,3,5,6,7,8 Sepsis, rheumatoid arthritis [48]
CXCR3 CXCL9,10,11 Transplant, psoriasis, cancer [49]
CXCR4 CXCL12 HIV, cancer [50, 51]
CXCR5 CXCL13
CXCR6 CXCL16
CXCR7 CXCL11,12 Cancer [52]
CCR1 CCL3,5,7,8,13,14,15,16,23 Psoriasis, cancer [53]
CCR2 CCL2,7,8,13,16 Diabetes, obesity, cancer [54]
CCR3 CCL5,7,8,11,13,15,16,24,26,28 Allergic diseases, Asthma1 [55]
CCR4 CCL17,22 Asthma, skin disease
CCR5 CCL3,4,5,8,11,14,16 HIV, transplant, cancer [56]
CCR6 CCL20 Asthma [57]
CCR7 CCL19,21 Cancer [58]
CCR8 CCL1
CCR9 CCL25 Irritable bowel disease [58]
CCR10 CCL27,28
XCR1 XCL1,2
CX3CR1 CX3CL1 Atherosclerosis [59]
D6 CCL2,3,4,5,7,8,11,13,14,17,22
CCX-CKR CCL19,21,25
DARC CCL2,7,8,11,13,14,16,17,18;
CXCL1,5,6,7,8,9,11,13
67.3 Methods to Study GPCR Dimerization
In 1996, Hebert firstly demonstrated that b2-adrenergic receptors could form

homodimers by using Co-immunoprecipitation [11]. Since then, many methods
have been used to detect the dimerization or higher order oligomerization of many
GPCRs [12]. Biochemical techniques are traditional methods to study the dimer-
ization of GPCRs, including SDS–Polyacrylamide Gel Electrophoresis (SDS-
PAGE), Cross-linking experiments, Co-immunoprecipitation (Co-IP) and western
blot [13]. However, such biochemical techniques can not be used to probe the
dimerization of GPCRs in living cells. In the past decade, there was a shift toward
using resonance energy transfer techniques to study the dimerization. Applications
of bioluminescence resonance energy transfer (BRET) and fluorescence resonance
energy transfer (FRET) can exhibit advantages over many more traditional tech-
niques because they can detect both intracellular and cell surface expressed dimers
in intact living cells [14]. BRET and FRET are based on the nonradioative transfer
of energy from a donor molecule to an acceptor molecule in a close distance (less
than 10 nm), which have overlapping excitation and emission spectra. Bimolecular
fluorescence complementation (BiFC) has also been used to detect the dimeriza-
tion. BiFC is based on the association between two nonfluorescent fragments of a
660 M. Wang et al.
Table 67.2 Methods to study GPCR dimerization

Biochemical techniques Biophysical techniques
SDS-PAGE, Fluorescence resonance energy transfer (FRET),
Cross-linking experiments, Bioluminescence resonance energy transfer (BRET),
Western blot, Biomolecular fluorescence complementation (BiFC),
Co-immunoprecipitation (Co-IP) Atomic force microscopy (AFM)
fluorescent protein, which could be fused to two GPCRs. If the two GPCRs can
interact, then the nonfluorescent fragments can be brought close to each other and
thus form a fluorescent protein. In addition, the dimerization and higher order
oligomerization of rhodopsin in native retinal disks was studied by using atomic
force microscopy [15] (Table 67.2).
67.4 Chemokine Receptor Dimerization and their

Functions
GPCRs were considered to exist and function as monomers which can interact with
G-proteins in 1:1 stoichiometry. However, in the past decades, the hypothesis was
challenged. The growing evidences indicate that GPCRs can physically interact
with each other. They can form dimers or even oligomers. In 1998, Jones et al.
found the GABAB (a member of class C GPCR) could exist and function as an
heterodimer [16]. Both GABABR1 and GABABR2 are nonfunctional when indi-
vidually expressed in cells, because GABABR1 is retained in the endoplasmatic
reticulum (ER), GABABR2 can not bind the ligand [17, 18]. The class C GPCR
including sweet and umami taste receptors can function in the form of heterodimer
[19, 20].
67.4.1 Chemokine Receptor Homodimerization

and Heterodimerization
Some chemokine receptors can exist as homodimers. In the early research, ligands
were thought to induce the homodimerization. For example, CXCL12 induced
CXCR4 homodimerization [21], while CCL2 and CCL5 could induce the homo-
dimerization of CCR2 and CCR5, respectively [22, 23]. Recent studies suggest
that CCR2 [24], CCR5 [25], CXCR1 [26], CXCR2 [27], CXCR4 [28, 29], CXCR7
[30], and DARC [31] can form constitutive homodimerization.
Some chemokine receptors can also form heterodimers. Mellado et al. first
reported CCR2/CCR5 heterodimerization as ligand dependent. His study sug-
gested that CCR2/CCR5 heterodimerization was induced by costimulation of
CCL2 and CCL5. El-Asmar et al. found CCR5 and CCR2 could heterodimerized
with the similar efficiency as they could homodimerize using BRET. And there
was no cooperative signaling after costimulation by CCL2 or CCL5 [32]. This
result was very different from Mellado’s study. Different research methods in the
two studies may cause the different results. Mellado et al. used cross-linking agent
before addition of ligand, which is prior to cell lysis and immunoprecipitation in an
effort to stabilize receptor interaction, but El-Asmar et al. did not use. The cross-
linking agent could induce association of receptors and the ligand could also help
enhance the cross-linking effort. More experiments suggested that CCR2 and
CCR5 formed constitutive homodimerization and heterodimerization. The role of
ligand in CCR2/CCR5 dimerization is unclear [32]. In addition, CXCR1/CXCR2
[26], CXCR4/CCR2 [33], CXCR4/CXCR7 [30], CXCR4/CCR5 [34], DARC/
CCR5 [31] can form constitutive heterodimerization (Table 67.3).
67.4.2 The Functions of Chemokine Receptor Dimerization
In contrast to class C GPCRs in which dimerization is strictly necessary for their

functions [35], while some chemokine receptors can exist and function as
monomeric form. The homodimers or hetrodimers of chemokine receptors may
have novel functions, which is possibly different from the monomers (Table 67.3).
The acknowledgment on dimerization of chemokine receptors may help find novel
drug targets for therapy.
Human immunodeficiency virus type 1(HIV-1) infection is mediated by binding
of the viral protein gp120 to two proteins on the surfaces of target cells, CD4 and a
co-receptor. The co-receptors are normally chemokine receptors, typically either
CCR5 or CXCR4. HIV-1 strains can be divided into three major groups based on
Table 67.3 Functions of chemokine receptors dimerization

Functions of dimerization
CCR2/CCR2 Important for migration
CCR2/CCR5 Alter signaling [60]
CCR2V64I/CCR5 Delayed HIV progression [61]
CCR2V64I/CXCR4 Delayed HIV progression [61]
CCR2/CXCR4 Transinhibition of chemotaxis and calcium response [62]
CCR5/CCR5 Important for migration
CCR5/CXCR4 T cell costimulation and alternative signaling [63]
CCR5/CCR5D32 HIV resistance [64]
CXCR4/CCR5D32 HIV resistance [64]
CXCR1/CXCR1 Important for migration and signaling [65]
CXCR1/CXCR2 No effect on CXCL1-induced signaling [65]
CXCR4/CXCR7 Delayed ERK activation [66]
DARC/CCR5 Transinhibition of chemotaxis and calcium response [31]
662 M. Wang et al.
their co-receptor specificity as follows: R5 (CCR5-tropic), X4 (CXCR4-tropic),

and R5X4 (able to use either CCR5 or CXCR4) [36]. CCR5D32 is a 32-bp deletion
in the portion of the human CCR5 open reading frame (ORF) that encodes the
second extracellular loop [37, 38]. CCR5D32 encodes a truncated protein, which is
not detected on the cell surface and therefore could not function as a co-receptor
with HIV [39, 40]. Only a small population of individuals have the allelic trun-
cation variant CCR5D32. People with CCR5D32 homozygotes can resist HIV-1.
Agrawal et al. evidence that expression of recombinant CCR5D32 protein confers
broad protection against R5 and X4 strains of HIV-1 [41]. The mechanism was that
CCR5D32 protein can heterodimerize with intracellular wide type CCR5 and
CXCR4. They can form heterodimerizaion and thus CCR5D32 protein can act as a
negative regulator of wide type CCR5 and CXCR4. The heterodimerizaion can
reduce the cell surface expression of the major HIV co-receptors and thus can
resist entry of HIV. Understanding the mechanism of CCR5D32 protein hetero-
dimerized with CCR5 and CXCR4 may lead to new cues into the relationships of
these receptors. Then novel therapeutic drugs which induce resistance to HIV-1
can be developed.
CCR2-V64I is a polymorphism in CCR2 in which Val 64 is replaced by Ile.
People with CCR2-V64I have four-year delay in the progress to AIDS [42].
However, relatively few virus strains that can use CCR2 in conjunction with CD4
to infect cells have been reported. Mellado et al. find that CCR5 and CXCR4 can
form heterodimerization with CCR2-V64I. The heterodimers can delay the HIV
progress [43].
WHIM (Warts, Hypogammaglobulinemia, Infections, and Myelokathexis) syn-
drome is an immune deficiency, where dimerization is thought to result in abnormal
function of the CXCR4 receptor. The expression of C-terminal truncation mutants
of CXCR4 results in uncommon genetic immunodeficiency disease. The studies
show that CXCR4(wt)/CXCR4(mu) heterodimers are at least twice as much as their
homodimers, when two receptors coexist in the same cell at the same concentration,
thus suggesting that CXCR4(wt)/CXCR4(mu) heterodimers are dominant in the
cells of patients with WHIM [44].
Some chemokine receptors are reported to take part in cancer metastasis
(Table 67.1). For example, CXCR4 is reported to be expressed in a variety of cell
types, including peripheral blood lymphocytes and monocytes. CXCR4 is also
highly expressed in 28 human cancers, including prostate cancer, lung cancer, and
pancreatic cancer, metastases, and malignant breast tumors. Wang et al. found
constitutive dimers of CXCR4 in malignant living cell using FRET [45]. Lipid raft
microdomains are important in directed migration of cancer cells by maintaining
receptor dimer conformation. An 18 residue peptide which is as the same as the
TM4 of CXCR4, reduce the energy transfer between protomers of CXCR4 dimer
then block CXCR4-mediated cancer cell migration. Therefore, it is possible to use
peptides to specifically control migration of cancer cells and to decrease the
number of CXCL12 attracted tumor-associated macrophages, which could pro-
mote tumor metastasis. The study of TM4 peptide from CXCR4 suggested that
chemokine receptor dimers were potential important targets for effective cancer
therapy. It is possible to block cancer metastases through drugs like TM4 peptide
that interfers with dimeric receptor structures [7, 45]. More efforts are needed to
address the structure of dimerization of chemokine receptors and their signaling
role in HIV-1 infections, immunity, cancer biology and therapy, allergic condi-
tions, and various inflammatory.
CXCR7 is a novel chemokine receptor, which has two natural ligands CXCL11
and CXCL12. CXCL12 is also the ligand of CXCR4. In addition, CCX771 is a
small specific antagonist of CXCR7, similar to CXCL11. CXCR7 is different from
other receptors in signaling. Ligand activation of CXCR7 cannot trigger Gi-
mediated signaling and induced cell migration. The stimulation of ligands can
induce CXCR7 to associate with b-arrestin2, which is a unique signaling prop-
erties of CXCR7. CXCR4, and CXCR7 could form constitutive heterodimer [46].
Because CXCR4 and CXCR7 are linked to many cancers, the study of the role of
CXCR4/CXCR7 heterodimer is a hot spot. CXCR7 is important for CXCL12-
mediated transendothelial migration (TEM) in CXCR4 ? CXCR7 ? tumor cells.
CXCR7 can help tumor cells pass through endothelial cells. Moreover, although
the TEM is mediated by CXCL12/CXCR4, CXCL11, and CCX771 (belonging to
ligands of CXCR7) can potently block TEM. CCX771 is more efficient in blocking
TEM than the CXCR4 antagonist AMD3100, but it does not change the binding
affinity of CXCL12 for CXCR4 [47]. These results suggest that ligands of CXCR7
can inhibit CXCL12-mediated transendothelial migration. The research suggested
CXCR7 could be a novel cancer therapeutic target.
67.5 Prospects
The growing evidence supports the concept that chemokine receptor dimers or
oligomers may have more novel functions. The dimers or oligomers are probably
the basic functional unit of some chemokines. The dimerization of chemokine
receptors may have novel specificity and have less or even no side effect, which
makes them a promising new generation of drug targets. Synthetic peptides of
transmembrane region of chemokines may be an effective tool to study the role of
receptor dimerization. The synthetic peptides and their modified forms may be
useful for the treatment of cancers, infectious disease, and inflammatory condi-
tions. Interfering of HIV-1 infection can be achieved by drugs targeting dimer-
ization of co-receptor CCR5, CXCR4. Above all, the research on chemokine
receptors dimerization will bring a new dawn in the treatment of cancers, AIDS,
asthma, and so on.
Acknowledgments This work was financially supported in part by the National Key Basic
Research Program of China (2012CB518000), the National Natural Science Foundation of China
(No. 31000377), Shandong Province Natural Science Foundation (No. ZR2010BQ016), the Nat-
ural Science Foundation for Distinguished Young Scholar of Shandong Province (No. JQ201008),
and the Fundamental Research Funds for the Central Universities (No. 11CX04030A).
664 M. Wang et al.
References
1. Vassilatis DK, Hohmann JG, Zeng H et al (2003) The G protein-coupled receptor repertoires
of human and mouse. Proc Natl Acad Sci USA 100:4903–4908
2. Drews J (2000) Drug discovery: a historical perspective. Science 287:1960–1964
3. Allen SJ, Crown SE, Handel TM (2007) Chemokine: receptor structure, interactions, and
antagonism. Annu Rev Immunol 25:787–820
4. Gerard C, Rollins BJ (2001) Chemokines and disease. Nat Immunol 2:108–115
5. O’Hayre M, Salanga CL, Handel TM (2010) Emerging concepts and approaches for
chemokine-receptor drug discovery. Expert Opin Drug Discov 5:1109–1122
6. Mandrika I, Petrovska R, Klovins J (2010) Evidence for constitutive dimerization of niacin
receptor subtypes. Biochem Biophys Res Commun 395:281–287
7. Wang J, Norcross M (2008) Dimerization of chemokine receptors in living cells: key to
receptor function and novel targets for therapy. Drug Discovery Today 11:625–632
8. Liddiard K, Jones E (2001) Chemokine/chemokine receptor nomenclature. J Leukoc Biol
70:465–466
9. Jaerve A, Muller HW (2012) Chemokines in CNS injury and repair. Cell Tissue Res
349:229–248
10. Massimo L, Raffaella B, Corsi MM (2005) Chemokines and Their Receptors. Pathology
Patterns Reviews 123(Suppl 1):S82–S95
11. Hebert TE, Moffett S, Morello JP et al (1996) A peptide derived from a beta2-adrenergic
receptor transmembrane domain inhibits both receptor dimerization and activation. J Biol
Chem 271:16384–16392
12. Milligan G (2007) G protein-coupled receptor dimerisation: molecular basis and relevance to
function. Biochim Biophys Acta 1768:825–835
13. Milligan G, Bouvier M (2005) Methods to monitor the quaternary structure of G protein-
coupled receptors. FEBS J 272:2914–2925
14. Boute N, Jockers R, Issad T (2002) The use of resonance energy transfer in high-throughput
screening: BRET versus FRET. Trends Pharmacol Sci 23:351–354
15. Fotiadis D, Liang Y, Filipek S et al (2003) Atomic-force microscopy: Rhodopsin dimers in
native disc membranes. Nature 421:127–128
16. Jones KA, Borowsky B, Tamm JA et al (1998) GABA(B) receptors function as a heteromeric
assembly of the subunits GABA(B)R1 and GABA(B)R2. Nature 396:674–679
17. Margeta-Mitrovic M, Jan YN, Jan LY (2001) Function of GB1 and GB2 subunits in G protein
coupling of GABA(B) receptors. Proc Natl Acad Sci U S A 98:14649–14654
18. Galvez T, Duthey B, Kniazeff J et al (2001) Allosteric interactions between GB1 and GB2
subunits are required for optimal GABA(B) receptor function. EMBO J 20:2152–2159
19. Li X (2009) T1R receptors mediate mammalian sweet and umami taste. Am J Clin Nutr
90:733S–737S
20. Zhao GQ, Zhang Y, Hoon MA et al (2003) The receptors for mammalian sweet and umami
taste. Cell 115:255–266
21. Vila-Coro AJ, Rodriguez-Frade JM, Martin DA et al (1999) The chemokine SDF-1alpha
triggers CXCR4 receptor dimerization and activates the JAK/STAT pathway. FASEB J
13:1699–1710
22. Rodriguez-Frade JM, Vila-Coro AJ, Ana AM et al (1999) The chemokine monocyte
chemoattractant protein-1 induces functional responses through dimerization of its receptor
CCR2. Proc Natl Acad Sci U S A 96:3628–3633
23. Hernanz-Falcon P, Rodriguez-Frade JM, Serrano A et al (2004) Identification of amino acid
residues crucial for chemokine receptor dimerization. Nat Immunol 5:216–223
24. Percherancier Y, Berchiche YA, Slight I et al (2005) Bioluminescence resonance energy
transfer reveals ligand-induced conformational changes in CXCR4 homo- and heterodimers.
J Biol Chem 280:9895–9903
25. Issafras H, Angers S, Bulenger S et al (2002) Constitutive agonist-independent CCR5

oligomerization and antibody-mediated clustering occurring at physiological levels of
receptors. J Biol Chem 277:34666–34673
26. Wilson S, Wilkinson G, Milligan G (2005) The CXCR1 and CXCR2 receptors form
constitutive homo- and heterodimers selectively and with equal apparent affinities. J Biol
Chem 280:28663–28674
27. Trettel F, Di Bartolomeo S, Lauro C et al (2003) Ligand-independent CXCR2 dimerization.
J Biol Chem 278:40980–40988
28. Babcock GJ, Farzan M, Sodroski J (2003) Ligand-independent dimerization of CXCR4, a
principal HIV-1 coreceptor. J Biol Chem 278:3378–3385
29. Rodriguez D, Gutierrez-de-Teran H (2012) Characterization of the homodimerization
interface and functional hotspots of the CXCR4 chemokine receptor. Proteins 80:1919–1928
30. Sierro F, Biben C, Martinez-Munoz L et al (2007) Disrupted cardiac development but normal
hematopoiesis in mice deficient in the second CXCL12/SDF-1 receptor, CXCR7. Proc Natl
Acad Sci U S A 104:14759–14764
31. Chakera A, Seeber RM, John AE (2008) The duffy antigen/receptor for chemokines exists in
an oligomeric form in living cells and functionally antagonizes CCR5 signaling through
hetero-oligomerization. Mol Pharmacol 73:1362–1370
32. El-Asmar L, Springael JY, Ballet S et al (2005) Evidence for negative binding cooperativity
within CCR5-CCR2b heterodimers. Mol Pharmacol 67:460–469
33. Sohy D, Parmentier M, Springael JY (2007) Allosteric transinhibition by specific antagonists
in CCR2/CXCR4 heterodimers. J Biol Chem 282:30062–30069
34. Contento RL, Molon B, Boularan C et al (2008) CXCR4-CCR5: a couple modulating T cell
functions. Proc Natl Acad Sci U S A 105:10101–10106
35. Johnston JM, Aburi M, Provasi D et al (2011) Making structural sense of dimerization
interfaces of delta opioid receptor homodimers. Biochemistry 50:1682–1690
36. Agrawal L, Alkhatib G (2001) Chemokine receptors: emerging opportunities for new anti-
HIV therapies. Expert Opin Ther Targets 5:303–326
37. Dean M, Carrington M, Winkler C et al (1996) Genetic restriction of HIV-1 infection and
progression to AIDS by a deletion allele of the CKR5 structural gene. Hemophilia Growth
and Development Study, Multicenter AIDS Cohort Study, Multicenter Hemophilia Cohort
Study, San Francisco City Cohort. ALIVE Study. Science 273:1856–1862
38. Huang Y, Paxton WA, Wolinsky SM et al (1996) The role of a mutant CCR5 allele in HIV-1
transmission and disease progression. Nat Med 2:1240–1243
39. Samson M, Libert F, Doranz BJ et al (1996) Resistance to HIV-1 infection in caucasian
individuals bearing mutant alleles of the CCR-5 chemokine receptor gene. Nature
382:722–725
40. Zimmerman PA, Buckler-White A, Alkhatib G et al (1997) Inherited resistance to HIV-1
conferred by an inactivating mutation in CC chemokine receptor 5: studies in populations
with contrasting clinical phenotypes, defined racial background, and quantified risk. Mol Med
3:23–36
41. Agrawal L, Lu X, Qingwen J et al (2004) Role for CCR5Delta32 protein in resistance to R5,
R5X4, and X4 human immunodeficiency virus type 1 in primary CD4 ? cells. J Virol
78:2277–2287
42. Smith MW, Dean M, Carrington M et al (1997) Contrasting genetic influence of CCR2 and
CCR5 variants on HIV-1 infection and disease progression. Hemophilia Growth and
Development Study (HGDS), Multicenter AIDS Cohort Study (MACS), Multicenter
Hemophilia Cohort Study (MHCS), San Francisco City Cohort (SFCC). ALIVE Study.
Science 277:959–965
43. Mellado M, Rodriguez-Frade JM, Vila-Coro AJ (1999) Chemokine control of HIV-1
infection. Nature 400:723–724
44. Lagane B, Chow KY, Balabanian K et al (2008) CXCR4 dimerization and beta-arrestin-
mediated signaling account for the enhanced chemotaxis to CXCL12 in WHIM syndrome.
Blood 112:34–44
666 M. Wang et al.
45. Wang J, He L, Combs CA (2006) Dimerization of CXCR4 in living malignant cells: control
of cell migration by a synthetic peptide that reduces homologous CXCR4 interactions. Mol
Cancer Ther 5:2474–2483
46. Levoye A, Balabanian K, Baleux F (2009) CXCR7 heterodimerizes with CXCR4 and
regulates CXCL12-mediated G protein signaling. Blood 113:6085–6093
47. Zabel BA, Wang Y, Lewen S et al (2009) Elucidation of CXCR7-mediated signaling events
and inhibition of CXCR4-mediated tumor cell transendothelial migration by CXCR7 ligands.
J Immunol 183:3204–3211
48. Godessart N, Kunkel SL (2001) Chemokines in autoimmune disease. Curr Opin Immunol
13:670–675
49. Vicari AP, Caux C (2002) Chemokines in cancer. Cytokine Growth Factor Rev 13:143–154
50. Amin K, Janson C, Harvima I (2005) CC chemokine receptors CCR1 and CCR4 are
expressed on airway mast cells in allergic asthma. J Allergy Clin Immunol 116:1383–1386
51. Muller A, Homey B, Soto H et al (2001) Involvement of chemokine receptors in breast
cancer metastasis. Nature 410:50–56
52. Miao Z, Luker KE, Summers BC et al (2007) CXCR7 (RDC1) promotes breast and lung
tumor growth in vivo and is expressed on tumor-associated vasculature. Proc Natl Acad Sci
USA 104:15735–15740
53. Luboshits G, Shina S, Kaplan O et al (1999) Elevated expression of the CC chemokine
regulated on activation, normal T cell expressed and secreted (RANTES) in advanced breast
carcinoma. Cancer Res 59:4681–4687
54. Peters W, Charo IF (2001) Involvement of chemokine receptor 2 and its ligand, monocyte
chemoattractant protein-1, in the development of atherosclerosis: lessons from knockout
mice. Curr Opin Lipidol 12:175–180
55. Suzuki K, Morokata T, Morihira K et al (2006) In vitro and in vivo characterization of a
novel CCR3 antagonist, YM-344031. Biochem Biophys Res Commun 339:1217–1223
56. Wenzel J, Henze S, Worenkamper E et al (2005) Role of the chemokine receptor CCR4 and
its ligand thymus- and activation-regulated chemokine/CCL17 for lymphocyte recruitment in
cutaneous lupus erythematosus. J Invest Dermatol 124:1241–1248
57. Reibman J, Hsu Y, Chen LC (2003) Airway epithelial cells release MIP-3alpha/CCL20 in
response to cytokines and ambient particulate matter. Am J Respir Cell Mol Biol 28:648–654
58. Papadakis KA, Prehn J, Moreno ST et al (2001) CCR9-positive lymphocytes and thymus-
expressed chemokine distinguish small bowel from colonic Crohn’s disease.
Gastroenterology 121:246–254
59. Greaves DR, Hakkinen T, Lucas AD et al (2001) Linked chromosome 16q13 chemokines,
macrophage-derived chemokine, fractalkine, and thymus- and activation-regulated
chemokine, are expressed in human atherosclerotic lesions. Arterioscler Thromb Vasc Biol
21:923–929
60. Mellado M, Rodriguez-Frade JM, Vila-Coro AJ et al (2001) Chemokine receptor homo- or
heterodimerization activates distinct signaling pathways. EMBO J 20:2497–2507
61. O’Byrne PM, Inman MD, Parameswaran K (2001) The trials and tribulations of IL-5,
eosinophils, and allergic asthma. J Allergy Clin Immunol 108:503–508
62. Ting PC, Lee JF, Wu J et al (2005) The synthesis of substituted bipiperidine amide
compounds as CCR3 antagonists. Bioorg Med Chem Lett 15:1375–1378
63. Erin EM, Williams TJ, Barnes PJ (2002) Eotaxin receptor (CCR3) antagonism in asthma and
allergic disease. Curr Drug Targets Inflamm Allergy 1:201–214
64. Flood-Page P, Menzies-Gow A, Phipps S et al (2003) Anti-IL-5 treatment reduces deposition
of ECM proteins in the bronchial subepithelial basement membrane of mild atopic
asthmatics. J Clin Invest 112:1029–1036
65. Berkman N, Ohnona S, Chung FK (2001) Eotaxin-3 but not eotaxin gene expression is
upregulated in asthmatics 24 hours after allergen challenge. Am J Respir Cell Mol Biol
24:682–687
66. Struyf S, Menten P, Lenaerts JP et al (2001) Diverging binding capacities of natural

LD78beta isoforms of macrophage inflammatory protein-1alpha to the CC chemokine
receptors 1, 3 and 5 affect their anti-HIV-1 activity and chemotactic potencies for neutrophils
and eosinophils. Eur J Immunol 31:2170–2178
Chapter 68
The Mechanism of Apoptosis
in Adenocarcinoma of Lung Cancer A549
Cells Induced by Albumin-Derived
from Peanut
Minhui Long, Yuejun Sun, Ni Chen, Zimin Zhang, Wen Chu,

Yue Ma, Shenheng Luo, Zhongpeng Zhao and Aipo Diao
Abstract Peanut albumin which possesses protease inhibitor activity could be

used as an anticancer regent. This paper would discuss the effect and mechanism
of apoptosis induced by peanut albumin on human adenocarcinoma lung cancer
A549. MTT assay was used to evaluate the inhibition of peanut albumin on 11
kinds of cancer cells. Compared with other cells, there was the great significant
change in A549 cells. Morphological structures were detected by fluorescence
microscope, and cell cycle was measured by flow cytometry (FCM). Annexin V/PI
was used to detect cell cycle of A549 treated with peanut albumin. The differential
expressions between the group treated with peanut albumin and the control were
detected by Western-blot and quantitative-PCR. It was found that peanut albumin
could inhibit proliferation of A549 cells, and induce apoptosis of A549. The
possibility apoptosis of A549 cells induced by peanut albumin maybe correlated
with mitochondrial apoptosis pathway.
Keywords Peanut albumin A549 Apoptosis Mitochondrial pathway
Note: Y. Sun and M. Long are joint primary author.
M. Long Y. Sun W. Chu Y. Ma S. Luo A. Diao (&)

College of Biotechnology, Tianjin University of Science and Technology, Tianjin 300457,
e-mail: diaoaipo@tust.edu.cn
M. Long (&) N. Chen Z. Zhang
College of Life Science, South China Normal University, Guangzhou 510631,
e-mail: longminhui2006@yahoo.com.cn
Z. Zhao
State Key Laboratory of Pathogen and Biosecurity, Institute of Microbiology and
Epidemiology, Academy of Military Medical Sciences, Beijing 100071,
670 M. Long et al.
68.1 Introduction
Much epidemiologic evidence indicates that diets containing legumes products,

such as peanuts and soybeans, are relevant low cancer incidence and mortality rates,
particularly with respect to colon, breast, prostates cancer [1–5]. Protease inhibitors
in these products are effective suppressors of carcinogenesis and have ability to
prevent carcinogen-induced transformation [6–10]. Albumins are major groups of
seed storage proteins widely distributed in both mono- and di-cotyledonous plants,
such as peanuts and soybeans. In addition to the storage protein function of albu-
mins, recent findings have demonstrated that albumins have protease inhibitor
activity/or anti-proliferative activity and can also play a protective role in plants as
defensive weapons against fungal attack/or anti-bacteria [11–13].
Previous work from our laboratory demonstrated that albumins-derived from
peanut exerts trypsin inhibitor activity. Interestingly, this activity is stronger than
Bowman-Birk trypsin inhibitor, a candidate for anti-cancer, which has been
reported to exert powerful anti-carcinogenic activity [14–17]. Studies have been
verified that the inhibition of various types of cancers is one of anti-cancer
characteristics of BBI [18]. Much evidence shows that many different trypsin
inhibitors in their pure forms suppress carcinogenesis. Although some data from
in vitro studies suggest that peanut-derived isoflavones and other compounds may
have anti-carcinogenic activity, there is a scarcity of published studied in a pure
form [19]. Albumin in peanut has the character of trypsin inhibitor, it is supposed
that the albumin is one of constitutes which can inhibit carcinogenesis in peanut.
This study will demonstrate that albumin in peanut is responsible for the anti-
carcinogenesis and will find which kind of mechanisms of albumin is in action. On
the basis of this knowledge, several kinds of tumor cells will be used with respect
to the application of such constitute to verify its anti-carcinogenesis.
68.2 Materials and Methods
68.2.1 Extraction Albumins of Peanut
Local peanut cultivars were provided by the ShanDong Agricultural Institute in

ShanDong Province in china. Peanut was pulverized in the presence of liquid
nitrogen, 1 g peanut fine power was mixed with 6 ml of N-hexane for 24 h at -
20 C, filtered with filter paper and dried with vacuum pump, then mixed with
phosphate buffer (10 mM, pH 7.9) at 4 C for overnight according to 10 ml/g, and
centrifuged (Beckman Coulter, Krefeld, Germany) at 8,000 g for 20 min to collect
supernatant. To gain the protein, the supernatant was homogenized in 65 %
ammonium sulfate and kept at 4 C for 4 h, centrifuged for 20 min (12,000 g,
4 C). Part of the protein precipitated here and the supernatant was discarded after
centrifugation. The sediment was dissolved in phosphate buffer as described before.
68 The Mechanism of Apoptosis in Adenocarcinoma of Lung Cancer A549 Cells 671
68.2.2 Assay of Trypsin Inhibitor Activity Using BAPNA

as Substrate
A reaction mixture of 200 ll containing protein(0–0.01 mg) and 0.25 mg tryp-

sinase in reaction buffer (50 mMTris, 20 mM CaCl2, pH 7.5) was incubated at
37 C for 30 min., then added 1 ml of BAPNA solution containing 0.2 g BAPNA
(Sigma) in reaction buffer was incubated at 37 C for 10 min. The reaction was
stopped with 200 ll of cold 30 % acetic acid, incubated in ice for 10 min, and
centrifuged at 10,000 g for 10 min. To the supernatant, the A410 was taken. One
unit of trypsin was arbitrarily defined as the amount that increased A410 by 0.01
under the assay conditions. One unit of TI was defined as the amount that inhibited
one unit of trypsin.
68.2.3 Cell Cultures
The A549, HGP-2, Hele, 786O, MCF-7, BGC-823, DU-145, CaCo-2, Colo 320,
Ramos, U-87MG, cell lines were kindly provided by Dr WenYan. HE and Pro-
fessor DongGang XU (Institute of Basic Medical Science Academy of Military
Medical Sciences, Beijing, China). The cells were cultured in DMEM-Hams’s F-
12 (1:1) supplemented with 50 mg mL-1 gentamicin, 50 mg mL-1 kanamycin,
10 mg/ml.
68.2.4 MTT Assay for Albumins Application
The solution of albumins was poured into bag filter for renaturation in PBS at
4 C. The albumins were added to the cell culture medium at a concentration of
50–200 lg mL in different cell lines as described before and incubated for
6–48 h. Then MTT was added to the medium 500 lg mL and incubated for 4 h.
The medium was removed, and the Formazan was diluted in dimethyl sulphoxide
(DMSO). After vibration, the formazane concentration of the supernatant was
measured by determination of the absorbance at 490 nm.
68.2.5 Total RNA Preparation and Real-Time PCR(qPCR)

Assay
RNA pure reagent kit for rapid extraction of ultrapure RNA (Biomed, China) was
used to extract the total RNA from the A549 cells-treated with/without albumin for
6 h, respectively, according to the operation manual. PrimerScript Reverse
672 M. Long et al.
Table 68.1 The follow primers are used in qPCR assay

Caspase 3 CAS3-1 50 -CTGCCGGAGTCTGACTTGGAA-30
CAS3-2 50 -ATCAGTCCCACTGTCTGTCTCAATG-30
Caspase 9 CAS9-1 50 -ACCAGCTGGATGCTGTGTCAAG
CAS9-2 50 -TGCTCCAGAATGCCATCCAA-30
Caspase 8 CAS8-1 50 -GGACATGTTGTCCATCCTGA-30
CAS8-2 50 -TTTCTTGGTCAGCGTGTAGC-30
Bcl-2 Bcl-2-1 50 -ATGAGCGATGAGTTTGAGGGTTC-30
Bcl-2-1 50 -CGATCCCACCAGGACTGGATA-30
Bax Bax-1 50 -TTTGCTTCAGGGTTTCATCC-30
Bax-2 50 -CAGTTGAAGTTGCCGTCAGA-30
Transcriptase (TaKaRa Biotechnology Co. Ltd. (Dalian)) was used for the reverse-
transcription of 1 lg total RNA of each group by strictly following the operation
manual enclosed with the kit. The resulted cDNA should be used for QPCR that
was carried out by using the fluorescent MaximaTMSYBR Green/ROX qPCR
Master Mix (29) in Mx3000PQPCR Systems (Agilent Technologies Stratagene
Products Division, USA), and the reaction system (20 ll) should be used
respectively to detect the mRNA expression levels of caspase3, 8, 9, Bcl-2 and
Bax in A549 cells (primers information was shown in Table 68.1).
68.2.6 Protein Extraction and Immunoblot Analysis
The A549 cells of various group-treated with/without 100 lgmL for 12 h were
rinsed with the pre-cooled phosphate buffer (1 9 PBS) for three times, then from
which the cell total protein was extracted by RIPA lysis buffer (Applygen Tech-
nologies Inc., China) and quantified by the Protein Detection Kit with Lowry’s
method (KeyGEN Biotechnology Co., China).
Cell protein was separated by electrophoresis on 15 %SDS-PAGE, and then
transferred onto a PVDF membrane of 0.2 lm aperture (ImmobilonTM Millipore,
USA) by Western blotting. The nonspecific binding sites on PVDF membrane
should be blocked by 5 % defatted milk powder dissolute in Tris-buffered saline/
1%Tween20 (TBS-T) at 4 C for overnight. Then, the specific antibodies (1st
antibody) against caspase3, 8, 9 (Cell Signaling Technology Inc., USA), and Bcl-2,
Bax (Cell Signaling Technology Inc., USA) were prepared with 5 % defatted milk
powder, and diluted for 1,000 times (1:1000). Finally, SuperSignal West Femto
Substrate (Thermo Scientific, USA) was used for development in a dark room, and
the house-keeping gene GAPDH (Cwbiotech Inc., China) as internal reference.
68.2.7 Measurement of Apoptosis
Double staining method with Annexin V-FITC/Propidium iodide (PI) (Nanjing

Keygen Biotech Co, Ltd.) was used to detect the phosphatidylserine (PS) at the cell
surface to evaluate the apoptotic cell number. A549 cells were inoculated I at the
concentration of 6 9 105/well into a 6 well-plate, which were divided into
untreated (control) group, negative group (BSA), treated with albumins at con-
centrations of 100 lg. The cells were collected after the treatment with albumins
for 24 h, digested with 0.25 % trypsin without EDTA (invitrogen, USA) and
washed with phosphate buffer for two times to which 500 ll Binding Buffer and
5 ll Annexin V-FITC were added, 5 ll PI-suspended cells were mixed homoge-
neously, and reacted in dark for 15 min. The stained cells were counted and
analyzed by flow cytometry (FACSCalibur, BD Bioscience).The above-mentioned
tests should be repeated for three times.
68.2.8 Statistics
All the parameters were expressed as mean SD, the softwares: Student t test,
one-way ANOVA, SPSS13.0, and MxPro 3000- QPCR were used for statistical
analysis. *p \ 0.05 and **p \ 0.01 were used to express the statistically signifi-
cant difference.
68.3 Results and Discussion
68.3.1 The Trypsin Inhibitor Activity of Albumins in Peanut
The protein was extracted with 10-mM phosphate buffer, pH 7.9. The TI activity
of this protein was tested and compared to BBI and bovine TI. The change in
turbidity in every sample was measured by turbidimeter. The turbidity of albumins
decreased from 31 to 15 at equal concentration. BBI and Bovine TI also showed
similar pattern with turbidity being reduced from 33 to 10 and from 33 to 14,
respectively. TI assay done with BSA as control showed no activity (Fig. 68.1).
The turbidity, therefore, decreased by 51, 61, and 55 % for purified protein, BBI,
Bovine TI respectively at a concentration of 100 lg ml-1. Although the decrease
in turbidity was better in case of BBI and Bovine TI, the protein also showed
significant and comparable TI activity (Fig. 68.1).
674 M. Long et al.
Fig. 68.1 TI activity of purified peanut albumin protein along with BBI and Bovine TI. The
bovine serum albumin was used as a control. All experiments were done three times and
averaged. Collumn 1 Bovine TI; Collumn 2 BBI; Collumn 3 albumins; Collumn 4 BSA
68.3.2 The Effects of Peanut’s Albumins on Different Tumor

Cell Lines
BBI are responsible for anti-cancer or inhibitor tumor cells growth, migration,
differentiation [14–18]. BBI have the ability of anti-cancer, but some types of
tumors are highly resistant to these BBI therapy or BBI treatment [20]. Albumins
maybe have the similarity to BBI. We have therefore tested ability of 2 s albumins
to inhibit the different types of tumor cells. A549, HGP-2, Hele, 786O, MCF-7,
BGC-823, DU-145, CaCo-2, Colo 320, Ramos, U-87MG cells were grown for
4 days in DMED and harvested. 1 9 105 cells for every kind of cell line were
plated in 96-well dishes, then treated with 100 lg/mL of albumins for 24 h and
then subjected to MTT assay. The MTT assay is a convenient colorimetric assay of
mitochondrial viability that assesses the number of viable cells versus the number
of dead cell in a given sample. Figure 68.2 shows that the A549, MCF-7, Colo
320, Romos cells are more sensitive to albumins. These phenomena maybe due to
Fig. 68.2 Effects of peanut albumins treatment on the growth of 11 kinds of tumor cell lines.
Different cells were incubated with 100 lg/ml peanut albumin for 24 h. The color intensity was
measured using a microtiter plate reader (Bio-Rad model 550) at 490 nm. All the cell lines could
be inhibited by peanut albumin except 768O
the fact that those cells were stimulated to apoptosis by peanut albumins more
easily than the others. Similar results were achieved by treating the cells with the
peanut albumins for 1 h and subjecting the samples to an MTT assay 24 h later
(data not shown). These data have been confirmed with other techniques such as
measurement of cell viability by trypan blue exclusion cell-count before and after
peanut albumins treatment, as well as by flow-cytometry analysis (data not
shown). Interestingly, the 786O cells had an overall resistance to any dose of the
peanut albumins, whether above or below the assessed LD50. However, A549 and
MCF-7 are the most sensitive to albumins. The results showed albumins enhanced
A549, MCF-7 cell death even at doses well below the LD50(refer to BBI), sug-
gesting that albumins could easily simulate A549 and MCF-7 cell to die, maybe
used to lower the necessary dose of albumins treatments for patients.
Surprisingly, the Hele, BGC-823, DU-145, CaCo-2, Colo 320, Ramos, U-
87MG, cells were sensitive to treatments with 2S albumins. However, the affect of
albumins on those cells were more less than A549, MCF-7.
68.3.3 Changes of A549 Cell Mitochondrial Pathway

and the Apoptosis and Proliferation of Tumor Cell
After Treatment with Peanut Albumin
There were some interactions between tumor cells and peanut albumin when tumor
cells were incubated with peanut albumin in previous experiment, and the A549
cells were the most sensitive to albumins. For the further exploring the effect of on
A549 cells growth when they were treated with peanut albumin, different con-
centrations of peanut albumin were incubated with A549 cell, and the expression
change of Bcl-2, Bax, Caspase3, Caspase9, and Caspase8 were monitored. Then
the finding expression of Bax, Caspase3, Caspase9 displayed a significant
increasing tendency (p \ 0.05), and the level of Caspase8 expression was not
significantly changed, while Bcl-2 mRNA expression was significantly decreased
(p \ 0.05), and its protein expression was also significantly decreased (Fig. 68.3a,
b). These results suggested that peanut albumin as a new anti-tumor candidate
could induce A549 cells to apoptosis which displayed a character similar to the
action produced by BBI, which might be related with its trypsin inhibitor activity.
We also observed the influence of both on cell apoptosis, and found that the cell
apoptosis rate (42.5 %) was significantly higher than the control group (3.6 %),
further verifying that peanut albumin possesses the promotion effect on cell
apoptosis (Fig. 68.3c). This study demonstrated that the albumin in peanut can
regulate A549 cells’ function, and demonstrated the promotion effect to cell
apoptosis possibly through mitochondrial pathway.
Our goal was to find whether components of the peanut proteins, when they
were added into media, would inhibit the growth of the tumor cell or induce tumor
cell to death. We also hoped to find which type of tumor cells that response to
676 M. Long et al.
(a) 10
9 60
8 caspase3
relative quantity
caspase9 50
7 caspase8
6 bcl-2 40
5 bax
4 30
3
2 20
1
10
0
1 2
0
1 2
1 Control group 2 Albumin group
C3 C9 C8 Bcl-2 Bax C3 C9 C8 Bcl-2 Bax
GAPDH GAPDH
1 Control 2 Albumin
(b) 1control 2 Albumin group
(c)
Caspase3
Caspase9
Caspase8
Bcl-2
Bax
× 40 ×40
GAPDH
Fig. 68.3 The expression and protein levels change of above-mentioned various cytokines in
cytoplasm were observed after A549 cell lines were treated with peanut albumin. A. The
expression levels change of Bcl-2, Bax, Caspase3, Caspase9, Caspase8 in inta-cellular were
detected by qPCR. B. The expression of Bcl-2, Bax, Caspase3, Caspase9, Caspase8 in protein
levels were detected. C. A549 cells apoptosis was detected by flow cytometry
peanut albumins at the time of culture, though in practice our screen was more
effective for finding the former. We chose different cell lines imaging to read out
our screening assay, an information rich method that facilitated monitoring of
multiple phenotypes. Typically, an imaging screen for cellular appearances would
be performed as a fixed endpoint assay in microplates with DAPI staining for DNA
and perhaps also apoptosis. The advantage of this method lies in ease of image
analysis; however, fixed endpoint imaging would limit our ability to quantify both
the cell growth and apoptosis responses, since they are separated by * 24 h.
Other potential drawbacks of a fixed endpoint DAPI assays include demarcation of
the necrosis and apoptosis cell as well as potential loss of weakly adherent cells
and distortion of cellular structures during fixation. Hence, to assess whether
peanut albumins-induced cell death, MTT assay was used to measure the relative
survival of cells. When A549, HGP-2, Hele, MCF-7, BGC-823, DU-145, CaCo-2,
Colo 320, Ramos, and U-87MG cells were incubated with increasing concentra-
tions of peanut albumins and the proteins caused a dose-dependent inhibition of
cell proliferation (data not shown) except 786O cells, whereas the inhibitory effect
of peanut albumins was approximately twofold higher than that of BBI with
concentrations ranging from 30 to 40 lg. Some components in peanut albumins
are family of trypsin inhibitors isolated from plant seeds that exhibit anti-bacterial
and anti-fungal properties [21, 22]. Few studies show they have the capacity to
induce cell death in human cancer cells. In this report, we first used A549 cell lines
as models for assay and found that albumins which possess the activity of trypsin
inhibitor inhibited the growth of this cell lines in vitro. Most significantly, A549
cells were more sensitive to albumin than normal pneumonocyte with lower
concentration of albumins, indicating A549 cells might be potentially model for
investigating the anticancer of peanut albumin (data not shown). Furthermore,
peanut albumins induced a form of apoptotic cell death in A549 cells, which was
characterized by extensive vacuolization, surface exposure of PS, and loss of
mitochondrial membrane. Moreover, the A549 cells apoptotic process induced by
peanut albumin was caspase-dependent. Caspase3, one member of caspases which
are a family of proteases involved in the execution of apoptosis, is known to be an
important molecule in the cellular suicide cascade. It can be activated by stimuli
with a membrane (receptor-activated) or mitochondrial origin [23]. In fact, cas-
pase3 is a downstream response factor of caspase9, which, in turn, is activated by
cytochrome c released by mitochondria or by caspase8 that is activated by
membrane death receptors [23]. Pro- and anti-apoptotic genes of the Bcl2 family
act by stabilizing (Bcl2-like) or destabilizing (Bax-like) the mitochondrial mem-
brane, thus altering the release of cytochrome c that, in turn, activates caspase9 and
caspase3 sequentially [24]. On the other hand, membrane-dependent stimuli such
as Fas/FasL or tumor necrosis factor a (TNF-a)/TNF-aR interaction may trigger
caspase8 activation, which eventually leads to caspase3 activation [23]. Over high
level of mRNA expression of caspase3, caspase9, Bax occurred in A549 cells in
this study and we observed that caspase3, caspase9, Bax also has the similar
changing tendency at protein level. Our study also found that peanut albumin can
inhibit Bcl-2 mRNA transcription, and decrease the expression of anti-apoptotic
protein Bcl-2 in A549 cell strain and little effect on caspase8 when A549 cells
were stimulated by peanut albumin, demonstrating that peanut albumin displayed
an effect of promotion of A549 cell’s apoptosis.
68.4 Conclusion
In summary, cell death pathway induced by peanut albumins was main charac-
teristic of mitochondrial pathway in A549 cells for great changes in expression of
caspase3, caspase9, Bcl-2, Bax ðP \0:05Þ, and for little change of caspase8 was
observed (P = 0.974). The anti-tumor function of ðP \0:05Þ peanut albumin was
further understood, laid the theoretical basis for subsequent research and provided
a new idea for the research and development of the drugs against cancer.
678 M. Long et al.
References
1. Park SY, Murphy SP, Wilkens LR et al (2008) Legume and isoflavone intake and prostate
cancer risk: the multiethnic cohort study. Int J Cancer 123(4):927–932
2. Adlercreutz H, Honjo H, Higashi A et al (1991) Urinary excretion of lignans and isoflavonoid
phytoestrogens in Japanese men and women consuming a traditional Japanese diet. Am J Clin
Nutr 54:1093–1100
3. Adlercreutz H, Markkanen H, Watanabe S (1993) Plasma concentrations of phyto-oestrogens
in Japanese men. Lancet 342:1209–1210
4. Hebert JR, Hurley TG, Olendzki BC et al (1998) Nutritional and socioeconomic factors in
relation to prostate cancer mortality: a cross-national study. J Natl Cancer 90(1637–1647):9
5. Jacobsen BK, Knutsen SF, Fraser GE (1998) Does high soy milk intake reduce prostate
cancer incidence? The adventist health study (United States). Cancer Causes Control
9:553–557
6. Sarkar FH, Li Y, Wang Z et al (2010) Lesson learned from nature for the development of
novel anti-cancer agents: implication of isoflavone, curcumin, and their synthetic analogs.
Curr Pharm Des 16(16):1801–1812
7. Li Y, Wang Z, Kong D et al (2008) Regulation of Akt/FOXO3a/GSK-3beta/AR signaling
network by isoflavone in prostate cancer cells. J Biol Chem 283:27707–27716
8. Su Y, Simmen RC (2009) Soy isoflavone genistein upregulates epithelial adhesion molecule
E-cadherin expression and attenuates beta-catenin signaling in mammary epithelial cells.
Carcinogenesis 30:331–339
9. Su Y, Simmen FA, Xiao R et al (2007) Expression profiling of rat mammary epithelial cells
reveals candidate signaling pathways in dietary protection from mammary tumors. Physiol
Genomics 30:8–16
10. Wagner J, Lehmann L (2006) Estrogens modulate the gene expression of Wnt-7a in cultured
endometrial adenocarcinoma cells. Mol Nutr Food Res 50:368–372
11. Wu Y, Wang W, Messing J (2012) Balancing of sulfur storage in maize seed. BMC Plant
Biol 12:77
12. Mandal S, Kundu P, Roy B et al (2002) Precursor of the inactive 2S seed storage protein from
the Indian mustard Brassica juncea is a novel trypsin inhibitor. characterization, post-
translational processing studies, and transgenic expression to develop insect-resistant plants.
J Biol Chem 277(40):37161–37168
13. Pelegrini PB, Noronha EF, Muniz MA et al (2006) An antifungal peptide from passion fruit
(Passiflora edulis) seeds with similarities to 2S albumin proteins. Biochim Biophys Acta
1764(6):1141–1146
14. Clemente A, Sonnante G, Domoney C (2011) Bowman-Birk inhibitors from legumes and
human gastrointestinal health: current status and perspectives. Curr Protein Pept Sci
12(5):358–373
15. Clemente A, Moreno FJ, Marín-Manzano Mdel C et al (2010) The cytotoxic effect of
Bowman-Birk isoinhibitors, IBB1 and IBBD2, from soybean (Glycine max) on HT29 human
colorectal cancer cells is related to their intrinsic ability to inhibit serine proteases. Mol Nutr
Food Res 54(3):396–405
16. Marín-Manzano MC, Ruiz R, Jiménez E et al (2009) Anti-carcinogenic soyabean Bowman-
Birk inhibitors survive faecal fermentation in their active form and do not affect the
microbiota composition in vitro. Br J Nutr 101(7):967–971
17. Tang M, Asamoto M, Ogawa K et al (2009) Induction of apoptosis in the LNCaP human
prostate carcinoma cell line and prostate adenocarcinomas of SV40T antigen transgenic rats
by the Bowman-Birk inhibitor. Pathol Int 59(11):790–796
18. Palavalli MH, Natarajan SS, Wang TT (2012) Imbibition of soybean seeds in warm water
results in the release of copious amounts of Bowman-Birk protease inhibitor, a putative
anticarcinogenic agent. J Agric Food Chem 60(12):3135–3143
19. Yeh CC, You SL, Chen CJ (2006) Peanut consumption and reduced risk of colorectal cancer
in women: a prospective study in Taiwan. World J Gastroenterol 12(2):222–227
20. Dittmann KH, Dikomey E, Mayer C (2000) The Bowman-Birk protease inhibitor enhances
clonogenic cell survival of ionizing radiation-treated nucleotide excision repair-competent
cells but not of xeroderma pigmentosum cells. Int J Radiat Biol 76(2):223–229
21. Wang T, Zhang E, Chen X et al (2010) Identification of seed proteins associated with
resistance to pre-harvested aflatoxin contamination in peanut. BMC Plant Biol 10:267
22. Ye XY, Ng TB (2001) Hypogin, a novel antifungal peptide from peanuts with sequence
similarity to peanut allergen. J Pept Res 57(4):330–337
23. Ashkenazi A, Dixit VM (1998) Death receptors, signaling and modulation. Science
281:1305–1308
24. Green DR, Reed JC (1998) Mitochondria and apoptosis. Science 281(5381):1309–1312
Chapter 69
Serum miR-124 and TNF-a are
Biomarkers of Ischemic Cerebrovascular
Disease
Jiajie Liu, Xinghua Liao, Nan Wang, Jun Zhou, Lian Duan, Dalin Lu,
Zhipeng Liu, Tingbao Yan, Deyun Ma, Xiumei Dong, Xueguang Sun
and Tong-Cun Zhang
Abstract MicroRNAs are small non-coding RNAs with 19-22 nucleotides. MiR-
124 expresses abundantly in brain tissue and is involved in the development of
ischemic cerebrovascular disease (ICVD). Tumor necrosis factor-alpha (TNF-a) is
one of the important factors of the inflammatory reaction after cerebral ischemia.
To explore the roles of miR-124 and TNF-a in the process of ICVD, here, we
collected the serum of 15 patients with ICVD and 5 normal individuals. The levels
of miR-124 and TNF-a were detected by real-time PCR and ELISA. The results
showed that compared with the normal individuals, the levels of miR-124 and
TNF-a in serum were upregulated in the patients, while they were downregulated
after clinical treatment, suggesting that these two factors could be used as good
biomarkers for the diagnosis and prognosis of ICVD. Besides, our research also
provided a theory foundation for understanding the mechanism of inflammatory
response in cerebral ischemia mediated by miR-124.

Keywords Ischemic cerebrovascular disease (ICVD) Inflammation miR-124
Tumor necrosis factor-alpha (TNF-a)
The first two authors contributed equally to the project.
J. Liu X. Liao J. Zhou L. Duan D. Lu X. Dong T.-C. Zhang (&)

College of Medicine, Wuhan University of Science and Technology,
Wuhan 430065, People’s Republic of China
X. Liao N. Wang Z. Liu T. Yan D. Ma X. Sun T.-C. Zhang
Key Laboratory of Industrial Microbiology, Ministry of Education and Tianjin City,
College of Biotechnology, Tianjin University of Science and Technology,
682 J. Liu et al.
69.1 Introduction
Ischemic cerebrovascular disease (ICVD) is a group of brain dysfunctions related

to disease of the blood vessels supplying the brain. The most common forms of
ICVD are transient ischemic attack (40 % of cases) and cerebral embolism
(30 %), followed by cerebral thrombosis (20 %) [1]. Cerebrovascular disease is
commonly known as activity limitations (also referred to as ‘‘disabilities’’), mostly
in elderly patients, manifested as paralysis, weakness, aphasia, and mental health
changes. Stroke is a leading cause of mortality and permanent disability, with two-
thirds of onsets due to ischemia. Major modifiable risk factors of ICVD include
hypertension, smoking, obesity, and diabetes .
MicroRNAs are a class of small non-coding RNAs that can regulate gene
expression and play a critical role in many biological and pathological processes
[2, 3]. Although the total number of microRNAs remains controversial [4–7], and
the roles of some specific microRNAs need to be defined, recent research has
shown that expression of microRNAs in diverse tumors is significantly different
from normal tissue [8–10].Present studies have indicated that specific MicroRNAs
played important roles in ICVD occurrence and development process. MicroRNAs
may also provide a new strategy for the preservation and diagnosis of ischemic
stroke [11].
MiR-124 expresses abundantly in brain tissue and is involved in the develop-
ment of the ICVD. Besides, stroke-induced inflammatory reaction and the level of
tumor necrosis factor-alpha (TNF-a) in serum would be increased during inflam-
matory. These results lead to invasion of leukocytes into the evolving brain infarct,
seeming to play a key role in the deterioration of ICVD [12, 13]. In order to
understand the mechanism of inflammatory response in cerebral ischemia and the
roles of miR-124 and TNF-a played in such process, in the present study, the level
of miR-124 and TNF-a is tested in the serum of 15 ICVD patients and 5 normal
individuals.
69.2.1 Clinical Data
The study was conducted on 15 patients with first-ever ICVD stroke (mean age
63.4 ± 5.2 years, 66 % men). ICVD was confirmed by either MRI or CT imaging
of the brain, and the risk factors were characterized based on the ancillary blood
and other biochemical examinations. The study excluded the patients with hem-
orrhage stroke. Patients with concurrent diseases or conditions interfering with the
result of the study, like infections, type 2 diabetes mellitus (T2DM), hematological
disorders, autoimmune diseases, myocardial infarctions, severe liver disease,
malignancies, undergoing surgical interventions within the past 12 months, and
69 Serum miR-124 and TNF-a 683
Table 69.1 Clinical data of Group ICVD Control

patients
N 15(10/5) (M/F) 5(3/2) (M/F)
Average age 63.4 ± 5.2 60.2 ± 3.7
M male, F female
those on immunosuppressive drugs were also excluded. All the patients presented
completed ICVD stroke, defined as clinical symptoms persisting for more than
48 h. All patients with acute stroke had symptoms confined to the carotid artery
territory. The diagnosis of acute stroke was confirmed by tomography of the brain
performed immediately after admission. Blood samples were obtained for white
blood cell (WBC) counts within the first 24 h after the attack of stroke [14–16].
Five healthy volunteers without risk factors (mean age ± SD—60.2 ± 3.7 years,
3 men, and 2 women) served as a control group. The study was performed on the
basis of the written consent of each patient and approval of the Ethics Committee
of the University School of Medicine in Wuhan.
The age and sex distribution of these 20 cases are shown in Table 69.1.
69.2.2 Blood Specimen Collection
The blood was respectively obtained on the morning of the first day and on the
seventh day after attack, and all serum was obtained by the initial centrifugation of
the blood samples at 3,000 g for 15 min at 4 C (Centrifuge 5810R; Eppendorf).
Supernatants were collected and immediately stored at -80 C until use [15].
69.2.3 Real-Time Polymerase Chain Reaction (PCR)
The level of miR-124 was tested by real-time PCR according to manufacturer’s

instructions (TIANGEN). The three operation step kits (miRcutemiRNA isolation
kit, miRcutemiRNA first-strand cDNA synthesis kit, miRcutemiRNA qPCR
detection kit (SYBR Green)) were provided. First, total RNA was isolated from
serum lysis buffer. Then Poly (A) was added to the 30 terminal of miRNA before
reverse transcription. Real-time PCR was performed in the StepOneTM Real-Time

PCR System (Applied Biosystems, Inc., Carlsbad, USA). Fast SYBR Green
Master Mix was obtained from Applied Biosystems. The experimental steps were
strictly in accordance with the instructions [17]. U6 snRNA was used for the
normalization.
684 J. Liu et al.
69.2.4 Enzyme Linked Immunosorbent Assay (ELISA)
The levels of TNF-a in serum were measured by a human TNF-a ELISA kit
(Quantikine, R&D Systems, Minneapolis, USA). A standard curve for quantitative
basis was first drawn with five different contents of TNF-a standard samples, and
then the serum samples were detected and the concentration of TNF-a calculated
using the standard curve. The minimum detectable concentrations in our labora-
tory were 7 pg/mL for TNF-a.
69.2.5 Statistical Analysis
All statistical analyses were computed using SPSS statistical software, and the level
of significance was set at P \ 0.05. The data are reported as mean ± standard error
of the mean.
69.3.1 The Change in mRNA Level of Serum miR-124

in ICVD
To understand the role of miR-124 in ICVD, we used real-time PCR to determine

the expression of miR-124 in serum of ICV patients. Compared with patients after
clinical treatment and controls, the circulatory miR-124 level of patients before
clinical treatment was increased, and compared with the controls, the patients after
clinical treatment were significant downregulated (Fig. 69.1). In this experiment,
one and a half times greater than the differences were considered as significant
difference criterion.
Fig. 69.1 The mRNA

level of miR-124 in serum of
the ICVD patients and
normal persons Control:
normal person; After: ICVD
patients after clinical
treatment; Before: ICVD
patients before clinical
treatment
69.3.2 The Change in Expression of Serum TNF-a in ICVD
In addition to test the serum concentrations of TNF-a in patients with ICVD before
and after clinical treatment and that in control group, the TNF-a level of the
samples were measured by ELISA. Results: X ±SEM. TNF-a value was signifi-
cantly higher in serum of ICVD patients before clinical treatment than that in
normal person (p = 0.016, P \ 0.05) (Table 2, Fig. 69.2). After the clinical
treatment, the level of TNF-a in the serum of patients decreased but was still a
little higher than that in normal person (Table 69.2, Fig. 69.2). This study showed
that increased serum TNF-a level was present in ICVD patients compared with
age-matched controls. TNF-a is engaged in the formation of damaged brain cells
during the acute cerebrovascular disease period [18–20].
The diagnosis and prognosis of ICVD are dependent on the clinical history and
physical examination. Many patients have seizures discontinued when treated, so
detailed inquiry seizures is more important. The development of modern imaging
technology provides great help for cerebrovascular disease diagnosis, but it cannot
apply more vital signs. Functional study of MicroRNAs has developed rapidly
recent years in the field of life sciences. A recent study determined that the
expression changes in some MicroRNAs and TNF-a in human serum or plasma
may be diagnostic markers for certain diseases or physiological changes. At
present, a variety of MicroRNAs has been found involved in the pathological
process of ICVD. It has been reported that miR-124 was related to the differen-
tiation of neural stem and precursor cells, and was significantly upregulated in the
acute phase of ICVD. The present study indicates that expression of circulatory
miR-124 was upregulated in serum of ICVD patients before clinical treatment, and
Table 69.2 The expression of TNF-a in serum of the ICVD patients and normal persons (TNF-
a/pg/ml, X ± SEM)
Group n TNF-a
Control 5 9.50 ± 0.68
Patients(after clinical treatment) 15 12.81 ± 2.15
Patients(before clinical treatment) 15 35.50 ± 10.53
Fig. 69.2 The expression of

TNF-a in serum of ICVD
patients and normal persons
(TNF-a/pg/ml, X ± SEM)
Control: normal person;
After: ICVD patients after
clinical treatment; Before:
ICVD patients before clinical
treatment
686 J. Liu et al.
downregulated after clinical treatment, compared to the controls. The finding may
have implications for the development of a desirable biomarker and therapy for
ischemic stroke. Since this study utilized serum, tested miR-124 and TNF-a levels
in system circulatorium, it would be beneficial for the elucidation of this disease
diagnosis method or treatment targets. Serum microRNA is stable and not easy to
be degraded, taken from the blood it is convenient, no tissue damage, quick and
simple, serum microRNA can be used as a new clinical diagnosis method.
69.4 Conclusion
Our results show that compared with normal serum, the level of serum miR-124 and
TNF-a were upregulated in the patients before clinical treatment, while miR-124
and TNF-a were downregulated after clinical treatment, suggesting that these two
factors could be used as good biomarkers for the diagnosis and prognosis of ICVD.
Besides, our research also provided a theory foundation for understanding the
mechanism of inflammatory response in cerebral ischemia mediated by miR-124.
Acknowledgments This work was financially supported by National Natural Science Founda-
tion of China (No. 30970615, 31071126) and Program for Changjiang Scholars and Innovative
Research Team in University of Ministry of Education of China (IRT1166) and the Key Project
of Chinese Ministry of Education (212010) and Outstanding Young Talent Project of Scientific
Research Plan of Education Department in Hubei province (Q20101111).
References
1. Thomas T, Stephen B, Colin M (2000) The global burden of cerebrovascular disease. Global
Burden Dis 21(06):06
2. Shlomit G, Eti M, Yariv Y et al (2008) Serum MicroRNAs are promising novel biomarkers.
Serum MicroRNA Biomark 3(9):e3148
3. Soifer HS, Rossi JJ, Saetrom P (2007) MicroRNAs in disease and potential therapeutic
applications. Mol Ther 15(12):2070–2079
4. Pheasant M, Mattick JS (2007) Raising the estimate of functional human sequences. Genome
Res 17(9):1245–1253
5. Bentwich I, Avniel A, Karov Y, Aharonov R et al (2005) Identification of hundreds of
conserved and nonconserved human microRNAs. Nat Genet 37(7):766–770
6. Berezikov E, Plasterk RH (2005) Camels and zebrafish, viruses and cancer: a microRNA
update. Hum Mol Genet. 14(2):R183–R190
7. Ng Tsui NB, Ng EK, Lo YM (2002) Stability of endogenous and added RNA in blood
specimens, serum, and plasma. Clin Chem 48(10):1647–1653
8. Calin GA, Croce CM (2006) MicroRNA signatures in human cancers. Nat Rev Cancer
6(11):857–866
9. Cummins JM, He Y, Leary RJ et al (2006) The colorectal microRNAome. Proc Natl Acad
Sci USA 103(10):3687–3692
10. Bartel DP (2009) MicroRNAs: target recognition and regulatory functions. Cell
136(2):215–233
11. Maddahi A, Edvinsson L (2010) Cerebral ischemia induces microvascular pro-inflammatory

cytokine expression via the MEK/ERK pathway. J Neuroinflammation 7:14
12. Zaremba J, Losy J (2001) The levels of TNF-alpha in cerebrospinal fluid and serum do not
correlate with the counts of the white blood cells in acute phase of ischaemic stroke. Folia
Morphol (Warsz) 60(2):91–97
13. Meda L, Cassatella MA, Szendrei GI et al (1995) Activation of microglial cells by beta-
amyloid protein and interferon-gamma. Nature 374(6523):647–650
14. Gan CS, Wang CW, Tan KS (2012) Circulatory microRNA-145 expression is increased in
cerebral ischemia. Genet Mol Res 11(1):147–152
15. Fischer CP, Perstrup LB, Berntsen A et al (2005) Elevated plasma interleukin-18 is a marker
of insulin-resistance in type 2 diabetic and non-diabetic humans. Clin Immunol
117(2):152–160
16. Bansal BC, Gupta RR, Bansal MR et al (1975) Serum lipids and uric acid relationship in
ischemic thrombotic cerebrovascular disease. Stroke 6(3):304–307
17. Kroh EM, Parkin RK, Mitchell PS et al (2010) Analysis of circulating microRNA biomarkers
in plasma and serum using quantitative reverse transcription-PCR (qRT-PCR). Methods
50(4):298–301
18. Alvarez XA, Franco A, Fernández-Novoa L et al (1996) Blood levels of histamine, IL-1b,
and TNF-a in patients with mild to moderate Alzheimer disease. Mol Chem Neuropathol
29(2–3):237–252
19. Arican O, Aral M, Sasmaz S et al (2005) Serum levels of TNF-a, IFN- c, IL-6, IL-8, IL-12,
IL-17, and I L-18 in patients with active psoriasis and correlation with disease severity.
Mediators Inflamm 5:273–279
20. Bi Y, Liu G, Yang R (2009) MicroRNAs: novel regulators during the immune response.
J Cell Physiol 218(3):467–472
Chapter 70
A New Process for Preparation
of Hydroxytyrosol
Yinghao Gao, Xijuan Liang, Yuanmou Chen, Fei Hu, Weizhu Liu,
Abstract Hydroxytyrosol is one of the major natural phenolic compounds, mainly

in virgin olive oil and the wastewater generated from olive oil processing. Based
on its strong antioxidation, hydroxytyrosol is widely used in medical treatment,
food, beauty, and other industries. Its diverse biological activities have for a long
time attracted considerable interest of synthetic and pharmacological areas. In this
paper, the new process of hydroxytyrosol synthesis has been explored, which starts
from catechol protection, followed by Friedel–Crafts reaction with ethyl oxalyl
monochloride, then the Wolff-Kishner-Huang reaction and reduction reaction with
LAH, and finally deprotection. The target compound was obtained by five-step
reaction with an overall yield of 23 %. The title compound was characterized on
the basis of 1 H NMR spectral.
Keywords Natural Hydroxytyrosol Synthesis New process
70.1 Introduction
Hydroxytyrosol (3,4-dihydroxyphenylethanol) is primarily found in fruits and

leaves of olive and has been reported to exert several biological and pharmaco-
logical activities [1]. It was first discovered and extracted from the wastewater that
resulted when green olives were rinsed in the process of making olive oil [2–4]
(Fig. 70.1).
For decades olive oil has been known for its many healthy properties. It has
long been noted that the Mediterranean diet has been associated with a lower
Y. Gao X. Liang Y. Chen F. Hu W. Liu P. Yu E. Hua (&)

Key Laboratory of Industrial Microbiology, Ministry of Education, College of
Biotechnology, Tianjin University of Science & Technology, Tianjin 300457,
e-mail: huarb@tust.edu.cn
690 Y. Gao et al.
Fig. 70.1 Structures of HO OH

hydroxytyrosol
HO
incidence of cardiovascular disease and certain cancers than the diet of other
Western countries [5]. And since extra-virgin olive oil is the principal source of fat
in the Mediterranean diet and has been identified as an important contributor to the
reduced mortality associated with this diet, researchers began studying olive oil,
looking for the compound that was responsible for the anti-inflammatory and
cholesterol-lowering effects [6].
That’s when they found hydroxytyrosol—the polyphenol thought to be
responsible for olive oil’s anti-inflammatory and antioxidant effects [7]. Its ability
to absorb free radicals and protect cells and mitochondria [8] from damage is quite
impressive.
The antioxidant activity is the most studied property of hydroxytyrosol. The
interest of hydroxytyrosol is based on its remarkable pharmacological and anti-
oxidant activities. Reactive oxygen species, which are continuously being formed
as a result of metabolic processes in the organism, may cause oxidation and
damage of cellular macromolecules, and therefore, may contribute to the devel-
opment of degenerative diseases, such as atherosclerosis, cancer, diabetes, rheu-
matoid arthritis, and other inflammatory diseases [9].
The high antioxidant efficiency of hydroxytyrosol, attributed to the presence of
the o-dihydroxyphenyl moiety, is due to its high capacity for free radical scav-
enging during the oxidation process and to its reducing power on Fe3+[10].
In numerous human, animal, and in vitro studies, hydroxytyrosol has been
shown to:
(1) Decrease markers or indicators of inflammation including PEG-1, IL-10,
C-reactive protein, TNF-a, COX-2, iNOS, and others [11].
(2) Significantly increasing ATP energy production and supporting healthy
mitochondrial function [12].
(3) Improve the quality of life for osteoporosis patients. Hydroxytyrosol may have
critical effects on the formation and maintenance of bone, and can be used as
effective remedies in the treatment of osteoporosis symptoms [13].
(4) Reduce the risk of macular degeneration and improve eye health [14].
(5) Boost significant and rapid reductions in LDL or ‘bad’ cholesterol [15].
(6) Have a treatment effect on the cardiovascular system [16].
Additional research shows that hydroxytyrosol holds great promise for a wide
variety of potential health benefits.
Hydroxytyrosol is the most powerful natural antioxidant currently known.
Well-documented studies confirm its anti-inflammatory, antibacterial, antioxidant,
and cardioprotective health benefits. Although it is not familiar to most people,
hydroxytyrosol promises to soon become a staple in natural health care. Its bio-
logical activities and beneficial effects on human health have stimulated the
70 A New Process for Preparation of Hydroxytyrosol 691
development of different procedures for the chemical and enzymatic synthesis of

hydroxytyrosol. In this paper, we designed a new, economically effective, tech-
nically attractive process for preparation of hydroxytyrosol starting from catechol,
because catechol is commercially available.
70.2.1 Materials and Measurements
All reagents and solvents used were of reagent grade. Reaction temperatures were
controlled by oil bath temperature modulator. Thin layer chromatography (TLC)
was performed using E. Merck silica gel 60 GF254 precoated plates (0.25 mm).
Silica gel (particle size 200–400 mesh) was used for flash chromatography. 1H
spectra were recorded on Bruker AM-400 NMR spectrometers in deuterated
chloroform.
70.2.2 General procedures
The route to prepare hydroxytyrosol was presented in Scheme 70.1 .

General procedure for the preparation of 1,2-methylenedioxybenzene(3) [17]
O
O CH3 O
Cl
HO O O O CH3
NaOH,TBAB O
O O
HO CH2Cl2,DMSO O AlCl3,CH2Cl2
2 3 4
(1)NH2NH2;(2)KOH;(3)HCl
O COOH LAH,r.t O OH
O O
5 6
BBr3,CH2Cl2 HO OH
HO
1
Scheme 70.1 Synthesis of hydroxytyrosol

692 Y. Gao et al.
A mixture of DMSO (80 ml), dichloromethane (20 mL), and tetrabutyl

ammonium bromide (1.9 g, 6 mmol) was rigorously stirred and heated to reflux.
Then a solution of catechol (11 g, 0.1 mol) in DMSO (60 mL) and a solution of
sodium hydroxide (8 g, 0.2 mol) in water (8 mL) were added dropwise at the same
time at such a rate that the addition was complete after 2 h. After the addition was
complete, the reaction mixture was stirred and refluxed for a further hour.
Then water (100 mL) was slowly added to the reaction mixture. The reaction
mixture was heated and the distillates were accumulated from 99 to 104 C. The
distillates were 1,2-methylenedioxybenzene (3) and water. The distillates were
poured into separator funnel and separated. Then 1,2-methylenedioxybenzene(3)
was obtained in 81.7 % yield.
1
H-NMR(CDCl3): d/ppm 5.96-5.97 (2H, s, CH2), 6.85-6.88 (4H, s, ArH).
General procedure for the preparation of ethyl 2-(benzo[d] [1, 3] dioxol-
6-yl)-2-oxoacetate(4) [18]
In a three-necked round-bottomed flask mounted with a cooler system under
inert conditions, AlCl3 (11.7 g, 0.086 mol) was suspended in CH2Cl2 (120 mL) at
0 C. To this mixture ethyl oxalyl monochloride (11.7 g, 0.086 mol) was added
dropwise in about 10–15 min. After 10 min the stirred suspension became a pale
yellow solution. At 0 C 1,2-methylenedioxybenzene (3) (10 g, 0.082 mol) was
added dropwise in about 10 min. Then the solution was stirred at r.t. for 1 h. To
this reaction mixture the three fold volume of H2O was carefully added. Extraction
was performed with EtOAc (5 9 60 mL). The organic layers were collected and
washed with saturated NaCl solution (2 9 100 mL), dried over Na2SO4, and
concentrated in vacuo. The crude product was purified by column chromatography
on silica gel eluted with (PE/EtOAc80:1) to give the compound 4 (10.2 g, 56.7 %)
as a pale yellow oil.
1
H-NMR(CDCl3): d/ppm 1.41-1.45 (3H, t, CH2CH3), 4.42-4.47 (2H, m,
CH2CH3), 6.10 (2H, s, CH2), 6.90-6.92 (1H, d, ArH), 7.49-7.50 (1H, d, ArH), 7.62-
7.64(1H, dd, ArH).
General procedure for the preparation of 3,4-(methylenedioxy)phenylacetic
acid(5) [19]
In a three-necked round-bottomed flask compound 4(6.7 g, 0.03 mol) and 85 %-
hydrazine hydrate (8.85 g, 0.15 mol) was dissolved in ethylene glycol (60 mL).
The reaction mixture was stirred and heated at 120 C for 2 h then it was cooled to
room temperature and KOH (5 g, 0.09 mol) was added in. The reaction mixture
was heated at 180 C for 2 h to remove low-boiling point compounds then refluxed
for 4 h. When the reaction mixture was cooled to room temperature, the pH was
adjusted to around 3 by progressively adding hydrochloric acid (6 mol/L). To this
reaction mixture H2O (60 mL) was added. Extraction was performed with EtOAc
(5 9 40 mL). The organic layers were collected and washed with saturated NaCl
solution (2 9 50 mL), dried over Na2SO4, and concentrated in vacuo. The crude
product was purified by column chromatography on silica gel eluted with (PE/
EtOAc5:1) to give the compound 5 (3.39 g, 62.8 %) as a white solid.
1
H-NMR(CDCl3): d/ppm 3.59 (2H, s, CH2COOH), 5.97 (2H, s, CH2), 6.73-
6.75 (1H, dd, ArH), 6.78 (1H, s, ArH), 6.80-6.81 (1H, d, ArH).
General procedure for the preparation of 3,4-(methylenedioxy)phenethyl

alcohol(6)
In a round-bottomed flask compound 5(3 g, 0.017 mol) was dissolved in dry
THF (30 mL) at 0 C. To this mixture LiAlH4 (1.7 g, 0.05 mol) was carefully
added. The mixture was stirred at room temperature for 1 day. When the reaction
was complete, the reaction mixture was quenched with 10 % HCl at 0 C until
evolution of gas stopped. For work-up, the mixture was diluted with H2O(50 mL).
Extraction was performed with EtOAc (5 9 20 mL). The organic layers were
collected and washed with saturated NaCl solution (2 9 30 mL), dried over
Na2SO4, and concentrated in vacuo. The crude product was purified by column
chromatography on silica gel eluted with (PE/EtOAc3:1) to give the compound 6
(1.28 g, 46 %) as a colorless oil.
1
H-NMR(CDCl3): d/ppm 1.55 (1H, s, CH2CH2OH), 2.79-2.82 (2H, t,
CH2CH2OH), 3.82-3.85 (2H, t, CH2CH2OH), 5.95 (2H, s, CH2), 6.69-6.71 (1H,
dd, ArH), 6.74-6.75 (1H, d, ArH), 6.77-6.79 (1H, d, ArH).
General procedure for the preparation of hydroxytyrosol(1) [20]
In a round-bottomed flask compound 6 (0.2 g, 1.20 mmol) was dissolved in dry
CH2Cl2 (25 mL) at -40 C. To this mixture a solution of BBr3 (0.7 g, 2.4 mmol)
in CH2Cl2 (2 mL) was carefully added via syringe. The mixture was stirred at
room temperature for 2 h. When the reaction was completely detected by TLC, the
reaction mixture was quenched with CH3OH (5 mL) at 0 C. For work-up, the
mixture was diluted with H2O (30 mL). Extraction was performed with EtOAc
(3 9 20 mL). The organic layers were collected and washed with saturated NaCl
solution (2 9 30 mL), dried over Na2SO4, and concentrated in vacuo. The crude
product was purified by column chromatography on silica gel eluted with (PE/
EtOAc1:1) to give the compound 1 (0.141 g, 76 %).
1
H-NMR(CDCl3): d/ppm 3.03-3.07 (2H, t, CH2CH2OH), 3.49-3.53 (2H, t,
CH2CH2OH), 5.04 (1H, s, ArOH), 5.14 (1H, s, ArOH), 6.64-6.66 (1H, dd, ArH),
6.73-6.74 (1H, d, ArH), 6.80-6.82 (1H, d, ArH).
In this work, a novel and efficient method based on Friedel–Crafts reaction and
Wolff-Kishner-Huang reaction to synthesize hydroxytyrosol has been developed.
This process has several advantages compared with the traditional pathway for the
synthesis of hydroxytyrosol. This method has fewer steps with lower cost which
uses cheap catechol as the starting material. In this procedure, catechol was reacted
with CH2Cl2 in DMSO at 140 C to obtain 1,2-methylenedioxybenzene. Then 1,
2-methylenedioxybenzene was converted into ethyl2-(benzo[d][1,3]dioxol-6-yl)-
2- oxoacetate(4) by Friedel–Crafts reaction. Compound 4 was subsequently
reduced with hydrazine hydrate to obtain 3,4-(methylenedioxy)phenylacetic
acid(5) which was readily separated by column chromatography in a high yield.
Finally hydroxytyrosol was obtained by reduction of compound 5 with LiAlH4 and
694 Y. Gao et al.
deprotection with BBr3. The target compound was obtained by five-step reaction
with an overall yield of 23 %. Although this method involves several steps, it can
be easily performed in large scale and the starting material is inexpensive.
70.4 Conclusion
In conclusion, we have introduced a new method for accessing hydroxytyrosol, by

utilizing catechol as a starting material. The overall procedure involves com-
mercial available and inexpensive materials, using standard experimental proce-
dures, wherein all intermediates are stable and isolatable in moderate and good to
yields.
Acknowledgments This work was supported by National Natural Science Foundation of China
(No: 81072521), the Science & Technology Project of Tianjin (11ZCGHHZ00400), International
Science & Technology Cooperation Program of China (2013DFA31160) and Tianjin University
of Science and Technology (No: 20100411).
References
1. Tuck KL, Hayball PJ (2002) Major phenolic compounds in olive oil: metabolism and health
effects. J Nutr Biochem 13:636–644
2. Capasso R, Evidente A, Avolio S et al (1999) A highly convenient synthesis of
hydroxytyrosol and its recovery from agricultural waste waters. J Agric Food Chem
47:1745–1748
3. Fernández-Bolaños J, Rodríguez G, Rodríguez R et al (2002) Production in large quantities of
highly purified hydroxytyrosol from liquid-solid waste of two phase olive oil processing or
Alperujo. J Agric Food Chem 50:6804–6811
4. Allouche N, Fki I, Sayadi S (2004) Toward a high yield recovery of antioxidants and purified
hydroxytyrosol from olive mill wastewaters. J Agric Food Chem 52:267–273
5. Perrinjaquet-Moccetti T, Busjahn A, Schmidlin C et al (2008) Food supplementation with an
olive (Olea europaea L.) leaf extract reduces blood pressure in borderline hypertensive
monozygotic twins. Phytother Res 22:1239–1242
6. Tripoli E, Giammanco M, Tabacchi G et al (2005) The phenolic compounds of olive oil:
structure, biological activity and beneficial effects on human health. Nutr Res Rev 18:98–112
7. Ragione FD, Cucciolla V, Borroello A et al (2000) Hydroxytyrosol, a natural molecule
occurring in olive oil, induces cytochrome c-dependent apoptosis. Biochem Biophys Res
Commun 278(3):733–739
8. Hao JJ, Shen WL, Yu GL et al (2010) Hydroxytyrosol promotes mitochondrial biogenesis
and mitochondrial function in 3T3-L1 adipocytes. J Nutr Biochem 7:634–644
9. Clara B, Anna A (2009) Antioxidant effects of natural bioactive compounds. Curr Pharm Des
15:3063–3073
10. Torres de Pinedo A, Peñalver P, Morales JC (2007) Synthesis and evaluation of new
phenolic-based antioxidants: structure-activity relationship. Food Chem 103:55–61
11. Sanchez-Fidalgo S, Sanchez de Ibargüen L, Cardeno A et al (2012) Influence of extra virgin
olive oil diet enriched with hydroxytyrosol in a chronic DSS colitis model. Eur J Nutr
51(4):497–506
12. Liu ZB, Sun LJ, Zhu L, Xu J et al (2007) Hydroxytyrosol protects retinal pigment epithelial
cells from acrolein-induced oxidative stress and mitochondrial dysfunction. J Neurochem
103(6):2690–2700
13. Hagiwara K, Goto T, Araki M et al (2011) Olive polyphenol hydroxytyrosol prevents bone
loss. Eur J Pharmacol Jul 15;662(1-3):78-84
14. Zhu L, Liu ZB, Feng ZH et al (2010) Hydroxytyrosol protects against oxidative damage by
simultaneous activation of mitochondrial biogenesis and phase II detoxifying enzyme
systems in retinal pigment epithelial cells. J Nutr Biochem 21(11):1089–1098
15. Gonzalez-Santiago M, Martín-Bautista E, Carrero JJ et al (2006) One-month administration
of hydroxytyrosol, a phenolic antioxidant present in olive oil, to hyperlipemic rabbits
improves blood lipid profile, antioxidant status and reduces atherosclerosis development.
Atherosclerosis Sep;188(1):35-42
16. Vazquez-Velasco M, Esperanza Díaz L, Lucas R et al (2011) Effects of hydroxytyrosol-
enriched sunflower oil consumption on CVD risk factors. Br J Nutr May;105(10):1448-52
17. Bashall P, Collins F (1975) A convenient, high-yielding method for the methylation of
catechols. Tetrahedron Lett 16:3489–3490
18. Ianni A, Waldvogel SR (2006) Reliable and versatile synthesis of 2-aryl-substituted cinnamic
acid esters. Synthesis 13:2103–2112
19. Guoxin Y, Gang C, Yong L et al (2010) An alternative process for preparation of 3,
4-dimethoxyphenylacetic acid. Chinese Journal of Pharmaceuticals 41(10):730–730
20. Alvarez E, Chahboun R, Haidoour B (2009) Method for the preparation of hydroxytyrosol
and 3-(3, 4-dihydroxyphenyl) propanol from methylene dioxybenzenes. WO: 2009153374,
2009-12 -23
Chapter 71
Design and Synthesis
of 2-Arylbenzimidazole Analogues
as Novel SIRT1 Activators
for the Treatment of Type II Diabetes
Fei Hu, Yuanmou Chen, Yinghao Gao, Shaolong Jia, Weizhu Liu,
Abstract SIRT1, an NAD+-dependent sirtuin deacetylase, has emerged as

potential therapeutic target for treatment of human illnesses such as type II dia-
betes, cancer, cardiovascular and neurodegenerative diseases. Resveratrol, a nat-
urally occurring small molecule activator of SIRT1, has been demonstrated to
improve metabolism and glucose tolerance. SRT1720, an imidazothiazole deriv-
ative, recently made as the most potent SIRT1 activator is structurally unrelated to
resveratrol. In this work, we design and synthesize a series of compounds as novel
potential SIRT1 activators through a two-step convenient synthetic procedure.
Fourteen 2-Arylbenzimidazole analogues were characterized on the basis of 1H
NMR spectra. Tests for biological activity of these compounds are underway.

Keywords Synthesis SIRT1 activator Type II diabetes 2-Arylbenzimidazole
analogues
71.1 Introduction
The prevalence of metabolic syndrome associated with increased risk for cardio-
vascular disease, type II diabetes, or cancer has been increasing over the past
decade [1, 2]. The metabolic syndrome was a complex process and can be regu-
lated by genetic alterations and calorie restriction [3]. Recently, a growing list of
evidence implicates mammalian sirtuins in the regulation of various aspects of CR
responses, namely, glucose homeostasis [4], insulin secretion [5, 6], fat metabo-
lism [7], stress resistance [8–12], and physical activity [13]. There has been much
F. Hu Y. Chen Y. Gao S. Jia W. Liu P. Yu E. Hua (&)

Biotechnology, Tianjin University of Science and Technology, Tianjin 300457,
698 F. Hu et al.
interest in developing pharmacological agents that mimic the effects of calorie

restriction. SIRT1, an NAD+-dependent deacetylase, has been implicated as one of
the key downstream regulators of CR in yeast, rodents, and humans [14–16]. Small
molecule activators of SIRT1 have been identified that exhibit efficacy in animal
models of diseases typically associated with aging including type II diabetes [17].
Resveratrol, a polyphenolic SIRT1 activator, mimics the anti-aging effects of
calorie restriction in lower organisms and in mice fed a high-fat diet ameliorates
insulin resistance, increases mitochondrial content, and prolongs survival [18, 19].
Milne et al. identified SRT1720 as potent SIRT1 activators, which are structurally
unrelated to but 1,000-fold more active than resveratrol toward improving glucose
homeostasis, increasing insulin sensitivity, and increasing mitochondrial function
in rodent models of type II diabetes [20]. Thus, SIRT1 activation is a promising
new therapeutic approach for treating diseases of aging such as type II diabetes.
On this basis, numerous efforts have been devoted to discover novel activators
of SIRT1. We synthesis 2-Arylbenzimidazole as new scaffold instead of the
nuclear structure of SRT1720, then fourteen 2-Arylbenzimidazole analogues as the
novel potential SIRT1 activators were synthesized. The aim of this work is to
explore new template structures for novel potent SIRT1 activators.
N N
OH
O
HO
HN
S N
N
OH
N
HN
resveratrol SRT1720
Silica gel (particle size 200–400 mesh) was used for flash chromatography. 1H
spectra were recorded on Bruker AM-400 NMR spectrometer in deuterated
chloroform and deuterated DMSO.
71 Design and Synthesis of 2-Arylbenzimidazole Analogues 699
71.2.2 Experimental Methods
The route to prepare the 2-Arylbenzimidazole analogues was presented in

Fig. 71.1.
The methods of synthesizing and purifying intermediate 1 were as follows.
To a flask 1, 2-diaminobenzene (3.24 g, 30 mmol), 3-Aminobenzoic acid (4.93 g,
36 mmol), and PPA (33 g) were added, then the reaction mixture was allowed to be
heated to 200 C by oil bath and kept reflux for 5 h. After the reaction was completely
finished, the reaction mixture was slowly poured into ice water and the resulting
mixture is basified with solid NaOH and NaHCO3. At pH8-10 the precipitate was
filtered, washed with water, and dried to obtain the crude product, which purified by
flash column chromatography (silica gel, pure CH2Cl2) to afford intermediate 1.
The synthesis and purity methods of intermediate 2 were the same as the method for
intermediate 1.
The second step b: two scaffolds (intermediate 1 and intermediate 2) with
aromatic carboxylic acid by acylation reaction.
In a round-bottomed flask, aromatic carboxylic acid (1.2 mmol) was dissolved in
suitable amount of CH2Cl2 (25 mL), followed by adding EDCI (1.5 mmol), Et3N
(2 mmol), DMAP (0.5 mmol), and intermediate 1 (1 mmol). Then the reaction
mixture was allowed to be heated to 80 C and kept reflux for 6 h. After cooling, the
reaction mixture was poured into a 100 mL separating funnel, then water was added,
then extracted by CH2Cl2, the organic layer was washed by water, saturated salt
water, and dried by sodium sulphate. The organic phase was evaporated under
vacuum to remove the solution CH2Cl2, providing the crude product. Then it was
purified by flash column chromatography to afford 2-Arylbenzimidazole
compounds.
Synthesized route R2
O
COOH NH2 NH
a H H
NH2 N b N
R1 NH2 NH2 R1 N R1 N
intermediate 1 R1= H 2-Arylbenzimidazole analogues 1-14
intermediate 2 R1= CH 3
R1= H , CH3
R 2=
O O O O NO2
O O Br
1 2 3 4 5 6 7
Fig. 71.1 Reagents and conditions: a PPA, 200 C, 5 h (yield 87-90 %); b CH2Cl2, EDCI,
DMAP, Et3N, 80 C, 6 h (yield 35–86 %)
700 F. Hu et al.
71.2.3 Syntheses
2-(20 -aniline) benzimidazole (intermediate 1)

A white solid, 87.4 % yield.
1
H NMR (400 MHz DMSO): d/ppm 12.682 (s, 1H), 7.555 (s, 2H), 7.438–7.429
(t, 1H), 7.293–7.273 (d, 1H), 7.195–7.156 (m, 3H), 6.699–6.675 (dd, 1H),
5.286–5.284(d, 2H).
2-Arylbenzimidazole analogue 1
1
H NMR (400 MHz CDCl3): d/ppm 8.418–8.410 (t, 1H), 8.080 (s, 1H),
7.878–7.856 (m, 3H), 7.648–7.625 (m, 3H), 7.593–7.557 (m, 1H), 7.518–7.480 (m,
2H), 7.449–7.410 (t, 1H), 7.291–7.248 (m, 3H).
1
H NMR (400 MHz DMSO): d/ppm 12.778–12.740 (d, 1H), 10.430 (s, 1H),
8.682 (s, 1H), 8.037–8.019 (d, 2H), 7.860–7.841 (m, 2H), 7.639–7.314 (m, 6H),
7.063–7.011 (m, 1H), 2.443–2.426 (m, 3H).
1
H NMR (400 MHz CDCl3): d/ppm 8.338 (s, 1H), 8.110 (s, 1H), 7.826–7.806
(d, 1H), 7.714–7.666 (m, 2H), 7.403–7.363 (t, 1H), 7.252–7.237 (m, 1H),
6.955–6.950 (d, 2H), 6.603–6.592 (t, 1H), 3.796 (s, 6H).
1
(t, 2H), 7.552–7.531 (dd, 2H), 7.283 (s, 1H), 7.270–7.231 (t, 1H), 7.220–7.197(m,
2H), 3.873 (s, 3H), 3.753 (s, 6H).
1
(d, 1H), 7.812 (s, 1H), 7.645 (d, 2H), 7.506–7.486 (m, 3H), 7.396 (t, 1H),
7.303–7.270 (m, 4H), 2.533 (s, 3H).
1
7.876–7.857 (d, 1H), 7.776–7.754 (m, 3H), 7.681–7.659(m, 2H), 7.546–7.506 (t,
1H), 7.322–7.260(m, 3H).
1
H NMR (400 MHz DMSO): d/ppm 12.952 (s, 1H), 10.791 (s, 1H),
8.889–8.880 (t, 1H), 8.717–8.709 (t, 1H), 8.488–8.461 (dd, 2H), 7.938–7.860 (m,
3H), 7.686–7.668 (d, 1H), 7.595–7.535 (dd, 2H), 7.239–7.200 (m, 2H).
2-(20 -aniline) -5-methyl-benzimidazole (intermediate 2).
1
H NMR (400 MHz CDCl3): d/ppm 9.337 (s, 1H), 7.468–7.461(t, 1H),
7.291–7.244 (m, 4H), 7.107–7.083 (dd, 1H), 6.786–6.758 (m, 1H), 3.804 (s, 2H),
2.487(s, 3H).
1
H NMR (400 MHz CDCl3): d/ppm 10.445 (s, 1H), 8.482 (s, 1H), 8.008 (s,
1H), 7.927–7.911 (d, 1H), 7.886–7.864 (d, 2H), 7.822 (s, 1H), 7.559 (s, 1H),
7.521–7.489 (d, 2H),7.262 (m, 2H), 7.021–6.998 (d, 2H), 3.896 (s, 3H).
1
(m, 3H), 7.637–7.617 (d, 1H), 7.554–7.534 (d, 1H), 7.464–7.424 (t, 1H), 7.404 (s,
1H), 7.110–7.089 (d, 1H), 7.003–6.981 (d, 2H), 3.887 (s, 3H), 2.485 (s, 3H).
1
7.875–7.855 (d, 1H), 7.657–7.633 (dd, 1H), 7.552 (s, 1H), 7.493–7.453 (t, 2H),
7.406 (s, 1H), 7.115–7.092 (dd, 1H), 6.999–6.993 (d, 2H), 6.651–6.640 (t, 1H),
3.861 (s, 6H), 2.489 (s, 3H).
1
H NMR (400 MHz CDCl3): d/ppm 8.347-8.338 (t, 1H), 8.073 (s, 1H),
8.817–7.768 (m, 2H), 7.545 (s, 1H), 7.504–7.464 (t, 2H), 7.404 (s, 1H), 7.110 (m,
3H), 3.940 (s, 6H), 3.925 (s, 3H), 2.491 (s, 3H).
1
H NMR (400 MHz CDCl3): d/ppm 8.750–8.736 (dd, 2H), 8.475–8.451 (dd,
2H), 8.409–8.387 (dd, 2H), 7.637–7.596 (dt, 2H), 7.479–7.458 (t, 1H), 7.447 (s,
1H), 7.426 (s, 1H), 7.416–7.415 (d, 1H), 7.396 (s, 1H), 2.684 (s, 6H).
1
(dd, 3H), 7.610–7.607 (dd, 1H), 7.587–7.509 (m, 2H), 7.498–7.461 (t, 2H),
7.404–7.365 (t, 2H), 7.088–7.065 (dd, 1H), 2.460 (s, 3H).
1
H NMR (400 MHz DMSO): d/ppm 12.814–12.774 (d, 1H), 10.775 (s, 1H),
8.885–8.882 (d, 1H), 8.675 (s, 1H), 8.484–8.457 (m, 2H), 7.941–7.856 (m, 3H),
7.579–7.323 (m, 3H), 7.070–7.014 (m, 1H), 2.448–2.429 (d, 3H).
702 F. Hu et al.
Table 71.1 Effect of the Entry Acid: diamine Yield (%)

ratio of aromatic carboxylic
acid 1 1 76.5
2 1.1 83.5
3 1.2 90.6
4 1.3 91.1
5 1.4 91.6
In this work, we synthesized intermediate from 1,2-diaminobenzene and

3-Aminobenzoic acid with PPA under solvent-free conditions. In this reaction, the
temperature is very important. In our initial attempts, when temperature was under
180 C, the reaction produced a complicated composition and made the separation
difficult. When 200 C, the reaction can react completely and easily work up to
afford pure product. Interestingly, the ratio of aromatic carboxylic acid can affect
on this reaction yield (Table 71.1). We found the increased yield with higher ratio
of acid, but when the ratio is higher than 1.2, the yield is not increased obviously.
In addition, the excess aromatic carboxylic acid can bring a side reaction and this
material is not cheap. So the ratio of 1.2 is the best choice.
In the step b, fourteen 2-Arylbenzimidazole analogues were synthesized by
acylation reaction. In our initial attempts, we use HATU as the catalyst but TLC
showed two main spots, the HATU may induce reaction within aniline and
imidazole acylations whatever the ratio of aromatic carboxylic acid to aniline was
changed. Without HATU the reaction directed to a major product and excessive
acid can increase the yield of reaction. In all, we take 1.2 equivalent acids in this
reaction. The total yield was 31–77 %; this method was lower cost, simple, and
convenient.
2-Arylbenzimidazole analogues have the similar structure with SIR1720, to
choose benzimidazole as structural template is due to its important pharmacophore
in modern drug discovery [21]. Benzimidazole derivatives have exhibited signif-
icant activity against several viruses such as HIV [22, 23], herpes (HSV-1) [24],
and human cytomegalovirus (HCMV) [23]. Benzimidazole and its derivatives
have been used as angiotensin II inhibitors [25], potential antitumor agents [26],
and antimicrobial agents [27].
71.4 Conclusion
In summary, we have synthesized two kinds of 2-arylbenzimidazole compounds

with moderate yield from relevant 1, 2-diaminobenzene and aromatic carboxylic
acids through two steps for imidazole formation and acylation. The imidazole
formation was conducted only in the present of PPA without using solvent. The
salient features of this reaction are mild reaction conditions, moderate yields, and
clean work-up procedure. These advantages should render the synthesis of 2-
arylbenzimidazole analogues more efficient and environmental friendly.
Acknowledgments Funding for this study was provided by National Natural Science Founda-
tion of China (No: 81072521), Tianjin University of Science & Technology (No: 20100411),
International Science & Technology Cooperation Program of China (2013DFA31160) and the
Science & Technology Project of Tianjin (11ZCGHHZ00400).
References
1. Dekker JM, Girman C, Gieln R, Nijpels G, Stehouwer CDA, Bouter LM, Heine RJ (2005)
Metabolic syndrome and 10-year cardiovascular disease risk in the hoorn study.
Epidemiology 112:666–673
2. Russo A, Autelitano M, Bisanti L (2008) Metabolic syndrome and cancer risk. Eur J Cancer
44(2):293–7
3. Guarente Leonard (2006) Sirtuins as potential targets for metabolic syndrome. Nature
444:868–874
4. Rodgers, JT Carlos Lerin, Wilhelm Haas, Steven P Gygi Bruce. M,Spiegelman. (2005)
Nutrient control of glucose homeostasis through a complex of PGC-1a and SIRT1. Nature
434:113-118
5. Bordone L, Motta MC, Picard F, Robinson A, Ulupi SJ, Apfeld J (2006) Sirt1 regulates
insulin secretion by repressing UCP2 in pancreatic beta cells. PLoS Biol 4(2):e31
6. Moynihan KA, Grimm AA, Bernal-Mizrachi E, Plueger MM, Ford E, Cras-Méneur C,
Permutt MA, Imai S (2005) Increased dosage of mammalian Sir2 in pancreatic beta cells
enhances glucose-stimulated insulin secretion in mice. Cell Metab Aug; 2(2):105–17
7. Picard F, Kurtev M, Chung N et al (2004) SIRT1 promotes fat mobilization in white
adipocytes by repressing PPAR-c Nature 429:771–776
8. Brunet A et al (2004) Stress-dependent regulation of FOXO transcription factors by the
SIRT1 deacetylase. Science 303:2011–2015
9. Luo J et al (2001) Negative control of p53 by Sir2a promotes cell survival under stress. Cell
107:137–148
10. Motta MC et al (2004) Mammalian SIRT1 represses forkhead transcription factors. Cell
116:551–563
11. Vaziri H et al (2001) hSIR2 (SIRT1) functions as an NAD-dependent p53 deacetylase. Cell
107:149–159
12. Wang C et al (2006) Interactions between E2F1 and SirT1 regulate apoptotic response to
DNA damage. Nat Cell Biol 8:1025–1031
13. Chen D et al (2005) Increase in activity during calorie restriction requires Sirt1. Science
310:1641
14. Cohen HY et al (2004) Calorie restriction promotes mammalian cell survival by inducing the
SIRT1 deacetylase. Science 305:390–392
15. Bordone L, Guarente L (2005) Calorie restriction, SIRT1 and metabolism: understanding
longevity. Nature Rev Mol Cell Biol 6:298–305
16. Barzilai N, Banerjee S, Hawkins M, Chen W, Rossetti L (1998) Caloric restriction reverses
hepatic insulin resistance in aging rats by decreasing visceral fat. J Clin Invest
101:1353–1361
17. Smith JJ, Gagne DJ, Galonek HL (2009) Small molecule activators of SIRT1 replicate
signaling pathways triggered by calorie restriction in vivo. BMC Syst Biol 3:31
704 F. Hu et al.
18. Baur JA et al (2006) Resveratrol improves health and survival of mice on a high-calorie diet.
Nature 444:337–342
19. Wood JG et al (2004) Sirtuin activators mimic caloric restriction and delay ageing in
metazoans. Nature 430:686–689
20. Milne JC, Philip D, Lambert, David P, Carney et al (2007) Small molecule activators of
SIRT1 as therapeutics for the treatment of type 2 diabetes. Nature 29 450(7170):712–6
21. Tebbe MJ, Spitzer WA, F Victor S.C. Miller CC, Lee TR, Sattelberg E, Mckinney, Tang CJ
(1997) Antirhino/enteroviral vinylacetylene benzimidazoles: a study of their activity and oral
plasma levels in mice. J Med Chem 40 (24):3937–3946
22. Porcari AR, Devivar RV, Kucera LS, Drach JC, Townsend LB (1998) Design, synthesis, and
antiviral evaluations of 1-(substituted benzyl)-2-substituted-5, 6-dichloro-benzimidazoles as
nonnucleoside analogues of 2, 5, 6-trichloro1- ((-d-ribofuranosyl)benzimidazole. J Med
Chem 41:1251
23. Roth M, Morningstar ML, Boyer PL, Hughes SH, Bukheit RW, Michejda CJ (1997)
Synthesis and biological activity of novel nonnucleoside inhibitors of HIV-1 reverse
transcriptase. 2-Aryl-Substituted Benzimidazoles. J Med Chem40(26): 4199–4207
24. Migawa MT, Giradet JL, Walker JA, Koszalka GW, Chamber-Lain SD, Drach JC, Townsend
LB (1998) Design, synthesis, and antiviral activity of a-Nucleosides: D- and L-Isomers of
Lyxofuranosyl- and (5-Deoxylyxofuranosyl) benzimidazoles. J Med Chem 41(8):1242–1251
25. Nadaf RN, Siddiqui SA, Daniel T, Lahoti RJ, Srinivasan KV (2004) Room temperature ionic
liquid promoted regioselective synthesis of 2-arylbenzimidazoles, benzoxazoles and
benzthiazoles under ambient conditions. J Mol Catal A: Chem 214:155
26. Denny WA, Rewcastle GW, Baguley BC (1990) Structure-activity relationships for 2-
phenylbenzimidazole-4-carbo-xamides, a new class of ‘‘minimal’’ DNA-intercalating agents
which may not act via topoisomerase II. J Med Chem 33(2):814–819
27. Forseca T, Gigante B, Gilchrist TL (2001) A short synthesis of phenanthro[2,3-d]imidazoles
from dehydroabietic acid. Application of the methodology as a convenient route to
benzimidazoles. Tetrahedron 57(9):1793–1799
Chapter 72
Design and Synthesis of SRT1 Activators
for Potential Lead Compounds
of Treatment of Diabetes
Weizhu Liu, Qiuyue Wang, Fei Hu, Yinghao Gao, Yingying Wang,
Abstract Sirtuins catalyze NAD+-dependent protein deacetylation and are key

regulators of transcription, apoptosis, metabolism, and aging. There are seven
human sirtuins (SIRT1–7), and SIRT1 has been proven as a key mediator of the
pathways downstream of calorie restriction that has been shown to delay the onset
and the incidence of age-related diseases such as type II diabetes. Increasing
SIRT1 activity, either by transgenic over expression of the SIRT1 gene in mice or
by pharmacological activation by small molecule activator SRT1720, has shown
beneficial effects in rodent models of type II diabetes. In this paper, several small
molecules were designed and synthesized through a convenient synthetic proce-
dure. Ten newly synthesized compounds were characterized on the basis of 1H
NMR.
Keywords Sirt1 Activator 2-phenylbenzo[d]thiazole 2-phenylbenzo[d]oxa-

zole Synthesis
72.1 Introduction
Silent information regulator 2(Sir2) was first identified as a gene that is required to
maintain cell mating type in Saccharomyces cerevisiae by repressing the tran-
scription of mating type genes [1]. It leads to a decrease in histone acetylation [1,
2] and an increase in lifespan in yeast [3]. Extensive researches show that four
sirtuins (Hst1-4) in addition to Sir2 in Saccharomyces cerevisiae, and seven
homologs (SIRT1-7) have been identified in mammals. Among the seven members
W. Liu Q. Wang F. Hu Y. Gao Y. Wang P. Yu E. Hua (&)

Key Laboratory of Industrial Microbiology of Ministry of Education,
706 W. Liu et al.
OMe
N O
O O
OMe
HN N HN HN
S N OMe
S N S N OH
N
N N
HO
N
N N
OH NH
NH OH
SRT1720 SRT2183 SRT1460 Resveratrol
Fig. 72.1 Structures of SRT1720, SRT2183, SRT1460 and Resveratrol [24]
of the homologs, the nuclear SIRT1 is the closest homolog of yeast Sir2 [4].
SIRT1, an NAD+-dependent deacetylase [5],is critical regulators of transcription
and playing important roles in the regulation of apoptosis, differentiation,
metabolism, and chromatin remodeling [6–14]. SIRT1 has shown to be activated
by fasting and Calorie restriction [15, 16]. SIRT1 is a principal modulator of
pathways downstream of calorie restriction that produces beneficial effects on
glucose homeostasis and insulin sensitivity in adipose tissue, skeletal muscle, and
liver [17–20]. On this basis, activation of SIRT1 could serve as a novel approach to
treat type II diabetes.
Resveratrol, a naturally occurring small molecule activator of SIRT1, has been
reported to improve insulin sensitivity, increase mitochondrial content, and
prolong survival of mice fed a high fat, high calorie diet [21–23]. So it indicates
that SIRT1 may represent an attractive therapeutic target for the treatment of type
II diabetes. Recently, SRT1720, SRT2183, and SRT1460 were described by Sirtris
Pharmaceuticals as SIRT1 activators [24] (Fig. 72.1). They are structurally unre-
lated to resveratrol. SRT1720, the strongest activator of the series, was reported
that it could improve glucose homeostasis, increase insulin sensitivity, and
increase mitochondrial function in rodent models of type II diabetes [23, 24].
According to the structure of SRT1720, We have tried change the core structure of
SRT1720 from imidazo[1,2-b]thiazoles into 2-phenylbenzo[d]thiazole or 2-phen-
ylbenzo[d]oxazole. Ten new compounds were synthesized. In this paper, we
mainly explore a kind of new structures of potential SRT1 activators.
72.2 Experimental
Silica gel (particle size 200–400 mesh) was used for flash chromatography.
72 Design and Synthesis of SRT1 707
1
H spectra were recorded on Bruker AM-400 NMR spectrometers in deuterated
chloroform and deuterated DMSO.
72.2.2 Experimental Procedure
The route to Synthesis of 2-phenylbenzo[d]thiazole and 2-phenylbenzo[d]oxazole

analogs was presented in Fig. 72.2.
72.2.2.1 The Procedure of Reaction a and b
The reaction a and b was used for the preparation of 2-aminobenzoic acid from
2-aminobenzoate. In a round-bottomed flask, 2-aminobenzoate (6.3 g, 41.6 mmol)
was dissolved in ethanol (30 ml). Then add 10 % NaOH solution (20 ml) in the
flask. The reaction mixture was warmed up to 60 C for 5 h. After the reaction was
completely finished by the addition of suitable amount of 10 % HCl solution,
white solid appears at PH 5-7 and vacuum dried . The crude product was used
directly for the next step without further purification.
The first route

COOCH 3 COONa
(a)
NH 2 NH 2 R
O
(b) NH
H 2N
SH HOOC (c) S (d) N
NH 2 H 2N N S
intermediate 1 compound 1-5
R
The second route O
NH 2
H 2N NH
OH (e) O (f) O
NH 2 N
N
COOH
intermediate 2 compound 6-10
R = O O O O
NO2 O
O O
O
Fig. 72.2 Reagents and conditions: a NaOH, EtOH, 60 C; b HCl; c PPA, 200 C,6 h;
d CH2Cl2, EDCI, Et3N, DMAP, Et3N, 80 C,8 h; e PPA, 200 C; f C5H5N, EDCI, Et3N,
90 C,5 h
708 W. Liu et al.
72.2.2.2 The Procedure of Reaction c and e
The methods of synthesizing and purifying intermediate 2 were the same as

intermediate 1, the experimental procedure are as follows [25]. To a flask which
contained 2-aminobenzenethiol (4 g, 29.6 mmol), 2-aminobenzoic acid (4.5 g,
32.8 mmol) from last step and PPA (44 g, 130.6 mmol). Then the reaction mixture
was allowed to be heated to 200 C and kept reflux for 6 h. After the reaction was
completely finished, the reaction mixture was slowly poured into ice water and the
resulting mixture basified with solid NaOH. At pH 5-6 the precipitate was filtered,
washed with water, and dried to give the intermediate 1.
72.2.2.3 The Procedure of Reaction d
In a round-bottomed flask, RCOOH (1.2 mmol) was dissolved in suitable amount

of CH2Cl2, followed by adding EDCI (1.5 mmol), Et3N (1.5 mmol) for stirring for
20 min, then DMAP (0.5 mmol) and intermediate 1(1 mmol) was added. The
reaction mixture was allowed to be heated to 80 C and kept reflux for 8 h. After
cooling the reaction mixture was poured into a 100 ml separating funnel, then
water was added and extracted by CH2Cl2, the organic layer was washed by water
and brine. The Solvent was dried under vacuum to offer the crude product. The
crude product was purified by flash column chromatography to afford
2-phenylbenzo[d]thiazole analogs.
72.2.2.4 The Procedure of Reaction f
In a round-bottomed flask, RCOOH (1.2 mmol) was dissolved in suitable amount

of C5H5N, followed by adding EDCI (1.5 mmol), Et3N (1.5 mmol) for stirring for
20 min, then intermediate 2(1 mmol) was added. Then the reaction mixture was
allowed to be heated to 90 C and kept reflux for 5 h. After the reaction was
completely finished, the mixture was filtered. The solid was recrystallized from
methanol and hexane to yield the pure product.
72.2.3 Syntheses
2-(benzo[d]thiazol-2-yl)aniline (Intermediate 1)
This compound was prepared in 80.2 % yield by following reaction a, b, and
c. light yellow solid.
1
H NMR (400 MHz CDCl3): d/ppm 7990, 7.985 (d, J = 2 HZ, 1H), 7.891,
7.871 (d, J = 8 HZ, 1H), 7.750–7.737 (t, J = 4 HZ,1H), 7.501–7.475 (dd,
J = 0.64, 0.18 HZ, 1H), 7.402–7.377 (t, J = 5.2 HZ, 1H), 7.273–7.246 (m, 1H),
6.836, 6.823 (d, J = 5.2 HZ, 1H), 6.798–6.773 (t, J = 5.2 HZ, 1H), 6.451 (s, 2H).
N-(2-(benzo[d]thiazol-2-yl)phenyl)-3-nitrobenzamide (Compound 1)
This compound was prepared in 40.7 % yield by following reaction a, b, c, and
d. white solid.
1
H NMR (400 MHz CDCl3): d/ppm 13.521 (s, 1H), 8.804, 8.783 (d, J = 2 HZ, 1H),
9.043–9.020 (q, J = 4 HZ, 1H), 8.607,8.587 (d, J = 8.4 HZ, 1H), 8.500–8.476 (dd,
J = 7.2, 1.3 HZ, 1H), 8.163, 8142 (d, J = 8.4 HZ, 1H), 7.967–7.934 (m, 2H),
7.818–7.778 (t, J = 8.4 HZ, 1H), 7.598–7.548 (m, 2H). 7.484–7.446 (t, J = 8.1 HZ,
1H), 7.282–7.244 (t, J = 8.5 HZ, 1H).
N-(2-(benzo[d]thiazol-2-yl)phenyl)-2-(3,4-dimethoxy-phenyl)acetamide
(Compound 2)
d. light yellow solid.
1
H NMR (400 MHz CDCl3): d/ppm 12.341 (s, 1H), 8.805–8.782 (dd, J = 8,0.8 HZ,
1H), 7.929–7.899 (q, J = 4 HZ, 2H), 7.843–7.820 (dd, J = 6.4,1.2 HZ, 1H), 7.548–7.416
(m, 3H), 7.177–7.136 (t, J = 7.6 HZ, 1H), 7.967–7.934 (m, 2H), 7.818–7.778(t, J = 8.0
HZ, 1H), 7.012–6.987 (dd, J = 6,1 HZ, 1H). 6.949, 6.945 (d, J = 2 HZ, 1H), 6.823,
6.802 (d, J = 8.5 HZ, 1H), 3.829 (s, 1H), 3.801 (s, 1H), 3.791 (s, 1H).
N-(2-(benzo[d]thiazol-2-yl)phenyl)-4-methoxybenzamide (Compound 3)
d. white solid.
1
H NMR (400 MHz CDCl3): d/ppm 13.257 (s, 1H), 9.052, 9.031 (d, J = 8.4
HZ, 1H), 8.224, 8.202 (d, J = 8.8 HZ, 2H), 8.027,8.007 (d, J = 8 HZ, 1H),
7.955–7.904 (dd, J = 8.4,1.6 HZ, 2H), 7.573–7.513 (q, J = 7.2 HZ, 2H),
7.472–7.431 (t, J = 8.4 1H), 7.260–7.167 (t, J = 6.8 1H), 7.097, 7.075 (d, J = 8.9
HZ, 2H), 3.936 (s, 3H).
N-(2-(benzo[d]thiazol-2-yl)phenyl)-3,5-dimethoxybenzamide (Compound 4)
d. white solid.
1
H NMR (400 MHz CDCl3): d/ppm 13.384 (s, 1H), 9.052, 9.031 (dd, J = 8.4
HZ, 1H), 8.187, 8167 (d, J = 8.4 HZ, 1H), 7.946–7.915 (m, 2H), 7.564–7.525 (m,
2H), 7.466, 7.446 (d, J = 8.4 HZ,1H), 7.422–7.417 (d, J = 2 HZ, 2H),
7.229–7.188 (t, J = 8.4, 1H), 6.700–6.689 (t, J = 2, 1H), 3.915 (s, 6H).
N-(2-(benzo[d]thiazol-2-yl)phenyl)-3,4,5-trimethoxybenzamide (Compound 5)
d. white solid.
1
H NMR (400 MHz CDCl3): d/ppm 13.170 (s, 1H), 9.001, 8.980 (d, J = 8.4
HZ, 1H), 8.187, 8167 (d, J = 8.4 HZ, 1H), 7.975–7.917 (q, J = 8.4 HZ, 3H),
7.572–7.499 (m, 2H), 7.460–7.422 (t, J = 8.4 HZ, 1H), 7.396 (s, 1H), 7.234–7.197
(t, J = 8.4 1H), 3.962 (s, 9H).
3-(benzo[d]oxazol-2-yl)aniline (Intermediate 2)
This compound was prepared in 82 % yield by following reaction e light yellow
solid.
1
H NMR (400 MHz CDCl3): d/ppm 7.785–7.7.740 (m, 1H), 7.660–7.635 (dt,
J = 8.4, 1.2 HZ, 1H), 7.588–7.560 (m, 2H), 7.369–7.326 (m, 2H), 7.306, 7.286 (d,
J = 8.4 HZ, 1H), 6.864–6.836 (ddd, J = 8.4, 2.4, 1.2 HZ, 1H), 3.842 (s, 2H).
710 W. Liu et al.
N-(3-(benzo[d]oxazol-2-yl)phenyl)-3-nitrobenzamide (Compound 6)
This compound was prepared in 68.3 % yield by following reaction e and f light
yellow solid.
1
H NMR (400 MHz DMSO): d/ppm 10.862 (s, 1H), 8.879 (s, 1H), 8.783 (s,
1H), 8.484, 8.464 (d, J = 8.4 HZ, 2H), 8.075, 8.055 (d, J = 8.4 HZ, 1H), 7.999,
7.980 (d, J = 7.2 HZ, 1H), 7.904–7.864 (t, J = 8.4 HZ, 1H), 7.862–7.818 (m, 2H),
7.664–7.624 (t, J = 8.4 HZ, 1H), 7.488–7.416 (m, 2H).
N-(3-(benzo[d]oxazol-2-yl)phenyl)-2-(3,4-dimethoxyphenyl)acetamide
(Compound 7)
This compound was prepared in 64.7 % yield by following reaction e and
f white solid.
1
H NMR (400 MHz CDCl3): d/ppm 8.074 (s, 1H), 7.984, 7.964 (d, J = 8.4 HZ,
1H), 7.905, 7.885 (d, J = 8.4 HZ, 1H), 7.757–7.734 (m, 1H), 7.586–7.563(m, 1H),
7.488–7.448 (t, J = 8.4 HZ, 1H), 7.377–7.329 (m, 2H), 7.310 (s, 1H), 6.938–6,888
(q, J = 4 HZ, 2H). 6.853 (s, 1H).
N-(3-(benzo[d]oxazol-2-yl)phenyl)-4-methoxybenzamide (Compound 8)
This compound was prepared in 50.5 % yield by following reaction e and f light
yellow solid.
1
H NMR (400 MHz CDCl3): d/ppm 8.408 (s, 1H), 8.047, 8.007 (t, J = 8.4 HZ,
2H), 7.894, 7.872 (d, J = 8.8 HZ, 3H), 7.788–7.766 (m, 1H), 7.607–7.576 (m,
J = 8.8 HZ,1H), 7.562–7.522 (d, J = 8.4 HZ, 1H), 7.380–7.357 (dd, J = 6, 3.2
HZ, 2H), 7.019, 6.997 (d, J = 8.8 HZ, 2H), 3.894 (s, 3H).
N-(3-(benzo[d]oxazol-2-yl)phenyl)-2-(3,5-dimethoxyphenyl)acetamide
(Compound 9)
f white solid.
1
H NMR (400 MHz CDCl3): d/ppm 8.421 (s, 1H), 8.057, 8.037 (d, J = 8.4 HZ,
1H), 8.004–7,973 (t, J = 12.4 HZ, 2H), 7.785–7.762 (m, 1H), 7.602–7.579 (m,
1H), 7.563–7.523 (d, J = 8.4 HZ, 1H), 7.378–7.356 (m, 2H), 7.019, 7.013 (d,
J = 2.4 HZ, 2H), 6.648–6.636 (t, J = 2.4 HZ, 1H). 3.862 (s, 1H).
N-(3-(benzo[d]oxazol-2-yl)phenyl)-2-(3,4,5-trimethoxyphenyl)acetamide
(Compound 10)
f white solid.
1
H NMR (400 MHz CDCl3): d/ppm 8.380 (s, 1H), 8.082–8.037 (m, 2H), 7.948
(s, 1H), 7.787–7.765 (m, 1H), 7.607–7.539 (m, 2H), 7.386–7.363 (m, 2H), 7.125
(s, 2H), 3.954, 3.928 (d, J = 10.4 HZ, 9H).
In this work, the core structure of SRT1720 has been changed from imidazo
[1,2-b]thiazoles to 2-phenylbenzo[d]thiazole or 2-phenylbenzo[d]oxazole. At the
same time, ortho-amide bond is shifted to meta-position one to check if these
changes could bring significant SAR improvement.
Table 72.1 The yield (%) of reaction under condition 1 and 2

Compounds Condition 1 Condition 2
1 40.7 26.5
2 36.8 22.3
3 32.1 24.4
4 35.5 20.9
5 28.6 19.6
6 46.7 68.3
7 38.6 64.7
8 30.5 50.5
9 36.7 57.8
10 31.2 60.3
As to the reaction c and d, the temperature is a very important factor. In our

initial attempts, when temperature under 170 C, the reaction produced a com-
plicated composition and made the separation difficult. When increased to over
200 C, the reaction can complete for easy work-up to afford pure product.
In addition, as to reaction e and f acylation, when reaction condition was
CH2Cl2 and DCC, all our reactions gave the yield among 14–19 %. We set up
other two new conditions: 1. CH2Cl2, EDCI, and DMAP as catalyst, Et3N, 80C,
and 8 h; 2. C5H5N as solvent, EDCI, Et3N, 90 C, and 5 h. Interestingly, two
different yield for this two different type reaction were observed (Table 72.1). In
Table 72.1, for compound 1–5 of 2-phenylbenzo[d]thiazole analog, yield under
condition 1 is higher than under condition 2; whereas for compound 6–10 of
2-phenylbenzo[d]oxazole analog, yield under condition 2 is higher than under
condition 1. Especially, compound 6–10 was formed as precipitation under con-
dition 2 for making the isolation easy.
72.4 Conclusion
In summary, the two suitable conditions for quick synthesis of different kinds of
compounds such as 2-phenylbenzo[d]thiazole and 2-phenylbenzo[d] oxazole were
developed, which offered overall yield 30–69 %. All compounds synthesized in
this paper are core-changed partially similar to the structure of SRT1720. The aim
of the work is to find suitable fragments for a further structural expansion for
seeking a lead compound with a potential biological activity toward Sirt1.
Acknowledgments Sponsor and financial support acknowledgments are provided by National

Natural Science Foundation of China (No: 81072521), Tianjin University of Science & Tech-
nology (No: 20100411), International Science & Technology Cooperation Program of China
(2013DFA31160) and the Science & Technology Project of Tianjin (11ZCGHHZ00400).
712 W. Liu et al.
References
1. Kong Xingxing, Wang Rui, Liu Xiaojun, Zhu Liuluan, Shao Di, Fang Fu-De et al (2009)
Function of SIRT1 in physiology. Biochemistry (Moscow) 74:703–708
2. Braunstein M, Rose AB, Holmes SG, Allis, Broach JR (1993) Transcriptional silencing in
yeast is associated with reduced nucleosome acetylation. Genes Dev 7:592–604
3. Kaeberlein M, McVey M, Guarente L (1999) The SIR2/3/4 complex and SIR2 alone promote
longevity inSaccharomyces cerevisiae by two different mechanisms. Genes Dev
13:2570–2580
4. Frye RA (2000) Phylogenetic classification of prokaryotic and eukaryotic Sir2-like proteins.
Biochem Biophys Res Commun 273:793–798
5. Michan S, Sinclair D (2007) Sirtuins in mammals: insights into their biological function.
Biochem J 404:1–13
6. Starai VJ, Celic I, Cole RN, Boeke JD, Escalante-Semerena JC (2002) Sir2-dependent
activation of acetyl-CoA synthetase by deacetylation of active lysine. Science
298:2390–2392
7. Rusche LN, Kirchmaier AL, Rine J (2003) The establishment, inheritance, and function of
silenced chromatin in Saccharomyces cerevisiae. Annu Rev Biochem 72:481–516
8. Gasser SM, Cockell MM (2001) The molecular biology of the SIR proteins. Gene 279:1–16
9. Dryden SC, Nahhas FA, Nowak JE, Goustin AS, Tainsky MA (2003) Role for human SIRT2
NAD- dependent deacetylase activity in control of mitotic exit in the cell cycle. Mol Cell Bio
23:3173–3185
10. Wood JG, Rogina B, Lavu S, Howitz K, Helfand SL (2004) Sirtuin activators mimic caloric
restriction and delay ageing in metazoans. Proc Natl Acad Sci USA 101:15998–16003
11. Tissenbaum HA, Guarente L (2001) Increased Dosage of a sir-2 gene extends lifespan in
Caenorhabditis elegans. Nature 410:227–230
12. Vaziri H, Dessain SK, Ng Eaton E, Imai SI, Frye RA, Pandita TK, Guarente L, Weinberg RA
(2001). Hsir2SIR1 Functions as an NAD-Dependent P53 Deacetylase. Cell 107(2):149–159
13. Luo J, Nikolaev AY, Imai S, Chen D, Su F, Shiloh A, Guarente L, Gu W (2001) Negative
control of p53 by Sir2 [alpha] promotes cell survival under stress. Cell 107:137–148
14. Langley E, Pearson M, Faretta M, Bauer UM, Frye RA, Minucci S, Pelicci PG, Kouzarides T
(2002) Human SIR2 deacetylates p53 and antagonizes PML/p53-induced cellular senescence.
EMBO J 21:2383–2396
15. Cohen HY, Miller C, Bitterman KJ, Wall NR, Hekking B, Kessler B, Howitz KT, Gorospe
M, de Cabo R, Sinclair DA (2004) Calorie restriction promotes mammalian cell survival by
inducing the SIRT1 deacetylase. Science 305:390–392
16. Heilbronn LK, Civitarese AE, Bogacka I, Smith SR, Hulver M, Ravussin E (2005) Glucose
tolerance and skeletal muscle gene expression in response to alternate day fasting. Obes Res
13:574–581
17. Milne JC, Lambert PD, Schenk S, Carney DP, Smith JJ (2007) Small molecule activators of
SIRT1 as therapeutics for the treatment of type 2 diabetes. Nature 450:712–716
18. Bordone L, Guarente L (2005) Calorie restriction, SIRT1 and metabolism: understanding
longevity. Nature Rev Mol Cell Biol 6:298–305
19. Cohen HY, Miller C, Bitterman KJ, Wall NR et al (2004) Calorie restriction promotes
mammalian cell survival by inducing the SIRT1 deacetylase. Science 305:390–392
20. Heilbronn LK et al (2005) Glucose tolerance and skeletal muscle gene expression in response
to alternate day fas-ting. Obes Res 13:574–581
21. Baur JA, Pearson KJ, Price NL, Jamieson HA, Lerin C, Kalra A, Prabhu VV, Allard JS,
Pistell PJ, Poosala S, Gwinn D, Wang M, Ramaswamy S, Fishbein KW, Spencer RG, Lakatta
EG, LeCouteur D, Shaw RJ et al (2006) Resveratrol improves health and survival of mice on
a high-calorie diet. Nature 444:337–342
22. Lagouge M, Argmann C, Gerhart-Hines Z, Meziane H, Lerin C, Daussin F, Messadeq N,
Milne J, Lambert P, Elliott P, Geny B, Laakso M, Puigserver P, Auwerx J (2006) Resveratrol
improves mitochondrial function and protects against metabolic disease by activating SIRT1
and PGC-1 [alpha]. Cell 127:1109–1122
23. Milne JC, Lambert PD, Schenk S, Carney DP, Smith JJ, Gagne DJ, Jin L, Boss O, Perni RB,
Vu CB, Bemis JE, Xie R, Disch JS, Ng PY, Nunes JJ, Lynch AV, Yang H, Galonek H (2007)
Israelian, and Westphal, C.H. Nature 450:712–716
24. Pacholec M, Bleasdale JE, Chrunyk B, Cunningham D, Flynn D, Garofalo RS, Griffith D,
Griffor M, Loulakis P, Pabst B, Qiu X, Stockman B, Thanabal V, Varghese A, Ward J,
Withka J, Ahn K (2010) SRT1720, SRT2183, SRT1460, and resveratrol are not direct
activators of SIRT1.J. Biol Chem 285:8340–8351
25. OXFORD GLYCOSCIENCES (UK) LTD; SCOPES, David, lan, Carter; WO2003/
74516;(2003); (A1) English
Chapter 73
Synthesis of 1,3-benzodioxol-5-ethanol
and Its Derivatives
Na Ji, Yinghao Gao, Yuanmou Chen, Shaolong Jia, Fei Hu,

Abstract It has been reported that resveratrol can enhance Sirt1 expression and
has the activation effect on the proteins related to insulin signaling. It can also
ameliorate insulin tolerance in order to achieve the function of preventing and
curing diabetes. In this work, we designed a new series of analogs related to the
structure of resveratrol such as 1,3-benzodioxol-5-ethanol, which is synthesized
from 1,3-benzodioxole by the reactions of Friedel-Crafts reaction, Wolff-Kishner-
Huang and reduction. In addition, seven new 1,3-benzodioxol-5-ethanol deriva-
tives were obtained through esterification with different substituents of organic
acid. All compounds were characterized by 1H-NMR. Yields of derivatives are
from 13.2 to 78.8 %.
Keywords 1,3-benzodioxol-5-ethanol 1,3-benzodioxole derivatives Pharma-

ceutical intermediate Synthesis
73.1 Introduction
It is a global problem that metabolic syndrome is a threat to human health. The key
point to treat metabolic syndrome is improving insulin resistance because it is the
pathogenesis of type II diabetes, obesity, and primary hypertension [1]. It has been
reported that Sirt-1 plays an important role [2, 3] in increasing insulin secretion
[4]. Resveratrol is the agonist of Sirt-1 and some derivatives have enhanced effect
on it [5]. In this paper, we aim to introduce 1,3-benzodioxole and design a new
series of analogs related to the structure of resveratrol. In the field of medicine
N. Ji Y. Gao Y. Chen S. Jia F. Hu P. Yu E. Hua (&)

Key Laboratory of Industrial Microbiology of Ministry of Education, College of
716 N. Ji et al.
synthesis, compounds with the group of 1,3-benzodioxole is not only the important
intermediates of berberine [6], but also the significant material to synthesis
quinolone drugs. Meanwhile good activity were found in the field of antitumor
1,3-benzodioxole derivatives [7, 8]. Thus, a series of active compounds and high
value added pharmaceutical intermediates derived from 1,3-benzodioxole is bound
to be more widely applied in the field of drug discovery in the future.
Economic and security synthetic technology of 1,3-benzodioxol-5-ethanol
has not been reported. The traditional method is from 1,3-benzodioxole by the
reaction of chloromethylation, nitrile, hydrolysis, and reduction [9]. However, the
virulent sodium cyanide used in this synthetic method is harmful to both envi-
ronment and experimenters, it is not an environmental friendly and safe process.
Wang Yuanxing [10] and his colleagues developed a relative safe synthetic
method using methyl methylthiomethyl sulfo (FAMSO) as an equivalent reagent
of carbonyl group. They gained 1,3-benzodioxol-5-acetic acid from piperonal with
three-steps reactions but it took a high production cost. In order to meet the needs
of developing new drugs, we have designed an economic and safe synthetic route
by using inexpensive 1,3-benzodioxole as the starting material. According to the
structure-activity relationship, we got seven new 1,3-benzodioxol-5-ethanol
derivatives.

1
H NMR spectra were recorded on Bruker AM-400 NMR spectrometers using
deuterated chloroform as solvent and tetramethylsilane as an internal standard.
Reaction temperatures were controlled by oil bath temperature modulator. Thin
layer chromatography (TLC) was performed using E. Merck silica gel 60 GF254
precoated plates (0.25 mm). Visualization was made with ultraviolet light. Col-
umn chromatography was performed on silica gel (particle size 200–400 mesh).
All reagents and solvents used in the present were of reagent grade.
73.2.2 Experimental Methods
The route to prepare the 1,3-benzodioxol-5-ethanol and derivatives was presented

in Fig. 73.1.
73 Synthesis of 1,3-benzodioxol-5-ethanol and its Derivatives 717
O
O OH
O (i) O O (ii)
O
O O
O O
(iii) O OH (iv) O O R
O O
O
(1~7)
NH 4:R=
1: R=CH 3 2: R=CH 2CH3 3:R= N
CH3
H3CO OAc
OCH3 OAc
5:R= 6:R= 7:R=
OCH3 OCH3 OAc
Fig. 73.1 Reagents and conditions: (i) C4H5ClO3, AlCl3, CH2Cl2, rt; (ii) N2H4H2O, EG, KOH,
HCl, 180 C; (iii) LAH, THF, rt; (iv) EDCI, DMAP, TEA, CH2Cl2, rt
73.2.2.1 Ethyl 2-(benzo[1,3]dioxole-5-yl)-2-oxoacetate [11]
In a three-necked round-bottomed flask mounted with a cooler system, AlCl3

(11.7 g, 0.089 mol) was suspended in CH2Cl2 (100 ml) under 0 C. To this stirred
mixture ethyl chlorooxoacetate (11.76 g, 0.086 mol) was slowly added in about
15 min. After 10 min the suspension became a pale yellow solution. 1,3-benzo-
dioxole (10 g, 0.082 mol) was added dropwise at 0 C in about 10 min. Then the
reaction mixture was stirred at room temperature for 1 h. After the reaction was
completely finished, the threefold volume of H2O was slowly added. Extraction
was performed with ethyl acetate (3 9 30 mL). The organic phase was washed
with saturated NaCl solution, filtered, dried (Na2SO4), and concentrated in vacuo.
The crude residue was purified by silica gel column chromatography (petroleum
ether/ethyl acetate 40:1) to give 10.2 g as yellow oil.
73.2.2.2 1,3-benzodioxol-5-acetic acid [12]
A mixture of ethyl 2-(benzo[1, 3]dioxole-5-yl)-2-oxoacetate (10.2 g, 0.046 mol),

85 % hydrazine hydrate (13.55 g, 0.23 mol), and ethanediol (100 ml) was stirred
at 120 C for 2 h. To the mixture was added KOH (7.65 g, 0.138 mol), then heated
to 180 C and kept reflux for 4 h. Cooling it to room temperature, dilute HCl
solution (6 mol/L) was poured into the mixture to adjust the pH value to 2–3. After
a while the mixture separated out a large amount of white solid. Filtered and
collected the crude product (5.18 g, 62.8 %), it was used directly for the next step
without further purification.
718 N. Ji et al.
73.2.2.3 1,3-benzodioxol-5-ethanol [13–15]
In a round-bottomed flask, lithium aluminum hydride (2.93 g, 0.086 mol) was

added to 1,3-benzodioxol-5-acetic acid (5.18 g, 0.029 mol) stirred in anhydrous
THF (50 mL) in ice bath. The mixture was warmed up to room temperature for
overnight. Ice water (20 mL) was added slowly to the mixture to quench reaction
and flocks were resolved by dilute HCl (10 %). The mixture was washed with
ethyl acetate (3 9 20 mL) and we used saturated NaHCO3 solution to neutralize
residual HCl. Dried (Na2SO4), filtered, concentrated in vacuo, and then purified by
silica gel column chromatography (petroleum ether/ethyl acetate 20:1) to afford
1,3-benzodioxol-5-ethanol 2.2 g.
73.2.2.4 General Procedure 1 (GP1) for 1,3-benzodioxole Derivatives

(1 ~ 7) [16–19]
In a round-bottomed flask, 1,3-benzodioxol-5-ethanol(0.2 g, 1.2 mmol) was added

to a mixture of organic acid (1.46 mmol), EDCI (0.28 g, 1.46 mmol), DMAP
(0.03 g, 0.25 mmol), and triethylamine (0.15 g, 1.48 mmol) were stirred in
anhydrous dichloromethane (20 mL) at room temperature. The organic layer was
washed with water (3 9 20 mL) and then dried over anhydrous Na2SO4. The
solution was concentrated and the residue was purified by silica gel column
chromatography, eluting with petroleum ether-ethyl acetate mixture.
73.2.3 Syntheses
73.2.3.1 Ethyl 2-(benzo[1,3]dioxole-5-yl)-2-oxoacetate
Yellow oil, 56.7 % yield.

1
H-NMR(CDCl3)d:1.412–1.448 (3H,t,CH2CH3), 4.417–4.471 (2H,m,CH2CH3),
6.101 (2H,s,CH2), 6.896–6.917 (1H,d,ArH). 7.490–7.494 (1H,d, ArH),7.618–
7.643 (1H,dd, ArH).
73.2.3.2 1,3-benzodioxol-5-ethanol

1
H-NMR(CDCl3)d:1.552(1H,s,CH2CH2OH),2.793–2.825(2H,t, CH2CH2OH),
3.819–3.851(2H,t, CH2CH2OH),5.953(2H,s, CH2).6.686–6.710(1H,dd, ArH),
6.743–6.747 (1H,d, ArH), 6.771–6.791 (1H,d, ArH).
73.2.3.3 1,3-benzodioxole derivative 1

1
H-NMR(CDCl3) d:2.038 (3H,s,CH2CH2OCOCH3). 827–2.862 (2H,t, CH2CH2
OCOCH3), 4.206–4.241 (2H,t,CH2CH2OCOCH3), 5.928 (2H,s,CH2), 6.646–6.6.751
(3H,m,ArH).

1
H-NMR(CDCl3) d:1.105–1.143 (3H,t,COCH2CH3), 2.288–2.345 (2H,q,CO
CH2CH3), 2.830–2.865 (2H,t,CH2CH2OCO), 4.215–4.250 (2H,t,CH2CH2OCO),
5.931 (2H,s,CH2), 6.648–6.752 (3H,m,ArH).
White solid, 19.2 % yield.

1
H-NMR(CDCl3) d:2.978–3.013 (2H,t,CH2CH2OCO), 4.480–4.516 (2H,t,CH2
CH2OCO) 5.930 (2H,s,CH2), 6.717–6.762 (3H,m,ArH), 6.837–6.842 (1H,d,Pyra-
zoleH), 7.660–7.665 (1H,d,PyrazoleH), 11.643 (1H,s,NH).

1
H-NMR(CDCl3) d:2.557 (3H,s,ArCH3), 2.969–3.003 (2H,t,CH2CH2OCO),
4.443–4.478 (2H,t,CH2CH2OCO), 5.928 (2H,s,CH2), 6.708–6.771 (3H,m,ArH),
7.215–7.253 (2H,m,ArH), 7.362–7.403 (1H,t,ArH), 7.850–7.870 (1H,d,ArH).
White solid, 62.5 % yield.

1
H-NMR(CDCl3) d:2.807–2.841 (2H,t,CH2CH2OCO), 3.536 (2H,s,COCH2),
3.852 (3H,s,ArOCH3), 3.867 (3H,s,ArOCH3), 4.236–4.270 (2H,t,CH2CH2OCO)
5.921 (2H,s,CH2), 6.573–6.577 (1H,d,ArH), 6.593 (1H,s,ArH), 6.693–6.712
(1H,d,ArH), 6.771–6.823 (3H,m,ArH).

720 N. Ji et al.
1
H-NMR(CDCl3) d:2.979–2.997 (2H,t,CH2CH2OCO), 3.802 (6H,s,OCH3),
4.473–4.508 (2H,t,CH2CH2OCO), 5.918 (2H,s,CH2), 6.541–6.562 (2H,d,ArH),
6.723–6.809 (3H,m,ArH), 7.261–7.277 (1H,m, ArH).
Brown oil, 13.2 % yield.

1
H-NMR(CDCl3) d:2.305 (9H,s,ArCOOCH3), 2.946–2.983 (2H,t,CH2CH2O
CO), 4.437–4.472 (2H,t,CH2CH2OCO), 5.936 (2H,s,CH2), 6.687–6.745 (3H,m,ArH),
7.765 (2H,s,ArH).
73.3 Result and Discussion
The key of experiment is to find a method with good selective substituted at 5-

position and high yield. There are two methods reported. One is that 1,3-ben-
zodioxol-5-ethanol was acquired through bromination at 5-position of 1,3-ben-
zodioxol and then ethylene oxide treated with Grignard reagents which were
prepared from bromo-substituted intermediate. The other is 1,3-benzodioxol as
raw material to get 1,3-benzodioxol-5-acetic acid after three-step reaction or form
piperonal through two-steps by using FAMSO then through reduction by Lithium
aluminum hydride to get target compound. After trying these two methods, we
found that the condition of operation was strict and got 5,6-disubstituted. There-
fore, we used ethyl chlorooxoacetate to get the substitution product at 5-position
without 5,6-disubstituted because of the steric effect. However, the yield of this
step has yet to be improved. Because a large amount of reddish brown sticky
substance contained in the products brought difficulties to separation. This problem
still remains to be solved by further experiments.
In addition, the reduction from 1,3-benzodioxol-5-acetic acid to 1,3-ben-
zodioxol-5-ethanol was incomplete. Enhancing temperature and extending
reaction time could help finish this reaction. We tried to rise yield by esterifying
1,3-benzodioxol-5-acetic acid to relative acetate followed by reduction to
1,3-benzodioxol-5-ethanol, but this method increased difficulty during work-up.
Esterification on hydroxyl group of 1,3-benzodioxol-5-ethanol made this
1,3-benzodioxole derivatives structurally similar to resveratrol. Aromatic acids
with different substituent groups have different reaction activity because of
directing effects of various substituent groups on activation. In order to achieve the
goals of promoting reaction and improving yields, we elevated temperature and
prolonged reaction time. In addition, charging sequence affected an extent of
reaction. The suitable charging sequence was aromatic acids, EDCI, TEA, DMAP,
and 1,3-benzodioxol-5-ethanol.
73.4 Conclusion
In this article, a novel synthetic method was developed to synthesize

1,3-benzodioxol-5-ethanol and its derivatives. This process has several advantages
such as fewer steps, good selectivity, safe, and environmental friendly compared
with the mainly used synthetic routes. We also afforded seven 1,3-benzodioxole
derivatives as potential active compounds for treatment of diabetes and cancer.
This method would provide a much better way for synthesis of new 1,3-benzo-
dioxole derivatives.
Acknowledgments This work was supported by National Natural Science Foundation of China
(No: 81072521), Tianjin University of Science & Technology (No: 20100411), International
Science & Technology Cooperation Program of China (2013DFA31160) and the Science &
Technology Project of Tianjin (11ZCGHHZ00400).
References
1. Gordon BA, Benson AC, Bird SR et al (2009) Resistance training improves metabolic health
in type 2 diabetes: A systematic review. Diabetes Res Clin Pr 83:157–175
2. Carles C, Johan A (2009) Caloric restriction, SIRT1 and longevity. Trends Endocrin Met
20:325–331
3. Hye-Sook K, Melanie O (2008) The ups and downs of SIRT1. Trends Biochem Sci
33:517–525
4. Yang T, Fu M, Pestell R et al (2006) SIRT1 and endocrine signaling. Trends Endocrin Met
17:86–91
5. Kaeberlein M, Mc Donagh T, Heltweg B et al (2005) Substrate specific activation of sirtuins
by resveratrol. J Biol Chem 280:17038–17045
6. Yang ZY, Liu ZL, Liu HW et al (2011) Synthesis of 1,3-benzodioxole. Fine Specially Chem
19:23–26
7. deM Moreira DR, Leite ACL, Ferreira PMP (2007) Synthesis and anti-tumor evaluation of
peptidyl-like derivatives containing the 1,3-benzodioxole system. Eur JMed Chem
42:351–357
8. Since M, Terme T, Vanelle P (2009) Original TDAE strategy using a-halo carbonyl
derivatives. Tetrahedron 65:6128–6134
9. Zhou LJ, He QG, Liu ZC et al (2002) Synthesis of 1,3-benzodioxol-5-acetic acid. Chem Ind
Forest Prod 22:80–82
10. Wang YX, Fang ZJ, Han XL (2007) A convenient synthesis of 3,4-(methylenedioxy)
phenylacetic acid. Chem Reagent 29(751–752):755
11. Ianni A, Waldvogel SR (2006) Reliable and versatile synthesis of 2-aryl-substituted cinnamic
acid esters. Chem Inform 13:2103–2112
12. Yao GX, Chen G, Lu Y et al (2010) An alternative process for preparation of 3,4-
dimethoxyphenylacetic acid. Chin J Pharm 41:730–731
13. Elger B, Huth A, Neuhaus R et al (2005) Novel a-Amino-3-hydroxy-5-methyl-4-isoxazole
propionate (AMPA)receptor antagonists of 2,3-benzodiazepine type: chemical synthesis,
in vitro characterization, and in vivo prevention of acute neurodegeneration. J Med Chem
14:4618–4627
14. Shahane S, Louafi F, Moreau J et al (2008) Synthesis of alkaloids of Galipea officinalis by
alkylation of an a-aminonitrile. Eur J Org Chem 27:4622–4631
722 N. Ji et al.
15. Capuano B, Crosby IT, Podloucka A et al (2003) Synthesis and preliminary pharmacological
evaluation of 40 -arylalkyl analogues of clozapine.II.effect of the nature and length of the
linker. Aus J Chem 56:875–886
16. Lai CC, Brian GC (2007) Kinetics of amide formation through carbodiimide/N-
Hydroxybenzotriazole (HOBt) couplings. J Org Chem 72:8863–8869
17. Jiang WL, Jutta W, Richard JL et al (2002) Total synthesis of the ramoplanin A2 and
ramoplanose aglycon. J Am Chem Soc 124:5288–5290
18. Hwa-Ok K, Hiroshi N, Min SL et al (2000) Design and synthesis of novel conformationally
restricted peptide secondary structure mimetics. Org Lett 2:301–302
19. Bryan KSY, Dale LB (2003) Synthesis of isochrysohermidin-distamycin hybrids. J Org
Chem 68:5249–5253
Chapter 74
Tetrandrine Inhibits Proteasomal
Chymotrypsin-Like Activity and Induces
Apoptosis in Human PC-3 Cells
Li Zhang, Wanxin Shi, Weihua Cao, Xiangru Liang, Yufu Hu,

Mo Chen and Guoqing Shi
Abstract The ubiquitin-proteasome pathway has been accepted as a promising

target for cancer therapy, as it plays a vital role in cell cycle, function, and
survival. In this research, in silico study by molecular docking predicted that
Tetrandrine(TET), a compound from the roots of Stephenia tetrandra S Moore,
could bind to the active site of the proteasome b5 subunit. In vitro assay proved
that TET inhibits the chymotrypsin-like (CT) activity of purified human 20S
proteasome in a dose-dependent manner with IC50 of 0.8 lmol/L. After exposed to
TET for 24 h, the CT activity in human prostate cancer PC-3 cells was inhibited
with IC50 of 35 lmol/L, and the ubiquited proteins were accumulated in dose-
dependent manner. This inhibition was further proved by the accumulation of
GFP-CL proteins, which is an indicator of proteasome inhibition in pEGFP-CL1
transferred PC-3 cells. The proteasomal activity inhibition by TET leads to
apoptosis like morphological changes and activation of caspase-3 activity in dose-
dependent manner in PC-3 cells. Based on these results, we suppose that TET is a
proteasome inhibitor and induces cell apoptosis.
Keywords Apoptosis Tetrandrine (TET) Proteasomal activity PC-3 cells
74.1 Introduction
Tetrandrine (TET) is a purified vasoactive bisbenzylisoquinoline alkaloid derived

from the roots of Stephenia tetrandra S Moore, a medicinal plant widely dis-
tributed in China. The structure is shown in Fig. 74.1.
L. Zhang W. Shi W. Cao X. Liang Y. Hu M. Chen G. Shi (&)

School of Chemistry and Biological Engineering, University of Science and Technology,
Beijing 100083, People’s Republic of China
e-mail: shiguoqing@ustb.edu.cn
724 L. Zhang et al.
Fig. 74.1 The structure of

tetrandrine
TET has been used traditionally for the treatment of congestive circulatory
disorder [1] and inflammatory diseases [2]. Many studies have shown that TET has
anti-tumor activity [3]. TET induces apoptosis in various cell types such as A549,
HepG2 [4], HL60 [5], HCT116 [6], and U937 [7] cells, etc. There have been many
mechanisms reported about TET-induced apoptosis. Byeong-Churl Jang [8] shows
that tetrandrine-induced apoptosis is mediated by activation of caspases and
PKC-d in U937 cells; Tetrandrine-mediated responses of cell proliferation and
cytotoxicity may be correlated with the tetrandrine-induced large-conductance
Ca2+-activated K+ (BK) channel block [9]. Recent studies show that TET induces
apoptosis by activating reactive oxygen species and repressing Akt activity in
human hepatocellular carcinoma [10]. But the specific mechanisms remain
unclear.
Ubiquitin-proteasome system is responsible for a vast majority of protein
degradation in eukaryotic cells, which plays an important role in cell cycle and
apoptosis [11]. The 26S proteasome is composed of the 20S core catalytic complex
flanked on both sides by the 19S regulatory complexes; The 20S proteasome has
three catalytic active sites: chymotrypsin-like(CT), trypsin-like(TL), and post-
glutamyl peptide hydrolase-like (PGPH), which are located in b5, b2, and b1
subunits, respectively [12]. Inhibition of the proteasomal CT activity can lead to
apoptosis in most tumor cell lines [13].
74 Tetrandrine Inhibites Proteasomal Chymotrypsin-Like Activity 725
74.2.1 Materials
1. Cells
Human prostate cells PC-3 were obtained from the Cell Culture Center,
Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences.
2. Materials
Cell culture medium Ham’s F12 and serum were obtained from Hyclone Inc.
Tetrandrine was purchased from sigma; A 50 mmol/L stock solution of TET
dissolved in 1 mol/L HCl and regulated PH with saturated NaHCO3 to 7.0 was
stored at -20 C. Purified human 20S proteasome was from BIOMOL
International LP. Antibody against ubiquitin (P4D1), actin (C-11), and horse-
radish peroxidase (HRP)-conjugated secondary anti-rabbit and anti-mouse IgG
were from Santa Cruz Biotechnology Inc. Fluorogenic peptide substrate
Suc-LLVY-AMC (for the proteasomal chymotrypsin-like activity) was from
Enzo Life Sciences Inc.
74.2.2 Methods
1. Proteasomal activity assay

The proteasome activity assay was performed as described [14]. PC-3 cells
were treated with different concentrations of TET for 24 h, after which, the
cells were harvested and lysed. Incubate the lysate with 40 lmol/L of fluoro-
genic peptide substrates for 2 h at 37 C in 100 lL assay buffer (25 mmol/L
Tris–HCl, pH 7.4). After incubation, cleaved fluorescent products were mea-
sured using fluorescence plate reader with an excitation filter of 380 nm and an
emission filter of 460 nm.
2. Western blotting analysis
The Western blotting analysis was performed as described previously [15]. Cell
lysates (40 lg) were separated by SDS-PAGE and transferred onto PVDF
membrane. The membrane was blocked by 5 % nonfat milk, and the membrane
was then probed with antibodies overnight at 4 C. After the unbinding anti-
bodies were washed, the membrane was incubated with horseradish peroxidase
(HRP)-conjugated secondary anti-rabbit or anti-mouse IgG for additional 4 h,
followed by the detection of the antibody-bound proteins using the ECL
detection kit.
3. PC-3-GFP-CL1 cells construction and exposure
The PC-3-GFP-CL1 cell line was constructed as described previously [16].
GFP-CL1 is consist of a short peptide degron fused to the carboxyl-terminus of
green fluorescent protein (GFP-CL1) [17, 18], which is known to be degraded
by proteasome, only when the proteasome was inhibited or the UPS crushed,
726 L. Zhang et al.
will the GFP level accumulate and can be detected by fluorescence microscope.
PC-3-GFP-CL1 cells were exposed to 50 lmol/L TET for designed time and
then pictured by fluorescence microscopy.
74.3.1 Molecular Docking
First of all, Autodock 4.0 software was used to predict the possible interaction
between TET and 20S proteasome [19]. The results showed that the lowest
‘‘estimated free energy of binding’’ between b5 subunit and TET was -6.28 kcal/
mol. The predicted binding conformations were shown in Figs. 74.2a, b.
From Fig. 74.2a, it was shown that TET has a close binding with the active site
of proteasome b5 subunit, and TET was inlaid with 20S proteasomal cavity with a
close distance to the Thr1 residue at b5 subunit [20] (marked by red), which is
responsible for the proteasomal CT activity; Fig. 74.2b showed that the major
binding power between TET and b5 subunit was hydrophobic interactions. Based
on these, we suppose that TET may be a kind of proteasomal inhibitor.
74.3.2 TET Inhibits Proteasomal CT Activity Both in Vitro

and in Vivo
TET inhibits purified 20S CT-like activity. In order to confirm the results pre-
dicted by in silico study, the CT activity change of purified 20S proteasome was
Fig. 74.2 Moleculor docking of TET to b5 subunit

Fig. 74.3 TET inhibits

purified 20S CT-like activity
investigated in different concentrations of TET. The results were shown in

Fig. 74.3. TET inhibited 20S proteasomal CT activity in a dose-dependent manner
with IC50 of 0.8 lmol/L.
TET inhibits proteasomal CT-like activity in PC-3 cells. In order to investigate
whether TET inhibits tumor cellular proteasome activity, PC-3 cells were treated
with different concentrations of TET, followed by measuring proteasome inhibi-
tory effect by the cellular proteasomal chymotrypsin-like activity assay and
accumulation of ubiquitinated proteins. As it was shown in Fig. 74.4, TET sig-
nificantly inhibited the proteasomal chymotrypsin-like activity in PC-3 cells in a
concentration-dependent manner (Fig. 74.4); at 50 lmol/L it reached of 70 %
inhibition. Coincidentally, levels of ubiquitinated proteins were accumulated in
PC-3 cells treated with TET in a concentration-dependent manner (Fig. 74.5).
Fig. 74.4 TET inhibits

proteasomal CT-like activity
in PC-3 cells
Fig. 74.5 TET induces

ubiquitinated proteins
accumulated
728 L. Zhang et al.
Fig. 74.6 TET induces GFP level accumulated in PC-3-GFP-CL1 cells
Furthermore, the PC-3-GFP-CL1 cells were exposed to 50 lmol/L TET for 0, 1, 2

,4, 8, 12 h and pictured by fluorescence microscopy as shown in Fig. 74.6, which
showed the GFP levels were accumulated with the time increased, and after 8 h the
GFP level was decreased because of apoptosis, which further indicated that the
proteasome was inhibited by TET. These results indicate that TET is an inhibitor
of 20S proteasome.
74.3.3 Inhibition of Cellular Proteasomal Activity by TET is

Associated with Apoptosis in PC-3 Prostate Cancer
Cells
Many studies have shown that inhibition of cellular proteasome activity induces
apoptosis [21, 22]. The Caspase-3 activity and cellular apoptotic morphologic
changes (condensation and fragmentation) were detected to evaluate the apoptosis
Fig. 74.7 TET activates

caspase-3 activity in PC-3
cells
Fig. 74.8 PC-3 cells apoptosis after treated TET(DMSO, 10, 20, 30, 50 lmol/L) for 2 h
Fig. 74.9 TET activates

caspase-3 activity
of cells. TET at 50 lmol/L induced caspase-3 activity by 11.3-fold after 2 h of

exposure (Fig. 74.7). Morphologically, the TET-treated cells turned to round and
had serious shrinks, moreover, the floating cells increased with the concentration
increased (Fig. 74.8). The results show that with the concentration of TET
increased cells’ apoptosis aggravate.
PC-3 cells were treated with TET for 0, 1, 2, 4, 8, 12, 24 h, respectively, and
then caspase-3 activity was detected. The results are shown in Fig. 74.9. It shows
that as early as 2 h the caspase-3 reached the peak by 15-fold. These results show
that the inhibition of TET to proteasome CT activity is associated with cell
apoptosis.
74.4 Conclusion
Molecular docking shows that proteasome subunit b5 has a low combined energy
with the natural small molecules tetrandrine. There is a closed conformation
between them; TET can significantly inhibit purified 20S proteasome CT activity
in an dose-dependent manner. Using prostate cancer cells PC-3 as cell model to
examine the inhibition of TET to 20S proteasome shows that: TET inhibits 20S
proteasome in PC-3 cells in a dose-dependent manner, 50 lmol/L TET has a
significant inhibition of 70 % in 24 h, and the ubiquitinated proteins obviously
accumulated, and TET induces the GFP level accumulated in PC-3-GFP-CL1
cells. These results suggest that TET is a potential proteasome inhibitor.
730 L. Zhang et al.
50 lmol/L TET induces caspase-3 activated by 15-fold in 2 h, and lead to

obvious apoptotic morphologic changes, which indicates the inhibition of TET to
proteasome CT activity is associated with cell apoptosis.
Acknowledgments This work was supported by the National Natural Science Foundation
(20977007), and Program for New Century Excellent Talents in University (NCET-11-0581).
References
1. Kwan CY, Achike FI (2002) Tetrandrine and related bis-benzylisoquinoline alkaloids from
medicinal herbs: cardiovascular effects and mechanisms of action. Acta Pharmacol Sin
23(12):1057–1068
2. Choi HS, Kim HS, Min KR et al (2000) Anti-inflammatory effects of fangchinoline and
tetrandrine. J Ethnopharmacol 69(2):173–179
3. Chen YJ (2002) Potential role of tetrandrine in cancer therapy. Acta Pharmacol Sin
23(12):1102–1106
4. Cheng Z, Wang K, Wei J et al (2010) Proteomic analysis of anti-tumor effects by tetrandrine
treatment in HepG2 cells. Phytomedicine 17(13):1000–1005
5. Dong Y, Yang MM, Kwan CY (1997) In vitro inhibition of proliferation of HL-60 cells by
tetrandrine and coriolus versicolor peptide derived from Chinese medicinal herbs. Life Sci
60(8):L135–L140
6. He BC, Gao JL, Zhang BQ et al (2011) Tetrandrine inhibits Wnt/beta-catenin signaling and
suppresses tumor growth of human colorectal cancer. Mol Pharmacol 79(2):211–219
7. Lai YL, Chen YJ, Wu TY et al (1998) Induction of apoptosis in human leukemic U937 cells
by tetrandrine. Anticancer Drugs 9(1):77–81
8. Jang BC, Lim KJ, Paik JH et al (2004) Tetrandrine-induced apoptosis is mediated by
activation of caspases and PKC-delta in U937 cells. Biochem Pharmacol 67(10):1819–1829
9. Wang G, Lemos JR, Iadecola C (2004) Herbal alkaloid tetrandrine: fron an ion channel
blocker to inhibitor of tumor proliferation. Trends Pharmacol Sci 25(3):120–123
10. Liu C, Gong K, Mao X et al (2011) Tetrandrine induces apoptosis by activating reactive
oxygen species and repressing akt activity in human hepatocellular carcinoma. Int J Cancer
129(6):1519–1531
11. Ciechanover A (1998) The ubiquitin-proteasome pathway: on protein death and cell life.
EMBO J 17(24):7151–7160
12. Coux O, Tanaka K, Goldberg AL (1996) Structure and functions of the 20S and 26S
proteasomes. Annu Rev Biochem 65:801–847
13. Almond JB, Cohen GM (2002) The proteasome: a novel target for cancer chemotherapy.
Leukemia 16(4):433–443
14. Sun F, Anantharam V, Latchoumycandane C et al (2005) Dieldrin induces ubiquitin-
proteasome dysfunction in alpha-synuclein overexpressing dopaminergic neuronal cells and
enhances susceptibility to apoptotic cell death. J Pharmacol Exp Ther 315(1):69–79
15. Shi G, Chen D, Zhai G et al (2009) The proteasome is a molecular target of environmental
toxic organotins. Environ Health Persp. 117(3):379
16. Sui XY, Liang XR, Hu YF et al (2012) The construction of a cellular model to monitor
intracellular proteasome activity. Adv Mater Res 518:5586–5589
17. Gilon T, Chomsky O, Kulka RG (1998) Degradation signals for ubiquitin system proteolysis
in saccharomyces cerevisiae. EMBO J 17(10):2759–2766
18. Link CD, Fonte V, Hiester B et al (2006) Conversion of green fluorescent protein into a toxic,
aggregation-prone protein by C-terminal addition of a short peptide. J Biol Chem
281(3):1808–1816
19. Shi GQ, Sun Q, Yang HJ et al (2010) Molecular modeling for the interaction between
proteasome beta 5 subunit and organotin compounds. Sci China Chem 53(11):2387–2393
20. Heinemeyer W, Fischer M, Krimmer T et al (1997) The active sites of the eukaryotic 20 S
proteasome and their involvement in subunit precursor processing. J Biol Chem
272(40):25200–25209
21. An WG, Hwang SG, Trepel JB et al (2000) Protease inhibitor-induced apoptosis:
accumulation of wt p53, p21WAF1/CIP1, and induction of apoptosis are independent
markers of proteasome inhibition. Leukemia 14(7):1276–1283
22. Shinohara K, Tomioka M, Nakano H et al (1996) Apoptosis induction resulting from
proteasome inhibition. Biochem J. 317(Pt 2):385–388
Chapter 75
The Purifying Effect of Apocynum
Venetum Seedlings on Estuarine Water
Yangcang Xu, Tao Yu, Yunshan Zhong and Xiaoyan Wang
Abstract The water in Bohai Bay has become more and more eutrophic, causing
a frequent red tide bloom. How to decrease eutrophication of this sea area is a
pressing problem. The seawater often enters the estuary by flood tide, so the
estuary may be a good place to remove eutrophic compounds from the seawater.
This paper reported apocynum venetum seedlings growth status in water from
Beitang estuary and its effects on nutrient removal. The results showed that
apocynum venetum seedlings could grow both in flood tide water and in ebb tide
water from Beitang estuarine, and the content of nitrogen and phosphorus in the
water was significantly decreased by apocynum venetum seedlings, and the
decrease level was largest for nitrite nitrogen in flood tide water. These results
indicated that the eutrophic water in Bohai Bay was probably purified by apocy-
num venetum growing in ecological floating boat at estuarine.
Keywords Apocynum venetum Beitang estuary Eutrophication Removal

Water quality
75.1 Introduction
The Bohai Bay is a semi-enclosed bay, located in the western region of Bohai Sea
in northern China. Due to the poor self-purification and increasing pollution
emission from land, pollution of the water body of Bohai Bay has become a
Y. Xu (&) T. Yu Y. Zhong X. Wang

College of Marine Science and Engineering, Tianjin University of Science and Technology,
e-mail: xuyc@tust.edu.cn
Y. Xu
Tianjin Key Laboratory of Marine Resources and Chemistry, Tianjin 300457, People’s
Republic of China
734 Y. Xu et al.
serious problem [1]. Eutrophication in seawater would often cause a red tide
bloom [2]. There were several ways of purifying eutrophic water. Due to some
special advantages, more attention has been paid to the ecological floating bed,
gradually applied in the treatment of eutrophic water [3]. However, most studies
have been focused on purifying eutrophic fresh water [4]. Is it possible to purify
eutrophic seawater by ecological floating bed technology? The higher salinity in
seawater, which inhibits the growth of many higher plants, restricts the technology
application in this field. Estuaries are transition zones between freshwaters and
seawater where large amounts of eutrophication compounds are discharged [5].
Therefore, the ecological floating bed technology may be applied in this zone. In
this paper, we studied whether the apocynum venetum seedlings could grow in the
medium of Beitang estuarine water and whether it could effectively remove the
eutrophic compounds in this water.
75.2.1 Estuarine Water Collection and Treatment
The water samples were collected respectively during flood tide and ebb tide in
June at Beitang estuarine of Tianjin, China. Then the water samples were filtered
by cotton wool.
75.2.2 Plant Material and Growth Condition
The seeds of apocynum venetum were collected in the Binhai New Area, Tianjin,
China. After sterilization by sodium hypochlorite, the seeds were germinated and
cultured in a Hoagland solution. Seeds were allowed to germinate and develop in a
controlled growth room. The growth chamber was set at relative humidity
50–80 %, day/night temperatures of 20/16 C, 16 h photoperiod (350 mol quanta/
m2.s.P.A.R.) supplied by fluorescent lamps with tungsten supplement. After 15 d
of growth, the seedlings were divided into three groups. One group was still
cultured in the Hogland solution, and another two groups were transplanted into
the flood tide estuarine water, or the ebb tide estuarine water.
75.2.3 Water Quality Determination
The pH, salinity, conductivity, and dissolved oxygen in estuarine water were
determined by water quality detector CX-401 (made by China).
75 The Purifying Effect of Apocynum Venetum Seedlings 735
75.2.4 Growth Rate Determination
The growth rate of the apocynum venetum seedlings was calculated by the variations
of leaf length and the seedlings’ dry weight.
75.2.5 The Phosphate Content was Analyzed by Ascorbic

Acid-Molybdenum Blue Spectrophotometric
Method [6]
75.2.6 Nitrate Nitrogen Content was Determined by Zinc

and Cadmium Reduction Method [7]
75.2.7 Ammonium Nitrogen Content was Determined

by a Salicylate Spectrophotometric Method [8]
Data was analyzed by analysis of variance and Student’s t test. The data shown
were mean and standard deviation (S.D.) of five repetitive tests. The statistical
significance for all tests was set at the P B 0.05 confidence level.
75.3.1 The Water Quality of Beitang Estuary
Beitang estuary is created where the Bohai Bay, the Yongdinghe River, the
Newchaobaihe River, and the Jiyunhe River join together. There, the flood tide and
ebb tide occurred daily. Table 75.1 showed that dissolved oxygen content was
lower in flood tide water than that in ebb tide water, but the salinity and the
736 Y. Xu et al.
Table 75.1 The water quality in Beitang estuary (n = 5)

Sample DO(mg/L) SA(%) CD(ms/cm) pH
FT 3.85 ± 0.11 3.18 ± 0.13 49.6 ± 2.2 8.23 ± 0.11
ET 4.80 ± 0.21 2.80 ± 0.10 43.5 ± 1.6 8.10 ± 0.13
Note: DO: dissolved oxygen. SA: salinity. CD: conductivity. FT: flood tide, ET: ebb tide
Table 75.2 The nutrients in Beitang estuary (n = 5)

Sample NN(mg/L) AN(mg/L) TP(mg/L)
FT 1.11 ± 0.09 0.47 ± 0.07 0.38 ± 0.09
ET 0.23 ± 0.11 0.41 ± 0.12 0.45 ± 0.11
Note: AN: ammonium nitrogen. NN: nitrate nitrogen. TP: total phosphate. FT: flood tide, ET: ebb
tide
conductivity were higher in the former than that in the later. These results were
consistent with those reported by Zhong [9]. There was no significant difference in
the pH between the flood tide water and the ebb tide water.
Nitrogen and phosphorus were the main eutrophic component of water body
[10]. Table 75.2 showed that nitrate nitrogen content was distinctly higher in the
flood tide water than that in the ebb tide water, but there was no significant
difference in ammonium nitrogen and phosphate content between flood tide water
and ebb tide water. The flood tide water had more seawater than the ebb tide water
[11]. The higher nitrate nitrogen in flood tide water indicated the nitrate nitrogen in
the seawater of the Bohai Bay was higher than that in nearby rivers. The Bohai
Bay is a semi-enclosed bay in which the water body exchange capacity with ocean
water was poor [1]. However, About 1 billion tons of wastewater was discharged
into the bay from Beijing, Tianjin, and Hebei Province every year [12]. Therefore,
the eutrophic compounds such as nitrate from these rives easily accumulated in the
bay. This may be the main reason why the nitrate content in the seawater of the
Bohai Bay was higher than that in nearby rivers.
75.3.2 The Growth Status of Apocynum Venetum Seedlings

in Beitang Estuarine Water
Apocynum venetum was Apocynaceae perennial herb. It was widely distributed in

the temperate zones of Eurasia and North America, especially in saline–alkali
land, river banks, fluvial plains and sandy soils [13]. Considering its hostile
environment, apocynum venetum is highly tolerant to salt and drought stress, and
can resists strong winds and sands [14]. It could grow in the soil of pH 7.07–9.21
[15] and salt content 8.32 % [16]. The pH of the Beitang estuary water body varied
Fig. 75.1 The variation of

the leaf length of apocynum
venetum seedlings cultured in
different medium
from 8.10 to 8.23 and the salinity varied from 2.80 % to 3.18 % (Table 75.1). It is
therefore possible for apocynum venetum to grow in the Beitang estuary water
body.
In order to prove the above view, a culture experiment was conducted. Fifteen
day old apocynum venetum seedlings were divided into three groups, one group
was still cultured in a Hogland solution, and another two groups were transplanted
into flood tide estuarine water, or ebb tide estuarine water. From the 4th day, the
length of leaves in the Hogland solution became longer than that in the other
mediums (Fig. 75.1). And the leaf length had no significant change at first 3 days
or first 6 days for the apocynum venetum seedlings that grew in the ebb tide water,
or in the flood tide water respectively compared to that at day zero. The higher
salinity in the flood tide estuarine water probably made the apocynum venetum
seedlings have longer lag phase. On the tenth day, the leaf length cultured in the
Hogland solution, the flood tide estuarine water, and the ebb tide estuarine water
increased by 126.8, 85.4, and 63.0 %, respectively compared to that at day zero
(Fig. 75.1). The dry weight of the apocynum venetum seedlings grown in different
medium was also measured at day zero and the tenth day of transplanting. It was
clear that the dry weight of the seedlings grown in the flood tide water was heavier
than that in the ebb tide water (Fig. 75.2). After adapting to the new growth
environment, the apocynum venetum seedlings grew quicker in the flood tide
water than in the ebb tide water. This is probably ascribed to more inorganic
nitrogen in the flood tide water than that in the ebb tide water (Table 75.1). The
above results indicated that the apocynum venetum seedlings could grow both in
flood tide estuarine water and in ebb tide estuarine water.
738 Y. Xu et al.
Fig. 75.2 The change of the

dry weight of apocynum
venetum seedlings cultured in
different medium
75.3.3 The Effect of Apocynum Venetum Seedlings

Removing Inorganic Nitrogen Compounds
and Phosphate in Beitang Estuarine Water
Fifteen day old apocynum venetum seedlings were transplanted into the Beitang
estuarine water, and 10 days later, the nitrate nitrogen, ammonium nitrogen, and
phosphate in medium were determined. The content of phosphate and ammonium
nitrogen in the ebb tide estuarine water was decreased by 51.1 and 41.5 %
respectively, but the nitrate nitrogen content had no significant change. The con-
tent of phosphate, ammonium nitrogen, and nitrate nitrogen in flood tide estuarine
water was decreased by 50.0, 75.7, and 48.9 %, respectively by the apocynum
venetum seedlings (Fig. 75.3). It indicated that the apocynum venetum seedlings
effectively removed nitrogen and phosphate in the Beitang estuarine water body.
Eutrophication is one of the biggest environmental problems in enclosed water
areas. The seawater in the Bohai Bay has become increasingly eutrophic during the
past several years as a result of runoff from land-base agriculture, industrial, and
other anthropogenic activities [17–20]. There are currently not many treatment
methods for purifying eutrophic waters. Existing in situ methods such as precip-
itation of phosphorus have not been successful. Wetland treatments have been
used for the removal of nutrients from eutrophic water, but their efficiency has not
been proven for (phosphorous) P removal [21]. It has been shown that ecological
floating bed effectively remove eutrophic matter in fresh water bodies [3]. Here,
we found that salt-tolerant apocynum venetum seedlings also effectively removed
eutrophic matter in estuarine water bodies in laboratory conditions. Hence, as long
as the ecological floating bed is favorable to the eatuarine environment, the
apocynum venetum seedlings can grow in this bed and purify the eutrophic
Fig. 75.3 The variation of

nutrient content in Beitang
estuarine water after planting
apocynum venetum
seedlings. Note: TP, total
phosphate. NN, nitrate
nitrogen. AN, ammonium
nitrogen. L, ebb tide estuarine
water. H, flood tide estuarine
water. L-TP means total
phosphate in ebb tide
estuarine water. The others
were same
estuarine water. The estuarine water elevation often changed because of flood tide
and ebb tide. Maybe an ecological floating boat would be favorable equipment for
purifying eutrophic estuarine water.
75.4 Conclusion
The Bohai Bay is one of the most polluted sea areas in China. The main pollutants
were inorganic nitrogen and phosphate [10]. How to control Bohai Bay pollution is
a pressing problem. Apocynum venetum is perennial which is widely distributed in
saline-alkali wasteland and has strong salt resistance. In this paper, we reported
that apocynum venetum seedlings could grow in Beitang estuarine water with the
salinity from 2.80 to 3.18 % and the pH from 8.10 to 8.23. What is more, it could
effectively remove nitrogen and phosphate in Beitang estuarine water. Therefore,
it is possible that nitrogen and phosphate compounds in eutrophic water of the Bohai
Bay are removed by apocynum venetum growing in ecological floating boat.
Acknowledgments This work was supported by the Foundation (No. 201102) of Tianjin Key
Laboratory of Marine Resources and Chemistry (Tianjin University of Science and Technology),
P. R. China and the Scientific Research Foundation for the Returned Overseas Chinese Scholars,
State Education Ministry (the forty fourth times).We are grateful to Carlos Arboleda for revising
the manuscript in writing.
References
1. Zhao X, Li D (2009) Pollution prediction of Bohai Sea basing on the BP neural network:
taking example of Laizhou Bay. Ecol Econ 213:139–141 (in Chinese)
740 Y. Xu et al.
2. Lin FA, Lu XW, Luo H et al (2008) History, status and characteristics of red tide in Bohai
Sea. Mar Environ Sci 27:S1–S5 (in Chinese)
3. Li M, Sun YK, Zhang JK (2010) The application research of ecological floating bed
technology. Ind Saf Environ Prot 36:35–36 (in Chinese)
4. Zhan JX, Zhi CY, Xia PH (2011) Mechanism and research progresses of purification of
wastewater with aquatic plants. Southwest China J Agric Sci 24:352–355 (in Chinese)
5. Waeles M, Tanguy V, Lespes G et al (2008) Behavior of colloidal trace metals (Cu, Pb and
Cd) in estuarine waters: An approach using frontal ultrafiltration (UF) and stripping
chronopotentiometric methods (SCP). Estuar Coast Shelf Sci 80:538–544
6. GB/T 12763.4–2007/9 (2011) The specification for oceanographic survey–Part 4:
Observations of chemical parameters in sea water. Beijing: Chinese Standard Press (in
Chinese)
7. Duan SW, Zhang S, Chen X (2000) Concentrations of nitrogen and phosphorus and nutrient
transport to estuary of the Yangtze River. Chin J Environ Sci 21:53–56 (in Chinese)
8. Liu LB (2011) Comparison of determination method for ammonia-nitrogen content in water.
Guangzhou chem 39:110–111 (in Chinese)
9. Zhong YC, Li YH, Zhang LG (1984) Preliminary ecological survey of zoology of the
zooplanktons in the beitang estuary. Acta Ecol Sinica 4:393–400 (in Chinese)
10. Zhang ZF, He X, Zhang Z et al (2012) Eutrophication status, mechanism and its coupling
effect with algae blooming in Bohai. Mar Environ Sci 31:465–483 (in Chinese)
11. Shen LJ, Chen DX, Huang HM (2009) Impact of reclamation project on the water exchange
capacity of the estuaries in Wenzhou. J Mar Sci 27:72–76 (in Chinese)
12. Duan L, Song J, Li X et al (2010) Distribution of selenium and its relationship to the eco-
environment in Bohai Bay seawater. Mar Chem 121:87–99 (in Chinese)
13. Editorial Committee of the Flora of China of Chinese Academy of Science (1977) Flora of
China. Science Press, Beijing (in Chinese)
14. Xie WY, Zhang XY, Wang T et al (2012) Botany, traditional uses, phytochemistry and
pharmacology of Apocynum venetum L. (Luobuma): A review. J Ethno Pharmacol 141:1–8
15. Gao XH, Liu H, Liu SX et al (2002) Chemometrics analysis on the saline-alkali components
of some main wild-hemp growing soils in Xingjia. J Yunnan Univ 24:218–222 (in Chinese)
16. Xi JB, Zhang FS, Mao DR et al (2003) The utilization of halophytes for traditional medicine
in Xin jiang. Rev China Agric Sci Technol 5:43–48 (in Chinese)
17. Liu SG, Lou S, Kuang CP et al (2011) Water quality assessment by pollution-index method
in the coastal waters of Hebei Province in western Bohai Sea, China. Mar Pollut Bull
62:2220–2229
18. Liu SM, Li LW, Zhang ZN (2011) Inventory of nutrients in the Bohai. Cont Shelf Res
31:1790–1797
19. Peng S, Dai M, Hu Y et al (2009) Long-term(1996–2006) variation of nitrogen and
phosphorus and their spatial distributions in Tianjin Coastal Seawater. Bull Environ Contam
Toxicol 83:416–421
20. Zhang J (1996) Nutrient elements in large Chinese estuaries. Cont Shelf Res 16:1023–1045
21. Inoue T, Fukue M, Mulligan CN et al (2009) In situ removal of contaminated suspended
solids from a pond by filtration. Ecol Eng 35:1249–1254
Chapter 76
Expression, Purification, and Activity
Assay of Chicken Interferon-Alpha
Yue Ma, Minhui Long and Aipo Diao
Abstract In this paper, Chicken alpha interferon (IFN-a) gene was cloned into
pHis-NusA expression vector, then the recombinant expression vector was trans-
formed into host bacteria E. coli BL21. The recombinant chicken IFN-a was
induced to express by IPTG, then the protein expression was analyzed with SDS-
PAGE. Under the condition that the recombinant protein was induced to express
with 0.1 mM IPTG at 16 C, the expressed protein was soluble. Recombinant
Chicken IFN-a was purified by Ni-metal chelate affinity chromatography. The
expressed protein was shown to inhibit the replication of Hand foot and mouth
disease virus in vero cells.
Keywords Chicken interferon-alpha Prokaryotic expression Protein purifica-

tion Antiviral activity
76.1 Introduction
Interferon (IFN) belongs to a class of natural proteins that can inhibit virus rep-
lication [1, 2]. IFNs constitute a large group of cytokines that are best known for
their ability to induce cellular resistance to viral pathogens. They also play a
critical role in the response to microbial infections by modulating the innate and
adaptive immune system. Furthermore, they are potent regulators of cell growth
and have anti-inflammatory effects. IFNs are commonly grouped into tow types,
type I and type II. Type I IFNs form a still growing family of cytokines that
comprises IFN-a,IFN-b [3–5]. Type II IFN isIFN-c [6]. IFNs had already been
characterized, and possess broad-spectrum antiviral activity [7–11].
Y. Ma M. Long A. Diao (&)

e-mail: diaoaipo@tust.edu.cn
742 Y. Ma et al.
In this study, chicken alpha interferon (IFN-a) gene was cloned into pHis-NusA
expression vector, then the recombinant expression vector was transformed into
host bacteria E. coli BL21 [12]. The expressed protein was shown to inhibit
replication of hand, foot, and mouth disease virus in vero cells.
76.2.1 Materials
76.2.1.1 Strains and Vector
E. coli TOP10 and BL21 (RILP) kept in our laboratory were used for cloning or
expression host. The pHis-NusA vector was a gift from Dr. Eddie McKenzie (The
University of Manchester, UK).
76.2.1.2 Virus, Cells and Enzymes
Hand, foot, and mouth disease virus and vero cell line were provided by the
Academy of Military Medical Sciences of the Chinese PLA. PCR kit, restriction
enzymes EcoR I and BamH I, T4 DNA ligase were purchased from Fermentas,
Ni-charged resin was from GenScript.
76.2.2 Measurements
76.2.2.1 Construction of Recombinant Expression Vector

pHis-NusA-chIFN-a
Chicken alpha interferon (IFN-a) gene (504 bp in length) was amplified by PCR
and digested with restriction enzymes EcoR I and BamH I, ligated into the
expression plasmid pHis-NusA and then transformed into E. coli TOP10-competent
cells. Finally, the nucleotide sequences of the selected clones were confirmed by
DNA sequencing. The positive clones with the correct sequence were named as
pHis-NusA-chIFN-a.
76.2.2.2 Expression and Purification of chIFN-a
The recombinant plasmid pHis-NusA-chIFN-a was transformed into E. coli

strain BL21(RILP) and plated on LB-agar supplemented with ampicillin and
76 Expression, Purification and Activity Assay of Chicken Interferon-Alpha 743
chloramphenicol. The transformant was grown for 4 h at 37 C in LB medium

supplemented with ampicillin and chloramphenicol. When the OD600 nm reached
0.6, 0.1 mM IPTG was added to induce expression of target protein with the
incubation at 16 C overnight. The cells were harvested by centrifugation at
4,000 rpm for 10 min at 4 C, re-suspended in Na2PO3 lysis buffer (pH 8.0) and
subjected to sonication with pulse 2 s and interval 9 s for 10 min. Then the lysate
was centrifuged at 10,000 rpm for 10 min at 4 C, the supernatant was collected
and stored at 20 C. A 12 % SDS-PAGE was engaged to detect the expression of
target protein. The expressed protein was visualized by staining with Coomassie
brilliant blue (CBB). The Ni-metal chelate affinity chromatography was used to
purify recombinant protein His-NusA-chIFN-a [13, 14].
76.2.2.3 Bioactivity of Recombinant chIFN-a Against Hand, Foot,

and Mouth Disease Virus
The antiviral activity of purified recombinant chIFN-a was assayed by its activity
to inhibit the cytopathic effect caused by hand, foot, and mouth disease virus
(HFMDV) in vero cells [15–17]. Vero cells were grown in DMEM high glucose
supplemented with 10 % serum and seeded into 96-well plates (2 * 105 cells/well)
until the cells formed a compact monolayer after incubation for 12 h at 37 C with
5 % CO2 atmosphere environment. A ten-step serial dilution of recombinant
chIFN-a was added into the cultures, and the dilutions were from 101 to 107.
After 12 h incubation, the culture media were removed from the vero cells
monolayer in 96-well plate and then vero cells were challenged with HFMDV of
100 TCID50. Wells where the serial dilution (101–107) of recombinant chIFN-a
was added but without adding HFMDV were used as negative control, and wells
where 100 TCID50 HFMDV was added but without adding the recombinant
chIFN-a were used as positive control. All cells in the 96-well plate were incu-
bated under the above culture conditions of monolayer cells for 24 h. When
pathological changes were formed by HFMDV in more than 50 % vero cells at
positive control, the antivirus activity of the recombinant chIFN-a was determined
in accordance with the proportion of the percentage cells with pathological
changes to all the cells in the same well.
76.3.1 Cloning and Sequencing of pHis-NusA-chIFN-a
Chicken alpha interferon (IFN-a) gene was amplified by PCR, the complete IFN-a
sequence consisted of 504 bp, the IFN-a gene fragment was digested with
restriction enzymes EcoR I and BamH I, and inserted into the expression plasmid
744 Y. Ma et al.
Fig. 76.1 The pHis-NusA-

chIFN-a was digested with
restriction enzymes EcoR I
and BamH I
pHis-NusA, which was digested with the same restriction enzymes. As shown in
Fig. 76.1, a specific DNA fragment about 504 bp was generated. The result of
DNA sequencing showed that the chIFN-a gene was correctly inserted into the
expression vector.
76.3.2 Expression and Purification of chIFN-a
Optimization of the expression conditions was performed to improve the expres-

sion of the soluble IFN-a protein in E. coli. To examine the temperature effect on
IFN-a soluble expression, two groups of recombinants were cultured at 16 and
37 C, respectively. The lysate was centrifugated at 10,000 rpm for 5 min, the
pellet and supernatant were collected. T, P, S were indicated total protein of E.coli,
protein in pellet, protein in supernatant, respectively.
As shown in Fig. 76.2, the recombinant protein was induced with 0.1 mM
IPTG at 37 C. A large amount of target protein at a molecular mass of approx-
imately 76 kDa was generated, and the chIFN-a protein was mainly in the pellet.
Fig. 76.2 The recombinant

protein was induced to
express with 0.1 mM IPTG at
37 C. M. protein marker (14/
18/25/35/45/66/116kDA) 1.
IFN-a-Total; 2. IFN-a- Pellet;
3. IFN-a- Supernatant
Fig. 76.3 Expression and purification of His-NusA-chIFN-a. The recombinant protein was
induced with 0.1 mM IPTG and 0.5 mM IPTG at 16 C. M. protein marker (14/18/25/35/45/66/
116kDA). 0.1 mM IPTG induction: 1. IFN-a-Total, 2. IFN-a- Pellet, 3. IFN-a- Supernatant, 4.
IFN-a-unbound, 5. IFN-a-E1 (Protein was eluted by eluting buffer with 250 mM imidazole), 6.
IFN-a-E2 (Protein was eluted by eluting buffer with 500 mM imidazole) 0.5 mM IPTG
induction, 7. IFN-a-Total, 8. IFN-a- Pellet, 9. IFN-a- Supernatant, 10. IFN-a-unboundd, 11. IFN-
a-E1 (Protein was eluted by eluting buffer with 250 mM imidazole), and 12. IFN-a-E2 (Protein
was eluted by eluting buffer with 500 mM imidazole)
As shown in Fig. 76.3, the recombinant protein was induced with 0.1 mM IPTG at
16 C, a large amount of target protein at a molecular mass of approximately 76 kDa
was generated and it was soluble. Moreover, the protein expression level was higher
with 0.1 mM IPTG than that with 0.5 mM IPTG. The Ni-metal chelate affinity
chromatography was used to purify recombinant His-NusA-chIFN-a.
76.3.3 Antivirus Activity
To determine whether the recombinant chIFN-a could possess biological activity,

the resistance of HFMDV reproduction in vero cells was evaluated using the CPE
reduction method [18]. The concentration of chIFN-a was 0.99 mg/ml. According
to the calculations of the Reed-Muench’s methods, 100TCID50 of HFMDV was
10-3.6. The vero cells in the positive control were destroyed more than 50 %, the
treatment of recombinant chIFN-a could obviously inhibit the reproduction of
HFMDV in vero cells [19, 20]. 100 %vero can be protected from 100TCID50 of
HFMDV attack when the concentration of chIFN-a was about 1.65 9 10-4mg/ml
(Fig. 76.4). 62.5 % vero can be protected from 100TCID50 of HFMDV attack
when the concentration of chIFN-a was about 1.65 9 10-5mg/ml (Fig. 76.4).
12.5 % vero can be protected from 100TCID50 of HFMDV attack when the
concentration of chIFN-a was about 1.65 9 10-6mg/ml (Fig. 76.4). Vero cells
could not be protected from 100TCID50 of HFMDV attack totally when the
concentration of chIFN-a was about 1.65 9 10-7mg/ml (Fig. 76.4). The results
showed that chIFN-a had biological activity against HFMDV when the concen-
tration of chIFN-a was about 9.28 9 10-6mg/ml and the 100TCID50 of HFMDV
was 10-3.6.
746 Y. Ma et al.
Fig. 76.4 The vero cells were protected from HFMDV by different concentrations of chIFN-a. 1.
The concentration of chIFN-a is 1.65910-4 mg/mL. 2. The concentration of chIFN-a is
1.65910-5 mg/mL. 3. The concentration of chIFN-a is 1.65910-6 mg/mL. 4. The concentration
of chIFN-a is 1.65910-7 mg/mL
76.4 Conclusion
In this study, the IFN-a was cloned into pHis-NusA expression vector, and the
recombinant expression vector was transformed into host bacteria E. coli BL21.
The recombinant chicken IFN-a was induced to express, and the molecular weight
of the expressed protein is about 76 kDa. Under the condition that the recombinant
protein was induced to express with 0.1 mM IPTG at 16 C, the expressed protein
was soluble. Recombinant ChIFN-a had biological activity against HFMDV when
the concentration of chIFN-a was about 9.28 9 10-6 mg/ml and the 100TCID50
of HFMDV was 10-3.6.
Acknowledgments This research is supported by the program for Changjiang Scholars and
innovative Research Team in University (RIT1166).
References
1. Maeda S, Kawai T, Obinata M et al (1985) Production of human a-interferon in silkworm

using a baculovirus vector. Nature 315:592–594
2. Smith GE, Summers MD, Fraser, et al (1983) Production of human b-interferon in insect cells
infected with a baculovirus expression vector. Mol Cell Biol 3:2156–2165
3. Song KD, Lillehoj HS, Choi KD et al (1997) Expression and functional characterization of
recombinant chicken interferon-gamma. Vet Immunol Immunop 58:321–333
4. Weining KC, Schultz U, Mtinster U, et al (1996) Biological properties of recombinant
chicken interferon-g. Eur J Immunol 26:2440–2447
5. Matsuura Y, Tatsumi M, Enami K, et al (1991) Biological function of recombinant IL-6
expressed in a baculovirus system. Lymphokine Cytokine Res 10:201–205
6. Smith GE, Ju G, Ericson BL, Moschera J, Lahm H, Chizzonite R, Summers MD (1985)
Modification and secretion of human interleukin-2 produced in insect cells by a baculovirus
vector. P Natl Acad Sci USA 82:8404–8408
7. Mark G, David L, Bruce S, Janice C, Dennis A, Daniel J, Darrell R, Spackman E (2004)
Development of a real-time reverse-transcription pcr for detection of newcastle disease virus
rna in clinical samples. J Clin Microbiol 42:329–338
8. Ealick SE, Cook WJ, Vijay-Kumar S, Carson M, Nagabhushan TL, Trotta PL, Bugg CE
(1991) Three-dimensional structure of recombinant human interferon-gamma. Science
252:698–702
9. Michael DR, Bryan SB, Francis VC (2004) Lambda interferon inhibits hepatitis B and C
virus replication. J Virol 79:3851–3854
10. Wheelock EF (1965) Interferon-like virus-inhibitor induced in human leukocytes by
phytohemagglutinin. Science 149:310–311
11. Wang LF, Baker ML (2011) Type III IFNs in pteropid bats: differential expression patterns
provide evidence for distinct roles in antiviral immunity. J Immunol 186:3138–3147
12. Isaacs A, Lindenmann J (1957) Virus interference. I. the interferon. P Roy Soc Lond
147:258–267
13. Nakayama A, Yamamoto K, Tabata S (2000) High expression of glycogendebranching
enzyme in Escherichia coli and its competent purification method. Protein Expres Purif
19:298–303
14. Park TJ, Kim JS, Choi SS, Kim Y (2009) Cloning, expression, isotope labeling, purification,
and characterization of bovine antimicrobial peptide, lactophoricin in E. coli. Protein Expres
Purif 65:23–29
15. Kadowaki N, Antonenko S, Lau JY, Liu YJ (2000) Natural interferon alpha/beta-producing
cells link innate and adaptive immunity. J Exp Med 192:219–226
16. Lillehoj HS, Li GX (2004) Nitric oxide production by macrophages stimulated with Coccidia
sporozoites, lipopolysaccharide, or interferon-gamma, and its dynamic changes in SC and TK
strains of chickens infected with Eimeria tenella. Avian Dis 48:244–253
17. Meager A (2002) Biological assays for interferons. J Immunol Methods 261:21–36
18. Espion D, De Henau S, Letellier C, Wemers CD, Brasseur R, Young JF, Gross M, Rosenberg
M, Meulemans G, Burny A (1987) Expression at the cell surface of native fusion protein of
the Newcastle Disease Virus (NDV) strain Italian from cloned cDNA. Arch Virol 95:79–95
19. Carr DJ, Alkhatib K, James CM, Silverman R (2003) Interferon-b suppresses herpes simplex
virus type I replication in trigeminal ganglion cells through an Rnase L-dependent pathway.
J Neuroimmunol 141:40–46
20. Koyama AH, Arakama T, Adachi A (1999) Comparison of an antiviral activity of
recombinant consensus interferon with recombinant interferon-alpha-2b.Microbes and Infect
1:1073–1077
Chapter 77
Synthesis and Controlled Release
of 5-Fluorouracil
from Hydroxyethylchitosan:
Based Polymer Prodrug
Yanfei Peng, Wanshun Liu, Baoqin Han and Ruixue Zhou
Abstract A novel water-soluble hydroxyethylchitosan-based polymer prodrug of

5-fluorouracil ((HECS-5-Fu) was synthesized through acetyl spacer via ester bond.
The conjugated content of 5-Fu was 12.2 % (w). In phosphate buffer solution
(pH 7.4) at 37 C, HECS-5-Fu slowly hydrolyzed to release 5-fluorouracil-1-yl
acetic acid as characterized by RP-HPLC and LC–MS. The controlled release of
drug from HECS-5-Fu powder sustained for more than 25 days. The in vitro
experiment indicated that 5-fluorouracil-1-yl-acetic acid at concentration of 400
ug/mL inhibited the proliferation of about 40.0 % mouse fibroblast cell line L929.
HECS-5-Fu could have a potential application as an antimetabolic material in
glaucoma filtration device implantation.

Keywords Hydroxyethyl chitosan 5-Fluorouracil Prodrug Release Fibroblast
77.1 Introduction
5-fluorouracil (5-Fu), as an antimetabolite has shown significant antitumor activ-

ities. However, its short plasma circulation half-life, serious systemic toxicities,
and poor tumor-targeting make it important to screen out more clinically efficient
derivatives of 5-Fu, alternatively to prepare controlled and site-specific drug
release system.
Polymer materials like peptides, polysaccharides, and other natural products
have recently attracted much attention as biodegradable drug carriers. A variety of
macromolecular prodrugs of 5-Fu have been developed [1]. In most cases, the
bioactivities are due to the free 5-Fu released by a nonspecific chemical hydrolysis
Y. Peng (&) W. Liu B. Han R. Zhou

College of Marine Life Sciences, Ocean University of China, Qingdao 266003, China
e-mail: yanfeipeng@ouc.edu.cn
750 Y. Peng et al.
of the ester, carbomate, amide bonds between the drug and the polymer backbone
[2–5]. 5-Fu-polymer conjugates have also been reported to be able to provide site-
specific release of 5-Fu by a step-wise enzymatic and chemical cleavage of
chemical bonds under the environmental conditions of target cells [6, 7].
Chitosan and its water-soluble derivatives have been extensively used in
developing drug release systems in view of their good biocompatibility, biode-
gradability, nontoxicity, antibacterial, antitumor, and other bioactivities. Many
reports are available on preparation of chitosan-based drug capsules, microspheres,
nanoparticles, beads, gels, and films. Chitosan prodrug, in which drug is covalently
linked onto chitosan chain has been found to be bioactive in the field of anti-
bacteria, anticancer, and antioxidant [8]. Our previous studies show that a blend
membrane based on hydroxyethylchitosan (HECS) has good biodegradability and
histocompatibility, and can potentially be used as a carrier for corneal endothelial
cell transplantation [9, 10]. A novel drug loaded membrane made of N-succinyl-
hydroxyethyl chitosan and mitomycin C could inhibit efficiently the in vitro
proliferation of fibroblast cell L929 [11]. In an effort to decrease the side effects
and potential danger of 5-Fu, and meanwhile prolong the useful life of filtering
bleb following trabeculectomy, we reported here a novel synthesis and controlled
release of conjugated 5-Fu from HECS prodrug. The inhibitory effect of the
released substance against fibroblast cell was evaluated in vitro.
77.2.1 Materials and Reagents
5-Fluorouracil was purchased from Beijing Chemical Reagents Company (Beijing,

China). Chloroacyl chloride and N-methylpyrrolidone (NMP) were purchased from
Shanghai Medpep Co., Ltd. (Shanghai, China). 3-(4,5-dimethylthiazol-2-yl)-2,
5-diphenyltetrazolium bromide (MTT) was purchased from Sigma Chemical
Co.(USA). Materials for cell culture including Dulbecco’s Modified Eagle Medium
(DMEM), fetal bovine serum (FBS), penicillin and streptomycin were from Gibco
Co (USA). Tissue culture flasks and 96-well plates were obtained from Corning Co.
(USA). All other chemicals and reagents were commercially available and used as
received.
77.2.2 Synthesis of Hydroxyethylchitosan -5-Fu Conjugate

(HECS-5-Fu)
Hydroxyethylchitosan (HECS) with molecular weight of 12.5 9 104 and substi-

tution degree of 3.0 was synthesized in our laboratory for the following experiment.
77 Synthesis and Controlled Release of 5-Fluorouracil from Hydroxyethylchitosan 751
1.0 g HECS was dissolved in 40 mL N-methylpyrrolidone, and 0.8 mL chloroacyl

chloride was added droplet to the solution in an ice-bath. The mixture was then kept
stirring at room temperature for 3 h. The chloracetylated HECS (Cl-HECS, 1.5 g)
was obtained by ether precipitation, anhydrous alcohol washing, and vacuum
drying. Then 1.0 g chloracetylated HECS was dissolved in 30 mL re-stilled
dimethylsulfoxide, 0.9 g 5-Fu and 0.7 mL triethylamine were added. The whole
solution was kept in 50 C for 24 h under stirring. After that, 60 mL acetone was
poured into, and the resultant precipitate was collected, washed with alcohol, and
dried in vacuum. 0.9 g HECS-5-Fu conjugate (HECS-5-Fu) was obtained as a white
powder.
5-fluorouracil-1-acetic acid (5-FuAA) was prepared according to the method
reported previously [12].
The content of 5-Fu in HECS-5-Fu was 12.7 % as determined by measuring the
amount of 5-Fu-1-acetic acid released from the conjugate placed in 2.0 mol/L
NaOH solution for 2 h at 40 C, and the unconjugated 5-Fu was 0.5 % by mea-
suring the amount of 5-Fu released in distilled water in parallel [13, 14].
77.2.3 Characterization
UV–Vis absorption spectra were recorded with Tu-1800 UV–Vis spectropho-

tometer (PGeneral, Beijing, China) between 190 and 400 nm. The infrared spectra
(KBr pellets) were recorded on Nicolet NEXUE470 FTIR in a range of
400–4,000 cm-1. HPLC profiles of the released medium collected in intervals
were determined on a Shimadzu LC-10A HPLC system equipped with a Waters
Symmetry C18 column (2.1 mm 9 100 mm, 3.5 lm) and a SPD-10A UV detector
at 266 nm at 30 C. The mobile phase was water: methanol 98:2 (v/v) with a flow
rate of 0.3 mL/min. LC–MS analyses of the released medium collected in the first
week were done with a Micromass LCT time-of-flight mass spectrometer equipped
with an electro-spray ionization source.
77.2.4 In Vitro Release Studies
The in vitro release was carried out in a sealed plastic tube at 37 C in phosphate
buffer (pH 7.4) solution. HPCS-5-Fu powders (100 mg) were suspended in 7.0 mL
of release medium and stirred at 100 rpm. At each selected time, the mixture was
firstly centrifuged at 10,000 rpm for 10 min, and then 5.0 mL of the supernatant
was removed and replaced by the same volume of fresh medium. The amount of
5-FuAA in the samples withdrawn was determined with an UV spectrometer at
274 nm as compared with the standard curve of 5-FuAA. The release experiment
was performed in triplicate. The curve of cumulative percent drug release as a
function of time was plotted.
752 Y. Peng et al.
77.2.5 In Vitro Effect on the Growth of Mouse Fibroblast

Cell Line L929
L929 cell line were cultured in DMEM supplemented with 10 % (v/v) fetal bovine
serum, 1 % penicillin and streptomycin solution. Cells seeded at 4 9 103 cells per
well (96-well culture plates) were maintained at 37 C in a humidified incubator
with 5 % CO2 atmosphere for 24 h, the culture medium was removed, fresh medium
(200 lL/well, control group), or 5-Fu (200 lL/well, prepared in cultural medium at a
final concentration of 20, 10, 5, and 2.5 ug/mL), or 5-FuAA (200 lL/well, prepared
in cultural media at a final concentration of 400, 200, 100, and 50 ug/mL) was then
added. The plate was returned for incubation for 72 h. Cytotoxicity of samples was
evaluated by the 3-(4, 5-dimethylthiazole-2-yl)-2, 5-diphenyltetrazolium bromide
(MTT) assay. The in vitro inhibition ratio was calculated with the following formula:
Inhibition ratio = (ODO - ODS)/(ODO - ODC) 9 100 %, where ODO,
ODS, and ODC were the average OD value at 490 nm of five wells in parallel of
the control (with the cultural medium), sample treated group and the blank
(without cell), respectively.
77.3.1 Synthesis of HECS-5-Fu
Based on the good solubility of HECS in N-methylpyrrolidone, a mild reaction

route for chloroacylation of HECS was developed in this report. Figure 77.1 shows
the FTIR of HECS and HECS-5-Fu conjugate. In the IR spectrum of the HECS,
both the OH groups at C-6 and C-3 and the NH2 group of chitosan were
hydroxyethyl substituted in view of the disappearance of the absorption peaks at
1,030 and 1,160 cm-1 and the weakening at 1,599 cm-1. As for HECS-5-Fu
conjugate, new signal at 1247 cm-1 assigned to the stretching vibration of C–N of
5-Fu appeared, and the mC = O moved to 1,670 cm-1 due to the covalent con-
jugation of 5-Fu into HECS. The peak at 1,747 (C = O) and 771 cm-1 (C–Cl)
indicated not all the C–Cl group of chloroacetylated HECS reacted with 5-Fu.
77.3.2 Structure of the Released Substance
During the in vitro release experiment, it was found that the peak absorption in UV
spectra of released medium moved from the initial 265 nm to 274 nm. From the
HPLC profiles (Fig. 77.2) of the released medium collected in different time
interval, it was obvious that the released substances were firstly a mixture,
Fig. 77.1 FTIR spectra of HECS

HECS and HECS-5-Fu
conjugate
Transmission
HECS-5-Fu
4000 3500 3000 2500 2000 1500 1000 500

Wavenumber / cm-1
Fig. 77.2 HPLC profiles of

the released medium
collected in the first day a, the
2-7 days b, the second week
c, the third week, and d the
forth week e
followed by a pure molecule, implying that chemical conjugation of HECS and

5-Fu could make changes of the released target substance.
To determine the structure of the molecules released, released sample collected
in the first week was analyzed by ESI-Q-TOF MS/MS. The first eluted substance with
[M ? H]+ of 131 was proved to be 5-Fu, and the second one to be 5-Fu-1-yl-acetic
acid (5-FuAA). It means that HECS-5-Fu conjugate released were no longer
pure 5-Fu but a mixture of 5-Fu and its derivatives. 5-Fu released in the beginning
might be those unconjugated, and just being embedded during the precipitation of
HPES-5-Fu from the reaction solution, while the conjugated 5-Fu released existed as
5-FuAA. It was reported that the release of 5-Fu from conjugates was strongly
dependent on the pH of the dissolution medium [15]. The ester bond linking 5-Fu and
HECS were firstly broken down to release 5-FuAA, which could be further hydro-
lyzed to give 5-Fu quickly in alkali solution, while remained unchanged in neutral
and acidic environment. Therefore, 5-FuAA was released in the slightly basic
medium as we chose.
754 Y. Peng et al.
Fig. 77.3 The release profile 1.0

of HECS-5-Fu conjugate in
phosphate buffer (pH 7.4) at
0.8
37 C
Cumulative release
0.6
0.4
0.2
0.0
0 5 10 15 20 25 30
Time (days)
77.3.3 Release Behavior of HECS-5-Fu Conjugate
The release profile of 5-Fu from the conjugate in PBS medium was shown in
Fig. 77.3. The conjugate was quiet stable and gave a slow and steady release of
5-FuAA in 26 days we followed. There was not a phenomenon of burst-release
usually observed in the initial period. The cumulative release was 43 % in the first
5 days and reached to 73 % in 22 days.
Mechanism for controlled release of bioactive agents from polymer matrices
has been well described in literature, suggesting the erosion, diffusion and swelling
followed by diffusion, etc. [16, 17]. In case of in vitro release of HECS-5-Fu
conjugate, the water-insoluble nature of the conjugate might govern the release
pattern. Although HECS adopted was originally hydrophilic and water-soluble,
while after chloroacetylation it could form crosslink as a result of the side reac-
tions between violable groups (–OH, –NH2) and the adjacent chloracetyl group in
the polymer chain. The conjugate firstly swelled in the slightly alkali medium, the
release was swelling-controlled. After the achievement of swelling equilibrium,
the release turned to a diffusion-controlled mechanism. The swelled particles
served as a reservoir for drug release.
77.3.4 Inhibitory Effect on the Proliferation of Mouse

Fibroblast Cell L-929
It has been reported that 5-FuAA could efficiently inhibit the in vitro proliferation
of several tumor cells including leukemia cells, sarcoma 180, hepatic carcinoma
and ehrlich ascites tumor [18]. 5-FuAA as the main released substance from
HECS-5-Fu conjugate, its antimetabolite effect had to be evaluated firstly.
The effect of 5-FuAA and 5-Fu on the proliferation of mouse fibroblast cell L-929
was shown in Fig. 77.4. Obviously, 5-Fu at a concentration of 20-2.5 ug/mL could
Fig. 77.4 Effect of 5-FuAA

and 5-Fu on the proliferation
of mouse fibroblast cell L929
inhibit the proliferation of over 60.0 % fibroblast. As for 5-FuAA, the efficient
concentration was much higher than 5-Fu. When 400 ug/mL of 5-FuAA was
employed, the inhibition ratio reached to be 42.0 %. Therefore, higher concentration
of 5-FuAA must be provided for efficient anti-proliferation of fibroblast cells at the
target site, especially in the first two weeks after trabeculectomy. This, however,
could be fulfilled due to the relative high 5-Fu content (12.7 %) and good release
efficiency of HECS-5-Fu. The unconjugated 5-Fu, which was released from HECS-
5-Fu in the beginning, could be another kind of help for the whole inhibition against
fibroblast cells.
Due to the effect of possible inflammatory effect of implanted material on drug
release from conjugate, the exact antimetabolite effect of HECS-5-Fu conjugate
needs to be checked in animal models in future.
77.4 Conclusion
In this study, a novel 5-Fu prodrug based on hydroxyethyl chitosan was synthe-
sized. In phosphate buffer solution, the HECS-5-Fu conjugate released 5-FuAA,
and a small amout of 5-Fu at the beginning. The controlled drug release could
sustain more than 25 days. Although less efficient than 5-Fu, 5-FuAA could inhibit
the in vitro proliferation of mouse fibroblast cell L-929 when higher concentration
was employed. The relative high drug loading, sustained release in long period and
good release efficiency made HECS-5-Fu conjugate a potential site specific anti-
metabolite material in glaucoma filtration device implantation.
Acknowledgments This work was financially supported by the National Natural Sciences
Foundation of China (No.30800193). Dr. Joensuu Päivi from Univeristy of Oulu is appreciated
for the expert help with mass spectrometry.
756 Y. Peng et al.
References
1. Nichifora M, Schachta EH, Seymour LW (1997) Polymeric prodrugs of 5-fluorouracil.

J Control Release 48:165–178
2. Akashi M, Takemoto K (1990) New aspects of polymer drugs. Adv Polymer Sci 97:108–146
3. Ouchi T, Fujino A, Tanaka K et al (1990) Synthesis and antitumor activity of conjugates of
poly(a-malic acid) and 5-fluorouracil bound via ester, amide or carbamoyl bonds. J Control
Release 12:143–153
4. Ouchi T, Hagihara Y, Takahashi K et al (1992) Synthesis and anti-tumor activity of
poly(ethylene glycol)s linked to 5-fluorouracil via urethane or urea bonds. Drug Design Disc
9:93–105
5. Ouchi T, Banba T, Matsumoto T et al (1990) Synthesis and anti-tumor activity of conjugates
of 5-fluorouracil and chito-oligosaccharides involving a hexamethylene spacer group and
carbamoyl bonds. Drug Design Del 6:281–287
6. Bundgaard H (1989) The double prodrug concept and its application. Adv Drug Del Rev
3:39–65
7. Amsberry KL, Borchardt RT (1991) Amine prodrugs which utilise hydroxy amide
lactonization. I. a potential redox-sensitive amide prodrug. Pharm Res 8:323–330
8. Vinsovam J, Vavrikova E (2008) Recent advances in drugs and prodrugs design of chitosan.
Curr Pharm Design 14:1311–1326
9. Liang Y, Liu W, Han B et al (2011) Fabrication and characters of a corneal endothelial cells
scaffold based on chitosan. J Mater Sci Mater Med 22:175–183
10. Liang Y, Liu W, Han B et al (2011) An in situ formed biodegradable hydrogel for
reconstruction of the corneal endothelium. Colloid Surface B 82:1–7
11. Li M, Han B, Liu W (2011) Preparation and properties of a drug release membrane of
mitomycin C with N-succinyl-hydroxyethyl chitosan. J Mater Sci Mater Med 22:2745–2755
12. Udo K, Hokonohara K, Motoyama K et al (2010) 5-Fluorouracil acetic acid/beta-cyclodextrin
conjugates: drug release behavior in enzymatic and rat cecal media. Int J Pharm 388:95–100
13. Wang Q, Liu X, Liu L et al (2007) Synthesis and evaluation of the 5-fluorouracil- pectin
conjugate targeted at the colon. Med Chem Res 16:370–379
14. Luo Q, Wang P, Miao Y et al (2012) A novel 5-fluorouracil prodrug using
hydroxyethylstarch as a macromolecular carrier for sustained release. Carbohydr Polym
87:2642–2647
15. Zhang Z, Zhang Q, Wang J (2010) Synthesis and drug release in vitro of porphyran carrying
5-fluorouracil. Carbohydr Polym 79:628–632
16. Peppas L (1997) Polymers in controlled drug delivery. Med Plast Biomater 4:34–44
17. Prabaharan M, Reis R, Mano J (2007) Carboxymethyl chitosan-graft-phosphatidylethanolamine:
amphiphilic matrices for controlled drug delivery. React & Funct Polym 67:43–52
18. Yang Z, Wang L, Yang X et al (2000) Pharmacological study on antitumor activity of
5- fluorouracil 1-acetic acid and its rare earth complexes. J Rare Earth 18:140–143
Chapter 78
Telomerase is Significant as an Early
Diagnostic Marker and Therapeutic
Target
Lian Duan, Nan Wang, Xinghua Liao, Jun Zhou, Dalin lu, Jiajie Liu,
Xueguang Sun and Tong-Cun Zhang
Abstract Breast cancer, a hormone-dependence disease, is the most common

malignant tumor in women. Breast cancer incidence rates increase with age.
Telomerase is a ribonucleoprotein that maintains chromosome ends and endows
cells with unlimited proliferative potential. Activation of telomerase maintains a
relatively stable telomere length, confers immortality on some cells, and may even
lead to cancer. It has been reported that, in the tissues of the breast, the activity of
telomerase can be detected in more than 90 % of invasive breast cancers, while not
in adjacent normal tissues. Thus, telomerase activation plays a critical role in
development of breast cancer. Telomerase has been proposed as a biomarker with
diagnostic and prognostic potential in breast cancer as well as a basis for the
targeted therapy of breast cancer.
Keywords Breast cancer Telomerase Chromosome ends Telomere
This work was financially supported by National Natural Science Foundation of China
(No.30970615,31071126) and Program for Changjiang Scholars and Innovative Research
Team in University Education of China (IRT1166) and the Key Project of Chinese Ministry
of Education (212010) and Outstanding Young Talent Project of Scientific Research Plan of
Education Department in Hubei province (Q20101111).
L. Duan X. Liao J. Zhou D. lu J. Liu T.-C. Zhang (&)

College of Medicine, Wuhan University of Science and Technology, Wuhan 430065,
N. Wang X. Liao X. Sun T.-C. Zhang
758 L. Duan et al.
78.1 Introduction
Breast cancer, a most common cancer mainly diagnosed in women, is the second
leading cause of death in the world. In 2008, breast cancer caused 458,503 deaths
worldwide (13.7 % of cancer deaths in women); this is due to difficulty in diag-
nosing at an early stage. Despite the improvements in diagnostic imaging tech-
niques such as computed tomography, magnetic resonance imaging, etc., the early
diagnosis of breast cancer is still difficult. Some reports indicate that telomerase
activity play a crucial role in cellular senescence and tumor initiation. So, the
detection of telomerase activity has been proposed to be a useful tool in the
diagnosis of pancreatic cancer.
Telomerase is a ribonucleoprotein enzyme that specifically restores telomere
sequences lost during replication by means of activity the catalytic subunit of
human telomerase reverse transcriptase (hTERT), and a telomerase RNA template
(hTR) [1]. It is activated in most immortal cell lines and in most malignant tumors
that is detected in 85–90 % of human cancer specimens. Telomerase activity is
found in breast cancer and pre-invasive lesions of the breast, such as ductal car-
cinoma in situ (DCIS), suggesting that telomerase activity is activated early in
breast carcinogenesis [2]. Since telomerase activity is present in a vast majority of
human cancers, it might have a role in the diagnosis and treatment of cancer. In
this paper, we mainly review the relationship between telomerase and early
diagnosis and therapy of breast cancer.
78.2 Function and Structure of the Telomeres

and Telomerase
The ends of linear eukaryotic chromosomes contain specialized structures called

telomeres. In humans, telomeres consist of long and repeated TTAGGG sequence,
which are associated with a variety of telomere-binding proteins. Telomere DNA
is dynamic, being progressively lost with each cell division due to incomplete
replication of the termini of linear DNA molecule [3]. After a finite number of
replications, the telomere reaches a critical length, and in turn induces replicative
senescence [4].
Recently, some researchers find that telomere integrity and function need to
bind to telomere response protein, such as telomeric repeat binding factor 1
(TRF1) and telomeric repeat binding factor 2 (TRF2) [5]. TRF1 is a negative
regulator of telomere length. Early reports indicated that overexpression of wild-
type TRF1 will decrease telomere length, whereas overexpression of mutant TRF1
will lead to telomere elongation. TRF2 also plays an important role in chromo-
some stabilization. Recent studies have found that overexpression of mutant TRF2
leads to the loss of TRF2 bound at the telomere, induction of the p53-dependent
damage pathway, end fusion, and growth arrest as in replication senescence [6, 7].
78 Telomerase is Significant as an Early Diagnostic Marker and Therapeutic Target 759
Although other mechanisms to maintain telomere stability are possible, the

mechanism for lengthening telomeres in humans is almost always by the reacti-
vation or upregulation of telomerase. It consists of two core function components
hTERT and hTR. These components jointly form the telomerase active site. hTR
contributes by binding the telomere end and acts as template for polymerization,
while hTERT catalyzes the addition of telomeric repeat [8].1 Telomerase functions
include addition of telomeric repeats, stabilization and maintenance of telomere
length, overall spatial orientation, structural integrity, and stability of the chro-
mosome [9]. It is only expressed in a small number of proliferating cell types, such
as germ line and somatic stem cells. Most normal human cells lack telomerase
activity and their telomeres shorten with each cell division, until they enter
replicative senescence. Cells that lose critical cell-cycle checkpoint functions
escape this initial growth arrest and divide until they enter crisis when chromo-
some end fusions and apoptosis occur. Cells remain in this crisis period acquires
telomerase expression, that can maintain telomeres is then able to grow continu-
ously (i.e., becomes immortal) and this is generally believed to be a critical step
toward cancer progression [10].
78.3 Effects of Telomerase Activity in Breast Cancer
Regulation of telomerase activity during normal cell development and tumori-

genesis is highly important in setting cell proliferative lifespan. A number of
mechanisms have been revealed to regulate telomerase activity that includes gene
transcriptional regulation, alternative splicing, and post-translational modifications
of hTERT. The tight correlation between hTERT mRNA expression and telome-
rase activity in cells suggests that transcriptional regulation of hTERT is one of the
primary regulatory mechanisms in regulating telomerase activity. Characterization
of the hTERT gene promoter has revealed a number of potential sites for tran-
scriptional regulation, including two typical E-boxes and several GC-boxes for the
transcription factors c-Myc and Sp1, respectively. Especially an imperfect estro-
gen response element (ERE) has also been identified within the hTERT promoter,
providing a platform for action of the sex steroid hormone estrogen with estrogen
receptor (ER) in regulating hTERT gene transcription and cell proliferative life-
span [11].
Breast cancer is an estrogen-dependent disease. Studies in vitro show that
estrogen can upregulate the hTERT gene expression and telomerase activity in MCF-
7 cells, further studies suggest the imperfect palindromic ERE (GGTCAGGCT-
GATC) at -2677 of the hTERT gene promoter (differing from the consensus
sequence by one nucleotide (GGTCAN3TGACC)). Deletion of this ERE dramati-
cally reduces estrogen-induced activation of telomerase. Interestingly, mutation of
1
Tong-cun Zhang: E-mail: tony@tust.edu.cn
760 L. Duan et al.
Fig. 78.1 Schematic model. In breast cancer, estrogen can promote the upregulation of
telomerase activity directly through binding to both nuclear and nonnuclear ER signal
transduction that activated Akt pathway
two c-Myc binding sites located within the proximal 181 bp region completely
blocks estrogen activation of telomerase activity. These findings suggest that
estrogen-responsive element is responsible for transcriptional activation by ligand-
activated ER and c-Myc/Max play additional roles in estrogen-induced transacti-
vation of hTERT [12]. The recent study shows that the activation of telomerase
induced by estrogen is due not only to transcriptional regulation of hTERT via an
ERE-dependent mechanism and a PI3 K/Akt/NF-jB cascade, but also to post-
translational regulation via phosphorylation of hTERT and association with NF-jB
in MCF-7 cells (Fig. 78.1), that is also true of the mechanism by which cytokines
modulate telomerase activity.
78.4 Telomerase: A Diagnostic Marker in Breast Cancer
There were multiple methods to detect telomerase in the breast cancer tissue. The
telomere repeat amplification protocol (TRAP) assay usually has detected telo-
merase activity. This sensitive polymerase chain reaction (PCR)-based assay can
detect as few as 1-10 positive cells or 0.01 % positive cells in a mixed population.
Kaori Saito et al. examined 38 breast cancer samples and 16 noncancerous breast
samples by TRAP that detected telomerase activity in 65.8 % (25/38) of breast
cancers, but no telomerase activity in any noncancerous sample [13]. He Guoping
detected telomerase activity in 47 of the 52 breast cancer samples (93.8 %), in 15
of 52 adjacent nonmalignant breast tissues (28.85 %) and in 10 of the 32 benign

lesions (31.25 %), but no activity was detected all of 14 normal mammary gland
tissues [14]. Expression of the hTERT mRNA can also be detected using real-time
reverse transcription polymerase chain reaction (RT-PCR). Mohammad et al.
measured the mRNA of hTERT in 65 breast cancer patients, and found that 53
(81.54 %) patients exhibited hTERT expression positive and 12 (18.46 %)
exhibited expression negative [15]. AE Elkak also tested the expression of hTERT
protein by immunohistochemical and confirmed that hTERT expression was
positive in 27 (71 %) of 38 tumors [16].
With the increasing number of breast cancers detected by screening procedures,
a marker is needed to stratify the risk of subsequent invasive cancer. Blanca Murillo
et al. found a significant correlation between telomerase activity and tumor size,
lymph node status, and stage. Specially, they found a significant correlation
between low levels of telomerase activity and a lack of ERb expression (p = 0.03),
while telomerase activity was not related to ERa expression (p = 0.61) [17].
A significant association between telomerase-positive infiltrating breast carcinomas
and lymphovascular invasion, a fundamental step in breast cancer metastasis and a
predictor of survival, has also been observed, making telomerase a useful prog-
nostic marker [18].
These assays provide highly sensitive methods for breast cancer diagnosis, but
have limitation. Consequently, for the diagnosis of breast cancer, these biomarkers
should be combined with other diagnostic technology to avoid false-positive and
false-negative results, and better tumor grade and tumor classification can be
given. Based on these results, reasonable therapeutic schedule is designed.
78.5 Telomerase: A Potential Therapeutic Target

in Breast Cancer
The average telomere length in breast cancer cells is usually well below that of
normal cells. Furthermore, most stem cells are quiescent, and telomere shortening
normally occurs only with cell division. Since most breast cancer cells have very
short telomeres, treatment with telomerase inhibitors should lead to growth arrest
and cell death. Thus, telomerase and telomeres offer a variety of potential targets
for the development of anticancer therapies. The telomerase protein complex
allows for multiple sites for inhibition. Recent research includes targeting the RNA
component of the telomerase, inhibition of the catalytic subunit, immunotherapy,
and small molecule inhibitors [19].
762 L. Duan et al.
78.5.1 HTR
Telomerase uses intrinsic RNA subunit as a template for synthesis of new telomere
repeats at the chromosome termini. Inhibiting hTR can block elongation of telo-
mere to suppress activation of telomerase. Include antisense oligonucleotides and
ribozyme.
78.5.2 Inhibit TERT
The enzymatic activity of telomerase may be inhibited by various telomerase

inhibitors, with the induction of accelerated senescence and cell death. The most
widely used reverse transcriptase inhibitor is 3¢-azido-3¢-deoxythymidine (AZT).
Melana et al. observed that AZT inhibited the growth of breast cancer cells and
telomerase activity at lower doses than in normal breast cells [20].
78.5.3 Immunotherapy
There is the elimination of telomerase expressing cells by immune effectors.

TERT-positive cells express TERT in association with major histocompatibility
complex on cell surfaces. Cells can then be recognized and eliminated by
CD8+ cytotoxic T cells. This would provide the rapid elimination of tumor cells
with no delay effect. However, TERT-expressing normal cells also would be
affected [21].
78.5.4 Small Molecule Inhibitor
One method of specific inhibition of telomerase is through RNA interference

(RNAi). Since its discovery, RNAi has been shown as a potent posttranscriptional
gene silencing mechanism. Introduction of small interfering RNAs (siRNAs) can
mediate the specific degradation of the mRNA, whose sequence is present in the
siRNAs. It has been reported that RNAi against hTERT could successfully inhibit
telomerase activity in several cancer cell lines. The study from Xue demonstrated
the potential of inhibiting telomerase as an effective treatment of breast cancer by
siRNA [22].
78.6 Conclusion
Ontogeny and progress of breast cancer were involved in several regulation of the
pathway. Although telomerase activation plays a role, the mechanism may involve
other regulation factors companied. It is expressed in over 90 % of breast cancer
cells, while it is not expressed in most normal cells. Recent research showing test
of telomerase has sensitivity toward diagnosis of breast cancer, but the guidance of
individualized radiation therapy, chemotherapy, and surgical treatment has limi-
tation. Research of telomerase inhibitors is increasing. Combining telomerase
inhibitors with current therapies to reduce tumor burden may provide a better
regimen to target breast cancer.
References
1. Ortiz BM, De la Vega HA, Medina SC et al (2006) Telomerase activity, estrogen receptors
(a, b), Bcl-2 expression in human breast cancer and treatment response. BMC Cancer 6:206
2. Xu JH, Chen YH, Olopade O (2010) MYC and breast cancer. Genes and Cancer
6(1):629–640
3. Martin-Ruiz CM, Gussekloo J, Van Heemst D et al (2005) Telomere length in white blood
cells is not associated with morbidity or mortality in the oldest old: a population-based study.
Aging Cell 4(6):287–290
4. Wai LK (2004) Telomeres, telomerase, and tumorigenesis – a review. Med Gen Med 6(3):19
5. Blasco MA (2003) Mammalian telomeres and telomerase: why they matter for cancer and
aging. Eur J Cell Biol 82(9):441–446
6. Greider CW (1999) Telomeres do D-loop-T-loop. Cell 97:419–422
7. Shay JW (1999) At the end of the millennium, a view of the end. Nat Gen 23:382–383
8. Natarajan S, Chen Z, Wancewicz EV, Monia BP et al (2004) Telomerase reverse
transcriptase (hTERT) mRNA and telomerase RNA (hTR) as targets for downregulation of
telomerase activity. Oligonucleotides 14(4):263–273
9. Saldanha SN, Andrews LG, Tollefsbol TO (2003) Analysis of telomerase activity and
detection of itscatalytic subunit, hTERT. Anal Biochem 315(1):1–12
10. Chiu CP, Harley CB (1997) Replicative senescence and cell immortality:the role of telomeres
and telomerase. Biol. Med 214(2):99–106
11. Sharyn B, Liu JP (2005) Hormones and growth factors regulate telomerase activity in ageing
and cancer. MCE 240(1–2):11–22
12. Kyo S, Takakura M, Kanaya T et al (1999) Estrogen activates telomerase. Cancer Res
59:5917–5921
13. Saito K, Yagihashi A, Nasu S, Izawa Y et al (2002) Gene expression for suppressors of
telomerase activity (telomeric-repeat binding factors) in breast cancer. Cancer Sci
93(3):253–258
14. He GP, Shui QL, Zhang LJ, Huang Y (2003) Semi-quantification of telomerase activity and
its relationship with pathological indexes in breast carcinoma. Chin J Exp Surg
11(20):986–988
15. Yamchi MR, Zarghami N, Rahbani et al (2011) Plasma leptin, hTERT gene expression, and
anthropometric measures in obese and non-obese women with breast cancer. Breast Cancer
5:27–35
764 L. Duan et al.
16. Elkak AE, Meligonis G, Salhab M et al (2005) hTERT protein expression I independent of
clinicopathological parameters and c-Myc protein expression in human breast cancer.
J Carcinog 4:17
17. Kawagoe J, Ohmichi M, Takahashi et al (2003) Raloxifene inhibits estrogen-induced up-
regulation of telomerase activity in a human breast cancer cell line. JBC 287(34):43363–43372
18. Mokbel KM, Parris CN, Ghilchik M, Amerasinghe CN et al (2000) Telomerase activity and
lymphovascular invasion in breast cancer. Eur J Surg Oncol 26:30–33
19. Herbert BS, Wright WE, Shay JW (2007) Telomerase and breast cancer. Breast Cancer Res
3:146–149
20. White LK, Wright WE, Shay JW (2001) Telomerase inhibitors. Trends Biotechnol
19(3):114–120
21. Domchek SM, Recio A, Mick R et al (2007) Telomerase-specific T-Cell immunity in breast
cancer:effect of vaccination on tumor immunosurveillance. Cancer Res 67:10546
22. Dong XJ, Liu A, Zer C et al (2009) siRNA inhibition of telomerase enhances the anti-cancer
effect of doxorubicin in breast cancer cells. BMC Cance 9:133
Chapter 79
Isolation, Identification, Antibacterial
Effects of Antibiotic Drugs, and Chinese
Herbal Extracts to the Pathogenic
Bacteria of Swollen Abdomen
from Scophthalmus maximus in Vitro
Xuan Wu, Dongqing Bai, Guoxia Zhu, Yanbin Ji, Zhichao Jia
and Peng Zhou
Abstract The pathogenic bacteria was isolated from Turbot (Scophthalmus

maximus) with swollen abdomen, and proved to be the pathogenic bacteria by the
infection experiment. In this research, VITEK-2 compact system was used to
identify the pathogenic bacteria, and test the antibacterial effects of antibiotic
drugs, paper diffusion method was used to evaluate the antibacterial effects of
three kinds of Chinese herbal extracts on the pathogenic bacteria of swollen
abdomen from Turbot in Vitro.The results showed that the pathogenic bacteria of
swollen abdomen from Turbot was stenotrophomonas maltophilia, and the sepa-
ration purity was 99 %. Without Trimethoprim, S. maltophilia had no CLSI salient
point to the antibiotics of Ampicillin, Amikacin, Aztreonam, Cefazolin, Cefepime,
Cefuroxime, Cefuroxime Axetil, Cefotetan, Ceftazidime, Ceftriaxone, Ciproflox-
acin, Piperacillin, Imipenem, Gentamicin, Levofloxacin, Nitrofurantoin, Sulbac-
tam, Tazobactam. Extract of the scutellaria and honeysuckle had different
antibacterial effects to the S. maltophilia, and then the best bacteriostatic (MIC)
and bactericidal (MBC) effects were 3.125 mg/mL and 6.25 mg/mL, respectively.
However, the best MIC and MBC effects to extract from polygonum cuspidate
were 100 mg/mL and 200 mg/mL, MIC and MBC effects lower than that extract
from the scutellaria and honeysuckle. The results can provide reference materials
for the clinical use of aquaculture and aquatic animal health cultivation.

Keywords Turbot (Scophthalmus maximus) Stenotrophomonas maltophilia
Isolation and identification
Antimicrobial susceptibility
Chinese herbal
medicine
X. Wu D. Bai (&) G. Zhu Y. Ji Z. Jia P. Zhou

Tianjin Key Lab of AQUA-Ecology and Aquaculture, Department of Fishery Science,
Tianjin Agricultural University, Tianjin 300384, People’s Republic of China
e-mail: baidongqing@tjau.edu.cn
766 X. Wu et al.
79.1 Introduction
Turbot (S. maximus) is one of the most economically important marine cultured fish
in the world. The fish mainly distributes in the west of Pacific Ocean. At present,
Turbot has become an important commercial species to the industrialized culture in
the coastal areas of north of Chinese. But with high density of culture, disease
outbreaks have occurred and caused heavy economic losses. Swollen abdomen is the
main disease in the Turbot. It was a comprehensive disease that can cause infections
to most of the aquatic organisms. The diseased fishes appeared slightly with
enlargement of liver and spleen and obviously bloated abdomen. The anatomy of the
diseased fishes show that mass ascites with pus in the abdominal cavity, and severe
cases may have gastrointestinal bleeding [1, 2]. Some researches have studied
swollen abdomen of Turbot, and made some achievements [3–5]. In this study,
mainly isolated pathogenic bacteria from Turbot (S. maximus) with swollen abdo-
men, and to identify it. Test the antibacterial effects of antibiotic drugs and anti-
bacterial effects of Chinese herbal extracts for the pathogenic bacteria. In order to
provide reference materials for the clinical use of aquaculture and aquatic animal
health cultivation.
79.2.1 Bacterial Isolation
For bacterial isolation, samples taken from abdominal cavity of diseased Turbot
(n = 30, body length 4.2 ± 0.6 cm) were directly streaked on agar plates (5 g/l
bacteriological peptone, 1 g/l yeast extract, 1 g/l KH2P04, 30 g/l NaCl, 15 g/l agar,
pH 7.2-7.4) [6]. After incubation for 48 h at 28 C, the dominant colonies were
picked and streaked for purity onto the same medium and incubated for 24 h at 28 C.
The pure isolates were saved on agar slopes and were routinely grown. Meanwhile
isolates were stored in a medium 15 % (v/v) glycerol at -80 C until use.
79.2.2 Induced Infection Assays
In order to confirm the bacteria was the pathogenic bacteria of swollen abdomen to
the Turbot, 50 ll the dosages of 1.0 9 106 CFU with suspensions of pure cultures
suspended in steriled physiological saline, and injected to the health Turbot. While
fish in the control group was injected with 0.85 % NaCl.
79 Isolation, Identification, Antibacterial Effects of Antibiotic Drugs 767
79.2.3 Biochemical Identification and Antibiotic

Susceptibility Test
The VITEK test method by the automated microbe identification analyzer (VITEK
2 compact, bioMérieux, France) was used to identify and characterize the isolates
further. The GN (Gram-negative) and AST-GN04 (antimicrobial susceptibility
testing) cards were employed for the biochemical identification and antibiotic
susceptibility test respectively. The test was done as reported by [7].
79.2.4 Antibacterial Activity Assay of Chinese Herbal

Extracts
A disk diffusion method [8] was used to assay the pathogenic bactericidal activity
of the Chinese herbal extracts from scutellaria, honeysuckle, and polygonum
cuspidate.
The Chinese herbal extracts were dissolved in sterile saline solution (0.85 %
NaCl) in double dilutions: at 400, 200, 100, 50, 25, 12.5, 6.25, 3.125 mg/ml. After
dilution, antibacterial activity assay was carried out immediately. Bacteria were
suspended respectively in sterile saline solution and were diluted to 1.0 9 106
CFU. The suspension (100 ll) was spread on the medium along the blank paper
disk (6 mm diameter) containing different levels of saturated Chinese herbal
extract. Blank paper disk with sterile saline solution was offered as control.
The inoculated plates were incubated at 27 C for 24 h. Antibacterial activity of
minimum inhibitory concentration (MIC) was evaluated by measuring the distance
of inhibition zone of the tested bacteria. The diameter of inhibition zone below
13 mm was regarded as resistant, between 13 mm and 17 mm moderately sus-
ceptible, and above 17 mm susceptible. Tests were performed in triplicate for each
test concentration.
The Chinese herbal extracts were dissolved in agar medium in double dilutions:
at 400, 200, 100, 50, 25, 12.5, 6.25, 3.125 mg/ml, and then emptied to the
plate. 100 suspensions was spread on the plate, the inoculated plates were incu-
bated at 27 C for 24 h. The MBC is defined as the lowest concentration of the
essential oils at which inoculated microorganism was completely killed (99.99 %).
Tests were performed in triplicate for each test concentration.
79.3 Results
79.3.1 Bacterial Isolation
Pathogenic bacteria of swollen abdomen were isolated from the abdominal cavity
of diseased Turbot, and it was identified as Gram-negative bacteria.
768 X. Wu et al.
During 5 days of the infection experiments, the Turbot of the control groups did
not show any disease signs. All of the treated Turbot showed different disease
signs similar to the original diseases. During the infection experiments, high
mortality was observed.
79.3.2 Characterization and Identification of Pathogenic

Bacteria
The results of biochemical identification test of pathogenic bacteria by VITEK-2

compact system were shown in Table 79.1 indicated that it was S. maltophilia with
99 % probability, which was considered as ‘‘a excellent identification’’ by the
system. The biochemical details were showed in Table 79.1.
Table 79.1 Biochemical details of pathogenic bacteria

Biochemical details Biochemical details
Ala-Phe-Pro-Arylamidase (APPA) + Saccharose/Sucrose (SAC) –
Adonitol (ADO) – D-Tagatose (dTAG) –
L-Pyrrolydonyl-Arylamidase (PyrA) – D-Trehalose (dTRE) –
L-Arabitol (lARL) – Citrate (Sodium) (CIT) –
D-Cellobiose (dCEL) – Malonate (MNT) +
Beta-Galactosidase (BGAL) – 5-Keto-D-Gluconate (5 KG) –
H2 s Production (H2S) – L-Lachate alkalinization (lLATk) +
Beta-N-Acetyl-Glucosaminidase – Beta-N-Acetyl-Galactosaminidase +
(BNAG) (NAGA)
Glutamyl Arylamidase pNA (AGLTp) – Succinate alkalinization (SUCT) +
D-Glucose (dGLU) – Alpha-Glucosidase (AGLU) –
Gamma-Glutamyl-Transferase (GGT) + Alpha-Galactosidase (AGAL) –
Fermentation/Glucose (OFF) – Phosphatase (PHOS) +
Beta-Glucosidase (BGLU) + Glycine Arylamidase (GlyA) –
D-Maltose (dMAL) – Ornithine Decarboxylase (ODC) –
D-Mannitol (dMAN) – Lysine Decarboxylase (LDC) –
D-Mannose (dMNE) – Decarboxylase Base (0DEC) –
Beta-Xylosidase (BXYL) – L-Histidine assimilation (lHISa) –
Beta-Alanine arylamidase pNA(BAlap) – Courmarate (CMT) –
L-Proline Arylamidase (ProA) + Beta-Glucuronidase (BGUR) –
LipaseI (LIP) – O/129 Resistance (O129R) –
Palatinose (PLE) – Glu-Gly-Arg-Arylamidase (GGAA) –
Tyrosine Arylamidase (TyrA) – L-Malate assimilation (lMLTa) –
Urease (URE) – Ellman (ELLM) –
D-Sorbitol (dSOR) – L-Lactate assimilation (lLATa) –
+, Positive; _, negative
79.3.3 Antibiotic Susceptibility Assay
Use VITEK-2 compact system test antibiotic susceptibility revealed that without
Trimethoprim, s. maltophilia had no CLSI salient point to the antibiotics of
Ampicillin, Amikacin, Aztreonam, Cefazolin, Cefepime, Cefuroxime, Cefuroxime
Axetil, Cefotetan, Ceftazidime, Ceftriaxone, Ciprofloxacin, Piperacillin, Imipenem,
Gentamicin, Levofloxacin, Nitrofurantoin, Sulbactam, Tazobactam (Table 79.2).
79.3.4 Antibacterial Activity Assay of the Chinese Herbal

Extracts
The in vitro antimicrobial activities of Chinese herbal extracts from scutellaria,

honeysuckle, and polygonum cuspidate against the s. maltophilia and their activity
potentials were qualitatively and quantitatively assessed by the presence or
absence of inhibition zones, zone diameters, bacteriostatic (MIC), and bactericidal
(MBC) values. Although the MICs and MBCs results varied between microor-
ganisms tested, in the most cases the MICs was less than the MBCs.
Table 79.2 Antibiotic susceptibility information of s. maltophilia

Antimicrobial MIC Interpretation
Ampicillin(AM) – –
Ampicillin/Sublactam(SAM) – –
Ticarcillin/Clavulanic Acid(TCC) – –
Piperacillin(PIP) – –
Piperacillin/Tazobactam(TZP) – –
Cefazolin (CZ) – –
Cefuroxime(CXM) – –
Cefuroxime Axetil – –
Cefotetan(CTT) – –
Ceftazidime(CAZ) – –
Ceftriaxone(CRO) – –
Cefepime(FEP) – –
Aztreonam(ATM) – –
Imipenem(IPM) – –
Amikacin(AN) – –
Gentamicin(GM) – –
Tobramycin(TM) – –
Ciprofloxacin(CIP) – –
Levofloxacin(LEV) – –
Nitrofurantoin(FT) – –
Trimethoprim/Sulfamethoxazole(SXT) B20 S
MIC = minimum inhibitory concentration. S = sensitive, R = resistant, and I = intermediate
770 X. Wu et al.
Table 79.3 Antimicrobial activity of the Chinese herbal extracts (1.0 9 106 CFU)
Chinese herbal extracts Bacteriostatic(MIC) Bactericidal
effects (MBC)
Scutellaria 3.125 6.25
Honeysuckle 3.125 6.25
Polygonum Cuspidate 100 200
Results obtained from disk diffusion method, followed by measurements of

MIC and MBC, indicate that extract of the scutellaria and honeysuckle had dif-
ferent antibacterial effects to the S. maltophilia, and then the best MIC and MBC
effects were 3.125 mg/mL and 6.25 mg/mL, respectively. However, the best MIC
and MBC effects to extract from polygonum cuspidate were 100 mg/mL and
200 mg/mL, MIC and MBC effects lower than that of extract from the scutellaria
and honeysuckle (Table 79.3) .
79.4 Discussion
In our study, we isolated pathogenic bacteria of swollen abdomen from the

abdominal cavity of diseased Turbot. And identified it was S. maltophilia
(S. maltophilia).
S. maltophilia is a Gram-negative, nonenterobacteriaceae, nonfermentative,
aerobic bacillus [9] that was formerly classified in the genus Xanthomonas [10].
The most common reported that this organism could infections to the human,
mammals, and many marine animals [11–15]. In recent years, S. maltophilia of
swollen abdomen has caused huge economic losses. It has been reported that at
Channel catfish (Ictalurus Punctatus), yellow catfish (Pelteobagrus fulvidraco),
Turbot (S. maximus), and so on [5, 16]. According to the research, the action
mechanism of S. maltophilia to the swollen abdomen was to produce exotoxin, and
then destroyed to cell membrane, finally disruption and dissolution of cell [17].
However, some scholar claims that swollen abdomen of Turbot is caused by
other pathogenic bacteria [1, 2]. It can be explained that swollen abdomen of
Turbot is comprehensive caused by many kinds of bacteria, such as Edwardsiella
tarda, V ibrioalg inolyticus, Aeromonas hydrophila. While only one kind of
pathogenic bacteria are to be found in our study.
It was well-known S. maltophilia that has resistance to most of the antibiotics.
S. maltophilia has wide resistance to the antibiotics, has only sensitivity to tri-
methoprim, gatifloxacin, and Levofloxacin [18, 19] has improved that S. maltophilia
has no salient point to the antibiotics of cafteroline. Levofloxacin and trimethoprim
were of the first choice for infection caused by S. maltophilia, others have not
significant difference [20]. The above-mentioned results in our research were
similar.
Scutellaria, honeysuckle, and polygonum cuspidate have been used traditionally

as medicinal herbs for the treatment of gastrointestinal infections in China. In this
study, the result showed that extract of the scutellaria, honeysuckle, and polygo-
num cuspidate had antibacterial effects to the S. maltophilia. In addition, several
studies showed that these medicinal herbs and extracts can be effective for treating
microbial infections. Zhang Bin [21] has shown scutellaria and honeysuckle has
different significant effect to resistance, the Edwardsiella ictaluri. The antibacterial
activity of rhus chinesis, scutellaria, and honeysuckle against Aerom on hydrophila
has been also reported [22]. Chinese medicinal herbs, such as Galla chinensis,
scutellaria, Pericarpium granat have synergistic inhibition for V ibrio splendidus,
Edwardsiellosis tarda, V ibrio parahaemolyticus, Aeromonas salmonicida, V ibrio
harveryi [23]. Schizandrae Fructus has also been found to have antimicrobial
activity against Bacillus spp, S. aureus, as well as viral infections [24]. At present,
it has not reported sensitivity to S. maltophilia by Scutellaria, honeysuckle, and
polygonum cuspidate. So these results will provide fundamental data for future
research.
Acknowledgments This research was financially supported by the Tianjin Agricultural Science
and Technology Achievements Transformation and Extension Project (Grant NO. 201004040).
References
1. Li Y, Yan XH, Chen JX et al (2006) Studies on the characteristics of pathogenic edwardsiella

tarda isolated from diseased scophthalmus maximus. Periodical Ocean Univ Chin 36(4):649-
654
2. Xue SX, Feng SM, Sun JS (2006) Isolation and identification of pathogenic bacteria in
swollen abdomen of cultured turbot (scophthalmus maximus) and flounder (paralichthys
olivaceus). Oceanologia Etlimnologia Sin 6(37):548-554
3. Zhang L, Wang J, Dong HJ et al (2011) The study of formalin-killed edwardsiella tarda
vaccination on the turbot (scophthalmus maximus). J Aquac 7(32):22–25
4. Fan RF, Wang YG, Liang Y et al (2011) Screening and identification of a eurythermal
probiotic bacterium in the intestine of cultured scophthalmus maximus. Prog Fishery Sci
1(32):40–46
5. Xue SX, Sun JS (2008) Detection of Pathogenic Bacterial (Edwardsiella Tarda and V ibrio
Alginolyticus) Associated with Swollen Abdomen of Cultured Turbot (Scophthalmus
maximus) and Flounder (Paralichthys olivaceus) by Nested PCR. Acta Hydrobiol Sin
6(32):856–860
6. Mouton JW (2003) Impact of pharmacodynamics on breakpoint selection for susceptibility
testing. Infect Dis Clin North Am 17:579–598
7. Garcia-Garrote F, Cercenado E, Bouza E (2000) Evaluation of a new system, VITEK2, for
identification and antimicrobial susceptibility testing of enterococci. J Clin Microbiol
38:2108–2111
8. Parekh J, Chanda SV (2008) Antibacterial activity of aqueous and alcoholic extracts of 34
indian medicinal plants against some staphylococcus species. Turk J Biol 32:63–71
9. Bruckner DA, Colonna P (1995) Nomenclature for aerobicand facultative bacteria. Clin
Infect Dis 21:263–272
772 X. Wu et al.
10. Palleroni NJ, Bradbury JF (1993) Stenotrophomonas, a new bacterial genus for xanthomonas
maltophilia. Int J Syst Bacterio l43:606–609
11. Marshall WF, Keating MR, Anhalt JP et al (1989) Xanthomonas maltophilia: an emerging
nosocomial pathogen. Mayo Clin Proc 54:1097–1104
12. Gutiérrez Rodero F, Masia MM, Cortés J et al (1996) Endocarditis caused by
stenotrophomonas maltophilia: case report and review. Clin Infect Dis 23:1261–1265
13. Cornwell EErd, Willey P, Belzberg H et al (1996) Characteristics of xanthomonas infections
in critically ill surgical patients. Am Surg 62:478-480
14. Papadakis KA, Vartivarian SE, Vassilaki ME et al (1997) Stenotrophomonas maltophilia
meningitis report of two cases and review of the literature. Clin Infect Dis 87:106–108
15. Vartivarian SE, Papadakis KA, Palacios JA et al (1994) Mucocutaneous and soft-tissue
infections caused by xanthomonas maltophilia. a new spectrum. Ann Intern Med
121:969–973
16. Geng Y, Wang K, Xiao D et al (2008) Pathologocal studies on channel catfish induced by
extracellular products of stenotrophomonas maltophilia. Acta Hydrobiol Sin 2(34):345–352
17. Huang Y, Wang K, Zheng J et al (2010) Preparation and characterization of monoclonal
antibodies against pathogenic stenotrophomonas maltophilia. Chin Vet Sci 40(9):907–912
18. Zhao Y, Liu Q, Xin X (2008) Identification and antimicrobial susceptibility test for
stenotrophomonas maltophilia. Chin J Mis diagn l8(28):6956-5957
19. Er H, Zhang Y, Wang J et al (2012) Distribution and antimicrobial susceptibility assay for
stenotrophomonas maltophilia. Chin J Clinicians (Electronic Edition) 6(11):3117–3118
20. Zhou T, Dai P, Xie Y et al (2006) Evaluation of the susceptibility test methods and analysis
of the antimicrobial resistance of stenotrophomonas maltophilia. Lab Med 21(1):25–27
21. Zhang B, Hang T, Chen M et al (2010) Antimicrobial susceptibility test and bacteriostatic of
chinese herbals to the edwardsiella ictaluri. Fish Sci Technol Inf 37(6):282–287
22. Cao L, Li Y (2009) Chinese medicinal herbs sensitivity test on the pathogen of bacterial
septicemia from ictalurus punctatus in vitro. J Hydroecology 2(1):95–97
23. Li H, LI Q, Fu L (2011) Antibacterial action of several chinese herbal medicines to major
marine pathogenic bacteria. J Dalian Ocean Univ 1(26):6-11
24. Sinclair S (1998) Chinese herbs: a clinical review of astragalus, ligusticum, and schizandrae.
Altern Med Rev 3:338–344
Chapter 80
Lichen: A Potential Anticancer Officinal
Resource
Meirong Ren, Xinli Wei and Feng Xu
Abstract Many natural products, which derived from plants, animals, and
microorganisms, have been isolated as bioactive compounds with great therapeutic
potential for cancer, but as a fungus, lichen has long been neglected in this area.
The special symbiotic form of fungi and algae and worldwide distribution even
extreme habitat of lichen contribute to its biological and chemical diversity, so,
lichen becomes an amazing resource for the discovery of new anticancer drugs.
The aim of this review is to show the value of lichen as a potential resource of
anticancer drugs, especially highlight several lichen metabolisms and their
derivatives, which can show the potentials to inhibit cellular proliferation or
cytotoxicity and trigger apoptosis of cancer cells. To identify the new lead-com-
pounds from lichen and elucidate the active principles with therapeutic potential
for cancer, it is essential to establish a high-throughput screening program and
dedicated collaboration among lichenologists, chemists, pharmacologists, and
biologists.
Keywords Anticancer Cytotoxicity Lichen Secondary metabolisms
M. Ren (&)
College of Life Science, Southwest Forestry University, Kunming 650224, People’s
Republic of China
e-mail: xiaohei504@hotmail.com
F. Xu
HeBei ZhiTong Biological Pharmaceutical Co., Ltd, Baoding 072656, People’s Republic of
China
X. Wei (&)
State Key Laboratory of Mycology, Institute of Microbiology, Chinese Academy of
Sciences, Beijing 100101, People’s Republic of China
e-mail: weixl@im.ac.cn
774 M. Ren et al.
80.1 Introduction
Cancer is a class of disease characterized by out-of-control cell growth. It is a

major health problem in the world, which is the second most common cause of
death disease for all ages [1]. The number of new cancer cases diagnosed has
been increasing steadily in recent decades, while the mortality of cancer patients
is decreasing. Earlier diagnosis and various treatments, especially chemotherapy,
have improved cure rates for malignancy and reduced risk of death. Natural
products and their derivatives, especially those from plants, animal, and
microorganisms, have long been a traditional source of drug which contributes
not less than 60 % drugs. Some of them, such as vinca alkaloid, vincristine,
taxol, fumiquinazolines, and rebeccamycin, etc. [2–4], show the strong anti-
cancer activity.
Lichens are a unique life form of symbiosis composed of fungi and algae and or
cyanobacteria. As pioneers, lichens show a worldwide distribution even various
extreme environmental conditions which were unfavorable to the survival of the
individual partners, from arctic to tropical regions, and from the plains to the
highest mountains (approximately 8 % of terrestrial ecosystems are lichen-domi-
nated) [5, 6]. It is not known how many species inhabit the earth; however, it is
becoming increasingly clear that the number of microbial species is many times
larger than estimated. For example, as conservatively estimated, there would be at
least 1.5 million species of fungi [7, 8], but up to now only 65,000 species are
known [9], accounting for less than 5 % of the total. The known lichen species is
about 13,500–17,000 [10], which only account for about 1 % of the total fungi
species.
In response to fancy physiological character and strong adaptability to extreme
conditions, there are great variety of secondary metabolites which are often
structurally unique produced by lichen, among which only a small number were
found in other fungi and higher plants [11]. Over 700 lichen metabolites have been
identified so far [12], only few of which are commercially available and the most
of known compounds are poorly investigated for their bioactivities and medicinal
potential [13]. Therefore increasing research on lichen natural resource may
provide good results for exploiting and developing valuable natural products
which benefit for human.
In 2000, 57 % of all drugs in clinical trails for cancer were either natural
products or their derivatives. Most of the important antitumor compounds used for
chemotherapy of tumors are microbial-produced antibiotics [14]. As fungi, for the
past 20–30 years, some studies with lichen, even with the limited screening effort,
have indicated the frequent occurrence of metabolites with antibiotic [15], anti-
bacterial [16], antiviral [17], anti-HIV [18], antiproliferation [19], and antioxidant
[20] properties. Recently, many researchers have been particularly interested in the
antineoplastic activities of lichen and have obtained some promising and inter-
esting results, which will be discussed in detail in this review.
80 Lichen: A Potential Anticancer Officinal Resource 775
80.2 The History of Lichen as Traditional Medicine
Throughout the ages, lichens have been used for various purposes, in particular as
dyes, perfumes, and remedies in folk medicines. The topical use of lichen extracts
has its origin in ancient Egyptian times [21]. The most important application of
lichens is to treat diseases of animals and humans as traditional medicine, which
can be traced back to the 18th dynasty (1700-1800 BC) when Evernia furfuracea
(L.) Mann was first used as a drug [22]. Wei [23] published the book ‘‘Lichens
Officinales Sinenses’’ to describe the lichen usage as Chinese traditional medicine.
Spanish folk medicine has documented use of lichens in various medical ailments.
Tea prepared from Flavocetraria nivalis (L.) Kärnefelt & Thell is used in the
treatment of motion-sickness and heart attacks of by natives of Qollahuaya
Andeans in Poland [24]. Lethariella zahlbruckneri (Du Rietz) Krog can be found
only at high elevation and has been used for long term as a traditional tea and
medicine in Tibet, and for lowing blood pressure and body fat in Yunnan of China.
Local ethnic people believed it to be useful for anti-inflammation [25]. Cetraria
islandica (L.) Ach. commonly known also as ‘Islandic moss’ is probably one of
the best known alpine lichens used in folk medicine. Until now, it is still sold
annually in European pharmacies for treatment of minor ailments. This species is
traditionally used as reconstituent after tuberculosis and anticatarrhal by the Ital-
ians [26]. Studies in Germany developed tablets of C. islandica extracts containing
polysaccharides and lichen acids, along with pediatric lozenges containing C.
islandica for the prophylaxis of coughs and catarrh [27]. Ramalina thrausta (Ach.)
Nyl. is used in Finland for treatment of wounds, athlete’s foot, or other skin
diseases and taken to relieve sore throat and toothache [28].
80.3 Cytotoxicity/Antiproliferation on Cancer Cell

of Lichen Extract
Some lichen species have been used in screening cytotoxicity since early 1980s.
The results obtained guaranteed for the potential application of these lichen in the
near future. The cytotoxicity/antiproliferation of lichen has been studied in various
cell lines and primarily cultured cells, including multiple tumor cell lines and
normal cells. Recent reviews have discussed the anticancer pharmaceutical
potential of lichen substances [27, 29, 30].
Since the distribution of bioactive compounds differs according to the lichen
used, different solvents were used to extract these compounds from different
lichens correspondingly. The methanol extract of Xanthoria parietina (L.) Beltr.
showed potent antimyeloma activity against P3X63-Ag8.653 cell line [31]. The
acetone extract of L. zahlbruckneri exhibited significant antiproliferative activity
by time- and dose-dependent manners and inducing apoptosis on HT-29 cell lines
by caspase-dependent and -independent pathways [19]. A potent cytotoxic activity
776 M. Ren et al.
was also reported for the hexane extract of Parmelia caperata (L.) Ach. against
different cancer cell lines and the diethyl ether extract of Cladonia convoluta
(Lamkey) Anders demonstrated high cytotoxic activity (IC50 \ 1 lg/ml) against
3LL cell line [32]. According to wide screening of cytotoxicity of lichen extracts,
it seems that cancer cell growth inhibitions can vary within the lichen extract,
solvent used for extraction.
A study monitored cytotoxic activity on 69 species of lichens from New Zealand
and showed their inhibitory effect against two cell lines: murine leukemia cells
P388 and monkey kidney cell BSC [33]. A high proportion of the lichen extracts
showed cytotoxic activity against one or both of the mammalian cell lines. Bézinvin
et al. reported that eight lichens C. convoluta, C. rangiformis Hoffm., Ramalina
cuspidata (Ach.) Nyl., Platismatia glauca (L.) W.L. Culb. & C.F. Culb., Parmelia
perlata (Huds.) Ach., P. caperata, Usnea rubicunda Stirt., Evernia prunastri (L.)
Ach. were extracted successively with n-hexane, diethyl ether, and methanol and
demonstrated interesting activities particularly on human cancer cell lines [32].
Also, Mitrović [20] evaluated methanol extracts of 5 different species and deter-
mined potent antiproliferative activity. Recently, Ranković [34] studied the anti-
cancer activity of extracts from Cladonia furcata, Lecanora atra, L. muralis. All
extracts were found to be strong anticancer activity toward both cell lines with IC50
values ranging from 8.51 to 40.22 lg/ml. Thus, the screening results of crude
extracts produced very useful information that lichen species mainly focuses on
the family Parmeliaceae Zenker, Cladoniaceae Zenker, Lecanoraceae Körb.,
Lobariaceae Chevall., Ramalinaceae C. Agardh, Sphaerophoraceae Fr.,
Teloschistaceae Zahlbr., Umbilicariaceae Chevall. However, it is difficult to
determine the contribution of individual components for the overall anticancer
effect with crude extract of lichen. Often, the activity of the extracts may be the
result of a synergistic effect of several compounds.
80.4 Anticancer of Lichen Metabolites
80.4.1 Usnic Acid
Usnic acid is the most extensively studied lichen metabolite since its first isolation
in 1844 and was originally discovered as a mycobacterial product with weak
antifungal activity against rust fungi. Antitumor activity of usnic acid was shown
for the first time by Kupchan and Kopperman (1975) against Lewis lung carci-
noma in mice [35]. Since then, many researchers pay more attention to the anti-
cancer effect of usnic acid. Expression of caspase-3 revealed induction of
apoptosis by usnic acid on L1210 cell line [32, 36]. Unchanged morphology in
microtubules or non-increase in the mitotic index on two cancer cell lines sug-
gested that the antineoplastic activity of usnic acid is not related to alterations in
the formation and/or stabilization of microtubules [37]. Usnic acid derivative did
not escape from the massive research to identify new potential anti-tumor com-
pounds. Cytotoxicity of nine usnic acid–amine conjugates was evaluated on
murine and human cancer cell lines. The author found the more active derivative
induced apoptosis via independent of the polyamine transport system (PTS) and
diaminooctane chain was a good vector to improve the cytotoxicity of usnic acid
[36].
80.4.2 Polysaccharides
Lichens have been used for medicinal purposes and are beneficial to some extent
being correlated with polysaccharides. Among the known lichen species, less than
100 species have been investigated for polysaccharides [38]. As plant and other
natural resource of polysaccharides, lichen polysaccharides have been known to
exert antitumor activity [39]. Japanese scientists were full of enthusiasm at this
area and their research show the lowering of non-toxic characteristic of lichen
polysaccharides. A lichen-derived polysaccharide CFP-2 reduced the viability of
HL-60 and K562 cells due to apoptotic pathway and telomerase activity, sug-
gesting its possible therapeutic potential against cancer [40].
80.4.3 Depsides and Depsidones
Depsides and depsidones, a class of compounds formed by condensation of a

phenolic carboxylic acid (such as gallic acid) with a similar compound, have been
isolated from plants, but most often found in lichens. Four depsides and nine
depsidones got from lichen were tested along with tridepside gyrophoric acid for
their cytotoxicity on lymphocytes. Compound pannarin, 1’-cloro pannarin, and
sphaerophorin have a cytotoxic effect stronger than positive control colchicine.
The activity of other compounds is moderate in degree except vicanicin and va-
riolaric acid. The results could provide useful information for determination of the
minimum structural requirements for the production of biological response by
these compounds, indicating that the presence of COOH or CHO groups adjacent
to an OH group appears to be indispensable [41]. Pannarin and sphaerophorin are
also reported to inhibit cell growth and to induce apoptosis in human prostate
carcinoma DU-145 [42] and human melanoma M14 cells [43]. Lobaric acid, an
orcinol depsidone isolated from Stereocaulon alpinum Laur., was shown to cause a
significant reduction of DNA synthesis on three malignant cell lines (from erythro-
leukemia) [44]. Gissurarson [45] reported the inhibition of cysteinyl-leukotrienes,
which are potent mediators of inflammation and constrictors of smooth muscles in
humans, with an effective dose of 5.5 lM.
778 M. Ren et al.
80.4.4 Others
A diphenyl ether, buellin, present in Diploicia canescens (Dicks) A Massal was

also found to act as cytotoxicity against B16 and HaCaT cell lines
(IC50 = 0.25 lM for B16 murine melanoma cell line, lower than IC50 = 0.28 lM
of positive control etoposide) [46]. The antiproliferative activities of protoli-
chesterinic acid (butyrolactone) isolated from Cetraria islandica showed inhibi-
tion of growth of breast cancer cell lines and mitogen stimulated lymphocytes [43].
Ernst-Russell [47] reported the isolation of hybocarpone, a naphthazarin-derived
pentacycle, from the cultured lichen mycobiont of Lecanora hybocarpa (Tuck).
Brodo which was collected from woodland in Louisiana, USA. It was found to
possess potent cytotoxicity against the murine mastocytoma P815 cell line and
IC50 value of 0.15 lg/ml. A new aryl-hydrazide L-glutamic acid derivative, pyg-
meine, was isolated from amethanolic extract of Lichina pygmaea, marine lichen.
The ortho-, meta-, and para-hydroxyl isomers along with their respective benzyl
intermediates, and a natural methoxylated analog were synthesized and cytotox-
icity of them were evaluated on murine and human melanoma cells (B16, A375).
The para-hydroxyl isomer was found to be the most active (IC50 = 1.6 lM) on
B16 cells [48]. Liu [49] and his colleague isolated the retigeric acid B, a natural
pentacyclic triterpenic acid from lichen and found retigeric acid B exerted its
antitumor effect by targeting the NF-kB pathway in prostate cancer cells, and this
could be a general mechanism for the antitumor effect of retigeric acid B in other
types of cancers as well.
80.5 Conclusions
The above-mentioned activities clearly indicated the potential of lichen com-

pounds for pharmaceutical purposes, but some properties of lichen metabolites still
need consideration. Structure of more than 700 lichen substances are available, but
due to the slow growth of lichen, their availability is insufficient in quantity and
difficulty in large-scale industrial production, lichens were frequently ignored by
pharmaceutical industries. As known, the secondary metabolites of lichen which
are deposited on the surface of mycelium were usually produced by fungi,
therefore it become possible that cultured mycobionts could replace the lichen. In
addition, advances in high-throughput screening technologies, have been a dra-
matic increasing in interest by the pharmaceutical and biotechnology industries.
Although many of lichen products are not likely to become therapeutics, the
information gained from studying them is likely lead to the development and
understanding of novel molecular targets and chemical synthesis or chemical
modification of natural metabolites, which in turn may lead to the development of
new classes of therapeutic agents. As alternative method, computer drug design
and the transfer of genes responsible for production of lichen metabolites may help
development of new synthetics with enhanced pharmacological potency. Even-

tually, a collaborative effort among lichenologists, chemists, pharmacologists, and
biologists should be another pivotal point for the new drug development.
Acknowledgments This work was financially supported by the Scientific Research Foundation
for Ph.D, Southwest Forestry University and the Youth Innovation Promotion Association,
Chinese Academy of Sciences
References
1. Micheli A, Mugnol E, Krogh V et al, the Europreval Working Group (2002) Cancer
prevalence in European reistry areas. Ann Oncol 13:840-865
2. Da Rocha AB, Lopes RM, Schwartsmann G (2001) Natural products in anticancer therapy.
Curr Opin Pharmacol 1:364–369
3. Sun YY, Xun KL, Wang YT et al (2009) A systematic review of the anticancer properties of
berberine a natural product from Chinese herbs. Anti-Canc D 20:757–769
4. Sánchez C, Zhu LL, Braña AF et al (2005) Combinatorial biosynthesis of antitumor
indolocarbazole compounds. PANS 102:461–466
5. Nash TH (1996) Lichen biology. Cambridge: Cambridge University Press 1–7
6. Guschina IA, Dobson G, Harwood JL (2003) Lipid metabolism in cultured lichen photobionts
with different phosphorus status. Phytochem 64:209–217
7. Hawksworth DL (1991) The fungal dimension of biodiversity: magnitude, significance, and
conservation. Mycol Res 95:641–655
8. Hawksworth DL (2001) The magnitude of fungal diversity: the 1.5 million species estimate
revisited. Mycol Res 105:1422–1432
9. DePriest PT (2004) Early molecular investigations of lichen-forming symbionts: 1986-2001.
Annu Rev Microbiol 58:273–301
10. Nash TH (2008) Lichen biology, 2nd edn. Cambridge University Press, New York
11. Stocker-Wörgötter E (2008) Metabolic diversity of lichen forming ascomycetous fungi:
culturing, polyketide and shikimate metabolite production, and PKS genes. Nat Prod Rep
25:188–200
12. Huneck S (1999) The significance of lichens and their metabolites. Naturwissenschaften
86:559–570
13. Bézivin C, Tomasi S, Lohézic-Le Dévéhat F, Boustie J (2003) Cytotoxic activity of some
lichen extracts on murine and human cancer cell lines. Phytomed 10:499–503
14. Tomasz M (1995) Mitomycin C: small, fast and deadly (but very selective). Curr Biol
2:575–579
15. Lauterwein M, Oethinger M, Belsner K et al (1995) In vitro activities of the lichen secondary
metabolites vulpinic acid, (+)-usnic acid, and (–)-usnic acid against aerobic and anaerobic
microorganisms. Antimicrob Agents Chemother 39:2541–2543
16. Honda NK, Pavan FR, Coelho RG et al (2010) Antimycobacterial activity of lichen
substances. Phytomedicine 17:328–332
17. Fazio AT, Adler MT, Bertoni MD et al (2007) Lichen secondary metabolites from the
cultured lichen mycobionts of teloschistes chrysophthalmus and ramalina celastri and their
antiviral activities. Z Naturforsch C 62:4360–4365
18. Neanati N, Hong HX, Mazumder A et al (1997) Depsides and depsidones as inhibitors of
HIV-1 integrase: discovery of novel inhibitors through 3D database searching. J Med Chem
40:942–952
19. Ren MR, Hur JS, Seo KI et al (2009) Anti-proliferative effects of Lethariella zahlbruckneri
extracts in HT-29 human colon cancer cells. Food Chem T47:2157–2162
780 M. Ren et al.
20. Mitrović T, Stamenković S, Marković S et al (2011) Antioxidant, antimicrobial and

antiproliferative activities of five lichen species. Int J Mol Sci 12:5428–5448
21. Mitrović T, Stamenković S, S.tojičić D et al (2011) Lichen as source of versatile bioactive
compounds. Biolog Nys-san 2:1-6
22. Zambare VP, Christopher LP (2012) Biopharmaceutical potential of lichens. Pharm Biol
50:778–798
23. Wei JC, Wang XY, Hou JL et al (1982) Lichenes officinales sinenses. Science Press, Beijing
24. Bastien JW (1983) Pharmacopoeia of the qollahuaya andeans. J Ethnopharmacol 8:97–111
25. Wang LS, Takao N, William LC et al (2001) Ethnic uses of lichens in Yunnan, China.
Bryologist 104:345–349
26. Lokar LC, Poldini L (1998) Herbal remedise in the traditional medicine of the Venezia Giulia
Region (north east Italy). J Ethnophar 22:231–178
27. Podterob AP (2008) Chemmical composition of lichen and their medical applications. Pharm
Chem J 42:32–38
28. Vartia KO (1973) Antibiotics in lichens. In: Ahmadjian V, Hale ME (eds) The lichens.
Academic Press, New York 547–569
29. Boustie J, Tomasi S, Grube M (2011) Bioactive lichen metabolites: alpine habitats as an
untapped source. Phytochem Rev 10:287–307
30. Müller K (2001) Pharmaceutically relevant metabolites from lichens. Appl Microbiol
Biotechnol 56:9–16
31. Triggiani1 D, Ceccarelli1 D, Loppi S et al (2009) Antiproliferative activity of lichen extracts
on murine myeloma cells. Biologia 64:59-62
32. Bézinvin C, Tomasi S, Boustie J et al (2003) Cytotoxic activity of some lichen extracts on
murine and human cancer cell lines. Phytomed 10:499–503
33. Perry NB, Benn MH, Tangney RS et al (1999) Antimicrobial, antiviral and cytotoxic
activikty of New Zealand lichens. Lichenologi 31:627–636
34. Ranković BR, Kosanić MM, Stanjkvić TP (2011) Antioxidant, antimicrobial and anticancer
activity of the lichens Cladonia furcata, Lecanora atra and Lecanora muralis. CAM
11:97–104
35. Kupchan M, Kopperman HL (1975) Usnic acid: tumor inhibitor isolated from lichens.
Experientia 31:625
36. Bazin MA, Le Lamer AC, Delcros JG (2008) Synthesis and cytotoxic activities of usnic acid
derivatives. Bioorg Med Chem 16:8737–8744
37. O’Neill MA, Mayer M, Appleyard VCL et al (2010) Does usnic acid affect microtubules in
human cancer cells? Braz. J. Biol 70:659–664
38. Olafsdottir ES, Lngólfsdottir K (2001) Polysaccharides from lichens: structural
characteristics and biological activity. Planta Med 67:199–208
39. Whistler RL, Bushway AA, Singh PP (1976) Noncytotoxic, antitumour polysaccharides. Adv
Carbohydr Chem Biochem 32:235–275
40. Chihara G, Hamuro J, Maeda YY (1970) Fractionation and purification of the
polysaccharides with marked antitumor activity, especially lentinan, from lentinus edodes
(berk.) sing. (an edible mushroom). Cancer Res 30:2776–2781
41. Correche E, Carrasco M, Enriz D et al (2002) Cytotoxic screening activity of secondary
lichen metabolites. Acta Farm Bonaerense 4:273–278
42. Russo A, Piovano M, Lombardo L (2006) Pannarin inhibits cell growth and induces cell
death in human prostate carcinoma DU145 cells. Anti-canc D17:1163–1169
43. Ogmundsdottir HM, Zoega GM, Gissurarson SR (1998) Anti-proliferative effects of lichen-
derived inhibitors of 5- lipoxygenase on malignant cell-lines and mitogenstimulated
Lymphocytes. J Pharm Pharmacol 50:107–115
44. Haralsdottir S, Guolaugsdottir E, Ogmundsdóttir HM et al (2004) Anti-proliferative effects of
lichen-derived lipoxygenase inhibitors on twelve human cancer cell lines of different tissue
origin in vitro. Planta Med 70:1098–1110
45. Gissurarson SR, Sigurdsson SB, Ingólfsdóttir K et al (1997) Effect of lobaric acid on
cysteinyl- leukotriene formation and contractile activity of guinea pig taenia coli.
J Pharmacol Exp Ther 280:770–773
46. Millot M, Tomasi S, Boustie J et al (2009) Cytotoxic constituents of the lichen Diploicia
canescens. J Nat Prod 72:2177–2180
47. Ernst-Russell MA, Elix JA, Nash IIITH et al (1999) Hybocarpone, a novel cytotoxicity
naphthazarin derivative from mycobiont cultures of the lichen Lecanora hybocarpa.
Tetrahedr L 40:6321–6324
48. Roullier C, Chollet-Krugler M, Boustie J et al (2010) A novel aryl-hydrazide from the marine
lichen Lichina pygmaea: isolation, synthesis of derivatives and cytotoxicity assays. Bioorg
Med 20:4582–4586
49. Liu YQ, Hu XY, Lou HX et al (2012) Rentigeric acid B exhibits antitumor activity through
suppression of nuclear factor-kB signaling in Prostate cancer cells in vitro and in vivo. PLoS
ONE 7:1–11
Chapter 81
Clinical Significance of Screening
Impaired Glucose Tolerance in Essential
Hypertension Patients
Jun Zhu, Peiqing Feng, Shu Guo, Xinghua Liao, Jiajie Liu,
Junfang Zhang, Tingbao Yan, Yue Wang and Tong-Cun Zhang
Abstract Objective: Monitoring data of patients with essential hypertension

associated with impaired glucose tolerance then provide clinical basis for the
intervention of diabetes and reduce cardiovascular and cerebrovascular disease
risk factors. Method: Select 158 patients without sugar metabolic abnormalities
previously, whose fasting plasma glucose is \5.6 mmol/L and diagnosed as
essential hypertension. Results: After OGTT, in 158 patients, there are 99 cases
(62.7 %) with normal glucose tolerance, 45 patients (28.4 %) with impaired glu-
cose tolerance, and 14 cases (8.9 %) with confirming diabetes. Conclusion: The
primary hypertensive patients with impaired glucose tolerance abnormalities show
a high proportion in hypertensive patients. With metabolic syndrome, patients
should be monitored regularly and actively fasting glucose and after 2 h of OGTT
to detect and intervene in diabetes earlier, reduce the risk factors of severe car-
diovascular and cerebrovascular complications.
Keywords Diabetes Hypertension IGT OGTT
J. Zhu P. Feng
The First People’s Hospital of Qingdao Economic and Technological Development Zone,
Qingdao 266555, People’s Republic of China
J. Zhu P. Feng S. Guo X. Liao J. Liu T. Yan Y. Wang T.-C. Zhang (&)
J. Zhang
The Community Service Center of Tanggu Development Zone in Tianjin, Tianjin 300457,
784 J. Zhu et al.
81.1 Introduction
Metabolic abnormalities were observed in the early duration of hypertension,

previous studies found that patients with essential hypertension have significant
differences in TC, TG, HDL-C, blood insulin levels, and fasting plasma glucose
compared with normal ones [1]. Early detection of glucose tolerance abnormalities
and therapeutic intervention for hypertensive patients may reduce insulin resis-
tance in phase of impaired glucose tolerance [2, 3], which is key point to prevent
and delay the development of T2DM and reduce cardiovascular complications
[4–6]. In this study, blood sugar of essential hypertensive patients with normal
fasting plasma glucose was detected 2 h after OGTT, thus providing the basis for
intervention in the incidence of diabetes and reducing the risk factors of severe
complications of cardiovascular and cerebrovascular.
81.2.1 Object of Study
Investigate 586 cases of patients with essential hypertension tested by OGTT in

our hospital from May 2007 to 2008. Inclusion criteria: patients who have been
confirmed as essential hypertension by outpatient wards, fasting plasma glu-
cose \ 5.6 mmol/L, without regarding the merger of other cardiovascular and
cerebrovascular risk factors; outpatients with essential hypertension. Exclusion
criteria: acute cardiovascular and cerebrovascular complications, severe trauma
patients with infection; long-term diuretics used patients; long-term hormones
used patients; thyroid function, kidney function, urine, B-mode ultrasonography of
abdominal renal artery, adrenal CT, serum renin—angiotensin—aldosterone lev-
els, catecholamine, and other tests were carried out to rule out endocrine hyper-
tension, renal hypertension, renal vascular hypertension, secondary hypertension.
81.2.2 Methods
Try fasting plasma glucose and glucose 2 h after OGTT of eligible patients are
monitored by recommended method according to WHO. Patients whose glucose
C7.8 mmol/L 2 h after OGTT must be tested for the second time. If glucose
C11.1 mmol/L 2 h after the second OGTT, they are diagnosed as diabetes; plasma
glucose B7.8 mmol/L and C11.1 mmol/L 2 h after second OGTT are diagnosed as
abnormal glucose tolerance. The patients were divided into three groups according
to blood glucose results 2 h after the OGTT: glucose \7.8 mmol/L is the normal
group (NG group), plasma glucose \7.8 and C11.1 mmol/L is impaired glucose
81 Clinical Significance of Screening Impaired Glucose Tolerance 785
tolerance group (IGT group), glucose C11.1 mmol/L is the diabetes group (DM).
We selected NG group as the control. Data analyzed include age, BMI, systolic
blood pressure, diastolic blood pressure, uric acid, TG, TC, HDL-C, and influence
of HDL-C toward glucose 2 h after the OGTT.
Measurement data show as x ± S, count data expressed as a percentage, mea-

surement data using analysis of deviation.
81.3.1 Basic Situation of Patients
(Table 81.1) we selected includes 158 patients in which 88 cases (55.7 %) were
male patients and 70 cases (44.3 %) were female patients. There are 12 cases of
patients with coronary heart disease, 32 cases of cerebrovascular disease, 72 cases
of metabolic syndrome patients. In OGTT, 199 cases (62.7 %) of them are normal
in glucose tolerance, 45 cases (28.4 %) are IGT, 14 cases (8.9 %) are confirmed as
diabetes (Table 81.2).
81.3.2 Comparison of Risk Factors in Combined Patients

with Different Sugar Metabolic Status
Results showed that there were statistically significant differences among patients
of different glucose metabolism status like age, fasting plasma glucose, serum uric
acid, LDL-C level. Except for fasting plasma glucose, any other two groups were
statistically significant in the rest three groups (P \ 0.01). There is not statistical
Table 81.1 Basic situation Item Parameter

of Patients(x ± s)
Number (M/F) 88/70
Age (Year) 52.6 ± 13.2
Fasting plasma glucose mmol/L 4.8 ± 0.4
Systolic blood pressure mmHg 145.8 ± 20.0
Diastolic blood pressure mmHg 90.4 ± 13.5
BMI(kg/m) 26.5 ± 3.7
786 J. Zhu et al.
Table 81.2 Comparison of risk factors in combined patients with different sugar metabolic status
Item NG IGT DM P F
Age (Year) 51.5 ± 13.3 54.6 ± 12.7 56.0 ± 12.5 0.002 6.121
Fasting plasma glucose mmol/L 4.7 ± 0.4 4.9 ± 0.4 5.16 ± 0.3 0.000 27.552
Systolic blood pressure mmHg 144.1 ± 19.0 148.6 ± 20.9 151.9 ± 24.3 0.008 4.887
Diastolic blood pressure mmHg 90.2 ± 13.6 90.5 ± 12.9 92.7 ± 15.3 0.532 0.633
BMI(kg/m) 26.4 ± 3.8 26.6 ± 3.4 26.7 ± 3.3 0.811 0.210
UA 326.0 ± 90.7 348.9 ± 95.4 340.7 ± 92.2 0.027 3.644
TG 1.8 ± 1.2 1.8 ± 1.0 1.8 ± 0.9 0.871 0.138
TC 4.8 ± 0.8 4.8 ± 0.9 5.0 ± 1.0 0.284 1.261
HDL-C 1.0 ± 0.2 1.0 ± 0.3 1.0 ± 0.2 0.993 0.007
LDL-C 3.1 ± 0.8 3.2 ± 0.9 3.9 ± 0.4 0.001 7.412
significance in age, systolic blood pressure, LDL-C level between the DM group,
and the NG group with the NG group (P [ 0.05).
81.4 Discussion
Impaired glucose tolerance (IGT) population is at high risk of diabetes. IGT

patients are prone to develop into diabetes, IGT is also the independent risk factor
for cardiovascular and cerebrovascular complications [7–10]. The DECODE study
further confirmed that relationship of coronary heart disease mortality and 2-hour
postprandial blood glucose are more close than fasting plasma glucose. Early
detection of glucose tolerance abnormalities and therapeutic intervention for
hypertensive patients may reduce insulin resistance in phase of impaired glucose
tolerance, which is key point to prevent and delay the development of T2DM and
reduce cardiovascular complications.
In this study, there are 45 cases of impaired glucose tolerance in all selected
hypertensive patients accounted for 28.4 %, diagnosed diabetes cases accounted
for 8.9 %, indicating that the proportion of abnormal glucose metabolism in
hypertensive patients is relatively high, especially over the age of 35. Difference
between NG group and IGT group is statistically significant and also statistically
significant between NG group and DM group, and the trend for glucose is growing,
illustrating that the abnormality of fasting plasma glucose and glucose after 2 h of
OGTT are closely related.
The results indicated that high level of systolic blood pressure, uric acid, and
LDL-C in patients with abnormal glucose metabolism may be associated with their
own metabolic abnormalities. This study shows that there was no significant dif-
ference between the DM group and the NG group in age, systolic blood pressure,
LDL-C level, which may be caused by a high proportion of metabolic syndrome in
selected populations.
81 Clinical Significance of Screening Impaired Glucose Tolerance 787
Results of glucose metabolism survey in Chinese hospitalized patients with

coronary heart show that coronary heart disease combined with impaired glucose
tolerance and patients with high blood sugar after 2 h of single OGTT accounted
for 54.6 % [11–17]. Investigation and screening results of the Chinese hyperten-
sive glucose metabolism status in 218 cases of patients whose fasting plasma
glucose was \5.6 mmol/L show that 2 h after OGTT patients whose plasma
glucose C7.8 mmol/L accounted for 22 % [18–20].
81.5 Conclusion
The above studies have shown patients of primary hypertension with no history of
diabetes in newly diagnosed glucose metabolism abnormalities are very common.
For hypertensive patients, monitoring fasting plasma glucose, especially by
OGTT, has significant meaning in understanding of glucose metabolism status,
early detection of hypertensive patients with metabolic syndrome, and intervention
of abnormal glucose metabolism positively. Meanwhile, it may reduce the risk
factors of cardiovascular and cerebrovascular disease more effectively.
References
1. Arauz-Pacheco C, Parrott MA, Raskin P, American Diabetes Association. (2004)

Hypertension management in adults with diabetes. Diabetes Care. 27(Suppl 1):S65–S67
2. Wang J, Geiss LS, Cheng YJ et al (2011) Long-term and recent progress in blood pressure
levels among U.S. adults with diagnosed diabetes, 1988–2008. Diabetes Care
34(7):1579–1581
3. UK Prospective Diabetes Study Group (1998) Tight blood pressure control and risk of
macrovascular and microvascular complications in type 2 diabetes: UKPDS 38BMJ
317(7160):703–713
4. King H, Aubert RE, Herman WH (1998) Global burden of diabetes, 1995–2025: prevalence,
numerical estimates, and projections. Diabetes Care 21(9):1414–1431
5. Bartnik M, Malmberg K, Hamsten A et al (2004) bnormal glucose tolerance—a common risk
factor in patients with acute myocardial infarction in comparison with population-based
controls. J Intern Med 256(4):288–297
6. Gu D, Reynolds K, Duan X, et al InterASIA Collaborative Group (2012) Erratum to:
Prevalence of diabetes and impaired fasting glucose in the Chinese adult population:
International collaborative study of cardiovascular disease in Asia (InterASIA). Diabetologia
7. Marques-Vidal P, Bastardot F, von Känel R et al (2012) Association between circulating
cytokine levels, diabetes and insulin resistance in a population-based sample (CoLaus study),
Clin Endocrinol (Oxf). doi: 10.1111/j.1365-2265.2012.04384.x
8. Yamagishi S (2011) Cardiovascular disease in recent onset diabetes mellitus. J Cardiol
57(3):257–262
9. Bryhni B, Arnesen E, Jenssen TG (2010) Associations of age with serum insulin, proinsulin
and the proinsulin-to-insulin ratio: a cross-sectional study. BMC Endocr Disord 10:21
788 J. Zhu et al.
10. Nathan AA, Mohan V, Babu SS et al (2011) Glucose challenge increases circulating
progenitor cells in Asian Indian male subjects with normal glucose tolerance which is
compromised in subjects with pre-diabetes: a pilot study. BMC Endocr Disord 11:2
11. Coutinho M, Gerstein HC, Wang Y et al (1999) The relationship between glucose and
incident cardiovascular events. A metaregression analysis of published data from 20 studies
of 95,783 individuals followed for 12.4 years. Diabetes Care 22(2):233–240
12. Epidemiology Study Group (1998) Will new diagnostic criteria for diabetes mellitus change
phenotype of patients with diabetes? Reanalysis of European epidemiological data. DECODE
Study Group on behalf of the European Diabetes BMJ. 8;317(7155):371–375
13. Bartnik M, Malmberg K, Norhammar A et al (2004) Newly detected abnormal glucose
tolerance: an important predictor of long-term outcome after myocardial infarction. Eur Heart
J 25(22):1990–1997
14. Norhammar A, Tenerz A, Nilsson G et al (2002) Glucose metabolism in patients with acute
myocardial infarction and no previous diagnosis of diabetes mellitus: a prospective study.
Lancet 359(9324):2140–2144
15. Bartnik M, Rydén L, Ferrari R et al (2004) Euro heart survey investigators. the prevalence of
abnormal glucose regulation in patients with coronary artery disease across Europe. The euro
heart survey on diabetes and the heart. Eur Heart J 25(21):1880–1890
16. Hashimoto K, Ikewaki K, Yagi H et al (2005) Glucose intolerance is common in Japanese
patients with acute coronary syndrome who were not previously diagnosed with diabetes.
Diabetes Care 28(5):1182–1186
17. Choi KM, Lee KW, Kim SG et al (2005) Inflammation, insulin resistance, and glucose
intolerance in acute myocardial infarction patients without a previous diagnosis of diabetes
mellitus. J Clin Endocrinol Metab 90(1):175–1780
18. DeFronzo RA, Tobin JD, Andres R (1979) Glucose clamp technique: a method for
quantifying insulin secretion and resistance. Am J Physiol 237(3):E214
19. Chiu KC, Cohan P, Lee NP et a1 (2000) Insulin sensitivity differs among ethnic groups with a
compensatory response in IS-cell function Diabetes Care 23:1353
20. DaYH ChangYP, Jin MY (2006) The relationship between coronaryartery disease and
abnormal glucose regulation in China: the ChinaHeart Survey. Eur Heart J 27:2573–2579
Chapter 82
Cardiac Hypertrophy-Specific Genes are
Synergistic Activated by Myocardin
and CREB-binding protein (CBP) p300
Zhenyu Wang, Xuehua Zhao, Mingzhe Li, Dongsun Cao

and Tong-Cun Zhang
Abstract Myocardin is a remarkably potent transcriptional co-activator expressed

in a broad range of embryonic and adult tissues, and it can induce cardiac
hypertrophy. However, it remains poorly understood about the effects of myo-
cardin in cardiac hypertrophy. Here, we show that the p300, a histone acetyl-
transferase, enhanced transcriptional activity of myocardin. Conversely, class II
histone deacetylases HDAC5 suppress cardiac-special genes activation by myo-
cardin and p300. These findings point that myocardin maybe a nexus for regulation
of cardiac hypertrophic-special genes expression by changes in chromatin acety-
lation. Our results provide novel evidence to explore the roles of myocardin and
their co-factors in cardiac hypertrophy for the future studies.
Keywords Myocardin p300 Transactivation Cardiac hypertrophy
Zhenyu Wang and Xuehua Zhao are the two co-first authors.
Z. Wang M. Li D. Cao T.-C. Zhang (&)

Institute of Life Science, Wuhan University of Science and Technology,
Wuhan 430065, China
e-mail: zhangtongcun@wust.edu.cn
Z. Wang
e-mail: wangzhenyu@wust.edu.cn
X. Zhao M. Li
Department of Biological Chemistry, College of Medical, Wuhan University of Science
and Technology, Wuhan 430065, China
790 Z. Wang et al.
82.1 Introduction
Hypertrophy is a principal response of the heart to overload from any causes,

which include myocardial infarction, dilated cardiomyopathy, valvar heart disease,
and hypertension [1]. At the cellular level, the characteristics of cardiac hyper-
trophy includes that cell size and protein synthesis is increased, and a set of fetal
cardiac genes, which are normally expressed in the heart only before birth, are
reactivated [2–4]. It suggests that the transcriptional control program of cardiac
fetal genes may be redeployed to regulate hypertrophic cardiac growth. However,
the molecular mechanisms that regulate cardiac hypertrophy remain poorly
understood over the past years.
Serum response factor, SRF, a protein expressed in all tissues and containing
conserved MADS (MDM1, agamous, deficiens, SRF) domain, is required for
specification of muscle tissue lineages, such as cardiac and smooth muscle [5, 6].
SRF binds CArG box, a highly conserved cis-regulatory element CC(A/T)6GG,
and existing in promoters of target genes include cardiac and smooth muscle-
specific genes which encodes atrial natriuretic factor (ANF), a-actin, myosin heavy
chain (cardiac-MHC), and so on, and plays key role in the expression of these
genes [7, 8]. Except binding to specific DNA sequence, SRF can also interact with
a wide variety of cell-restricted and/or signal-dependent accessory co-factors.
Until now, myocardin may be the most potent co-factor of the SRF-associated
proteins identified [9]. Myocardin is the strongly transcriptional coactivator
expressed specifically in cardiac muscle and smooth muscle cells (SMCs) during
postnatal development, and is required for cardiomyocyte survival and mainte-
nance of heart function [10]. Myocardin interacts with SRF, and then binds to
CArG box motifs to synergistically activate expression of cardiac and smooth
muscle-specific genes [8–12], then induces cardiomyocyte hypertrophy [13]. But
currently, we still know relatively little about the function of myocardin in the
heart and its hypertrophy.
Chromatin remodeling and histone modifications, e.g., histone acetylation/
deacetylation play essential roles in heart development and disease by repro-
gramming gene expression under different pathophysiological conditions [14].
CREB-binding protein (CBP) p300, the most extensively studied histone acetyl-
transferases (HATs) in muscle, is required for heart muscle development and
hypertrophy [15]. The study showed that CBP can be recruited to the SRFmyo-
cardin complex, and acetylates nucleosomal histones surrounding the SRF-binding
site, and transactivates differentiation marker genes of SMCs [16]. In cardiac
hypertrophy, the interaction between myocardin and p300 and their effects remain
poorly understood.
In our studies, we investigated the effect how p300 regulates cardiac hypertro-
phy-specific genes transcription activated by myocardin. Luciferase reporter assays
illustrated that p300 significantly increased synergistic activity of ANF-promoter,
a-actin-promoter, and MHC-promoter with myocardin in COS-7 cells and neonatal
rat myocytes. Furthermore, we show that co-transfection of myocardin and p300 in
82 Cardiac Hypertrophy-Specific Genes 791
neonatal rat cardiomyocytes could significantly upregulate cardiac hypertrophic

gene expression. This study indicates that myocardin and p300 might combine
together and play an important role in cardiac hypertrophy.
82.2.1 Plasmids
Plasmids, which were used in this study, have all been reported previously [13, 16],
and the expressive plasmid, pcDNA3.1(-)(Invitrogen), was used as a control.
82.2.2 Preparation of Primary Neonatal Rat Myocytes
Cultured cardiomyocytes were obtained from 1–3-day-old SD rats with the

following modifications. Briefly, the ventricles were isolated, dissected from major
vessels, and cut into small pieces. The heart tissues were then digested through
multiple rounds in phosphate buffered solution (PBS), pancreatin (Sigma), and
100 units/mL collagenase (GIBCO) at 37 8C for 15 min. After centrifugation, the
cells were resuspended in DMEM/F12 (HyClone) containing 20 % fetal bovine
serum (FBS). Afterward, the cells were differentially plated for 1 h to remove
contaminating nonmyocytes, and were then plated on dishes with a density of
1 9 106 cells/mL. Cardiomyocytes were cultured in medium supplemented with
20 % FBS for 12 h at 37 8C in a 5 % CO2 incubator and changed to serum-free
DMEM/F12 before transfections and/or treatments.
82.2.3 Transient Transfection and Luciferase Reporter

Assays
COS-7 cells and cardiomyocytes were seeded at 1.5 9 104 cells/cm2 onto 24-well
plates approximately 12 h before transfection. Plasmids were transfected into cells
using Fugene HD (Roche Applied Science). 10 ll of extracts (100lL/well) were
prepared for luciferase activity assays by using a luciferase reporter assay system
according to the manufacturer’s directions (Promega). Report gene luciferase
activities were normalized to the luciferase activity of the control. Each sample
was examined in duplicate, and it was repeated in 3 different experiments.
792 Z. Wang et al.
82.2.4 Semi-quantitative RT-PCR
Semi-quantitative RT-PCR analysis was carried out as described previously

[13, 16]. To show equal loading of the cDNA samples, GAPDH (glyceraldehyde-
3-phosphate dehydrogenase) was used as an internal control. The PCR primer
sequences are as follows: GAPDH: Forward-ATTCAACGGCACAGTCAAGG,
Reverse-GCAGAAGGGGCGGAGATGA; ANF: Forward-AGAGAGTGAGCC-
GAGACAGC, Reverse-TCTGAGACGGGTTGACTTCC; a-actin: Forward-CAT
AGCCAGCAAAGGG, Reverse-CAAGGCACAGA AACCAA; cardiac-MHC:
Forward-TGAGACGGACGCCATACAG, Reverse-CCTCATACTTCTGCTTCC
ACTC.
Data were expressed as mean ± SE and accompanied by the number of experi-

ments performed independently, and analyzed by t- test.
82.3 Results
82.3.1 The Transcriptional Activity of Myocardin is

Modulated by p300
We tested whether p300, a ubiquitous transcriptional coactivator with intrinsic

HAT activity, might modulate myocardin activity. The expression plasmids
encoding myocardin and p300 were co-transfected into COS cells, and resulted in
synergistic and dose-dependent activation of luciferase reporters linked to the
cardiac muscle-specific ANF, cardiac-a-actin, and cardiac-MHC promoters
(Fig. 82.1a–c), all controlled by CArG boxes. Similarly, the ability of myocardin
activating a luciferase reporter linked to ANF, a-actin, and MHC promoter was
enhanced by p300 in cultured neonatal rat myocytes (Fig. 82.1d–f). And, we can
see that p300 alone could not stimulate expression of CArG box-dependent
reporters, whereas it could augment the promyogenic activity of myocardin, and
these suggested that effects of p300 were directed at myocardin, not SRF, the
endogenous factor both in COS cells and cardiac myocytes (Fig. 82.1a–f).
To further investigate whether the histone acetylation–deacetylation affects the
activation of cardiac muscle gene expression by myocardin, we tested potential
involvement of HDAC5, a class II HDAC, in the transcriptional activity of
myocardin. Increasing the relative level of p300 could counteract the repressive
effect of HDAC5 on the transcriptional activity of myocardin, and vice versa
(Fig. 82.1g). In part, the study suggested that p300 and HDAC5 stimulate and
Fig. 82.1 P300 and HDAC5 modulate the transcriptional activity of myocardin. a–c Expression
vectors encoding myocardin (0.1 lg) and p300 (0.1, 0.3and 0.5 lg) were transiently
co-transfected into COS cells and the indicated luciferase reporters as described in Sect. 82.2.
d–f Expression vectors encoding myocardin (0.2 lg) and p300 (0.2, 0.6 and 1 lg) were
transiently co-transfected into primary neonatal rat cardiacmyocytes and the indicated luciferase
reporters as described in Sect. 82.2. g Expression vectors encoding myocardin (0.2 lg), p300
(1 lg), HDAC5 (0.5 lg), and increasing amounts of p300 (0.6 and 1 lg) and HDAC5 (0.5,and
1 lg), respectively, were transiently transfected into primary neonatal rat cardiacmyocytes, and
the ANF-luciferase reporter as described in Sect. 82.2
794 Z. Wang et al.
suppress the activity of myocardin respectively, and exert opposing influences on

cardiac muscle gene expression.
82.3.2 The Cardiac Hypertrophy-Specific Genes are

Regulated by Overexpressing Myocardin and p300 In
Vivo
Xing et al. reported that myocardin might promote cardiomyocyte hypertrophy

[13]. To investigate whether p300 enhances the transcriptional activity of myo-
cardin in cardiomyocytes, RT-PCR was carried out to determine changes in car-
diac hypertrophy-specific genes expression as a result of co-transfecting
expression plasmids of myocardin and p300 into primary neonatal rat myocytes.
As shown in Fig. 82.2, ANF, a-actin, and MHC mRNA levels were significantly
elevated. Therefore, in partially, p300 plays an important role in cardiac hyper-
trophy induced by myocardin.
All of these suggest that myocardin and p300 may combine to regulate cardiac-
special genes and induce cardiac hypertrophy. In our study, the results demonstrate
that transcription effect of cardiac-specical genes promoter activated by myocardin
could be enhanced by p300, and suppressed by HDAC5.
Furthermore, the expression of cardiac gene is induced with co-transfecting
myocardin and p300 into neonatal rat cardiomyocytes. Our studies indicate that
combined activities of myocardin and p300 may play an important role in cardiac
hypertrophy. Our results provide novel evidence to explore the roles of myocardin
and its co-factors in cardiac hypertrophy and potential therapeutic targets of heart
disease for the future studies.
Fig. 82.2 P300 upregulated

the expression of cardiac
hypertrophy-specific genes
activated by myocardin.
Semi-quantitative RT-PCR
analysis for ANF, a-actinin,
and MHC in cardiomyocytes
overexpressing myocardin
and p300 at 48 h
82.4 Discussion
Cardiac hypertrophy is regulated by a complex transcription factor interaction.

SRF, a highly interactive transcription factor, associates with other known
hypertrophic regulatory factors and influences cellular growth [17]. Our previous
results show that, in the heart, myocardin, a member of megakaryoblastic leukemia
(MKL) family, binds directly to SRF, and activates a subset of cardiomyocyte-
specific genes, such as those encoding myofibrillar, cytoskeletal, and structural
proteins, and overexpression of these factors induces hypertrophy in neonatal rat
cardiomyocytes, whereas their dominant-negative mutants block agonist-induced
growth [13].
Histones involve in modulating the structure of chromatin and the accessibility
of regulatory DNA sequences to transcriptional activators and repressors, and then
controlling gene expression. Acetylation of histones by histone acetyltransferases
can relax chromatin structure, and allow access of transcription factors to DNA
and then stimulates gene expression [14]. Our previous study shows that p300
enhanced the activity of myocardin, and then induces the acetylation of nucleo-
somal histones surrounding CArG box in the control regions of smooth muscle
genes [16].
Acknowledgments This work was financially supported by national natural science foundation
of China (No. 30970615), natural science foundation of Hubei (No. 2010CDB03506), key project
of Science and Technology Research of Hubei (No. D20111102), and college students’
innovation fund of Wuhan university of Science and Technology (No. 10ZRZ097).
References
1. Levy DK, Anderson M, Savage DD et al (1988) Echocardiographically detected left

ventricular hypertrophy: prevalence and risk factors. Aann Int Med 108:7–13
2. Akazawa H, Komuro I (2003) Roles of cardiac transcription factors in cardiac hypertrophy.
Circu Res 92:1079–1088
3. Frey N, Olson EN (2003) Cardiac hypertrophy: the good, the bad, and the ugly. Ann Rev
Physio 65:45–79
4. Olson EN, Schneider MD (2003) Sizing up the heart: development redux in disease. Genes
Dev 17:1937–1956
5. Arsenian S, Weinhold B, Oelgeschlager M et al (1998) Serum response factor is essential for
mesoderm formation during mouse embryogenesis. EMBO J 17:6289–6299
6. Belaguli NS, Schildmeyer LA, Schwartz RJ (1997) Organization and myogenic restricted
expression of the murine serum response factor gene. J Biol Chem 272:18222–18231
7. Miano JM (2003) Serum response factor: toggling between disparate programs of gene
expression. J Mol Cell Cardiol 35:577–593
8. Small EM, Warkman AS, Wang DZ et al (2005) Myocardin is sufficient and necessary for
cardiac gene expression in Xenopus. Development 132:987–997
9. McDonald Wamhoff BR, Hoofnagle MH et al (2006) Control of SRF binding to CArG box
chromatin regulates smooth muscle gene expression in vivo. J Clin Invest 116:36–48
796 Z. Wang et al.
10. Huang J, Lu M, Cheng L et al (2009) Myocardin is required for cardiomyocyte survival and
maintenance of heart function. Proc Natl Acad Sci U S A 106:18734–187349
11. Wang Z, Wang DZ, Pipes GC et al (2003) Myocardin is a master regulator of smooth muscle
gene expression. Proc Natl Acad Sci U S A 100:7129–7134
12. Li S, Wang DZ, Wang Z et al (2003) The serum response factor coactivator myocardin is
required for vascular smooth muscle development. Proc Natl Acad Sci U S A 100:9366–9370
13. Xing W, Zhang TC, Cao D et al (2006) Myocardin induces cardiomyocyte hypertrophy.
Circu Res 98:1089–1097
14. Backs J, Olson EN (2006) Control of cardiac growth by histone acetylation/deacetylation.
Circu Res 6:15–24
15. Han P, Hang CT, Yang J et al (2011) Chromatin remodeling in cardiovascular development
and physiology. Circul Res 108:378–396
16. Cao D, Wang Z, Zhang C et al (2005) Modulation of smooth muscle gene expression by
association of histone acetyltransferases and deacetylases 6 with myocardin. Mol Cell Bio
25:364–376
17. Oh J, Wang Z, Wang DZ et al (2004) Target gene-specific modulation of myocardin activity
by GATA transcription factors. Mol Cell Biol 24:8519–8528
Chapter 83
Design, Synthesis and Biological
Evaluation of the Novel Antitumor Agent
2-benzyl-3, 4-dihydroisoquinolin-1(2H)-
one and Its Derivatives
Jian Lv, Lei Lv, Xiaomin Zhang, Yao Zhou, Kui Lu, Yifei lu,
Yuou Teng, Hua Sun and Peng Yu
Abstract Tetrahydroisoquinoline and its derivatives have a wide range of

biological activities, such as antitumor, antimicrobial, and analgesic properties and
so on. Some tetrahydroisoquinoline alkaloid derivatives have been studied as
antitumor drug molecules, but 2-benzyl-7-substituted-ethoxy]-3, 4-dihydro-1(2H)-
isoquinolinone series have not been reported yet. In this paper, we would like to
report the design, synthesis, and biological evaluation of the novel tetrahydro-
isoquinoline derivatives. Among those compounds, four new tetrahydroisoquino-
line derivatives have not been reported before. All the newly synthesized
compounds were characterized by 1H NMR and their antitumor activities were
evaluated by using HT-29, K562 and HepG2 cell line. 2-Benzyl-7-[2-(tert-butyl-4-
piperazinecarboxylate) ethoxy]-3, 4-dihydro-1(2H)-isoquinolinone demonstrated
good antitumor activity against K562 cancer cell with an IC50 of 1.58 lM.
Keywords Tetrahydroisoquinoline derivatives Synthesis Antitumor MTT

83.1 Introduction
Tetrahydroisoquinolines are naturally occurring small molecules belonging to the

alkaloids family, which possess a lot of biological activities such as antitumor,
antimicrobial, analgesic, and antiarrhythmic [1–3]. Recently, it was reported that
J. Lv L. Lv X. Zhang Y. Zhou K. Lu Y. Teng H. Sun P. Yu (&)

e-mail: yupeng@tust.edu.cn
J. Lv L. Lv X. Zhang Y. Zhou K. Lu Y. Teng H. Sun P. Yu
Tianjin Key Laboratory of Industry Microbiology, College of Biotechnology, Tianjin
University of Science and Technology, Tianjin 300457, People’s Republic of China
Y. lu
China Pharmaceutical University, Jiangsu 210009, People’s Republic of China
798 J. Lv et al.
animals and humans also have endogenous tetrahydroisoquinolines compounds,

which play an important role by acting as the receptor or regulating the activity of
enzymes [4].
Cancer is a global public health problem. WHO estimates that there are about
10 million new cancer patients each year. At present, cancer mortality rate is still
on the rise. The existing chemotherapy drugs mostly by interfering cell division to
kill cancer cells, in clinical practice by using anticancer drugs, the phenomenon of
resistance gradually emerged. Thus there is an urgent need for more effective
anticancer drugs.
In this paper, we would like to report the design and synthesis of novel tetra-
hydroisoquinolines derivatives with nucleophilic substitution reaction as the key
step. The target compounds (6a–d) were synthesized in six steps through cycli-
zation, nucleophilic substitution reaction, and so on. Biological activity evaluation
indicated that 2-Benzyl -7-[2-(tert-butyl-4-piperazinecarboxylate) ethoxy]-3,
4-dihydro-1(2H)-isoquinolinone (6d) shows good antitumor activity against K562
and HepG2 cells.
All reagents and solvents used in this paper were of reagent grade. Reaction
temperatures were controlled using oil bath temperature modulator. Thin layer
chromatography (TLC) was performed using E. Merck silica gel 60 GF254 pre-
coated plates (0.25 mm) and visualized using a combination of UV. Silica gel
(particle size 200–400 mesh) was used for flash chromatography. 1H NMR spectra
was recorded on Bruker AM-400 NMR spectrometers in deuterated chloroform or
deuterated DMSO. The chemical shifts are reported in d (ppm) relative to tetra-
methylsilane as internal standard.
83.2.2 Chemistry
Figure 83.1 demonstrates the synthetic approach to the target compound 6a–d.
4-Methoxyphenethylamine was employed to react with ethyl chloroformate in
basic condition to provide compound 1 which was then cyclized in PPA at 120 C
to afford the key intermediate 2. In this step, anhydrous conditions and appropriate
reaction time were required. If the reaction conditions were not controlled well,
almost no desired product or low yield was obtained.
After Compound 2 was charged to benzyl chloride to provide compound 3 in good
yield (83 %), it was converted into compound 4 when treated with BBr3 at -78 C.
With compound 4 in hand, two methods were tried for the preparation of compound
83 Design, Synthesis and Biological Evaluation 799
NH2 NH
i COOCH2CH3 ii NH
H3CO H3CO
H3CO
O
1 2
iii iv
N N
H 3 CO HO
O O
3 4
v vi
Cl N R N
O O
O O
5 6
N O N
6a R= 6c R=
6b R= N 6d R= Boc N N
Fig. 83.1 Synthetic route to tetrahydroisoquinolines derivative
5. First, ethylenedichloride was used as reactant, but very low yield was obtained
because the bis-alkylated byproduct was generated at the reaction condition. So we
changed to the different approach with 1-bromo-2-chloroethane as the reactant which
resulted in very good yield for the key intermediate. Compound 5 was then reacted
with pyrrolidine, piperidine, morpholine, and 1-Boc-piperazine to afford compound
6a–d respectively. In order to optimize the reaction condition, different times and
temperatures were tested for each target compound, finally it was found that the best
condition was 80 C for 1 h for compound (6a) with 84 % yield; 90 C for 5 h for
compound (6b) with 54 % yield; 80 C for 2 h for compound (6c) with 82 % yield,
and 100 C for 7 h for compound (6d) with 75 % yield, respectively.
Reagents and conditions: (i) ClCO2Et, Et3N, CH2Cl2; (ii) PPA; (iii) NaH, DMF,
benzyl chloride; (iv) BBr3, CH2Cl2; (v) K2CO3, DMF, 1-bromo-2-chloroethane;
(vi) K2CO3, DMF.
83.2.3 Biological Assay
The inhibition activities of above newly synthesized compounds were tested on the
K562, HT-29, and HepG2 cells. The results of compounds 6a–d were listed in
Table 83.1. The results in Table 83.1 indicated that 2-benzyl-7-[2-(tert-butyl-4-
piperazinecarboxylate) ethoxy]-3, 4-dihydro-1(2H)-isoquinolinone (6d) demon-
strated good antitumor activity against K562 and HepG2 with an IC50 of 1.58 lM
and 3.86 lM, respectively. But it was not active against HT-29 (IC50 [ 10 lM) at
our test condition.
800 J. Lv et al.
Table 83.1 Inhibition activity of the compound 6a, 6b, 6c, and 6d
Tested cell Samples (IC50)
6a 6b 6c 6d
K562 [10 [10 [10 1.58
HepG2 [10 [10 [10 3.86
HT-29 [10 [10 [10 [10
83.3.1 Synthesize and Characterize tetrahydroisoquinolines

Derivatives by 1H NMR
[2-(4-Methoxyphenyl) ethyl]carbamic acid ethyl ester (1) [5, 6] To the

4-Methoxyphenethylamine (4.0 g, 0.026 mol) in dry dichloromethane (50 mL) at
0 C was added dropwise triethylamine (4.02 g, 0.039 mol). After stirring for
10 min ethyl chloroformate (4.31 g, 40 mmol) was added. The reaction mixture
was cooled to 5 C and stirred at 5 C for 2 h. The reaction mixture was diluted
with dichloromethane (100 mL) and water (50 mL). The phases were separated
and the organic layer was washed with water (2 9 100 mL), brine (100 mL), and
dried over anhydrous magnesium sulfate. The solvent was removed under vacuum
to afford the crude which was purified by flash column chromatography (silica gel,
petroleum ether/ethyl acetate 20:1) to yield the compound 1 (5.5 g, 93 %).
1
H NMR (CDCl3 400 MHz): d/ppm 1.22 (t, J = 7.2 Hz, 3H), 2.74
(t, J = 7.2 Hz, 2H), 3.41–3.36 (m, 2H), 3.78 (s, 3H), 4.12–4.07 (q, 2H), 4.72 (s,
1H), 6.86–6.82 (m, 2H), 7.11–7.09 (m, 2H).
7-methoxy-3, 4-dihydro-1(2H)-isoquinolone (2) [7–9] To a flask (50 mL) under
Ar was added polyphosphoric acid (PPA) (75.7 g) and stirred for 30 min
at 120 C, then the compound 1 (5.0 g, 22.39 mmol) was rapidly added. The
reaction mixture was stirred for 4.5 h at 120 C. The reaction mixture was cooled
to room temperature, poured into ice-water (100 mL), and then extracted with
dichloromethane (3 9 100 mL). The combined organic layers were washed with
water (2 9 100 mL), brine (100 mL), and dried over anhydrous magnesium sul-
fate. The solvent was removed under vacuum to afford the crude which was
purified by flash column chromatography (silica gel, petroleum ether/ethyl acetate
1:1) to yield compound 2 (2.6 g, 67 %).
1
H NMR (d6-DMSO 400 MHz): d/ppm 2.87 (t, J = 6.8 Hz, 2H), 3.37
(t, J = 4.8 Hz, 2H), 3.81 (s, 3H), 7.10–7.07 (m, 1H), 7.28–7.25 (m, 1H), 7.41
(d, J = 2.8 Hz, 1H), 7.97 (s, 1H).
2-Benzyl-7-methoxy-3, 4-dihydro-1(2H)-isoquinolinone (3) [10] To a solution
of compound 2 (2.0 g, 11.29 mmol) in dry N, N-Dimethylformamide (8 mL) was
added NaH (60 % in oil, 0.54 g, 22.57 mmol) in portions at 0 C. Benzyl chloride
(2.14 g, 16.93 mmol) was added. The mixture was brought to room temperature
and stirred until completion (TLC monitor). The reaction mixture was quenched
with saturated solution of NH4Cl and then extracted with dichloromethane

(3 9 100 mL). The combined extracts were washed with water (2 9 100 mL),
brine (100 mL), and dried over anhydrous magnesium sulfate. The solvent was
removed under vacuum to provide the crude which was purified by flash column
chromatography (silica gel, petroleum ether/ethyl acetate 15:1) to afford com-
pound 3 (2.5 g, 83 %).
1
H NMR (CDCl3 400 MHz): d/ppm 2.90 (t, J = 4.4 Hz 2H), 3.50
(t, J = 4.4 Hz, 2H), 3.88 (s, 3H), 4.82 (s, 2H), 7.10–7.00 (m, 2H), 7.37–7.29
(m, 5H), 7.72 (d, J = 1.6 Hz, 1H).
2-Benzyl-7-hydroxy-3, 4-dihydro-1(2H)-isoquinolinone (4) [11] To a solution of
compound 3 (1.5 g, 5.61 mmol) in dry dichloromethane (25 mL) at -78 C was
added dropwise BBr3 (5.62 g, 22.44 mmol) and the mixture was brought to room
temperature and stirred overnight. MeOH was added at 0 C until the reaction
mixture was clear. The solvent was removed in vacuo to give the crude product
which was purified by flash column chromatography (silica gel, petroleum ether/
ethyl acetate 1:1) to afford compound 4 (1.2 g, 84 %).
1
H NMR (CDCl3 400 MHz): d/ppm 2.88 (t, J = 6.4 Hz, 2H), 3.51
(t, J = 6.8 Hz, 2H), 4.83 (s, 2H), 7.01–6.99 (m, 1H), 7.07–7.05 (m, 1H), 7.36–7.28
(m, 5H), 8.17 (d, J = 2.4 Hz, 1H).
2-Benzyl-7-(2-chloroethoxy)-3, 4-dihydro-1(2H)-isoquinolinone (5) [12–14]
To a solution of compound 4 (2.0 g, 7.90 mmol) in dry N, N-Dimethylformamide
(5 mL) was added K2CO3 (3.27 g, 23.69 mmol). After stirring for 10 min
1-bromo-2-chloroethane (3.40 g, 23.69 mmol) was added. The reaction mixture
was heated to 80 C and refluxed for 24 h. The reaction mixture was cooled to
room temperature, and diluted with dichloromethane (100 mL). The organic layers
were washed with water (100 mL), brine (100 mL), and dried over anhydrous
magnesium sulfate. The solvent was removed under vacuum to afford the crude
which was purified by flash column chromatography (silica gel, petroleum ether/
ethyl acetate 10:1) to get compound 5 (1.9 g, 76 %).
1
H NMR (CDCl3 400 MHz): d/ppm 2.90(t, J = 6.4 Hz, 2H), 3.50
(t, J = 6.8 Hz, 2H), 3.85 (t, J = 5.6 Hz, 2H), 4.33 (t, J = 6.0 Hz, 2H), 4.82 (s, 2H),
7.06–7.04 (m, 1H), 7.12–7.10 (m, 1H), 7.36–7.30 (m, 5H) 7.70 (d, J = 2.8 Hz, 1H).
Compounds (6a–d) To a solution of compound 5 (1 equiv) in dry N, N-
Dimethylformamide (2 mL) was added K2CO3 (3.0 equiv). After stirring for
10 min a-d (1.5 equiv) was added. The reaction mixture was heated to the
80–100 C and refluxed for 5 h. The reaction mixture was cooled to room tem-
perature, and diluted with dichloromethane (100 mL). The organic layers were
washed with water (100 mL), brine (100 mL), and dried over anhydrous magne-
sium sulfate. The solvent was removed under vacuum to afford the crude which
was purified by flash column chromatography (silica gel, petroleum ether/ethyl
acetate 1:1) to get compounds (6a–d).
2-Benzyl-7-[2-(1-pyrrolidinyl) ethoxy]-3, 4-dihydro-1(2H)-isoquinolinone
(6a) [15] Starting from compound 5 (1.5 g, 4.75 mmol) and pyrrolidine (0.51 g,
7.12 mmol), compound 6a was obtained in 84 % yield.
802 J. Lv et al.
1
H NMR (CDCl3 400 MHz): d/ppm 1.85–1.82 (m, 4H), 2.68–2.65 (m, 4H),
2.88 (t, J = 6.4 Hz, 2H), 2.94 (t, J = 6.0 Hz, 2H), 3.45 (t, J = 6.8 Hz, 2H), 4.20
(t, J = 6.0 Hz, 2H), 4.81 (s, 2H), 7.06–7.03 (m, 2H), 7.35–7.28 (m, 5H), 7.71
(d, J = 2.8 Hz, 1H).
2-Benzyl-7-[2-(1-piperidinyl) ethoxy]-3,4-dihydro-1(2H)-isoquinolinone
(6b) [16] Starting from compound 5 (2.0 g, 6.33 mmol) and piperidine (0.81 g,
9.50 mmol), compound 6b was obtained in 54 % yield.
1
H NMR (CDCl3 400 MHz): d/ppm 1.48–1.45 (m, 2H), 1.66–1.60 (m, 4H),
2.55-2.53 (m, 4H), 2.82 (t, J = 6.0 Hz, 2H), 2.88 (t, J = 6.4 Hz, 2H), 3.49
(t, J = 6.8 Hz, 2H), 4.19 (t, J = 6.0 Hz, 2H), 4.81 (s, 2H), 7.09–7.00 (m, 2H),
7.36–7.29 (m, 5H), 7.70 (d, J = 2.8 Hz, 1H).
2-Benzyl-7-[2-(4-morpholinyl) ethoxy]-3,4-dihydro-1(2H)-isoquinolinone (6c)
[17] Starting from compound 5 (1.6 g, 5.07 mmol) and morpholine (0.67 g,
7.60 mmol), compound 6c was obtained in 82 % yield.
1
H NMR (CDCl3 400 MHz): d/ppm 2.61–2.59 (m, 4H), 2.83 (t, J = 5.6 Hz,
2H), 2.88 (t, J = 6.8 Hz, 2H), 3.48 (t, J = 6.8 Hz, 2H), 3.76-7.40 (m, 4H), 4.19
(t, J = 5.6 Hz, 2H), 4.81 (s, 2H), 7.09–6.99 (m, 2H), 7.35–7.30 (m, 5H), 7.70
(d, J = 2.4 Hz, 1H).
2-Benzyl-7-[2-(tert-butyl-4-piperazinecarboxylate) ethoxy]-3, 4-dihydro-
1(2H)-isoquinolinone (6d) [18] Starting from compound 5 (1.6 g, 5.07 mmol)
and 1-Boc-piperazine (1.42 g, 7.60 mmol), compound 6d was obtained in 75 %
yield.
1
H NMR (CDCl3 400 MHz): d/ppm 1.47 (s, 9H), 2.57–2.54 (m, 4H), 2.90-2.84
(m, 4H), 3.50–3.47 (m, 6H), 4.20 (t, J = 5.6 Hz, 2H), 4.80 (s, 2H), 7.02–6.99
(m, 1H), 7.09–7.07 (m, 1H), 7.35–7.28 (m, 5H), 7.70(d, J = 2.8 Hz, 1H).
83.3.2 Biological assay
The antiproliferative effect of these compounds was determined against K562,

HepG2, and HT-29 cells by using MTT assay [19]. The cells were diluted to a
density of 5 9 104 cells/mL and added 100 lL to each well of the 96-well plates
with a multichannel pipet. After incubating for 24 h, 0.5 lL compounds were
added and then cells were further incubated for 48 h (final concentrations of each
compound: 0.1, 0.3, 1, 3 and 10 lM). The culture plates were incubated for 4 h
after which 20 lL MTT was added to each well, then the medium were removed
from the wells and 100 lL DMSO added into each well. After leaving for further
10 min to dissolve the formazan crystals formed, the optical density (OD) was
measured at 490 and 630 nm. Cell viability was calculated from measurements of
OD value according to the corresponding formula and a graph is plotted of Cell
viability (y-axis) against drug concentration (x-axis) [20]. The inhibitory con-
centrations by 50 % values (IC50) of sample compounds toward test cell prolif-
eration were presented in Table 83.1.
83.4 Conclusion
We report the design and synthesis of novel tetrahydroisoquinolines derivatives,

several steps among this route were optimized, such as cyclization, nucleophilic
substitution reaction. The nucleophilic substitution reaction was the key step. All
the target compounds were synthesized in six steps with the overall yield of
20–25 %, respectively. The structures of these novel targets and all of intermediates
were confirmed by 1H NMR. Biological activity test indicated that 2-Benzyl-7-
[2-(tert-butyl-4-piperazinecarboxylate) ethoxy]-3, 4-dihydro-1(2H)-isoquinolinone
(6d) has good antitumor activity against K562 and HepG2 cell. In order to improve
the antitumor activity further modification base on compound (6d) was undergoing
in our lab.
Acknowledgments The authors sincerely thank the financial support from the Tianjin Univer-
sity of Science and Technology (20090431), the Science and Technology Project of Tianjin
(10ZCKFSY07700 and 11ZCGHHZ00400), the Natural Science Foundation of Tianjin
(11JGYBJC14300) and the High School Science and Technology Development Foundation of
Tianjin (20090226).
References
1. Gitto R, Damiano FM, Ferro S (2011) Synthesis and biological profile of new 1, 2, 3,
4-tetrahydroisoquinolines as selective carbonic anhydrase inhibitors. Bioorg Med Chem
19:7003–7007
2. Nicolaou KC, Valiulin RA, Pokorski JK (2012) Bio-inspired synthesis and biological
evaluation of a colchicine- related compound library. Bioorg Med Chem Lett 22:3776–3780
3. Horling A, Mueller C, Barthel R (2012) A new class of selective and potent
7-dehydrocholesterol reductase inhibitors. J Med Chem 55:7614–7622
4. Kartnig T, Bucar F, Wagner H et al (1991) Flavonoids from the aboveground parts of Ruscus
aculeatus. Planta Med 57:85
5. Funke U, Fischer S, Hiller A et al (2008) 3-(4-(6-Fluoroalkoxy-3, 4-dihydroisoquinoline-
2(1H)-yl)cyclohexyl)-1H –indole-5-carbonitriles for SERT imaging: chemical synthesis,
evaluation in vitro and radiofluorination. Bioorg Med Chem Lett 18:4727–4730
6. Anderson WK, McPherson HL Jr, New JS et al (1984) Synthesis and murine antineoplastic
activity of bis[(carbamoy- loxy)methyl] derivatives of pyrrolo[2,1-a]isoquinoline. J Med
Chem 27:1321–1325
7. Kessar SV, Kulkarni SK, Jain R et al (2009) Preparation of isoquinoline compounds as
monoamine re-uptake inhibitor for treating nervous system disorders WO 2009118765
8. Flynn DL, Petillo PA (2008) Preparation of pyrazolyl phenyl ureas as enzyme modulators.
US 20080113967
9. Plobeck N, Delorme D, Wei ZY et al (2000) New diarylmethylpiperazines as potent and
selective nonpeptidic delta opioid receptor agonists with increased In vitro metabolic
stability. J Med Chem 43:3878–3894
10. Fisher MJ, Gunn B, Harms Cs et al (1997) Non-peptide RGD surrogates which mimic a Gly-
Asp beta-turn: potent antagonists of platelet glycoprotein IIb-IIIa. J Med Chem
40:2085–2101
11. Sall DJ, Grunewald GL et al (1987) Inhibition of phenylethanolamine N-methyltransferase
(PNMT) by aromatic hydroxy-substituted 1, 2, 3, 4,-tetrahydroisoquinolines: further studies
804 J. Lv et al.
on the hydrophilic pocket of the aromatic ring binding region of the active site. J Med Chem
30:2208–2216
12. Hardcastle IR, Rowlands MG, Houghton J et al (1995) Rationally designed analogues of
tamoxifen with improved calmodulin antagonism. J. Med.Chem 38:241–248
13. Bogomazova AA, Kunakova RV, Zlotskii SS (2010) Reactions of 1,1- and 1,2-dihaloalkanes
with substituted phenols. Bashkirskii Khimicheskii Zhurnal 17:19–22
14. Staneva TD, Nacheva EB, Lazarov VK et al (2004) Method for the production of methyl
2-{4-[2-(1-piperidinyl) ethoxy]benzoyl}benzoate hydrochloride BG 107390
15. Blume E, Winkelmann E, Schaper W et al (1985) 1-(2-Aryl-1,3-dioxolan-2-ylmethyl)azoles,
their salts, and their use DE 3410070
16. Kumar A, Pathak SR, Ahmad P et al (2006) Novel substituted naphthalen-1-yl-methanone
derivatives as anti-hyperg- lycemic agents. Bioorg Med Chem Lett 16:2719–2723
17. Pierce AC, Arnost M, Davies RJ et al (2004) Preparation of 3,5-diamino[1,2,4]triazoles as
protein kinase inhibitors WO 2004046120
18. Hennequin, Laurent Francos Andre (2005) Preparation of quinazolines as inhibitors of VEGF
receptor tyrosine kinases. WO 2005014582
19. Mosmann T (1983) Rapid colorimetric assay for cellular growth and survival: application to
proliferation and cytotoxicity assays. J Immunol Methods 65:55–63
20. Haudecoeur R, Ahmed-Belkacem A, Yi W et al (2011) Discovery of naturally occurring
aurones that are potent allosteric inhibitors of hepatitis C virus RNA-dependent RNA
polymerase. J Med Chem 54:5395–5402
Chapter 84
Using Water Miscible Ionic Liquid
to Improve the Efficiency
of 15a-hydroxylation of 13-ethyl-gon-4-en-
3,17-dione by Penicillium raistrickii
Shuhong Mao, Na Wang, Zhijiang Ge, Boyuan Hua, Yanqing Li

and Fuping Lu
Abstract Improved efficiency of steroid microbial transformation by co-solvents

is generally attributed to their positive effects on the solubility of substrate in
aqueous media. Ionic liquids have been widely researched as possible ‘green’
replacements for organic solvents. In this study, the effect of water miscible ionic
liquids on the 15a-hydroxylation of 13-ethyl-gon-4-en-3,17-dione by Penicillium
raistrickii ATCC 10490 was investigated. The results indicated that the striking
improvement of biotransformation of substrates up to 94.46 % were obtained after
addition of [BMIM]BF4 under the optimized conditions. This also resulted in
morphological changes of P. raistrickii mycelia in the fermentation broth with or
without [BMIM]BF4. Based on the above observations, we therefore conclude that
[BMIM]BF4-induced changes of mycelial morphology of P. raistrickii have
positive effects on the production of the desired product, thus most likely con-
tributing to the observed higher yield of steroid biotransformation in addition to
[BMIM]BF4 known effects on substrate solubility.
Keywords Biotransformation Fungal morphology Ionic liquids Penicillium

raistrickii
S. Mao B. Hua F. Lu (&)

Key Laboratory of Industrial Fermentation Microbiology, Ministry of Education, Tianjin
e-mail: lfp@tust.edu.cn
N. Wang Z. Ge F. Lu
National Engineering Laboratory for Industrial Enzymes, Tianjin University of Science
and Technology, Tianjin 300457, People’s Republic of China
Y. Li
Tianjin Key Laboratory of Industrial Microbiology, College of Biotechnology, Tianjin
806 S. Mao et al.
84.1 Introduction
Gestodene is exogenous female sex steroid with extremely potent oral

contraceptive. And gestodene appears to cause fewer adverse effects. Therefore,
they are commonly used in clinics [1]. In the preparation of gestodene, 15a-
hydroxylation of 13-ethyl-gon-4-en-3,17-dione, an important intermediate prod-
uct, plays an important role.
In steroid microbial transformation, the dissolution of substrate is the key step [2].
Solubility of steroids in water-containing media is very low, i.e., 10-4–10-5 mol/l.
This considerably limits the productivity of the biotransformation systems, where the
initial substrate concentration hardly ever exceeds 2 9 10-3 mol/l. Conventional
approach to solve this problem is the feeding of substrates in the form of saturated
solutions in water-miscible solvents. In fact, there are many literatures on the opti-
mization of co-solvents for the yield improvement of desired product [2–4], and to
study the relationship between biotransformation rate and factors influencing this.
Ionic liquids have been widely researched as possible ‘green’ replacements for
organic solvents. ILs are salts with unique physical properties, such as a negligible
vapor pressure, low viscosity, and high thermal stability. There are many examples
for the use of these kinds of ILs in biocatalysis and biotransformations [5].
However, the kinds of biocatalysts used in ionic liquids have been very limited,
and most of those reported so far are hydrolytic enzymes such as lipases. To this
day, the possibility of whole-cell catalysis in the presence of ILs remains largely
unexplored, with only a few published accounts [6–8]. In this study, we
investigated the application of four water miscible ILs in 15a-hydroxylation of 13-
ethyl-gon-4-en-3,17-dione catalyzed by P. raistrickii ATCC 10490. Besides, the
effect of ILs as co-solvents on the morphological changes in the bioconversion was
also discussed.
84.2.1 Microorganisms and Medium Format
P. raistrickii ATCC 10490 were maintained on glucose/peptone/agar slants which

were incubated at 28 C for a week, followed by adding 5 ml water to each slant,
and scalping the spores from the agar surface. The harvested spore suspensions
were inoculated into 50 ml fermentation medium in a 250 ml flask, with a final
concentration of 5 9 106 spores/ml. After growth for 21 h on a shaking operating
at 28 C and 180 rpm, 5 % of the seed culture was inoculated in the fermentation
medium which contains (g/L) glucose, 20; corn steep liquor, 10; NaNO3, 2;
KH2PO4, 1; K2HPO4, 2; MgSO4, 0.5; FeSO4, 0.02; KCl, 0.5. After 36 h, the
substrates with 3 % ILs were added to the fermentation medium to investigate the
effects of ILs on the morphology of P. raistrickii ATCC 10490.
84 Using Water Misible Ionic Liquid to Improve the Efficiency 807
84.2.2 Chemicals Analysis
The cultures of 500 ll were collected, then extracted 30 min with one volume of
ethyl acetate. The extracts were dried in air, and afterwards resolved in 1,000 ll
methanol. The determination of substrate and product was carried out by high-
pressure liquid chromatography at 241 nm with an isocratic run of methanol/
water = 80:20 and a flow of 1 ml/min using ODS-2HPERSIL C18 column.
84.2.3 Morphological Measurement
Pellet particles were analyzed by determining the number of pellet per given
volume and pellet size. Images of P. raistrickii ATCC 10490 were captured by
BX51 microscopy (OLYMPUS Ltd., Japan); the captured images were analyzed
by FerAnaForAv software developed by the State Key Laboratory of Bioreactor
Engineering, National Research Center for Biotechnology (Shanghai). The size of
the pellet was quantified using the diameter corresponding to a circular area
equivalent to the pellet projected area.
84.3.1 Effect of ILs on the Production of 15a-hydroxylation

of 13-ethyl-gon-4-en-3,17-dione
ILs are usually added to the fermentation broth to improve the dissolution of
substrate in aqueous by the formation of water-solubility agents with substrates
[9]. Moreover, hydrophile ILs reduced the polarity of the conversion system and
enhanced the transportation of substrates into fungi [5]. Therefore, during the
microbial hydroxylation at C-15 of 13-ethyl-gon-4-en-3,17-dione by P. raistrickii
ATCC 10490, water-miscible ILs and organic solvents such as [BMIM]DCA,
[BMIM]Cl, [BMIM]BF4, [BMIM]Br, and 1,2-propanediol, were used as co-
solvents to enhance the solubility of 13-ethyl-gon-4-en-3,17-dione and to improve
the yields of desire product.
As shown in Figs. 84.1 and 84.2, the addition of ILs and hydrophile organic
solvents plays positive effects on biotransformation. In contrast to the biocon-
version system without co-solvents, the conversion rate of the initial substrate
concentration of 3.0 g/l, has been improved obviously after the addition of 4 %
[BMIM]DCA, [BMIM]Cl, [BMIM]BF4, [BMIM]Br, and 1,2-propanediol,
respectively. Actually, it was found that the conversion rates were higher than
70.0 % after the addition of 4 % [BMIM]DCA, [BMIM]Cl, [BMIM]BF4,
[BMIM]Br, and 1,2-propanediol, separately.
808 S. Mao et al.
80
Bioconversion Rate(%)
60
40
20
0
[BMIM]DCA [BMIM]Cl [BMIM]BF4 [BMIM]Br 1,2-propanediol water
Fig. 84.1 Bioconversion rate of 13-ethyl-gon-4-en-3,17-dione to 15a-hydroxylation of 13-ethyl-

gon-4-en-3,17-dione without co-solvents, and with 4 % [BMIM]DCA, [BMIM]Cl, [BMIM]BF4,
[BMIM]Br, 1,2-propanediol, respectively
Subsequently, the effects of concentration of hydrophile ILs and organic solvent

on steroid bioconversion were investigated. As displayed in Fig. 84.2, the maxi-
mum conversion rate up to 90.24 % was obtained when 3.0 % [BMIM]BF4 were
added. And then, the conversion rate decreased with the increasement of
[BMIM]BF4. Similar results were also found for [BMIM]DCA, [BMIM]Cl,
[BMIM]Br, and 1,2-propanediol.
84.3.2 Fungal Morphology
P. raistrickii ATCC 10490 showed the pellet type of morphology in the

fermentation broth under the optimized condition. In this work, morphological
characteristics of mycelia grown in the culture media with ILs (3 % [BMIM]BF4)
and without co-solvents were explored, respectively. According to the classifica-
tion of the pellets [10], the morphology of pellet was characterized as a spherical
shape of particle with a dense core zone surrounded by a flurry region, namely, the
hairy type.
The frequency distribution of fungal morphology was shown in Fig. 84.3. The
size of pellets was in the range of 0.6–4 mm. The pellets grown in both two culture
media had narrow size distributions. In case of culture medium with ILs (3 %
[BMIM]BF4), the pellet size was diverse, and pellets bigger than 1.8 mm com-
prised 88 % of all pellets. Nevertheless, in the fermentation broth without co-
solvents, pellets in the same size range comprised only 10 % of all pellets, at the
84 Using Water Misible Ionic Liquid to Improve the Efficiency 809
90
Bioconversion rate(%) 80
70
60
50
[BMIM]DCA
40 [BMIM]Cl
[BMIM]BF4
30 [BMIM]Br
1,2-propanediol
20
1 2 3 4 5 6
Concentration of hydrophile ILs and organic solvent (%)
Fig. 84.2 Bioconversion rate of 13-ethyl-gon-4-en-3,17-dione to 15a-hydroxylation of 13-ethyl-

gon-4-en-3,17-dione after addition different concentration of [BMIM]DCA (j), [BMIM]Cl (d),
[BMIM]BF4 (m), [BMIM]Br (.), and 1,2-propanediol (b)
Fig. 84.3 Pellet size 90

distribution of P. raistrickii in
the culture media with ILs 75
(3 % [BMIM]BF4) (j) and
Frequence (%)
without co-solvents (h) 60
45
30
15
0
<0.6 0.6-1.2 1.2-1.8 1.8-2.4 2.4-3 >3
Pellet Size (mm)
same time, pellets smaller than 1.8 mm comprised 90 %. The larger pellets
induced by ILs (3 % [BMIM]BF4), in which mycelial morphologies were plump
and symmetry, were benefit to osculation of substrate with pellets and the followed
transformation of substrate into the P. raistrickii ATCC 10490.
810 S. Mao et al.
84.4 Conclusion
In conclusion, effects of ILs (3 % [BMIM]BF4) on the bioconversion to

15-a-hydroxylation of 13-ethyl-gon-4-en-3,17-dione by P. raistrickii ATCC 10490
were studied. And the higher yield (94.46 %) of desire product was obtained, as
compared with those reported. Furthermore, the morphology changes induced by
ILs (3 % [BMIM]BF4), were first studied. Results indicated that the productive
morphology of P. raistrickii ATCC 10490 formed, being benefit to mass transfer,
occurred after the addition of ILs (3 % [BMIM]BF4).
Acknowledgments This work was financially supported by National High-tech R&D Program
of China (863 Program) ‘‘Biotransformation Technology of Steroids’’ (No. 2011AA02A211),
Applied Basic Research Programs of Science and Technology Commission Foundation of Tianjin
(No.12JCQNJC06400), Science & Technology Development Project of Tianjin Higher Education
(No. 20100601).
References
1. Nevado JJB, Flores JR, Castañeda Peñalvo G (1999) Voltammetric behavior of gestodene
using square-wave technique determination in oral contraceptives. Electroanal 11:268–273
2. Irrgang S, Schlosser D, Fritscher W (1997) Involvement of cytochrome P-450 in the
15[alpha]-hydroxylation of 13-ethyl-gon-4-ene-3,17-dione by Penicillium raistrickii.
J Steroid Biochem Mol Biol 60:339–346
3. Li J, Geng X, Weng L et al (2005) Study on fermentation condition of steroid
15a-hydroxylation by Penicillium raistrickii. Microbiology 32:87–91
4. Romano A, Romano D, Ragg E et al (2006) Steroid hydroxylations with Botryodiplodia
malorum and Colletotrichum lini. Steroids 71:429–434
5. Gangu SA, Weatherley LR, Scurto AM (2009) Whole-cell biocatalysis with ionic liquids.
Curr Org Chem 13:1242–1258
6. Wu DX, Guan YX, Wang HQ et al (2011) 11a-Hydroxylation of 16a, 17-epoxyprogesterone
by Rhizopus nigricans in a biphasic ionic liquid aqueous system. Bioresour Technol
102:9368–9373
7. Mao S, Hua B, Hu X, et al (2012) 11a Hydroxylation of 16a, 17-epoxyprogesterone in
biphasic ionic liquid/water system by Aspergillus Ochraceus. J Chem Technol Biotechnol.
doi: 10.1002/jctb.3828
8. Mao S, Hu X, Sun Y, Hua B et al (2012) 15a Hydroxylation of 13-ethyl-gon-4-en-3, 17-dione
by Penicillium raistrickii in an ionic liquid/water biphasic system. Biotechnol Lett
34:2113–2117
9. Parvulescu VI, Hardacre C (2007) Catalysis in IL. Chem Rev 107:2615–2665
10. Cox PW, Thomas CR (1992) Classification and measurement of fungal pellets by automated
image analysis. Biotechnol Bioeng 39:945–952
Chapter 85
Nuclear Receptor Property of E2F1
for Novel Anticancer Drug Discovery
Ning Zhang, Jin Li and Aimin Meng
Abstract E2F1, a member of transcription factor superfamily E2F, is similar to

nuclear receptors such as estrogen receptor (ER) and peroxisome proliferators-
activated receptors (PPARs) in structure and function. However, E2F1 plays a
paradoxical role in cancer progression control. Instead of non-transcriptional
function, the paradox mainly derives from E2F1 transcriptional function, which
determines cell death or survival by different cofactors recruitment. This charac-
teristic of E2F1 establishes itself as a good target for novel anticancer drug
discovery and it is promising to develop appropriate small molecules with E2F1
antagonism activity or inverse agonist activity which might be even better for
tumor suppression.
Keywords Anticancer effects Antagonism E2F1 Drug target Transcrip-

tional function
85.1 Introduction
E2F family members are key regulators of genes involved in cell cycle progres-
sion, cell fate determination, and apoptosis. E2F1, an E2F family member, is
similar to nuclear receptor members (such as PPARs and ER) in structure and
function. Structurally E2F1 has similar function domains to nuclear receptor
members such as DNA binding domain, transactivation domain, cofactor binding
domain, dimerization domain, and can form dimmer with DP1 to bind to DNA and
initiate gene transcription. Functionally E2F1 regulates many different biopro-
cesses depending on different cofactors recruited. Besides its transcriptional
N. Zhang J. Li A. Meng (&)

Institute of Radiation Medicine, Peking Union Medical College, Chinese Academy of
Medical Sciences, Tianjin 300192, People’s Republic of China
e-mail: aiminmeng@irm-cams.ac.cn
812 N. Zhang et al.
function, it also bears non-transcriptional function: being recruited to broken DNA

strand for DNA repair.
However, there are paradoxical effects of E2F1 on determination of cell death
and survival. E2F1 was initially found to promote cell cycle progression and
proliferation [1, 2] but was lately demonstrated to be involved in cell apoptosis
induced by DNA damage through p53-dependent and independent pathway [3].
Furthermore, upregulation of E2F1 levels in different kinds of cancers obtained
contradictory prognosis [4]. Finally, E2F1 can both contribute to chemoresistance
and chemosensitivity of DNA damage agents in cancer treatment [5–8].
Recent observations suggest that E2F1 transcriptional function is regulated by
its cofactors and finally results in two different consequences discussed below: one
is cell survival and proliferation by recruitment of coactivator; the other is cell
cycle arrest and apoptosis by recruitment of corepressor. Moreover some com-
pounds discussed below have directly or indirectly antagonism effects on E2F1 by
increasing its corepressor recruitment or coactivator dissociation, has tumor
repression effects. These studies suggest that E2F1 is a potential target for anti-
cancer drug development.
85.2 E2F Family
E2F family plays an important role in the control of cell cycle progression,
development, tissue homeostasis, and apoptosis. To date, eight members of E2Fs
(E2F1-8) have been identified in human genome and can be divided into two
subgroups according to structural and functional similarities: E2F1, E2F2, and
E2F3a are transcriptional activators, whereas E2F4, E2F5, E2F6, E2F7, and E2F8,
act as repressors of transcription [9]. Five functional domains of E2Fs have been
identified including N-terminal domain (containing a cycilinA/Chk2 binding site),
DNA binding domain (DBD), DPs dimerization domain, marked box, transacti-
vation domain. E2F1-3 have all these domains, while E2F4 and E2F5 have the last
four domains, E2F6 only have DBD domain and dimerization domain, E2F7 and
E2F8 have a duplicate DNA binding domain. Typically, E2F proteins, except
E2F7 and E2F8, associate with a dimerization partner (DP1-4) protein to form a
heterodimeric complex that binds to the promoter of target genes [10, 11].
E2F family and nuclear receptors (NRs) are all transcriptional factors with
similar structural domains. E2F1 is most similar to NRs in structure and function.
NRs contain the following domains: (1) N-terminal regulatory domain: contains
the activation function 1 (AF-1) which synergize with AF2 to produce a more
robust upregulation of gene expression independent of the presence of ligand but
normally very weak. (2) DBD: a highly conserved domain contains two zinc
fingers that bind to specific sequences of DNA. (3) Hinge region: connects the
DBD with the LBD and influences intracellular trafficking and subcellular distri-
bution. (4) Ligand binding domain (LBD): along with the DBD, the LBD con-
tributes to the dimerization interface of the receptor and binds to coactivator and
85 Nuclear Receptor Property 813
N-terminal
domain DBD Dimeriz ation MB TD
N
C
E2F1
CyclinA Cofactors RB family

binding binding binding
N-terminal Hinge C-terminal

domain DBD region LBD domain
N C
NRs
AF1 /TD AF2 /TD
Dimerization Cofactors Ligand binding

binding
Fig. 85.1 The domains of E2F1 and NRs
corepressor. The LBD also contains the activation function 2 (AF-2) domain
whose role is dependent on the presence of bound ligand. (5) C-terminal domain:
highly variable in sequence between various NRs [12]. Compared to NRs, E2F1
contains the following domains: (1) N-terminal domain: contains an nuclear
localization signal (NLS) signaling for nuclear trafficking functionally similar to
the NRs’ hinge region and a cyclin A binding domain for cyclinA to recruit Chk2
to mediate E2F1 phosphorylation and transactivation similar to AF1 domain of
NRs. (2) DBD: contains conserved DNA sequence to recognize E2F promoters
and binds to DNA. (3) Dimerization domain: along with DBD, dimerization
domain contributes to the heterodimerization of DP1 and E2F1. (4) Marked box
domain: binds cofactors. (5) Transactivation domain (TD): binds cofactors and
mediates transactivation. It seems that NRs’ LBD includes the functions of
dimerization domain, marked box domain, and transactivation domain of E2F1
[13–16], (Fig. 85.1).
85.3 The Transcriptional and Non-transcriptional

Function of E2F1
Among E2F members, E2F1 is the only member that considered is as both
oncoprotein and tumor suppressor protein because it paradoxically influences
human cancer development [17]. The real role of E2F1 gets fiercely debated.
According to its transcriptional function, E2F1 associates with DP1 to form a
814 N. Zhang et al.
heterodimer on DNA to regulate downstream gene expression to induce corre-

sponding biological effects. E2F1 is first found to directly upregulate the expres-
sion of many cell proliferation related genes, such as cyclin E, cyclin A, c-myc,
DNA polymerase, and RBM38 [18–20]. However, E2F1 is also found to directly
upregulate the transcription of proapoptosis genes, such as p73, caspase7,
p14ARF, Apaf1, PUMA, and DBC2, to induce cell apoptosis [21, 22]. E2F1 also
has non-transcriptional activity that E2F1 interacts with proteins and regulates
their activity without affecting on cell proliferative or apoptotic genes expression.
For example, E2F1 can recruit NBS1 and GCN5 to DNA broken strand for DNA
repair [13].
85.4 E2F1 Cofactors
Cofactors, also called coregulators, are proteins that can be recruited to NRs and
other transcription factors to alter chromatin and initiate (coactivators) or repress
(corepressors) gene expression. Antagonist ligand interacts with NRs and enhances
them to recruit corepressors on DNA to prevent gene transcription, while agonist
ligand interaction induces the dissociation of corepressor complexes and favors the
recruitment of coactivators to initiate gene transcription [23]. Compared to NRs,
cofactors that interact with E2F1 to initiate or repress genes induction has been
identified and some of them mediate E2F1 distinct bidirectional regulation, being
activator in one bioprocess and simultaneously repressor in the opposite
bioprocess.
85.4.1 Coactivator
E2F1 coactivators including MDM2, ANCCA, ACTR, nuclear EGFR, AHR, and
SIRT1 induce proliferative genes expression and/or repress apoptotic genes
expression. Murine double minute 2 (MDM2) is an oncoprotein. Martin K and
colleages first observed that MDM2 directly contacts the transactivation domain of
E2F1 using residues conserved in the activation domain of P53 to stimulate E2F1/
DP1 formation and augment cell proliferation. Another study also demonstrated
that MDM2-E2F1 signaling is essential for melanoma cell proliferation cells and
identified E2F1 as a biomarker to consider when stratifying putative candidates for
clinical studies of P53-MDM2 [24, 25]. AAA nuclear coregulators cancer asso-
ciated protein (ANCCA) is an AAA ? ATPase and has been strongly implicated
to promote tumorigenesis. Revenko and its colleagues first identified ANCCA as
an E2F coactivator and demonstrated that its N terminus interacts with both the N
and C termini of E2F1-3 to induce E2F target genes expression and a novel
mechanism involving ANCCA bromodomain may contribute to cancer cell
proliferation [26]. Nuclear epidermal growth factor receptor (EGFR), a nuclear
tyrosine kinase receptor, can promote tumor progression and chemoresistance

[27]. Hanada and colleagues have recently found that EGF-activated nuclear
EGFR binds to E2F1 to induce B-Myb gene expression and breast tumors
proliferation in vivo [28]. ACTR (also named AIB1, SRC-3), a coactivator of NRs,
is considered as an oncoprotein. Louie and its colleagues first found that ACTR
protein directly interacts with E2F1 through its N-terminal domain and is required
for E2F1-mediated breast cancer cells proliferation. Another study found that the
ACTR gene expression is also positive regulated by E2F1 [29, 30]. The aryl
hydrocarbon receptor (AHR) is a ligand-activated transcription factor and plays an
important role in cell cycle progression and tumor progression. AHR ligands
include dioxin and related compounds which can induce a bidirectional regulation
of E2F1. In the presence of AHR ligand, AHR directly interacts with E2F1 on the
E2F promoter of cell proliferative genes to promote cancer cell proliferation, while
the complex of AHR and E2F1 can also bind on E2F promoter of apoptotic genes
to inhibit Apaf1 and P73 gene expression to inhibit cancer cell apoptosis [31, 32].
SIRT1, an NAD(+)-dependent deacetylase, is a metabolic regulator and recently
found to contribute to cancer cell survival [33]. Wang and colleagues found that
SIRT1 can directly interact with E2F1 to inhibit response of P73 to DNA damage
and rescue DNA damaged cancer cell. Another study found SIRT, PCAF, and
E2F1 corectuited in vivo on the P1p73 promoter to repress E2F1 induced P73
expression and contributes to cancer cells survival [34, 35].
85.4.2 Corepressor
RB family members, Alien, Necdin, and RIP140 are considered as corepressors of

E2F1 which stimulate apoptosis genes expression and/or repress proliferative
genes expression. Retinoblastoma gene (RB) family including RB1, p107, and
p130 are potent corepressors of E2F1. There are two different E2F1-RB1 com-
plexes probably formed in response to DNA damage: a repressing complex con-
taining histone deacetylase 1 (HDAC1) and an activating complex containing P/
CAF, which cause a bidirectional regulation of E2F1-RB1 that repress cell cycle
genes expression but stimulate proapoptotic genes expression to induce cell arrest
and apoptosis [36, 37]. P107 and P130 also directly interact with E2F1 and repress
its proliferative gene expression in cancer cells [38, 39]. c-Jun activation domain-
binding protein-1 (Jab1), is formerly reported as a coactivator of other transcrip-
tion factors and promotes cell progression but identified as an extremely specific
corepressor of E2F1 [40]. Jab1 can selectively interact with the marked box
domain of E2F1 and exhibits a significant effect on the E2F1-mediated expression
of proapoptotic genes [41, 42]. Receptor-interacting protein of 140 kDa (RIP140)
is a cofactor of nuclear receptor involved in reproduction and energy homeostasis.
Aurélie and colleagues found that RIP140 can directly interact with E2F1 on E2F
target promoters to represses the expression of E2F1 target genes (such as cyclin E
and cyclin B2) and found that low RIP140 mRNA expression was associated with
816 N. Zhang et al.
high E2F1-target gene levels and basal-like tumors in analysis of human breast
cancers and indicated that RIP140-E2F1 pathway can discriminate human breast
tumor subtypes [43]. Necdin (NDN), a member of the melanoma-associated
antigen (MAGE) family, is a tumor suppressor protein. Taniura and colleagues
found that NDN binds to a C-terminal domain of E2F1, and repress E2F-dependent
transactivation in vivo, and suppresses the colony formation of RB-deficient
SAOS-2 osteosarcoma cells [44, 45]. Alien is a corepressor of several nuclear
receptor superfamilies and mediates gene silencing and cell proliferation repres-
sion [46]. Tenbaum and colleagues found that Alien interacts with E2F1 in vivo on
the E2F promoter and inhibits tranctivation of E2F1 and endogenous E2F1 gene
expression using a proteomic approach. Another two studies also demonstrated
that Alien inhibits E2F1 activity to represses proliferative genes expression and
reduces cancer cell proliferation [47, 48].
The characteristic of NRs-like regulatory mode and distinct bi-directional
transcriptional regulation of E2F1 indicate that compounds with high affinity to
E2F1, which recruit corepressors and dissociate coactivators, may have value to
develop targeted anticancer drugs.
85.5 Anticancer Compounds Directly Modulate E2F1

Activity
It is unclear whether E2F1 has endogenous ligands. Some compounds are found to
repress tumor progression via modulating E2F1 activity. Beta-Lapachone though
does not cause DNA damage but can induce cancer cell apoptosis via increasing
the amount of RB binding to E2F1including mutant p53 cancer cells [49, 50].
Nutlin-3 and its enantiomer of nutlin-3a are MDM2 antagonist and potent
anticancer compounds. They both can induce apoptosis through inhibiting the
interaction between E2F and MDM2 and subsequently p73 and Noxa expression in
normal and p53 mutant cancer cell [51, 52]. SU9516 prevents the dissociation of
RB from E2F1 and induces cancer cell apoptosis [53, 54]. Esculetin induces G1
arrest in human leukemia U937 cells partially through the enhancement of RB/
E2F1 interaction and subsequently cyclin E expression repression [55]. Resveratrol
induces E2F1-mediated gene expression of ASPP1, a new member of the apoptosis
stimulation protein of p53 (ASPP) family and subsequently apoptosis in MCF-7 and
MDA-MB231 breast cancer cells [56]. Amurensin G, a potent natural SIRT1
inhibitor, inhibits angiogenesis and tumor growth of tamoxifen-resistant breast
cancer via repressing E2F1 mediated Pin1 gene and protein expression [57, 58].
SAHA and TSA, inhibitors of histone deacetylases, stimulate apoptosis
through selectively induction of E2F1-mediated proapoptotic BH3-only protein
expression [59].
E2F1 completely or partially participate in the tumor suppression effects of
compounds listed above. Some was already been observed directly E2F1
antagonist-like effect with enhancing its corepressors recruitment such as

Beta-Lapachon and Esculetin or coactivators dissociation such as MDM2
antagonist. And the others display indirect antagonist-like effect in regulation of
E2F1 target genes. So it is feasible to develop little molecules with E2F1
antagonism for cancer treatment.
85.6 Perspectives
The paradoxical effects of E2F1 lie in its NRs-like regulatory mode depending on
cofactors recruitment, and can be resolved via properly modulating E2F1.
Moreover, P53 and RB protein are often mutated or deficient in malignances,
which cause chemoresistance and tumor recurrence [60, 61], while E2F1 is normal
in most cancer cells and can induce cancer cell apoptosis both dependent and
independent of p53 and RB. In addition, E2F1 has distinct bi-directional regulatory
function and some compounds repress tumor progression via direct and indirect
antagonist-like regulation of E2F1. These characteristic of E2F1 provide a potent
anticancer drug target and it is promising to develop appropriate small molecules
with E2F1 antagonism or inverse agonism even better for tumor suppression
(Fig. 85.2).
DNA damage agents and other cell EGF, ACH agonist and
apoptosis factors other cell growth factors
Ideal
compounds
DP1 E2F1 E2F1 DP1

Corepressors E2F1
recruitment Coractivators
recruitment
Proapoptosic Proliferative
genes genes
Cell apoptosis Cell survival
Tumor repression Tumor progression
E2F1 signaling Compounds

pathways effects
Fig. 85.2 Development compound targeting transcription function of E2F1 for cancer therapy
818 N. Zhang et al.
References
1. Timmers C, Sharma N, Opavsky R et al (2007) E2f1, E2f2 and E2f3 control E2F target
expression and cellular proliferation via a p53-dependent negative feedback loop. Mol Cell
Biol 27:65–78
2. Wu L, Timmers C, Maiti B et al (2001) The E2F1-3 transcription factors are essential for
cellular proliferation. Nature 414:457–462
3. Engelmann D, Pützer BM (2010) Translating DNA damage into cancer cell death-A roadmap
for E2F1 apoptotic signalling and opportunities for new drug combinations to overcome
chemoresistance. Drug Resist Updates 13:119–131
4. Johnson DG, Degregori J (2006) Putting the oncogenic and tumor suppressive activities of
E2F into context. Curr Mol Med 6:731–738
5. Engelmann D, Pützer BM (2012) The dark side of E2F1: in transit beyond apoptosis. Cancer
Res 72:571–575
6. Banerjee D, Schnieders B, Fu JZ et al (1998) Role of E2F1 in chemosensitivity. Cancer Res
58:4292–4296
7. Dong YB, Yang HL, McMasters KM (2003) E2F1 overexpression sensitizes colorectal
cancer cells to camptothecin. Cancer Gene Ther 10:168–178
8. Hao H, Zhou HS, McMasters KM (2009) Chemosensitization of tumor cells: inactivation of
nuclear factor-kappa B associated with chemosensitivity in melanoma cells after combination
treatment with E2F1 and doxorubicin. Methods Mol Biol 542:301–313
9. Lammens T, Li J, Leone G et al (2009) Atypical E2Fs: new players in the E2F transcription
factor family. Trends Cell Biol 19:111–118
10. DeGregori J, Johnson DG (2006) Distinct and overlapping roles for E2F family members in
transcription, proliferation and apoptosis. Curr Mol Med 6:739–748
11. Rowland BD, Bernards R (2006) Re-evaluating cell cycle regulation by E2Fs. Cell
127:871–874
12. Chris MB, Moray JC (2010) Nuclear Receptors. Springer, New York
13. Biswas AK, Johnson DG (2012) Transcriptional and nontranscriptional functions of E2F1 in
response to DNA damage. Cancer Res 72:3–7
14. Rubin SM, Gall AL, Zheng N et al (2005) Structure of the Rb C-terminal domain bound to
E2F1-DP1: a mechanism for phosphorylation-induced E2F release. Cell 123:1093–1106
15. Slansky JE, Farnham PJ (1996) Introduction to the E2F family: protein structure and gene
regulation. Curr Top Microbiol Immunol 208:1–30
16. Cress WD, Nevins JR (1996) A role for a bent DNA structure in E2F-mediated transcription
activation. Mol Cell Biol 16(5):2119–2127
17. Lazzerini Denchi E, Helin K (2005) E2F1 is crucial for E2F-dependent apoptosis. EMBO
Rep 6:661–668
18. Ren B, Cam H, Takahashi Y et al (2002) E2F integrates cell cycle progression with DNA
repair, replication, and G2/M checkpoints. Genes Dev 16:245–256
19. Alonso MM, Alemany R, Fueyo J et al (2008) E2F1 in gliomas: a paradigm of oncogene
addiction. Cancer Lett 263:157–163
20. Feldstein O, Ben-Hamo R, Bashari D et al (2012) RBM38 is a direct transcriptional target of
E2F1 that limits E2F1 induced proliferation. Mol Cancer Res 0(9):1169–1177
21. Wu Z, Yu Q (2009) E2F1-mediated apoptosis as a target of cancer therapy. Curr Mol
Pharmacol 2:149–160
22. Freeman SN, Ma Y, Cress WD (2008) RhoBTB2 (DBC2) is a mitotic E2F1 target gene with a
novel role in apoptosis. J Biol Chem 283:2353–2362
23. Lonard DM, O’Malley BW (2012) Nuclear receptor coregulators: modulators of pathology
and therapeutic targets. Nat Rev Endocrinol 8:598–604
24. Martin K, Trouche D, Hagemeier C et al (1995) Stimulation of E2F1/DP1 transcriptional
activity by MDM2 oncoprotein. Nature 375:691–694
25. Verhaegen M, Checinska A, Riblett MB et al (2012) E2F1 dependent oncogenic addiction of

melanoma cells to MDM2. Oncogene 31:828–841
26. Revenko AS, Kalashnikova EV, Gemo AT et al (2010) Chromatin loading of E2F-MLL
complex by cancer-associated coregulator ANCCA via reading a specific histone mark. Mol
Cell Biol 30:5260–5272
27. Brand TM, Iida M, Li C et al (2011) The nuclear epidermal growth factor receptor signaling
network and its role in cancer. Discovery Med 12:419–432
28. Hanada N, Lo HW, Day CP et al (2006) Coregulation of B-Myb expression by E2F1 and
EGF receptor. Mol Carcinog 45:10–17
29. Mussi P, Yu C, O’Malley BW et al (2006) Stimulation of steroid receptor coactivator 3
(SRC-3) gene overexpression by a positive regulatory loop of E2F1 and SRC-3. Mol
Endocrinol 20:3105–3119
30. Louie MC, Zou JX, Rabinovich A et al (2004) ACTR/AIB1 functions as an E2F1 coactivator
to promote breast cancer cell proliferation and antiestrogen resistance. Mol Cell Biol
24:5157–5171
31. Watabe Y, Nazuka N, Tezuka M et al (2010) Aryl hydrocarbon receptor functions as a potent
coactivator of E2F1-dependent trascription activity. Biol Pharm Bull 33:389–397
32. Marlowe JL, Fan Y, Chang X et al (2008) The aryl hydrocarbon receptor binds to E2F1 and
inhibits E2F1 induced apoptosis. Mol Biol Cell 19:3263–3271
33. Knight JR, Milner J (2012) SIRT1, metabolism and cancer. Curr Opin Oncol 24:68–75
34. Wang C, Chen L, Hou X et al (2006) Interactions between E2F1 and SirT1 regulate apoptotic
response to DNA damage. Nat Cell Biol 8:1025–1031
35. Pediconi N, Guerrieri F, Vossio S et al (2009) hSirT1-dependent regulation of the PCAF-
E2F1-p73 apoptotic pathway in response to DNA damage. Mol Cell Biol 29:1989–1998
36. Julian LM, Palander O, Seifried LA et al (2008) Characterization of an E2F1 specific binding
domain in pRB and its implications for apoptotic regulation. Oncogene 27:1572–1579
37. Dick FA, Dyson N (2003) pRB contains an E2F1 specific binding domain that allows E2F1
induced apoptosis to be regulated separately from other E2F activities. Mol Cell 12:639–649
38. O’Connor RJ, Schaley JE, Feeney G et al (2001) The p107 tumor suppressor induces stable
E2F DNA binding to repress target promoters. Oncogene 20:1882–1891
39. Dai Y, Hamm TE, Dent P et al (2006) Cyclin D1 overexpression increases the susceptibility
of human U266 myeloma cells to CDK inhibitors through a process involving p130-, p107-
and E2F-dependent S phase entry. Cell Cycle 5:437–446
40. Shackleford TJ, Claret FX (2010) JAB1/CSN5: a new player in cell cycle control and cancer.
Cell Div 18:26
41. Lu H, Liang X, Issaenko OA et al (2011) Jab1/CSN5 mediates E2F dependent expression of
mitotic and apoptotic but not DNA replication targets. Cell Cycle 10:3317–3326
42. Hallstrom TC, Nevins JR (2006) Jab1 is a specificity factor for E2F1 induced apoptosis.
Genes Dev 20:613–623
43. Docquier A, Harmand PO, Fritsch S et al (2010) The transcriptional coregulator RIP140
represses E2F1 activity and discriminates breast cancer subtypes. Clin Cancer Res
16:2959–2970
44. Chapman EJ, Knowles MA (2009) Necdin: a multi functional protein with potential tumor
suppressor role? Mol Carcinog 48:975–981
45. Taniura H, Taniguchi N, Hara M et al (1998) Necdin, a postmitotic neuron-specific growth
suppressor, interacts with viral transforming proteins and cellular transcription factor E2F1.
J Biol Chem 273:720–728
46. Papaioannou M, Melle C, Baniahmad A (2007) The coregulator Alien. Nucl Recept Signal
5:e008
47. Tenbaum SP, Papaioannou M, Reeb CA et al (2007) Alien inhibits E2F1 gene expression and
cell proliferation. Biochim Biophys Acta 1773:1447–1454
48. Hong W, Li J, Wang B et al (2011) Epigenetic involvement of Alien/ESET complex in
thyroid hormone-mediated repression of E2F1 gene expression and cell proliferation.
Biochem Biophys Res Commun 415:650–655
820 N. Zhang et al.
49. Li Y, Sun X, LaMont JT et al (2003) Selective killing of cancer cells by beta-lapachone:

direct checkpoint activation as a strategy against cancer. Proc Natl Acad Sci U S A
100:2674–2678
50. Choi YH, Kang HS, Yoo MA (2003) Suppression of human prostate cancer cell growth by
beta-lapachone via down-regulation of pRB phosphorylation and induction of Cdk inhibitor
p21(WAF1/CIP1). J Biochem Mol Biol 36:223–229
51. Ambrosini G, Sambol EB, Carvajal D et al (2007) Mouse double minute antagonist Nutlin-3a
enhances chemotherapy induced apoptosis in cancer cells with mutant p53 by activating
E2F1. Oncogene 26:3473–3481
52. Kitagawa M, Aonuma M, Lee SH et al (2008) E2F1 transcriptional activity is a critical
determinant of Mdm2 antagonist-induced apoptosis in human tumor cell lines. Oncogene
27:5303–5314
53. Yu B, Lane ME, Wadler S (2002) SU9516, a cyclin dependent kinase 2 inhibitor, promotes
accumulation of high molecular weight E2F complexes in human colon carcinoma cells.
Biochem Pharmacol 64:1091–1100
54. Lane ME, Yu B, Rice A et al (2001) A novel cdk2-selective inhibitor, SU9516, induces
apoptosis in colon carcinoma cells. Cancer Res 61:6170–6177
55. Lee SH, Park C, Jin CY et al (2008) Involvement of extracellular signal-related kinase
signaling in esculetin induced G1 arrest of human leukemia U937 cells. Biomed
Pharmacother 62:723–729
56. Shi Y, Yang S, Troup S et al (2011) Resveratrol induces apoptosis in breast cancer cells by
E2F1-mediated up-regulation of ASPP1. Oncol Rep 25:1713–1719
57. Oh WK, Cho KB, Hien TT et al (2010) Amurensin G, a potent natural SIRT1 inhibitor,
rescues doxorubicin responsiveness via down regulation of multidrug resistance. Mol
58. Kim JA, Kim MR, Kim O et al (2012) Amurensin G inhibits angiogenesis and tumor growth
of tamoxifen resistant breast cancer via Pin1 inhibition. Food Chem Toxicol 50:3625–3634
59. Zhao Y, Tan J, Zhuang L et al (2005) Inhibitors of histone deacetylases target the Rb-E2F1
pathway for apoptosis induction through activation of proapoptotic protein Bim. Proc Natl
Acad Sci U S A 102:16090–16095
60. Muller PA, Vousden KH, Norman JC (2011) P53 and its mutants in tumor cell migration and
invasion. J Cell Biol 192:209–218
61. Gordon GM, Du W (2011) Targeting Rb inactivation in cancers by synthetic lethality. Am J
Cancer Res 1:773–786
Chapter 86
MRTF-A Promotes Migration of MCF-7
Breast Cancer Cells via Transactivation
of CYR61
Xuegang Luo, Chunling Zhang, Wenwen Zhao, Lei Liu, Shu Guo,
Zhipeng Liu, Jing Wang and Tong-Cun Zhang
Abstract Myocardin-related transcription factor A (MRTF-A) is a transcriptional

coactivator of serum response factor (SRF). Recent studies have found that the
MRTF–SRF signal pathway might play critical role in Rho-dependent cytoskeletal
rearrangements and tumor metastasis. To further explore the detailed molecular
mechanisms for MRTF-A-mediated cell migration, in this study, the effect of
MRTF-A on the migration of mouse fibroblast NIH3T3 cells and MCF-7 human
breast cancer cells was detected using a scratch wound model, and its transcrip-
tional activity on the promoter of Cysteine-rich angiogenic inducer 61 (CYR61)
was also analyzed by luciferase assay. The results showed that overexpression of
MRTF-A could significantly promote the migration of NIH3T3 cells and drive the
transcriptional activity of CYR61 promoter in African green monkey kidney COS-
7 cells and strongly enhance upregulation of CYR61 gene. In contrast, RNA
interference-mediated knockdown of MRTF-A reduced the migration ability of
MCF-7 breast cancer cells. Taken together, our results suggested that MRTF-A is
involved in tumor metastasis via transactivation of CYR61.
Keywords MRTF-A CYR61 Breast cancer Migration
X. Luo C. Zhang W. Zhao L. Liu S. Guo Z. Liu J. Wang T.-C. Zhang (&)
Bioengineering, Tianjin University of Science and Technology, Tianjin, China
X. Luo
e-mail: luoxuegang@tust.edu.cn
X. Luo C. Zhang W. Zhao L. Liu S. Guo Z. Liu J. Wang T.-C. Zhang
Tianjin Key Laboratory of Industrial Microbiology, Tianjin, China
822 X. Luo et al.
86.1 Introduction
Tumor metastasis is one of the biological characteristics of malignant tumor, and it

is the leading cause of death to clinical tumor patients, 90 % of all cancer-related
deaths are caused by tumor metastasis. Only by effectively controlling the
occurrence and development of tumor metastasis can we overcome tumor. Thus,
understanding the regulation of these series of molecular interactions and signal
transduction pathways are important in developing new antimetastatic treatment
strategies [1].
MRTFs are a group of transcriptional coactivators of serum response factor
(SRF) [2–4]. Myocardin, myocardin-related transcription factor-A (MRTF-A), and
myocardin-related transcription factor-B (MRTF-B), which are expressed in a
broad range of embryonic and adult tissues [5–8]. They all have similar structural
features and the transcription initiation function. Studies have demonstrated that:
MRTFs associates with SRF via the highly conserved cis-regulatory components
of CArG box motifs to synergistically regulate gene transcription [4, 9–11]. One
central signal pathway regulating MRTFs is regulated trough actin and is closely
linked to cytoskeletal rearrangements and tumor metastasis, such as cell polarity,
shape, and motility [12–16]. MRTF-A have recently been implicated in tumor cell
invasion and metastasis [17]. Suppression of MRTF-A decreased MCF-7 cell
motility while cell proliferation was unaffected.
CYR61 is a member of the CCN family, the CYR61 gene of human is located
on chromosome lq22.3, CYR61 have the mosaic multimodule structure and
interact with a variety of factors, it is a very important regulatory factor and play
critical role in the regulation of cell adhesion, migration, proliferation and angi-
ogenesis, inflammatory response, tissue remodeling, and other important physio-
logical and pathological processes [18–19]. More importantly CYR61 is involved
in occurrence and development of tumors, and the function is different in diverse
tumors. CYR61 can induce tumor cells proliferation and migration in breast cancer
and glioma tumor.
In our studies, to further explore the detailed molecular mechanisms for MRTF-
A-mediated cell migration. MRTF-A on the migration of NIH3T3 cells and MCF-
7 cells was detected using a scratch wound model, its transcriptional activity on the
promoter of CYR61 was analyzed by luciferase assay and RNA interference-
mediated knockdown of MRTF-A reduced the migration ability of MCF-7 breast
cancer cells.
86.2.1 Cell Culture, Plasmids Used, and Cell Transfection
COS-7 cells, NIH3T3 cells, and MCF-7 cells were cultured at 37 C in

(DMEM)/F12 (HyClone) supplemented with 10 % fetal bovine serum (FBS) in
86 MRTF-A Promotes Migration of MCF-7 Breast Cancer Cells 823
a 5 % CO2 incubator. The plasmid encoding human MRTF-A was purchased

from Addgene (Cambridge, MA). Promoter of CYR61 was amplified by poly-
merase chain reaction (PCR) using the genomic DNA isolated from MCF-7 cells
as template. For transfection experiments, the cells were cultured in serum
medium without antibiotics at 80 % confluence for 24 h, and then transfected
with transfection reagent (Turbofect, Thermo) according to manufacturer’s
instructions. After incubation for 6 h, the medium was removed and replaced
with normal culture medium for 24 h. Then, the RT-PCR and Western blotting
were performed as follows .
86.2.2 Measurement of Cellular Migration
NIH3T3 cells and MCF-7 cells were grown to confluence in 24 well plates, and
then scratched with the narrow end of a sterile pipet tip. The width of the scratch
was taken a picture in each well after initial wounding, Medium was immediately
replaced with serum-free DMEM/F12 containing MRTF-A to NIH3T3 and sh-
MRTFA to MCF-7 cells, and cells were incubated for 72 h at 37 C in a CO2-
incubator. After 72 h, the scratch width was taken a picture again.
86.2.3 Luciferase Assays
COS-7 cells were grown in 24 well plates, within 24 h of transfection, cells were
treated with lysis buffer (Promega), luciferase assays (Promega) were conducted
by the GloMax-Multi Detection System.
86.2.4 Semi-Quantitative Reverse-Transcription Polymerase

Chain Reaction
Semi-quantitative RT-PCR analysis was performed as previously reported [20]. The

total cellular RNA was extracted from cells with Trizol reagent (Invitrogen) and the
total RNA was reverse-transcribed with M-MLV reverse transcriptase (Promega)
according to the manufacturer’s instructions. GAPDH was the internal control.
Data analyzed by t test. The difference at P \ 0.05 was considered statistically

significant.
824 X. Luo et al.
86.3.1 MRTF-A Promote Cell Migration
To investigate whether MRTF-A promotes cell migration, we overexpressed

MRTF-A in NIH3T3 cells and RNA interference-mediated knockdown of MRTF-
A in MCF-7 cells using a scratch wound model. Within 72 h of transfection,
overexpression of MRTF-A caused a concentration-dependent decrease in
NIH3T3 cells migration. cell migration is shown in Fig. 86.1a. In contrast, RNA
interference-mediated knockdown of MRTF-A reduced the migration ability of
MCF-7 cells, cell migration is shown in Fig. 86.1b.
NIH3T3 cells and MCF-7 cells migration were assessed using a scratch assay.
NIH3T3 cells were treated with MRTF-A, and cell migration into cell-free area
was assessed after 72 h (a). MCF-7 cells were treated with shMRTF-A, and cell
migration into cell-free area was assessed after 72 h (b).
86.3.2 MRTF-A Drive the Transcriptional Activity of CYR61
CYR61 plays critical role in the regulation of cell adhesion, migration, prolifer-
ation, and angiogenesis. To determine whether MRTF-A promotes migration of
MCF-7 cells via transactivation of CYR61, we overexpressed MRTF-A in COS7
and MCF-7. Within 24 h of transfection, MRTF-A caused a significant increase in
the activity of the CYR61-Luc reporter. The figure is shown in Fig. 86.2a, and
mRNA levels in Fig. 86.2b.
Luciferase assay for CYR61-Luc reporter in transfected with MRTF-A plasmid
for 24 h in COS-7 (a). RT-PCR analysis for CYR61 in transfected MCF-7 at 24 h
(b). (*P \ 0.05 vs. pcDNA3.1, n = 3).
Fig. 86.1 Effect of MRTF-A on cell migration. a NIH3T3 cells were treated with MRTF-A, and
cell migration into cell-free area was assessed after 72 h. b MCF-7 cells were treated with
shMRTF-A, and cell migration into cell-free area was assessed after 72 h
86 MRTF-A Promotes Migration of MCF-7 Breast Cancer Cells 825
Fig. 86.2 MRTF-A upregulated the expression of CYR61. a Luciferase assay for CYR61-Luc
reporter in transfected with MRTF-A plasmid for 24 h in COS-7. b RT-PCR analysis for CYR61
in transfected MCF-7 at 24 h. (*P \ 0.05 vs. pcDNA3.1, n = 3)
86.4 Conclusion
In summary, our results show that overexpression of MRTF-A promotes migration

of NIH3T3 cells and drive the transcriptional activity of CYR61. Furthermore,
h-shMRTF-A reduced the migration ability of MCF-7 breast cancer cells. Our
studies indicate that MRTF-A promotes migration of MCF-7 breast cancer cells
via transactivation of CYR61.
References
1. Diers AR, Dranka BP, Ricart KC et al (2010) Modulation of mammary cancer cell migration
by 15-deoxy-D12, 14-prostaglandin J2: implications for anti-metastatic therapy. Biochem J
430(1):69–78
2. Arsenian S, Weinhold B, Oelgeschläger M et al (1998) Serum response factor is essential for
mesoderm formation during mouse embryogenesis. EMBO J 17(21):6289–6299
3. Bass-Zubek AE, Godsel LM, Delmar M et al (2009) Plakophilins: multifunctional scaffolds
for adhesion and signaling. Curr Opin Cell Biol 21(5):708–716
4. Pipes GCT, Creemers EE et al (2006) The myocardin family of transcriptional coactivators:
versatile regulators of cell growth, migration, and myogenesis. Genes Dev 20:1545–1556
5. Miralles F, Posern G, Zaromytidou AI et al (1998) Actin dynamics control SRF activit by
regulation of its coactivator MAL. Cell 2003(113):329–342
6. Mouilleron S, Guettler S, Langer CA et al (2008) Molecular basis for G-actin binding to
RPEL motifs from the serum response factor coactivator MAL. EMBO J 27:3198–3208
7. Vartiainen MK, Guettler S, Larijani B et al (2007) Nuclear actin regulates dynamic sub
cellular localization and activity of the SRF cofactor MAL. Science 316:1749–1752
826 X. Luo et al.
8. McDonald OG, Wamhoff BR, Hoofnagle MH et al (2006) Control of SRF binding to CArG
box chromatin regulates smooth muscle gene expression in vivo. J Clin Invest 116:36–48
9. Wang D, Chang PS, Wang Z et al (2001) Activation of cardiac gene expression by
myocardin, a transcription cofactor for serum response factor. Cell 105:851–862
10. Cen B, Selvaraj A, Burgess RC et al (2003) Potent transcription coactivator for serum
response factor(SRF), is required for serum induction of SRF target genes. Mol Cell Biol
23:6597–6608
11. Posern G, Treisman R (2006) Actin’ together: serum response factor, its cofactors and the
link to signal transduction. Trends Cell Biol 16:588–596
12. Li J, Zhu X, Chen M et al (2005) Myocardin-related transcription factor B is required in
cardiac neural crest for smooth muscle differentiation and cardiovascular development. Proc
Nat l Acad Sci USA 102:8916–8921
13. Li S, Chang S, Qi X et al (2006) Requirement of a myocardin-related transcription factor for
development of mammary myoepithelial cells. Mol Cell Biol 26:5797–5808
14. Sun Y, Boyd K, Xu W et al (2006) Acute myeloid leukemia-associated Mkl1 (Mrtf-a) is a
key regulator of mammary gland function. Mol Cell Biol 26:5809–5826
15. Parmacek MS (2007) Myocardin-related transcription factors: critical coactivators regulating
cardiovascular development and adaptation. Circ Res 100:633–644
16. Medjkane S, Perez-Sanchez C, Gaggioli C et al (2009) Myocardin-related transcription
factors and SRF are required for cytoskeletal dynamics and experimental metastasis. Nat Cell
Biol 11:257–268
17. Almeida EA, Ilic D, Han Q et al (2000) Matrix survival signalling: from fibronectin via focal
adhesion kinase to c-Jun NH(2)-terminal kinase. J Cell Biol 149:741–754
18. Babic AM, Kireeva ML, Kolesnikova TV et al (1998) CYR61, a product of a growth factor-
inducible immediate early gene, promotes angiogenesis and tumor growth. Proc Natl Acad
Sci USA 95:6355–6360
19. Tsai MS, Bogart DF, Castaneda JM et al (2002) Cyr61 promotes breast tumorigenesis and
cancer progression. Oncogene 21:8178–8185
20. Xing W, Zhang TC, Cao D et al (2006) Myocardin induces cardiomyocyte hypertrophy. Circ
Res 98:1089–1097
Chapter 87
The Analysis of the Inhibition Effect
of Cholic Acid Derivatives
on the Proliferation of Breast Cancer Cells
Xuegang Luo, Jing Wang, Xiangchao Gu, Chunling Zhang,

Xiangzheng Hu and Tong-Cun Zhang
Abstract Cancer is one of the major causes of death worldwide. Many clinical
evidences showed that the incidence of colon cancer increased after the chole-
cystectomy, suggesting that bile acid and its derivatives might play roles in the
process of tumorigenesis and its prevention. Bile acid derivative is a kind of good
candidates for prodrug design, but there are still few reports of its development for
anticancer drugs either domestically or internationally. In the present study, IC50
of 9 bile acid derivatives against MCF-7 human breast cancer cells was detected
by MTT assay, and the safety of several bile acid derivatives with high anticancer
effect were further analyzed in human umbilical vein endothelial cells. The results
showed that among 9 bile acid derivatives, cholic acid n-buthyl ester had lower
IC50 against cancer cells, but it did not have cytotoxicity to normal cell at low
concentration, indicating that they would be a good candidate for the development
of novel anticancer agents.
Keywords Bile acid derivatives MTT assay Cholic acid n-buthyl ester
X. Luo J. Wang X. Gu C. Zhang T.-C. Zhang (&)

Bioengineering, Tianjin University of Science and Technology, Tianjin 300457,
X. Luo J. Wang X. Gu C. Zhang T.-C. Zhang
Tianjin Key Laboratory of Industrial Microbiology, Tianjin 300457,
J. Wang
The Second People’s Hospital of Hengshui City, Hengshui 053000,
X. Hu
College of Science, Tianjin University of Science and Technology, Tianjin 300457,
e-mail: hxz0903@yahoo.com.cn
828 X. Luo et al.
87.1 Introduction
Cancer remains one of the leading causes of morbidity and mortality worldwide
[1–4]. Natural products have been used extensively in traditional medicine for
treatment of a myriad of diseases including various types of cancers [5]. Investi-
gation of natural products is a research field with great potential [6–8]. Primary
bile acids (cholic and chenodeoxycholic acid) are hydrophobic derivatives of
cholesterol synthesized in the liver and secreted with bile into the duodenum
where they play important role in digestion and absorption of dietary lipids [9]. It
not only can promote digestion and absorption of lipids, regulate cholesterol
metabolism, but also be used directly as the drug treatment of liver disease,
gallstones, and inflammation and other diseases.
Although bile acid derivative is a kind of good candidates for prodrug design,
but there are still few reports of its development for anticancer drugs either
domestically or internationally. Thus, to screen such novel effective anticancer
drugs, in this study, the cytotoxic effect and the 50 % inhibitory concentration
(IC50) of 9 bile acid derivatives against human cancer cells and normal cells was
detected with MTT assay.
87.2.1 Materials
Bile acid derivatives (Fig. 87.1) were synthesized in our lab. Dulbecco’s Modified
Eagle Medium (DMEM) and Fetal bovine serum (FBS) were purchased from Hy-
Clone (Thermo scientific). DMSO was purchased from Biochem Technology
(Shanghai, China). Trypsin and MTT were purchased from Solarbio (Beijing, China).
87.2.2 Cell Culture
Both MCF-7 human breast cancer cells and human umbilical vein endothelial cells
(HUVEC) were grown in Dulbecco’s Modified Eagle Medium (DMEM) supple-
mented with 10 % fetal bovine serum at 37 C in a humidified atmosphere of 5 %
CO2 and 95 % air.
87.2.3 MTT Assay
The MTT assay has proven to be a rapid and reproducible means of estimating cell
numbers in various eukaryotic systems [10]. MCF-7 or HUVEC were seeded into
87 The Analysis of the Inhibition Effect 829
Fig. 87.1 The structure of the bile acid derivatives
96-well dishes at a density of 1 9 104 per well in a fixed volume of 100 lL and
kept under 5 % CO2 at 37 C for 12 h. After 12 h, cells were attached as con-
trolled by microscopy and treated with the different bile acid derivatives dissolved
with DMSO, which final concentration range from 1 to 625 lmol/L. After 24 h
incubation, 20 lL of MTT solution (5 mg/mL) were added to each well and
incubation with MTT for 4 h. The supernatants were removed and the cells were
solubilized in DMSO (100 lL) for 10 min [11–13]. Finally, the absorbance of the
formazan product of MTT reduction was measured at 570 nm using BioTek
SynergyTM 4 Hybrid Microplate Reader.
830 X. Luo et al.
The inhibitory rate was calculated based on the following formula [14, 15]:

Aexperimental
Inhibition rate (% ) ¼ 1 100
Acontrol
(A means absorbance)
Furthermore, IC50 is the concentration of the cytotoxic agent that led to a
decrease of 50 % of the recorded signal. The IC50 was calculated by using SPSS
Statistics 19 statistical analysis software.
87.3.1 Effect of Bile Acid Derivatives on Proliferation

of MCF-7 Breast Cancer Cells
We first performed a MTT-based proliferation assay to explore how the bile acid
derivatives influence the growth of MCF-7 cells, while taxol (paclitaxel) was used
as the positive control. Taxol is one of the most effective microtubule- targeting
drugs for breast cancer treatment, and it accounts for significant improvements in
the survival of breast cancer patient in the last two decades [16]. As shown in
Fig. 87.2, all the 9 compounds had remarkable inhibitory effect on the prolifera-
tion of MCF-7 cancer cells, and it showed a dose-dependent manner under the
concentrations range from 1 to 625 lmol/L.
MCF-7 cells were treated with bile acid derivatives (CAME, CAEE, CABE,
UDCA, CDCA, 3ABC, 2HCA, 4HCA, CAHE) and taxol. After 24 h, cell number
was determined by MTT assay. Data shown were average ± SE from one typical
experiment with 6 replicates out of a series of 3 independent experiments.
The MTT (3-(4, 5-dimethylthiazole-2-yl)-2, 5-diphenyltetrazolium bromide)
assays are widespread methods to assess cell viability [17, 18]. MTT is reduced by
mitochondrial dehydrogenases in living cells to a blue-magenta-colored formazan
precipitate. The absorption of dissolved formazan in the visible region correlates
with the number of intact alive cells [19]. In the present study, the results sug-
gested that bile acid derivatives are able to damage and destroy MCF-7 human
breast cancer cells, and thus decrease the reduction of MTT to formazan.
Furthermore, to compare the anticancer function among the tested compounds,
IC50 values of the bile acid derivatives and taxol were calculated based on the
former data. The results showed that the IC50 of CAME, CAEE, CABE, UDCA,
CDCA, 3ABC, 2HCA, 4HCA, CAHE, and taxol were 56.272, 72.289, 13.685,
418.279, 395.918, 372.743, 182.356, 36.767, 104.081, 32.134 lmol/L, respec-
tively (Fig. 87.3). The results showed that among 9 bile acid derivatives, CABE
1 µ mol/L 25 µ mol/L 625 µ mol/L

5 µ mol/L 125 µ mol/L
100
80
Inhibition Rate (%)
60
40
20
0
CAME CAEE CABE UDCA CDCA 3ABC 2HCA 4HCA CAHE taxol
-20
Concentration (µ mol/L)
Fig. 87.2 Effects of bile acid derivatives on the proliferation of MCF-7 cells
450
400
350
IC50 (µ mol/L)
300
250
200
150
100
50
0
CAME CAEE CABE UDCA CDCA 3ABC 2HCA 4HCA CAHE taxol
Fig. 87.3 IC50 of bile acid derivatives against MCF-7 cells
had the lowest IC50 against MCF-7 cells, and it was even lower than the IC50
values of taxol, indicating that CABE might be powerful anticancer agents.
87.3.2 Effect of Bile Acid Derivatives on Proliferation

of HUVEC
Human umbilical vein endothelial cells (HUVEC) are a kind of human body
endothelial cells [20]. Therefore, we chose HUVEC as the normal cell lines to
assess the safety of bile acid derivatives with high anticancer effects. As shown in
Fig. 87.4, CAEE, 2HCA, CABE, 4HCA, CAHE were quite safe to the normal
cells, especially CABE and CAEE, which could even promote the proliferation of
HUVEC when the concentration was lower than 5 lmol/L.
HUVEC cells were treated with bile acid derivatives (CAEE, CABE, 2HCA,
4HCA, CAHE). After 24 h cell number was determined by MTT assay. Data
832 X. Luo et al.
1 µ mol/L 5 µ mol/L 25 µ mol/L

125 µ mol/L 625 µ mol/L
100
80
Inhibition Rate (%)
60
40
20
-20 CAME CAEE CABE 3ABC 4HCA

Concentration (µ mol/L)
-40
Fig. 87.4 Effects of bile acid derivatives on the proliferation of HUVEC
shown were average ± SE from one typical experiment with 6 replicates out of a
series of 3 independent experiments.
87.4 Conclusions
Our results strongly suggest that bile acid derivatives can be promising sources of
potential anticancer activity. The present results will form the basis for selection
of bile acid derivatives for further investigation in the potential drug discovery of
new natural bioactive compounds. Among 9 bile acid derivatives tested in the
present study, cholic acid ethyl ester and cholic acid n-buthyl ester had high
anticancer activity but low toxic effect on normal cells, indicating that these two
compounds would be a good candidate for the development of novel bile acid-
derived anticancer agents. Our future work will further confirm the in vivo anti-
cancer activity of them and explore its detailed mechanism.
Acknowledgments This work was financially supported by the National Basic Research Pro-
gram of China (973 Program) (NO. 2009CB825504), the National Natural Science Fundation of
China (NO. 31000343, NO. 31071126), the Science & Technology Project of Tianjin (No.
10JCZDJC22500,10ZXCXSY10100), and the High School Science & Technology Development
Fundation of Tianjin (NO.20090602).
References
1. Kanavos P (2006) The rising burden of cancer in the developing world. Ann Oncol
6(17):15–23
2. Shibuya K, Mathers CD, Pinto BC (2002) Global and regional estimates of cancer mortality
and incidence by site: II. results for the global burden of disease 2000. BMC Cancer 2:37
3. Salminen E, Izewska J, Andreo P (2005) IAEA’s Role in the global management of cancer-
focus on upgrading radiotherapy services. Acta Oncol 44:816–824
4. Sener SF, Grey N (2005) The global burden of cancer. Surg Oncol 92:1–3
5. Sudhakar C, Sabitha P, Shashi KR (2007) Betulinic acid inhibits prostate cancer growth
through inhibition of specificity protein transcription factors. Cancer Res 67:2816–2823
6. García SR, Ng C, Anderson H et al (2011) Synergistic drug combinations for tuberculosis
therapy identified by a novel high-throughput screen. Antimicrob Agents Ch
55(8):3861–3869
7. Aydee CE, Syrovets T, Pitterle K et al (2010) Tirucallic acids are novel pleckstrin homology
domain-dependent Akt inhibitors inducing apoptosis in prostate cancer cells. Mol Pharmacol
3(77):378–387
8. Gaube F, Wolfl S, Pusch L et al (2007) Gene expression profiling reveals effects of
cimicifuga racemosa (L.) NUTT. (black cohosh) on the estrogen receptor positive human
breast cancer cell line MCF-7. BMC Pharmacol 7:11
9. Pai R, Tarnawski AS, Tran T (2004) Deoxycholic acid activates b-catenin signaling pathway
and increases colon cell cancer growth and invasiveness. Mol Biol Cell 15:2156–2163
10. Lazaro JE, Gay F (1998) Plasmodium falciparum: in vitro cytotoxicity testing using MTT.
J Biomol Screen 1(3):49–53
11. Hida T, Ueda R, Takahashi T et al (1989) Chemosensitivity and radiosensitivity of small cell
lung cancer cell lines studied by a newly developed 3-(4,5-dimethylthiazol-2-yl)-2,5-
diphenyltetrazolium bromide (MTT) hybrid assay. Cancer Res 9(49):4785–4790
12. Noguchi K, Tani MI, Nakamura M (2005) Evaluation of chemosensitivity testing with highly
purified tumor cells in 435 patients with gastric carcinoma using an MTT assay. Anticancer
Res 25:931–938
13. Montoro E, Lemus D, Echemendia M et al (2005) Comparative evaluation of the nitrate
reduction assay, the MTT test, and the resazurin microtitre assay for drug susceptibility
testing of clinical isolates of mycobacterium tuberculosis. J Antimicrob Chemth
2(55):500–505
14. Akiri SR, Sareddy GR, Phanithi PB et al (2010) The antioxidant and antiproliferative
activities of methanolic extracts from njavara rice bran. BMC Complem Altern M 10:4
15. Pieters R, Loonen AH, Huismans DR et al (1990) In vitro drug sensitivity of cells from
children with leukemia using the MTT assay with improved culture conditions. Blood
11(76):2327–2336
16. Lu J, Tan M, Huang WC et al (2009) Mitotic deregulation by survivinin ErbB2-
overexpressing breast cancer cells contributesto taxol resistance. Clin Cancer Res
15(4):1326–1334
17. Nakamura R, Saikawa Y, Kubota T et al (2006) Role of the MTT chemosensitivity test in the
prognosis of gastric cancer patients after postoperative adjuvant chemotherapy. Anticancer
Res 26:1433–1438
18. Mueller H, Kassack MU, Wiese M (2004) Comparison of the usefulness of the MTT, ATP,
and calcein assays to predict the potency of cytotoxic agents in various human cancer cell
lines. J Biomol Screen 9(6):506–515
19. Mosmann T (1983) Rapid colorimetric assay for cellular growth and survival: application to
proliferation and cytotoxicity assays. J Immunol Methods 65:55–63
20. Mukherjee P, Anthony CF, Laura M et al (2008) Ganglioside GM3 suppresses the
proangiogenic effects of vascular endothelial growth factor and ganglioside GD1a. J Lipid
Res 2(49):929–938
Chapter 88
Design, Synthesis, and Biological
5-Bromobenzofuran-3(2H)-One and its
Derivatives
Lei Lv, Xiaomin Zhang, Jian Lv, Yao Zhou, Weiguo Hu, Peng Yu,
Hua Sun and Yuou Teng
Abstract Aurones and auronols are naturally occurring 2-benzylidenebenzof-

uranone-3(2H)-one derivatives. Aurones have a limited occurrence in fruits,
vegetables, and bright yellow color to flowers such as cosmos and coreopsis.
Aurones possess a wide range of biological activities, such as antitumor, anti-
fungal, phytoalexin, and so on. Some aurone derivatives have been studied as
antitumor drug molecules, but 2-benzylidene-5-bromobenzofuranone-3(2H)-one
series have not been reported yet. In this paper, we’d like to report the design,
synthesis, and biological evaluation of the novel aurone derivatives. All the newly
synthesized compounds were characterized by 1H NMR and their antitumor
activities were evaluated by using MTT method in HT-29, K562, and HepG2 cell
lines. 5-bromo-2-(4-nitrobenzylidene) benzofuran-3(2H)-one demonstrated good
antitumor activity against K562 cells with an IC50 of 0.37 lM.
Keywords Aurone derivatives Synthesis Antitumor MTT
L. Lv X. Zhang J. Lv Y. Zhou P. Yu H. Sun Y. Teng (&)

e-mail: tyo201485@tust.edu.cn
L. Lv X. Zhang J. Lv Y. Zhou P. Yu H. Sun Y. Teng
Tianjin Key Laboratory of Industry Microbiology, College of Biotechnology, Tianjin
W. Hu
North China Pharmaceutical Co. Ltd, Hebei 050015, People’s Republic of China
836 L. Lv et al.
88.1 Introduction
Aurones, a class of flavonoids found in fruits and flowers [1], possess a lot of
biological activities such as antitumor, antifungal, and phytoalexin [2–4]. Their
occurrence in marine organisms has been recently reported [5]. Compared to
flavones, the medicinal literature on aurones is in its infancy with trends and
design are just now emerging [6, 7].
Cancer is a global public health problem. Cancer chemoprevention aimed at
reducing the risk of cancer by avoiding exposure to cancer-causing agents,
enhancing the host defense capacity, adjusting lifestyle, supplementing with
chemopreventive agents that inhibit, reverse, or block tumorigenesis [8–10]. In
clinical practice with the usage of anticancer drugs, the phenomenon of resistance
gradually emerged, thus a tremendous effort will be made to enhance the intra-
cellular accumulation of antitumor agents in resistant cells [11, 12].
Aurones are recently attracting the interest of an increasing number of research
groups. In this paper, we report our works made on the design and synthetic routes
toward a series of functionalized aurones. The target compounds (6a–6e) were
synthesized in six steps through esterification reaction, nucleophilic substitution
reaction, aldol reaction [13], and so on. We also detected their antitumor activity
against K562, HT29, and HepG2 cancer cells. Their biological activity results
indicated that 5-bromo-2-(4-nitrobenzylidene) benzofuran-3(2H)-one (6a) shows
good antitumor activity against K562 cells.
was recorded on Bruker AM-400 NMR spectrometers in deuterated chloroform
and deuterated DMSO. The chemical shifts are reported in d (ppm) relative to
tetramethylsilane as internal standard.
88.2.2 Chemistry
The synthetic approaches of target compound 6a–6e were demonstrated in

Fig. 88.1.
88 Design, Synthesis, and Biological Evaluation 837
Br Br Br Br
i ii iii
COOH COOCH3 COOCH3 COOH

OH OH O COOC2H5 O COOH
1 2 3
O
O O
O v Br Br
iv Br vi
O O R
O
5 6
4
S
6a R= 6b R=
NO 2
6c R= 6d R = 6e R=
CN CH 3 OH
Fig. 88.1 Synthetic route of aurone derivatives
5-Bromosalicylic acid was employed to react with methanol at 80 C to provide

compound 1 which was then reacted with Ethyl chloroacetate at 70 C to afford the
key intermediate 2. Compound 2 was reacted with 10 % aqueous NaOH at 60 C to
provide compound 3 in good yield (81 %), then it was converted into compound 4
when treated with Ac2O, CH3COONa at 160 C for 4 h. A mixture of compound 4,
methanol, water, and 1 N HCl was heated to reflux for 3 h to obtain compound 5.
Compound 5 was then reacted with 4-Nitrobenzaldehyde, 2-Thenaldehyde, 4-
Cyanobenzaldehyde, 4-methylbenzaldehyde, and 4-Hydroxybenzaldehyde to afford
compound 6a, 6b, 6c, 6d, and 6e.
The anticancer activities for newly synthesized compounds were tested on the K562,
HT-29, and HepG2 cells by using MTT method. The results of compounds (6a–6e)
were listed in Table 88.1 which indicated that 5-bromo-2-(4-nitrobenzylidene)-
benzofuran-3(2H)-one (6a) demonstrated good antitumor activity against K562 and
HT-29 with an IC50 of 0.37 lM and 7.19 lM, respectively. But it was not active
against HepG2 (IC50 [ 10 lM) at our test condition.
Reagents and conditions: (i) CH3OH, conc H2SO4; (ii) ClCH2COOC2H5,
K2CO3, acetone; (iii) 10 % NaOH, H2O, then HCl; (iv) Ac2O, HAc, CH3COONa;
(v) CH3OH, HCl; and (vi) HAc, conc HCl.
838 L. Lv et al.
Table 88.1 Inhibition Activity of the compound 6a, 6b, 6c, 6d, and 6e
6a 6b 6c 6d 6e
K562 0.37 4.14 [10 [10 [10
HepG2 [10 [10 [10 [10 [10
HT-29 7.19 [10 [10 [10 [10
88.3.1 Synthesis and Characterize Aurones Derivatives by 1H

NMR
2-hydroxy-5-bromobenzoic acid methyl ester (1) [14]. The conc. H2SO4 (6 mL)
was added dropwise into 5-Bromosalicylic acid (6.0 g, 27.65 mmol) in methanol
(180 mL) at 0 C. After stirring for 10 min, the reaction mixture was heated to
80 C for 12 h. The solvent was removed under vacuum to afford the crude which
was purified by flash column chromatography (silica gel, petroleum ether/ethyl
acetate 25:1) to yield the compound 1 (5.7 g, 89 %).
1
H NMR (CDCl3 400 MHz): d/ppm 3.98 (s, 3H), 6.90 (d, J = 8.8 Hz, 1H), 7.55
(dd, J = 8.8 Hz, 2.41 Hz, H), 7.97 (d, J = 2.8 Hz, 1H), 10.71(s, 1H).
Methyl 2-((Ethoxycarbonyl)methoxy)-5-bromobenzoate(2). To a solution of 2-
hydroxy-5-bromobenzoic acid methyl ester (4.8 g, 20.78 mmol) in acetone
(120 mL) was added K2CO3 (8.64 g, 62.33 mmol) and ethylchloroacetate(5.1 g,
41.55 mmol).The mixture was stirred for 5 h at 70 C. After the solvent was
evaporated, the residue was dissolved in water and extracted with ethyl acetate, the
organic layer was dried over Na2SO4. The solvent was removed under vacuum to
provide the crude which was purified by flash column chromatography (silica gel,
petroleum ether/ethyl acetate 10:1) to afford compound 2 (5.8 g, 87 %).
1
H NMR (d6-DMSO 400 MHz): d/ppm 1.29 (t, J = 9.6 Hz, 3H), 3.92 (s, 3H),
4.28(q, J = 9.6 Hz, 2H), 4.71 (s, 2H), 6.80 (d, J = 12.0 Hz, 1H), 7.55 (d,
J = 8.4 Hz, 1H), 7.96 (s, 1H).
2-(Carboxymethoxy)-5-bromobenzoic Acid (3) [15]. To a solution of compound
2 (4.6 g, 14.49 m mol) in 1 N aqueous NaOH (262 mL), the mixture was stirred
for 4 h at 60 C. The product formed by adding 1 N HCl was filtered to give
3.18 g of compound 3 (80 %).
1
H NMR (d6-DMSO 400 MHz): d/ppm 4.79 (s, 2H), 6.99 (d, J = 9.2 Hz, 1H),
7.64 (dd, J = 2.8 Hz, 8.8 Hz, 1H), 7.75 (d, J = 2.4 Hz, 1H), 13.1 (broad, s, 1H).
5-Bromo-3-acetoxybenzofuran(4). A mixture of acetic anhydride(170 mL),
acetic acid(157 mL), anhydrous sodium acetate(20 g, 240 mmol), and compound
3 was heated to reflux for 4 h. Saturated aqueous sodium carbonate was then
added, and the mixture was extracted with CH2Cl2. The solvent was removed in
vacuo to give the crude product which was purified by flash column
chromatography (silica gel, petroleum ether/ethyl acetate 8:1) to afford compound

4 (2.4 g, 81.7 %).
1
H NMR (CDCl3 400 MHz): d/ppm 2.37 (s, 3H), 7.33 (d, J = 12.0 Hz, 1H),
7.43 (dd, J = 4.8 Hz, 2.8 Hz 1H), 7.71 (s, 1H), 8.02 (s, 1H).
5-Bromobenzofuran-3(2H)-one (5). A mixture of compound 4 (2.4 g,
9.54 mmol), methanol (50 mL), water (30 mL) and 1 N HCl (60 mL) was heated
to reflux for 3 h. The precipitate formed was collected by filtration, washed with
water, and dried under vacuum to get compound 5 (1.9 g, 86 %).
1
H NMR (CDCl3 400 MHz): d/ppm 4.67(s, 2H), 7.06 (d, J = 12.0 Hz, 1H),
7.69 (dd, J = 2.8 Hz, 2.8 Hz, 1H), 7.79 (d, J = 2.8 Hz, 1H).
Compounds (6a–6e) [16]. To a solution of compound 5 (1 equiv) and 1.2 equiv of
appropriate benzaldehyde derivatives in 10 mL of glacial acetic acid, 2 drops of
concentrated hydrochloric acid was added at the room temperature, the reaction
was stirred at the same temperature for 3 h. The reaction mixture was poured into
ice–water and filtered. The filter cake was purified by flash column chromatog-
raphy (silica gel, petroleum ether/ethyl acetate 30:1–20:1) to get compounds (6a–
6e).
5-bromo-2-(4-nitrobenzylidene) benzofuran-3(2H)-one (6a). Starting from
compound 5 (0.2 g, 0.94 mmol) and 4-Nitrobenzaldehyde (0.17 g, 1.13 mmol),
compound 6a was obtained in 66 % yield.
1
H NMR (CDCl3 400 MHz): d/ppm 6.90 (s, 1H), 7.30 (s, 1H), 7.82–7.79(dd,
J = 8.8 Hz, 2.4 Hz, 1H), 7.95 (d, J = 2.0 Hz, 1H), 8.05 (d, J = 8.8 Hz, 2H), 8.26
(d, J = 4.4 Hz, 2H).
5-bromo-2-(thiophen-2-ylmethylene) benzofuran-3(2H)-one (6b). Starting from
compound 5 (0.2 g, 0.94 mmol) and 2-Thenaldehyde (0.13 g, 1.13 mmol), com-
pound 6b was obtained in 71 % yield.
1
H NMR (CDCl3 400 MHz): d/ppm 7.17–7.14 (m, 1H), 7.19 (s, 1H), 7.23 (s,
1H), 7.55 (d, J = 3.6 Hz, 1H), 7.63 (d, J = 5.2 Hz, 1H), 7.74–7.71 (dd,
J = 8.4 Hz, 2 Hz, 1H), 7.90 (d, J = 2.0 Hz, 1H).
5-bromo-2-(4-cyanobenzylidene) benzofuran-3(2H)-one (6c). Starting from
compound 5 (0.2 g, 0.94 mmol) and 4-Cyanobenzaldehyde (0.15 g, 1.13 mmol),
compound 6c was obtained in 54 % yield.
1
H NMR (CDCl3 400 MHz): d/ppm 6.85 (s, 1H), 7.29 (s, 1H), 7.73 (d,
J = 8.4 Hz, 2H), 7.79 (dd, J = 8.8 Hz, 2 Hz, 1H), 7.93 (d, J = 2.0 Hz, 1H), 7.98
(d, J = 10.4 Hz, 2H).
5-bromo-2-(4-methylbenzylidene) benzofuran-3(2H)-one (6d). Starting from
compound 5 (0.2 g, 0.94 mmol) and 4-methylbenzaldehyde (0.14 g, 1.13 mmol),
compound 6d was obtained in 88 % yield.
1
H NMR (CDCl3 400 MHz): d/ppm 2.41 (s, 3H), 6.91 (s, 1H), 7.23 (s, 1H),
7.28 (d, J = 6.8 Hz, 2H), 7.73 (dd, J = 8.8 Hz, 2 Hz, 1H), 7.80 (d, J = 8.0 Hz,
2H), 7.96 (d, J = 2.0 Hz, 1H).
5-bromo-2-(4-hydroxybenzylidene) benzofuran-3(2H)-one (6e). Starting from
compound 5 (0.2 g, 0.94 mmol) and 4-Hydroxybenzaldehyde (0.14 g,
1.13 mmol), compound 6e was obtained in 65 % yield.
840 L. Lv et al.
1
H NMR (d6-DMSO 400 MHz): d/ppm 6.91 (d, J = 8.8 Hz, 2H), 6.96 (s, 1H),
7.55 (d, J = 8.4 Hz, 1H), 7.87–7.94 (m, 4H), 10.30 (s, 1H).
88.3.2 Anticancer Activity Assay
All the above compounds were tested for their in vitro anticancer activity against
HT-29, K562, and HepG2 cells by MTT-Based assay. The cells were diluted to a
with a multichannel pipet. After incubating for 24 h, 0.5 lL compounds were
compound: 0.1, 0.3, 1, 3, and 10 lM). The culture plates were incubated for 4 h
after which 20 lL MTT was added to each well, then the medium was removed
from the wells and 100 lL DMSO was added into each well. After leaving for
further 10 min to dissolve the formazan crystals formed, the optical density (OD)
was measured at 490 and 630 nm. Cell viability was calculated from measure-
ments of OD value according to the corresponding formula and a graph is plotted
of Cell viability (y-axis) against drug concentration (x-axis). The given values are
mean values of three experiments. The IC50 concentration represents the con-
centration which results in a 50 % decrease in cell growth after 2 days incubation.
The results were presented in Table 88.1.
88.4 Conclusion
We report the design and synthesis of novel aurone derivatives. Several steps among
this route were optimized, such as cyclization, nucleophilic substitution reaction,
aldol reaction, and so on. The cyclization reaction was the key step. All the target
compounds were synthesized in six steps with the overall yield of 25-30 %,
respectively. The structures of these novel targets and all of intermediates were
confirmed by 1H NMR. Biological activity test indicated that 5-bromo-2-(4-nitro-
benzylidene) benzofuran-3(2H)-one (6a) has good antitumor activity against K562
and HT-29 cells. In order to improve the antitumor activity, further modification
based on compound (6a) was undergone in our lab.
Acknowledgments The authors sincerely thank the financial support from the Tianjin University
of Science and Technology (20110406, 20110115), the Natural Science Foundation of Tianjin
(11JGYBJC14300), the Science amp Technology Project of Tianjin (11ZCGHHZ00400) and the
Natural Science Foundation of Tianjin (12JCYBJC31600).
References
1. Harborne JR (1994) The flavonoids: advances in research since 1986. Chapman and Hall,
London, pp 341–399
2. Brooks CJW, Watson DG (1985) Phytoalexins. Nat Prod Rep 2:427–459
3. Aufmkolk M, Koerhle J, Hesch RD et al (1986) Inhibition of rat liver iodothyronine
deiodinase.Interaction of aurones with the iodothyronine ligand-binding site. J Biol Chem
261:11623
4. Kayser O, Kiderlen AF, Folkens U et al (1999) In vitro leishmanicidal activity of aurones.
Planta Med 65:316
5. Choudhary MI, Hayat S, Khan AM et al (2001) Two new aurones from marine brown alga
spatoglossum variabile. Chem Pharm Bull 49:105–107
6. Boumendjel A (2003) Aurones: a subclass of flavonoids with promising biological potential.
Curr Med Chem 10:2621–2630
7. Lawrence NJ, Rennison D, McGown AT et al (2003) The total synthesis of an aurone isolated
from Uvaria hamiltonii: Aurones and flavones as anticancer agents. Bioorg Med Chem Lett
13:3759–3763
8. Sporn MB, Liby KT (2005) Cancer chemoprevention: scientific promise, clinical uncertainty.
Nat Clin Pract Oncol 2:518–525
9. Hail NJ, Cortes M, Drake EN et al (2008) Cancer chemoprevention: a radical perspective.
Free Rad Biol Med 45:97–110
10. Chen C, Kong AN (2005) Dietary cancer-chemopreventive compounds: from signaling and
gene expression to pharmacological effects. Trends Pharmacol Sci 26:318–326
11. Ford JM (1996) Experimental reversal of P-glycoprotein-mediated multidrug resistance by
pharmacological chemosensitizers. Eur J Cancer 32:991–1001
12. Wiese M, Pajeva IK (2001) Structure-activity relationships of multidrug resistance reversers.
Curr Med Chem 8:685–713
13. Lee CY, Chew EH, Go ML (2010) Functionalized aurones as inducers of NAD(P)H: quinone
oxidoreductase 1 that activate AhR/XRE and Nrf2/ARE signaling pathways: synthesis,
evaluation and SAR. Eur J Med Chem 45:2957–2971
14. Ohkata K, Tamura Y, Shetuni BB et al (2004) Stereoselectivity control by oxaspiro rings
during Diels-Alder cycloadditions to cross-conjugated cyclohexadienones: the syn oxygen
phenomenon. J Am Chem Soc 126:16783–16792
15. Cheng C, Zhu SF, Liu B et al (2007) Highly enantioselective insertion of carbenoids into O-H
bonds of phenols: an efficient approach to chiral alpha-aryloxycarboxylic esters. J Am Chem
Soc 129:12616–12617
16. Cheng H, Zhang L, Liu Y et al (2010) Design, synthesis and discovery of 5-hydroxyaurone
derivatives as growth inhibitors against HUVEC and some cancer cell lines. Eur J Med Chem
45:5950–5957
Chapter 89
Preliminary Study on the Mechanism
of Cartilage Polysaccharide Inducing H22
Cell to Engender Immunogenicity
Guoqiang Zheng, Pan Li, Anguo Teng, Jie Zheng, Wenhang Wang
and Anjun Liu
Abstract It was discussed that the apoptosis product of H22 hepatocarcinoma

cells induced by cartilage polysaccharide (CP) could activate the body immune
system to antitumor. The mice’s survival time, life extension rate (LER) and
livability were measured by animal experiment. Lymphocyte proliferation was
determined by MTT. The immune serum titer was identified by ELISA. The
tumor protein antigen was analyzed by SDS-PAGE, Western blot, 2-D, and mass
spectrometry analysis (MS). Compared with the model group, there was a sig-
nificant improvement on the survival time, LER, livability, thymus index, spleen
index, and stimulation index in immune group. The serum had high antibody titer
which was up to 1:6,400. The tumor-specific antigen was tubulin alpha chain by
MS and molecular weight is 50 KDa. The apoptosis product of H22 induced by
CP had immunogenicity and could activate the immune system of the mouse to
antitumor.
Keywords Cartilage Polysaccharide Immunogenicity Tumor-specific

antigen Antitumor
89.1 Introduction
Immunotherapy is an approach to induce immune responses to tumor-associated

antigens. Yet, the immunogenicity of tumor antigen is generally weak requiring
an adjuvant which stimulates the immune system against tumor [1]. Several
studies have applied cytokines as adjuvant in vaccine [2], but in recent years
G. Zheng P. Li A. Teng J. Zheng W. Wang A. Liu (&)

College of Food Engineering and Biotechnology, Tianjin University of Science
e-mail: laj@tust.edu.cn
844 G. Zheng et al.
polysaccharide has been shown to be a good biological response modifier

(BRM) without the adverse side effects compared to traditional agents [3].
There are more than 220 kinds of antitumor polysaccharides extracted from
Ganoderma lucidum, Lentinus edodes, Grifola frondosa, and others [4–6].
Previous studies confirmed in our lab that cartilage polysaccharide (CP) isolated
from porcine cartilage could significantly induce cell apoptosis and inhibit
tumor growth in vivo and extend the survival rate of mice. The pathogenesis of
systemic lupus erythematosus (SLE) had close relation with cell apoptosis that
apoptotic body could denature their own tissue and engender immunogenicity
of proteins antigen in mice immune system [7]. Due to the discovery of tumor
antigen with immunogenicity, some people attempted to search the high
expression tumor-associated protein as tumor antigen [8]. In this study, H22
hepatocarcinoma cells were treated with CP to investigate whether its apoptosis
product as the tumor cell vaccine could protect the immune mice from tumor
or not.
89.2.1 Cell Line and Experimental Animal
The murine H22 hepatocarcinoma cells line was purchased from Tianjin Medical
Sciences University. The animals were female BALB/c mice, 6–8 weeks of age,
20 g in weight, and purchased from Chinese Academy of Military Medical Sci-
ences Experimental Animal Center.
89.2.2 Preparation of the Tumor Vaccine
The H22 hepatocarcinoma cells (2.5 9 108 cells) were cultured in 8 ml

RPMI1640 medium with 10 % FBS and mixed with 400 lg/mL CP for 48 h. Cells
were harvested by centrifugation (12,000 r/min for 20 min). The pellet was sus-
pended in distilled water and then subjected to six repeated freeze–thaw cycles in
liquid nitrogen as vaccine. The vaccine was injected in back subcutaneous once a
week, amount to four times. After 4 weeks, H22 hepatocarcinoma cells (2 9 106/
0.2 mL) were injected in armpits.
89.2.3 Animal Immune Experiment
Animal trials were undertaken using groups of 20 animals for each treatment
(control, model, and immune group). The model group was immunized with equal
89 Preliminary Study on the Mechanism of Cartilage 845
amount of 0.9 % saline. Trials were performed over a 30-day period with the
survival time, life extension rate (LER), and livability of each group.
89.2.4 Spleen Index and Thymus Index
The mice body weight was measured and then they were sacrificed. Organs (spleen
and thymus) were removed and weighed.
89.2.5 Lymphocyte Proliferation Experiment
Lymphocytes proliferation experiment was assayed by MTT. The fresh spleen of

each group was ground into single cell suspension, about 5 9 106 cells/ml. The
H22 cells (100 ll/well) were cultured in the 96-well microplate and simulta-
neously treated with ConA and LPS for 48 h, whose concentration is 5 lg/ml
respectively. The cells were added MTT solution (0.5 mg/ml in 1 9 PBS pH 7.4)
for 4 h and DMSO simultaneously shaking for 2 min. The culture medium and the
untreated cells were used as controls. The optical absorption at 570 nm was
measured and the stimulation index (Si) was calculated.
89.2.6 Preparation of Immune Serum
After 4 weeks, blood was taken from the eyeball of immunized mice and incubated at
4 C for 3 h. The serum was subsequently collected by centrifugation (5,000 r/min,
10 min) and stored in liquid nitrogen prior to analysis.
89.2.7 SDS–PAGE and Western Blot
The proteins were extracted from the H22 cells treated with CP (24, 48, and
72 h) respectively, and the control cells by Ripa lysis buffer. One SDS-PAGE
gel was stained with Coommassie Brilliant Blue R-250. The other duplicate
SDS-PAGE gel was transferred to a nitrocellulose membrane (NC) and subse-
quently treated with blocking reagent (5 % w/v skimmed milk powder) for 2 h at
4 C. The NC membrane was then reacted with immunized serum at 1:150
dilution and incubated overnight at 4 C followed by incubation with goat anti-
mouse IgG labelled with HRP at a dilution of 1:2,500 for 1 h at 37 C.
Immunodetection was accomplished by enhanced ECL and autoradiography on
Kodak film.
846 G. Zheng et al.
89.2.8 2D-PAGE and MS
To perform 2-D PAGE, first, proteins (1 mg) were applied to isoelectric focusing
(IEF), the IPG strips (17 cm, pH 3–10) were rehydrated overnight. Secondly, IPG
strips were equilibrated twice in the equilibration buffer (0.375 M Tris–HCl [pH
8.8], 6 M urea, 20 % glycerol, 2 % sodium dodecyl sulfate [SDS]) for 15 min. In
the first equilibration, 200 mg of DTT was dissolved in 10 ml buffer. In the second
equilibration 250 mg iodoacetamide was added. Strip was then transferred to the
12 % SDS-PAGE gels and covered with 0.5 % low melting agarose. The gel was
stained with Coommassie Brilliant Blue R-250 and then used for MS analysis.
One Way Analysis of variance (ANOVA) was performed to determine differences

in life extension rate and livability. A P value of\0.05 was considered significant.
89.3 Results
89.3.1 Survival Status was Improved in Immunized Mice
The survival time (30.06 ± 0.84 d) was increased in immune group compared
with model group (18.0 ± 0.91 d) (P \ 0.05) (Table 89.1). The life extension rate
(66.87 %) and livability (70 %) in immune group were significantly different from
model group (p \ 0.01). The result showed that the immunized mice were gen-
erated immunogenicity by tumor vaccine, which activated the immune system and
enhanced immunity to provide protection against tumor intrusion.
89.3.2 Thymus and Spleen were Protected by Tumor Vaccine
The thymus was severely atrophied and spleen was swollen obviously in model
group compared with blank group, but in immune group thymus atrophy and
Table 89.1 Survival status of the mice (

x±s)(n = 20)
Groups Survival time(d) Life extension rate ( %) Livability (%)
Blank group – – –
Model group 18.0 ± 0.91 0 0
Immune group 30.06 ± 0.84* 66.87** 70**
*P \ 0.05 vs. model group; **P \ 0.01 vs. model group
Table 89.2 Spleen and Groups Thymus index (Ti) Spleen index (Si)
thymus indexes of the mice in
different groups (x±s) Blank group 4.17 ± 0.98 4.86 ± 0.47
(n = 20) Model group 0.49 ± 0.32 9.35 ± 0.41
Immune group 3.43 ± 0.24** 4.41 ± 0.71**
**P \ 0.01 vs. model group
splenomegalia were changed slightly, which was close to normal mice

(Table 89.2). The result showed that, to a certain extent, immune organ in the
immune group was protected after treatment with vaccine. The reasons for sple-
nomegalia are required further study in model group.
89.3.3 Lymphocyte was Activated with Tumor Vaccine
From Table 89.3, compared with the model group, B and T cells’ stimulation
index (SI) of the immune group had increased remarkably (P \ 0.01). Although
the immunized mice had extreme gap with the blank group, it had much
improvement contrast with the model group. Results revealed that tumor vaccine
could activate lymphocyte to protect mice to resist the tumor cells.
89.3.4 High Level Antibody was Detected in Immunized

Mice
The serum of the immune group had higher antibody titer than the blank group
([ 1:6,400) (Fig. 89.1). The result showed the tumor vaccine treated with CP
adjuvant could produce tumor antigen or enhance the immunogenicity of tumor-
specific antigen which could generate antibody to enhance humoral immune. Thus
the tumor vaccine could generate antibody to inhibit tumor cell proliferation.
89.3.5 A 50 kDa Tumor Protein Antigen was Found

by SDS-PAGE and Western Blotting
A tumor protein antigen band emerged at 50 kDa, which showed strong reaction
with immunized serum rather than the blank serum. We presumed that the tumor
Table 89.3 Lymphocyte Group Con A LPS
proliferation of each group (
x
± s, n = 20) Blank group 10.29 ± 0.68 9.86 ± 0.32
Model group 1.26 ± 0.15 1.74 ± 0.18
Immune group 5.87 ± 0.41** 4.29 ± 0.71**
**P \ 0.01 vs. model group
848 G. Zheng et al.
Fig. 89.1 The absorbance of

serum antibody titer
protein antigen could activate the immune responses due to the changes in antigen
protein’s expression, which could combine with these specific antibodies. It could
be the tumor protein antigen producing these specific antibodies to stop the
invasion of tumor cells (Fig. 89.2).
89.3.6 The Tumor Antigen was Tubulin Alpha Chain

by 2-D-PAGE and MS
The total protein extracted from H22 cell mixed CP for 48 h and the untreated H22
cells were analyzed in at least three independent experiments. The result showed
that a protein was up-regulated obviously in treated H22 cells with CP in Fig. 89.3.
According to MS analysis, the protein is tubulin alpha chain (Accession Number:
M 0 24 48 72 0 24 48 72 0 24 48 72
(a) (b) (c) (d)

Fig. 89.2 Result of tumor-specific antigen by Western blotting. a Marker; The numbers above
are for H22 cells treated with the CP for 0, 24, 48, and 72 h, respectively; b SDS-PAGE; c The
result of western blot incubated with the immunized serum; d blank serum
Fig. 89.3 Result of 2-D PAGE stained by Coomassie blue. a The protein from the untreated H22
cells. b The protein from the treated H22 cells with CP for 48 h
gi|549052). Its pI is 4.94 and molecular weight is 50.81 kDa. The result of the
50 kDa protein was consistent with previous results of SDS-PAGE and Western
Blot.
89.4 Discussion
The primary cause of CP that inhibited cell proliferation and induced cell apop-
tosis was used as a blocker in cell cycle which was blocked in the G1 and S phase
and could not inverse to the G2 phase; the changes in cellular morphology such as
nuclear condensation and fragmentation occurring upon CP treatment was also
observed [1].
This study tried to evaluate the effect of tumor vaccine treated with CP for 48 h.
Compared with model groups, there was an evident improvement in survival time,
life extension rate, and livability in the immune group. Thymus index and spleen
index were also demonstrated as available protection for immune organ. Lym-
phocyte proliferation experiment had increased remarkably in comparison with
model group. These results revealed that the tumor vaccine could significantly
stimulate the homologous antitumor immune responses, containing cellular
immunity and humoral immunity. Western blot and 2D-PAGE showed the
expression of a tumor antigen at an estimated molecular mass of 50 kDa, was
up-regulated after treatment with CP, and the tumor antigen was tubulin alpha
chain by MS. Tubulin alpha chain was the component of the microtubule involved
in maintaining the cell morphology, mitotic progression, and chromosomal seg-
regation. Tubulin alpha chain binding the drug could promote cell apoptosis by
inhibiting mitotic program. Some studies illustrated that tubulin alpha chain had a
850 G. Zheng et al.
certain effect on occurrence, development, and prognosis in lung cancer. With the
development of the tumor, the expression of tubulin alpha chain increased grad-
ually, so that controlling tubulin alpha chain in cancer cells had vital significance
on the treatment of cancer [9].
In our opinion, the expression of tumor-specific antigen (TSA) in H22 hepa-
tocarcinoma cells was controlled by CP. We may deduce a conclusion that the
immunogenicity of the tumor vaccine was increased due to the high expression of
protein or post-translational protein modification by CP. When the tumor vaccine
was injected into mice, the antitumor immune responses were activated, so that the
mice could keep from invasion of tumor cells. The identification of TSA led to the
development of immunotherapy aimed at augmenting antitumor immune respon-
ses [10]. From this fact we could conclude that TSA might be a therapeutic target.
Tumor vaccines based on TSA played a key role in cancer prevention. Active
immunotherapy with cancer vaccines could induce humoral and cellular immune
responses and the development of immunological memory which may substan-
tially reduce the relapse of the tumor [11, 12].
Acknowledgments This work was supported by grants from China National Natural Science
Foundation (No.31271975 and No.20776113).
References
1. Liu A, Gao Y, Zhang H et al (2011) Immunologic mechanism of the anti-tumor immunity

responses induced by the altogether culture medium of porcine cartilage polysaccharide and
S180 ascites lump cells as a tumor vaccine. ICBBE:1–5
2. Richard M (2010) Antibody and cell-mediated immunity to Streptococcus pneumoniae:
implications for vaccine development. J Mol Med 88:135–142
3. Tzianbos O (2000) Polysaccharide immunomodulators as therapeutic agents: Structural
aspects and biologic function. Clin Micro Rev 13(4):523–533
4. Wei D, Li N, Wei D et al (2009) Tumor-inhibitory and liver-protective effects of
Phellinusigniarius extracellular polysaccharides. World J Microbiol Biotechnol 125:633–638
5. Zhang L, Liu W, Han B et al (2008) Isolation and characterization of antitumor
polysaccharides from the marine mollusk Ruditapes philippinarum. Eur Food Res Technol
227:103–110
6. Maria L, Daniel P, Ana P et al (2009) In vivo growth-inhibition of Sarcoma 180 by an a-
(1 ? 4)-glucan–b-(1 ? 6)-glucan-protein complex polysaccharide obtained from Agaricus
blazei Murill. J Nat Med 63:32–40
7. Li H, Wang J (2005) Cell apoptisis and systemic lupus erythematosus. Shandong Med J
45(16):4–6
8. Ke X, Wang J, Yang X (2006) The new concept of tumor antigen and the importance of
immunotherapy in lymphoma and other tumors. J Exp Hematol 14(3):151–154
9. Chen Q, Jiang Z, Wu L (2010) Relativity expression of Tubulin alpha chain and MDR1 with
lung cancer biology. Chinese J Oncol 32(4):278–282
10. Constantin N, Baxevanis S, Perez M (2009) Combinatorial treatments including vaccines,
chemotherapy and monoclonal antibodies for cancer therapy. Cancer Immunol Immunother
58:317–324
11. Neelapu S, Kwak L (2007) Vaccine therapy for B-cell lymphomas: next-generation
strategies. American Society of Hematology education program book. Atlanta GA:243–249
12. Paula W, Olga R, Jennifer B et al (2009) Her-2 DNA versus cell vaccine: mmunogenicity and
anti-tumor activity. Cancer Immunol Immunother 58:759–767
Chapter 90
Design and Synthesis of Novel
20-Substituted Hydroxycamptothecin
Derivatives
Shaopeng Wen, Dewu Quan, Yao Zhou, Haiyong Jia, Peng Yu,
Hua Sun and Na Guo
Abstract Camptothecin (CPT) is a potent antitumor alkaloid isolated in 1966 by

M.E. Wall. Clinical use of camptothecin in cancer therapy, however, was limited
by its poor water solubility. Recently, there is a growing tendency to develop some
new methods for the synthesis of novel derivatives to solve the problem. In this
paper, we’d like to report the design and synthesis of a novel series of 20-
substituted Hydroxycamptothecin to increase the water solubility. All the five
products have never been reported before. All the products and important inter-
mediates were characterized by 1HNMR and LC–MS spectra.
Keywords Hydroxycamptothecin derivatives Water solubility
90.1 Introduction
Camptothecin is a pentacyclic alkaloid, which was first isolated in 1966 from the
extract of a Chinese plant, Camptotheca acuminate, by M.E. Wall [1], and soon it
was found that CPT possess good inhibitory activity against a broad spectrum of
tumors. Interest in CPT derivatives was revitalized in 1985 by the discovery that
CPT exhibits a unique mechanism of action because it targets the nuclear enzyme
topoisomerase I [2–4]. CPT forms a ternary complex with topoisomerase I and
S. Wen D. Quan Y. Zhou H. Jia P. Yu H. Sun N. Guo (&)

Key Laboratory of Industrial Microbiology, Ministry of Education,
e-mail: guona@tust.edu.cn
S. Wen D. Quan Y. Zhou H. Jia P. Yu N. Guo
Tianjin Key Laboratory of Industry Microbiology, College of Biotechnology,
Tianjin University of Science and Technology, Tianjin 300457,
854 S. Wen et al.
DNA, and the stabilization of these complex results in DNA breaks by preventing
DNA relegation [5–7].
Initial clinical trials with CPT were limited by its poor solubility in physio-
logically compatible media [8]. Early attempts to form a water-soluble sodium salt
of CPT by opening the lactone ring with sodium hydroxide resulted in a compound
with poor antitumor activity [9–11]. It was later reported that the closed lactone
form is an absolute requisite for antitumor activity [12, 13]. Intensive efforts in
medicinal chemistry over the past several decades have provided a large number of
camptothecin analogues, of which topotecan and irinotecan [14] are among those
clinically approved for the treatment of cancers.
In order to increase the water solubility, we added some water soluble groups in
appropriate position of hydroxycamptothecin. In this paper, we would like to
report the design and synthesis of novel 20-substituted hydroxycamptothecin
derivatives. The target compounds (4a–4e) were synthesized through four steps.
90.2.1 Chemistry
Figure 90.1 demonstrates the synthetic approach to the target compounds 4a–4e.
Hydroxycamptothecin reacted with Di-tert-butyl dicarbonate in DMF generated
compound 1, which was then reacted with 4-Nitrophenyl chloroformate under
argon to afford the key intermediate compound 2. In this step, anhydrous and
anaerobic conditions were required because low yield was observed when the
reaction conditions were not well controlled. Compound 2 respectively reacted
with diethylamine, propylamine, n-Butylamine, morpholine and pyrrolidine to get
compounds 3a–3e. Compounds 3a–3e in dichloromethane was allowed to react
with trifluoroacetic acid to produce the target compounds 4a–4e.
90.3 Experimental
All reagents and solvents used in this paper were of reagent grade. Thin layer
(particle size 200-400 mesh) was used for flash chromatography. 1H NMR spectra
was recorded on Bruker AM-400 NMR spectrometers in CDCl3 or d6-DMSO. The
chemical shifts are reported in d (ppm) relative to tetramethylsilane as internal
standard.
90 Design and Synthesis of Novel 20-Substituted Hydroxycamptothecin Derivatives 855
O NO2
HO O (Boc) O,pyridine, O O O Cl O
N 2 N
O
N DMF N DMAP,DCM
O O
OH O 1 OH O
O O O O O
O TFA
N N
O O
N DMF N DCM
O O
O O O O
O R
2 3
O O
H
3a R= N N
NO2 3b R=
HO 3c R= N 3d R= O N
O H
N
N 3e R= N
O
O O
R
4 O
H
4a R= 4b R= N
N
4c R= N 4d R= O N
H
4e R= N
Fig. 90.1 Synthetic route of 20-substituted hydroxycamptothecins derivatives
90.3.2 Experimental Section
tert-butyl(4-ethyl-4-hydroxy-3,14-dioxo-3,4,12,14-tetrahydro-1H-pyrano[30 ,40 :
6,7]indolizino[1,2-b]quinolin-9-yl) carbonate (1). To the hydroxycamptothecin
(12 g, 0.055 mol) in dry N,N-Dimethylformamide (137 mL) at 0 C was added Di-
tert-butyl dicarbonate (10 g, 0.027 mol). The reaction mixture was stirred at room
temperature for 10 h. The reaction mixture was diluted with dichloromethane
(800 mL). The phases were separated and the organic layer was washed with water
(3 9 300 mL), 1 N HCl (3 9 100 mL) and dried over anhydrous magnesium sul-
fate. The solvent was removed under vacuum to afford the crude, which was purified
by flash column chromatography (silica gel, dichloromethane/methanol 20:1) to yield
the compound 1 (14.5 g, 95 %).
1
H NMR (CDCl3 400 MHz): d/ppm 1.06 (t, J = 6 Hz, 3H), 1.62 (s, 9H), 1.91
(m, J = 6 Hz, 2H), 5.30 (s, 2H), 5.31 (d, J = 16.5 Hz, 1H), 5.75 (d, J = 16.5 Hz,
856 S. Wen et al.
1H), 7.66 (dd, J = 2.4 Hz, 1H), 7.67 (s, 1H), 7.75 (d, J = 2.4 Hz, 1H), 8.21
(s, 1H), 8.25 (s, 1H), 8.34(s, 1H).
tert-butyl(4-ethyl-3,14-dioxo-3,4,12,14-tetrahydro-1H-pyrano[30 ,40 :6,7]indo-
lizino[1,2-b]quinoline-4,9-diyl) (4-nitrophenyl) dicarbonate (2). To the com-
pound 1 (4.0 g, 8.4 mmol) in dry dichloromethane (400 mL) at 0 C was added 4-
Dimethylaminopyridine (1.52 g, 42 mmol) slowly. The reaction mixture was
stirred at 0 C for 10 min, then 4-nitrophenylchloroformate (5.2 g, 25.1 mmol)
was added. The reaction mixture was stirred for 10 h at room temperature. The
reaction mixture was diluted with dichloromethane (100 mL). The phases were
separated and the organic layer was washed with water (2 9 100 mL), brine
(100 mL), and dried over anhydrous magnesium sulfate. The solvent was removed
under vacuum to afford the crude which was purified by flash column chroma-
tography (silica gel, dichloromethane/methanol 120:1) to yield the compound 2
(3.3 g, 60 %).
1
H NMR (d6-DMSO 400 MHz): d/ppm 1.06 (t, J = 6 Hz, 3H), 1.54 (s, 9H),
2.26 (m, 2H), 5.28 (s, 2H), 5.56 (d, J = 6.4 Hz, 2H), 7.28 (s, 1H), 7.52 (d,
J = 12 Hz, 2H), 7.66 (dd, J = 9.2 Hz, 2 Hz, 1H), 8.01 (s, 1H), 8.21 (d,
J = 9.2 Hz, 1H), 8.28 (d, J = 9.2 Hz, 2H), 8.68 (s, 1H).
9-((tert-butoxycarbonyl)oxy)-4-ethyl-3,14-dioxo-3,4,12,14-tetrahydro-1H-pyr-
ano[30 ,40 :6,7]indolizino[1,2-b]quinolin-4-yl diethylcarbamate (3a). To a solu-
tion of compound 2(1.0 g, 1.59 mmol) in dry N,N-Dimethylformamide (8 mL) was
added diethylamine (0.23 g, 3.18 mmol). The reaction mixture was stirred for
30 min at room temperature. The reaction mixture was diluted with dichloro-
methane (25 mL). The phases were separated and the organic layer was washed
with water (2 9 50 mL), brine (100 mL), and dried over anhydrous magnesium
sulfate. The solvent was removed under vacuum to afford the crude which was
purified by flash column chromatography (silica gel, dichloromethane/methanol
175:1) to yield the compound 3a (0.3 g, 60 %).
1
H NMR (d6-DMSO 400 MHz): d/ppm 0.97 (m, 6H) 1.06 (t, J = 6 Hz, 3H),
1.54 (s, 9H), 2.26 (m, 2H), 3.40 (m, 4H), 5.28 (s, 2H), 5.56 (d, J = 6.4 Hz, 2H),
7.28 (s, 1H), 7.66 (dd, J = 9.2 Hz, 2 Hz, 1H), 8.01 (s, 1H), 8.21 (d, J = 9.2 Hz,
1H), 8.68 (s, 1H).
ano[30 ,40 :6,7]indolizino[1,2-b]quinolin-4-yl propylcarbamate (3b). To a solu-
tion of compound 2(1.0 g, 1.59 mmol) in dry N,N-Dimethylformamide (8 mL)
was added propylamine (0.19 g, 3.18 mmol). The reaction mixture was stirred for
with water (2 9 50 mL), brine (100 mL) and dried over anhydrous magnesium
175:1) to yield the compound 3b (0.3 g, 60 %).
1
1.54 (s, 9H), 1.60 (m, 2H), 2.26 (m, 2H), 3.18 (m, 2H), 3.40 (m, 4H) 5.28 (s, 2H),
5.56 (d, J = 6.4 Hz, 2H), 7.28 (s, 1H), 7.66 (dd, J = 9.2 Hz, 2 Hz, 1H), 8.01
(s, 1H), 8.21 (d, J = 9.2 Hz, 1H), 8.68 (s, 1H).
ano[30 ,40 :6,7]indolizino[1,2-b]quinolin-4-yl butylcarbamate (3c). To a solution
of compound 2 (1.0 g,1.59 mmol) in dry N,N-Dimethylformamide (8 mL) was
added n-Butylamine (0.23 g, 3.18 mmol). The reaction mixture was stirred for
175:1) to yield the compound 3c (0.3 g, 60 %).
1
1.54 (s, 9H), 1.60 (m, 2H), 2.26 (m, 2H), 3.18 (m, 2H), 3.40 (m, 4H) 5.28 (s, 2H),
5.56 (d, J = 6.4 Hz, 2H), 7.28 (s, 1H), 7.66 (dd, J = 9.2 Hz, 2 Hz, 1H), 8.01 (s,
1H), 8.21 (d, J = 9.2 Hz, 1H), 8.68 (s, 1H).
ano[30 ,40 :6,7]indolizino[1,2-b]quinolin-4-yl morpholine-4-carboxylate (3d). To
asolutionofcompound2(1.0 g, 1.59 mmol)indryN,N-Dimethylformamide (8 mL)
was added morpholine (0.23 g, 3.18 mmol). The reaction mixture was stirred for
175:1) to yield the compound 3d (0.3 g, 60 %).
1
1.81 (m, 2H), 1.91 (m, 2H), 2.11 (m, 2H), 3.17 (m, 2H), 3.61 (m, 2H), 5.28 (s, 2H),
1H), 8.21 (d, J = 9.2 Hz, 1H), 8.68 (s, 1H).
ano[30 ,40 :6,7]indolizino[1,2-b]quinolin-4-yl pyrrolidine-1-carboxylate (3e). To
a solution of compound 2 (1.0 g, 1.59 mmol) in dry N,N-Dimethylformamide
(8 mL) was added pyrrolidine (0.24 g, 3.18 mmol). The reaction mixture was
stirred for 30 min at room temperature. The reaction mixture was diluted with
dichloromethane (25 mL). The phases were separated and the organic layer was
washed with water (2 9 50 mL), brine (100 mL) and dried over anhydrous
magnesium sulfate. The solvent was removed under vacuum to afford the crude
which was purified by flash column chromatography (silica gel, dichloromethane/
methanol 175:1) to yield the compound 3e (0.3 g, 60 %).
1
1.81 (m, 2H), 1.91 (m, 2H), 2.11 (m, 2H), 3.17 (m, 4H), 3.65 (m, 4H), 5.28 (s, 2H),
1H), 8.21 (d, J = 9.2 Hz, 1H), 8.68 (s, 1H).
858 S. Wen et al.
4-ethyl-9-hydroxy-3,14-dioxo-3,4,12,14-tetrahydro-1H-pyrano[30 ,40 :6,7]ind

olizino[1,2-b]quinolin-4-yl diethylcarbamate (4a). To a solution of compound
3a (0.3 g, 0.53 mmol) in dry dichloromethane (25 mL) at 0 C was added triflu-
oroacetic acid (1 mL) and the mixture was brought to room temperature and
stirred overnight. The solvent was removed in vacuo to give the crude product
methanol 120:1) to afford compound 4a (0.12 g, 50 %).
1
2.26 (m, 2H), 3.40 (m, 4H) 5.28 (s, 2H), 5.56 (d, J = 6.4 Hz, 2H), 7.28 (s, 1H),
7.66 (dd, J = 9.2 Hz, 2 Hz, 1H), 8.01 (s, 1H), 8.21 (d, J = 9.2 Hz, 1H), 8.68 (s,
1H).
olizino[1,2-b]quinolin-4-yl propylcarbamate (4b). To a solution of compound
3b (0.3 g, 0.54 mmol) in dry dichloromethane (25 mL) at0 C was added triflu-
oroacetic acid (1 mL) and the mixture was brought to room temperature and
stirred overnight. The solvent was removed in vacuo to give the crude product
methanol 120:1) to afford compound 4b (0.11 g, 51 %).
1
1.60 (m, 2H), 2.26 (m, 2H), 3.18 (m, 2H), 3.40 (m, 4H), 5.28 (s, 2H), 5.56 (d,
J = 6.4 Hz, 2H), 7.28 (s, 1H), 7.66 (dd, J = 9.2 Hz, 2 Hz, 1H), 8.01 (s, 1H), 8.21
(d, J = 9.2 Hz, 1H), 8.68 (s, 1H).
olizino[1,2-b]quinolin-4-yl butylcarbamate (4c). To a solution of compound 3c
(0.3 g, 0.53 mmol) in dry dichloromethane (25 mL) at 0 C was added trifluoro-
acetic acid (1 mL) and the mixture was brought to room temperature and stirred
overnight. The solvent was removed in vacuo to give the crude product which was
120:1) to afford compound 4c (0.11 g, 53 %).
1
1.60 (m, 2H), 2.26 (m, 2H), 3.18 (m, 2H), 3.40(m, 4H), 5.28 (s, 2H), 5.56 (d,
(d, J = 9.2 Hz, 1H), 8.68 (s, 1H).
olizino[1,2-b]quinolin-4-yl morpholine-4-carboxylate (4d). To a solution of
compound 3d (0.3 g, 0.56 mmol) in dry dichloromethane (25 mL) at0 C was
added trifluoroacetic acid (1 mL) and the mixture was brought to room tempera-
ture and stirred overnight. The solvent was removed in vacuo to give the crude
product, which was purified by flash column chromatography (silica gel, dichlo-
romethane/methanol 120:1) to afford compound 4d (0.12 g, 52 %).
1
H NMR (d6-DMSO 400 MHz): d/ppm 0.90 (t, J = 6 Hz, 3H), 1.81 (m, 2H),
1.91(m, 2H), 2.11(m, 2H), 3.17(m, 2H), 3.61(m, 2H), 5.28(s, 2H), 5.56 (d,
(d, J = 9.2 Hz, 1H), 8.68 (s, 1H).

olizino[1,2-b]quinolin-4-yl pyrrolidine-1-carboxylate (4e). To a solution of
compound 3e (0.3 g, 0.53 mmol) in dry dichloromethane (25 mL) at 0 C was
added trifluoroacetic acid (1 mL) and the mixture was brought to room tempera-
ture and stirred overnight. The solvent was removed in vacuo to give the crude
product which was purified by flash column chromatography (silica gel, dichlo-
romethane/methanol 120:1) to afford compound 4e (0.11 g, 50 %).
1
H NMR (d6-DMSO 400 MHz): d/ppm 0.90 (t, J = 6 Hz, 3H), 1.81 (m, 2H),
1.91 (m, 2H), 2.11 (m, 2H), 3.17 (m, 4H), 3.65 (m, 4H), 5.28 (s, 2H), 5.56 (d,
(d, J = 9.2 Hz,1H), 8.68 (s, 1H).
90.4 Summary
Here we describe the synthesis of a series of novel 20-substituted hydroxycam-

ptothecin derivatives, several steps among this route were optimized, such as the
coupling reaction. The coupling reaction was the key step in the entire route. In
this step, anhydrous and anaerobic conditions were required. All the target com-
pounds were synthesized through four steps with the overall yield of 12–15 %.
Compared with the hydroxycamptothecin, the water solubility has increased a lot.
These new target compounds and key intermediates were confirmed by 1H NMR
and LC–MS spectra. The biological activities of these compounds are being
evaluated.
Acknowledgments The authors sincerely thank thefinancial support from the Tianjin University
of Science and Technology (20110406, 20110115), the Natural Science Foundation of Tianjin
(11JGYBJC14300), the Science & Technology Project of Tianjin(11ZCGHHZ00400) and the
Natural Science Foundation of Tianjin(12JCYBJC31600).
References
1. Wall ME, Wani M, Cook C, Palmer KH et al (1996) Sim, Plant antitumor agents. I. The
isolation and structure of camptothecin, a novel alkaloidal leukemia and tumor inhibitor from
camptotheca acuminata. J Am Chem Soc 88:3888–3890
2. Hsiang YH, Liu LF, Wall ME et al (1989) DNA topoisomerase I-mediated DNA cleavage
and cytotoxicity of camptothecin analogues. Cancer Res 49:4385
3. Kawato Y, Aonuma M, Hirota Y et al (1991) Intracellular roles of SN-38, a metabolite of the
camptothecin derivative CPT-11, in the antitumor effect of CPT-11. Cancer Res 51:4187
4. Loza MC, Wellinger RE (2009) A novel approach for organelle-specific DNA damage
targeting reveals different susceptibility of mitochondrial DNA to the anticancer drugs
camptothecin and topotecan. Nucleic Acids Res 37:e26
860 S. Wen et al.
5. Han M, He CX, Fang QL et al (2009) A novel camptothecin derivative incorporated in nano-

carrier induced distinguished improvement in solubility, stability and anti-tumor activity both
in vitro and in vivo. Pharm Res 26:926–935
6. Hsiang YH, Liu LF (1988) Identification of mammalian DNA topoisomerase I as an
intracellular target of the anticancer drug camptothecin. Cancer Res 48:1722–1726
7. Davis ME (2009) Design and development of IT-101, a cyclodextrin-containing polymer
conjugate of camptothecin. Adv Drug Deliv Rev 61:1189–1192
8. Hsu JL, Ho YF, Li TK et al (2012) Rottlerin potentiates camptothecin-induced cytotoxicity in
human hormone refractory prostate cancers through increased formation and stabilization of
topoisomerase I-DNA cleavage complexes in a PKCd-independent pathway. Biochem
9. Cao Z, Mendoza J, Kozielski A, Liu X et al (2012) Giovanella, Anticancer Activity of New
Haloalkyl Camptothecin Esters against Human Cancer Cell Lines and Human Tumor
Xenografts Grown in Nude Mice. Anti Cancer Agents Med Chem Anti Cancer Agents
12:818–828
10. Min KH, Park K, Kim YS et al (2008) Hydrophobically modified glycol chitosan
nanoparticles-encapsulated camptothecin enhance the drug stability and tumor targeting in
cancer therapy. J Controll Release 127:208–218
11. Ozeki T, Hashizawa K, Kaneko D et al (2010) Treatment of rat brain tumors using sustained-
release of camptothecin from poly (lactic-co-glycolic acid) microspheres in a
thermoreversible hydrogel. Chem Pharm Bull 58:1142
12. Sapra P, Zhao H, Mehlig M et al (2008) Novel Delivery of SN38 Markedly Inhibits Tumor
Growth in Xenografts, Including a Camptothecin-11–Refractory Model. Clin Cancer Res
14:1888–1896
13. Swaminathan S, Pastero L, Serpe L et al (2010) Cyclodextrin-based nanosponges
encapsulating camptothecin: Physicochemical characterization, stability and cytotoxicity.
Eur J Pharm Biopharm 74:193–201
14. Li P, Zheng Y, Ran H et al (2012) Ultrasound triggered drug release from 10-
Hydroxycamptothecin-loaded phospholipid microbubbles for targeted tumor therapy in
mice. J Controll Release 162:349–354
Chapter 91
Design and Synthesis of 5-Azacytidine
Analogs
Jianbo Xing, Hua Sun, Xijuan Liang, Yuou Teng, Peng Yu

and Kui Lu
Abstract 5-azacitidine is a prescription injectable drug used for the treatment of

myelodysplastic syndromes (MDS) and acute myelogenous leukemia (AML). In
this paper, we would like to report a new approach to 5-azacitidine analogs from
dicyanodiamine and formic acid or benzoic acid through several efficient reac-
tions, such as cyclization reaction, Vorbrüggen coupling, and so on. Among those
compounds, two azacytosine analogs and two 5-azacitidine analogs have not been
reported yet. All products and important intermediates were characterized by
1HNMR and MS spectrums.
Keywords 5-azacytidine analogs Antiproliferative activity Cyclization reac-

tion and Vorbrüggen coupling
91.1 Introduction
5-azacytidine (5-aza-CR) is well-known DNA methyltransferase inhibitor and has

been approved to be prescription injectable drug for the treatment of myelodys-
plastic syndrome (MDS), chronic myelomonocytic leukemia (CMML) and acute
myelogenous leukemia (AML) [1]. 5-azacitidine and its anologs extensively exist
in nature and possess lots of biological activities like antiviral, anticarcer,
J. Xing H. Sun X. Liang Y. Teng P. Yu K. Lu (&)

Biotechnology, Tianjin 300457, China
e-mail: lukui@tust.edu.cn
J. Xing H. Sun X. Liang Y. Teng P. Yu K. Lu
Tianjin 300457, China
J. Xing H. Sun X. Liang Y. Teng P. Yu K. Lu
Tianjin University of Science & Technology, Tianjin 300457, China
862 J. Xing et al.
anti-HIV, etc. Recently, there is a growing tendency to develop some new methods
for the synthesis of 5-azacitidine analogs to study their biological properties [1, 2].
Usually, the azacytosine analogs were synthesized from guanylurea with
orthoesters, refluxed with the dimethylformamide [3–5]. In this paper, a new
method is developed for the synthesis of azacytosine, we would like to report the
design and synthesis of azacitidine analogs with cyclization and Vorbrüggen
coupling as the key steps [6, 7]. The target compounds (1-3) were synthesized in
three steps in 15–40 % overall yield.
91.2.1 Chemistry
As illustrated in Scheme 91.1, the target compounds 1 were synthesized from

dicyanodiamine through the intermediate compounds 2 and compound 3. Com-
pound 3, 4-Amino-6-1,3,5-triazin-2(1H)-ones, prepared from the reactions of
dicyanodiamine and formic acid (or acetic acid, benzoic acid), reacted with hex-
amethyldisilazane (HMDS) to produce N,O-bistrimethylsilylated-1,3,5-triazinones
[8]. Vorbrüggen coupling of compound 2 with acylated sugars in anhydrous
acetonitrile in the presence of a Lewis acid catalyst (SnCl4) gave the acylated
nucleosides [9, 10].
Reagents and Conditions: (i) carboxylic acid/anhydrous sodium salfate/DMF,
145 C, 70–80 %; (ii) HMDA/(NH4)2SO4/toluene,130 C, 85–95 %; and (iii)
acylated sugars/SnCl4/acetontrile, 10–40 %
NH2 Si NH2
NH2 NH
i ii iii N N
HN NH
N N N N
Si O N R
N O N R R N O O O
H O
3 2 O O 1
O
O
1a R= H 1c R=
1b R= H3C 1d R= H3CO 1e R= F
Scheme 91.1 Synthetic route to azacytidine analogs

91 Design and Synthesis of 5-Azacytidine Analogs 863
91.2.2 Experimental
Materials and Instruments. All reagents and solvents used in this paper were of
reagent grade. Reaction temperatures were controlled using oil bath temperature
modulator or ice bath. Thin layer chromatography (TLC) was performed using E.
Merck silica gel 60 GF254 precoated plates (0.25 mm) and visualized using a
combination of UV. Silica gel (particle size 200–400 mesh) was used for flash
chromatography. 1H-NMR spectra was recorded on Bruker AM-400 NMR spec-
trometers in deuterated chloroform and deuterated DMSO. The chemical shifts are
reported in d (ppm) relative to tetramethylsilane as internal standard. Mass spectra
were recorded on LCMS-QP2010 mass instrument.
91.2.2.1 Compounds (3a–3b)
To a flask (100 mL) dicyanodiamine (2 g, 0.12 mol), formic acid (2.2 g, 0.24 mol),
or acetic acid (3.3 g, 0.24 mol) were added. The mixture was heated to 120 C for
20 min, then the system was cool to room temperature, the precipitate was filtered
and washed with EtOH to give a white solid. The white solid to was put into a flask
(100 mL), and heat to 145C for 4 h. Then the reaction system was cooled to 75 C,
and water (30 mL) was added, the mixture was stirred for 5 min, hydrochloric acid
was added until the white solid was completely dissolved. The mixture was filtered
and the ammonia (aq) was added until the pH = 8–9, the precipitate was filtered to
give another white solid which was then put into a flask (100 mL), water (30 mL)
and ammonia (aq, 10 mL) was added. The mixture was heated to 75 C for 10 min.
After cooling to room temperature, the mixture was filtered and the filtrate was
adjust to pH = 8–9 by hydrochloric acid. The precipitate was filtered to give the
pure product as a white solid.
4-Amino-1,3,5-triazin-2(1H)-one(3a). Starting from dicyanodiamine (2 g, 0.12
mol) and formic acid (2.2 g, 0.24 mol), compound 3a was obtained (1.73 g,
65 %). 1H NMR (d6-DMSO 400 MHz): d/ppm 7.26(s, 2H), 8.05 (s, 1H), 11.56
(s, 1H). EMS-MS: m/z 113[M ? 1]+.
4-Amino-2-methyl-1,3,5-triazin-one(3b). Starting from dicyanodiamine (2 g,
0.12 mol) and acetic acid (3.3 g, 0.24 mol), compound 3b was obtained (1.8 g,
61 %). 1H NMR (d6-DMSO 400 MHz): d/ppm 2.37 (s, 3H), 7.89 (s, 1H), 11.67
(s, 1H). EMS-MS: m/z 127[M ? 1]+, 125[M-1]-.
91.2.2.2 Compounds (3c–3e)
To a flask (100 mL), dicyanodiamine (2 g, 0.12 mol), benzoic acid (2.6 g, 0.12
mol), or 4-methyoxybenzoic acid (3.3 g, 0.12 mol) or 3-fluorobenzoic acid (3.3 g,
0.12 mol), anhydrous sodium sulfuric (2 g) were added. The mixture was heated to
145 C for 6 h. Then the mixture was cool to room temperature for 12 h, the
864 J. Xing et al.
precipitate was filtered and washed with EtOH to give a white solid. The white
solid was put into a flask (100 mL), water (10 mL) was added, the mixture was
stirred for 5 min, hydrochloric acid was added until the white solid was completely
dissolved. The mixture was filtered and the ammonia (aq) was added until the
pH = 8–9, the precipitate was filtered to give another white solid which was then
put into a flask (100 mL), water (30 mL) and ammonia (aq, 10 mL) was added.
The mixture was heated to 75 C for 10 min. After cooling to room temperature,
the mixture was filtered and the filtrate was adjust to pH = 8–9 by hydrochloric
acid. The precipitate was filtered to give the pure product as a white solid.
4-Amino-2-phenyl-1,3,5-triazin-one(3c). Starting from dicyanodiamine (2 g,
0.12 mol) and benzoic acid (2.6 g, 0.12 mol), compound 3c was obtained
(1.0 g, 23 %). 1H NMR (d6-DMSO 400 MHz): d/ppm 7.49 (s, 1H), 7.51
(t, J = 10.4 Hz, 3H),7.60 (s, 1H), 8.19(d, J = 8.8 Hz, 2H) 11.53 (s, 1H). EMS-
MS: m/z 189.0[M ? 1]+, 187.1.0[M-1]-.
4-Amino-2-(4-methoxyphenyl)-1,3,5-triazin-one(3d). Starting from dicyanodi-
amine (2 g, 0.12 mol) and 4-methyoxybenzoic acid (3.3 g, 0.12 mol), compound
3d was obtained (1.5 g, 29 %). 1H NMR (d6-DMSO 400 MHz): d/ppm 3.85 (s,
3H), 7.06 (d, J = 6.2 Hz, 2H), 7.38 (s, 1H), 8.19 (d, J = 6.2 Hz, 2H), 11.74 (s,
1H), 11.78 (s, 1H). EMS-MS: m/z 219.1[M ? 1]+, 217.3[M-1]-.
4-Amino-2-(3-fluorophenyl)-1,3,5-triazin-one(3e). Starting from dicyanodiamine
(2 g, 0.12 mol) and 3-fluorobenzoic acid (3.3 g, 1.2 mol), compound 3e was
obtained (2.0 g, 40 %). 1H NMR (d6-DMSO 400 MHz): d/ppm 7.39 (s, 1H),
7.56(d, J = 10.0 Hz, 1H), 7.64 (s, H), 8.16 (d, J = 9.4 Hz, 1H), 8.21 (s, 1H), 11.26
(s, 1H). EMS-MS: m/z 207.1[M ? 1]+, 205.2[M-1]-.
91.2.2.3 Compounds (1a–1e)
To a solution of compound 3a–3e (4.46 mmol) in HMDS (10 mL) was added
(NH4)2SO4 (0.01 g). The mixture was refluxed for 12–16 h. After evaporation
under vacuum, compound 2a–2e was obtained. The crude product was used to
glycosylation without further purification. Compound 2a–2e (1 equiv) was dis-
solved in anhydrous acetonitrile, l,2,3,5-tetra-O-acetyl-b-D-ribose (1 equiv) and
SnCl4 (2 equiv) in acetonitrile were added. The mixture was stirred at room
temperature for 10–18 h, then diluted in chloroform and neutralized with a satu-
rated solution of sodium bicarbonate. The organic layer was separated, dried, and
evaporated. The residue was purified by flash column chromatography (CHCl3-
CH3OH) to give Compound 1a–1e as white solids.
1-(2,3,5-tri-O-acetyl-b-D-ribose)-4-Amino-1,3,5-triazin-2(1H)-one(1a). Start-
ing from the compound 3a (500 mg), compound 1a was obtained in (600 mg,
40 %). 1H NMR (d6-DMSO 400 MHz): d/ppm 2.05 (s, 3H), 2.06 (s, 3H), 2.07 (s,
3H), 4.27–4.32 (m, 1H), 5.33 (t, J = 11.2 Hz, 1H), 5.43 (t, J = 5.1 Hz, 1H), 5.78
(d, J = 4.1 Hz, 1H).
1-(2,3,5-tri-O-acetyl-b-D-ribose)-4-Amino-2-methyl-1,3,5-triazin-one(1b).
Starting from the compound 3b (500 mg), compound 1b was obtained
91 Design and Synthesis of 5-Azacytidine Analogs 865
(380 mg, 27 %). 1H NMR (d6-DMSO 400 MHz): d/ppm 2.05 (s, 3H), 2.06
(s, 3H), 2.07 (s, 3H), 2.44 (s, 3H), 3.69–3.75 (m, 1H), 4.19–4.29 (m, 2H),
4.50–4.54 (m, 1H), 5.62–5.72 (m, 3H).
1-(2,3,5-tri-O-acetyl-b-D-ribose)-4-Amino-6-phenyl-1,3,5-triazin-one(1c).
Starting from the compound 3c (500 mg), compound 1c was obtained (237 mg,
20 %). 1H NMR (d6-DMSO 400 MHz): d/ppm 2.05 (s, 3H), 2.06 (s, 3H), 2.07 (s,
3H), 4.27–4.37(m, 2H), 4.64 (m, 1H), 5.37 (m, 1H), 5.66 (t, J = 12.6 Hz, 1H),
6.54 (s, 2H), 6.83 (d, J = 11.2, 1H), 7.46 (t, J = 10.1, 2H), 7.55 (d, J = 9.5, 1H),
8.41 (d, J = 9.5, 2H).
1-(2,3,5-tri-O-acetyl-b-D-ribose)-4-Amino-2-(4-methoxyphenyl)-1,3,5-triazin-
one(1d)). Starting from the compound 3d (500 mg), compound 1d was obtained
(106 mg, 9 %). 1H NMR (d6-DMSO 400 MHz): d/ppm 2.05 (s, 3H), 2.06 (s, 3H),
2.07 (s, 3H), 3.87 (s, 3H), 4.14(m, 2H), 4.64 (m, 1H), 5.35 (m, 1H), 5.63
(t, J = 12.7 Hz,1H), 6.46 (s, 2H), 6.80 (d, J = 11.2, 1H), 7.09 (m, 2H), 7.34
(t, J = 10.8, 1H), 7.94 (s, 1H), 7.99 (d, J = 9.5, 1H).
1-(2,3,5-tri-O-acetyl-b-D-ribose)-4-Amino-2-(3-fluorophenyl) -1,3,5-triazin-
one(1e). Starting from the compound 3e (500 mg), compound 1e was obtained in
(160 mg, 15 %). 1H NMR (d6-DMSO 400 MHz): d/ppm 2.05 (s, 3H), 2.06 (s, 3H),
2.07 (s, 3H), 4.22 (m, J = 40.4, 2H), 4.37 (m, 1H), 5.25 (m, 1H), 5.63(t,
J = 12.7 Hz,1H), 6.41 (s, 2H), 6.80 (d, J = 11.1, 1H), 7.23 (m, 1H), 7.40 (m, 1H),
8.09 (d, J = 11.8, 1H), 7.99 (d, J = 9.5, 1H).
91.3 Summary
In summary, we report the design and synthesis of azacitidine analogs by using

cyclization reaction and Vorbrüggen coupling as the key steps. Among this, the
cyclization reaction is a new approach to synthesize the azacytosine analogs. With
this method in hand, the synthesis of azacytosines becomes easier and cheaper. All
the target compounds were synthesized in three steps with the total yield of
15–40 %. These new target compounds and all intermediates were confirmed by
1
HNMR and MS. The biological activities of these compounds are being
evaluated.
Acknowledgments The authors sincerely thank the financial support from the Tianjin Uni-
versity of Science & Technology (20110407), the Science & Technology Project of Tianjin
(11ZCGHHZ00400), the Natural Science Foundation of Tianjin (11JGYBJC14300), International
Science & Technology Cooperation Program of China (2013DFA31160) and Tianjin City High
School Science & Technology Fund Planning Project (20110504).
866 J. Xing et al.
References
1. Griffiths EA, Gore SD (2008) DNA methyltransferase and histone deacetylase inhibitors in
the treatment of myelodysplastic syndromes. Semin Hematol 45:23–30
2. Grønbaek K, Hother C, Jones PA (2007) Epigenetic changes in cancer. APMIS 115:
1039–1059
3. Hartenstein R, Fridivich I (1967) Amidinourea formate, a precursor of 2-amino-4-hydroxy-
s-triazine. J Org Chem 32:1653–1654
4. Piskala A (1967) Synthesis of 5-azacytosine (4-amino-1,2-dihydro-1,3,5-triazin-2-one) and
its methyl derivatives. Coll Czech Chem Commun 32:3966–3976
5. Hanna NB, Masojidkova M, Fiedler P, Piskala A (1998) Synthesis of some 6-substituted 5-
azacytidine. Collect Czech Chem Commun 63:222–230
6. Hanna NB, Zajicek J, Piskala A (1997) 6-Methyl-5-azacytidine-synthesis, conformational
properties and biological activity, a comparison of molecular conformation with 5-azacytidine.
Nucleos Nucleot 16:129–144
7. Niedballa U, Vorbruggen H (1974) General synthesis of N-glycoside, synthesis of
5-azacytidines. J Org Chem 39:3672–3674
8. Winkey MW, Robins RK (1970) Direct glycosylation of 1,3,5-triazinones. New approach to
the synthesis of the nucleoside antibiotic 5-azacytidine (4-amino-1-.beta.-D-ribofuranosyl-
1,3,5-triazin-2-one) and related derivatives. J Org Chem 35:491–495
9. Pierce AC, Arnost M, Davies RJ, Forster C (2004) Diaminotriazoles useful as inhibitors of
protein kinases. WO Patent 2004046120
10. Gaubert G, Mathe C, Imbach JL, Eriksson S, Vincenzetti S, Salvatori D, Vita A, Maury G
(2000) Unnatural enantiomers of 5-azacytidine analogues: synthesis and enzymatic
properties. Eur J Med Chem 35:1011–1019
Chapter 92
Stigmasterol from the Flowers of Trollius
chinensis
Mengmeng Zhou, Min Wang, Daoqing Xu and Qin Pan
Abstract After being extracted with 75 % ethanol, Trollius chinensis extract was
obtained by evaporation of its supernatant under vacuum conditions and dissolved with
water, followed by extraction with petroleum ether. The petroleum ether part was
collected and subjected to silica gel column chromatography and separated individual.
Components were further purified by several rounds of silica gel column, followed by
recrystallization with methanol. In total, three compounds were isolated from the air-
dried flowers of Trollius chinensis and identified as b-sitosterol, stigmasterol and
hellebore acid based on spectral analysis, NMR experimentation. Among these three
compounds, stigmasterol was found for the first time in Trollius chinensis.
Keywords Trollius chinensis Ranunculaceae b-sitosterol Stigmasterol

Hellebore acid
92.1 Introduction
Thanks to its remarkable curative effect [1, 2], Trollius chinensis Bunge (Ran-
unculaceae), is now widely used for treating upper respiratory infection [3],
chronic pharyngitis, laryngitis, and amygdalitis in traditional Chinese medicine.
M. Zhou M. Wang (&)

Key Laboratory of Industrial Microbiology, Ministry of Education, National Engineering
Laboratory for Industrial Enzymes, Tianjin Key Laboratory of Industrial Microbiology,
e-mail: minw@tust.edu.cn
D. Xu (&)
Zhongxin Pharmaceuticals, Tianjin 300193, People’s Republic of China
e-mail: xudaoqing@vip.sina.com
Q. Pan
Key Laboratory of Chinese Medicine Quality Control Enterprise, Tianjin, R&D Center
Tianjin Zhongxin Pharmaceutical, Tianjin 300457, People’s Republic of China
868 M. Zhou et al.
Recently, medicines that mainly contain Trollius chinensis are more popular [1],
such as Trollius chinensis Particles, Trollius chinensis Capsule, and Trollius
chinensis Dispersible Tablets. It is also used in cigarette as a spice [4]. The yellow
pigment [5] in this plant is now widely used as a natural dyestuff [5]. In agri-
culture, it plays a role as a natural insecticide because of the active insecticidal
ingredients 200 -O-(2 -methylbutyryl)-vitexin and ursolic acid [6]. In the field of
food production, it is also used as an antioxidant [7, 8].
The origin habitat of Trollius chinensis is in Peru. It prefers to live in the areas
that are warm, moist, and full of sunshine. In China, it is mainly distributed in the
southwest, northwest, and northeast, especially in Chengde of Hebei province,
Neimenggu, Yunnan, and Xinjiang province. The statistical data from Doroszewska
in 1974 showed that there are 31 species of Trollius chinensis in the whole word.
Previous studies indicate that the main components of Trollius chinensis are
flavones, organic acids, and alkaloids [9, 10]. It is also reported that the main
constituents that contribute to pharmacological function is flavones [11, 12].
Recently, thanks to new technologies, more active ingredients were found from
this valuable medicine plant, for example, vitexin, orietin, and their derivatives.
Jian-Hua Zou [13] identified four flavone C-glycosides in 2005; Zhan-Lin Li [14]
isolated three new flavone C-glycosides in 2008; Shao-Qing Cai in 2006 isolated
an antiviral flavonoid-type C-Glycosides [15]. Ru-Feng Wang isolated trollioside
[16] in 2003, a new alkaloid [17] in 2004, and a new natural ceramide in 2010.
However, little work has been conducted to isolate and identify active ingredients
from the petroleum ether part of the Trollius chinensis extracts.
In this paper, we report the isolation and structure elucidation of the compounds
that obtained from the petroleum ether part, one of the identified compounds was,
for the first time, found in this plant, which was a supplement to the composition of
the Trollius chinensis.
92.2.1 General
NMR spectra were recorded in CDCl3 with an BRUKER 400 NMR spectrometer
with TMS as an internal standard. Silica gel H and silica gel 60–100, 200–300
mesh (both from Qingdao Haiyang Chemical Co., Qingdao, P.R. China) were used
for column chromatography.
92.2.2 Plant Material
The air-dried flowers were bought from Anguo Chinese herbal medicine market,
Hebei, China, in June 2011. And it is stored in the medicine storage of R&D
Center Tianjin Zhong Xin Pharmaceutical.
92 Stigmasterol from the Flowers of Trollius chinensis 869
92.2.3 Extraction and Isolation
The air-dried flowers were extracted (20 kg) with 75 % ethanol three times,
soaking for 24 h each time. The supernatant was evaporated in vacuo at 50 C into
small volume and made sure there was no ethanol left. Then dissolve it with water.
After that, partition the solution with petroleum ether, ethyl acetate, and n-butyl
alcohol one by one [18], and yield petroleum ether extractum 720 g. The petroleum
ether extractum dissolved by petroleum ether was subjected to silica gel (200–300
mesh), eluting with a petroleum ether—ethyl acetate gradient to gain 10 fractions
judging by the result of TLC. Number them as fraction 1, fraction 2 and so on.
Fraction 4 was set up to silica gel (200–300 mesh), eluting with a petroleum
ether—ethyl acetate gradient to give four parts. Then, put the third part to the silica
gel, eluting it with a petroleum ether–acetone gradient to yield three sections.
Dissolve the last section with the lest methanol in 50 C water bath, then put it into
the refrigerator when its temperature was near to the room temperature. In this
way, we got both I and II by the method of recrystallization.
Fraction 5 was set up to silica gel (200–300 mesh), eluting with a petroleum
ether-ethyl acetate gradient to get 6 parts. The last part was evaporated to small
volume, and lay aside at room temperature. Few days later, there was crystal yield,
washed it with method, the crystal of III was obtained from the last part.
92.3.1 Identification of the Compound I
Compound I was got as a white powder, mp: 135–137 C; It is easy to be dissolved in
CDCl3, while hard in methanol. 13C (400 MHz, CDCl3) d(ppm): 140.78(s, C-5),
121.73(d, C-6), 71.83(d, C-3), 56.89(d, C-14), 56.09(t, C-17), 50.16(d, C-9),
45.87(t, C-4), 42.26(s, C-13), 39.71(t, C-12), 38.86(t, C-1), 36.16(s, C-10), 35.89
(d, C-20), 33.98(s, C-7), 33.73(d, C-8), 32.43(t, C-22), 30.31(t, C-2), 29.19(t, C-24),
28.26(d, C-25), 26.13(d, C-16), 25.41(t, C-28), 24.38 (t, C-15), 2 l.22
(t, C-27), 21.10(t, C-11), 19.82(q, C-26), 19.41(q, C-19), 18.99(q, C-27), 18.79
(q, C-21), 11.99(q, C-29), 11.87(q, C-18). Comparing the detail spectral date with that
from the literature [19], this compound was identified as b-sitosterol (Table 92.1).
92.3.2 Identification of the Compound II
Compound II was obtained as a white powder, mp: 135 C * 137 C; It is easy to
be dissolved by CHCl3, while hard in methanol. 1H (400 MHz, CDCl3) d(ppm):
5.36(1H, s, H-6). 13C (400 MHz, CDCl3) d(ppm): 140.78(C-5), 138.31(C-22),
870 M. Zhou et al.
Table 92.1 Basic information of the compounds I–III

Number Name Molecular formula Structural formula
I b-sitosterol C29H50O
HO
II Stigmasterol C29H48O
HO
III Hellebore acid C9H10O4 O
O
OH
129.31(C-23), 121.73(C-6), 71.83(C-3), 56.80(C-17), 55.99(C-14), 51.25

(C-24), 50.16(C-9), 42.34(C-4), 42.24(C-13), 40.45(C-20), 39.71(C-12), 37.28
(C-1), 36.53(C-10), 31.93(C-2,8,25), 31.69(C-7), 28.91(C-16), 25.41(C-28),
24.38(C-15), 2 l.22(C-21), 21.10(C-11, 27), 19.41(C-19), 18.99(C-26), 12.25
(C-29), 11.87(C-18). Comparing the detail spectral date with the literature [20],
identified it as stigmasterol.
92.3.3 Identification of the Compound III
Compound III was obtained as a yellow powder, mp: 179 C * 182 C; It is easy
to be dissolved in CHCl3. 13C (400 MHz, CDCl3) d (ppm): 171.88(COOH), 153.92
(C-4), 148.87(C-3), 124.76(C-8), 121.85 (C-1), 112.52 (C-2), 110.51(C-5),
56.23(OCH3-4), 56.17 (OCH3-3). 1H (400 MHz, CDCl3) d (ppm): 11.806 (1H, s,
COOH), 7.79 (1H, d, 2-H), 7.61(1H, d, 2-H), 6.93(1H, d, 5-H), 3.96(3H, s, 4-
OCH3), 3.95(3H, s, 3-OCH3). This detail spectral data was compared with liter-
ature date [21], as the result, this compound was recognized as hellebore acid
(Tables 92.2, 92.3, 92.4).
The petroleum ether part contains a variety of aliphatics and chlorophyll, which
made the separation harder. To remove the aliphatics, the experiment was per-
formed in cold temperatures and samples were loaded to the silica gel column,
eluted with petroleum ether, ether acetate. The above procedure was repeated as
necessary to minimize the amounts of aliphatics. However, each round of silica gel
column purification resulted in 10 % loss of contents.
Our results showed that recrystallization with normal hexane are an efficient
method to remove chlorophyll in the extracts, as the chlorophyll is very hard to
Table 92.2 13C NMR (400 MHz) spectral data of compound I

The number of C d (ppm) The number of C d (ppm)
1 38.36 16 26.1
2 30.31 17 56.09
3 71.83 18 11.87
4 45.87 19 19.41
5 140.78 20 35.89
6 121.73 21 18.79
7 33.98 22 32.43
8 33.73 23 2 l.22
9 50.16 24 29.19
10 36.16 25 28.26
11 21.10 26 19.82
12 39.71 27 18.99
13 42.24 28 25.41
14 56.89 29 11.99
15 24.3
solve in normal hexane. Thus, after silica gel column chromatography, the sections
that contain the target compounds were collected and the chlorophyll removed by
recrystallization. In addition, part of the chlorophyll also can be removed by silica
gel column chromatography. However, the chlorophyll cannot be completely
removed by either method. Therefore, effective new methods for chlorophyll
removal are needed.
The petroleum ether extractum contains a large variety of sterols and terpe-
noids, and many of them have the same core structure and only differ in some
functional groups. Repeated silica gel chromatography and recrystallization cannot
Table 92.3 13C NMR (400 MHz) spectral data of compound II

The number of C d (ppm) The number of C d (ppm)
1 37.28 16 28.91
2 31.93 17 56.80
3 71.83 18 11.87
4 42.34 19 19.41
5 140.78 20 40.45
6 121.73 21 21.22
7 31.69 22 138.31
8 31.93 23 129.31
9 50.16 24 51.25
10 36.53 25 31.93
11 21.10 26 18.99
12 39.71 27 21.10
13 42.24 28 25.41
14 55.99 29 12.25
15 24.38
872 M. Zhou et al.
Table 92.4 13C NMR The number of C d (ppm)

(400 MHz) spectral data of
compound III C-1 121.85
C-2 112.52
C-3 148.87
C-4 153.92
C-5 110.51
C-8 124.76
OCH3-3 56.17
OCH3-4 56.23
COOH 171.88
separate them efficiently. And it is essential to develop novel methods to separate

the above classes of functional compounds.
The main chemical compositions in the petroleum ether are volatile oils [21],
aliphatics [22], chlorophyll, sterols, and terpenoids. Many of them are active
ingredients. The currently reported compounds found in the Trollius chinensis fail
to account for the pharmacological activities of this medicinal plant. Further study
of its petroleum ether extracts might help uncover the active ingredient responsible
for the curative effects of this valuable medical plant.
92.4 Conclusions
Through silica-gel column chromatography and recrystallization, three compounds

were isolated from the air-dried flowers of the Trollius chinensis. All three com-
pounds are medicinally active ingredients. Especially, the discovery of stigmas-
terol is a valuable addition to the list of medicinally active ingredients in the genus
Trollius. Given that lack of attention to the petroleum ether extracts of Trollius
chinensis, more efforts are taken to further isolate additional active ingredients that
are warranted.
References
1. Pan HF, Xin CL, Li SZ (2007) Study on the effect of Trollius beverrage in clearing and
moistening throat. Lishizhen Med Mater Med Res 9:2233–2234
2. Wang P (1996) The observation of the treatment of upper respiratory tract infection by
Trollius chinensis infusion. Chin Tradit Pat Med 3:50
3. Geng JT, Geng YX (1976) The medicine optional of prevention and control in pharyngeal
chronic inflammation. Shanxi Med 03:37
4. Ji XM, Zhao HX, Li BJ et al (2011) Analysis of volatile components in Trollius chinensis
bunge extract and its application in cigarette. Fine Chem 28(5):467–470
5. Cao LJ, Yi DF (2011) Dyeing of wool with globe flower. Wool Tex J 39(8):9–12
6. Yang F, Liu ZY, Liu W et al (2009) Inhibitory effects of three compounds extracted from
Trollius ledebouri on phenoloxidase of spodotera exigua. Chin J Pestic Sin 02:235–238
7. Zhao EL, Zhao XH, Fan JF (2008) Study on the extraction and antioxidation of flavone from
Trollius chinensis bunge. J Food Sci Biot 28(1):81–85
8. Yan J, Hu HN, Tian JM et al (2010) The antioxidant action research of the total Trollius
flavonoids. Lishizhen Med Mater Med Res 02:386–387
9. Song DM, Sun QS (2004) Chemical studies on the constituents of Trollius altaicus C.A.Mey.
China. J Med Chem 14(04):233–235
10. Zou JH, Yang JS (2005) Study on chemical constituents of Trollius ledebouri. Chin Pharm J
10:733–736
11. Su LJ, Wang H, Su ZW et al (2005) Chemical composition and pharmacological action of the
Trollius chinensis. World Notes Plant med 20(1):14–16
12. Li ZL, Li DY, Wang Y et al (2008) Antibacterial constituents from the flowers of Trollius
chinensis Bunge. J Shenyang Pharm Univ 25(8):627–629
13. Zou J, Yang J, Dong Y et al (2005) Flavone glycosides from flowers of Trollius chinensis.
China Pharm J 40(10):1121–1125
14. Li ZL, Li DY, Hua HM et al (2009) Three new acylated flavone C-glycosides from the
flowers of Trollius chinensis. Nat Prod Lett J 5:426–432
15. Cai SQ, Wang RF, Yang XW et al (2006) Antiviral flavonoid-Type C-glycosides from the
flowers of Trollius chinensis. Chem Biod 3(3):343–348
16. Wang RF, Ma CM, Zhang QY et al (2004) Trollioside, a new compound from the flowers of
Trollius chinensis. Nat Prod Lett 6(2):139–144
17. Wang RF, Yang XW, Ma CM et al (2004) A bioactive alkaloid from the flowers of Trollius
chinensis. Heterocycles 63(6):1443–1448
18. Ye SM, Li YL, Yang YT et al (2002) The extraction technology of Trollius chinensis. Chin
Med Mat 06:463–464
19. Luo YJ, Xiao XF, Wang ZL (2009) Studies on chemical constituents of Stenoloma
chusana(L.)Ching. Chem Res Appl 21(1):97–99
20. Zhang XQ, Qi J, Ye WC et al (2004) Chemical constituents from Xanthium sibiricum. J Chin
Pharm Univ 05:18–19
21. Feng XF (1998) Chemical constituents from Trollius chinensis. Chin Tradit Herbal Drugs J
29(9):587–588
22. Wang RF, Yang XW, Ma CM et al (2010) Analysis of fatty acids from the flowers of Trollius
chinensis. Chin Med Mat 10:1579–1581
Chapter 93
Design, Synthesis and Primary Biological
Indoline-3-One and Its Derivatives
Haiyong Jia, Guojun Pan, Yiqian Wang, Shaopeng Wen,

Qiannan Guo, Weiguo Hu, Peng Yu, Hua Sun and Yuou Teng
Abstract Indolinone displays promising antitumor properties by inhibiting various

kinase families. In this paper, we’d like to report the design, synthesis, and primary
biological evaluation of the novel indoline-3-one and its derivatives. All the newly
synthesized compounds including the novel compound 2-(4-(trifluoromethyl)ben-
zylidene)indolin-3-one (5f) were characterized by 1H NMR and their antitumor
activities were evaluated by using MTT method in HT-29, K562, and HepG2 cell
lines. 2-(2-nitrobenzylidene)indolin-3-one (5d) demonstrated good antitumor
activity against HT-29, K562, and HepG2 with an IC50 of 2.04 lM, 2.33 lM,
2.24 lM, respectively. 2-(4-(trifluoromethyl)benzylidene)indolin-3-one(5f) dem-
onstrated good antitumor activity against K562 and HepG2 with an IC50 of 2.27 lM,
3.47 lM.
Keywords Indoline-3-one Synthesis Antitumor MTT
H. Jia G. Pan Y. Wang S. Wen Q. Guo P. Yu H. Sun Y. Teng (&)

e-mail: tyo201485@tust.edu.cn
H. Jia G. Pan Y. Wang S. Wen Q. Guo P. Yu H. Sun Y. Teng
Tianjin University of Science and Technology, Tianjin 300457,
W. Hu
North China Pharmaceutical Co. Ltd, Hebei 050015, People’s Republic of China
876 H. Jia et al.
93.1 Introduction
Indolinone displays promising antitumor properties by inhibiting various kinase

families [1]. Indolinone tyrosinekinase inhibitors block kit activation and growth
of small cell lung cancer cells [2]. Sunitinib is an oral multitarget tyrosine kinase
inhibitor with potent antiangiogenic properties, and it possess similar core struc-
ture to indolinone. Preclinical data have demonstrated that pancreatic neuroen-
docrine tumors depend on vascular endothelial growth factor receptors and platelet
growth factor receptors-signaling pathways for tumor angiogenesis. Sunitinib has
recently been approved for the treatment of patients with advanced, progressive
pancreatic neuroendocrine tumors [3–7].
Microtubules are among the most successful targets for anticancer therapies and
for the development of new anticancer drugs. A-432411 is a novel small molecule
that destabilizes microtubules at high concentration and disrupts normal spindle
formation at low concentration. A-432411 is an indolinone that is structurally
different from other known synthetic microtubule inhibitors. This compound is
efficacious against a variety of human cancer cell lines including drug-resistant
HCT-15 that over expresses Pgp170. Biochemical studies show that A-432411
competes with the colchicine-binding site on tubulin and inhibits microtubule
polymerization [8, 9]. Receptor tyrosine kinases (RTKs) have been shown to be
important mediators of cellular signal transduction in cells [10]. Many RTKs have
been shown to be oncogene products implicating their role in the transformation
process associated with human cancers [11]. 3-substituted indolin-2-ones have
been designed and synthesized as a novel class of tyrosine kinase inhibitors which
exhibit selectivity toward different RTKs [12]. We’d like to design, synthesis and
biological evaluation of the novel indoline-3-one and its derivatives.
Indolinone are recently attracting the interest of an increasing number of
research groups. In this paper, we report our works made on the design and
synthetic routes toward a series of functionalized aurones. The target compounds
(5a–5f) were synthesized in five steps through hydrolysis reaction, nucleophilic
substitution reaction, aldol reaction [13], and so on. We also detected their anti-
tumor activity against K562, HT29, and HepG2 cancer cells. Their biological
activity results indicated that 2-(2-nitrobenzylidene)indolin-3-one (5d) demon-
strated good antitumor activity against HT-29, K562 and HepG2 with an IC50 of
2.04, 2.33, 2.24 lM, respectively. 2-(4-(trifluoromethyl)benzylidene)indolin-
3-one(5f) demonstrated good antitumor activity against K562 and HepG2 with an
IC50 of 2.27 lM, 3.47 lM.
93 Design, Synthesis and Primary Biological Evaluation 877
was recorded on Bruker AM-400 NMR spectrometers in deuterated chloroform
and deuterated DMSO. The chemical shifts are reported in d (ppm) relative to
tetramethylsilane as internal standard.
93.2.2 Chemistry
The synthetic approaches of target compound 5a–5f were demonstrated in

Fig. 93.1.
i ii iii O
COOCH3 COOH COOH

N
NH2 NH2 HN COOH
O
1 2 3
O v O
iv
N N R
H
4 O
5
5a R= 5b R= 5c R=
CH3 CN
NO2
5d R= 5e R= 5f R=
NO2 CF3
Fig. 93.1 Synthetic route of indolin-3-one derivatives

878 H. Jia et al.
Table 93.1 Inhibition activity of the compound 6a, 6b, 6c, 6d and 6e (lM)
5a 5b 5c 5d 5e 5f
K562 [10 [10 [10 2.33 [10 2.27
HepG2 [10 [10 [10 2.24 [10 3.47
HT-29 [10 [10 [10 2.04 [10 [10
Methyl anthranilate was employed to react with 10 % aqueous NaOH at 80 C

to provide compound 1 which was then reacted with chloroacetic at 100 C to
afford the key intermediate 2, then it was converted into compound 3 when treated
with Ac2O, CH3COONa at 160 C for 8 h. A mixture of compound 3, Sodium
sulfite, water was heated to reflux for 2 h to obtain compound 4. Compound 4 was
then reacted with benzaldehyde, 4-methylbenzaldehyde, 4-Cyanobenzaldehyde,
2-Nitrobenzaldehyde, 4-Nitrobenzaldehyde, and 4-(trifluoromethyl) benzaldehyde
to afford compound 5a, 5b, 5c, 5d, 5e and 5f.
The anticancer activities for newly synthesized compounds were tested on the
K562, HT-29, and HepG2 cells by using MTT method [14]. The results of com-
pounds (5a–5f) were listed in Table 93.1 which indicated that 2-(2-nitrobenzyli-
dene)indolin-3-one (5d) and 2-(4-(trifluoromethyl)benzylidene)indolin-3-one(5f)
demonstrated good antitumor activity against K562 and HepG2 with an IC50 of
2.33, 2.24, 2.27, and 3.47 lM, respectively. But it was not active against HT-29
(IC50 [ 10 lM) at our test condition.
Reagents and conditions: (i) 10%NaOH, H2O, then HCl; (ii) ClCH2COOH,
Na2CO3, NaOH, H2O, then HCl; (iii) Ac2O, HAc, CH3COONa; (iv) C2H5OH,
H2O, Na2SO3; (v) C2H5OH, H2O, conc HCl.
93.3.1 Synthesis Indoline-3-One and Its Derivatives

by 1H NMR
2-aminobenzoic acid (1). To a solution of methyl 2-aminobenzoate (10 g,

66.15 m mol) in 10 % aqueous NaOH (80 mL), the mixture was stirred for 4 h at
80 C. The product formed by adding 1 N HCl was filtered to give 8.2 g of 1 (90 %).
1
H NMR (CDCl3 400 MHz): d/ppm 6.689–6.723 (m, 2H), 7.341 (t, J = 8.0 Hz,
1H), 7.962 (d, J = 8.4 HZ, 1H).
2-((2-carboperoxyphenyl)amino)acetic acid (2) [15]. To a solution of

2-aminobenzoic acid (10 g, 72.92 mmol) in water (120 mL) was added NaOH
(9.33 g, 233.35 mmol), Na2CO3 (9.27 g, 87.50 mmol) and chloroacetic (8.27 g,
87.50 mmol). The mixture was stirred for 10 h at 100 C. The product formed by
adding 1 N HCl was filtered to give 11.4 g of 2 (80 %).
1
H NMR (d6-DMSO 400 MHz): d/ppm 3.666 (d, J = 4.8 Hz, 2H), 6.464–6.498
(m, 2H), 7.216–7.258 (m, 1H), 7.781–7.805 (dd, J = 8.0 Hz, 1.6, 1H).
1-acetyl-1H-indol-3-yl acetate (3). A mixture of acetic anhydride (100 mL),
acetic acid (30 mL), anhydrous sodium acetate (16.81 g, 204.95 mmol), and
compound 2 was heated to reflux for 4 h. Saturated aqueous sodium carbonate was
then added, and the mixture was extracted with CH2Cl2. The solvent was removed
in vacuo to give the crude product, which was purified by flash column chroma-
tography (silica gel, petroleum ether/ethyl acetate 15:1) to afford compound 3
(4.45 g, 40 %).
1
H NMR (CDCl3 400 MHz): d/ppm 2.409 (s, 3H), 2.632 (s, 3H), 7.311–7.348
(m, 1H), 7.399–7.440 (m, 1H), 7.564 (d, J = 4.0 Hz, 1H), 7.740 (s, 1H), 8.485
(d, J = 4.0 Hz, 1H).
1-acetylindolin-3-one (4). A mixture of compound 3 (4.0 g, 18.41 mmol), ethanol
(40 mL), water (80 mL), and Na2SO3 (2.79 g, 22.10 mmol) was heated to reflux
for 2 h. Ethanol was removed in vacuo to give the precipitate which was collected
by filtration, washed with water, and dried under vacuum to get compound 4
(2.7 g, 90 %).
1
H NMR (CDCl3 400 MHz): d/ppm 2.343(s, 3H), 4.316 (s, 2H), 7.240
(t, J = 7.2 Hz, 1H), 7.666–7.708 (m, 1H), 7.769 (d, J = 4.0 Hz, 1H), 8.582
(d, J = 4.0 Hz, 1H).
Compounds (5a–5f) [16]. To a solution of compound 4 (1 equiv) and 1.2 equiv of
appropriate benzaldehyde derivatives in 2.5 mL of water, 2.5 mL of ethanol, 2
drops of concentrated hydrochloric acid was added at the room temperature, the
reaction was heated to reflux for 2 h. The reaction mixture was poured into ice-
water and filtered. The filter cake was washed with petroleum ether and dried
under vacuum to get compounds (5a–5f).
2-benzylideneindolin-3-one (5a). Starting from compound 4 (0.2 g, 1.14 mmol)
and benzaldehyde (0.15 g, 1.37 mmol), compound 5a was obtained in 70 % yield.
1
H NMR (CDCl3 400 MHz): d/ppm 6.697 (s, 1H), 6.897 (s, 1H),
6.983–7.030(m, 2H), 7.367 (d, J = 7.2 Hz, 1H), 7.458–7.522 (m, 3H), 7.578
(d, J = 3.6 Hz, 2H), 7.780 (d, J = 4.0 Hz, 1H).
2-(4-methylbenzylidene)indolin-3-one (5b). Starting from compound 4 (0.2 g,
1.14 mmol) and 4-methylbenzaldehyde (0.15 g, 1.37 mmol), compound 5b was
obtained in 75 % yield.
1
H NMR (d6-DMSO 400 MHz): d/ppm 2.360 (s, 3H), 6.630 (s, 1H), 6.918
(t, J = 7.2 Hz, 1H), 7.150 (d, J = 3.6 Hz, 1H), 7.295 (d, J = 4.0 Hz, 2H),
7.503–7.544 (m, 1H), 7.585 (d, J = 4.0 Hz, 1H), 7.644 (d, J = 4.0 Hz, 1H).
4-((3-oxoindolin-2-ylidene)methyl)benzonitrile (5c). Starting from compound 4
(0.2 g, 1.14 mmol) and 4-Cyanobenzaldehyde (0.18 g, 1.37 mmol), compound 5c
was obtained in 50 % yield.
880 H. Jia et al.
1
H NMR (d6-DMSO 400 MHz): d/ppm 6.627 (s, 1H), 6.963 (t, J = 7.2 Hz,
1H), 7.149 (d, J = 4.0 Hz, 1H), 7.562 (t, J = 8.0 Hz, 2 Hz, 1H), 7.610
(d, J = 4.0 Hz, 1H), 7.874 (dd, J = 11.6 Hz, 3.2 Hz, 4H), 10.058 (s, 1H).
2-(2-nitrobenzylidene)indolin-3-one (5d). Starting from compound 4 (0.2 g,
1.14 mmol)and 2-Nitrobenzaldehyd (0.21 g, 1.37 mmol), compound 5d was
1
H NMR (d6-DMSO 400 MHz): d/ppm 6.801 (s, 1H), 6.948 (t, J = 7.2 Hz
1H), 7.090 (d, J = 4.0 Hz, 1H), 7.549 (t, J = 7.6 Hz, 1H), 7.592–7.689 (m, 2H),
7.843 (t, J = 7.2 Hz, 1H), 7.931 (d, J = 4.0 Hz, 1H), 8.109 (d, J = 4.0 Hz, 1H),
10.000 (s, 1H).
2-(4-nitrobenzylidene)indolin-3-one (5e). Starting from compound 4 (0.2 g,
1.14 mmol) and 2-Nitrobenzaldehyd (0.21 g, 1.37 mmol), compound 5e was
1
1H), 7.160 (d, J = 4.0 Hz, 1H), 7.553–7.594 (m, 1H), 7.619 (d, J = 4.0 Hz, 1H),
7.948 (d, J = 8.8 Hz, 2H), 8.263(d, J = 4.0 Hz, 2H), 10.155 (s, 1H).
2-(4-(trifluoromethyl)benzylidene)indolin-3-one (5f). Starting from compound 4
(0.2 g, 1.14 mmol) and 4-(trifluoromethyl)benzaldehyde (0.24 g, 1.37 mmol),
compound 5f was obtained in 75 % yield.
1
1H), 7.151 (d, J = 4.0 Hz, 1H), 7.539–7.622 (m, 1H), 7.795 (d, J = 4.0 Hz, 2H),
7.922 (d, J = 4.0 Hz, 2H), 9.995 (s, 1H).
93.3.2 Anticancer Activity Assay
All the above compounds were tested for their in vitro anticancer activity against
HT-29, K562, HepG2 cells by MTT-based assay. The cells were diluted to a
with a multichannel pipet, After incubating for 24 h, 0.5 lL compounds were
compound: 0.1, 0.3, 1, 3, and 10 lM). The culture plates were incubated for 4 h
after which 20 lL MTT was added to each well, then the medium were removed
from the wells and 100 lL DMSO added into each well. After leaving for further
10 min to dissolve the formazan crystals formed, the optical density (OD) was
measured at 490 and 630 nm. Cell viability was calculated from measurements of
OD value according to the corresponding formula and a graph is plotted of cell
viability (y-axis) against drug concentration (x-axis). The given values are mean
values of three experiments. The IC50 concentration represents the concentration
which results in a 50 % decrease in cell growth after 2 days incubation. The results
were presented in Table 93.1.
93.4 Conclusion
We report the design and synthesis of novel indoline-3-one and its derivatives.
Several steps among this route were optimized, such as cyclization, nucleophilic
substitution reaction, aldol reaction, and so on. The cyclization reaction was the key
step. All the target compounds were synthesized in five steps with the overall yield
of 25–30 %, respectively. The structures of these novel targets and all of inter-
mediates were confirmed by 1H NMR. Biological activity test indicated that
2-(2-nitrobenzylidene)indolin-3-one (5d) and 2-(4-(trifluoromethyl)benzylidene)
indolin-3-one(5f) have good antitumor activity against K562 and HepG2 cells.
In order to improve the antitumor activity, further modifications based on com-
pound (5d) and (5f) were undergoing in our laboratory.
Acknowledgments The authors sincerely thank the financial support from the Natural Science
Foundation of Tianjin (12JCYBJC31600), the Science and Technology Project of Tianjin
(10ZCKFSY07700, 11ZCGHHZ00400) and Tianjin University of Science and Technology
(20110115, 20120117).
References
1. Prakash CR, Raja S (2012) Indolinones as promising scaffold as kinase inhibitors: a review.
Mini Rev Med Chem. 12(2):98–119
2. Krystal GW, Honsawek S, Kiewlich D et al (2001) Indolinone tyrosine kinase inhibitors
block Kit activation and growth of small cell lung cancer cells. Cancer Res 61(9):3660–3668
3. Wood L (2012) Sunitinib malate for the treatment of renal cell carcinoma. Expert Opin
Pharmacother 13(9):1323–1336
4. Raymond E, Hammel P, Dreyer C et al (2012) Sunitinib in pancreatic neuroendocrine tumors.
Target Oncol 7(2):117–125
5. Naraev BG, Strosberg JR, Halfdanarson TR (2012) Current status and perspectives of
targeted therapy in well-differentiated neuroendocrine tumors. Oncology 83(3):117–127
6. Figlin R, Sternberg C, Wood CG (2012) Novel agents and approaches for advanced renal cell
carcinoma. J Urol 188(3):707–715
7. Ito T, Igarashi H, Jensen RT et al (2012) Current status and therapeutic strategy for pancreatic
neuroendocrine tumors in Japan. Fukuoka Igaku Zasshi 103(7):131–137
8. Chen Z, Merta PJ, Lin NH et al (2005) A-432411, a novel indolinone compound that disrupts
spindle pole formation and inhibits human cancer cell growth. Mol Cancer Ther
4(4):562–568
9. Mulligan JM, Greene LM, Cloonan S et al (2006) Identification of tubulin as the molecular
target of proapoptotic pyrrolo-1,5-benzoxazepines. Mol Pharmacol 70(1):60–70
10. Halaban R (1991) Growth factors and tyrosine protein kinases in normal and malignant
melanocytes. Cancer Metastasis Rev 10(2):129–140
11. Bishop JM (1987) The molecular genetics of cancer. Science 235(4786):305–311
12. Sun L, Tran N, Tang F et al (1998) Synthesis and biological evaluations of 3-substituted
indolin-2-ones: a novel class of tyrosine kinase inhibitors that exhibit selectivity toward
particular receptor tyrosine kinases. J Med Chem 41(14):2588–2603
13. Lee CY, Chew EH, Go ML (2010) Functionalized aurones as inducers of NAD(P)H:quinone
oxidoreductase 1 that activate AhR/XRE and Nrf2/ARE signaling pathways: synthesis,
evaluation and SAR. Eur J Med Chem 45:2957–2971
882 H. Jia et al.
14. Islam I, Bryant J, Chou YL et al (2004) Indolinone based phosphoinositide-dependent kinase-

1 (PDK1) inhibitors. Part 1: design, synthesis and biological activity. Bioorg Med Chem Lett
17(14):3814–3818
15. Nirogi RV, Deshpande AD, Kambhampati R et al (2011) Indole-3-piperazinyl derivatives:
novel chemical class of 5-HT(6) receptor antagonists. Bioorg Med Chem Lett 21(1):346–349
16. Zhang W, Go ML (2009) Functionalized 3-benzylidene-indolin-2-ones: inducers of
NAD(P)H-quinone oxidoreductase 1 (NQO1) with antiproliferative activity. Bioorg Med
Chem 17(5):2077–2090
Chapter 94
Research Progress on the Anti-Rheumatoid
Arthritis Drugs
Peng Wang, Xuegang Luo, Chongxi Wang, Xinjia Wang, Guang Hu

and Tong-cun Zhang
Abstract Rheumatoid arthritis (RA) is a chronic systemic autoimmune disease

leading to synovial hyperplasia and a series of multisystem comorbidities. Per-
manent disability usually occurs in 20–30 % of untreated patients within 2–3 years
of the disease. Therefore, it is important to diagnose the disease and initiate
treatment as early as possible. The drug therapy plays an important role in
maintaining a state of very low disease activity and slowing the progression of
joint damage. Traditional drug therapy in RA is a pyramid approach, in which
nonsteroidal anti-inflammatory drugs (NSAIDs) serve as the base of pyramid and
disease-modifying antirheumatic drugs (DMARDs) are employed relatively late.
But since this approach is no longer valid, many new drugs used to manage RA
have been developed. In this review, we specifically summarize the current drug
therapies for the treatment of RA and briefly describe the etiology, pathology and
pathogenesis of RA.
Keywords Rheumatoid arthritis Etiology Pathology Pathogenesis Drug

therapy
The first two authors contributed equally to the project.
P. Wang X. Luo C. Wang X. Wang T.-C. Zhang (&)

Bioengineering, Tianjin University of Science and Technology, Tianjin, China
X. Luo C. Wang X. Wang G. Hu T.-C. Zhang
Tianjin Key Laboratory of Industrial Microbiology, Tianjin, China
e-mail: oldmoonlake@gmail.com
G. Hu
Shaoxing Institute of Technology, College of Engineering, Peking University, Shaoxing,
Zhejiang, China
884 P. Wang et al.
94.1 Introduction
Rheumatoid arthritis (RA) is a lifelong chronic inflammatory disease characterized

by synovial hyperplasia, eventually, cartilage erosion and bone destruction [1–4].
Although its etiology remains largely unknown, evidence points to a complex
interplay between environmental and genetic factors [5]. RA usually attacks joints of
the hands, feet, wrists, knees, elbows, ankles, and shoulders symmetrically. Fatigue
and weight loss as common symptoms are accompanied by lean blood, slight fever,
pericarditis, vasculitis, subcutaneous nodules, etc. Pain and stiffness followed by
swelling, redness, and muscle pain in one or more small joints may become worse
after a few weeks or months. As the disease progresses, irreversible joint damage
may lead to deformity of joint and loss of function. Long-term studies have sug-
gested that disease popularity is estimated to be 1 % all over the world, about
50–70 % of persons with RA become permanently physical disability after
10–15 years of diagnosis [6]. Furthermore, the number of the women suffering from
RA is three times more than men, and the disease bedevils all age groups ranging
from children to the elderly, but the people in middle age are in supreme danger [7].
Therapeutics options for RA have become more and more. In general, there are
four methods in the treatment of RA, i.e., physical therapy, function exercise, drug
therapy, and surgical therapy. While physical therapy and function exercise act as
adjuvant therapy and work temporarily only for patients in early phase of the
disease, surgical therapy is suitable for those with severe disease. However, RA is
not simply a joint inflammation but autoimmune disease involved in multiple
systems, hence, effective drug therapy is crucial for decreasing the rate of disease
progression. A great majority of patients need to change drug types frequently
because of efficacy reduction and the lack of significant disease control. Therefore,
development of new and better drugs can obtain markedly improved outcomes to
patients with RA, with a goal of alleviation of symptoms and improvement of
physical function. In the last decade, all kinds of the agents used in the treatment of
RA have been developed from immunomodulatory agents to molecules targeting
specific cytokines and cells related to the pathogenesis of RA. Fortunately, mul-
tiple drug therapies for RA substantially bring about long-term good outcomes for
many patients.
94.2 Etiology of Rheumatoid Arthritis
The etiology of RA is not fully known, although quite a lot of researches are
ongoing regarding it. For example, it has been determined that the frequency of
RA in monozygotic twins is obviously higher than that in the general population
[8]. Furthermore, there is a more than 30 % concordance rate of disease in
identical twins. The polymorphic human leukocyte antigen DR (HLA-DR) b chain
genes (some DRl and DR4 subtypes) seem to be the mainly identified
94 Research Progress on the Anti-Rheumatoid Arthritis Drugs 885
susceptibility genes [9, 10]. A recent research of class II genes and molecules of
the major histocompatibility complex has showed an increase susceptibility to
seropositive RA patients expressing the HLA-DR4 subtypes [11]. It has been
indicated that Collagen II and HLA-DR b molecular form dimer complex in order
to drive immune responses possibly in the pathogenesis of RA. However, there is
not any convincing evidence that a rheumatoid specific antigen has been forth-
coming, although some antigens rich in joints, such as collagen II, are possible
candidates [12]. An investigation has pointed out that a majority of adult patients
present more DR1 antigens than others in the early development of RA [13, 14].
However, nongenetic factors, such as environmental factors, bacteria, viruses,
sex hormones, play a major role in initiating and maintaining RA for the majority
of patients. A research has showed that a constant stimulus for pathogenesis of RA
is peptidoglycan existing in group A streptococcus. And a continuous high titer of
anti-EB virus antibody was found in the sera and synovial fluids of patients with
RA. Furthermore, the number of the women suffering from RA is three times more
than men, however, women with RA will go into remission if they are in gestation
period or take the pill. It is known to us that many contributors, e.g., cold, damp,
fatigue, malnutrition, trauma, mental factor, etc., would give rise to RA. Many
patients are very curious to know whether the cause of RA is attributed to
improper nutrition, however, by now no investigations have determined that
specific nutritional factors are causative agents.
94.3 Pathology and Pathogenesis of Rheumatoid Arthritis
The pathological changes of RA include synovial membrane arthritis, rheumatoid

nodules, and rheumatoid vasculitis. Active inflammation is first seen in the
synovial membranes of the joints. The normal synovial lining of joint capsule
holding the fluid that lubricates the joints is generally two or three cells in
thickness. Therefore, thickening of the synovial membranes will gradually cause
inflammation and further lead to irreversible damage to joint capsule and articular
cartilage because these structures are replaced by scar-like tissue called pannus.
After a triggering incident, possibly autoimmune or infectious, synovial macro-
phages, and fibroblasts begin to proliferate. Then lymphocytes infiltrate perivas-
cular regions and endothelial cells proliferate. It has been suggested that the
vascular endothelium plays an active and key role in a variety of immunological
processes. In addition, neovascularization occurs and blood vessels are blocked by
small clots or inflammatory cells. As time passes, the damaged synovial tissue
begins to grow irregularly and then forms pannus tissue. Later, thick and hardened
pannus protrudes over the surface of the cartilage and gives rise to joint destruction
[15]. Unfortunately, the skin, bones, and muscles adjacent to the joints atrophy
from disuse and destruction. Rheumatoid nodules and rheumatoid vasculitis, as
severe RA indications, are extra-articular pathological changes of RA and appear
in organizations and organs of the whole body.
886 P. Wang et al.
94.4 Drug Therapy
94.4.1 Nonsteroidal Anti-Inflammatory Drugs
Traditional drug therapy of RA is a pyramid approach, with nonsteroidal

anti-inflammatory drugs (NSAIDs) serving as the first-line medicine. Although
support for the use of NSAIDs in RA, NSAIDs have lost their historical roles
because they cannot be used alone to alter the disease course [16, 17]. NSAIDs are
associated with gastropathy, so new NSAIDs were approved and came into broad
use in order to decline incidence of NSAIDs gastropathy. In addition, all of these
agents, such as nabumetone, etodolac, rofecoxib, etc., were used for initial treat-
ment of RA to reduce joint pain and promoted as being safer than their predecessors.
94.4.2 The Traditional Disease-Modifying Antirheumatic

Drugs
Disease-modifying antirheumatic drugs (DMARDs) are very effective for all RA

patients to reduce joint swelling and pain, inhibit progressive joint damage, and
improve function. The traditional DMARDs consist of methotrexate, hydroxy-
chloroquine, sulfasalazine, leflunomide, etc. MTX is the dominant DMARDs for
treatment of RA for many years, SSZ and leflunomide are also widely used.
Historically, MTX has been the mainstay of treatment for RA [18], because it
slows the progression of joint destruction. However, many trials have showed that
methotrexate in combination with another DMARDs is more effective than alone
[19].
94.4.3 Biological Agents
Efforts to develop safer and more effective treatments for RA have been achieved
through the development of the biologic agents. A few different cellular and
cytokine targets have been identified, and some biologics have been approved to
treat RA at present, including TNF-a antagonists (adalimumab, etanercept, inf-
liximab), IL-1 antagonist (anakinra), an inhibitor of T cell costimulation (abata-
cept), and a selective depleter of B cells (rituximab) etc. These biological agents
have shown the ability to bring good outcomes for many RA patients.
94.4.3.1 Cytokine Antagonists
Though there are many effective therapeutic targets, inhibition of cytokines seems
to be a particular effective approach to controlling inflammation and preventing
further joint destruction [20].
TNF Antagonists
TNF-a is a trigger that causes joint tissue damage resulting in bone erosion, so the
development of anti-TNF-a monoclonal antibodies alleviates symptoms effec-
tively and prevents the progression of joint damage.
Etanercept (ETN), a soluble tumor necrosis factor (TNF) receptor fusion pro-
tein, has been approved for the treatment of RA. TNF-a plays its functions via
interaction with its membrane receptors, p55 or TNF receptor I (TNFRI) and p75
(TNFRII), which activate two kinds of completely different signal pathways and
cause distinct biological effects. Etanercept, a dimeric human p75-Fc fusion pro-
tein, consists of extracellular domains of the human p75 and the constant Fc
portion of human IgG1. It has been proved that Etanercept can reduce RA activity
for those who have had an inadequate response to other therapies [21–23]. The
reason is that Etanercept competitively prevents the binding of TNF-a to cell
surface TNF-a receptor, inhibiting the biological activity of TNF [24]. Inhibition
of TNF activity may slow or halt progressive joint damage in order to improve the
quality of life for patients. Compared with oral methotrexate, subcutaneous eta-
nercept acted more rapidly to decrease disease activity and prevent structural
damage in patients with early active RA. The findings indicated that the combi-
nation of etanercept and methotrexate was significantly better in decreasing dis-
ease activity and slowing joint damage compared with methotrexate or etanercept
alone.
Adalimumab (ADA, Humira) is a fully human recombinant immunoglobulin
G1 (IgG1) anti-TNF monoclonal antibody, therefore it is thought to be less
immunogenic than chimeric antibodies. Adalimumab is suitable for those who
have had an inadequate response to DMARDs and also effective in the treatment of
patients with moderately to severely RA. Adalimumab, either alone or in com-
bination with methotrexate or standard antirheumatic therapies, has an obvious
effect in early treatment of RA. In a key study [25], adalimumab in combination
with methotrexate, at a higher dose of 40 mg subcutaneously every 2 weeks,
yielded a statistically remarkable improvement compared with methotrexate plus
placebo. In general, adalimumab significantly decreased symptoms of active RA
and established a long-lasting clinical response in patients, as well as a well-
tolerated feature with few patients discontinuing treatment because of side effects.
Infliximab (IFX), a Human-Mouse Chimeric anti-TNF monoclonal antibody, is
found to be effective for the treatment of early RA [26]. It is a heterotetrameric
protein, and its hypervariable region is murine in origin and the constant domain of
the immunoglobulin is made up with a human IgG1 Fc heavy chain and partial k
888 P. Wang et al.
light chain. Infliximab is usually administered intravenously in an outpatient

setting every 4–8 weeks. It has been demonstrated that infliximab plus MTX
regimens caused significantly greater improvement in patients with active RA
compared with the patients receiving monotherapy with methotrexate.
Golimumab (GLM) is a novel fully human monoclonal antibody to TNF which
is used as an immunosuppressive drug. It was derived from hybridomas generated
from a transgenic mouse including activated human immunoglobulin genes and
inactivated mouse immunoglobulin genes [27]. Golimumab was used as once a
month subcutaneous treatment for adults with moderately to severely active RA.
The results of GLM administered subcutaneously plus background MTX have
suggested a benefit in the long-lasting symptoms reduction of RA [28].
Certolizumab pegol (CZP), lacking a Fc region, is a novel construct consisting
of the Fab’ antigen binding domain of a humanized anti-TNF mAb and site-
specifically attaches to a 40kD molecule of polyethylene glycol (PEG). So it
cannot induce complement or antibody-dependent cell mediated cytotoxicity,
which has been found in vitro with ADA, ETN and IFX [29]. CZP also increases
lengths of disease duration compared with other TNF antagonists. PEG does not
cross the placenta, so this drug can be used throughout pregnancy without adverse
effects on the fotus. In addition, applicable scope of CZP is very broad, including
patients with or without other TNF antagonists, with or without MTX or other
DMARDs.
Additional Cytokine Antagonists
A lot of cytokines except TNF are also targets for RA therapy, including IL-1, IL-6
and RANKL etc. Anakinra is the first IL1-receptor antagonist, either alone or in
combination with methotrexate, has played a very good efficacy in moderate-to-
severe RA. Tocilizumab is a fully humanized mAb targeting the IL6-receptor, now
approved for the treatment of RA [30, 31]. However, biologic inhibition of either
IL-1 or IL-6 shows no obviously superior outcomes to TNF blockade.
94.4.3.2 B Cell Targets
B lymphocytes are implicated in the pathogenesis of RA. Rituximab (RTX), a

chimeric mAb against the protein CD20 which is primarily found on the surface
of B cells, effectively destroys B cells in peripheral blood [32]. Several additional
agents targeting B cells have been developed, such as ocrelizumab and of-
atumumab. Ocrelizumab-a fully human mAb against CD20 can effectively
improve symptoms for serum positive patients. Ofatumumab is a complete
humanized anti-CD20 antibody, appearing to inhibit early stage B lymphocyte
activation. It had been launched by Genmab pharmaceutical company and
GlaxoSmithKline (GSK) for the treatment of RA. Although these agents similarly
target CD20, ofatumumab can bind to more different antigenic epitopes on CD20
than rituximab or ocrelizumab. All of these compounds targeting B cells cause a

reduction in B cell numbers, rheumatoid factors and total immunoglobulin levels
in order to preferably control inflammation and prevent joint destruction in the
case of inadequate response to anti-TNF-a therapy and conventional therapy.
94.4.3.3 T Cell Targets
Activated CD4+ T cells lead to stimulation of osteoclastogenesis and activation of

metalloproteinases and further result in joint destruction. Simple activation signal
without complementary costimulation signal is unable to achieve full T cell
activation. In general, CD80 or CD86 on the surface of antigen-presenting cells
(APC) should naturally bind to CD28 on T cells in order to activate T cells.
Abatacept (CTLA4–Ig, Orencia), a cytotoxic T-lymphocyte-associated antigen
4–IgG1 fusion protein, contains a high-affinity binding site for CD80 or CD86. As
a result, it can effectively prevent the CD80 or CD86-CD28 from delivering
costimulatory signal to T cells [33, 34]. The findings indicate that the combination
of abatacept and methotrexate was significantly better in improving symptoms of
RA and physical function, compared with methotrexate or abatacept alone.
94.4.4 Glucocorticoids
Short-term glucocorticoids (GCs) reduce joint swelling and pain temporarily in a

short period when a single inflamed joint contributes to disability acutely. While
the long-term steroids may decrease joint damage [35] but have significant side
effects, such as osteoporosis, cataracts, cushingoid symptoms, and infection.
Besides, increasing evidences show that prudent use of GCs in the treatment of RA
should be recommended [36] because of the low risk of adverse effects. In prac-
tice, low-dose GCs (less than 10 mg/d) can relieve most patients from pains.
94.4.5 Chinese Herbal Medicine
Previous study has demonstrated that the various active ingredients in Chinese
herbal medicine for RA have multiple physiological functions, such as antimi-
crobial, anti-inflammatory, analgesic, and immunomodulatory activities. In addi-
tion, the Chinese herb medicine is effective with higher safety and less adverse
effect. Tripterygium wilfordii Hook. F (TWHF), a Chinese herbal medicine and a
member of the Celastraceae family, has been reported to be a therapeutic agent
against a number of autoimmune and inflammatory diseases such as RA. The
extractives of TWHF, for instance tripterygium glycosides, can effectively inhibit
the production of cytokines by suppressing quite a number of proinflammatory
890 P. Wang et al.
genes and then induce the apoptosis in lymphocytes and synovial fibroblasts [37].
Patients taking extractives of TWHF frequently developed adverse effects, and
occasionally severe toxicity to their livers and kidneys.
94.4.6 Other Agents for RA
Tetracyclines and a number of their semisynthetic derivatives, such as minocy-

cline, have been used as therapeutic agents for RA since the late 1960s. In addition
to their antimicrobial activities, antibiotics of the tetracycline family have been
further shown to have anti-inflammatory, immunoregulatory, and chondroprotec-
tive properties. And anti-inflammatory activity is found to be independent of their
antimicrobial properties [38]. The tetracycline compounds directly suppress
activities of B and T cells and inhibit matrix metalloproteinase (MMP) by
downregulating the expression of type 2 nitric oxide synthase mRNA, an important
mediator in collagen degradation.
94.5 Conclusion
In recent decades, development and application of new therapeutic agents for the
treatment of RA bring a remarkable development for the treatment of this disease
and contribute to research on the pathogenesis of RA. Furthermore, it is very
apparent that RA is a multidimensional disease with a highly variable course, so a
great majority of patients need to change drug types frequently because of
reduction of efficacy and the lack of significant control of disease. RA is a lifelong
disease, therefore, it is still necessary to develop novel effective therapeutic
approaches against RA in the future. The drugs at present will be replaced by the
new drugs which not only target all phases of RA disease progression, but also can
be used in combination with other agents. The development of multiple new drugs
for RA must be able to bring about long-term good outcomes for many patients.
Acknowledgments This study was financially supported by the Program for Changjiang
Scholars and Innovative Research Team in University of Ministry of Education of China (NO.
IRT1166).
References
1. Harris ED (1990) Rheumatoid arthritis: pathophysiology and implications in therapy. New

Eng J Med 322:1277–1289
2. Carmona L, Cross M, Williams B et al (2010) Rheumatoid arthritis. Best Pract Res Clin
Rheumatol 24:733–745
3. Zvaifler NJ (1983) Pathogenesis of the joint disease of rheumatoid arthritis. Am J Med

75:3–8
4. Smolen JS, Aletaha D, Redlich K (2012) The pathogenesis of rheumatoid arthritis: new
insights from old clinical data? Nat Rev Rheumatol 8:235–243
5. Gregersen PK (1999) Genetics of rheumatoid arthritis: confronting complexity. Arthritis Res
1:37–44
6. Schuna AA (1998) Update on treatment of rheumatoid arthritis. J Am Pharm Assoc
38:728–735
7. Erhardt CC, Mumford PA, Venables PJ et al (1989) Factors predicting a poor life prognosis
in rheumatoid arthritis: an eight year prospective study. Ann Rheum Dis 48:7–13
8. Silman AJ, MacGregor AJ, Thomson W et al (1993) Twin concordance rates for rheumatoid
arthritis: results from a nationwide study. Br J Rheumatol 32:903–907
9. Vaughan JH, Kouri T, Petersen J et al (1988) On the etiology of rheumatoid arthritis. Scand J
Rhetrmatol Suppl 74:19–28
10. Gregersen PK, Silver J, Winchester RJ et al (1987) The shared epitope hypothesis: an
approach to understanding the molecular genetics of susceptibility to rheumatoid arthritis.
Arthritis Rheum 30:1205–1213
11. Stastny P (1978) Association of the B-cell alloantigen Dm4 with rheumatoid arthritis. N Engl
J Med 298:869–871
12. Ronnelid J, Lysholm J, Engstrom-Laurent et al (1994) Local anti-type II collagen antibody
prodution in rheumatoid arthritis synovial fluid: evidence for an HLA-DR4-restricted IgG
response. Arthritis Rheum 37:1023–1029
13. Schiff B, Mizrachi Y, Orgad S et al (1982) Association of HLA-Aw31 and HLA-DR1 with
rheumatoid arthritis. Ann Rheum Dis 41:403–404
14. Woodrow JC, Nichol FE, Zaphiropoulos G (1981) DR antigens and rheumatoid arthritis: a
study of two populations. Br Med J 283:1287–1288
15. Goldring SR (2000) A 55-year-old woman with rheumatoid arthritis. JAMA2000
283:524–531
16. Scott PA, Kingsley GH, Smith CM et al (2007) Non-steroidal anti-inflammatory drugs and
myocardial infarctions: Comparative systematic review of evidence from observational
studies and randomised controlled trials. Ann Rheum Dis 66:1296–1304
17. Schaffer D, Florin T, Eagle C et al (2006) Risk of serious NSAID-related gastrointestinal
events during long-term exposure: a systematic review. Med J Aust 185:501–506
18. Donahue KE, Gartlehner G, Jonas DE et al (2008) Systematic review: comparative
effectiveness and harms of disease-modifying medications for rheumatoid arthritis. Ann
Intern Med 148:124–134
19. Kremer JM, Genovese MC, Cannon GW et al (2002) Concomitant leflunomide therapy in
patients with active rheumatoid arthritis despite stable doses of methotrexate. Ann Intern Med
137:726–733
20. Choy EH, Panayi GS (2001) Cytokine pathways and joint inflammation in rheumatoid
arthritis. N Engl J Med 344:907–916
21. Lovell DJ, Giannini EH, Reiff A et al (2000) Etanercept in children with polyarticular
juvenile rheumatoid arthritis. N Engl J Med 342:763–769
22. Moreland LW, Baumgartner SW, Schiff MH et al (1997) Treatment of rheumatoid arthritis
with a recombinant human tumor necrosis factor receptor (p75)-Fc fusion protein. N Engl J
Med 337:141–147
23. Weinblatt ME, Kremer JM, Bankhurst AD et al (1999) A trial of etanercept, a recombinant
tumor necrosis factor receptor: Fc fusion protein, in patients with rheumatoid arthritis
receiving methotrexate. N Engl J Med 340:253–259
24. Mohler KM, Torrance DS, Smith CA et al (1993) Soluble tumor necrosis factor (TNF)
receptors are effective therapeutic agents in lethal endotoxemia and function simultaneously
as both TNF carriers and TNF antagonists. J Immunol 151:1548–1561
25. Keystone EC, Kavanaugh AF, Sharp JT et al (2004) Radiographic, clinical, and functional
outcomes of reatment with adalimumab (a human anti-tumor necrosis factor monoclonal
892 P. Wang et al.
antibody) in patients with active rheumatoid arthritis receiving concomitant methotrexate

therapy: a randomized, placebo-controlled, 52-week trial. Arthritis Rheum 50:1400–1411
26. Taylor PC, Steuer A, Gruber J et al (2002) Infliximab attenuates joint destruction in early RA
patients with ultrasonographic markers of poor prognosis. Arthritis Rheum 46:334
27. Fishwild DM, O’Donnell SL, Bengoechea T et al (1996) High-avidity human IgG kappa
monoclonal antibodies from a novel strain of minilocus transgenic mice. Nat Biotechnol
14:845–851
28. Kremer J, Ritchlin C, Mendelsohn A et al (2010) Golimumab, a new human anti-tumor
necrosis factor alpha antibody, administered intravenously in patients with active rheumatoid
arthritis: forty-eightweek efficacy and safety results of a phase III randomized, double- blind,
placebocontrolled study. Arthritis Rheum 62:917–928
29. Nesbitt A, Fossati G, Bergin M et al (2007) Mechanism of action of certolizumab pegol
(CDP870): in vitro comparison with other anti-tumor necrosis factor alpha agents. Inflamm
Bowel Dis 13:1323–1332
30. Gomez-Reino JJ, Fairfax MJ, Pavelka K et al (2007) Targeted inhibition of IL-6 with
tocilizumab improves quality of life and function in patients with rheumatoid arthritis with
inadequate response to a range of DMARDs. Arthritis Rheum 56:4234
31. Genovese M, McKay J, Nasonov E et al (2007) IL-6 receptor inhibition with tocilizumab
reduces disease activity in patients with rheumatoid arthritis with inadequate response to a
range of DMARDs: the TOWARD Study. Arthritis Rheum 56:4309–4310
32. Dass S, Vital EM, Emery P (2006) Rituximab: novel B-cell depletion therapy for the
treatment of rheumatoid arthritis. Expert Opin Pharmacother 7:2559–2570
33. Moreland LW, Alten R, Van den Bosch F et al (2002) Costimulatory blockade in patients
with rheumatoid arthritis: a pilot, dose-finding, double-blind, placebo-controlled clinical trial
evaluating CTLA-4Ig and LEA29Y eighty-five days after the first infusion. Arthritis Rheum
46:1470–1479
34. Emery P (2003) The therapeutic potential of costimulatory blockade with CTLA-4Ig in
rheumatoid arthritis. Expert Opin Investig Drugs 12:673–681
35. Kirwan JR, Bijlsma JW, Boers M et al (2007) Effects of glucocorticoids on radiological
progression in rheumatoid arthritis. The Cochrane Libr doi: 10.1002/s14651858006356
36. Bijlsma JW, van der Goes MC, Hoes JN et al (2010) Lowdose glucocorticoid therapy in
rheumatoid arthritis: an obligatory therapy. Ann N Y Acad Sci 1193:123–126
37. Little C, Parsons T (2000) Herbal therapy for treating rheumatoid arthritis. The Cochrane
Libr. doi:10.1002/s14651858002948
38. Alarcon GS (2000) Tetracyclines for the treatment of rheumatoid arthritis. Expert Opin
Investig Drugs 97:1491–1498
Chapter 95
Design and Synthesis of 1H-2,
3-Dihydro-1-Pyrrolizinones Derivatives
Changhai Sun and Jing Cao
Abstract Pyrrolizinone derivatives were discovered showing remarkable

anti-inflammatory and analgesic activities. Based on the SAR summarized before,
a series of pyrrolizinone derivatives were designed and synthesized in this paper.
All the eight target compounds were characterized by 1HNMR spectra, and the test
of anti-inflammatory and analgesic activities is in progress.
Keywords Anti-inflammatory Analgesic Pyrrolizinone
95.1 Introduction
Anti-inflammatory drugs has a long history of clinical application, more research

showed that inflammation is associated with a variety of diseases. Therefore, the
anti-inflammatory drugs is also expected for the treatment of many inflammatory-
related diseases, such as atherosclerosis, cancer, stroke, etc., the research of new
anti-inflammatory drugs have never been stopped.
Nonsteroidal anti-inflammatory drugs (NSAID) are one of the most important
class of anti-inflammatory drugs, widely used in clinic. However, many NSAID
could lead to various side effects, for example, the gastrointestinal damage,
nephrotoxicity and hepatotoxicity, and so on. Therefore, developing new anti-
inflammatory and analgesic agents with lower toxicity have still been the interest
of this field [1–8].
C. Sun (&)
Tianjin Chasesun Pharmaceutical Co. Ltd, Tianjin 301700, People’s Republic of China
e-mail: suns-s@vip.163.com
J. Cao
894 C. Sun and J. Cao
It has been reported that some 1H-1, 2-dihydro-1-pyrrolizinone derivatives

showed remarkable anti-inflammatory and analgesic activities with new mecha-
nism of action, however, the application of such compounds was restricted due to
its toxicity and low activities. In order to improve their activities and reduce the
toxicities, a series of new pyrrolizinone derivatives were designed and synthesized
based on the SAR reported before [5–8]. Finally, target compouds (5a–5h) were
obtained and characterized by 1H NMR and LC–MS spectra.
was recorded on Bruker AM-400 NMR spectrometers in deuterated solvent. The
chemical shifts are reported in d (ppm) relative to tetramethylsilane as internal
standard.
95.2.2 Chemistry
Figure 95.1 demonstrates the synthetic approach to the target compounds 5a–5h.
CN O
KCl NaCl AlCl3 NBS
NH N
N
CN
1 2
O
O HO OH
O B
RCHO R' N
N
N
Br
Br R
R R'
3 5a-5h
4
Fig. 95.1 Synthetic route of target compounds 5a–5h

95 Design and Synthesis of 1H-2, 3-Dihydro-1-Pyrrolizinones 895
1H-pyrrole was employed to react with acrylonitrile to provide 3-(1H-pyrrol-1-yl)

propanenitrile (compound 1) which was then cyclized in the presence of Lewis acid
to afford the key intermediate 2. Compound 2 was bromonated with NBS in a
specific site to provide compound 3, it was converted into compound 4a–4h through
aldol condensation, 4a–4h were treated with different boric acid to provide target
compounds 5a–5h.
As described above, eight target compounds (5a–5h) were obtained (Table 95.1)
with a simple and feasible synthetic route. The evaluation of anti-flammatory and
analgesic activities of these compounds are ongoing right now.
95.4 Experimental
95.4.1 3-(1H-pyrrol-1-yl)propanenitrile (1)
To the 1H-pyrrole (30 g, 0.45 mol) was added 20 % TEBA (6.5 mL), then at 0 C
added acrylonitrile dropwise for about 1 h. After stirring for another 1 h at
35–40 C, compound 1 was obtained with 80 % yield by distillation in vacuum
(130–132 C/1,066pa, Lit: 132–136 C/1,066.2pa).
95.4.2 2,3-dihydropyrrolizin-1-one (2)
Potassium chloride (5.6 g), sodium chloride (5.6 g), and anhydrous aluminum
chloride (28 g) were heated to melt together in a 100 mL round bottom at 140 C,
then the compound 1 was poured into the melted salt mixture, stirred for 35–40 s,
the mixture was poured into ice water, adjusted pH to 6–7 with potassium
hydroxide, heated with a water bath at 75 Cfor 30 min. After cooling, the reaction
mixture was extracted with CH2Cl2 (50 mL 9 3), organic phases were combined
and dried over anhydrous magnesium sulfate, purified by flash chromatography
using 200–300 mesh silica gel (petroleum ether:ethyl acetate = 8:1), 4.55 g
compound 2 was obtained (65 % yield) with m.p 54–55 C (Lit. :53.5–54 C).
1
H NMR (CDCl3, d):3.11(t, 2H,2-H),4.33(t, 2H, 3-H),6.54(q, 1H, 6-H),6.76
(t, H, 7-H),7.06(d, H, 5-H).
Table 95.1 Structures of target compounds 5a–5h

Compounds Structure Compounds Structure
no. no.
5a O 5e O
N N
H 3CO
F
5b O 5f O
N
N
OCH3
S F
5c O 5g O
N N
O CH2
O CH2
H3CO
F
5d O 5h O
N N
OCH3 OCH3
Cl
95.4.3 5-bromo-2,3-dihydropyrrolizin-1-one (3)
5.0 g (41.3 mol) of 2,3-dihydropyrrolizin-1-one (2) was dissolved in 20 mL

CH2Cl2, the solution of NBS (8.0 g, 45.4 mol) in CH2Cl2 was added dropwise to
solution of 2 at 0 C, then stirred at room temperature for 3 h. After the reaction
was completed, washing reaction mixture with sodium chloride aqueous solution,
organic phases were dried over anhydrous magnesium sulfate. Compound 3 was
purified by column chromatography with a yield of 90 % (silica gel 200–300
mesh, petroleum ether: ethyl acetate = 10:1).
1
H-NMR (CDCl3, d):3.12(t, 2H,2-H),4.2(t, 2H, 3-H),6.5(d, 1H, 6-H),6.72(d, H,
7-H).
95 Design and Synthesis of 1H-2, 3-Dihydro-1-Pyrrolizinones 897
95.4.4 (E)-2-(4-substitued benzylidene)-5-bromo-2,

3-dihydropyrrolizin-1-one (4)
Compound 3 (100 mg) was dissolved in 5 mL ethanol, which was then added with
0.2 mL 10 % sodium hydroxide aqueous solution under ice-bath condition, stirred
for 10 min, 4-substituted benzaldehyde ethanol solution was added dropwise, then
stirred for 1 h at room temperature. The reaction mixture was filtrated, washed
with cold 95 % ethanol 2–3 times, the yellow solid were dried to give the com-
pounds 4 with 58–70 % yield. The following is 1H NMR example of compounds 4.
(E)-2-benzylidene-5-bromo-2,3-dihydropyrrolizin-1-one: 1H NMR (CDCl3,
d):5.0(d, 2H,3-H),6.53(d, 1H, 6-H),6.89(d, 1H, 7-H),7.47(m, 5H, Ar–H),7.6(s, H,
=CH–).
95.4.5 Target Compounds 5a–5h
To a pressure flask-added compounds 4 respectively (1 eq.), 4-substituted phenyl

boronic acid (1 eq.), potassium carbonate (1 eq.), triphenylphosphonium
(0.05 eq.) and palladium acetate (0.025 eq.). A 3 mL DMF was poured at the
condition of N2 protection, then reacted in a microwave reactor at 130 C for 1 h,
cooled to room temperature, added water, extracted with CH2Cl2 three times,
combine the organic solution, dried over anhydrous magnesium sulfate, and
purified by column chromatography with petroleum ether and ethyl acetate system.
5a (46 % yield): 1H NMR (CDCl3, d):3.91(s, 3H, –OCH3),5.3(d, 2H, 3-H),6.69(t,
1H, 6-H),7.02(d, 1H, 7-H),7.06(d, 2H, Ar–H),7.44(m, 5H, Ar–H),7.51(q, 3H, Ar–
H and =CH–).
5b (33 % yield): 1H NMR (CDCl3, d):5.28(d, 2H, 3-H),6.7(d, 1H, 6-H),7(d, 1H,
7-H),7.23(t, 2H, Ar–H),7.45(m, 5H, Ar–H),7.6(q, 3H, Ar–H and = CH-).
5c (40 %): 1H NMR (CDCl3, d):5.27(d, 2H, 3-H),6.73(d, 1H, 6-H),6.97(d, 1H,
7-H),7.52(m, 8H, Ar–H and Thiophene-H),7.58(s, 1H, =CH–).
5d (38 %): 1H NMR (CDCl3, d):3.87(s, 3H, –OCH3),5.21(d, 2H, 3-H),6.70(d, 1H,
6-H),6.95(d, 1H, 7-H),7.0(d, 2H, Ar–H),7.42(d, 2H, Ar–H),7.5(m, 3H, Ar–H and
=CH–),7.57(d, 2H, Ar–H).
5e (34 %): 1H NMR (CDCl3, d):5.16(s, 2H, –OCH2–),5.30(d, 2H, 3-H),6.76(d, 1H,
6-H),7.02(d, 1H, 7-H),7.09(d, 2H, Ar–H),7.46(m, 8H, Ar–H),7.54(t, 3H, Ar–H and
=CH–),7.66(d, 3H, Ar–H).
5f (46 %): 1H NMR (CDCl3, d):3.87(s, 3H, –OCH3), 5.05(s, 2H, –OCH2–),5.15(d,
2H, 3-H),6.63(d, 1H, 6-H),6.88(d, 1H, 7-H),6.98(d, 2H, Ar–H),7.37(m, 11H, Ar–
H) .
5g (45 %): 1H NMR (CDCl3, d):3.87(s, 3H, –OCH3),5.21(d, 2H, 3-H),6.70(d, 1H,
6-H),6.95(d, 1H, 7-H),7.0(d, 2H, Ar–H),7.42(d, 2H, Ar–H),7.5(m, 3H, Ar–H and
=CH–),7.57(d, 2H, Ar–H).
5h (48 %): 1H NMR (CDCl3, d):3.87(s, 3H, –OCH3),5.25(d, 2H, 3-H),6.74(d, 1H,
6-H),6.98(t, 3H, Ar–H and 7-H),7.42(m, 3H, Ar–H),7.52(t, 3H, Ar–H and =
CH–),7.64(d, 2H, Ar–H).
95.5 Conclusion
Finally, a series of novel 1H-2, 3-dihydro-1-pyrrolizinones Derivatives were

designed and synthesized, further SAR research will be carried out in the future.
Acknowledgments The authors sincerely thank Professor Peng Yu and his team in the Tianjin
University of Science and Technology for the characterization of compounds and other generous
help.
References
1. Morriello GJ, Chicchi G, Johnson T et al (2010) Fused tricyclic pyrrolizinones that exhibit
pseudo-irreversible blockade of the NK1 receptor. Bioorg Med Chem Lett 20(19):5925–5932
2. Morriello GJ, Mills SG, Johnson T et al (2010) Substituted fused bicyclic pyrrolizinones as
potent, orally bioavailable hNK1 antagonists. Bioorg Med Chem Lett 20(6):2007–2012
3. Despinoy XL, McNab H (2009) 1-Methoxycarbonylpyrrolizin-3-one and related compounds.
Org Biomol Chem 7(10):2187–2194
4. Lescot E, Bureau R, Sopkova-de Oliveira Santos J et al (2005) 3D-QSAR and docking studies
of selective GSK-3beta inhibitors. comparison with a thieno[2,3-b]pyrrolizinone derivative, a
new potential lead for GSK-3beta ligands. J Chem Inf Model 45(3):708–715
5. Zhao LQ, Hu YD, Yuan Y et al (2001) Studied on docking of 5,6-diaryl-2,3-dihydro-1-
pyrrolizinone derivatives with cyclooxygenase. Yao Xue Xue Bao 36(6):415–418
6. Zhao LQ, Yuan Y, Hu YD et al 3D-QSAR of antiinflammatory activities of 5,6-diaryl-2,3-
dihydro-1-pyrrolizinone derivatives]. Yao Xue Xue Bao. 36(5):343–346
7. Zhao LQ, Yang Z, Zhang SF (2001) 5, 6-diaryl-2, 3-dihydro-1-pyrrolizinone derivatives
synthesis and antiiflammatory and analgesic activities. Yao Xue Xue Bao 36(4):258–261
8. Zhang SF, Gao WF, Hen HZ (1988) Synthesis of 3H-1, 2-dihydro-1-pyrrolizinone derivatives.
Yao Xue Xue Bao 23(1):28–33
Chapter 96
Inhibition of iNOS to Protect Intermittent
Hypoxia-Induced Hippocampal Neurons
Impairment by Astragalus Extract in Rat
Qiang Zhang, Wenyuan Gao, Shuli Man, Yun Zhang and Baoyuan
Chen
Abstract The aim of this paper is to research the protective effect of Astragalus
against intermittent hypoxia-induced hippocampal neurons impairment in rat and
lay the theoretical foundation for sleep apnea improvement in cognitive function
by Astragalus. Male Wistar rats were divided into four groups: (1) blank control
group; (2) normoxia group; (3) intermittent hypoxia group; (4) Astragalus treated
intermittent hypoxia group. After 6-week treatment, the expression of iNOS was
detected by real-time reverse transcription polymerase chain reaction (RT-PCR) at
mRNA level as well as by immunohistochemistry (IHC) and western blot at
protein level. As a result, Astragalus reduced the expression of iNOS at mRNA
and protein levels in hippocampus compared with non-treated groups (P \ 0.05).
In conclusion, Astragalus could protect intermittent hypoxia-induced hippocampal
neurons impairment in rat.

Keywords Astragalus Intermittent hypoxia Hippocampus neurons apoptosis
INOS
Q. Zhang (&) Y. Zhang B. Chen

Tianjin Medical University General Hospital, Tianjin Institute of Geriatrics, Anshan Road,
e-mail: zhangqianyulv@163.com
W. Gao (&)
School of Pharmaceutical Science and Technology, Tianjin University, Weijin Road,
e-mail: pharmgao@tju.edu.cn
S. Man
Key Laboratory of Industrial Microbiology, Ministry of Education, College
ofBiotechnology, Tianjin University of Science and Technology, TEDA, Tianjin 300457,
China
900 Q. Zhang et al.
96.1 Introduction
Astragalus extract is an important candidate for the treatment of memory disorders

[1]. Previous research reported that Astragalus extract has antioxidant activity. In
vitro results show that AST-IV protects cardiomyocytes from oxidative stress-
mediated injury under hypoxic conditions [2]. Astragalus membranaceus can also
protect intestinal mucosa against intestinal oxidative damage after hemorrhagic
shock [3]. This study aimed to observe the effects of astragalus membranaceus to
protect intermittent hypoxia-induced hippocampal neurons impairment in rat.
The hippocampus is related with cognitive function. Intermittent hypoxia in
hippocampal neurons may cause damages to different systems. Astragalus extract
modulated the hypoxia/reoxygenation injury of hippocampal neurons and inhibited
the apoptosis[4]. Intermittent hypoxia is a hypoxia re-oxygen cycle process.
Therefore, we used the intermittent hypoxia (alternating cycles of normoxia (2 min at
21 % O2) and hypoxia (2 min at 10 % O2), repeated continuously for 8 h/day during
the light portion of the cycle for 6 weeks) to simulate OSA patients and researched
whether Astragulus could intervene damage progress of hippocampal neurons.
96.2.1 Animal Model
Twenty-four adult male Wistar rats, with body weight around 310 ± 30 g, were
provided by the Animal Center of Tianjin Medical University, Tianjin. The animals
were randomly divided into four groups (n = 6), blank control group, normoxia
group, intermittent hypoxia group, and Astragalus treated group. All groups had free
access to water and food. The hypoxia condition was intermittently induced 30 times
per hour (h), and the lowest concentration of oxygen in capsule was 5 %. The capsule
inducing hypoxia was circularly charged with nitrogen for 30 s (10 L/min), atmo-
sphere for 40 s (10 L/min) and atmosphere for 50 s (5 L/min), overall 2 min/cycle.
The oxygen concentration in capsules ranged from 5 to 21 %. Rats were exposed to
alternating cycles of normoxia (2 min at 21 % O2) and hypoxia (2 min at 10 % O2),
repeated continuously for 8 h/day during the light portion of the cycle for 6 weeks.
The experiment was conducted according to the ethics of animal experiments.
96.2.2 Astragalus Extraction
Four hundred and twenty g of Astragalus were crushed and extracted by 75 %

ethanol three times for 3.5 h. The extract was filtered and rotary evaporated, and
the remaining part was diluted to 300 mL by distilled water, then the extract
96 Inhibition of iNOS to Protect Intermittent 901
stored at 4 C. The rats were administrated with 3.5 g/2 mL/kg body weight of
Astragalus extract once everyday for six months.
96.2.3 Immunohistochemistry
The IHC was performed using Rabbit Anti-Mouse HIF-1a antibody (Santa, USA),
Rabbit Anti-Mouse iNOS antibody (Santa, USA), streptavidin–biotin complex
(SABC) kit (Boster, China), and diaminobenzidine (DAB) kit (Boster, China).
There was no false positive by setting the blank and replacing the control. Five
fields of view without overlapping and at high magnification (9400) were selected
and the average optical density was detected.
96.2.4 Real-Time RT-PCR
The primers of genes were designed by Gene Runner, a comprehensive sequence

analysis utility, and no significant homologous sequence was discovered using
National Center for Biotechnology Information, The Basic Local Alignment
Search Tool (NCBI BLAST). Quantitative real-time RT-PCR was performed
according to the protocol using the following primers: iNOS (179 base pairs, bp),
50 - CCTCAAGTCTTATTTCCTCAAC-30 (sense) and 50 -TCAGCAGCAAGT
TC-CATC -30 (antisense), glyceraldehyde-3-phosphate dehydrogenase (Gapdh)
(121 bp), 50 - TTCAACGGCACAGTCAAG-30 (sense) and 50 -CGACATACTCAG
CACCAG-30 (antisense). We performed real-time RT-PCR using SYBR green
PCR kit (Takara, Japan) and analyzed the amplification curve. The relative
expression of the target gene was represented by the 2-DCT value of the tested
sample (CT are cycles at threshold detection fluorescence; DCT = CT value of
target gene - CT value of Gapdh).
96.2.5 Western Blot
The proteins were extracted using Protein Extraction Kit (Promega, USA). Thirty
lg of proteins were mixed with 2 9 sodium dodecyl sulfate/sulphate (SDS)-
PAGE sample buffer at the ratio of 1:1. The electrophoresis was performed and the
proteins were transferred to the nitrocellulose (NC) film. The film was blocked
overnight using a buffer. The NC film was washed thrice using a buffer. The
monoclonal Goat Anti-Rat iNOS antibodies (1:400) (Santa, USA) were incubated
with NC film and shake at 4 C overnight. The NC film was washed thrice and the
secondary antibody of Rabbit Anti-Goat immunoglobulin (IgG) (1:5,000) was
902 Q. Zhang et al.
added. After incubation at 37 C for 1 h, the NC film was exposed. b-Actin (Santa,
USA) was used for normalization.
Data were presented as the mean ± standard deviation (SD) and analyzed by using
Statistical Package for the Social Sciences computer program (SPSS version 13.0).
We employed multi-factor variance to analyze the data and performed the com-
parison by using Student–Newman–Keuls test. Differences were considered sta-
tistically significant if P values were less than 0.05.
96.3.1 Immunohistochemistry Assay of iNOS
Studies have shown that Astragalus may improve cerebral hypoxia and reoxy-
genation of hippocampal neurons apoptosis. Ethyl acetate fractions of Astragalus
membranaceus (Fisch.) Bunge var. mongholicus (Bunge) Hsiao (Fabaceae) sig-
nificantly decreased pro-inflammatory mediators (e.g., NO and PGE(2))[5].
Intermittent hypoxia is also a hypoxia and reoxygenation of the pathophysiol-
ogy process. Thus, we tried the above findings applied to intermittent hypoxia rat
model experiments to investigate the protective effect of Astragalus intermittent
hypoxia in rat hippocampal neurons.
The negative cells appeared purplish-blue under optical microscope and the
cytoplasm of positive cells brownish-yellow. Compared with normoxia group and
blank control group, large quantity of brown-yellow particles in hypoxia group
were observed. In Astragalus group, the brownish-yellow particles decreased, and
-blue cells also could be observed (Fig. 96.1). Statistical significant difference was
observed between Astragalus group and hypoxia group (P \ 0.05), as indicated in
Table 96.1.
Fig. 96.1 Immunohistochemistry analysis of iNOS in brain of rats. a iNOS in control group;
b iNOS in normoxia group; c iNOS in hypoxia group; d iNOS in Astragalus group
Table 96.1 The IHC assay of iNOS in hippocampal neurons statistically analyzed
Groups Number of rats iNOS
(mean ± SD)
The first group (blank control group) 6 1.434 ± 0.072
The second group (normoxia group) 5 1.366 ± 0.004
The third group (intermittent hypoxia group) 6 7.803 ± 0.053
The fourth group (Astragalus group) 10 3.709 ± 0.046
F value 27 21661.803*
Comparison between the third and the first group 6.369 ± 0.029*
Comparison between the third and the second group 6.437 ± 0.029*
Comparison between the third and the fourth group 4.093 ± 0.029*
*P \ 0.05, compared with intermittent hypoxia groups
96.3.2 The Expression of iNOS at mRNA Level
As shown in Fig. 96.2, the expressions of iNOS at mRNA level in Astragalus

group were lower than those in hypoxia group, and the expressions of iNOS in
hypoxia group were higher than those in normoxia and blank control groups.
Statistical significant difference was observed between Astragalus and hypoxia
groups (P \ 0.05), as indicated in Table 96.2.
96.3.3 The Expression of iNOS by Western Blot
The expressions of iNOS in Astragalus group were lower than those in hypoxia
group. The expressions of iNOS in hypoxia group were higher than those in
normoxia and blank control groups, as shown in Fig. 96.3.
Fig. 96.2 The electrophoretic analysis of PCR products of iNOS in different samples. 1 The
band in normoxia group is not clear (179 bp). 2, 3 The band in Astragalus group is clear (167 bp).
4 Marker, from bottom to top: 100, 250, 500, 750, 1,000, 2,000 bp. 5 The band in blank control
group is 179 bp. 6, 7 The band in hypoxia group is 179 bp
904 Q. Zhang et al.
Table 96.2 The expression of iNOS at mRNA level in hippocampal neurons statistically analyzed
Groups Number of rats iNOS
(mean ± SD)
The first group (blank control group) 6 0.202 ± 0.032
The second group (normoxia group) 5 0.125 ± 0.040
The third group (intermittent hypoxia group) 6 3.394 ± 1.344
The fourth group (Astragalus group) 10 1.121 ± 0.595
F value 27 25.510*
Comparison between the third and the first group 3.192 ± 0.421*
Comparison between the third and the second group 3.269 ± 0.441*
Comparison between the third and the fourth group 2.273 ± 0.376*
*P \ 0.05, compared with intermittent hypoxia groups
Fig. 96.3 The expression of

iNOS in hippocampal
neurons detected by western
blot. The molecular weight of
iNOS is 132 kDa. The
molecular weight of beta-
actin is 43 kDa. 1 blank
control group; 2 norm oxia
group; 3 Astragalus treated
hypoxia group; 4 non-treated
hypoxia group
Our findings showed that the expressions of iNOS at mRNA and protein levels
as well as the apoptosis of neurons increased in hippocampus of rats exposed to
intermittent hypoxia, but, Astragalus decreased the expression of iNOS at mRNA
and protein levels and inhibited the apoptosis of neurons in hippocampus. These
results are in accordance with previous studies.
Any condition of hypoxia could induce rapidly an abundant expression of HIF-
1a. Meanwhile, it was reported that NO generated by iNOS mainly played
a cytotoxic role during the process of hypoxia [6]. The apoptosis is one of the
important mechanisms to delay neuron death after cerebral ischemia or hypoxia.
HIF-1a can regulate the expression of iNOS [7]. Astragalus reduced HIF-1a
expression. Therefore, it inhibited the production of NO and then avoided the
apoptosis of hippocampus neurons and other tissues injury. In our previous
research, we found that Astragalus could inhibit the expression of HIF-1a (data are
published elsewhere).
96.4 Conclusion
Astragalus inhibited the apoptosis of neurons under intermittent hypoxia through

down-regulation of the mRNA and protein levels of iNOS. The dose-dependent
activity and discovery of the valid parts of Astragalus still need to be carried out in
the future.
Acknowledgments This work was supported by a grant 10JCYBJC25800 from Natural Science
Foundation of Tianjin, a grant 20100132 from Tianjin higher school science and technology
development fund project and a grant 2009KY17 from Tianjin Medical University Fund.
References
1. Tohda C, Tamura T, Matsuyama S et al (2006) Promotion of axonal maturation and prevention

of memory loss in mice by extracts of Astragalus mongholicus. Br J Pharmacol 149:532–541
2. Hu JY, Han J, Chu ZG et al (2009) Astragaloside IV attenuates hypoxia-induced
cardiomyocyte damage in rats by upregulating superoxide dismutase-1 levels. Clin Exp
Pharmacol Physiol 36:351–357
3. Gan XL, Hei ZQ, Huang HQ et al (2006) Effect of Astragalus membranaceus injection on the
activity of the intestinal mucosal mast cells after hemorrhagic shock-reperfusion in rats. Chin
Med J (Engl). 119:1892–1898
4. Zhu FF, Yin YY, Li WP (2009) Protective effect of extract of a stragalus against injury
induced by hypoxia/reoxygenation in hippocampus neuron. Chin Pharm Bull. 25:213–216
5. Chao WW, Kuo YH, Li WC et al (2009) The production of nitric oxide and prostaglandin E2
in peritoneal macrophages is inhibited by Andrographis paniculata, Angelica sinensis and
Morus alba ethyl acetate fractions. J Ethnopharmacol 122:68–75
6. Iadecola C, Zhang F, Casey R et al (1997) Delayed reduction of ischemic brain injury and
neurological deficits in mice lacking the inducible nitric oxide synthase gene. J Neursci
17:9157–9164
7. Palmer LA, Semenza GL, Stoler MH et al (1998) Hypoxia induces type II NOS gene
expression in pulmonary artery endothelial cells via HIF-1. Am J Physiol 274:212–219
Chapter 97
Prepared and Characterization of 12b,
15a-Dihydroxy- 16a,17-Epoxyprogesterone
Yibo Wang, Yanbing Shen, Jiajia Ren, Jianmei Luo and Min Wang
Abstract The compound 12b, 15a-dihydroxy-16a, 17-epoxyprogesterone was

biotransformed from 16a, 17-epoxyprogesterone by Colletotrichum lini AS3.4486,
and its structure was characterized by 1H NMR, 13C NMR, HREI-MS and single-
crystal X-ray diffraction. The crystal of the title compound belongs to monoclinic,
space group R3 with a = 8.0655(8), b = 12.1955 (12), c = 18.589(2) Å, b = 90, Z = 4,
V = 1828.4(3) Å 3, Dc = 1.309 mg/m3, l = 0.092 mm-1, F(000) = 776, R =
0.0407 and wR =0.0792. X-ray analysis indicates that intermolecular hydrogen
bonds O(2)–H(2)O(5), O(3)-H(3)O(2) are observed.
Keywords Biotransformation 16a 17-epoxyprogesterone Hydroxylation

Colletotrichum lini
97.1 Introduction
16a,17a-epoxyprogesterone (EP, 1) is an important intermediate of pharmaceutical

industry [1, 2]. The production of several high value steroid drugs is mostly derived
from the key compounds by microbiological hydroxylation. Biotransformation
exhibits higher regio- and stereo-selectivity, may contribute to new derivatives of
16a, 17-epoxyprogesterone for research of lead compounds.
The literature data indicated the ability of Colletotrichum lini AS3. 4486 (C. lini
AS3.4486) to hydroxylate on steroidal substrates. e. g., The 7b and 12b hydroxy
Y. Wang Y. Shen J. Ren J. Luo M. Wang (&)

Key Laboratory of Industrial Fermentation Microbiology(Tianjin University of Science and
Technology), Ministry of Education; College of Biotechnology, Tianjin University of
Science and Technology, Tianjin 300457, People’s Republic of China
908 Y. Wang et al.
group was introduced to progesterone [3], the 11a, and 15a hydroxy group was
introduced to androstenedione [4], and Romano reported that the hydroxylation of
the position 7 and 15 of dehydroepiandrosterone (3b-hydroxy-5-androsten-
17- one) [5]. In the present paper, we studied the biotransformation of 1 by C. lini
AS3. 4486. Notably, a product 12b, 15a-dihydroxy-16a,17-epoxyprogesterone (2)
was formed. The introduction of hydroxy group at C12 and C15 position of
steroids was very difficult by chemical synthesis. Therefore, it is a mild and
selective method that hydroxylated steroid substrates at positions C12 and C15
with C. lini AS3.4486.
97.2.1 Apparatus and Reagents

1
H NMR and 13C NMR spectra were measured on a Bruker AV400 Instrument
(400 MHz) with DMSO-d6 as the solvent. Mass spectra were recorded on
a Thermo-Finingan mass detector. The single-crystal structure was determined on
a Rigaku Saturn CCD area detector. Substrate 16a, 17a-epoxyprogesterone (EP,
98.4 % purity) was obtained from Tianjin Jinjin Pharmaceutical Co., Ltd. All
chemical solvents and salts used were of analytical grade or higher.
97.2.2 Preparation of 12b,15a-Dihydroxy-16a,

17-Epoxyprogesterone
Colletotrichum lini AS3. 4486 was obtained from Institute of Microbiology,

Chinese Academy of Sciences and maintained on PDA agar slants at 4 C. The
microorganism was further cultivated in 250 mL shake flasks containing 50 mL
culture medium in two consecutive cultivation steps as previously described by
Shen et al. [3].
For the biotransformation, 100 mg of 1 dissolved in 2 mL of ethanol was added
to the culture after 24 h for growth and the reaction was allowed to proceed for
48 h. The mycelium was then removed by filtration. The biomass and the broth
were extracted separately with EtOAc. All extracts were combined and dried
(anhydr. MgSO4). The solvents after filtration were evaporated under reduced
pressure. The crude extracts were purified by Si gel column using dichlorometh-
ane/ether/methanol (25:2:1, v/v/v). The white powder was diffused with n-hexane/
acetone at room temperature. Colorless prismatic crystals suitable for X-ray
analysis were obtained.
97 Prepared and Characterization of 12b 909
97.2.3 Structure Determination
The colorless needle crystal of compound 2 with dimensions of 0.22 mm 9

0.18 mm 9 0.12 mm was selected for X-ray diffraction analysis. The data were
collected by a Rigaku Saturn CCD area detector equipped with a graphite-
monochromatic MoKa radiation (k = 0.71073 Å) using a u-x scan mode at 113(2)
K. In the range of 2.00 B h B 27.87, a total of 19,354 reflections were collected
with 4,393 unique ones (Rint = 0.0559), of which 2,494 were observed with
I[ 2r(I) and used in the succeeding refinements. Intensity data were corrected for
Lp factors and empirical absorption. The structure was solved by direct methods
and expanded by different Fourier techniques with SHELXS-97 program [6]. All
of the nonhydrogen atoms were located with successive different Fourier synthe-
ses. The structure was refined by full-matrix least-squares techniques on F2 using
anisotropic thermal parameters for all nonhydrogen atoms. The hydrogen atoms
were added according to theoretical models. The final full-matrix least-squares
refinement converged at R = 0.0407, wR = 0.0927 (x = 1/[r2(Fo2) ? (0.0428 P)2
? 0.0000 P], where P = (Fo2+2Fc2)/3), S = 1.020 (Dq)max = 0.185 (Dq)min =
–0.229 e/Å3 and (D/r)max = 0.000.
The purified transformation product was characterized by NMR and MS. The
detailed results are as follows: HREI-MS: m/z 361.2006 [M+H]+ C21H28O5, Calcd.
for 360.1937; 1H NMR (DMSO-d6, 400 MHz): d (ppm): 0.98 (3H, s, H-18), 1.15
(3H, s, H-19), 2.10 (3H, s, H-21), 4.72 (1H, d, H-12), 4.98 (1H, d, H-15), 5.62 (1H,
s, H-4); 13C NMR (DMSO-d6, 400 MHz): d(ppm): 204.89(C-20),197.95 (C-3),
170.52(C-5), 123.09 (C-4), 71.23 (C-17), 70.28 (C-12), 62.66 (C-15); Rf in dichlo-
romethane/ether/methanol (12.5:2:1, v/v/v): 0.48.
Fig. 97.1 Molecular structure of the compound 2

910 Y. Wang et al.
Fig. 97.2 Crystal packing of

the compound 2
The formula weight added 32 to 16a, 17-epoxyprogesterone from ESI-MS(+). It

supposed that the production added two hydroxyls. The molecular structure and
perspective view of the crystal packing in a unit cell of compound 2 are shown in
Table 97.1 Selected bond lengths (Å) and bond angles () for the compound 2
Bond Dist. Bond Dist. Bond Dist.
O(1)–C(3) 1.229(3) C(5)–C(10) 1.524(3) C(12)–C(13) 1.525(3)
O(2)–C(12) 1.446(2) C(6)–C(7) 1.530(3) C(13)–C(17) 1.542(3)
O(3)–C(15) 1.421(2) C(7)– C(8) 1.524(3) C(13)–C(18) 1.544(3)
O(4)–C(16) 1.442(2) C(8)–C(14) 1.531(3) C(13)–C(14) 1.547(3)
O(4)–C(17) 1.456(2) C(8)–C(9) 1.542(3) C(14)–C(15) 1.537(3)
O(5)–C(20) 1.223(3) C(9)–C(11) 1.542(3) C(15)–C(16) 1.512(3)
C(1)–C(10) 1.538(3) C(9)–C(10) 1.567(3) C(16)–C(17) 1.479(3)
C(2)–C(3) 1.501(3) C(10)–C(19) 1.550(3) C(17)–C(20) 1.501(3)
C(3)–C(4) 1.460(3) C(11)–C(12) 1.535(3) C(20)–C(21) 1.501(3)
C(4)–C(5) 1.347(3)
Angle (?) Angle (?) Angle (?)
C(4)–C(5)–C(6) 120.1(2) C(1)–C(10)– 110.15(17) C(18)–C(13)– 112.31(15)
C(19) C(14)
C(4)–C(5)–C(10) 123.1(2) C(12)–C(11)– 114.04(15) C(8)–C(14)– 121.05(16)
C(9) C(15)
C(6)–C(5)–C(10) 116.81(16) C(5)–C(10)– 107.79(15) C(8)–C(14)– 112.88(15)
C(9) C(13)
C(5)–C(6)–C(7) C(1)–C(10)– 108.01(15) C(15)–C(14)– 105.13(15)
111.38(16) C(9) C(13)
C(8)–C(7)–C(6) 111.16(16) C(19)–C(10)– 112.23(16) O(3)–C(15)– 109.93(15)
C(9) C(16)
C(7)–C(8)–C(14) 111.91(15) O(2)–C(12)– 112.74(15) O(3)–C(15)– 113.14(15)
C(13) C(14)
(continued)
97 Prepared and Characterization of 12b 911
Table 97.1 (continued)

Bond Dist. Bond Dist. Bond Dist.
C(7)–C(8)–C(9) 110.75(15) O(2)–C(12)– 106.99(15) C(16)–C(15)– 102.30(16)
C(11) C(14)
C(14)–C(8)–C(9) 105.95(15) C(13)–C(12)– 111.21(16) C(17)–C(16)– 109.49(17)
C(11) C(15)
C(8)–C(9)–C(11) 112.18(15) C(12)–C(13)– 117.67(16) C(16)–C(17)– 121.90(18)
C(17) C(20)
C(8)–C(9)–C(10) 114.71(15) C(12)–C(13)– 112.30(16) C(16)–C(17)– 107.46(16)
C(18) C(13)
C(11)–C(9)–C(10) 112.55(16) C(17)–C(13)– 106.24(15) C(20)–C(17)– 124.45(17)
C(18) C(13)
C(5)–C(10)–C(1) 110.30(16) C(12)–C(13)– 106.72(15) C(17)–C(20)– 118.40(18)
C(14) C(21)
C(5)–C(10)–C(19) 108.35(16) C(17)–C(13)– 101.18(15)
C(14)
Table 97.2 Hydrogen bonds for shelx [A and deg.]

D-H…A d(D-H) d(H…A) d(D…A) \(DHA)
O(2)–H(2)…O(4)a 0.83(2) 1.96(2) 2.7715(19) 164(2)
O(5)–H(5)…O(1)b 0.87(3) 1.95(3) 2.810(2) 166(3)
Symmetry transformations used to generate equivalent atoms
a
x - 1, y, z; b -x+3/2,-y+1,z-1/2
Figs 97.1 and 97.2, respectively. The selected bond lengths and bond angles are
listed in Table 97.1.
Compound 2 has three six-membered rings (A/B/C) and one five-membered
rings (D). Ring A has a 1a-sofa conformation. Rings B and C adopt chair con-
formations, while the cyclopentane ring D adopts a 14a-envelope conformation. In
the crystal structure, there are short intermolecular C–HO contacts. The title
compound was chiral space group. The 12-hydroxy is b configuration with the
torsion angles C12–C13–C14–O2 = 175.98(15). The 15-hydroxy is a configu-
ration with the torsion angles C13–C14–C15–O3 = -153.64(15). The bond
lengths and angles are within normal ranges [7, 8]. In the crystal packing
(Fig. 97.2), X-ray analysis indicates that intermolecular hydrogen bonds O(2)–
H(2)O(5), O(3)–H(3)O(2) are observed (Table 97.2).
97.4 Conclusion
The hydroxylated 16a, 17-epoxyprogesterone was obtained by biotransformation

with Colletotrichum lini AS3. 4486 and its structure was characterized by
1
H NMR, 13C NMR, HREI-MS, and single-crystal X-ray diffraction. In the
912 Y. Wang et al.
view of all these observations, the product should be 12b, 15a- dihydroxy-16a, 17-
epoxyprogesterone.
Acknowledgments This work was supported by the National High Technology Research and
Development of China (2011AA02A211), the National Natural Science Foundation of China
(Nos. 21076158 and 21276196), and Tianjin City High School Science & Technology Fund
Planning Project (20120629).
References
1. Wu DX, Guan YX, Wang HQ et al (2011) 11a-Hydroxylation of 16 a,17-epoxyprogesterone

by Rhizopus nigricans in a biphasic ionic liquid aqueous system. Bioresource Technol
102:9368–9373
2. Chen K, Tong WY, Wei DZ et al (2007) The 11b-hydroxylation of 16,17a-epoxyprogesterone
and the purification of the 11b-hydroxylase from Absidia coerulea IBL02[J]. Enzyme Microb
Tech 41(1/2):71–79
3. Shen Y, Sun H, Fu Y et al (2012) Progesterone hydroxylation with Colletotrichum lini AS3.
4486. Adv Mater Res 343–344:1070–1073
4. Shen YB, Wang M, Liang QK et al (2011) 11a,15a-Dihydroxyandrost-4-ene-3,17-dione. Acta
Cryst E67:o2752
5. Romano A, Romano D, Ragg E et al (2006) Steroid hydroxylations with Botryodiplodia
malorum and Colletotrichum lini. Steroids 71:429–434
6. Sheldrick GM (2004) SHELX97. University of Göttingen, Germany
7. Wang S, Wang Y, Nie Q et al (2004) 16a,17-Epoxy-4-pregnene-3,20-dione. Acta Cryst
E60:o2337–o2338
8. Nie Q, Wang JK, Wang S et al (2005) 16a,17-Epoxy-11a-(p-tolylsulfonyloxy)pregn-4- ene-
3,20-dione. Acta Cryst E61:o912–o913
Part IV
Agricultural, Environmental, Marin
Biotechnology and Bio-energy Technology
Chapter 98
Structure Elucidation of Two
Triterpenoid Saponins from Leaves
of Schima superba Gardn. et Champ
Guanghua Huo, Changling Zhang and Yingjun Zhang
Abstract Two new oleanane-type triterpenoid saponins with two angeloyls at

C-21, C-22, and a branch of tetrasaccharide moiety (Rha, Cal, Glc, GlcA, or Rha,
Xyl, Glc, GlcA) at C-3 were isolated from leaves of Schima superba Gardn. et
Champ. Their structures were established using one- and two-dimensional NMR
and high resolution electrospray ionization mass spectrometry as 21,22-di-O-
angeloyl-R1-barrigenol-3-O–{b-D-glucopyranosyl-(1?2)-b-D-galactopyranosyl-
(1?2)-[a-L-rhamnopyranosyl-(1?4)]}-b-D-glucuronopyranoside, named schi-
masuoside A(1), 21,22-di-O-angeloyl-R1-barrigenol-3-O-{b-D–glucopyranosyl-(1
?2)-b-D–xylopyranosyl-(1?2)-[a-L-rhamnopyranosyl-(1?4)]}-b-D-glucurono-
pyranoside, named schimasuoside B (2). There are strong antifungal effect of their
mixture on Magnaporthe oryzae.
Keywords Schima superba Schimasuoside A Schimasuoside B Structure

elucidation
98.1 Introduction
Schima superba Gardn. et Champ (Theaceae) is mainly distributed in central and

southern China. The plant is commonly cultivated as an ornamental tree, for
timber production and as a firebreak planting. Its bark powder is used as a repellant
agent to dispel wild pigs and birds from crops in Fujian mountain, to poison fish in
G. Huo (&) C. Zhang

College of Bioscience and Engineering, Jiangxi Agricultural University,
330045 Nanchang, People’s Republic of China
e-mail: hgh3813899@sohu.com
Y. Zhang
Kunming Institute of Botany, Chinese Academy of Sciences,
650204 Kunming, People’s Republic of China
916 G. Huo et al.
Taiwan, and as an arrow tip toxin by traditional hunters. A methanolic extract of

its stem bark is used to kill snails [1], to induce apastia in Plutella xylostella, and
Pieries rapae [2], and to control intestinal parasite. We recently found a strong
antifungal effect of an ethanolic extract of S. superba leaves on Magnaporthe
oryzae [3, 4]. The presence of a variety of chemical constituents in its stem such as
saponins, flavonoids, lignanoids, have been reported [5, 6]. However, no report on
the isolation and identification of saponins from the leaves of S. superba was
available until now. The current study presents the isolation, structural elucidation
of two new saponins from the leaves of S. superba in this paper.
98.2.1 General Experimental Procedures
Optical rotations were measured with JASCOP-1020 digital polarimeter (Japan

Jasco Pty Ltd). HRESI-MS spectra were acquired on API QSTAR Pulsa LC/TOF
mass spectrometer (American AB corp). GC–MS spectra were obtained on Agilent
5973N with Shimadzu GC-14C column gas-mass spectrometer. One- and two-
dimensional NMR spectra were recorded on Bruker DRX-500 or Avance III 600
Fourier Transform NMR spectrometer and chemical shifts were given in ppm with
TMS as internal standard. UV spectra were measured with Shimadzu UV 2401PC
ultraviolet spectrometer. IR spectra were recorded on Bruker Tensor-27 Fourier
Transform infrared spectrometer. Preparative and analytical HPLC were per-
formed on HPLC system consisted of Waters 2695 separations module-2,996
photodiode array detector (Auto injection), Waters 600-486 pumps tunable
absorbance detector (manual-injection), Water Delta 600-2,487 dual wavelength
absorbance detector using Agilent ZORBAX StableBond C-18 (9.4 9 150 mm,
5 lm; 4.6 9 250 mm, 5 lm).
98.2.2 Plant Material
Leaves of S. superba were collected from Jiangxi province of China in November

2010 and identified by Prof. X. H. Shi of Forestry College in Jiangxi Agricultural
University. Voucher specimens have been deposited at the herbarium of this
university.
98.2.3 Extraction and Isolation
Dried and powdered leaves of the plant (10 kg) were extracted with 80 % EtOH.
After concentrated under vacuum, the EtOH extract was suspended into water, and
98 Structure Elucidation of Two Triterpenoid Saponins 917
then extracted successively with CHCl3 and n-BuOH. The n-BuOH fraction
(679.2 g) was subjected to Diaion HP20SS column chromatography (CC)
(MeOH–H2O, 0:100–100:0 v/v) to give eight fractions (Fr.1–8). Fraction 8
(87.68 g) was applied to silica gel CC (CHCl3–MeOH-H2O, 100:0:0–55:45:10) to
yield a crude saponin mixture (44.03 g) from the eluate (CHCl3–MeOH-H2O,
6:4:1). The saponin mixture was further purified by RP-18 CC (MeOH–H2O,
75:25–90:10) to give fractions I–IV (2.29, 3.02, 4.34, 1.59 g). The fraction I was
further purified by semi-preparative reversed phase HPLC (MeCN–MeOH–H2O,
48:16:36, v/v/v) to afford saponin 1 (rt = 24.38 min) and saponin 2
(rt = 24.85 min).
Compound 1: Amorphous powder ½a24 D 15:2 ðc 0:15; MeOHÞ; UV ðMeOHÞ;
kmax : 203:2 nm; IR (KBr) mmax 3421, 3210, 1720, 1679, 1401, 1207, 1135 cm-1;
ESI–MS (positive ion mode): m/z 1339 [M ? Na]+; HRESI–MS m/z 1339.6302
[M ? Na]+ (calcd for C64H100O28, 1316.6404); 1H-, 13C-NMR (pyridine-d5,
600 MHz): Tables 33.1, 33.2.
Compound 2: Amorphous powder ½a24 D 12:3ðc 0:15; MeOHÞ; UV ðMeOHÞ
kmax : 203:4 nm; IR (KBr) mmax 3375, 2924, 1675, 1460, 1206, 1135, 1044 cm-1;
ESI–MS (positive ion mode): m/z 1309 [M ? Na]+; HRESI–MS m/z 1309.6181
[M ? Na]+ (calcd for C63H98O27, 1286.6283); 1H-, 13C-NMR (pyridine-d5,
600 MHz): Tables 33.1, 33.2.
98.2.4 Acid Hydrolysis of Saponins
The saponin mixture (30 mg) fraction from RP-18 column chromatography dis-
solved in 50 % aqueous dioxane (2 mL) and 1.5 N HCl (90 mL) was heated at
96 C for 6 h. The reaction mixture was extracted twice CHCl3 and evaporated to
dryness. The aglycone (1a) was purified by silica gel CC (petroleum ether: EtOAc,
2:1) and detected by HPLC [column Zorbax SB-C18; 4.6 9 250 mm, solvent
MeCN–H2O (3:7–10:0) ? 0.1 % TFA; flow rate 1 mL/min; detection wavelength
210 nm; rt = 43.18 min]. The water layer was dried and dissolved in pyridine.
The solution was examined for sugars by paper chromatography [n-BuOH–
HOAc–H2O (4:1:5)] against standard samples as well as by GC after being con-
verted to their trimethylsilylimidazole derivatives; conditions: [column 30QC2/
AC-5 (30 m 9 0.32 mm), column temperature; 180 C/280 C, temperature-pro-
grammed; 3 C/min, sample temperature; 250 C, carrier gas; N2, retention time
D-Glc (18.398 min), L-Glc (18.873 min), D-Gal (19.009 min), L-Gal (19.665 min),
D-Rha (15.849 min), L-Rha (14.950 min), D-Xyl (14.285 min), L-Xyl
(14.939 min). From the new saponins, rhamnose was in the L-form, while glu-
curonic acid, glucose, galactose, and xylose were in the D-form.
Compound 1a: Amorphous powder, ½a24 D þ8:7ðc 0:15; MeOHÞ; UV ðMeOHÞ;
kmax : 207:8; 273:8 nm; IR (KBr) mmax 3,442, 2,959, 2,927, 1,459, 1,385, 1,242,
918 G. Huo et al.
Table 33.1 13C NMR data of compounds 1, 1a and 2

Position 1d 2d 1ad Position 1d 2d 1ad
1 39.3 39.3 38.5 Gal Xyl
2 27.1 27.1 26.6 1 100.7 100.8
3 78.8 78.7 78.6 2 79.6 79.5
4 37.5 37.3 38.6 3 73.7 78.9
5 56.0 56.0 54.8 4 71.6 76.7
6 19.2 19.2 18.5 5 75.8 78.7
7 36.9 36.9 35.5 6 63.6 –
8 40.2 40.2 40.8
9 47.5 47.5 46.5 Glc-1 102.5 102.1
10 37.0 36.9 36.8 2 76.2 76.2
11 23.2 23.2 23.4 3 78.6 78.6
12 124.9 124.9 125.9 4 72.7 72.7
13 144.5 144.5 141.5 5 78.4 78.4
14 47.3 47.3 47.1 6 63.7 63.7
15 67.4 67.4 66.8
16 73.4 73.4 72.5 Rha-1 102.8 102.5
17 48.3 48.3 48.1 2 71.2 73.1
18 39.6 39.6 39.7 3 72.5 73.2
19 47.5 47.5 45.9 4 73.6 74.3
20 37.5 37.5 35.6 5 69.8 70.5
21 79.4 79.4 77.6 6 18.3 17.9
22 73.5 73.5 72.5
23 16.3 16.3 15.2 Ang (C-21) Ang (C-21) Ang (C-21)
24 27.1 27.1 27.8 1 168.8 167.2 169.1
25 16.3 16.3 15.2 2 129.5 128.2 127.1
26 17.9 17.9 17.6 3 137.3 138.6 138.3
27 20.1 20.3 20.5 4 16.3 16.3 15.2
28 62.6 62.6 62.3 5 21.4 18.8 19.8
29 21.9 21.9 19.4
30 30.1 30.1 29.0 Ang (C-22) Ang (C-22) Ang (C-22)
1 167.2 167.2 168.2
GlcA-1 105.2 105.1 2 128.2 128.2 127.6
2 81.9 81.9 3 138.6 138.6 139.5
3 76.9 76.9 4 16.3 15.3 15.2
4 76.4 76.3 5 21.4 18.8 19.8
5 78.6 78.5
6 136.8 136.8
Compound 1 and 2 d, in C5D5N, 600 MHz; Compound 1a d, in C5D5N, 500 MHz
1,165, 1,074, 1,042 cm-1; ESI–MS (positive ion mode): m/z 693 [M ? Na]+; ESI–
MS (negative ion mode): m/z 705 [M ? Cl]-; 1H-, 13C-NMR (pyridine-d5, 500 MHz):
Tables 33.1, 33.2.
Table 33.2 1H NMR data compounds 1, 2, and 1a

Position 1d 2d 1ad Position 1d 2d 1ad
1 0.74 s 0.74 s 0.89 s Gal (1?2) GlcA Xyl (1?2) GlcA
2 1.71 s 1.71 s 1.51 m 1 6.31 d (10.2) 6.17 d (6.5)
3 6.67 dd 6.67 dd 3.10 m 2 4.61 s 4.61 s
4 – – – 3 4.42 m 4.36 m
5 0.71 s 0.71 s 0.67 m 4 4.46 s 4.66 s
6 1.52 dd 1.52 dd 1.48 m 5 4.51 d 4.35 m
7 2.08 s 2.08 s 1.57 s 6 4.72 m
2.13 dd 2.13 dd 1.65 s
8 – – –
9 1.65 m 1.65 m 1.48 m Glc (1?2) Gal Glc (1?2) Xyl
10 1 5.88 d (6.8) 5.83 d (6.8)
11 2.08 dd 2.08 dd 1.83 dd 2 4.09 t 4.09 t
12 7.21 s 7.21 s 5.42 m 3 4.37 m 4.37 m
13 – – – 4 3.99 m 3.99 m
14 – – – 5 6.30 s 6.30 s
15 4.21 m 4.21 m 3.62 dd 6 4.22 m 4.22 m
16 3.99 s 3.99 s 3.66 s
17 – – – Rha (1?4) Rha (1?4)
GlcA GlcA
18 1.29 s 1.29 s 1.29 s 1 6.17 brd (1.8) 6.05 brd (1.8)
19 1.37 s 1.37 s 1.17 s 2 4.46 s 4.46 s
1.64 m 1.64 m
20 – – – 3 4.66 m 4.66 m
21 6.69 dd 6.69 dd 5.74 dd 4 4.22 s 4.22 s
22 6.52 s 6.52 s 5.51 dd 5 6.13 s 6.13 s
23 0.73 s 0.73 s 0.69 s 6 0.96 s 0.96 s
24 1.06 s 1.06 s 0.89 s
25 0.77 s 0.77 s 0.68 s Ang (C-21) Ang (C-21) Ang (C-
21)
26 0.97 s 0.97 s 0.90 s 1 – – –
27 1.28 s 1.28 s 1.29 s 2 – – –
28 4.23 s 4.23 s 2.87 s 3 5.80 m 5.80 m 5.98 m
3.21 s
29 1.28 s 1.28 s 0.90 s 4 1.95 d (6.8) 1.95 d (6.2) 1.83 s
30 1.07 s 1.07 s 0.82 s 5 1.29 s 1.29 s 1.30 s
Sugar C-3 C-3
GlcA GlcA Ang (C-22) Ang (C-22) Ang (C-
22)
1 4.84 4.84 1 – – –
d (7.2) d (7.2)
2 4.81 s 4.81 s 2 – – –
3 4.29 s 4.29 s 3 5.96 m 5.96 m 5.98 m
4 4.67 s 4.67 s 4 1.95 d (6.8) 1.95 d (6.2) 1.83 s
5 4.38 m 4.38 m 5 1.29 s 1.29 s 1.30 m
6 7.58 s 7.58 s
Compound 1 and 2 d, in C5D5N, 600 MHz; Compound 1a d, in C5D5N, 500 MHz
920 G. Huo et al.
The n-butanol fraction of the ethanolic extract of S. superba leaves was repeatedly
chromatographed on Diaion HP20SS, silica gel and reversed phase silica gel (RP-
18) columns together with semi-preparative reversed phase HPLC to afford two
new triterpenoid saponins (1–2) (Fig. 33.1).
Part of the saponin mixture of 1 and 2 before purification was hydrolyzed by
1.5 N HCl to give compound 1a as aglycone, and D-glucose, D-galactose, L-
rhamnose, glucuronic acid and D-xylose as sugar moieties, suggesting that 1 and 2
were the glycosides of 1a. Compound 1a was a white amorphous powder, and
showed positive Libermann -Burchard and Molish reactions, suggesting that 1a
might be a triterpenoid glycoside or a steroidal glycoside. ESI–MS (positive) of 1a
showed a quasi-molecular ion peak at m/z 693 [M ? Na]+. The 13C NMR
spectrum of 1a showed characteristic signals for 40 carbons, including two iso-
prenyl groups [dC 127.1 (C-20 ), 138.3 (C-30 ), 127.6 (C-200 ), 139.5 (C-300 ), 15.2 (2C,
C-40 , C-400 ), 19.8 (2C, C-50 , C-500 )] and two ester carbonyl groups (dC 169.1 and
168.2), establishing two angeloyl groups by comparing with those in the literature
[7–9], and an oleanane type triterpene with 30 carbons including seven methyls,
five quaternary carbons, one double bond [dC 125.9 (C-12), 141.5 (C-13)] and six
oxygen-bearing methines [dC 78.6 (C-3), 66.8 (C-15), 62.3 (C-16), 62.3 (C-28),
77.6 (C-21), 72.5 (C-22)] referring to the literature [10, 11]. In the HMBC spec-
trum of 1a, correlations of H-21 and H-22 with the carbonyl carbon in two an-
geloyls were observed, respectively, indicating the two angeloyls located on C-21
and C-22 of the aglycone. Furthermore, ROESY correlations of H-21 and H-3,
H-22 and H-29, H-15, H-16, and H-26, established the relative stereochemistry
of each hydroxy group. The above evidences indicated that 1a was a sapogenin
of triterpenoid saponin, named as 21,22-di-O-angeloyl-R1-barrigenol [7]
(Fig. 33.1(1a)).
Compound 1 was obtained as a white amorphous powder. HR-ESI-MS (posi-
tive) of 1 showed the quasi -molecular ion at m/z 1339.6302 [M ? Na]+ (calcd.
For 1339.6302, C64H100O28Na), establishing the molecular formula of 1 as
C64H100O28 combined with DEPT and 13C NMR spectra. IR spectrum of 1 showed
O H O O H
H
O O
O O
O 20 O
O
OH 21 O
OH
H H
OH OH
HOOC 12 22
OH HOOC OH
O O 13 17 O
O O
O
HO O
O O 1 14 16 OH HO O
HO HO O O O
10 8 15 OH H
HO O HO
OH O
HO HO
3 OH
OH
O OH HO OH
HO 4 HO HO O
HO HO
OH OH
OH OH
1 1a 2
Fig. 33.1 Structures of compounds 1, 1a and 2

characteristic signals for hydroxyl (3,420 cm-1) and carbonyl (1,720 cm-1).
Comparison of the 13C NMR spectra data of 1 with those of compound 1a, sug-
gested 1 to be the 3-O-glycoside of 21,22-di-O-angeloyl-R1-barrigenol (1a). The
sugar moieties of 1 were characterized by use of 2D NMR experiments (HSQC,
HSQC-TOCSY, and HMBC), as b-D-glucuronopyranosyl, b-D-galactopyranosyl,
a-L-rhamnopyranosyl and b-D-glucopyranosyl moieties (anomeric H at d 4.84
(d, J = 7.2 Hz), 6.31 (d, J = 10.2 Hz), 6.17 (brd, J = 1.8 Hz), 5.88 (d, J =
6.8 Hz),respectively). The HMBC correlations verified the sugar linkages of C-3
(d 78.8) of the oleanolic acid residue with GlcA H-1(d 4.84), Rha H-1 (d 6.17)
with GlcA C-4 (d 76.4), Gal H-1 (d 6.31) with GlcA C-2 (d 81.9), and Glc H-1
(d 5.88) with Gal C-2 (d 79.6). Therefore the structure of 1 was elucidated as
21,22-di-O-angeloyl-R1-barrigenol-3-O-{b-D-glucopyranosyl-(1?2)-b-D-galacto-
pyranosyl-(1?2)-[a-L-rhamnopyranosyl-(1?4)]}-b-D-glucuronopyranoside
(Fig. 33.1(1)).
Compound 2, a white amorphous powder, showed the quasi-molecular ion at m/
z 1309.6181 [M ? Na]+(calcd. For 1309.6181, C63H98O27Na) in the HR-ESI-MS
(positive), establishing the molecular formula of 2 as C63H98O27, combined with
DEPT and 13C NMR spectra. Comparison of the 1H and 13C NMR spectra data of
2 with those of Compound 1, there were very similar characteristic signals except
for the sugar moieties. The sugar moieties of 2 were characterized by analysis of
NMR data obtained from the combined use of 2D NMR spectra (HSQC, HSQC-
TOCSY, and HMBC). The data allowed identification of a b-D-xylopyranose unit
with anomeric proton at d 6.17 (d, J = 6.5 Hz). The remaining unit with the
anomeric proton at d 4.84 (d, J = 7.2 Hz), 6.05 (brd, J = 1.8 Hz), 5.83 (d,
J = 6.8 Hz) were characterized as b-D-glucuronopyranosyl, a-L-rhamnopyranosyl,
and b-D-glucopyranosyl units, respectively. The branched nature of the tetrasac-
charide moiety at the C-3 position of the oleanane moiety was established from the
HMBC correlations between C-3 (d 78.7) and GlcA H-1(d 4.84), between Rha H-1
(d 6.03) and GlcA C-4 (d 76.3), between Xyl H-1 (d 6.17) and GlcA C-2 (d 81.9),
and Glc H-1(d 5.83) and Xyl C-2 (d 79.5). Thus, the structure of 2 was deduced to
be 21,22-di-O-angeloyl-R1 -barrigenol-3-O-{b-D-glucopyranosyl-(1?2)-b-D-xy-
lopyranosyl-(1?2)-[a-L-rhamnopyranosyl-(1?4)]}-b-D-glucuronopyranoside
(Fig. 33.1(2)).
To the best of our knowledge [12], the oleanane-type triterpenoid saponin
bearing two angeloyls at C-21, C-22, and a branch of tetrasaccharide moiety (Rha,
Cal, Glc, GlcA, or Rha, Xyl, Glc, GlcA) at C-3 is rarely found in the nature.
Therefore, this is the first report on the presence of two triterpenoid saponins
above.
Acknowledgments The authors are very grateful to Dr. Min Xu of Kunming Institute of Botany,
Chinese Academy of Sciences, for her help in structure identification, Dr. Hongtao Zhu and Dr.
Dong Wang of Kunming Institute of Botany, for their help in HPLC facility. This project was
supported by National Natural Science Foundation of China (31060250) and the Natural Science
Foundation of Jiangxi Province (2009GXN0029).
922 G. Huo et al.
References
1. Zeng X, Ju J (2005) Molluscidal activity of the methanol extracts of 40 species of plants.

Plant Prot 31:31–34
2. Deng ZY, Deng YC, Liu YH (2007) Antifeedant activities of the extracts from Shima
superba against Plutella xylostella and Pieries rapae. Pesticide 46:854–856
3. Huo GH, Zhan WG, Chen MH (2008) Antifungal activities from Schima superba and
Camellia oleifera of Theaceae against Pyricular oryzae. Acta Agric Univ Jiangxiensis
30:48–52,72
4. Huo GH, Zhan WG, Fu RH et al (2010) In vitro antifungal activity of saponin extracts from
Schima superba in combination with Sapindus mukorossi against Piricularia oryzae. Nat
Prod Res Dev 22:755–760
5. Xu W, Zhou GX, Dai Y et al (2010) Chemical constituents in stems of Schima superba. Chin
Tradit Herbal Drugs 41(6):863–866
6. Xu W, Zhou GX, Yao XS (2010) Lignans from the stem of Schima superba. Nat Prod Res
Dev 22(6):945–948
7. Aurada E, Jurenitsch J, Kubelka W (1984) Structure of triterpene-sapogenins of Aesculus
glabra. Planta Med 50(5):391–394
8. Voutquenne L, Guinot P, Froissard C et al (2005) Haemolytic acylated triterpenoid saponins
from Harpullia austro-caledonica. Phytochemistry 66:825–835
9. Fu HZ, Li CJ (2011) Potential anti-inflammatory constituents of the stems of Gordonia
chrysandra. J Nat Prod 74(5):1066–1072
10. Chen CX, Ye HY, Shen YL et al (1997) The chemical constituents from Schima wallichii.
Acta Bot Yunnanica 79(2):201–206
11. Chen WX, Wu D (1977) Studies on sapogenins from Schima argentea. Acta Chim Sinica
3(36):229–232
12. Zhang ZZ, Li SY, Lian XY (2010) An overview of genus Aesculus: ethnobotany,
phytochemistry, and pharmacological activities. Pharm Crops 1:24–51
Chapter 99
Study on Extraction of Xylan
from Bamboo Shoot Shell
Nengfu Yu, Nengliang Wu, Yu Wang and Yegou Tu
Abstract Using bamboo shoot shell as raw material, the experiment utilized the
method of alkali extraction after bamboo shoot shell was pretreated. Effects of
alkali concentration,extraction temperature, ratio of solid to liquid, and extraction
time on yield of xylan were analyzed. The conditions of alkali extraction were:
alkali concentration 5 %, ratio of solid to liquid 1:10 (g:mL),extraction time 3 h,
extraction temperature 120 C. The yield of xylan from bamboo shoot shell
reached 24.77 %,which shows that:bamboo shoot shell is a good raw material with
the content of 35.08 % hemicellulose in it.
Keywords Bamboo shoot Xylan Bamboo shoot shell Xylo-oligosaccharide
99.1 Introduction
Bamboo shoot shell(Bambusa spp) is one of traditional green vegetables in China.

Since ancient times, it is regarded as ‘‘food treasures,’’ ‘‘delicacies in the dry
frozen ground,’’ and ‘‘the first vegetarian products’’ [1]. As the bamboo forest and
the high yield technology of bamboo forest improved, the fresh bamboo shoot
production increased year by year. In 2006, the output of bamboo shoot were more
than 5 million tons in China [2]. At present, the output of bamboo shoot in China
N. Yu (&) Y. Wang Y. Tu
Jiangxi Academy of Forestry, Jiangxi 330013 Nanchang, People’s Republic of China
e-mail: yunengfu@126.com
N. Wu
Agri-tech Service Station of Bajiang Township Yongfeng County Jiangxi Province, Ji’an
331500 Jiangxi, People’s Republic of China
924 N. Yu et al.
ranks first in the world. Because of short and focused shooting time, about 60 % of
the bamboo shoot was produced to bamboo shoots and dried bamboo shoot as raw
material. Bamboo shoot shell also known as bamboo sheath, is the bulk waste in
the processing of bamboo shoot. In recent years, because the processing of bamboo
shoot was weeping development, the bamboo shoot shell as waste piled up like a
mountain on annual shooting season. Due to the high moisture content and very
easy to decay, the fresh bamboo shoot shell becomes the main pollution source in
the processing of bamboo shoot. It may bring hidden trouble to the ecological
environment of the bamboo shoot producing area [3, 4]. In China, studying
bamboo shoot shell as food is rare. It is mainly used to shoes, caps, and packaging.
It is also made into bamboo shell silk, so it can be the raw materials of sofa and be
made into straw sandals [5–7]. It reported that bamboo shoot shell can be made to
feed [8]. But it did not form dimensions production. Or there were some problems
in technology, product quality, and environmental pollution. Besides the economic
benefits was indistinctive.
Xylan is a complex polysaccharide which is linked by b-1, 4 wood glycosidic
linkage. And its main chain is D-xylose residues. Its main chain is connected to a
variety of glucuronic acid, arabinose, acetyl, p-coumaric acid, ferulic acid, and
other side chain substituent groups [9, 10]. We can get xylo-oligosaccharides
(XOS) which is a kind of functional food through the degradation of xylan.
Due to its unique physicochemical properties and on bifidobacteria selective
proliferation XOS is much attention in numerous functional food. XOS can be
used as low-calorie food additives. It can also be used as humectant in food
applications. It was added to baked goods to preserve moisture and change the
rheological properties of dough. Another XOS can be widely used in medicine
because it has a surface active site which can adsorb the toxic substances and
pathogenic bacteria in human intestinal tract to increase body resistance to disease
and activate the immune system. Because of difficult digestion, XOS can prevent
and treat diarrhea and reduce the incidence of otitis media on early children.
In addition, it is a good effect of feed additives [11–14]. But the raw materials for
the preparation of XOS relatively lacked. It reported that corn cob, rice hulls,
peanut shells, and cotton seed shell were materials for the preparation of XOS
[15–18]. Bamboo shoot shell rich in hemicellulose whose main component is the
multipentose, can be used to produce XOS [3, 4, 16, 19, 20]. In this study, the
bamboo shoot shell is collected from Nanping City, Fujian Province. We got xylan
by preparation of holocellulose and the alkali extraction method. In this paper, we
analyzed different alkali concentration, temperature, solid–liquid ratio, and time on
the yield of hemicellulose pentosan. That laid the foundation for the preparation of
XOS, and provided the basic data support for the comprehensive utilization
of bamboo shoot shell.
99 Study on Extraction of Xylan from Bamboo Shoot Shell 925
99.2 Experimental Methods
99.2.1 Experimental Materials, Reagents, and Apparatus
Experimental materials: Bamboo shoot shell collected from Pucheng County

Nanping City, Fujian Province.
Reagents: sodium hydroxide, phenol, 3,5-dinitrosalicylic acid, anhydrous
sodium sulfite, sulfuric acid, hydrochloric acid (All of above reagents were ana-
lytical grade.), industrial alcohol;
Instruments: biofuge stratos (Beckman), centrifuge (Thermo), UV/ visible
spectrophotometer (Amersham Bioscience, Ultrospec 2100 pro).
99.2.2 The Extraction of Xylan
Xylan extraction range is roughly: alkali concentration is 1–10 %, temperature is

60–130 C, time is 1–12 h.
99.2.3 Determination of Total Sugar in Xylan
We determined the total sugar content in xylan by 3,5-dinitrosalicylic acid (DNS)

method.
99.2.3.1 Preparation of Standard Curve by DNS Method
Preparation of DNS reagent: 6.3 g DNS and 262 mL 2 mol/L sodium hydroxide
solution were added to 500 mL hot aqueous solution containing 185 g sodium
tartrate, then plused 5 g sodium sulfite and 5 g crystalline phenol. After cooling,
added 1000 mL distilled water .At last put them on a dark place to be saved for a
week [16]. Standard xylose solution whose concentration was 1 mg/mL was
compounded. The preparation of standard curve: Draw 0, 0.2, 0.4, 0.6, 0.8, 1.0,
1.2, 1.4, 1.6 mL 1 mg/mL standard xylose in 25 mL colorimetric tube which had
plug. And added water to 2 mL. Then added 3 mL DNS reagent. Next put the
colorimetric tubes in boiling water to heat for 5 min. Then rapid cool them with
water. Next added boiled water to make the volume to 25 mL. At last determined
their absorbance under the conditions of a wavelength of 480 nm by UV spec-
trophotometer. Drew standard curve according to the result. The regression
equation is following.
y ¼ 0:658x 0:0336; R2 ¼ 0:9975 ð34:1Þ

926 N. Yu et al.
99.2.3.2 Determination of Total Sugar in the Xylan
Added 8 % H2 SO4 solution whose volume is as much as xylan solution in a

certain volume of xylan solution, and remain constant temperature at 121 C for
1 h. And then it was neutralized by 20 % NaOH solution to pH about 7. Added
boiled water to make the sugar mass concentration in 0.2–2 g/L. Determined the
reducing sugar concentration C (g/L) in neutralization liquid by the DNS method.
Then the concentration of the total reducing sugar in the measured sample (CT) is
computed according to (34.2).
CT ¼ C diluted multiples 0:9 ð34:2Þ
99.2.4 Calculation of Xylan Yield
Xylan ratio ¼ total quality of reducing sugar = quality of dry raw materials
of xylan 100 %
ð34:3Þ
99.3.1 Different Extraction Conditions on the Yield of Xylan
Crushed bamboo shoot shell to powder whose size is 100 mesh. Took a certain
amount of bamboo shoot shell powder in a flask. Then added sodium hydroxide
solution whose solid–liquid ratio is 1:10 and the mass fraction is 5 % into the flask.
After that, made the flask remain constant temperature at 80 C for 3 h. Repeated
the experiment for 3 times. So we can get the average value. Changing the con-
ditions to investigate different factors on the yield of xylan.
99.3.1.1 The Effect of the Concentration of Alkali Solution
As you can see from Fig. 34.1 the yield of xylan increased with sodium hydroxide
concentration increasing. However, when the mass fraction of sodium hydroxide is
greater than 5 % the increase of xylan yield is not obvious. Considering getting rid
of the alkali commodiously and cost control, we selected the mass fraction of 5 %
of the alkali to extract xylan.
Fig. 34.1 Effect of alkali

solution concentration
99.3.1.2 The Effect of Temperature
As can be seen from Fig. 34.2, the yield of xylan swell during 80–120 C, peaking
at 120 C. As the temperature raised, the yield of xylan declined slightly before
80 C, but after 120 C it declined sharply. With the increase of temperature part
of xylan may degrade into xylose, leading to the decrease in xylan content .
99.3.1.3 The Ratio of Solid to Liquid on the Yield of Xylan
We can see from Fig. 34.3 that shows the yield of xylan increased remarkably
from 10.44 % at 1:5 to 19.96 % at 1:10. However the solid–liquid ratio increased
the yield of xylan declined slightly. Therefore, the solid–liquid ratio was selected
at 1:10.
99.3.1.4 The Impact of Soaking Time on the Yield of Xylan
It can be seen from Fig. 34.4 that the yield of xylan took place with an increasing
number during 1–3 h. But after 3 h the yield of xylan raised at a slower rate. In
order to save time and energy, we consider choosing the best time that is 3 h.
Fig. 34.2 The influence of

temperature on yield of xylan
928 N. Yu et al.
Fig. 34.3 The ratio of solid

to liquid on the yield of xylan
Fig. 34.4 The impact of

soaking time on the yield of
xylan
99.4 Conclusion
We select bamboo shoot shell as the raw material in this study, which shows that:
bamboo shoot shell is a good raw material with the content of 35.08 % hemi-
cellulose in it. The content of hemicellulose in the bamboo shoot shell is higher
than that in raw rice husk, peanut shell, and cotton seed shell which were the raw
material of current production of XOS. There was no difference between the
content of hemicellulose in the bamboo shoot shell and corn cob [21]. Producing
XOS by bamboo shoot shell has broad application prospect. The conditions of
alkali extraction were : alkali concentration 5 %, ratio of solid to liquid 1:10
(g:mL),extraction time 3 h, extraction temperature 120 C. The yield of xylan
from bamboo shoot shell reached 24.77 %.
Acknowledgments The authors thank Jiangxi Science and Technology Support Programme
(2011ZBBF6005) for funding.
References
1. Jianxian Z (1995) Functional food. China Light Industry Press, Beijing, pp 68–72
2. Weisu H, Boyi L (2008) Bamboo shoot deep processing technology status and trends. For Sci
44(8):118–123
3. Yanfang J, Weiyong S (2011) Chemical compositions and natural cellulose fiber

characteristics of several bamboo shoot shells. J Zhejiang Univ (Agric Life Sci)
37(3):338–342
4. Yanfang J, Weiyong S (2011) Effects of different additive treatments on fermentation quality
of bamboo shoot shell silage. J Zhejiang Agric Sci 2:341–343
5. Junyan Z (1991) Arts and crafts made of a bamboo shoot shell heap painting. China:
91106716.7
6. Songqiang Z (2003) Bamboo shell slippers. China: 02314598.6
7. Jiaqing H (2006) The production of bamboo shell insole. China: 200510006579.3
8. Xiaoqin W, Jianxin L (1999) Conservation and feeeding value of bamboo shoot shell
ensilaged with rice straw and wheat bran. Chin J Anim Nutr 11(1):53–55
9. Stephen AM (eds) (1985) The polysacharides (Aspinall, G. O. ed.), Academic Press, Orlando,
pp 98–193
10. Puls J and Poutanen K (eds) (1989) Enzyme systems for lignocellulose degradation
(Coughlan, M. P. ed.), Elsevier Applied Science, Barking, England, pp 151–166
11. Huiliang W (2004) Chemical products production technology. Jiangxi, China
12. Xin Y (2004) Functional oligosaccharides production and application. Beijing, China
13. Alejandra M, Raimundo G-A, Rafael R (2005) Molecular and microbiological analysis of
caecal microbiota in rats fed with diets supplemented either with prebiotics or probiotics. Int
J Food Microbio 98(3):281–289
14. Cherie JZ, Glenn R (1998) An overview of probiotics, prebiotics and synbiotics in the
functional food concept: perspectives and future strategies. Int Dairy J 8:473–479
15. Na S, Changhe D, Lite L (2007) Study on Production of xylooligosaccharides from corncob
with steaming and enzymatic hydrolysis. Food Ind 5:1–4
16. Baoliang L, Guizhen F (2005) Study on extraction of xylan from rice hull. Chem Ind For
Prod 25:121–124
17. Xiaoyan X, Fusheng C, Dongquan G, Chongbin J (2007) Enzymatic preparation of peanut
shells XOS. Food Ferment Ind 33:118–120
18. Xinwei Z, Zhusheng L (2007) Research of isolation and purification of xyloolgosaccharides
from cotton seed husk. Cereal and Oil Processing 9:89–91
19. Weimin W, Guanmu Z, Gensheng L, Bingqi L, Zude H (1992) Comprehensive development
and utilization of fresh bamboo shoot shell. Prod Dev Guide 1:12–13
20. Zhaoxiang Z, Jingxiang T, Chungen L et al (1991) Chemical compositions of bamboo shoot
shel. J Zhejiang For Univ 8(1):54–59
21. Ruijin Y, Ying X, Zhang W et al (2000) The functional properties of the enzymatic
production of XOS. Chin Food Addit 2:89–93
Chapter 100
Study on Preparation of Low Alcoholic
Wine from Tomato
Kai-ye Deng and Er-na Li
Abstract Tomato is the most popular fruit in the world and the largest tomato
growing field is in China. In the present study, tomato juice was used as raw
material, which is available in the region were selected for wine production. The
conditions for inoculums concentration, fermentation temperature, and initial
sugar degree were optimized. The results showed that the tomato juices were
similar to grape juice in terms of sugar and acidity. After fermentation, the ethanol
concentration was 6–7 % w/v. Enzymatic hydrolysis and fermentation conditions
were optimized for producing tomato low alcohol wine. The results demonstrated
that the pectase amount 2 %, temperature 50 C, and enzymolysis period 4 h,
initial sugar content 15 %, inoculums size of yeast 5 %, temperature 22 C, fer-
mentation period 7 days, and clarified agents amount 5 mL. The alcohol content of
tomato wine was 6-7 degrees with similar sugar content and acidity of the tomato
juice. The product was clear, no precipitation, and in good flavor.
Keywords Food sensory evaluation Optimization Tomato Wine production
100.1 Introduction
Grapes are the main raw materials that have been used for wine production for
many years. A lot of research groups have investigated the suitability of fruits
other than grapes like cajá [1], banana [2], pupunha [3], mango [4], acerola [5],
cocoa, [6] and apple [7–9] for the purpose of wine-making.
Tomato belongs to the nightshade family. The plants typically grow up to 1–3
meters in height and have a weak stem that often sprawls over the ground and
K. Deng (&) E. Li
College of Light Industry and Food, Zhongkai University of Agriculture and Engineering,
Guangzhou 510225, People’s Republic of China
e-mail: dengkaiye1968@126.com
932 K. Deng and E. Li
vines over other plants. The tomato fruit is consumed in various ways, including
raw, as an ingredient in considerable dishes and sauces, and in drinks. The fruit is
rich in lycopene, which may have beneficial health effects [10].
Tomato has high nutrition and miraculous efficacy. Tomatoes are now eaten
freely in the world, and their consumption is believed to benefit the heart, among
other organs. Tomato is rich in Vitamin (A, B1, B2, C, and P), mineral elements
(calcium, phosphor, iron, and zinc), amino acid, carotene, and lycopene, one of the
most powerful natural antioxidants. In some studies, lycopene, especially in
cooked tomatoes, has been found to help prevent prostate cancer and reduce the
harmful effect on the skin by radiation or ultraviolet rays [11–17].
With the global market saw a steady rise in the strength of the wine, the reaction
is proportional to the growth. Many consumers favor wines at 13 % or below and
technology appears to be accommodative of these desires. In view of this, it was
initiated to investigate the suitability of tomato fruit for low alcoholic wine pro-
duction. The tomato alcohol wine keeps the nutrition value of tomato and has
health function at the same time which tastes well and smells sweet. Therefore, it
can be accepted by customers especially by the females. It is worthwhile to study
the tomato low alcohol wine.
100.2.1 Materials
Fresh tomato and white sugar bought in the market; wine yeast zk-1 was screened
and stored in biology lab in Zhongkai University.
100.2.2 Processing
See Fig. 100.1.
Fig. 100.1 Technological

process of low wine from
tomato
100 Study on Preparation of Low Alcoholic Wine from Tomato 933
100.2.3 The Influence of Pectase on the Juice Yield
Powered composite complex pectase was used as main materials. Enzymolyzed

conditions were determined through the studies of amounts, temperature, and the
quantity of tomato juice [18–20].
100.2.4 Determination of Processing Conditions of Wine
100.2.4.1 Determination of Inoculums’ Concentration
Different inoculums’ concentrations, 2, 5, 10, and 15 %, were added in 100 mL

tomato juice with 13 % sugar degree, pH = 3.5, fermented at 25 C for 7 days,
deployed and sensory evaluated, inoculums’ concentration was determined.
100.2.4.2 Determination of Fermentation Temperature
Different temperatures, 20, 25, 30, 35 C, were adopted to fermentation for 7 days
with 13 % sugar degree, pH = 3.5, deployed and sensory evaluated, fermentation
temperature was determined.
100.2.4.3 Determination of Initial Sugar Degree
Different initial sugar degrees, 5, 10, 15, 20 %, were adjusted in tomato juice,
fermented at 25 C for 7 days, deployed and sensory evaluated, initial sugar
degree was determined.
100.2.4.4 Optimization of Fermentation Conditions
According to the above results, orthogonal experiment method was adopted

to optimize the producing conditions. The best fermentation conditions can be
determined.
100.2.5 Determination of the Dosage of Clarified Agent
Select gelatin as clarified agent. Gelatin was placed into cold water first, then
heated in bath until the gelatin clarified, swelled, and then washed in cold water.
When 50 ml wine was mixed with 2–10 ml gelatin liquor in a graduated cylinder
clarified gelatin was observed and the bulk of deposit measured to determine the
dosage of the gelatin [21–23].
100.2.6 Quality Evaluation
100.2.6.1 Sensory Evaluation
Seven people were chosen to evaluate the quality of tomato low alcohol wine
according to the standards in Table 100.1.
100.2.6.2 Examination of Physicochemical Characteristics

and Microorganisms
Sugar degree, total acid, pH value, alcohol content, and the rate of juice yield were
examined. Total number of bacteria, number of Escherichia coli and Lactobacillus
were examined.
Table 100.1 Standards of sensory evaluation of tomato low-alcohol wine

Opinion
Color With light yellow or yellow, limpid and clarify and bright, the score is 10
(10 %) With limpid and clarify, the brightness is slightly worse, the score is 8–9
Slightly limpid and clarify, the brightness is worse, the score is 4–7
Turbidity, without brightness, the score is 0–3
Smell With a full bodied faint scent, mellow and fragrant smell, the score is 25
(25 %) With faint scent, mellow and fragrant smell, the score is 22–24
With faint scent, slight mellow, the score is 19–21
With smelly, the score is 0–5
Flavor With sour and sweet taste, mellow and a soft aftertaste, the score is 50
(50 %) With faint scent, strange mellow and slightly freeze, the score is 44–45
With slightly faint and bitter alcohol and maturity, the score is 35–44
With faint, bitter and strange sour alcohol, the score is 25–34
Wine Gentle and fleshly wine, which has the special style of tomato alcohol that the
(15 %) score is 15
Dissonancy wine, which have tomato alcohol style that the score is 12–14
Slightly dissonancy wine, which sweet and soul out of place that the score is 5–11
With strange sour, the score is 0–4
100.3.1 The Effect of Pectase on the Juice Yield
100.3.1.1 Determination of the Addition of Pectase
The addition of pectase was determined through the rate of juice yield. The effects
of addition of the pectase and tomato juice yield (%) are shown in Fig. 100.2.
With the increase in addition of pectase, tomato juice yield also increased. Juice
yield was 75.5 and 75.7 % when addition of pectase was 2 and 3 %, respectively.
Considering the producing cost, 2 % addition of pectase was determined.
100.3.1.2 Determination of the Enzymolyzed Temperature
Temperatures of 40, 45, 50, and 55 C were chosen to ferment tomato juice for 3 h
with the addition of pectase 2 %. The effects of the enzymolyzed temperature and
tomato juice yield (%) are shown in Fig. 100.3.
With the increase in fermentation temperature, tomato juice yield increased.
Juice yield reached the peak when temperature was 50 C, and then declined. So
50 C was determined as fermentation temperature.
Tomato juice yield(%)
Fig. 100.2 The effect of the 78

addition of the pectase on the 76 75.7
rate of tomato juice yield 74 75.5
72
70 71
68
66
65
64
0 1 2 3 4
The addition of pectase(‰)

enzymolyzed temperature on 77.8 77.6

77.5
the rate of tomato juice yield
77
76.5 76.6
76
75.5
75.2
75
35 40 45 50 55 60
The enzymolyzed temperature(°C)

enzymolyzed time on the rate 80
of tomato juice yield 79.8 79.6
79
78
77.7
77
76
75.4
75
0 1 2 3 4 5 6
The enzymolyzed time
100.3.1.3 Determination of the Enzymolyzed Time
Enzymolyzed times of 2, 3, 4, and 5 h were chosen to ferment tomato juice at

50 C with the addition of pectase 2 %. The effects of the enzymolyzed time and
the tomato juice yield (%) are shown in Fig. 100.4.
With the extended enzymolyzed time, tomato juice yield increased. Juice yield
reached the peak when time was 4 h, and then declined. Therefore, 4 h was
determined as fermentation period.
100.3.2 Optimization of Processing Conditions of Wine
100.3.2.1 Determination of Inoculums’ Volume
Inoculums’ volume has a significant impact on fermentation period and flavor of

wine. Less inoculums’ volume will lead to prolong fermentation period, however,
more inoculums’ volume make fermentation rate excessive against flavor
formation.
The results in Table 100.2 showed that fermentation period and flavor of wine
was better than the others when inoculums’ volume was 5 %.
Table 100.2 Sensory evaluation of tomato low alcohol wine for inoculums’ volume
Inoculum volume Flavor Mouthfeel
(%)
2% With fruit flavor, not enough Less sour, a bit acerbity
mellow
5% With fruit flavor, have mellowed. With sour and strong alcohol flavor
10 % With fruit flavor, rather mellowed A little sour and strong alcohol
flavor
15 % Not enough fruit flavor Too sour
Table 100.3 Sensory evaluation of tomato low alcohol wine for temperature
Temperature Flavor Mouthfeel
(C)
20 With fruit flavor, not enough Weak taste and less sour
mellow
25 With fruit flavor and mellow Sweet and sour moderate
30 With fruit flavor, too much Sweet and sour moderate, strong alcohol
mellow flavor
35 Not enough fruit flavor Too sour
100.3.2.2 Determination of Fermentation Temperature
Temperature changes have profound effects upon tomato wine. Chemical reactions
within yeast are facilitated by enzymes, which are large organic catalysts. Each
enzyme has an ‘‘optimal temperature range’’, a temperature range at which it
performs best. For many enzymes, the optimal temperature range is to make the
best wine.
The results in Table 100.3 showed that fermentation temperature at 20 C with
less flavor production and alcohol. It was at 35 C fermentation rate was too quick,
with sour in alcohol. So 25 C was chosen as proper fermentation temperature.
100.3.2.3 Determination of Initial Sugar Degree
Most fruits contain sugars that will be fermented when combined with yeasts;
sugars are the most common substrate of fermentation. Less sugar may make wine
taste not so good, mouthfeel would be light. But too much sugar to make wine was
so sweet. The optimal initial sugar degree is the most important factor to make a
wine with good flavor.
The results in Table 100.4 showed that initial sugar degree at 10–15 % was
better. Less or more initial sugar degree makes mouthfeel too light or too sweet.
100.3.2.4 Optimization of Fermentation Conditions of Low Alcoholic

Wine
According to the initiative fermentation experiments, the different inoculums’

volume, fermentation temperature and the initial sugar degree of liquor have the
most effective taste on the flavor of wine, so the orthogonal test could be used to
Table 100.4 Sensory evaluation of tomato low alcohol wine for initial sugar degree
Initial sugar degree (%) 5 10 15 20
Mouthfeel Too light Just enough Just enough Too sweet
Table 100.5 Factor and level table of orthogonal test

Level factor
A Inoculums’ volume (%) B Fermentation temperature (C) C Initial sugar degree (%)
1 3 22 11
2 5 25 13
3 8 28 15
Table 100.6 Design and analysis of orthogonal test of fermentation conditions

No. A Inoculums’ B Fermentation C Initial sugar Opinion Wine
volume (%) temperature (C) degree (%) degree
1 1 1 1 83.00 5.0
2 1 2 2 82.75 7.3
3 1 3 3 83.00 5.5
4 2 1 2 83.75 6.5
5 2 2 3 83.25 7.5
6 2 3 1 84.00 4.5
7 3 1 3 85.25 6.5
8 3 2 1 81.25 4.6
9 3 3 2 81.38 6.5
K1 248.75 252.00 248.25
K2 251.00 247.25 247.88
K3 247.88 248.38 251.25
K1 82.91 84.00 82.75
K2 83.67 82.42 82.63
K3 82.63 82.80 83.75
R 1.04 1.58 1.21
Factors B[A[C
lever
The better A2 B1 C3
lever
optimize the fermentation conditions according to the color, smell, flavor, and
wine (Table 100.5).
Optimum conditions were optimized through orthogonal test, the sensory
evaluation was as target, and the results were shown in Tables 100.6 and 100.7.
The results showed that the fermentation temperature could affect the quality of
wine most. The initial sugar degree affected lightly. Optimum fermentation con-
ditions were as follows: inoculums’ volume 5 %; fermentation temperature 22 C,
and initial sugar degree 15 %. The conditions from the evaluations were inocu-
lums’ concentration 8 %, fermentation temperature 22 C, and initial sugar degree
15 %. However, the two kinds of conditions were inconsistent, the results from
optimized tests should be verified.
Table 100.7 Variance analysis for the experimental results of orthogonal array design
Variance Sum of Degree of Estimator of F Value Significance
source square freedom variance
A 1.728 2 0.864 6.14054* F0.05(2, 8)
= 5.14
B 4.105 2 2.053 7.46842* F0.01(2, 8)
= 10.92
C 2.645 2 1.322 8.81104*
Total 8.48 6
100.3.3 The Validation Experiment of the Orthogonal Test
Preparation of low alcoholic wine was fermented under the conditions as fer-
mentation period 7 days, fermentation temperature 22 C, pH 4.0, and initial sugar
degree 15 %. The inoculums’ volume was 5 and 8 %.
From Table 100.8, the low alcoholic wine had the best color, taste when fer-
mentation conditions were used as inoculums’ volume 5 %, fermentation tem-
perature 22 C, and initial sugar degree 15 %.
100.3.4 Clarification of Low Alcoholic Wine from Tomato
Gelatin was placed into cold water before using it. At this step, the impurity of
gelatin would be removed when it sops up and swells.
Heat gelatin in water bath until it began to turn into a clear solution. The dosage
of gelatin was determined by the kind of alcohol and gelatin.
Table 100.8 Analysis of proof test results

No. Inoculums’ concentration Temperature Initial sugar degree Wine degree Score
(%) (C) (%) (%)
1 8 22 15 6.5 84.55
2 5 22 15 6.5 86.23
Table 100.9 The effect of dosage of gelatin low alcoholic wine

Gelatin (mL) in 50 mL Clarify impaction
wine
3 Wine admixture and the bulk with 8.5 mL deposit
4 Wine admixture white granular and the bulk with 8.5 mL deposit.
5 Wine is limpid and clarifies; the bulk of deposit was 17 mL deposit.
6 Wine admixture white granular with 5 mL deposit.
7 Wine is limpid and clarifies with 11 mL deposit.
When 50 mL wine was mixed with 3–7 mL gelatin liquor in a graduated

cylinder, the degree of clarification was observed.
From Table 100.9, the gelatins’ volume was 5 mL to clarify tomato wine
because wine was clear and the volume of deposit was the largest.
100.3.5 The Qualitative Index of the Produce
Tomato alcohol wine was light yellow, clear, and with no deposition. Its flavor was
full of tomato’s special flavor and tastes well; meanwhile. The low alcoholic
tomato wine with total acidity 7.0 g/L, alcohol degree 7 V %, number of colony
89/mL, E. Coli and pathogenic bacteria were not detected.
100.4 Conclusion
The rate of tomato juice yield could reach 80 % under the optimum conditions.
The optimum enzymolysis conditions of low alcoholic tomato wine were amount
of pectase 2 %, pH 4.0, and the enzymolyzed time was 4 h. The optimum fer-
mentation conditions were fermentation time 7 days, temperature 22 C, pH 4.0,
initial sugar degree 15 %, amount of inoculums’ volume 5 %, and volume of
gelatin 5 mL. The sensory evaluation showed that tomato wine has new charac-
teristics in smell and taste. Tomatoes are grown very widely as choicest fruits, but
used in the preparation of wine still goes a long way. Once the production of
tomato wine is successful for commercial use, it will be beneficial for tomato
production all around the world.
References
1. Dias DR, Schwan RF, Lima LCO (2003) Metodologia para elaboração de fermentado de cajá
(Spondias mombin L.). Cienc Tecnol Alimentos 23:342–350
2. Akubor PI, Obio SO, Nwadomere KA et al (2003) Production and quality evaluation of
banana wine. Plant Foods Hum Nutr 58:1–6
3. Andrade JS, Pantoja L, Maeda RN (2003) Melhoria do rendimentoe do processo de obtenção
da bebida alcoólica de pupunha (Bactrisgasipaes Kunth). Cienc Tecnol Alimentos 23:34–38
4. Reddy LVA, Reddy OVS (2005) Production and characterization of wine from mango fruit
(Mangifera indica L.). World J Microbiol Biotechnol 21:1345–1350. doi:10.1007/s11274-
005-4416-9
5. Santos CS, Almeida SS, Toledo AL et al (2005) Elaboração e análise sensorial do fermentado
de acerola (Malpighia punicifolia L.). Braz J Food Technol 10:47–50
6. Dias DR, Schwan RF, Freire ES Serôdia RS (2007) Elaboration of a fruit wine from cocoa
(Theobroma cacao L.). Int J Food Sci Technol 42:319–329. doi:10.1111/j.1365-
2621.2006.01226.x
7. Joshi VK, Bhutani VP (1991a) The influence of enzymatic clarification in fermentation

behavior and qualities of apple wine. Science des Aliments 11:491–498
8. Joshi VK, Bhutani VP, Sharma RC (1990) Effect of dilution and addition of nitrogen source
in chemical, mineral and sensory qualities of wild apricot wine. Am J Enol Vitic 41:229–231
9. Joshi VK, Sandhu DK, Attri et al (1991) Cider preparation from apple juice concentrate and
its consumer acceptability. Indian J Hort 48:321
10. Liu Z, Meng L, Jiang H (2005) Study on quality improvement of tomato juice beverage. Food
Sci 07:149–151
11. Rao AV, Agarwal S (1998) Bioavailability and antioxidant properties of lycopene from
tomato products. Nutr Cancer 31:199–203
12. Minhthy L Nguyen, Schwartz Steven J (1999) Lycopene: chemical and biological properties.
Food Technol 02:38–43
13. Li Zhang, Zheng-jun Wang (2009) Lycopene health function review. Chin Condiment
09:98–100
14. Stahlw Siesh (1995) Vitamins E and C, b2 carotene and other carotenoids as antioxidants. Am
J Clin Nutr 62(6):1315–1321
15. Sharma SK, Mangeur ML (1996) Kinetics of lycopene degradation in tomato pulp solids
under different processing and storage condition. Food Res Int 29:309–3151
16. Johnn Andrews (2006) Risk assessment for the carotenoids lutein and lycopene. Regul
Toxicol Pharm 45(5):289–298
17. Nguyen ML, Schwartz SJ (1999) Lycopene: chemical and biological properties. Food
Technol 2:38–43
18. Chen J, Kan J, Du M et al (2006) Pectinase preparation and its application in pulp’s
producing-juice and juice clarifying. Chin Food Addit 3:119–124
19. Wang W, Sun Y (2006) Pectinase and its application in fruit and vegetable juice processing.
Food Res Dev 11:222–226
20. Joshi VK, Chauhan SK, Lal BB (1991) Extraction of juices from peaches, plums and apricots
by pectinolytic treatment. J Food Sci Technol 28(1):64–65
21. Lin J, Wan Z, Guo Z et al (2012) Effects of multiple clarifiers on flavor of Shatangju wine.
Food Res Dev 02:51–54
22. Wang Y, Zeng Q, Chen S et al (2009) Effects of different clarifiers on clarification of
mulberry fruit wine. J Storage Process 04:52–54
23. Ni Z, Xiao Z, Niu Y et al (2012) Effects of three common clarificants on clarification of
cherry wine. J Food Ind 01:25–28
Chapter 101
Effects of Glucose Assimilation on Lutein
and Chlorophyll Biosyntheses
in the Green Alga Chlorella pyrenoidosa
Tao Li, Yi-han Liu, Fu-ping Lu and Yue Jiang
Abstract Glucose assimilation caused a significant decrease of lutein and

chlorophyll accumulation in Chlorella pyrenoidosa cultivated in low nitrogen
medium, which are in line with the previously reported glucose-bleaching effect on
the green alga Chlorella protothecoides cultivated in nitrogen deficient medium.
Our study showed that an excessive lipid production induced by nitrogen deficiency
was expected to be responsible for the decrease of lutein and chlorophyll accumu-
lation in C. pyrenoidosa under heterotrophic conditions. When C. pyrenoidosa was
cultivated in high nitrogen medium, the lutein and chlorophyll biosyntheses acted
very differently: lutein content still decreased markedly whereas chlorophyll content
remained stable. In addition, when we inhibited chlorophyll biosynthesis with
levulinic acid, the chlorophyll a (chl a) and chlorophyll b (chl b) contents decreased
markedly, but the lutein biosynthesis was not influenced at all. It was concluded that
lutein and chlorophyll biosyntheses were possibly not coordinated in C. pyrenoidosa
under heterotrophic conditions.
Keywords Lutein Chlorophyll Chlorella pyrenoidosa Heterotrophic
T. Li
Basic Science Department, Tianjin Agricultural University, Tianjin 300384,
T. Li Y. Jiang (&)
Department of Biology and Kwong Living Trust Food Safety and Analysis Lab,
Hong Kong Baptist University, Kowloon Tong, Hong Kong,
e-mail: yjiang@hotmail.com.hk
Y. Liu F. Lu
The College of Biotechnology, Tianjin University of Science and Technology,
944 T. Li et al.
101.1 Introduction
Chlorella pyrenoidosa is a nonmotile, unicellular freshwater green alga [1]. It can

grow not only under photoautotrophic conditions but also in darkness by making use
of glucose as carbon and energy sources. Lutein, chlorophyll a (chl a), chlorophyll b
(chl b), and other photosynthetic pigments can also be produced by C. pyrenoidosa
under darkness [2–5].
In plant and green alga, lutein, and other carotenoids bind the light harvesting
complexes which are located in the thylakoids membrane of chloroplast. So the
biosynthesis of carotenoid must be coordinated with the formation of other
photosynthetic components [6]. Chlorophyll and lutein biosyntheses are coordi-
nated and regulated through the action of phytochrome and blue/UV receptors in
plant and green alga under photoautotrophic conditions [7]. Besides, the presence
of chlorophyll is prerequisite for the biosynthesis of carotenoid in the plastid of
Sinapis alba [8]. So it was reported that the accumulation of carotenoids was
inhibited when the chlorophyll biosynthesis was arrested in the green alga
Chlamydomonas [9]. Other researchers even indicated that carotenoid biosynthesis
was also under the control of factors which participated in the regulation of
chlorophyll biosynthesis in tomato seedlings [10].
Soluble sugars have been proven as a negative regulator in the photosynthesis
process [11]. So far plenty of studies focused on the repression of photosynthesis by
carbohydrate have been reported [11–15]. However, little work has been conducted to
study the effects of sugar assimilation on carotenoid biosynthesis in plant and green
alga. The chlorophyll content decreased significantly in Chlorella protothecoides
cultivated in low nitrogen medium under heterotrophic conditions [12]. This phe-
nomenon was called ‘‘glucose-bleaching’’. Moreover soluble carbohydrate was
reported to repress the expression of genes involved in carotenoid biosynthetic pathway
and limit the accumulation of carotenoid in tomato leaves [6]. But sucrose also showed
the effect in stimulating carotenoid accumulation in tomato fruit pericarp discs [16].
In this study we investigated the influence of glucose assimilation on lutein and
chlorophyll biosyntheses in C. pyrenoidosa under heterotrophic conditions. We
also studied the relationship between lutein and chlorophyll biosyntheses in
C. pyrenoidosa grown in the dark. Our study provided preliminary information for
understanding the biosynthesis of photosynthetic pigments in C. pyrenoidosa
101.2.1 Microalga and Culture Conditions
The algal strain C. pyrenoidosa was purchased from Carolina Biological Supply
Co., Burlington, USA. The basic medium was the same as that used in the previous
report and the potassium nitrate concentration is 1.25 g L-1 [3]. The heterotrophic
101 Effects of Glucose Assimilation on Lutein and Chlorophyll 945
cultivation was realized by culturing the algal cells in the basic medium
supplemented with 40 g L-1 glucose at 28 C with orbital shaking at 180 rpm
under darkness. For the cultivation of the algal cells in high nitrogen medium, the
concentration of potassium nitrate was 8.25 g L-1. The autotrophic cultivation
was performed by incubating the algal cells in the basic medium under a light
intensity of 100 lE m-2 s-1 produced by two fluorescent lamps with a 16:8 of
light to dark photoperiod. The mixotrophic mode was the same as the autotrophic
cultivation except for supplementing 40 g L-1 glucose in the medium. As to the
inhibition experiment, the inhibitors were added into the culture after 48 h
incubation. No inhibitor was added in the control.
101.2.2 Biomass and Pigments Analyses
For the biomass measurement, 5 mL culture was filtered through the pre-dried
filter paper (Walkman) and the cell pellets were rinsed twice with deionized water.
Then cell pellets were dried at 105 C to a constant weight.
For the measurement of lutein content, the lyophilized cells were ground after
freezing with liquid nitrogen. Extraction was carried out with acetone until the cell
debris became colorless. 20 lL of extract was separated on a Waters Spherisorb
5 lm ODS 4.6 9 250 mm analytical column (Waters, Milford, MA, USA) fol-
lowing the previous method [17]. Individual carotenoids were identified by
comparing their absorption spectra to those of standards (Sigma-Aldrich, USA).
The concentration of pigment was calculated with corresponding standard curve.
101.2.3 Glucose Concentration Measurement
The concentration of residual glucose in the culture was measured by 3,

5-dinitrosalicylic acid (DNS) method [18].
101.2.4 Cell Composition Analysis
The lyophilized algal powder was resuspended in 1 M NaOH and then boiled for
10 min. The total protein concentration in the supernatant obtained after centri-
fuging the mixture at 3000 g for 5 min was quantified using the DC protein assay
kit (Bio-Rad, USA) [19].
The cellular starch content was analyzed by following the method from other
researchers [20]. Briefly, the algal powder was resuspended in 100 % ethanol and
boiled for 30 min. Then the suspension was centrifuged at 3000 g for 5 min and
the debris was dried. Afterwards the starch was extracted by boiling the cell debris
946 T. Li et al.
in 0.2 M NaOH for 30 min and the mixture was neutralized with 1 M acetic acid.
Then the mixture was digested with amyloglucosidase at 37 C over night. The
starch level was calculated by measuring the glucose concentration in the super-
natant by DNS method after centrifuging the digested mixture at 3000 g for 5 min.
The total lipids were assayed by following the reported method [21]. Briefly the
lyophilized algal cells were resuspended in the extraction solution (chloroform:
methanol = 2:1, by vol.) and disrupted with a Ultra-Turrax T25 homogenizer
(IKA, Germany) at 20000 rpm. The extracted lipids dissolved in the chloroform
phase were dried in a rotary evaporator and then weighed.
101.2.5 Transmission Electronic Microscope (TEM)

Experiment
The ultrathin sections of algal cells were examined with a Philips EM 208S
transmission electron microscope at 80 kV. The section images were obtained by a
Gatan 794 Camera System (Gatan Inc., CA) [22].
The data are expressed as averages ± S.D. Statistical significance was evaluated
by independent paired two sample t-test (OriginPro 7.0) when comparing two
groups. p \ 0.01 was considered as significant.
101.3 Results
101.3.1 Time Course of Lutein and Chlorophyll

Accumulation in C. pyrenoidosa Cultivated in Low
Nitrogen Medium
After comparing the cell dry weight under three cultivation modes, we found that
glucose assimilation by C. pyrenoidosa was in favor of biomass production under
both mixotrophic and heterotrophic conditions (Table 101.1). The cell dry weight
achieved 16.2 g L-1 after 120 h cultivation under heterotrophic conditions, four
times as high as that obtained under autotrophic conditions. But light irradiation
was more favorable for the accumulation of lutein and chlorophyll. The pigment
contents in C. pyrenoidosa under autotrophic and mixotrophic conditions were
much higher than that under heterotrophic conditions (Table 101.1). In addition,
glucose assimilation by C. pyrenoidosa caused marked decrease of cellular lutein
Table 101.1 Cell growth and pigments content of C. pyrenoidosa under three cultivation modes
Mode Biomass (g L-1) Lutein (mg g-1) Chl a (mg g-1) Chl b (mg g-1)
Autotrophy 4.09 ± 0.07 13.9 ± 0.1 20.3 ± 0.07 14.49 ± 0.1
Mixotrophy 10.78 ± 0.11 5.16 ± 0.05 5.39 ± 0.22 3.87 ± 0.03
Heterotrophy 16.2 ± 0.05 1.47 ± 0.02 0.77 ± 0.02 1.07 ± 0.02
and chlorophyll contents (Figs. 101.1, 101.2). The cellular lutein content
decreased by 36.6 and 39.6 % respectively during the period in which the algal
cells assimilated glucose rapidly under heterotrophic and mixotrophic conditions.
The cellular chlorophyll content also decreased by 61.5 and 60.5 % respectively
under heterotrophic and mixotrophic conditions (Figs. 101.1, 101.2).
The transmission electronic microscope images show that the ultrastructure of
C. pyrenoidosa cultivated under mixotrophic and heterotrophic conditions are dif-
ferent from those cultured under autotrophic conditions (Fig. 101.3a, b, and c).
Compared with the autotrophic algal cell, the amount of C-shape chloroplast in the
mixotrophically and heterotrophically cultivated cells were almost negligible,
especially in the latter. Besides, large amounts of starch granules were present in the
mixotrophic and heterotrophic cells. The lipid content in the mixotrophic and het-
erotrophic cells also increased sharply, especially in the latter in which the total lipid
content reached as high as 43.7 % of cell dry weight (Table 101.2). Moreover, the
algal culture became etiolated during the period when the glucose was assimilated
rapidly by algal cells. This phenomenon called ‘‘glucose-bleaching’’ effect was also
observed in C. protothecoides cultivated in nitrogen deficient medium [12]. So we
investigated the influence of glucose assimilation on lutein and chlorophyll accu-
mulation in C. pyrenoidosa cultured in nitrogen-enriched medium further.
101.3.2 Time Course of Lutein and Chlorophyll

Accumulation in C. pyrenoidosa Cultivated in High
Nitrogen Medium
Lutein and chlorophyll biosyntheses acted very differently when C. pyrenoidosa

was cultured in high nitrogen medium under heterotrophic conditions (Fig. 101.4).
The chlorophyll content remained stable, the chlorophyll a and b content obtained
at 120 h decreased by 6.5 and 15.3 % compared with the value at 36 h (chl a,
p [ 0.01; chl b, p [ 0.01). However, lutein content decreased significantly, by
38.9 % (p \ 0.01).
As to the cell composition, the image of algal cell ultrastructure shows that
plenty of starch granules still occupy large inner space in C. pyreonoidosa culti-
vated in high nitrogen medium under heterotrophic conditions (Fig. 101.3d).
However the lipid production was greatly repressed, the lipid content decreased to
25.6 % of cell dry weight (Table 101.2).
948 T. Li et al.
Fig. 101.1 Glucose 16
Lutein, ch a and b (mg g-1)

consumption and the 40
14
Residual glucose (g L )
pigments accumulation in C.
-1
pyrenoidosa cultivated in low 12 36
nitrogen medium under
mixotrophic conditions. Data 10 32
points are expressed as
8
averages ±S.D. of triplicates 28
(filled square chl a; open 6
triangle chl b; open circle 24
lutein; filled triangle glucose) 4
2 20
0 20 40 60 80 100 120
Time (h)
Fig. 101.2 Glucose 3.0 44

Lutein, chl a and b (mg g-1 )
consumption and the 40
Residual glucose (g L )
-1
pigments accumulation in C. 2.5
36
pyrenoidosa cultivated in low 32
nitrogen medium under 2.0
28
heterotrophic conditions.
Data points are expressed as 1.5 24
1.0
(filled square chl a; open 16
triangle chl b; open circle 12
0.5
lutein; filled triangle glucose) 8
0.0 4
0 20 40 60 80 100 120
Time (h)
Based on the results shown in Fig. 101.4, we thought that the biosynthesis of
lutein and chlorophyll in C. pyrenoidosa under heterotrophic conditions were
expected to be non-coordinated. So we conducted another experiment to validate
the relationship between lutein and chlorophyll biosyntheses in C. pyrenoidosa
101.3.3 Relationship Between Lutein and Chlorophyll

Biosyntheses in C. pyrenoidosa Under Heterotrophic
Conditions
Levulinic acid and fluridone has been proven to be effective inhibitors for
chlorophyll and lutein biosynthesis respectively in green alga [25, 26]. In our work
we used these two chemicals to regulate chlorophyll and lutein biosyntheses in
C. pyrenoidosa.
Fig. 101.3 Ultrastructure of C. pyrenoidosa. Algal cells used in this experiment were cultivated
for 120 h. a Autotrophic cell cultivated in low nitrogen medium. b Mixotrophic cell cultivated in
low nitrogen medium. c Heterotrophic cell cultivated in low nitrogen medium. d Heterotrophic
cell cultivated in high nitrogen medium. e Heterotrophic cell treated with 40 mM levulinic acid.
f Heterotrophic cell treated with 20 lg mL-1 fluridone. Cellular components: C chloroplast;
L lipid body; S starch granule. The cellular components were identified according to the previous
reports [23, 24]
Although chl a and b contents decreased markedly after inhibiting chlorophyll

biosynthesis, especially for the treatment with high concentration of levulinic acid
(40 mM), but the lutein content did not change at all compared with the control
(Fig. 101.5), whereas, the inhibition of lutein biosynthesis also caused the decrease
950 T. Li et al.
Table 101.2 Cell composition of C. pyrenoidosa cultivated in high and low nitrogen medium
under heterotrophic conditions
Medium Lipid (%) Protein (%) Starch (%)
Low nitrogen 43.7 ± 0.7 6.5 ± 0.1 44.3 ± 0.5
High nitrogen 25.6 ± 2.4 15.9 ± 0.5 48.8 ± 1.6
Fig. 101.4 Glucose 50

5.5
consumption and the
Lutein, chl a and b (mg g )
Residual glucose (g L-1 )

-1
pigments accumulation in C. 5.0
40
pyrenoidosa cultivated in 4.5
high nitrogen medium under 4.0 30
heterotrophic conditions. 3.5
Data points are expressed as
3.0 20
averages ±S.D. of triplicates
(filled square chl a; open 2.5
10
triangle chl b; open circle 2.0
lutein; filled triangle glucose) 1.5
0
1.0
0 20 40 60 80 100 120 140 160
Time (h)
Fig. 101.5 Changes of lutein 100

and chlorophyll contents in C.
Pigment content (%)
pyrenoidosa under 80
heterotrophic conditions after
inhibiting chlorophyll 60
biosynthesis with levulinic
acid. Content (%) of lutein 40
and chlorophyll respect to the
control in which no levulinic 20
acid was added. Data are
expressed as averages ±S.D. 0
of triplicates 2 10 40
Levulinic acid (mM)
Lutein Chl a Chl b
of chlorophyll content. The contents of cellular lutein, chlorophyll a and b

decreased by 73.7, 79.8, and 48.6 %, respectively when treating C. pyrenoidosa
with 20 lg mL-1 of fluridone (Fig. 101.6). The decrease of cellular lutein and
chlorophyll contents after treatment with fluridone also caused the change of algal
cell ultrastructure (Fig. 101.3f). The amount of filamentous chloroplast in fluridone
treated algal cell decreased markedly compared with untreated C. pyrenoidosa
(Fig. 101.4d). But for levulinic acid treated algal cell, the ultrastructure did not
show big difference with that of untreated C. pyrenoidosa (Fig. 101.3d, e).
Fig. 101.6 Changes of lutein 100

Lutein
and chlorophyll contents in C. Chl a
Pigment content (%)

pyrenoidosa under 80 Chl b
heterotrophic conditions after
inhibiting lutein biosynthesis 60
with fluridone. Content (%)
of lutein and chlorophyll 40
respect to the control in
which no fluridone was 20
added. Data are expressed as
0.5 4 20
Fluridone (µg mL-1)
101.4 Discussion
101.4.1 Effects of Glucose Assimilation on Lutein

and Chlorophyll Accumulation in C. pyrenoidosa
Cultivated in Low Nitrogen Medium
Sugars have been reported to repress the biosynthesis of chlorophyll and photo-
synthesis efficiency, limit the development of photosynthesis apparatus [27]. In
this study, large amounts of C-shape chloroplast disappeared when C. pyrenoidosa
was cultivated in the medium containing glucose. Assimilation of glucose by
C. pyrenoidosa cultivated in low nitrogen medium accompanied with a profound
decrease of cellular lutein and chlorophyll contents under both heterotrophic and
mixotrophic conditions. Our results were consistent with the reported ‘‘glucose-
bleaching’’ phenomenon that was thought to be caused by the metabolites pro-
duced in the ‘‘glucose respiration’’ process [12].
In our study we found that the lipid content in C. pyrenoidosa cultivated in low
nitrogen medium was much higher than that cultured under high nitrogen condi-
tions, but the protein content was much lower. Besides, the images of the algal cell
ultrastructure show that small amounts of filamentous chloroplasts which can be
observed in C. pyrenoidosa cultivated in high nitrogen medium was almost neg-
ligible under low nitrogen conditions. But the starch content had no obvious
change. Other researchers have shown the evidence that sugars repressed the
expression of photosynthetic genes [11]. The content of D1 protein of PS II
reaction center decreased significantly when the leaf was incubated in the medium
supplied with glucose [15]. Moreover, the decrease of D1 protein caused break-
down of light harvesting complex II and decrease of chlorophyll content. In green
alga, the organic carbon source is mainly converted into proteins, lipid, and
carbohydrate [28]. Based on our experiment results and the previous reports we
proposed that more carbon flux channeled to lipid biosynthetic pathway when
C. pyrenoidosa was cultivated in low nitrogen medium compared with the normal
952 T. Li et al.
conditions (high nitrogen conditions). As a result, the protein production decreased

and accordingly an aggravated negative influence of glucose assimilation on the
chloroplast development took place. Because of this, the content of chlorophyll,
which is a required component of chloroplast protein complexes, decreased
markedly and the glucose bleaching occurred. So we think that an enhanced lipid
production induced by low nitrogen is expected to be responsible for the occur-
rence of ‘‘glucose-bleaching’’ in the green alga C. pyrenoidosa. In tomato leaves
the decrease of carotenoids caused by sugar accumulation was related to the
reduction of chlorophyll content [6]. In our study, we found that lutein and
chlorophyll biosyntheses were not coordinated in C. pyrenoidosa under
heterotrophic conditions. Lutein accumulation was not affected after inhibiting
chlorophyll biosynthesis. So the decrease of lutein accumulation is expected to be
nonrelated to the reduction of chlorophyll content in C. pyrenoidosa cultivated in
low nitrogen medium under heterotrophic conditions.
101.4.2 Effects of Glucose Assimilation on Lutein

and Chlorophyll Accumulation in C. pyrenoidosa
Cultivated in High Nitrogen Medium
The etiolated C. protothecoides cultured in low nitrogen medium turned green

after being transferred into the high nitrogen medium [29]. In our experiment,
marked decrease of chlorophyll content was also not observed any more when
C. pyrenoidosa was cultivated in high nitrogen medium. But lutein content still
decreased significantly during the period in which C. pyrenoidosa consumed
glucose rapidly.
In photoautotrophic plant cells, chlorophyll and lutein are required compo-
nents of light harvesting complexes of photosystems. So their biosyntheses are
coordinated and regulated by light through phytochrome receptors [7, 30]. Besides,
factors which participate in the regulation of chlorophyll biosynthesis are also
likely to control the accumulation of carotenoid [11]. The pool of free carotenoids
depended on the amounts of chlorophyll in S. alba [8]. The content of carotenoids
in tomato seedlings decreased after inhibiting chlorophyll biosynthesis with
gabaculine [10]. However, the chloroplast was not the energy supplier any more in
green alga grown in the dark and our results showed that lutein and chlorophyll
biosyntheses were not coordinated in C. pyrenoidosa under heterotrophic
conditions. When we inhibited chlorophyll biosynthesis, the lutein accumulation
was not influenced at all. However, when we blocked lutein biosynthesis with
fluridone, the chlorophyll content also decreased markedly. So it is expected that
the biosynthesis of chlorophyll is controlled by the accumulation of lutein which
drains the pool of chlorophyll by complex formation in C. pyrenoidosa under
heterotrophic conditions.
101.5 Conclusion
In conclusion, we demonstrate that an excessive lipid production is likely to be

responsible for the occurrence of glucose bleaching on C. pyrenoidosa cultivated
in low nitrogen medium under heterotrophic conditions. Glucose assimilation
leads to a significant decrease of lutein accumulation in C. pyrenoidosa. Lutein
and chlorophyll biosyntheses are expected not to be coordinated in C. pyrenoidosa
Acknowledgments The research was supported by Research Grant Council of Hong Kong SAR.
The TEM experiment was conducted in EM unit of the University of Hong Kong. We would like
to thank for their assistance.
References
1. Bold HC, Wynne MJ (1984) Introduction to the algae, 2nd edn. Prentice-Hall, New Jersey
2. Chen F (1996) High cell density culture of microalgae in heterotrophic growth. Trends
3. Shi XM, Chen F, Yuan JP, Chen H (1997) Heterotrophic production of lutein by selected
Chlorella strains. J Appl Phycol 9:445–450
4. Lee YK (2001) Microalgal mass culture systems and methods: their limitation and potential.
J Appl Phycol 13:307–315
5. Wu ZY, Shi XM (2006) Optimization for high-density cultivation of heterotrophic Chlorella
based on a hybrid neural network model. Lett Appl Microbiol 44:13–18
6. Mortain-Bertrand A, Stammitti L, Telef N et al (2008) Effects of exogenous glucose on
carotenoid accumulation in tomato leaves. Physiol Plant 134:246–256
7. Mohr H, Schopfer P (1995) Plant physiology. Springer, Berlin
8. Frosch S, Mohr H (1980) Analysis of light-controlled accumulation of carotenoids in mustard
(Sinapis alba L.) seedlings. Planta 148:279–286
9. Plumley FG, Schmidt GW (1995) Light-harvesting chlorophyll a/b complexes:
interdependent pigment synthesis and protein assembly. Plant Cell 7:689–704
10. Corona V, Aracri B, Kosturkova G et al (1996) Regulation of a carotenoid biosynthesis gene
promoter during plant development. Plant J 9:505–512
11. Gibson SI (2005) Control of plant development and gene expression by sugar signaling. Curr
Opin Plant Biol 8:93–102
12. Matsuka M, Hase E (1965) Metabolism of glucose in the process of ‘‘glucose-bleaching’’ of
Chlorella protothecoides. Plant Cell Physiol 6:721–741
13. Shäffer C, Simper H, Hofmann B (1992) Glucose feeding results in coordinated changes of
chlorophyll content, ribulose-1,5-bisphosphate carboxylase-oxygenase activity and
photosynthetic potential in photoautrophic suspension cultured cells of Chenopodium
rubrum. Plant Cell Environ 15:343–350
14. Krapp A, Hofmann B, Shäfer C, Stitt M (1993) Regulation of the expression of rbcS and
other photosynthetic genes by carbohydrates: a mechanism for the ‘sink regulation’ of
photosynthesis. Plant J 3:817–828
15. Kilb B, Wietoska H, Godde D (1996) Changes in the expression of photosynthetic genes
precede loss of photosynthetic activities and chlorophyll when glucose is supplied to mature
spinach leaves. Plant S 115:225–235
954 T. Li et al.
16. Telef N, Stammitti-Bert L, Mortain-Bertrand A et al (2006) Sucrose deficiency delays

lycopene accumulation in tomato fruit pericarp discs. Plant Mol Biol 62:453–469
17. Baroli I, Do AD, Yamane T, Niyogi KK (2003) Zeaxanthin accumulation in the absence of a
functional xanthophyll cycle protects Chlamydomonas reinhardtii from photooxidative
stress. Plant Cell 15:992–1008
18. Miller GL (1959) Use of dinitrosalicylic acid reagent for determination of reducing sugar.
Anal Biochem 31:426–429
19. Illman AM, Scragg AH, Shales SW (2000) Increase in Chlorella strains calorific values when
grown in low nitrogen medium. Enzyme Microb Technol 27:631–635
20. Izumo A, Fujiwara S, Oyama Y et al (2007) Physicochemical properties of starch in
Chlorella change depending on the CO2 concentration during growth: comparison of
structure and properties of pyrenoid and stroma starch. Plant S 172:1138–1147
21. Christie WW (2003) Lipid analysis: isolation, separation, identification, and structural
analysis of lipids. Oily Press, Bridgwater
22. Yamada T, Sakaguchi K (1982) Electron microscopic studies of Chlorella ellipsoidea
protoplast formation. J Gen Appl Microbiol 128:1319–1327
23. Pino Plumed M, Villarejo A, Róos A et al (1996) The CO2-concentrating mechanism in a
starchless mutant of the green unicellular alga Chlorella pyrenoidosa. Planta 200:28–31
24. Libessart N, Maddelein ML, Koornhuyse N et al (1995) Storage, photosynthesis, and growth:
the conditional nature of mutations affecting starch synthesis and structure in
Chlamydomonas. Plant Cell 7:1117–1127
25. Samuel IB (1971) Studies on the biosynthesis and metabolism of d-Aminolevulinic acid in
Chlorella. Plant Physiol 48:316–319
26. Patricia EG, John EM (1986) Inhibition of carotenoid accumulation and abscisic acid
biosynthesis in fluridone-treated dark-grown barley. Eur J Biochem 160:117–121
27. Pego JV, Kortstee AJ, Huijser C, Smeekens SCM (2000) Photosynthesis, sugars and the
regulation of gene expression. J Exp Bot 51:407–416
28. Li YT, Han DX, Hu GR, Sommerfeld M, Hu Q (2010) Inhibition of starch synthesis results in
overproduction of lipids in Chlamydomonas reinhardtii. Biotechnol Bioeng 107:258–268
29. Aoki S, Hase E (1964) De- and re-generation of chloroplasts in the cells of Chlorella
protothecoides I. Synthesis of nucleic acids and protein in relation to the process of
regeneration of chloroplast. Plant Cell Physiol 5:473–484
30. Von Lintig J, Welsch R, Bonk M et al (1997) Light-dependent regulation of carotenoid
biosynthesis occurs at the level of phytoene synthase expression and is mediated by
phtochrome in Sinapis alba and Arabidopsis thaliana seedlings. Plant J 12:625–634
Chapter 102
RNA Interference and Applications
in Plants
Yunrong An, Zhongyou Pei, Nan Xin and Haifeng Wang
Abstract RNA interference (RNAi) inhibits gene expression in a very specific

way. It has a vital significance in the regulation of gene expression, the defense of
viral infection, the controlling of jumping genes. In recent years, RNAi has
become an important method of studying gene function with its high specificity,
efficiency, hereditability and other significant advantages and has been used in the
study of functional genomics and traits improvement. This paper simply introduces
the RNAi mechanism and discusses the applications of RNAi in plant functional
genomics, crop quality improvement, and resistance of disease and insect.

Keywords Crop quality improvement Disease and insect resistance Functional

genomics RNA interference
102.1 Introduction
RNA interference (RNAi) is a new technology of studying genetic function. It has

gradually become one of the useful tools in studying molecular biology and cell
biology since 1990s. Now, RNAi has been widely used in the research of plant
functional genomics and plants traits improvement. RNA is the sequence-specific
gene silencing induced by double-stranded RNA, which means that RNAi provides
Fund project: project supporting by science and technology in Tianjin, sweet sorghum polymer
molecular breeding (10ZCKFNC00100).
Y. An Z. Pei (&) N. Xin H. Wang

Department of Agronomy, Tianjin Agricultural University, Tianjin 300384, People’s
Republic of China
e-mail: peizhy@126.com
956 Y. An et al.
a rapid mean of depleting mRNAs by introducing double-stranded RNA. The

double-stranded RNA could degrades its homologous mRNA in intracellular, thus
inhibit the expression of corresponding gene specifically and efficiently to get the
effect ‘‘gene knockout.’’ RNAi is a common phenomenon in organisms, initially
found in some plants, and then in nematodes, flies, zebrafish, and mammalian
cells. It has shown its great prospects in functional analysis of genes in animal and
plant, crop quality improvement as a new gene blocking technology. It is an
important protection mechanism for organisms against external infection. There-
fore, RNAi was awarded as one of the important achievements in 2001 by Science,
and as one of the major scientific and technological achievements in 2002 by
Nature. This paper has reviewed the function mechanism of RNAi and its appli-
cation in plant.
102.2 Mechanism of RNAi
In 1995, Guo and Kemphues found that the introduction of sense or antisense RNA
to par-1 mRNA resulted in degradation of the par-1 message RNA in Caeno-
rhabditis elegans in the experiment [1], which challenged the traditional expla-
nation of antisense RNA, because antisense was one of the most attractive means
of eliminating gene expression at that time. In 1998, Fire and Xu found that
mRNA of target genes degrades when they introduce double-stranded RNA
(dsRNA) into cells [2], proving that highly purified dsRNA could effectively and
specifically block the corresponding gene expression, and at least two orders of
magnitude higher than single-strand RNA in efficiency. It reveals the phenomenon
Guo and Kemphues met for the first time, namely, RNAi. Hereto, as a regulation
mechanism of gene expression, it gradually revealed its mysterious veil, opened a
new field for life science research.
The mechanism of RNAi, as an important research method, has a rapid
development. At present, what has been widely recognized is that dsRNA will be
processed into the 21–23 nucleotide small interfering RNAs (siRNAs) by a par-
ticular enzyme called Dicer (Dicer enzyme belongs to RNase III family), and
could identify double-stranded RNA specifically, cut double-stranded RNA which
is exogenously imported, transgenic, or virus-infected. In 1999, Hamilton and
Baulcombe proved that siRNAs are the key mediators in RNAi [3]. In 2001,
Bernstein completed the cloning of Dicer—the RNase III-like enzyme [4]. These
siRNAs were incorporated into a nuclease complex labeled the RNA-induced
silencing complex (RISC). The activated RISC targets and cleaves mRNA which
is complementary to the siRNA, thus make the specific gene which corresponds to
the mRNA transcriptional silence [5]. From then on, RNAi mechanism research
gradually goes to mature.
102 RNA Interference and Applications in Plants 957
102.3 The Application of RNAi in Plant Research
102.3.1 The Application of RNAi in Plant Functional

Genomics Research
As the mechanism of RNAi gradually matures, RNAi has been widely used in the
plant functional genomics research. In the research, RNAi can be used as a
powerful tool because RNAi has a highly sequence specificity. It could make the
specific gene silence, and lose its function or reduce its expression in order to
validate its function. In 2000, in the flower development research, Chuang further
verified the function of known functional genes, including AG, CLV3, AP1, PAN
by RNAi [6], and pioneered in the application of RNAi in plant functional
genomics. In 2004, Padmanaban found two VHA-C genes by RNAi, which supply
V-ATPase to cell by active exocytosis, supporting the growth of amplified cells in
arabidopsis, It has showed that they are necessary to the growth of arabidopsis
cells [7]. In 2005, Moritoh silenced OsGEN-L gene by RNAi, leading to the
development of rice early microspore inhibited and pollen difficultly mature [8]. It
has showed that it has a close relationship between OsGEN-L gene and the for-
mation of rice pollen. In 2006, Travella successfully inhibited target gene in
constructing the transgenic crops of sextuploid wheat by PDS-RNAi and EIN1-
RNAi. He thought that RNAi was a good tool in the research of function lack
mutations of polyploid plants [9]. In 2009, Li amplified two gene fragments using
the CP gene of Y virus in potatoes as template, and then inserted plant expression
vector pROK II. Therefore, he established RNAi express carrier pROKY300 that
targeted the CP gene of PVY and then turned it into agro bacterium tumefactions
EHA105. The result showed that the instantaneous expression of hairpin RNA
interfered effectively the PVY infection [10]. In 2011, Zibu constructed the RNAi
expression carrier of starch branch enzyme gene sbe2b in grain endosperm and
turned it into tobacco to detect its influence to the amylose synthesis. The result
showed that the expression of sbe2b gene was lower than the control. The content
of chain starch changed significantly, and amylose content increased than the
control but no significant change [11].
102.3.2 The Applications of RNAi in Crop Quality

Improvement
Although production problem is the most important goal in traditional breeding,

people has given more and more attention on improving crop nutrition value.
RNAi not only shows its superiority on the expansion of scope in the operated
gene, but also on the controllability of the expression of target genes. Researchers
have improved plant phenotype and crop quality by using RNAi. It has been a
958 Y. An et al.
great success. In 2002, Liu increased the proportion of stearic acid and oleic acid
in the cottonseed oil by inhibiting the expression of two critical fatty acids
desaturase genes. He raised the stearic acid content from 2–3 to 40 % and the oleic
acid content from 15 to 77 % respectively. He got the plant which could raise
stearic acid and oleic acid content at the same time by hybridizing the offspring
[12]. In 2003, Ogita inhibited the expression of CaMXMT1 gene which could code
theobromine synthase in coffee plants. It has made theobromine content decreased
30–80 % and caffeine content decreased 50–70 %, which reduced the stimulation
caffeine to sensitive people [13]. In 2004, Tang knocked out 22 kDa maize storage
protein gene (a protein of low lysine content) by RNAi and got a mutation plant of
high lysine content [14]. In 2004, Fukusaki inhibited the expression of key
enzymes–—CHS gene, which is necessary to biosynthesis of flower pigments and
flavonoid. He successfully changed the original color, blue, to white and pink and
created new commodity flowers [15]. In 2007, Chen suppressed the expression of
endogenous ACO gene in tomato by RNAi and made the production of ethylene
reduced greatly. It has provided reference for extending the shelf life of fruits and
vegetables [16]. In 2007, Wan increased the content of lycopene greatly in
tomato’s fruit by RNAi, which provides references for improving the nutritional
value of tomato [17].
102.3.3 The Application of RNAi in Plant Diseases

and Insects Resistance
RNAi has been used widely in the study of plant diseases resistance. In 1984,
Lichtenstein silenced genes, iaam, ipt, in arabidopsis, and tomato by RNAi. These
two genes could cause many perennial fruits, nuts, and appreciation plants getting
root cancer. By doing this, these plants could successfully resist root cancer [18–
20]. In 1998, Waterhouse first reported the successful application of RNAi in
preventing and controlling of potato virus Y [21]. In 1999, Pinto induced gene
silence by introducing the enzyme which is needed for copying Rice yellow mottle
virus into rice. It has made the plants resisted RYMV [22]. In 2000, Wang suc-
cessfully got the plant that could resist Barley yell dwarf virus (BYDV) by RNAi
[23]. In 2002, Kalantidis successfully got the plant that could resist Cucumber
mosaic virus (CMV) by RNAi [24]. In addition, in 2005, Ida proved that RNAi-
induced resistance of Beet necrotic yellow vein virus (BNYVV) was more
effective in the leaves than in the root [25, 26].
RNAi has also successfully used in agricultural insect control. Researchers used
transgenic plants, engineering bacterium, and direct feeding to make insect intake
dsRNA to suppress the growth. In 2007, Mao successfully reduced mRNA level of
the body cytochrome P450 in tobacco and arabidopsis by RNAi [27]. The growth
of larvae has been inhibited after being fed two transgenic plants. In 2009, Bautista
inhibited the expression of the pigment p450 gene, CYP6BG1, which is highly
expressed in the body of diamondback moth [28]. When diamondback moth that
resisted to the synthesis of pyrethrum ester is fed dsRNA solution which made it
very sensitive to pyrethroid pesticides.
102.3.4 The Application of RNAi in Plant Male Sterility
Male sterility is a common phenomenon in life activity of higher plants, and has a
great application value in agriculture. Many researchers controlled gene expres-
sion of plant flowering, studied plant male sterility, and fertility restoration by
RNAi. In 2000, Chuang proved genes about flowering development in Arabidopsis
by RNAi and got the male sterility mutations of stable heredity [6]. In 2005, Cigan
directly silenced the promoter MS45 of maize pollen sac gene, inhibiting the
formation of pollen sac and forming the male sterility plant. The maize could
restore fertility by using different promoter to make the promoter MS45 expressed
again [29]. In the same year, Moritoh observed rice plants of OSGEN-L-RNA and
found that part of it have a very low sterility and part of it are male sterility, so
found the rice male sterility materials [8].
102.4 Prospects
RNAi, as a convenient and practical genome research method, has been widely
used in all areas of biological research and made many important achievements.
Using RNAi to reveal the inherent law and molecular basis of plant development
or make the harmful genes silenced, it has important significance for speeding up
the application of molecular breeding technology in crop breeding, selecting dif-
ferent varieties of breeding materials. However, RNAi also has its deficiencies.
First of all, they will be interfered by RNAi at the same time if several genes have
the same or similar sequence. Therefore, which genes could be interfered cannot
be determined. Scientists have not made breakthrough although they have done a
lot of work in this respect. Second, the application of RNAi in the study of
improving quantitative traits controlled by micro effect gene was little. Even if the
function gene is knocked out, the effect is too little . It is hard to find phenotype
change because its genetic effects are weak. Finally, since the same or similar
genetic background of the polyploid species between different chromosome set,
there are also certain difficulties in studying and applying polyploid function
genome by RNAi. With the continuous development of technology and method, it
will play a significant role on gene function, plant development, traits improve-
ment, and other fields. People will break new ground in the biology research and
application and bring greater social value.
960 Y. An et al.
References
1. Guo S, Kemphues KJ (1995) Par-1, a gene required for establishing polarity in C. elegans
embryos, encodes a putative Ser/Thr kinase that is asymmetrically distributed. Cell
81(4):611–620
2. Fire A, Xu S, Montgomery MK (1998) Potent and specific genetic interference by double
stranded RNA in Caenorhabditis elegans. Nature 391:806–811
3. Hamilton AJ, Baulcombe DC (1999) A species of small antisense RNA in post-
transcriptional gene silencing in plants. Science 286:950–952
4. Bernstein E, Caudy A, Hammond SM, Hannon GJ (2001) Role for a bidentate ribonuclease in
the initiation step of RNA interference. Nature 409:363–366
5. Kim VN (2003) RNA interference in functional genomics and medicine. Korean Med. Sci.
18:309–318
6. Chuang C, Meyerowitz EM (2000) Specific and heritable genetic interference by double
stranded RNA in Arabidopsis thaliana. Proc Natl Acad Sci USA 97(9):4985–4990
7. Padmanaban S, Lin XY, Perera I (2004) Differential expression of vacuolar H+ 2ATPase
subunit c genes in tissues active in membrane trafficking and their roles in plant growth as
revealed by RNAi. Plant Physiol 134:113
8. Moritoh S, Miki D, Akiyama M (2005) RNAi mediated silencing of OsGEN-L (OsGEN-
like), a new member of the RAD-XPG nuclease family, causes male sterility by defect of
microspore development in rice. Plant Cell Physiol 46:699–715
9. Travella S, Klimm TE, Keller B (2006) RNA interference-based gene silencing as an efficient
tool for functional genomics in hexaploid bread wheat. Plant Physiol 142:6–20
10. Li Q, Tao G, Qiu Y (2009) RNAi vector construction of potato Y virus gene CP and
determination of interference effect. Genom Appl Biol 28(3):460–464
11. Zibu W, Qi J (2011) Construction of the RNAi vector and expression of starch branch
enzyme gene in wheat grain endosperm, mol. Plant Breed 9(4):438–442
12. Liu Q, Singh SP, Green AG (2002) High-stearic and high-oleic Cotton seed oils produced by
hairpin RNA-mediated post-transcriptional gene silencing. Plant Physiol 129(4):1732–1743
13. Ogita S, Uefuji H, Yube Y (2003) Producing decaffeinated coffee plants. Nature 423(19):823
14. Tang G, Galili G (2004) Using RNAi to improve plant nutritional value: from mechanism to
application. Trends Biotechnol 22(9):463–469
15. Fukusaki E, Kawasaki K, Kajiyama S et al (2004) Flower color modulations of Torenia
hybrida by down regulation of chalcone sythase genes with RNA interference. J Biotechnol
111(3):229–240
16. Chen Y, Li H (2007) The cloning of tomatos ACO gene and inhibition of its RNAi to release
ethylene. J Agri Biotechnol 15(3):464–468
17. Wan Q, Zhang X, Song M (2007) RNAi specific mediated gene Lcy silenced to increase the
content of lycopenein tomatoes. J Biol Eng 23(3):429–433
18. Lichtenstein C, Klee H, Montoya A (1984) Nucleotide sequence and transcript mapping of
the gene of the pTiANC octopine Ti-plasmid: a bacterial gene involved in plant tumori
genesis. J Mol Appl Genet 2:354–362
19. Ooms G, Hooykaas PJ, Moolenaar G (1981) Crown gall plant tumors of abnormal
morphology, induced by Agro bacterium tumefaciens carrying mutated octopine Ti plasmids;
analysis of T2 DNA functions. Gene 14:33–50
20. Depicker A, van Montagu M, Schell J (1978) Homologous DNA sequences in different Tip
lasmids are essential for oncogenicity. Nature 275:150–153
21. Waterhouse PM, Graham MW, Wang MB (1998) Virus resistance and gene silencing in
plants can be induced by simultaneous expression of sense and antisense RNA. Proc Natl
Acad Sci USA 95(23):13959–13964
22. Pinto YM, Kok RA, Baulcombe DC (1999) Resistance to rice yellow mottle virus (RYMV)
in cultivated African rice varieties containing RYMV transgenes. Nat Biotechnol 17:702–707
23. Wang MB, Abbott DC, Waterhouse PM (2000) A single copy of a virus-derived transgene
encoding hairpin RNA gives immunity to barley yellow dwarf virus. Mol Plant Pathol
1(6):3472356
24. Kalantidis K, Psaradakis S, Tabler M (2002) The occurrence of CMV2 specific short RNAs
in transgenic tobacco expressing virus derived double-stranded RNA is indicative of
resistance t o the virus. MPMI 15(8):8262833
25. Tenlado F, Dlaz- Rufz JR (2001) Double- stranded RNA- mediated interference with plant
virus infection. J Virol 75(24):12288–12297
26. Andika IB, Kondo H, Tamada T (2005) Evidence that RNA silencing-mediated resistance to
Beet necrotic yellow vein virus is less effective in roots than in leaves. MPMI 18(3):194–204
27. Mao YB, Cai WJ, Wang JW (2007) Silencing a cotton boll worn P450 monooxygenase gene
by plant-mediated RNAi impairs larval tolerance of gossypol. Nat Biotechnol 25:1307–1313
28. Bautista M, Tanaka T (2009) RNA interference mediated knockdown of a cytochrome P450,
CYP6BG1, from the diamondback moth, Plutella xylostella, reduces larval resistance to
permethrin. Insect Biochem Mol Biol 39:38–46
29. Cigan AM, Unger Wallace E, Collet H (2005) Source transcriptional gene silencing as a tool
for uncovering gene function in maize. Plant J 43:929–940
Chapter 103
Isolation, Identification and Degradation
Characteristics of Three Thick Oil
Degrading Bacteria Strains
Chan Tian, Shengyan Tian, Xianbin Liu and Lulu Qin
Abstract In order to find the microbe suited to microbial enhanced oil recovery
(MEOR), three bacterial strains DS1, DS2, and DS3 with excellent degrading
effect on thick oil were isolated from the thick oil and water reservoir of oil well
51-82# in Erlian Oil Field. The three bacteria were identified as Acinetobacter sp.,
Enterococcus sp. and Brevibacterium sp. through 16S rDNA sequence similarity
search. Viscosity reducing experiment was conducted using thick oil with a vis-
cosity of 1746 mPas (50 C) from Erlian Oil Field as the substrate with the three
isolated bacterium alone and their consortium. The viscosity reduced 49.1, 46.6,
and 49.0 % by DS1, DS2, and DS3, respectively, during 7 days degradation
experiment. However, the reduction rate of viscosity reached 57.0 % with the
consortium, which was significantly higher than that of single strain. It demon-
strated that viscosity reduced effect was better with the consortium of the three
isolated bacteria. The consortium can be applied in MEOR.
Keywords Bacteria MEOR Thick oil Viscosity reducing 16S rDNA
103.1 Introduction
In contemporary society, energy issue should not be underestimated. The oil has
gone deep into all aspects of life as the most important energy substance in modern
society. So the oil exploration has become the key of energy issues. Only 5–50 %
of the crude oil can be mined by primary and secondary exploitation, and the
remaining two-third of the crude oil will be exploited by tertiary oil recovery
[1, 2]. At present tertiary oil recovery technology mainly includes heat
C. Tian S. Tian X. Liu (&) L. Qin

Tianjin Key Laboratory of Marine Resources and Chemistry, Tianjin University of Science
e-mail: lxb0688@tust.edu.cn
964 C. Tian et al.
flooding, steam flooding, chemical flooding, and microbial enhanced oil recovery
(MEOR) [3]. Microbe can metabolize the long-chain saturated hydrocarbons in
crude oil to be shorter hydrocarbons, and can produce surfactants, organic acids,
and carbon dioxide. The surface tension of crude oil was reduced, the flow
properties of crude oil was improved after microbial action [4–6]. Compared to the
other tertiary oil recovery, MEOR is a green mining technology with the advantage
of low cost, less energy consumption, and minimal damage to the stratum [7].
Usually there is a relatively stable microbial community in the reservoir, which
was mostly injected by water. Some of them (Archaea) adapt to the poor strata
through self-regulation and can use the limited nutrition in the formation to grow
slowly which were there before the reservoir developed [5, 8]. In recent years, the
researches of MEOR are increasing, MEOR has become one of the fastest
development technology to enhanced oil recovery and it has achieved initial
success in field test both at home and abroad [9–13]. In order to find the microbe
suited to MEOR, three bacterial strains with excellent degrading effect on thick oil
were isolated from the thick oil and water reservoir of oil well 51-82# in Erlian Oil
Field. Their identification and degradation characteristics were researched.
103.2.1 Reagent and Medium
The thick oil were collected in 51–82# oil well of Erlian Oil Field which has a
density of 0.9078 g/cm3 (20 C) and a viscosity of 1746 mPas (50 C).
The medium for enrichment contained the following, in grams per liter of
water: yeast extract, 3; K2HPO4, 10; (NH4)2SO4, 1; KH2PO4, 4; MgSO4, 0.25;
NaCl, 5; pH 7.2, sterilized at 121 C for 15 min.
LB medium contained the following, in grams per liter of water: peptone, 10;
yeast extract, 5; NaCl, 10; pH 7.2, sterilized at 121 C for 15 min.
103.2.2 Enrichment of Thick Oil Degrading Bacterial

Consortia
The thick oil was used as the sole carbon to enrich thick oil degrading bacteria
strains from water reservoir of oil well 59-82# in Erlian Oil Field. A portion of
10 g thick oil was transferred to a 250 mL conical flask containing 50 mL medium
and 50 mL water reservoir. The flasks were shaken on a thermostat incubator at
40 C at a speed of 100 rpm. After 7 days, an aliquot of 5 mL supernatant was
then transferred into a150 mL conical flask containing 50 mL medium and 5 g
thick oil. The flasks were shaken on a thermostat incubator at 40 C at a speed of
100 rpm for 7 days. This step was repeated once to attain a thick oil degrading
enriched consortium.
103 Isolation, Identification and Degradation Characteristics 965
103.2.3 Isolation and Identification of Bacterial Strains
At the end of the enrichment, bacterial strains in each consortium were isolated by
spreading the 10-fold serial diluted consortium on agar plates coated with LB
medium. Bacterial colonies producing clear zones were scored positive and picked
up from the plates, further purified by repetitive streaking on nutrient agar plates.
The isolated strains were then identified by Gram’s stain, scanning electron
microscope and 16S rDNA gene sequence.
The total DNA was extracted by kit after pure cultures of bacteria in LB
medium. The bacterial 16S rDNA gene fragment was amplified in a 50lL reaction
containing 25lL Mix, 10lL of each primer (27F: 50 -AGA GTT TGA TCA TGG
CTC AG-30 ; 1492R: 50 -CTA CGG TTA CCT TGT TAC GAC-30 ), 2lL template
DNA, and 21lL distilled water. The PCR was performed in a thermocycler with
the thermal profile: initial denaturing 4 min at 94 C, followed by 30 cycles of
denaturing (94 C for 1 min); annealing (55 C for 1 min) and elongation (72 C
for 2 min). The purifying and sequencing of 16S rDNA sequence was finished by
BGI Beijing. DNA sequence of the cloned 16S rDNA fragments was compared
using BLASTN at http://www.ncbi.nlm.nih.gov/BLAST/ maintained by National
Center of Biotechnology Information (NCBI). The clone sequences were aligned
and phylogenetic trees were constructed by the neighbor-joining method with the
Molecular Evolutionary Genetics Analysis (MEGA) software and Cluster X.
103.2.4 Biodegradation of Thick Oil by Enriched Consortia

and Bacterial Isolates
To start the biodegradation experiment, 2 mL aliquot of the enriched bacterial

consortium or single bacterial isolated reaching the late exponential growth phase
was aseptically inoculated into 40 mL enrichment medium containing 40 g thick
oil, at an initial concentration of 50 g/L. Enrichment medium containing the same
amount of thick oil but without any microbial inoculum was used as the control to
determine abiotic losses of thick oil. Triplicate flasks were prepared for each
enriched consortium and the control. The flasks were shaken in the same way as
described above. After 7 days, they were measured by Brookfield viscometer.
103.3.1 Isolation of Strains and Phenotypic Characteristics
In the medium containing thick oil as the sole carbon source, few bacterial col-
onies were able to grow and resulted in the formation of clear zones. In this study,
we focused on three bacterial strains named DS1, DS2, and DS3 which produced
966 C. Tian et al.
Fig. 103.1 SEM photos of DS1, DS2, and DS3
the largest clear zones on the agar plates. By repeated picking up and dilution of
the colony of three strains, pure cultures of these strains were successfully
obtained. Microscopic examination of the three strains (DS1: gram-negative, DS2:
gram-positive, and DS3: gram-positive) revealed the presence of short bacillus
cells, short cocci cells, and short bacillus cells. Cells of strains were nonmotile and
shaped 0.6–0.8 9 1.2–1.6 lm, 0.6–0.8 9 1.0–1.2 lm, 0.4–0.6 9 1.2–1.4 lm cell
diameter (Fig. 103.1). Microscopic examination did not reveal any evidence of
spores or of swimming motility.
103.3.2 Genotypic Characterization of the Isolated Strains
The taxonomic position of the bacteria has, however, not been known with
certainty. We solved this problem by PCR amplification, and subsequent
sequencing of the 16S rDNA genes directly from the isolated bacteria. Genomic
DNA of three isolates were extracted and used as DNA template for PCR
amplification. The single amplified DNA fragments of approximately ± 1,500 bp
size were generated as shown in Fig. 103.2. It was accord with the amplification
interval in template DNA between the two 16S rDNA primers. It was showed that
the amplification products have a high concentration by the clear bandings in
electrophoretic test. So the sequencing reaction could be continued.
The three strains were identified on the basis of their 16S rDNA homologies with
entries in the GenBank databases. Experimental results showed that three isolated
microorganisms were able to grow on thick oil as the sole carbon source. The three
isolated strains were named DS1, DS2, and DS3 prior to further analysis for
genotypic characteristics using 16S rDNA technique. When examined by BLAST
similarity analysis, DS1, DS2, and DS3 were determined to be Acinetobacter sp.,
Enterococcus sp. and Brevibacterium sp. by the strains which have a similarity
more than 98 % to the three strains.
Download the 16S rDNA sequences of the strains that have a high sequence
similarity (above 98 %) to the three strains. The clone sequences were aligned and
phylogenetic tree was constructed by the neighbor-joining method with the
Molecular Evolutionary Genetics Analysis (MEGA) software and Cluster X. DS1,
Fig. 103.2 Agarose gel

electrophoresis of 16S rDNA-
PCR fragment obtained from
the amplification of genomic
DNA of the three isolates:
Lane M (20 Kb DNA ladder);
Lane 1 (isolate DS1); Lane 2
(isolate DS2); Lane 3 (isolate
DS3)
DS2, and DS3 were closely related to Acinetobacter haemolyticus, Enterococcus

gallinarum, and Brevibacterium otitidis with a homology of 99 %, 99 %, and
98 %, respectively (Fig. 103.3).
It has great significance to search and select appropriate microbial strain to
enhance oil recovery from the nature as MEOR has got much attention. In this
study, we got three strains that can significantly reduce the viscosity of heavy oil
and use thick oil as the sole carbon source from authigenous microorganism. It has
been reported that petroleum hydrocarbon can be degraded by Acinetobacter sp.
and Brevibacterium sp. It has been found that Acinetobacter sp. with perfect
adaptive capacity to environment has good effect to remove pristane and phytane
in thick oil [14]. Brevibacterium sp. was able to degrade polycyclic aromatic
hydrocarbons such as anthracene, phenanthrene, pyrene, and naphthalene. The one
with the less hoops was easier to be degraded [15]. And it has been found that
Acinetobacter sp. can produce surface. Acinetobacter calcoaceticus can produce a
kind of surfactant named HBS-1 which make the surface tension and the oil water
interfacial tension reduced [16], and then the flow properties of crude oil was
improved. Li Qing’s research also showed that surfactant was produced by Aci-
netobacter sp. [17]. Zhang Hao did the MEOR field test with the microorganism of
Brevibacterium sp. they selected. The result was that 947t oil was gained within
half a year [18]. Enterococcus sp. also had a great viscosity reduced effect for the
thick oil in Erlian Oil Field. While Enterococcus sp. on the degradation is rarely
reported. The three strains were selected directionally in particular circumstances.
Study on the shape, physiological, and biochemical and molecular laid a good
foundation for the function gene cloning and expression of the three strains.
968 C. Tian et al.
Fig. 103.3 Phylogenetic tree of thick oil degrading bacteria strains. The bacteria strains isolated
are highlighted in boldface. The tree was constructed by the neighbour-joining method, with the
Kimura two parameter correction factors. Bootstrap values higher than 50 % are shown at
the nodes. The scale bar represents substitutions per nucleotide position. The length of the
representative T-RF is listed in the end of each clone. Sequences are shown in the phylogenetic
tree when they showed high sequence similarity (above 98 %)
103.3.3 Degradation Characteristics of Three Bacteria

Strains
The thick oil in experimental group has emulsified by the three isolated bacterium
alone and their consortium after 3 days. The viscosity reduced 49.1, 46.6 and
49.0 % by DS1, DS2, and DS3, respectively, during 7 days degradation experi-
ment. The viscosity of crude oil changed after the effect of microbe. The viscosity
of crude oil can reduce 10–50 % in normal [19–23],but the reduction rates of
viscosity of the three strains we got were more than 45 %. It proved that they are
excellent thick oil degrading bacteria strains. However, the reduction rate of vis-
cosity reached 57.0 % with the consortium, which was significantly higher than that
of single strain (Fig. 103.4). It demonstrated that viscosity reduced effect were
better with the consortium of the three isolated bacteria. The degradation to thick oil
with microbe has a strong selectivity [24], so single bacteria strain can only
degrades some composition in crude oil selectively. Compared to single strains, the
Fig. 103.4 The reduction 75%
The reduction rates of viscosity

rate of viscosity by the three
isolated bacterium alone and
65%
their consortium
55%
45%
35%
25%
DS1 DS2 DS3 consortium
consortium of different bacteria strains can degrade more composition in crude oil.
And different strains produced different surfactants, organic acid, as well as enzyme
composition. They respectively act on different petroleum hydrocarbon fractions to
reduce the surface tension of the thick oil, so the liquidity is changed. The bacteria
strains applied to MEOR should be able to produce metabolites such as gases, acids,
surfactants that benefit to oil displacement. They also should be adaptable of
anaerobic survival, high temperature, high pressure, different pH, and salinity
conditions. For a single strain, it is too difficult to satisfy these requirements, so the
consortium should be used in MOER [25]. She Yuehui’s study also found that the
viscosity reduced effect of consortium is better than the single strain [26]. The
consortium can be applied in MEOR.
103.4 Conclusion
Three bacterial strains DS1, DS2, and DS3 with excellent degrading effect on thick
oil were isolated from the thick oil and water reservoir of oil well 51–82# in Erlian
Oil Field. The three bacteria were identified as Acinetobacter sp., Enterococcus
sp., and Brevibacterium sp. through 16S rDNA sequence similarity search.
The viscosity reduced 49.1, 46.6, and 49.0 % by DS1, DS2, and DS3, respec-
tively, during 7 days degradation experiment. However, the reduction rate of vis-
cosity reached 57.0 % with the consortium. The consortium can be applied in
MEOR.
Acknowledgments This work was supported by the Project of Prospering Ocean with Science
and Technology of Tianjin Municipality (No. KJXH2012-23).
970 C. Tian et al.
References
1. Sen R (2008) Biotechnology in petroleum recovery: the microbial EOR. Prog Energy
Combust 34:714–724
2. Youssef N, Elshahed MS, Mclnerney MJ (2009) Microbial processes in oil fields: culprits,
problems, and opportunities. Adv Appl Microbiol 66:141–251
3. Sui CH, Li H, Bi XZ (2010) The situation and development trend of tertiary oil recovery
around the World. Foreign Oilfield Eng 26:13–16 (in Chinese)
4. Zhou LG, Xiang YS, She YH (2004) Development of microbial enhanced oil recovery in
Qinghai oil field. Biotechnology 14:58–59 (in Chinese)
5. Yang ZY, Shi M, Wang DW et al (2006) Study on authigenous microorganism community
distribution and oil recovery mechanism in daqing oilfield. Acta Petrolei Sinica 27:95–100
(in Chinese)
6. Belyaev SS, Borzenkov IA, Nazina TN et al (2004) Use of microorganisms in the
biotechnology for the enhancement of oil recovery. Microbiology 73:590–598 (in Chinese)
7. Hao CL, Liu YJ, Wang DW (2007) Advance of research for MEOR in oil reservoir after
polymer flooding. Biotechnology 17:87–90 (in Chinese)
8. Xiang YS, Feng QX, Nazina NT et al (2004) Mechanism of indigenous Microbial
enhancement of oil recovery and pilot test. Acta Petrolei Sinica 25:63–67 (in Chinese)
9. Van Hamme JD, Singh A, Ward OP (2003) Recent advances in petroleum microbiology.
Microbiol Mol Biol Rev 4:503–549
10. She YH, Yi SJ (2002) The technology of petroleum and environmental microbe. China
University of Geosciences Press, Beijing, pp 64–88 (in Chinese)
11. Wang H, Lu Y, Yin XY (2003) The summarization of microbial enhanced oil recovery
technology. Petrol Geol Oilfield Dev Daqing 22:49–52 (in Chinese)
12. Hao GY, Xu YT, Huang MS (2004) Application and developing trends of microbial
enhanced oil recovery. Energy Environ Prot 18:8–13 (in Chinese)
13. Wang CM (2007) Separation and study of degradation characteristics of polycylic aromatic
hydrocarbon bacteria and their effects on heavy oil in MEOR. Sichuan University
(in Chinese)
14. Jia QC, Guo CL, Lu GN et al (2011) Isolation and identification of two strains efficiently
degrading heavy oil and their degradation characteristics. Chinese J Environ Eng
5:1181–1186 (in Chinese)
15. Nie MX, Zhang ZJ, Lei P (2001) Biodegradation of polycyclic aromatic hydrocarbons by a
preponderant Brevibacterium. Environ Sci 22:83–85 (in Chinese)
16. Luo Q (2008) Studies on synthesis of biosurfactant HBS-1 and function of viscosity-reduced
by emulsification on nanbao 35-2 heavy crude oil. Southwest Petroleum University
(in Chinese)
17. Li Q, Shao ZZ (2008) Components in bioemulsifier produced by Acinetobacter strains.
Chinese J Appl Environ Biol 14:553–557 (in Chinese)
18. Zhang H, Zhao B, Chen JM et al (2003) Recover heavy oil and extra heavy oil by MEOR. Oil
Drill Prod Technol 25:49–50 (in Chinese)
19. Wu PC, Ju QY, Li CL et al (1998) A study on effects of microbes on crude oil in microbial
enhanced oil production. Oilfield Chem 15:362–365 (in Chinese)
20. Zhang TS, Lan GZ, Deng L et al (2001) Experiments on heaving oil degradation and
enhanced oil recovery by microbial treatments. Acta Petrolei Sinica 22:54–57 (in Chinese)
21. Zhang TS, Ren ZM, Lan GZ et al (2003) Microbial degradation influences on heave oil
characters. J Southwest Petrol Inst 25:1–4 (in Chinese)
22. He ZG, Xiang TS, Mei BW et al (1999) Lab research of enhancing oil recoveru with
microorganism. Oil Drill Prod Technol 21:95–99 (in Chinese)
23. Wang CM, Li DP, Liu SG (2007) Effects of biophysiological and biochemical characteristics
of a strain of Microbacterium sp. on properties of thickened oil. Acta Petrolei Sinica
28:89–92 (in Chinese)
24. Bao JP, Zhu CS, Ma AL et al (2002) Quantitative study of biomarker composition in
biodegrated oils. J Jianghan Petrol Inst 24:22–26 (in Chinese)
25. Donaldson EC, Chilingarian GV, Yen TF (1989) Microbial enhanced oil recovery. Elsevier
Science Publishers B.V., Amsterdam, pp 7–11
26. She YH, Xia J, Huang JF et al (2009) Characteristics of indigenous microorganisms for
enhancing oil recovery after polymer flood in Daqing oilfield. Oilfield Chem 26:98–101
(in Chinese)
Chapter 104
Effect of Anti-Nematode Preparations
on Physiological Traits of Cucumber
Leaves Affected by Root-Knot Nematode
Shuchang Lu
Abstract This paper was to study the effects of anti-nematode preparations with
different mechanisms on changes of enzyme systems and membrane permeability
of cucumber leaves, so as to provide reference basis for effective control of soil
root-knot nematode in greenhouse. With cucumber seedlings affected by root-knot
nematode as material, changes of superoxide dismutase (SOD), peroxidase (POD),
relative conductivity in cucumber were tested after the seedling soil was treated by
preparations of Wuxianmei, Hailvsu, Duxiandna, and Avermectin. After treated by
different preparations, SOD and POD activity of cucumber leaves were higher than
control, and that treated by Wuxianmei was the highest. In addition to Duxiandna,
the relative conductivity content of other treatments were significantly lower than
control. When cucumbers were planted for 70 days, the effect of Avermectin
against root-knot nematode was the best of 64.7 %. After cucumbers were infected
by root-knot nematode, different preparation treatments all had certain control
effect, which made the physical indicators of cucumber have obvious change.

Keywords Cucumber Root-knot nematode Preparation Leaf Physiological
trait
104.1 Introduction
The damage of soil root-knot nematode in the main vegetables producing areas is
increasingly serious in China, and it shows significant aggravation trend especially
in northern producing area of off-season protected vegetables, being a serious
obstacle restricting the production of protected vegetables.
S. Lu (&)
Department of Agronomy, Tianjin Agricultural University, 300384
Tianjin, People’s Republic of China
e-mail: lsc9707@163.com
974 S. Lu
According to the survey, the disease has different degrees of occurrence in the
main producing areas in Jixian, Wuqing, and Jinghai of Tianjin City, especially in
Jixian, root-knot nematode disease has caused great harm on the local vegetable
production [1]. When root-knot nematode infects the roots of cucumber, the
enzyme systems and membrane permeability of root system will change, thus
affecting the physiological traits of aboveground leaf tissue. This not only directly
affects the growth and development of vegetables, causing the production decline
and quality reduce, but also exacerbates the occurrence of bacterial and fungal
diseases such as Fusarium wilt [2].
Currently, the mechanisms for the prevention of soil root-knot nematodes are as
follows: (1) using preparations to kill root-knot nematode; (2) using preparations
to drive root-knot nematodes away from the roots to prevent roots being infected;
(3) using root growth promoting preparation to promote the growth of new roots,
thus increasing the transportation of soil moisture and nutrients to aerial part [3].
The traditional control against soil root-knot nematode mainly relies on chemical
preparations, but many chemical preparations are highly toxic and high residue
pesticides, large amount of application will cause serious pollution on soil and
groundwater, so the research and development of new preparations and new
technologies with high efficiency and low toxicity against root-knot nematode is
extremely urgent [4, 5]. How the preparations with different mechanisms affect the
soil root-knot nematode and plant physiological traits is rarely reported. To this
end, taking cucumber seedlings infected by soil root-knot nematode as the
material, the author used several preparations of Hailvsu (root growth promoting
preparation), Wuxianmei (botanical nematode driven preparation), Duxiandan
(chemical nematicide preparation), and Avermectin (biological nematicide prep-
aration) with different mechanisms to control root-knot nematode, and further
analyzed the changes of enzyme systems and membrane permeability of plant
leaves after application of preparations, so as to provide reference for effective
control of soil root-knot nematode in protected vegetable fields.
104.2.1 Materials
104.2.1.1 Test Crops
The crop used in the test was cucumber, and the variety was Jinyou 35.
104.2.1.2 Preparations
The preparations used in the test were as follows: 2 % Avermectin EC (Jiangsu

Gaoyang Agriculture Technology Co., Ltd.), 3 % Duxiandan granules (active
104 Effect of Anti-Nematode Preparations 975
ingredient was 3 % chlorpyrifos, Shandong Qingdao Haibeil Chemical Co., Ltd.),

Hailvsu water solvent (algae extract, Beijing New Hefeng agricultural information
Co., Ltd.), and Wuxianmei EC (botanical nematode driven preparation, Beijing
New Hefeng agricultural information Co., Ltd.).
104.2.1.3 Test Soils
The overwintering soils in cucumber greenhouse with serious damage caused by

root-knot nematodes in Xiniantuozui Village in Xiqing District of Tianjin City
were collected at the end of 2009 and taken as the test soils, the soil texture was
medium loam, and the soil type was alluvial soil.
104.2.2 Methods
104.2.2.1 Experimental Design
Four different types of preparation treatments including Wuxianmei, Hailvsu,

Duxiandan, and Avermectin were set in the test, and water irrigation treatment was
set as control, each treatment contained three repeats.
The test was started on March 5, 2011. The cucumber seeds were placed in the
Petri dishes covered with wet gauze, then the dishes were placed in 25 C incu-
bator for 5 days. After germination, the seeds were planted in the pots with the
diameter of 15 cm, each pot was covered with 500 g semi-wet soil containing
nematodes. Two seedlings with vigorous growth were kept after 20 days. 30 days
later, 50 mL Wuxianmei 3000 times, Hailvsu 1000 times, Duxiandan 500 times,
and Avermectin 1000 times were used to irrigate, respectively, and control group
was irrigated with water. The physiological indicators such as enzyme activity,
relative conductivity were determined after 40 days, and the number of soil root-
knot nematodes was counted after 70 days.
104.2.2.2 Determination of Physiological Indicators
Superoxide dismutase (SOD) was determined using NBT photoreduction method,

suppressing 50 % of photoreduction was adopted as an enzyme activity unit;
peroxidase (POD) was determined using guaiacol method; conductivity was
determined using conductometry. The determination of the above four indicators
was carried out according to the method by HAO Zai-bin [6].
976 S. Lu
104.2.2.3 Determination of the Number of Root-Knot Nematodes

in Soil and Calculation of Control Effect
The separation of root-knot nematode in soil referred to Bayesian funnel method.

20 g fresh soil samples were weighed, covered with 4-layer gauze, and placed in
the funnel containing 50 mL clean water. The funnel end was connected with a
section of rubber tube, the other end of rubber tube was tightly clamped with water
clip. After being placed stilly for 48 h, the clip was opened and about 10 mL
bottom water sample flew out to centrifuge tube, then the tubes were centrifuged at
2,000 r/min for 2 min. Each sample had two tubes, the upper liquid was aban-
doned, and 1 mL base liquid was kept. The tubes were placed under microscope to
count for three times. The number of soil root-knot nematodes was counted before
planting and 70 days after planting, respectively.
Control effect (%) = (number of nematodes in control-number of nematodes
in preparation treatment)/(number of nematodes in control-number of nematodes
before planting) 9 100
104.2.2.4 Data Processing
Experimental data obtained were preliminarily processed using Mircrosoft Office

Excel 2003, and SAS9.1 software was used for statistical analysis (Duncan’s
method for verification, A = 0.05).
104.3 Results and Analysis
104.3.1 Effect of Different Pesticides on the Content

of Chlorophyll in Cucumber Leaves
After treated by different preparations, the content of chlorophyll in leaves of

cucumber seedlings were shown in Fig. 104.1. As shown in Fig. 104.1, contents of
chlorophyll a, chlorophyll b, and carotenoids of cucumber leaves treated by
hailvsu were the highest, being 11.17, 4.15, 2.49 mg/L, respectively. The content
of chlorophyll of cucumber leaves treated by Duxiandan was the lowest. It showed
that root-knot nematode affected the photosynthesis of cucumber leaves. After the
pesticides application, the photosynthesis of cucumber leaves was improved.
Chlorophyll content(mg/L) 14
11.17
12 Chlorophyll a Chlorophyll b Carotenoids
10
8
6
4.15
4
2.49
2
0
Hailvsu Avermectin Duxiandan Wuxianmei Control
Different pesticides
Fig. 104.1 Effect of different pesticides on the content of chlorophyll in cucumber leaves
104.3.2 Changes of SOD and POD Activity in Leaves

of Cucumber Seedlings
After treated by different preparations, the changes of SOD and POD activity in
leaves of cucumber seedlings were shown in Table 104.1. As shown in
Table 104.1, SOD activity of cucumber leaves treated by Wuxianmei was the
highest, being 100.7 U/g, and SOD activities of cucumber leaves treated by
Wuxianmei, Hailvsu, and Avermectin were significantly higher than control. SOD
activity treated by Wuxianmei was higher than other three preparations, indicating
that Wuxianmei led to the minimum decrease of SOD activity, thereby main-
taining a certain degree of resistance of cucumber. SOD activity of cucumber
leaves treated by Duxiandan was the lowest, this indicated that the impact of
chemical preparations on physiological traits of cucumber leaves was higher than
other biological preparations; POD activity of cucumber leaves treated by Wux-
ianmei was 260.0 U/g, which was significantly higher than that treated by other
three preparations, and was 3.17 times of control. The changes of POD activity
after treated by Hailvsu and Avermectin were similar, POD activity of cucumber
leaves treated by Duxiandan was the lowest. This indicated that these four prep-
arations could increase POD activity of cucumber leaves, which was conducive to
the protection of enzyme system, thus increasing the resistance of cucumber in a
certain degree.
Table104.1 Effect of different preparations on SOD and POD activity of cucumber leave
Index Different treatments
Wuxianmei Hailvsu Duxiandan Avermectin Control
SOD (U/g) 100.7 ± 20.1 82.4 ± 26.0 44.1 ± 10.3 66.3 ± 15.7 46.2 ± 10.3
POD (U/g) 260.0 ± 23.2 186.7 ± 20.7 160.2 ± 12.8 190.2 ± 22.2 81.9 ± 11.2
978 S. Lu
104.3.3 Changes of Relative Conductivity in Leaves

and Roots of Cucumber Seedlings
After treated by different preparations, the changes of relative conductivity in

leaves and roots of cucumber seedlings were shown in Figs. 104.2 and 104.3. As
shown in Figs. 104.2 and 104.3, the relative conductivity in control was the largest
of 0.371, and the relative conductivity treated by preparations was lower than
control. The conductivity in cucumber leaves treated by Duxiandan was the
largest, the conductivity treated by Hailvsu, Wuxianmei, and Avermectin was
relatively low, and the difference among them was not significant. This indicated
that after treated by these three preparations, cell membrane permeability of
cucumber leaves decreased, the leakage of electrolyte reduced, and the damage
suffered by cells was also significantly alleviated. The damage degree of roots was
higher than ones of leaves, above 0. After the pesticides application, the damage
degree of roots was decreased. The effects of Wuxianmei and Avermectin were
evident.
104.3.4 Control Effects of Different Preparations Against

Soil Root-Knot Nematode
The initial number of root-knot nematodes in semi-wet soil per 100 g after over-
wintering was 153. After cucumbers were planted for 70 days, the number of root-
knot nematodes in pots greatly increased due to the increase of soil temperature.
After treated by four preparations, the number of root-knot nematodes in soil was
significantly lower than control. The control effect of Avermectin against root-knot
0.8
Relative conductivity in tomato leavers
0.6
0.371
0.4 0.318
0.2
0.0
Wuxianmei Hailvsu Duxiandan Avermectin CK
Fig. 104.2 Effect of different preparations on relative conductivity of cucumber leaves

0.5 25
Relative conductivity
Relative conductivity
0.4 20
Damage degree (%)

Damage degree
0.3 15
0.2 10
0.1 5
0.0 0
Duxiandan Wuxianmei Hailvsu Avermectin Control
Fig. 104.3 Effect of different preparations on relative conductivity and damage degree of
cucumber roots
Table104.2 Control effect of different pesticides on root-knot nematode

Item Treatment
Wuxianmei Hailvsu Duxiandan Avermectin Water (CK)
Number of root-knot nematode 153 153 153 153 153
pre planting (head/100 g)
Number of root-knot nematode 826 945 760 534 1203
after the pesticides use
(head/100 g)
Control effect ( %) 35.9 26.7 43.8 64.7 -
nematode was the best, reaching 64.7 %. The control effect of Wuxianmei was
lower than Avermectin and Duxiandan, but it was non-toxic and had no pollution
on environment, which could be used in production. As the root growth promoting
preparation, Hailvsu also increased the plant resistance against root-knot nema-
tode, which had certain control effect (Table 104.2).
104.4 Conclusion and Discussion
The metabolic balance of generation and elimination of reactive oxygen species in

plant is damaged under adversity stress, and excess reactive oxygen species can
cause and aggravate peroxidation of membrane lipids, thus destroy the structure
and function of membrane. The results showed that SOD activity and POD activity
of cucumber leaves treated by preparations were significantly higher than control,
biological preparation, and root growth promoting preparation had better
improvement effect on leaf physiological traits of cucumber infected by root-knot
nematode than chemical preparations. SOD and POD are the key enzymes in
980 S. Lu
protective enzyme systems for eliminating reactive oxygen species [7]. These all
indicated that the antioxidant system of cucumber changed after treated by prep-
arations, and the level of POD activity could better reflect the strength of free
radical elimination or antioxidant capacity [8].
After infection for 70 days, the number of root-knot nematode significantly
increased, but the increase in control was significantly larger than preparation
treatments. This indicated that preparations had certain control effect against root-
knot nematode, Avermectin had better control effect, while Wuxianmei and
Hailvsu mainly improved the resistance of soil against root-knot nematode via
driving root-knot nematode and promoting root growth. Although the control
effect of Wuxianmei is not as good as other two nematicides, it is pollution-free
and safe, which can be combined with other preparations for integrated use in
practice, and control the damage caused by root-knot nematode from different
mechanisms. So, the preparation of integrated agents will have a very broad
development prospect.
Acknowledgments This work was financially supported by special fund for basic application
and cutting-edge technology research projects of Tianjin City (09JCYBJC08600).
References
1. Huang GM, Wang JC, Liu P et al (2009) Study on plant nematodes in Tianjin vegetable base.
In: Peng YL, Zhu YL (eds) 2009 Conference papers of Chinese society of plant pathology.
Chinese Agric ScienTech Press, Beijing
2. Zhang SS, Hu L, Liu ZL et al (2006) Relationship between the disease defense related
enzymes and the disease resistance of plants. J Anhui Agric Sci 12:48–49
3. Huang CD, Ren T, Dong LL et al (2010) The application effectiveness of integrated control
techniques for root knot nematode in intensive vegetable production fields. China Veg
21:23–25
4. Dui H, Zheng G, Lv HP et al (2009) Effect control of sever kinds of pharmacy on the root-knot
nematode of cucumber. Gansu Agric ScienTech 12:40–49
5. Kounbobr RD, Saliou N, Sabine F et al (2005) Influence of irrigation on the distribution and
control of the nematode Meloidogyne javanica by the biocontrol bacterium Pasteuria penetrans
in the field. Biol Fert Soils 41:205–211
6. Hao ZB, Cang J, Xu Z (2004) Plant physiology experiments. Harbin Industrial University
Press, Heilongjiang
7. Jaizme MC, Tenoury PJ (1997) Interactions between the root-knot nematode Meloidogyne
incognita and Glomus mosseae in banana. Plant Soil 196:27–35
8. Wang HH, Lin QY, Xie LH (2001) The effects of three cucumber mosaic virus isolates on the
defendant enzymes and cell membrane permeability in tobacco cells. Acta Phytopathol Sin
31:39–43
Chapter 105
Enzymolysis and Microbial
Transformation of Geniposide
in Gardenia Jasminoides into Genipin
by Aspergillus niger
Yu Li, Wenbin Jin, Wei Jing, Mengcheng Yao, Yanyang Tang

and Fuping Lu
Abstract A filamentous fungi strain, Aspergillus niger, producing b-glucosidase

was screened to transform geniposide in traditional Chinese medicine Gardenia
jasminoides into genipin. The conversion rate of gardenia hydrolyzed by b-glu-
cosidase which had been extracted from fermentation broth of A. niger could reach
15 % at the enzyme concentration of 5 %, enzyme digestion time of 40 min,
temperature at 50 C. On the other hand, genipin was achieved with the method of
microbial cell transformation. The optimum conversion conditions by cells were:
b-glucosidase activity dose 10.12 U/mL at a fermentation time of 96 h, rotation
speed of 180 r/min, medium capacity of 50 mL and gardenia concentration of
10 %. By HPLC analysis, the maximum conversion efficiency of 22 % was
achieved. By this way, conversion efficiency was increased by 7 % and the
extraction process was saved compared with enzymatic hydrolysis method.

Keywords Genipin Gardenia Microbial transformation Enzymatic hydrolysis
105.1 Introduction
The fruit of gardenia (Gardenia jasminoides Ellis) is an oriental folk medicine

which has been included in traditional formulations [1, 2]. The chief effectual
components of Gardenia are geniposide and genipin. The pharmacokinetic study of
Gardenia showed that geniposide could be changed into genipin quickly in vitro by
human intestinal flora [3]. Genipin has obvious effects used for the treatment of
inflammation [4] , jaundice, hepatic disorders. Additionally, genipin is a natural
Y. Li W. Jin W. Jing M. Yao Y. Tang F. Lu (&)

Key Laboratory of Industrial Fermentation Microbiology, Ministry of Education, National
Engineering Laboratory for Industrial Enzymes, The College of Biotechnology, Tianjin
University of Science and Technology, 300457 Tianjin, People’s Republic of China
e-mail: lfp@tust.edu.cn
982 Y. Li et al.
Fig. 105.1 The mechanism

of blue pigment formation in
gardenia fruit
cross-linking agent with advantages of low toxicity and high biocompatibility.

Thus it has been widely applied in a variety of medical fields such as nerve
regeneration [5] and drug delivery [6]. According to this, in Gardenia jasminoides
the compound genipin is much more preferred to geniposide, however, the con-
centration of genipin is very low in gardenia fruits (about 0.005–0.01 %), while
geniposide presents abundantly (about 3.06–4.12 %) [7]. It is difficult to extract
genipin from gardenia fruits directly, so the methods of enzymatic hydrolysis and
microbial transformation have been used to replace the traditional method. The
two conversion methods were optimized in this paper to find out the most suit-
able conditions for maximum industrial production of genipin from gardenia by
using the Aspergillus niger.
Geniposide from gardenia fruit is hydrolyzed by b-glucosidase to produce
genipin. Geniposide has specific absorbance at 340 nm, but this specific absorbance
is disappeared after the transforming from geniposide into genipin [8, 9], so they
pose difficulties to the testing of genipin. While other researches suggested that
genipin became blue when being reacted with amino acids (Fig. 105.1) [10, 11].
Even though the mechanism of the blue pigment formation has not been clear
[12, 13], genipin could produce blue colored pigments with amino acids that
provided a simpler, safer, sensitive and stable alternative method for the colori-
metric detection of genipin. The blue pigments were stable in alkaline (pH 9.0) and
remained stable after 10 h at 60–90 C [14]. Furthermore, the absorbances of blue
pigments possessed stability and high sensitivity[15, 16].
105.2.1 Materials
Gardenia (extracted from gardeniae fruits, contains 3 % of geniposide by HPLC);

DNS reagent (3,5-dinitrosalicylic acid 1 %, phenol 0.2 %, sodium sulfite 0.05 %,
NaOH 1 %, sodium potassium tartrate 20 %); genipin standard (Seebio Biotech-
nology); glycin and salicin (Sangon Biotech).
105 Enzymolysis and Microbial Transformation of Geniposide 983
105.2.2 Strain Screening
Try to follow the type sizes and typefaces specified in Table 105.1 as best as your
can. The whole paper should use Times New Roman font with 10 pts in the main
text. Use 14 pts bold characters for the paper title, and capitalize the first letter of
each substantive in the title. Author names should use 12 pts characters and
separated by commas. Capitalize the surnames and the first letters of the first
names. Use superscript on the right if authors’ sequence numbers are necessary.
Use 10 pts characters for the main text and author’s affiliations, please be sure that
there are sequence numbers in front of them. Capitalize the first letter of the
beginning word for each section title and subheading. Use 12 pts bold Roman
characters for section titles and 10 pts bold Roman characters for subheadings.
105.2.3 Extraction and Activity Detection of b-glucosidase
The cell culture was centrifuged at 5,000 r/min and 4 C for 10 min. The super-
natant was mixed with sodium acetate buffer (pH 4.0) and then the supernatant was
concentrated by ultrafiltration. The crude enzyme would be used for the deter-
mination of b-glucosidase activity.
The measurement of activity of crude enzyme was performed by the DNS
method [17]. The determination method of b-glucosidase was as follows: salicin
solution (0.3 mL), 0.05 M sodium acetate buffer (pH 5.0, 0.7 mL) and suitable
amount of the crude b-glucosidase were mixed and incubated in water bath
(50 C) for 30 min. Then the reaction was stopped by adding DNS reagent (1 mL).
Color was developed by heating for 5 min in a boiling water bath. The tubes were
cooled with running tap water and solution was dilute to 10 mL. Then 0.05 M
sodium acetate buffer (pH 5.0) was taken as a blank control and the solution was
monitored at 550 nm by UV–Vis.
Table 105.1 Levels of factors for the best enzymatic hydrolysis efficiency of geniposide from
gardenia fruit
Factors Enzyme concentration Enzyme digestion Temperature
(% V/V) time (min) (C)
Level 1 1.0 20 40
Level 2 2.0 40 50
Level 3 5.0 60 60
Level 4 10.0 90 70
Level 5 20.0 120 80
984 Y. Li et al.
105.2.4 Analytical Methods
Thin layer chromatography (TLC) analysis of genipin, which was the fermentation
product, was carried out on silica gel GF254 TLC plate (50 mm 9 100 cm) with
mobile phase of the mixture of ethyl acetate and petroleum ether (2:1, V/V).
Gardenia in water and genipin standard were used as controls. Then it was detected
under UV light (254 nm).
High Performance Liquid Chromatography (HPLC, Agilent) was used to
determine the content of genipin [18]. The mobile phase consisted methanol and
water with a ratio of 45:55 and a flow-rate of 1 mL/min. The samples were filtered
by 0.45 lm microporous filtering membrane before injection. The assay was
carried out after injecting 20 lL sample to HPLC with the ODS-2HPERSIL C18
chromatographic column (4.6 mm 9 250 mm, 5.0 lm) temperature of 25 C and
the detection wavelength of 238 nm. The linear regression equation for genipin
was Y = 7858.9x – 389.19 (R2 = 0.993).
Actual yield of genipinðmolÞ
Productivity of genipin ð%Þ ¼ times100%
Theoretical yield of genipinðmolÞ
ð105:1Þ
105.2.5 Optimization of Hydrolysis of Gardenia Using

b-glucosidase from Aspergillus niger
The crude b-glucosidase (10 mL), 1 % gardenia solution (10 mL), phosphate buffer
(pH 5.0, 250 mL) were mixed and incubated in water bath (50 C) for 40 min. Then
glycine was added into the system and the mixture was reacted in 80 C water bath
for 1 h. After the reaction, it was detected under UV light (590 nm). Geniposide
from gardenia fruit was hydrolyzed by b-glucosidase to produce genipin and genipin
became blue when being reacted with amino acids. Based on this mechanism, the
absorbances could represent the concentration of genipin a large extent [19].
The factors, including the enzyme concentration, enzyme digestion time, and
fermentation temperature were optimized for the best enzymatic hydrolysis effi-
ciency of geniposide from gardenia fruit. The levels of factors were showed in
Table 105.1.
105.2.6 The Optimization of Microbial Transformation

Conditions
Spores of strain were inoculated into a 250 ml flask in which liquid media of tap
water and the powder of gardenia were added, and then cultivated. After 4 days,
Table 105.2 Levels of factors for the best conversion conditions by cells
Factors Fermentation Rotation Medium Gardenia concentratin
time (h) speed (r/min) capacity (mL) (% V/V)
Level 1 48 150 5 5
Level 2 72 160 10 10
Level 3 84 180 30 15
Level 4 96 190 50 20
Level 5 120 200 70 25
glycine was added into the system and the mixture was reacted in 80 C water bath
for 1 h. After the reaction, it was detected under UV light (590 nm). Geniposide
from gardenia fruit was hydrolyzed by b-glucosidase to produce genipin and
genipin became blue when being reacted with amino acids. Based on this mech-
anism, the absorbances could represent the concentration of genipin a large extent.
The conditions of fermentation were established by one-factor-at-a-time
method. The influencing factors, including the fermentation time, rotation speed,
medium capacity and gardenia concentration were optimized for the best con-
version conditions by cells. The levels of factors were showed in Table 105.2.
105.3.1 Screening Strains of High Transformation Activity
Genipin can react with amino acids to form a blue pigment, thus microbial
transformation of genipin can be evaluated by the size of the blue circle formed on
the screening plate. The strain B-4 with high microbial transformation capacity
was screened easily and fast. The strain B-4 was identified as A. niger, based on its
Fig. 105.2 Effect of enzyme 0.4

concentration on the
0.35
hydrolysis of geniposide
0.3
0.25
OD
0.2
0.15
0.1
0.05
0
1 2 5 10 20
Enzyme concentration (%V/V)
986 Y. Li et al.
morphological properties and the sequence of 18S rDNA. Used the method of
DNS, enzyme activity was determined at 10.12 U/mL.
105.3.2 The Optimization of Hydrolysis of Gardenia Using

b-glucosidase
The crude b-glucosidase which had been extracted from fermentation broth of
Aspergillus niger was evaluated for its capability to hydrolyze geniposide from
gardenia fruit. Attempts were made to increase the overall conversion efficiency by
optimizing the reaction parameters (enzyme concentration, enzyme digestion time
and temperature). The optimum hydrolysis condition by b-glucosidase was
determined according to the method described in Sect.105.2.5.
As Figs. 105.2 and 105.3 showed that when the enzyme concentration increased
to 5 %, and enzyme digestion time was 40 min, the enzymatic reaction was
completed and the yield of genipin had not obvious improvement.
Figure 105.4 summarized the influence of temperature on the degree of
hydrolysis of geniposide. During this period, the activity of b-glucosidase
increased gradually till reaching the maximum value of 10.12 U/ml at 50 C, and
the conversion rate increased along b-glucosidase activity. Because the maximum
activity of b-glucosidase was observed at pH 6.0 at 50 C, and b-glucosidase was
stable at 50 C [20].
Taking all the influencing factors and the results into consideration, the optimal
transformation conditions by the crude b-glucosidase which had been extracted
from fermentation broth of A. niger was considered as follows: the enzyme con-
centration of 5 %, enzyme digestion time of 40 min, temperature at 50 C. By
HPLC analysis, the maximum conversion efficiency of 15 % was achieved.
Fig. 105.3 Effect of enzyme 0.45

digestion time on the 0.4
hydrolysis of geniposide
0.35
0.3
0.25
OD
0.2
0.15
0.1
0.05
0
20 40 60 90 120
Enzyme digestion time (min)
Fig. 105.4 Effect of 0.35

temperature on the hydrolysis
of geniposide 0.3
0.25
OD
0.2
0.15
0.1
0.05
0
40 50 60 70 80
Fermentation temperature (˚C)
105.3.3 The Optimization of Fermentation Condition

by Cells
The effect of fermentation conditions of the strain on genipin production has been
studied. The optimum fermentation condition by cells has been determined
according to the method described in Sect.105.2.6.
The absorbances of blue pigments were assayed in different fermentation time
(48, 72, 84, 96, 120 h). As Fig. 105.5 showed, the geniposide mostly converted
into genipin after 96 h. Due to the instability of genipin and the reactions of
genipin with amino acids, the longer fermentation times the more yield of genipin
lost [21]. As a result, the most suitable time of fermentation termination was 96 h.
As Figs. 105.6 and 105.7 showed that when the rotating speed increased to
180 r/min and capacity at 50 mL, the conversion rate was at its maximum. The
probable reason was that Aspergillus niger was an aerobic microorganisms and
dissolved oxygen concentration had the greatest influence on fungus growth [22].
As a result, the dissolved oxygen was not enough when the speed below 180 r/
min, and the mycelium in the medium was ruptured at excessive speed. Those
were not conducive to the growth of microorganisms.
fermentation time on the
0.3
conversion rate of geniposide
0.25
0.2
OD
0.15
0.1
0.05
0
48 72 84 96 108 120
Fermentation time (h)
988 Y. Li et al.
The absorbances of blue pigments was assayed in different gardenia concentration

(5, 10, 15, 20, 25 % V/V). As Fig. 105.8 showed that when the gardenia concen-
tration at 10 %, the yield reached maximum. The cost of the medium is a crucial
factor in determining the feasibility of a fermentation process. Because there was no
other nutrient added in the fermentation medium, it was expected that the production
would be cost efficient.
Taking all the influencing factors and the results into consideration, the optimal
transformation conditions by cells was considered as follows: fermentation time of
96 h, rotation speed of 180 r/min, medium capacity of 50 mL and gardenia con-
centration of 10 %.
105.3.4 Fermentation Production Analysis
During the fermentation by B-4, the results by TLC showed that sample III (pre-
fermentation) did not show any blue spots while sample II (after fermentation)
showed a clear blue spot with Rf 1.5, and the Rf of sample II was consistent with

rotational speed on the
conversion rate of geniposide 0.1
0.08
OD
0.06
0.04
0.02
0
150 160 180 190 200
Rotation speed (r/min)
Fig. 105.7 Effect of medium 0.3

volume on the conversion
rate of geniposide 0.25
0.2
OD
0.15
0.1
0.05
0
5 10 30 50 70
Medium capacity (mL)

gardenia concentration on the 0.4
conversion rate of geniposide
0.35
0.3
OD
0.25
0.2
0.15
0.1
0.05
0
5 10 15 20 25
Gardenia concentration (% V/V)
Fig. 105.9 Products of the

fermentation detected by
TLC
I II III
Fig. 105.10 Genipin standard products analyzed by HPLC

990 Y. Li et al.
Fig. 105.11 Sample analyzed by HPLC
sample I (standard of genipin). It indicated that substrate geniposide had been

transformed into the product genipin (Fig. 105.9).
The fermentation samples by A. niger B-4 used gardenia fruit as substrate were
subjected to HPLC analysis. As Figs. 105.10 and 105.11 showed, the fermentation
of B-4 strain and gardenia converted, and the conversion rate of geniposide to
genipin could reach 22 % by the method of peak area spectrophotometry. With
this method, conversion efficiency was increased at 7 % and the extraction process
was saved compared with enzymatic hydrolysis method.
105.4 Conclusion
A strain of A. niger was obtained to transform geniposide in gardenia into genipin

successfully, and b-glucosidase from the strain was used to hydrolyze gardenia.
The conversion rate could reach 15 % at the enzyme concentration of 5 %,
enzyme digestion time of 40 min, temperature at 50 C.
In this study, the fermentation technology used traditional Chinese medicine
Gardenia as the medium composition to transform geniposide into genipin. No
extra nutrient was needed in the fermentation medium. By the method of microbial
cell transformation, the conversion rate could reach 22 % under the optimized
fermentation conditions (a fermentation time of 96 h, rotation speed of 180 r/min,
medium capacity of 50 mL and gardenia concentration of 10 %). Therefore the
method of microbial transformation had the potential to be applied on industry.
Our study supplied new information for the optimization and development of
microbial production of genipin from gardenia.
Acknowledgments The authors gratefully acknowledge the support of Tianjin Municipal Sci-
ence and Technology Committee (10ZCKFNC01700) and the National High-tech Research and
Development Program (863 Program), NO.2012AA021502.
References
1. Zheng HZ (2000) Modern research and application of Chinese Traditional Medicine. Beijing
4:3166–3172
2. Ni HY, Zhang ZH, Fu HZ (2006) Research and development of Fructus Gardeniae. China J
Chin Mat Med 31:538–541
3. Mie I, Satoshi M, Atsushi M et al (2004) Japanese herbal medicine inchin-ko-to as a
therapeutic drug for liver fibrosis. J Hepatol 41:584–591
4. Peng J, Qian ZY, Liu TZ et al (2003) Comparative studies on hepatic protective and
choleretic effect of geniposide and crocetin. Chin New Drug 12:105–108
5. Chen YH, Chang JY, Cheng CY et al (2005) An in vivo evaluation of a biodegradable
genipin-crosslinked gelatin peripheral nerve guide conduit material. Biomaterials
26:3911–3918
6. Chen SC, Wu YC, Mi FL et al (2004) A novel pH-sensitive hydrogel composed of N, O-
carboxymethyl chitosan and alginate cross-linked by genipin for protein drug delivery.
J Control Release 96:285–300
7. Cao JP, Wang YL, Jia YJ (2001) Simultaneous determination of geniposide and genipin in
Gardenia jasminoides Eillis by high performance liquid chromatography. J Dalian Med Univ
23:61–62
8. Yao XS, Wu LJ, Wu JZ (2004) Natural medicine chemistry, vol 220, 4th edn. People’s
Medicinal Publishing House, Beijing
9. Park JE, Lee JY, Kim HG (2002) Isolation and characterization of water-soluble
intermediates of blue pigments transformed from geniposide of gardenia jasminoides.
Agric and Food Chem 50:65l1–6514
10. Paik YS, Lee CM, Cho MH et al (2001) Physical stability of the blue pigments formed from
geniposide of gardenia fruits:effects of pH, temperature and light. J Agric Food Chem
49:430–432
11. Lee SW, Lim JM, Bhoo SH et al (2003) Colorimetric determination of amino acids using
genipin from Gardenia jasminoides. Anal Chem Acta 480:267–274
12. Park JE, Hahn TR, Park YS (2001) Separation and characterization of water soluble blue
pigments formed from geniposide of gardenia fruits. J Agric Chem Biotechnol 44:190–193
13. Park JE, Lee JY, Kim HG et al (2002) Dietary blue pigments derived from genipin, attenuate
inflammation by iInhibiting LPS-induced iNOS and COX-2 expression via the NF-jB
inactivation. Agric Food Chem 50:6511
14. Paik YS, Lee CM, Cho MH et al (2003) Colorimetric determination of amino acids using
genipin from Gardenia jasminoides. Anal Chim Acta 480:267–274
15. Fujikawa S, Fukui Y, Koga K et al (1987) Brilliant skyblue pigment formation from Gardenia
fruits. Agric Food Chem 65:419–424
16. Fujikawa S, Nakamura S, Koga K et al (1987) Continuous blue pigment formation by
gardenia fruit using immobilized growing cells. J. Ferment Tech 65:711–717
17. Paik YS, Lee CM, Cho MH et al (2001) Physical stability of the blue pigments formed from
geniposide of gardenia fruits: effects of pH, temperature, and light. J Agric Food Chem
49:430–432
18. Lu Y, Zhang T, Tao JS (2008) Study on processing of hydrolyzing geniposide with b-
glucosidase. Acta Univ Trad Med Sinensis Pharmacol Shanghai 22:76–78
19. Lee SW, Lim JM, Bhoo SH et al (2003) Hahn. Colorimetric determination of amino acids
using genipin from Gardenia jasminoides. Anal Chim Acta 480:267–274
992 Y. Li et al.
20. Kaur J, Chadha BS, Kumar BA et al (2007) Purification and characterization of b-glucosidase
from Melanocarpus sp. MTCC 3922. Electron J Biotechn 10:260–270
21. Djerassi C, Nakano T, Zalkow L et al (2004) Genipin—a novel fingerprint reagent with
colorimetric and fluorogenic activity. J Forensic Sci 49:1192–1194
22. Zhang QB, Xiao AF, Ni H et al (2012) Effects of oxygen conditions on naringinase
production in Aspergillus niger DB056 fermentation. Food Science Technol 37:7–10
Chapter 106
Study on the Application of a
Thermotolerant Saccharomyces cerevisiae
in the Production of Bio-ethanol
Yueqiang Li, Yefu Chen, Jian Dong, Xinxin Zhang, Tong Shen
and Dongguang Xiao
Abstract Bio-ethanol has attracted extensive attention because of its advantages

response to energy crisis and environment pollution. However, the ethanol pro-
duction could be decreased due to the high temperature created by the exothermic
reactions during the fermentation process of bio-ethanol. In this study, the ther-
motolerant Saccharomyces cerevisiae strain constructed in our precious work was
applied to the very high gravity fermentation (VHG) process for the production of
bio-ethanol. The ethanol production of F3 and the control strain AY12 via different
fermentation techniques were tested. Our results illustrate that the F3 strain
exhibits higher ethanol production compared to the strain AY12 in different
temperatures, and that the fermentation technique of simultaneous saccharification
and fermentation (SSF) possesses the predominance among the four. The
orthogonal test was also performed to optimize the fermentation conditions.
Finally, the ratio of nutriment and water 1:2.6, inoculum size 25 ml, fermentation
period 56 h were identified as the optimal fermentation conditions and the ethanol
production was 12.2 % (v/v).
Keywords Bio-ethanol Saccharomyces cerevisiae SSF VHG
Y. Li Y. Chen J. Dong X. Zhang T. Shen D. Xiao (&)

Key Laboratory of Industrial Fermentation Microbiology, Ministry of Education, Tianjin
Industrial Microbiology Key Laboratory, College of Biotechnology, Tianjin University
of Science and Technology, Tianjin 300457, People’s Republic of China
e-mail: xdg@tust.edu.cn
994 Y. Li et al.
106.1 Introduction
Due to rising focuses on the environmental problems and the periodic crises in
some of the larger oil exporting countries, bio-ethanol has becomes a viable and
realistic alternative energy in the global market [1–4]. Highly concentrated bio-
ethanol production means less volume in fermentation tanks and consumes less
distillery energy. The very high gravity (VHG) technology is attracting more and
more interests due to its economic value [5–8].
The analog fermentation technique is a diminution of the current ethanol
industry production processes. In this process, the incubate temperature rise when
fermentation enter the peak period. Judging from the cost of production, raw
material fermentation technique is minimal in all of the techniques. However,
since the starch material has not been liquefied and saccharified, the free glucose
concentration is low in the mash and this would be an inhibition to the ethanol
fermentation. Now the ripe fermentation process is the most sophisticated fer-
mentation process, but at the same time, the energy cost is very high because of the
large amount of cooling water which is used to maintain the temperature of the
mash. In simultaneous saccharification and fermentation, two different processes
(saccharification and fermentation) were carried on in the same bioreactor at the
same time [9, 10]. As the single saccharification step is saved, the cost of pro-
duction can be significantly reduced. Considering about the large scale of the bio-
ethanol industry, simultaneous saccharification and fermentation is more suitable
to the actual production. At the same time, the cooling energy consumption will
significantly reduce if thermotolerant strain which can work normally at high
temperature in the fermentation process is used.
Due to the advantages of thermotolerant strain, it was broadly studied in recent
years. Several breeding methods such as physical and chemical mutagenesis [11, 12],
adaptation [13], protoplast fusion [14], evolution engineering [15], global transcription
machinery engineering [16], and genome shuffling [17], had been previously used to
improve the thermotolerance and ethanol production of yeast. D’Amore et al. screened
numerous yeast strains for glucose fermentation at 40 C [18]. In another study,
Banat’s yeast (Saccharomyces cerevisiae) showed a maximum ethanol production of
7.0 % and 6.9 % (w/v) at 37 C and 40 C, when 14 % (w/v) glucose used as sub-
strate [19]. S. cerevisiae F111, which can grow at temperatures up to 50 C, has been
isolated and applied to industrial scale fermentation. S. cerevisiae NPO1 produced
11.3 % of ethanol from sweet sorghum juice medium containing 24.8 % of total sugar
(89 % theoretical ethanol yield) [6, 20].As the properties of yeast thermotolerance are
controlled by so many genes and mediated through so many pathways, the achieve-
ments of previous studies were not efficient adequately.
In this study, the ethanol production of thermotolerant yeast F3 constructed
through genome shuffling and its control strain AY12 was measured by four
techniques at different temperature to verify the advantages of F3. Then the fer-
mentation conditions were optimized by orthogonal test.
106 Study on the Application of a Thermotolerant 995
106.2 Material and Method
106.2.1 Strain and Incubate Conditions
In this study, S. cerevisiae AY12 used is an industrial diploid strain. S. cerevisiae

F3 is a thermotolerant yeast constructed through genome shuffling based on AY12.
The first stage seed medium: 0.5 % yeast extract is added to 8Brix corn
hydrolyzate. It is sterilized at 100 C for 15 min and then cooled to room tem-
perature before used.
The second stage seed medium: 0.5 % yeast extract is added to 12Brix corn
hydrolyzate. It is sterilized at 100 C for 15 min and then cooled to room tem-
perature before used.
Raw material fermentation medium: 60 g corn flour is in a 250 ml flask, then add
130 ml water (60-70 C), 20 min later, 30 ll (10 U/g) amylase, 90 ll (150 U/g)
glucoamylase, 1.2 ml acid protease (15 U/g), 1 ml nutrient solution (150 g MgSO4/L,
75 g KH2PO4/L, 81 g CON2H4/L) is added. The mash is cooled to room temperature
before used.
The ripe material fermentation medium: 60 g corn flour is in a 250 ml flask,
then add 130 ml water (60-70 C), 20 min later, 30 ll (10 U/g) amylase is added
and incubated at 85-90 C for 1.5 h in a water bath incubator, 90 ll (150 U/g)
glucoamylase is added and incubated at 55-60 C for 20 min in a water bath
incubator, 1.2 ml acid protease (15 U/g), 1 ml nutrient solution is added and
incubated at 55-60 C for 20 min in a water bath incubator. The mash is cooled to
room temperature before used.
Analog technique fermentation medium: It is the same as the ripe material
fermentation medium. Simultaneous saccharification and fermentation medium:
60 g corn flour is in a 250 ml flask, then add 130 ml water (60-70 C), 20 min
later, 30 ll (10 U/g) amylase is added and incubated at 85-90 C for 1.5 h in a
water bath incubator, 90 ll (150 U/g) glucoamylase, 1.2 ml acid protease (15 U/g),
1 ml nutrient solution is added. The mash is cooled to room temperature before
used.
106.2.2 Fermentation Technique
The seed culture process of four kinds of techniques in our study is same. Firstly, the
strain is inoculated into tube with 4 ml sterilized the first stage seed medium, static
culture for about 24 h. Then put it all into 250 ml flask with 36 ml sterilized the
second stage seed medium, static culture for 16-17 h. Then the inoculum is added
to fermentation medium by size of 10 %. The mash is incubated at the given tem-
perature. In the process of analog technique, the mash is firstly incubated at 30 C
during the initial 11 h, then at 40 C for the rest time (about 61 h). Ethanol was
removed from the fermented mash via distilling apparatus at the end of fermentation.
996 Y. Li et al.
106.3.1 Effect of Different Temperature on the Ethanol

Production of F3 and AY12
In order to investigate the effect of different temperature on the ethanol production

of AY12 and F3 which was constructed through genome shuffling in our previous
work, we separately tested their ethanol productions in temperatures of 30 C,
35 C, 38 C, 40 C, 42 C, respectively, and the results are showed in Fig. 106.1.
As can be seen from Fig. 106.1, the ethanol production of AY12 and F3 were
almost the same at 30 C. While the performance of F3 was better than AY12 at
35 C, 38 C, 40 C, when the incubate temperature rise to 42 C, the ethanol
production of these two strains was almost identical. Though the ethanol pro-
duction of both strains decreased as the increase of the incubate temperature, it is
obvious that the ethanol production of F3 was higher than AY12 at almost all the
temperatures. According to the results above, it is obvious that the thermotolerance
of the strain was increased compared with the control strain AY12. In conclusion,
the strain F3 constructed through genome shuffling displays a higher thermotol-
erance compared with strain AY12.
106.3.2 Effect of Fermentation Technique and Temperature

on the Ethanol Production of F3 and AY12
In order to determine the most appropriate fermentation technique of the thermo-

tolerant strain F3, experiments were carried on through different techniques (raw
material fermentation technique, ripe material fermentation technique, analog
fermentation technique, simultaneous saccharification, and fermentation technique)
Fig. 106.1 Effect of ethanol 16
AY12
production of AY12 and F3 at F3
different incubate 15
Ethanol production(%,v/v)
temperature
14
13
12
11
10
8
30 35 40 45
Temperature( )
Table 106.1 Fermentation result of AY12

Ethanol Techniques
production
Raw material Ripe material Simultaneous Analog
(%,v/v)
fermentation fermentation saccharification and fermentation
technique technique fermentation technique technique
Temperature 30 8.0 15.0 15.0 15.0
(C) 38 10.1 13.9 11.2 12.0
40 9.3 10.0 10.6 9.5
Table 106.2 Fermentation result of F3

Ethanol Techniques
production
Raw material Ripe material Simultaneous Analog
(%,v/v)
fermentation fermentation saccharification and fermentation
technique technique fermentation technique technique
Temperature 30 9.5 15.0 15.0 14.8
(C) 38 10.1 14.3 12.2 13.9
40 8.8 10.2 11.1 12.4
at different temperatures. 30 C, 38 C, 40 C had been selected as the fermentation

temperatures. The results are showed in Tables 106.1 and 106.2.
According to the results above, the ethanol production of ripe material fer-
mentation technique (15, 14.3, 10.2) was highest of all four fermentation tech-
niques, and that of raw material fermentation technique (9.5, 10.1, 8.8) was the
lowest of all these technique at temperature of 30 C, 38 C, 40 C, respectively.
At 38 C, the ethanol production of raw material fermentation technique
increased first compared with that at 30 C, and then decreased when the tem-
perature rise to 40 C. But we all know that the production cost of ripe material
fermentation technique is very high and this is not suitable to actual production.
Therefore, considering both of the production cost and fermentation results,
simultaneous saccharification and fermentation is the best technique for the
ethanol production of F3.
106.3.3 Optimization of the Fermentation Conditions of F3

Through Simultaneous Saccharification
and Fermentation Technique
In order to save the material and shorten the fermentation time, here we studied the
optimum fermentation conditions of F3. We tested three factors that influence
simultaneous saccharification and fermentation condition for ethanol production
via single-factor test. The three factors are ratios of material to water, inoculum
998 Y. Li et al.
concentration and fermentation time. And then, we optimized the fermentation

process through orthogonal test.
106.3.3.1 Effect of Ratios of Water to Material on Alcohol Production
Ratios of water to material were adjusted to 2.4, 2.6, 2.8, 3.0, and 3.2; the
experimental data is shown in Fig. 106.2. As presented, the yield of ethanol
exhibits a basically stable situation when ratio of water to material is in the range
of 2.2–2.8. However, as the ratios of water to material rise above 2.8, the ethanol
production was significantly decreased.
106.3.3.2 Effect of Inoculum Concentrations on Alcohol Production
Inoculum concentration also plays an important role in ethanol production. Fer-

mentation time will be extended if the inoculum concentration is too small.
However, large inoculum concentration leads to a high inoculum cost. 10 ml,
15 ml, 20 ml, 25 ml inoculum were added to the mash. Results are showed in
Fig. 106.3. As we can see, the ethanol production will be not increased when the
inoculum concentration rise above 15 ml.
106.3.3.3 Effect of Fermentation Time on Alcohol Production
Shorter fermentation time means lower cooling cost, higher equipment utilization,
and business profits, so the fermentation time was optimized. As results presented
in Fig. 106.4, the ethanol production rise slower than previous time after 48 h. The
production would not increase if fermentation time was prolonged.
Fig. 106.2 Effect of ratios of 16

water to material on alcohol Ethanol production
production 15
Ethanol production (%,v/v)
14
13
12
11
10
8
2.0 2.2 2.4 2.6 2.8 3.0 3.2 3.4
Ratios of material to water
Fig. 106.3 Effect of 16

inoculum concentrations on Ethanol production
alcohol production 15

14
13
12
11
10
8
5 10 15 20 25 30
Inoculum concentration(ml)

fermentation time on alcohol Ethanol production
production 15
14
13
12
11
10
8
20 30 40 50 60 70 80
Fermentation time (h)
106.3.3.4 Orthogonal Test
According to the results of the single-factor tests, ratios of water to material,

inoculum concentration, and fermentation time were optimized by orthogonal
experiment. Ratios of water to material 2.8, inoculum concentration 15 ml, fer-
mentation time 48 h were used as intermediate level in the orthogonal tests. The
experimental design and results of analysis are showed in Tables 106.3 and 106.4.
Based on the results of experiments, the influence of factors on the ethanol
production was ordered from larger to little as the amount of. As can be seen from
Table 106.4, the best combination was A1B3C3, revealing that the optimized
fermentation conditions are as follow: ratios of water to material 2.6, inoculum
concentration 25 ml, fermentation time 56 h.
1000 Y. Li et al.
Table 106.3 Factors and levels of orthogonal test

Level Ratios of water to material Inoculum concentration Fermentation time Blank
(A) (B) (C)
1 1:2.6 15 48
2 1:2.8 20 52
3 1:3.0 25 56
Table 106.4 Results of orthogonal test

Test No. Factors
Ratios of water to Inoculum Fermentation Blank Result
material (A) concentration (B) time (C)
1 1 1 1 1 11.2
2 1 2 2 2 11.8
3 1 3 3 3 12.2
4 2 1 2 3 11.5
5 2 2 3 1 11.9
6 2 3 1 2 11.7
7 3 1 3 2 11.8
8 3 2 1 3 11.2
9 3 3 2 1 11.5
Mean1 11.733 11.500 11.367 11.533
Mean2 11.700 11.633 11.600 11.767
Mean3 11.500 11.800 11.967 11.633
Pole difference 0.233 0.300 0.600 0.234
Order Fermentation time [ ratios of water to material [ inoculum
concentration
Optimized A1 B3 C3
factor
Optimized A1B3C3
combination
Table 106.5 Results of verification testing

1 2 3 Average
Ethanol production ( % vol) 12.1 12.1 12.2 12.1
At last, three parallel experiments which have been carried out on ethanol
fermentation by the optimal technique to verify the orthogonal test result
(Table 106.5). The ethanol productions of them were 12.1, 12.1, 12.2, respec-
tively, and the average was 12.1.
106.4 Conclusion
From all the experiments above, we have verified the advantage of the thermotolerant
strain F3 compared with its control strain AY12. Simultaneous saccharification and
fermentation technique has been identified to be the proper technique for F3 through
the ethanol production comparison of four techniques. The fermentation conditions
were optimized via single-factor test and orthogonal test. The optimal fermentation
conditions are as follows, the ratio of nutriment and water 1:2.6, inoculum size
25 ml, fermentation period 56 h.
Acknowledgments This work was financially supported by the program of the National
Agricultural Research Projects Fund (Grant No. 2012AA021505), the Cheung Kong Scholars and
Innovative Research Team Program in University of Ministry of Education, China (Grant No.
IRT1166), and Tianjin Municipal High School Science and Technology Development Fund
Program, China (No. 20110625).
References
1. Matsushika A, Inoue H, Murakami K et al (2009) Bioethanol production performance of five

recombinant strains of laboratory and industrial xylose-fermenting Saccharomyces
cerevisiae. Bioresour Technol 100:2392–2398
2. Bothast RJ, Schlicher MA (2005) Biotechnological processes for conversion of corn into
ethanol. Appl Microbiol Biotechnol 67:19
3. Najmul AR (2003) Optimization and Cost Estimation of Novel Wheat Biorefining for
Continuous Production of Fermentation Feedstock. Biotechnol Bioeng 23:872–880
4. Basso LC, De Amorim HV, De Oliveira AJ et al (2008) Yeast selection for fuel ethanol
production in Brazil. FEMS Yeast Res 8:1155–1163
5. Cardona CA, Sánchez ÓJ (2007) Fuel ethanol production: Process design trends and
integration opportunities. Bioresour Technol 98:2415–2457
6. Abdel W, Fattah R (2000) Isolation of thermotolerant ethanologenic yeasts and use of
selected strains in industrial scale fermentation in an Egyptian distillery. Biotechnol Bioeng
68:531–535
7. Limtong S, Sringiew C, Yongmanitchai W (2007) Production of fuel ethanol at high
temperature from sugar cane juice by a newly isolated Kluyveromyces marxianus. Bioresour
Technol 98:3367–3374
8. Kida K, Kume K, Morimura S et al (1992) Repeated-batch fermentation process using a
thermotolerant flocculating yeast constructed by protoplast fusion. J Ferment Bioeng
74:169–173
9. Shen Y, Tang Q, Wu TX(2010) Optimization of clear liquid fermentation condition for
ethanol production from Canna edulis Kerl. Natural Science 2:115-119
10. Claassen PAM, Lier JB, Lopez AM et al (1999) Utilisation of biomass for the supply of
energy carriers. Appl Microbiol Biotechnol 52:741
11. Sridhar M, Kiran N, Venkateswar L (2002) Effect of UV radiation on thermotolerance,
ethanol tolerance and osmotolerance of Saccharomyces cerevisiae VS1 and VS3 strains.
Bioresour Technol 83:199–202
12. Rajoka MI, Ferhan M, Khalid AM (2005) Kinetics and thermodynamics of ethanol
production by a thermotolerant mutant of Saccharomyces cerevisiae in a microprocessor-
controlled bioreactor. Lett Appl Microbiol 40:316–321
1002 Y. Li et al.
13. Balakumar S, Arasaratnam V, Balasubramaniam K (2001) Isolation and improvement of a

thermotolerant Saccharomyces cerevisiae strain. World J Microbiol Biotechnol 17:739–746
14. Sakanaka K, Yan W, Kishida M et al (1996) Breeding a fermentative yeast at high
temperature using protoplast fusion. J Ferment Bioeng 81:104–108
15. Petek Z, Akar U (2002) Evolutionary engineering of multiple-stress resistant Saccharomyces
cerevisiae. FEMS Yeast Res 5:569–578
16. Ratnam BVV, Narasimha Rao M, Damodar Rao M et al (2005) Optimization of fermentation
conditions for the production of ethanol from sago starch using response surface
methodology. World J Microbiol Biotechnol 19:523–526
17. Shi D, Wang C, Wang K (2009) Genome shuffling to improve thermotolerance, ethanol
tolerance and ethanol productivity of Saccharomyces cerevisiae. J Ind Microbiol Biotechnol
36:139–147
18. D’Amore T, Celotto G, Russell I et al (1989) Selection and optimization of yeast suitable for
ethanol production at 40 C. Enzyme Microb Technol 11:411–416
19. Banat IM, Nigam P, Marchant R (1992) Isolation of thermotolerant, fermentative yeasts
growing at 52 C and producing ethanol at 45 C and 50 C. World J Microbiol Biotechnol
8:259
20. Laopaiboon L, Nuanpeng S, Srinophakun P et al (2009) Ethanol production from sweet
sorghum juice using very high gravity technology: Effects of carbon and nitrogen
supplementations. Bioresour Technol 100:4176–4182
Chapter 107
Different Chemicals Stimulate Diapause
Termination of Artemia Embryos
Yuqing Chen and Bo Zhang
Abstract This paper studied the effect of the chemicals on the diapause
termination of the Artemia cysts, including reactive oxygen species (ROS) pro-
ducing reagent CaO2, reactive nitric species (RNS) producing reagent NO, and
antioxidant reagents tea polyphenol (TP) and ascorbic acid (VC). The results
showed that all the tested chemicals could significantly promote Artemia cysts
development, and the optimum range for CaO2, TP, VC, and sodium nitroprusside
(SNP, NO generators) was 38–94, 50–150, 625–2500, and 25–100 mg/L,
respectively. The hatching percentage (H %) was raised from 20 % for the control
group to 86 % for the CaO2 treated group, 86 % for the TP treated group, 85 % for
the VC treated group, and 67 % for the SNP treated group, respectively. An
analysis of trehalose consumption and glycerol accumulation of the Artemia cysts
was also performed during incubation.
Keywords Artemia cysts Chemical stimulation Diapause termination

Trehalose
107.1 Introduction
To survive from harsh environment, Artemia tends to release encysted gastrulae

(cysts) instead of swimming larvae (nauplii). The cysts usually have low level of
development and remarkable tolerance to hypoxia, anoxia, and temperature
Y. Chen B. Zhang
B. Zhang (&)
Tianjin Key Laboratory of Marine Resources and Chemistry, College of Marine Science
and Engineering, Tianjin University of Science and Technology, Tianjin 300457,
e-mail: zhangbo@tust.edu.cn
1004 Y. Chen and B. Zhang
variations [1–3]. It has been reported that in a short period after cysts being
released, they remain in diapause and the hatching percentage (H %) is very low,
even under the optimal environmental conditions [4].
Eggs remaining in diapause stage need specific stimuli and right environmental
conditions to resume development [5]. Physical factors, such as dehydration/
rehydration, freezing/thawing, and light alone or in combination, are considered as
useful tools to terminate diapause and promote development of Artemia cysts
[6–9], though the intracellular molecular changes driven by these factors are not
yet known. Compared to the physical process, chemical treatments are easily to
control.
Three kinds of chemical stimulations have been confirmed having apparent
effects on the hatching of encysted gastrulae, including oxidants (e.g., hydrogen
peroxide, H2O2 and/or calcium peroxide, CaO2) [10, 11] antioxidants (e.g., tea
polyphenol, TP) [12], and second messenger nitric oxide (NO) [13]. The oxidants
are regarded as reactive oxygen species (ROS) signal producer. However, the
antioxidants are well known for clearance of ROS. NO is related to reactive nitric
species (RNS). Interestingly, all of them play key roles in promoting the devel-
opment of Artemia cysts.
In this work, chemicals including CaO2, NO, TP, and vitamin C (VC) were
applied to investigate their induction on diapause termination and development of
Artemia embryos. To our best knowledge, this is the first time to introduce vitamin
C in similar researches.
Cysts from a parthenogenetic Artemia strain were harvested in Seitien, Kazakhstan

in September, 2011. After the removal of impurities (such as empty shells and
debris), the cysts were soaked in brine (salinity of 150) for 2 h, and then collected
with a 0.125 mm sieve. The purified cysts were stored at -20 C.
107.2.1 Hatching Assays
Four chemicals, including NO generator sodium nitroprusside (SNP), H2O2 sup-

plier (CaO2), TP, and VC, were added into hatching medium at the beginning of
incubation. Their final concentrations in the medium were selected within the
range from 5–250 mg/L for SNP, 2–113 mg/L for CaO2, 3–250 mg/L for TP, and
10–2500 mg/L for ascorbic acid (VC), respectively. As the addition of VC
remarkably reduced the medium acidity, NaOH was used to adjust pH to 7.5. The
pH values remained constant when the cysts were treated by TP, SNP and CaO2.
Briefly, cysts were immersed in brine (salinity of 30) for 20 min after unfrozen for
24 h and then hatched under the standard hatching conditions [14]: the salinity of
107 Different Chemicals Stimulate Diapause Termination 1005
25, pH 8.0, the temperature of 28 ± 1 C, the density of about 2.5 g cysts dry
matter per liter, the illumination of 2000 lux, and continuous aeration. The
hatching percentage (H %) was recorded after 24 h incubation unless otherwise
stated.
107.2.2 Analysis of Trehalose and Glycerol Contents

in Decapsulated Cysts
To analyze the content of trehalose and glycerol in the cysts at each time point
after the chemical treatment, the sample was collected and rinsed thoroughly with
running water to remove traces of chemicals after incubation of 0, 2, 4, 6, 8, 10 h.
Each sample was divided into two parts, one part was further hatched in seawater
to assay H % and the other was decapsulated and the contents of trehalose and
glycerol were analyzed. About 0.5 g decapsulated cysts were homogenized in
4.5 mL 72 % ethanol on ice, and then centrifuged at 9 800 g (0 C) for 10 min to
remove the insoluble fragments. The supernatants were to 5 mL with the addition
of 72 % ethanol, and the contents of trehalose and glycerol were analyzed by high-
performance liquid chromatography (HPLC) [15]. The results were recorded as the
percentage of mg trehalose/glycerol per mg dry weight of decapsulated cysts.
107.3 Results and Discussions
107.3.1 Chemicals Induction Analysis
As shown in Fig. 107.1, similar hatching efficiencies were obtained by the addition
of CaO2, TP, and VC to the hatching medium respectively. The optimal concen-
trations for achieving the highest hatching percentage were 75 mg/L for CaO2 and
TP, and 1250 mg/L VC. While maximum cyst development obtained with SNP
was about 67 %. When SNP concentration reached to 250 mg/mL, H % dropped
to zero. This inhibition may be due to the harmful effect of SNP. To our knowl-
edge, this is the first time to point that VC could improve diapause termination
greatly, which is another example of ROS elimination.
107.3.2 Analysis of Diapause Termination
As the proceeding of incubation, the amount of trehalose dropped significantly

from 2–10 h. The reduction percentage was 14.1 % (control group), 50.2 % (H2O2
treated group), 68.8 % (CaO2 treated group) and 71.9 % (TP treated group)
Fig. 107.1 Hatching percentage of Artemia cysts treated by different chemicals. 0.5 g of cysts in
non-supplemented sea water added with CaO2 (a), TP (b), VC (c) or SNP (d) were hatched with
rotation for 24 h. Results are presented as the mean values of three replicates with error bars
representing standard deviation, and the X-axis for C and D is log10. The data were analyzed by a
non-linear regression. If the error bars are not shown, the error is smaller than the symbol
(Fig. 107.2a). The results indicated that trehalose deduction might correlate with
hatching rate of each sample. The content of glycerol increased from 5.7–9.0 % at
first 6 h and reduced to 5.0 % at 10 h with 85 larvae developed per 100 cysts
induced by TP (Fig. 107.2b). Before 6 h, the longer TP and CaO2 accompanied
cysts during incubation, the higher H % presented. However, the H % remained at
about 61 % by H2O2 treatment and at 10 % of control sample (Fig. 107.2c). At
first 2 h, the increase rate of trehalose was 6.5 % for control sample, 13.7 % for
H2O2 treatment, 6.5 and 5.5 % for CaO2 and TP treatment respectively. The results
for each time point were subjected to two-way analysis of variance (ANOVA)
followed by F-test. Both trehalose (P \ 0.05) and glycerol (P \ 0.01) had
increased at first 2 h, which indicated diapause had been terminated and metabolic
process had started in this period. It has been reported that when diapause was
broken [7], the trehalose metabolism would be initiated, undergoing complete
oxidation and serving as a substrate for glycogen and glycerol synthesis [8, 16].
The result in this study indicated that the consumption of trehalose started from
2 h. In consideration of short treatment time of H2O2, molecular switch might have
been triggered before hatching, and that suggested that trehalose might not be the
Fig. 107.2 Different performance by varying stimulation. With different stimulation, trehalose
(a), glycerol (b), and H % (c) yielded various changes at each time point during the incubation.
The aliquot treated by H2O2 was prehydrated in water for 60 min. Before hatching in non-
supplemented sea water, these cysts were collected on a sieve and rinsed thoroughly with running
water to remove traces of H2O2. The last two were hatched with CaO2 and TP added separately at
the beginning of incubation. u—control sample, s—H2O2 (3 %, w/w, 10 min), m—CaO2
(75 mg/L), 9 —TP (60 mg/L)
key of switch. There may be another unknown energy system functioning

immediately after diapause termination.
No direct evidence was provided here, but Clegg’s research on diguanosine
(Gp4G) has supported this assumption [17]. Wang et al. reported the activation of
cellular was ignited as early as 0.5 h after rehydration [18], which confirmed the
changes in some substance in the first 2 h. Studies suggested that diapause was
triggered by external and internal signals, and the molecular switches, playing
regulatory roles, were considered as the central issues in the study of diapause
[19]. More researches have been conducted to investigate the potential mecha-
nisms and the characteristics of the chemicals as the specific stimuli of diapause
termination. The studies mainly focused on the investigation of gene expression,
differential mRNA, and proteomic profiling during post-diapaused embryonic
development of Artemia franciscana [18, 20, 21], but there is a lack of these
investigations after chemical stimulation.
107.4 Conclusion
This work studied the effect of the chemicals (CaO2, TP, VC, and SNP) on the
diapause termination of the Artemia cysts. The results showed that the tested
chemicals significantly promoted Artemia cysts development, and the optimum
range for CaO2, TP, VC, and SNP was 38–94, 50–150, 625–2500, and 25–100 mg/L,
respectively. The hatching percentage (H %) was raised from 20 % for the control
group to 86 % for the CaO2 treated group, 86 % for the TP treated group, 85 % for the
VC treated group, and 67 % for the SNP treated group, respectively. Additionally,
the rate of trehalose consumption and glycerol accumulation inside the Artemia cysts
was also measured.
Acknowledgments This study was supported by the International Cooperation Research Pro-
gram of the Ministry of Science & Technology of China (grant number CK08-03 and
2010DFA32300).
References
1. Clegg JS (1997) Embryos of Artemia franciscana survive four years of continuous anoxia:
the case for complete metabolic rate depression. J Exp Biol 200:467–475
2. MacRae TH (2003) Molecular chaperones, stress resistance and development in Artemia
franciscana. Semin Cell Dev Bio 14:251–258
3. Clegg JS (2007) Protein stability in Artemia embryos during prolonged anoxia. Biol Bull
212:74–81
4. Clegg JS, Conte FP (1980) A review of the cellular and developmental biology of Artemia.
In: Persoone G, Roels O, Jaspers E (eds) The brine shrimp Artemia. Universa Press,
Wetteren, Belgium
5. Kostal V (2006) Eco-physiological phases of insect diapause. J Insect Physiol 52:113–127
6. Li Y (2008) Differential proteomic analysis in different development stages of Artemia
sinica. Master thesis, Liaoning Normal University (in Chinese)
7. Drinkwater LE, Clegg JS (1991) Experimental biology of cyst diapause. In: Browne RA,
Sorgeloos P, Trotman CNA (eds) Artemia biology. CRC Press, Boca Raton
8. Boulton AP, Huggins AK (1977) Biochemical changes occurring during morphogenesis of
the brine shrimp Artemia salina and the effect of alterations in salinity. Comp Biochem
Physiol A: Mol Integer Physiol 57:17–22
9. Clegg JS (1986) The physical properties and metabolic status of Artemia cysts at low water
contents. In: Leopold AC (ed) Membranes, metabolism and dry organisms. Cornell
University Press, Ithaca
10. Van Stappen G, Lavens P, Sorgeloos P (1998) Effects of hydrogen peroxide treatment in
Artemia cysts of different geographical origin. Adv Limnol 52:281–296
11. Naessens E, Trackaert W, Van NL et al (2002) Method for producing free swimming Artemia
nauplii and packaged cysts for use in that method. European, EP1195088A1, 10.04.2002
12. Fan XY (2008) Method to hatch free swimming nauplii from Artemia cysts. China,
ZL200710137409.8, 05.12.2008 (in Chinese)
13. Robbins HM, Van Stappen G, Sorgeloos P et al (2010) Diapause termination and
development of encysted Artemia embryos: roles for nitric oxide and hydrogen peroxide.
J Exp Biol 213:1464–1470
14. Lavens P, Sorgeloos P (eds) (1996) Manual on the production and use of live food for
aquaculture. FAO fisheries technical paper, Rome
15. Yue ME, Niu X (2009) Determination of trehalose and glycerin in Artemias by high
performance liquid chromatography. Chem. Reagents 31:375–376 (in Chinese)
16. Clegg JS (1964) The control of emergence and metabolism by external osmotic pressure and
the role of free glycerol in developing cysts of Artemia salina. J Exp Biol 41:879–892
17. Warner AH, Clegg JS (2001) Diguanosine nucleotide metabolism and the survival of artemia
embryos during years of continuous anoxia. Eur J Biochem 268:1568–1576
18. Wang WW, Meng B, Chen WH et al (2007) A proteomic study on postdiapaused embryonic
development of brine shrimp (Artemia franciscana). Proteomics 7:3580–3591
19. MacRae TH (2010) Gene expression, metabolic regulation and stress tolerance during
diapause. Cell Mol Life Sci 67:2405–2424
20. Tate WP, Marshall CJ (1991) Post-dormancy transcription and translation in the brine
shrimp. In: Browne RA, Sorgeloos P, Trotman CNA (eds) Artemia biology. CRC Press, Boca
Raton
21. Chen WH, Ge XM, Wang WW et al (2009) A gene catalogue for post-diapause development
of an anhydrobiotic arthropod Artemia franciscana. BMC Genomics 10:52
Chapter 108
Dominant Bacteria TCCC15005 Used
for Treatment of Alkaline Wastewater
from Oil Refinery in a SBR
Jing Yang, Hua Zhao, Xi Wang, Xin Feng and Xinhua Wang
Abstract Biological treatment was an important and integral part of any wastewater
treatment plant that treats wastewater from either municipality or industry. In this
study, dominant bacteria TCCC15005 was used for treating alkaline wastewater
from oil refinery in a SBR system. Subsequently, the optimized treatment conditions
were investigated. The result indicated that the optimized treatment conditions were
0.5 % corn mill, 1.0 % corn steep liquor, 0.2 % MgSO47H2O, 1.03 g/L inoculation
amount, 35 C, pH 7.5. And the treatment time was 28 h. Under the optimal
conditions, the removal rate of COD can reach 84.16 %.
Keywords Alkaline wastewater Dominant bacteria Sequencing batch reactor

(SBR) Treatment conditions
108.1 Introduction
In the process of oil refining, the alkaline wastewater was mainly resulted from the
process of removing acid liquid of straight-run diesel and gasoline by alkaline
cleaning [1]. Such alkaline wastewater contained a lot of material of environ-
mental pollution, and even many carcinogens. The main components were sodium
hydroxide, naphthenic acid sodium, phenol sodium, sodium carbonate, sodium
sulfide and so on [2]. If this kind of alkaline wastewater was discharged directly, it
would contaminate the environment gravely; if it entered the wastewater treatment
system without disposal, it would have seriously impacted on both the subsequent
disposal process and water quality [3].
J. Yang H. Zhao (&) X. Wang X. Feng X. Wang

College of Bioengineering, Tianjin University of Science and Technology,
e-mail: zhaohua@tust.edu.cn
1012 J. Yang et al.
Petrochemical production technology had grown more sophisticated in recent

years. Organic substances in alkaline wastewater tended to be prosperous, which
caused a great burden to traditional treatment process [4]. Nowadays most of
alkaline wastewater disposal techniques was based on the recovery of the naph-
thenic acid sodium and phenol sodium [5, 6] while the alkaline residue wastewater
should be processed after the recovery [7].
Biotechnology of treating alkaline wastewater had a long history [8]. Modern
biotechnology, especially selecting and cultivating dominant bacteria, could
enhance the biological systems removal capability to refractory organics [9].
Comparing with other methods, this method had many advantages, such as lower
cost, higher efficiency, easier to be handled and without secondary pollution. All
those characteristics attracted a great of attention from all over the world. There had
been many relevant searches on this issue in different fields, including printing and
dyeing, chemical waste water and so on [10].The sequencing batch reactor (SBR)
system was a fill-and-draw activate-sludge treatment system that could be applied
to treat piggery wastewater, either in aerobic/anoxic conditions [11], or in anaerobic
digestion [12], domestic sewage [13], industrial sewage [14–16] and so on.
Now, feasibility of using combined dominant bacteria and SBR for oilfield
wastewater treatment had been reported [17]. The present work was focused on
optimization of treatment condition, namely carbon source, nitrogen source,
inorganic salt, inoculum concentration, pH, temperature and the treating time. The
biological treatment conditions could provide data and technical support to prac-
tical application in alkaline wastewater.
108.2.1 Microorganisms and Culture Medium
One bacterial strain, TCCC15005 was isolated from sludge nearby a petroleum
smelter [18]. The culture medium was LB medium containing tryptone 10 gL-1,
yeast extract 5 gL-1, sodium chloride (NaCl) 10 gL-1, the pH values of the
media were adjusted to the optimum pH values of 7.0. Prior to use,the media were
sterilized in an autoclave at 121 C for 20 min. The flasks were incubated at 37 C
in a rotary shaker at 120 r/min [19]. After 24 h, centrifuging at 4,000 r/min for
10 min, cleaning twice, collecting bacteria and blending with sterilized bran, then
drying it, and keeping in 4 C.
108.2.2 Pretreated Alkaline Wastewater
Alkaline wastewater obtained from oil refinery should be pretreated. Firstly, 5.5 %
sulfate acids was added. 24 h later, the sublayer liquid was collected and used as
experimental material. Table 108.1 showed the properties that the sublayer liquid
and their values after these pretreatment operations.
108 Dominant Bacteria TCCC15005 Used for Treatment 1013
Table 108.1 Composition of sublayer liquid

Properties pH COD (mg/L) Sulfide (mg/L) Phenol (mg/L)
Values 6.13 58016 10196 41.39
108.2.3 Sequencing Batch Reactor (SBR)
The SBR process was presented in Fig. 108.1.

One 1.5-L reactor, as shown in Fig. 108.1, was used in the experiments. The
dominant bacteria was inoculated in the SBR reactors and pretreated alkaline
wastewater was added (final volume of 1.0 L). During the feeding of the waste-
water, the reaction system was fully aerated and the aeration continued for 22 h.
The reaction process was then shut down for 5 h. After full settling of the bio-
sludge, the 1/2–2/3 supernatant was removed. Then the alkaline wastewater was
filled into the reactor up to the final volume of 1.0 L and the above operation was
repeated [20, 21].
108.2.4 Method of COD Determination
The COD in alkaline wastewater was determined by potassium dichromate

method [22].
108.2.5 Determination of the Optimized Treatment

Condition and Treating Time
Carbon sources, nitrogen sources, inorganic salt, inoculum concentration, pH,

temperature and the treating time were varied accordingly in the optimization
dilution water
fresh water
air
dosing tank
biological reaction
alkaline water tank

regulation
buffer tank
tank
Fig. 108.1 SBR process

1014 J. Yang et al.
experiments, carbon sources each at 0.5 %, nitrogen sources each at 1.0 %,and
inorganic salt each at 0.2 %, temperature range of 10–60 C, pH range of 6–8.5.
At the same time, different inoculum concentration, treating time and consecutive
treatment were investigated.
108.3.1 Effects of Nutrient Substance on the Cod Removal

Rate
In the process of treating alkaline wastewater, bacteria took all kinds of organic
pollutant as nutrition for their growth. But nutrients of pretreated alkaline
wastewater may not completely meet the need of bacteria, in that case, some extra
nutrients should be added.
108.3.1.1 Effects of Carbon Sources on the Cod Removal Rate
In order to research the effect of adding carbon sources on the COD removal rate,
we chose glucose, sucrose, starch, maltose and corn mill as carbon source. It could
be concluded from the results presented graphically in Fig. 108.2 that TCCC15005
can use various carbon sources, but the best carbon source was corn mill and
additive amount was 0.5 %.
108.3.1.2 Effects of Nitrogen Sources on the Cod Removal Rate
The influence of nitrogen sources and additive amount on the COD removal rate
was investigated.In the treatment process, adding nitrogen source can increase the
COD removal rate, the COD removal rate was illustrated as Fig. 108.3. Because of
its high COD removal rate and economic applicability, corn steep liquor was
chosen as nitrogen source and its optimal additive amount was 1 %.
108.3.1.3 Effects of Inorganic Salt on the Cod Removal Rate
Inorganic salt was the indispensable substances of microbial life activities, so

different inorganic salt magnesium sulfate (MgSO47H2O), sodium dihydrogen
phosphate (NaH2PO412H2O), potassium phosphate(K3PO4), calcium chloride
(CaCl2), manganese sulfate(MnSO4) were added to increase COD removal rate. It
was showed that the optimum inorganic salt was magnesium sulfate
(MgSO47H2O) and its additive amount was 0.2 % (Fig. 108.4).
76.5
76
COD removal rate/%

75.5
75
74.5
74
73.5
73
72.5
glucose sucrose starch maltose corn mill
carbon source
Fig. 108.2 Effects of carbon sources on the COD removal rate. TCCC15005 was inoculated into
SBR reactor. 0.5 % (m:m) glucose, sucrose, starch, maltose and corn mill was added respectively.
0.50 g inoculum concentration. Then cultured at pH 7.0 at 37. 25 h later, the COD value was
measured
108.3.2 Effects of Inoculum Concentration on the Cod

Removal Rate
At the same time, the effect of inoculum concentration on COD removal rate was
tested. It was obvious from the date presented graphically in Fig. 108.5 that the
optimum inoculum concentration for TCCC15005 was 1.03 g at which the COD
removal rate is up to 81.65 %. When inoculum concentration was low, the deg-
radation was not obvious. With the inoculum concentration increased, the COD
removal rate increased gradually. When inoculum concentration was more than
1.03 g, COD removal rate was up to 81.65 %, about 10.46 % higher compared
with that of modified before. But the increment of COD removal rate was not
obvious if inoculum concentration continued to increase. So the optimum inocu-
lum concentration was 1.03 g considering comprehensively the degrading effi-
ciency and economy.
108.3.3 Effects of Treating Condition on the Cod Removal

Rate
108.3.3.1 Effects of Temperature on the Cod Removal Rate
The effect of temperature on the COD removal rate of combined TCCC15005 and
SBR was studied at temperatures ranging from 10 to 60 C (Fig. 108.6). It was
showed that the optimum treatment temperature for TCCC15005 with SBR was
1016 J. Yang et al.
Fig. 108.3 Effects of nitrogen sources on the COD removal rate. TCCC15005 was inoculated
into SBR reactor. 1.0 % (m:m) ammonium nitrate, ammonium sulfate, bran, yeast powder, corn
steep liquor was added respectively. 0.5 % (m:m) corn mill was used as carbon source. The
culture condition was as following, 0.50 g inoculum concentration, pH 7.0, 37. 25 h later, the
COD value was measured
Fig. 108.4 Effects of inorganic salt on the COD removal rate. TCCC15005 was inoculated into
SBR reactor. 0.2 % (m:m) different inorganic salt (MgSO47H2O, NaH2PO412H2O, K3PO4,
CaCl2, MnSO4) was added respectively. 0.5 % corn mill was used as carbon source and 1.0 %
corn steep liquor was used as inorganic salt. The culture condition was as following, 0.50 g
inoculum concentration, pH 7.0, 37 C. 25 h later, the COD value was measured
35 C, as in this case, the COD removal rate was up to 82.08 %. When the
temperature was less than 25 C or more than 40 C, the COD removal rate
decreased significantly.
3 90
80
2.5
COD removal rate %

COD×10 / mg/L)
70
2 60
4
1.5 50
40
1 COD 30
COD removal rate
0.5 20
0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 1.8 2
inoculum concentration/g
Fig. 108.5 Effects of inoculum concentration on the COD removal rate. TCCC15005 was
inoculated into SBR reactor according to six different inoculum concentrations (0.43, 0.63, 0.83,
1.03, 1.23, 1.43, 1.63 g). The culture condition were 0.5 % corn mill, 1.0 % corn steep liquor,
0.2 % MgSO47H2O, pH 7.0, 37 C. 25 h later, the COD value was measured
108.3.3.2 Effects of pH on the Cod Removal Rate
The influence of pH on the COD removal rate was investigated. Seven different
pH(6.0, 6.5, 7.0, 7.5, 8.0, 8.5) were test. It could be concluded from the results
presented graphically in Fig. 108.7 that pH would have a major influence to
bacteria breeding and COD removal rate. The optimum pH value for TCCC15005
with SBR was 7.5 at which the COD removal rate is up to 82.27 %. When
pH \ 6.5, COD removal rate was not obvious and less than 50 %. If pH was more
than 6.5, with pH increased, the COD removal rate also increased rapidly, until pH
is 7.5, COD removal rate reached the peak. If pH [ 7.5, the COD removal rate
decreased dramatically. So the optimum pH was 7.5.
108.3.4 Effects of the Treating Time on the Cod Removal

Rate
The treating time of SBR also affect the COD and COD removal rate. We get COD
and COD removal rate every 4 h. It could be concluded from the results presented
graphically in Fig. 108.8 that the optimum treating time was 28 h. At the begin-
ning, COD was higher than original alkaline wastewater because of adding bac-
teria. After 12 h, COD variation was not obvious because of bacterial extension
and logarithm. But from 12 to 28 h, bacteria was in stable phase and they has
exuberant metabolism, so COD removal rate increased dramatically and COD
removal rate was up to 84.16 %. But the increment of COD removal rate was not
obvious if treating time continued to increase because of decline phase. So we
determined that the treating time of SBR was 28 h.
1018 J. Yang et al.
2.3 85
2.1
80
1.9
COD removal rate(%)

COD×10 / (mg/L)
75
1.7
1.5 70
4
1.3 65
1.1
60
0.9
COD
0.7 55
COD removal rate
0.5 50
10 20 30 40 50 60
temperatures/
Fig. 108.6 Effects of temperature on the COD removal rate. TCCC15005 was inoculated into
SBR reactor and cultured at different temperatures which were ranging from 10 to 60 C. The
culture condition was as following, 0.5 % corn mill, 1.0 % corn steep liquor, 0.2 %
MgSO47H2O, 1.03 g inoculum concentration, pH 7.0. 25 h later, the COD value was measured
3.5 90
3 80
COD removal rate(%)

70
COD×10 4 /( mg/L
2.5
60
2 50
1.5 40
30
1
COD 20
0.5 10
COD removal rate
0 0
5.5 6 6.5 7 7.5 8 8.5 9
pH
Fig. 108.7 Effects of pH on the COD removal rate. TCCC15005 was inoculated into SBR
reactor. The condition of culture was as following, the volume of the alkaline wastewater which
was prepared at pH 6.0, 6.5, 7.0, 7.5, 8.0 and 8.5. The culture condition were 0.5 % corn mill,
1.0 % corn steep liquor, 0.2 % MgSO47H2O, 1.03 g inoculum concentration, 35 C. 25 h later,
the COD value was measured
108.3.5 Effects of Consecutive Treatment on the Cod

Removal Rate
In summary, dominant bacteria with SBR was used to treat alkaline wastewater
from oil refinery, the COD of alkaline wastewater decreased perceptibly under the
optimized condition after 28 h. But wastewater was polluted seriously and its
initial COD was high, so the COD of treated wastewater was still extremely high.
6 90
80
5
COD removal rate/%

70
COD×10 /(mg/L)
4 60
50
4
3
40
COD
2 COD removal rate 30
20
1
10
0 0
0 4 8 12 16 20 24 28 32 36 40
Time/h
Fig. 108.8 Effects of the processing time on the COD removal rate. TCCC15005 was inoculated
into SBR reactor. The culture condition was as following, 0.5 % corn mill, 1.0 % corn steep
liquor, 0.2 % MgSO47H2O, pH 7.5, 35 C, 1.03 g inoculum concentrations. Every 4 h, the COD
value was measured
100
the first treatment
90 the second treatment
COD removal rate/%
80
70
60
50
40
30
20
10
0
0 4 8 12 16 20 24 28 32 36 40
Time/h
Fig. 108.9 Effects of consecutive treatment on the COD removal rate. TCCC15005 was
inoculated into SBR reactor. The culture condition was as following, 0.5 % corn mill, 1.0 % corn
steep liquor, 0.2 % MgSO47H2O, pH 7.5, 35 C, 1.03 g inoculum concentrations. Every 4 h, the
COD value was measured. Then centrifuging treated alkaline wastewater at the speed 4,000 r/min,
10 min, and taking 30 mL clear liquid to 250 mL flask. The above step was repeated
The effect of consecutive treatment on the COD removal rate was researched.
According to the data presented graphically in Fig. 108.9, we known that the COD
removal rate was up to 84.16 % after the first treatment, and on that basis, by the
second treatment the COD removal rate was up to 90.69 %, which was 7.75 %
higher than a single disposal process. Through the second disposal process, the
COD removal rate increased unobviously. It appeared likely that alkaline waste-
water contained large amounts of sulfide and phenol which were harmful to
1020 J. Yang et al.
bacterial growth. So we can consider that reducing COD of alkaline wastewater by

removing toxic substances in order to achieve better results. Further studies were
necessary in this direction.
108.4 Conclusion
Through optimizing treating conditions with dominant bacteria into SBR, the
optimized conditions was ensured as follows: 0.5 % corn mill, 1.0 % corn steep
liquor, 0.2 % MgSO47H2O, 1.03 g/L inoculation amount, 35 C, pH 7.5. And
treating time was 28 h. In such optimized conditions, the removal rate of COD can
be up to 84.46 % and almost 13.85 % higher than before. So the method that
treating alkaline wastewater with dominant bacteria with SBR is feasible, the
treating efficiency was good. Moreover, the dominant bacteria still can use cheap
culture medium to degrade the alkaline wastewater, so it had important applicable
value and became foundation for industrial production.
References
1. Sublette KL (1997) A preliminary cost analysis of the biotreatment of refinery spent-sulfidic

caustic. Appl Biochem Biotech 63(1):695–696
2. Strom AD, Danilevskaya IP, Ptitsa RP et al (1970) Experiments in the biological purification
of petroleum refinery wastewater. Chem Technol Fuels Oils 6(4):277–280
3. Xie WY, Zhong L, Ren W et al (2009) Technological advances in treatment of alkaline
wastewater from petrochemical industry. Mod Chem Ind 29(6):28–31
4. Balcıoğlu IA, Ötker M (2003) Treatment of pharmaceutical wastewater containing antibiotics
by O3 and O3/H2O2 process. Chemosphere 50(1):85–95
5. Cheng LH, Chen JJ, Liu HB et al (2006) Commercial tests for alkaline wastewater treatment
by biologic catalytic oxidation. Pet Ref Eng 36(7):59–62
6. Cheng LH, Chen JJ, Zhong HW et al (2006) Pretreatment of alkaline wastewater from
refinery by biologic catalytic oxidation process. Pet Process Petrochem 37(3):64–67
7. Milan P, Miroslav S, Mirjana S et al (2008) Influence of the waste oil concentration in water
on the efficiency of the aeration process in refinery wastewater treatment. J Mech Eng
54(10):675–684
8. Matveev MS (1996) Biological purification of waste water from oil refineries. Chem Technol
Fuels Oils 2(5):329–332
9. Speece RE (1983) Anaerobic biotechnology for industrial wastewater treatment. Environ Sci
Technol 17(9):416–427
10. Eigenson AS, Loakimas EG, Lukinskaya NT et al (1974) Prospects for development in water
usage and water discharge in petroleum refineries and petrochemical plants. Chem Technol
Fuels Oils 10(9):665–667
11. Jern NW (1987) Aerobic treatment of piggery wastewater with the sequencing batch reactor.
Biol Wastes 22(4):285–294
12. Masse DI, Patni NK, Drostc RL et al (1996) Operation strategies for psychrophilic anacrobic
digestion of swine manure slurry in sequencing batch reactor. Can J Civil Eng 23(6):
1285–1294
13. Song JN (2012) Experimental research on ABR-SBR process for the treatment of domestic
sewage. China Rural Water Hydropower 0(2):75–77
14. Wei N, Ji K, Yu XQ et al (2012) Effects of pollutants removal by multi-stage sequencing
batch reactor (SBR) processes. Water Pur Technol 31(1):42–46
15. Han HJ, Zhou FX, Liu YS et al (2012) Experimental study of oil hydrocarbons in coal
chemical wastewater by SBR process. Water Wastewater Eng 38(2):57–60
16. Cai XP, Liu LC (2012) Study on the treatment of liquor-making wastewater by SBR. Liquor-
making Sci Technol 1:98–99
17. Li SC, Liu ZH, Li Z et al (2006) Treatment of oilfield produced wastewater with
SBR ? concentrated microorganisms. Urban Environ Ecol 16(S1):74–75
18. Zhao H, Cao QQ, Liu K et al (2009) Degrading conditions of the optimized strains in the
alkaline wastewater biological treatment. Appl Chem Ind 38(2):229–232
19. Banerjee A, Ghoshal AK (2010) Isolation and characterization of hyper phenol tolerant
Bacillus sp. from oil refinery and exploration sites. J Hazard Mater 176(1–3):85–91
20. Sirianuntapiboon S, Preeyatum A (2006) Some properties on the application of Candida utilis
TISTR No. 5001 into sequencing batch reactor (SBR) System. Afr J Biotechnol
5(23):2377–2387
21. Berent N, Delgenes N, Akunna JC et al (2000) Combined anaerobic-aerobic SBR for the
treatment of piggery wastewater. Water Res 34(2):611–619
22. Rocenkery M (1993) The fast method of the COD determination. Anal Lett 26(9):2025–2030
Chapter 109
Isolation and Characterization of a New
Moderately Halophilic Bacterium Strain
SM. 200-5 from Solar Saltern Ponds
Gaochao Xu, Yuangao Deng, Donghui Song and Liying Sui
Abstract A new moderately halophilic bacterium strain SM. 200-5 was isolated
from the solar saltern ponds with salinity 200 in Hangu Saltworks, Tianjin, China.
The cells of the strain SM. 200-5 were rods and Gram-negative. They could grow
in a salinity range of 30–150 and initial pH 6–11, with optimum of salinity 100 and
initial pH 7. 16S rDNA alignment showed that the strain SM. 200-5 had 93–95 %
similarity with those sequences of genus Salimicrobium sp.. Biochemical char-
acterization analysis via API 20E system indicated that biochemical characters of
the strain SM. 200-5 were partially different from Salimicrobium sp. ISL-25,
which was its closest member in the phylogenetic tree. Therefore, the strain SM.
200-5 proposed a new species of Salimicrobium.
Keywords Halophilic bacterium Phylogenetic analysis Salimicrobium sp.

16S rDNA
109.1 Introduction
Halophilic bacteria are defined as those microorganisms inhabiting hypersaline

environments such as salt lakes, salt mines, solar saltern ponds, and salted food
[1, 2]. Moderately halophilic bacteria manifest optimal growth in salinity 30–150
[3]. In response of the hypersaline environment, halophilic bacteria usually have
special physiological structures and produce valuable active compounds, such as
poly-b-hydroxybutyrate (PHB), extracellular polysaccharides, ectoine, and thus
possess the potential of biotechnological utilization [4–7]. Recent years many
researches have focused on the taxonomy [8, 9] and biodiversity [10–13] of the
G. Xu Y. Deng D. Song L. Sui (&)

Tianjin Key Laboratory of Marine Resources and Chemistry, Tianjin University of Science
e-mail: suily@hotmail.com
1024 G. Xu et al.
halophilic bacteria, as well as their metabolites (e.g., bacteriorhodopsin, halocins)

[14–17] and the ability to degrade pollutants (e.g., azo dye, hydrocarbon) [18, 19].
Halophilic bacteria play an important role in decomposing organic compounds
in solar saltern ponds. High density of halophilic bacteria reduces the viscosity of
the brine and enhances absorption of solar energy, and thus accelerates the
evaporation rate of the brine and improves the quality and quantity of the salt yield
[20]. A few studies have conducted in aspect of halobacterium in solar saltern
ponds. Yoon et al. [21] isolated a halophilic bacterial strain MSS-155 from a
marine solar saltern of the Yellow Sea in Korea; Montalvo-Rodríguez et al. [22]
isolated three strains of halobacteria in the solar salterns in Cabo Rojo, Puerto
Rico; Chen et al. isolated and identified moderately halophilic bacteria from solar
saltern in Shandong, China and investigated their potential antimicrobial and
antitumor activities [23]. Yeon et al. [12] evaluated the diversity among the iso-
lated halophiles from the local solar salterns via RFLP analyses of PCR-amplified
16S rDNAs, and followed by phylogenetic analysis of the partial 16S rDNA
sequences.
In this study, we isolated and indentified a strain named SM. 200-5 from solar
saltern ponds (salinity 200) in Hangu Saltworks, Tianjin, China. The purpose of
this study is to provide basic information for further investigation and application
of halobacterium in saltern ponds.
109.2.1 Collection of Samples
Sediment sample was collected from solar saltern ponds (salinity 200) in Hangu
Saltworks, Tianjin, China in March, 2011. It was kept in sterile plastic bags and
stored in the refrigerator at 4 C.
109.2.2 Selection of Culture Medium
Before insolating the bacterial colony, the growth of bacteria in three kinds of
culture medium with different formulations (Table 109.1) was compared in order
to select the optimal culture medium for the halophilic bacteria. The modified CM
and Gibbons medium were prepared with brine water taken from the same salt
pond to ensure that the ionic composition of the medium was consistent with the
bacterial living conditions. The brine water was treated with NaClO and auto-
claved previous to use.
1 g of sediment sample was added in the Erlenmeyer flask containing 49 mL
culture medium. The flasks were incubated in an orbital shaker (150 rpm) at 37 C
109 Isolation and Characterization 1025
Table 109.1 Formulation of the culture medium

Modified CM Modified Gibbons Gauze’s No.1
medium [24] medium [25] medium [26]
Carbon resource yeast extract 10.0 yeast extract 10.0 soluble starch 20.0
(g/L)
Nitrogen resource acid hydrolyzed acid hydrolyzed KNO3 1.0
(g/L) casein 7.5 casein 5.0
peptone 5.0
Inorganic salts Brine water Brine water NaCl 20.0
(g/L) sodium citrate 3.0 FeSO47H2O 0.01
KCl 2.0 MgSO47H2O 0.5
MgSO47H2O 20.0 K2HPO4 0.5
Salinity 200 200 200
pH 7.2–7.4 7.2–7.4 7.2–7.4
for 30 min, 2 mL supernatant was then added to 98 mL culture medium,

respectively. OD600 was determined after 3 days incubation.
109.2.3 Isolation of Bacterial Colony
Bacteria were isolated from sediment sample with the method above, and 100 lL
plating dilutions were then streaked onto agar of the modified CM medium. The
agar plates were incubated for 5–7 days. The single colony was picked up on the
basis of differences in morphology and inoculated into the modified CM liquid
medium, and was incubated in an orbital shaker (150 rpm) at 37 C for 5–7 days.
The above procedure was repeated three times for purification.
109.2.4 DNA Extraction and PCR Amplification of the 16S

rDNA Gene
DNA was extracted from the isolated bacteria using AxyPrep Bacterial Genomic
DNA Miniprep Kit (Axygen, USA), and stored at -20 C for later use. The 16S
rDNA gene was amplified with two general bacterial primers: 27 f (5’-AGAGTT
TGATCCTGGCTCAG-3’) and 1525 r (5’-AAAGGAGGTGATCCAGCC-3’). The
PCR amplification contained 1 lL of each primer, 4 lL dNTP, 5 lL 10 9 buffer,
0.5 lL Taq (TaKaRa, Japan), and 1lL template DNA, in a final volume of 50 lL.
The following conditions were used in the amplification of the 16S rDNA genes:
94 C for 5 min, followed by 30 cycles of 94 C for 30 s, 55 C for 30 s, 72 C for
3 min, and with a final 10 min extension at 72 C. Amplified PCR products were
1026 G. Xu et al.
checked by 1 % agarose gel electrophoresis. Sequencing of 16S rDNA gene was

done by BGI (China).
109.2.5 Phylogenetic Analysis
Sequences of the isolated bacterial strains were compared to the 16S rDNA gene
sequences in the GenBank database, via BLAST searches. Alignment of sequences
was carried out with CLUSTAL X software. A phylogenetic tree was constructed
using the neighbor-joining method as implemented within the MEGA 5.0, and
bootstrap consensus trees were inferred from 1000 permutations of the datasets.
109.2.6 Morphological, Physiological, and Biochemical

Characterization
Based on the phylogenetic analysis results, morphological characterizations of the

isolated strain SM. 200-5 was determined through Gram-stain [27] and electron
microscope (SU-1510, Hitachi, Japan).
Salt tolerance for bacterial growth was tested by adding fresh bacterial culture
into the modified CM medium with salinities of 0, 30, 50, 100, 150, 200, and 250,
respectively, in a proportion of 1:103. Growth at different pHs was evaluated using
the modified CM medium with initial pH of 5, 6, 7, 8, 9, 10, and 11, respectively.
The bacterial growth was determined at OD600 after incubating for 24 h at 37 C.
API 20E Bacterial Identification Kit (Biomérieux, France) was used to deter-
mine the biochemical characterization of the isolated strain SM. 200-5. The kit
contained 20 biochemical indicators, such as enzymes, acid production, etc.
109.3.1 Optimal Culture Medium
Bacterial growth in three culture media was shown in Fig. 109.1. The results
showed that the growth of halophilic bacteria in the modified CM medium was the
fastest, followed by modified Gibbons medium and those in the Gauze’s No.1
medium was the slowest. Therefore, the modified CM medium was chosen as the
optimal medium for later isolation and characterization of the halobacteria. The
inferior bacterial growth in Gauze’s No.1 medium indicated that the carbon
(starch) and inorganic nitrogen (KNO3) could not sustain the halobaterial growth.
The higher concentration of nitrogen resources (acid hydrolyzed casein) and
Fig. 109.1 Bacterial growth

in different culture medium
similar ionic composition with their living environment in the modified CM may
be more suitable for halophilic bacteria growth comparing with the modified
Gibbons medium.
109.3.2 Phylogenetic Analysis
16S rRNA gene sequence (about 1.5 kb nucleotides) of the five isolate were
determined for this study. 16S rDNA fregments of the five isolated strains were
aligned to those closely related species in the database. In the phylogenetic tree,
strain SM. 200-5 fell within the clade comprising Salimicrobium species
(Fig. 109.2). The homology assay indicated that four isolates were related to the
genus Halomonas (97–99 % similarity), while the strain SM. 200-5 showed 95 %
identity to Salimicrobium flavidum sp. ISL-25, which was a member of the genus
Salimicrobium.
109.3.3 Phenotypic Characterization of the Strain SM. 200-5
Colony of the strain SM. 200-5 was circular, pale yellow, smooth, slightly convex,
opaque, and 0.5–1 mm in diameter. The cells were rods, (0.3–0.4) lm 9 (1.8–3.0)
lm, Gram-negative (Fig. 109.3). Salimicrobium flavidum sp. ISL-25 was its
closest-related strain, while the cells of it were coccoids, ovoids, or rods, (0.4–1.3)
lm 9 (0.8–9.0) lm, gram-variable-staining [28]. Morphological analysis showed
that the strain SM. 200-5 had differences with Salimicrobium flavidum sp. ISL-25
on cell morphology and size (Table 109.2).
1028 G. Xu et al.
Fig. 109.2 Phylogenetic tree of the strain SM. 200-5 and other closely related bacteria based on
partial 16S rDNA sequence
Fig. 109.3 Electron

microscopic image of the
strain SM. 200-5 (95000)
109.3.4 Physiological and Biochemical Characterization
The strain SM. 200-5 could grow in a range of salinity 30–200 and initial pH 6–11,
with the optimum of salinity 100 and initial pH 7 (Figs. 109.4 and 109.5). This is
consistent with Salimicrobium flavidum sp. ISL-25, whose optimal salinity and pH
was 100 and pH 7–8 as indicated in Table 109.2.
In assays with the API 20E system, H2S could be produced. D-glucose, L-
rhamnose, laetrile, L-arabinose were fermented and D-mannite, myoinositol, D-
sorbierite, D-sucrose, D-melibiose were weakly present, whereas b-galactosidase,
arginine dihydrolase, lysine decarboxylase, ornithine decarboxylase, tryptophan
Table 109.2 Comparison of morphological and biochemical characteristics of the strain SM.
200-5 and Salimicrobium flavidum sp. ISL-25
Characteristics SM. 200-5 Salimicrobium flavidum sp. ISL-25 [28]
Cell morphology Rods Cocci, ovals or rods
Cell size (lm) (0.3–0.4) 9 (1.8–3.0) (0.4–1.3) 9 (0.8–9.0)
Salinity range for growth 30–200 10–260
Optimal salinity 100 100
pH range for growth 6.0–11.0 ND
Optimal pH 7.0 7.0–8.0
H2S produce + –
Enzymes produce
Gelatinase – –
b- galactosidase – ±
Acid production from
L- rhamnose + –
L- arabinose + –
Myoinositol ± –
D- mannite ± +
D- sucrose ± +
D- melibiose ± +
D- sorbierite ± –
* +: positive, –: negative, ± : weakly positive; ND: not determined
Fig. 109.4 Growth of the

strain SM. 200-5 at different
salinities
deaminase, urease, and gelatinase were absent, indole and acetoin were not pro-
duced and citrate were not used. The results indicated that the strain SM. 200-5
and its closest strain Salimicrobium sp. ISL-25 had differences in producing H2S,
fermenting rhamnose and arabinose to produce acid (Table 109.2).
1030 G. Xu et al.
Fig. 109.5 Growth of the

strain SM. 200-5 at different
pH
109.4 Conclusions
The isolated strain SM. 200-5 was a member of the genus Salimicrobium, which
grow in a salinity range of 30–150 and pH 6–11 with optimum of salinity 100 and
initial pH 7. The strain SM. 200-5 had a 95 % similarity with Salimicrobium
flavidum sp. ISL-25 in terms of 16S rDNA sequencing. Strain SM. 200-5 was
distinguished from Salimicrobium flavidum sp. ISL-25, by cell shape, ranges of
salinity and pH for growth, biochemical characteristics, and acid production, as
shown in Table 109.2. On the basis of its phenotypic and genotypic properties,
strain SM. 200-5 represented a novel species of the genus Salimicrobium.
Therefore, we proposed that the strain SM. 200-5 is a new species of
Salimicrobium.
Acknowledgments This study was supported by the International Cooperation Research Pro-
gram of the Ministry of Science & Technology of China (grant number 2010DFA32300); the
International Cooperation Research Program of the Bureau of Science & Technology of Tianjin
(grant number 09ZCGHHZ01200); Key program of Natural Science Foundation of Tianjin (grant
number 09JCZDJC25400).
References
1. Oren A, Larimer F, Richardson P et al (2005) How to be moderately halophilic with broad

salt tolerance: clues from the genome of Chromohalobacter salexigens. Extremophiles
4:275–279
2. Ashrafaddin S, Ali AK, Ferdous RJ (2005) Identification and characterization of salt-
inducible polypeptide in Paenibacillus sp., a moderately halophilic bacterium. J Biosci
Bioeng 5:573–575
3. Rodríguez-Valera F, Ventosa A, Juez G (1985) Variation of environmental features and
microbial populations with salt concentrations in a multi-pond saltern. Microb Ecol
2:107–115
4. Oren A (2008) Microbial life at high salt concentrations: phylogenetic and metabolic
diversity. Saline Syst 1:2–14
5. Liu JJ, Chen QZ, Zeng JN et al (2007) Advances in the research of bioactive substances from
marine microorganisms. J Mar Sci 1:55–65 (Chinese)
6. Lv JS, Huang HQ, Cong M et al (2006) Identification for a marine bacterium and preliminary
study on purification of metabolite from the bacterium. Acta oceanol sin 5:173–178
7. Oren A (2002) Diversity of halophilic microorganisms: environments, phylogeny,
physiology, and applications. J Ind Microbiol Biotechnol 1:56–63
8. Boudjelal F, Zitouni A, Mathieu F et al (2011) Taxonomy and antimicrobial activities of two
novel halophilic Saccharomonospora strains isolated in Algerian Sahara soils. Ann Microbiol
2:299–305
9. Das Sarma P, Das Sarma S (2008) On the origin of prokaryotic ‘‘species’’: the taxonomy of
halophilic Archaea. Saline Syst 4:5–9
10. Wang J, Dang HY, Yang GP et al (2009) Physiochemical and phylogenetic analysis of
moderately halophilic bacteria halomonadaceae in deep-sea sediments of the Southern
Okinawa Trough. J Mar Sci 5:17–22 (Chinese)
11. Tang J, Zheng AP, Bromfield ESP et al (2011) 16S rRNA gene sequence analysis of
halophilic and halo-tolerant bacteria isolated from a hypersaline pond in Sichuan, China. Ann
Microbiol 2:375–381
12. Yeon SH, Jeong WJ, Park JS (2005) The diversity of culturable organotrophic bacteria from
local solar salterns. J Microbiol 1:1–10
13. Zahran HH (1997) Diversity, adaptation and activity of the bacterial flora in saline
environments. Biol Fert 3:211–223
14. Brown LS (2001) Proton transport mechanism of bacteriorhodopsin as revealed by site-
specific mutagenesis and protein sequence variability. Biochemistry 11:1249–1255
15. Habden X, Tohty D, Wu M et al (2007) Studies on bacteriorhodopsin gene and sequence of
16S rRNA encoding genes of halophilic archaea of Xinjiang Aibi Lake. J Biotechnol 1:46–50
(Chinese)
16. Lanyi JK, Schobert B (2003) Mechanism of proton transport in bacteriorhodopsin from
crystallographic structures of the K, L, M1, M2, and M2’ intermediates of the photocycle.
J Mol Biol 2:439–450
17. Kis-Papo T, Oren A (2000) Halocins: are they involved in the competition between
halobacteria in saltern ponds. Extremophiles 1:35–41
18. Guo JB, Zhou JT, Wang D et al (2008) A novel moderately halophilic bacterium for
decolorizing azo dye under high salt condition. Biodegradation 1:15–19
19. Litchfield CD (2011) Potential for industrial products from the halophilic Archaea. J Mol
Biol 10:1635–1647
20. Sorgeloos P, Takaert W (1990) Roles and potentials of Artemia in coastal saltworks. In:
Cheng L (ed) Proceeding of International Symposium on Biotechnology of Saltponds,
Tanggu, Tianjin, pp 69–77
21. Yoon JH, Kang KH, Oh TK et al (2004) Halobacillus locisalis sp. nov., a halophilic
bacterium isolated from a marine solar saltern of the Yellow Sea in Korea. Extremophiles
1:23–28
22. Montalvo-Rodríguez R, Ruíz-acevedo A, Ló pez-Garriga J (1997) New isolates of extremely
halophilic Archaebacteria (Halobacteria) from Puerto Rico and the Caribbean. Caribean J Sci
1:98–104
23. Chen L, Wang GY, Bu T et al (2010) Identification of a moderately halophilic bacterium
whb45 and screening of its antimicrobial and antitumor activity. Microbiol China 1:85– 90
(Chinese)
24. Gochnauer MB, Kushner DJ (1969) Growth and nutrition of extremely halophilic bacteria.
Canadian J Microbiol 10:1157–1165
25. Sehgal SN, Gibbons NE (1960) Effect of some metal ions on the growth of halobacterium
cutirubrum. Canadian J Microbiol 2:165–169
1032 G. Xu et al.
26. Feng EM, Su HY, Wang L (2010) Isolation, identification and phylogenetic analysis of
moderately halophilic bacterium isolated from Yantai Sea area. Mar Sci Bul 1:52–58
(Chinese)
27. Dong XZ, Cai MY (2001) Common bacterial identification manual. Science Press, Beijing
28. Yoon JH, Kang SJ, Oh KH et al (2009) Salimicrobium flavidum sp. nov., isolated from a
marine solar saltern. Int J Syst Evol Microbiol 11:2839–2842
Chapter 110
Preparation of Wetting Powder
for Biocontrol Bacillus Subtilis
Fang Chen, Shangjing Guo, Haiying Shi, Deduo Han, Yuanjun Kang,
Yu Zheng and Min Wang
Abstract Bacillus subtilis is considered as one kind of beneficial strains which

can effectively inhibit the pathogenic fungus of the plants and promote plant
growth. B. subtilis wetting powder exhibited better prevention and cure of
powdery mildew, phytophthora blight, gray mold, and plant growth promoting
ability. B. subtilis wetting powder was formulated using diatomite and calcium
carbonate as carrier, sodium dodecyl sulfate, PVA, and CMC-Na as co-formu-
lants, soluble starch, sucrose, and sodium glutamate as protective agent. Optimal
formulation recipe and processing technology of B. subtilis wetting powder were
developed. The best composition was diatomite 5 %, calcium carbonate 5 %, SDS
5 %, CMC-Na 5 %, soluble starch 0.5 %, sucrose 0.5 %, and sodium glutamate
0.5 %. Quality index analysis revealed that the wetting powder reached the bio-
logical pesticide standards.
Keywords Bacillus subtilis Wetting powder Stability Preparation
This research was supported by the Natural Science Foundation of Tianjin, China (Project No.
09JCZDJC19100). Scientific Research foundation for Doctor, Liaocheng University, China
(Project No. 3010)
F. Chen S. Guo H. Shi D. Han Y. Kang

School of Pharmaceutical, Liaocheng University, Liaocheng, 252059 Shandong, China
Y. Zheng M. Wang (&)
Key Laboratory of Industrial Fermentation Microbiology, Ministry of Education,
Collage of Biotechnology, Tianjin University of Science and Technology, Tianjin 300457,
China
1034 F. Chen et al.
110.1 Introduction
There is increasing market demand for the environmental friendly biopesticide.

Antagonistic bacteria are considered as an important functional group of beneficial
bacteria used for biological control as well as for promoting plant growth[1, 2].
Recently, biological control has become an important approach to suppress many
plant pathogens[3–6]. Bacillus subtilis is considered to be an excellent biocontrol
agent not only due to its ability on inducing plant systematic resistance, but also on
producing various hydrolytic enzymes and antibiotics [7–14]. From the large
amount of antimicrobials produced, lipopeptides stand among the most represen-
tative. These antifungal peptides have been proved safe to people and no pollution
to environment [15, 16]. So, they have high potential for being used in biological
control, food antisepsis, medicine, and so on.
As B. subtilis has the characteristics of omnipresence in soils, thermal tolerance,
rapid growth, and ready formation of resistant spores, it is considered to be a good
biological control agent. Hot air was used in process of spray drying. Temperature
was thought to be a main factor for the bacteria. In the process of dehydration, the
bacteria cells were smaller than that of freeze-drying. So the species of protective
agent in spray drying played an important role. Protective agents are usually used
according to the optimized formulation, because single protective agent cannot
meet the requirement. Various composition of the optimized protective agent
formulation had its own effect in spray drying; also they had a synergistic effect.
The maximum protection effect was achieved only when the formulation had an
optimized proportion and concentration, based on the structure and size of the
cells.
B. subtilis B579 (deposition number CGMCC No. 2270) was isolated from
rhizosphere of cucumber in Tianjin, China. It could effectively inhibit the growth
of pathogenic Fusarium oxysporum, Rhizoctonia solani, Fusarium gramirum,
Phytophthora capsici, and Fusarium solani on Potato Dextrose Agar (PDA) plates
using the dual plate assay [17]. The experiments in glasshouse showed that
B. subtilis B579 could effectively control Fusarium wilt of cucumber caused by
F. oxysporum f. sp. Cucumerinum. The percentage of germination of seeds and the
vigor index of the plants, also the weight of fruits were improved by treating the
plant or seed with the fermentation broth of B. subtilis B579 indicating a potential
biocontrol agent [18]. Two kinds of lipopeptide antifungal compounds of B579
were identified. Genes involved in the biosynthesis of six antifungal compounds
were detected in genomic DNA [19]. In this paper, the best composition of the
biocontrol agent of B. subtilis B579 was developed. Wetting powder was made
using the method of spray drying. The suspensibility, wetting time, fineness, and
thermal stability of the wetting powder were tested.
110 Preparation of Wetting 1035
110.2.1 Microorganism and Medium
B. subtilis B579 (conserved in our laboratory) is maintained at 4 C on slant of LB

agar medium. F. oxysporum is stored at 4 C on the eggplant bottle containing
potato dextrose agar (PDA) medium. Seed medium was comprised of peptone
10 g/L, glucose 5 g/L, yeast extract 5 g/L, beef extract 5 g/L, and NaCl 5 g/L
(pH7.0). Fermentation medium used for batch cultivation is composed with yeast
extract 6 g/L, soluble starch 11 g/L, glucose 6 g/L, soy bean meal 13.9 g/L, beef
extract 8.9 g/L, and maize meal 12.6 g/L (pH 7.0).
110.2.2 Fermentation of B. Subtilis B579
A 250-mL Erlenmeyer flask containing 30 mL of seed medium was inoculated

with one inoculating loop of B. subtilis B579. The seed culture was performed at
37 C and 180 rpm on a rotary shaker for 12 h. A 7 L bioreactor (Baosheng Ltd.,
Shanghai, China) with a working volume of 5 L was used for B. subtilis B579
cultivation. The batch fermentation was initiated with 5 % inoculums from seed
culture. Cultivation temperature, aeration rate, and the agitation rate were main-
tained at 37 C, 2 L/min and 500 rpm, respectively. The pH was adjusted with
1 mol/L NaOH when required.
110.2.3 Preparation of Wetting Powder
The fermentation was ended after about 26 h cultivation, and 5 L broth was
harvested. The diatomite and calcium carbonate as carrier, sodium dodecyl sulfate,
PVA and CMC–Na as co-formulants, soluble starch, sucrose, and sodium gluta-
mate as thermal protective agent. The optimal formulation recipe was optimized
by response surface methodology. The wetting powder was obtained by spray-
dried [20]
110.2.4 Dual Plate Assay of Biocontrol Agent
The antagonism of biocontrol agent against F. oxysporum was tested on PDA

plates using the dual plate assay. The biocontrol agent was diluted to 0, 1, 2, 5, and
10 g/L, respectively. The pathogen F. oxysporum was inoculated to the center of
PDA plates. The inhibition zones of the agent solution with different concentration
1036 F. Chen et al.
were compared. Then pathogens were incubated on the center of PDA plates at
28 C for 3 d. The sterile-distilled water was served as control. Three replications
were carried out for each treatment.
110.2.5 Quality Index Analysis of Biocontrol Agent
Quality index of wetting powder was analyzed according to the wetting powder
quality national standard of China [20–22]. The effective composition of wetting
powder is not less than the marked content; fineness (44 lm test sie-
ve) C 95–98 % (National standard of China GB/T 16150-1995). Wetting time was
1–2 min (GB/T 5451-2001), and moisture content generally is not more than 3 %
(GB/T 1600-2001). Suspension rate was about 70 % (GB/T 14825-2006). The
value of pH was neutral, according to the requirement of stability, and the pH was
sometimes 5–9 (GB/T 1601-1993). Hot storage stability was stored at 54 ± 2 C
for 14 d, and the effective component decomposition rate was less than 10 % (GB/
T 19136-2003).
One gram of biocontrol agent was suspended in 9 mL of sterile distilled water and
treated in a blender (IKA, Germany) for 10 min. Serial dilutions of the cell sus-
pension from 10-7 to 10-10 were prepared. Appropriate dilution of 100 lL was
spread on solid LB media with 3 replicates. Plates were incubated at 37 C for
24 h, and then the colony forming units (CFU) were counted. Response surface
methodology was used by SAS 6.0 software.
110.3.1 Preparation of Wetting Powder
The fermentation broth was collected and the optimal formulation recipe was
developed by response surface methodology. The best composition was diatomite
5 %, calcium carbonate 5 %, SDS 5 %, CMC-Na 5 %, soluble starch 0.5 %,
sucrose 0.5 %, and sodium glutamate 0.5 %. The obtained agent of B. subtilis
B579 as shown in Fig. 110.1 indicated that the agent of B. subtilis B579 with even
and small particle size could be successfully prepared by the method of spray
drying. The viable count of the agent was 1.2 9 109 CFU/g.
Fig. 110.1 Picture of

wetting powder of B. subtilis
B579
The solution was spray-dried with temperature 180 at paste entrance, 70 at
outlet, pump rate 60 mL/min and the atomization was controlled at an air pressure
of 0.1 MPa.
110.3.2 Inhibitory Effect Assay of Wetting Powder
Cylinder-plate method was used to verify the inhibitory effect of the prepared
agent against F. oxysporum. The inhibition zones for different biocontrol agent
concentrations were 0, 9, 17, and 20 mm, respectively. So, the effective concen-
tration of the wetting powder for use was 2–5 g/L.
110.3.3 Quality Index Analysis of Wetting Powder
Quality index of wetting powder was analyzed. The transmission rate of wetting
powder through 44 lm test sieve was 98 %. The wetting time was 110 s. The
moisture content was 2.8 %. The suspension rate was as high as 83 %. The value
of pH was neutral, which was 7.3. The wetting powder was stable to hot, and the
effective component decomposition rate was 6 % after hot storage for 14 d.
Quality index of wetting powder reached the biological pesticide standards.
110.4 Conclusion
The optimal formulation recipe and processing technology of B. subtilis B579

wetting powder were developed. The best composition was diatomite 5 %,
calcium carbonate 5 %, SDS 5 %, CMC-Na 5 %, soluble starch 0.5 %, sucrose
1038 F. Chen et al.
0.5 %, sodium glutamate 0.5 %. The wetting powder was obtained by spray-dried
with temperature 180 at paste entrance, 70 at outlet, pump rate 60 mL/min and
the atomization was controlled at an air pressure of 0.1 MPa. Quality index
analysis revealed that the wetting powder reached the biological pesticide stan-
dards. The effective concentration of the wetting powder for use was 2–5 g/L.
References
1. Fravel D, Olivain C, Alabouvette C (2003) Fusarium oxysporum and its biocontrol. New
Phytol 157:493–502
2. Chung S, Kong H, Buyer JS et al (2008) Isolation and partial characterization of Bacillus
subtilis ME488 for suppression of soilborne pathogens of cucumber and pepper. Appl
Microbiol Biotechnol 80:115–123
3. Uppal AK, Hadrami AE, Adam LR et al (2008) Biological control of potato Verticillium wilt
under controlled and field conditions using selected bacterial antagonists and plant extracts.
Biol Control 44:90–100
4. Siddiqui IA, Shaukat SS (2004) Systemic resistance in tomato induced by biocontrol bacteria
against the root-knot nematode, Meloidogyne javanica is independent of salicylic acid
production. J Phytopathology 152:48–54
5. Ahn IP, Chung HS, Lee YH (1998) Vegetative compatibility groups and pathogenicity
among isolates of Fusarium oxysporum f. sp. cucumerinum. Plant Dis 82:244–246
6. Wang SL, Shih IL, Wang CH et al (2002) Production of antifungal compounds from chitin by
Bacillus subtilis. Enzyme Microbial Technol 31:321–328
7. Thilagavathi R, Saravanakumar D, Ragupathi N et al (2007) A combination of biocontrol
agents improves the management of dry root rot (Macrophomina phaseolina) in greengram.
Phytopathol Mediterr 46:157–167
8. Lee HJ, Park KH, Shim JH et al (2005) Quantitative changes of plant defense enzymes in
biocontrol of pepper (Capsicium annuum L.) late blight by antagonistic Bacillus subtilis
HJ927. J Microbiol Biotechnol 15:1073–1079
9. Kavitha S, Senthilkumar S, Gnanamanickam S et al (2005) Isolation and partial
characterization of antifungal protein from Bacillus polymyxa strain VLB16. Process
Biochem 40:3236–3243
10. Stover AG, Driks A (1999) Secretion, localization, and antibacterial activity of TasA, a
Bacillus subtilis spore-associated protein. J Bacteriol 181:1664–1672
11. Hwang SF, Chakravarty P (1992) Potential for the integrated control of Rhizoctonia root-rot
of Pisum sativum using Bacillus subtilis and a fungicide. J Plant Dis Prot 99:626–636
12. Chu IM, Lee C, Li TS (1992) Production and degradation of alkaline protease in batch
cultures of Bacillus subtilis ATCC 14416. Enzyme Microbial Technol 14:755–761
13. Brannen PM, Kenney DS, Kodiak (1997) A successful biological-control product for
suppression of soil-borne plant pathogens of cotton. J Ind Microbiol Biotech 19:169–171
14. Choudhary DK, Johri BN (2009) Interactions of Bacillus spp. and plants—with special
reference to induced systemic resistance (ISR). Microbiol Res 164(5):493–513
15. Chen H, Yuan CL, Cai KZ et al (2008) Purification and identification of iturin A from
Bacillus subtilis JA by electrospray ionization mass spectrometry. Acta Microbiologica
Sinica 48:116–120
16. Tsuge K, Inoue S, Ano T et al (2005) Horizontal transfer of iturin A operon, itu, to Bacillus
subtilis 168 and conversion into an iturin A producer. Antimicrob Agents Chemother
49:4641–4648
17. Wang M, Chen F, Zheng Y et al (2009) Identification and characterization of antifungal

compounds produced by Bacillus subtilis B579. In: International conference of natural
products and traditional medicine (TCNPTM’09), conference proceedings, pp 291–295
18. Chen F, Wang M, Zheng Y et al (2010) Quantitative changes of plant defense enzymes and
phytohormone in biocontrol of cucumber Fusarium wilt by Bacillus subtilis B579.World J
Microbiol Biotechnol 26(4):675–684
19. Chen F, Han D, Wang M et al (2012).Production and identification of antifungal compounds
produced by Bacillus subtilis B579.In: 2012 international conference on bioinformatics and
biomedical engineering, vol 4. pp 87–90
20. Wang J, Wang N, Gao G et al (2010) Research on wetting powder of Bacillus subtilis with
each gram 20 billion spores. Agrochemicals 49(7):486–489
21. Collins DP, Jacobsen BJ (2003) Spatial and temporal population dynamics of a phyllosphere
colonizing Bacillus subtilis biological control agent of sugar beet cercospora leaf spot. Biol
Control 26(2):153–161
22. Shoda M (2000) Bacterial control of plant diseases. J Biosci Bioeng 89(6):515–521
Chapter 111
Isolation and Characterization of
s-Butanol Tolerant Microorganisms
Litao Shi, Hongjiang Yang, Qian Li and Xuying Qin
Abstract s-butanol can be produced indirectly from biomass by fermentation. To

construct recombinant strains producing s-butanol directly, microbes naturally
with high tolerance to s-butanol are required for metabolic engineering. In this
study, totally 30 s-butanol tolerant microorganisms were isolated from different
environmental soil samples by screening and enrichment method. Among the
isolates, strains S-2, S-9, S-24, and S-26 were able to tolerate 15 g/L s-butanol.
Additionally, s-butanol tolerance mechanisms were also studied by quantitatively
analyzing degradation ability of the isolates. The results indicated that strains S-9
and S-24 possessed relatively low levels of s-butanol degrading enzyme activity
and might be used as native tolerant strains for metabolic engineering. Strain S-13
showed the highest s-butanol degradation efficiency (72.7 %) in LB medium,
suggesting that strain S-13 disrupted s-butanol via a way of co-metabolism and
suitable for bioremediation of the chemical under more complicated environments.
Furthermore, the isolated strains were identified by comparative analysis of the
16S rRNA gene sequences.
Keywords s-butanol Screening Tolerance Identification
111.1 Introduction
S-butanol has many applications including industrial solvents, emulsifiers, dyes,

dispersants, dehydrating agents, paint removers, and industrial detergents. Also
s-butanol can be used as gasoline octane components, plasticizers, mineral pro-
cessing agents, and herbicides [1].
L. Shi H. Yang (&) Q. Li X. Qin

e-mail: hongjiangyang@tust.edu.cn
1042 L. Shi et al.
S-butanol is industrially manufactured by the hydration of 1-butene or 2-butene

on a large scale. The production level of s-butanol reached 9,00,000 tons/year, and
manufacturers are mainly located in Europe and the United States [2].
A number of strains of Lactobacillus spp. have been reported to be able to
convert meso-2, 3-butanediol into s-butanol in a few studies [3]. However, no
further genetic and biochemical evidences have been obtained to prove the exis-
tence of s-butanol synthesis pathway in bacteria. The s-butanol can be produced
indirectly with microbial fermentation, and the production process practically
involves the fermentation processes and the chemical reaction. First, various
carbon sources were converted to 2, 3-butanediol via a series of metabolic path-
ways[4]. Second, 2, 3-butanediol was dehydrated into methyl ethyl ketone (MEK)
efficiently through enzymatic bioconversion without purification. Third, MEK was
transformed to s-butanol through hydrogenation, the chemical reaction [5].
Although no known pathway involving in s-butanol synthesis available in
isolated microbes, attempts have been making to construct recombinant strains
with the ability to produce s-butanol directly during fermentation process [6]. The
candidate strains suitable for metabolic engineering would meet the certain cri-
teria, and s-butanol tolerance would be a critical variable affecting s-butanol
production level of the engineered microbes [6].
In this paper, s-butanol tolerant microorganisms were isolated via screening and
enrichment method. The isolates were characterized for their growth rate in the
presence of s-butanol and their degradation ability of s-butanol. With the com-
parative analysis of the 16S rRNA gene sequences, some of the isolated strains
were identified.
111.2.1 Experimental Materials
The soil and sludge samples were collected from various environmental sites, and
they were stored in sterile sealed bags at 4 C refrigerator ready for use.
111.2.2 Media
LB medium was used for routine cultivation of bacteria, and it was composed of
NaCl 10 g/L, Peptone 10 g/L, and Yeast extract 5 g/L. The medium was adjusted
to pH 7.0.
Enrichment medium was used for the isolation of s-butanol tolerant microor-
ganisms, and it was composed of KH2PO4 0.5 g/L, K2HPO4 0.5 g/L, FeSO47H2O
0.01 g/L, MgSO4 0.2 g/L, NaCl 9 g/L, Peptone 5 g/L, and Glucose 30 g/L. The
111 Isolation and Characterization of s-Butanol Tolerant Microorganisms 1043
medium was adjusted to pH 7.0 [7]. Before cultivation, s-butanol was added to the
medium for the enrichment and selection of s-butanol tolerant strains.
To analyze the s-butanol degradation efficiency of the isolates, two media was
used for cultivation the isolates, the basic medium and LB medium. The basic
medium (pH 7.0) was composed of KH2PO4 0.5 g/L, K2HPO4 0.5 g/L, FeS-
O47H2O 0.01 g/L, MgSO4 0.2 g/L, NaCl 9 g/L, and (NH4)2SO4 5 g/L [7]. Before
cultivation, s-butanol was added to the media to the certain concentration.
111.2.3 Enrichment and Isolation of s-Butanol Tolerant

Bacteria
Add soil and sludge samples (10 g) to 150 mL enrichment medium (supplement
with 5 g/L s-butanol) in 250 mL flask sealed with a solid cap. The mixture was
incubated at 37 C with a shaking speed 220 rpm. After 24 h incubation, 10 mL
supernatant was transferred to 150 mL fresh enrichment medium (supplement with
5 g/L s-butanol), the mixture was cultured for another 24 h under the same con-
ditions. The enrichment step was repeated for three more times [8].
After enrichment, take 1 mL enrichment culture and make serial dilutions. Take
150 lL of each dilution and spread on solid enrichment medium supplementing
with s-butanol (5 g/L). The Petri dishes were incubated at 37 C for 72 h [9].
111.2.4 Growth Rate Analysis
The isolated bacteria were inoculated in 5 mL LB medium and incubated at 37 C

overnight. The cultures were transferred into 5 mL fresh LB medium at 5 %
inoculum size. S-butanol was added to the cultures at the concentrations of 0.5, 1,
and 1.5 %, respectively. After incubation at 37 C for 24 h with shaking speed of
220 rpm, the cell optical density at wavelength of 600 nm (OD600) was measured
[10, 11].
The isolates were also inoculated on L-agar plates supplementing with s-
butanol (0.5, 1, and 1.5 %, respectively). The growth was observed after 48 h
incubation at 37 C [12].
111.2.5 Degradation Efficiency Analysis
Degradation efficiency analysis was performed as described previously [13]. In

brief, the isolated strains were inoculated in 5 mL LB medium and incubated at
37 C overnight. The cultures were transferred into 5 mL fresh LB medium at 5 %
1044 L. Shi et al.
inoculum size. One percent of s-butanol was added to the cultures, while sterile
saline buffer was used as control. After 24 h incubation at 37 C, s-butanol level in
the fermentation broth was subjected to gas chromatography analysis. Basic
medium was also used to replace LB medium for degradation efficiency analysis
[14].
Gas chromatography (Agilent 7890A) with column HP–INNOWAX was used
to determine the remaining amount of s-butanol in the fermentation broth. The
detailed procedure as described according to the manual with modifications [15–
17]. Briefly, column temperature was held at 45 C for 1 min, and then pro-
grammed at 8 C/min to 155 C and held for 1 min; flow rate: 1 mL/min; Inlet
was 180 C; Detector was 200 C; The flow rate of nitrogen gas, hydrogen gas,
and air were 35, 35, and 350 mL/min, respectively. Isoamyl alcohol was used as
internal control standard [18, 19].
111.2.6 Identification of the Isolated Strains
Bacterial genomic DNA was extracted as described previously [20]. To amplify

bacterial 16S rRNA gene fragments, specific primers 27F and 1492R were adopted
and their sequences were as follows [21]:
27F: 50 -AGAGTTTGATCCTGGCTCAG-30
1492R: 50 -GGTTACCTTGTTACGACTT-30
PCR reaction system was 50lL and the parameters were heating at 94 C for
5 min, 1 cycle; heating at 94 C for 40 S, annealing at 51 C for 2 min, extension
at 72 C for 3 min, 30 cycles; 72 C for 10 min.
PCR products were purified from gel and subjected to sequencing analysis with
the same primers used in PCR. Sequence homology search was carried out with
BLAST provided by NCBI to identify the isolates. The isolates were classified to
genus level with Classfier (Ribosomal Database Project II) [22].
111.3.1 Isolation of s-Butanol Tolerant Strains
As described in Materials and methods, the 5 d enriched culture was diluted and
spread on L-agar medium supplementing with 5 g/L s-butanol. Totally, 30 strains
with different morphologies were obtained from various environmental samples.
111.3.2 Growth Rate Analysis under Various s-Butanol

Concentrations
The isolated strains were subjected to growth rate analyzing. The experiment results
showed that strains S-2, S-9, S-24, and S-26 still grew well in the presence of 15 g/
L s-butanol. Their relative growth rates were 0.58, 0.64, 0.31, and 0.29, respec-
tively, compared with the corresponding cultures without supplementing with 15 g/
L s-butanol. The relative growth rates were below 0.13 in the remaining 26 strains.
In the medium supplementing with 5 g/L and 10 g/L s-butanol, the relative growth
rate of 30 strains had no significant difference (Fig. 111.1a, b, and c).
5g/L
(a) 1.0
0.9
Relative growth rate
0.8
0.7
0.6
0.5
0.4
0.3
0.2
0.1
0.0
S-1
S-2
S-3
S-4
S-5
S-6
S-7
S-8
S-9
S-10
S-11
S-12
S-13
S-14
S-15
S-16
S-17
S-18
S-19
S-20
S-21
S-22
S-23
S-24
S-25
S-26
S-27
S-28
S-29
S-30
10g/L
(b) 1.0
0.9
0.8
0.7
0.6
0.5
0.4
0.3
0.2
0.1
0.0
S-1
S-2
S-3
S-4
S-5
S-6
S-7
S-8
S-9
S-10
S-11
S-12
S-13
S-14
S-15
S-16
S-17
S-18
S-19
S-20
S-21
S-22
S-23
S-24
S-25
S-26
S-27
S-28
S-29
S-30
(c) 1.0 15g/L

0.9
0.8
0.7
0.6
0.5
0.4
0.3
0.2
0.1
0.0
S-1
S-2
S-3
S-4
S-5
S-6
S-7
S-8
S-9
S-10
S-11
S-12
S-13
S-14
S-15
S-16
S-17
S-18
S-19
S-20
S-21
S-22
S-23
S-24
S-25
S-26
S-27
S-28
S-29
S-30
Fig. 111.1 The relative growth rate analysis of the 30 isolated strains. a the relative growth rates
of the isolates in the presence of 0.5 % s-butanol; b the relative growth rates of the isolates in the
presence of 1 % s-butanol; c the relative growth rates of the isolates in the presence of 1.5 %
s-butanol
1046 L. Shi et al.
On L-agar plates supplementing with 5, 10, and 15 g/L s-butanol, respectively,

only strains S-2, S-9, S-24, and S-26 formed colonies similar to the results
obtained from the relative growth rate analysis. To our best knowledge, no study
has been reported on isolation of s-butanol tolerant microorganisms [23, 24].
111.3.3 Degradation Efficiency Analysis of the Isolated

Strains
Solvent tolerance mechanisms have been studied in microbes [24]. Several

structures were involved in such a functionality, including cellular membrane lipid
barrier, efflux pumps, cellular membrane protein contents, and enzymes digesting
solvents [25]. In this work, we investigated s-butanol tolerance mechanism by
analyzing their s-butanol degradation efficiency in both LB medium and basic
medium, respectively.
Strains S-2, S-9, S-24, and S-26 thrived in the medium with 1.5 % s-butanol
(Fig. 111.1c). Their s-butanol degradation efficiency was 56.4, 8.2, 17.0, and
21.4 %, respectively, in the basic medium (Fig. 111.2b); while in LB medium the
corresponding degradation efficiency was 63.7, 22.0, 17.2, and 54.1 %, respec-
tively (Fig. 111.2a). These data suggested that the dominated mechanism for
strains S-2 and S-26 tolerating s-butanol might be due to the existence of
(a) 0.8 LB medium

Degradation efficiency
0.7
0.6
0.5
0.4
0.3
0.2
0.1
0
S-1
S-2
S-3
S-4
S-5
S-6
S-7
S-8
S-9
S-10
S-11
S-12
S-13
S-14
S-15
S-16
S-17
S-18
S-19
S-20
S-21
S-22
S-23
S-24
S-25
S-26
S-27
S-28
S-29
S-30
(b) 0.6
Basic medium
Degradation efficiency
0.5
0.4
0.3
0.2
0.1
0
S-1
S-2
S-3
S-4
S-5
S-6
S-7
S-8
S-9
S-10
S-11
S-12
S-13
S-14
S-15
S-16
S-17
S-18
S-19
S-20
S-21
S-22
S-23
S-24
S-25
S-26
S-27
S-28
S-29
S-30
Fig. 111.2 S-butanol degradation efficiency of the isolates incubated in different media. a the
related analysis in LB medium; b the related analysis in the basic medium
Table 111.1 Homology analysis and classifications of the isolated strains

Strains Most similar strains (accession no.) Similarity % Genusa
S-2 Arthrobacter luteolus (DQ486130.1) 100 Arthrobacter
S-9 Bacillus aryabhattai (HQ242766.1) 100 Bacillus
S-13 Lysinibacillus fusiformis (FJ973545.1) 100 Lysinibacillus
S-24 Bacillus tequilensis (JF411311.1) 100 Bacillus
S-26 Bacillus tequilensis (JF411311.1) 100 Bacillus
a
Classification results by classifier from RDPII [22]
enzyme(s) degrading s-butanol, and both strains might be used as bioremediation

strains; while strains S-9 and S-24 should have relatively low levels of s-butanol
degrading enzymatic activity, and they might be used as native s-butanol tolerant
strains for construction of s-butanol producing strains via metabolic engineering.
Among the tested strains, S-13 showed the highest s-butanol degradation efficiency
72.7 % within 24 h incubation in LB medium. This suggested that strain S-13
disrupted s-butanol via a way of co-metabolism and suitable for bioremediation of
s-butanol under more complicated environments [26].
111.3.4 Identification of the Isolates
Extract chromosome DNA of the isolated bacteria and then amplify their 16S
rRNA gene with primers 27F and 1492R [27]. The obtained 16S rRNA gene
sequences were analyzed with BLAST program in the NCBI and Classifier in
RDPII [28, 29]. As shown in Table 111.1, with similarity of 100 %, strain S-2 was
highly homologous to Arthrobacter luteolus, S-13 was highly homologous to
Lysinibacillus fusiformis, S-9 was highly homologous to Bacillus aryabhattai, and
S-24 and S-26 were highly homologous to Bacillus tequilensis, respectively. It is
interesting to find that strains S-9, S-24, and S-26 all belong to the genus of
Bacillus but with different aspects for s-butanol tolerance. This is the first study on
s-butanol tolerant strains isolation [30–32]. Strains S-9 and S-24 might be engi-
neered for construction of recombinant microbes producing s-butanol directly via
fermentation [6].
111.4 Conclusion
S-butanol cannot be synthesized directly from biomass by fermentation. Con-

struction of recombinant strains producing s-butanol directly could be an alter-
native to indirectly production via fermentation, and isolation of microbes
naturally with high tolerance to s-butanol is required for metabolic engineering. In
this work, totally 30 s-butanol tolerant microorganisms were isolated, and strains
1048 L. Shi et al.
S-2, S-9, S-24, and S-26 were able to tolerate 15 g/L s-butanol. To investigate s-
butanol tolerance mechanisms, the degradation ability of the isolates was quan-
titatively analyzed. Strains S-9 and S-24 possessed relatively low levels of s-
butanol degrading enzymatic activity and might be used as native tolerant strains
for construction of s-butanol directly producing strains via metabolic engineering.
Strain S-13 showed the highest s-butanol degradation efficiency in LB medium.
This suggested that strain S-13 disrupted s-butanol via a way of co-metabolism and
suitable for bioremediation of s-butanol under more complicated environments.
Acknowledgments This work was partly supported by The National Natural Science Founda-
tion of China (Grant No. 30970114) and The National Key Technology R&D Program of China
(Grant No. 2011BAC11B05).
References
1. Baertsch Chelsey D, Kenny T, Komala et al (2002) Genesis of Bronsted acid sites during
dehydration of 2-butanol on tungsten oxide catalysts. J Catal 212:44–57
2. Huichang Z (1989) S-butanol production by water legitimate directly. Jiangsu chemical
17(3):50–53
3. Ching THOU, Ramesh PATEL, Nancy BARNABR et al (1981) Stereospecificity and other
properties of a novel secondary-alcohol-specific alcohol dehydrogenase. Biochem
119:359–364
4. Yu EC, Levitin N, Saddler JN (1982) Production of 2.3-butanediol by Klebsiella pneumoniae
grown on acid hydrolyzed wood hemicelluslose. Biottechnol Lett 4(11):741–746
5. Kaoutar E, Mohamed K, Mahfoud Z et al (2004) Cobalt-exchanged hydroxyapatite catalysts:
magnetic studies, spectroscopic investigations, performance in 2-butanol and ethane
oxidative dehydrogenations. J Catal 187:16–24
6. Robin E. Osterhout, San Diego et al (1011) Microorganisms and methods for carbon-efficient
biosynthesis of MEK and 2-butanol: US, 0008858[P]
7. Taosheng C, Qizu L (1991) Fermentation of acetone and butanol production technology, vol
14. Chemical Industry Press, Beijing, pp 18–21
8. Zvaigzne AI, Acree WE Jr (1994) Solubility of anthracene in binary alkane ? 2-butanol
solvent mixtures. Chem Eng J 39:114–116
9. Chou Junpeng, Yan Xu, Ruan Wenquan et al (2004) Metabolic regulation of breeding and
fermentation of L-lactic acid fermentation influence factors. Microbiology 34(5):929–933
10. Liu J, Fan LT et al (2004) Downstream process synthesis for biochemical production of
butanol ethanol, and acetone from grains: eneration of optimal and near optimal flow sheets
with conventional operating units. Biotechnology 20(5):1518–1527
11. Hartmanis MGN, Klason T, Gatenbeck S (1984) Uptake and aivation of acetate and butyrate
in Clostridium acetobutylicum. Microbiol Biotechnol 20:66–71
12. Anan H, Keke C, Yan S et al (2009) Strain selection and medium optimization of the
metabolism of glycerol yielding lactic acid. Microbiology 36(8):1195–1199
13. Huang WC, Ramey DE, Yang ST (2004) Continuous production of butanol by Clostridium
acetobutylicum immobilized in a fibrous bed bioreactor. Appl Biochem Biotechnol
22(16):113–116
14. Martin JR, Petitdemange H, Ballongue J, Gay R (1985) Effects of acetic and butyric acids on
solvents production by Clostridium acetobutylicum. Biotechnol Letters 2:89–94
15. Jingchuan H (2009) Acetone butanol producing strain breeding and fermentation process.
Biological and Environmental Engineering College of Zhejiang. Zhejiang University
16. Ruonong F, Yongfu C (1989) Gas chromatography and thermal analysis techniques, vol 34.
National Defence Industry Press, Beijing, pp 11–12
17. Qureshi N, Schripsema J, Lienhardt J et al (2000) Continuous solvent production by
Clostridium beijerinckii BA101 immobilized by adsorption onto brick. World J Microbiol
Biotechnol 16(4):377–382
18. Smith Christy A, Hyman Michael R (2004) Oxidation of methyl ter-butyl ether by alkane
hydroxylase in dicyclopropylketone-induced and n-octane-gro-grown Pseudomonas putida
GPo1. Appl environ microb 70(8):4544–4550
19. Bennett GN, Scotcher MC (2007) Blocking sporulation by inhibiting Spoiie. US, 0020740
20. Sambrook J, Russell DW (2001) Molecular cloning: a laboratory manual, 3rd edn.Cold
Spring Harbor Press, New York, pp 1.31–1.38
21. Hendrickson ER, Payne JA, Yong RM et al (2002) Molecular analysis of dehalococcoides
16S ribosomal DNA from chloroethene-contaminated sites throughout north America and
Europe. Appl environ microb 68(2):485–495
22. Qing W, Garrity GM, Tiedje JM et al (2007) Naive Bayesian classifier for rapid assignment
of rRNA seguence into the new bacterial taxonomy. Appl Environ Microbiol
73(16):5261–5267
23. Macfie Sheila M, Cossins Edwin A, Taylor Gregory J (1994) Effects of excess manganese on
production of organic acids in acids in Mn-tolerant and Mn-sensitive cultivars of Triticum
aestivum L(Wheat). J Plant Physiol 143:135–144
24. Hongzhi M, Qunhui W, Dayi Q (2009) The utilization of acid-tolerant bacteria on ethanol
production from kitchen garbage. Renewable Energy 34:1466–1470
25. Folsom BR, Chapman PJ (1990) Phenol and trichloroethylene degradation by Pseudomonas
cepacia G4: kinetics and interactions between substrates. Appl Environ Microbiol
56:1279–1285
26. Yuquan X, Wei Z (2000) Isolation and identification of a phenol-degrading bacterial strain.
Acta Scientiae Circumstantiae 20:4
16S ribosomal DNA from chloroethene-contaminated sites throughout north America and
Europe. Appl environ microb 68(2):485–495
28. Sambrook J, Russell DW (2001) Molecular cloning: a laboratory manual, 3rd edn. Cold
Spring Harbor Press, New York, pp 1:31–1.38
29. Jinghui Z, Madden TL (1997) PowerBLAST: a new network BLAST application for
interactive or automated sequence analysis and annotation. Genome Res 7(6):649–656
30. Papoutsakis ET, Alsaker KV, Borden J (2005) Understanding butanol and butyrate toxicity
and tolerance in clostridia at the genomic scale. United States: 229th ACS National Meeting,
San Diego
31. Eric P, Knoshaug Min Zhang (2009) Butanol tolerance in a selection of microorganisms.
Appl Biochem Biotechnol 153:13–20
32. Liyanage Hemachandra, Young Michael, Kashket Eva R (2000) Butanol tolerance of
Clostridium beijerinckii NCIMB 8052 associated with down-regulation of gldA by antisense
RNA. Mcrobiol Biotechnol 2:87–93
33. Atsumi S, Canan AF, Connor MR et al (2007) Metabolic enginerring of Escherichia coli for
1-butanol production. Metab Eng [Epub ahead of print] 10(6):305–311
34. Inui M, Suda M, kimura S et al (2008) Expression of Clostridium acetobutylium butanol
synthetic genes in Escherichia coli. Appl Microbiol Biotechnol 77(6):1305–1316
Chapter 112
Application of Support Vector Machine
in Base Liquor Classification
Junsen Lu, Liping Du, Haimei Ding, Ziping Du and Dongguang Xiao
Abstract Considering the deficiency of the traditional liquor classification

method, a novel method for liquor classification based on support vector machine
is discussed in this paper. Liquor chromatographic data is used as basis and the
LIBSVM toolbox is used as classification tool in this method. Two different grades
of 490 base liquor samples (containing 242 samples of ordinary base liquor, 248
samples of high-quality base liquor) were used to test the method. In the experi-
ment, 180 samples of ordinary base liquor and 184 samples of high-quality base
liquor were selected as the training set to build the model and the remaining base
liquor were used as the testing set to test the accuracy of the model. The model
accuracy could reach 98 % without the correlation parameter optimization. The
results show that the method can achieve a higher accuracy, and prove the cor-
rectness and effectiveness of the method.
Keywords LIBSVM Support vector machine Base liquor Classification
112.1 Introduction
With thousand years of history and culture heritage, liquor is endemic to China. At
present, the identification of liquor classification is not only tested by physical and
chemical character, but also, in most cases, dependent on the experts, who are well
J. Lu L. Du H. Ding D. Xiao (&)

Key Laboratory of Industrial Fermentation Microbiology Ministry of Education, Tianjin
Industrial Microbiology Key Laboratory, College of Biotechnology, Tianjin University
of Science and Technology, Tianjin 300457, People’s Republic of China
e-mail: xiao99@tust.edu.cn
Z. Du
College of Economics and Management, Tianjin University of Science & Technology,
1052 J. Lu et al.
trained and experienced. Based on the observation, analysis, and description, the
experts evaluate liquor product from many aspects such as color, flavor, taste and
style, and finally give a comprehensive report, which can be the important evi-
dence for liquor classification assessment [1]. However, this subjective method
leads to the result that the judging results vary with each individual. Even the same
wine taster can give the different results due to different physical status, envi-
ronment, and emotions. In practice, the same wine taster can hardly obtain the
same result of samples of the same batch. Moreover, the accuracy of evaluation
cannot be guaranteed in case of giving quick comment for large number of liquor
samples [2]. Because of the demands of nondestructive and intelligent rapid
detection technology, in the meantime, in order to achieve the fairness and
accuracy for further of liquor classification with a strict and consistent standard,
using instrument to measure alcohol substance contend and using scientometric
indicators to evaluate liquor have been one of the necessary means [3].
The Support Vector Machine (SVM) method was proposed by Vapnik [4, 5] in
AT&T Bell laboratory in 1963 is a new promising classification technology. SVM
researches machine learning problems with limited number of samples, whereas
the traditional statistical recognition method can only achieve theory-guaranteed
performance in the case of large number of sample. Therefore, SVM has obvious
advantages [6, 7]. Compared with Artificial Neural Networks (ANNs), SVM has
no overfitting problems; instead, it has better generalization ability [8]. LIBSVM
toolbox, which is developed based on MATLAB by associate professor Lin Chin-
Jen from National Taiwan University, is an effective tool using SVM as theory for
classification. There are a lot of default parameters and few parameters need to be
input in the toolbox, which can be used to solve many problems conveniently [9].
In this paper, we focus on the application of SVM in base liquor classification.
In the experiment, the data from the liquor gas chromatography (GC) were divided
into the training set and the test set. The training set was used to build the model by
SVM and the test set was for testing the classification accuracy of the model. The
results showed that different samples of base liquor were well separated.
112.2.1 Data Sources
The liquor samples were provided by Sitir Liquor Co., Ltd. containing 242 sam-
ples of ordinary base liquor and 248 samples of high-quality base liquor. The
contents of main substance in each base liquor were analyzed by gas chroma-
tography (GC). Each sample included the content of 16 attributes. The attributes
were ethyl acetate, ethyl acetate, ethyl acetate, ethyl lactate, ethyl ester, ethyl ester,
ethyl acetate, acetic acid, propionic acid, butyric acid, caproic acid, lactic acid,
propyl alcohol, isobutyl alcohol, isoamyl alcohol, and methanol.
112 Application of Support Vector Machine in Base Liquor Classification 1053
112.2.2 Method
The experiment process as Fig. 112.1:
112.2.3 Data Preprocessing [10]
In the process of using LIBSVM toolbox, we found that data preprocessing had
significant impact on the model predicting accuracy. However, at present, there
was no improved theory to support how to choose preprocessing method, and
uniform standards had not yet been discovered. So, in the experiment, three dif-
ferent methods were adopted and the model with the highest accuracy would be
chosen.
(a) Raw data without any processing
(b) [0,1] normalization
The mapping function used in this method shows as follow:

x xmin
f :x!y¼ ð1Þ
xmax xmin
In the formula, xmin ¼ minðxÞ; xmax ¼ maxðxÞ. The raw data is normalized
within the range of [0, 1].
(c) [-1,1] normalization
The mapping function used in this method was as follows:

x xmin
f :x!y¼2 þ ð1Þ ð2Þ
xmax xmin
Fig. 112.1 The process map of application of SVM in base liquor classification
1054 J. Lu et al.
In the formula, xmin ¼ minðxÞ; xmax ¼ maxðxÞ. The raw data is normalized to
the range of [-1, 1].
In MATLAB, the normalization can be achieved by the ‘‘mapminmax’’ function.
112.2.4 Building the Model
According to the percentage of 75 %, 180 samples of ordinary base liquor and 184
samples of high-quality base liquor were selected as the training set. The label ‘‘1’’
represented the ordinary base liquor and the label ‘‘2’’ represented the high-quality
base liquor. In the model, the parameter ‘‘c’’ in LIBSVM was selected in 5 and the
parameter ‘‘g’’ was selected in 2. The following MATLAB codes built the model.
wine_labels = wine (:,1);
wine_data = wine (:,2:end);
train_wine = [wine_data (1:180,:);wine_data(243:426,:)]; % Selecting the train-
ing set
train_wine_labels = [wine_labels(1:180,:);wine_labels(243:426,:)]; % Extracting
the training set labels
model = svmtrain (train_wine_labels, train_wine, ‘-c 5 -g 2’) % Building the
model
112.2.5 The Predicting Accuracy
The remaining 25 % liquor samples (62 samples of ordinary base liquor and 64
samples of high-quality base liquor) as the test set were used to predict the
accuracy of the model we built. The following MATLAB codes predicted the
accuracy.
test_wine = [wine_data(181:242,:);wine_data (427:490,:)]; % Selecting the test
set
test_wine_labels = [wine_labels (181:242,:); wine_labels (427:490,:)]; %
Extracting the test set labels
[predict_label, accuracy] = svmpredict (test_wine_labels, test_wine, model); %
The predicting accuracy
The accuracy of the predicting results with three different preprocessing methods
is shown in Table 112.1 and Fig. 112.2.
From Table 112.1 and Fig. 112.2, it could be seen the predicting accuracy by
[0,1] normalization was the highest, which was up to 98.41 %. Only 2 of 126
112 Application of Support Vector Machine in Base Liquor Classification 1055
Table 112.1 The accuracies of the model with three different processing methods
No. Preprocessing Predicting Predicting accuracy of Predicting accuracy of high-
methods accuracy (%) ordinary base liquor (%) quality base liquor (%)
1 Raw data without 94.44 96.77 92.18
Normalization (119/126) (60/62) (59/64)
2 [0,1] 98.41 98.38 95.31
Normalization (124/126) (61/62) (61/64)
3 [-1,1] 96.03 93.54 98.43
Normalization (121/126) (58/62) (63/64)
Fig. 112.2 The actually and predicting labels of the test set with three different processing
methods, a: raw data without normalization, b:[0,1] Normalization, c:[-1,1] Normalization
samples were misclassified. The predicting accuracy of ordinary base liquor was
98.38 % and the predicting accuracy of high-quality base liquor was 95.31 %. The
predicting accuracy still reached to 94.44 % when the raw data without normal-
ization was used. Thus, base liquor classification was accurately realized by SVM
and the experiments obtained some satisfied results.
1056 J. Lu et al.
112.4 Conclusion
Results obtained from experiments showed that the proposed approach had the
merits of high learning efficiency, classification accuracy, and generalization
capability. This method performed well and fast, it was suitable for practical
application. In the future, how to improve the predictive accuracy of the model by
parameter optimization of ‘‘c’’ and ‘‘g’’ is worthy to be studied. This method could
be widely used with the step of continual study.
References
1. Shen Y (2006) The history and development of Chinese liquor sensory quality and evaluation
technology [J]. Liquor Mak 33(4):3–4 (in chinese)
2. Jiang A, Peng J, Peng S et al (2010) Research on SVM-based liquor infrared spectrum
analysis method. Comput Appl Chem 27(2):233–236 (in chinese)
3. Zhang J, Zhao L, Ouyang Y et al (2007) Applications of modern equipment analytical
techniques in sensory evaluation of liquor [J]. Food Sci 10:561–565 (in chinese)
4. Vapnik VN (1998) Statistical learning theory. John Wiley and Sons, Inc., New York
5. Vapnik VN (2000) The nature of statistical learning theory. Springer, New York
6. Burges CJ (1998) A tutorial on support vector machines for pat tern recognition. Data Min
Knowl Discov 2:127–167
7. Cristianini N, Shaw a-Taylor J (2000) An introduction of support vector machines and other
kernel based learning methods. Cambridge University Press, New York
8. Wang L, Lin J (2006) Development and application of Support Vector Machine [J]. Automat
PetroChem Ind 3:34–38 (in chinese)
9. Chang CC, Lin CJ (2010) LIBSVM: LIBSVM—A library for support vector machines. 2011.
software available at http://www.csie.ntu.edu.tw/*cjlin/libsvm/
10. Shi F, Wang X, Yu L et al (2010) Analysis of 30 neural network cases by MATLAB [M].
Beihang University Press (in chinese), Beijing
Chapter 113
Isolation and Characterization
of n-Butanol Tolerant Microorganisms
Yue Yu, Hongjiang Yang, Qun Li and Xuying Qin
Abstract n-butanol is produced traditionally by acetone butanol ethanol (ABE)

fermentation with relatively low productivity. To improve n-butanol synthesis
level, microbes naturally with high tolerance to n-butanol are required for meta-
bolic engineering. In this study, a total of 30 n-butanol tolerant microorganisms
were isolated from various environmental samples by screening the enriched
cultures. Ten of them were able to tolerate more than 2 % (v/v) n-butanol, and
strain YY-23 even thrived in the presence of 3 % (v/v) n-butanol. In addition,
n-butanol tolerance mechanisms were investigated by quantitatively analyzing
degradation ability of the isolates. The results showed that strains YY-13, YY-14,
YY-15, and YY-18 didn’t metabolize n-butanol in LB medium, suggesting that
they didn’t have n-butanol degrading enzymes and all of them might be used as
candidates for construction of high n-butanol producing strains. Strains YY-10 and
YY-29 showed strong n-butanol degradation efficiency (31 and 20 %, respec-
tively), and might be used for n-butanol bioremediation. Furthermore, the isolated
strains were identified by the 16S rRNA gene sequences comparative analysis.
Keywords Characterization Degradation n-butanol Tolerance
113.1 Introduction
Butanol is an important fine chemical raw material, mainly used in the production
of dibutyl phthalate (DBP) and butyl acrylate (BA) [1]. More importantly, butanol
is regarded as good bio-fuel because it has high energy content, high miscibility
with gasoline, high octane rating, and low volatility [2, 3]. Studies have shown that
Y. Yu H. Yang (&) Q. Li X. Qin

1058 Y. Yu et al.
equal volume of butanol could release twice as much energy as ethanol did when
burning [4]. With the shortage of the fossil oil fuel resources and the increasing
greenhouse effect, biofuels especially n-butanol have been attracting growing
attentions [5, 6].
Traditionally n-butanol was produced by Clostridium acetobutylicm and related
variants by using starch or sugars under anaerobic condition [7–9], and the process
was usually known as acetone butanol ethanol (ABE) or solvent fermentation [10].
Acetone, butanol, and a small amount of alcohol and other solvents can generally be
produced by several clostridia species, and the mainly n-butanol producing strains
currently used in industrial production are C. acetobutylicum, C. beijerinckii,
C. saccharobutyl-acetonicum, and C. saccharobutylicum [11, 12].
ABE fermentation had been adopted for n-butanol production for a long time.
However, its yields, productivity and final concentrations were too low for bio-
production to compete economically with chemical synthesis [13–15]. To improve
the productivity of n-butanol by microbial fermentation, various approaches have
been applied in strains breeding, including synthetic biology, mutagenesis, genetic
engineering, metabolic engineering, cell immobilizations, and the continuous
n-butanol removal during fermentation process [16]. Due to the slow growth rate
and stringent equipments requirements for ABE fermentation, n-butanol synthesis
pathways have been and cloned into various industrial microbes for heterologous
expression, including Escherichia coli, Pseudomonas putida, Bacillus subtilis, and
Lactobacillus brevis [17–19]. These microbes have relatively higher tolerance to
n-butanol and much faster growth rate compared with clostridia species.
In this work, to get more strains natively against n-butanol, we selected
n-butanol tolerant microorganisms from various environmental samples. The
isolates were further characterized for their n-butanol tolerance abilities and their
degradation efficiency of n-butanol. The isolates will be native candidates for
further metabolic engineering to produce n-butanol heterologously.
113.2.1 Environmental Samples
The soil and sludge samples were collected from 36 different environmental sites,
and they were stored in sterile sealed bags at 4 C refrigerator ready for use.
113.2.2 Media
Luria–Bertani (LB) medium was used for routinely cultivation and maintenance of
bacteria, and it was composed of NaCl 10 g/L, peptone 10 g/L, and yeast extracts
113 Isolation and Characterization of n-Butanol Tolerant Microorganisms 1059
5 g/L. The medium was adjusted to pH 7.0. To make the solid medium, 15 g/L
agar is added to LB medium.
Enrichment medium was used for the isolation of n-butanol tolerant microbes,
and it was composed of KH2PO4 0.5 g/L, K2HPO4 0.5 g/L, FeSO47H2O 0.01 g/L,
MgSO4 0.2 g/L, NaCl 9 g/L, Peptone 5 g/L, and Glucose 30 g/L. The medium was
adjusted to pH 7.0 [20]. Suitable amount of n-butanol was added to the medium for
the enrichment and selection of n-butanol tolerant strains.
The basic medium and LB medium were used for cultivation of the isolates to
analyze the n-butanol degradation efficiency. The basic medium (pH 7.0) was
composed of KH2PO4 0.5 g/L, K2HPO4 0.5 g/L, FeSO47H2O 0.01 g/L, MgSO4
0.2 g/L, NaCl 9 g/L, and (NH4)2SO4 5 g/L. Suitable amount of n-butanol was
added to the media for the analysis.
113.2.3 Enrichment and Isolation of n-Butanol

Tolerant Strains
Add soil and sludge samples (20 g) to 150 mL sterile saline buffer and shake for
30 min. After keep the mixture statically for 15 min, transfer 10 mL supernatant to
150 mL enrichment medium (supplement with 10 g/L and 50 g/L n-butanol,
respectively) in 250 mL flasks sealed with solid caps. The mixtures were incubated
at 35 C. After 24 h incubation, 10 mL supernatant was transferred to 150 mL
fresh enrichment medium (supplement with 10 g/L and 50 g/L n-butanol,
respectively), the mixtures were continuously cultured for another 24 h under the
same conditions. Repeat the enrichment step three more times. At the end of
enrichment, take 1 mL enrichment culture and make serial dilutions. Take 150 lL
of each dilution and spread on solid enrichment medium supplementing with n-
butanol (10 g/L). The Petri dishes were incubated at 35 C for 72 h for
observation.
113.2.4 Tolerance Analysis
The isolated strains were continuously cultivated in 5 mL LB medium at 35 C to

prepare primary and secondary seeding cultures. The secondary seeding cultures
were transferred into test tubes with 5 mL fresh LB medium at 5 % inoculum
sizes. n-butanol were added to the cultures at the concentration of 1, 2, and 3 %,
respectively. After incubation at 35 C for 24 h with shaking speed of 220 rpm,
the cell optical density at wavelength of 600 nm (OD600) was determined [21].
1060 Y. Yu et al.
Degradation efficiency analysis was performed as described previously [22]. In

brief, the isolated strains were inoculated in 5 mL LB medium and incubated at
35 C overnight. The cultures were transferred into 5 mL fresh LB medium at 5 %
inoculum size. One percent of n-butanol was added to the cultures, while sterile
saline buffer was used as control. After 24 h incubation at 35 C, n-butanol level in
the fermentation broth was subjected to gas chromatography analysis. Basic
medium was also used for degradation efficiency analysis.
Agilent 7890A with column HP–INNOWAX (30 m*0.32 mm*0.25 lm) was
used. Sample preparation includes centrifugation and filtering with 0.25 lm filter.
The main parameters were set up according to the manual with modifications [23].
Briefly, the temperature of column oven was held at 45 C for 1 min, and then
programmed at 8 C/min to 155 C and held for 1 min; the flow rate of nitrogen
gas, hydrogen gas, and air were 35, 35, and 350 mL/min, respectively. The
injection port temperature was maintained at 180 C and the dual hydrogen flame
ionization detector temperature was 200 C. Isoamyl alcohol was used as internal
control standard [13].
113.2.6 Identification of the Isolated Strains
Bacterial genomic DNA was extracted as described previously [24]. Specific

primers 27F and 1492R were used to amplify bacterial 16S rRNA gene fragment,
and their sequences were as follows:
27F: 50 -AGAGTTTGATCCTGGCTCAG-30 (corresponding to Escherichia coli
positions 8–27).
1492R: 50 -GGTTACCTTGTTACGACTT-30 (corresponding to Escherichia coli
positions 1,507–1,492).
The PCR reaction system was 50lL and the parameters include denaturation at
94 C for 5 min, 1 cycle; denaturation at 94 C for 1 min, annealing at 53 C for
45 s, and extension at 72 C for 1 min, 33 cycles; 72 C for 10 min.
PCR products were purified from gel and subjected to sequencing analysis with
the same primers used in PCR. Sequence homology search was carried out with
BLAST provided by NCBI to identify the isolates [25]. The isolates were classified
to genus level with Classifier (Ribosomal Database Project II) [26].
113.3.1 Enrichment and Isolation of n-Butanol

Tolerant Strains
Totally 30 strains with different morphologies were selected from various envi-
ronmental samples. Among them, 25 strains were screened out from the enriched
culture in presence of 10 g/L n-butanol, and 5 strains were screened out from the
enriched culture in the presence of 50 g/L n-butanol.
113.3.2 Tolerance Analysis
Solvents have natural toxicity to microbes [27]. n-Butanol toxicity is a crucial

factor affecting the production level of fermentation [28, 29]. The tolerance ability
of the 30 isolates was quantitatively determined by measuring the relative growth
rate of different strains in the presence of 1, 2, and 3 % n-butanol, respectively.
Almost all the isolated strains grew well in the medium supplementing with 1 %
n-butanol, indicating they can tolerate 1 % n-butanol during growth (Fig. 113.1a).
In the presence of 2 % n-butanol, the relative growth rates of 10 strains were over
40 % of their corresponding controls (Fig. 113.1b). Among them, strain YY-23
had the highest relative growth rate 67.8 %. Even in the presence of 3 %
n-butanol, strain YY-23 still thrived though the relative growth rate was only 30 %
of the control (Fig. 113.1c). Its tolerance ability was similar to the strains isolated
previously [30].
The mechanisms of n-buanol tolerance in microbes have been explored, and

mainly including the barrier by cell membrane lipid, expulsion by efflux pumps,
adjustment in cellular membrane protein content, and degradation of n-buanol
[31–33]. In this work, we investigated n-butanol tolerance mechanisms of the
isolated strains by analyzing their n-butanol degradation efficiency in LB medium
and the basic medium, respectively.
As described in Materials and methods, remaining n-butanol in LB medium was
tested. Strains YY-13, YY-14, YY-15, and YY-18 didn’t digest n-butanol at all,
while strains YY-4, YY-8, YY-16, YY-30, and YY-10 degraded more than 20 %
n-butanol, especially strain YY-10 can remove as much as 31 % n-butanol within
24 h incubation (Fig. 113.2a).
The degradation efficiency was also investigated in the basic medium supple-
ment with n-butanol as sole carbon source. As shown in Fig. 113.2b, strains YY-2,
1062 Y. Yu et al.
(a) 1
0.8
0.6
0.4
0.2
0
YY-10
YY-11
YY-12
YY-13
YY-14
YY-15
YY-16
YY-17
YY-18
YY-19
YY-20
YY-21
YY-22
YY-23
YY-24
YY-25
YY-26
YY-27
YY-28
YY-29
YY-30
YY-1
YY-2
YY-3
YY-4
YY-5
YY-6
YY-7
YY-8
(b) YY-9
1
0.8
0.6
0.4
0.2
0
YY-10
YY-11
YY-12
YY-13
YY-14
YY-15
YY-16
YY-17
YY-18
YY-19
YY-20
YY-21
YY-22
YY-23
YY-24
YY-25
YY-26
YY-27
YY-28
YY-29
YY-30
YY-1
YY-2
YY-3
YY-4
YY-5
YY-6
YY-7
YY-8
YY-9
(c) 1
0.8
0.6
0.4
0.2
0
YY-10
YY-11
YY-12
YY-13
YY-14
YY-15
YY-16
YY-17
YY-18
YY-19
YY-20
YY-21
YY-22
YY-23
YY-24
YY-25
YY-26
YY-27
YY-28
YY-29
YY-30
YY-1
YY-2
YY-3
YY-4
YY-5
YY-6
YY-7
YY-8
YY-9
Fig. 113.1 Relative growth rates of the isolates. a The relative growth rates of the isolates in the
presence of 1 % n-butanol. b The relative growth rates of the isolates in the presence of 2 % n-
butanol. c The relative growth rates of the isolates in the presence of 3 % n-butanol
YY-7, YY-11, YY-21, and YY-29 digested more than 25 % n-butanol within 24 h,
especially strain YY-29 remove as much as 31.7 % n-butanol in the basic medium
within 24 h (Fig. 113.2b).
Strains YY-10 and YY-29 showed high n-butanol degradation efficiency in LB
and the basic medium. Both of them could be used in bioremediation of n-butanol
associated contaminations. Especially strain YY-10 could digest n-butanol even in
the presence of other carbon sources, indicating it might disrupt n-butanol in a way
of cometabolism and suitable for bioremediation in more complicated environ-
ments [34]. No degradation of n-buanol was observed in strains YY-13, YY-14,
YY-15, and YY-18, the mechanisms of their n-butanol tolerance might not be
related with degradation, and these strains might be more suitable for metabolic
engineering to construct high level n-butanol producing strains.
(a)
0.4
0.3
0.2
0.1
YY-10
YY-11
YY-12
YY-13
YY-14
YY-15
YY-16
YY-17
YY-18
YY-19
YY-20
YY-21
YY-22
YY-23
YY-24
YY-25
YY-26
YY-27
YY-28
YY-29
YY-30
YY-1
YY-2
YY-3
YY-4
YY-5
YY-6
YY-7
YY-8
(b) YY-9
0.4
0.3
0.2
0.1
0
YY-10
YY-11
YY-12
YY-13
YY-14
YY-15
YY-16
YY-17
YY-18
YY-19
YY-20
YY-21
YY-22
YY-23
YY-24
YY-25
YY-26
YY-27
YY-28
YY-29
YY-30
YY-1
YY-2
YY-3
YY-4
YY-5
YY-6
YY-7
YY-8
YY-9
Fig. 113.2 Degradation efficiency of the isolated strains. a Remaining n-butanol analysis in LB
medium b Remaining n-butanol analysis in the basic medium
Strains YY-10, YY-13, YY-14, YY-15, YY-18, YY-23, and YY-29 are selected
for identification. Their genomic DNA was used as templates for PCR to amplify
16S rRNA gene fragments. PCR products were purified and subjected to
sequencing analysis. Homology searches were performed via BLAST provided by
NCBI [25]. Their taxonomy classifications were carried out by the program
Classifier of RDPII [26]. Both analyses gave similar results, strains YY-10, YY-
14, and YY-29 were homologous to Bacillus subtilis with the similarity of 100, 99,
and 100 %, respectively, strain YY-13 was homologous to Bacillus cereus with the
similarity of 99 %, strain YY-15 was homologous to Bacillus tequilensis with the
similarity of 99 %, strain YY-18 was homologouos to Bacillus methylotrophicus
with the similarity of 99 %, and strain YY-23 was homologous to Pseudomonas
stutzeri with the similarity of 99 % (Table 113.1). Previously, Escherichia coli,
Zymomonas mobilis, Saccharomyces cerevisiae, and Lactobacillus had been
reported to resist to 1–3 % n-butanol [30, 35, 36]. However, their n-butanol tol-
erance mechanisms were not studied [30]. For n-butanol producing strain con-
struction, tolerant strains which showed high n-butanol degradation efficiency
should be expelled from the candidate list.
1064 Y. Yu et al.
Table 113.1 Homology analysis and classifications of the isolated strains

Strains Accession no. Most similar strains (accession no) Similarity (%) Genusa
YY-10 JX575604 Bacillus subtilis (JQ039972.1) 100 Bacillus
YY-13 JX575605 Bacillus cereus (GQ462534.1) 99 Bacillus
YY-14 JX575606 Bacillus subtilis (FJ263018.1) 99 Bacillus
YY-15 JX575607 Bacillus tequilensis (JX077105.1) 99 Bacillus
YY-18 JX575608 Bacillus methylotrophicus (JN700125.1) 99 Bacillus
YY-23 JX575609 Pseudomonas stutzeri (AB680456.1) 99 Pseudomonas
YY-29 JX575604 Bacillus subtilis (JQ039972.1) 100 Bacillus
a
Classification results by classifier from RDPII [26]
113.4 Conclusions
Tolerance was a crucial factor affecting synthesis level of n-butanol producing

strains. To construct n-butanol high producing recombinant strains, native
n-butanol tolerant strains are required for metabolic engineering. In this work,
totally 30 strains tolerant to n-butanol were isolated. Strains YY-13, YY-14, YY-
15, and YY-18 didn’t metabolize n-butanol in LB medium, strain YY-23 had the
highest relative growth rate even in the presence of 3 % butanol with relatively
low n-butanol degradation efficiency, and all of them might be used as candidates
for genetic engineering to construct high n-butanol producing strains. Their
n-butanol tolerance mechanisms needed to be further investigated. Strains YY-10
and YY-29 showed strong n-butanol degradation efficiency and could be used for
n-butanol bioremediation.
References
1. Lee SY, Park JH, Jang SH et al (2008) Fermentative butanol production by Clostridia.
Biotechnol Bioeng 101(2):209–228
2. Schwarz WH, Gapes JR (2006) Butanol-rediscovering a renewable fuel. BioWorld Europe
1:16–19
3. Riehard VN (2008) Biobutanol enters battle of the alcohols. Chem World-UK 5(2):21
4. Ladisch MR (1991) Fermentation-derived butanol and scenarios for its uses in energy-related
applications. Enzym Microbiol Technol 13:280–283
5. Shota A, Anthony FC et al (2008) Metabolic engineering of Escherichia coli for 1-butanol
production. Metab Eng 10:305–311
6. Jiang M, Wei P et al (2006) Consideration on the development of industrial biotechnology of
post-petroleum epoch. Chem Ind Eng Prog 25(10):1119–1123
7. Qureshi N, Blaschek HP (2001) Recent advances in ABE fermentation: hyper-butanol
producing Clostridium beijerinckii BA101. J Ind Microbiol Biotechnol 27(5):287–291
8. Parekh M, Formanek J, Blaschek HP (1998) Development of a cost-effective glucose-corn

steep medium for production of butanol by Clostridium beijerinckii. J Ind Microbiol
9. Madihah MS, Ariff AB (2001) Direct fermentation of gelatinized sago starch to acetone-
butanol-ethanol by Clostridium acetobutylicum. World J Microbiol Biotechnol 17:567–576
10. Karakashev D, Thomsen AB, Angelidaki I (2007) Anaerobic biotechnological approaches for
production of liquid energy carriers from biomass. Biotechnol Lett 29:1005–1012
11. Papoutsakis ET (2008) Engineering solventogenic clostridia. Curr Opin Biotechnol
19(5):420–429
12. Keis S, Shaheen R, Jones DT (2001) Emended descriptions of Clostridium acetobutylicum
and Clostridium beijerinckii, and descriptions of Clostridium saccharoperbutylacetonicum sp.
Nov. and Clostridium saccharobutylicum sp Nov. Int J Syst Evol Microbiol 51:2095–2103
13. Woods DR (1995) The genetic engineering of microbial solvent production. Trends
Biotechnol 13(7):259–264
14. Linden JC, Moreira AR, Lenz TG (1985) Comprehensive biotechnology. Pergamon Press,
Oxford
15. Jones DT, Woods DR (1986) Acetone-butanol fermentation revisited. Microbiol Rev
50(4):484–524
16. Jin X, Wang G, He B (2007) Research progress and high yield strategy of acetone-butanol
fermentation. Chem Ind Eng Prog 26:1727–1732
17. Nair RV, Papoutsakis ET (1944) Expression of plasmid-encoded aad in Clostridium
acetobutylicum M5 restores vigorous butanol production. J Bacteriol 176(18):5843–5846
18. Harris LM, Blank L, Desa IRP et al (2001) Fermentation characterization and flux analysis of
recombinant strains of Clostridium acetobutylicum with an inactivated solR gene. J Ind
Microbiol Biotechnol 27(5):322–328
19. Tomas CA, Welker NE, Papoutsakis ET (2003) Overexpression of groESL in Clostridium
acetobutylicum results in increased solvent production and tolerance, prolonged metabolism,
and changes in the cell’s transcriptional program. Appl Environ Microbiol 69(8):4951–4965
20. Chen Taosheng, Qizu Lu (1991) Fermentation of acetone and butanol production technology.
Chemical Industry Press, Beijing
21. Liu J, Fan LT et al (2004) Downstream process synthesis for biochemical production of
butanol, ethanol, and acetone from grains: Generation of optimal and near optimal flow
sheets with conventional operating units. Biotechnol Prog 20(5):1518–1527
22. Huang WC, Ramey DE, Yang ST (2004) Continuous Production of butanol by Clostridium
acetobutylicum immobilized in a fibrous bed bioreactor. Appl Biochem Biotechnol
22(16):113–116
23. Jingchang He (2009) Study on the selecting of high acetone and butanol production strain and
its new fermentation technology, Zhejiang University of Technology, Zhejiang
24. Sambrook J, Russell DW (2001) Molecular Cloning: A Laboratory manual, 3rd edn. Cold
Spring Harbor Press, New York
25. Zhang Jinghui, Madden TL (1997) Power BLAST: A new network BLAST application for
interactive or automated sequence analysis and annotation. Genome Res 7(6):649–656
26. Wang Qing, Garrity GM, Tiedje JM et al (2007) Naive Bayesian classifier for rapid
assignment of rRNA sequence into the new bacterial taxonomy. Appl Environ Microbiol
73(16):5261–5267
27. Clark DP, Beard JP (1979) Altered phospholipid composition in mutants of Escherichia coli
sensitive or resistant to organic solvents. J Gen Appl Microbiol 113:267–274
28. Bowles LK, Ellefson WL (1985) Effects of butanol on Clostridium acetobutylicum. Appl
Environ Microbiol 50:1165–1170
29. Papoutsakis ET, Alsaker KV, Borden J (2005) Understanding butanol and butyrate toxicity
and tolerance in clostridia at the genomic scale. United States: 229th ACS National Meeting,
San Diego
30. Knoshaug EP, Zhang M (2009) Butanol tolerance in a selection of microorganisms. Appl
Biochem Biotechnol 153(1–3):13–20
1066 Y. Yu et al.
31. Baer SH, Blaschek HP, Smith TL (1987) Effect of butanol challenge and temperature on lipid
composition and membrane fluidity of butanol-tolerant Clostridium acetobutylicum. Appl
Environ Mircobiol 53:2854–2861
32. Ramos JL et al (2002) Mechaisms of solvent tolerance in gram-negative bacteria. Annu Rev
33. Weber FJ, Bont JA (1996) Adaptation mechanisms of microorganisms to the toxic effects of
organic solvebts on membranes. Biochim Biophys Acta 1286:225–245
34. Yuquan Xu, Zhang Wei (2000) Isolation and identification of a phenol-degrading bacterial
strain. Acta Sci Circumst 20(4):450–455
35. Luong JHT, Nguyen AL (1986) Diffusion in k-carrageenan gel beads. Biotechnol Bioeng
29:242–248
36. Antoce OA et al (2007) A calorimetric method applied to the study of yeast growth inhibition
by alcohols and organic acids. Am J Enol Viticult 48(4):413–422
Chapter 114
Effects of Dual-Frequency Ultrasound
with a-amylase on the Properties
and Structure of Mung Bean Starch
Aijun Hu, Jing Lu, Jie Zheng, Xiaoqing Zhang, Ying Zhang,
Tong-Cun Zhang, Qian Li and Lin Yang
Abstract In this paper, we focus on the effects of dual-frequency ultrasound

(40 and 80 kHz) with a-amylases (5U/g) on the properties and structure of mung
bean starch. The reducing sugar value and starch solubility in the treated starch
slurry under ultrasound enzyme were studied. Scanning electron microscopy
(SEM) and Fourier transform infrared spectrometer (FTIR) were used to measure
the apparent structure and crystal texture of starch. The results indicated that
compared with the results of single-frequency ultrasound treatment, dual-fre-
quency ultrasound promoted the starch hydrolysis by amylase and increased the
starch solubility remarkably. More channels and holes were found on the surface
of treated starch granule by SEM. The results of FTIR analysis showed the FTIR
peak shape of ultrasonic treated starch was different from that of the control starch.
Keywords Ultrasound Mung starch Property Structure a-amylases
A. Hu (&) L. Yang J. Zheng Y. Zhang Q. Li J. Lu

Key Laboratory of Food Nutrition and Safety (Tianjin University of Science& Technology),
Ministry of Education, College of Food Engineering and Biotechnology, Tianjin University
of Science & Technology, Tianjin 300457, People’s Republic of China
e-mail: huaijun@tust.edu.cn
X. Zhang
Modern Analytic Technique Research Center, Tianjin University of Science & Technology,
T.-C. Zhang
Bioengineering, Tianjin University of Science & Technology, Tianjin, China
1068 A. Hu et al.
114.1 Introduction
As a renewable resource and a carbohydrate, starch is very abundant, and its yield is
only less than cellulose in nature [1]. It is often used as an important raw material in
many fields such as food, chemical, paper, and textile industry [2]. Because of the
defects in structure and properties, for example, insoluble in cold water, easy to be
aged, native starch is limited to wide applications. In order to improve them and to
meet the requirement of modern industrial processing, many technologies are
applied to modify starch, including chemical modification, physical modification,
and biochemical medication [3]. In many cases, chemical modification is replaced
by environmental friendly technologies considering its chemical contamination,
safety, and solvent residue in the product. Of which, two green modifications,
ultrasonic and enzymatic method are focused in the relevant area.
Ultrasound is a mechanic wave with the frequency of above 20 kHz [4]. It can be
divided into three types: power ultrasound, high frequency ultrasound, and diag-
nostic ultrasound [5]. The power ultrasound is usually used in textile industry,
pharmaceutical, and food processing, such as ultrasonic extraction, disinfecting,
emulsification, pasteurization, crystallization, degassing of liquids, defoaming, and
sonochemical reaction [6, 7]. These applications are introduced mainly owing to
three effects of ultrasound, physical effect, thermal effect, and cavitation effect [8, 9].
Ultrasonic Cavitation is the momentary creation of vacuum ‘‘bubbles’’ in the
fluid which immediately and violently implode to produce millions of microscopic
jets of liquid. In addition, a local temperature near this activity has been shown to
be as high as 10,000 C, and the pressure produced may be as high as 10,000 PSI.
It is considered as the main reason that ultrasound is successfully used in many
fields and sonochemical reaction takes place. And it has been studied extensively
from the mid-twentieth century owing to its importance for ultrasonic applications
[10]. Ultrasound treatment of corn starch could distort the crystalline region, and
destruct the granular structure [11].
Enzyme is a biological catalyze with many varieties such as a-amylases,
b-amylase, and protease. a-amylases are very important in biological reactions
such as fermentation, germination, or digestion, and also widely used in starch
processing industry. a-amylases only attack the a, 1–4 glycosidic bond in starch
granules, produce a small quantity of glucose which raises the dextrose equivalent.
Moreover, it can cause starch granules surface some little holes or other kinds of
damage with no change of starch X-ray pattern or the crystal structures [12, 13].
Nowadays ultrasonic and enzymatic application are paid more interests and
focuses, however till now, no researches are found on the effects of dual-frequency
ultrasonic with enzyme on starch. The aim of this work was to research the effects
of dual-frequency ultrasound with a-amylases on properties and structure of mung
bean starch (MBS), which provides a theoretical and experimental background for
dual-frequency ultrasonic application in starch and enzymic hydrolysis.
114 Effects of Dual-Frequency Ultrasound with a-amylase 1069
114.2.1 Materials and Equipment
Commercially available MBS (13 % moisture) was obtained from Jin Cheng
Co., Ltd, (Shandong, China). Sodium hydroxide, AR, was supplied by the Tianjin
DeEn Chemical Reagent Company (Tianjin, China). Fehling reagent was obtained
from Sigma Company (American). a-amylase (2,000U/mL) was supplied by
Imperial Jade Bio-Technology Co.,Ltd (Ningxia, China). Ultrasonic cleaner was
supplied by Scientz Biotechnology Co.,Ltd (Ningbo, China). Electronic analytic
balance (FA1604S) was supplied by Weighing Scales Instrument Factory
(Shanghai, China). pH Meter (PHS-3C) was supplied by LEICI Instrument
Company (Shanghai, China). Electric blast oven (DGG-101-2) was supplied by
Tianjin Tianyu Instrument Company (Tianjin, China). Electric heated hater bath
(HW-SY21-K) was supplied by Beijing Changfen Instrument Company (Beijing,
China). Electronic balance (TD1200) was supplied by Tianjin Tianma Instrument
Company (Tianjin, China). Scanning Electron Microscope SU-1510 was obtained
from Hitachi Ltd (Tokyo, Japan). Infrared spectrometer Vector22 was obtained from
Bruker spectrometer (Germany).
114.2.2 Sample Preparation Method
Sample suspensions were prepared by stirring 100 g mung starch and 900 mL
distilled water. Sodium hydroxide was used to neutralize the solution (pH = 6.0)
and then mixed with a-amylases according to 5U per 1 g starch. Calcium chloride
(0.2 %) was applied to protect the enzyme activity. Prepared samples were placed
into the bath and ultrasonic treated with 40 kHz, 80 kHz, and 40 ? 80 kHz for
90 min in 60 C, respectively. Treatments without the ultrasound were used as
controls. The preparation of sonicated mung starch was performed in triplicate.
114.2.3 Determination of Reducing Sugar
The reducing sugar of suspension was determined, using the titrimetric method
according to GB/T5009.7-2008. Dextrose equivalent (DE) was used to examine
the degree of hydrolysis of starch. DE was calculated as follows:
Greducingsugar expressed glucose
DE ¼ 100 % ð114:1Þ
g dry solid weight
1070 A. Hu et al.
114.2.4 Determination of Starch Solubility
Five starch suspensions of 1 % (w/w) were separately prepared in a flask and were
heated to 95 C for 30 min with shaking every 5 min and left for cooling to room
temperature (30 ± 2 C) and centrifuged for 15 min at 3,000 g. The supernatant
was decanted, and the residual volume was determined. The solid part was dried in
an oven for 2 h at 130 C [14]. The result was expressed as the mean of the
determination results of above suspensions.
114.2.5 Scanning Electron Microscopy
The samples were sprinkled on double-sided adhesive tape and mounted on an

aluminum stub, and then coated with a thin gold film. Optical sections of granules
were obtained by scanning electron microscope [15].
114.2.6 Fourier Transforms Infrared (FTIR) Spectroscopy
FTIR spectra of samples in KBr pellets (1 mg/30 mg) were measured on a spec-
trophotometer with a DTGS detector and OMNIC 7.0 software using 64 scans at
resolution of 4 cm-1. The spectra were recorded over the wave number range
between 4,000 and 500 cm-1. The samples were dried at 105 C for 4 h before
analysis to avoid interference by moisture [16].
114.3.1 Effect of Ultrasound and Amylase on Reducing

Sugar
Figure 114.1 indicated that ultrasound had a remarkable effect on DE of the starch
hydrolysate. Ultrasound promoted amylase action on the starch granules to produce
smaller molecules and reducing sugar, as a result, the DE increased. As the ultra-
sonic frequency was increased, the effect on DE was more obvious. DE of K4
treated by dual-frequency was bigger than the others. This may be explained that
dual-frequency ultrasonic treatment can create more bubbles and cavitations which
contribute to the enzymatic hydrolysis and the decomposition of starch granules
[17].

ultrasound and a-amylase
18
treatment on dextrose
equivalent (K1 was treated 16
Dextrose equivalent/%
only with amylase; K2, K3,
14
K4 were treated respectively
by 40, 80, and 40 ? 80 kHz 12
ultrasound with amylase).
10
‘‘**’’ difference is extremely
significant (P \ 0.01) 8
6
4
2
0
K1 K2 K3 K4
Sample Number
114.3.2 Effect of Ultrasound and Amylase on Samples

Solubility
It can be shown from Fig. 114.2 that starch solubility was affected by both
ultrasound and amylase. Compared with K0, the solubility of K1 and K2 increased,
however, K3 and K4 had greater solubility. The structure of starch may be
destroyed by ultrasound and amylase, thus its internal soluble matter can be easier
to release [18]. Dual-frequency ultrasound acts starch granule more seriously and
the solubility reached the maximum. This trend was consistent with DE.

45
treatment on solubility (K0
was native starch, K1 was 40
treated only with amylase; 35
K2, K3, K4 were treated,
Solubility/%
respectively by 40 kHz, 30
80 kHz, and 40 ? 80 kHz 25
ultrasound with amylase).
‘‘*’’ Difference is significant 20
(P \ 0.05). ‘‘**’’ Difference 15
is extremely significant
10
(P \ 0.01)
5
0
K0 K1 K2 K3 K4
Sample Number
1072 A. Hu et al.
K0 K1 K2
K3 K4
Fig. 114.3 Effect of ultrasound and a-amylase treatment on apparent structure (K0 was native
starch, K1 was treated only with amylase; K2, K3, K4 were treated respectively by 40 kHz,
80 kHz, and 40 ? 80 kHz ultrasound with amylase)
114.3.3 Influence of Ultrasound and Amylase on Apparent

Structure of Samples
As shown in Fig. 114.3 that native starch granule was oval or kidney-shaped and
some attachments could be seen on the surface of granule, which may be protein
(K0) [19]. After treated with only amylase, some little holes and channels were
found on the surface of granules (K1). Both 40 kHz and 80 kHz ultrasonic
treatment with amylase made the holes or channels bigger and deeper. K4 clearly
indicated that starch granule was broken seriously and parts of structure were
separated from granule. This was probably because of the more powerful cavita-
tion of dual-frequency ultrasound [20].
114.3.4 Influence of Ultrasound and Amylase on Crystal

Structure of Samples
FTIR spectroscopy was used to verify the change in the crystal structure of sample
molecules resulting from ultrasound and amylase. The FTIR spectra of K0, K1,
K2, K3, and K4 are shown in Fig. 114.4. It could be seen that the spectrum of five
samples had a little difference at about 1,390 cm-1. In every sample spectrum, the
bands 3,386 and 2,930 cm-1 correspond to OH and CH stretching, respectively,
while the bands at 1,645 cm-1 correspond to the scissoring of two O–H bonds of
water molecules [21]. Compared to K0, FTIR spectra of K1, K2, K3, and K4 have
similar profiles indicating that the ultrasound and amylase had effect on the crystal
100
Fig. 114.4 Effect of
treatment on crystal structure
80
Transmittance/%
(K0 was native starch, K1
was treated only with
60
amylase; K2, K3, K4 were
treated respectively by
40
40 kHz, 80 kHz, and
40 ? 80 kHz ultrasound with
20
amylase)
3386
2930
1645
1404
1155
1080
1022
931
859
763
709
577
528
4000 3500 3000 2500 2000 1500 1000 500
-1
Wavenumber/cm
structure. The spectra of K1, K2, K3, and K4 provide evidence of ultrasonic effect
by showing the presence of important band at 1,404 cm-1(C–H). These C–H
bands were from glucoses which were produced by both amylase and ultrasound.
That was consistent with the conclusion of DE.
114.4 Conclusion
Both single-frequency (40 and 80 kHz) and dual-frequency ultrasound (40 ?

80 kHz) can promote amylase to act on the starch granule to increase the dextrose
equivalent. Also ultrasonic treatment with amylase can increase the solubility.
Ultrasonic treatment could produce many holes and channels on the surface, and
dual-frequency treatment destroyed the integrity of the particles, but did not
change the crystal structure. Compared to single-frequency ultrasound, dual-
frequency ultrasonic treatment has more significant effect on the properties and
structure of mung bean starch.
Acknowledgments The authors acknowledge the financial support from the National Natural
Science Foundation of China (Project No.: 31071608), the Science and Technology Innovation
Funded Project of Dongli District, Tianjin (Project No.:2010312), the 863 (Hi-tech research and
development program of China) program under contract NO.2012AA021505 and the National
Natural Science Foundation of China (Project No.: 31201354).
1074 A. Hu et al.
References
1. Liu XZ, Luo ZG, Hu ZH et al (2008) Effect of ultrasonic treatment on rheological properties
of corn starch. Mod Food Sci Technol 4:316–321
2. Yoshinobu I, Takehisa K, Toshiyuki W (1994) Ultrasound degradation of waxy rice starch.
Biosci Biotech Biochem 58:1799–1802
3. Ji GQ, Shao XZ, Wang YT (2010) Application of ultrasound technology in the modification
of starch. Cereals Oils 1:1–5
4. Melissa ML, Samir KK, Larson DJ et al (2010) Ultrasonic pretreatment of corn slurry for
saccharification, a comparison of batch and continuous systems. Ultrason Sonochem
17:939–946
5. Anet RJ, Zoran H, Drago S (2010) Ultrasound effect on physical properties of corn starch.
Carbohydr Polym 79:91–100
6. Devon KC, Ya JW (2006) Application of protease and high-intensity ultrasound in corn
starch isolation from degermed corn flour. Cereal Chem 83:506–509
7. Cao C, Liu BL (2009) Application and prospect of high-frequency ultrasound technique in
food industry. J Anhui Agric Univ 37:18143–18144
8. Kamaljit V, Richard M, Raymond M et al (2006) Ultrasonic recovery and modification of
food ingredients. Chem Mater Sci. doi:10.1007/978144197472313
9. Feng Z, Jiang FY, He TL (2010) Application of ultrasound in the food processing. J Wu Yi
Univ 34:21–26
10. Brennen CE (1995) Cavitation and Bubble Dynamics. New York: Oxford University Press
11. Anet RJ, Zoran H, Drago S (2010) Ultrasound effect on physical properties of corn starch.
Carbohydr Polym 79:91–100
12. Zhou Y, Hoover R, Liu Q (2004) Relationship between a-amylase degradation and the
structure and physicochemical properties of legume starches. Carbohydr Polym 57:299–317
13. Georges T, Anders VN, Agnes RS (2010) Hydrolysis of concentrated raw starch, a new very
efficient a-amylase from Anoxybacillus flavothermus. Carbohydr Polym 87:46–52
14. Luo ZG, Lu JJ (2010) Effect of ultrasound treatment on the thermal properties of maize
starch. Mod Food Sci Technol 7:666–668
15. Wang LF, Wang YJ (2003) Application of high-intensity ultrasound and surfactants in rice
starch isolation. Cereal Chem 81:140–144
16. Zhang B, Cui DP, Liu MZ et al (2012) Corn porous starch: Preparation, characterization and
adsorption property. Int J Biol Macromol 50:250–256
17. Mason TJ, Paniwnyk L, Lorimer JP (1996) The uses of ultrasound in food technology.
Ultrason Sonochem 3:253–260
18. Renate CB, Bozena R, Salah L et al (2005) Degradation of chitosan and starch by 360 kHz
ultrasound. Carbohydr Polym 60:175–184
19. Zhao YL, Liao DL, Zhang YQ et al (2007) The ultrasound effect on the properties and
structure of cassava starch. Chin J Process Eng 7:1138–1143
20. Huang Q, Li L, Fu X (2007) Ultrasound effects on the structure and chemical reactivity of
cornstarch granules. Starch—Starke 59:371–378
21. Zhang LM, Zuo BM, Wu PL (2012) Ultrasound effect on the acetylation of dioscorea starch
isolated from Dioscorea zingiberensis C. H. Wrigh. Chem Eng Process 54:29–36
Chapter 115
Relationship Between Diet and Stable
Carbon and Nitrogen Isotope Composition
in Beef Tissues
Fengmei Sun, Guangyu Shi, Huiwen Wang and Shuming Yang
Abstract The effect of the amount of C4 plants in diets on the carbon and nitrogen
stable isotope composition of different types of beef tissues was investigated.
Eighteen young bulls were randomly divided into six groups and fed with a diet
consisting of different content of C4 plant material. At the end of experiment, the
d13C values of cattle tail hair, defatted muscle, and crude fat all become enriched
and significantly correlated with increasing proportions of C4 constituents in the
diet. However, the d15N values of beef tissues did not increase regularly with the
change of diet, but the correlation among d13C and d15N values of above tissues
were highly correlated. Based on these results, it is possible for the proportion of
C4 plant material to be estimated from the d13C values of the different tissue
samples. And, cattle tail hair instead of muscle in beef origin is available.
Keywords d13C d15N Beef Diet Stable isotope
F. Sun (&) G. Shi

Department of Food Science, Hebei North University, Zhangjiakou 075131, People’s
Republic of China
e-mail: Shiliu0616@163.com
F. Sun S. Yang
Institute of Quality Standard and Testing Technology for Agro-Product, Chinese Academy
of Agricultural Science, Beijing 100081, People’s Republic of China
H. Wang
Department of Animal Husbandry and Engineering, Hebei North University, Zhangjiakou
075131, People’s Republic of China
1076 F. Sun et al.
115.1 Introduction
Food safety has become a focus of public concern. Because of diseases such as
bovine spongiform encephalopathy (BSE) and foot and mouth disease (FMD),
consumers are demanding to know the truth about provenance of animal products.
The Swiss Federal Office of Public Health carried out an investigation that showed
82 % of customers purchased their food based on knowing the origin of the
product [1]. Since January 2005, EU regulations have mandated that all food and
feed should be traced at all stages of production, processing, and distribution in
order to sell food and feed products in EU countries [2]. Therefore, a compre-
hensive tracing system is urgently needed for beef.
During the past 30 years, stable isotope ratio analysis (SIRA) has been suc-
cessfully used in some areas of food production to determine the authenticity of
food and to verify the geographic origin of food such as honey, fruit, and wine, etc.
[3–5]. Some methods for food authentication have been officially acknowledged
by institutions such as the European Commission for Normalization (CEN) or the
Association of Official Analytical Chemists (AOAC) [6]. In recent years, SIRA has
been regarded as a potential tool for tracing the geographic origin of animal food
such as milk, cheese, butter, lamb, beef [7–12], and beef diet [13–15]. Previous
studies have shown that the stable carbon and nitrogen composition of diets
influence the d13C and d15N values of animal tissue, where the former is varying
with proportions of C3 or C4 photosynthetic plant, and the latter is affected by
many other factors, but to some extent to reflect the legumes and cultivation
density of feed.Thus those of values of tissue are good indicators of diet [16].
Today, maize is largely used as cow and cattle feed to increase milk production or
weight. Boner [12] and Schmidt [10] have reported the d13C values of defatted
beef muscle could be used to distinguish organic from conventional cattle farming,
because the fodder of organic cattle farming mainly consists of C3 plants whereas
the C4 plants are more typically used in conventional cattle farming. Increasingly,
SIRA techniques are being developed as a quantitative tool for inferring the
proportion of C3/C4 plant components in cattle diets [15].
This study investigated the effect of different diets on the stable carbon (d13C)
and nitrogen (d15N) stable isotope composition of different bovine tissues with the
aim of establishing a quantitative relationship between the dietary C4 plant intake
and d13C of bovine tissues.
115.2.1 Animals and Experimental Designing
Eighteen (12–14 months old) young bulls were randomly divided into six treat-
ment groups of three animals each. Two dietary formulas were given to the cattle,
115 Relationship Between Diet and Stable Carbon and Nitrogen Isotope Composition 1077
Table 115.1 Dietary formula on a dry mass basis

Basic diet (%) C4 diet (%)
Maize silage C4 plants 44 Maize silage 30
Maize meal 8 Distiller maize 63
Soybean meal C3 plants 16 Maize meal 7
Wheat bran 12
Wheat flower 11
Cottonseed cake 9
Total 100 100
a basal diet and a diet consisting of entirely of C4 plants (Table 115.1). Initially,
these two kinds of diets were prepared, then the following portions, 0, 20, 40, 60,
80 and 100 %, of the C4 diet were mixed with 100, 80, 60, 40, 20, 0 % of the basal
diet for the six treatments, respectively. Where ultimately the C4 components
accounts for 52.0, 61.6, 71.2, 80.8, 90.4, 100 % of the total diet for the group 1
through 6, respectively. All animals were slaughtered after feeding for 132 days.
115.2.2 Feed Samples
During the study, feed samples were collected and stored at -20 C before SIRA.
Each individual composite sample was oven-dried at 60 C for 48 h and triturated.
The roughage feed (maize silage) and other materials were then sieved using 0.177
and 0.149 mm mesh screen, respectively.
115.2.3 Cattle Tail Hair
Prior to the commencement of the study and the start of the new diets, a strand of
tail hairs was cut close to the skin of each cattle. A sample was then taken in the
same way from the same position at the end of the experiment. The hair of entire
cattle tail was first soaked and was rinsed in deionized water and then dried at
60 C for 12 h. Then the samples were soaked in methanol/chloroform (2:1) for
2 h to removal fat and then rinsed and soaked in deionized water for another
30 min. Finally, the samples were rinsed with deionized water, dried at 60 C, and
cut into 1*2 mm [14, 16, 17].
115.2.4 Meat and Fat Samples
Buttock muscles were collected at 48 h after post-mortem and stored at -20 C.
The sample preparation followed a common preparation approach. Briefly, a
1078 F. Sun et al.
minimum 50 g sample is cut into small pieces with a ceramic scissors and dried
completely with the aid of a lyophilizer (freeze-drier). The dried pieces are
homogenized with a mortar and pestle. The resulting dry powder is extracted with
diethyl ether for 6–8 h in a Soxhlet apparatus. Afterwards the fat-free dry mass
(raw protein) is sieved through a 0.074 mm mesh screen and the lipid fractions
(after evaporating the solvent) for each beef sample is stored at 4 C until analysis.
115.2.5 Stable Carbon and Nitrogen Isotope Analysis
Pretreated samples (1 mg) were weighed into tin capsules and introduced into the
elemental analyzer (Flash EA1112) by an autosampler, where the samples were
combusted into CO2 and N2. The gas was separated using a gas chromatograph and
analyzed using a Thermal Finnigan DELTAPlus XL). The uncertainty of mea-
surements was typically ± 0.2 % for d13C and d15N. The values of the isotopic
ratios were expressed in d % according to the following general formula:

d ¼ Rsample = Rstandard 1 1; 000 ð115:1Þ
Where Rsample and Rstandard represent the abundance ratio of 13C/12C and
15
N/14N isotopes in the sample and the standard respectively. The standard used in
this study was the international standard V-PDB (Vienna Pee Dee Belemnite) for
d13C and air for d15N.
115.3.1 Feedstuff
The d13C and d15N values of the various feed materials are presented in
Table 115.2. Plants are divided into three types of C3, C4, and CAM according to
their different photosynthetic pathways. Maize silage, distiller maize, and maize
meal are all typical C4 plants which have enriched d13C values. Soybean meal,
wheat bran, wheat flower, and cottonseed cake are C3 plants, and their d13C values
Table 115.2 The d13Cand Feedstuff d13C (%) d15N (%)

d15N values of feed material
Maize meal -12.10 ± 0.14 1.14 ± 0.18
Distiller maize -13.00 ± 0.35 1.92 ± 0.27
Cottonseed cake -25.47 ± 0.38 1.84 ± 0.25
Wheat bran -26.21 ± 0.22 -0.64 ± 0.11
Wheat flower -27.65 ± 0.09 -0.19 ± 0.04
Maize silage -13.10 ± 0.64 0.60 ± 0.13
Soybean meal -25.41 ± 0.29 -0.60 ± 0.11
Table 115.3 The d13C values of cattle tissues and corresponding C4 content (mean ± SD),
N=3
Groups C4 content aDiets d13C Cattle tail hair Defatted muscle Crude fat d13C
13 13
( %) (%) d C (%) d C (%) (%)
1 52.0 -19.28 -18.17 ± 0.93 -18.58 ± 1.15 -21.11 ± 0.24
2 61.6 -18.02 -17.22 ± 0.39 -18.15 ± 1.11 -19.31 ± 1.90
3 71.2 -16.75 -16.36 ± 0.18 -17.91 ± 0.86 -19.65 ± 0.17
4 80.8 -15.49 -14.91 ± 0.31 -16.46 ± 0.38 -18.87 ± 0.63
5 90.4 -14.23 -13.41 ± 0.12 -14.70 ± 0.45 -17.49 ± 0.29
6 100 -12.97 -12.02 ± 0.14 -14.72 ± 0.68 -17.55 ± 0.45
a. these values were calculated based on the proportions of C3 and C4 plants and measured
isotope compositions of each.
Table 115.4 The d15N values of cattle tissues in different C4 content

Groups C4 content ( %) Diets d15N(%) Cattle tail hair d15N (%) Defatted muscle d15N (%)
1 52.0 0.15 4.82 ± 0.26 4.50 ± 0.10
2 61.6 0.42 5.30 ± 0.16 4.62 ± 0.10
3 71.2 0.68 5.23 ± 0.19 4.66 ± 0.32
4 80.8 0.94 4.61 ± 0.24 3.31 ± 0.18
5 90.4 1.21 5.11 ± 0.37 4.93 ± 0.59
6 100 1.47 4.48 ± 0.18 3.84 ± 0.19
are depleted. More materials for feed were manually mixed in most occasions, and
roughages such as grass silage and straw were difficult to be homogenized.
Therefore, the d13C values of medley of each group were calculated based on the
d13C values of feed ingredient and its proportion in the total diet (Table 115.3).
Generally, the d15N value of grass is higher than that of corn feed, and nitrogen-
fixing plants such as soybean, alfalfa are lower (close to atmospheric nitrogen 0
% or much lower). However, the d15N value of alfalfa was high in this study. The
d15N values of plants are affected by many factors, such as soil conditions, the
intensity of agricultural land use and nitrogen fertilizer [15, 18]. The d15N values
of medley of each group were calculated according to the same method
(Table 115.4).
115.3.2 Stable Carbon Isotope
Table 115.3 shows the d13C values of cattle tail hair, defatted muscle and crude
fat, all enrich in 13C with the increasing proportions of C4 constituents in the diet.
Moreover, all d13C values of the various beef tissues are significantly correlated
with the content of C4 plant material (Fig. 115.1). The correlation coefficient
between the d13C values of cattle tail hair and C4 plant content in the diet was the
highest (R2 = 0.99, P\ 0.01), followed by defatted muscle (R2 = 0.92, P \0.01)
1080 F. Sun et al.
δ13 C values of different tissues(‰)

Fig. 115.1 Relationship
between C4 content and d13C -11 y = 0.13x - 25.23
-12 2
values of the different tissue R = 0.99,P 0.01
types -13
y = 0.09x - 23.79
-14
-15 R2 = 0.92,P 0.01
-16
-17
-18 y = 0.07x - 24.44
-19
R2 = 0.88,P 0.01
-20
-21
-22
50 60 70 80 90 100 110
C4 plant content(%)
Cattle tail hair Defatted muscle Crude fat
and the crude fat (R2 = 0.88, P \ 0.01). A Previous investigation found that the
d13C values of different tissues taken at slaughter such as kidney fat, liver, blood,
plasma, and muscle are highly correlated (R2 = 0.92–0.99) with the calculated
d13C values of the diet given [14]. Another study showed that there was a strong
linear relationship between maize carbon in the diet and d13C values of lipid-free
muscle (R2 = 0.98) and lipid (R2 = 0.93) [16]. However, in the other two studies,
feed were constantly changed with the growth stages of cattle, and the feed
ingredients are very different at every stage. The significant correlations were
showed between d13C values of cattle tail hair segment and feeds, and they were
significantly correlated with the proportion of C4 plant of feeds, but there were no
significant correlation between d13C values of whole cattle tail hair and feeds [14,
19].The cattle tail hair mainly consists of keratin that is a kind of structure protein.
Once the keratin structure is formed, hair tissue metabolism will stop [16].
Therefore, the isotopic information recorded by every section of the hair reflects
the diet for growth at that time, and cattle tail hair can be regarded as an isotopic
archive recording feeds changes. In this study, the diet of each group was not
changed during the whole experiment, thus, the d13C values of cattle tail hair at the
end of the experiment should essentially have the same isotopic information
throughout the hair. Based on these results, the proportion of C4 plant material
could be estimated from the d13C values of different beef tissue samples.
As shown in Table 115.3 and Fig. 115.1, the d13C values of cattle tail hair is the
most enriched followed by defatted muscle, and then the crude fat, and the corre-
lation among them is significant. The correlation coefficients between defatted
muscle and tail hair and crude fat were separately 0.90 (P \ 0.001) and 0.87
(P \ 0.001). Meanwhile, the correlation coefficients between hair and crude fat was
0.81 (P \ 0.001). These results were similar to a previous study that showed the d13C
values of hair, defatted muscle, and crude fat similarly decreased, and the d13C values
between them are significant [17]. In another study, the d13C values declined in order
of hair, muscle, plasma, blood, liver, and kidney fat [14]. Because of the discrimi-
nation against 13C during the process of lipid synthesis, the d13C values of crude fat
are more depleted than that of diet, but d13C of muscle, hair, liver, blood, and plasma
are more enriched relative to the diet. In this study, the correlation coefficient
between defatted muscle and crude fat was not as high as found in previous studies,
r = 0.976 and 0.98 [15, 20]. The reason maybe that the lipid extraction methods were
different, or non- lipid fractions were mixed into crude fat when being transferred,
and therefore leading to a lower correlation coefficient.
115.3.3 Stable Nitrogen Isotope
The nitrogen isotope in the feed was not controlled. The result (Table 115.4)
showed that d15N values of the feed had nothing to do with the content of C4
plants, and d15N values of cattle hair, defatted muscle did not increase regularly
with the change of feed. However, in each group, the d15N values of muscle were
lower than that of cattle tail hair, the correlation between them was significant
(P \ 0.01), and the correlation coefficient was 0.732. As mentioned earlier, the
nitrogen isotope in the feed was affected by a number of factors which resulted in
d15N values of animal tissue without regularity. Nevertheless, the nitrogen isotope
in tracing the origin of beef will provide additional information. Guo reported that
cattle could be distinguished from pastoral or agricultural areas with d15N values,
and the correct classification rate of beef origin could be significantly improved by
d13C and d15N values complement each other [21].
The correlation among d13C and d15N values of cattle tail hair, defatted muscle,
and crude fat were highly correlated, and indicating that tail hair instead of muscle
in beef origin was available. According to the report, the lowest growth rate of tail
hair is 0.51 mm/d [22]. Therefore, the appropriate section of tail hair in the light of
fatting time is clipped from the root for analysis, which reflects the feed of cattle
fattening period. Thus, it will make the isotope traceability technology easier.
115.4 Conclusion
The d13C values of cattle tail hair, defatted muscle, and crude fat all enhanced with
the increment of the proportions of C4 constituents in diet. Moreover, all d13C
values of different tissues were significantly correlated with the content of C4 plant
material, so the proportion of C4 plant material could be estimated from the d13C
values of tissues. At the same time, d15N values of cattle hair, defatted muscle did
not increase regularly with the change of feed. And the correlation among d13C and
d15N values of cattle tail hair, defatted muscle, and crude fat were highly corre-
lated. Thus, tail hair instead of muscle in beef origin is available.
Acknowledgments This research was financially supported by the Ministry of Science and
Technology of the People’s Republic of China. The project was tracing technology of beef.
1082 F. Sun et al.
References
1. Franke BM, Gremaud G, Hadorn R et al (2005) Geographic origin of meat-elements of an

analytical approach to its authentication. Eur Food Res Technol 221:493–503
2. Schwägele F (2005) Traceability from a European perspective. Meat Sci 71:164–173
3. Croft LR (1987) Stable isotope mass spectrometry in honey analysis. TrAC, Trends Anal
Chem 6:206–209
4. Simpkins WA, Patel G, Harrison M (2000) Stable carbon isotope ratio analysis of Australian
orange juices. Food Chem 70:385–390
5. Roßmann A, Schmidt HL, Hermann A et al (1998) Multielement stable isotope ratio analysis
of glycerol to determine its origin in wine. Z Lebensm Unters Forsch A 207:237–243
6. Roßmann A (2001) Determination of stable isotope ratios in food analysis. Food Rev Int
17:347–381
7. Renou JP, Deponge C, Gachon P et al (2004) Characterization of animal products according
to geographic origin and feeding diet using nuclear magnetic resonance and isotope ratio
mass spectrometry: Cow milk. Food Chem 85:63–66
8. Manca G, Franco MA, Versini G et al (2006) Correlation between multielement stable
isotope ratio and geographical origin in Peretta cows’milk cheese. J Dairy Sci 89:831–839
9. Rossmann A, Haberhaue G, Hölzl S et al (2000) The potential of multielement stable isotope
analysis for regional origin assignment of butter. Eur Food Res Technol 211:32–40
10. Schmidt O, Quilter JM, Bahar B et al (2005) Inferring the origin and dietary history of beef
from C, N and S stable isotope ratio analysis. Food Chem 91:545–549
11. Camin F, Bontempo L, Heinrich K et al (2007) Multi-element (H, C, N, S) stable isotope
characteristics of lamb meat from different European regions. Anal Bioanal Chem
389:309–320
12. Boner M, Forstel H (2004) Stable isotope variation as a tool to trace the authenticity of beef.
Anal Bioanal Chem 378:301–310
13. Gebbing T, Schellberg J, Kühbauch W (2004) Switching from grass to maizechanges the C
isotope signature of meat and fat during fattening of steers. Proceedings of the 20th General
Meeting of the European Grassland Federation. Grassland Science in Europe, vol 9. Luzern,
pp 1130–1132
14. De Smet S, Balcaen A, Claeys E et al (2004) Stable carbon isotope analysis of different
tissues of beef animals in relation to their diet. Rapid Commun Mass Spectrom 18:1227–1232
15. Bahar B, Monahan FJ, Moloney AP et al (2005) Alteration of the carbon and nitrogen stable
isotope composition of beef by substitution of grass silage with maize silage. Rapid Commun
Mass Spectrom 19:1937–1942
16. Schwertl M, Auerswald K, Schnyder H (2003) Reconstruction of the isotope history of
animal diets by hair segment analysis. Rapid Commun Mass Spectrom 17:1312–1318
17. Guo BL, Wei YM, Pan JR et al (2006) Study on the change of stable carbon isotope
composition in cattle tissues. Sci Agric Sini 39:1885–1890 (Chinese)
18. Ghidini S, Ianieri A, Zanardi E et al (2006) Stable isotopes determination in food
authentication: A review. Ann Fac Medic Vet di Parma XXVI: 193 –204
19. Guo BL, Wei YM, Pan JR (2008) Study on the changing law of stable carbon isotope
composition in cattle tail hair. Sci Agric Sini 41:2105–2111 (Chinese)
20. Piasentier E, Valusso R, Camin F (2003) Stable isotope ratio analysis for authentication of
lamb meat. Meat Sci 64:239–247
21. Guo BL, Wei YM, Pan JR et al (2007) Application of carbon and nitrogen isotope in beef
origin traceability. Sci Agric Sini 40:365–372 (Chinese)
22. Schwertl M, Auerswald K, Schäufele R et al (2005) Carbon and nitrogen stable isotope
composition of cattle hair: ecological fingerprints of production system? Agric Ecosyst
Environ 109:153–165
Chapter 116
Expression and Sequence Analysis
of ChRpS3, a Ribosomal Protein S3 cDNA,
and its Potential Role in Ovary
Development of Cymbidium hybridium
Xiaoqiang Chen, Xiulan Li, Ning Sun and Wenqin Song
Abstract A full length cDNA sequence, Ch-RpS3, was isolated by RT-PCR and
further characterized by sequencing and expression analysis. The cDNA fragment
was 1,003 bp in length and contained a complete open reading frame of 786 bp,
encoding a protein of 261 amino acid residues with high sequence homology to
RpS3 from other plants such as monocotyledon Oryza sativa (91 %). Phylogenetic
analysis at the amino acid level also confirmed that Ch-RpS3 belonged to the
monocot-specific RpS3 clade. Furthermore, spatial and temporal expression anal-
ysis with RT-PCR indicated that Ch-RpS3 was highly expressed in ovaries 2 days
after pollination and is predicted to encode a novel member of RPS3 participating in
cell growth and proliferation. It is deduced that this 40S ribosomal S3 like protein is
involved in initiating ovary development of C. hybridium, which might provide
novel insights into the molecular mechanism of ovary and floral development.

Keywords Cymbidium hybridium Differential display RT-PCR Floral

development 40S ribosomal S3 protein (RPS3)
116.1 Introduction
Floral development is one of the most complicated processes in phanerogam

development. Floral development in Arabidopsis and other plants has been the
focus of classic and molecular genetic analyses in recent years [1, 2]. With the
X. Chen (&) N. Sun

Department of Agronomy, Tianjin Agricultural University, Tianjin 300384, People’s
Republic of China
e-mail: chenxiaoqiang@tjau.edu.cn
X. Li W. Song
Collge of Life Sciences, Nankai University, Tianjin 300071, People’s Republic of China
1084 X. Chen et al.
development of molecular biology tools and theories, many floral development

genes and floral homology genes have been isolated and cloned from a lot of plant
species such as the fern, gymnosperm, and angiosperm [3]. Through the research
on interactions of these genes, rapid progress is being made in elucidating the
molecular mechanisms involved in the floral development of flowering plants.
C. hybridium is a member of the family orchidaceae, one of the largest and most
diverse families of flowering plants. Being different from the flowers in other
flowering plants, the nearly identical shape of sepals and petals as well as the
production of a unique large lip (labellum) and a gynostemium or column in orchid
flowers make it as a very special plant species in the study of floral development [4].
Furthermore, for other flowering plants, ovaries are mature before pollination [5],
whereas ovule development of orchids only starts after successful pollination. So
the ovary of orchids is an ideal tissue material to study flower ovule initiation and
development [6, 7]. However, molecular studies on orchid ovary development are
still too limited [8, 9]. Therefore, the isolation of more new variant ovary genes in
orchids and further studies of their roles in orchid floral development are necessary.
The ribosome is a large ribonucleoprotein machine that synthesizes proteins
from transcribed mRNA. Ribosomal protein S3 (RpS3) is a member of ribosomal
small subunit and is also well known to be involved in the initiation of translation.
Several ribosomal proteins have also been found to play roles in the translational
apparatus which seems to be a major function and other extraribosomal functions
[10–13] including induction of apoptosis, suppression of tumors, regulation of
development, and DNA repair, and RPS3 is no exception.
Here, a cDNA fragment, CDD-470, was isolated by using Differential Display
RT-PCR (DDRT-PCR) methods to study the changes of gene expression between the
non-pollinated ovaries and the pollinated ones in Cymbidium hybridium. According
to its sequences, a full-length cDNA with an open reading frame of 786 nucleotides,
Ch-RpS3, encoding a protein of 261 amino acids has been obtained by RT-PCR. The
amino acid sequence predicted from the corresponding region of the cDNA of
C. hybridium exhibited significant homology with that of other RpS3 proteins. The
similarities between RpS3 and the corresponding region in C. hybridium suggest that
the homologous sequence, Ch-RpS3, in C. hybridium is a novel gene that is func-
tionally homologous to RpS3. Its function was predicted in this paper.
116.2.1 Plant Materials
Cymbidium hybridium used in this study was grown in greenhouses under natural
light and controlled temperature ranging from 23 to 27 C. Various organs of these
orchids (the petals, the sepals, the labellums, and the columns), roots, stems, and
vegetative leaves, were separately dissected, immediately frozen in liquid nitro-
gen, and stored at -80 C.
116 Expression and Sequence Analysis 1085
116.2.2 RNA Extraction and mRNA Purification
Frozen materials of the pollinated flowers and the untreated ones were ground in

liquid nitrogen and simultaneously extracted using TRIZOl (BBI, Markham,
Canada), according to the manufacturer’s instructions. The possible contaminated
DNA was digested by RNase free DNase I (Takara, Shiga, Japan) for 30 min at
37 C. The RNA was checked for quality and quantity by agarose gel electro-
phoresis (1.2 % formaldehyde denaturing agarose gel) and fluorimetry (ND-1000,
NanoDrop, Wilmington, USA). Poly (A)+ RNA was isolated and purified by using
Oligotex mRNA Mini kit (Qiagen, Valencia, USA).
116.2.3 Cloning of cDNA for CDD-700
The total RNA extracted from ten individual materials was equivalently pooled and
subjected to the following reactions. 2 lg samples in every reaction were reverse
transcribed using 0.05 lg reverse primers of M11 (50 -AAGCTTTTTTTTTTA-30 )
and 200 unit M-MLV reverse transcriptase under conditions specified by the
enzyme supplier (Promega, Madison, USA) in a final volume of 0.01 cm3. Fol-
lowing reverse transcription, PCR amplifications were performed in 0.025 cm3 of a
reaction mix with 0.001 cm3 of the reverse-transcribed cDNA, 0.5 lmol/L of each
forward DD-17 (50 -GATCCAGTAC-30 ) and reverse primer (M11), 200 lmol/L
dNTPs, 1x polymerase buffer and 1 U Taq DNA polymerase (Takara). PCR
amplification reactions were performed in the MG5331 thermal cycler (Eppendorf,
Hamburg, Germany) using the following program: after denaturation at 94 C for
5 min, amplification was performed with 40 cycles of 30 s at 94 C, 2 min at
40 C, and 1 min at 72 C, followed by a final extension at 72 C for 10 min.
Amplified PCR products were separated on a 6 % (w/v) polyacrylamide gel
(PAGE). After silver staining, the gel was dried in room temperature and photo-
graphed. A 100-bp ladder was used to estimate the molecular size of fragments. All
reactions were performed in triplicate to avoid false-positive results.
116.2.4 Cloning of cDNA for Ch-RpS3
Single-stranded cDNA was synthesized from purified mRNA with QIAEXII Gel
Extraction Kit (Qiagen) according to the supplier’s instructions. To isolate the
RpS3 genes which may be involved in ovary development, the synthesized cDNAs
of the pollinated ovaries of orchid C. hybridium were used as templates in PCR
experiments. PCR amplification was performed by touchdown program using
Plant RpS3 gene degenerate primer RpS3-S1 (50 - G(G\A)AG(A\C\G)A(A\G)CAA
CCATGGCGT-30 ) and RpS3-A1 primer (50 - ACACCAAAATCTTCCTTGTAA
1086 X. Chen et al.
TCT -30 ) which was designed according to CDD470. The conditions for PCR
amplication were as follows: 94 C for 3 min; 16 cycles at 94 C for 30 s, 0.5 C/
cycle from 65 C to 58 C for 45 s and 72 C for 1 min; Another 20 cycles of PCR
amplication were used after touchdown program. The denaturing step was 94 C
for 30 s, the annealing step was 58 C for 45 s, and the extension step at 72 C for
1 min; A final extension was at 72 C for 10 min.
A PCR product about 700 bp long was purified by the QIAEXII Gel Extraction
Kit (Qiagen), ligated to the pUCmT-easy vector (BBI) and then transformed into
competent cells of Escherichia coli DH5a by heat shock. Positive clones were
identified by PCR methods and subsequently sequenced as described below.
According to the sequence that joins together the 700 bp fragment with
CDD470 above, the full length cDNA for Ch-RpS3 was amplified using specific 50
primer RpS3-S2 (50 -GAAGAAGCAACCATGGCCGT-30 ) and 30 primer RpS3-A2
(50 - GTAAATGCTCATGAACACAATCCAA -30 ) as described above with 32
cycles of PCR amplication were used, 94 C for 30 s, 50 C for 45 s, and 72 C
for 1 min, followed by a final extension at 72 C for 10 min.
Sequencing and sequence analysis: Clones were sequenced at the Sangon
(Shanghai, China) using the PRISM Ready Reaction DyeDeoxy Termination cycle
sequencing kit with an ABI-3700 DNA Sequencer (Applied Biosystems, USA).
Pairwise comparisons and multiple alignments of nucleotide sequences and
deduced amino acid sequences were performed using the Align program [14]
and CLUSTAL W version 1.8 [15], with default cost settings for opening and
extending gaps.
116.2.5 Construction of Phylogenetic Trees
The phylogenetic tree was constructed with the neighbor-joining method [16] with
the Poisson correction distance [17]. The reliability of the tree was established by
conducting 1,000 neighbor-joining bootstrap sampling steps [18].
116.2.6 RT-PCR
Total RNA was isolated from various organs of C. hybridium. 2 lg RNA was
reverse-transcribed in a 0.02 cm3 reaction mixture in every reaction using
0.05 lg M11. PCR amplification reactions were performed in the MG5331 ther-
mal cycler using the programme as described above. b-actin is as a control. The
PCR product was analyzed by electrophoresis in 1.5 % agarose gels.
In addition, a reaction without reverse transcriptase was included as a control for
each cDNA first-strand synthesis. PCR amplifications of these latter controls gave
no amplified fragments indicating that the RNA preparations were free from
contaminating DNA. RT-PCR products were directly sequenced as described

below. Primers specific for Ch-RpS3: RpS3-S2 and RpS3-A2. Primers specific for
b-actin:
b-s, 50 - GCAGCTCCTCTGTTGAGAAGAAC-30 .
b-a, 50 - TTCTGGGCAACGGAATCTCT -30 .
116.2.7 Reverse Northern Blot Analysis
Reverse northern blot was performed as described by Vögeli et al. [18, 19] and Li
et al.[20]. with some modifications. 0.001 cm3 PCR products of positive clones
from differential displayed bands were dotted and fixed in duplicate sets onto
nylon membranes (Pall, NY, USA). After the total cDNA from the non-pollinated
or the pollinated ovaries that had been labeled with digoxigenin (DIG)-11-dUTP
by using the Random Primer DNA Labeling System (Roche, Basel, Switzerland),
reverse northern hybridization and detection were performed following the
instructions of the Roche DIG High Prime DNA Labeling and Detection Starter
Kit II. The membranes were then hybridized at 42 C overnight, high-stringency
washed twice in 2 9 SSC–0.5 % SDS at 42 C for 30 min, and washed twice in
0.5 9 SSC–0.52 % SDS at 65 C for 15 min. b-actin was used as positive control
and distilled H2O was used as negative control.
116.3 Results
116.3.1 Isolation of the Full Length cDNA Sequences

of Ch-RpS3 from Cymbidium Hybridium
CDD-470 (DQ159867) was determined and compared with those published

sequences in the GenBank database by BLAST searches. On the basis of the
deduced amino acid sequence, CDD-470 showed homology with sequences
encoding components of 40S ribosomal S3 proteins (RPS3) [21]. According to the
sequence of CDD-470, two primers
(RpS3-S1 and RpS3-A1) have been designed to amplify a cDNA fragment of
about 700 bp using mRNA from the pollinated ovaries of C. hybridium as a
template. The full-length cDNA sequence for C. hybridium RpS3 gene, Ch-RpS3
(accession No. DQ683575), was isolated and characterized with primers RpS3-S2
and RpS3-A2 according to sequence joining together the 700 bp fragment with the
CDD470.
1088 X. Chen et al.
116.3.2 Sequence and Phylogenetic Analysis of Ch-RpS3
Ch-RpS3 is 1,003 bp long with a 786 bp ORF that encodes a putative protein
consisting of 261 amino acids. Sequence comparison (Fig. 116.1) of the putative
Ch-RpS3 protein with other published plant RpS3 proteins indicates that Ch-RpS3
shows extensive similarity to plant RpS3 proteins, with the highest identity (91 %)
with monocotyledon Oryza sativa (P49397). To determine the evolutionary rela-
tionship between Ch-RpS3 and the RPS3 genes from other species, a phylogenetic
tree (Fig. 116.2) based on analysis of RPS3 amino acid sequence of Ch-RpS3 and
its homologous from other ten species was constructed. According to the param-
eters used, the phylogenetic analysis showed that these ten species with Ch-RpS3
had been divided into 4 large groups, i.e., animals (Drosophila melanogaster,
Rattus norvegicus, Homo sapiens), dicotyledons (Arabidopsis thaliana, Helianthus
annuus, Solanum tuberosum, Medicago truncatula, Cicer arietinum), monocoty-
ledons (Oryza sativa, Cymbidium hybridium), and yeast (Schizosaccharomyces
pombe). It was evident that Ch-RpS3 fell into the clade of plant ribosomal protein
S3 genes and it was phylogenetically closely related to the RPS3 of Oryza sativa
(P49397) which belonged to monocotyledons.
Fig. 116.1 Alignment of the translated Ch-RpS3, along with the known RPS3a from other
plants, using CLUSTAL W 1.8 [15]. Identical amino acids are highlighted by black boxes.
GenBank/EMBL/DDJB Nucleotide Sequence Databases, accession numbers: A-RPS3a
(Q42262), S-RPS3a (ABB72801), M-RPS3Ae (ABE88517), C-RPS3a (AJ515028), and O-RPS3a
(P49397)
Fig. 116.2 Phylogenetic tree showing the relationship between the Ch-RpS3 and various
ribosomal proteins S3 of other species. A-RPS3a from Arabidopsis thaliana (GenBank accession
No. Q42262); D-RPS3 from Drosophila melanogaster (P55830); Sp-RPS3 from Schizosaccha-
romyces pombe (Q09781); H-RPS3 from Homo sapiens (AAH04981); R-RPS3 from Rattus
norvegicus (CAA53004); O-RPS3a from Oryza sativa (P49397); He-RPS3a from Helianthus
annuus (P49198); Ch-RpS3 from our study (DQ159867); S-RPS3a from Solanum tuberosum
(ABB72801); M-RPS3Ae from Medicago truncatula (ABE88517); C-RPS3a from Cicer
arietinum (AJ515028)
116.3.3 Reverse Northern Blot Analysis of Ch-RpS3
We probed the PCR fragments against complex cDNA probes made from RNA
isolated from the non-pollinated and the pollinated ovaries. As shown in
Fig. 116.3, Ch-RpS3 was successfully confirmed by reverse northern blot to be
true differentially expressed cDNA band in the pollinated ovaries.
Fig. 116.3 Reverse Northern

blot analysis of isolated
differentially expressed
cDNA fragments Ch-RpS3.
CK+: positive control from
b-actin; CK-: negative
control from distilled H2O; P:
with pollinated ovary cDNA
probe; C: with non-pollinated
ovary cDNA probe
1090 X. Chen et al.
Fig. 116.4 Detection of the ChRPS3 expression by RT-PCR in different tissues and flower
organs. Total RNA was extracted from roots (Ro), stems (St), leaves (Le), sepals (Se), petals (Pe),
labellum (La), column (Co), and ovary (ov). cDNA reverse transcribed from mRNA was,
respectively, used as template. b-actin was used to show the amount of cDNA used for each
RT-PCR reaction
116.3.4 Expression Pattern of Ch-RpS3
RT-PCR was used to analyze the expression pattern of Ch-RpS3. Total RNA was
prepared from roots, stems, leaves, ovaries (the non-pollinated and different stages
of the pollinated), and the different floral organs of C. hybridium.
A single band of the same size as the Ch-RpS3 cDNA (approximately 1 kb) was
detected. As shown in Fig. 116.4, Ch-RpS3 was highly expressed in roots and the
pollinated ovaries, but detected in non-pollinated ovaries, floral organs (the petals,
the sepals, the labellum, and the column), and two vegetative tissues (stems and
leaves) quite weakly. Toward different stages of pollinated ovaries, Ch-RpS3 was
highly expressed at the 2 days stage, with a subsequent decrease in abundance in 8
and 16 days developmental stages (Fig. 116.5).
116.4 Discussion
The molecular mechanisms involved in floral development are largely unknown

and, currently, the interactions between genes related to floral development are
poorly understood. Only recently, applications of molecular methods to the study
of plant development, genes involved in floral development have begun to be
identified [3]. We have carried out DDRT-PCR analysis to isolate a cDNA frag-
ment differentially expressed in the pollinated ovaries of C. hybridium, CDD-470.
The full length cDNA sequence of Ch-RpS3 was isolated by RT-PCR. Ch-RpS3
Fig. 116.5 RT-PCR analysis

of ChRPS3 in different stages
of pollinated ovaries. 1, 2, 3,
4 on the top indicated
pollinated ovaries on 2, 4, 8,
16 days, respectively
was composed of a 1,003 bp fragment containing an ORF capable of encoding a

protein of 261 amino acids. Sequences analysis showed that it was homologous to
the ribosomal protein S3. It is reported that several higher plant RP genes show
size diversity in comparison to the prokaryotype counterparts, but RPs of
homologous proteins from different sources have similar sizes [22]. And the length
of the Ch-RpS3 is similar to that of other homologous RPS3 proteins.
Furthermore, RpS3 genes from plants to mammals not only have highly con-
served protein size, but also code similar amino acid sequences [23]. The sequence
alignment of Ch-RpS3 performed with other plant RpS3 s using CLUSTAL W also
confirmed this (Fig. 116.1). Of all the similar proteins, the predicted gene product
from C. hybridium yielded the highest identity with the Oryza sativa proteins
(91 %) (P49397). The strong homology suggested that Ch-RpS3 and plant RPS3
gene especially monocot Oryza sativa encoded proteins of similar function. The
phylogenetic analysis (Fig. 116.2) based on analysis of amino acid sequence of
Ch-RpS3 and its homologous from other ten species also showed Ch-RpS3 fell into
the clade of plant ribosomal protein S3 genes and it was phylogenetically closely
related to the RPS3 of Oryza sativa (P49397) which belonged to monocotyledons.
The ribosome is a large ribonucleoprotein machine that synthesizes proteins
from transcribed mRNA. The 80 s eukaryotic ribosomes contain at least 30 pro-
teins in the small subunit (40 s) and 40 in the large (60 s) subunit [24]. Ribosomal
proteins are in general highly conserved in evolution [10]. In addition to their role
in ribosomal functions, several ribosomal proteins have also been found to play
roles in the translational apparatus and other extraribosomal functions such as
regulation of development [25–27]. The fact that mutations in several genes
encoding ribosomal proteins in arabidopsis result in morphological alterations and
a significant delay in development [28, 29] indicated the important roles of
ribosomal proteins in plant development.
Ribosomal protein S3 (RPS3) is no exception. It is one of the ribosomal pro-
teins in the 40S subunit and is located on the surface of the 40S ribosomal subunit.
It is a multifunctional ribosomal protein and it is highly conserved between dis-
tantly related species [30]. Consistent with its location, several studies indicated
that expression of S3a gene and/or its homologues is required for cell growth and
proliferation in various evolutionarily distant species. It is known that RPS3
functions as a DNA repair endonuclease and ribosomal protein S3 [31, 32]. Chang
[27] reported a third function of RPS3, induction of apoptosis. In synchronously
cultured Catharanthus roseus cells, the rps3 (encoding S3a homologue in plants) is
preferentially and transiently expressed at the G1/S boundary [33]. LmS3arp, a
component of the small ribosomal 40S subunit, was also involved in a number of
cellular processes including cell proliferation, differentiation, and apoptosis. In our
study, the mRNA for Ch-RpS3 which was detected and expressed in the pollinated
ovaries was confirmed by cDNA reverse northern blot (Fig. 116.3). The genes
from plants are expressed in the locations where they ultimately perform their
function, so the possibility cannot be excluded that Ch-RpS3 function in the
development of the pollinated ovaries. A possible mechanism by which the ovary
development is triggered by enhancing RPS3a expression can be explained, at
1092 X. Chen et al.
least in part, in terms of the role of RPS3a in cell growth and proliferation.
However, interestingly, RT-PCR in this study (Fig. 116.4) further showed that
Ch-RpS3 was also highly expressed in roots other than pollinated ovary in
Cymbidium hybridium. It is reported that some genes also specifically expressed in
the roots except in their relative tissues [34, 35]. The function is not identified so
far. Since roots are the tissue in which cell division is active, it appeared that there
was a strong correlation between RPS3a expression levels and cell division and
proliferation. To clarify its molecular mechanism and physiological significance,
further research would be required. Furthermore, to detect temporal pattern of
expression of Ch-RpS3 in ovaries at different pollinated stages, we performed
cDNA reverse Northern blots (data not shown). It is found Ch-RpS3 showed
relative higher levels at the 2 days stage, with a subsequent decrease in abundance
in 8 and 16 days developmental stages, which was also verified by RT-PCR
experiments (Fig. 116.5). This is similar to the report that ribosomal protein genes
RpS3 had proportionately lower steady-state mRNA levels in later stages of
seedling development [36]. Apoptosis could be induced by sequential alterations in
RPS3a expression involving enhancement from an initially low constitutive level,
followed by suppression [27]. Whether the development of ovary could also be
induced by sequential alterations in RPS3a expression needs further study.
So far, little information is available on the functional role of ribosomal protein
S3 in plant development especially in monocotyledonous species [37, 38]. In this
study, the fact that Ch-RpS3 isolated from C. hybridium was homologous to the
ribosomal protein S3 genes and deduced to play a role in the development of ovary
provides novel insights into the conservation and diversification of ribosomal
protein S3 genes in the floral development of a highly evolved monocotyledonous
species. It is tempting to suggest the possible functional diversification between
the monocot and the dicot during the evolutionary development of flowering.
Acknowledgments The authors are grateful for the generous support provided by Profs.
Chengbin Chen and Ruiyang Chen. The work was supported by the Natural Science Foundation
of Tianjin (10JCYBJC09000).
References
1. Coen ES, Meyerowitz EM (1991) The war of the whorls: genetic interaction controlling
flower development. Nature 353:31–37
2. Weigel D, Meyeerowitz EM (1994) The ABCs of floral homeotic genes. Cell 78:203–209
3. Moriyah Z, Vivian FI (2003) Flower development: initiation, differentiation, and
diversification. Annu Rev Cell Dev Biol 19:119–140
4. Yu H, Goh CJ (2000) Identification and characterization of three orchid MADS-Box genes of
the AP1/AGL9 subfamily during floral transition. Plant Physiol 123:1325–1336
5. Bouman F (1984) The ovule in embryology of angiosperm. In: Johri BM (ed) Springer,
Berlin. p 123–157
6. Wang L, Zhang X (1999) Expression and sequence analysis of a cDNA relative to orchid
ovule development. Acta Bot Sinica 41(3):276–279
7. Zhu GF, Guo ZF (2004) Progress on molecular biology of main ornamental orchidaceae.
Chinese Bull Bot 21(4):471–477
8. Lu ZX, Wu M, Loh CS, Yeong CY et al (1996) Nucleotide sequence of a flower-specific
MADS box cDNA clone from orchid. Plant Mol Biol 23:901–904
9. Bui AQ, O’Neill SD (1998) Three 1-aminocyclopropane -1-carboxylate synthase genes
regulated by primary and secondary pollination signals in orchid flowers. Plant Physiol 116:
419–428
10. Wool IG, Chan YL, Gluck A (1995) Structure and evolution of mammalian ribosomal
proteins. Biochem Cell Biol 73:933–947
11. Wool IG (1996) Extraribosomal functions of ribosomal proteins. Trends Biochem Sci
21:164–165
12. Kim J, Chubatsu LS, Admon A et al (1995) Implication of mammalian ribosomal protein S3
in the processing of DNA damage. J Biol Chem 270:13620–13629
13. Naora H, Naora H (1999) Involvement of ribosomal proteins in regulating cell growth and
apoptosis: translational modulation or recruitment for extraribosomal activity? Immunol Cell
Biol 77(3):197–205
14. Myers EW, Miller W (1988) Optimal alignments in linear space. Comp Appl Biosci 4:11–17
15. Thompson JD, Gibson TJ, Plewniak F et al (1997) The clustal X windows interface flexible
strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res
24:4876–4882
16. Saitou N, Nei M (1987) The neighbor-joining method: a new method for reconstructing
phylogenetic trees. Mol Biol Evol 4:406–425
17. Nei M, Kumar S (2002) Molecular evolution and phylogenetics. Oxford University Press,
New York
18. Felsenstein J (1985) Confidence limits on phylogenesis: an approach using the bootstrap.
Evolution 39:783–791
19. Vögeli LR, Bürckert N, Boller T (1996) Rapid selection and classification of positive clones
generated by mRNA differential display. Nucleic Acids Res 4:1385–1386
20. Li Z, Chen S (1998) Rapid screening and classification of positive cDNA clones generated by
differential display. High Tech Bull 8:44–48
21. Chen XQ, Wang CG, Zhang Y et al (2007) Identification and sequence analysis of cDNA
fragments relative to ovary development of Cymbidium hybridium after pollination. Biol
Plant 51(2):249–256
22. Chan YL, Olvera J, Paz V et al (1996) The primary structures of rat ribosomal proteins S3a
(the V-Fos transformation effector) and of S3b. Biochem Biophys Res Commun 228:141–147
23. Fingen-Eigen M, Domdey H, Kohrer K (1996) The ribosomal protein gene RPS3 is an
essential single copy gene of the yeast Saccharomyces cerevisiae. Biochem Biophys Res
Commun 223:397–403
24. Moore PB (1998) The three-dimentional structure of the ribosome and its components. Annu
Rev Biomol Struct 27:35–38
25. Wilson DM, Deutsch WA, Kelley MR (1994) Drosophila ribosomal protein S3 contains an
activity that cleaves DNA at apurinic/apyrimidinic sites. J Biol Chem 269:25359–25364
26. Lim Y, Lee SM, Lee JY et al (2002) Complete genomic structure of human rpS3:
Identification of functional U15b snoRNA in the fifth intron. Gene 286:291–297
27. Chang YJ, Jae YL, Joon K (2004) RPS3, a DNA repair endonuclease and ribosomal protein,
is involved in apoptosis. FEBS Lett 560:81–85
28. Ito T, Kim GT, Shinozaki K (2000) Disruption of an Arabidopsis S-13 homologous gene by
transposon-mediated mutagenesis causes aberrant growth and development. Plant J
22:257–264
29. Weijers D, Franke-van Dijk M, Venken RJ et al (2001) An Arabidopsis minute-like
phenotype caused by a semi-dominant mutation in a ribosomal protein S5. Genes Dev
128:4289–4299
30. Andersson S, Sæbøe-Larssen S, Lambertsson A et al (1994) A Drosophila third chromosome
Minute locus encodes a ribosomal protein. Genetics 137:513–520
1094 X. Chen et al.
31. Yacoub A, Augeri L, Kelley MR et al (1996) A Drosophila ribosomal protein contains 8-

oxoguanine and abasic site DNA repair activities. EMBO J 15:2306–2312
32. Sandigursky M, Yacoub A, Kelley MR et al (1997) The Drosophila ribosomal protein S3
contains a DNA deoxyribophosphodiesterase (dRpase) activity. J Biol Chem 272:17480–17484
33. Kodama I, Ito M, Hattori T (1991) Isolation of genes that are preferentially expressed at the
G1/S boundary during the cell cycle in synchronized cultures of Chataranthus roseus cells.
Plant Physiol 95:406–411
34. Villand P, Aolen R, Olsen OA (1992) PCR amplification and sequences of cDNA clones for
the small and large subunits of ADP-glucose pyrophosphorylase from barly tissues. Plant Mol
Biol 19(3):381–389
35. Zhou DX, Bisanz-Seyer C, Mache R (1995) Molecular cloning of a small DNA binding
protein with specificity for a tissue-specific negative element within the rps1 promoter.
Nucleic Acid Res 23(7):1165–1169
36. Li-Pook-Than J, Carrillo C, Bonen L (2004) Variation in mitochondrial transcript profiles of
protein-coding genes during early germination and seedling development in wheat. Curr
Genet 46:374–380
37. Gao J, Kim SR, Chung YY (1994) Developmental and environmental regulation of two
ribosomal protein genes in tobacco. Plant Mol Biol 25:761–770
38. Braun HP, Emmermann M, Mentzel H (1994) Primary structure and expression of a gene
encoding the cytosolic ribosomal protein S4 from potato. Biochim Biophys Acta
1218:435–438
Chapter 117
Lichen Flora on the Genera Alectoria,
Pseudephebe, and Sulcaria (Lichenized
Ascomycota, Parmeliaceae) from
the Hengduan Mountains in China (4)
Xinyu Wang, Dong Liu, Jianwen Li, Hiroshi Harada

and Lisong Wang
Abstract Alectorioid lichen specimens used in this study were collected since
1981, mainly from the Hengduan mountain region, all the specimens were
examined using standard microscopic techniques and hand-sectioned under dis-
secting microscope, secondary metabolites were identified by TLC. After detailed
taxonomical and chemical study of our specimens and the type specimens,
Sulcaria virens var. forrestii is found to have same diagnostic characters with
S. virens except for the diameter of the main branch, thus, it is treated as the
synonym of S. virens. Alectoria ochroleuca, Pseudephebe pubescens, and S. virens
have rather restricted distribution in Hengduan Mountains, they are considered as
rare lichens. Taxonomic characters together with distribution map and key to
Alectorioid lichens are provided in this paper. All the specimens involved in this
study are deposited in Herbarium of Kunming Institute of Botany (KUN).
Keywords Alectorioid Lichenized fungi Hengduan mountains Taxonomy

Species revision
X. Wang L. Wang (&)

Key Laboratory of Biodiversity and Biogeography, Kunming Institute of Botany,
Chinese Academy of Sciences, Kunming 650201, China
e-mail: wanglisong@mail.kib.ac.cn
D. Liu J. Li
Yunnan University of Traditional Chinese Medicine, Kunming 650500, China
H. Harada
Natural History Museum and Institute, Chiba 2608682, Japan
1096 X. Wang et al.
117.1 Introduction
The genera Alectoria Ach., Pseudephebe M. Choisy and Sulcaria Bystr. belong to
the family Parmeliaceae (Lecanorales) [1], they are characterized by fruticose or
caespitose thallus, mat-shaped, erect, or pendulous, without axils in the medulla,
apothecia lecanorine type [2]; mainly distributed in alpine region. Hengduan
Mountain is located in the Southwest of Qingzang highland, including east of
Xizang, Northeast of Yunnan, and west of Sichuan, including a land of about
500,000 sq. kms, it is the biodiversity hot spot in China. There were very few
reports on these genera in Hengduan Mountain region [3–8].
Sulcaria virens var. forrestii was published by Hawksworth [9] based on two
specimens collected from Yunnan Dali and Deqin, they were collected by
G. Forrest in 1912 and 1914, this species variety is published based on the
diameter difference of the main branches with S. virens. After the examination of
the type specimens (Holotypus 13271, Paratypus 20808) and 50 new specimens
collected from the original habitat, the authors discovered more varieties of the
main branch diameter, it is not a stable character, thus, it should not be treated as a
key taxonomic character, detailed discussion, and the results are shown below.
Two hundred and seventy one specimens were collected from 1981 to 2011,
including 13 Bryoria, 254 Sulcaria, and 4 Pseudephebe, these collections covered
41 counties from Hengduan Mountain central area, and are deposited in the
Herbarium of Kunming Institute of Botany, China (KUN). We also examined the
type specimens of S. virens var. forrestii (Holotypus 13271, Paratypus 20808)
from Royal Botanic Garden Edinburgh (E), and Pseudephebe specimens from
North America and Finland as comparison.
The dried specimens were examined using standard microscopic techniques and
hand-sectioned under NIKON 102 dissecting microscope. All measurements were
made on material mounted in GAW (glycerol: ethanol: water = 1:1:1); anatomical
descriptions are based on observations of these preparations under a NIKON E 200
microscope. Secondary metabolites were identified by TLC as described by
Culberson [10].
117 Lichen Flora on the Genera Alectoria, Pseudephebe and Sulcaria 1097
117.3.1 Key to Alectorioid Lichen
1. Thallus surface with longitudinal furrow, holdfast present in the base Sulcaria
2.. Thallus surface without longitudinal furrow, holdfast absent 2
3.. Ascus containing 1 spore, spores muriform Oropogon
4.. Ascus containing 2–8 spores 3
5. 2-4 spores per ascus, spores brown when mature Alectoria
6. 8 spores per ascus, spores hyaline 4
7. Thallus closely attach to the substrate, mat-shaped, without secondary Pseudephebe
compounds
8. Thallus erect or pendulous, medulla P+, K+ Bryoria
117.3.2 The Genus Alectoria Ach. in Luyken, Tent. Hist.

Lich.: 95 (1810). Brodo and Hawksw., Opera Bot.
42:56. (1977)
Type species: Alectoria sarmentosa (Ach.) Ach.

Thallus fruticose, erect to pendent, attach to the substrate by a holdfast in the
base part; branching variable, dichotomously to irregularly branched, tips pointed;
surface grayish white to dull yellow, covered with speckled pseudocyphellae;
cortex composed of periclinal, conglutinate hyphae; medulla without axis, med-
ullary hyphae loosely composed, usually ornamented; apothecia lecanorine-type,
2–4 (–8) spores per ascus, ascospores 1-celled, ellipsoid, turning brown or dark
brown at maturity; photobiont green algae; containing usnic, diffractaic, and a-
lectoronic acid as main compounds.
This genus is characterized by fruticose, grayish white to yellow thallus, having
speckled pseudocyphellae, medullary hyphae verrucose, 2–4 spores per ascus,
spores 1-celled and brown when mature, containing usnic acid as main compound.
It differs from Sulcaria by having no longitudinal furrow on the surface, it could be
distinguished from Oropogon and Bryoria by having brown spores and usnic acid.
Eight species were reported worldwide [2], including 2 from China [11].
Alectoria ochroleuca (Hoffm.) Mass., Sched. Crit. Lich. Ital.: 47. 1855.
(Fig. 117.1a–c)
:Usnea ochroleuca Hoffm., Descr. Adunbr. Pl. Lich. 2(1): 7. 1791.
Diagnostic characters: Thallus fruticose, erect to decumbent, 5–15 cm tall,
main branches 1–3 mm in diam., branching anisotomic dichotomous or irregular,
apices pointed; surface grayish yellow, tips turning brown to black, without
soredia or isidia; pseudocyphellae speckled, elongate fusiform, conspicuous,
1098 X. Wang et al.
Fig. 117.1 a–c Habit of Alectoria ochroleuca. d–f Habit of Pseudephebe pubescens
usually more than 1 mm long; medullary hyphae 5 lm in diam., verrucose on the

surface; apothecia not seen.
Chemistry: Cortex K-, P-, C-, KC+ yellow, medulla K-, P-, C-, KC+
yellow, CK+ gold yellow. Containing usnic, diffractaic, and alectoronic acid.
Ecology and distribution: Growing on the alpine grassland, rocky area or
sometimes on the bark of Rhododendron impeditum and Juniperus indica, altitude
varies from 4,000 to 5,000 m.
It has been reported from Inner Mongolia and Heilongjiang Prov [11], new to
Yunnan and Tibet, Worldwide distribution: Nepal, India [12], Japan [6], Korea
peninsula [13, 14], North America, Canada, New Zealand, and Europe [2].
Usage: Antibiotics, material for litmus reagent [5].

Remarks: This species is characterized by the dull yellow surface with
blackened apices; white and conspicuous pseudocyphellae, medullary hyphae
verrucose, and containing usnic acid as the main compound. It is similar with
Sulcaria sulcata, but the latter species differs in having longitudinal furrow on the
surface and without usnic acid.
Specimens examined: Yunnan Prov., Deqin Co., Mt. Baima, 4,000–4,800 m,
under Rhododendron shrub, Li S. Wang 94-15,361, 93-13,500, 81-22,849, 85-
8,898, 81-22,850, 85-8,891, 84-41a. Tibet Prov., Demula Co., alt. 5,000 m, Mu
Zang 9,419; Yadong Co., alt. 4,760 m, on rock, Mu Zang 44.
117.3.3 The Genus Pseudephebe M. Choisy, Icon. Lich.

Univ. ser. 2, fasc. 1: (sine pag.) (1930)
Type species: Pseudephebe pubescens (L.) M. Choisy.

Diagnostic characters: Thallus fruticose, mat-shaped, compacted, and closely
adnate to the rock, 0.5–1 cm tall; main branches cylindrical to compressed,
branching isotomic dochotomous to irregular; surface dark brown to black, without
pseudocyphellae, isidia or soredia; cortex 2-layered, outer layer verrucose, inner
layer composed of compact longitudinally orientated hyphae; medulla without
axis, medullary hyphae smooth; phototbiont green algae; apothecia lecanorine-
type, 8-spores per ascus, ascospores ellipsoid, hyaline, 1-celled, 7–12 9 6–8 lm;
lichen compounds absent.
Arctic and alpine distribution.
The genus is characterized by brown mat-shaped thallus closely attached to the
substrate, cortex 2-layered, spores hyaline, and without lichen substrate; It is
similar with Bryoria, but differs that Bryoria erect or pendulous, usually more than
5 cm long, cortex 1-layered, and containing lichen compounds.
2 species are known worldwide [2], 1 is reported from China [15].
Pseudephebe pubescens (L.) M. Choisy, Icon. Lich. Univ., ser. 2, 1:(sine
pag.)(1930) (Fig. 117.1d–f)
: Lichen pubescens L., Sp. Pl. 2: 1155 (1753)
Diagnostic characters: Thallus fruticose, rather slim, mat-shaped and closely
attached to the substrate, roundish or irregular, 3–12 cm in diam., dark brown to
black, shiny; main brain 0.1–0.2 mm in diam., curved with roundish pit on the
surface, but not forming pseudocyphellae or perforation, without spinules, isidia or
soredia; apothecia not seen.
Chemistry: All reaction negative, no lichen substances present.
Ecology and distribution: Growing on the surface of alpine rocks between
4,300 to 5,070 m, usually mixed with Umbilicaria indica, Ophioparma ventosa,
Rhizoplaca chrysoleuca, and Rhizocarpon spp.
1100 X. Wang et al.
It has been reported from Sichuan and Tibet Provinces [15]; worldwide dis-
tribution: Europe [16], North America [2, 17], and Japan [6].
Remarks: This species is characterized by mat-shaped thallus closely adnate,
dark brown to black ,and with no lichen substrates, it is rather similar with P.
minuscula from North America and Europe, but the latter species differs in having
broader main branches (0.2–0.5 mm), apices flattened, with numerous short lateral
branches, and thallus surface verrucose.
117.3.4 The Genus Sulcaria Bystr. Ann. Univ. Mariae Curie-

Sklodowska, C. 26: 275 (1971); Brodo and Hawksw.,
Opera Bot. 42: 146 (1977)
Type species: Sulcaria sulcata (Lev.) Bystr. ex Brodo and D. Hawksw.

Thallus fruticose, erect, or pendulous, 5–50 cm long, attached by a holdfast in
the base; surface with longitudinal furrow, usually expose the white medulla,
without pseudocyphellae; medullary hyphae loose, hyphae surface verrucose,
without axis; apothecia lecanorine type; ascus clavate, 8-spored, ascospores
ellipsoid, 1-cell and hyaline when young, 2–3(–4) celled and brown at maturity;
containing atranorin as main compound.
The genus is characterized by having longitudinal furrow on the surface, brown,
and 2–3 celled spores.
4 species are known worldwide, S. isidiifera and S. badia mainly distribute in
North America [2, 18], 2 species and 1 variety are known in China [11].
Key to the speceis of Sulcaria
1.Thallus pendulous, 10–30 cm long, surface yellowish green, containing S.virens

vulpinic acid
2.Thallus shrub-like, erect or suberect, 5–15 cm tall 2
3.Thallus grayish white to grayish brown, apices blackened, containing S. sulcata f. sulcata
psoromic acid
4.Thallus yellowish green, containing vulpinic acid S. sulcata f.
vulpinoides
117.3.4.1 Sulcaria sulcata f. Sulcata (Lev.) Bystr. ex Brodo

and D. Hawksw., Opera Bot. 42:156.1977. (Fig. 117.2a–b)
:Cornicularia sulcata Lev., in Jacquin, Fr.-Voy. Inde, Descr. Coll. 4: 179 (1844).
—Alectoria sulcata (Lev.) Nyl., Mem. Soc. Imp. Sci. Nat. Cherbourg 5: 98
(1857).
—Alectoria sulcata var. barbata D. Hawksw., Taxon 19: 242 (1970).
Fig. 117.2 a–b Habitat of Sulcaria sulcata f. Sulcata; c Habitat of Sulcaria sulcata f.
vulpinoides. d, f Habitat of Sulcaria virens; E Holytype of Sulcaria virens var. forrestii
Diagnostic characters: thallus erect or suberect, 5–15 cm tall, attached to the

substrate at the base; main branch cylindrical, partly flattened, c. 3 mm in diam.;
branching dichotomous or irregular, angle between branches varies from 30 to 80,
apices pointed; surface of the thallus grayish white to grayish brown, smooth and
shiny, apices blackened; longitudinal furrow present, usually exposing the white
medulla, without soredia, isidia, or pseudocyphellae; apothecia disc-like, 0.3–1 cm
in diam., growing near the apices, margin complete, without spinules or cilia; disc
light brown to brown, usually covered with white pruina; medullary hyphae ver-
rucose; apothecia clavate, 8-spored, ascospores ellipsoid, 1-celled and hyaline
when young, 2–3celled and brown at maturity, 25–35 9 10–15 lm.
1102 X. Wang et al.
Chemistry: Cortex K+ yellow, Medulla K-, C-, KC-, P+ deep yellow.

Containing atranorin, virensic acid, ethyl hematommate, 2-methoxypsoromic acid,
and olivetoric acid.
Ecology and distribution: Usually growing on the bark of Quercus spp.,
Rhododendron spp., Salix sp. and Sorbus sp., rarely on Pinus densata, P. yun-
nanensis, Picea, Abies and Tsuga, altitude varies from 1,700 to 3,700 m.
It has been reported from Yunnan, Shanxi, Sichuan, Hubei, Zhejiang, Anhui
and Taiwan [11], it is new record for Guizhou and Tibet; Worldwide distribution:
India, Bhutan, Nepal [12], Japan [6], Korea peninsula [13, 14].
Usage: It is used as food and medicine by local people in Yunnan.
Remarks: This species is characterized by fruticose thallus and surface grayish
white to grayish brown, surface with longitudinal furrow, exposing the white
medulla, it could be distinguished by these characters easily.
Specimens examined: Yunnan Prov., Lijiang Co., Jiuhe Village, Laojunshan
Mt., 26 390 N 99 460 E, alt. 3,500–3,750 m, on Rhododendron sp., Li S. Wang
00-20,166, 05-24,409, 05-24,403, 05-25,074. Yulong Snow Mt., 27 040 N 100 120
E, ganheba, 2,700–3,450 m, on bark of Pinus densata and Quercus sp., Li S. Wang
04-2,777, 04-23,506, 93-13,607, 88-11,052, 85-0208, 85-145a, Z. A. Sheng 14,
1,882, Lix-9, J. X. Xi 0103, 0104, 0113, 0114, X. J. Li 80-1,509, Ahti 87-46,467,
87-46,257, M. Zang 25,109a; Lidiping Village, alt. 3,250 m, Li S. Wang 0163, 0175;
Yunlong Co., Caojian Village, Ziben Mt., 24 550 N 98 450 E, alt. 2,400–3,150 m, on
Salix sp., Li S. Wang 00-18,897, 00-18,822, 00-19514, 05-24,317, 05-24,389,
05-24,376, 05-24,634, J.X. Xi 0326, 0337, 0360; Gongshan Co., Bingzhongluo
Village, Songta snow mountain, 28 090 N 98 330 E, alt., 2,400–2,600 m, Li S. Wang
82-733, 82-752a, 82-736, 82-743, 788a, 00-19,229, 00-19,652, 00-19,208,
00-19,601; Binchuan Co., Jizushan Mt., alt. 3,000 m, on decaying bark, Li S. Wang
96-15,953; Dali Co., Cangshan Mt., S.E. Liu 018004a, 22,090, 22,090a, Ga By 20c;
Deqin Co., Meili snow mountain, Xiaonong village, alt. 3,100–3,500 m, on Salix,
Picea and Quercus, Li S. Wang 94-15014, 94-15016, 94-15391, 94-15411; Sichuan
Prov., Huili co., Longzhou Mt. alt. 3,000–3,500 m, on Rhododendron and Jasminum,
Li S. Wang 97-18,133, 96-17,969, 97-18,133, 96-18,059, 97-17923; Wolong Co.,
Wolong village, on shrub, Li S. Wang 96-17,698; Luding Co., Gongga Mt., 29 200 N
101 300 E, alt. 2,450–3,000 m, on Sorbus sp., and stump, Li S. Wang 96-16186,
96-16,119, 96-16,978; Guizhou Prov., Jiangkou Co., Fanjing Mt., alt. 2,300 m, on
Rhododendron sp., Li S. Wang 88-233; Anhui Prov., Huangshan Mt., D. A. Lu 520,
511, 485, 553, 522, 2,618; Zhejiang Prov., Tianmu Mt., D. A. Lu 279.
117.3.4.2 Sulcaria sulcata f. vulpinoides (Zahlbr.) D. Hawksw.,

Opera Bot. 42:156.1977. (Fig. 117.2c)
:Alectoria sulcata var. vulpinoides Zahlbr., in Handel-Mazzetti, Symb. Bot.

Sin. 3: 202 (1930).
Diagnostic characters: This form differs from f. sulcata by the bright yellow–
green thallus surface, and containing vulpinic and psoromic acid.
Ecology and distribution: Growing on the bark of Quercus sp., Rhododendron

sp., Salix sp., or Pinus densata, altitude varies from 2,000–3,600 m.
This species is endemic to Hengduan mountain area, it has been reported from
Yunnan and Sichuan Provinces.
Specimens examined: Yunnan Prov., Lijiang Co., Wenhai Village, alt.
3,200 m, on bark, Li S. Wang 04-2,3474; Heibaishui Village, alt. 2,750 m, Li S.
Wang 94–14,628, 98–18,176; Laojunshan Mt., 26 390 N 99 460 E, alt. 3,500 m,
Li S. Wang 00-20,142; Hongshan Village, under Abies sp., alt. 3,500,. M. Zang
10,149; Yulong Mt., on Pinus densata, alt. 3,200 m, Li S. Wang 85-0165, on
Quercus sp. 85-0107, S. G. Wu 128, 4087c; Zhongdian Co., Haba Mt., 27 200 N
100 040 E, alt. 2,800–3,600 m, on Picea sp., Li S. Wang 02-22,167, 02-22,068;
Wenshui Village, Daxueshan Mt., 28 300 N 99 490 E, alt. 3,400 m, on Rhodo-
dendron sp. and Quercus sp. Li S. Wang 00-19,902, 00-20,067; Shigashan Mt., alt.
3,600–3,780 m, S. Q. Wang 98-18,421, 96-17,142, Li S. Wang 1982; Hongshan
Mt., alt. 3,400-3,600, on Quercus pseudosemicarpifolius, Li S. Wang 81-22b, M.
Zang 10,552; Tianchi lake, 27 370 N 99 330 E, alt. 3,200–3,600, on Quercus sp.,
Li S. Wang 04-23,296, on Rhododendron sp., Li S. Wang 98-18,164, 98-18,455;
Baishuitai, 27 390 N 100 010 E, alt. 3,350 m, on Picea sp., Li S. Wang 94-14,686;
Napahai Village, 27 550 N 98 370 E, alt. 3,350–3,580 m, on Pinus densata and
Quercus sp. Li S. Wang 03-22,817, 81-1,972, 81-8, X.J. Li 1970; Deqin Co., Meili
Mt., Yupeng Village, 28 240 N 98 480 E, alt. 3,100–3,500 m, on Quercus sp.and
Salix sp., Li S. Wang 94-15,407, 94-15,148, 94-15,016; Kunming, Songming Co.;
Sichuan Prov., Muli Co., on bush, alt. 2,000 m, Li S. Wang 83-2,436.
117.3.4.3 Sulcaria virens (Tayl.) Bystr. ex Brodo and D. Hawksw.,

Opera Bot. 42:156.1977. (Fig. 117.2d–f)
:Alectoria virens Tayl., Hook. Lond. J. Bot. 6: 188 (1847).

—Alectoria virens v. forrestii Hawksw. Misc. Bryol. Lichenol., Nichinan 5: 1
(1969);
—Sulcaria virens var. forrestii (D. Hawksw.) D. Hawksw., Opera Bot. 42:156
(1977); —Sulcaria virens f. decolorans (Asah.) Hawksw., in Brodo and Hawksw.,
Opera Bot. 42:156 (1977);
—Wei Jiang-chuen, in An enumeration of lichens in China (1991).
Diagnostic characters: Thallus pendent, soft, and long, 10–25(–30) long,
attached to the substrate by the basal holdfast; main branch cylindrical to flat,
0.5–4 mm in diam.; branching isotomic dichotomous, axil part usually flattened,
surface light yellow to lemon yellow, smooth and dull, with longitudinal furrow,
usually exposing the white medulla, without soredia, isidia or pseudocyphellae;
medullary hyphae loose, partly hollow, surface verrucose; apothecia not seen.
Chemistry: Thallus K-, medulla K-, P+ red, containing vulpinic acid, atr-
anorin and evernic acid.
1104 X. Wang et al.
Ecology and distribution: Usually on the bark of Rhododendron and Quercus,

or on the tree crown and bark of Pinus yunnanensis, P. densata, Picea likiangensis
and Abies sp., rarely on rock, altitude varies from 1,900–3,900 m.
It has been reported from Yunnan, Sichuan, Tibet and Taiwan [11], endemic in
Himalaya region [12, 19, 20].
Usage: This species is first reported in Shaanxi Chinese Medicine named as
‘Jinsidai’, later on, it is cited in other books such as Chinese Medical Dictionary and
son on. Although the description of the species in the book Shaanxi Chinese Medicine
is same with Sulcaria virens, but from the geographical aspect, the species is not
supposed to be present in Shaanxi, the species in this book might be actually Leth-
ariella zahlbruckneri, more research on the medical use of the species is needed.
Remarks: Sulcaria virens is characterized by soft and long pendulous thallus,
up to 20–30 cm long, 0.5–4 mm in diameter, surface bright yellow and containing
vulpinic acid; S. sulcata f. vulpinoide differs from this species by the fruticose,
erect thallus; Genera with pendulous thallus such as Bryoria, Lethariella and
Usnea could be distinguished from this species by the dull thallus color, not bright
yellow but brown or gray to yellowish, without longitudinal furrow on the surface,
and different secondary compounds.
Specimens examined: Yunnan Prov., Bijiang Co., Gaoligongshan Mt., Li S.
Wang 5,779; Dali Co., Zhonghesi Temple, alt. 3,620 m, on Rhododendron sp.;
Dongchuan Co., Luoxue Village, on rock, alt. 4,020 m, Li S. Wang 09-30573;
Gongshan Co., Dulongjiang Village, alt. 2,600 m, on Picea sp., Li S. Wang 05-
24,307, 99-18,493, 05-25,793; Yeniugu Village, alt. 2,400 m, on bushes, Li S.
Wang 00-19,556, 00-19,300, 00-19,365; Tengchong Co., Guyong Village, alt.
2,200 m, Li S. Wang 83-2,609; Zhongdian Co., Tianbao Mt., alt. 3,580 m, Li S.
Wang 81-24; Lijiang Co., Lidiping, alt. 3,270 m, Li S. Wang 06-26,363,07-
28,793,82-15,06-26,363; 82-15, 1,982-10-1; Jiuhe Village, Laojunshan Mt., alt.
3,450 m, on Abies sp., Li S. Wang 05-25,015, 05-2,5311, 03-22,666, 05-24,408,
02-21,270, 05-24,756, 05-24,306, 99-18,708, 05-2,4631; Sichuan Prov., Dukou
Co., Daheishan Mt., alt. 2,450 m, on Quercus, Li S. Wang 83-22,520.
117.4 Conclusion
Sulcaria virens var. forrestii published by Hawksworth was based on two speci-
mens collected from Yunnan Dali and Deqin, this species is characterized by flat
main branch, 2.5–4 mm in diam., containing vulpinic acid, while the main bran-
ches of S. virens is no wider than 1.5 mm. After the examination of the type
specimens (Holotypus 1,3271, Paratypus 20,808) and 50 new specimens collected
from the original habitat, the authors discovered 41 specimens which has a
diameter less than 1.5 mm, 6 of them is between 1.5–2.6 mm, only 4 of them has
diameter wider than 2.6 mm. All those specimens share the same morphological,
anatomical, and chemical characters, except for the diameter of the main branch,
about 12 % of the specimens have a diameter between 1.5–2.6 mm, so the value of
the diameter might not be a good character to distinguish these two varieties, thus,
it is suggested that S. var. forrestii is treated as synonym of S. virens.
And three lichen species: Alectoria ochroleuca, Pseudephebe pubescens, and
Sulcaria virens have rather restricted distribution in Hengduan Mountains and they
are considered as rare lichens.
Acknowledgments This study was supported by a grant from the National Natural Science
Foundation of China (No. 31170023), Foundation of Key Laboratory, CAS (KLBB-201210) and
Flora Lichenum Sinicorum (KSCX2–EW–Z–9).
References
1. Tehler A, Wedin M (2008) Systematics of lichenized fungi. In: Nash III (ed) Lichen Biology.
Cambridge University Press, Cambridge, p 336–352, doi:10.1017/CBO9780511790478.018
2. Brodo IM, Hawksworth DL (1930) Alectoria and allied genera in North America. Opera Bot
42:1–164
3. Zahlbruckner A (1930) Lichens in Handel-Mazzetti. Symb Sin 3:1
4. Wei JC, Jiang YM (1986) Lichens of Tibet. Scientific press, Beijing, pp 62–65
5. Wu JN, Wang LS (1992) Alectoriaceae and Anziaceae lichens from Yunnan Lijiang region.
Acta Bot Yunnanica 14(1):37–44
6. Harada H, Wang LS (2004) Thallial branch connection to create a loop in the filmentous
lichenm, sulcaria virens. Lichenology 3(1):29–30
7. Zhou ZY, Wang LS, Wang F, Liu JK (2007) Chemical compoud of Sulcaria virens. Acta Bot
Yunnanica 29(5):586–590
8. Wang LS, Harada H (2008) Ethnic uses of lichens in Yunnan (2), sulcaria sulcata.
Lichenology 7(1):31–34
9. Hawksworth DL (1969) A new variety of Alectoria virens Tayl. From Yunnan province,
China. Misc Bryol Lichenol 5(1):1–3
10. Culberson CF (1972) Improved conditions and new data for the identification of lichen
products by a standardized thin-layer chromatography method. J Chromatogr 72:113–125.
doi:10.1017/CBO9780511790478.018
11. Wei JC (1991) An Enumeration of Lichens in China. International Academic Publishers,
Beijing
12. Singh KP, Sinha GP (2010) Indian Lichens: An Annotated Checklist. Botanical Survey of
India Ministry of Environment and Forests: 68
13. Lee YJ (1988) Cryptogam of North Korea 7. Scientific dictionary press, Pyongyang
14. Hur JS, Koh YJ, Harada H (2005) A checklist of Korean lichens. Lichenology 4(2):65–95
15. Wang LS, McCune B (2010) Contributions to the lichen flora of the Hengduan mountains,
China 1. Genus Pseudephebe (lichenized Ascomycota, Parmeliaceae). Mycotaxon
113:431–437. doi:10.5248/113.431
16. Hawksworth DL (1972) Regional studies in Alectoria (Lichenes) II. The British species.
Lichenologist 5:181–261. doi:10.1017/S002428297200026X
17. Thomson JW (1979) American Arctic Lichens, vol 1. The University of Wisconsin Press,
Wisconsin
18. Brodo IM (1986) A new species of the lichen genus Sulcaria (Ascomycotina, Alectoriaceae)
from California. Mycotaxon 27:113–117
19. Awasthi G, Awasthi DD (1985) Lichen genera Alectoria, Bryoria and Sulcaria from India
and Nepal. Candollea 40(1):305–320
20. Obermayer W, Elix JA (2002) Notes on chemical races in Sulcaria sulcata from southeastern
Tibet and adjacent regions. Bibl Lichenol 86:33–46
Chapter 118
Discussion on the New and the Old
Country Mark in Detecting the Coliform
Bacteria
Lin Huang, Chunxia Wang, Ying Zhang, Fan Mei, Yan Huang,
Jinpeng Wang and Bo Zheng
Abstract For the application of the new country mark in practice detection, the
lactose method and the LST method were compared. Lactose method and LST
method were used to determine the different consistence bacterium fluid of the
coliform bacteria and pollution-free eggs, beverages and tablewares, which had
110 samples in all. The result of two different detection methods had no difference
in statistics. Within the MPN 95 % confidence interval, lactose method and LST
method were credible and accurate. Compared with lactose method, the unquali-
fied rate of LST method in sample detection was increased by an average of
48.4 %. Although there was no difference between these two kinds of methods in
statistics, the unqualified rate of LST method was absolutely higher than lactose
method. This result showed that LST method could reduce the rate of false neg-
atives in sample detection.
Keywords Coliform bacteria Difference Lactose method LST method
118.1 Introduction
Recently, some food testing departments, factories and experiment course in

colleges are still using the lactose bile salts method in country mark GB/T4789.3-
2003 [1] to detect coliform numbers in samples. In 2008, our country health
L. Huang (&) C. Wang F. Mei Y. Huang J. Wang B. Zheng

Key Laboratory of Ministry of Education Industrial Fermentation Microbiology, Tianjin
Key Laboratory of Industrial Microbiology, Tianjin University of Science and Technology,
e-mail: huanglin731@tust.edu.cn
Y. Zhang
China National Research Institute of Food and Fermentation Industries, Beijing 100027,
1108 L. Huang et al.
department made the new test standard GB/T4789.3-2008 [2], which was similar
with coliform detection method of the export food, LST method, but it hasn’t been
widespread used by most detection departments [3]. And then, China published
new detection standard GB4789.3-2010 [4] in 2010. Compared with the edition in
2003, new method has more changes in the part of culture medium, detection
method and detection time et al. This paper aims to explore the difference in two
detection methods.
118.2.1 Bacteria Sources
Escherichia coli was obtained from type culture collection of Tianjin university of
science & technology.
118.2.2 Sample Sources
Pollution-free eggs samples were collected from supermarket and sour milk
beverages samples were obtained from one company. Tableware samples were
collected from our college dining room in different dining time. Different con-
centrations of bacteria standard liquid were made of E. coli.
118.2.3 Cultural Media
GB/T4789.3-2003: lactose bile broth (incipient medium), eosin-methylene blue

agar medium (EMB), lactose broth (recurrence medium);
GB 4789.3-2010: lauryl tryptose broth (LST), brilliant green lactose bile broth
(BGLB);
118.2.4 Culture Experiment
A loopful activated E.coli was transferred to a 100 mL triangular flask containing

50 mL broth liquid medium, and incubated for 24 h at (36 ± 1) C. Sterile saline
solution was used for serial dilution with 1 mL overnight suspension culture.
Colony forming unit (CFU) of each dilution was counted by VRBA method in
118 Discussion on the New and the Old Country Mark 1109
country mark GB4789.3-2010 [5]. Repeated the experiment procedure above, and
then obtained the consistence result of each dilution gradient.
1 mL known concentration bacterium fluid were transferred to 49 mL sterile
water, and this liquid were used as sample for later detection. The same sample’s
CFU results of VRBA method, coliform numbers of lactose method and LST
method were recorded. The lactose method’s results were unified divided by 100,
in order to compare with LST method’s results(MPN/mL).
118.2.5 Sample Experiment
Samples, pollution-free eggs, beverages and tablewares were detected coliform by

using method in country mark GB/T4789.3-2003 and GB4789.3-2010, then
recording the results.
GB/T4789.3-2003: (i) lactose fermentation experiments: samples were diluted
and three consecutive dilutions were chosen. Portion liquid of each dilution were
transferred to three same tubes respectively, which containing lactose ferment
broth. Then incubated the tubes at (36 ± 1) C for (24 ± 2) h, observing acid and
gas production about every tube; (ii) separated culture: transferred suspension of
the tube, which had acid and gas production, to eosin methylene blue plate.
Incubated the plates at (36 ± 1) C for (18–24) h, observing the colony mor-
phology and choosing the typical colonies [6]; (iii) verification experiment: picked
suspicious colonies on the plate for gram staining, and then observed them under a
microscope; at the same time, a loopful of bacterium suspension was transferred to
a tube containing lactose broth. Incubated the tubes at (36 ± 1) C for (24 ± 2) h,
results of acid and gas production were recorded. Reported experimental results:
according to the positive pipe number in verification experiment, most probable
number (MPN) of each sample was calculated, coliform MPN value per 100 mL (g)
was recorded.
GB4789.3-2010: (i) incipient experiment: the pH value of samples mix liquid
were regulated between 6.5 and 7.5. Samples were diluted and three consecutive
dilutions were chosen. Portion liquid of each dilution were transferred to three
tubes respectively, which containing LST broth, incubated at (36 ± 1) C for
(48 ± 2) h; (ii) recurrence experiment : bacterium fluid of tubes, which had gas
production, were transferred to BGLB tubes, incubated at (36 ± 1) C for
(48 ± 2) h, and then results of gas production about each tube was recorded.
Reported experimental results: according to the positive pipe number of verifi-
cation experiment, MPN of each sample was calculated, and coliform MPN value
per 1 mL(g) was recorded. In order to compare with industry standard, the results
of samples experiment were unified multiplied by 100 (MPN/100 mL).
118.3.1 E. coli Standard Liquid Test Results By Lactose

Method and LST Method
Bacteria liquid of E.coli were prepared different concentration of 0–100 cfu/mL,

100–1,100 cfu/mL and greater than 1,100 cfu/mL. Totally there were 45 samples,
which were detected coliform numbers by VRBA plate method, lactose method
and LST method. The 0–100 cfu/mL concentration test results were listed in
Table 118.1, 100–1100 cfu/mL results were shown in Table 118.2 and greater
than 1100 cfu/mL results were shown in Table 118.3.
Results of 0–100 cfu/mL concentration were analyzed the otherness. The actual
number of colonies, detected by VRBA plate method, were found in the MPN
95 % confidence interval of the two detection methods. This phenomenon
Table 118.1 Results of VRBA plate method, lactose method and LST method (0–100 cfu/mL
concentration)
Number VRBA plate method Lactose LST
(cfu mL) method(MPN mL) method(MPN mL)
1 2 \3 \3
2 3 \3 \3
3 3 4 3
4 5 7 3
5 8 12 9.4
6 6 7 7.4
7 30 24 27
8 22 29 20
9 45 42 43
10 41 42 38
11 33 42 38
12 35 42 38
13 40 53 43
14 100 95 93
15 1 \3 \3
16 3 3 3
17 2 \3 \3
18 4 3 3
19 4 \3 \3
20 16 12 15
21 18 19 15
22 16 20 16
23 93 95 93
24 44 39 43
25 47 36 43
Table 118.2 Results of VRBA plate method, lactose method and LST method (100–1100 cfu/mL
concentration)
No. VRBA plate method (cfu mL) Lactose method (MPN mL) LST method(MPN mL)
1 110 93 93
2 145 120 150
3 120 150 120
4 250 240 210
5 200 160 160
6 115 120 93
7 321 290 290
8 477 460 460
9 224 240 240
10 208 160 150
Table 118.3 Results of VRBA plate method, lactose method and LST method (C1100 cfu/mL
concentration)
No. VRBA plate method (cfu mL) Lactose method (MPN mL) LST method(MPN mL)
1 Cannot be counted 1100 [1100
2 Cannot be counted [2400 [1100
4 1200 [2400 [1100
7 Cannot be counted 1100 [1100
8 1132 [2400 [1100
confirmed that E. coli bacteria liquid test results of two methods were credible and
accurate. According to Table 118.1, the otherness of two detection methods by T
inspection method was compared. Established hypothesis as followed, H0:
la = 0, mean that lactose method and LST method had no otherness, H1 la = 0,
level of significance is a = 0.05.
Calculated datas as formula (118.1) and (118.2) showed:
vffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi
uP P .
u d 2 ð d Þ2
t n
Sd ¼ ð118:1Þ
n1
d
t¼ pffiffiffi ð118:2Þ
Sd= n
X X
d ¼ 32:2; d ¼ 32:2=25 ¼ 1:29; n = 25; d2 ¼ 376:92
sffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi
376:92 ð32:2Þ2 =25
Sd ¼ ¼ 3:74
24
1:288
t¼ pffiffiffiffiffi ¼ 1:72; v ¼ n 1 ¼ 24
3:74: 25
a = 0.05, t0.05(24) = 2.064 was read from T test critical value table. In this
case, t \ t0.05(24), so P [ 0.05, mean it isn’t refused to H0. This result explained
lactose method and LST method had no significant difference in statistics, when
the bacteria liquid concentration was 0–100 cfu/mL. But it still could not be
considered that the value and actual significance of the two methods were just the
same.
Results of 100–1100 cfu/mL concentration were analyzed the otherness. As
Table 118.2 shown, the actual number of colonies by VRBA plate method also
were found in the MPN 95 % confidence interval. Therefore results of two
methods also were credible and accurate. The otherness of two detection methods
under this concentration (100–1100 cfu/mL concentration) was compared.
Established hypothesis as followed, H0: la = 0, H1: la = 0, level of significance
is a = 0.05. Calculations’ result was t = 1.15. When a was 0.05, t0.05(9) read from
table was 2.262. In this situation, t \ t0.05(9), so P [ 0.05, mean it isn’t refused to
H0 either. This result explained two detection methods had no significant differ-
ence in statistics, when the bacteria liquid concentration was 100–1100 cfu/mL.
According to datas in Table 118.3, when LST method detected bacteria liquid
concentration just over 1,100 MPN/mL, lactose method’s results always displayed
great than or equal to 2,400 MPN/mL. That was far beyond the reality number,
however, these results of VRBA plate were still in 95 % confidence interval. But
the otherness of two methods could not be calculated accurately.
118.3.2 Sample Test Results of Lactose Method and LST

Method
Three kinds of samples, pollution-free eggs, sour milk beverages and tablewares,
totally 65 samples in all, were respectively detected coliform numbers by lactose
method and LST method, testing whether they exceed corresponding standard of
themselves. The test results were shown in Table 118.4 and Table 118.5.
Results of samples were analyzed the otherness. As data were shown in
Table 118.4, paired sample T test was used, and established hypothesis as fol-
lowed, H0: la = 0, H1: la = 0, level of significance a was 0.05. Calculations
result, t was 0.80. When a was 0.05, t0.05(29) read from T test critical value table
was 2.045. In this case, t \ t0.05(29), so P [ 0.05, which mean it isn’t refused to
H0. This result explained lactose method and LST method had no significant
difference in statistics, which was also conformed with standard liquid detection
Table 118.4 The detection results of pollution-free eggs detected by lactose method and LST
method
Number Lactose method (MPN 100 mL) LST method (MPN 100 mL)
1 40 30
2 60 30
3 90 110
4 70 \30
5 90 94
6 90 72
7 110 140
8 90 74
9 120 140
10 \30 \30
11 \30 \30
12 \30 \30
13 \30 \30
14 \30 \30
15 \30 \30
16 60 30
17 40 30
18 70 62
19 60 61
20 90 94
21 90 94
22 90 74
23 30 30
24 \30 \30
25 \30 \30
26 \30 \30
27 \30 \30
28 \30 \30
29 \30 \30
30 30 30
Table 118.5 The unqualified results of coliform detected by lactose method and LST method
Sample Number of Lactose method LST method
used samples
Number of Rate of Number of Rate of
unqualified unqualified unqualified unqualified
(%) (%)
Egg 30 2 6.7 3 10
Beverage 10 0 0 0 0
Tableware 25 2 8 3 12
Total 65 4 6.2 6 9.2
results. According to coliform requirements in pollution-free eggs health standard

NY5039-2005, coliform numbers in qualified samples are less than or equal to 100
MPN/100 mL. According to this standard, 30 samples of pollution-free eggs in this
paper, had different unqualified rates with lactose method and LST method.
The beverages and tablewares detected results were relatively small, hence,
they could not be compared by statistics method. However, standard of sour milk
beverage health GB16321-2003 and standard of food (drink) disinfection hygiene
GB14934-94 are issued standards of qualified coliform numbers in samples.
(qualified beverage: B3 MPN/100 mL, qualified tableware: B3 MPN/100 cm 9
100 cm). According to these standards, results were shown in Table 118.5, 25
samples of tablewares in this paper, unqualified rate of LST method was absolutely
higher than lactose method. Although there was no difference with two methods in
statistics, actual samples’ qualified rate had significant difference. Compared with
lactose method, the unqualified rate of LST method in sample detection was
increased by an average of 48.4 %.
118.4 Conclusion
118.4.1 Conclusions
Bacteria liquid with different concentration, 0–100 cfu/mL, 100–1100 cfu/mL and
greater than 1,100 cfu/mL, totally 45 samples in all were respectively detected
coliform number by VRBA plate method, lactose method and LST method. The
results were shown that, within MPN 95 % confidence interval, lactose method
and LST method were credible and accurate. Meanwhile, two detection methods
were analyzed by statistical analysis, and the results had no significant difference
in statistics. Three kinds of samples, pollution-free eggs, beverages, tablewares,
totally 65 samples in all, were detected by lactose method and LST method, and
the results indicated that the value had no statistical meaning and the unqualified
rate of LST method was higher than lactose method, average higher 48.4 %.
118.4.2 Discussion
(1) The MPN index of LST method and lactose method are different. MPN index are
not established on large number of previous test results, they are calculated from
the Poisson distribution [7–9]. The intercommunity about two detection meth-
ods’ MPN index was researched by Tan et al. [10]. Through the series calcu-
lations comparison, under three consecutive dilution gradients, two methods’
MPN index could be interchangeable used. In this paper, a problem was found,
when the positive tube numbers are 1–2–3 or 2–1–3, the corresponding results
couldn’t be found in LST method’s MPN index, but could be found in lactose’s
MPN index. MPN index of LST method indeed lack some positive tube num-
bers’ corresponding results. We think that indications lack in LST method’s
MPN may be consisted in the 95 % confidence interval of adjacent positive tube
readings. And if the conclusions as Tan et al. described, when MPN value can’t
be found in LST method, it can be obtained from lactose method’s MPN index.
(2) Two methods’ mediums are different. Tryptone in LST method’s medium is
superior to peptone and better for the coliform group to absorb nitrogen
source. Lauryl sodium sulfate (bacteriostatic agent) in LST method medium
has surface activity effect. And this bacteriostatic agent is easier for thalli
dispersion. The activity of gram-negative bacteria also cloud be improved by
this bacteriostatic agent [11]. Buffer in LST medium was the mixed solution of
dipotassium phosphate and monopotassium phosphate, which can keep med-
ium pH relative stability.
(3) Two methods’ steps are different. The pH should be controlled during sample
treatment in LST method. Although this step was operated under aseptic
condition, it still may be polluted by small amount bacteria. Pollution may also
exist during fussy operation process in lactose method, especially during the
step of gram stain and picking typical colonies [12–14]. Incipient time of LST
method last (48 ± 2) h, that is more than lactose method’s incipient time. It
was found that extended the time of incipient process was benefit for the
damaged cells getting recovery, and reducing the rate of residual. The result in
this paper that unqualified rate of LST method was higher than lactose method
just coincided with the theory above [15–17].
In general, it was found that lactose method and LST method had no difference
in statistics in this research. But the unqualified rates of LST method were obvious
higher than lactose method. Those conclusions fit with Zheng and Wang’s
researches [18–20]. In addition, national health standards of most samples are still
using MPN value unit, MPN per 100 mL(g), that is one reason why the new
country mark can’t be applied in most filed. We hope the related departments will
take some appropriate adjustments in future.
References
1. GB/T4789.3-2003 Microbiological examination of food hygiene, coliform group

determination
2. Mu YJ (2010) GB/T4789.3-2008 coliform count method. Beer Sci Tech 7:16–18 (in Chinese)
3. Song HH (2007) The comparison of country mark method and industry standard method.
Food Saf Guide1:58–60(in Chinese)
4. GB4789.3-2010, The national food safety standards microbiology test coliform group
determination
5. Yang LH, Liu L, Wang HJ (2011) Intensified the contrastion between the number of colonies
and most probable number in food detection. Heilongjiang Med J 24:588–589 (in Chinese)
6. Qian CR, Huang YX (1997) Microbiology experiment course. Beijing University Press,
Haidian, p 196
7. Jin PH (2003) Medical statistics. Fudan University Press, Shanghai, pp 207–209
8. Shen B, Wang YQ, Xu JH (2009) Data evaluation about the TEMPO instrument detection
coliform in food using MPN theory. J Insp Quar 19:39–40 (in Chinese)
9. Xu BJ (1985) The theory of probability about MPN of coliform. Environ Prot Tech 10:1–5
(in Chinese)
10. Tan Z, Wei YX, Luo DP et al (2012) The intercommunity discussion about GB 4789.3-2010
and GB/T4789.3-2003 MPN index.Guangxi J Light Ind 4:121–122 (in Chinese)
11. Liu JZ, Huang K, Chen WL (2003) Medium affect the total bacterial count and its
improvement. Food Sci 24:105–108 (in Chinese)
12. Zhang P, Zhang JQ, He XS (2003) Coliform detection problems in food detection. Agric
Tech 23:33–34 (in Chinese)
13. Wang XJ, Zhao L, Jiao AY (2000) Problem study in total bacterial count and total coliform
group detection. J Shandong Environ (supplement):130 (in Chinese)
14. Lu SB (2003). Development trend of food intestinal bacteria family detection. China Food
Ind 11:56–57 (in Chinese)
15. Zhang Y, Liu HC, Yin QZ et al (2005) A study on the method of recovering the freeze-
injured Escherichia coli at—20.Chinese J Health Lab Tech 15:289–292 (in Chinese)
16. Nakagawa H, Hara KY, Kojina T et al (2000) Detection of freeze-injured Escherichia coli
O157:H7 cells from foods by resuscitation prior to selectice enrichment. Int J Food Microbiol
60:107–110
17. Hara KY, Ikedo M, Kodaka H et al (2000) Selective enrichment with a resuscitation step for
isolation of freeze-injured Escherichia coli O157:H7 from foods. Appl Environ Microb
66:2866–2872
18. Zheng ES (2010).The Country Mark GBT4789. 3- 2003 and GBT4789. 3- 2008 examination
is intelligent sex research.Anhui Agric Sci Bull 16:227, 276 (in Chinese)
19. Wang Q (2011) Research of the otherness in detecting the coliform bacteria from lactose
method and LST method. Food Sci Tech 36:22–26 (in Chinese)
20. Li Q (2010) Discussing the difference between GB 4789.2-2003 and GB 4789.2-2010, GB
4789.3-2003 and GB 4789.3-2010.Food Ferment Tech 46:69–71 (in Chinese)
Chapter 119
Screening Autotetraploid Plantlets
of Glycyrrhiza uralnesis Fisch
by Colchicine-Treated Bud Culture
Xinglin Li, Junting Lu, Xuefei Cao, Na Zhao, Yang Han, Aijia Cao,
Jie Ding and Jun Zhao
Abstract To screen effective and useful autopolyploid of Glycyrrhiza uralnesis

Fisch, the buds were used to dip in the medium with colchicine at different
concentrations for different times. The treated buds were transferred to pots with
perlite to grow at room temperature. After 2 weeks, the root tips from the cultured
seedlings were cut to observe their cell morphology and chromosome counts, and
the individual contained four chromosome groups harvested as an autotetraploid.
The results indicated that, the colchicine of low concentration might promote the
bud0 s development, whereas high concentration colchicine is harmful for the buds
of Glycyrrhiza uralnesis Fisch. Moreover, over 30 % autotetraploids might be
obtained using 0.15 or 0.20 % of colchicine for 12–36 h, but in comparison with
the diploids, the plantlets of many autotetraploids became badly weak at first
generation. Therefore, the autotetraploids preliminary obtained will be faced to
strictly screen according to agricultural traits and effective component.
Keywords Autotetraploid
Chromosome counts Chromosome doubling

Colchicine Glycyrrhiza uralnesis Fisch
119.1 Introduction
Polyploidy plants usually grow bigger than those of the diploid plant, thus they can
increase the biomass or product yields [1–3]. Research on the induction, identi-
fication, and chemical analysis of the polyploidy plantlets of Salvia miltiorrihiza
was reported by Gao et al. [4], and the selected 61-2-22, an excellent autotetraploid
plant, was higher than the control in major chemical compounds and developed
X. Li (&) J. Lu X. Cao N. Zhao Y. Han A. Cao J. Ding J. Zhao

Industrial Fermentation Microbiology, Ministry of Education, Tianjin University of Science
e-mail: lxlszf@tust.edu.cn
1118 X. Li et al.
into a new variety for large-scale production. Glycyrrhiza uralnesis Fisch is also a
kind of traditional Chinese medicinal plant with many important usages, whose
roots have glycyrrhizinic acid, glycyrrhizin, and glycyrrbetinic acid [5–9]. How-
ever, owing to low induction ratio of the autotetraploid, for further study, lack of
abundant mutants will become one of the biggest problems. In this paper, the aim
is to optimize mutant condition to screen more autotetraploid of G. uralnesis Fisch
by different concentrations of colchicine.
119.2.1 Culture Procedure
Seeds of G. uralnesis Fisch were purchased from the medicinal market in Tianjin.
In this paper, from seed treatment to bud induction, the culture procedure was
performed as described by Gao et al. [4, 10].
119.2.2 Induction of Autopolyploid Seedlings
All buds were inoculated in MS inorganic medium containing different concen-

trations of colchicine (0.1, 0.15, 0.2, and 0.3 %, w/v) at different times (12, 24, 36,
and 48 h). Then the treated buds were transferred to the inorganic medium of MS
and cultured at 25 C. After two weeks, the root tips of the seedlings were used for
chromosome determination.
119.2.3 Chromosome Observation
The chromosome observation of the root tips of seedlings was performed as

described by Gao et al. [4]. No less than three roots per seedling were tested in all
trials except for less than three roots.
119.2.4 Data Analysis
Actual survival ratio (ASR,%) = survival number/(treatment seed num-

ber 9 survival ratio of CK); Mutation ratio (MR,%) = mutation number/survival
number.
119 Screening Autotetraploid Plantlets 1119
119.3.1 Effect of Colchicine on Growth of the Seedlings
Colchicine can obviously affect seeds’ bourgeon of G. uralnesis Fisch. At early

stage, the treated seeds by 0.10 % colchicine germinated better than that of other
treatments, and 0.3 % of colchicine for a long time would significantly inhibit the
bud growth (Fig. 119.1). Thus, in order to harvest more original materials, the
concentration of colchicine should be of low levels for a short time [5, 11–13].
119.3.2 Effect of Colchicine on Chromosome Counts

and Cell Morphology of Seedling Roots
The roots treated were observed under microscope. Figure 119.2 shows the dif-
ferences of the cells between normal and over-treated root tips. The cell formation
from the latter was mostly changed into rotundity, in which the cells will have
difficulty in distinguishing chromosome count and morphology. Optimizing
treatment condition of root tip, all tested materials were assayed by individual
Fig. 119.1 The seeds bourgeon observation at different concentrations of colchicine: a 0.10 %;
b 0.15 %; c 0.20 %; d 0.30 %
1120 X. Li et al.
Fig. 119.2 Two kinds of cells treated by dyeing and standing agents: a normal cell formation;
b over-treated cell formation
plant, and the cells divided into many mutants are lined in Fig. 119.3, in which the
variation consisted of the chromosome bridge, the sectorial chimera, and the
autopolyploid, respectively.
Fig. 119.3 Chromosome counts and morphological observations of the root tip cells from G.
uralnesis Fisch: a shows the chromosome of the diploid cells; b, c, and d show the chromosome
of the mutant cells
119.3.3 Effect of Colchicine on Survival Ratio

and Autopolyploid Ratio of Seedlings
After transferring to medium with perlite for 2 weeks, the number of survival
buds, the actual survival ratio, and the mutant ration of all seedlings were counted
and analyzed according to treatment time and concentration of colchicine
(Table 119.1). Over 30 % autotetraploids might be obtained using 0.15 or 0.20 %
of colchicine for 12–36 h, whereas other treatments were very low at both actual
survival ratio and mutant ratio.
Table 119.1 Effect of colchicum on survival ratio and mutant ratio of seedlings
Treatment of Number of Number of Number of Actual survival Mutant
colchicum buds tested survival buds mutants ratio (%)a ratio (%)b
Time Concentration
(hrs) (%, w/v)
CK 100 78 0 100 0
12 0.1 100 27 5 34.6 18
0.15 100 25 6 32.1 24
0.2 100 16 5 20.5 31
0.3 100 9 2 11.5 22
Subtotal/Mean 400 77 18 24.7 23.4
24 0.1 100 24 4 30.8 21
0.15 100 20 7 25.6 35
0.2 100 13 3 16.7 23
0.3 100 5 1 6.4 20
Subtotal/Mean 400 62 15 19.9 24.2
36 0.1 100 19 4 24.4 21
e
0.15 100 10 3 12.8 30
0.2 100 7 1 9.0 14
0.3 100 2 0 2.6 0
Subtotal/Mean 400 38 8 12.2 21.1
48 0.1 100 10 1 12.8 10
0.15 100 4 0 5.2 0
0.2 100 1 0 1.3 0
0.3 100 0 0 0 0
Subtotal/Mean 400 15 1 4.8 6.7
Total/Mean not 1600 192 42 15.4 21.9
containing CK
a
Actual survival ratio (ASR, %) = survival number/(treatment seed number 9 survival ratio of
CK);
b
Mutation ratio (MR, %) = mutation number/survival number
1122 X. Li et al.
119.3.4 Morphological Comparison Between the Diploid

and the Autopolyploid from G. uralnesis Fisch
All well-developed seedlings were classed by chromosome numbers and registered

their morphological characteristic. Figure 119.4 and Table 119.2 show the dif-
ference between the diploid and the autopolyploid from G. uralnesis Fisch. In
comparison with diploids, plantlets of many autotetraploids became badly weak at
first generation, especially, it was short of fibril roots [4, 10–12]. For further study,
obtaining useful and effective autopolyploid of G. uralnesis Fisch will need to be
screened again in subsequent generations.
Fig. 119.4 Morphological comparisons between the diploid and autopolyploid from G. uralnesis
Fisch: a and d show the diploids; b, c, and e show the autotetraploids
Table 119.2 Biological comparison of the characteristics between diploids and autotetraploids
of G. uralnesis Fisch
Plantlet types Seedling Root Leaf Distance Axilla Stem Stem
height (cm) length color between buds perimeter color
(cm) leaves
Diploids(29, [7.0 [9.0 Thin Long Little Wide Poppy
CK) green
Autotetraploids 3.0–5.0 2.0–3.0 Thick Short Much Narrow Red
(49) green
119.4 Conclusion
Colchicine of low concentration for a short time can promote bud development,
whereas high concentration colchicine for a long time is harmful for buds of G.
uralnesis Fisch. Moreover, over 30 % autotetraploids might be obtained using
0.15 or 0.20 % of colchicine for 12–36 h, but in comparison with diploids, the
plantlets of many autotetraploids became badly weak at first generation. Therefore,
the autotetraploids preliminary obtained will be faced to strictly screen according
to agricultural traits and effective component.
Acknowledgments The work was supported by ‘‘National Training Project of College Students’
Innovative and Pioneering Work in Tianjin’’ and ‘‘Natural Science Funds of Tianjin University of
Science and Technology (20100209).’’
References
1. Itokawa H, Morris-Natschke S, Akiyama T, Lee K (2008) Plant-derived natural product

research aimed at new drug discovery. J Nat Med 62:263–280
2. Jian WW, Jian YW (2010) Tanshinone biosynthesis in Salvia miltiorrhiza and production in
plant tissue cultures. Appl Microbiol Biotechnol 88:437–449
3. Yan Y, Wang Z (2007) Genetic transformation of the medicinal plant Salvia miltiorrhiza by
Agrobacterium tumefaciens-mediated method. Plant Cell Tissue Organ Cult 88:175–184
4. Gao S, Zhu D, Cai Z, Xu D (1996) Autotetraploid plants from colchicine-treated bud culture
of Salvia miltiorrhiza Bge. Plant Cell Tissue Organ Cult 47:73–77
5. Chandler RF (1985) Liquorice, more than just a flavour. Can Pharm J 118:420–424
6. Badam L, Amagaya S, Pollard B (1997) In vitro activity of licorice and glycyrrhetinic acid on
Japanese encephalitis virus. J Commun Dis 29:91–99
7. Fuji H, Tian J, Luka C (1986) Effect of glycyrrhetinic acid on influenza virus and pathogenic
bacteria. Bull Chin Mater Med 11:238–241
8. Guo N, Takechi M, Uno C (1991) Protective effect of glycyrrhizine in mice with systemic
Candida albicans infection and its mechanism. Acta Academiae Medicinae Sinicae
12:380–383
9. Salari M, Sohrabi N, Kadkhoda Z, Khalili M (2003) Antibacterial effects of enoxolone on
periodontopathogenic and capnophilic bacteria isolated from specimens of periodontitis
patients. Iran Biomed J 7:39–42
10. Gao S, Chen B, Zhu D (2002) In vitro production and identification of autotetraploids of
Scutellaria baicalensis. Plant Cell Tissue Organ Cult 70:289–293
11. Dhooghe E, Laere K, Eeckhaut T, Leus L, Huylenbroeck J (2011) Mitotic chromosome
doubling of plant tissues in vitro. Plant Cell Tissue Organ Cult 104:359–373
12. Huang H, Gao S, Chen L, Jiao X (2008) In vitro induction and identification of
autotetraploids of Dioscorea zingiberensis. Vitro Cell Dev Biol–Plant 44:448–455
13. Kim Y, Hahn E, Murthy H, Paek K (2004) Effect of polyploidy Induction on biomass and
ginsenoside accumulations in adventitious roots of ginseng. J Plant Biol 47:356–360
Chapter 120
Screening of Antimicrobial Marine
Microorganisms and Purifying of Its
Bioactive Substances
Zhiwen Liu, Qiankun Ruan, Sirigulen Qian and Lina Cong
Abstract A bacterium HS-A38 with antimicrobial activities was isolated from the
intestine of wild sea cucumbers in Dalian sea area. Based on the analysis of
morphological, physiological, and 16S rDNA sequence, the strain HS-A38 was
identified as Bacillus subtilis. Two bioactive substances (1 and 2) were purified
from the fermented broth of the Bacillus subtilis HS-A38 using the methods of
fractional sedimentation with ammonium sulfate, CM-52 ion-exchange chroma-
tography and Sephadex G-75 column. The SDS-PAGE analysis indicated that the
relative molecular weight of these bioactive substances were 41 kDa and 28 kDa,
respectively. The antibacterial spectra showed that substance 1 could only inhibit
Gram-positive bacteria, whereas substance 2 could significantly inhibit both the
Gram-positive and negative bacteria.
Keywords Antibacterial activities Antimicrobial marine microorganisms

Bioactive substance Purification
120.1 Introduction
Bioactive substances are believed to play a key role in microbial interactions by

mediating antagonistic activity and intercellular communication [1]. In addition,
many microbial natural products have biotechnological potential as antibiotics,
Zhiwen Liu and Qiankun Ruan contributed equally to this work.
Z. Liu Q. Ruan S. Qian L. Cong (&)

College of Bio & Food Technology, Dalian Polytechnic University, Dalian 116034,
Liaoning, People’s Republic of China
e-mail: congln@dlpu.edu.cn
1126 Z. Liu et al.
biosurfactants, antifungal, or anticancer agents [2]. Sequences of microbial gen-

omes revealed that only a small fraction of the natural product diversity is known,
which highlighted the potential for finding novel bioactive compounds in envi-
ronmental microorganisms [3]. The need for novel antimicrobials to combat
increasing antibiotic resistances in pathogenic bacteria has stimulated the explo-
ration of other than the traditional sources, such asterrestrial actinomycetes or
fungi [4].
The marine environment harbors bacteria with antagonistic traits [5, 6], and
marine microorganisms are a potential source of novel antimicrobials [7].
Antagonistic marine bacteria have been isolated from surface and deep waters
[8, 9], but the majority originated from biotic surfaces such as sponges [10],
zooplankton and macroalgae [11], corals [12], and bryozoans [13]. Bioactive
bacterial strains predominantly belong to Pseudoalteromonas spp [14], the
Roseobacter clade [15], and Actinobacteria [16]. A number of marine derived
antimicrobials have been characterized in greater detail, including halogenated and
sulfuric compounds [17, 18], depsipeptides and lipopeptides [19, 20], glycolipids
[21], as well as high molecular weight structures such as amino acid oxidases [22].
An emerging source of new bioactivity may result from the many recent studies
of microbial diversity in the marine environment, particularly those microbes
associated with marine plants and animals [23,24]. Several studies have demon-
strated that ‘‘living surfaces’’ represent an environment rich in epibiotic micro-
organsims that produce bioactivity [25,26]. Nevertheless, the vast biotechnological
potential of marine epibiotic microorgansims remains mostly unexplored. This
study mainly explores new sources with potential bioactivity from marine
microorganism host and isolates the bioactive substance producing by
microorganisms.
120.2.1 Isolation of Bacterial Strains from Sea Cucumber

Intestin
Fresh sea cucumber intestine was grinded, shook, and mixed fully under the sterile
environment. The supernatant of the samples were progressively diluted with
sterilized ddH2O by gradient diluents of 10-1, 10-2, 10-3, 10-4, and 10-5. Each
0.2 ml of them was spread onto marine agar 2216 media, incubated at 25 C for
2 days, and then selected the single cell colon based on the differences of the
sample and the morphological of the strains.
120 Screening of Antimicrobial Marine Microorganisms 1127
120.2.2 Screening of Strains with Antibacterial Activity
Screening of strains with antibacterial activity was conducted by the method of

agar well diffusion. All isolated strains were respectively inoculated in 5 mL LB
liquid medium and cultured on a rotary shaker (150 rpm) at 28 C for 2 days. The
fermented broth was spun down at 8,000 g for 10 min, whereas the supernatant
was passed through a 0.45 lm Millipore filter. The indicator strains in this test are
Micrococcus lysodeikticus, Staphylococcus aureus, Vibrio parahemolyticus, and
Pseudomonas aeruginosa. Wells of 5 mm diameter were punched in Brain Heart
Infusion agar plates seeded with indicator organisms. The fermented broth
(200 ll) was added in the wells. Plates were then incubated at 30 C for 48 h.
Where upon inhibitory activity was detected as a zone of clearing in the turbid agar
around the wells containing antibacterial activity (positive samples). The diameter
of the clearing zones was measured in (mm) to obtain a semi-quantitative
determination of the concentration of the antibacterial compound.
120.2.3 Identification of the Selected Strain
The marine selected bacteria strain with higher antibacterial activity than others was
selected and identified by chemotaxonomic, morphological characters, and its 16S
rDNA gene sequence. The sequence was initially analyzed on the NCBI (http://
www.ncbi.nlm.nih.gov/) using the BLAST tool and corresponding sequences were
retrieved. A similarity matrix was prepared using Dnadist program in PHYLIP
analysis package using Jukes-Cantor corrections. The phylogenetic tree was
constructed by the neighbor-joining method using the MEGA software package.
120.2.4 Preparation of Bioactive Substance Suspension
The strain was incubated in 2216E broth for 16 h at 28 C and 150 rpm. Then 2 %
of the seed culture was inoculated to fermentation media containing soluble starch
1.25 %, beef extract 2.5 %, steep water 1 %, Tween-80 0.01 %, and cultured on a
rotary shaker (150 rpm) at 28 C for 48 h. The cultured bacteria were centrifuged
at 8,000 rpm for 10 min and the supernatants were reserved.
120.2.5 Preliminary Authentication of the Bioactive

Substances
In order to identify the composition of bioactive substance, 500 ll fermentation

supernatants mixed with 20 ll Protease k and kept at temperature 50 C for 1 h,
1128 Z. Liu et al.
whereas the supernatants without Protease k were used as a control. The antibiotic
activity of the two supernatant samples was tested by the method of ager well
diffusion.
120.2.6 Ammonium Sulfate Precipitation
Crude proteins were precipitated by adding ammonium sulfate to the final

concentration of 60 % (w/v), and proteins were harvested by centrifugation
(12,000 rpm for 30 min at 4 C). The pellet was dissolved in sterilized water and
dialyzed to desalt crude protein using dialysis membrane (MWCO: 12–14,000).
Antimicrobial active of the crude proteins were assayed by the methods of ager
well diffusion.
120.2.7 Ion-Exchange Chromatography and Gel Filtration
The clear supernatant was subjected to purify by CM-52 ion-exchange chroma-

tography pre-equilibrated with 20 mM PBS (pH 5.0). The proteins were
fractionated with a 0.1–0.6 M step gradient of NaCl in 20 mM PBS buffer and
flow rate of 1 ml/min. Eluted fractions were collected and measured. Eluted
fractions (2 mL) were collected and the OD280 was measured for every fraction.
All fractions were used in the bioassay to check the antimicrobial activity, and then
the fractions with bioactivity were dried with a vacuum concentrator and weighed.
The above dried samples were diluted and the fractions were subjected to purify
by Sephadex G-75 column pre-equilibrated with 10 mM PBS (pH 7.0). The
column was eluted with 10 mM PBS at a flow rate of 0.6 ml/min. Eluted fractions
(2 ml) were collected and the OD280 was measured for every fraction. All
the fractions were used in the bioassay to check the antimicrobial activity and the
fractions were dried and weighed.
120.2.8 Protein Assay and Analysis of SDS-PAGE
The protein concentration was measured by the methods of Bradford using bovine
serum albumin. 15 % SDS–polyacrylamide gel electrophoresis (SDS-PAGE) was
performed to detect the purified bioactive substances.
120.3 Results
120.3.1 Screening of Antimicrobial Marine Microorganisms
200 marine bacteria strains were isolated and tested for their antimicrobial
activities against M. lysodeikticus, S. aureus, V. parahemolyticus, and P. aeru-
ginosa. The results showed that 13 strains (accounting for 6.5 %) possessed
antimicrobial activities. As shown in Table 120.1, the strain HS-A38 exhibited the
strongest inhibitory effects against the four indicator strains. The inhibition zone of
the strain reached 24.6, 32.4, 36.0, 18.0 mm, respectively.
120.3.2 Identification of the Strain HS-A38
The strain HS-A38 was identified through morphological and molecular tools. It
was strictly aerobic, motile, Gram-positive, spore forming, and rod-shaped
(Fig. 120.1). Its 16S rDNA gene sequence with 1,648 bp showed 100 % similarity
with Bacillus sp (AB195282). The 16S rDNA sequence was submitted to GenBank
under the accession number GQ 466597. The NJ-based phylogenetic tree showed
that it stood with Bacillus sp clade (Fig. 120.2). Hence, the strain HS-A38 selected
in the present study was identified as Bacillus sp.
Table 120.1 Strains with strongest antibacterial activities

Strain no Inhibition zone (mm)
ML SA VP PA
A9-4 22.6 26.6 26.8 –
A8-5 26.6 30.0 29.7 15.0
A1-15 23.0 22.0 28.1 –
A8-3 25.4 30.4 17.8 –
A8-20 25.4 28.0 18.0 –
A8-4 23.4 32.0 18.0 –
C6-7 23.2 26.0 27.0 –
C8-11 24.0 27.0 27.0 –
C7-17 21.5 26.7 26.2 –
C7-21a 22.0 24.7 28.5 –
C7-21b 20.0 25.3 31.2 –
C7-18 21.5 27.0 27.7 –
HS-A38 24.6 32.4 36.0 18.0
ML Micrococcus lysodeikticus, SA Staphylococcus aureus, VP Vibrio parahemolyticus, PA
Pseudomonas aeruginosa
1130 Z. Liu et al.
Fig. 120.1 Morphology of

the strain HS-A38 (9 1,000)
Fig. 120.2 Phylogenetic tree

of HS-A38 based on the 16S
rDNA sequence
120.3.3 Preliminary Authentication of Bioactive Substances
Compared with the no Protease k, the bacteria inhibition zone of the supernatant
with Protease k significantly diminished (Fig. 120.3). The results demonstrated
that the composition of the bioactive substances should contain proteins.
Fig. 120.3 Antibacterial

result of the extracted liquid
processed by Protease k
120.3.4 Purification of Bioactive Substances
The crude extracts from the supernatant of HS-A38 was precipitated by 60 %

ammonium sulfate solution and dialysed. The dialysate was supplied to CM-52
ion-exchange chromatography for purification (Fig. 120.4a). The fractions pos-
sessing antimicrobial activities were collected and rechromatographed on the
Sephadex G-75 column, and it showed that two peaks of bioactive substances
(Fig. 120.4b).
Each of the fractions was designated as substances 1 and 2, respectively. They
were collected and independently estimated its purity by SDS-PAGE. The results
showed that both of substances 1 and 2 exhibited a single band with the molecular
weight of 41 kDa and 28 kDa, respectively (Fig. 120.5).
Fig. 120.4 CM-52 anion-exchange chromatography (a) and the chromatography of Sephadex G-
75 (b)
1132 Z. Liu et al.
Fig. 120.5 SDS-PAGE

assay of purified protein after
chromatography of Sephadex
G-75. a substance 1,
b substance 2
120.3.5 Antimicrobial Activities Assay
The antimicrobial activities of substances 1 and 2 were tested with four indicator
strains (Fig. 120.6). The results showed that substance 1 exhibited inhibitory
effects against Gram-positive strains and substance 2 against both Gram-positive
and -negative bacteria (Table 120.2).
S1: substances 1
S2: substances 2
S1 S2
Micrococcus lysodeikticus
S1 S2 S2
Staphylococcus aureus Vibrio parachaemolyticus Pseudomonas aeruginosa
Fig. 120.6 Antibacterial results of bioactive substances 1 and 2

Table 120.2 Antibacterial spectrum of bioactive substances

Substance no Inhibition zone (mm)
ML SA VP PA
1 14.0 17.2 –
2 23.1 33.1 17.0
ML Micrococcus lysodeikticus; SA Staphylococcus aureus; VP Vibrio parahemolyticus; PA
Pseudomonas aeruginosa
120.4 Discussion
The widespread occurrence of antibiotic-resistant human pathogens and the

paucity of effective antifungal drugs have created an urgent need for new anti-
microbial agents Marine microorganisms have proved to be rich sources of bio-
active substances,and numerous with potent biological activities and unique
chemical structures were isolated.The large numbers, and diversity, of marine
microorganisms such as bacteria, fungi, and cyanobacteria suggest that this
resource will be of significant importance in the discovery of new antimicrobial
agents and other drugs,and are expected to compete with terrestrial microorgan-
isms in this aspect in the near future. In addition, compared with other marine
organism,marine microorganism owns its superiority that is easy to realize
industrialization by fermentation, we can optimistically predict unique metabolites
will be mass-produced by cultivation of genetically modified microbes It is no
doubt that study of marine microorganisms will have a vast range of prospects.
In this project, we report the screen of antimicrobial marine microorganisms
and purification of its bioactive substances The strain HS-A38 with obvious
antimicrobial activity was isolated from sea cumber intestine It was identified by
chemotaxonomic and morphological characters and its 16S rDNA sequence The
results showed that it belongs to Bacillus sp. Two bioactive substances were
purified from the selected strain with the methods of ammonium sulfate sedi-
mentation, CM-52 ion-exchange chromatography, and Sephadex G-75 column.
The molecular mass of purified bioactive substances detected on SDS-PAGE was
41 kDa and 28 kDa, respectively. Substance 1 exhibited antibacterial activities
against M. lysodeikticus and S. aureus, whereas substance 2 mainly focused on the
killing V. parahemolyticus, M. lysodeikticus, and S. aureus. The N-terminal amino
acid sequence will be analyzed for further study. We are planning to conduct
future studies in analyzing the gene responsible for bioactive substance 2 and to
overexpress it in a suitable recombinant expression system [27].
Acknowledgments This research was supported by the Natural Science Foundation of China
(Grant no. 31072224), Natural Science Foundation of Liaoning Province of China(Grant no.
20102009), and Foundation of Liaoning Educational Committee for Innovation Team (Grant no.
LT2010012).
1134 Z. Liu et al.
References
1. Hibbing ME, Fuqua C, Parsek MR et al (2010) Bacterial competition: surviving and thriving
in the microbial jungle. Nat Rev Microbiol 8:15–25
2. Demain AL, Sanchez S (2009) Microbial drug discovery: 80 years of progress. J Antibiot
62:5–16
3. Fischbach MA (2009) Antibiotics from microbes: converging to kill. Curr Opin Microbiol
12:520–527
4. Berdy J (2005) Bioactive microbial metabolites. J Antibiot 58:1–26
5. Nair S, Simidu U (1987) Distribution and significance of heterotrophic marine bacteria with
antibacterial activity. Appl Environ Microbiol 53:2957–2962
6. Long E, Azam F (2001) Antagonistic interactions among marine pelagic bacteria. Appl
Environ Microbiol 67:4975–4983
7. Zhang LX, An R, Wang JP et al (2005) Exploring novel bioactive compounds from marine
microbes. Curr Opin Microbiol 8:276–281
8. Gram L, Melchiorsen J, Bruhn JB (2010) Antibacterial activity of marine culturable bacteria
collected from a global sampling of ocean surface waters and surface swabs of marine
organisms. Mar Biotechnol 12:439–451
9. Hohmann C, Schneider K, Bruntner C et al (2009) Caboxamycin, a new antibiotic of the
benzoxazole family produced by the deep-sea strain streptomyces sp NTK 937. J Antibiot
62:99–104
10. Taylor MW, Radax R, Steger D et al (2007) Sponge-associated microorganisms: evolution,
ecology, and biotechnological potential. Microbiol Mol Biol Rev 71:295–347
11. Wiese J, Thiel V, Nagel K et al (2009) Diversity of antibiotic-active bacteria associated with
the brown alga laminaria saccharina from the baltic sea. Mar Biotechnol 11:287–300
12. Rypien KL, Ward JR, Azam F (2010) Antagonistic interactions among coral-associated
bacteria. Environ Microbiol 12:28–39
13. Herndl H, Wiese J, Thiel V et al (2010) Phylogenetic diversity and antimicrobial activities of
bryozoan-associated bacteria isolated from mediterranean and baltic sea habitats. Syst Appl
14. Bowman JP (2007) Bioactive compound synthetic capacity and ecological significance of
marine bacterial genus pseudoalteromonas. Mar Drugs 5:220–241
15. Martens T, Gram L, Grossart HP et al (2007) Bacteria of the roseobacter clade show potential
for secondary metabolite production. Microb Ecol 54:31–42
16. Bull JE (2007) Stach marine actinobacteria: new opportunities for natural product search and
discovery. Trends Microbiol 15:491–499
17. Andersen RJ, Wolfe MS, Faulkner DJ (1974) Autotoxic antibiotic production by a marine
chromobacterium. Mar Biol 27:281–285
18. Geng HF, Bruhn JB, Nielsen KF et al (2008) Genetic dissection of tropodithietic acid
biosynthesis by marine roseobacters. Appl Environ Microbiol 74:1535–1545
19. Romanenko LA, Uchino M, Kalinovskaya NI et al (2008) Isolation, phylogenetic analysis
and screening of marine mollusc-associated bacteria for antimicrobial, hemolytic and surface
activities. Microbiol Res 163:633–644
20. Das P, Mukherjee S, Sen R (2008) Antimicrobial potential of a lipopeptide biosurfactant
derived from a marine bacillus circulans. J Appl Microbiol 104:1675–1684
21. Kiran GS, Thomas TA, Selvin J (2010) Production of a new glycolipid biosurfactant from
marine nocardiopsis lucentensis MSA04 in solid-state cultivation. Colloids Surf B
Biointerfaces 78:8–16
22. Gomez D, Espinosa E, Bertazzo M et al (2008) The macromolecule with antimicrobial
activity synthesized by pseudoalteromonas luteoviolacea strains is an L-amino acid oxidase.
Appl Microbiol Biotechnol 79:925–930
23. Penesyan A, Marshall-Jones Z, Holmstrom C et al (2009) Antimicrobial activity observed

among cultured marine epiphytic bacteria reflects their potential as a source of new drugs:
research article. FEMS Microbiol Ecol 69:113–124
24. Hentschel U, Schmid M, Wagner M et al (2001) Isolation and phylogenetic analysis of
bacteria with antimicrobial activities from the mediterranean sponges aplysina aerophoba and
aplysina cavernicola. FEMS Microbiol Ecol 35:305–312
25. Muscholl-Silberhorn A, Thiel V, Imhoff J (2009) Abundance and bioactivity of cultured
spongesssociated bacteria from the mediterranean sea. Microb Ecol 55:94–106
26. Egan S, Thomas T, Kjelleberg S (2008) Unlocking the diversity and biotechnological
potential of marine surface associated microbial communities. Curr Opin Microbiol
11:219–225
27. Cong LN, Yang XJ, Wang XX et al (2009) Characterization of an i-type lysozyme gene from
the sea cucumber stichopus japonicus, and enzymatic and nonenzymatic antimicrobial
activities of its recombinant protein. J Bios Bioeng 107:583–588
Chapter 121
Determination of Dichloromethane
in Waste Water Using Headspace Gas
Chromatography
Chaozheng Zhang, Huijing Xu, Yutao Li and Fuhai Wang
Abstract A method for the detection of dichloromethane (DCM) in waste water

was developed by using head-space gas chromatography with FID detection. The
calibration curve was linear in three orders of magnitude range of DCM levels and
the linear correlation coefficient was 0.9995. The limit of detection was 0.004 mg/l
and the limit of quantitation was 0.01 mg/l. The system and method precision were
both accord with the requirement. The method, practiced in the quantitative
determination of DCM in waste water, solved many problems as such and high
water content in sample. Many impurities which impacted the detection of DCM
were separated visibly.
Keywords Determination Dichloromethane Headspace gas chromatography

Waste water
121.1 Introduction
Dichloromethane (DCM) is a toxic pollutant,widely used as a solvent in

pharmaceuticals industry [1]. DCM has been extensively used for several decades,
first applied in paint removal [2]. It has showed dogged persistence in water
C. Zhang (&) F. Wang

Key Laboratory of Ministry of Education Industrial Fermentation Microbiology, Tianjin
Key Laboratory of Industrial Microbiology, Tianjin University of Science and Technology,
e-mail: zhangchaozheng@tust.edu.cn
H. Xu
Tianjin Product Quality Inspection Technology Research Institute, Tianjin 300384,
Y. Li
Tianjin Trustworthy Biotechnology Limited, Tianjin 300200, People’s Republic of China
1138 C. Zhang et al.
(half-life over 700 years) and atmosphere (half-life 79 days). Thus, it is difficult to
remove DCM from contaminated water [3]. DCM is toxic to the central nervous
system at high exposure levels in air [4]. Carcinogenicity of DCM has been also
reported in the mouse lung and liver and there is suspected carcinogenicity in
human liver and kidney [5]. Therefore, the researchers are very interested in
biodegradation of DCM [1, 6–8]. But, it is very important how to detect the
concentration of DCM during biodegradation experiments.
The analysis of volatile organic compounds in aqueous using gas chromatog-
raphy has been performed by some researchers [9–13]. They often use head space
and solid phase microextraction as inject sources [14–18]. Ibrahim A. Wasfi
detected the ethanol and abused inhalants in blood using headspace gas chroma-
tography (HS-GC)-mass spectrometry method [19]. M. Guardia Rubio analyzed the
pesticides in washing waters by solid-phase extraction-gas chromatography [20].
The aim of this study is to establish a method of detecting the concentration of
DCM in the waste water using HS-GC. The standard curve and its limit of
quantitation (LOQ) and limit of detection (LOD) are investigated.
121.2.1 Chemicals and Reagents
HPLC-grad DCM was purchased from Concord (Tianjin, China). The waste water
was got back from a Wastewater treatment plant of pharmaceutical company. The
wastewater was boiled for 30 min prior to using blank solution and diluents.
121.2.2 Gas Chromatography Determination
An agilent 7890 gas chromatography with a flame ionization detector was used.
The column was a DB-624 (30 m 9 0.53 mm, 3 lm film thickness) from Agilent
Corporation. The injector was G1118 head-space injection resource. The carrier
gas was nitrogen gas. The method was as follows: the column flow is 3.0 ml/min,
constant flow mode; the split ratio was 5:1; the inlet temperature was 180 C; the
detector temperature was 250 C; the temperature program was 40 C for 4 min
followed ramp at 10 C/min to 200 C.
121.2.3 Head-Space Method
A 10 ml sample contained DCM was put into a 20 ml HS-GC vial (Agilent USA).
The head-space sampler conditions were: vial pressure is 14 psi, sample shaker is
121 Determination of Dichloromethane 1139
high, extractions per Vial is 2, oven temperature is 60 C, loop temperature is

75 C, transfer line temperature is 100 C, GC cycle time is 35 min, vial equili-
bration time is 15 min, vial pressurization time is 0.1 min, loop fill time is
0.15 min, loop equilibration time is 0.05 min, sample injection time is 1 min.
121.2.4 Calibration Solutions
A stock solution of DCM standard in boiled sewage was prepared at 8 mg/l and
stored in refrigerator. The calibration standard solutions were prepared in boiled
waste water at 0.05, 0.1, 0.5, 1, 2 , 4, 8 mg/l for HS-GC. All the solutions were
diluted with boiled waste water and always made extemporaneously.
121.2.5 Solution of the System and Method Precision
Accurately weighed DCM standard sample 20 mg to 100 ml volumetric flask,

dissolved by dilution and take to volume. Transfer 1.0 ml above solution to 100 ml
volumetric flask and take to volume with dilution as the system precision solution.
Accurately weighed DCM 10 mg to 100 ml volumetric flask, dissolved by
dilution and take to volume. Transfer 1.0 ml above solution to 100 ml volumetric
flask and take to volume with dilution as the sample solution. Prepare six solutions
use the same batch DCM.
121.3.1 Optimization of the HS Conditions
For the sampling of DCM from the waste water, HS was preferred to direct sampling
for several reasons: equilibrium time was less than SPME; the contact of the fiber
with the sample was avoided. For this study, the oven temperature and the vial
equilibration time were observed and studied. Five temperatures (50, 60, 70, 80,
90 C) were investigated and the result was shown in Fig. 121.1. The vial equili-
bration time was studied at 5, 8, 10, 15, 20, 25 min and Fig. 121.2 showed the finding.
Figure 121.1 indicates that the head-space concentration of DCM was
increasing as the oven temperature was ascending. There was no increase when the
oven temperature exceeded 60 C. The result is related with the boiling point of
DCM. It is 39.75 C. Figure 121.2 shows that a equilibration time of 15 min gives
satisfactory results; a longer time did not result in increasing of the concentration
in the head space of vial. Therefore, 60 C and 15 min were used for heated
temperature and equilibration time of the vial, respectively.
Fig. 121.1 Relationship 47

between oven temperature
and peak area at vial
equilibration time 15 min 46
Peak area
(the DCM concentration was
2 mg/l) 45
44
43
50 60 70 80 90
Temperature / o C
Fig. 121.2 Relationship of 47

vial equilibration time and
peak area at oven temperature
46
70 C (the DCM
Peak area
concentration was 2 mg/l)

45
44
43
0 5 10 15 20 25 30
equilibration time / min
121.3.2 Selectivity of GC Method
We have optimized the different steps of the GC to higher the resolution and lower the
limit of detection. To examine the specificity of the method, we injected three
samples: blank solution, blank solution with DCM, and waste water. The chro-
matograms are shown in Fig. 121.3. The blank solution, waste water boiled 30 min,
is not obvious responded on the chromatographic condition. The response time of
DCM is 7.806 min. The resolution of DCM and other impurities are all more than 1.5.
121.3.3 Quantization by Calibration Curve
Calibration standards should approximate the composition of the sample to be

analyzed not only with respect to the analyte concentration but also with regard to
the concentrations of the other impurities in the sample matrix. In particular, the
sample matrix plays an important role in the head space analysis. The waste water
is just like this.
Fig. 121.3 Chromatogram under the method condition. a the blank solution, b the blank solution
with DCM, c the waste water
In our study, the calibration curve in the concentration rang from 0.05 to 8 mg/l
of DCM in the matrix was prepared. In order to overcome the problem of the
matrix effect, the standard solutions were prepared by boiled waste water. The
linear relation between peak area and the DCM concentration in waste water is
presented in Fig. 121.4. The values for the intercept and slope for the regression
line y = a ? bx were calculated to be a = -0.28 ± 1.15, b = 23.56 ± 0.33 for
seven points (n = 7) at the 95 % confidence limit. The correlation coefficient of
the line was calculated to be R = 0.9995. From this regression line DCM
concentration in waste water were calculated.
121.3.4 System and Method Precision
The 2 mg/l DCM solution was used as the system precision solution. Six replicate
injections of the system precision solution were injected in the chromatograph and
Fig. 121.4 Calibration curve

by linear regression 200
150
Peak area
100
50
0 2 4 6 8
Concentration of DCM(mg/L)
recorded the retention time and peak area responses. The RSD % of retention time
and peak area responses was calculated. The RSD % of peak area and retention
time is not more than 2.0 %. The result is in line with the requirement of system
precision.
The 1 mg/l DCM solution was used as the method precision solution. Two
replicate injections of each sample solution, record the peak area of DCM. The
assay of DCM RSD % is not more than 2.0 %. The result accords with the
requirement of method precision.
121.3.5 LOD and LOQ of the Method
Gradually dilute the solution of method precision injected in chromatograph,

inspected the signal-to-noise ratio. When diluted the solution to 100 times, the
signal-to-noise ratio is 10.5, between 9 and 11. The signal-to-noise ratio is 2.6,
between 2 and 3, when diluted the concentration of method precision to 250 times.
Therefore, the LOQ and LOD is 0.01 and 0.004 mg/l respectively.
121.4 Conclusion
For the determination of DCM in waste water, the head space gas chromatographic
procedure was verified. The head space procedure was investigated and the result was
fine. In the concentration rang between 0.05 and 8 mg/l of DCM, a linear response
was observed. The correlation coefficient was 0.9995 for the calibration plot. The
system and method precision were in line with the requirement (RSD \ 2.0 %).
The LOD and LOQ, observed in this study, were 0.01 and 0.004 mg/l, respectively.
In comparison with extraction and adsorption procedures for DCM in waste
water, the head space method is faster and more accurate when the DCM
concentration is obviously low. Nevertheless, the precision measured by head
space method was reduced.
This study verified that the procedure described in this paper can be
successfully used for the determination of DCM in waste water in pharmacy
industry.
Acknowledgments The financial support of the Tianjin science and technology plan project
(Science and technology innovation fund for small and medium-sized enterprises NO.
11ZXCXGX16300) is gratefully acknowledged.
References
1. Krausova VI, Robb FT, Gonza0 lez JM (2003) Bacterial degradation of dichloromethane in
cultures and natural environments. J Microbiol Methods 54:419–422
2. U.S. International Trade Commission (1986) Synthetic organic chemicals. U.S. production
and sales. U.S. International Trade Commission, Washington, pp 1970–1985
3. Mackay DM, Cherry JA (1986) Groundwater contamination: pump-and-treat remediation.
Environ Sci Technol 23:630–636
4. WHO Working Group (1996) In: Methylene chloride-environmental health criteria 164.
World Health Organization, Geneva, p. 21
5. Sakai T, Morita Y, Wakui C (2002) Biological monitoring of workers exposed to
dichloromethane, using head-space gas chromatography. J Chromatogr B 778:245–250
6. Edwards RR, Campbell J, Milne GS (1982) The impact of chloromethanes on the
environment part 2, methyl chloride and methylene chloride. Chem Ind 41:619–627
7. Gälli R, Leisinger T (1985) Specialized bacterial strains for the removal of dichloromethane
from industrial waste. Conserv Recycl 8:91–100
8. Freedman DL, Gossett JM (1991) Biodegradation of dichloromethane and its utilization as a
growth substrate under methanogenic conditions. Appl Environ Microbiol 57:2847–2857
9. Kuráň P, Soják L (1996) Environmental analysis of volatile organic compounds in water and
sediment by gaschromatography. J Chromatogr A 773:119–141
10. Ashley DL, Bonin MA, Frederick L et al (1992) Determining volatile organic compounds in
human blood from a large sample population by using purge and trap gas chromatography/
mass spectrometry. Anal Chem 64(9):1021–1029
11. Cassada DA, Zhang Y, Snow DD et al (2000) Trace analysis of ethanol, MTBE, and related
oxygenate compounds in water using solid-phase microextraction and gas chromatography/
mass spectrometry. Anal Chem 72(19):4654–4658
12. Sarafraz-Yazdi A, Mosadegh M, Amiri A (2011) Determination of volatile organic
compounds in environmental water samples using three solid-phase microextraction fibers
based on sol–gel technique with gas chromatography–flame ionization detector. Anal
Methods 3:1877–1886
13. Leong MI, Huang SD (2012) Determination of volatile organic compounds in water using
ultrasound-assisted emulsification microextraction followed by gas chromatography. J Sep
Sci 35:688–694
14. Cervera MI, Beltran J, Lopez FJ et al (2011) Determination of volatile organic compounds in
water by head space-solid-phase microextraction gas chromatography coupled to tandem
mass spectrometry with triple quadrupole analyzer. Anal Chim Acta 74:87–97
15. Li YT, McCarty CL, George EdJ (2011) Determination of selected semi-volatile organic
compounds in water using automated online solid-phase extraction with large-volume
injection/gas chromatography/mass spectrometry. Fron Env Sci Eng 5(3):417–425 (in
chinese)
16. Zhang ZM, Wang QT, Li GK (2012) Fabrication of novel nanoporous array anodic alumina
solid-phase microextraction fiber coating and its potential application for headspace sampling
of biological volatile organic compounds. Anal Chim Acta 727:13–19
17. Cervera MI, Beltran J, Lopez FJ, Hernandez F (2011) Determination of volatile organic
compounds in water by headspace solid-phase microextraction gas chromatography coupled
to tandem mass spectrometry with triple quadrupole analyzer. Anal Chim Acta 704:87–97
18. Vera H, Raquel S, José Luís M et al (2012) Response surface optimisation applied to a
headspace-solid phase microextraction-gas chromatography-mass spectrometry method for
the analysis of volatile organic compounds in water matrices. Int J Environ An Ch
92(2):166–189
19. Wasfi IA, Al-Awadhi AH, Naser Z et al (2004) Rapid and sensitive static headspace gas
chromatography–mass spectrometry method for the analysis of ethanoland abused inhalants
in blood. J Chromatogr B 799:331–336
20. Guardia Rubio M, Ruiz Medina A, Pascual Reguera MI et al (2007) Multi residue analysis of
three groups of pesticides in washing waters from olive processing by solid-phase extraction-
gas chromatography with electron capture and thermionic specific detection. Microchem J
85:257–264
Chapter 122
Simulation of Bio-syngas Production
from Biomass Gasification via Pressurized
Interconnected Fluidized Beds
Fei Feng, Guohui Song, Laihong Shen and Jun Xiao
Abstract Bio-syngas production from biomass gasification via pressurized

interconnected fluidized beds was described. The interconnected fluidized beds
technology separates the gasification and combustion processes of biomass, and
the heat is transferred from combustor to gasifier by bed materials, while extra heat
needed in gasification process is provided by additional biomass burning in the
combustor. The simulation of the whole process was carried out with Aspen Plus
software. The effects of gasification temperature (Tg), gasification pressure (pg)
and steam to biomass ratio (S/B) on bio-syngas production were studied. The
results showed that gasification temperature, gasification pressure, and S/B had
great influences on the bio-syngas composition and to achieve high carbon con-
version and yield of high-quality bio-syngas, the suitable gasification temperature
is around 750 C, and the gasification pressure and S/B could not too high.

Keywords Pressurized Interconnected fluidized beds Bio-syngas Simulation
Biomass gasification
122.1 Introduction
Since biomass is one kind of renewable, clean energy, and can achieve the goal of
CO2 zero-emission and reduce the greenhouse effect during its industrial utiliza-
tion, its development and employment has obtained great attentions all over the
F. Feng G. Song L. Shen (&) J. Xiao

Key Laboratory of Energy Thermal Conversion and Control of Ministry of Education,
School of Energy and Environment, Southeast University, Jiangsu 210096,
e-mail: lhshen@seu.edu.cn
F. Feng
Department of Mechanical Technologies, Nanjing College of Chemical Technologies,
Jiangsu 210048, People’s Republic of China
1146 F. Feng et al.
world [1]. Biomass gasification is considered as a key technology in reaching

targets for renewable energy and CO2 emissions reduction [2]. After proper
purification and conditioning, bio-syngas from biomass gasification composed
mainly of CO and H2 can be synthesized to methane, methanol, gasoline, and
diesel oil [3–6]. So many researchers have done a lot of work about the bio-syngas
production from biomass gasification, including gasification agents, reactors,
catalysts, and so on. For instance, the oxygen-rich air was used as the gasification
agents to avoid the dilution of bio-syngas with the inert nitrogen of air, while some
researchers used a mixture of air and steam as gasification agents to produce bio-
syngas with relatively higher H2/CO ratio to meet the requirements of the further
synthetic reactions [7–9].
This article intends to study the laws of bio-syngas production with biomass
gasification from a new perspective of simulation. The process simulation with
Aspen Plus software was carried out to demonstrate the effects of operating
parameters, like gasification temperature, gasification pressure and the ratio of
steam to biomass fed into the gasifier (S/B), on the bio-syngas composition, yield,
and carbon conversion of biomass. These results provided reference data for the
further study of biomass gasification.
Gasifier is the core equipment of the biomass gasification process, which can be
classified as fixed bed gasifiers and fluidized bed ones. The interconnected fluid-
ized beds gasifiers are evolved from the conventional fluidized bed gasifiers [10].
The scheme of biomass gasification in interconnected fluidized beds is illustrated
in Fig. 122.1 [11]. It is in a loop with end-to-end configuration composed of a
circulating fluidized bed as a combustor, and a bubbling fluidized bed as a gasifier.
The circulating fluidized bed is designed for combustion fed with air as gasifi-
cation agent and the bubbling fluidized bed for biomass gasification fed with steam
as gasification agent. The gasification-required heat is achieved by means of the
circulation of bed particles (sand, ash, etc.), which serve as the heat carrier and
circulate in the system. In this way, the gasification and combustion processes are
separated from each other [12, 13].
Fig. 122.1 Bio-syngas

production from biomass Bed material Bio-syngas
gasification in interconnected Flue gas
fluidized beds
BiomC Combustor Heat Gasifier BiomG
Air Steam
Bed material and char
122 Simulation of Bio-syngas Production 1147
The whole biomass fed into the interconnected fluidized beds is divided into
two parts, which are BiomC and BiomG, respectively. One part (BiomG) is fed
into the bubbling fluidized bed (gasifier), where the biomass mixes with the steam
and hot bed particles, and the intense exchange of heat and mass occurs. Then the
volatile compounds in the biomass evaporate, followed by the pyrolysis of the
biomass. The reactions between gaseous product after pyrolysis combined with
solid residual and steam occur, where gases such as CO and H2 are generated [12].
The reactions occurring in the gasifier include [14, 15]:
0 0
Water gas: C þ H2 O ! CO þ H2 þ DHfð298KÞ ; DHfð298KÞ
¼ þ130:414 kJ=mol ð122:1Þ
0 0
Water-gas shift: CO þ H2 O ! CO2 þ H2 þ DHfð298KÞ ; DHfð298KÞ
¼ 42:200 kJ=mol ð122:2Þ
0 0
Boudouard: C þ CO2 ! 2CO þ DHfð298KÞ ; DHfð298KÞ ¼ þ 172:615 kJ=mol
ð122:3Þ
0 0
Methanation: C þ 2H2 ! CH4 þ DHfð298KÞ ; DHfð298KÞ ¼ 74:900 kJ=mol
ð122:4Þ
0 0
Steam reforming: CH4 þ H2 O ! CO þ 3H2 þ DHfð298KÞ ; DHfð298KÞ
¼ þ205:310 kJ=mol
ð122:5Þ
The other part (BiomC) is burnt in a circulating fluidized bed (combustor)
where the bed particles carry a great deal of heat. The flue gas carrying hot bed
particles from the combustor passes through a separator, where the hot particles
are separated from the flue gas and pass into the gasifier, providing the heat needed
for the biomass gasification. The unseparated particles are expelled from the
system in the form of flowing ash with the flue gas. The char mixed with the cold
bed particles in the gasifier is back-passed into the combustor to combust.
122.3 Process Simulation
Based on the application of Aspen Plus software, the following assumptions were
made [12, 16]:
(1) The combustor and the gasifier were operated under a steady state, and the
reactions reached the chemical equilibrium.
(2) Pressure losses in the combustor and the gasifier were not considered.
1148 F. Feng et al.
(3) The product gas of biomass gasification included H2, CO, CO2, CH4, H2O, N2,
H2S, NH3, COS, and SO2 and the solid products were ash and unburnt carbon.
Tar was not taken into account.
(4) Ash in biomass and bed particles (sand) were inert and would not participate in
the chemical reactions.
The simulation flowchart of bio-syngas production from biomass gasification in
pressurized interconnected fluidized beds was shown in Fig. 122.2. The whole
model mainly consisted of two basic modules, a gasification module and a com-
bustion module. The gasification module was composed of a pyrolyzer and a
gasifier, and the combustion module included a decomposer and a combustor. The
pyrolyzer block corresponded to Ryield block of Aspen Plus, whose function was
to decompose biomass into simple components. Unreacted char from the gasifier
was separated by a cyclone, and sent to the combustor of the combustion module.
The bed materials from the combustor (sand) were circulating, whereby the heat
was carried from the gasification module to the combustion module. Water was
heated in the steam generator with the flue gas from the combustor to provide the
gasifier with steam as the gasification agent.
The whole model of gasification module and combustion module was based on
the principle of minimization of Gibbs free energy, which originated from the
Rgibbs block of Aspen Plus. The Gibbs free energy is minimal when the chemical
equilibrium for the process is achieved [17]. Based on mass balance, chemical
equilibrium, and energy balance between the gasifier and the combustor, the
mathematical model for the gasification process was set up.
Heat Loss 1
Pyrolyzing Heat Water Condenser Gas Separator
BimassG Product Gas Cyclone Clean Gas Dry Gas Bio-syngas

Gasifier
Pyrogenation Production
Other Gas
Pyrolyzer Water
Superheated Steam Heat Release 1
Water Heater
Feed Water Heat Transfer 2

Bed Materials Bed Material and Coke
Heat Transfer 1
Heat Release 2
Pyrolyzing Heat
BiomassC
Combustor Flue Gas Cold Flue Gas
Pyrogenation Production
Flue Gas Condenser

Decomposer Heat loss 2
Air
Air Compressor
Fig. 122.2 Simulation flowchart of bio-syngas production from biomass gasification in

pressurized interconnected fluidized beds
122.4 Operating Conditions and Primary Parameters
The biomass sample was the pine sawdust from Jiangsu Province, China. The
proximate analysis and the ultimate analysis of biomass were illustrated in
Table 122.1.
The operating conditions and primary parameters in the simulation were shown
in Table 122.2.
122.5.1 Influences on Product Gas Composition
The product gas from biomass gasifier was mainly composed of bio-syngas
(H2 ? CO), CO2 and CH4. Figures 122.3, 122.4, 122.5 showed the influences on
its composition.
The product gas composition was shown as a function of gasifier temperature in
Fig. 122.3. In the case where the gasifier pressure remained 0.4 MPa and the S/
B was 0.6, the bio-syngas content was varied around 60–90 mol % at the gasifier
temperature range of 650–950 C and with the rise of gasifier temperature, it
increased and kept nearly constant at the temperature of about 800 C, whilst the
CO2 and CH4 content decreased correspondingly. The product gas composition in
the biomass gasifier is the result of the combination of a series of complex and
Table 122.1 Proximate and Proximate analysis (wt%) Ultimate analysis (wt%)
ultimate analysis of biomass
Moisture 7.89 C 40.06
Fixed carbon 14.77 H 5.61
Volatile 75.78 O 43.88
Ash 1.56 N 0.90
Low heating value (MJ/kg) 14.47 S 0.10
Table 122.2 Input data for Parameters Value

the process simulation
Room temperature 25 C
Biomass-flow rate of gasifier 3 kg/h
Air inlet temperature 25 C
Air flow rate 7 m3/h
Combustor temperature 750–1,050 C
Gasifier temperature 650–950 C
Feed water inlet temperature 25 C
1150 F. Feng et al.
Fig. 122.3 Effect of 100 pg=0.4 MPa S/B = 0.6
Product gas composition [mol %]

gasification temperature on 90
product gas composition H2 + CO
80
70
60
50
40
30
20
10 CO2
0 CH4
600 700 800 900 1000
Gasification temperature [ oC]
competing reactions, as given in reactions (122.1)–(122.5). Reactions (122.1),

(122.3), and (122.5) occurring in the gasifier are intensive endothermic processes,
while the reactions (122.2) and (122.4) are exothermic ones. As a result, higher
temperatures favor the endothermic reactions and the production of bio-syngas.
The effect of gasification pressure on product gas composition was shown in
Fig. 122.4, which indicated that as the gasification temperature was 750 C and S/
B was 0.6, with the increase of gasification pressure, the bio-syngas content
decreased, while the CO2 and CH4 content increased correspondingly. This was
because the increase of pressure would promote the gasification reactions toward
the direction that led to volume reduction, which favored the reaction (122.4),
while led the reactions (122.3) and (122.5) to the opposite direction.
Fig. 122.4 Effect of 100 Tg = 750 oC S/B = 0.6

gasification pressure on 90
product gas composition

80
70 H 2 + CO
60
50
40
30
20
CO2
10
0
CH4
0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7

Gasification pressure [MPa]
Fig. 122.5 Effect of S/B on 100 Tg = 750 oC pg= 0.4 MPa

product gas composition
90

80
70 H2 + CO
60
50
40
30
CO2
20
10
CH4
0
0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6
S/B
Figure 122.5 indicated the influence of S/B on product gas composition. When
the gasification temperature was 750 C and the gasification pressure remained
0.4 MPa, as the S/B increased, the bio-syngas content was not affected so evi-
dently, while CH4 content decreased and the CO2 content increased. More S/
B meant more steam participated in the reactions, which would promote reactions
(122.1), (122.2), and (122.5) toward the right direction.
122.5.2 Influences on Carbon Conversion of Biomass
One parameter of carbon conversion of biomass can be used to investigate the

effect of different operating parameters in the gasifier on the gasification process.
The carbon conversion of biomass was defined in Eq. (122.6).
gasified carbon in the gasifier (kg)
Carbon conversion of biomass ¼
carbon of biomass fed into the system (kg)
ð122:6Þ
The effect of gasification temperature on carbon conversion at different gasi-
fication pressure was indicated in Fig. 122.6. When S/B was kept 0.6, with the rise
of gasification temperature, the carbon conversion of biomass decreased corre-
spondingly at the same gasification pressure. This was because higher gasification
temperature meant more biomass was fed into the combustor and less biomass into
the gasifier, which resulted in a decrease of carbon conversion.
Figure 122.6 also showed that at the same gasification temperature, with the
increase of gasification pressure, the carbon conversion of biomass increased, too,
which indicated that higher gasification pressure favored the carbon conversion.
1152 F. Feng et al.
Fig. 122.6 Effect of 65 S/B =0.6

gasification temperature on
Carbon conversion of biomass [%]

0.1 MPa
carbon conversion of biomass
0.2 MPa
at different gasification 0.3 MPa
60
pressure 0.4 MPa
0.5 MPa
0.6 MPa
55
50
45
600 700 800 900 1000
S/B also had great influence on the carbon conversion of biomass. As shown in
Fig. 122.7, in the case where gasification temperature was 750 C and the gasi-
fication pressure was 0.4 MPa, with the increase of S/B, the carbon conversion
increased and then decreased, and reached maximum for the S/B of about 0.4.
As the S/B was lower than 0.4, there was not enough steam to react with the
biomass, and reactions (122.1), (122.2), and (122.5) may not reach a state of
completion. With the increase of S/B, more steam took part in the above reactions
and made the carbon conversion increase. However, larger S/B meant excessive
water was fed into the system, which resulted in more carbon that was needed in
the combustor to provide heat to make the water evaporate and overheat. Thus,
less biomass went into the gasifier, which led to a decrease of the carbon
conversion correspondingly.
Fig. 122.7 Effect of S/B on 60

carbon conversion of biomass Tg = 750 oC
Carbon conversion of biomass [%]
pg= 0.4 MPa
55
50
45
40
0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 1.8
S/B
Fig. 122.8 Effect of 45 S/B =0.6
Bio-syngas yield [mol / kg biomass]

gasification temperature on
bio-syngas yield at different
gasification pressure 40
35
0.1 MPa
30 0.2 MPa
0.3 MPa
0.4 MPa
25 0.5 MPa
0.6 MPa
20
600 700 800 900 1000
122.5.3 Influences on Bio-Syngas Yield
Bio-syngas yield is another important parameter to describe the gasification pro-

cess of biomass, which can be defined as
bio-syngas in the gasifier (mol)
Bio-syngas yield ¼
biomass fed into the system ( dry and ash free, kg)
ð122:7Þ
Figure 122.8 showed the influence of gasification temperature on bio-syngas
yield at different gasification pressure. In the case where S/B was 0.6, bio-syngas
yields all increased with the rise of gasification temperature and almost kept a high
value after the temperature reached 750 C and above. The reason was that higher
temperature favored the bio-syngas production, while the gasification pressure had
a weak effect on it at high temperature.
S/B also had great influence on the bio-syngas yield, as shown in Fig. 122.9.
In the case where the gasification temperature maintained 750 C and the gasifi-
cation pressure was 0.4 MPa, bio-syngas yield increased at first, reached the
maximum value when S/B was around 0.6, and then decreased. The reason was
somewhat the same as the explanation of the variant of carbon conversion of
biomass. With the increase of S/B, more steam participated in the biomass gasi-
fication process and promoted the bio-syngas production, while the lager S/B value
meant more water was needed in the system and resulted in the reduction of
biomass fed in the gasifier. As a result, the bio-syngas yield decreased as S/B was
larger than 0.6.
1154 F. Feng et al.
Fig. 122.9 Effect of S/B on 38

Tg = 750 oC
Bio-syngas yield [mol / kg biomass]

bio-syngas yield
37
pg = 0.4 MPa
36
35
34
33
32
31
30
0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 1.8
S/B
122.6 Conclusions
With the Aspen Plus software, simulation of bio-syngas production from biomass
gasification via pressurized interconnected fluidized beds was carried out. Some
valuable results were obtained as follows.
(1) Bio-syngas content in the product gas was influenced by the gasification
temperature, pressure, and S/B. It increased with the gasification temperature
rising, while the gasification pressure and S/B had a weak effect on it.
(2) When S/B remained 0.6, the carbon conversion of biomass decreased with the
increase of gasification temperature at the same gasification pressure, while it
increased with the rise of gasification pressure at the same gasification tem-
perature. In the case where gasification temperature was 750 C and the
gasification pressure 0.4 MPa, with the increase of S/B, the carbon conversion
increased and then decreased, and reached maximum as the S/B was about 0.4.
(3) When S/B was kept 0.6, bio-syngas yield almost increased with the increase of
gasification temperature at different gasification pressure. It kept a high value
as the gasification temperature was higher than 750 C.
(4) To achieve a high content of bio-syngas and high carbon conversion and bio-
syngas yield, the gasification temperature could be higher than 750 C, and the
gasification pressure and S/B could not be too high.
Acknowledgments This work was supported by the National Natural Science Foundation of
China (2010CB732206).
References
1. Fatih M, Mustafa B, Havva B (2009) Potential contribution of biomass to the sustainable

energy development. Energy Convers Manag 50:1746–1760
2. Turn S, Kinoshita C, Zhang Z et al (1998) Experimental investigation of hydrogen production
from biomass gasification. Int J Hydrogen Energy 23:641–648
3. Pengmei L, Zhenhong Y, Chuangzhi W et al (2007) Bio-syngas production from biomass
catalytic gasification. Energy Convers Manag 48:1132–1139
4. Jan K, Tilman JS, Serge MAB (2010) Production of synthetic natural gas (SNG) from coal
and dry biomass-technology review from 1950 to 2009. Fuel 89:1763–1783
5. Zhang XT, Chang J, Wang TJ et al (2006) Investigation into methanol synthesis from
biomass derived syngas over Cu-Zn-Al-Li catalysts. Chi J Pro Eng 6:104–107 (in Chinese)
6. Lu YX, Wang TJ, Li YP et al (2008) Direct synthesis of liquefied petroleum gas from
biomass synthesis gas. J Fuel Chem Tech 36:246–249 (in Chinese)
7. Dennis YCL, Yin XL, Wu CZ (2004) Review on the development and commercialization of
biomass gasification technologies in China. Renew Sust Energy Rev 8:565–580
8. Su DR, Zhou ZQ, Xie JJ et al (2011) Biomass oxygen enriched-steam gasification in an
atmospheric fluidized bed for singes production. Trans Chin Soc Agric Mach 42:100–104 (in
Chinese)
9. Song FE, Tan YS, Xie HJ et al (2009) Study on preparation of dimethyl ether from biomass-
derived syngas. Mod Chem Ind 29:306–308 (in Chinese)
10. Jose0 C, Jose0 M, Gregorio M (2007) Review on dual fluidized-bed biomass gasifiers. Ind Eng
Chem Res 46:6831–6839
11. Christoph P, Reinhard R, Hermann H (2004) In-bed catalytic tar reduction in a dual fluidized
bed biomass steam gasifier. Ind Eng Chem Res 43:1634–1640
12. Yanan Z, Jun X, Laihong S (2009) Simulation of methanol production from biomass
gasification in interconnected fluidized beds. Ind Eng Chem Res 48:5351–5359
13. Bischi A, Langørgenb øy, Saanum I et al (2011) Design study of a 150kWth double loop
circulating fluidized bed reactor system. Int J Greenh Gas Con 5:467–474
14. Ajay K, David D, Milford AH (2009) Thermochemical biomass gasification: a review of the
current status of the technology. Energies 2:556–581
15. Hugo D, Enrique S, Jahirul M et al (2011) Catalytic steam gasification of biomass: catalysts,
thermodynamics and kinetics. Chem Rev 111:5404–5433
16. Gao Y, Xiao J, Shen L (2008) Hydrogen production from biomass gasification in
interconnected fluidized beds. Acta Energiae Solaris Sinica 29:894–899 (in Chinese)
17. Qu YX (2011) Numerical simulation and software for chemical processes. Chem Ind Press,
Beijing (in Chinese)
Chapter 123
Research on Salt-tolerant Gene GPD1
in Zygosaccharomyces rouxii
Lihua Hou, Yanfei Yu, Cong Wang and Chunling Wang
Abstract To better understand the osmo-adaption mechanism, salt-tolerant gene

GPD1 coding for glycerol-3-phosphate dehydrogenase was evaluated in the
wild-type Zygosaccharomyces rouxii (S). Genomic DNA of S was used for PCR
reaction to amplify the GPD1 gene. The PCR products were sent into sequencing
vector pUC19 to achieve the plasmid pUC19-GPD1. The engineered strain
W303-YEp195-S and the control strain W303-YEp195 were constructed,
respectively. It was observed that the overexpression of SGPD1 can obviously
increase the tolerance of salt compared to the control. Identification, and over-
expression of SGPD1 from the S play an important role for the osmo-adaption
mechanism of salt-tolerant yeasts used in soy sauce fermentation.
Keywords Salt tolerance GPD1 Zygosaccharomyces rouxii
123.1 Introduction
Soy sauce, a traditional oriental food condiment with a salty taste and distinct
fragrance, is becoming more and more popular worldwide. Soy sauce fermentation
includes high-salt liquid fermentation mostly used in Japan and low-salt solid
fermentation usually applied in China. During soy sauce fermentation processes
salt-tolerant yeasts, such as Zygosaccharomyces rouxii, Torulopsis versatilis and
Candida versatilis are very important for flavor formation [1]. The concentration
of salt is 18 % in the high salt liquid fermentation of soy sauce, which causes high
osmotic stress [2]. In this environment, the metabolic activity of the yeast is low
L. Hou (&) Y. Yu C. Wang C. Wang

Ministry of Education, Key Laboratory of Food Nutrition and Safety (Tianjin University of
Science and Technology), Tianjin 300457, People’s Republic of China
e-mail: lhhou@tust.edu.cn
1158 L. Hou et al.
due to the high salt content of the soy sauce mash, where yeasts need to have the
ability of adjustment to the poor condition [3].
The gene GPD1 plays an important role in the adaptation to the hyper-osmotic
stress dependent on signal transduction pathways, and especially the transcription
controlled by the yeast High Osmolarity Glycerol (HOG) response pathway that
mediates cellular adaptation to hyperosmotic stress and is responsible for the pro-
duction of glycerol in yeast [4]. The gene GPD1 encodes the glycerol-3-phosphate
dehydrogenase (GPDH) which is related to glycerol synthesis [5]. The transcrip-
tional change in GPD1 seems to revolve around metabolism and is similar to that
caused by other stresses although Gpd1p in glycerol production and active glycerol
uptake is among those upregulated in a Hog1-dependent manner [6]. In case of
hyper-osmotic stress, yeast cells must react to the presence of external osmolytes
that alter the osmotic pressure acting on the cell. Part of the response consists of the
production of the intracellular osmolyte glycerol, a compatible solute, to increase the
internal osmolarity of the cell [7].
In the present work, SGPD1 was cloned and expressed in Saccharomyces
cerevisiae to analyze the cellular impact on salt tolerance and glycerol. Growth
characteristics, osmotic tolerance, and fermentation performance conditions of the
engineered strains were studied in the present work.
123.2.1 Strains and Media
The Z. rouxii (S yeast) and S. cerevisiae strain W303-1A (MATa leu2 ura3 trp1
his3 ade2 can1) were used in this study. The yeast cells were cultivated with
shaking after pre-cultivation for 2–3 days at 30 C in YPD medium (1 % yeast
extract, 2 % peptone and 2 % glucose) and YPDN (6–18 % NaCl dissolved in
normal YPD substrate) or CM-URA medium (0.67 %w/v yeast nitrogen base
without amino acids, 2 % glucose and 0.192 % CM-URA powder). The high
fidelity E.coil Top 10 was used for plasmid propagation, grown with shaking in LB
(0.5 % yeast extract, 1 % peptone, 1 % NaCl pH = 7.2) medium at 37 C. The
X-Gal LBA plate (50 ng/ml ampicillin, 0.5 mmol/l IPTG and 40 ug/ml X-Gal)
was used to screen the colonies. The plasmids were transformed into the strain
W303-1A by the lithium acetate method [8].
123.2.2 Plasmids and Strains Construction
PCR was performed using high-fidelity Pfu DNA polymerase to clone the SGPD1
with the primers GPD1-up(GCGCATGCTACGGTATAAAGGGTGTACA)
and GPD1-dn(GCAAGCTTTTCAATTCCCAGCTTATTCA). PCR products of
123 Research on Salt-tolerant Gene 1159
SGPD1 was digested with SphI and HindIII and then inserted into the sequencing
vector pUC19 to achieve the plasmids pUC19-S. The sequence of plasmids pUC19-S
was confirmed by DNA sequence analysis. Simultaneously, SGPD1 gene was cloned
into the plasmid YEp195, constructing the plasmids YEp195-S (Y-S). Subsequently,
the plasmids YEp195-S (Y-S) and the plasmids YEp195 were transformed into
W303-1A, forming the strains W303-YEp195-S (WYS) and W303-YEp195 (W-Y),
respectively.
123.2.3 The Real-time Quantitative PCR
Real-time quantitative PCR is non-competitive, while in the product formation it

was tested on. S yeast was cultivated in the presence of NaCl (0, 6, 12 and 18 %) at
30 C. The cells (about 3 9 108) were collected by centrifugation, washed, and
recollected. The total RNA was prepared using the tranzol made by TransGen
Biotech following the manufacturer’s instructions. RNA was then treated with
DNaseI according to the protocol. The mRNA samples (2 mg) were denatured with
formaldehyde. Aliquots (1.0 mg) of total RNA were used in the RT reaction (42 C
30 min, 85 C 5 min). QPCR was performed by using the cDNA produced by the
RT kit. Then cDNA samples were used for template in the PCR reaction with the
primers GPD1-R-up (CTGCAGGTGTTGCTGATTTG) and GPD1-R-dn (GCCAT
TTCAGTGGCTACACG). The length of PCR products GPD1-R was 70 bp. 18S
(128 bp) was used as internal reference with primers 18 s-up (CCAAGAA-
CATGATGGCTGCT) and 18 s-dn (CTTGAAGAGCTCCTGGATGG) [9].
123.2.4 Glycerol Estimation
The cells were grown in YPD media and harvested at 0.5 of OD550 to determine
intracellular and extracellular glycerol. The cells were then pre-cultivated in fresh
media and incubated for 1 h at 30 C. Cell extracts were prepared [10] and
glycerol was analyzed enzymatically using a glycerol assay kit (Applygen, China).
123.3.1 Sequence Analyses
The GPD1 genes amplified from genomic DNA from S yeast was cloned into
pUC19 and subsequently sequenced. The results showed the length of open
reading frame (ORF) of SGPD1 was 1167 bp, which encoded a 389 amino-acid
1160 L. Hou et al.
protein, and the sequences of the promoter and the terminator (data now shown).
The GPD1 sequence of S yeast was the same as that of CBS732 (http://www.
genolevures.org/concordance/?search=Zygosaccharomyces+rouxii) using blastn,
which suggests gene GPD1 present in Z. rouxii was conserved and played crucial
roles in osmoregulation. In our lab, other salt-tolerant genes of S and S3-2, such as
HOG1 and FPS1, are studied.
123.3.2 Structure Analyses
After sequencing, the second structure of SGPD1 was constituted to analyze the
quality of coding proteins for further research. The amino acids sequence of
SGPD1 was determined using Anthepro software. It was found structure composed
of all alpha 2.99, all beta 3.34, alpha ? beta 2.89, alpha/beta 1.88, and irregular
2.02. As shown in Fig. 123.1, the prediction of isoelectric point of SGPD1 was
4.925.
Fig. 123.1 The prediction of

isoelectric point of SGPD1
0.9
0.8
Gray value
0.7
0.6
0.5
0.4
0.3
0.2
0.1
0
0 8% 18%
Salt content
Fig. 123.2 Expression level of GPD1 under different salts
123.3.3 Expression Level of GPD1
The strain S was cultured in the media with salt content of 8, 18 %, and without salt,
followed by extraction of RNA. The salt content of 8, 18 %, and without salt was
carried out because 8 % NaCl was mostly used in the low-salt solid soy sauce
fermentation and 18 % NaCl was usually added during the high-salt liquid soy sauce
fermentation. Gray value was IOD of end products/IOD of internal reference. The
transcription levels of SGPD1 was estimated using QPCR analysis with 18s rDNA
as endogenous reference. As shown in Fig. 123.2, the transcription level of SGPD1
in the media was reduced with increase in the salt content.
123.3.4 Salt-tolerant Analyses
The plasmids YEplac195 and Y-S constructed in this study were transformed to
strain S. cerevisiae (W303-A), forming the engineered strains W-Y and WYS,
respectively. The resulting stains were cultivated in YPD with 8 and 18 % salt.
Figure 123.3 gives the growth of the strains. The results indicate that the
salt-tolerance of WYS was distinctly improved compared to the control W-Y. The
salt-tolerant analysis revealed that GPD1 of S had a significant effect on resistance
to high osmolarity in S. cerevisiae.
In addition, the glycerol contents in WYS along with the control W-Y grown in
YPD media with different salt were measured. WYS and W-Y were cultivated with
shaking in YPD media with 0, 8, and 18 % NaCl at 30 C for 2 or 3 days,
respectively. As shown in Fig. 123.4, for the same strain the glycerol content also
enhanced with the increase in the salt concentration, which indicated that the
glycerol could respond to the changes in external osmotic pressure. For the same
salinity, the glycerol content was of the order of WYS and W-Y. Meanwhile, the
glycerol content of WYS was higher than the control W-Y. Glycerol synthesis
plays significant physiological roles in metabolism of the yeast including
1162 L. Hou et al.
(a) 3.0 W-Y

(b) 2.5 W-Y
2.5
WYS 2.0 WYS
OD600
OD600
2.0
1.5
1.5
1.0 1.0
0.5 0.5
0.0 0.0
0 10 20 30 40 50 60 70 80 90 0 20 40 60 80 100 120
Time (h) Time (h)
Fig. 123.3 Salt-tolerant analyses of the engineered strains WYS and WY in the presence of 8 %
(a) and 18 % NaCl (b)
Glycerol content (mg/mL)
30 W-Y
25 WYS
20
15
10
5
0
0 8% 18%
Salt content
Fig. 123.4 Glycerol concentration of the engineered strains WY and WYS in the presence of 0,
8, and 18 % NaCl, respectively
osmoregulation and maintaining intracellular redox balance under an aerobic

condition. In the present work, the results demonstrated that the increase of
glycerol was one reason for the salt-tolerant improvement of S yeast.
123.4 Conclusion
In conclusion, overexpression of SGPD1 caused the stronger salt-tolerance com-

pared to the control WY. Identification and overexpression of SGPD1 from the S
play an important role for the osmo-adaption mechanism of the salt-tolerant yeasts
used in soy sauce fermentation. The utilization of overproducing glycerol is a
potentially valuable strategy for producing soy sauce to improve the performance
of salt tolerance and the flavor.
Acknowledgments This work was supported by these projects in China (2013AA102106,

2012BAD33B04, 31371819, 2012GB2A100016, 2012AA022108, 31171731, 10ZCZDSY07000,
2012AA021303 and IRT1166).
References
1. Cao XH, Hou LH, Lu MF et al (2010) Genome shuffling accelerated and enhanced flavor
formation of soy sauce by improving salt-tolerance of Candida versatilis. Int J Food Sci Tech
45:17–22
2. Yokotsuka T (1986) Soy sauce biochemistry. Adv Food Res 30:195–329
3. Luh BS (1995) Industrial production of soy sauce. J Ind Microbiol 14:467–471
4. Hohmann S (2002) Osmotic stress signaling and osmoadaptation in yeasts. Mol Biol Rev
66:300–372
5. Albertyn J, Hohmann S, Thevelein JM et al (1994) GPD1, which encodes glycerol 3-
phosphate dehydrogenase, is essential for growth under osmotic stress in Saccharomyces
cerevisiae and the high-osmolarity glycerol response pathway regulates its expression. Mol
Cel Biol 13:4135–4144
6. O’Rourke SM, Herskowitz I (1998) The Hog1 MAPK prevents cross talk between the HOG
and pheromone response MAPK pathways in Saccharomyces cerevisiae. Genes Dev
12:2874–2886
7. Hohmann S, Krantz M, Nordlander B (2007) Yeast osmoregulation. Methods Enzymol
428:269–286
8. Schiestl RH, Gietz RD (1989) High efficiency transformation of intact yeast cells using single
stranded nucleic acids as carrier. Curr Genet 16:339–346
9. Causton HC, Ren B, Koh SS et al (2001) Remodeling of yeast genome expression in response
to environmental changes. Mol Biol Cell 12:323–337
10. Andre L, Nilsson A, Adler L (1988) The role of glycerol in osmotolerance of the yeast
Debaryomyces hansenii. J Gen Microbiol 144:669–677
Chapter 124
Mutagenic Research on Ciliary
Neurotrophic Factor (CNTF)
in Escherichia coli After Heavy
Ions Irradiation
Xiaodong Jin, Qingfeng Wu, Xinguo Liu, Yan Liu, Yong Chen, Jian
Lu and Lin Jiang
Abstract Based on the natural human CNTF gene, Ying et al. acquired CNTF-T
mutant and constructed Escherichia coli expressing CNTF. In order to increase the
yield and enhance the protein expression in the constructed E. coli, the strains were
irradiated with high-LET heavy ions. Some mutants were obtained in this work
and the mechanisms underlying the enhanced expression of CNTF in E. coli after
exposure to heavy ions are discussed in this paper.
Keywords High-LET irradiation CNTF Mutant Molecular characterization
124.1 Introduction
Unlike conventional radiations such as X- and c-rays, high-LET (linear energy

transfer) charged particles lose most of their kinetic energy at the Bragg peak,
which is produced near the end of the range [1]. Thus, heavy ion irradiation has
been taken as a more effective mutagen compared with low-LET radiations and
has been used in mutation breeding widely. To date, the mutation-induction effects
of heavy ion beams have been investigated in various organisms [2–5].
Ciliary neurotrophic factor (CNTF) is a 22–26 kD acid protein, which was
originally purified from chick eye and characterized as a survivability factor for
neurons from chick embryonic ciliary ganglia in vitro [6]. Recent research shows
that CNTF, contacting with receptor located in thalamencephalon, decreases fat
and loses weight in mice. In diet-induced obesity (DIO) mice model, CNTF has the
same function. Noticeably, this model represents the real instance of human
X. Jin (&) Q. Wu X. Liu Y. Liu

Institute of Modern Physics, Chinese Academy of Sciences, Lanzhou, China
e-mail: jinxd@impcas.ac.cn
Y. Chen J. Lu L. Jiang
Lanzhou Institute of Biological Products, Lanzhou, China
1166 X. Jin et al.
obesity. Compared to banting, CNTF has no weight rebound after stopping

administration. Therefore, it is promisingly developed to a new-type and a high-
efficient anti-obesity product and has a prevalent clinic development future [7, 8].
Based on the natural human CNTF gene, Ying et al. in the Lanzhou Institute of
Biological Products acquired CNTF-T mutant and constructed Escherichia coli
expressing CNTF [9].
In this study, the constructed E. coli, which expresses recombinant CNTF, as
original strain was used and irradiated with high-LET heavy ions. Mutants with
increased yield and enhanced protein expression of CNTF are expected to be
obtained.
124.2 Materials and Method
124.2.1 Plasmid and Strain
Recombinant plasmid including CNTF gene and transpeptidase E. coli were

constructed by the Fourth research department, Lanzhou Institute of Biological
Products.
124.2.2 Irradiation
Heavy ion irradiation (neon ions) was performed in the therapy terminal at the
Heavy Ion Research Facility in Lanzhou (HIRFL). The dose averaged LET of the
neon ion beam on samples was calculated to be 96.6 keV/lm, and the dose rate was
adjusted to be about 2 Gy/min. Doses from 0 to 30 Gy were applied in this work.
124.2.3 Survival Curve
Four hours before irradiation, the strains were spread on the LB plate incubated at
37 C. After irradiation, the samples were cultured in an incubator at 37 C until
obvious colonies appeared. Single colonies were counted as survivors.
124.2.4 Growth Cycle and Viability Assay
The single colonies were isolated and cultured continuously in a rotary shaker. OD
values were detected every 60 min until 16 h. At the same time, the strains were
cultured on the LB plate overnight, and single colonies were counted.
124 Mutagenic Research on Ciliary Neurotrophic Factor (CNTF) 1167
124.2.5 Mutation of CNTF Protein Expression
To detect the change in CNTF protein expression after irradiation, we adopted the
SDS-PAGE analysis. In brief, the strains were cultured until plateau. IPTG was
added and then the strains were cultured for 4 h. The samples were lyzed by
ultrasonic. Thirty micrograms of total protein was separated by SDS-PAGE, and
then stained by coomassie brilliant blue R-250 and decolored.
124.2.6 Molecular Characterization of CNTF Induced

by Ion Beam Irradiation
The plasmids of the mutants, whose CNTF protein expression was higher or lower
compared with control, were isolated and their genomic DNA was extracted. The
CNTF gene and its upstream region were amplified with the primers
TCTTACTGTCCACTGAGACAGC-. Sequencing was performed by Sangon
Biotech (Shanghai) Co. The mutations were detected using Bioedit software.
After the neon ion irradiation, colonies were isolated on plates. As shown in
Fig. 124.1, the survival curve exhibits that the survival fraction declined with
increasing dose and the 50 % lethal dose was close to 10 Gy. After irradiation, 119
strains having viability irradiated at 10 or 30 Gy were screened. We observed the
OD values (strain concentration) at different time points in growth cycle. Com-
pared with control, the concentration of No. 59 was obviously increased by 20 %
after 11 h as shown in Fig. 124.2. In viability experiment, we found that the No.
48 strain was more active than control, that the number of colonies was 181 which
was much higher than control (143) by a factor of 1.26 (Fig. 124.3).
In order to obtain the mutants of CNTF protein expression, we analyzed the
change in CNTF protein expression in strains after irradiation. As shown in
Fig. 124.4, we found after heavy ions irradiation, compared with control, CNTF
contents in No. 7, 49, and 103 were increased obviously, and the contents were
lower in No. 60 and 70 than control.
Sequencing analysis of the CNTF fragments amplified from mutant lines shows
that single nucleotide deletions were a principal mutation in each case, and the
base substitutions and insertions had also occurred. The distribution of the deleted
positions appeared to be dispersed around the promoter. These deleted positions
also showed no homology to pET42a, and similar sequences in the host genome
were therefore searched using the BLAST algorithm. As a result of this analysis,
we found that the most deletion occurred in No. 60 strain, there was G deletion in
1168 X. Jin et al.
Fig. 124.1 Survivial fraction

of E. coli after neon 1.0
irradiation
0.8
survivial fraction
0.6
0.4
0.2
0.0
0 5 10 15 20 25 30
Dose (Gy)
Fig. 124.2 The change of 2.2

strains concentration in 2.0 CK
growth cycle irradiated with 1.8 No.59
neon ions 1.6
1.4
1.2
OD
1.0
0.8
0.6
0.4
0.2
0.0
-0.2
-2 0 2 4 6 8 10 12 14 16 18
Time (hour)
Fig. 124.3 The results of

viability experiment, 0 and 4, 1.2
represent control and No. 48
strains, respectively
colony number (unitary)
1.0
0.8
0.6
0.4
0.2
0.0
0 1 2 3 4 5 6 7 8 9 10
the serial number of strain
124 Mutagenic Research on Ciliary Neurotrophic Factor (CNTF) 1169
CNTF No.7 49 60 control 70 103 control
Fig. 124.4 CNTF protein expression in E. coli after heavy ions irradiation
the 1685 position, A in 1707, A in 1719, G in 1727, C in 1832, A in 1838, G in

1855, G in 1858, respectively. Moreover, 1727 and 1855 were the hottest mutant
positions and G was the highest frequency to lose compared with other positions
and bases in our experiments.
In this study, mutants with higher yield and enhanced protein expression
compared with the original strain using heavy ion irradiation were obtained. In
future studies, quantitative analysis will provide essential information to evaluate
the efficiency of ion-beam mutagenesis.
Acknowledgments The authors are grateful to the operating crew of the HIRFL accelerator for
supplying the neon ion beam for this experiment. This work is jointly supported by the National
Basic Research Program of China (973 Program, No. 2010CB834203), the Western Talents
Program of the Chinese Academy of Sciences (O962030XBO), and the National Natural Science
Foundation of China (No. 10905080 & No. 11075191).
References
1. Hamada N, Imaok T, Masunaga S et al (2010) Recent advances in the biology of heavy-ion

cancer therapy. J Radiat Res 51:365–383
2. Matuo Y, Nishijima S, Hase Y et al (2006) Specificity of mutations induced by carbon ions in
budding yeast Saccharomyces cerevisiae. Mutat Res 602:7–13
3. Kiefer J, Stoll U, Schneider E (1994) Mutation induction by heavy ions. Adv Space Res
14:257–265
4. Horneck G, Krasavin EA, Kozubek S (1994) Mutagenic effects of heavy ions in bacteria. Adv
Space Res 14:315–329
5. Hamada N, Hara T, Funayama T et al (2008) Energetic heavy ions accelerate differentiation in
the descendants of irradiated normal human diploid fibroblasts. Mutat Res 637:190–196
6. Kruttgen A, Grotzinger J, Kurapkat G et al (1995) Human ciliary neurotrophic factor: a
structure-function analysis. Biochem J 309:215–220
7. Gloaguen I, Coste P, Demartis A et al (1997) Ciliary neurotrophic factor corrects obesity and
diabetes associated with leptin deficiency and resistance. Proc Natl Acad Sci USA
94:6456–6461
1170 X. Jin et al.
8. Lambert P, Anderson K, Sleeman M et al (2001) Ciliary neurotrophic factor activates leptin-

like pathways and reduces body weight gain, even in leptin-resistance obesity. Proc Natl Acad
Sci USA 98:4652–4657
9. Ying LF, Lei Q, Liang LY et al (2007) Expression and biologic activity analysis of
recombinant human ciliary neurotrophic factor (CNTF) mutant. Biotechology 17:16–18
Chapter 125
Molecular Characterization
and Expression of Ribosomal
Protein L15 Gene (RPL15) From Arachis
hypogaea
Qi Wu, Xiuzhen Wang, Hongtao Yu, Yufei Ding, Fenggao Cui,

Jiancheng Zhang, Yueyi Tang and Chuantang Wang
Abstract RPL15 is a component of the large ribosomal subunit 60S. The

sequences of cDNA and DNA of RPL15 were cloned successfully from Arachis
hypogaea cultivar Ri Hua 1. These two sequences were analyzed preliminarily.
The full length RPL15 cDNA of A. hypogaea contains a 615-bp open reading
frame (ORF) which encodes 204 amino acids. The length of RPL15 gene was
1383 bp with three exons and two introns. Primary structure analysis revealed that
the molecular weight of the putative RPL15 protein is 24211.09 Da with a
theoretical pI of 11.44. The deduced amino acid sequence of RPL15 (A. hypogaea
cultivar Ri Hua 1) shared homology with other reported species. The expression of
RPL15 transcript showed that RPL15 mRNA was expressed mainly in root. The
cDNA of RPL15 was cloned successfully from A. hypogaea in this study. It
provides scientific material for enriching and improving the RPL15 gene database.
Keywords Peanut Arachis hypogaea Ribosomal protein RPL15 qRT-PCR
125.1 Introduction
The ribosome of eukaryote is universal and complicated, since it is involved in the

process of protein biosynthesis. Ribosomal proteins are the components of ribo-
some, which shows various functions in DNA repair, apoptosis, drug resistance,
and proliferation [1]. Majority studies gradually reveal the physiological functions
of ribosomal proteins playing an important role in human disease and development
[2].
Q. Wu X. Wang H. Yu Y. Ding F. Cui J. Zhang Y. Tang C. Wang (&)

Shandong Peanut Research Institute (SPRI), Qingdao 266100, People’s Republic of China
e-mail: chinapeanut@126.com
1172 Q. Wu et al.
The basic step to understand the structure and cellular function of ribosome is to
characterize the primary structure of the r-proteins according to the nucleotide
sequences of the genes and cDNAs. The mechanism of expression and assembly of
ribosome components has been studied in prokaryotes. Many studies have been
done on the r-proteins in animals and yeast. Most r-protein genes are coordin-
atively transcribed. It is demonstrated that the molecular strategies employed to
maintain the coordinate synthesis of r-proteins rely on the change of cellular
requirements in different tissues at different developmental stages [3].
RPL15 is a component of the large ribosomal subunit 60S which is encoded by
RPL15 gene belonging to the ribosomal proteins L15e family. This gene has
homology with the yeast ribosomal protein RPL15 gene. It is indicated that the
expression of RPL15 is markedly up-regulated in gastric cancer tissues [1] and
over expressed in some esophageal tumors compared to normal matched tissues
[4]. It might play a possible role in carcinogenesis of esophagus. RPL15 gene has
been reported in many plants and animals [3, 5, 6]. The expression level of RPL15
gene is correlative with the rate of growth in petunia. Active transcription of
RPL15 is often detected in young organs [3]. However, RPL15 from Arachis
hypogaea has not been reported yet.
In this study, we designed primers according to the available information of
homology sequences from other species to get the cDNA and genomic sequence of
RPL15 of peanut to test the relationship among these species.
125.2.1 Experimental Materials
The cultivated A. hypogaea L. variety Ri Hua 1 was employed in this study. All
seeds were pregerminated and sown then in growth chamber that was maintained
at 28 C, 12 h photoperiod (16,000 lx). For the case of specific tissue expression
patterns, we took three samples at the second month after seeding. The root, stem,
and leaf organs of each specimen were dissected out and snapped frozen in liquid
nitrogen for the experiment.
125.2.2 Full Length cDNA Cloning
Total RNA was extracted from leaf using Trizol Reagent according to the
manufacture’s protocol (Invitrogen, USA). cDNA was synthesized from total RNA
with M-MLV reverse transcriptase (Promega USA) and Oligo(dT) primer. A pair
of specific primers RPL15-F1 and RPL15-R1 was designed based on the homol-
ogous sequence of Glycine max (Glyma05g04870.1) to clone the RPL15 gene EST
125 Molecular Characterization and Expression 1173
sequence of A. hypogaea (Table 125.1). Simple PCR reactions were performed in

a Thermal Cycler in a 25-lL reaction volume containing 12.5 lL of 2 9 PCR
buffer (Tiangen, China), 1.0 lL of each primer (10 lmol/L) and 1 lL of template
mix (about 50 ng/lL). Lastly PCR-grade water was added to complement the
volume into 25 lL. The PCR temperature profile was 94 C for 5 min, followed
by 30 cycles of 94 C for 40 s, 57 C for 40 s, 72 C for 2 min, and the final
extension step at 72 C for 10 min. PCR products were analyzed on 1.2 % agarose
gel and the target band was purified and cloned into the pMD18-T vector (Takara,
Japan). After being transformed into the competent cells of Escherichia coli
Top10, the positive recombinants were identified through anti-Amp selection and
PCR screening with M13-47 and RV-M primers (Table 125.1). The positive
clones were sequenced on an ABI3730 Automated Sequencer (Applied Biosys-
tems, USA).
Based on the partial sequence data of RPL15, 30 and 50 ends of cDNA were
determined by SMART-RACE approaches (Clontech, USA). The 30 -end was cloned
by primer RPL15-F2 and UPM primer in the first round PCR, and RPL15-F3 and
NUP primers in the second round PCR. For 50 end RACE PCR, the first strand cDNA
was tailed at the 50 -end by terminal transferase TdT and dCTP. Primers RPL15-R2
and UPM were in the first round PCR and RPL15-R3 and NUP primers were in the
second round PCR (Table 125.1). All the PCR products were cloned and sequenced
following the procedures described above.
Table 125.1 Sequences of primers used in this study

Primers Sequence (50 -30 ) Application
RPL15-F1 TTTATGGCAAGCCCACGAACC Expressed sequence tag
RPL15-R1 GTAAACCCCTGTTAGACTTCC Expressed sequence tag
M13-47 CGCCAGGGTTTTCCCAGTCACGAC Vector universal primers
R-VM GAGCGGATAACAATTTCACACAGG Vector universal primers
RPL15-F2 TATGTGGTCTACCGTGTTCGTGTG 30 RACE first round PCR
RPL15-F3 GCCCACGAACCAGGGTGTTACTCA 30 RACE second round PCR
RPL15-R2 GACGAGCCTTGTCGGGGCGGGTTG 50 RACE first round PCR
RPL15-R3 TCTCATTACATCCGATTGCTTCTT 50 RACE second round PCR
UPM Long: ctaatacgactcactatagggcAAGCAGTGGT 30 , 50 RACE
ATCAACGCAGAGT Universal Primer
Short: ctaatacgactcactatagggc
NUP AAGCAGTGGTATCAACGCAGAGT 30 , 50 RACE
Nested Universal Primer
RPL15-F ATGGGTGCTTACAAGTATGTTTCGG Complete cDNA amplify
RPL15-R TCAACGGTAACGGCGGAGGGAAAGG Complete cDNA amplify
qRPL15-f TATGTGGTCTACCGTGTTCGTGTG RPL15 qRT-PCR
qRPL15-r TAACACCCTGGTTCGTGGGCTTGC RPL15 qRT-PCR
Actin-f TTGGAATGGGTCAGAAGGATGC Actin qRT-PCR
Actin-r AGTGGTGCCTCAGTAAGAAGC Actin qRT-PCR
1174 Q. Wu et al.
125.2.3 Cloning the Genomic Sequence of RPL15
The genomic DNA was isolated from leaf using Genomic DNA Purification Kit
(Tiangen, China) and dissolved in TE buffer (10 mmol/L Tris/1 mmol/L EDTA,
pH8.0) stored at -20 C. According to the full length cDNA of RPL15 gene from
A. hypogaea and G. max (Glyma05g04870.1), RPL15-F and RPL15-R were
designed to amplify the whole sequence of A. hypogaea RPL15 gene
(Table 125.1). Purified PCR products were cloned into the pMD18-T vector
(Takara, Japan) and sequenced in both directions as above.
125.2.4 Sequence Analysis, Multiple Sequences Alignment

and Phylogenetic Analysis
The homology searches of nucleotide and protein sequences were conducted with
BLAST algorithm at the National Center for Biotechnology Information
(http://www.ncbi.nlm.gov/blast). The nucleotide and deduced amino acid
sequences were analyzed using software BioEdit 7.0.9.0 [7]. A multiple sequences
alignment was performed with ClustalX 1.83 program [8] and a phylogenetic
Neighbor-Joining (NJ) tree was constructed. To derive the confidence value for the
phylogeny analysis, bootstrap trials were replicated 1,000 times [9]. The calculated
molecular mass and the theoretical isoelectric point were predicated by Protein
Mol Wt & AA Composition Calculator (http://www.proteomics.com.cn/proteo
mics/pi_tool.asp). The motif sequences were searched using the software of
SMART (http://smart.embl-heidelberg.de/).
125.2.5 RPL15 mRNA Distribution in Different Tissues
The expression of RPL15 mRNA transcript in root, stem, and leaf were determined
by quantitative real-time RT-PCR. Total RNA was extracted according to the
protocol of Trizol (Invitrogen, USA). The quantity of total RNA was detected by
1.2 % agarose gel. MMLV reverse transcriptase (Promega, USA) was used to
synthesize single-strand cDNA with oligo(dT) primer (Table 125.1). The mixture
was incubated at 42 C for 1 h, terminated the reaction by heating at 85 C for
5 min, and subsequently stored at -80 C. The cDNA was diluted 10 times by
DEPC-treated water for the next step.
The quantitative real-time RT-PCR assay was carried out in a Roche Light-
Cycler 2.0. The PCR was performed in a total volume of 20 lL, containing 10 lL
of 2 9 SYBR Green Master Mix (Takara, Japan), 2 lL of the diluted cDNA mix,
0.5 lL of each primers (10 lmol l-1), and 7 lL of DEPC-water. A 93-bp product
was amplified with qRPL15-f and qRPL15-r from cDNA template and then
sequenced to verify the PCR specificity. A pair of b-actin primers, actin-f/actin-r,

were used to amplify a 195-bp fragment as an internal control to verify the suc-
cessful reverse transcription and to calibrate the cDNA template.
The SYBR Green RT-PCR assay was carried out at 95 C for 30 s, followed by
45 cycles of 95 C for 5 s, 60 C for 20 s and 72 C for 15 s. In a 32-well plate,
each sample was run in triplicate along with the internal control gene. Melting
curve analysis of amplification products was done at the end of PCR reaction to
confirm that PCR product was the only amplified product. To maintain consis-
tency, the baseline was set automatically by the software. The comparative Ct
method [10] was used to analyze the relative expression level of RPL15. The Ct for
the target amplified RPL15 and the internal control b-actin were determined for
each sample. All data were given in terms of relative mRNA expression as
mean ± S.D. The results were subjected to analysis of t test, and the P values less
than 0.05 were considered statistically significant.
125.3 Results
125.3.1 Molecular Characterization of RPL15 cDNA
The full length cDNA of RPL15 from A. hypogaea (GenBank number JX424591)
contains a-615 bp open reading frame (ORF) which encodes 204 amino acids with
ATG as initiation codon and TGA as stop codon, which contains 25.37 % A,
23.58 % C, 27.8 % G, and 23.25 % T. The nucleotide sequence and the deduced
amino acid sequence are shown in Fig. 125.1. The calculated molecular mass of
the deduced mature RPL15 was 24211.09 Da and the protein had a theoretical
isoelectric point of 11.44. The analysis with SMART revealed that the RPL15 gene
encodes a novel protein containing a typical ribosomal protein L15e domain
(M1 to S170). RPL15 of A. hypogaea 3D model was constructed by the SWISS-
MODEL Protein Modelling Server (http://swissmodel.expasy.org/) (Fig. 125.2).
The ratios of structure alpha helix and random coil were 32.84 and 40.20 %,
respectively (Fig. 125.2).
125.3.2 Genomic Sequences of RPL15
The full length of RPL15 gene was 1383 bp (GenBank accession no. JX424603),
which made up of three exons and two introns. The introns were located within the
whole open reading frame. The first intron is 684 bp starting from 172 bp to
855 bp while the second intron is 84 bp from 1054 bp to1137 bp. And all exon–
intron junctions follow the consensus rule of the splice acceptor- AG/GT -splice
donor for splicing.
1176 Q. Wu et al.
Fig. 125.1 Nucleotide and deduced amino acid sequence of RPL15 from A. hypogaea
125.3.3 Multiple Sequences Alignment and Phylogenetic

Analysis
To further characterize the RPL15 gene, the cDNA sequences of RPL15 from other
species were downloaded from GenBank (Table 125.2). Sequences were aligned
using the ClustalW program (Fig. 125.3). The deduced amino acid sequence of
RPL15 (A. hypogaea Ri Hua 1) shared homology with other reported species, such
Fig. 125.2 a The secondary structure prediction of RPL15 from A. hypogaea. b Predicted 3D
structure of RPL15 protein of A. hypogaea. H alpha helix; e extended strand; t beta turn;
c random coil
as 90.6 % similarity with G. max (13g19930.1), 91.6 % with V. vinifera

(XP_002264206.1), 91.1 % with A. thaliana (NP_193405.1), 93.1 % with P.
trichocarpa (XP_002304285.1), and 81.3 % with C. reinhardtii (Table 125.3).
The NJ phylogenic tree constructed based on RPL15 amino acid sequences was
shown in Fig. 125.4. The phylogenetic tree is made up of two main clades. One
clade was composed of all sequences from plant and C. reinhardtii while the other
clade contained Vertebrata and Nemathelminthes, respectively. It is shown that
RPL15 is conserved within either plant or animal which may indicate the function
conservation adapting to evolution.
125.3.4 The Expression of RPL15 Transcript in Different

Tissues
Quantitative real-time RT-PCR was employed to investigate the distribution of

RPL15 expression level in root, stem, and leaf with b-actin as internal control.
There was only one peak at the corresponding temperature in melting curve for
RPL15, b-actin gene indicating that the amplification was specific. The result was
1178 Q. Wu et al.
Table 125.2 A listing of the species in this study

Species Lineage Accession number
A. hypogaea Ri Hua1 Dicotyledon JX424591
Arabidopsis thaliana Dicotyledon NP_193405.1
Vitis vinifera Dicotyledon XP_002264206.1
Populus trichocarpa Dicotyledon XP_002304285.1
Glycine Max Dicotyledon Glyma05g04870.1
Oryza sativa Japonica Group Monocotyledon NP_001050612.1
Caenorhabditis elegans Nemathelminthes Invertebrate NP_499964.1
Chlamydomonas reinhardtii Chlorophyta XP_001701780.1
Danio rerio Osteichthyes Vertebrata NP_001003447.1
Mus musculus Rodentia Mammalia Vertebrata XP_001481087.1
Homo sapiens Hominoid Mammalia Vertebrata NP_002939.2
Fig. 125.3 The alignments of deduced amino acid sequences of RPL15 with those from other
species. Identical amino acids are marked by gray and dashes mark gaps optimizing sequence
alignment. Variant sites are marked by black
showed in Fig. 125.5. RPL15 mRNA was the most expressed in root and a little bit
fewer in leaf and stem. However, no significant differences were found between
tissues (P [ 0.05) (Fig. 125.5).
Table 125.3 The similarity of RPL15 protein sequences between species
Species A. G. A. P. V. O. C. C. D. M. H.
Hypogaea Max Thaliana Trichocarpa Vinifera Sativa Elegans Reinhardtii Rerio Musculus Sapiens
A. hypogaea – 0.95 0.911 0.931 0.916 0.906 0.619 0.813 0.721 0.712 0.712
G. max 0.95 – 0.906 0.926 0.901 0.897 0.604 0.799 0.721 0.712 0.712
A. thaliana 0.911 0.906 – 0.892 0.906 0.872 0.619 0.789 0.702 0.697 0.697
P. trichocarpa 0.931 0.926 0.892 – 0.936 0.901 0.624 0.808 0.731 0.721 0.721
V. vinifera 0.916 0.901 0.906 0.936 – 0.901 0.634 0.789 0.731 0.721 0.721
125 Molecular Characterization and Expression
O. sativa 0.906 0.897 0.872 0.901 0.901 – 0.619 0.799 0.712 0.712 0.712
C. elegans 0.619 0.604 0.619 0.624 0.634 0.619 – 0.604 0.75 0.759 0.764
C. reinhardtii 0.813 0.799 0.789 0.808 0.789 0.799 0.604 – 0.687 0.687 0.687
D. rerio 0.721 0.721 0.702 0.731 0.731 0.712 0.75 0.687 – 0.95 0.955
M. musculus 0.712 0.712 0.697 0.721 0.721 0.712 0.759 0.687 0.95 – 0.995
H. sapiens 0.712 0.712 0.697 0.721 0.721 0.712 0.764 0.687 0.955 0.995 –
1179
1180 Q. Wu et al.
75 Arachis hypogaea
50 Glycine max
53 Arabidopsis thaliana
Populus trichocarpa
98
50 Vitis vinifera
100
Oryza sativa Japonica Group
Chlamydomonas reinhardtii
Caenorhabditis elegans
Danio rerio
98 Mus musculus
98 Homo sapiens
Fig. 125.4 The NJ phylogenic tree of RPL5 protein sequences from eleven species. The protein
sequences used for phylogenetic analysis are as follows: A. hypogaea Ri Hua 1 (JX424591),
Arabidopsis thaliana (NP_193405.1), Vitis vinifera (XP_002264206.1), Populus trichocarpa
(XP_002304285.1), Glycine Max (Glyma05g04870.1), Oryza sativa Japonica Group (NP_0010
50612.1), Caenorhabditis elegans (NP_499964.1), Chlamydomonas reinhardtii (XP_00170
1780.1), Danio rerio (NP_001003447.1), Mus musculus (XP_001481087.1), Homo sapiens
(NP_002939.2)
The relative expression
1.2
1
level of RPL15
0.8
0.6
0.4
0.2
0
root stem leaf
The analyzed tissues
Fig. 125.5 Tissues distribution of the RPL15 transcripts measured by SYBR Green qRT-PCR.
The tissues, including root, stem, and leaf, were collected from three individual A. hypogaea
cultivar Ri Hua 1. Vertical bars represent the mean ± S.D
125.4 Discussions
Here, we reported the characterization of cDNA and genomic sequences of RPL15

gene of A. hypogaea. A comparison of the deduced amino acid sequences from
eleven species including plants and animals indicated that RPL15 is highly
conserved and remain essentially the same. There is not any deletion or insertion
of amino acid residue in alignment sequences. RPL15 is a highly basic ribosomal
protein containing a composition of 33 Arg, 19 Lys, 18 Val, 16 Gly and 5 His
residues and only 5 Asp and 7 Glu residues, in which the highest content of Arg
residues (16.10 %), is far higher than other amino acids and Cys content of the
lowest, only 0.98 %. RPL15 is conserved either in plants or animals. According to

the phylogenetic tree, we can see that the division of RPL15 may be earlier than
the formation of plant and animal. It has been forming the specific function for
plant and animal to adapt different environment. Protein synthesis in all organisms
requires r-proteins and rRNA components into the ribosome complex. In this
study, the results of the real-time RT-PCR showed that RPL15 mRNA was the
most expressed in root and a little bit fewer in leaf and stem.
125.5 Conclusions
The characterization of DNA and cDNA clones encoding ribosomal proteins

would be beneficial in the study of ribosomal biogenesis and allow the elucidation
of structure and regulation of genes encoding ribosomal proteins in eukaryote.
These data will enrich and supplement the information about RPL15. This paper
provides theoretical references for the construction of molecular phylogenetic tree.
In addition, it will contribute to the discussion of the genetic polymorphism.
Acknowledgments The authors wish to express their sincere thanks to all the laboratory
members for continuous technical advice and helpful discussion. This research was supported
from Qingdao Science and Technology Support Program (12-1-4-11-(1)-jch, 11-2-4-9-(3)-jch),
and China Agricultural Research System (CARS-14).
References
1. Wang H, Zhao LN, Li KZ et al (2006) Overexpression of ribosomal protein L15 is associated

with cell proliferation in gastric cancer. BMC Cancer 6:91–98
2. Yang F, Liu WP (2005) Study on the relation of ribosomal protein gene and human diseases.
Chin J Clin Exp Pathol 3:354–356
3. Lee HS, Mun JH, Kim SG (1999) Characterization of cDNA encoding cytoplasmic ribosomal
protein L15 and L27a in petunia (Petunia hybrida): Primary structures and coordinate
expression. Gene 2:155–163
4. Wang Q, Yang C, Zhou J et al (2001) Cloning and characterization of full-length human
ribosomal protein L15 cDNA which was overexpressed in esophageal cancer. Gene
263:205–209
5. Tom M, Waterman MR, Bocking D et al (1999) Cloning and characterization of the L15
ribosomal protein gene homologue from the crayfish Orconectes limosus. Biochem Biophy
Res Comm 2:313–316
6. Xiang Z, Zhang JN, Song P et al (2006) The study of ribosomal protein L15 cDNA sequences
as a molecular marker in the teleostei phylogenetic analysis. Hereditas (BEIJING)
28:171–178
7. Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis
program for Windows 95/98/NT. Nucleic Acids Symp Ser 41:95–98
8. Thompson JD, Gibson TJ, Plewniak F et al (1997) The ClustalX windows interface: flexible
strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res
25:4876–4882
1182 Q. Wu et al.
9. Tamura K, Dudley J, Nei M et al (2007) MEGA4: Molecular Evolutionary Genetics Analysis

(MEGA) software version 4.0. Mol Biol Evol 24:1596–1599
10. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using realtime
quantitative PCR and the 2(-Delta Delta C (T)) method. Methods 25:402–408
Chapter 126
Optimization of Extraction Conditions
for Glycosaminoglycan from Urechis
unicinctus by Response Surface
Methodology
Chunying Yuan, Xu Han, Qingman Cui and Ping Liu
Abstract The enzyme dosage, enzymolysis time, and alcohol precipitation

concentration as independent variables and the extraction rate as the response value,
the extraction technology of glycosaminoglycan from Urechis unicinctus was
optimized via response surface methodology on the basis of single-factor experi-
ments. The extraction rate of glycosaminoglycan was affected in the following
order: concentration of alcohol precipitation [ enzymolysis time [ enzyme
dosage. The optimal conditions for the glycosaminoglycan extraction were as follows:
alcohol precipitation concentration 75 %, enzymolysis time 4 h, and enzyme dosage
0.4 %.

Keywords Urechis unicinctus Glycosaminoglycan Optimization of extraction

conditions Response surface methodology
126.1 Introduction
Glycosaminoglycans, such as heparin, heparan sulfate, chondroitin sulfate, dermatan

sulfate, hyaluronic acid, and keratan sulfate, are polysaccharides containing uronic
acid and hexosamine. They not only exhibit anticoagulant, hypolipidemic, antitu-
mor, and antiviral activities, but also enhance the body’s immune system [1, 2].
Glycoproteins or glycosaminoglycans have been extracted from Argopecten irra-
dians, Ruditapes philippinarum, Sinonovacula constricta, Scapharca subcrenata,
Mactra veneriformis, and Bullacta exarata et al., and some of their activities have
been investigated [3–10]. Urechis unicinctus is a species of marine spoon worms,
also known as sea intestines, mainly distributed in the Yellow Sea, Bohai Coast. It
C. Yuan (&) X. Han Q. Cui P. Liu

Key Laboratory for Marine Chemistry and Resource, College of Marine Science and
Engineering, Tianjin University of Science and Technology, Tianjin 300457, China
e-mail: cqm80@163.com
1184 C. Yuan et al.
is rich in protein and many essential amino acids. Research had shown that the
polypeptide extracted from U. unicinctus exhibited a certain antitumor activity and
improved the immune function of mice, and the fibrinolytic enzyme extracted from
the same species had antithrombotic effects [11, 12]. In order to utilize fully the
quality resources, we optimized the extraction methods of glycosaminoglycan
from U. unicinctus.
126.2.1 Materials
U. unicinctus were purchased from farmers’ markets in Tianjin Tanggu. Trypsin

(enzyme activity, 250 U/g; optimum temperature, 50 C; optimum pH of 8.0) was
purchased from Beijing Solarbio Science & Technology Co., Ltd. A Ds-1
high-speed organization broken machine, a SHA-C water bath oscillator, a T6
new century UV/Vis spectrophotometer, a TGL-16LM high-speed refrigerated
centrifuge, a 99-1 magnetic stirrer, a RE-3000 rotary evaporator, and a FD-10-50
vacuum lyophilizer were also used in the experiment.
126.2.2 Methods
126.2.2.1 Glycosaminoglycan Extraction Process
U. unicinctus samples were homogenized and subjected to autolysis and enzymolysis.

Subsequently, enzyme inactivation, decoloration, centrifugation, deproteinization,
and alcohol precipitation were performed. The samples were then washed with
ethanol and acetone before drying.
126.2.2.2 Determination of Glycosaminoglycan Content
Glycosaminoglycan content was determined by Alcian Blue colorimetric assay

[13].
126.2.2.3 Experimental Design of the Response Surface
Enzyme dosage, enzymolysis time, and concentration of alcohol precipitation were

represented by A, B, and C, respectively. The extraction rate of glycosamino-
glycan was expressed as the response value Y. The experimental factors and levels
obtained in this study are shown in Table 126.1.
126 Optimization of Extraction Conditions for Glycosaminoglycan 1185
Table 126.1 Coded values Factor Coded values

of experimental factors and
levels 1 0 -1
A 0.20 3 60
B 0.40 4 70
C 0.60 5 80
The experimental results were analyzed and processed using Design Expert 7.0.
126.3 Experimental Results
126.3.1 Experimental Results and Analysis of Response

Surface
The experiment was optimized using a Box–Behnken design. The experimental

program and results are detailed in Table 126.2.
Quadratic regression models were fitted, and the regression analysis and results
were reported in Tables 126.3, 126.4, 126.5.
As shown in Tables 126.3 and 126.4, the model was very significant (P \
0.001), and lack of fit was not significant (P [ 0.05). These results suggested that
the experimental program was reliable, and the selected model fitted the actual
situation well.
Table 126.2 Experimental Run A/ % B/h C/ % Y%

program and results of
response surface 1 0.20 3 70 0.03726
2 0.20 5 70 0.03787
3 0.20 4 60 0.03478
4 0.40 3 60 0.03264
5 0.40 5 80 0.06396
6 0.60 4 80 0.04289
7 0.60 3 70 0.03415
8 0.40 5 60 0.03347
9 0.60 4 60 0.02969
10 0.40 4 70 0.07196
11 0.20 4 80 0.05617
12 0.40 4 70 0.06844
13 0.60 5 70 0.04905
14 0.40 3 80 0.06534
1186 C. Yuan et al.
According to the P values in Table 126.3, the extraction rate was affected in the
following order: concentration of alcohol precipitation [ enzymolysis time [ -
enzyme dosage.
The multiple correlation coefficient and correcting correlation coefficient were
0.9926 and 0.9758 respectively, and the variation coefficient of Y was lower,
indicating that the predicted values of the model fitted the experimental values
well and the reliability of the experiment was higher (Table 126.5). Therefore, the
best extraction conditions could be determined using the regression model, and the
regression equation was determined ultimately as follows:
Y ¼ 0:072 0:002763A þ 0:003358B þ 0:010C þ 0:004798AB 0:002873AC

þ 0:002198BC 0:018A2 0:012B2 0:014C2
Table 126.3 Variance analysis of regression model

Variance source Sum of square Degrees of freedom Mean square F-value P-value
Model 0.0027 9 0.0027 59.27 0.0007
A 6.105 9 10-5 1 6.105 9 10-5 12.24 0.0249
B 9.018 9 10-5 1 9.018 9 10-5 18.08 0.0131
C 0.0008 1 0.0008 165.52 0.0002
AB 9.206 9 10-5 1 9.206 9 10-5 18.45 0.0127
AC 3.301 9 10-5 1 3.301 9 10-5 6.62 0.0618
BC 1.932 9 10-5 1 1.932 9 10-5 3.87 0.1205
A2 0.0011 1 0.0011 210.56 0.0001
B2 0.0004 1 0.0004 88.91 0.0007
C2 0.0006 1 0.0006 122.57 0.0004
Table 126.4 Lack-of-fit test and error analysis of regression model

Variance source Sum of squares Degrees of freedom Mean square F-value P-value
Residuals 1.996 9 10-5 4 4.989 9 10-6
Lack of fit 1.984 9 10-5 3 6.614 9 10-6 57.41 0.0966
Pure error 1.152 9 10-7 1 1.152 9 10-7
The total deviation 0.027 13
Table 126.5 Credibility analysis of regression model

Item Value Item Value
Standard deviation 0.0022 Multiple correlation coefficient R2 0.9926
Mean 0.047 Correcting correlation coefficient R2 0.9758
Variation coefficient 4.730 Predicting correlation coefficient R2 0.8814
PRESS 0.0003 The ratio of signal to noise 22.361
126.3.2 Determination of Optimal Extraction Conditions
The response surface analysis charts were plotted based on response surface
regression analysis and the regression equation (Figs. 126.1, 126.2, 126.3). The
Y values gradually increased with increasing enzymolysis time and enzyme
dosage, reached their maximum at certain values of enzymolysis time and enzyme
dosage, and then gradually decreased with increasing enzymolysis time and
enzyme dosage (Fig. 126.1). A similar phenomenon appeared in Figs. 126.2 and
126.3. Three graphs exhibited an opening downward, convex surface, indicating
that maximum response values were obtained. The contour center of these graphs
was located in -1 to 1, revealing that the optimal extraction conditions existed at
the levels of the designed factors. The optimal conditions of extraction were as
follows: enzyme dosage (A) = 0.38 %, enzymolysis time (B) = 4.16 h, and
Fig. 126.1 Effects of enzymolysis time and enzyme dosage on the extraction rate of
glycosaminoglycan
Fig. 126.2 Effects of concentration of alcohol precipitation and enzyme dosage on the extraction
rate of glycosaminoglycan
1188 C. Yuan et al.
Fig. 126.3 Effects of concentration of alcohol precipitation and enzymolysis time on the
extraction rate of glycosaminoglycan
concentration of alcohol precipitation (C) = 73.89 %, the predicted extraction rate

was 0.075 %, and the actual extraction rate based on three validation experiments
was 0.074 %. The optimal extraction conditions were modified considering
operation convenience as enzyme dosage (A) = 0.4 %, enzymolysis time
(B) = 4 h, and concentration of alcohol precipitation (C) = 75 %, the actual
extraction rate was 0.076 % under these conditions, with only little difference
between the actual and theoretical extraction rates, indicating that the parameters
of extraction obtained using the response surface method were accurate and
reliable, and the model exhibited a higher application value.
126.4 Conclusion
In this paper, we have determined the order of affecting extraction rate of

glycosaminoglycan from U. unicinctus: concentration of alcohol precipitation [
enzymolysis time [ enzyme dosage. We have also identified the following opti-
mal extraction conditions using response surface methodology: concentration of
alcohol precipitation, 75 %; enzymolysis time, 4 h; enzyme dosage, 0.4 %, and the
glycosaminoglycan extraction rate was 0.076 % under these conditions.
Acknowledgments This research was supported by the Tianjin Program of Revitalizing the Sea
by Science and Technology (Grant No. KX2010-0003).
References
1. Wang YC, Guan HS, Li BF (1995) Status and prospects of glycosaminoglycan. Prog Bioeng
6:2–10
2. Kariya Y, Watabe S, Ochiai Y et al (1990) Glycosaminoglycan from the body wall of sea
cucumber, Stichopus japonicus. CompBiochem Physicol 2:387–392
3. Wang CY, Guan HS (1995) Studies on methods of extraction and purification of
glycosaminoglycans from Argopecten irradians Larmarck. J Qingdao Ocean Univ 4:203–208
4. Wang RF, Wu HM, Fan XP (2008) Purification and monosaccharide composition analysis of
glycosaminoglycans of Ruditapes philippinarum. J Guangdong Ocean Univ 6:25–29
5. Lei XL, Wu HM, Fan XP et al (2004) Extraction and isolation of glycosaminoglycan from
Sinonovacula constricta and its anti-tumor activity in vitro. Pharm Biotech 3:146–149
6. Hu XQ, Wu HM, Lin ZM et al (2008) Preliminary study on physicochemical property of
glycosaminoglycan from Scapharca subcrenata lisehke and its effects on immune organs of
mice. Mod Food Sci Tech 8:763–766
7. Yuan CY, Cui QM, Sun XP et al (2011) Optimization of extraction conditions for
glycosaminoglycan from Mactra veneriformis by response surface methodology. Food Ind
11:18–21
8. Yuan CY, Cui QM, Sun XP et al (2011) Study on purification and functional activity of
glycosaminoglycan from Mactra quadrangularis. J Anhui Agric Sci 10:5882–5884
9. Xu JL, Cui QM, Yuan CY et al (2012) Study on optimization of extraction technology for
glycosaminoglycan from Bullacta exarata by response surface method. J Anhui Agric Sci
6:3559–3561
10. Yuan CY, Xu JL, Cui QM (2011) Purification and analysis of chemical compositions on
glycosaminoglycan from Bullacta exarata. The 3rd ICBNPTM, Xi An, pp. 186–188
11. Zhao X (2008) Research on purification and characteristics of polypeptides from Urechis
unicinctus. Ocean Univ China, Qingdao, pp. 19–43
12. Chu JX, Cai WD, Han BQ et al (2010) Thrombolytic effect, hemolytic toxiciity and acute
toxicity of the fibrinolytic enzyme UFEI from urechis unicinctus. Pharm Biotech
17(4):331–333
13. Glod EW (1979) A simple spectrophotometic method of estimating glycosaminoglycan
concentrations. Anal Biochem 99:183–188
Chapter 127
Quantitative Trait Loci Mapping
of Unstripped Germ Rate in Milled Rice
Shengbin Liu, Fang Wang, Zetian Hua, Meng Meng, Fei Zhao
and Xin Liu
Abstract The objectives of this study were to investigate the genetic factors
controlling unstripped germ rate in milled rice using Quantitative trait loci (QTL)
analysis. A linkage map consisting of 80 DNA markers was constructed by using
224 recombinant inbred lines (RILs). A total of 8 QTLs located on chromosomes 3,
4, 6, 7, 8, 9, and 12 were detected. These QTLs explained phenotypic variations
ranging from 26.44 to 57.28 %. The results and the tightly linked molecular markers
that flank the QTL will be useful for improvement of quality in rice breeding.
Keywords QTL Mapping Unstripped germ rate Milled rice RILs
127.1 Introduction
With the population enlarging, the global demand of cereal grains is increasing.
It is estimated that the world population may reach 8.9 billion in 2025 [1], and the
total food product needs an increase more than 50 % [2]. As one of the most
important staple food crops, rice (Oryza sativa L.) plays an important role in food
security in China. Rice quality depends on many attributes of the rice grain and is
also related to preference among different cultures and habits, its major elements
include milling performance, appearance, cooking, eating, and nutrient quality.
With the rapid development in researches of Quantitative trait loci (QTL) based
on molecular linkage mapping, many studies have been conducted in recent years
that have identified a large number of QTLs for morphological and agronomic
S. Liu F. Wang Z. Hua (&) M. Meng

e-mail: liushengbin2012@126.com
S. Liu F. Wang Z. Hua F. Zhao X. Liu
Chinese National Engineering Research Center for Japonica Rice,
1192 S. Liu et al.
traits of rice [3–8]. However, to our knowledge, genetic analysis of QTLs asso-
ciated with unstripped germ rate in milled rice has not been conducted. The
objectives of this study were to identify QTLs for unstripped germ rate traits in
milled rice using recombinant inbred lines (RILs) from cross Z601 and C14, so to
provide basic information for breeding new rice varieties with higher quality
through DNA molecular marker techniques.
127.2.1 Plant Materials
The RILs in this study were kindly provided by Professor Zetian Hua of Chinese
National Engineering Research Center for Japonica Rice. A set of 224 F5 RILs,
derived from a cross between Z601 (high unstripped germ rate) and C14 (low
unstripped germ rate) via single-seed descent, were used in the current study. All
plants of the RILs and the two parental lines were planted in the rice cropping
season in Tianjin, China and the seeds harvested at maturation were stored at a
temperature lower than 10 C for use.
127.2.2 DNA Preparation and PCR Amplification
DNA was extracted from fresh leaves of 224 RIL individuals and their parents
using the SDS method [9–12]. The extracted DNA was dissolved in TE buffer and
tested for quality and quantity. Then, these 224 DNA samples were diluted into
25 ng/ml with sterilized double distilled water and stored at 4 C for the poly-
merase chain reaction (PCR). PCR [13] was performed with an initial 4 min period
at 94 C, followed by 40 cycles of 30 s of denaturing at 94 C, 30 s of annealing at
56 C, and 30 s of extension at 72 C, and a final 10 min extension at 72 C. PCR
products with large difference were separated on 3 % agarose gel and detected by
using a UV-GIS detection system [14].
127.2.3 Linkage Map Construction and Data Analysis
The genotypic constitution of 224 individuals from the RIL population with
respect to 80 simple sequence repeats (SSRs) was used to construct a genetic map.
This map spanned 1889.15 cM with the mean inter-marker distance of 27.0 cM
and involved all 12 rice chromosomes [15]. Composite interval mapping was
performed to identify QTL by using the software package QTL IciMapping V3.0,
with a LOD threshold of 2.5 for declaring the presence of a putative QTL [16–19].
For the designation of QTL, we followed the rule formulated by McCouch [20].
127 Quantitative Trait Loci Mapping 1193
127.3.1 Distribution of Unstripped Germ Rate

in the Segregating Ril Population
10 g rice of every segregating RIL population was dealt with by Detecting System
for Appearance Quality of Rice and Seeds. The differences between the two
parents Z601(83.62 %) and C14(5.42 %) were rather big, significant differences
were observed in the RIL population. The average values of the unstripped germ
rate were studied, namely, UGR. Unstripped germ rate of RIL population is pre-
sented in Fig. 127.1. In the analyzed data, normal distribution and transgressive
segregation in RIL population were observed, indicating that unstripped germ rate
was quantitatively inherited and suitable for QTL analysis.
127.3.2 QTLs for UGR
Eight QTLs governing UGR were identified and mapped to chromosomes 3, 4, 6,

7, 8, 9, and 12 (Table 127.1 and Fig. 127.2). These QTLs explained phenotypic
variations ranging from 26.44 to 57.28 %.
70
60
50
UGR %
40
30
20
10
01 31 61 91 121 151 181 211
Number of segregating RIL population
Fig. 127.1 Unstripped germ rate of RIL population
Table 127.1 Location of QTLs for UGR in rice

Number of Left maker Right maker LOD value Variation
chromosome explained
(%)
3 RM3525 RM1432 10.36 57.28
4 RM16251 AL606649-132 12.55 54.44
6 RM5850 RM494 10.65 53.63
7 AP003742-48 RM7479 7.05 32.81
8 RM5891 RM8020 7.98 43.52
8 RM8020 RM72 6.21 39.86
9 RM24336 RM7364 10.35 55.35
12 RM7102 BX00050-91 6.09 26.44
1194 S. Liu et al.
Fig. 127.2 Chromosomal

locations of QTLs for UGR
in RIL population
127 Quantitative Trait Loci Mapping 1195
127.4 Conclusion
Rice is the most important crop in the world, with over 1.5 billion hectares under
cultivation and a production of over 583.2 million tons. It is grown in 117
countries and is a staple food for people in 39 countries, which include 2.7 billion
people in Asia alone [21]. Thus, it is very important to ensure a balance of grain
supply–demand, which can be affected by reduction of cultivated land, sharp
population growth, and environmental deterioration.
In this study, we investigate the genetic factors controlling unstripped germ rate
in milled rice using QTL analysis. A linkage map consisting of 80 DNA markers
was constructed. Eight QTLs were located on chromosomes 3, 4, 6, 7, 8, 9, and 12
were detected. The results will be useful for improvement of quality in rice
breeding.
Acknowledgments This work was supported by National High-tech R&D Program of China
(863 Program) (Grant No. 2011AA10A101), Natural Science Foundation of Tianjin, China
(Grant No.11ZCKFNC01200), and the National Natural Science Foundation of China Grant
(No. 31271676).
References
1. Khush GS (2003) Productivity improvements in rice. Nutr Rev 61:114–116

2. Khush GS (2001) Challenges for meeting the global food and nutrient needs in the new
millennium. Proc Nutr Soc 60:15–26
3. Wu WR, Tang DZ, Li WM (2000) Genetic dissection and molecular dissection of
quantitative traits. Acta Agr Sin 26:501–507
4. Li JZ, He P, Zheng XW et al (1999) Identification and interaction analysis of six agronomic
trait loci of rice based on a recombinant inbred population. Acta Bot Sin 41:1199–1203
5. McCouch SR, Teytelman L, Xu YB (2002) Development and mapping of 2240 new SSR
markers for rice (Oryza sativa L.). DNA Res 9:199–207
6. Bao JS, Wu YR, Hu B et al (2002) QTL for rice grain quality based on a DH population
derived from parents with similar amylose content. Euphytica 128:317–324
7. Lu CF, Shen LS, Tan ZB et al (1996) Comparative mapping of QTLs for agronomic traits of
rice across environments using a doubled haploid population. Theor Appl Genet 93:145–150
8. Guo LP, Luo LJ, Xing YZ et al (2003) Dissection of QTLs in two years for important
agronomic traits in rice (Oryza sativa L.). Chin J Rice Sci 17:211–218
9. Zhang FJ, Zhang ML, Zhu SF (2004) An improved method of DNA extraction in rice. Plant
Q 18:330–332
10. Peng ST, Yan QC, Wang XD (2002) Research on rice weed DNA extraction and RAPD
procedure improvement. J SJTU 20:34–41
11. Vanni A, Anfossi L, Giovannoli C (2004) Evaluation of purification procedures of DNA from
maize meal samples by exploiting different analytical techniques for the assessment of DNA
quality. Ann Chim 94:269–280
12. Collardl BCY, Dasa Virkp S L (2004) Evaluation of quick and dirty DNA extraction methods
for marker assisted selection in rice (Oryza sativa L.). Plant Br 126:47–50
13. Zhu SY, Luo TK, Zhang XL (2009) Improvement of SSR-PCR reaction system. A Agr Sci
37:3441–3443
1196 S. Liu et al.
14. Xu SB, Tao YF, Yang ZQ et al (2002) A simple and rapid methods used for silver staining
and gel preservation. Hereditas 24:335–336
15. Jing W, Zhang WW, Jiang L et al (2007) Two novel loci for pollen sterility in hybrids
between the weedy strain Ludao and the japonica variety Akihikari of rice (Oryza sativa L.).
Theor Appl Genet 114:915–925
16. Bao JS, Sun M, Zhu LH et al (2004) Analysis of quantitative trait loci for some starch
properties of rice (Oryza sativa L.): thermal properties, gel texture and swelling volume.
J Cereal Sci 39:379–385
17. Wu QS, Wan XY, Su N et al (2006) Genetic dissection of silicon uptake ability in rice (Oryza
sativa L.). Plant Sci 171:441–448
18. Churchill GA, Doerge RW (1994) Empirical threshold values for quantitative trait mapping.
Genetics 138:963–971
19. Wang DL, Zhu J, Li ZK et al (1999) Mapping QTLs with epistatic effects and
QTL 9 environment interactions by mixed linear model approaches. Theor Appl Genet
99:1255–1264
20. McCouch SR, Cho YG, Yano M et al (1997) Report on QTL nomenclature. Rice Genet
Newsl 14:11–13
21. Sardesai N, Rajyashri KR, Behura SK et al (2001) Genetic, physiological and molecular
interactions of rice with its major dipteran pest, gall midge. Plant Cell Tiss Org 64:115–131
Chapter 128
The Application of the GSI
in the Preservation and Quality Control
of Oat Beverage
Yuzhu Liu and Min Zhang
Abstract The purpose of this paper is to introduce the concept of Globle stability
index (GSI) in the quality control of oat beverage. The Q10 value of oat beverage
was determined by protracting the GSI curve. The results showed that the Q10
were 1.40 and 3.00, respectively, when the temperatures were changed from 28 to
38 C and 38 to 48 C. The GSI indicator of oat beverage was established. The key
factors of the quality control of oat beverage were total acid, total sugar, viscosity,
soluble solids, precipitation, chromatic aberration, and pH. The GSI equation was
y = 0.9889e-0.001x, R = 0.9898. The impact factors of the simplified GSI test
through experiments and data processing were determined, included soluble
solids, precipitation, color, and pH. The simplified GSI equation was
y = 1.0021e-0.0012x, R = 0.9746. The GSI indicator of oat beverage was
established through the application of the two curves. That provided technical
preparation for the production of oat beverage.
Keywords Oat beverage GSI Q10 Key factors
128.1 Introduction
In the world’s eight major cereal crops, the production of Oat ranked sixth after
wheat, rice, corn, barley, and sorghum, so it has huge significance in the food
processing [1]. Moreover, it showed various bioactivities, and the main active
components are oat polysaccharides and Oat ethanol extracts. The study had
indicated that they had the health functions of reducing blood sugar and cholesterol,
anticancer, and so on [2]. A new concept is based on the defining and formulating
Y. Liu M. Zhang (&)

Key Laboratory of Food Nutrition and Safety, Tianjin University of Science and
Technology, Tianjin 300457, People’s Republic of China
e-mail: zm0102@tust.edu.cn
1198 Y. Liu and M. Zhang
a single index called the Global Stability Index (GSI), varying between zero and
one and taking simultaneously into account the time variations of all pertinent
quality indices proper to the food product under study [3]. In order to evaluate the
degradation of the product quality in terms of the sensory, the microbiological and
the physicochemical properties, various properties, and quality indices must be
experimentally followed as a function of time, depending on the product nature [4].
In this paper, the oat beverage was produced with Oat bran, and the changes of its
quality were measured at different storage temperatures.
The concept of GSI was introduced in this process, the Q10 value was calcu-
lated through completing the GSI curve. Then the curve coincided with GSI was
received through data processing of a single or fewer several indicators. The GSI
curve could be simplified, consequently.
128.2 Materitals and Methods
128.2.1 Measurement of Coliform Organisms
128.2.1.1 Sample Processing
Oat beverage dope was diluted and three groups of samples were obtained by
gradient dilution method, then adjusted the pH to 7.2-7.4.
128.2.1.2 Vaccination
The three groups of samples were inoculated, and each group was inoculated with
1 mL.
128.2.1.3 Proof Test
The inoculated samples would be cultured for 16 – 18 h at 37 C. The positive

number of Coliform organisms for each dilution was recorded, and the corre-
sponding number of coliform organisms was identified according to the coliform
MPN table.
128.2.2 Measurement of Total Acid (GB/T 12456-90)
128.2.2.1 Sample Determination
Put the sample of oat beverage (50 mL) in a 250 mL flask, then add 0.2 mL of 1 %
PHenolpHthalein solution as indicator and titrate with NaOH solution until a faint
128 The Application of the GSI 1199
pink color is obtained and do not fade for 30 s. The consumption of NaOH
standard titrant (V1) was recorded.
128.2.2.2 Blank Test
The water was applied instead of the test sample, and then the test was carried out
according to 2.2.1. The consumption of sodium hydroxide standard titrant (V2)
was recorded. 2.2.3 Computational formula:
X ¼ CðV1 V2Þ F= V0 1000
128.2.3 Measurement of Total Sugar
128.2.3.1 Sample Processing
Put 1 mL of oat beverage in an Erlenmeyer flask, then 5 mL of hydrochloric acid

(6 mol/L) and 20 mL of distilled water were added, then heated in boiling water
for 2 h, balanced the pH to 7.0 with 6 mol/L NaOH solution, diluted with water to
100 mL, got the required sample after blending [5].
128.2.3.2 Measurement of Sample
Each of 5 mL alkaline tartaric acid copper liquid A and liquid B were taken to a
250 ml Erlenmeyer flask, then 10 ml of distilled water and three glass beads were
added. The sample solution which was less 1 mL than the consumption of test sample
solution was added. The sample solution was dropping continually with the speed of
1 drop every 2 s and maintaining the solution boiling within 2 min, until the blue just
faded away. The consumption of the total volume of sample solution was recorded.
128.2.3.3 Calculation of Results
Formula : X ¼ ðF 100Þ = ðV1 V2Þ
128.2.4 Measurement of viscosity
The viscosity meter (DV-IIPr) was applied to the determination, the RV2 rotor was
selected and measured in the condition of 220 r/min.
128.2.5 Measurement of the Precipitation
After oscillating and mixing, the oat beverage (100 mL) deposited under different
conditions was centrifugated at 3,000 r/min for 10 min. The precipitant was added
and heated for 2 h at 105 C, after the supernatant solution was poured out.
128.2.6 Measurement of the Soluble Solids Content
The contents of soluble solids of oat beverage deposited under different conditions
were measured by the saccharimeter.
128.2.7 Measurement of pH
The changes of the pH of oat beverage in different preservation conditions were

measured by the pH meter.
128.2.8 Measurement of the Chromatic Aberration
The changes of the chromatic aberration of oat beverage in different preservation

conditions were measured by using the DC-P3-automatic colorimeter meter.
128.2.9 The Calculation of the GSI
The experiment introduced this formula [3]:

Vij ¼ ðCij Ci0 Þ=ðLi ¼ Ci0 Þ ð128:1Þ
Where Cij is the measured value of the criterion i at time j units; Ci0 is the
initial value of the criterion I, at the start of the experiment (t = 0); Li is
the threshold value of criterion i, set by regulations or common practices, i.e., by
the user. Finally, we define the Global Stability Index, GSIj, at any storage time
equal to j units, as:
X
GSIj ¼ 1 aiVij ð128:2Þ
where j is the j units of storage time; P is the sum of i = 1 to n, n being the total
number of the quality degradation criteria; i is the criterion; Vij is the variation of
criterion i at time j units from Eq. 128.2; ai is a weighting factor reflecting the
relative importance of criterion i in terms of describing the quality of the product.
It varies between 0 and 1.
128.3 Results
128.3.1 Measured Results of Coliform Organisms
The results of the experiment showed that the coliform bacteria was not detected
after had been stored for 180 d, therefore we could ensure that the condition of
sterilization in the experiment was consistent with the requirement, and ensured
that oat beverage had preserved value during the period.
128.3.2 The Content of Total Acid
The Fig. 128.1 showed that the total acid content would increase gradually with
the extension of the time. Under the storage conditions of 48 C, the total acid
content increased quickly, and the total acid content increased gently with the
extension of time, while under the storage conditions of 28 and 38 C, the increase
had been gentle relatively.
128.3.3 Measurement of Total Sugar Content
According to the Fig. 128.2, the general trend of the total sugar content was that it
would decrease with the extension of the time. The total sugar content had changed
obviously, under the storage condition of 48 C, while it changed more gently
under the storage conditions of 28 and 38 C. It might be that the precipitation had
taken away part of the sugar, which leaded to the decline of the content of total
sugar.
128.3.4 Measurement of the Oat Beverage Viscosity
The Fig. 128.3 showed that the viscosity had no obvious trend, only when it was
preserved under the conditions of 48 C, the viscosity had the trend of increase.
Fig. 128.1 Curve of the total 28 38 48

acid content 1.4
1.3
Content/mg/mL
1.2
1.1
1
0.9
0.8
0 20 40 60 80 100 120 140 160 180
Time/d
Fig. 128.2 Curve of the total 28 38 48

1.1
sugar content
1.05
1
Content/mg/mL
0.95
0.9
0.85
0.8
0.75
0.7
0 20 40 60 80 100 120 140 160 180
Time/d
Fig. 128.3 Curve of the 1.1 28 38 48

viscosity 1.05
1
Viscosity/mPa.s
0.95
0.9
0.85
0.8
0.75
0.7
0 20 40 60 80 100 120 140 160 180
Time/d
128.3.5 Measurement of the Oat Beverage Precipitation

Amount
According to the Fig. 128.4, the general trend of the precipitation amount was that
it would increase with the extension of the time. Under the storage conditions of
48 C, it had increased obviously in a short time, then gently.
Fig. 128.4 Curve of the 6 28 38 48

precipitation amount
5
Precipitation/mg/mL
4
0
0 20 40 60 80 100 120 140 160 180
Time/d
128.3.6 Measurement of the Soluble Solids Content
The Fig. 128.5 showed that the soluble solids content of oat beverage changed
gently during experiment of preservation.
128.3.7 Measurement of Oat Beverage pH
The Fig. 128.6 showed that the pH of the oat beverage would decrease with the
extension of the time, and it had changed obviously under the storage conditions of
48 C.
128.3.8 Measurement of the Chromatic Aberration Changes

of Oats Beverage
Figure 128.7 The chart showed that the chromatic aberration of oats beverage
changed larger with the extension of the time, and the higher its storage-
temperature was, the more violently it changed.
Fig. 128.5 Curve of the 1.1 28 38 48

soluble solids content
Soluble solids
1.05
0.95
0.9
0 20 40 60 80 100 120 140 160 180
Time/d
Fig. 128.6 Curve of the pH 1.1 28 38 48
pH
0.9
0.8
0.7
0 20 40 60 80 100 120 140 160 180
Time/d
Fig. 128.7 Curve of the 1.1

chromatic aberration 28 38 48
1
0.9
E
0.8
0.7
0.6
0 20 40 60 80 100 120 140 160 180
Time/d
128.3.9 Application of GSI Method in the Results
Determination of weight coefficients: MPN value of Coliform group was an

important index to reflect the changes of beverage quality. Once the microorgan-
isms exceeded, the beverage would not have value in use. A single experimental
result showed that the change of soluble solids content was very little, its weight
coefficient was 0.05; while the change of precipitation amount was most obvious
during the process of preservation, its weight coefficient was 0.20. The weight
coefficients of other indexes were 0.15. The index weight coefficient was:{total acid
content, total sugar content, viscosity, soluble solid content, precipitation amount,
chromatic aberration, pH} = {0.15, 0.15, 0.15, 0.05, 0.20, 0.15, 0.15}.
The GSI was solved by using matrix. According to the kinetic equation [6], we
could use the formula A = A0exp(-Kt) to fit the three curves, and the result was
shown in Fig. 128.8.
Calculation of the Q10 values which were the temperature coefficients:
when the temperature was from 28 to 38 C, KC = 0.001 and KC ? 10 =
0.0014, Q10 = KC ? 10/KC, Q10 = 1.40.
` when the temperature was from 38 to 48 C, KC = 0.0014 and KC ? 10 =
0.0042, Q10 = KC ? 10/KC, Q10 = 3.00.
Fig. 128.8 Fitting curve of 28 38 48

1.1
GSI
1 y = 0.9889e-0.001x
0.9
R2 = 0.9405
0.8
GSI
0.7 y = 0.959e-0.0014x
0.6 R2 = 0.9497
0.5 y = 0.8219e -0.0042x
0.4 R2 = 0.9077
0.3
0 20 40 60 80 100 120 140 160 180
Time/d
Data indicate that, when the food had chemical changes in the process of
storage, the value of Q10 generally was between 2 and 4 [7]. As mentioned above,
the results of the experiment was consistent with the data. Therefore, cryopres-
ervation had great significance to ensure the quality of oat beverage.
128.3.10 Simplifying the Calculation of GSI of Oat Beverage
The simplified method which was considered comprehensively with chromatic

aberration, precipitation, pH, and viscosity was received through a large amount of
data process. The weight coefficient was {precipitation, pH, viscosity, chromatic
aberration} = {0.3, 0.2, 0.3, 0.2}, then we could process date and fit to get
Fig. 128.9.
Calculating the values of Q10 from Fig. 128.9:
when C = 28 C and C ? 10 = 38 C, KC = 0.0012 and KC ? 10 =
0.0015, Q10 = KC ? 10/KC, Q10 = 1.25.
Fig. 128.9 The curve of 28 38 48

simplified GSI 1.1
1 y = 1.0021e-0.0012x
R2 = 0.9499
0.9
Simplified GSI
0.8
0.7 y = 0.9763e -0.0015x

0.6 R2 = 0.9456
0.5 y = 0.8537e -0.0041x

R2 = 0.9175
0.4
0.3
0 50 100 150 200
Time/d
` when C = 28 C and C ? 10 = 38 C, KC = 0.0015 and KC ? 10 =

0.0041, Q10 = KC ? 10/KC, Q10 = 2.73.
We could find that the relevant coefficients in Fig. 128.9 were better, and had
higher fitting accuracy than others. The Q10 values were calculated from
Fig. 128.8 and the results were 1.25 and 2.73, that had little difference from the
Q10 values which were calculated from the general Fig. 128.9, and the detection
experiment of index was relatively simple. These indexes included viscosity,
precipitation capacity, color, the pH. So we could use the figure to replace the GSI
general figure for getting the simplified effect.
128.4 Discussion
The qualitative change of Oat beverage during storage could be reflected by the GSI.
The GSI curve could be determined by these seven indicators, including total acid
content, total sugar content, viscosity, soluble solids, precipitation, color, and the pH.
The GSI curve equation was y = 0.9889e-0.001x, R = 0.9898; we could use
four indicators which were viscosity value, precipitation, chromatic aberration,
and the pH to get simplified GSI curve, and the simplified GSI equation was
y = 1.0021e-0.0012x, R = 0.9746.
When the temperature was changed from 28 to 38 C and 38 to 48 C, the Q10
values which were calculated by GSI curve were 1.40 and 3.00. While the tem-
perature was from 28 to 38 C and 38 to 48 C, the Q10 values were calculated by
the simplified GSI curve were 1.25 and 2.73. The Q10 values had a good degree of
coincidence before and after simplifying, showed that the simplified GSI curve was
a valuable method to measure the quality changes of oat beverage during storage.
References
1. Li J (1993) Nutritional value and health benefits of oats[J]. Xinjiang Agric Sci Technol (in
China) 5:38-39
2. Autiok K, Myllymakio O (1987) Flow properties of solution of oat b-glucan[J]. Food Sci
52(5):564–568
3. Achour M (2006) A new method to assess the quality degradation of food products during
storage[J]. J Food Eng 75:560–564
4. Labuza, TP (1985) An integrated approach to food chemistry: illustrative cases. Marcel
Dekker Inc, New York, Food Chem
5. Wang XP (ed) (2006) Food analysis[M]. Agric Sci (in China), Agric Press, 2–3
6. Labuza TP (1984) Application of chemical kinetics to deterioration of foods. J Chem Educ
61:348–358
7. Zhao JF (ed) (2008) Principles of food technology[M]. China Light Industry Press, china, p 2
Chapter 129
The Effect of Carbon Nanotubes on Rice
Seed Germination and Root Growth
Yumei Jiang, Zetian Hua, Yiqing Zhao, Qindai Liu, Fang Wang
and Qin Zhang
Abstract There are few researches available on the effects of carbon nanotubes
on rice seed germination and root growth. Aiming at this problem, rice seeds were
co-cultured with carbon nanotubes of different concentrations. The rice seedling
growth situation was observed including germination percentage rates, length of
seeding stem, and root. The absorbance was measured and the root activity was
calculated. Experiment results showed that the rice seed germination and root
growth were promoted by carbon nanotubes with appropriate concentrations
(0 * 100 lg/ml). When the concentration increased to 150 lg/ml, the root length,
root activity, and stem length decreased in comparison with the value of 100 lg/
ml, but still slightly higher than the control, although the root and stem lengths
were shorter than the control. Our results demonstrated, for the first time, that
carbon nanotubes could promote rice seed germination and root growth at lower
concentrations, and may have toxic effects at high concentrations.
Keywords Rice seed Carbon nanotubes Germination Root growth
129.1 Introduction
Materials of particle size less than 100 nm in at least one dimension are generally
classified as nanomaterials. The great potential of using nanoscale particles for
different biological and medical applications including gene and drug delivery,
Y. Jiang Z. Hua (&) Y. Zhao Q. Liu F. Wang Q. Zhang

e-mail: hzetian@yahoo.com.cn
Y. Jiang
Tianjin International Joint Academy of Biotechnology and Medicine, Tianjin 300457,
1208 Y. Jiang et al.
biosensing, diagnostic, and tissue engineering was widely documented during the
last several years.
Most investigations were focused on animals and humans at various levels, and
detailed studies and reliable information on the effects of nanomaterials such as
carbon nanotubes on plant physiology and plant development at the organism level
are very limited. However, there is an extensive interest to investigate the ability of
nanoparticles to penetrate plant cell walls and work as smart treatment-delivery
systems in plants [1–3]. Rice (Oryza sativa L.) is one of the most important food
crops worldwide. To achieve the goals of nano-agriculture, detailed studies on the
effects of nanotubes on rice seed germination and development of seedlings are
needed. This study is the first report, to our best knowledge, that describes the
effect of penetration of rice seed coats by carbon nanotubes.
The seeds were the number 294 liao japonica rice seeds. Standard Specification for
carbon nanotubes: OD \8 nm, Length *30 lm, Purity [95wt %, Ash \1.5wt %,
SSA [500 m2/g, EC [102 s/m, MFG Code: M1091016.
Germination of rice seeds. The rice seeds were inoculated on standard agar
Murashige and Skoog medium (MS medium) supplemented with different con-
centrations of carbon nanotubes tubes (50, 100, 150 lg/ml). The MS medium
without carbon nanotubes tubes was used for blank control experiments. 16–18
rice seeds were sterilized by 5 min treatment with 0.1 % mercuric chloride and
then rinsed five times with sterile water. Sterile rice seeds were placed on MS
medium without or with carbon nanoparticles (0, 50, 100, 150 lg/ml) for germi-
nation. The rice seeds in the culture bottles were inoculated in biochemical
incubator at 28 C for 6 days. The experiment was repeated twice.
Seed germinations were observed, and the germination rate was calculated. The
growth heights of rice seedling stem and the root lengths of rice seedling were
recorded everyday according to different concentrations. TTC standard curve was
drawn and root activity was calculated according to the root lengths and absor-
bance of rice seeding in different concentrations for 4.5–6 days.
Addition of carbon nanotubes to agar medium was found to accelerate the process
of seed germination and significantly shortened the germination time. Rice seeds
placed on medium with carbon nanotubes (50, 100, 150 lg/ml) germinated on the
first day, while rice seeds placed on regular MS did not germinate at that time. The
germination percentage rates were dramatically higher for seeds treated with
129 The Effect of Carbon Nanotubes 1209
nanoparticles. Seedlings with developed cotyledons and root system were recog-
nized as fully germinated in this experiment.
We observed the growth condition and carried out a variety of parameter
determination of rice seedlings for the last 3 days. For different concentrations of
carbon nanotubes tubes, there were different values. Carbon nanotubes-exposed
rice seedlings (50, 100 lg/ml) had longer and more developed stems and root
system compared with blank control seedlings. (Fig. 129.1a, b, c. Tables 129.1,
129.2). With increasing concentration of carbon nanotubes, the positive effect was
more and more strong. The positive effect was strongest when the concentration
was 100 lg/ml. However, the effect of carbon nanotubes (150 lg/ml) on plant
physiology was complex. Rice seedlings (150 lg/ml) had shorter root system
compared with blank control seedlings (Fig. 129.1a, d. Table 129.1). Although
shorter even than the seeding stem (50 lg/ml), the stem length (150 lg/ml) was
still slightly longer than blank control seedlings on the fourth and fifth days. On the
sixth day, the length of stem (150 lg/ml) was already shorter than blank control
seedlings (carbon nanotubes nontreated) (Fig. 129.1a, d. Table 129.2).
As the culture time increased, the absorption value and root activity of rice
seedling roots increased gradually. With the increase in carbon nanotubes con-
centration (0–100 lg/ml), the root activity also enlarged. When the concentration
increased to 150 lg/ml, the root activity decreased less than the value of 100 lg/
ml. This result was content with the measured length. However, there was a
conflict between the result of root activity and the measured length when they were
compared with root activity of the blank control. Root activity was still slightly
higher than the control, although the root length was shorter than the blank control
(Table 129.3).
Nanomaterials have been applicated in various fields such as water purification,
wastewater treatment, environmental remediation, food processing and packaging,
industrial and household purposes, medicine, and smart sensor development. The
majority of applications in these areas had been focused on the significance of the
nanomaterials for improved efficiency and productivity. However, in the field of
agriculture, the use of nanomaterials is relatively new and needs further
Fig. 129.1 Effect of carbon nanotubes on growth and development of rice seedlings. Four-day-
old seedlings were used to show the growth of rice seeding: a 0 lg/ml, b 50 lg/ml, c 100 lg/ml,
d 150 lg/ml
Table 129.1 The length of seeding root for rice seed (average ± SE cm)
0 lg/ml 50 lg/ml 100 lg/ml 150 lg/ml
The fourth day 4.922 5.367 5.298 4.289
The fifth day 5.075 5.479 5.680 4.416
The sixth day 5.266 5.694 5.739 4.552
Table 129.2 The length of seeding stem for rice seed (average ± SE cm)
The forth day 3.116 3.695 4.103 3.249
The fifth day 5.087 5.572 5.912 5.235
The six day 9.388 9.716 10.722 9.330
Table 129.3 The absorbance (ab.) and root activity of rice (ra.)
ab. ra. ab. ra. ab. ra. ab. ra.
Fourth day 0.143 0.280 0.204 0.407 0.269 0.542 0.172 0.340
Fifth day 0.214 0.428 0.293 0.591 0.336 0.680 0.243 0.488
Sixth day 0.231 0.463 0.313 0.633 0.343 0.695 0.248 0.498
Root activity unit = C/(1,000*W*h) [mg TTF/(gh)], absorbance abbreviated as ab., root activity
abbreviated as ra.
exploration [1–3]. Till date, only a few plant species and nanomaterials have been
studied on seed germination or 15-day-old seedlings. Most of the studies were
performed on vegetable seeds. To our knowledge, this is the first report on the
effect of nanomaterials on rice seed germination.
Previously, limited reports indicated both positive and negative effects of dif-
ferent nanoparticles on plant physiology [4]. It was demonstrated that nano-TiO2
treatment in proper concentration accelerated the germination of the aged spinach
seeds and increased its vigor [5]. Nanoparticles (Pd, Au at low concentrations; Si,
Cu at higher concentrations, and combination of Au and Cu) also had a positive
influence on lettuce seed germination, measured in terms of shoot to root ratio and
growth of the seedling [6]. Some other studies also support the positive effects of
suspensions of nanomaterials on seed germination and root growth of nine dif-
ferent crop species,such as tomato [3], radish (Raphanus sativus), rape (Brassica
napus), rye grass (Lolium perenne), lettuce (Lactuca sativa), corn (Zea mays),
cucumber (Cucumis sativus) [7], zucchini [8], onion, and cucumber [9].
There were also negative reports of nanomaterials for seed germination and root
growth, such as the inhibition effect on ryegrass and corn [7]. Nanomaterials have
also been reported to have no influence on the germination and root growth of
tomato, cabbage, and carrots [9]. Our results were consistent with the positive
reports. Carbon nanotubes were able to penetrate plant seed coat and dramatically
affect seed germination and plant growth [3]. The reason for the contradictory
129 The Effect of Carbon Nanotubes 1211
conclusions of different reports may be due to the type of plant species, the nature
of nanomaterials, and the concentrations of nanomaterials [7–9]. The higher
concentrations (2,000 mg/L) of nanosized Zn (35 nm) and ZnO (w20 nm) inhib-
ited the germination in ryegrass and corn, respectively; this result was similar to
the reports of Lin and Xing. They found that the root growth depended on different
nanoparticles and their concentrations [7, 10]. In this study, we also found that the
ability of rice seed germination and root growth increased with the increasing
nanomaterial concentrations before 100 lg/ml. But the ability decreased when the
concentrations reached 150 lg/ml. Although the root activity was still slightly
higher than the control, the lengths of root and stem (150 lg/ml) were already
shorter than blank control. This result means that nanomaterials of high concen-
trations may have toxic effects on plant. The phytotoxicity of nanomaterials is a
question that is gradually attracting more and more attention.
129.4 Conclusion
Our results demonstrated, for the first time, that carbon nanotubes could promote
rice seed germination and root growth at lower concentrations, and had toxic
effects at high concentrations.
Acknowledgments This work was partially supported by National High-tech R&D Program of
China (863 Program) (Grant No. 2011AA10A101), Natural Science Foundation of Tianjin, China
(Grant No. 11ZCKFNC01200) and the National Natural Science Foundation of China Grant
(No.31271676).
References
1. Rafsanjani MS, Alvari A, Samim M et al (2012) Application of novel nanotechnology

strategies in plant biotransformation: a contemporary overview. Recent Pat Biotechnol
6:69–79
2. Sozer N, Kokini JL (2009) Nanotechnology and its applications in the food sector. Trends
3. Mariya K, Enkeleda D, Meena M et al (2009) Carbon nanotubes are able to penetrate plant
seed coat and dramatically affect seed germination and plant growth. ACS Nano
3:3221–3227
4. Klaine SJ, Alvarez PJJ, Batley GE et al (2008) Nanomaterials in the environment: behavior,
fate, bioavailability, and effects. Environ Toxicol Chem 27:1825–1851
5. Zheng L, Hong F, Lu S et al (2005) Effect of nano-TiO2 on strength of naturally aged seeds
and growth of spinach. Biol Trace Elem Res 104:83–91
6. Adhikari RM, Shah BK, Palayangoda SS (2009) Solvent dependent optical switching in
carbazole-based fluorescent nanoparticles. Langmuir 7:2402–2406
7. Lin B (2007) Phytotoxicity of nanoparticles: inhibition of seed germination and root growth.
Environ Pollut 150:243–250
8. Stampoulis D, Sinha SK, White JC (2009) Assay-dependent phytotoxicity of nanoparticles to

plants. Environ Sci Technol 15:9473–9479
9. Cañas JE, Long M, Nations S et al (2008) Effects of functionalized and nonfunctionalized
single-walled carbon nanotubes on root elongation of select crop species. Environ Toxicol
Chem. 7:1922–1931
10. Ma Y, Kuang L, He X et al (2010) Effects of rare earth oxide nanoparticles on root elongation
of plants. Chemosphere 78:273–279
Chapter 130
Study on the Accumulation Laws
of Protein in Japonica Rice Seed During
Development
Fang Wang, Bolian Sun, Chunkai Gu, Jiajia Mi, Qin Zhang
and Zetian Hua
Abstract Rice protein is nutritionally superior over most of the other food cereals
in terms of amino acid composition. But rice is usually a low protein crop. So, it is
important to investigate the change laws of protein for breeding rice with high
protein content. The rice seed start to accumulate protein after flowering. In this
study, Z601, a japonica rice variety, was used as the experimental material. Seeds
of five days, ten days, fifteen days, twenty days, and twenty-five days after
flowering (DAF) were collected. Protein contents were determined by Kjeldahl
method in order to confirm the surge stage in rice seed. The components of rice
protein at various development stages were analyzed by SDS-PAGE analysis to
find the accumulation law of the individual protein components. The results
showed that 15–20 DAF was the surge stage of protein accumulation in rice seed.
The protein components in the seeds of 5 DAF did not include albumin and
globulin and only contained glutenin and gliadin. After that stage albumin and
globulin start to synthesis and the components of protein tended to be stable. The
vast majority content of protein during rice seed development was glutenin with
about 48 % of the total. The proportion of albumin to total protein content is 20 %
and globulin is 15 %, also as gliadin.
Keywords Rice seeds Protein Kjeldahl determination SDS-PAGE
F. Wang B. Sun C. Gu J. Mi Q. Zhang Z. Hua (&)

College of Food Engineering and Biotechnology, Tianjin University of Science and
Technology, Tianjin 300457, People’s Republic of China
e-mail: hzetian@tust.edu.cn
F. Wang Z. Hua
China National Japonica Rice R&D Center, Tianjin 300457, People’s Republic of China
1214 F. Wang et al.
130.1 Introduction
Rice is the most important cereal crop with about 40 % of total grain production in
China. Rice protein is the best among cereals because of the biological value,
digestibility, and net protein utilization [1, 2]. But rice is usually a low protein crop
compared with other cereals. The protein content depends on the genetic and
environmental factor. At present, the way to increase the protein content of rice
depends on breeding and applying Nitrogenous fertilizer. Studying the accumu-
lation laws of rice protein during seed development is helpful for early selecting
rice variety with high protein content at a particular period never need to wait until
the seed maturation. On the other hand, it can be used as a guidance at the time of
applying Nitrogenous fertilizer to promote the protein accumulation during rice
seed development.
130.2.1 Materials
Z601, the japonica rice varieties, was grown in rice growing season in 2011 on the
experimental farms of Tianjin rice original seed farm, in Tianjin (39.08 oN, 117.12
o
E), China. The seeds were marked on the glume on the flowering day by black
marker pen and collected the seeds on 5, 10, 15, 20, 25 DAF, respectively.
130.2.2 Determination of Protein Content
Protein contents were determined by Hanon K9840 Auto Kjeldahl Analyzer (Jinan
Hanon Instruments Co.,Ltd), according to AACC method 46-13 (2000). Each
sample was taken 0.2 g and twice repeats were carried out.
130.2.3 SDS-PAGE
Protein component analysis was conducted according to S.Iida [3]. Each seed
sample of different developmental stage was taken 0.2 g and ground to powder in
liquid nitrogen and then added 2 9 SDS-PAGE buffer, vortex several seconds and
then it was put on the shaking table at 40 C for 12 h, and centrifuged at the speed
of 8,000 r/min for 20 min at 4 C. The supernatant was transferred to a new EP
tube for analysis by SDS-PAGE or stored at -20 C until use. Samples of
extractable proteins were separated on 15 % SDS-PAGE gels (13 cm length)
130 Study on the Accumulation Laws of Protein 1215
Fig. 130.1 The rice seed

protein accumulation law
according to [4] and stained with Coomassie Brilliant Blue R250 (Sigma, St Louis,
MO, USA) according to [5]. Three repeats of each sample were carried out.
Quantitative analysis of polypeptide bands was carried out by Quantity One 4.6.2.
130.3.1 The Accumulation Law of Rice Protein During Seed

Development
The rice seeds of 5, 10, 15, 20, 25 DAF were collected to determine protein
content by Auto Kjeldahl Analyzer. All the samples were tested twice showing the
same trend of protein accumulation during the seed development. The protein
content was very low and accumulated slowly in the seeds before 15 DAF. The
protein accumulation surge stage was at the period of 15–20 DAF with protein
content increasing from 0.0788 to 0.14735 g/100 g, almost enhancing one time,
and then the protein accumulation speed slowed down and tended to stable
(Fig. 130.1).
130.3.2 SDS-PAGE Analysis of Protein Components
In order to investigate the difference of protein components during seed devel-

opment in rice, the proteins were extracted from seeds at different developmental
stage and assayed by SDS-PAGE (Fig. 130.2).
Further quantitative analysis of polypeptide bands in Fig. 130.2 was carried out
by Quantity One 4.6.2 (Bio-Rad Laboratories, Inc.). According to previous report,
each polypeptide composition has different molecular weight [6], glutelin
1216 F. Wang et al.
Fig. 130.2 SDS-PAGE

analysis of total protein at
various stages of rice seed
development M, marker; The
letters above each lane
indicated the day numbers
after flowering
Table 130.1 Percentage of DAF (d) Albumin (%) Globulin (%) Glutenin (%) Gliadin (%)
protein components during
seed development in rice 5 71.13 28.87
10 19.12 14.18 49.00 17.70
15 23.62 13.31 47.46 15.02
20 24.25 14.71 47.46 13.58
25 22.36 14.12 48.07 15.45
(22–23,37–39,57 k Da), albumin (16,76 kDa), globulin (26 kDa), and gliadin
(13 kDa).
Table 130.1 showed the percentage of different components. It clearly exhibited
the percentage of the main protein component to the total protein. The protein
components in the seeds of 5 DAF contained only glutenin and gliadin, albumin
and globulin were not detected. Glutenin was easy to detect because of its high
content which consists with Tanaka et al. [7]. From 10 DAF, the percentage of
protein component tends to be stable. The albumin occupies 20 % and globulin
14 % of the total protein. The proportion of gliadin slowed down from 28 % at 5
DAF to 17 % at 10 DAF and then stayed at about 15 %. The value of glutenin was
much higher than the other components during all the developmental stages of rice
seeds which could reach about 48 % of total protein.
130.4 Conclusion
This paper provides a protein accumulation profile of seed development in the

japonica rice variety Z601. The analysis indicated that the developmental stage at
15 DAF can be considered as a change in direction in protein synthesis, peaking at
20 DAF as shown in Fig. 130.1. The study result could be used as guidance for
selecting rice variety with high protein content at early stage of 20 DAF and settle
the time and amount of applying Nitrogenous fertilizer to promote the protein
accumulation for common rice variety.
130 Study on the Accumulation Laws of Protein 1217
Acknowledgments This work was supported by National High-tech R&D Program of China
(863 Program) (Grant No. 2011AA10A101), Natural Science Foundation of Tianjin, China
(Grant No. 11ZCKFNC01200) and the National Natural Science Foundation of China Grant
(No.31271676).
References
1. Tanaka K, Sugimoto T, Ogawa M (1980) Isolation and characterization of two types of protein
bodies in the rice endosperm. Agric Biol Chem 44:1633–1639
2. Cagampang GB, Cruz LJ, Espiritu SG (1966) Studies on the extraction and composition of rice
protein. Cereal Chem 43:145–155
3. Iida S, Amano E, Nishio T (1993) A rice (Oryza sativa L.) mutant having a low content of
glutelin and a high content of prolamine. Theor Appl Genet 87:374–378
4. Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of
bacteriophage T4. Nature 227:680–685
5. Devouge V, Rogniaux H, Nesi N et al (2007) Differential proteomic analysis of four near-
isogenic Brassica napus varieties bred for their erucic acid and glucosinolate contents.
J Proteome Res 6:1342–1353
6. Ogawa M, Kumamaru T, Satoh H et al (1987) Purification of protein body-purification of
protein body-I of rice seed and its polypeptide composition. Plant Cell Physiol 28:15
7. Tanaka K, Sugimoto T, Ogawa M et al (1980) Isolation and characterization of two types of
protein bodies in rice endosperm. Agric Biol Chem 44:1633–1639
Chapter 131
Prevalence Investigation of Tetracycline
Resistant Bacteria in Raw Milk
Xiaomei Zhang and Hongjiang Yang
Abstract To evaluate the prevalence of tetracycline resistant bacteria in raw milk,

totally 198 raw milk samples were collected from Hohhot, Inner Mongolia.
Preliminary screening results showed that 187 isolated strains were resistant to
tetracycline. Fifteen strains were randomly selected for comparative 16S rRNA
analysis, and they belonged to different genera including Serratia (5), Pseudo-
monas (4), Bacillus (1), Providencia (1), Enterobacter (1), Staphylococcus (1),
Acinetobacter (1), and one unclassified Bacillales strain, respectively. Their tet-
racycline resistance phenotype was further validated with K–B disk diffusion
method, and 11 strains were resistant to tetracycline and 4 isolates intermediate.
Tetracycline resistant determinants were investigated by PCR method. Gene
tetAC, tetB, and tetK were found in 11, 8, and 1 isolates, respectively. Furthermore,
their hemolytic phenotypes were also characterized. The results showed that tet-
racycline resistant bacteria with a relatively high diversity commonly existed in
raw milk with a high prevalence.

Keywords Raw milk Tetracycline resistant bacteria Prevalence Tetracycline
resistant determinant
131.1 Introduction
Food-borne illness was caused by various pathogens during every stage of pro-
duction, and it is mainly related to animal source foods especially milk [1, 2]. Raw
milk is natural habitat of Lactobacillus, Pseudomonas, Staphylococcus aureus,
Escherichia coli, Micrococcaceae, and yeast [3, 4].
X. Zhang H. Yang (&)

Tianjin Key Laboratory of Industrial Microbiology, Ministry of Education, College of
Biotechnology, Tianjin University of Science and Technology, Tianjin 300457, China
1220 X. Zhang and H. Yang
To prevent and control pathogens which may cause infections of cow, a variety
of antibiotics are widely used as feed additives in raw milk production. The mainly
applied antibiotics included penicillins, tetracycline, amino glycosides, macrolide,
and polypeptides [5, 6]. With the extensive application of antibiotics, various
resistant bacteria have been isolated from clinical and environmental specimens.
Among the antibiotics resistant microbes, methicillin-resistant Staphylococcus
aureus (MRSA) is resistant to almost all antibiotics treatment and has been heavily
studied [7].
Tetracycline was discovered in the 1940s. Due to its broad spectrum of bac-
tericidal activity and low cost, it has been widely used in infection treatment and as
feed additives for growth promotion in animal husbandry. In 1953, the first tet-
racycline resistant strain was isolated during a Shigella outbreak in Japan [8].
Currently, with the widely use of tetracycline, tetracycline resistance phenotype
has been found in a variety of bacteria including pathogens and commensal flora
[9, 10], raising great concerns to human health and food safety issues. The
increasing emergence of tetracycline resistance in bacteria is often due to the
acquisition of horizontally transferred genes encoding various tetracycline resis-
tance determinants [9].
The tetracycline resistance mechanisms mainly included efflux pumps [8],
ribosomal protection [9, 11], enzymatic inactivation, and target modification [9,
12, 13]. Until recently, in both Gram negative and positive microorganisms, there
were many genes have been identified relating to the tetracycline resistance phe-
notype. Most genes are responsible for encoding efflux pumps proteins, such as
tet(AC), tet(B), tet(D), tet(E), tet(G), tet(H), tet(I), tet(J), tet(Z), tet(30), tet(31),
tet(K), tet(L), otr(B), tcr3c, tetP(A), tet(V), and tet(Y). Some genes are responsible
for ribosomal protection, such as tet(M), tet(O), tet(S), tet(W), tet(Q), tet(T), otr(A),
and tetP(B). Gene tet(X) is involved in enzymatic inactivation of the antibiotic [9].
In this study collected 198 raw milk samples and investigated the prevalence of
tetracycline resistant bacteria in raw milk samples. Determinants for tetracycline
resistance were also identified by PCR method.
131.2.1 Materials
Raw milk samples were collected from Tuoketuo county, which is located at
11120 3000 –111320 2100 E longitude and 4050 3500 –40350 1500 N latitude, north of
the Yellow River, in Hohhot, Inner Mongolia. Sampling process was compliance
with aseptic procedures strictly. Briefly, rinsing udder with warm water, sterilizing
udder with 0.2 % benzalkonium bromide, and disinfecting teat with 75 % alcohol.
Hand milking was performed and milk samples were collected in sterile tubes after
dumping the first three squirts to clean out the teat [14]. The samples were stored at
4 C before analyzing.
131 Prevalence Investigation of Tetracycline Resistant Bacteria in Raw Milk 1221
131.2.2 Screening of Tetracycline Resistant Bacteria
Milk sample was subjected to 10-fold serial dilutions before spreading on plates.
In brief, 100 lL mixtures of diluted samples were spread on Luria–Bertani (LB)
agar plates with tetracycline (16 lg/mL). The plates were incubated at 35 C for
16–18 h and the results were recorded.
131.2.3 Comparative Analysis of 16S rRNA Gene
Genomic DNA was extracted from bacterial cells harvested from overnight cul-
ture of the isolated strains according to methods described previously [15, 16].
The purified chromosome DNA was used as templates for 16S rRNA gene
amplified. PCR was performed as described and specific primers used are listed in
Table 66.1 [17].
The parameters for PCR included initial denaturation at 94 C for 5 min, 30
cycles of denaturation at 94 C for 40 s, annealing at 51 C for 2 min, and
extension at 72 C for 3 min, and 1 cycle of extension at 72 C for 15 min.
Purified amplification products were subjected to sequencing analysis with the
same primers used in PCR [18]. Sequence similarity was analyzed with BLAST
provided by NCBI for strains identification [19]. Classifier program was used to
classify the isolates based on the 16S rRNA gene sequences [20].
131.2.4 Hemolysis Test
The isolates were tested for their hemolytic properties on blood agar plates [21].
The isolated strains were streaked on the plates and incubated at 35 C for 24 h.
Colony morphology and hemolytic zones around colonies were recorded after
incubation.
Table 66.1 Primers sequences

Genes Primers Primer sequences Amplicon size References
16S rRNA 27F 50 AGAGTTTGATCATGGCTCAG 30 *1465 bp [17]
1492R 50 GGTACCTTGTTACGACTT 30 [17]
tet(AC) tetAC–F 50 GCTRTATGCGTTGRTGCAAT 30 567 bp [24]
tetAC–R 50 TCCTCGCCGAAAATGACC 30 [24]
tet(B) tetB–F 50 TTGGTTAGGGGCAAGTTTTG 30 704 bp [25]
tetB–R 50 GTAATGGGCCAATAACACCG 30 [25]
tet(K) tetK–F 50 CCTGGAATTACAAACTGGGT 30 1080 bp [26]
tetK–R 50 CCTCCTACAATTGCTATACC 30 [26]
tet(M) tetM–F 50 GTTAAATAGTGTTCTTGGAG 30 657 bp [27]
tetM–R 50 CTAAGATATGGCTCTAACAA 30 [27]
131.2.5 Tetracycline Resistance Validation with K–B Disk

Diffusion Method
K–B disk diffusion method was used to test tetracycline resistance phenotype of
the isolates and it was performed according the descriptions [22]. In brief, over-
night isolate culture was diluted to suspension of 1.5 9 108 cfu/mL with sterile
phosphate buffered saline, and 100 lL was spread on MH agar plate. The tetra-
cycline disk was attached to the premarked position and the diameters of zones of
inhibition were measured after 16–18 h incubation at 35 C. Antibiotic suscepti-
bility was determined according to the manual of Clinical and Laboratory Stan-
dards Institute (CLSI) [23].
131.2.6 Tetracycline Resistance Related Genes Screening
A series of genes have been found related to tetracycline resistance in both Gram
negative and positive bacteria. With the identification of the isolates by compar-
ative analysis of 16S rRNA, the primers are selected to amplify tetracycline
resistance genes based on the previous studies [9]. The sequences of primers and
the amplicon sizes are listed in Table 66.1. The PCR reactions are performed
according to the previous descriptions [24–27].
131.3.1 Screening of Tetracycline Resistant Bacteria
Diluted milk samples were spread on LB agar plates supplement with 16 lg/mL
tetracycline. Totally, 187 strains were isolated from 198 raw milk samples. Among
the isolates, some of them were from the same samples but with different mor-
phologies. Screening results showed that 98 (49.49 %) samples had tetracycline
resistant strains, similar to the previous studies [28].
Fifteen strains were randomly selected for comparative 16S rRNA analysis
(Table 66.2). Five strains belonged to the genus Serratia. They were harmful
human pathogen [29] or insect pathogen [30] (KDZ411). Four strains were
homologous to Pseudomonas aeruginosa, an opportunistic and important noso-
comial human pathogen [31]. Strain KDZ420 was homologous to Bacillus cereus
Table 66.2 16S rRNA sequence homology alignments of the isolates

Isolates No. Homologous strains Maximum identity (%)
KDZ411 Serratia nematodiphila POT3 99
KDZ412 Serratia marcescens N2.4 99
KDZ418 Serratia marcescens XJCS-MB-3 99
KDZ413 Pseudomonas aeruginosa HNYM41 100
KDZ414 Pseudomonas aeruginosa R13 99
KDZ417 Pseudomonas aeruginosa F1 99
KDZ422 Pseudomonas aeruginosa S2QPS8 99
KDZ415 Bacillus cereus SWFU2816 90a
KDZ420 Bacillus cereus HKS1-1 97
KDZ419 Providencia rettgeri SNCO1_1A 98
KDZ421 Enterobacter cloacae MS2 99
KDZ423 Staphylococcus pasteuri Z1 99
KDZ424 Acinetobacter junii NW123 99
a
Strain KDZ415 is homologous to Bacillus cereus SWFU2816 with the similarity of 90 % and it
can only be classified to the order of Bacillales with the confidence of 97 %
causing food-borne illness [32]; KDZ419 was Providencia rettgeri, also an

opportunistic human pathogen [33]; KDZ421 was Enterobacter cloacae, an
important nosocomial pathogen responsible for various infections [34]; KDZ423
was Staphylococcus pasteuri, a Gram positive bacterium emerging as an agent of
nosocomial infections [35, 36]; KDZ424 was Acinetobacter junii, a rare human
pathogen associated with bacteraemia in neonates and pediatric oncology patients
[37]. KDZ415 only showed 90 % similarity to the known sequences in databases
of GenBank and cannot be assigned to specific genus [38]. After analysis with
Classifier in RDPII, strain KDZ415 was tentatively assigned to the order Bacillales
with 97 % confidence [39].
131.3.3 Tetracycline Resistance Validation and Hemolysis

Test of Part of the Isolates
The tetracycline-resistant phenotypes were validated by K–B disk fusion method.

The results showed that 11 isolates resistant to tetracycline (R) and 4 isolates were
intermediate (I) (Table 66.3). No strain was found susceptible to tetracycline. The
results suggested that LB agar plates with antibiotics were suitable for primary
screening of antibiotic resistant bacterial strains from clinical or environmental
samples.
To investigate the virulence of the 15 isolates, their hemolytic properties were
analyzed with blood agar plates. Beta-hemolysis was observed in 4 strains
including one P. aeruginosa strain, one S. marcescens strain, one B. cereus strain,
Table 66.3 Characterization of the tetracycline resistant strains

Isolates Identity Resistance Hemolysis Resistance tet(AC) tet(B) tet(K) tet(M)
genesa
KDZ411 S. nematodiphila tet(AC), tet(B) c R •
KDZ412 S. marcescens tet(AC), tet(B) c I
KDZ416 S. marcescens tet(AC), tet(B) c R • •
KDZ418 S. marcescens tet(AC), tet(B) c R • •
KDZ425 S. marcescens tet(AC), tet(B) b R • •
KDZ413 P. aeruginosa tet(AC) a R • •
KDZ414 P. aeruginosa tet(AC) c R •
KDZ417 P. aeruginosa tet(AC) b R •
KDZ422 P. aeruginosa tet(AC) c R •
KDZ415 Unclassifiedb tet(K), tet(M) b R • •
KDZ420 B. cereus tet(K), tet(M) b I
KDZ419 P. rettgeri tet(B) c R • •
KDZ421 E. cloacae tet(B) c I • •
KDZ423 S. pasteuri tet(K), tet(M) c R • •
KDZ424 A. junii tet(M) c I
a
The resistance genes are the main determinants found in the species
b
KDZ415 is an unclassified Bacillales strain
and one unclassified Bacillales strain, a-hemolysis in 1 strain, and c-hemolysis in

10 strains (Table 66.3), indicating the widely existence of virulence factors in the
isolates [29, 33–37].
131.3.4 PCR Screening of Tetracycline Resistance Genes
Primers specific for amplification of genes tet(AC), tet(B), tet(K), and tet(M) were
used to screen tetracycline resistance determinants in the isolates.
All tetracycline resistant strains had one or two resistance related genes, while
the tetracycline intermediate strains were negative in amplification of the target
genes except strain KDZ421 which was E. cloacae had gene tet(AC) and
tet(B) (Table 66.3). The results indicated gene tet(AC) and tet(B) were the most
discovered genes relating to tetracycline resistance phenotype. Previous studies
have shown that gene tet(A), tet(B), tet(C), tet(D), tet(E), tet(G), tet(H), tet(I),
tet(J), tet(Z), tet(30), tet(31), tet(K), tet(L), otr(B), tcr3c, tetP(A), tet(V), and
tet(Y) were widely distributed among different Gram negative genera [9, 40]. They
encoded proteins for various efflux pumps extruding tetracycline out of cells.
Among them, the most common tet genes identified were gene tet(AC) and
tet(B) [9, 41, 42]. However, Gram positive strains KDZ415 and KDZ423 were
shown having tetracycline resistant gene tet(AC) and tet(B), suggesting resistance
determinants could be horizontally transferred even across far distant species and
bringing in a high-profile biosafety issue [43].
131.4 Conclusions
By screening 197 collected raw milk samples, we obtained 187 tetracycline

resistant strains from 98 samples and the prevalence rate was as high as 49.49 %
(98/197). The resistance phenotypes were further confirmed with K–B disk dif-
fusion method. With the comparative 16S rRNA analysis of 15 randomly selected
strains, the isolates were identified belonging to different genera including Serratia
(5), Pseudomonas (4), Bacillus (1), Providencia (1), Enterobacter (1), Staphylo-
coccus (1), Acinetobacter (1), and one unclassified Bacillales strain, respectively.
In addition, tet genes were also investigated by PCR method. All tetracycline
resistant strains had one or two tetracycline resistance related genes, and gene
tet(AC) and tet(B) were the most discovered genes. Moreover, gene tet(AC) and
tet(B) were even detected in Gram positive strains KDZ415 and KDZ423, sug-
gesting resistance determinants could be horizontally transferred even across far
distant species and bringing in a high-profile biosafety issue. Our results showed
that tetracycline resistant bacteria with a relatively high diversity commonly
existed in raw milk with a high prevalence.
References
1. Asao T, Kumeda Y, Kawai T et al (2003) An extensive outbreak of staphylococcal food

poisoning due to low-fat milk in Japan: estimation of enterotoxin A in the incriminated milk
and powdered skim milk. Epidemiol Infect 130:33–40
2. Jorgensen HJ, Mork T, Hogasen HR et al (1999) Enterotoxigenic Staphylococcus aureus in
bulk milk in Norway. Appl Microbiol 99(1):158–167
3. Desmasures N, Bazin F, Gueguen M (1997) Microbiological composition of raw milk from
selected farms in the Camembert Region of Normandy. Appl Microbiol 83:53–58
4. Desmasures N, GUEGUEN M (1997) Monitoring the microbiology of high quality milk by
monthly sampling over two years. Dairy Res 64:271–280
5. Yamamoto K, Takagi M, Endoh YS et al (2000) Influence of antibiotics used as feed
additives on the immune effect of erysipelas live vaccine in swine. J Vet Med B Infect Dis
Vet Public Health 47(6):453–460
6. Docic M, Bilkei G (2003) Differences in antibiotic resistance in Escherichia coli, isolated
from East-European swine herds with or without prophylactic use of antibiotics. J Vet Med B
Infect Dis Vet Public Health 50(1):27–30
7. Sievert DM, Boulton ML, Stoltman G et al (2002) Staphylococcus aureus resistant to
Vancomycin—United States. MMWR 51(26):565–567
8. Akiba T, Koyama K, Ishiki Y et al (1960) On the mechanism of the development of multiple-
drug-resistant clones of Shigella. Jpn J Microbiol 4:219–227
9. Chopra I, Roberts M (2001) Tetracycline antibiotics: mode of action, applications, molecular
biology, and epidemiology of bacterial resistance. MMBR 65(2):232–260
10. Roberts MC (1996) Tetracycline resistance determinants: mechanisms of action, regulation
of expression, genetic mobility, and distribution. FEMS Microbiol Rev 1(19):1–24
11. Burdett V (1986) Streptococcal tetracycline resistance mediated at the level of protein
synthesis. Bacteriol 165:564–569
12. Ross JI, EADY EA, COVE JH et al (1998) 16S rRNA mutation associated with tetracycline
resistance in a Gram-positive bacterium. ANTIMICROB AGENTS CH 42:1702–1705
13. Yang W, Moore IF, Koteva KP et al (2004) TetX is a favin-dependent monooxygenase
conferring resistance to tetracycline antibiotics. Biol. Chem. 279:52346–52352
14. Yuan Y, Zhang Y, Hou Y et al (1991) The isolation and identification procedures of cow
mastitis bacteria. Chin J Vet Sci Technol 21(2):7–10
15. Fitzgetald JR, Meaney WJ, Hartigani PJ (1997) Fine-structure molecular epidemiological
analysis of Staphylococcus aureus recovered from cows. Epidemiol Infect 119(5):261–269
16. Shinefield HR (2006) Use of a conjugate polysaccharide vaccine in the prevention of invasive
staphylococcal disease: is an additional vaccine needed or possible. Vaccine 24(2):65–69
16S ribosomal DNA from chloroethene-contaminated sites throughout North America and
Europe. Appl Environ Microb (AEM) 68(2):485–495
18. Roe DE, Braham P, Weinbetg A, et al (1995) Characterization of tetracycline resistance in
Actinobacillus actinomycetemcomitans. Oral Microbiol Immunol 10:227–232
19. Tiedje JM, Wang QG, Garrity M et al (2007) Naive Bayesian classifier for rapid assignment
of rRNA sequences into the new bacterial taxonomy. Appl Environ Microb (AEM)
73(16):5261–5267
20. Janda JM, Sharon L (2007) 16S rRNA gene sequencing for bacterial identification in the
diagnostic laboratory: pluses, perils, and pitfalls. J Clin Microbiol 45(9):2761–2764
21. Johnson MK, Boese-Marrazzo D (1980) Production and properties of heat-stable
extracellular hemolysin from Pseudomonas aeruginosa. Infect Immun 29(3):1028–1033
22. Kastner S, Perreten V, Bleuler H et al (2006) Antibiotic susceptibility patterns and resistance
genes of starter cultures and probiotic bacteria used in food. Syst Appl Microbiol 29:145–155
23. CLSI/(NCCLS) (2005) Performance standards for antimicrobial susceptibility testing.
Fifteenth Informational Supplement, 25(1):44–51, 110–115
24. Jones CH, Tuclman M, Howe AYM et al (2006) Diagnostic PCR analysis of occurrence of
methicillin and tetracycline resistance among Staphylococcus aureus isolates from phase 3
clinical trials of tigecycline for complicated skin and skin structure infection. Antimicrob
Agents Chemother 20(2):505–510
25. Yu Z, Michel FC Jr, Hansen G et al (2005) Development and application of real-time PCR
assays for quantification of genes encoding tetracycline resistance. APPL ENVIRON
MICROB (AEM) 71(11):6926–6933
26. Rahman MH, Sakamoto KQ, Nonaka L et al (2008) Occurrence and diversity of the
tetracycline resistance gene tet (M) in enteric bacteria of Antarctic adelie penguins.
J Antimicrob Chemoth 62(3):627–628
27. Liu W-H, Xu Y-D, Guo A-Z, Jia A-Q, Liu J-F, Chen H-C (2006) PCR amplification of tetB
gene for pathogenic Salmonella isolated from diseased pigs. Chin J Antibiot 31(11):51–55
28. Huys G, D’Haene K, Collard J-M et al (2004) Prevalence and molecular characterization of
tetracycline resistance in Enterococcus isolates from food. Appl Environ Microbiol
70(3):1555–1562
29. Kurz CL, Chauvet S, Andrès E et al (2003) Virulence factors of the human opportunistic
pathogen Serratia marcescens identified by in vivo screening. EMBO J 22:1451–1460
30. FLYG C, Kenne K, Boman HG (1980) Insect pathogenic properties of Serratia marcescens:
phage-resistant mutants with a decreased resistance to Cecropia immunity and a decreased
virulence to Drosophila. Microbiology 120(1):173–181
31. Pier GB (2002) CFTR mutations and host susceptibility to Pseudomonas aeruginosa lung
infection. Curr opin Microbiol 5(1):81–86
32. BBI (2001) International status of large scale production and use of fuel ethanol in Brazil.
World Fuel Ethanol Congress, Beijing
33. Camus AC, HawkeJP (2002) Providencia rettgeri-associated septicemia and

meningoencephalitis in juvenile farmed American alligators Alligator mississippiensis.
J Aquat Anim Health 14(2):149–153
34. Mezzatesta ML, Gona F, Stefani S (2012) Enterobacter cloacae complex: clinical impact and
emerging antibiotic resistance. Future Microbiol 7(7):887–902
35. Widerström M, Wiström J, Sjöstedt A et al (2012) Coagulase-negative staphylococci: update
on the molecular epidemiology and clinical presentation, with a focus on Staphylococcus
epidermidis and Staphylococcus saprophyticus. Eur J Clin Microbiol 31(1):7–20
36. Carpaij N, Willems RJL, Bonten MJM et al (2011) Comparison of the identification of
coagulase-negative staphylococci by matrix-assisted laser desorption ionization time-of-flight
mass spectrometry and tuf sequencing. Eur J Clin Microbiol 30(10):1169–1172
37. Cayô R, San Segundo LY, del Molino Bernal ICP et al (2011) Bloodstream infection caused
by Acinetobacter junii in a patient with acute lymphoblastic leukaemia after allogenic
haematopoietic cell transplantation. J Med Microbiol, 60(3):375–377
38. Goebel BM, Stackebrandt E (1999) A place for DNA–DNA reassociation and 16S rRNA
sequence analysis in the present species definition in bacteriology. Int J Syst Bacteriol,
94(44):846–849
39. Cole J et al (2005) The ribosomal database project (RDP-II): sequences and tools for high-
throughput rRNA analysis. Nucleic Acids Res 33:294
40. Roberts MC (2012) Acquired tetracycline resistance genes. Antibiot Discov Devel 3:543–568
41. Costa D, Poeta P, Sáenz Y et al (2008) Prevalence of antimicrobial resistance and resistance
genes in faecal Escherichia coli isolates recovered from healthy pets. Vet Microbiol
127(1–2):97–105
42. Santamaría J, López L, Soto CY (2011) Detection and diversity evaluation of tetracycline
resistance genes in grassland-based production systems in Colombia, South America. Front
Microbiol 2:252
43. Rizzotti L, La Gioia F, Dellaglio F et al (2009) Molecular diversity and transferability of the
tetracycline resistance gene tet(M), carried on Tn916-1545 family transposons, in enterococci
from a total food chain. Anton Leeuw Int J G 96(1):43–52
Chapter 132
Study on Biological Denitrification
Removal Technologies Treating
Eutrophication Water
Zongzheng Yang, Huan Zhang, Deqiang Zhang and Jinzhao Pang
Abstract In this paper, efficient bacteria including photosynthetic bacteria,

nitrifying bacteria, compound bacteria, etc., were applied to degrade pollutants of
the urban lakes. The results showed that the removal rates of organic substances,
chlorophyll-a and nitrogen compounds were 60, 90, and 50 %, respectively.
Moreover, dissolved oxygen (DO) content increased from 1 to 7 mg/L and pH
value remained at about eight by adding microbes. The conclusion can be drawn
that it is a feasible method for adding microbes into eutrophication water for its
decontamination.
Keywords Efficient bacteria Eutrophication Sewage decontamination

Bioaugmentation
132.1 Introduction
The urban landscape water is mostly static or closed and the fluidity of the water is
poor. Some of them even appear in different degrees of eutrophication, which
seriously affects the surrounding natural and living environment, and then the
Z. Yang (&) J. Pang

Tianjin Key Laboratory of Pulp and Paper, Tianjin University of Science & Technology,
e-mail: yzz3520@163.com
H. Zhang
College of Marine Science and Engineering, Tianjin University of and Technology, Tianjin
300457, People’s Republic of China
D. Zhang
Tianjin Qing Shuo Environmental Protection Engineering Co., Ltd, Tianjin 300451,
1230 Z. Yang et al.
Table 132.1 The quality of the original water

pH Turbidity NH4+-N CODMn DO Chlorophyll-a
(NTU) (mg/L) (mg/L) (mg/L) (mg/m3)
7.7–8.1 55–65 0.7–1 13–17 0.8–1.5 118–130
function of the landscape water is lost [1]. So it is of significance to study the

eutrophication water and protect water environment.
Now, the controlling methods of the landscape water eutrophication include
physical, chemical, biological methods, and ecological restoration and the treat-
ments have achieved good results. Zhang et al. used the diving aerating method to
remediate the urban landscape water [2]. Yuan et al. used the coagulant which
contained aluminum sulfate (Al2(SO4)318H2O) and ferric chloride (FeCl36H2O) to
remove the algae and phosphorus of the eutrophication landscape water [3].
Domaizon and Devaux researched the different densities of silver carps to remove the
algae [4]. Joebgen et al. used biological floating island to repair the eutrophication
water [5]. In this paper, the bioaugmentation technology was used to control the
growth of the algae of the water, to inhibit the growth of the algae by the biodeg-
radation of organic pollutants of the water, to prevent the occurrence of water bloom,
and to improve the quality of the landscape water. The removal rate of the organic
substances was significantly improved by using the efficient bacteria to treat urban
wastewater, and the production of solid substances was reduced. Moreover, nitrifi-
cation can be enhanced and the denitrification efficiency of sewage can be improved.
132.2.1 Test Water
The serious eutrophicatized water was taken from ‘‘Jingye Lake’’ in Tianjin
University campus (the quality of lake water was shown in Table 132.1) and
subpackaged in 350-L white plastic buckets. The water in Bucket 1 was left
untreated and used as the control; while the water in Bucket 2 and 3 was treated
successively by nitrifying bacteria, photosynthetic bacteria, and compound bac-
teria, with the interval of 1d. The total concentration of three kinds of bacteria was
50 mg/L for bucket 1, and 100 mg/L for bucket 2. The total bacteria concentrations
of the two buckets were 50 and 100 mg/L, respectively. The water temperature
during the test was between 24 and 30 C.
132.2.2 Test Methods
CODMn Acidic potassium permanganate index;

132 Study on Biological Denitrification Removal Technologies 1231
Ammonia Condensed sedimentation pretreatment, Nessler’s reagent

spectrophotometry;
Chlorophyll-a 90 % acetone extraction, spectrophotometer (722, Shanghai
Optical Instrument Factory, China);
Turbidity Optical turbidity meter (GDS-3B, Shanghai Jianglai Experiment
Equipment Co., Ltd., China);
DO Portable oxygen analyzer (IPB-60T, Shanghai Precision &
Scientific Instrument Co., Ltd., China);
pH value pH meter (PHS-3C, Tianjin Huayi Shengda Instrument Co., Ltd.,
China)
132.3.1 The Removal of CODMn
The organic substances were mainly from decomposing plants and animals,
domestic sewage, and industrial wastewater discharged. A large number of organic
substances in the water caused algae multiplication and DO reduced. Therefore, it
is very important to remove CODMn. CODMn changed with time is shown in
Fig. 132.1.
In Fig. 132.1, it is shown that CODMn of the untreated water appeared as the
maximum value 22.1 mg/L on the 7 day, and this value was much higher than the
initial value 13.8 mg/L. Moreover, the fluctuation of the untreated water was much
bigger, but the other CODMn curves with bacteria showed declining trends. Its
removal rate was more than 50 % with the bacteria concentration of 100 mg/L on
the 5th day. The results showed that efficient bacteria had a good function of
CODMn removal. And it can also be seen that the curve with the bacteria
Control 50mg/L 100mg/L

25
COD Mn (mg/L)
20
15
10
5
0
1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35
time (d)
Fig. 132.1 CODMn changed with time

1232 Z. Yang et al.
concentration of 100 mg/L had a much greater decline trend. So it is shown that
the removal rate of CODMn increased with the increasing bacterial concentration.
132.3.2 The Removal of NH4+-N
Ammonia nitrogen in the water was first converted into nitrate nitrogen by nitrifying
bacteria, and then nitrate nitrogen was converted into nitrogen by denitrifying
bacteria, releasing to the atmosphere. Concentration of NH4+-N changed with time
is shown in Fig. 132.2.
In Fig. 132.2, NH4+-N value increased to a certain extent during the early days
after bacteria inputting. That is because nitrogen compounds were converted into
ammonia nitrogen, then ammonia nitrogen was converted into nitrate nitrogen
mainly by nitrifying bacteria. Nitrifying bacteria are strict autotrophic bacteria.
Moreover, nitrifying bacteria adapt to the environment relatively slow, and the
growth rate and metabolism are also very slow. So that NH4+-N value descend rate
was very slow at the beginning of the test. And the growth rate of nitrifying
bacteria and nitrification rate were also low at this period. Its removal rate was
more than 50 % with the bacteria concentration of 100 mg/L on the 5th day.
Furthermore it can also be seen that the curve had a much greater decline trend
with bacteria concentration of 100 mg/L, in comparison with that of bacterial
concentration 50 mg/L. So it is shown that the removal rate of NH4+-N increased
with increasing bacteria concentration. It can be found that the fluctuation of
NH4+-N and CODMn value accorded well with each other by comparing
Figs. 132.1 and 132.2, because the complex organic substances in the wastewater
were decomposed gradually [6].

1.8
1.6
NH 4 -N (mg/L)
1.4
1.2
1
0.8
0.6
+
0.4
0.2
0
1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33
time (d)
Fig. 132.2 NH4+-N changed with time

70 Control 50mg/L 100mg/L

60
Turbidity (NTU) 50
40
30
20
10
0
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18
time (d)
Fig. 132.3 Turbidity changed with time
132.3.3 The Removal of Turbidity
Water turbidity is caused mainly by the substances such as sand, clay, protozoa,
algae, bacteria, virus, and organic polymer. Turbidity changed with time is shown
in Fig. 132.3.
In Fig. 132.3, water turbidity decreased obviously. Because the organic sub-
stances was degraded by efficient bacteria, supernatant turbidity of water sample
with the bacteria concentration of 100 mg/L dropped from 62NTU(?) to about
7NTU(?) on the 8th day, and the removal rate of turbidity was about 88 %. The
decrease rate of turbidity became faster with increase in bacteria concentration.
Turbidity of the untreated water also decreased because of natural settling, but the
decline trend was slower than the test.
8 Control 50mg/L 100mg/L

7
6
DO (mg/L)
5
4
3
2
1
0
1 3 5 7 9 11 13 15 17 19 21 23 25 27
time (d)
Fig. 132.4 DO changed with time

1234 Z. Yang et al.
132.3.4 Effect on DO
In the lakes of the eutrophication, the algae are so dense that it was difficult for the
sunlight to penetrate into deep lake, which caused a limited and weakened pho-
tosynthesis for deep water. Moreover, the DO value of the source water is
decreased due to the accumulation of algae. Next, decomposition of died algae will
also consume a lot of DO of in the deep water. But organic substances decrease
continuously as they become microbial foodstuffs after the efficient bacterial have
been applied, which inhibit the growth of algae. As a result, DO recovers as a
result of weakened coverage of algae. DO changed with time is shown in
Fig. 132.4.
In Fig. 132.4, DO value was lower than 2 mg/L for the previous 10 days of the
test, which was mainly due to growing of nitrifying bacteria at this period. DO
value increased steadily from 2 mg/L to about 7 mg/L after the 10th day, which
was beneficial for the nitrification, and caused the decreased NH4+-N value of the
water. DO value was about 4.2 mg/L with the bacteria concentration of 50 mg/L
on the 15th day. While the DO value of the untreated water was only 2.36 mg/L. It
is shown that the bacteria method is superior to natural re-oxygenation. It can be
seen from Fig. 132.4 that DO value with higher bacteria concentration was lower
than that of lower bacteria concentration. Because the water of the high bacteria
concentration decomposed a large number of the organic substances, and then the
DO value decreased much slowly.
132.3.5 Changes of Chlorophyll-a
Contents of nitrogen and phosphorus in water are the main factors that affected the
multiplication of the algae. The higher the contents of nitrogen and phosphorus
are, the more algae become. The contents of nitrogen and phosphorus of the

chlorophyll-a(mg/m3)
150
100
50
0
7 14 21 28 35
time (d)
Fig. 132.5 Chlorophyll-a changed with time

8.2 Control 50mg/L 100mg/L
pH Value
8
7.8
7.6
7.4
0 3 6 9 12 15 18 21 24 27
time (d)
Fig. 132.6 pH value changed with time
sediment increase after the algae died or sank into the lake, since the sediment
releases nitrogen and phosphorus into the water, so that the algae grows more
quickly, and then a negative cycle is formed. Chlorophyll-a is an important
indicator of the algae. Chlorophyll-a changed with time is shown in Fig. 132.5.
In Fig. 132.5, the concentration of chlorophyll-a in three barrels decreased
significantly for a week after the bacteria being input. The reason why the control
declined was that the water can self-purify without sediment, so that nitrogen and
phosphorus of the water reduced and then the concentration of chlorophyll-a
decreased. The decreased rate of chlorophyll-a became faster with increase in the
bacteria concentration. The color of the water began to change from dark green to
clear 2 days after the bacteria treatment and the floating algae on the water also
decreased markedly [7].
132.3.6 Change of pH Values
The water maintained alkaline during the test, and the pH value was around eight
because the various bacteria coordinated with each other [8]. The pH value
changed over time is shown in Fig. 132.6.
The pH value kept stable in the testing duration of 27 days, because photo-
synthetic bacteria and compound bacteria produced alkali, and nitrifying bacteria
consumed alkali in the metabolic activities. The various bacteria maintained good
activity and appropriate metabolic conditions, so that the pH was in equilibrium.
132.4 Conclusions
(1) It was convinced that photosynthetic bacteria, nitrifying bacteria, and com-
pound bacteria behaved well in decontaminating micro-polluted water in this
paper.
1236 Z. Yang et al.
(2) The eutrophication of landscape water can be well controlled and decontam-
inated by inputting microbes, which was very simple to operate. Furthermore,
it could not form the secondary pollution or transfer pollutants.
Acknowledgments This work was financed by the Tianjin Binhai New Area Tanggu Science
and Technology Development Foundation (2010STHB09-04), China.
References
1. Shan B, Liu H (2008) Field study on usage of bio-eco treatment of circulation & purifying
system for polluted scenic water in urban areas. Chn J Environ Eng 2(5):702–706
2. Zhang Z, Zheng Z, Zhang P et al (2007) Study on re-oxygenation effect diving aerating device
repairing the urban landscape water. China Water & Wastewater 20(Supplement):207–210
3. Yuan L, Zhang W, Kong H (2009) Removal test of phosphate and algae from eutrophic
landscape water by coagulation. J Xi’an Univ Archit Technol (Nat Sci edn) 41(2):236–240
4. Joebgen A, Palm A, Melkonian M (2004) Phosphorus removal from eutrophic lakes using
periphyton on submerged artificial substrata. Hydrobiologia 528(1–3):123–142
5. Domaizon I, Devaux J (2009) Experimental study of the impacts of silver carp on plankton
communities of eutrophic Villerest reservoir. Aquat Ecol 33:193–204
6. Zonghua W, Pang J, Xinzheng W et al (2009) Study on dominant consortium treating
eutrophication water. J Nanyang Normal Univ 8(09):43–45
7. Pang J, Yang Z, Sun Y (2008) Purifying the urban lake by adding dominant bacteria. China
Water Wastewater 19(6):51–52
8. Lillie SH, Pringle JR (1980) Reserved carbohydrate metabolism in Saccharomyces cerevisiae:
response to nutrient limitation. J Bacteriol 26(4):1384–1394
Chapter 133
Study on Decolorization Effect
of Biological Strengthening the Activated
Carbon with White Rot Fungi
Zongzheng Yang, Junxia Xu, Peng Yu and Jinzhao Pang
Abstract The colority and Chemical Oxygen Demand (COD) removal rates of
biological strengthening the activated carbon with Phanerochaete chrysosporium
and Rhodopseudomonas for papermaking and printing-dyeing wastewater were
investigated. With 1 % (v/v) Phanerochaete chrysosporium, the colority removal
rate for papermaking wastewater reached 80 % at 3 h of retention time, and for
printing-dyeing wastewater at 1.5 h of retention time; the COD removal rate was
65.14 and 78.78 % respectively at 3 h of retention time. Having been treated by
1 % Rhodopseudomonas, the colority removal rate was lower than that induced by
Phanerochaete chrysosporium, and the COD removal rate was 71.35 % for
papermaking wastewater. Combined strains treatment produced the colority and
COD removal rate of 90 and 80 % respectively for papermaking wastewater. The
COD removal rate of the biological strengthening activated carbon technique
strengthened by Rhodopseudomonas first was higher than that strengthened by
Phanerochaete chrysosporium first.
Keywords Phanerochaete chrysosporium

Rhodopseudomonas Biological

activated carbon technique Papermaking wastewater Printing-dyeing waste-

water The Colority removal rate
Z. Yang (&) J. Pang

Tianjin Key Laboratory of Pulp & Paper, Tianjin University of Science and Technology,
e-mail: yzz3520@163.com
J. Xu P. Yu
1238 Z. Yang et al.
133.1 Introduction
The pollution of printing-dyeing and papermaking industry wastewater is the major

pollution in the industrial wastewater. Both of printing-dyeing wastewater and
papermaking wastewater with larger chromaticity contain a variety of toxic and
harmful substances, which can cause dying of aquatic creatures and serious envi-
ronment pollution if they are discharged directly into the natural water system [1, 2].
Discharge standard of water pollutants for pulp and paper industry(GB3544-2008)
[3] puts forward more strict effluent standards, which requires COD B 80 mg/L and
chromaticity less than 50 of the effluent. Sewage emission concentration of textile
printing and dyeing enterprise wastewater also has corresponding stipulation
(COD B 100 mg/L, chromaticity less than 50). Therefore, it is very necessary to
study the treatment methods for dyeing-printing and papermaking wastewater.
Phanerochaete can damage and eliminate chromophoric accumulation of the
printing-dyeing and papermaking wastewater by secreting special degradation
enzymes [4]. Jia Rong et al. [5]. treated printing and dyeing wastewater by
biocontact oxidation membrane-forming with white-rot fungi, found that the
decolorization rate of the mixed dye wastewater reached 79.5 %. Some researchers
treated CEH (Chloride, Enzyme treatment, Hypochlorite) bleaching wastewater
with Trichocherma sp fixed in RBC (rotating biological contactor), the decolor-
ization rate was 85 % after 3 days [6]. In practice, the treatment effect of the high
efficiency degradation immobilized bacterium is better than that of dosing directly
[7]. Activated carbon has strong adsorption ability due to its huge specific surface
area, so that the contaminants can be removed by the apposition growth micro-
organism. But the activated carbon needs to be regenerated or replaced after
adsorption saturation, which causes a lot of inconvenience. Biological intensifying
activated carbon technique is a kind of typical immobilization technology, which
can be repeatedly used by putting free microorganism in limited space and making
it keep active for a long time by using chemical or physical methods [8, 9]. It is a
very practical way that intensifying biological technology was used in combination
with the activated carbon, which not only can prolong the service life of the
activated carbon, but also can enhance the microbial degradation effect.
In this paper, the treatment effect by biological intensifying activated carbon
technique for printing-dyeing wastewater and papermaking wastewater has been
discussed. The operating parameters were optimized to achieve ideal efficiency.
133.2.1 Strains
Strain A (Phanerochaete chrysosporium) and strain B (Rhodopseudomonas) were

screened and stored in the Lab of Wastewater Treatment in Tianjin University of
Science and Technology.
133 Study on Decolorization Effect of Biological Strengthening 1239
Table 133.1 The water Item Papermaking Printing-dyeing

qualities of the two wastewater wastewater
wastewaters
COD (mg/L) 138.24 103.24
BOD (mg/L) 26.27 28.91
BOD/COD 0.19 0.28
pH 6.75 6.23
Chromaticity (multiple) 37 42
Turbidity (Nephelometric 2.35 25.9
turbidity unit)
Phanerochaete chrysosporium: slant culture was activated to prepare a

suspension. Then it was inoculated in a potato medium, and cultured at 30 C,
150 r/min to get biomass. The same treatment was applied to Rhodopseudomonas.
133.2.2 The Influent Wastewater
The papermaking wastewater was the effluent after secondary treatment of

Shandong Huatai Paper Co., Ltd., Dongying, Shandong, China.
The printing-dyeing wastewater was the effluent after anaerobic–aerobic
biological film process of a textile factory in Wujiang County, Jiangsu, China. The
water qualities for the two wastewaters are listed in Table 133.1.
133.2.3 Methods
The experiment of the printing-dyeing wastewater and papermaking wastewater

treatment was carried out in the shaker (HNY-200D, OuNuo Instrument Limited
Company, Tianjin, China) at 150 r/min, 30 C, with 4–8 mesh activated carbon as
filler and high efficient fungal strain A (Phanerochaete chrysosporium) and
bacterial strain B (Rhodopseudomonas) as cultured strains. The wastewaters were
treated according to Table 133.2. Each sample was operated in duplicate.
Chemical Oxygen Demand (COD): potassium chromate method;

Decolorization rate [10, 11]: the relationship between absorbance and wave-
length of papermaking wastewater was measured by UV–VIS spectrophotometer.
The results showed that the maximum absorption wavelength of papermaking
wastewater was at 460 nm. By measuring the absorbance reduction at maximum
1240 Z. Yang et al.
Table 133.2 The treatment of wastewater

Sample No Wastewater Strain Inoculation
amount (%)
1 Printing-dyeing A 1
2 Printing-dyeing B 1
3 Printing-dyeing A?B 1
4 Papermaking A 1
5 Papermaking B 1
6 Papermaking A?B 1
A Phanerochaete chrysosporium, B Rhodopseudomonas
absorption wavelength of supernatant of the six samples in Table 133.2, the

decolorization rates induced by different strains were determined. The supernatant
of the wastewaters were monitored every 0.5 h. If the initial absorbance concen-
tration is A, and the residual absorbance concentration is B, then the decolorization
rate is calculated by Eq. (133.1).
Decolorization rate ¼ ðA BÞ=A 100 % ð133:1Þ
133.3.1 The Decolorization Effect of Printing-Dyeing

Wastewater and Papermaking Wastewater
The samples were taken every 8 h and observed continually under a microscope
until there were a few bacteria existing in the water. So it was believed that most of
bacteria have been attached on the carriers. The decolorization rate was measured
every 1 h; the experimental results are shown in Figs. 133.1 and 133.2.
No. 1 and 3 had good decolorization effect and higher decolorization rate at
90 min. The decolorization effect of No. 2 with only Rhodopseudomonas was worst
(Fig. 133.1). The mechanism of decolorization by white-rot fungus is attribute to its
special enzyme system produced, which catalyze the oxidate redox chromophoric
groups and destroy the unsaturated conjugated bonds. Rhodopseudomonas has good
biological flocculation, which can further facilitate the decomposition of small
molecule organic pollutants. But most of the dyes are synthetic macromolecular
aromatic compounds that can not be broken down, so it is impossible to achieve the
purpose of decolorization, and its decolorization effect should be the function of
adsorption. Figure 133.2 shows the decolorization effect of papermaking waste-
water, which reflects mainly the same decolorizing law, but the highest decolor-
ization rate was reached in 180 min. According to the above phenomenon, white-rot
fungus has good biological decolorizing effect for printing-dyeing wastewater and
Fig. 133.1 Decolorization 100

No.1 No.2 No.3
effect of printing-dyeing
wastewater 80
Decolorization rate / %
60
40
20
0
0 30 60 90
Time /min
Fig. 133.2 Decolorization 100 No.4 No.5 No.6

effect of papermaking
wastewater 80
Decolorization rate / %
60
40
20
0
0 60 120 180 240 300
Time /min
papermaking wastewater, which means that white-rot fungus has wide adaptability,
non-specificity and the ability of degrading chromophoric accumulation completely.
133.3.2 The COD Removal Effect of Printing-Dyeing

Wastewater and Papermaking Wastewater
According to the above decolorization effects, the COD removal effect of the two
strains in 180 min was tested respectively; the results are shown in Figs. 133.3 and
133.4.
The COD removal effect of No. 3 and 6 with combined strains was higher than
that of the single strain. This can be attributed to extracellular peroxidase (such as
lignin peroxidase Lip and manganese peroxidase Mnp) produced by Phanerochaete
chrysosporium, which can cause a series of free radical reaction, and divide
macromolecular complex organic compounds into small molecular substances by
opening conjugated bond and benzene rings. Rhodopseudomonas has good
1242 Z. Yang et al.

retention time on COD No.1 No.3
removal rate for printing- 80
COD removal rate / %

dyeing wastewater
60
40
20
0
0 30 60 90 120 150 180
Time /min

retention time on COD No.4 No.5 No.6
removal rate for papermaking
COD removal rate / %
80
wastewater
60
40
20
0
0 30 60 90 120 150 180
Time /min
biological flocculation which can further promote small molecule organic pollutants
to accelerate the COD removal efficiency.
133.3.3 The Decolorization and COD Removal Effect

of Papermaking Wastewater with Combined Strains
The papermaking wastewater was treated respectively by biological activated

carbon with strain A, biological activated carbon with strain B, biological
activated carbon strengthened by strain A first and then strengthened by strain B,
biological activated carbon strengthened by strain B first and then strengthened by
strain A. The combination way of the two strains was divided into two stages for
15 min of each stage respectively; the experiment results are shown in Fig. 133.5.
Figure 133.5 shows that the treatment effect of the papermaking wastewater
with combined strains was better than that of the single strain at the same time.
In the beginning of 60 min, strain B showed the best COD removal effect, while
afterwards the beneficial effect of combined strains appeared gradually. Strain
B ? strain A behaved better than strain A ? strain B in terms of COD removal
Fig. 133.5 Comparison of 80

COD removal rate between strain A
single strain and combined strain B
60
COD removal rate/%

strains for papermaking strain A+strain B
wastewater strain B+strain A
40
20
0
0 30 60 90 120 150 180
Time /min
rate, with about 75 % higher COD removal rate. This is because Phanerochaete
chrysosporium degraded the macromolecular organic matter, in combination with
Rhodopseudomonas, which degraded the small molecule organic matters.
133.4 Conclusions
(1) The function of Phanerochaete chrysosporium (strain A) and Rhodopseudo-

monas (strain B) in the advanced treatment of printing-dyeing wastewater and
the papermaking wastewater treatments was investigated. The highest decol-
orization rate can be achieved in 90 min with the treatment of two strains for
the printing-dyeing wastewater, and 180 min for the papermaking wastewater.
(2) The decolorization rates for both wastewaters were higher than 80 %, having
been treated by biological activated carbon with the white rot fungus. In the
condition of 180 min and 150 r/min shaking speed, the papermaking waste-
water effluent COD was 60.82 mg/L with Phanerochaete chrysosporium,
49.5 mg/L with Rhodopseudomonas, and 33.28 mg/L with the combined
strains, which all meet the industrial effluent standards.
(3) In the treatment of the papermaking wastewater with the combined strains, COD
removal rate of the biological activated carbon technique strengthened by
Rhodopseudomonas first was higher than that strengthened by Phanerochaete
chrysosporium first.
Acknowledgments This work was financed by the National Science and Technology Planning
Project of China under Grant No. of 2011BAC11B04.
1244 Z. Yang et al.
References
1. Li ZP, Liu QJ, Lin QT et al (2010) The application study progress of advanced treatment
technology of papermaking wastewater. Trans China Pulp Pap 25:102–103
2. Gu PJ, Chen WH, Wang PN et al (2006) Considerations on printing-dyeing wastewater
treatment. Pollut Control Technol 10:52–55
3. GB3544-2008 (2008) Discharge standard of water pollutants for pulp and paper industry.
China Standards Press, Beijing
4. Pratima P (2012) Brief description of the pulp and paper making process. In: Biotechnology
for pulp and paper processing. Springer, New York
5. Zhang RC, Miao XZ, Ma HY et al (2008) A study on advance treatment with bioactive
carbon for pulp and paper mill effluent. China Pulp Pap Ind 21:54–56
6. Jia R, Zhao F, Wu S et al (2004) Treatment of dyestuff wastewater with white rot fungus bio-
contact oxidation technique. China Environ Sci 24:205–208
7. Arora DS, Sharma RK (2010) Ligninolytic fungal laccases and their biotechnological
applications. Appl Biochem Biotech 160:1760–1788
8. Freitas AC, Ferreira F, Costa AM et al (2009) Biological treatment of the effluent from a
bleached kraft pulp mill using basidiomycete and zygomycete fungi. Sci Total Environ
407:3282–3289
9. Pang JZ, Liu Y (2008) The intensive treatment of paper mill effluent with biological stuffing
process. China Pulp Pap Ind 29:36–37
10. Kaushik G, Thakur IS (2009) Isolation of fungi and optimization of process parameters for
decolourization of distiller mill effluent. World J Microbiol Biotechnol 25:955–964
11. Wang A, Xie N, Liang Z (2000) Study on the determination of water colority. Environ Monit
China 4:37–40
Chapter 134
The Removal of Crude Oil in Waste
Drilling Muds by a Constructed Microbial
Consortium
Yunkang Chang, Xingbiao Wang, Yifan Han, Manman Wang,

Chenggang Zheng, Yongli Wang and Zhiyong Huang
Abstract Waste drilling muds (WDMs) contain serious pollutants produced by

crude oil and gas well drilling. Bioremediation has been known as a useful and
cost-effective method for disposal of contaminants in various environments. In this
study, an efficient and stable microbial consortium was constructed successfully by
successive enrichment of indigenous microorganisms, which can remove oil
contaminants from waste drilling muds. Denaturing gradient gel electrophoresis
analysis (DGGE) and 16S rRNA gene clone library analysis were used to evaluate
the dynamic changes in the microbial consortium in the process. After 7 days’
treatment, the main contaminants were removed mostly by constructed microbial
consortium than control treatment, which showed that the constructed consortium
was of great potential to remediate polluted drilling fields.
Keywords Bioremediation Crude oil removal Microbial consortium Waste

drilling muds
Y. Chang X. Wang Y. Han M. Wang Z. Huang (&)

Tianjin Key Laboratory for Industrial Biological Systems and Bioprocessing Engineering,
Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences,
e-mail: huang_zy@tib.cas.cn
M. Wang
C. Zheng
Petroleum Exploration and Production Research Institute, SINOPEC, Beijing 100083,
Y. Wang
Lanzhou Institute of Geology, Chinese Academy of Sciences, Lanzhou 730000,
e-mail: wyll6800@lzb.ac.cn
1246 Y. Chang et al.
134.1 Introduction
Waste drilling muds (WDMs) are one of the major pollutants during crude oil and
gas well drilling activities in the oil industry. The discharge of WDMs into the
environment without any treatment causes problems to the circumjacent soil,
groundwater, and human beings due to the harmful ingredients of both organic and
inorganic contaminants such as aromatics and heavy metals with carcinogenicity,
teratogenicity, and mutagenicity [1–3].
In recent years, researchers pay more and more attention to dealing with WDM
contaminants. Some technologies carried out to decrease the environmental
damages include thermal disposal [4], microwave treatments [5], supercritical fluid
extraction [6], solidification, and stabilization and phytodegradation [7, 8]. How-
ever, traditional treatments usually could not overcome some shortcomings in
WDMs treatments such as high energy consumption, large land occupation, pro-
hibitive cost, long remediation time, and secondary pollution [9–11].
Bioremediation has been approved by many researchers due to its remarkable
advantages such as cost-effectivenesss, less land occupation, and no secondary
pollution [12]. Hence, researchers have carried out many studies to remediate
WDMs using microorganism-related technologies. However, most previous stud-
ies only focused on single strain, and the utilized microbial consortium was not
stable and not suitable for field application [13, 14].
In this study, the major pollutants of WDMs collected from Dagang oilfield
were investigated by X-ray fluorescence spectrometer analysis and total oil
extraction analysis. The biodiversity of WDMs sample was investigated by the 16S
rRNA gene clone library analysis. Further, a microbial consortium was constructed
successfully to remove the oil contaminants from WDMs by successive enrich-
ment of the indigenous microorganisms, and the dynamic changes in the consor-
tium were monitored by DGGE analysis during the enrichment process.
134.2.1 Preparation and Characteristics Of WDMs
134.2.1.1 Physical and Chemical Properties
WDMs were obtained from the drilling field in Dagang Oilfield, southeastern
Tianjin, China. The pH, water content, and electrical conductivity of the WDMs
were 8.2, 60 % (w/w), 1,796 ls/cm, respectively, which showed that the WDMs
were of high water content and weakly saline-alkaline characteristics.
134 The Removal of Crude Oil in Waste Drilling Muds 1247
134.2.1.2 Biodiversity of WDMs
Total DNA was extracted from the WDMs sample by UltraCleanTM Soil DNA
Isolation Kit (Mo Bio Laboratories, Inc., USA) according to the operation manual.
The biodiversity of WDMs was tested by 16S rRNA gene amplification and clone
library construction, DNA sequencing, alignment, and phylogenetic analysis
according to the reported method [15].
134.2.2 Pollutants of WDMs
134.2.2.1 Heavy Metals
Heavy metals of WDM samples were analyzed by X-ray fluorescence spectrom-

eter (PW 4,400/40, PANalytical B.V., Holland) according to the reported method
[16].
134.2.2.2 Oil Contaminants in WDMs
According to the reported method [17, 18], the total oil was extracted by
dichloromethane and tested by weighing the dry extraction after evaporating the
solvent under nitrogen, and then the four fractions (aliphatic, aromatic, resins, and
asphaltenes) of the extracted oil were separate by silica gel column chromatog-
raphy. The fractions were analyzed by gas chromatography–mass spectrometer
(GC–MS) (7,890–5,975c, Agilent, USA) equipped with an Agilent HP-5MS fused
silica capillary column (60 m 9 0.25 mm 9 0.25 lm) following the reported
method [2].
134.2.3 Construction and Analysis of Microbial Consortium
134.2.3.1 Enrichment of Indigenous Microorganisms
WDMs (10 g, without sterilization) were added to a 250 ml flask containing 50 ml

sterile Bushnell–Haas mineral solution (BHM) [19], then 0.05 % (w/v) yeast
extract was added to the medium to stimulate the biological activity of indigenous
microorganisms of the WDMs. After three days0 cultivation at 30 C, 150 rpm in
the shaker, 5 ml of fermentation broth was transferred to 45 ml fresh sterile BHM
medium containing 2 % (w/v) crude oil from Dagang Oilfield as the sole carbon
source. The culture was enriched through successive inoculum every week over 12
times to obtain a stable microbial consortium with oil-degrading activities.
134.2.3.2 DNA Extraction of Enriched Microorganisms
Bacterial cells of the enriched microbial consortium were collected periodically

(0 day, 6, 8, 10, and 12 weeks) in a 2 ml Eppendorf tube by centrifugation at
10,000 g for 5 min. Total DNA of enriched microbial cells was extracted using
UltraCleanTM Soil DNA Isolation Kit as described above.
134.2.3.3 Primers and 16S rRNA Gene Amplification
The 16S rRNA gene fragments were amplified with primers 341F (5’-
CCTACGGGAGGCAGCAG-3’) and 518R (5’-ATTACCGCGGCTGCTGG-3’),
which targeted universal conserved bacterial 16S rRNA gene sequences [20].
A GC-clamp was attached to the 5’ end of primer 341F to prevent complete
melting of the DNA fragments during the DGGE analysis [21]. A hot-start PCR
was performed at 94 C for 5 min and a touchdown PCR was performed as
follows: the annealing temperature was initially set at 65 C and then decreased by
0.5 C every cycle until it decreased to 60 C, then 18 additional cycles were
carried out at 60 C. Denaturing was carried out at 94 C for 1 min, and primer
annealing was performed at 72 C for 0.5 min. The final extension step was at
72 C for 3 min [22].
134.2.3.4 DGGE Analysis
DGGE analysis was performed using a model DCodeTM System (Bio-Rad Labo-
ratories Inc., USA) with a denaturing gradient of 40–70 % in a 7.5 % polyacryl-
amide gel following the manufacturer’s instructions. PCR products from the
previous step were mixed with the same volume of 2 9 Gel loading Dye, and
DNA fragments were separated for 12–16 h at 80 V, 60 C [23]. The gel was
stained for 30 min with Super Green I and visualized using a Gel Doc EQ gel
documentation system (Bio-Rad Laboratories Inc., USA).
134.2.3.5 Single Bands Excision and PCR Amplification
Single bands from the DGGE gel were excised and placed into 0.5 ml micro-
centrifuge tubes with 50 ll sterile water. The tubes were incubated overnight at
4 C. PCR amplifications were carried out with the same program as described
above using 1 ll of the DNA eluted from the bands and the same primers. Again,
PCR products were used for DGGE analysis to verify whether the excised band
was single or not. After that, the true single bands were re-amplified again with the
same primers without GC-clamp and the PCR products were sent for sequencing
by BGI (http://www.genomics.cn/index, China).
134.2.3.6 Analysis of DGGE-Banding Profiles
To assess the dynamic changes in microbial consortium during the enrichment

process, DGGE-banding profiles were analyzed by the software Quantityone-1-D
(Version 4.6.2) according to the reported method [22].
134.2.4 Crude Oil-Related Experiment
The efficiency of crude oil degraded by constructed microbial consortium was

assessed by simulated experiments in the laboratory. WDMs (20 g, without ster-
ilization) were added to 250 ml conical flask containing 80 ml BHM medium and
10 % (v/v) inoculum and incubated at 30 C, 150 rpm in shaker. The control
treatment was the same with microbial flask without inoculum. All the treatments
were carried out in triplicate and the average calculated. The degradation rates of
crude oil were determined after 7 days’ treatment by calculating the weight of the
residual oil.
134.2.5 Data Analysis and Chemicals
All the obtained data were subjected to one-way analysis of variance and post hoc
Tukey test using the SPSS Version 13.0 statistical package. The results were tested
for significance at the 5 % level. All the chemicals used in this study were ana-
lytical reagent grade and chromatographic reagent grade.
134.3.1 Microbial Diversity Analysis of WDMs Samples
Phylogenetic analysis (Phylip, Version 3.69) of the partial 16S rRNA gene
revealed that indigenous microbial diversity in the WDMs remained a relative high
value (Fig. 134.1).
Totally 164 clones were selected and sequenced successfully. After BLAST in
NCBI (http://www.ncbi.nlm.nih.gov/), the results revealed that sequences mainly
grouped with Alpha- and Gamma-proteobacteria (29.88 and 27.44 %, respec-
tively) and Clostridia (16.46 %). In addition, a few clones were affiliated with
Beta-proteobacteria (6.71 %) and Delta-proteobacteria (6.71 %) (Fig. 134.2).
Alpha-proteobacteria was the most dominant group in the clone library,
which accounted for 29.88 % of the total. These sequences were mainly
Fig. 134.1 Phylogenetic tree of clones based on partial 16S rRNA gene sequences
grouped and belonged to the genus of Rhizobium and Rhodobacter (Fig. 134.3).
Gamma-proteobacteria was another dominant bacteria, which is of the nearest
relationship with the genus of Pseudomonas. Many bacteria from these three
main genuses could degrade petroleum hydrocarbons or their derivatives and
play a very important role in oil contaminated environments according to for-
mer studies [24–26].
Fig. 134.2 The percentages 12.80%

of different microorganisms
of the WDMs 29.88%
16.46%
6.71%
6.71%
27.44%
Alpha-proteobacteria Gamma-proteobacteria
Beta-proteobacteria Delta-proteobacteria
Clostridia some other class
Fig. 134.3 The percentages 22.55%

of microorganisms belong to 27.44%
different genuses in the
WDMs
1.22%
1.22%
1.22%
1.83%
2.44%
4.88%
7.93% 20.73%
8.54%
Pseudomonas Rhizobium Rhodobacter

Dethiobacter Acidovorax Desulfobulbus
Desulfuromonas Rikenellaceae Desulfitibacter
Cytophaga some other genus
134.3.2 Major Pollutants in WDMs
X-ray fluorescence spectrometers analysis revealed different kinds of heavy metals

in the WDMs, including Ba, As, and Pb. Hence, the microorganisms in the WDMs
could partly tolerate the toxicity of these heavy metals. However, oil contaminants
(containing: aliphatic fractions, 18.76 %, w/w; aromatic fractions, 42.01 %, w/w;
resins, 20.31 %, w/w and asphaltenes, 18.92 %, w/w) were determined as the
major pollutants according to the oil analysis. The percentage of oil contaminants
was about 1.2 ± 0.2 % (w/w), which was quite higher than the threshold of
500 mg/kg set by previous study as serious pollution [27]. The results of silica gel
column chromatography analysis revealed that the aromatic fractions were the
main part in the contaminated oil of WDMs (Fig. 134.4). The reason may be the
aromatic fractions were more difficult to be degraded than aliphatic fractions by
indigenous microorganisms and the latter had been degraded at a large scale due to
the long time of discard in the drilling field.
In order to study more details of the pollutants in WDMs, further analysis by
GC–MS was carried out (Fig. 134.5). The results showed that C14 fraction was the
dominant component in the crude oil of WDMs.
Phenanthrene and anthracene were found to be responsible for this result
(Fig. 134.6). Similar results were also found by other studies [2, 13]. These two
kinds of substances all belonged to polycyclic aromatic hydrocarbons with three
cycles, which had been previously reported as environment pollutant for poor
bioavailability [28–31], which partially indicated that the WDMs were also of poor
bioavailability for microorganisms. The percentages of fractions with carbon
Fig. 134.4 The composition 18.92% 18.76%

of extracted oil by silica gel
column chromatography
analysis
20.31%
42.01%
Aliphatic fractions Aromatic fractions

Resins Asphaltenes
35
30
25
Percentage (%)
20
15
10
0
C9 C10 C11 C12 C13 C14 C15 C16 C17 C18 C19 C20 C22 C23 C24 C26 C27 C28 C30
Fractions with different carbon number
Fig. 134.5 The percentage of fractions with different carbon number by GC–MS analysis
Fig. 134.6 The percentages 15.27% 0.62%

of phenanthrene and
anthracene in oil
contaminants
12.94%
71.17%
All fractions except C14

Anthracene
Phenanthrene
C14 fractions except anthracene and phenanthrene
number more than C16 were usually higher than the fractions with carbon number
less than C16, which indicated that the long chain hydrocarbon fractions in WDMs
were harder to be degraded by microorganisms [32].
Fig. 134.7 DGGE profiles

of microbial consortium
composition during the
enrichment process
134.3.3 Analysis of Enriched Microbial Consortium
Microbial consortium profiles elucidated by DGGE of different times at 0 day, 6,

8, 10, and 12 weeks are shown in Fig. 134.7.
The result revealed that a stable microbial consortium had been constructed after
12 weeks’ enrichment. Prominent single band was excised, PCR-amplified and
sequenced (Table 134.1). At day 0, the most intensive two bands, band 1 and band 2
were sequenced and identified as Pseudomonas aeruginosa and Pseudomonas
Table 134.1 Sequence analysis of the major DGGE bands

Band Systematic affiliation (closest relatives) Sequence homology (%) Accession number
1 Pseudomonas aeruginosa 99 DQ459316
2 Pseudomonas stutzeri 100 HQ189757
3 Alishewanella sp. 99 EU287929
4 Alishewanella aestuarii 100 NR_044344
5 Halomonas sp. 100 AB477015
6 Halomonas sp. 100 HM566027
7 Halomonas desiderata 100 AB362300
stutzeri, respectively. It was consistent with the result of 16S rRNA gene clone
library. These two species were usually studied in petroleum hydrocarbons deg-
radation experiments [33, 34]. The results showed the intensity of band 1, 3, 4, 5, 7
remained relatively constant during the last 4 weeks’ enrichment process from
which it could be inferred that these five species were synergistic in this specific
environment (Fig. 134.7). At the end of the enrichment process, band 4 and band 5
belonged to the genus of Alishewanella and Halomonas, tied for the first place in
the microbial consortium. Alishewanella could typically use multiple electron
acceptors to enhance the biodegradation of oil contaminants in anoxic environ-
ments [35]. Halomonas had been previously studied as good oil contaminant
degraders, especially in saline and alkaline environments [36–38].
134.3.4 Degradation Rate of Crude Oil by Microbial

Consortium
After 7 days’ treatment, nearly 69 % (w/w) of total oil contaminants were suc-
cessfully degraded, and the degradation rate by the control treatment was only 8 %
(w/w). The indigenous microorganisms of the added WDMs may cause oil con-
taminants degradation in the control treatment, but there was low cell density and
poor nutrients in the WDMs, so the degeneration proportion of oil in control
treatment was low. By contrast, the added microbial consortium and abundant
nutrients caused great power to remove the oil contaminants from WDMs.
134.4 Conclusions
An efficient and stable microbial consortium was constructed successfully by

successive enrichment of indigenous microorganisms which were used to remove
the oil contaminants from WDMs. DGGE proved to be a very useful method for
monitoring the dynamic changes in the constructed active microbial consortium.
According to the results, the constructed active microbial consortium was of high
genetic stability for the dominant members kept constant in the final stage of
enrichment process and remarkable crude oil degradation rate which showed that
the microbial consortium was of great potential applied value in polluted drilling
fields. A field treatment model will be designed in the future to access the effi-
ciency for field application.
Acknowledgments This work was supported by the Major Project of Tianjin Science and
Technology Support Plan (Grant No. 11ZCZDSY09000), the CAS Strategic Priority Research
Program (Grant No. XDA05120204), the Knowledge Innovation Program of the Chinese
Academy of Sciences (Grant No. KZCX2-EW-104), the NSFC (Grant No. 51104106) and
Western Light Joint scholars project.
References
1. Zhao XB, Ji XH, Zhang YH et al (2004) Effect of solvent on the microstructures of

nanostructured Bi2Te3 prepared by solvothermal synthesis. J Alloy Compd 368:349–352
2. Yan P, Lu M, Guan Y et al (2011) Remediation of oil-based drill cuttings through a
biosurfactant-based washing followed by a biodegradation treatment. Bioresour Technol
102:10252–10259
3. Jacques RJ, Okeke BC, Bento FM et al (2008) Microbial consortium bioaugmentation of a
polycyclic aromatic hydrocarbons contaminated soil. Bioresour Technol 99:2637–2643
4. Zupan T, Kapila M (2000) Thermal desorption of drill muds and cuttings in Ecuador: the
environmental and financially sound solution. Soc Petrol Eng. doi:10.2118/61041-MS
5. Robinson J, Kingman S, Snape C et al (2010) Scale-up and design of a continuous microwave
treatment system for the processing of oil-contaminated drill cuttings. Chem Eng Res Des
88:146–154
6. Street C, Guigard S (2009) Treatment of oil-based drilling waste using supercritical carbon
dioxide. J Can Petrol Technol 48:26–29
7. Leonard S, Stegemann J (2010) Stabilization/solidification of petroleum drill cuttings:
leaching studies. J Hazard Mater 174:484–491
8. Ji GD, Yang YS, Zhou Q et al (2004) Phytodegradation of extra heavy oil-based drill cuttings
using mature reed wetland: an in situ pilot study. Environ Int 30:509–517
9. Vasudevan N, Rajaram P (2001) Bioremediation of oil sludge-contaminated soil. Environ Int
26:409–411
10. Benka-Coker MO, Olumagin A (2006) Effects of waste drilling fluid on bacterial isolates
from a mangrove swamp oilfield location in the Niger Delta of Nigeria. Bioresour Technol
55:175–179
11. Okpokwasili GC, Nnubia C (1995) Effects of oil spill dispersants and drilling fluids on
substrate specificity of marine bacteria. Waste Manage 15:515–520
12. Mao J, Luo YM, Teng Y et al (2012) Bioremediation of polycyclic aromatic hydrocarbon-
contaminated soil by a bacterial consortium and associated microbial community changes. Int
Biodeter Biodegr 70:141–147
13. Okparanma RN, Ayotamuno JM, Araka PP (2009) Bioremediation of hydrocarbon
contaminated-oil field drill-cuttings with bacterial isolates. Afr J Environ Sci Technol
3:131–140
14. Toldo JEE, Ayup Zouain RN (2009) Environmental monitoring of offshore drilling for
petroleum exploration (MAPEM): a brief overview. Deep Sea Research Part II: Deep-Sea
Res Pt Ii 56:1–3
15. Filteau M, Lagacé L, LaPointe G et al (2010) Seasonal and regional diversity of maple sap
microbiota revealed using community PCR fingerprinting and 16S rRNA gene clone libraries.
Syst Appl Microbiol 33:165–173
16. Zarazua G, Ávila-Pérez P, Tejeda S et al (2006) Analysis of total and dissolved heavy metals
in surface water of a Mexican polluted river by total reflection X-ray fluorescence
spectrometry. Spectrochim Acta, Part B 61:1180–1184
17. Cai Z, Zhou Q, Peng S et al (2010) Promoted biodegradation and microbiological effects of
petroleum hydrocarbons by Impatiens balsamina L. with strong endurance. J Hazard Mater
183:731–737
18. Bastow TP, van Aarssen BGK, Lang D (2007) Rapid small-scale separation of saturate,
aromatic and polar components in petroleum. Org Geochem 38:1235–1250
19. Wyndham R, Costerton J (1981) Heterotrophic potentials and hydrocarbon biodegradation
potentials of sediment microorganisms within the Athabasca oil sands deposit. Appl Environ
Microb 41:783–790
20. Luo YR, Tian Y, Huang X et al (2009) Analysis of community structure of a microbial
consortium capable of degrading benzo(a)pyrene by DGGE. Mar Pollut Bull 58:1159–1163
21. Maarit Niemi R, Heiskanen I, Wallenius K et al (2001) Extraction and purification of DNA in
rhizosphere soil samples for PCR-DGGE analysis of bacterial consortia. J Microbiol Meth
45:155–165
22. He Z, Zhao Y, Gao F et al (2010) Monitoring bacterial community shifts in bioleaching of
Ni-Cu sulfide. Bioresour Technol 101:8287–8293
23. Gonzalez N, Simarro R, Molina MC et al (2011) Effect of surfactants on PAH biodegradation
by a bacterial consortium and on the dynamics of the bacterial community during the process.
24. Wei GH, Yu JF, Zhu YH et al (2008) Characterization of phenol degradation by Rhizobium
sp. CCNWTB 701 isolated from Astragalus chrysopteru in mining tailing region. J Hazard
Mater 151:111–117
25. Gemini VL, Gallego A, de Oliveira VM et al (2005) Biodegradation and detoxification of-
nitrophenol by Rhodococcus wratislaviensis. Int Biodeter Biodegr 55:103–108
26. Zhang XS, Xu DJ, Zhu CY et al (2012) Isolation and identification of biosurfactant producing
and crude oil degrading Pseudomonas aeruginosa strains. Biochem Eng J 209:138–146
27. Chang W, Dyen M, Spagnuolo L et al (2010) Biodegradation of semi-and non-volatile
petroleum hydrocarbons in aged, contaminated soils from a sub-Arctic site: laboratory pilot-
scale experiments at site temperatures. Chemosphere 80:319–326
28. Ting WTE, Yuan SY, Wu SD et al (2011) Biodegradation of phenanthrene and pyrene by
Ganoderma lucidum. Int Biodeter Biodegr 65:238–242
29. Janbandhu A, Fulekar MH (2011) Biodegradation of phenanthrene using adapted microbial
consortium isolated from petrochemical contaminated environment. J Hazard Mater
187:333–340
30. Krivobok S, Miriouchkine E, Seigle-Murandi F et al (1998) Biodegradation of Anthracene by
soil fungi. Chemosphere 37:523–530
31. Jacques RJS, Santos EC, Bento FM et al (2005) Anthracene biodegradation by Pseudomonas
sp. isolated from a petrochemical sludge landfarming site. Int Biodeter Biodegr 56:143–150
32. Das N, Chandran P (2011) Microbial degradation of petroleum hydrocarbon contaminants: an
overview. Biotechnol Res Int 2011:941810
33. Zhang Z, Zhou Z, Yang C et al (2011) Degradation of n-alkanes and polycyclic aromatic
hydrocarbons in petroleum by a newly isolated Pseudomonas aeruginosa DQ8. Bioresour
Technol 102:4111–4116
34. Moscoso F, Deive FJ, Longo MA et al (2012) Technoeconomic assessment of phenanthrene
degradation by Pseudomonas stutzeri CECT 930 in a batch bioreactor. Bioresour Technol
104:81–89
35. Morris JM, Jin S, Crimi B et al (2009) Microbial fuel cell in enhancing anaerobic
biodegradation of diesel. Biochem Eng J 146:161–167
36. Hassanshahian M, Emtiazi G, Cappello S (2012) Isolation and characterization of crude-oil-
degrading bacteria from the Persian Gulf and the Caspian Sea. Mar Pollut Bull 64:7–12
37. Dosta J, Nieto JM, Vila J et al (2011) Phenol removal from hypersaline wastewaters in a
Membrane Biological Reactor (MBR): operation and microbiological characterisation.
38. Shao ZZ, Cui ZS, Dong CM et al (2010) Analysis of a PAH-degrading bacterial population in
subsurface sediments on the Mid-Atlantic Ridge. Deep-Sea Res Pt I 57:724–730
Chapter 135
Isolation and Identification of Saline
Tolerance Phosphate-Solubilizing
Bacteria Derived from Salt-affected Soils
and Their Mechanisms of P-solubilizing
Yang Han, Chunmei Wang, Xinglin Li, Xuefei Cao,

Aijia Cao and Na Zhao
Abstract The salt-affected soils of beach from Tianjin China were sampled to
screen the saline tolerance phosphate-solubilizing bacteria (SA-T-PSB) using
inorganic phosphorous medium. On basis of the phenotypic characterization and
16S rRNA gene sequencing, 4 isolates with the highest PSA, B1114, B1213,
B1303, and J101 were identified as Enterobacter ludwigii, Pantoea ananatis,
Pseudomonas psychrotolerans, and Gluconobacter frateurii, respectively. Subse-
quently, aimed to assaying the mechanisms of P-solubilizing, organic acid types of
the 4 isolates were determined by high performance liquid chromatography. The
results showed that all 4 isolates mainly secreted gluconic acid. The effect of
carbon and nitrogen source on P-solubilization activity of the strains also indicated
that the production of gluconic acid is the main mechanisms of P-solubilizing.

Keywords Microorganism isolation Microorganism identification Phosphate-

solubilizing bacteria P-solubilizing mechanisms
135.1 Introduction
Phosphorus as the most essential macronutrients beside N is the second largest

agricultural fertilizer limiting the crop yields [1]. However, many soils in the
world are P-deficient and thus cannot sustain the good crop yield [2]. Total P in
soil generally ranges from 400 to 1,200 mg/kg which is far beyond the plant’s
requirement [3], but only a small proportion (about 0.1 %) can be efficiently
utilized by plant [4]. Most P is precipitated with cations (Ca, Fe, Al) in the form of
insoluble P which is unavailable to plant [5]. So the chemical P fertilizer is applied
Y. Han C. Wang X. Li (&) X. Cao A. Cao N. Zhao

Key Lab of Industrial Fermentation Microbiology, Ministry of Education,
Tianjin University of Science and Technology, Tianjin 300457, People’s Republic of China
e-mail: lxlszf@tust.edu.cn
1260 Y. Han et al.
to yield, but a large proportion of available phosphate is rapidly transformed into

its poorly soluble forms before plant absorbing it [6]. Microorganisms are con-
sidered to play a fundamental role in P cycle by biologically mediated processes.
Phosphate solubilizing bacteria (PSBs) could dissolve fixed soil P to soluble form
which is utilized by plant. Many reports showed that the application of PSBs could
increase available P in soil and improve crop yields [7].
But environmental factors might affect severely on the colonization and
performance of PSBs. Especially under stress of hash environment, introduced
PSBs cannot survive in quantity or compete with the native organisms in plant
rhizosphere [5]. In China, the saline-alkali soil account nearly 4.88 % of the total
cultivated area [8]. The saline-alkali soil is characterized with high salt, alkalinity,
and low nutrition, which can lead to poor growth and low survival of PSBs [9].
Moreover, this soil with Ca–P as a major phosphorous source has a strong sorption
and buffer capacity. The factors above are disadvantageous for the establishment
and performance of PSBs [10, 11].
Native stress-tolerant microorganisms isolated from saline-alkali environment
might survive and perform better under stress physiology. Therefore, the objective
of the present research is to isolate SA-T-PSBs from the salt-effected soils in Tianjin.
135.2.1 Soil Sample and Isolation of Saline-Tolerance

Phosphate Solubilizing Bacteria
The soil samples were locally collected from the salt-effected barren land (38440
North, 117460 West, Tianjin, China) in sterile plastic bags and conserved at -4 C.
The soils in this area were characterized by ECe 38.36, organic matter 14.4 g/kg,
total N, P 1.02 g/kg, and 1.62 g/kg, respectively, available P 30 mg/kg with pH 7.8.
Soil pH was measured using a soil-to-water ratio of 1:2.5. Electrical conductivity
(EC) was estimated using a saturation soil extract. To isolate SA-T-PSB, 1 g soil was
homogenized in 50 sterile distilled water containing 0.85 % NaCl (w/v) and shaken
at 240 rpm for 30 min. The serial dilution was plated on standard NBRIP growth
agar mediums [12] amend with different concentrations of NaCl. The plates were
incubated at 25 C for 3 days. The isolates showing clear halo, which indicated
P-solubilizing ability, were picked and further purified on NBRIP medium.
135.2.2 Quantitative Assay of Phosphate Solubilization
All purified isolates were estimated qualitatively in NBRIP liquid medium with
Ca3(PO4)2 (TCP) as single P source. After 7 days culture, the culture was
centrifuged at 10,000 rpm for 10 min and filtered with 0.22 lm syringe filter.
135 Isolation and Identification of Saline Tolerance Phosphate 1261
The soluble P in the filtrate was measured by the Mo-blue method with a spec-
trophotometer at 700 nm [13]. The concentration of P was calculated by a standard
curve obtained using KH2PO4.
135.2.3 Physiology Identification of the SA-T-PSBs
The identification of the isolates was performed based on morphology and bio-
chemical reactions including Gram staining, gelatin hydrolysis, oxidase test,
methyl red test, Voges–Proskauer (V–P) reaction, and utilization of different
carbon sources according to Bergey’s Manual of Systemic Bacteriology [14].
135.2.4 Molecular Identification of the SA-T-PSBs
The isolates were cultured in LB medium at 27 C for 12 h, and their genomic

DNA were extracted using BacteriaGen DNA kit (CWBIO, China). Amplification
of the DNA templates was performed using the universal primers Ad (50 -AGA
GTT TGA TCC TGG CTCA-30 ) and rJ (50 -GGT TAC CTT GTT ACG ACT T-30 )
[15]. The PCR reaction was performed using PCR kit (CWBIO, China). The cycle
condition ran in iCycler thermocycler was 5 min of preheating at 95 C, 30 cycles
of 30 s of denaturation at 95 C, 30 s of primer annealing at 55 C, 2 min of
elongation at 72 C, and 10 min of extension step at 72 C. The PCR products
were sequenced by sequencing company. The sequences were compared with
GenBank data (NCBI) for identification of the SA-T-PSBs.
135.2.5 Gluconic Acid Identification of the SA-T-PSBs
The culture filtrates as described above were diluted ten times and then used for
the analysis of gluconic acid by HPLC (Agilent 1100, USA) equipped with KYA
TECH HiQ Sil RP-C18 column 250 9 4.6 mm. The mobile phase was 0.05 M
KH2PO4 containing 5 % methanol with a pH 2.2 [16], the absorption was mea-
sured at 210 nm, the column temperature was 25 C. The identification and esti-
mation of the concentration of gluconic acid in sample were determined by
comparing retention times and peak areas of chromatograms with the standards
sample of gluconic acid, respectively.
135.2.6 Effect of Carbon and Nitrogen Source on

P-solubilizing Activity of Strain J101
To study the effect of different carbon sources on the growth and P-solubilizing
activity of strain J101, glucose was replaced with an equal amount (10 g/L) of
1262 Y. Han et al.
fructose or maltose or starch or lactose or sucrose or xylose or mannitol sterilized

separately and added to the NBRIP medium. Ammonium sulfate was replaced
with 0.5 g/L urea or potassium nitrate or ammonium chloride or ammonium
oxalate or ammonium nitrate. The culture filtrate was analyzed for biomass,
soluble P, and pH reduction.
135.2.7 Data Analysis
The date was subjected to analysis of variance (ANOVA) with the software SPSS
version II. Statistical comparisons of their means were performed by the LSD test
at P B 0.05. All values were the means of three replicates.
135.3.1 Isolation and Characterization of the Selected

SA-T-PSBs
A total of 108 saline-tolerance isolates showing clear halos and/or different

colonial morphology was selected and purified. The results showed that B1114,
B1213, B1303, and J101 denote the highest P-solubilization values, with more
than 400 mg/l in medium. And all SA-T-PSBs have the ability of tolerating 2.5 %
NaCl stress. B1114, B1303 are able to tolerate 5 % NaCl stress (Table 135.1). The
strains B1213 and B1303 have the ability of secreting IAA. The coastal saline-
alkali soil in Tianjin was characterized with high salt concentrations and low
nutrition which limited growth and performance of microorganisms, especially for
some introduced strains. Therefore, the saline tolerance of isolates was considered
as one of the main index for screening of PSBs. The initial screening of PSBs was
processed in NBRIP plate with a saline stress condition (1.5 %). Four saline-
tolerance PSBs which exhibited the highest P solubilizing ability among 108
isolates had a higher P solubilizing activity than those microorganisms of other
reports [3, 17]. The SA-T-PSBs could express strong P-solubilization activity in a
low available P environments, suggesting that the organisms might be of the
adaptability in such a condition or on the basis of the so-called ‘‘stress physiology
paradigm’’ proposed by Goldstein et al. [18].
135.3.2 Identification of the Selected SA-T-PSBs
Four selected SA-T-PSBs were shown to be Gram-negative and had small rods.
Their colony morphologies were white or/and yellow, circular, smooth, raised and
entire edge when observed in LB agar medium. All strains except B1114 are
Table 135.1 Solubilized P, final pH, salinity tolerance, and IAA production by 4 SA-T-PSBs
Isolates Solubilized Salinity Final pHa IAA contents
P (mg/l)a tolerance (%) (mg/l)a,
B1114 561 ± 23 a 5.0 4.91 ± 0.13 a NO
B1213 582 ± 27 a 2.5 4.30 ± 0.07 b 13.47 ± 2.1 a
B1303 441 ± 42 b 2.5 4.16 ± 0.11 b 7.88 ± 0.51 b
J101 612 ± 25 a 1.5 3.37 ± 0.18 d NO
a
The values were the mean ± SD from three replicates, and there was significant difference
(P B 0.05) between the mean values with different letters by LSD
Gelatin hydrolysis, Oxidase, V–P reaction, Methyl red test positive, and Gelatin
hydrolysis negative. B1114 is Gelatin hydrolysis positive. All 4 strains can utilize
Glucose, Lactose, Fructose, Maltose, Starch, Sucrose, Glycogen, Mannitol,
Glycerol, and Sorbito as single carbon. By comparing the 16S rRNA gene
sequences of the isolates with the GenBank database, it could be indicated that
B1114 and B1213 were similar to E. ludwigii and P. ananatis, respectively, and
B1303 and J101 were identified to be P. psychrotolerans and G. frateurii,
respectively (Table 135.2).
135.3.3 Identification of Gluconic Acid
HPLC analysis of the culture filtrates showed that all of 4 SA-T-PSBs could
secrete gluconic acid which was probably the major component since there is no
other higher peak (Fig. 135.1). Furthermore, gluconic acid might be one of the
major organic acids during P-solubilization. J101 with maximum P-solubilization
produced the highest content of Gluconic acid (8.47 mM), followed by B1303
which had the lowest P-solubilizing ability (Fig. 135.1). The acidification of
medium in process of bacteria-mediated insoluble solubilization suggested the
possibility of organic acid produce which was main strategy for dissolution of
insoluble phosphate through organometallic complex formation or through metal
chelation processes. Particularly for Gram-negative bacteria, production of glu-
conic acid is the common and efficient organic acid during P solubilizing [19]. In
this research, the authors identified and quantified the production of gluconic acid
Table 135.2 Identification of the SA-T-PSBs by 16S rDNA sequencing

Strains GenBank Most similar Identity (%)
accession organisms
numbers
B1114 JX215328 E. ludwigii 99
B1213 JX215331 P. ananatis 99
B1303 JX215329 P. psychrotolerans 99
J101 JX215330 G. frateurii 99
1264 Y. Han et al.
Fig. 135.1 Identification of gluconic acid of the SA-T-PSBs by HPLC
in supernate culture. Gluconic acid is the main organic acid produced by all 4
SA-T-PSBs as previous reports.
135.3.4 Effect of Carbon and Nitrogen Source on

P-Solubilizing Activity of Strains J101
As Table 135.3 showed that, the different carbon source had significant effect
on the growth, P-solubilizing activity and final medium pH. Different carbon
sources in relation to P-solubilization activity were in the following order: glu-
cose [ xylose [ maltose [ mannitol [ starch [ lactose [ sucrose [ fructose.
The glucose and xylose were best carbon source for P-solubilizing. Strain J101
was able to grow with all carbon sources. For nitrogen source (Table 135.4), there
was no significant effect on the P-solubilization activity of strain J101. The soluble
P content released by strain J101 utilizing the glucose as single carbon source far
higher than other carbon source, while there was no significant influence on the
P-solubilization activity of J101 for various nitrogen source. This result was dis-
agreement with Illmer and Schinner (1995) [20] who suggested that the protons
releasing accompanying NH3+ assimilation account for the P solubilization. Our
result indicated the gluconic acid was the main mechanism for P-solubilizing.
There was no relation between the quantities of gluconic acid release by the SA-T-
PSBs and the P-solubilizing value, though strain J101 with highest P-solubilization
Table 135.3 Effect of carbon source on P-solubilization value and cell biomass (OD600) of
strains J101a
Carbon source P-solubilization OD600 pH
value
Glucose 618 ± 48 0.62 ± 0.001 3.99 ± 0.07
Fructose 56 ± 2 0.67 ± 0.009 4.78 ± 0.11
Maltose 121 ± 10 0.24 ± 0.01 4.89 ± 0.21
Starch 65 ± 3 0.41 ± 0.008 4.9 ± 0.38
Lactose 63 ± 4 0.51 ± 0.012 4.9 ± 0.11
Sucrose 59 ± 2 0.73 ± 0.009 4.90 ± 0.21
Xylose 347 ± 10 0.69 ± 0.009 4.31 ± 0.13
Mannitol 91 ± 5 1.1 ± 0.012 4.85 ± 0.05
a
Values were the mean ± SD from three replicates
Table 135.4 Effect of nitrogen source on P-solubilization value and biomass (OD600) of strains
J101a
Nitrogen source P-solubilization OD600 pH
value
Ammonium sulfate 625 ± 19 0.536 ± 0.0119 3.66 ± 0.06
Potassium nitrate 504 ± 8 0.328 ± 0.057 3.36 ± 0.04
Ammonium chloride 532 ± 5 0.522 ± 0.0023 3.31 ± 0.03
Ammonium nitrate 613 ± 19 0.419 ± 0.0085 3.33 ± 0.11
Ammonium oxalate 510 ± 20 0.796 ± 0.0141 3.31 ± 0.03
Urea 534 ± 7 0.521 ± 0.0614 3.35 ± 0.03
a
Values were the mean ± SD from three replicates
ability produced the highest amounts of gluconic acid, which was in agreement
with Yi Yanmei et al. (2008) [21].
135.4 Conclusion
In this study, we isolated four SA-T-PSB which have high P-solubilizing activity
(C400 mg/l). And the P-solubilizing mechanism of 4 strains is mainly to secrete
the gluconic acid secretion.
Acknowledgments The work was supported by ‘‘National Training Project of College Students’
Innovative and Pioneering Work of Tianjin University of Science and Technology
(201210057049)’’, ‘‘The National Natural Science Foundation of China’’ and ‘‘Spark Plan of
Ministry of Science and Technology of China (2012GA610011)’’.
1266 Y. Han et al.
References
1. Hameeda B, Harini G, Rupela OP et al (2008) Growth promotion of maize by phosphate-

solubilizing bacteria isolated from composts and macrofauna. Microbiol Res 163:234–242
2. Hinsinger P (2001) Bio-availability of soil inorganic P in the rhizosphere as affected by root
induced chemical changes: a review. Plant Soil 237:173–195
3. Malboobi MA, Owlia P, Behbahani M et al (2009) Solubilization of organic and inorganic
phosphates by three highly efficient soil bacterial isolates. World J Microbiol Biotechnol
25:1471–1477
4. Zou X, Binkley D, Doxtader KG (1992) A new method for estimating gross phosphorus
mineralization and immobilization rates in soils. Plant Soil 147:243–250
5. Chang CH, Yang SS (2009) Thermo-tolerant phosphate-solubilizing microbes for multi-
functional biofertilizer preparation. Bioresour Technol 100:1648–1658
6. Sulbarán M, Pérez E, Ball MM et al (2009) Characterization of the mineral phosphate-
solubilizing activity of Pantoea aglomerans MMB051 isolated from an iron-rich soil in
southeastern Venezuela (Bolívar State). Curr Microbiol 58:378–383
7. Kumar V, Behl RK, Narula N (2001) Establishment of phosphate-solubilizing strains of
Azotobacter chroococcum in the rhizosphere and their effect on wheat cultivars under green
house conditions. Microbiol Res 156:87–93
8. Yang JS (2008) Development and prospect of the research on salt-affected soils in China.
Acta Pedol Sin 45:837–845
9. Nautiyal CS, Bhadauria S, Kumar P et al (2000) Stress induced phosphate solubilization in
bacteria isolated from alkaline soils. FEMS Microbiol Lett 182:291–296
10. Gyaneshwar P, Naresh Kumar G, Parekh LJ (1998) Effect of buffering on the P-solubilizing
ability of microorganisms. World J Microbiol Biotechnol 14:669–673
11. Zhang L, Song FB (2005) Sorption and desorption characteristic of cadmium by four
different soil in northeast China. Chin Geogrphical Sci 15:344–347
12. Nautiyal CS (1999) An efficient microbiological growth medium for screening phosphate
solubilizing microorganisms. FEMS Microbiol Lett 170:265–270
13. Murphy J, Riley JP (1962) A modified single solution method for the determination of
phosphate in natural waters. Anal Chim Acta 27:31–36
14. Holt JG, Krieg NR, Sneath PHA et al (1994) Bergey’s Manual of Determinative
Bacteriology, 9th edn. Williams & Wilkins, Baltimore
15. Janvier M, Grimont PAD (1995) The genus Methylophaga, a new line of descent within
phylogenetic branch c of Proteobacteria. Res Microbiol 146:543–550
16. Farhat MB, Farhat A, Bejar W et al (2009) Characterization of the mineral phosphate
solubilizing activity of Serratia marcescens CTM 50650 isolated from the phosphate mine of
Gafsa. Arch Microbiol 191:815–824
17. Chen YP, Rekha PD, Arun AB et al (2006) Phosphate solubilizing bacteria from subtropical
soil and their tricalcium phosphate solubilizing abilities. Appl Soil Ecol 34:33–41
18. Goldstein AH (1995) Recent progress in understanding the molecular genetics and
biochemistry of calcium phosphate solubilization by gram negative bacteria. Biol Agric
Hortic 12:185–193
19. Gulati A, Sharma N, Vyas P et al (2010) Organic acid production and plant growth promotion
as a function of phosphate solubilization by Acinetobacter rhizosphaerae strain BIHB 723
isolated from the cold deserts of the trans-Himalayas. Arch Microbiol 192:975–983
20. Illmer P, Schinner (1995) Solubilization of inorganic calcium phosphates solubilization
mechanisms. Soil Biol Biochem 27:257–263
21. Yi YM, Huang WY, Ge Y (2008) Exopolysaccharide: a novel important factor in the
microbial dissolution of tricalcium phosphate. World J Microbiol Biotechnol 24:1059–1065
Chapter 136
Isolation and Characterization
of a Bacillus Strain for Alkaline
Wastewater Treatment
Kun Chen, Wenyu Shi, Jing Yang, Tong-cun Zhang and Hua Zhao
Abstract Biological treatment is one of the considerable choices for removing of

organic pollutants present in petrochemical wastewaters. In this study, five strains,
named as BS1, BS2, BS3, BS4 and BS5, were isolated from sludge nearby a
petroleum smelter. BS5, the isolate with the highest COD removal rate, was
identified as Bacillus flexus, based on 16S rDNA sequences. Subsequently, the
optimized COD removal conditions of BS5 were investigated. It was indicated that
the optimal conditions were 0.5 % corn starch, 1 % corn steep liquor, 35 C, pH
7.5, and 10 % (v:v) inoculation size. Under such circumstance, the removal rate of
COD can reach 81.04 %. The isolation of Bacillus flexus strain BS5 provided an
alternative for the bioremediation of alkaline wastewater. Lastly, the study showed
that consecutive disposal process may help to reducing COD of wastewater
effectively.
Keywords Alkaline wastewater Bacillus flexus Chemical oxygen demand
K. Chen W. Shi J. Yang T.-C. Zhang H. Zhao (&)

Key Laboratory of Industrial Fermentation Microbiology, Ministry of Education,
College of Bioengineering, Tianjin University of Science and Technology, Tianjin 300457,
e-mail: zhaohua@tust.edu.cn
T.-C. Zhang H. Zhao
Tianjin Key Laboratory of Industrial Microbiology, Tianjin 300457,
W. Shi
Tianjin Vocational Institute, Tianjin 300410, People’s Republic of China
1268 K. Chen et al.
136.1 Introduction
Petrochemical production technology had became more sophisticated in recent

years, in turns, organic substances in the sewage tends to be prosperous, which
caused a great burden to traditional treatment process [11]. Sewage in petroleum
processing industry was mainly resulted from liquid hydrocarbon alkali refining,
diesel alkaline cleaning, and ethane pyrolysis gas alkaline cleaning process and so
on [4]. Such sewage contained neutral oil, volatile phenol, sulfide and other toxic
and detrimental organic substance in abundance [15], which endowed it with a
high chemical oxygen demand (COD), high total dissolved solids, high levels of
volatile phenol and sulfide, and high alkalinity [8].
The sewage discharged contaminates the environment gravely and also has
seriously impacts on the subsequent disposal process [9]. Nowadays, most of
sewage disposal techniques based on the recovery of the naphthenic acid and
phenol [1], while the alkaline residue wastewater should be processed after the
recovery [2].
Modern biotechnology, especially molecular techniques, to select and cultivate
the dominant strains so to enhance the biological systems removal capability to
refractory organics [12]. Comparing with other methods, this method has many
advantages, such as lower cost, higher efficiency, easier to be handled and without
secondary pollution [7]. All those characteristics attracted a great attention from all
over the world [5]. Many relevant studies had been carried out, including printing
and dyeing, chemical waste water and removal characteristics [3].
In this study, bacteria with high efficiency of degrading alkaline wastewater had
been screened from sludge nearby a petroleum smelter. Furthermore, a strain with
the highest COD removal rate was identified and characterized for the possible
applications for environmental management.
136.2.1 Samples
Sludge samples were collected from a petroleum smelter.
136.2.2 Bacteria Screening Culture Medium
Screening culture medium was LB medium which containing a different propor-

tion of pretreated alkaline wastewater.
Alkaline wastewater obtained from the oil refinery should be pretreated. Firstly,
5.5 % sulfate acids was added. 24 h later, the sublayer liquid was collected and
136 Isolation and Characterization of a Bacillus Strain 1269
Table 136.1 Composition of the sublayer liquid

Properties pH COD(g/L) Sulfide(mg/L) Phenol(mg/L)
Values 6.73 58 996 41.39
used as experimental material. The main composition of the sublayer liquid

obtained showed as Table 136.1.
136.2.3 Degrading Medium
The degrading medium was consisted of pretreated alkaline wastewater, necessary

salts for growth, extra carbon and nitrogen sources. The pH value was adjusted to
7.0. The medium was sterilized at 121 C for 20 min.
136.2.4 Isolation of Strains Degrading Alkaline Wastewater
Enrichment and isolation of bacteria degrading alkaline wastewater were done

using bacteria screening culture medium.
136.2.5 Identification of the Bacteria Isolated
DNA extraction was adapted from the protocol previously. The 16S rDNA was
amplified by PCR using the following universal primers pairs, 50 -AGTTTG
ATCCTGGCTCA-30 and 50 -ACGGCTACCTTGTTACGACTT GCA-30 [2]. The
protocol consisted of 30-33 cycles of incubation at 94 C for 30 s, 58 C for 30 s,
and 72 C for 1 min, followed by extension for 5 min at 72 C. The 16S rDNA
amplified was sequenced and blast before it was submitted to NCBI GenBank.
136.2.6 Method of COD Determination
The COD was determined by potassium dichromate method [14]. Wash culture
tubes and caps with 20 % H2SO4 before using to prevent contamination. Place
sample in culture tube or ampule and add digestion solution. Carefully run sulfuric
acid reagent down inside of vessel so an acid layer is formed under the sample-
digestion solution layer and tightly cap tubes or seal ampules, and invert each
several times to mix completely. Place tubes or ampules in block digester
1270 K. Chen et al.
preheated to 150 C and reflux for 2 h behind a protective shield. Cool to room
temperature and place vessels in test tube rack. Some mercuric sulfate may pre-
cipitate out but this will not affect the analysis. Remove culture tube caps and add
small TFE-covered magnetic stirring bar. Add 0.05 to 0.10 mL (1 to 2 drops)
ferroin indicator and stir rapidly on magnetic stirrer while titrating with stan-
dardized 0.10 M FAS (ferrous ammonium sulfate titrant). The end point is a sharp
color change from blue-green to reddish brown, although the blue-green may
reappear within minutes. In the same manner reflux and titrate a blank containing
the reagents and a volume of distilled water equal to that of the sample.
136.2.7 Determination of the Optimized Alkaline-Degrading

Condition
The effects of different carbon sources, nitrogen sources, pH, temperature, inoc-
ulum concentration and consecutive treatment process on COD removal rate were
investigated.
136.3.1 Isolation of Strains with High Alkaline Wastewater

Degrading Activity
Five bacteria exhibiting high alkaline wastewater degrading activity were isolated
after serial enrichment, which called BS1, BS2, BS3, BS4 and BS5 respectively.
The COD removal rate of the five optimized strains was compared as
Fig. 136.1. It was showed that BS5 had the highest COD removal rate, which was
up to 73.42 %.
Fig. 136.1 COD removal 100

COD removal rate %
rate of five strains. The strains

were inoculated into 80
pretreated alkaline 60
wastewater, respectively, and
then cultured at 35 C at 150 r/ 40
min, the pH was control at
7.0. Fifty h later, the COD 20
value was measured 0
BSI BS2 BS3 BS4 BS5
Strains
136.3.2 Identification of BS5
The genome DNA of BS5 was extracted and its 16S rDNA was amplified by PCR.
The 1067 bp product was sequenced and analyzed. It was identified as Bacillus
flexus. The 16S rDNA sequence was submitted to NCBI GenBank and the
accession number was JX677863.
136.3.3 Effects of Nutrient Substances on the COD Removal

Rate of BS5
In the processes of alkaline wastewater treatments, bacteria make use of all kinds
of organic pollutant as nutrition for their growth and proliferation. But these
nutrients in industry wastewater cannot fully meet the need of these demands. So,
some extra nutrition should be added.
136.3.4 Effects of Different Carbon Sources on the COD

Removal Rate
Glucose, sucrose, maltose and corn starch were chosen as carbon source,
respectively. The group without extra carbon source was used as control. As
shown in Fig. 136.2, the addition of carbon source remarkably increased the COD
removal rate of the alkaline wastewater. It was proved that the best carbon source
was corn starch.
COD removal rate(%)
100
80
60
40
20
0
control glucose sucrose maltose corn strach
Fig. 136.2 Effects of different carbon sources on the COD removal rate. BS5 was inoculated into
degrading medium. 0.5 % (m:m) glucose, sucrose, maltose and corn starch were added
respectively, inoculum size 10 %, then cultured at 35 C at 150 r/min, the pH was control at 7.0.
50h later, the COD value was measured
1272 K. Chen et al.
Fig. 136.3 Effects of different nitrogen sources on the COD removal rate. BS5 was inoculated
into degrading medium. 1 % (m:m) ammonium nitrate, ammonium sulfate, bran, yeast powder
and corn steep liquor was added, respectively. Corn starch (0.5 %) was used as carbon source.
The culture condition were inoculum size 10 %, 35 C, pH 7.0, and agitation rate 150 r/min. 50h
later, the COD value was measured
136.3.5 Effects of Different Nitrogen Sources on the COD

Removal Rate
Ammonium nitrate, ammonium sulfate, bran, yeast powder and corn steep liquor
was selected as extra nitrogen source, respectively. The group without additional
nitrogen source was used as control. It was showed that these nitrogen sources can
increase the COD removal rate dramatically (Fig. 136.3). Corn steep liquor was
performed as the optimal nitrogen source.
Besides nutrition, the physical culture conditions can also have dramatically
influences on the wastewater disposal process.
136.3.6 Effects of Temperature on the COD Removal Rate
The effects of temperature on the COD removal rate of BS5 in degrading medium
were studied. It was showed that the optimum growth temperature for higher
degrading rate was 35 C. When the temperature was less than 25 C or more than
40 C, the COD removal rate decreased significantly (Fig. 136.4).
2.5 COD COD removal rate 90
COD removal rate (%)

COD×104 (mg/L)
2 80
1.5 70
1 60
0.5 50
15 25 35 45 55
Temperatures ( )
Fig. 136.4 Effects of temperature on the COD removal rate. BS5 was inoculated into degrading
medium and cultured at temperatures ranging from 20 C to 50 C. The culture condition were
0.5 % corn starch, 1 % corn steep liquor, inoculum size 10 %, pH 7.0, and agitation rate 150 r/
min. 50h later, the COD value was measured
136.3.7 Effects of pH on the COD Removal Rate
The effects of pH on the COD removal rate were tested. It was obviously presented
that the optimum pH value for COD removal was 7.5 (Fig. 136.5). When pH \ 6.0,
COD removal rate was less than 50 %. If pH was higher than 6.0, the COD removal
rate increased rapidly while pH increased. Until pH was 7.5, COD removal rate
reached its peak. If pH [ 7.5, the COD removal rate decreased dramatically.
136.3.8 Effects of Inoculum Size on the COD Removal Rate
The influence of inoculum size on the COD removal rate was investigated. Six
different inoculum sizes (4 %, 6 %, 8 %, 10 %, 12 %, 14 %, 16 %) were test. It
3.5 COD COD removal rate 100

COD removal rate(%)
3
80
(
2.5
COD×10 (mg/L
2 60
4
1.5 40
1
20
0.5
0 0
5.5 6 6.5 7 7.5 8 8.5 9
pH value
Fig. 136.5 Effects of pH on the COD removal rate. BS5 was inoculated into degrading medium
at pH 6.0, 6.5, 7.0, 7.5, 8, and 8.5, respectively. The condition of culture was as following, the
volume of the alkaline wastewater was 30 mL/250 mL, 0.5 % corn starch, 1 % corn steep liquor,
10 % inoculum size, then cultured at 35 C at 150 r/min. 50h later, the COD value was measured
1274 K. Chen et al.
3 COD COD removal rate 100
COD removal rate %

COD×10 4 mg/L)
2.5
80
2
60
1.5
40
1
0.5 20
2 4 6 8 10 12 14 16 18
Inoculum size (%)
Fig. 136.6 Effects of inoculum size on the COD removal rate. BS5 was inoculated into
degrading medium at six different inoculum size (4, 6, 8, 10, 12, 14, and 16 %). The condition of
culture was as following, the volume of the alkaline wastewater 30 mL/250 mL, 0.5 % corn
starch, 1 % corn steep liquor, then cultured at 35 C, pH 7.5, at 150 r/min. 50h later, the COD
value was measured
could be concluded from the results presented in Fig. 136.6 that inoculum size
would have a major influence on bacteria breeding and COD removal rate. When
inoculum size was low, the degradation was lower obviously. When the inoculum
size increased, the COD removal rate increased gradually. The COD removal rate
reached 81.04 % while the inoculum size was 10 %. But the increment of COD
removal rate was not obvious if inoculum size continued to increase. So the
optimum inoculum size was set as 10 %.
136.3.9 Effects of Consecutive Treatment on the COD

Removal Rate
The performance of optimized strain BS5 was stable by taming. The COD of
alkaline wastewater obviously decreased under the optimized condition after 50 h-
treatment with the bacteria. But when the initial COD of wastewater was very
high, the COD of treated wastewater cannot satisfy the demand of discharge or
utilization standards. Take it into account, consecutive treatment processes may be
necessary.
The wastewater disposed for one, two or three times process, and the corre-
sponding COD removal rate was showed. According to the data presented in
Fig. 136.7, the aim of consecutive treatment on the COD removal rate was
achieved. After the first round treatment, the COD removal rate was up to 78. 3 %.
Whereas, the second round treatment culture enabled the COD removal rate
reached 90.5 %. Through a third disposal process, the COD removal rate was
96.2 %. It was considered that consecutive disposal process may help to reducing
COD of wastewater effectively.
Effects of consecutive process on COD removal rate

100
COD removal rate(%)

80
60
40
20
0
one time two times three times
Fig. 136.7 Effects of consecutive process on COD removal rate. Firstly, treated alkaline
wastewater at the speed 4000 r/min, 10 min, and take 30 mL clear liquid to 250 mL flask. The
culture condition were 0.5 % corn mill, 1 % corn steep liquor, 35 C, pH 7.5, 10 % inoculum size
and agitation rate 150 r/min. 50h later, the COD value was measured. The wastewater disposed
by one, two, three times process, and the correspond COD removal rate was showed
136.4 Conclusion
The organic pollutants in petrochemical and oil refining which are resistant to
degradation can be dreadfully hazardous to human health. As they persist in the
environment, they are capable of long range transportation, bioaccumulation in
human and animal tissue and biomagnification in food chain [13]. Thus treatment
of alkaline wastewaters is necessary and biological methods are the most appro-
priate techniques due to mineralization of toxic organic compounds and inex-
pensiveness [10].
The use of microbial catalysts in the biodegradation of organic compounds has
advanced significantly during the past days. It has been found that large numbers
of microbes co-exist in almost all natural environments. Identification of effective
microbial species is considered as one of the important priorities for production of
the biomass in order to achieve desirable kinetic of biological reactions [6].
At the same tine, several external factors can limit the rate of biodegradation of
organic compounds. These factors may include temperature, pH, oxygen content
and availability, substrate concentration and physical properties of contaminants.
Each of these factors should be optimized for the selected organism for the
maximum degradation of the organic compound of choice.
In this study, strains degrading alkaline wastewater were isolated from the
sludge nearby petroleum smelter and enriched, among which BS5 performed the
highest degradation ability. Furthermore, BS5 was identified as Bacillus flexus
through 16S r DNA and some other data (not shown in this paper). Data presented
in this study demonstrated that the strain’s optimum disposal condition should be
0.5 % corn starch, 1 % corn steep liquor, temperature 35 C, initial pH 7.5, 10 %
inoculation size. In such conditions, the removal rate of COD can be up to 81.04 %
and almost 10.38 % higher than before. Meanwhile, successive process was
developed to enhance the degradation efficiency.
1276 K. Chen et al.
In conclusion, a Bacillus flexus strain characterized stable performance and

inexpensive cost in alkaline wastewater treatment was isolated and identified,
which has prospective application values in this area.
Acknowledgments This work was supported by the Tanggu Technical Development Founda-
tion Grant of Tianjin in China.
References
1. Choe EK, Son EJ, Lee BS et al (2005) NF process for the recovery of caustic soda and
concentration of disodium terephthalate from alkaline wastewater from polyester fabrics.
Desalination 186(1–3):29–37
2. David AB, Peter RR (1995) Sequence and analysis of the O antigen gene (rfb) cluster of
Escherichia coli 0111. J. Gene 164(1):17–23
3. García Becerra FY, Acosta EJ et al (2010) Alkaline extraction of wastewater activated sludge
biosolids. Bioresour Technol 101(18):6972–6980
4. Garcia GI, Pena PRJ, Venceslada B et al (2000) Removal of phenolic compounds from olive
mill wastewater using Phanerochaete chrysosporium, Aspergillus terreus and Geotrichum
candidum. Proc Biochem 35(8):751–758
5. Leal K, Chacin E, Behling E et al (1998) A mesophilic digestion of brewery wastewater in an
unheated anaerobic flter. Bioresour Technol 65(1–2):51–55
6. Liu WT, Chan OC, Fang HH (2002) Characterization of microbial community in granular
sludge treating brewery wastewater. Water Res 36(7):1767–1775
7. Loh KC, Liu J (2001) External loop inversed fluidized bed aircraft bioreactor (EIFBAB) for
treating high strength phenolic waste water. Chem Eng Sci 56:6171–6176
8. Ma FR, Mu T, Bai B et al (2006) Application of High-concentration Sewage Disposal
Technology in Treatment of Diesel Alkaline Residue. J Environ Protect Oil & Gas Fields
16(2):19–21
9. Prisciandaro M, Mazziotti di Celso G, Vegliò F (2005) Development of a reliable alkaline
wastewater treatment process: optimization of the pre-treatment step. Water Res
39(20):5055–5063
10. Prieto MB, Hidalgo A, Rodriguez FC et al (2002) Biodegradation of phenol in synthetic and
industrial wastewater by Rhodococcus erythropitics. UPV-1 immobilized in air-stirred
reactor with clarifier. Appl Microbiol Biotechnol 58:583–859
11. Rao AG, Reddy TS, Prakash SS et al (2007) pH regulation of alkaline wastewater with
carbon dioxide: A case study of treatment of brewery wastewater in UASB reactor coupled
with absorber. Bioresour Technol 98(11):2131–2136
12. Richard ES (1983) Anaerobic biotechnology for industrial wastewater treatment. J Environ
Sci Technol 17(9):416–427
13. Robles A, Lucas R, Cienfueges AD et al (2000) Phenol oxidase activity in strains of the
hyphomycete Chalara paradoxa isolated from Olive mill wastewater disposal ponds. Enzyme
Microbial Technol 26(7):484–490
14. Rocenkery M (1993) The fast method of the COD determination. Anal Lett 26(9):2025–2030
15. Xie WY, Tan GQ, Zhong L (2007) Research and application of treatment technology for
alkaline waste from oil refinery. J M Chem Ind 27(6):10–14

Bok:978 3 642 37922 2

Uploaded by

Copyright:

Bok:978 3 642 37922 2

Uploaded by

Document Information

Original Title

Copyright

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Bok:978 3 642 37922 2

Uploaded by

Copyright:

Lecture Notes in Electrical Engineering 250

For further volumes:

Samuel Kaplan Bill Skarnes

Proceedings of the 2012

Pingkai Ouyang Bill Skarnes

ISSN 1876-1100 ISSN 1876-1119 (electronic)

Library of Congress Control Number: 2013945796

Springer-Verlag Berlin Heidelberg 2014

Printed on acid-free paper

Springer is part of Springer Science+Business Media (www.springer.com)

2012 International Conference on Applied Biotechnology (ICAB2012) was

Tianjin, China Tong-Cun Zhang

Chinese Society of Biotechnology

Tianjin University of Science and Technology

Tianjin Society for Microbiology

Pingkai Ouyang, Academician, Nanjing University of Technology, China

Zixin Deng, Academician, Shanghai Jiaotong University, China

Prof. Baishan Fang, Xiamen University, China

Prof. Ning Chen, Tianjin University of Science and Technology, China

Prof. Shuheng Ma, Vice Dean, Tianjin Institute of Industrial Biotechnology,

Yinhua Wan, Deputy Secretary General, Chinese Society of Biotechnology, China

Dingcheng Liu, Vice Dean, Division of Science and Technology, Tianjin

Prof. Shuheng Ma, Vice Dean, Tianjin Institute of Industrial Biotechnology,

Deputy Secretary General

Prof. He Huang, Dean, Division of Science and Technology, Nanjing University of

Part III Pharmaceutical Biotechnology

66 Promising Biomarkers: MicroRNAs at Diagnosis,

67 Dimerization of Chemokine Receptors and its Novel Roles

68 The Mechanism of Apoptosis in Adenocarcinoma

69 Serum miR-124 and TNF-a are Biomarkers

70 A New Process for Preparation of Hydroxytyrosol . . . . . . . . . . . 689

71 Design and Synthesis of 2-Arylbenzimidazole Analogues

72 Design and Synthesis of SRT1 Activators for Potential

73 Synthesis of 1,3-benzodioxol-5-ethanol and Its Derivatives . . . . . 715

74 Tetrandrine Inhibits Proteasomal Chymotrypsin-Like Activity

75 The Purifying Effect of Apocynum Venetum Seedlings

76 Expression, Purification, and Activity Assay

77 Synthesis and Controlled Release of 5-Fluorouracil

78 Telomerase is Significant as an Early Diagnostic Marker

79 Isolation, Identification, Antibacterial Effects of Antibiotic

80 Lichen: A Potential Anticancer Officinal Resource . . . . . . . . . . . 773

81 Clinical Significance of Screening Impaired Glucose

82 Cardiac Hypertrophy-Specific Genes are Synergistic

83 Design, Synthesis, and Biological Evaluation of the Novel

84 Using Water Miscible Ionic Liquid to Improve the Efficiency

85 Nuclear Receptor Property of E2F1 for Novel Anticancer

86 MRTF-A Promotes Migration of MCF-7 Breast Cancer

87 The Analysis of the Inhibition Effect of Cholic Acid

88 Design, Synthesis and Biological Evaluation of the Novel

89 Preliminary Study on the Mechanism of Cartilage

90 Design and Synthesis of Novel 20-Substituted

91 Design and Synthesis of 5-Azacytidine Analogs . . . . . . . . . . . . . 861

92 Stigmasterol from the Flowers of Trollius chinensis . . . . . . . . . . 867

93 Design, Synthesis and Primary Biological Evaluation

94 Research Progress on the Anti-Rheumatoid Arthritis Drugs . . . . 883

95 Design and Synthesis of 1H-2,3-Dihydro-1-Pyrrolizinones

96 Inhibition of iNOS to Protect Intermittent Hypoxia-Induced

97 Prepared and Characterization of 12b,15a-Dihydroxy-

Part IV Agriculture, Environmental, Marin Biotechnology

98 Structure Elucidation of Two Triterpenoid Saponins

99 Study on Extraction of Xylan from Bamboo Shoot Shell . . . . . . 923

100 Study on Preparation of Low Alcoholic Wine from Tomato . . . . 931

101 Effects of Glucose Assimilation on Lutein and Chlorophyll