DNA-Based Molecular Diagnostic Techniques
DNA-Based Molecular Diagnostic Techniques
DNA-Based Molecular Diagnostic Techniques
FISHERIES
TECHNICAL
DiagnosticTechniques PAPER
ResearchNeedsforStandardizationand 395
ValidationoftheDetectionofAquatic
AnimalPathogensandDiseases
AUSTRALIAN CENTRE
FOR INTERNATIONAL
AGRICULTURAL
RESEARCH
DEPARTMENT FOR
INTERNATIONAL
DEVELOPMENT
NETWORK OF
AQUACULTURE
CENTRES
IN ASIA-PACIFIC
COMMONWEALTH
SCIENTIFIC AND
INDUSTRIAL
RESEARCH
ORGANIZATION
FAO
DNA-based Molecular FISHERIES
TECHNICAL
Diagnostic Techniques: PAPER
Research Needs for Standardization and
Validation of the Detection of Aquatic
395
Animal Pathogens and Diseases
Edited by
Peter Walker
CSIRO, Australia
and
Rohana Subasinghe
FAO, Rome
DFID International
Development
i
The designations employed and the presentation of material in this publication do not imply the expression of any
opinion whatsoever on the part of the Food and Agriculture Organization of the United Nations concerning the legal
status of any country, territory, city or area or of its authorities, or concerning the delimitation of its frontiers or
boundaries.
All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted in any form or by
any means, electronic, mechanical, photocopying or otherwise, without the prior permission of the copyright owner. Applications
for such permission, with a statement of the purpose and extent of the reproduction, should be addressed to the Director,
Information Division, Food and Agriculture Organization of the United Nations, Viale delle Terme di Caracalla, 00100 Rome,
Italy.
FAO 2000
ii
PREPARATION OF THIS DOCUMENT
This document contains the report, including recommendations, and thirteen papers presented at the
Expert Workshop on DNA-based Molecular Diagnostic Techniques: Research Needs for Standardization
and Validation of the Detection of Aquatic Animal Pathogens and Diseases, held in Bangkok, Thailand,
from 7-9 February 1999.
The Expert Workshop was jointly organized by FAO Inland Water Resources and Aquaculture Service,
Network of Aquaculture Centres in Asia-Pacific (NACA), Centre for Scientific and Industrial Research
for Australia (CSIRO), Australian Centre for International Agriculture Research (ACIAR), and the
Department for International Development of the United Kingdom (DFID) and was held at the NACA
Headquarters in Bangkok. The editing, publishing, and distribution of the document were undertaken by
FAO, Rome.
Distribution:
iii
Walker, P. and Subasinghe, R. (eds.)
DNA-based molecular diagnostic techniques: research needs for standardization and validation of the
detection of aquatic animal pathogens and diseases. Report and proceedings of the Joint
FAO/NACA/CSIRO/ACIAR/DFID Expert Workshop. Bangkok, Thailand, 7-9 February 1999.
FAO Fisheries Technical Paper. No.395. Rome, FAO. 2000. 93p.
ABSTRACT
In efforts to limit trans-boundary movement of pathogens and reduce the economic and socioeconomic
impact of disease in aquaculture, there is considerable scope for more effective use of DNA-based
methods of pathogen detection. These technologies offer rapid results with potentially high sensitivity and
specificity, at relatively low cost. Recognition of these advantages has led to rapid adoption of available
DNA-based tests, particularly in shrimp culture for which histological procedures lack specificity and
culture-based methods have not been possible. However, few if any of the available tests have been
assessed appropriately against other diagnostic methods or standardized and validated for specified
applications. In fish and shrimp, type or strain specificity of most tests for pathogens in the Asian region
is poorly understood and, in molluscs, there is little information on the significant pathogens and few tests
of any kind have been developed. Furthermore, tests presently available are frequently conducted by
technicians who may not be sufficiently aware of the need for stringent test protocols or the meaning and
limitations of the data generated. Implementation of standardized practices that produce reliable, useful
and comparable data will require a significant investment in research, training and infrastructure
development. Effective implementation will also be assisted by enhanced communication between
aquatic animal health practitioners in the region and scientists with expertise in molecular diagnostic
technologies.
To increase the availability of scientists and technicians with skills in pathology and molecular diagnostic
technologies, the review also recommends development of FAO/NACA-sponsored training programs for
staff from key laboratories in the region. Training priorities should be in: i) the use of standard
histopathological methods for health screening of fish and molluscs; and ii) the use of standard DNA-
based methods for pathogen detection including sample collection, application of test protocols and the
analysis and interpretation of test results. Because of the urgency of disease problems and the availability
of suitable tests, training in DNA-based methods should focus initially on detection of shrimp pathogens.
The review also recommends the development of a laboratory accreditation program in order to achieve
standardization of sampling methods and test procedures. The establishment of reference laboratories will
assist accreditation for each of the major pathogens. Laboratory accreditation and training programs
should complement the activities of OIE in obtaining internationally agreed test standards for molecular
diagnostic technologies.
iv
CONTENTS
1 BACKGROUND........................................................................................................................................... 2
1.1 GLOBAL AQUACULTURE DEVELOPMENT .................................................................................................... 2
1.2 IMPACT OF DISEASE ................................................................................................................................... 2
1.3 ROLE OF DNA-BASED TECHNOLOGIES IN DIAGNOSIS AND PATHOGEN DETECTION .................................... 2
1.4 IMPEDIMENTS TO THE USE OF DNA-BASED DIAGNOSTIC TECHNIQUES ...................................................... 3
2 EXPERT WORKSHOP ............................................................................................................................... 4
2.1 TERMS OF REFERENCE ............................................................................................................................... 4
2.2 PARTICIPANTS ........................................................................................................................................... 4
2.3 WORKSHOP PROCESS ................................................................................................................................. 5
3 PATHOGEN FOCUS GROUP REPORTS................................................................................................ 5
3.1 SHRIMP PATHOGENS .................................................................................................................................. 5
3.1.1 Status of research and identification of research needs ............................................... 5
3.1.2 Standardization of DNA-based diagnostic tests ........................................................... 6
3.1.3 Networking and communication ................................................................................. 7
3.1.4 Training and extension .............................................................................................. 7
3.2 MOLLUSC PATHOGENS............................................................................................................................... 8
3.3 FINFISH PATHOGENS .................................................................................................................................. 9
3.3.1 Diseases requiring application of DNA-based technologies .......................................... 9
3.3.2 Evaluation of needs for rapid detection techniques ...................................................... 9
3.3.3 Status of research..................................................................................................... 9
3.3.4 Key constraints to establishment of international standards........................................ 10
3.3.5 Recommendations for research programs ................................................................ 10
4 ISSUES RELATING TO THE ADOPTION OF INTERNATIONAL STANDARDS FOR DISEASE
DIAGNOSIS AND HEALTH CERTIFICATION................................................................................... 11
1
1 Background
1.1 Global aquaculture development
In 1995, global production from aquaculture reached 27.8 million tones and was valued at US$ 42,300
million. Developing countries contributed over 87% of total production, of which 90.1% was from
Asia. China contributed 63.4% of total world production. Over the past decade, global aquaculture
production has grown at an average annual rate of 9.6% compared to 3.1% for livestock meat and 1.6%
for capture fisheries. Between 1984 and 1995, growth in aquaculture production in low-income food
deficit countries (LIFDCs) was over five times faster than in developed countries (Rana, 1997).
Efforts to overcome these problems have led to the development of immunoassay and DNA-based
diagnostic methods including fluorescent antibody tests (FAT), enzyme-linked immunosorbent assays
(ELISA), radioimmunoassay (RIA), in situ hybridization (ISH), dot blot hybridization DBH) and
polymerase chain reaction (PCR) amplification techniques. The use of DNA-based methods derives
from the premise that each species of pathogen carries unique DNA or RNA sequences that
differentiate it from other organisms. The techniques offer high sensitivity and specificity, and
2
diagnostics kits allowing rapid screening for the presence of pathogen DNA are moving rapidly from
development in specialized laboratories to routine application. DNA probes are expected to find
increasing use in routine disease monitoring and treatment programs in aquaculture, in field
epidemiology and in efforts to prevent the international spread of pathogens (national quarantine and
certification programs).
DNA-based methods have been used in diagnosis and for detection of many economically important
viral pathogens of cultured finfish and penaeid shrimp. For finfish, tests have been developed for
pathogens such as channel catfish virus (CCV), infectious hematopoietic necrosis virus (IHNV),
infectious pancreatic necrosis virus (IPNV), viral hemorrhagic septicemia virus (VHSV), viral
nervous necrosis virus (VNNV) and Renibacterium salmoninarum (see Muroga, 1997; Plumb, 1997).
PCR has been used in Japan to screen striped jack (Pseudocaranx dentex) broodstock for VNNV,
permitting selection of PCR-negative spawners as an effective means of preventing vertical
transmission of this pathogenic virus to the larval offspring (Muroga, 1997).
DNA-based detection methods for detection of penaeid shrimp viruses are now used routinely in a
number of laboratories around the world. These include probes for such diseases as white spot
syndrome virus (WSSV), yellow head virus (YHV), infectious hematopoietic and infectious
hypodermal and haematopoeitic necrosis virus (IHHNV) and Taura syndrome virus (TSV) which
pose the greatest threat to world shrimp culture production (Lotz, 1997). DNA probes have also been
developed for an intracellular parasites and bacteria infecting shrimp. DNA-based techniques will
have an important role to play in efforts to develop sustainable shrimp culture in Asia and elsewhere.
Production facilities in Thailand are currently using PCR techniques to screen shrimp post-larvae for
WSSV. Culturing such larvae in closed (biosecure) or semi-closed culture systems can prevent or
minimize viral infections, leading to a viable shrimp industry. The development of specific pathogen-
free shrimp stocks will also depend on the use of such techniques.
The further development and use of DNA-based diagnostic techniques will also assist international
efforts to control the introduction of exotic diseases into new geographic areas. Reliable and rapid
techniques are needed by national and regional diagnostic laboratories to screen imported fish and
shellfish for important pathogens. The Office International des Epizootics (OIE) or World Animal
Health Organization, is a veterinary organization with 147 member countries. The OIE (through its
Fish Diseases Commission) is responsible for tracking diseases of fish and shellfish that have a
serious economic impact on aquaculture and capture fisheries. There is considerable potential to
apply DNA-based methods for OIE testing if they can meet the stringent criteria of a standardized,
validated, accurate, reliable and accessible diagnostic technique.
x The extreme sensitivity of these methods allows the detection of target DNA present at very low
levels. However, positive results provide little quantitative assessment of the infection level, and
do not indicate whether the pathogen is replicating or causing disease in the species tested. Thus,
carrier status and viability of the pathogen are not determined using DNA-probes.
x The extremely high specificity of these tests, coupled with the ability of many viruses to rapidly
change in genetic structure, can result in failure to detect a virus that has altered its genetic profile.
3
x Large differences in sensitivity are related to the PCR method used (e.g., 1-step PCR or 2-step
PCR with nested primers).
x "False negatives" are easily caused by the selection of inappropriate host tissue sources for
detection of the pathogen in question, incorrect choice of DNA extraction method, or low
pathogen prevalence in the population sampled.
DNA-based detection and diagnostic methods have the potential for widespread application of in
aquaculture. As the technology is already being adopted rapidly in developing countries in Asia,
there is an urgent need to address these issues and to develop an action plan for research and training
activities that will facilitate more effective utilization.
2 Expert Workshop
2.1 Terms of reference
The terms of reference were as follows:
x Identify and prioritize research areas where the introduction and use of nuclear and related
technologies is likely to have the most significant impact on improving disease diagnosis, with
emphasis on diseases affecting aquaculture, in developing countries.
x Evaluate needs for rapid diagnostic techniques for the principal diseases of cultured fish and
shellfish.
x Identify problems and key constraints related to establishing international standards for protocols
and procedures for such tests and make recommendations towards their solution
x Make recommendations for programs of research to be developed jointly by IAEA, FAO, and
other interested and concerned agencies and institutions, to assist developing countries to develop,
standardize and validate nuclear related, DNA-based rapid diagnostic tools for major aquatic
animal pathogens.
2.2 Participants
Dr Alexandra Adams, University of Stirling, Scotland.
Dr Franck Berthe, IFREMER, France.
Dr Eugene Burreson, Virginia Institute of Marine Science, Virginia, USA.
Dr Pornlerd Chanratchakool, Aquatic Animal Health Research Institute, Bangkok, Thailand.
Dr Supranee Chinabut, Aquatic Animal Health Research Institute, Thailand.
Mr Dan Fegan, Natl. Centre for Genetic Engineering and Biotechnology, Bangkok, Thailand.
Prof. Timothy Flegel, Maihidol University, Bangkok, Thailand.
Dr Barry Hill, Fish Diseases Commission, OIE, Weymouth, England.
Dr Mike Hine, National Institute of Water and Atmospheric Research, New Zealand.
Dr Maura Hiney, National University of Ireland, Galway, Ireland.
4
Dr Indrani Karunsagar, University of Agricultural Sciences, Mangalore, India.
Prof. Donald Lightner, Arizona State University, Tucson, USA.
Dr James Lilley, Institute of Aquaculture, University of Stirling, Scotland.
Dr Sharon McGladdery, Gulf Fisheries Centre, New Brunswick, Canada.
Dr Gary Nash, Shrimp Culture Research and Development Company, Thailand.
Dr Michael Phillips, NACA, Bangkok, Thailand.
Dr Krishen Rana, FAO, Rome, Italy.
Dr Melba Reantaso, NACA, Bangkok, Thailand.
Prof. Mohamed Shariff, University Putra Malaysia, Serdang, Malaysia.
Dr Rohana Subasinghe, FAO, Rome, Italy.
Dr Kamonporn Tonguthai, Aquatic Animal Health Research Institute, Bangkok, Thailand.
Dr Peter Walker, CSIRO Tropical Agriculture, Brisbane, Australia.
In March and April 1999, Dr Franck Berthe (IFREMER, France) and Dr Peter Walker (CSIRO,
Australia) conducted consultancies at FAO, Rome to consider the outputs of the workshop and to
assemble this report.
Shrimp pathogens in the Asia-Pacific region presently listed by NACA include WSSV and YHV
(notifiable), INNHV, GAV, MBV, BMNV and SMV (significant pathogens). HPV also may have
significant effects on production. The range of histopathological and molecular techniques available
for detection of these agents has recently been reviewed (Lightner and Redman, 1998). Research
needs pertaining to the application of DNA-based technologies vary, reflecting the stage of
development of the technology and the relative importance of the pathogens. In view of their ongoing
impact on shrimp aquaculture in Asia and OIE-notifiable status, this report has focussed primarily on
the research status and needs for WSSV, YHV and viruses in the YHV complex. The urgency of
implementing measures to control these viruses is presently the dominant concern for shrimp health in
Asia.
5
WSSV. A number of PCR, nested-PCR and hybridization tests has been developed for WSSV
detection. The tests use a range of different PCR primers and hybridization probes targeted to
different and poorly defined sites in the WSSV genome. Methods of DNA sample preparation and
PCR test protocols vary and there has been no objective comparison of the sensitivity and specificity
of the tests. A recent analysis of PCR products amplified from WSSV samples obtained from a wide
geographic range has indicated remarkable uniformity. However, the data suggested that at least one
WSSV-related virus in the USA may be distinct (Lo et al., 1999). Other reports also suggest some
variability in the detection specificity of PCR tests (Park et al., 1998; R.A.J. Hodgson and P.J. Walker,
unpublished data). There is evidence that a range of crustaceans and other arthropods test positive by
PCR (Lo et al., 1996; Alday-Sanz and Flegel, 1997; Maeda et al., 1998), but the significance of these
results for the epidemiology WSSV infection in shrimp is unclear. A more extensive analysis of
WSSV variation should be conducted to determine the implications for detection and disease
diagnosis.
The proliferation of PCR tests and protocols for WSSV detection also presents problems for
comparative validation. The one-step and nested PCR primers and procedures described by Lo et al.
(1996) are well documented in the published literature and the utility of the tests has been
demonstrated for a range of applications. The test appears to be reliable and not subject to commercial
restrictions, and would be suitable as a primary reference for standardization purposes. Estimation of
the level of WSSV infection may have important applications in disease management strategies and
this should be more clearly defined. It may be useful to adopt a quantitative PCR test as a secondary
reference standard.
YHV. The YHV complex constitutes a group of related agents which includes yellow head virus
(YHV), gill-associated virus (GAV) and lymphoid organ virus (LOV). YHV and GAV are closely
related but distinct pathogens; LOV is a variant of GAV which occurs in healthy shrimp. Yellow head
disease has been reported from many countries in the Asian region but, in most cases, the agents have
not been clearly defined. To date, YHV has been shown to occur only in Thailand and GAV/LOV
only in Australia.
An RT-PCR test is available for YHV but the test does not detect GAV. RT-PCR and nested RT-PCR
tests are available for GAV. The GAV RT-PCR also detects at least some isolates of YHV but the test
will not distinguish GAV and LOV. In situ hybridization probes have also been developed for YHV
and GAV. The YHV probe detects both YHV and GAV. All tests developed to date have targeted
sequences in the polymerase gene.
More research is required to determine the range and distribution of YHV complex viruses in the
region, to identify other possible members of the complex and to develop both pan-specific and type-
specific detection tests. If possible, tests should also be developed to differentiate pathogenic from
non-pathogenic variants. There may be value in the adoption of multiplex PCR tests for YHV that
allow discrimination of viruses in the complex.
6
It is proposed that FAO/NACA accreditation should be issued by reference laboratories designated for
each pathogen. The reference laboratory should publish a detailed standard protocol including
procedures for sample collection, DNA/RNA preparation, PCR reagent preparation and storage, PCR
amplification and sample analysis, and preparation and use of control reagents. Adoption of the
standard protocol will be facilitated by publication in local languages. The reference laboratories
should also be responsible for:
x maintaining an agreed test as the primary reference standard against which other testing protocols
should be assessed;
x maintaining standard PCR reagents including primers and suitable positive and negative controls;
Accreditation should initially focus on WSSV diagnosis. Because of the proliferation of WSSV PCR
testing protocols, a primary reference standard should be identified. It is proposed that the one-step
and nested WSSV PCR tests described by Lo et al. (1996a; 1996b) should be adopted as the primary
standard. Implementation of a regional accreditation program should proceed following the issue of
standard protocols. A relative evaluation of the diagnostic capabilities of participating laboratories
should be conducted using standard coded samples of extracted DNA and shrimp tissue. An
epidemiologist should be involved in the design of the evaluation and data analysis. The evaluation
should be used as a basis for the development of an accreditation protocol.
NACA should be the conduit for maintaining communication between regional diagnostic
laboratories, preferably through an email network. The establishment of an accreditation program
should involve an initial meeting of participating laboratories to set up comparison protocols.
There is a need for training both at farm-level and of diagnostic practitioners. Practitioner training
should be through intensive short courses which include both theory and practice of DNA-based
technologies and high quality tertiary courses for veterinarians and fish pathologists. Farm-level
training is best achieved through in-country training of extension officers to meet local needs and
should include: i) instruction on sample collection and preparation methods; ii) accurate interpretation
of PCR results; iii) limitations of PCR technology; and iv) basic epidemiology.
7
Standard procedures for the application of DNA-based technologies for disease prevention should also
be documented. These should include the use of PCR in hatcheries and on-farm, and for the selection
of SPF broodstock.
With the possible exception of Australia and New Zealand, there is a lack of published or readily
available information on molluscan parasites, pests and diseases in the Asia-Pacific region. Most
countries lack dedicated expertise, facilities and infrastructures for molluscan health examination.
However, in many countries, mollusc production (subsistence and aquaculture) is established and
growing. Species under cultivation for food or secondary products include pearl oysters, edible
oysters, mussels, scallops, abalone and capiz shell. Although there is no immediate application for use
of DNA-based diagnosis methods on a routine basis for molluscs, tools already developed could be
used for cross-checking the specific/generic identities of emerging parasites which appear related to
known pathogens e.g. Haplosporidium spp., Marteilia spp. and Perkinsus spp. Unpublished data from
Australia indicates the presence of Haplosporidium sp. in Pinctada maxima, and Perkinsus sp. in
Saccostrea commercialis. In view of the presence of potential pathogens, the reported growth of
mollusc aquaculture industries and the increasing pressure for live introductions and transfers, there is
an urgent need for a survey of normal and diseased animals to obtain more extensive data on mollusc
health.
There is also a need to establish national and regional expertise through training. As a prerequisite to
implementation, NACA should contact National Coordinators to: i) confirm support for a mollusc
health program; ii) identify commercially significant species; and iii) designate at least two technicians
who would be dedicated to the project. NACA should also establish a panel of experts (from within
and outside the region) who will support the project and provide reagents and reference material.
Initially, training will aim to establish an initial baseline of expertise in husbandry, sampling, gross
observations, fixation, anatomy, and histology. This first step would provide the basis for national
programs for mollusc health monitoring. Where resources are limited, this could include market
samples. Initial training would be followed (3-4 months later) by an advanced session for the same
participants covering histopathology and technical problem solving. During this session, each
participant would bring examples of their own material for joint consultation and evaluation. In
addition, contacts with mollusc pathology specialists and reference material from other collections
(slides and guides) should be available for these participants. The goal of this training program would
be to establish a capability for independent monitoring of mollusc health in each country.
As a result of this training program, a clearer picture of the health status of molluscs and the diagnostic
needs in the region should emerge. The connection between this initiative and the supporting network
(comprising specialist mollusc pathology laboratories) will enable access to the advanced diagnostic
tools discussed in detail in the full workshop forum (for finfish, shrimp and molluscan pathogens).
The mollusc pathogen Focus Group determined that, in the Asia-Pacific region, these methods should
be reserved for cross-checking material containing organisms resembling known pathogens for which
advanced diagnostic methods are available in supporting laboratories (e.g., Marteilia spp. DNA-
probes). They could also be used to determine the geographic and host distributions of these
pathogens as they emerge. DNA sequence analysis should also be conducted (e.g. to confirm positive
probe results) to validate application of available probes to pathogens in the region. The need to
develop additional molecular diagnostic tools and other pathogen/pathogen-group research needs will
be determined as pathogens emerge from this surveillance program.
8
3.3 Finfish pathogens
Alexandra Adams, Supranee Chinabut, Barry Hill, Maura Hiney, James Lilley, Kamonporn
Tonguthai.
There are 3 areas for which the introduction and use of DNA-based techniques is likely to have a
significant impact on improving disease diagnosis in developing countries.
Mycobacteriosis. As there is a zoonosis risk associated with M. marinum, there is a special need to
identify mycobacterium infections to the species level. Currently available PCR methods should be
standardized and validated to the extent that stocks can be certified (see paper by Adams, Appendix 1).
Viral nervous necrosis (VNN). VNN is a potential threat to an important grouper industry in the
region. DNA probes are available to particular strains in Europe and possibly Australia. A
comparative study of available probes is required and a validated method for screening wild grouper
broodstock should be developed.
Epizootic ulcerative syndrome (EUS). EUS infections cannot presently be distinguished from
occurrences of ulcerative mycosis in USA. There is a need for a standardized, validated in situ
hybridization test that is specific for A. invadans. The development of PCR primers and/or
hybridization probes for the EUS-associated rhabdovirus would also assist in understanding the
disease syndrome (see Lilley and Chinabut, Appendix I)).
In addition to these 3 areas, there is a need for basic research on potentially emerging diseases,
including red spot disease and streptococcal infections.
The majority of pathogens causing the principal diseases of fish in the Asia-Pacific region can be
detected and identified using existing methodologies. These include visual observation and light
microscopy for parasitic infections, and routine bacteriology and histology for bacterial pathogens.
Specific staining methods and antibody-based techniques are also utilized. Cell culture is used for
grown and identification of viral pathogens. The primary fungal infection (EUS) is detected by
histology. However, DNA-based technologies would assist in controlling the spread of fish diseases
disease if used for confirmation of diagnosis and for screening fish for specific pathogens such as M.
marinum, VNNV and A. invadans.
Mycobacterium spp. Monoclonal antibodies (MAbs), PCR primers and DNA probes are available.
The MAbs can discriminate M. marinum at species level but do not detect all isolates. New MAbs are
currently being developed. Two PCR-based methods have been developed, one employing enzyme
restriction analysis of the PCR product, and the other employing reverse cross-blot analysis. The later
appears to be more specific and can detect all 3 species infecting fish (M. marinum, M. fortuitum and
M. chelonei). This test is presently used to detect aquatic mycobacteria in fish tissue samples, water
samples and in human clinical biopsies but it requires further standardization and field validation.
9
VNNV. VNN is present in Australia and has recently been detected in grouper in Thailand.
Diagnostic antibodies, PCR primers and DNA probes have been developed for VNNV isolates from
the Mediterranean region where the disease causes widespread mortalities. These reagents should be
used to determine their specificity for VNNV isolates from the Asia-Pacific region.
EUS. PCR and in situ hybridization tests are currently being developed to detect A. invadans from
Asia. These should be utilized to screen samples from different geographical locations for the
presence of A. invadans. Primers should also be developed against the rhabdovirus which is often
isolated in association with EUS.
The need for a more formal set of protocols and procedures for PCR-based diagnostic assays has been
recognized for a number of years. However, as in many other areas of diagnostics, there has been no
serious attempt to set agreed international standards. For a technique with the potential power PCR,
the lack of clear guidelines for the correct performance is a serious constraint to its routine use. A
second and more serious constraint is the almost complete absence of validation studies undertaken on
field samples for any of the currently available assays (see Hiney, Appendix I). Although validation
programs are expensive and time consuming, and carefully designed laboratory studies can provide
much of the data required to ensure that PCR-based assays perform with acceptable precision,
information on the meaning of the results generated by non-culture-based diagnostic techniques can
only be obtained through field validation programs. Therefore, collaborative projects to assess
currently available PCR-based diagnostic techniques through comparative and predictive field
validation studies are urgently required and should be actively supported by funding agencies.
Adoption of PCR-based diagnostic assays, to replace more established methods is an attractive option
for many laboratories. These assays are seen as more sensitive, rapid and logistically simple, and have
the allure of high technology. However, in the absence of adequate internal (laboratory) and external
(field) validation, interpretation of the meaning of the results generated by the PCR-based assays will
remain problematic. While an assay may be acceptable in a research context it will not be acceptable
in either a diagnostic or regulatory context and could generate misleading data. Therefore, the priority
of any research program that aims to replace current diagnostic methods with PCR-based assays must
be a carefully considered validation program that addresses the issue of interpretation of meaning.
As a first approach, comparative validation programs should be conducted in which PCR-based assays
are performed in parallel with established methods over a reasonable period of time and using
statistically significant number of samples. This type of validation program would also allow
standardization of the performance of the assay in the laboratory. Standard reference material (both
positive and negative controls) supplied from a central reference laboratory would be important to
ensure the precision of the results generated by such a study.
More importantly, it is essential that results generated by PCR-based diagnostic assays can be related
to field situations. Positive or negative results generated by the assay should be reliably related to
actual disease episodes. It is only through such ‘predictive validation’ that interpretation of the results
in relation to disease diagnosis is meaningful. Some components of a predictive validation study
could be conducted retrospectively if field data of adequate quality were available.
The 3 fish diseases (mycobacteriosis, VNN and EUS) highlighted in this report are recommended for
future research.
10
4 Issues relating to the adoption of international
standards for disease diagnosis and health
certification
In 1995, the World Trade Organisation (WTO) implemented the Agreement on the Application of
Sanitary and Phyto-Sanitary Measures (SPS Agreement) to define the conditions under which countries
can impose sanitary conditions on imports of animal and animal and plant products. This Agreement
is intended to promote international trade by requiring all member states to use only international
standards for reducing disease risks associated with imported products. For animals and animal
products, the Agreement identifies the guidelines and recommendations established by the Office
International des Epizooties (OIE) as the appropriate and preferred international standard. However,
the Agreement also allows governments to use standards developed by other relevant international
organisations whose membership is open to all WTO members, or to use higher standards if an
appropriate risk assessment provides adequate scientific justification.
In Europe, EU Member States have agreed common standards for the health conditions applying to
intra-Community trade in aquaculture animals and their products, based on those recommended by
OIE. Countries in the Asia-Pacific Region may also wish to agree on common standards of diagnostic
and health assurance tests. However, if international standards established in a particular region differ
significantly from those recommended by the OIE, trade with countries outside the region may be
adversely affected. For example, if the standard adopted in a region is lower than the OIE standard,
countries which apply the OIE standards could rightly refuse imports on the basis that they have
insufficient health guarantees. Conversely, if the standard agreed in a region is higher than those of
OIE, the same standard must be applied to imports from other regions, to ensure equivalence and
protection of the regional health situation. Furthermore, if an individual country adopts higher health
protection standards, the SPS Agreement requires scientific justification based on import risk
assessment. For diseases not listed by the OIE, trading countries may agree on any mutually
acceptable standards.
If a regional training and laboratory accreditation program for molecular diagnosis is to be established
in the Asia-Pacific region, the adoption of tests recommended in the OIE Diagnostic Manual for
Aquatic Animal Diseases would assist in achieving universally agreed standards. However, as the
Manual is revised only every 3 years or so, better methods may emerge from research before the next
edition is published. In considering a case for adoption of new molecular diagnostic methods, the
suitability must be rigorously assessed in consultation with independent experts. Acceptance is more
likely if the method has been published, has received wide scientific acceptance and has been
standardised, and preferably validated, in comparison with other standardised methods.
11
Although there are some common themes, it is also evident that there are significant differences in the
current relevance of DNA-based methods of pathogen detection for the different aquaculture sectors.
DNA-based methods are particularly suitable for detection and diagnosis of shrimp and mollusc
pathogens because of the absence of an antibody response in invertebrates and lack of suitable cell
lines for virus cultivation. In shrimp, the primary pathogens are well known and many DNA-based
methods have already been developed. However, in molluscs there is very limited knowledge of
pathogens and few diagnostic procedures of any kind are being employed in the Asia-Pacific region.
In fish, antibody and culture-based diagnostic methods are available and considered to be robust and
effective for routine diagnostic applications. As such, DNA-based methods in fish appear to be most
suitable for confirmatory diagnosis and rapid screening of low level or unapparent infections. To
achieve maximum impact, it is essential that research and training programs recognise these
differences and are tailored to reflect current levels of knowledge and sector-specific needs.
Where DNA-based tests are available and/or suitable, the most significant impediment to effective
implementation is the lack of standardised methodologies that are validated for specific applications.
There is a need for international agreement on methodologies that have been rigorously evaluated and
accredited for specific applications in disease diagnosis and pathogen screening. There is also a need
to ensure that tests are performed by trained staff with access to standardised reagents and suitably
equipped laboratories.
Because of existing limitations on the reliability and accessibility of the methods, international
standards recommended by OIE do not presently include DNA-based methodologies. However, the
potentially high sensitivity and specificity and relatively low cost of these tests has resulted in a
surprisingly rapid adoption rate in Asia, particularly for shrimp pathogens. Therefore, it is essential
that DNA-based tests are assessed on their merits against existing technologies and that programs to
achieve improved performance and international standardisation should be developed. It is also
essential that these programs should assist and complement the activities of OIE in obtaining
internationally agreed test standards.
Program A: Identification and characterisation of potential pathogens of molluscs, shrimp and fish in
the Asia-Pacific region.
This program should focus on improving the knowledge base by identification of new and emerging
pathogens (through health screening, epidemiological investigation and subsequent molecular
characterisation), relating pathogens in the region to those described elsewhere, and defining the
extent of genetic variation between related pathogens in the region. The program should include the
following priority projects:
12
x Health screening and pathogen identification in molluscs;
x Characterization of WSSV and YHV strain and pathotype variation in prawns;
x Characterization of Haplosporidium, Marteilia and Perkinsus spp. infecting molluscs in Asia;
x Characterization of VNNV strain variation in grouper and other fish of economic importance;
x Characterization of emerging fish diseases including red spot and streptococcal infections.
Program B: Development and validation of DNA-based diagnostic and detection methods for diseases
of aquaculture in the Asian region.
This program should draw on information currently available or obtained from Program A to develop
suitably specific DNA-based diagnostic methods and to evaluate and validate the methods for disease
diagnosis and pathogen screening programs. The research program should include the following
priority projects:
x Standardisation and validation of group and strain-specific DNA-based detection tests for WSSV
and YHV-complex viruses;
x Development and validation of species and strain-specific DNA-based detection tests for
mycobacteriosis, viral nervous necrosis and epizootic ulcerative syndrome in Asia-Pacific;
x Development and validation of DNA-based detection tests for Haplosporidium, Marteilia and
Perkinsus spp. in Asia-Pacific.
Recommendation. FAO/NACA should develop training programs for staff from key laboratories in the
region. Training is required in the following priority areas:
x The use of standard histopathological methods for health screening of fish and molluscs.
x The use of standard DNA-based methods for pathogen detection including sample collection,
application of test protocols and the analysis and interpretation of test results. Initially, training
should focus on detection of shrimp pathogens.
Recommendation. FAO/NACA should establish and maintain sector-based (fish, molluscs, shrimp)
communication networks of diagnostic practitioners and internationally recognised experts in aquatic
animal health. Activities of the networks should include:
x Exchange on information pathogen distribution in the Asia-Pacific region and the availability of
diagnostic tests and reagents;
x Development of cooperative research projects and training programs;
x Development of cooperative programs for test validation and laboratory accreditation.
13
5.5 International standardisation
Lack of standardisation of tests and test protocols is a major impediment to effective implementation
of DNA-based methods in the Asia-Pacific region. Standardisation requires international agreement
and cooperation in test selection, practitioner training and laboratory accreditation. Improvements in
the reproducibility, validity and comparability of data resulting from accreditation will also assist OIE
in assessing the suitability of DNA-based methods for detection of listed pathogens.
6 References
ADB/NACA. (1991). Fish Health Management in Asia-Pacific. Report on a regional study and
workshop on fish disease and fish health management. ADB Agriculture Department Report
Series No. 1. Network of Aquaculture Centres in the Asia Pacific, Bangkok, Thailand.
ADB/NACA. Final Report on the Regional Study and Workshop on Aquaculture Sustainability and
the Environment (RETA 5534). Asian Development Bank and Network of Aquaculture
Centres in Asia-Pacific. NACA, Bangkok, Thailand. (in press).
Alday-Sanz, V. and Flegel, T.W. (1997). The risk of introducing yellow-head and white-spot viral
infections from Asia to the Americas. CD ROM Paper No. 1, IV Congreso Ecuatoriano de
Acicultura, 22-27 October, 1997, Guayaquil, Ecuador, 9 p.
Ambrosia, R.E. and De Wall, D.T. (1990). Diagnosis of parasitic disease. Reviews of Sci Techn.,
Office Intern. Epizool. 9, 759-778.
Chamberlain, G.W. Sustainability of world shrimp farming. In: E.K. Pikitch, D.D. Huppert, and
M.P. Sissenwine (eds.) In: Global Trends: Fisheries Management. American Fisheries
Society Symposium 20, Bethesda, Maryland . (in press).
Chanratchakool, P., Turnbull, J.F., Funge-Smith, S.J., MacRae, I.H. and Limsuwan, C. (1998).
Health Management in Shrimp Ponds. Aquatic Animal Health Research Institute, Bangkok,
Thailand, 152 p.
Knowles, D.P. and Gorham, J. R. (1990). Diagnosis of viral and bacterial diseases. Reviews of Sci.
Techn., Off. Intern. Epizool. 9, 733-757.
Lightner, D.V. and Redman, R.M. (1998). Shrimp diseases and current diagnostic methods.
Aquaculture 164, 201-220.
Lo C.-F., Ho, C.-H., Peng, S.-E., Chen, C.-H., Hsu, H.-C., Chiu, Y.-L., Chang, C.-F., Liu, K.-F., Su,
M.-F., Wang, C.-H. and Kou, G.-H. (1996a). White spot syndrome (WSBV) detected in
cultured and captured shrimp, crabs and other arthropods. Diseases of Aquatic Organisms
27, 215-225.
Lo C.-F., Leu, J.-H., Ho, C.-H., Chen, C.-H., Peng, S.-E., Chen, Y.-T. Chou, C.-M., Yeh, P.-Y.,
Huang, C.-J., Chou, H.-Y., Wang, C.-H. and Kou, G.-H. (1996b). Detection of baculovirus
associated with white spot syndrome (WSBV) in penaeid shrimps using polymerase chain
reaction. Diseases of Aquatic Organisms 25, 133-141.
Lo C.-F., Hsu, H.-C., Tsai, M.-F., Ho, C.-H., Peng, S.-E., Kou, G.-H. and Lightner, D.V. (1999).
Specific genomic DNA fragment analysis of different geographical clinical samples of
shrimp white spot syndrome virus. Diseases of Aquatic Organisms 35, 175-185.
14
Lotz, J.M. (1997). Special topic review: Viruses, biosecurity and specific pathogen-free stocks in
shrimp aquaculture. World Journal of Microbiology and Biotechnology 13, 405-413.
Muroga, K. (1997). Recent advances in infectious diseases of marine fish with particular reference to
the case in Japan. p. 21-31. In: T.W. Flegel and I.H. MacRae (eds.) In: Diseases in Asian
Aquaculture III. Fish Health Section, Asian Fish. Soc., Manila.
Plumb, J.A. (1997). Trends in freshwater fish disease research. p. 35-47. In: T.W. Flegel and I.H.
MacRae (eds.) In: Diseases in Asian Aquaculture III. Fish Health Section, Asian Fish.
Soc., Manila.
Rana, K.J. (1997). Recent trends in global aquaculture production: 1984-1995. 14-19p. FAO
Aquaculture Newsletter. No. 16. August 1997, FAO, Rome. 28pp.
15
7 CONTRIBUTED PAPERS AND REVIEWS
16
Technological constraints to disease prevention and
control in aquatic animals, with special rference
to pathogen detection
Sharon McGladdery
Introduction
Effective disease management and risk analyses rely on accurate data and information. For aquatic
organisms, much of this information has been derived from a relatively narrow array of diagnostic
tools, most of which are either non-pathogen-specific or have undergone “the test of time” rather than
methodical validation or standardization procedures. Recently, however, this range of diagnostic
methods has expanded to encompass the molecular expertise pioneered by human health and
agricultural food production needs. The complexity of many of these techniques, and their rapid
adaptation to “field kits” for use by non-specialist personnel, has prompted a serious re-evaluation of
what we use in aquatic animal health management and why (Hiney, 1997).
This paper is aimed at determining which areas of aquatic animal health management are limited by
diagnostic and pathogen detection technology, and which are adequately met by traditional methods.
Specific disease examples are described elsewhere in these proceedings by the specialists working
with them, thus, the points below are deliberately general and provided as “food for thought”.
The Issues
Aquatic animal health management needs arise from two separate situations:
What do we have?
The tools available for disease diagnosis differ between the types of aquatic organisms being
examined. For finfish, there is a relatively broad range of diagnostic techniques, many of which can be
used as cross checks for diagnosis of a single disease. For example, epizootic haematopoietic necrosis
17
of redfin perch (Perca fluviatilis) and rainbow trout (Oncorhynchus mykiss) can be confirmed by: i)
conventional isolation on BF-2 (bluefin gill 2) or FHM (fathead minnow) cell lines with serological
identification of the iridovirus agent; ii) an indirect immunofluorescence antibody test (IFAT); iii) an
enzyme-linked immunosorbent assay (ELISA); or iv) polymerase chain reaction (PCR) amplification
and subsequent sequencing of the iridovirus DNA, using two published primers (OIE, 1997). Viral
encephalopathy and retinopathy (viral nervous necrosis) virus and related nodaviruses are detectable
using a range of specific and less specific techniques including: i) ultrastructural confirmation of
virus-induced histopathology; ii) immunohistochemistry; iii) DFAT; iv) ELISA; and v) PCR
amplification and sequence analysis (OIE, 1997). Some diseases with a more limited range of
diagnostic options can be diagnosed accurately using the techniques available e.g. whirling disease of
salmonids, caused by Myxosoma cerebralis, is presumptively diagnosed by behaviour, with
confirmatory observation of the myxosporean spores in cartilage digests or histology preparations.
Furthermore, few finfish diseases with a single aetiology, have defied conclusive diagnosis for long
periods.
The role of multiple infectious agents in a disease can usually be resolved through experimental
research and verification using Koch’s postulates. One example for finfish (which has an as yet
unidentified aetiologic agent) is erythrocytic inclusion body syndrome (EIBS). Although the causative
agent is believed to be viral in nature, secondary infections by bacteria and fungi can confound
diagnosis (Thoesen, 1994; Jarp et al., 1996). Once the primary infectious agent for such diseases is
identified, subsequent diagnosis is simplified and, generally, ignores the presence of the secondary
pathogens. The classic example of one such multi-factorial disease is epizootic ulcerative syndrome
(EUS) which is described in detail elsewhere in these proceedings.
The range of diagnostic techniques available for molluscan and crustacean diseases is narrower than
that for finfish. Most significantly, aquatic invertebrates lack self-replicating cell lines for isolation
and identification of intracellular pathogens. Finfish cell lines can be used, but the nature of the
isolated viruses is often subject to question, since they could be vertebrate contaminants rather than
primary invertebrate pathogens (Hill et al., 1986). In addition, Koch’s postulates have rarely been
fulfilled or replicated for molluscan or crustacean isolates from fish cellm lines. Thus, most
intracellular infections which cause overt disease in crustaceans and molluscs require histopathology
for presumptive diagnosis, with ultrastructural confirmation of viral or bacterial aetiology. Histology,
although laborious, has the advantage that it provides a permanent record of the pathogen in situ and
can be used to assess focal or systemic histopathology. Conversely, it is limited in sensitivity to
infectious agents which can be detected, and identified, at the light microscope level, eliminating most
viruses, many bacteria, protists and even some metazoan parasites (which require whole mount or
adult-stage identification).
As with finfish, multiple diagnostic techniques are available for a number of shrimp diseases
(Lightner, 1996) but most clinical cases can be presumptively diagnosed using non-specific techniques
(gross observation, histology and tissue smears). Confirmatory diagnosis is then achieved using
culture e.g. crayfish plague (Alderman and Polglase, 1986) or electron microscopic examination of
ultrastructural features (Lightner, 1996). Pathogen culture is rarely used for diagnosis of molluscan
diseases with the exception of two groups of significant disease agents: i) Perkinsus spp. (Ray, 1966;
Gauthier and Vasta, 1993; LaPeyre et al., 1993); and ii) Labyrinthuloides-like protists (Bower, 1987;
Kleinschuster et al., 1998). In clinical cases, however, these are also readily diagnosed using standard
histology. Most other significant disease agents of molluscs are difficult to culture, but can be isolated
under certain conditions (Hervio et al., 1993; 1995) i.e. acute infections. However, pathogen isolation
is normally reserved for development of more specific detection and identification techniques rather
than clinical diagnoses.
18
What are the limitations?
Speed of diagnosis is always a concern, especially with acute losses relying on histopathology,
ultrastructural confirmation or long periods of tissue/media culture. The time span required for
confirmatory diagnosis is frequently overcome by remedial action being based on presumptive
diagnoses such as tissue smears, gross pathology or behavioural changes. This is most effective in
areas with a well defined history of the disease e.g. Denman Island disease which is caused by
Mikrocytos mackini in Pacific oysters (Crassostrea gigas) on the west coast of Canada (Bower, 1988).
First time disease outbreaks in new species to culture, or appearing at a location for the first time, can
undergo protracted periods of non-diagnosis or, worse, misdiagnosis. Examples include a serious
disease of hard shell clams, Mercenaria mercenaria, caused by an unidentified Labyrinthuloides-like
organism, “QPX”. This may have been causing mortalities in pre-culture history (Drinnan and
Henderson, 1963) but its significance was not fully realised until hatchery broodstock and cultured
stock on grow-out beds started to die (Whyte et al., 1994; Ragone Calvo et al., 1997; Smolowitz et al.,
1996). Similarly, infectious salmon anaemia of Atlantic salmon (Salmo salar) was described as
haemorrhagic kidney syndrome (HKS) when first detected in Atlantic Canada (Getchell, 1997). It
took over a year before the causative agent was recognised as a virus and identified as ISAV, an agent
previously known only from Norway (Hastein, 1997).
Since disease risk analyses have been, and continue to be, well-debated (DeVoe, 1992), more effort
has been focussed on epidemiological principals in an effort to quantify and standardise the broad
range of qualitative-based risk evaluations (Hiney, 1997; Thorburn, 1999). This has revealed a broad
gap between the probability of detection of a single pathogen in a given sample and the statistical
confidence in that detection. This reflects non-survey-based assumptions for pathogen prevalence in
wild or open-water populations, as well as detection sensitivity, since prevalence is one of the critical
factors determining confidence of detection of a single pathogen in any given sample size (Ossiander
and Wedemeyer, 1973).
19
What do we have now?
Pathogen screening of aquatic animals involves the same techniques described above for disease
diagnosis. In addition to culture-based techniques, immunoassays (fluorescent antibody tests,
agglutination tests, ELISA) and nucleic acid probes have been available for finfish pathogens for
years, and some form the basis of kits now used for pathogen screening (e.g. Aeromonas salmonicida
which causes furunculosis, and Renibacterium salmoninarum which causes bacterial kidney disease).
Pathogen-sensitive techniques for molluscs pathogens have been developed more recently e.g.
immunoassays for Perkinsus marinus (Dungan and Roberson, 1993), Bonamia ostreae (Mialhe et al.,
1988), Vibrio tapetis (causative agent of brown ring disease of Manila and Portuguese carpet clams,
Ruditapes philippinarum and R. descussatus, respectively) (Castro et al., 1995) and giant rickettisia of
the sea scallop Pecten maximus (Le Gall et al., 1992). However, none of these techniques has yet
been transformed from research to routine diagnostic application and histology remains the most
broadly used detection/diagnostic method applied to molluscs. Detection of sub-clinical infections in
shrimp is limited to infectious hypodermal and hematopoietic necrosis virus (IHHNV), using
bioassays as well as in situ and dot blot hybridisation or PCR of viral product in haemolymph or tissue
homogenates, and baculoviral midgut gland necrosis virus (BMNV) using bioassays in susceptible
Penaeus japonicus and a fluorescent antibody test (Lightner, 1996). Stress-induced enhancement of
infections is another procedure used to enhance some sub-clinical viral infections in shrimp (and other
aquatic species) which cannot be detected by histology (Lightner, 1996).
For most disease agents in sub-clinical or abnormal “carrier” hosts, this means that sample size or
sampling frequency has to be increased to enhance the level of confidence in detection. For
techniques such as histology and ultrastructure, this frequently involves compromise between sample
size (confidence level) and resource capability (time and manpower). For other more sensitive
techniques (tissue culture, immunoassays and nucleic acid probes), the compromise may involve time,
expense and specialist resource factors.
Where can molecular techniques enhance zonation establishment and surveillance or transfer
disease risk analysis?
As described above, most agents of significant infectious diseases are difficult to detect using routine
diagnostic techniques in healthy, sub-clinical hosts. This means that establishing an area which is
designated free of a specific pathogen, inherently, includes a degree of error. Molecular screening
techniques for specific pathogens could reduce this error margin by increasing confidence of detection.
This would be especially important for areas that export live aquatic animals on a regular basis
(“uninfected” zone to “uninfected” zone transfers). However, the pathogen specificity of these
screening techniques negates detection of any other pathogenic or potentially significant organisms in
the same specimens. Additional non-specific, but less sensitive, screening techniques may, therefore
be required to give a true health “profile”. In addition, full-scale molecular-based testing of
populations for a given pathogen, especially where there has been no history of the disease, could meet
with varying degrees of resistance on both a practical and political level. Interpretation of low positive
results from such an area would be especially problematic and difficult to resolve. In conclusion,
molecular techniques might best serve as confirmatory screening to reinforce/refute results from
20
general screening methods both for establishing zones and for certifying stocks free of specific
pathogens. This would reduce the sample size and frequency required for high-technology screening,
making their application more practical and easy to justify. Ideally the confirmatory screening should
be on the same specimens (or sub-samples) from the same collections to ensure cross-reference
validity.
Certification of stocks as free of a specific pathogen could also benefit from the application of
molecular-based detection techniques, especially where transmission is direct and negative result
accuracy is imperative to prevent the spread of an endemic disease. Again, however, use of molecular
probes or other pathogen-specific assays would mean any other infectious organisms would be
undetected. Thus, as with zonation and surveillance, this pathogen-specific technology may best be
applied as a confirmatory detection method, especially for certification of transfers from disease
endemic areas.
Another limitation to epidemiological research into aquatic animal pathogens is the inability to easily
detect abnormal hosts (carrier, reservoir, accidental) of significant pathogens, especially those with
low or unknown host-specificity. Abnormal hosts may demonstrate non-characteristic lesions or
harbour the agents in tissues that are not infected in the “normal” host. This makes both detection and
identification difficult, or even impossible, using routine diagnostic techniques.
Conclusion
In general the range of tools available and under development show different advantages and
disadvantages for a range of different aquatic animal health applications. No one technique shows a
replacement advantage over another, and none appear sufficient to merit “stand-alone” application,
with the possible exception of pathogen-specific research.
References
Alderman, D.J. and Polglase, J.L. (1986). Aphanomyces astaci: isolation and culture. Journal of Fish
Diseases 9, 367-379.
Bachere, E., Mialhe, E., Noel, D., Boulo, V., Morvan, A. and Rodriguez, J. (1995). Knowledge and
research prospects in marine mollusc and crustacean immunity. Aquaculture 132, 17-32.
Bower, S.M. (1987). Artificial culture of Labyrinthuloides haliotidis (Protozoa: Labyrinthomorpha),
a parasite of juvenile abalone. Canadian Journal of Zoology 65, 2013-2020.
Bower, S.M. (1988). Circumvention of mortalities caused by Denman Island oyster disease during
mariculture of Pacific oysters. American Fisheries Society Special Publication 18, 246-248.
Brock, J.A. and Lightner, D.V. (1990). Diseases of Crustacea. Diseases caused by microorganisms.
In: Kinne, O. (ed.) Diseases of Marine Animals. Vol III: Introduction, Cephalopoda,
Annelida, Crustacea, Chaetognatha, Echinodermata, Urochordata. Biologische Anstalt
Helogoland, Hamburg, Germany, pp. 245-349.
Castro, D., Luque, A., Santamaria, J.A., Maes, P., Martinez-Manzanares, E. and Borrego, J.J. (1995).
Development of immunological techniques for the detection of the potential causative agent
of the brown ring disease. Aquaculture 132, 97-104.
DeVoe, R.M. (ed.). (1992). Introductions and Transfers of Marine Species: Achieving a Balance
Between Economic Development and Resource Protection. South Carolina Sea Grant
Consortium, Charleston, South Carolina. 198 pp.
Drinnan, R.E. and Henderson, E.B. (1963). 1962 mortalities and a possible disease organism in
Neguac quahaugs. In: Ellerslie Biological Station Annual Report 1962-63, B. Department of
Fisheries and Oceans, Canada, 18-20.
Dungan, C.F. and Roberson, B.S. (1993). Binding specificities of mono- and polyclonal antibodies to
the protozoan oyster pathogen Perkinsus marinus. Diseases of Aquatic Organisms 15, 9-22.
Gauthier, J.D. and Vasta, G.R. (1993). Continuous in vitro culture of the eastern oyster parasite
Perkinsus marinus. Journal of Invertebrate Pathology 62, 321-323.
Getchell, R. (1997). ISA investigation continues; new disease challenges fish diagnosticians. Fish
Farming News 5, 12.
Haastein, T. (1997). Infectious salmon anaemia (ISA): a historical and epidemiological review of the
development and spread of the disease in Norwegian fish farms. Infectious Salmon Anaemia
Workshop, St. Andrews, NB (Canada), Nov 26 1997.
Hervio, D., Bower, S.M. and Meyer, G.R. (1993). Detection, isolation, and host specificity of
Mikrocytos mackini, the cause of Denman Island disease in Pacific oysters Crassostrea
gigas. Journal of Shellfish Research 12, 136.
Hervio, D., Bachere, E., Boulo, V., Cochennec, N., Vuillemin, V., Le Coguic, Y., Cailletaux, G.,
Mazurie, J. and Mialhe, E. (1995). Establishment of an experimental infection protocol for
the flat oyster, Ostrea edulis, with the intrahaemocytic protozoan parasite, Bonamia ostreae:
Application in the selection of parasite-resistant oysters. Aquaculture 132, 183-194.
Hill, B.J., Way, K. and Alderman, D.J. (1986). IPN-like birnaviruses in oysters: infection or
contamination? In: Vivares, C.P., Bonami, J.-R. and Jaspers, E. (eds.) Pathology in Marine
Aquaculture (Pathologie en Aquaculture Marine). European Aquaculture Society, Special
Publication no. 9, Bredene, Belgium. p. 297 (abstract only).
Hiney, M. (1997). How to test a test: Methods of field validation for non-culture-based detection
techniques. Bulletin of the European Association of Fish Pathologists 17, 245-250.
22
Jarp J., Taksdal T. and Torud B. (1996). Infectious pancreatic necrosis in Atlantic salmon Salmo
salar in relation to specific antibodies, smoltification, and infection with erythrocytic
inclusion body syndrome (EIBS). Diseases of Aquatic Organisms 27, 81-88.
Kleinschuster, S. J., Smolowitz, R., and Parent, J. (1998). In vitro life cycle and propagation of
quahog parasite unknown. Journal of Shellfish Research 17, 75-78.
Klontz, G.W. (1993). Epidemiology. In: Stoskopf, M.K. (ed.) Fish Medicine. W.B. Saunders,
Philadelphia, US. pp. 210-213.
LaPeyre, J.F., Faisal, M. and Burreson, E.M. (1993). In vitro propagation of the protozoan Perkinsus
marinus, a pathogen of the eastern oyster, Crassostrea virginica. Journal of Eukaryotic
Microbiology 40, 304-310.
Le Gall, G., Mourton, C., Boulo, V., Paolucci, F., Pau, B. and Mialhe, E. (1992). Monoclonal
antibodies against a gill Rickettsiales-like organism of Pecten maximus (Bivalvia):
application to indirect immunofluorescence diagnosis. Diseases of Aquatic Organisms 14,
213-217.
Lightner, D.V. (1996). A Handbook of Shrimp Pathology and Diagnostic Procedures for Diseases of
Cultured Penaeid Shrimp. World Aquaculture Society, Baton Rouge, Louisiana, US. (loose-
leaf non-paginated).
McGladdery, S.E. (1999). Shellfish diseases (Viral, bacterial and fungal). In: Woo, P.T.K. and
Bruno, D.W. (eds.) Fish Diseases and Disorders Vol. 3. Viral, bacterial and fungal
infections. CAB International, Oxon, UK. pp. 723-842.
McGladdery, S.E., Drinnan, R.E. and Stephenson, M.F. (1993). A manual of parasites, pests and
diseases of Canadian Atlantic bivalves. Canadian Technical Report of Fisheries and Aquatic
Science 1931, 123 pp.
Mialhe, E., Boulo, V., Elston, R.A., Hill, B.J., Montes, J., van Banning, P. and Grizel, H. (1988).
Serological analysis of Bonamia in Ostrea edulis and Tiostrea lutaria using polyclonal and
monoclonal antibodies. Aquatic Living Resources 1, 67-69.
OIE (1997). OIE Diagnostic Manual for Aquatic Animal Diseases. 2nd Edition. OIE, Paris, France.
251 pp.
Ossiander, F.J. and Wedemeyer G. (1973). Computer program for sample size required to determine
disease incidence in fish populations. Journal of the Fisheries Research Board of Canada
30, 1383-1384.
Ragone Calvo, L.M., Walker, J.G. and Burreson, E.M. (1997). Occurrence of QPX, quahog parasite
unknown in Virginia hard clams, Mercenaria mercenaria. Journal of Shellfish Research 16,
334.
Ray, S.M. (1966). A review of the culture method for detecting Dermocystidium marinum, with
suggested modifications and precautions. Proceedings of the National Shellfisheries
Association 54, 55-69.
Smolowitz, R., Leavitt, D. and Perkins, F. (1996). An important new disease of hard clams,
Mercenaria mercenaria, in the Northeast United States. Journal of Shellfish Research 15,
460-461.
Stewart, J.E. (1984). Lobster diseases. Helgolander Meeresuntersuchungen 37, 243-254.
Stewart, J.E. and Zwicker, B.M. (1972). Natural and induced bacterial activities in the hemolymph of
the lobster, Homarus americanus: products of hemocyte-plasma interaction. Canadian
Journal of Microbiology 18, 1499-1509.
Stewart, J.E. and Zwicker, B.M. (1974). Comparison of various vaccines for inducing resistance in
the lobster Homarus americanus to the bacterial infection, Gaffkemia. Journal of the
Fisheries Research Board of Canada 31, 1887-1892.
Stokes, N.A., Flores, B.S., Burreson, E.M., Alcox, K.A., Guo, Ximing and Ford, S.E. (1997). Life
cycle studies of Haplosporidium nelsoni (MSX) using PCR technology. Journal of Shellfish
Research 16, 336.
Thoesen, J.C. (ed.). (1994). Suggested procedures for the detection and identification of certain
finfish and shellfish pathogens. 4th Edition, Version 1, Fish Health Section, American
Fisheries Society, Bethesda, Maryland, USA (loose-leaf, non-paginated).
23
Thomas, P.T. and Woo, P.T.K. (1995). Immunological approaches and techniques. In: Woo, P.T.K.
(ed.) Fish Diseases and Disorders Vol. 1. Protozoan and Metazoan Infections. CAB
International, Oxon, UK., pp. 751-771.
Thorburn, M.A. (1999). Applying epidemiology to infectious diseases of fish. In: Woo, P.T.K. and
Bruno, D.W. (eds.) Fish Diseases and Disorders Vol. 3. Viral, bacterial and fungal
infections. CAB International, Oxon, UK. pp. 689-722.
van Muiswinkel, W.B. (1995). The piscine immune system: Innate and acquired immunity. In: Woo,
P.T.K. (ed.) Fish Diseases and Disorders Vol. 1. Protozoan and Metazoan Infections. CAB
International, Oxon, UK., pp. 729-750.
Whyte, S.K., Cawthorn, R.J. and McGladdery, S.E (1994). QPX (Quahaug Parasite X), pathogen of
northern quahaug Mercenaria mercenaria from the Gulf of St. Lawrence, Canada. Diseases
of Aquatic Organisms 19, 129-136.
24
The absolute requirement for predictive validation of
non-culture based detection techniques
Maura Hiney
Quality assurance. For diagnostic assays of any type, quality assurance strives to ensure that the
results are repeatable and reproducible i.e. that the assay has an acceptable level of precision (Welac
Working Group, 1993). The precision of results is assured by stipulation of the source of reagents and
disposable materials, acceptability limits for instrument calibration, the generation of standard
operating procedures (SOPs) for the performance of the assay and the incorporation of appropriate
positive and negative controls into the performance of the assay. These controls should, if
appropriately chosen, function as both safeguard and check against deviation in the performance of the
assay that might be generated as a consequence of inhibition and contamination, sample to sample
variation and variability arising from the use of the technique by different operators or laboratories.
Standardisation also requires description of other parameters of the assay including specification of the
sample type to be analysed and how that sample should be collected, stored and processed. It is
assumed, for the purpose of this paper, that all the facets of quality assurance of molecular-based
detection techniques would already be in place prior to the application of the technique in the field.
Validation. Quality assurance is clearly vital in the performance of diagnostic assays upon which
important management or regulatory decisions may be made. However, quality assurance cannot
provide information on how to interpret assay results. This information can only be obtained by the
process of validation, defined here as “investigation of the extent to which a technique can legitimately
be used for a particular purpose”. Validation does not demonstrate that an assay will have standardised
performance, but rather that it is appropriate for a given application. Therefore, validation is essential
to determine the extent to which the potential of PCR-based techniques for detection aquatic animal
pathogens will be realised in practice.
Hiney and Smith (1999) have provided a framework for the validation of PCR-based detection
techniques which outlines three major criteria (quantitivity, qualitivity and reliability) which should,
where possible, be evaluated sequentially at four levels of increasing experimental complexity (in vitro,
seeded samples, incurred samples and field samples). In vitro studies and studies in seeded and incurred
samples can be performed in the laboratory. Although these laboratory-based validation studies form a
vital part of the validation process, they can only provide information on the performance of the
technique in the sample type to which it will be applied. In order to ascribe meaning to the results
generated in the field, the last level of validation (i.e. field application) is the most important.
Ascribing meaning to results. When assessing the data generated by a non-culture-based detection
technique, either DNA- or immunological-based, the critical question to be addressed is: ‘what can the
results validly be taken to mean”. The meaning that can be attributed to the results generated by any
non-culture-based detection technique will be dependent on the application for which that technique is
validated, and also on the context in which the results will be interpreted.
25
a). Application
With regard to the intended application of a detection technique, the sample type being examined may
be either CLINICAL or ENVIRONMENTAL. Laboratory validation should, therefore, have
demonstrated that the detection technique performs reliably in the sample type in which that technique
will be used. In addition, the type of study being conducted will normally be designed to answer
questions of either ECOLOGICAL or EPIZOOTIOLOGICAL relevance. Hiney (1997) outlined the
difference in emphasis of the questions being asked in these two types of studies and the importance of
designing a validation programme suitable for the study type.
b). Context
The meaning that will be attributed to results will also depend on the context of the interpretation.
Contexts include research, disease diagnostics and regulation of fisheries operations which will require
different levels of validity (Fig. 1). In the research context, the required level of validity need not be
high provided the technique generates information of use for the formulation or confirmation of models
of disease. On the other hand, the use of the technique for diseases diagnosis necessitates a much
higher level of validity because of the therapeutic and/or management decisions that may rest on the
outcome of the application of that technique. At the highest level of validity, the interpretation of
results in a regulatory context may have far-reaching and serious implications for a fish farmer, region
or country.
LOW
Research
Disease Diagnosis
Regulation
HIGH
Figure 1. Required levels of validity of detection techniques in the context of their application.
The selectivity of non-culture-based detection techniques. Regardless of the application intended for
a non-culture-base detection technique or the context of that application, the most important question
that must be asked of any detection technique is whether the technique provides THE TRUTH, THE
WHOLE TRUTH, AND NOTHING BUT THE TRUTH. In other words, does the technique detect the
species (viral, bacterial or protozoan) of interest, does the technique detect all members of that species
and is there cross-reaction with members of any non-target species?
The property of ‘truth’ is often referred to as ‘specificity’ in scientific reports on detection techniques.
However, in veterinary terms ‘specificity’ has another meaning, that is, the number of false-negatives
in a population, which is clearly not the property we wish to describe. More correctly, the property of
truth should be called ‘selectivity’. The Welac Working Group (1993) defined selectivity as “the
extent to which a technique can detect a particular analyte in a complex mixture without interference
from other components in the mixture”. In the case of microbial detection techniques, the mixture will
be a sample, either clinical or environmental, and potential interfering components would include non-
target species and chemical components in that mixture which might generate false positive or negative
responses.
26
Non-culture-based techniques are proxy measurements. In determining the selectivity of non-
culture-based detection techniques it must be born in mind that these techniques provide a proxy
measurement of the presence of the target species i.e. they detect only a fragment of that cell. The use
of proxy measurements is based on two important assumptions about the meaning of signals generated
by non-culture-based detection techniques: i) that the SIGNAL = TARGET; and ii) that the SIGNAL =
DISEASE RISK. The purpose of validation is to establish that these assumptions are true.
However, a number of problems can be identified for control panels. The first is that many of these
control panels are badly designed, containing too few target organisms (especially in the case of
heterogeneous species), inappropriate representatives of the target species or too few or badly chosen
closely related non-target organisms. A second problem frequently observed in control panels is that
they do not contain appropriate application-dependent non-target organisms. Application dependent
panels should take account of the sample type in which the technique will be applied and should,
therefore, contain the non-target organisms most likely to be present in that sample type, be they other
pathogenic species that infect the same host or species indigenous to that environment.
Even where these problems have been addressed, there still remains a fundamental problem with the
design of control panels, especially for environmental applications (although clinical applications will
also be effected), namely that ONLY ORGANISMS THAT CAN BE CULTURED CAN BE
INCLUDED IN CONTROL PANELS. It has been variously estimated that only 0.1 - 1% of all
organisms present in the environment have been cultured in the laboratory. This leaves a vast and
unknowable reservoir of organisms whose potential for cross-reaction cannot be assessed.
Comparative validation
In reality, no amount of internal or laboratory validation or standardisation can tell us how we should
interpret results generated in the field. To do this we need to use external validation techniques, of
which there are two main types, comparative validation and predictive validation.
Comparative validation involves the comparison of results generated by two or more methods targeted
against the same organism. There are a number of approaches that can be taken to comparative
validation.
a). Compare against method previously validated for the same application
As there are currently no non-culture-based detection techniques adequately validated for diagnosis of
fish diseases this option will for the moment remain theoretical.
The comparison of two methods based on the same detection principle, such as two PCR-based assays,
is not ideal. This type of comparison cannot allow for inherent flaws (e.g. inhibition, matrix interaction)
in the technique. Ideally the methods being compared should be based on different detection principles
(genetic, immunological or culture-based) and should not, in theory, be inhibited by the same
components of the test matrix or generate the same false positives from that matrix. If the degree of
concordance in the results generated by these techniques is high when applied to the same samples,
then the methods can be said to mutually co-validate each other.
27
What results may comparative validation generate?
There are a number of possible outcomes to a comparative validation programme:
Regardless of the results generated by a comparative validation, this approach can only provide us with
information on the presence of the target per se (Assumption 1). It is still possible that what we are
detecting are cell fragments or dead cells. Therefore, comparative validation cannot give us any
information about what the presence of that target means in terms of disease (Assumption 2). So how
could we interpret these results in any meaningful way?
Predictive validation
One possible means of interpreting the results generated in the field by a non-culture-based detection
technique is through predictive validation (i.e. ‘ESTABLISHING THE ABILITY OF A TECHNIQUE
TO PREDICT A DISEASE EVENT’).
Clearly, with regard to diagnostic techniques the most important event that can be predicted would be
the occurrence of a disease episode in the host following the detection of a positive response through
application of a non-culture-based detection technique to either host tissue or the environment of that
host. However, ‘disease’ is a rather loose concept, defined by the World Health Organisation as “any
divergence from a healthy state”. Therefore, the event to be predicted must be capable of being
established empirically (e.g. that the detection of positive responses by a PCR assay would predict the
future isolation of the pathogen of interest bacteriologically from host tissue). Equally, the prediction
could be that the absence of a positive response would predict a reduction in the requirement for
antibiotic therapy in the host population.
Regardless of the predicted event, the ultimate objective of a predictive validation program is to
establish that the detection of a positive signal by a non-culture-based technique has meaning in terms
of disease, that is the SIGNAL = DISEASE (Assumption 2).
Meaning in context
Getting back to the relevance of context in the interpretation of results a number of observations can be
made. In terms of research, a great deal of interesting and useful data can generated by the use of
techniques of poor validity or whose validity has not been adequately established through either
comparative or predictive validation studies. However, as diagnostic tools, assays with poor validity or
28
whose validity has not been adequately established may generate completely misleading data and
should not be considered for application in this context until sufficient data on their performance in the
field is available. Most seriously, from the regulatory viewpoint, the interpretation of the data obtained
by assays with poor validity or whose validity has not been adequately established, to indicate a disease
risk and warrant regulatory sanctions would be completely invalid. Therefore, the first priority of any
programme that hopes to introduce non-culture-based detection techniques for detection of aquatic
animal pathogens must be to establish an adequate validation programme which includes both
comparative and predictive validation which take cognisance of the intended application (i.e. sample
type, conditions, context). Only by such an approach can we have confidence that we are ascribing the
correct meaning to the results we generate.
References
Hiney, M. (1997). How to test a test: Methods of field validation for non-culture-based detection
techniques. Bulletin of the European Association of Fish Pathologists 17, 245-250
Hiney, M.P. and Smith, P.R. (1999). Validation of polymerase chain reaction-based techniques for
proxy detection of bacterial fish pathogens: Framework, problems and possible solutions for
environmental applications. Aquaculture 162, 41-68.
Welac Working Group (1993). Welac Eurochem Guidance Doc. No.1. Accreditation for chemical
laboratories: Guidance on the interpretation of the EN45000 series of standards and ISO/IEC
guide 25. Addition 1. April.
29
Evaluation of diagnostic tests: the epidemiological approach1
Daniel F. Fegan
BIOTEC, Thailand
The use of diagnostic tests is widespread in studies of disease in aquatic animals. These are often used
in isolation and the results interpreted or applied to populations without sufficient regard to wider
implications of the results. Much effort is devoted to the understanding of disease processes at the
individual animal, organ, cellular and genetic levels, and the complex interplay between individuals in
populations and the environment can be forgotten. At the population level the use of diagnostic tests
is made more complicated by population effects such as prevalence of the pathogen, expression and
impact of the disease on the population and potential for pathogen spread among others. The
inadequacy of the Henle-Koch postulates in animal disease has long been recognised as they do not
work well with multi-factorial causes of disease and the impact of predisposing factors. As a result,
the familiar “epidemiological triad” concept (Host-Pathogen-Environment), illustrated in the famous
diagram of Snieszko (1974) was introduced (Figure 1).
This neatly illustrates the complex interplay of factors which result in disease at the individual and
population levels. The existence of multiple contributing factors to disease outbreak is summarised in
the epidemiological definition of the cause of a disease as “an event, condition or characteristic that
plays an essential role in producing an occurrence of the disease” (Baldock, 1996). This implies that
the presence of a pathogen may not, in itself, be sufficient to cause disease in the absence of other
factors, a concept expressed in the statement that a pathogen is a necessary but not sufficient cause of a
particular disease. This is classically seen in epizootic ulcerative syndrome (EUS) of fish where
epidermal damage by a stress such as lowered pH is required to before infection with Aphanomyces
sp. and the resultant characteristic lesions can occur.
Application of these concepts requires a different approach to the interpretation of diagnostic test
results, particularly where they will be applied to a decision-making process. This paper is intended to
1
This paper draws heavily on the information on diagnostic testing in Chapter 17 of Thrusfield (1995). This
should be referred to for a fuller explanation than is possible here.
30
briefly introduce the basic concepts of epidemiology as they relate specifically to diagnostic tests.
[For a fuller treatment, the reader is referred to the textbooks of Thrusfield (1995) or Pfeiffer (1998).]
Factual
Knowledge
Uncertainty
Diagnostic
Diagnosis Disease Status
Tests
Experience
Intuition
Prevalence
This differs somewhat from the classical concept of diagnosis in the Henle-Koch postulates as the
consistent isolation and identification of a particular aetiological agent associated with a disease.
Definitions
Unfortunately, some of the terms used in veterinary epidemiology are the same as those used in
clinical pathology but with different definitions. The terms “sensitivity” and “specificity” in
particular, have been the cause of considerable confusion. Some definitions of terms used in
veterinary diagnosis are given above.
31
PPV (Positive Predictive Value ) The probability (or likelihood) that
an animal which returns a positive test result actually has the
disease in question.
NPV (Negative Predictive Value) The probability (or likelihood) that
an animal which returns a negative test result actually does not
have the disease in question.
True prevalence Proportion of animals in the population which really do have the
disease in question regardless of their test result. From a test
result point of view, it includes the “true” positives and the
“false” negatives.
Diagnostic testing
Diagnostic tests are more or less objective methods which reduce the uncertainly factor in diagnosis.
Diagnostic tests are often interpreted using a dichotomous outcome (normal/abnormal,
diseased/healthy, treat/don’t treat) which poses less difficulty when the test itself is dichotomous
(presence or absence of a pathogen) but can cause considerable difficulty in interpretation when it is
continuous (e.g. serum antibody levels or cell counts). In such cases, the selection of an appropriate
cut-off point to separate ‘positive’ and ‘negative’ results introduces a level of uncertainty. In most
diagnostic tests false positives and false negatives occur. Some of the reasons for positive and
negative results in serology, for example, are given in Table 1. Consequently any diagnostic test
which does not directly identify the presence of the infection can only produce an estimate of the
apparent prevalence of a disease (i.e. the proportion of animals giving a positive test result) and does
not equate to the presence of infection. Estimates of true prevalence, however, can be made taking
into account test sensitivity and specificity where these are known.
Positive Results
Actual infection True positive
Group cross-reaction
Non-specific inhibitors False positives
Non-specific agglutinins
Negative Results
Absence of infection True negative
Natural/induced tolerance
Improper timing
Improper selection of test
Non-specific inhibitors False negative
Toxic substances
Antibiotic induced immunoglobulin suppression
Incomplete or blocking antibody
Insensitive tests
Table 1: Reasons for positive and negative results from serological tests (from Stipes et al. 1982).
Estimates of true prevalence, however, can be made taking into account test sensitivity and
specificity.
32
Sensitivity and specificity are indicators of the validity of diagnostic tests (Thrusfield, 1995). When a
cut-off point is used, sensitivity and specificity show an inverse relationship – as sensitivity increases,
specificity decreases and vice versa. Estimation of the sensitivity and specificity requires testing of
animals for which the disease status is known. This requires the use of an appropriate unequivocal
diagnostic method as a “gold standard”. For example, in the case of the protistan oyster pathogen
Haplosporidium nelsoni (MSX disease)2, data on which was presented at the workshop, the
histological demonstration of the disease may be used as an estimation of true status (the “gold
standard”) and to evaluate the PCR data obtained by constructing the following simple table.
True Status
+ve -ve
Test 1 +ve a b a+b
Test 1 –ve c d c+d
a+c b+d a +b + c + d
In the table, “a” represents the true positives, “d” the true negatives and “b” and “c” the false positives
and false negatives respectively. The various epidemiological values can also be simply calculated as
follows:
x Sensitivity = a/(a+c)
x Specificity = d/(b+d)
x PPV = a/(a+b)
x NPV = d/(c+d)
x Apparent prevalence = a+b/(a+b+c+d)
x True prevalence = a/(a+b+c+d)
Histology
+ve -ve
PCR +ve 74 55 129
PCR –ve 2 127 129
76 182 258
From the table, it appears that the PCR test has a high sensitivity but only a moderate specificity. In
other words, 97% of animals with the disease test positive using PCR (a false negative rate of 3%) but
only 70% of animals without the disease test negative with PCR (i.e. a false positive rate of 30%).
Therefore, although the test would be useful for screening to reduce the possibility of introducing
infected individuals into a population (for which false positives are not a major concern), it would not
2
Data used with kind permission of Dr. Eugene Burreson, Virginia Institute of Marine Science.
33
be sufficient on its own to make a definitive diagnosis of the disease due to the high false positive
rate, and would certainly not be appropriate as the basis for a decision on action to be taken.
The selection of the appropriate level of sensitivity and specificity often depends upon the particular
need. When screening for a disease or pathogen (for example, testing animals to eliminate infected
individuals) we require a reliable positive result with few false negatives and a reasonable number of
false positives (within an economically justifiable level of rejection). This would require a test with a
high sensitivity and reasonable specificity. This type of test would be used in a quarantine situation,
for example, to reduce the risk of disease introduction or when demonstrating absence of a disease to
establish “disease-free” zones. On the other hand, if we need as few false positives as possible (e.g. to
confirm a tentative diagnosis) a test with a high specificity and reasonable sensitivity is used. It is,
however, important to note that the consequence of any diagnostic test with imperfect specificity (less
than 100%) is that if a large number of tests are made on a single uninfected animal, there is a
significant chance of finding a positive result.
Predictive values
For a diagnostic decision, it is also useful to make some estimate of the predictive value of a
diagnostic test. The predictive value quantifies the probability that a positive test result for a particular
animal or sample correctly identifies the presence of infection and a negative test result correctly
identifies the absence of infection. This requires knowledge of not only the sensitivity and specificity
of the test but the prevalence of the condition. The effect of prevalence on predictive values is
considerable. As prevalence increases, Positive Predictive Value (PPV) increases and Negative
Predictive Value (NPV) decreases.
Formulae for calculating predictive values are based on Bayes' theorem of conditional probability
(Fleiss, 1981) and are as follows:
Se: sensitivity; Sp: specificity; Prev: pre-test probability of disease (or true prevalence).
Predictive values are functions of prevalence and the test characteristics of sensitivity and specificity. As
prevalence declines so does positive predictive value. The converse is true for negative predictive value
(see Table 2).
If the sensitivity and specificity of a diagnostic test are known for a particular target population, then
predictive value graphs can be drawn for the range of all possible pre-test probabilities of disease from 0
to 1 (100%).
Table 2: Effect of prevalence on positive predictive value (PPV) with a hypothetical serological
test (Se and Sp = 0.95)
The important point that this table indicates is that despite using a good test (Se and Sp = 0.95) most
reactors are non-infected (false positives) when the disease is present in the population at a low
34
prevalence. Of the 2 test properties, it can be shown that specificity exerts a greater influence on PPV
than does sensitivity. On the other hand, sensitivity exerts a greater influence on negative predictive
value (NPV).
Again using the data for oysters, the PCR test has a good negative predictive value but poor positive
predictive value (Proportion of PCR -ve animals which do not have disease = 98%; Proportion of
PCR +ve animals which have the disease = 57%) where the true prevalence is 29%. In other words,
the test is a poor predictor of disease occurrence and would be of limited use in confirming the
existence of suspect disease. As a rule of thumb, highly specific tests should be used to confirm
tentative diagnoses while highly sensitive tests should be used to rule out possible disease.
Finally, the impact of the test on estimated prevalence is clearly seen. Because of the low specificity
and PPV, the prevalence of infection is overestimated considerably (apparent prevalence is 50%
compared with the true prevalence of 29%). This would diminish the usefulness of PCR as a
diagnostic tool in this particular case.
The PPV of a particular test can be improved by appropriate selection strategies (Baldock, 1996):
1. Testing of “high risk” groups (animals with clinical signs rather than normal animals)
2. For the same test using a higher cut-off with higher specificity or use a second test with a higher
specificity)
3. Use of multiple tests for interpretation of results.
At the group level we require high sensitivity and high specificity in a test, the same as for individual
level tests. It is important to note, however, that individual and group level test characteristics are not
equivalent. At a group level, sensitivity and specificity are influenced by sample size (as the sample
size increases, so does sensitivity) and the number of positives required (as the number of positives
required increases, there is a corresponding increase in specificity). Again, as with individual level
tests, sensitivity and specificity are inversely related.
It should be noted that even relatively good tests with high sensitivity and specificity will have a low
predictive value at low levels of prevalence. For example, if a test with sensitivity of 99% and
specificity of 99.9% was used at a high prevalence, say 10%, a single test conducted on 10 million
animals would give 9,000 false positives and 990,000 true positives. On the other hand, if the
prevalence were 0.01% the test would give 9,900 true positives and 9,990 false positives. This has
important implications for eradication campaigns, quarantine screening and other situations where
prevalence may change with time.
The kappa test uses the same table as for calculation of epidemiological values with the observed
agreement given by the formula: OA = (a + d)/(a + b + c + d).
This is compared to the expected agreement which would be obtained by chance which is given by the
formula: EA = [{(a + b)/n} x {(a + c)/n}] + [{(c + d)/n} x {(b + d)/n}]
Kappa is the agreement greater than that expected by chance divided by the potential excess.
The kappa values are evaluated according to arbitrary “benchmarks” as shown in Table 3.
For example, again using the data from oysters used previously.
It should be noted that the kappa value gives no indication which of the tests is better and that a good
agreement may indicate that both tests are equally good or equally bad.
Another important characteristic of a test is its repeatability or the consistency of the test results in
two or more replicates on the same animal. For a test whose outcome is either positive or negative,
the level of agreement will give an indication of the reliability of the test result. The statistical tests
used are outside the scope of this paper and can be found in Thrusfield (1995) or standard statistical
3
Note that these interpretations are relatively arbitrary and that other authors may use different values for the
level of agreement.
36
texts. However, if the test is repeated twice, then McNemar’s chi square test for related samples can
be used, and for three or more, Cochran’s Q-test is used. If the proportion of positive and negative
results are significantly different between the replicates, the repeatability of the test may be low.
Conclusions
The interpretation of diagnostic tests depends upon the definition of clinical disease and its distinction
from the presence of the pathogen. It is the case in most disease outbreaks that the presence of the
pathogen is a necessary but not sufficient cause of disease. This is because there are often other
factors involved in the expression of the disease condition, an important consideration when making a
diagnosis for a population in which a decision has to be made. In studying disease outbreaks,
especially in populations, we need to look at them from both a pathological and epidemiological
standpoint. Ideally, a diagnostic test can be evaluated based on a clear relationship with an
unequivocal "gold standard" diagnosis.
The analytical sensitivity of a method and its relationship with the epidemiological sensitivity, at a
population level can change as prevalence increases, as sample size increases and depending upon the
number of positive reactions we accept as sufficient on which to base a diagnosis. Highly sensitive (in
the analytical sense) methods such as PCR may pick up early stages of a disease condition and this
will often manifest itself by a change in the number of false positives over time. Thus, it can be the
case that a simplified interpretation of data taken at one point in time may represent a snapshot view.
However, as data accumulates, it should be possible to establish a more accurate picture.
Pathologists and researchers involved in lab-based diagnostic work should consider the
epidemiological approach required if such results are to be extrapolated to populations. The use of
epidemiological methods in the planning and analysis of diagnosis, or better still, a greater co-
operation between pathologists and epidemiologists, will assist greatly in the development and
interpretation of better diagnostic tests.
References
Thrusfield. M. (1995). Veterinary Epidemiology 2nd Edition. Publ. Blackwell Science Ltd., Oxford,
UK.
Baldock, C. (1996). Course notes from the Australian Centre for International Agricultural Research
Workshop on “Epidemiology in Tropical Aquaculure” Bangkok, 1-12 July, 1996.
Snieszko, S.F. (1974). The effects of environmental stress on outbreaks of infectious diseases of
fishes. Journal of Fisheries Biology 6, 197-208.
Pfeiffer, D. (1998). Veterinary Epidemiology. An Introduction. Institute of Veterinary, Animal and
Biomedical Sciences. Massey University, Palmerston, New Zealand.
Stites, D.P., Stobo, J.D., Fundenberg, H.H. and Wells, J.V. (1982). Basic and Clinical Immunology,
4th Edition. Lange Medical Publications, Los Altos, USA.
37
DNA-based diagnostic and detection methods for
penaeid shrimp viral diseases
Donald V. Lightner
The most important diseases, in terms of economic impact, of cultured penaeid shrimp in Asia, the
Indo-Pacific, and the Americas have infectious etiologies. Among the infectious diseases of cultured
shrimp, certain virus-caused diseases stand out as the most significant. Since the first report of a
penaeid shrimp virus disease by Couch in 1974, at least 20 more viruses have been described from the
penaeids (Table 1). The earliest diagnostic methods developed for these pathogens included the
traditional methods of morphological pathology (direct light microscopy, histopathology, and electron
microscopy), as well as enhancement and bioassay methods. While tissue culture is considered to be
a standard tool in medical and veterinary diagnostic labs, it has never been developed as a useable,
routine diagnostic tool for shrimp pathogens. Likewise, there are few antibody-based diagnostic tests
available for the penaeid virus diseases (Lightner and Redman, 1998). The need for rapid and
sensitive diagnostic methods has led to the application of modern biotechnology to penaeid shrimp
diseases. DNA-based detection methods for the most important viral pathogens (IHHNV, HPV, SMV,
TSV, YHV, GAV/LOV, WSSV, MBV, and BP) have been reported in the literature and some DNA-
based diagnostic methods are commercially available. PCR or RT-PCR methods are available for
several of these viruses and some are in routine use by certain sectors of the industry. For others,
specific DNA probes tagged with non-radioactive labels provide highly specific detection methods for
application in dot blot formats with hemolymph or tissue extracts, and with routine histological
sections using in situ hybridization (Lightner, 1996; OIE, 1997; Lightner and Redman, 1998).
The OIE Fish Disease Commission at its September 1998 meeting voted to recommend to the OIE that
three of the penaeid shrimp viruses diseases from the “listed” category be upgraded to the “notifiable”
category. If the recommendations of the Fish Disease Commission are approved by the OIE’s General
Assembly in May 1999, the notifiable and listed viral pathogens of crustacea will be those shown in
Table 2. All of these viral diseases affect cultured penaeid shrimp. Before a disease may be included
on the OIE lists of notifiable and listed diseases, several criteria must be met: 1) the etiological agent
must be known, 2) reliable diagnostic(s) methods must be available, and 3) the disease must be a
significant disease of local, regional, or international importance.
The accompanying Tables in this report list the known penaeid shrimp viruses and summarize the
available traditional and DNA-based diagnostic and detection methods available for the recently
proposed OIE notifiable and listed pathogens of penaeid shrimp (OIE, 1997; OIE, unpublished
report). The diagnostic and detection methods for these viruses are listed in Table 3. There is a
growing need to standardize and validate the DNA-based diagnostic methods and the laboratories that
use them. Standardization of DNA-based diagnostic methods is almost inherent in the nature of the
tests. That is, a specific DNA probe, or a specific set of primers, that is used to demonstrate the
presence of absence of a unique DNA or RNA sequence does not vary from batch to batch. Hence,
with proper controls, these DNA-based methods are readily standardized (Reddington and Lightner,
1994). However, despite the growing dependence of the shrimp culture industry on DNA-based
diagnostic methods, none of the tests that are available from commercial sources nor from the
literature have been validated using controlled field tests. Likewise, there are no formal accreditation
or certification programs yet in place to assure that test results from technicians and laboratories
running the tests are indeed accurate and properly controlled (Lightner and Redman, 1998). The
38
implementation of a formal program by appropriate international agencies or professional societies is
needed to validate new diagnostic methods and to periodically review the accreditation and
certification of diagnosticians and diagnostic laboratories. The establishment of regional reference
laboratories for DNA-based diagnostic methods of penaeid shrimp/prawn pathogens would fit well
into such a program with the goal of making these methods uniform, reliable, and readily applicable
to disease control and management strategies for viral diseases of cultured penaeids.
References
Adams, J.R., and Bonami, J.R. Eds. (1991). Atlas of Invertebrate Viruses. CRC Press, Boca Raton,
FL. 684 pp.
Arimoto, M., Yamazaki, T., Mizuta, Y. and I. Furusawa. (1995). Characterization and partial cloning
of the genomic DNA of a baculovirus from Penaeus japonicus (PjNOB = BMNV).
Aquaculture 132, 213-220.
Bonami, J.R., Brehelin, M., Mari, J., Trumper, B. and Lightner, D.V. (1990). Purification and
characterization of IHHN virus of penaeid shrimps. Journal of General Virology 71,
2657-2664.
Bonami, J.R., Lightner, D.V., Redman, R.M. and Poulos, B.T. (1992). Partial characterization of a
togavirus (LOVV) associated with histopathological changes of the lymphoid organ of
penaeid shrimps. Diseases of Aquatic Organisms 14, 145-152.
Bonami, J.R., Bruce, L.D., Poulos, B.T., Mari, J. and Lightner, D.V. (1995). Partial characterization
and cloning of the genome of PvSNPV (= BP-type virus) pathogenic for Penaeus vannamei.
Diseases of Aquatic Organisms 23, 59-66.
Bonami J.R., Hasson, K.W., Mari, J., Poulos, B.T. and Lightner, D.V. (1997). Taura syndrome of
marine penaeid shrimp: characterization of the viral agent. Journal of General Virology 78,
313-319.
Boonyaratpalin, S., Supamattaya, K., Kasornchandra, J., Direkbusaracom, S., Aekpanithanpong, U.
and Chantanachooklin, C. (1993). Non-occluded baculo-like virus, the causative agent of
Yellow Head Disease in the black tiger shrimp (Penaeus monodon). Fish Pathology 28,
103-109.
Brock, J.A., Gose, R., Lightner, D.V. and Hasson, K.W. (1995). An overview on Taura syndrome, an
important disease of farmed Penaeus vannamei. Pp. 84-94 In C.L. Browdy and J.S. Hopkins,
editors. Swimming through troubled water, Proceedings of the special session on shrimp
farming, Aquaculture '95. World Aquaculture Society, Baton Rouge, LA, USA.
Brock, J.A., Gose, R. B., Lightner, D. V. and Hasson, K. (1997). Recent developments and an
overview of Taura Syndrome of farmed shrimp in the Americas. Pp. 275-284 In: T.W.
Flegel and I.H. MacRae (eds.) Diseases in Asian Aquaculture III. Fish Health Section, Asian
Fisheries Society, Manila.
Chang P.S., Lo, C.F., Kou, G.H. and Chen, S.N. (1993). Purification and amplification of DNA from
Penaeus monodon-type baculovirus (MBV). Journal of Invertebrate Pathology 62, 116-120.
Chantanachookin, C., Boonyaratpalin, S., Kasornchandra, J., Direkbusarakom, S., Ekpanithanpong,
U., Supamataya, K., Sriurairatana, S. and Flegel, T.W. (1993). History and ultrastructure
reveal a new granulosis-like virus in Penaeus monodon affected by `yellow head' disease.
Diseases of Aquatic Organisms 17, 145-157.
Chou, H.Y., Huang, C.Y., Wang, C.H., Chiang, H.C. and Lo, C.F. (1995). Pathogenicity of a
baculovirus infection causing white spot syndrome in cultured penaeid shrimp in Taiwan.
Diseases of Aquatic Organisms 23, 165-173.
Couch, J.A. (1974a). Free and occluded virus similar to Baculovirus in hepatopancreas of pink
shrimp. Nature 247, 229-231.
Couch, J.A. (1974b). An enzootic nuclear polyhedrosis virus of pink shrimp: ultrastructure,
prevalence, and enhancement. Journal of Invertebrate Pathology 24, 311-331.
Durand, S., Lightner, D.V., Nunan, L.M., Redman, R.M., Mari, J. and Bonami, J.R. (1996).
Application of gene probes as diagnostic tool for the white spot baculovirus (WSSV) of
penaeid shrimps. Diseases of Aquatic Organisms 27, 59-66.
39
Durand, S., Lightner, D.V., Redman, R.M. and Bonami, J.R. (1997). Ultrastructure and
morphogenesis of white spot syndrome baculovirus (WSSV). Diseases of Aquatic
Organisms 29, 205-211.
Flegel, T.W., Sriurairtana, S., Wongteerasupaya, C., Boonsaeng, V., Panyim, S. and
Withyachumnarnkul, B. (1995). Progress in characterization and control of yellow-head
virus of Penaeus monodon. Pp. 76-83 In: C.L. Browdy and J.S. Hopkins, editors.
Swimming Through Troubled Water, Proceedings of the Special Session on Shrimp
Farming, Aquaculture '95. World Aquaculture Society, Baton Rouge, LA, USA.
Fraser, C.A. and Owens, L. (1996). Spawner-isolated mortality virus from Australian Penaeus
monodon. Diseases of Aquatic Organisms 27, 141-148.
Hasson, K.W., Lightner, D.V., Poulos, B.T., Redman, R.M., White, B.L., Brock, J.A. and Bonami,
J.R. (1995). Taura Syndrome in Penaeus vannamei: demonstration of a viral etiology.
Diseases of Aquatic Organisms 23, 115-126.
Huang, J., Song, X.L., Yu, J. and Yang, C.H. (1995). Baculoviral hypodermal and hematopoietic
necrosis - study on the pathogen and pathology of the shrimp explosive epidemic disease of
shrimp. Marine Fisheries Research 16, 1-10.
Kasornchandra, J., Boonyaratpalin, S. and Itami, T. (1998). Detection of white-spot syndrome in
cultured penaeid shrimp in Asia: microscopic observation and polymerase chain reaction.
Aquaculture 164, 243-251.
Kimura, T., Yamano, K., Nakano, H., Momoyama, K., Hiraoka, M. and Inouye, K. (1996). Detection
of penaeid rod-shaped DNA virus (PRDV) by PCR. Fish Pathology 31, 93-98.
Lightner, D.V. (1996). A Handbook of Shrimp Pathology and Diagnostic Procedures for Diseases of
Cultured Penaeid Shrimp. World Aquaculture Society, Baton Rouge, LA, USA. 304 p.
Lightner, D.V., Redman, R.M., Bell, T.A. and Brock, J.A. (1983a). Detection of IHHN virus in
Penaeus stylirostris and P. vannamei imported into Hawaii. Journal of the World
Mariculture Society 14, 212-225.
Lightner, D.V., Redman, R.M. and Bell, T.A. (1983b). Observations on the geographic distribution,
pathogenesis and morphology of the baculovirus from Penaeus monodon Fabricius.
Aquaculture 32, 209-233.
Lightner, D.V. and Redman, R.M. (1993). A putative iridovirus from the penaeid shrimp
Protrachypene precipua Burkenroad (Crustacea: Decapoda). Journal of Invertebrate
Pathology 62, 107-109.
Lightner D.V., Redman, R.M., Hasson, K.W. and Pantoja, C.R. (1995). Taura syndrome in Penaeus
vannamei: histopathology and ultrastructure. Diseases of Aquatic Organisms 21, 53-59
Lightner, D.V. and Redman, R.M. (1998). Shrimp diseases and current diagnostic methods.
Aquaculture 164, 201-220.
Lo, C.F., Leu, J.H., Chen, C.H., Peng, S.E., Chen, Y.T., Chou, C.M., Yeh, P.Y., Huang, C.J., Chou,
H.Y., Wang, C.H. and Kou, G.H. (1996a). Detection of baculovirus associated with white
spot syndrome (WSBV) in penaeid shrimps using polymerase chain reaction. Diseases of
Aquatic Organisms 25, 133-141.
Lo, C.F.,. Ho, C.H, Peng, S.E., Chen, C.H., Hsu, H.C., Chiu, Y.L., Chang, C.F., Liu, K.F., Su, M.S.,
Wang, C.H. and Kou, G.H. (1997). White spot syndrome baculovirus (WSBV) detected in
cultured and captured Shrimp, crabs and other arthropods. Diseases of Aquatic Organisms
27, 215-225.
Lo, C.F., Kou, G.H., Hsu, H.C., Ho, C.H., Tsai, M.F. and Lightner, D.V. (1999). Specific genomic
DNA fragment analysis of different geographical isolates of Shrimp white spot syndrome
associated virus. Disease of Aquatic Organisms (in press).
Lu, Y., and Loh, P.C. (1994). Viral structural proteins and genome analyses of the rhabdovirus of
penaeid shrimp (RPS). Diseases of Aquatic Organisms 19, 187-192.
Mari, J., Bonami, J.R. and Lightner, D. (1993). Partial cloning of the genome of infectious
hypodermal and hematopoietic necrosis virus, an unusual parvovirus pathogenic for penaeid
shrimps; diagnosis of the disease using a specific probe. Journal of General Virology 74,
2637-2643.
40
Mari, J., Bonami, J.R. and Lightner, D.V. (1998). Taura syndrome of Penaeid shrimp: cloning of
viral genome fragments and development of specific gene probes. Diseases of Aquatic
Organisms 33, 11-17.
Momoyama, K., and Sano, T. (1996). Infectivity of baculovirus midgut gland necrosis virus (BMNV)
to larvae of 5 crustacean species. Fish Pathology 31, 81-85.
Nadala, E.C.B., Jr., Lu, Y., Loh, P.C. and Brock, J.A. (1992). Infection of P. stylirostris (Boone) with
a rhabdovirus isolated from Penaeus spp. Fish Pathology (Gyobyo Kenkyu) 27, 143-147.
Nunan, L.M., Poulos, B.T. and Lightner, D.V. (1998). Reverse transcription polymerase chain
reaction (RT-PCR) used for the detection of Taura Syndrome Virus (TSV) in experimentally
infected shrimp. Diseases of Aquatic Organisms 34, 87-91.
OIE. (1997). Diagnostic Manual for Aquatic Diseases. Office International des Epizooties, Paris, 251
p.
Owens, L. (1993). Description of the first haemocytic rod-shaped virus from a penaeid prawn.
Diseases of Aquatic Organisms 16, 217-221.
Owens, L., DeBeer, S. and Smith, J. (1991). Lymphoidal parvovirus-like particles in Australian
penaeid prawns. Diseases of Aquatic Organisms 11, 129-134.
Reddington, J. and Lightner, D. (1994). Diagnostics and their application to aquaculture. World
Aquaculture 25, 41-48.
Spann, K.M., Vickers, J.E. and Lester, R.J.G. (1995). Lymphoid organ virus of Penaeus monodon.
Diseases of Aquatic Organisms 26, 127-134.
Spann, K.M., Cowley, J.A., Walker, P.J. and Lester, R.J.G. (1997). A yellow-head-like virus from
Penaeus monodon cultured in Australia. Diseases of Aquatic Organisms 31, 169-179.
Takahashi, Y., Itami, T., Kondo, M., Maeda, M., Fujii, R., Tomonaga, S., Supamattaya, K. and
Boonyaratpalin, S. (1994). Electron microscopic evidence of bacilliform virus infection in
Kuruma shrimp (Penaeus japonicus). Fish Pathology 29, 121-125.
Takahashi, Y., Itami, T., Maeda, M., Suzuki, N., Kasornchandra, J., Supamattaya, K., Khongpradit, R.,
Boonyaratpalin, S., Kondo, M., Kawai, K., Hirono, I. and Aoki, T. (1996). Polymerase
chain reaction (PCR) amplification of bacilliform virus (PV-PJ) DNA in Penaeus japonicus
Bate and systemic ectodermal and mesodermal baculovirus (SEMBV) DNA in Penaeus
monodon Fabricius. Journal of Fish Diseases 19, 399-403.
Tang, K.F.J. and Lightner, D.V. (1999). A yellow-head virus gene probe: application to in situ
hybridization and determination of its nucleotide sequence. Diseases of Aquatic Organisms
(in press).
Tsing, A. and Bonami, J.R. (1987). A new virus disease of the tiger shrimp Penaeus japonicus Bate.
Journal of Fish Diseases 10, 139-141.
Wang, C.H., Lo, C.F., Leu, J.H., Chou, C.M., Yeh, P.Y., Chou, H.Y., Tung, M.C., Chang, C.F., Su,
M.S. and Kou. G.H. (1995). Purification and genomic analysis of baculovirus associated
with white spot syndrome (WSBV) of Penaeus monodon. Diseases of Aquatic Organisms
23, 239-242.
Wang, S.Y., Hong, C. and Lotz, J.M. (1996). Development of a PCR procedure for the detection of
Baculovirus penaei in shrimp. Diseases of Aquatic Organisms 25, 123-131.
Wang, Y.C., Lo, C.F., Chang, P.S. and Kou, G.H. (1998). White spot syndrome associated virus
(WSSV) infection in cultured and wild decapods in Taiwan. Aquaculture 164, 221-231.
Wongteerasupaya, C., Vickers, J.E., Sriurairatana, S., Nash, G.L., Akarajamorn, A., Boonsaeng, V.,
Panyim, S., Tassanakajon, A., Withyachumnarnkul, B. and Flegel, T.W. (1995). A non-
occluded, systemic baculovirus that occurs in cells of ectodermal and mesodermal origin and
causes high mortality in the black tiger prawn, Penaeus monodon. Diseases of Aquatic
Organisms 21, 69-77.
Wongteerasupaya, C., Sriurairatana, S., Vickers, J.E., Anutara, A., Boonsaeng, V., Panyim, S.,
Tassanakajon, A., Withyachumnarnkul, B. and Flegel, T.W. (1995). Yellow-head virus of P.
monodon is an RNA virus. Diseases of Aquatic Organisms 22, 45-50.
41
Wongteerasupaya, C., Boonsaeng, V., Panyim, S., Tassanakajon, A., Withyachumnarnkul, B. and
Flegel, T.W. (1997). Detection of yellow-head virus (YHV) of Penaeus monodon by RT-
PCR amplification. Diseases of Aquatic Organisms 31, 181-186.
Table 1a. DNA Viruses of Penaeid Shrimp (as of February 1999; modified from Lightner, 1996;
Lightner and Redman, 1998)
DNA VIRUSES
PARVOVIRUSES:
IHHNV = infectious hypodermal and hematopoietic necrosis virus Lightner et al., 1983a,b
HPV = hepatopancreatic parvovirus Bonami et al., 1990
SMV = spawner-isolated mortality virus Adams and Bonami,
LPV = lymphoidal parvo-like virus 1991
Fraser and Owens,
1996
Owens et al., 1991
BACULOVIRUSES and BACULO-LIKE VIRUSES:
Couch 1974a; 1974b
BP-type = Baculovirus penaei type viruses (PvSNPV type sp.): BP strains Bonami et al., 1995
from the Gulf of Mexico, Hawaii and Eastern Pacific Adams and Bonami,
1990
MBV-type = Penaeus monodon-type baculoviruses (PmSNPV type sp.): Wang et al., 1996
MBV strains – East and SE Asia, Australia, the Indo-Pacific, and India Momoyama and Sano,
BMN-type = baculoviral midgut gland necrosis type viruses: 1996
BMN = from Ma. Japonicus in Japan Arimoto et al., 1995
TCBV = type C baculovirus of P. monodon Mari et al., 1993
PHRV = hemocyte-infecting non-occluded baculo-like virus Chang et al., 1993
Owens, 1993
WHITE SPOT SYNDROME VIRUSES (PmNOBII-type):
42
Table 1b. RNA Viruses of Penaeid Shrimp (as of February 1999; modified from Lightner, 1996;
Lightner and Redman, 1998).
RNA VIRUSES
43
Table 2. Proposed list of OIE notifiable and listed penaeid shrimp diseases and their current,
presently known distribution in wild and cultured stocks (modified from Lightner, 1996;
Lightner and Redman, 1998
Table 3. Diagnostic and pathogen detection methods for the OIE notifiable and listed viral
diseases of penaeid shrimp (modified from Lightner, 1996; Lightner and Redman, 1998
44
Practical problems with PCR detection in Asia:
The importance of standardization
Introduction
The use of any DNA-based diagnostic technology faces some fundamental problems, as
implementation requires knowledge in the field of molecular diagnostics. Such knowledge is obtained
by experience gained from research on molecular detection methods. It is important that true expertise
is established in molecular biology and that technologies are not introduced with a “jump in the
bandwagon” mentality. It should also be recognised that interpretation of results can be problematic
when strict controls, guidelines and problem solving are not adhered to.
Furthermore, the implementation of DNA-based diagnostic programs must add real value. They
should not be implemented for the sake of novelty, particularly when employed for diagnostic
certification. The need for implementation needs to be determined in terms of practicality, ease of use,
speed and technical capabilities of trained manpower. The programs must also be reliable and
reproducible with very low frequency of false interpretation and variation between laboratories.
Finally, the cost involved in running such programs should not be prohibitive as the outcome of results
reflects the professionalism, responsibility and standards with which the tests were conducted.
Such advantages have been of great benefit to molecular diagnostics. In general, 2 areas that has
benefited the most from this technology are disease gene mutation screening and of course the
detection and characterisation of specific pathogens. Can there be any doubt that PCR should be used
as a diagnostic tool when it can pick up a needle and amplify it in a haystack?
Firstly, PCR requires some technical knowledge for effective implementation. Standardization
between laboratories that may have no molecular biological research background will require the
provision of support to develop technical capabilities. Secondly, due to the flexibility of PCR with
its many amplification strategies, the selection of appropriate gold standards that will be critical for
45
acceptance of diagnostic certification for WSSV requires careful consideration. The use of different
strategies such as single or nested PCR leads to differences in the sensitivity of detection. There has
been strong inclination for laboratories in Asia to adopt the nested approach, as the method is at least
100 to 1000 times more sensitive than single PCR. This extreme sensitivity comes with its own set of
problems as will be discussed later.
Another important factor that needs to be addressed is that of reproducibility between laboratories.
The assay procedure not only consists of performing the PCR but also reproducing the same
sensitivity, eliminating of false interpretation and implementing contamination control procedures.
Questions have also been posed as to whether PCR results should be just a simple positive or negative.
This issue stems from an interpretation that a PCR result represents an absolute presence or absence of
WSSV in the test sample. Presently, routine PCR detection of WSSV can result in the same
observation for both early and late stages of infection. The biological significance of such a PCR
result is somewhat obscure. How do we assess the degree of infection? This problem has been
demonstrated by the reports of farms having white spot infection but with varying degrees of
mortality. The use of PCR in WSSV diagnosis is presently devoid of the ability to monitor the
progress of the disease. There are ways to slightly overcome this problem, but the work and effort
required for routine diagnosis may be prohibitive and the methods do not provide good accuracy in
predicting the viral load of WSSV.
Another area of serious concern is the high probability of false interpretation of results. This is largely
due to ignorance in establishing, employing and following strict PCR controls for verification of
results. For example, failure to use negative controls can lead to the interpretation of negative WSSV
detection in a test which was actually a failed PCR! This is frequently caused by PCR inhibition – a
factor which deserves greater attention in WSSV diagnosis as shrimp tissues frequently contain PCR
inhibitory substances. False positive interpretation is almost exclusively due to contamination from
post-PCR amplification products. While sample to sample contamination do exist, it is contamination
from PCR products that causes greatest concern and headache. This problem is even more serious
when procedures such as nested PCR are used for routine WSSV detection. In view of these
problems, it will be important to ensure that, in addition to the use of standard PCR procedures,
appropriate positive and negative controls are also employed. The use of proper controls is seldom
emphasised, and if controls are emphasised obtaining them is not easy.
Perhaps the greatest concern in the use of PCR for WSSV diagnosis is the lack of strict quality control
on the results released. Without proper guidelines, consistent, standard and valid PCR diagnosis of
WSSV will be virtually impossible to achieve.
The areas we have identified that may lead to initiatives in standardization and validation programs are
sample processing, PCR set-up, amplification strategies, controls, specificity and sensitivity.
Sample processing. The initial stages before performing PCR analysis involve sample processing,
and correct sampling methods. It is important to ensure the correct sample size for reliable detection of
pathogens as possible low prevalence of the agents can render a false negative interpretation. In
determining sample size for PCR analysis, the statistical confidence levels provided by Amos (1985)
are a useful guide. However, a practical issue to consider is the sampling method by the farmer. For
example, we have had cases in which hatchery operators have requested PCR analysis on post-larval
46
samples that have been pooled from various tanks. This sampling practice jeopardises the accuracy
and statistical confidence of the PCR results.
The proper selection of DNA sources is also critical in obtaining accurate PCR results. From our own
experience, use of gill, muscle and integument tissues yields good results, provided that the amount of
DNA is appropriate. An excess of DNA may inhibit the PCR process. Haemolymph can also be used
but it is usually not appropriate for routine diagnosis. PCR on post-larvae is sometimes more
problematic as PCR inhibitory substances are present in the eyes which should be removed before
DNA extraction. The inhibitory substances have not yet been properly identified but there is evidence
suggesting the involvement of poryphrin which is a common component of pigment in shrimp. Little
research has been conducted to resolve this problem.
The DNA extraction procedure may be a good area in which to commence standardisation. There are
a number of methods to obtain DNA for PCR analysis and these will be discussed later. The key
factors to consider in the development of a standardized procedure are time/manpower, safety,
reliability, contamination risks, inhibition and DNA quality.
The significance time required to conduct the test is important, especially when a large sample number
has to be screened. The availability of manpower and technical technical skills should also be
considered. Worker safety when employing the procedures should not be compromised. The
extraction procedure should be evaluated for its reliability and risk of contamination when processing
a large number of samples. The extraction methods should minimise the use of PCR inhibitory
substances as will be described later. There is also a need for some level of DNA quality for PCR
analysis to generate accurate results.
Methods which can be employed for extraction of WSSV DNA include alkaline lysis, proteinase K
digestion, treatment with guanidinium salts (passive) and boiling. Alkaline lysis is rapid and provides
good quality DNA for PCR. However, a boiling step to properly liberate DNA from tissues and a
neutralisation step are required. Depending on how the samples are handled, contamination risks can
increase when boiling is employed. Proteinase K digestion is relatively slow as it involves several
subsequent steps and the protocol also usually involves the use of hazardous materials such as phenol
and chloroform. Detergents are also commonly used for the liberation of DNA. However, ionic
detergents such as SDS can inhibit Taq polymerase at certain concentrations. Residual phenol can
also cause inhibition of Taq polymerase.
Guanidinium salts have not been widely used but could provide some very useful advantages.
Guanidinium salts are non-toxic and the method is rapid, requiring only a few steps involving ethanol
washing and precipitation. The technique also allows passive lysis for release of DNA from tissues
without the need to boil or homogenise. As such, contamination risks can be significantly reduced.
Guanidinium salts also inhibit common DNA degrading enzymes so tissue can be stored in solution
while being transferred or while awaiting extraction. The use of simple boiling methods in lysis
buffers should be evaluated carefully in terms of contamination risks and DNA quality. It is our
opinion that the disadvantages far outweigh its advantages of DNA extraction using this method.
In summary, a good DNA extraction protocol after going through all the above discussion should
ideally be rapid, non-toxic, economical, and have a low risk of contamination.
PCR set-up. The second area for which standardisation is the set-up of the PCR laboratory. A
properly equipped laboratory to perform PCR diagnostics is absolutely critical if routine WSSV
diagnosis is to be conducted. The use of dedicated instruments such micro-pipettors and aerosol
resistant tips for PCR must be strictly observed. A PCR facility must be clean and well managed, and
the architecture of the laboratory must include separate rooms for pre- and post-amplification
procedures. Samples must not be prepared in the same room as the PCR machine is located and PCR
47
post-amplification analysis is performed. The laboratory in which PCR reagents are prepared should
also clean benches and ideally should include a laminar flow cabinet with built-in UV lamps for
decontamination procedures after every reaction set-up.
The need for trained manpower is critical, not just to perform the PCR assay but to ensure the reliable
management of a PCR diagnostic laboratory. PCR reagents must be properly prepared and
troubleshooting skills must be available so that the quality of result test results is consistently and
strictly controlled. Decontamination protocols should also be established and strictly followed.
Amplification strategies. Despite all care, it is our experience that contamination can and will occur.
For this reason, the use of low contamination risk amplification strategies is essential. The following
PCR strategies are now in use.
PCR may be conducted using single step or nested primer methodologies. In our experience, as shared
by many other laboratories in Asia, nested PCR can reach 1000 times the sensitivity as compared to
single step PCR. The extreme sensitivity of nested PCR works well in many cases but the test is
highly susceptible to contamination as it involves more time for sample manipulation. The most
common source of contamination is the product from a previous PCR. In fact, one molecule of a
contaminating PCR template in the first step reaction may be sufficient to obtain a false positive result
by nested PCR. The nested PCR is also more costly as it involves the use of 2 separate reactions to
arrive at one result. The cost will increase dramatically if assays are repeated when contamination
occurs.
A new methodology which may give more biological significance to the test result is quantitative
PCR. Qualitative PCR provides no useful quantitative assessment of the infection level or disease
progression and does not indicate pathogen replication. Because of this deficiency, the application of
primary cell lines have been suggested to be more appropriate pathogen detection than PCR, despite
the difficulty in establishing shrimp cell lines. However, quantitative PCR technology has been
available for some time and has been widely applied in diagnosis of human pathogens such as HIV
and herpes simplex virus. The ability to quantify using PCR allows investigation of the molecular
pathogenesis of an infection. Such information for WSSV has been very limited apart from studies
conducted using DNA probes in Taiwan. In situ hybridisation (ISH) using DNA probes also available
for disease investigation but the method is technically demanding and requires time for data
interpretation. Although it does not provide a direct quantification of the virus, ISH may give
information on the severity of infection. Quantification using PCR is more rapid and accurate, and can
provide an absolute determination of the number or copies of the targeted DNA. The most reliable
method for PCR quantification is by competitive PCR. This technique utilises a known amount of
engineered internal standard which has the same primer binding sites as the target DNA or RNA. The
internal standard is differentiated from the target by size on the basis of size by inclusion of a small
deletion, or by including a single base mutation that allows separation after restriction enzyme
digestion. Since the target DNA and internal standard are virtually identical, the efficiency of
amplification should be equivalent, leading to a fair competition when co-amplified and an accurate
measurement of the relative concentrations. This eliminate tube-to-tube and template variability.
PCR quantification can be conducted in real time with specialised equipment which uses fluorescent
dye quenching technology. The cost to purchase such equipment may be prohibitive for some
laboratories. The procedure makes absolute quantification possible but is technically demanding in
the initial stages of design and development of engineered standards for co-amplification. It is also
more costly as it requires the amplification of multiple standards simultaneously and is less sensitive
as compared to nested PCR.
In order to develop an easy, sensitive and robust method with lower risk of contamination for the
routine diagnosis of WSSV infection, we have been developing a single sample load, single-tube
nested PCR. By this method, we can reliably detect 1-10 copies of double-stranded viral DNA target.
48
The assay is much easier, more user friendly and faster with very little hands-on manipulation of the
PCR reaction preparation and is less susceptible to sporadic contamination. The assay is also half the
cost of our normal 2 tube nested PCR as only require one reaction tube and set of PCR reaction
components are required.
Semi-quantitative properties can also be incorporated into the system for an assessment of the WSSV
infection level. The two tube nested PCR provides very little quantitative information. A positive
PCR signal has very much the same overall intensity over a wide range of DNA target copies. The re-
amplification of the first step PCR product quickly masks differences in the concentrations of
amplified products due to the tendency of the PCR process to reach a plateau after 30 or 40 cycles,
regardless of the amount of the input target template. This is also due in part to the presence of
renewed sources for PCR amplification in the second tube. The characteristics of the single-tube
nested PCR approach are different. There is a direct relationship between the amount of the first step
PCR product and the amount of the nested PCR product. At low target concentration, the nested PCR
step does not proceed to reach a plateau as in the 2 tube nested PCR. This phenomenon occurs only
when high template target is present. As such, different levels of PCR signal intensity can be
observed, reflecting the severity of the infection. This permits a semi-quantitative approach to be
applied to the assessment of a positive result.
Although this requires extensive and intensive optimisation to achieve reliability, such approaches
may be more beneficial in the long run. In our case, the use of more sophisticated PCR methods has
been worth the investment in energy, money and manpower.
Diagnostic controls. Standardisation is also required in the use of appropriate diagnostic controls.
Without proper controls for result interpretation, no PCR result should ever be accepted as valid.
Appropriate controls, which are essential for elimination of false negative results, involve the
simultaneous amplification of a fragment of host DNA using primers targeting conserved sequences in
the host genome. This control indicates that the PCR has been successful and that template quality was
adequate for PCR amplification. It also allows the recognition of PCR inhibition factors in the sample.
The process will require the use of multiplex PCR as it will be more reliable when the control is
amplified in the same diagnostic reaction.
Appropriate control reactions to indicate false positive results should also be performed. A negative
control reaction without template must be used in every assay. The use of vapour barriers such a
mineral oil overlay of the PCR reaction is advised even though most thermal cyclers now employ a
heated bonnet to prevent vapour transfers. Strict adherence to contamination prevention and
decontamination procedures must also be followed. The use of positive controls that can be
differentiated from the target is also advantageous when it is necessary to distinguish a true positive
result from contamination with a positive control. By knowing whether contamination is from a
diagnostic target or from a positive control permits a more focused approach in eliminating the source
of contamination. Weak positive controls (low amount of target) can also be employed if necessary to
minimise the risk of contamination in the laboratory. A novel approach is the use of engineered
controls that differ in properties from diagnostic targets. Differentiation can be accomplished by
another round of PCR or by hybridisation with an internal probe that detects the difference in the PCR
fragments. However, the fastest and easiest way is to use restriction enzymes that cut either the target
or control fragments. By this method, the result can be determined by analysing the PCR products
elctrophoretically.
Diagnostic specificity. In establishing standard PCR protocols for WSSV diagnosis, the specificity of
PCR primers for conserved regions of the genome also should be considered. WSSV variants may
occur that cannot be detected by certain primer sequences. For example, Korean researchers (Park et
al., 1998) could amplify PCR products from WSSV-diseased shrimp using primers developed for RV-
PJ but not when using primers developed by Lo and co-workers. It is also interesting that the Korean
49
virus looks similar to WSSV found in Taiwan and not to RV-PJ from Japan. The sequence of the PCR
product was identical to sequence of RV-PJ fragment. It seems likely that mutations in WSSV are
occurring and this should be investigated. The possibility of having less virulent or virulent strains of
WSSV should also be considered. This has been reported for yellow head viruses in research
conducted in Australia (Dr. Peter Walker, CSIRO, Chiang Mai Meeting). However, as YHV is an
RNA virus, it would be expected to mutate more frequently than WSSV which is a DNA virus.
Confirmation of PCR specificity is quite straightforward. The nested PCR approach is already an
accepted method for confirmation of PCR specificity based on the distinct size of the nested PCR
product. Other techniques such as RFLP analysis and the use of an internal ISH probe are more
laborious.
Diagnostic sensitivity. Another area that sometimes evokes confusion that requires proper
standardisation is the definition of PCR diagnostic sensitivity or the limit of PCR detection.
Descriptions of detection limits currently vary from the number of DNA target copies to the number of
virus particles. It has not been established for WSSV whether the identification and detection of
single gene sequence reflects the detection of a single viable virus. It should be determined if
sensitivity can be standardised with quantitative qualities such as infection status, disease progression,
viral replication or antiviral therapies and strategies. The ideal WSSV diagnostic PCR assay would
determine the infection status and allow more accurate monitoring of the progression of the disease.
The monitoring of the disease has an important role in the management of WSSV infection on farms.
There is clearly potential to reduce the economic impact of WSSV by developing disease
management plans based on viral load information. In this approach, it will be important to determine
whether the virus is replicating and causing the disease.
The most important potential application of PCR technology is the possibility of developing new
antiviral therapies or strategies against WSSV. It is impossible to assess these accurately using the
techniques presently available.
Conclusion
How do we begin to validate PCR protocols then for WSSV diagnosis? Is it first through
standardisation or it is more practical to identify areas for validation that would allow a better
standardisation exercise? After evaluating all the problems and technical issues associated with the
PCR process, validation steps can be perhaps grouped into a few general areas.
Firstly, it is obvious that for a procedure to be valid, the protocol must be reliable, simple and sensitive
enough to do the work required. It must be technically easy to perform to allow reliable replication
between laboratories. This should encompass the entire process from DNA preparation to PCR
amplification.
Secondly, the use of proper controls must be employed consistently to totally eliminate false negative
and false positive results. In other words, very strict quality control must be imposed on laboratories
performing diagnosis.
Thirdly, it may be important to include a quantitative element to add the biological significance
dimension to diagnosis. This criterion has often been applied to diagnostic assays for infectious
pathogens. In any case, it is easier to verify a result when degree of infection is incorporated into the
assay. Again strict quality control must be implemented to allow the validation of a diagnostic result.
This may also minimise legal concerns and certainly will reduce unnecessary economic losses on
farms.
The use of a PCR test kit may help in the validation process. In this way, individual laboratories
would need only to meet certain requirements and avoid the need to develop diagnostic methods that
50
meet the imposed standards. However, a suitable PCR diagnostic kit must first be developed. This
will help encourage private companies to provide commercial clinical diagnostic services without a
huge investment in RandD. The kit in our opinion must satisfy basic criteria such as being simple to
perform and interpret, have a low contamination risk, include an appropriate false negative and false
positive control/indicators, have appropriate sensitivity controls and the test should be semi-
quantitative.
In short, the test should be designed to meet the expectations of the novice clinician for whom the use
of PCR as a diagnostic tool is still foreign. The test should also be sufficiently complete in its features
to satisfy the experienced investigator. The interpretation of results should be similarly and readily
understood by both groups. The complete package should be sufficiently attractive to justify its use
despite a potentially higher cost. The test must be the gold standard if is to be implemented as a
service to our local farmers who depend on us in seeing through their crop and their livelihood.
References
Botwell, D.D.L. (1987). Rapid isolation of eukaryotic DNA. Analytical Biochemistry 162, 463-465.
Chang, P.S., Lo, C.F., Wang, Y.C. and Kou, G.H. (1996). Identification of white spot syndrome
associated baculovirus (WSBV) target organs in shrimp Penaeus momnodon by in situ
hybridization. Diseases of Aquatic Organisms 27, 131-139.
Chomczynski, P., Mackey, K., Drews, R. and Wilfinger, W. (1997). DNAzol£: A reagent for the
rapid isolation of genomic DNA. BioTechniques 22, 550-553.
Clementi, M., Menzo, S., Bagnarelli, P., Manzin, A., Valenza, A. and Varaldo, P.E. (1993).
Quantitative PCR and RT-PCR in virology. PCR Methods and Application 2, 191-196.
Clementi, M., Menzo, S., Manzin, A. and Bagnarelli, P. (1995). Quantitative molecular methods in
virology. Archives of Virology 140, 1523-1539.
Flegel, T.W. (1997). Major viral diseases of the black tiger prawn (Penaeus monodon) in Thailand.
World Journal of Microbiology and Biotechnology 13, 433-442.
Lo, C.F., Leu, J.H., Ho, C.H., Chen, C.H., Peng, S,E., Chen, Y.T., Chou, C.M., Yeh, P.Y., Huang,
C.J., Chaou, H.Y., Wang, C.H. and Kou, G.H. (1996). Detection of baculovirus associated
with white spot syndrome (WSBV) in penaeid shrimps using polymerase chain reaction.
Diseases of Aquatic Organisms 27, 131-139.
Park, J-H., Lee, Y.S., Lee, S. and Lee, Y. (1998). An infectious viral disease of penaeid shrimp
newly found in Korea. Diseases of Aquatic Organisms 34, 71-75.
Rolfs, A., Schuller, I., Finckh, U. and Weber-Rolfs, I. (1992). PCR: Clinical diagnostics and
research. Springer-Verlag Berlin Heidelberg. 268 pp.
Saiki, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn, G.T., Mullis, K.B. and Erlich,
H.A. (1988). Primer directed enzymatic amplification of DNA with a thermostable DNA-
polymerase. Science 239, 487-491.
Wongteerasupaya, C., Wongwisansri, S., Boonsaeng, V., Panyim, S., Pratanpipat, P., Nash, G.L.,
Withyachumnarnkul, B. and Flegel, T.W. (1996). DNA fragment of Penaeus monodon
baulovirus PmNOBII gives positive in situ hybridization with white spot viral infections in
six penaeid shrimp species. Aquaculture 143, 23-32.
Xu, H., Jevnikar, A.M. and Rubin-Kelly, V.E. (1990). A simple method for the prepartion of
chromosomal DNA from cell. Culture. Nucleic Acids Research 18, 4943.
51
Application of polymerase chain reaction for detection of
shrimp pathogens in India
Indrani Karunasagar
Rapid detection of pathogens would be very essential for effective health management in aquaculture.
While conventional microbiological isolation methods are used in case of bacterial pathogens,
histopathology is widely used to detect viral infections. However, these methods are time consuming
and lack sensitivities to detect latent pathogens. Polymerase chain reaction (PCR) on the other hand is
highly sensitive and rapid and can be used to detect latent pathogens.
In our laboratory, we have been studying the application of PCR for rapid detection of shrimp
pathogens such as whitespot syndrome virus (WSSV) and Vibrio spp. WSSV is a serious pathogen
that has caused extensive mortalities in shrimp culture systems in India (Karunasagar et al., 1997,
1998; Karunasagar and Karunasagar, 1999). We have studied the application of PCR primers reported
by Lo et al. (1996) for detection of WSSV. Our results indicate that one step PCR is able to detect
infection in case of clinically symptomatic animals. Two step PCR was necessary to detect WSSV in
clinically asymptomatic shrimps and in other carrier animals (Otta et al., 1999). Using two step PCR,
a large number of apparently healthy P.monodon post larval stages were screened for the presence of
WSSV. Only 5% apparently healthy PL gave positive reaction in one step PCR whereas 48% showed
positive reaction in two step PCR (Otta et al., 1999). These results suggest that two step PCR is very
essential for detection of WSSV in asymptomatic animals and carriers.
Using PCR, WSSV could be detected in carrier animals such as crabs, Acetes spp and even in water
samples. An evaluation of the relation between PCR positivity and infectivity was studied in the case
of Penaeus monodon showing clinical signs of white spot syndrome. Viral extracts from freshly
harvested shrimp (22-25g) were highly infective causing clinical signs and mortality in healthy shrimp
within 48 h. Viral extracts prepared from clinically symptomatic animals, which were stored under
frozen conditions (-20qC) for two months, showed positive reaction in PCR. However, the viral
extracts from the frozen specimens failed to induce clinical signs or mortality in healthy animals. This
suggests that WSSV might lose infectivity during frozen storage in shrimp tissue. Therefore, PCR
positivity in frozen shrimp should be interpreted with caution with respect to its potential to spread the
virus.
In our laboratory, PCR is also being used to detect Vibrio parahaemolyticus in shrimp. Comparision
of culture and PCR methods show that PCR would be very useful in detecting this organism and the
technique has potential to detect even atypical strains showing variation in biochemical reactions
(Karunasagar et al., 1997). Thus PCR would be a very useful tool for rapid and sensitive detection of
pathogens in shrimp. The technique has applications in diagnostic laboratories, for monitoring health,
to identify environmental reservoirs of infections, to detect the presence of pathogens in animals in
quarantine etc.
References
Lo, C.F., Leu, J.H., Ho, C.H., Chen, C.H., Peng, S.E., Chen, Y.T., Chou, C.M., Yeh, P.Y., Huang,
C.J., Chou, H.Y., Wang, C.H. and Kou, G.H. (1996). Detection of white spot syndrome
baculovirus (WSSBV) in penaeid shrimp using polymerase chain reaction. Diseases of
Aquatic Organisms 25, 133-141.
52
Karunasagar, I., Otta, S.K. and Karunasagar, I. (1997). Histopathological and bacteriological study of
white spot syndrome of Penaeus monodon along west coast of India. Aquaculture 153, 9-
13.
Karunasagar, I., Nayak, B.B. and Karunasagar, I. (1997). Rapid detection of Vibrio parahaemolyticus
from fish by polymerase chain reaction. In Diseases in Asian Aquaculture III. T.W. Flegel,.
et al (Ed). Pp. 119-122. Asian Fisheries Society, Manila..
Karunasagar, I., Otta, S.K. and Karunasagar, I. (1998). Disease problems affecting cultured penaeid
shrimp in India. Fish Pathology 33, 413-419.
Karunasagar, I. and Karunasagar, I. (1999). Diagnosis, treatment and prevention of microbial diseases
of fish and shellfish. Current Science 76, 387-399.
Otta, S.K., Shubha, G., Biju, J., Karunasagar, I. and Karunasagar, I. (1999). Polymerase chain
reaction based detection of whitespot syndrome virus in cultured and wild crustaceans in
India. Diseases of Aquatic Organisms (in press).
53
Viral genetic variation: implications for disease diagnosis
and detection of shrimp pathogens
Introduction
During the past 10 years, the shrimp farming industry in the Asia-Pacific region and in the Americas
has experienced the devastating impact of successive panzootics of viral disease (Chamberlain, 1999).
In the ongoing effort to control and prevent these diseases, molecular methods are finding increasing
application for differential diagnosis, epidemiological investigations and screening of covert infections
in hatcheries and on farms. Methods such as the polymerase chain reaction (PCR), dot-blot
hybridisation (DBH) and in situ hybridisation (ISH) have now been developed for a wide range of
shrimp viruses and a number of significant bacterial pathogens (Lightner and Redman, 1998).
Although technically complex and requiring specialised analytical equipment, these molecular methods
have been adopted at a suprisingly rapid rate by diagnosticians, researchers and industry. This is
primarily due to their exquisite sensitivity and specificity compared to standard histological procedures.
The rapid uptake has also been driven by the lack of other methods that are used commonly in
diagnosis of animal viral infections. Because of the absence of adaptive immunity in invertebrates
(Fearon and Locksley, 1996), serology cannot be used to detect existing or prior infections with shrimp
viruses. Virus propagation in vitro has had very limited application because of the absence of suitable
cultured cell lines. Antibody-based methods for viral detection (eg. ELISA, indirect
immunofluorescence or immunoperoxidase tests) appear to offer considerable potential but have yet to
be explored adequately for most shrimp viruses.
Although molecular genetic methods can provide rapid and accurate information on the infection status
of shrimp, there is a considerable risk of misdiagnosis if the various parameters that determine reaction
specificity are not carefully monitored and controlled. In each of these methods, diagnostic specificity
is determined by a hybridisation (annealing) reaction in which a DNA (or RNA) probe must bind to the
target sequence in the infecting virus. The efficiency of this annealing reaction will be determined by
various parameters such as temperature, ion concentration, the accessibility and integrity of the target,
the size of the probe and the relative concentrations of target and probe. The test result will also be
influenced by the accuracy of the match between the probe and target sequences. This is particularly a
problem in PCR tests for which a single base mismatch can sometimes prevent primer efficient
extension of the primer-template hybrid (Kwok et al., 1990; Sommer and Tautz, 1989).
This paper will consider the inherent genetic variability of viruses and the implications of sequence
variation for pathogen detection and diagnosis. The potential to exploit variations in the genetic
sequence of viral isolates to determine disease epidemiology and to track the movements of aquatic
animal pathogens will also be considered.
54
pattern of expression also present a changing environmental landscape that can determine susceptibility
to infection or efficiency of replication (Gibbs et al. 1995; Morse, 1994).
RNA viruses known to infect farmed shrimp include Taura syndrome virus (TSV), yellow head virus
(YHV), gill-associated virus (GAV), lymphoid organ virus (LOV) and rhabdovirus of penaeid shrimp
(RPS). Each of these viruses is likely to replicate with a high mutation frequency. Some may also
have a capacity for genetic recombination.
In DNA viruses, the mutation rate is usually far lower than in RNA viruses (Steinhauer and Holland,
1987). DNA polymerases, both cellular and viral, do employ proof reading and repair functions to
reduce the intrinsic error rate. However, some small DNA viruses (eg. parvoviruses) appear to produce
factors that suppress the repair function, generating an error rate similar to that of RNA viruses (Parrish
et al., 1991). Even at the lower error frequency, the prodigious replication rate of DNA viruses
generates mutations in the genome that can be observed over time. For example, during natural
infections of palm beetles following experimental release, the Oryctes rhinoceros non-occluded
baculovirus has been reported to mutate at the rate of approximately 0.05 % (or 100 nucleotides) per
year. Over a monitoring period of 4 years, changes in genome structure such as insertions, point
mutations and recombinations could easily be detected in molecular tests (Crawford and Zelany, 1990).
DNA viruses have also been reported to produce sequence duplications and insert host DNA sequences
into the viral genome.
DNA viruses known to infect farmed shrimp include white spot syndrome virus (WSSV), monodon
baculovirus (MBV), baculoviral midgut necrosis virus (BMNV), infectious hypodermal and
haematopoeitic necrosis virus (IHHNV), spawner mortality virus (SMV) and hepatopancreatic
parvovirus (HPV). A recent study of WSSV DNA from sources in different geographic locations has
suggested little sequence variation between isolates, except in some samples obtained from the USA
(Lo et al., 1999). It is not yet known if crustacean parvo-like viruses (HPV, SMV and IHHNV) have a
capacity to suppress the error repair function of DNA polymerases.
55
Genetic variation in viral detection and disease diagnosis
Observations of genetic variability in viruses proclaim the need for care in the use of molecular
methods for disease diagnosis. Mutations in the nucleotide sequence can prevent binding of PCR
primers to target sequences, cause primers to bind non-specifically to non-target sequences, or prevent
PCR extension of the sequence from the primer site (Kwok et al., 1990; Sommer and Tautz, 1989).
Sequence insertions or duplications can generate size variations in the PCR product. In each case, the
result may appear falsely negative. At the protein level, mutations and other variations in sequence can
affect the binding of diagnostic reagents such as monoclonal antibodies. Variations can also cause
closely related strains to have significantly different biological properties such as pathogenicity, tissue
tropism or host range. An understanding of these factors is important for accurate interpretation of data
obtained for disease diagnosis, epidemiolgical investigation or screening for disease-free certification.
Yellow head virus (YHV) was first reported to be associated with mass mortalities of farmed P.
monodon in Thailand in 1990 (Limsuwan, 1991). It now appears that YHV or related viruses may have
been responsible for serious production losses in Taiwan, Indonesia, China, Malaysia and the
Philippines since 1986 (Lightner, 1996). Yellow head disease affects juvenile to sub-adult prawns in
which it usually causes a yellowish colouration of the cephalothorax and gills, and stimulates erratic
swimming near the surface at the pond edge. YHV replicates in the cytoplasm of infected tissues that
include lymphoid organ, haemocytes and gills. The virus infects a range of penaeid species but appears
not to infect other crustaceans.
Gill-associated virus (GAV) has been the primary cause of a yellow head-like disease and associated
mortalities that have affected the industry in Australia since 1994. The virus is indistinguishable from
YHV by TEM, infects a similar range of tissues, and causes similar histopathology (Spann et al., 1997).
In moribund prawns, the lymphoid organ displays extensive structural degeneration and cellular
necrosis. In GAV infections, mortality is usually preceded by varying degrees of red colouration of the
body and pink to yellow colouration of the gills. There has been no evidence of pale body colouration
or yellowing of the cephalothorax as described for YHV.
Prior to the identification of GAV, a virus with similar morphology was observed to be common in
healthy P. monodon in Australia (Spann et al., 1995). Lymphoid organ virus (LOV) causes the
formation of distinct foci of hypertrophic cells (spheroids) in the lymphoid organ which otherwise
remains structurally intact. ISH and TEM of lymphoid organ tissue indicate that LOV is contained
only within spheroids. The virus has not been observed by TEM in other tissues but can be detected in
haemolymph and gills by PCR tests. LOV infections appear to be non-pathogenic in uncompromised
P. monodon.
The complete nucleotide sequence of the GAV genome has now been obtained (JA Cowley and PJ
Walker, unpublished data). Analysis of the sequence has indicated that GAV is most closely related to
RNA viruses in the family Coronaviridae. In order to assess the genetic relationship between GAV
and YHV, sequence comparisons were conducted in 3 regions of the RNA replicase (ORF1b) gene that
had been used for the development of PCR and ISH tests (Wongteerasupaya et al., 1997; Tang and
Lightner, 1998; Cowley et al., submitted). The comparisons over a total of 1780 nucleotides
(approximately 6.0 % of the total genome) indicate that GAV and YHV vary by 17.6 % in nucleotide
sequence and 10.7 % in amino acid sequence. This degree of variation is typical of closely related
56
RNA viruses that constitute distinct geographic topotypes (Cowley et al., 1999). As the sequence of
viral polymerase genes usually is relatively conserved, more genetic variation between YHV and GAV
might be expected in some other regions of the genome. Comparison of sequences amplified from the
ORF1b gene of a large number of LOV isolates from healthy P. monodon has indicated that they vary
from the prototype GAV nucleotide sequence by an average of d1.5 % (Cowley et al., 1999). This is
within the range of variation expected within a single population of replicating RNA sequences and
indicates that the GAV and LOV are pathogenic and non-pathogenic variants of the same virus.
The available nucleotide sequence data has been used to develop primary and nested RT-PCR tests to
detect GAV in infected prawn tissue (Cowley et al., submitted). Each of these GAV RT-PCR tests will
detect both GAV and LOV, which cannot presently be distinguished genetically. The GAV RT-PCR
test will also amplify the expected product from a Thai isolate of YHV. This occurs because the
nucleotide sequences of GAV and YHV in the regions targeted by the PCR primers are sufficiently
related to allow primer hybridization under the conditions of the test. An RT-PCR test has also been
described for detection of YHV (Wongteerasupaya et al., 1997). However, due to significant
differences in sequence from YHV at one of the primer binding sites, this test will not detect either
GAV or LOV (Cowley et al., 1999). A comparison of the sequences of YHV and GAV isolates in the
primer binding sites for each of these PCR tests is shown in Fig.1, illustrating the poor correspondence
in sequence at the site of primer 144R.
A first assessment of these tests might suggest that the GAV PCR is group-specific, detecting all 3
viruses, and that the YHV PCR discriminates between GAV and YHV. However, as the extent of
variation among viruses associated with yellow head disease in Thailand and the Asian region is
presently unknown, such a presumption is premature. It is also possible that other non-pathogenic
LOV-like viruses are common in the region. We have observed that the prevalence of LOV in healthy
P. monodon captured in northern Queensland is extremely high (Cowley et al., submitted) and it is
likely that pathogenic YHV-complex viruses emerge from such a background of non-pathogenic
infection. This clearly illustrates the need for care in the design and interpretation of PCR tests and the
need for accreditation and standardisation of procedures. Ultimately, when adequate information on
the nature and distribution of YHV complex viruses is available, sequence data could be used to devise
a range of encompassing and discriminatory molecular tests.
Primer 10F
YHV 5’-CCGCTAATTTCAAAAACTAAG-3’
: ::: ::::: ::::: :
GAV ATGATAACTTCAAGAACTATG
Primer 144R
YHV 5’-CTTCCTCGACATAACACCTT-3’
:: :: : :: :: :
GAV TCATCTTGATCTCACGCCCT
Figure 1. Comparison of the YHV and GAV sequences at the primer binding sites for YHV PCR
primers 10F and 144R Wongteerasupaya et al. (1997). Dots indicate the location of homologous
nucleotides. GAV sequences are described in Cowley et al. (1999).
In the case of YHV-complex viruses, sequence analysis of the 618 nucleotide product generated by the
GAV PCR test has already demonstrated that LOV and GAV are variants in the same virus population
of which individual isolates are genetically distinct (J.A. Cowley and P.J. Walker, unpublished data). It
has also been possible to define the Australian viruses as a population that has evolved with a different
lineage to that of YHV from Thailand. The accumulation of more comprehensive data from multiple
domains of the genome and from YHV complex isolates obtained throughout the Asia-Pacific region
will provide better understanding of these viruses, the origins of disease and the risk factors associated
with farming practices.
The principles illustrated here for the YHV complex are equally applicable to other RNA viruses and
may well apply to DNA viruses infecting aquatic animals. Through the use of modern PCR and
sequencing technology and the development of bioinformatics systems, the capability for rapid
accumulation and analysis of nucleotide data is now a reality. If standard analytical procedures and
appropriate security protocols can be agreed, there is obvious potential for such an approach to be a
powerful tool in managing disease and in defining a more rational basis for controlling the movement
of aquatic animal pathogens.
Acknowledgements
Work reported in this paper was conducted as a co-operative project involving CSIRO Australia, and
Mahidol University, NACA and the Aquatic Animal Health Research Institute in Thailand. This
research has been supported by the Australian Centre for International Agricultural Research (ACIAR)
and the National Centre for Genetic Engineering and Biotechnology (BIOTEC) in Thailand.
References
Chamberlain, G.W. (1999). Sustainability of world shrimp farming. In: Global Trends: Fisheries
Management. EK Pikitch, DD Huppert and MP Sissenwine, Eds American Fisheries Society
Symposium 20, Bethesda, MD.
Cowley, J.A., Dimmock, C.M., Spann, K.M. and Walker, P.J. Detection of Australian gill-associated
virus (GAV) and lymphoid organ virus (LOV) of Penaeus monodon by RT-nested PCR.
Diseases of Aquatic Organisms (submitted).
Cowley, J.A., Dimmock, C.M., Wongteerasupaya, C., Boonsaeng, V., Panyim, S. and Walker, P.J.
(1999). Yellow head virus from Thailand and gill-associated virus from Australia are closely
related but distinct prawn viruses. Diseases of Aquatic Organisms 36, 153-157.
Crawford, A.M. and Zelany, B. (1990). Evolution in Oryctes baculovirus: rate and types of genomic
change. Virology 174, 294-298.
Fearon, D.T. and Locksley, R.M. (1996). The instructive role of innate immunity in the aquired
immune response. Science 272, 50-54.
Gibbs, A.J., Calisher, C.H. and Garcia-Arenal, F. (Eds.) (1995). Molecular Basis of Viral Evolution.
Cambridge University Press.
Kwok, S., Kellogg, D.E., McKinney, N., Spasic, D., Goda, L., Levenson, C. and Sninsky, J.J. (1990).
Effects of primer-template mismatches on the polymerase chain reaction: Human
immunodeficiency virus type 1 model studies. Nucleic Acids Research 18, 999-1005.
Lightner, D.V. (1996). A Handbook of Shrimp Pathology and Diagnostic Procedures for Diseases of
Cultured Penaeid Shrimp. World Aquaculture Society, Baton Rouge, LA, USA. 304 p.
Lightner, D.V. and Redman, R.M. (1998). Shrimp diseases and current diagnostic methods.
Aquaculture 16, 201-220.
Limsuwan, C. (1991). Handbook for cultivation of black tiger prawns. Tansetakit Co. Ltd,
Bangkok.
58
Lo, C.-F., Hsu, H.-C., Tsai, M.-F., Ho, C.-H., Kou, G.-H. and Lightner, D.V. (1999). Specific
genomic DNA fragment analysis of different geographical clinical samples of shrimp white
spot syndrome virus. Diseases of Aquatic Organisms 35, 175-185.
Morse, S.S. (1994). Towards an evolutionary biology of viruses. In The Evolutionary Biology of
Viruses. (S.S. Morse Ed.). Pp. 1-28. Raven Press, New York.
Parrish, C.R., Aquadro, C.F., Strassheim, M.L., Evermann, J.F., Sgro, J.-Y. and Mohammed, H.O.
(1991). Rapid antigenic-type reeplacement and DNA sequence evolution of canine
parvovirus. Journal of Virology 65, 6544-6552.
Sommer, R. and Tautz, D. (1989). Minimal homology for PCR primers. Nucleic Acids Research 17,
6749.
Spann, K.M., Vickers, J.E. and Lester, R.J.G. (1995). Lymphoid organ virus of Penaeus monodon
from Australia. Diseases of Aquatic Organisms 23, 127-134.
Spann, K.M., Cowley, J.A., Walker, P.J. and Lester, R.J.G. (1997). A yellow-head-like virus from
Penaeus monodon cultured in Australia. Diseases of Aquatic Organisms 31, 169-179.
Steinhauer, D.A., Domingo, E. and Holland, J.J. (1992). Lack of evidence fro proofreading
mechanisms associated with RNA virus polymerase. Gene 122, 281-288.
Steinhauer, D.A. and Holland, J.J. (1987). Rapid evolution of RNA viruses. Annual Review of
Microbiology 41, 409-433.
Tang, K.F-J. and Lightner, D.V. (1999). A yellow head virus gene probe: application to in situ
hybridization and determination of its nucleotide sequence. Diseases of Aquatic Organisms
35, 165-173.
Wongteerasupaya, C., Tongcheua, W., Boonsaeng, V., Panyim, S., Tassanakajon, A.,
Withyachumnarnkul, B. and Flegel, T.W. (1997). Detection of yellow-head virus of Penaeus
monodon by RT-PCR amplification. Diseases of Aquatic Organisms 31, 181-186.
59
The need for molecular tools in the study of mollusc pathogens
P.M. Hine
Introduction
The OIE list of notifiable diseases of molluscs and the pathogens causing them comprises marteiliosis
(Marteilia refringens, Marteilia sydneyi), bonamiosis (Bonamia ostreae, Bonamia sp.), mikrocytosis
(Mikrocytos mackini, Mikrocytos roughleyi), haplosporidiosis (Haplosporidium nelsoni,
Haplosporidium costale) and perkinsosis (Perkinsus marinus, Perkinsus olseni). This paper gives a
brief overview of the areas in which molecular tools are needed to overcome problems associated with
these diseases, and considers the needs of the Asian region.
Infection levels
Moderate to heavy infections with Marteilia refringens, Marteilia sydneyi, both Bonamia spp., and
both Haplosporidium spp. are relatively easy to detect by routine histology. Both Perkinsus spp. can be
cultured using Ray’s Fluid Thioglycollate Medium (RTFM) (Bushek et al., 1994), allowing light
infections to be amplified, and consequently detected. Mikrocytos spp. are much harder to detect.
Mikrocytos roughleyi infects the haemocytes of Sydney rock oysters (Saccostrea commercialis) in
eastern (Georges River) and western (Carnarvon, Albany) Australia, and ultrastructurally it has a single
mitochondrion. Mikrocytos mackini infects connective tissue cells of Pacific oysters (Crassostrea
gigas) off the coast of British Columbia, and ultrastructurally it lacks a mitochondrion. Currently it is
thought that these two pathogens are not closely related, and M. roughleyi may be more closely related
to Bonamia spp. Macroscopically both Mikrocytos spp. produce macroscopic pustular or abcess-like
lesions in cases of heavy infection, and if occurring in the known range of these two pathogens, may
allow presumptive diagnosis. However, microscopically both Mikrocytos spp. are only ~2 m in
diameter, do not stain well, consequently they are difficult to detect in moderate to light infections
(Hervio et al., 1996). Therefore probes are needed to detect light infections with all OIE listed
pathogens except (Perkinsus spp.), and light to moderate infections with Mikrocytos spp.
The two species of Bonamia have also not yet been clearly distinguished, although B. ostreae has dense
forms that are seldom seen in Bonamia sp, and the latter has a vacuolated stage (Hine, 1991) that has
not been reported from B. ostreae. The two species of Haplosporidium can be distinguished by spore
size, and H. nelsoni can be distinguished from all other Haplosporidium spp. as it sporulates in
epithelial cells of the digestive diverticulae, and the other species sporulate in connective tissue.
Currently, H. costale cannot be distinguished reliably from other Haplosporidium spp. except H.
nelsoni. Mikrocytos spp. do not resemble each other closely and M. roughleyi may be more closely
related to Bonamia spp. (see above). Perkinsus olseni shows similarities to Perkinsus atlanticus
60
(Hamaguchi et al., 1998), but Perkinsus marinus also shows similarities to P. atlanticus (Robledo et
al., 1997). Specific probes are currently available, or are being developed for, Marteilia refringens,
Marteilia sydneyi, Bonamia spp., Haplosporidium nelsoni, and H. costale.
Life cycles
Bonamia spp., Mikrocytos mackini, and Perkinsus spp., transmit directly from one host to another.
Haplosporidium spp. and Marteilia spp. cannot be transmitted directly from one to another, and
probably require an intermediate host (Roubal et al., 1989; Berthe et al., 1998). Probes currently
developed or being developed for Haplosporidium spp. and Marteilia spp. will be used to identify the
DNA of these pathogens in likely alternative hosts, such as filter feeding or detrivorous invertebrates.
Marteilia sydneyi, Bonamia sp., Mikrocytos roughleyi and Perkinsus olseni have been reported from
Australia, and a Perkinsus sp. from clams (Tapes philippinarum) in Japan (Hamaguchi et al., 1998).
The Japanese isolate had sequences intermediate between P. olseni in Australia, and P. atlanticus in
Manila clams (Tapes philippinarum) from Spain. Perkinsus atlanticus from Ruditapes philippinarum
and Ruditapes decussatus around Spain and Portugal, are closely related to P. olseni (Robledo et al.,
1997). It may be therefore that P. olseni was moved from Asia in Manila clams to Europe, where it
was described as P. atlanticus. If so, P. olseni/atlanticus may be widely distributed throughout
Southeast Asia.
Although Haplosporidium nelsoni has not been formally reported from Asia, a Haplosporidium sp.,
similar in size and pathology to H. nelsoni, occurs in Pacific oysters (Crassostrea gigas) in California
and in Matsushima Bay, Japan, from which the Californian stocks derived (Friedman et al., 1991;
Friedman, 1996). A sensitive and specific probe for H. nelsoni (Stokes and Burreson, 1995) labels the
Californian and Japanese Haplosporidium, suggesting that it is also H. nelsoni, and that H. nelsoni was
originally introduced into California in Japanese Pacific oysters.
Therefore, some of the temperate OIE listed diseases occur in Australia and Japan, and it is likely that
Haplosporidium nelsoni and Perkinsus olseni/atlanticus occur more widely in Asia than is currently
realized. As bivalve health expertise becomes more widespread in Asia, other serious diseases of
tropical, as well as temperate bivalves, are likely to emerge. One such pathogen may be a
Haplosporidium sp. pathogenic in silverlip pearl oysters (Pinctada maxima) in northwestern Australia
(Hine and Thorne, 1998). Also, an apparently infectious disease that has caused massive mortalities
among akoya pearl oysters (Pinctada fucata) in Japan since 1994 (Miyazaki et al., 1998) may well
prove to be a serious disease in Asia. Currently a parasite related to Marteilia, called Marteilioides
chungmuensis, which parasitizes the ova of Pacific oysters (Crassostrea gigas) is having a serious
impact on oyster production, and may also prove to be a problem in Asia. Once such problems have
been identified, molecular tools will need to be developed to detect low infection levels, distinguish
species and study life cycles, as for the currently listed diseases.
The OIE protocols are designed to control spread of aquatic animal diseases, using a certification and
reporting system that requires a national infrastructure, based in law, and a network of skilled and
experienced aquatic animal health specialists, including technicians, inspectors and pathologists.
61
Development of such systems occurs as industries to be serviced develop, and therefore are found
where aquaculture industries are well established. Such established industries use hatchery production
or natural spat settlement as their source of stock. Certification allows stock to be traded between
farms, and the identification and establishment of disease free zones minimizes risk of disease spread.
In developing bivalve farms, it is often necessary to initially acquire brood stock from the wild, or to
move bivalves into an area to enhance natural spat settlement. Such movements are already taking
place throughout Asia. This process must be undertaken with extreme care to minimize the risk of
introducing disease onto the farm site. Studies on the parasites and diseases of wild bivalves in
northwestern Australia have shown that the prevalence of potentially serious diseases in wild stocks
may be extremely low (Table 1). Prevalences of ~0.1% are common. To detect such infection with
95% confidence, it is necessary to sample 2,994 animals, and even then a light infection may well be
missed. Molecular tools are needed to detect such low levels of infection before stocks are moved.
References
Berthe, F.C.J., Pernas, M., Zerabib, M., Haffner, P., Thébault, A. and Figueras, A.J. (1998). Experimental
transmission of Marteilia refringens with special consideration of the life cycle. Diseases of
Aquatic Organisms 34, 135-144.
Bower, S.M., McGladdery, S.E. and Price, I.M. (1994). Synopsis of infectious diseases and parasites of
commercially exploited shellfish. Annual Review of Fish Diseases 4, 1-199.
Bushek, D., Ford, S.E. and Allen, S.K. (1994). Evaluation of methods using Ray’s fluid thioglycollate
medium for diagnosis of Perkinsus marinus infections in the eastern oyster, Crassostrea
virginica. Annual Review of Fish Diseases 4, 201-217.
Friedman, C.S. (1996). Haplosporidian infections of the Pacific oyster, Crassostrea gigas (Thunberg), in
California and Japan. Journal of Shellfish Research 15, 597-600.
Friedman, C.S., Cloney, D.F., Manzer, D. and Hedrick, R.P. (1991). Haplosporidiosis of the Pacific
oyster, Crassostrea gigas. Journal of Invertebrate Pathology 58, 367-372.
Hamaguchi, M., Suzuki, N., Usuki, H. and Ishioka, H. (1998). Perkinsus protozoan infection in short-
necked clam Tapes (=Ruditapes) philippinarum in Japan. Fish Pathology 33, 473-480.
Hervio, D., Bower, S.M. and Meyer, G.R. (1996). Detection, isolation, and experimental transmission of
Mikrocytos mackini, a microcell parasite of Pacific oysters Crassostrea gigas (Thunberg).
Journal of Invertebrate Pathology 67, 72-79.
Hine, P.M. (1991). Ultrastructural observations on the annual infection pattern of Bonamia sp. in flat
oysters Tiostrea chilensis. Diseases of Aquatic Organisms 11, 163-171.
Hine, P.M. and Thorne, T. (1998). Haplosporidium sp. (Haplosporidia) in hatchery-reared pearl oysters,
Pinctada maxima (Jameson, 1901), in north Western Australia. Journal of Invertebrate
Pathology 71, 48-52.
Miyazaki, T., Goto, K., Kobayashi, T. and Miyata, M. (1998). An emergent virus disease associated
with mass mortalities in Japanese pearl oysters Pinctada fukata martensii. In: Proceedings of
the VIIth International Colloquium on Invertebrate Pathology and Microbial Control.
Sapporo, Japan, August 23-28th 1998, pp. 154-159.
Moyer, M.A., Blake, N.J. and Arnold, W.S. (1993). An ascetosporan disease causing mass mortality in
the Atlantic calico scallop Argopecten gibbus (Linnaeus, 1758). Journal of Shellfish Research
12, 305-310.
Robledo, J.A.F., Wright, A.C., Coss, C.A., Vasta, G.R. and Goggin, C.L. (1997). Further studies of
conserved genes from Perkinsus isolates. Journal of Shellfish Research 16, 342.
Roubal, F.R., Masel, J. and Lester, R.J.G. (1989). Studies on Marteilia sydneyi, agent of QX disease in
the Sydney rock oyster, Saccostrea commercialis, with implications for its life cycle. Australian
J.ournal of Marine and Freshwater Research 40, 155-167.
Stokes, N.A. and Burreson, E.M. (1995). A sensitive and specific DNA probe for the oyster pathogen
Haplosporidium nelsoni. Journal of Eukaryote Microbiology 42, 350-357.
62
Table 1. Prevalence of parasites in Saccostrea spp. IVI = intranuclear virus-like inclusions. RLOs = Rickettsiales-like organisms.
RLOs 3 0 0 0 - 0.3%
Marteilia sydneyi 0 0 1 0 - 0.1%
Perkinsus sp. 0 0 0 1 - 0.1%
Ancistrocomid ciliates 13 0 0 0 - 1.4%
Spenophyra-like ciliates 12 0 1 0 - 1.4%
Tylocephalum sp. 3 13 0 1 - 1.8%
Sporocysts 0 1 0 0 - 0.1%
IVI 0 1 0 0 - 0.1%
RLOs 0 1 0 0 - 0.1%
Haplosporidium sp. 0 121 4 0 - 10.0%
Marteilia sp. 0 1 0 0 - 0.1%
Perkinsus sp. 0 0 1 0 - 0.1%
Ancistrocomid ciliates 0 3 4 0 - 0.6%
Nematopsis sp. 0 1 0 0 - 0.1%
Tylocephalum sp. 0 0 9 0 - 0.7%
Nematode larvae 0 4 0 0 - 0.3%
63
Development and validation of DNA-based diagnostic techniques
with particular reference to bivalve mollusc pathogens
Introduction
The International Aquatic Animal Health Code of the OIE (the World Organization for Animal
Health) includes serious pathogens that have been causing important losses in the mollusc aquaculture
industry throughout the world. This list also meets the ones established by the European Union
regulation (Annex B of Directive 91/67/EC; Annex D of Directive 95/70/EC). In fact, one of the very
few ways to reduce the impact of such pathogens on commercially exploited molluscs, is to establish
effective programmes to prevent the transfer of infected stocks. Consequently, an area where molluscs
are infected with any of these pathogens should not be allowed to export into another area free of this
pathogen. Obviously, both country imports and abnormal mortality outbreaks in mollusc stocks
should be examined for the presence of listed pathogens. This includes the detection of exotic
diseases as well as emerging diseases. As a matter of fact, the effective control of diseases of bivalve
molluscs requires an access to diagnostic tests that are rapid, reliable, accurate and sensitive.
Techniques applicable to molluscan pathogens are limited and most investigations are based on
histological and ultrastructural examinations. Arising from this, the development of molecular
diagnostic tools will probably be one of the most important areas for research in the near future.
Another example of particular interest is Bonamia ostreae which, in 1979, dramatically affected the
flat oyster (O. edulis) industry in France (Pichot et al., 1979). This pathogen rapidly spread to almost
all oyster farming areas in Europe, including Spain, Netherlands, Ireland and United Kingdom (Van
Banning, 1982; Banister and Key 1982; Polanco et al., 1984; McArdle et al., 1991). A microcell
disease similar to bonamiosis was also described in California in the 1960s and was known to occur in
several populations of flat oysters from the western coast of North America (Elston et al., 1986).
Bonamia ostreae was later identified as the causative agent of this disease on the basis of host
susceptibility and ultrastructural characteristics. Moreover, the use of monoclonal antibodies
64
demonstrated no antigenic differences between B. ostreae isolates originating from Europe and the
USA (Mialhe et al., 1988). More recently, bonamiosis was recorded from the east coast of the USA,
New Meadows River, Quahog Bay and Damariscotta River (Barber and Davis, 1994; Friedman and
Perkins, 1994). These results and historical commercial records lead to the hypothesis that the
Californian microcell disease was actually bonamiosis and that bonamiosis spread from California to
Europe because of transfers of B. ostreae infected flat oysters (Elston et al., 1986; Cigarria and Elston,
1997).
Decision makers responsible for supervising translocations of molluscs deal with a high risk situation.
Risk analysis prior to transfers should help to minimise this risk. However, a serious limiting factor is
a lack of scientific information on even basic biology of mollusc pathogens (Hine, 1996).
Surveillance for mollusc pathogens is routinely performed by histology. This technique is time
consuming and dependant of visula observation. In 1998, the Community Reference Laboratory
proposed a ring test for the detection of two parasites (Bonamia ostreae and Marteilia refringens) by
means of histology which is currently the standard method. The goal of this profeciency test was to
establish that examination of a given sample lead to the same conclusions in any of the eight
participating laboratories. The ring test was based on an itinerant collection of stained histological
sections of Ostrea edulis. Statistical analysis of the results was based on the test of symetry and kappa
coefficient. Significant discordance among the results obtained by participating laboratories was
evident from the study. This clearly illustrated the need for training in histological diagnosis,
particularly for exotic diseases, and the need for epidemiological surveillance programmes in order to
prevent the transfer of diseases. However, using histological methods many pathogens are difficult to
detect when present in low numbers.
Recent efforts to overcome these problems have led to the development of immunoassay techniques
and nucleic acid-based diagnostic methods. Serological methods for diagnostic purposes obviously
cannot be applied to molluscs as they do not produce antibodies. Molecular probes, such as
monoclonal antibodies or nucleic acid probes, may be used for direct detection of pathogenic agents.
These techniques are expected to find increasing use in routine disease monitoring programs in
aquaculture, in field epidemiology and in efforts to prevent the international spread of pathogens.
Therefore, it is extremely important to develop, validate and standardize this type of diagnostic
technique for major mollusc diseases and pathogens.
Obviously, the required quality criteria of the selected method depend on the level of investigation for
which it is to be used. For example, detection procedures require techniques that are easy to perform
(e.g. smears or tissue imprints) or sensitive techniques that usually are based on an amplification step
(e.g. culture of the pathogen or polymerase chain reaction- PCR). Choice of technique may then be
based on the time required to obtain a result and this can range from few hours to few days. In the
case of diagnostic procedures, specificity of the selected methods is obviously the most important
criterion. Confirmatory procedures currently in use are ultrastructural observations by transmission
electron microscopy. One should say that in the near future, with the increasing use of molecular
technics, diagnostic procedures will increasingly be confirmatory.
65
Increased sensitivity is often used as an argument for the use of new diagnostic methods. However,
we should stress here that sampling strategy is of a central importance to ensure detection of a
pathogen whatever detection method is used. The timing and frequency of sampling should be
determined by the cycle of infection and pre-patent period. Also, the intensity of infection may
increase following spawning due to loss of host condition and therefore molluscs should be sampled
post-spawning. The recommanded sample size for each sampling site is 150 or a sufficient number to
ensure detection at a 95% confidence level of pathogens at a prevalence of 2%. However, if molluscs
are to be moved from natural beds onto a farm site or between natural beds in different zones, large
numbers of molluscs must be sampled because of low parasite prevalence. In Western Australia,
Perkinsus sp. occurs in isolated beds sometimes at very low prevalences (Hine, 1996). However, the
probability of detecting an infection may be increased by holding the molluscs in quarantine for a long
period, subjecting them to stress and examination of cohabitant species of molluscs that are highly
susceptible to the infection. The use of PCR could help in such situations. However, widely
recognized limitations of PCR methods include the false positive results (due to inhibiting substances
in marine organisms, lack of target organs, pre-patent periods, etc) and false positive results (cross-
reaction with closely related organisms, laboratory contamination of samples, etc). This leads us to
consider specificity as one of the main imput of molecular diagnostic methods currently developped.
Perkinsus atlanticus is another well documented example of data gap in the field of taxonomy prior to
the development of molecular tools. This organism is known to occur in both Europe (Azevedo, 1989)
and Asia (Hamaguchi et al., 1998). In fact, more than 50 species of molluscs may harbour Perkinsus
species from temperate to tropical waters of the Atlantic and Pacific oceans and Mediterranean Sea,
apparently without harmful effect. Nucleotide sequence analysis of the internal transcribed spacers
(ITS) of the ribosomal gene cluster (rDNA) has indicated that the Australian organism P. olseni is
probably conspecific to Perkinsus atlanticus (Goggin, 1994). Taking this into account, the
geographical distribution of the mollusc pathogen P. osleni could be wider than currently accepted.
This should be urgently investigated because of the obvious consequences of such considerations.
In summary, we would like to pinpoint the need of adequacy of the methods to be developed and
validated, as well as the absolute need of a clear taxonomy of pathogens under consideration.
Universal primers provide an internal control for amplification experiments. Working with marine
organisms, such an internal control of the PCR reaction is of a central importance as the reaction
efficiency depends on various parameters including the presence of inhibitory factors and the quality
and quantity of targeted DNA. In the present study, universal primers were designed and successfully
used to amplify DNA from both Marteilia refringens and its hosts. These primers should be included
in further use of PCR for M. refringens detection.
For in situ hybridization, four probes were tested by Northern blotting for the specific detection of 18S
RNA isolated from Marteilia refringens and other eukaryotic cells. The most specific probe was used
successfully to detect Marteilia refringens by in situ hybridization. The selected probe produced
consistent strong reactions when used for Marteilia refringens-infected Ostrea edulis and Mytilus
edulis, as well as for Marteilia maurini-infected Mytilus galloprovincialis. A similar result was
obtained with Marteilia sydneyi in Saccostrea commercialis. However, no cross-reaction was noted
when the probe was tested against Marteilioides chungmuensis in Crassostrea gigas. It was concluded
that the sequence of Smart 2 is shared partially, if not completely, by Marteilia spp.
Similarly, specific primers designed from the 18S sequence of Marteilia refringens led to the
amplification of specific fragment from European Marteilia-infected bivalves. No amplification was
obtained when M. sydneyi DNA was targeted. Although the taxonomic relationships among the
European species are not clearly established, PCR could be used to specificity discriminate Marteilia
refringens from M. sydneyi.
Repeatability and reproduceability were successfully tested. A study was commenced to validatethe in
situ hybridization as a confirmatory method. Oysters originating from three different European zones
(highly infected originating from Marennes-Oléron, France (n = 200); medium infection from
Brittany, France (n = 200); and free of marteiliosis (n = 200) originationg from Lake Grevelingen,
Netherlands) were processed by this method and compared with classical histology which is
considered to be the standard method. Statistical analysis indicated a strong validation of the in situ
hybridization method for the detection of Marteilia refringens. However, most of these resulsts were
obtained on laboratory material stored in good condition, small size samples and were conducted by
trained staff. Further work is underway in our laboratory to further validate of these tools.
In the case of Marteilia refringens, it is possible to recommand selected methods for the three different
levels of investigation described above. The detection of Marteilia refringens by in situ hybridization
could be used in addition to classical histological examination as a confirmatory method at a genus
level. Histology and in situ hybridization can thus be used as a two step diagnostic procedure, and
67
could become a standard method for the assessment of a disease free status in a zone. Detection
procedures that require presumptive methods for rapid detection of a suspected pathogen could be
cunducted by using digestive gland imprints. It is very important to keep in mind the multiple
advantages of such a method (which can be applied in the course of sample preparation for histology)
as it is cheap and provides an immediate answer. PCR tests, because of their specificity, could be
proposed for the specific identification of encountered pathogens as a confirmatory procedure.
However, standardization of protocols, including negative and positive controls, is required.
Compared to transmission electron microscopy (the currently used confirmatory procedure), PCR
provides a quick and specific answer.
In the near future, the number and diversity of available methods should increase. In the case of
Marteilia spp., oligoprobes targetting the ITS region have been developed and should be used for
diagnostic purposes at a species level. Similarly, the sequencing of this region of the ribosomal gene
cluster is currently demonstrating the possible existance of different strains within the species
refringens. Further development in the knowledge of these parasites could lead to an increasing
number of molecular methods at different levels of specificity (i.e. genus, species and strain). These
could include techniques such as restriction fragment lengh polymorphism (RFLP) and reverse blot
PCR.
At a national and regional level, reference laboratories will provide sequences of primers and
oligoprobes to be used. The role of these laboratories in the validation of molecular reagents as
diagnostic tools is obvious. Furthermore, these laboratories will have a growing responsibility in
providing standardized protocols including positive and negative controls. Proficiency evaluations
such as ring tests should also be organized for these diagnostic procedures in order to avoid mis-
interpretation of results.
It should be said here that some of the DNA-based methods presented in this paper were aiming the
study of life-cycle of Marteilia refringens which may include intermediate hosts or free-living stages
(Berthe et al., 1998). With similar goals, a number of research laboratories are already engaged in
developing DNA-based diagnostic techniques for mollusc pathogens. Therefore, several new
diagnostic tools for mollusc diseases should be available in the future.
Another potential use of molecular diagnostic tools is for detection of Haplosporidium nelsoni, one of
the causative agent of haplosporidiosis - a disease of eastern oyster (Crassostrea virginica). A parasite
morphologically similar to H. nelsoni was described in the Pacific oyster (Crassostrea gigas) on the
west coast of the USA (Friedman et al., 1991). This parasite was identified as H. nelsoni by the use a
specific DNA probe (Stokes and Burreson, 1995). Furthermore, some of the C. gigas stocks were
traced back to Japan where the examination of native C. gigas, demonstrated infection by a
Haplosporidium sp. indistinguishable from H. nelsoni described in C. gigas from the USA (Friedman,
1996). A Minchinia sp. (Haplosporidium-like organism) has also been known to occur in C. gigas in
Korea since the mid-1970s (Kern, 1976). In France, several authors have reported the occurance
Haplosporidium spp. in several species of molluscs (Bonami et al., 1985; Chagot et al., 1987; Comps
and Pichot, 1991). There is some confusion in the taxonomic relationship of the two pathogens H.
nelsoni and H. costale. This should be investigated in the near future. This example illustrates an
unforseen consequence of the use of DNA probes and reveals how taxonomy is an underestimated key
point in mollusc pathology.
Acknowledgements
Work reported in this paper was partly conducted as a cooperative project - MARS - funded by the
FAIR programme, and by the Community Reference Laboratory for mollusc diseases (Ifremer La
Tremblade) with the financial assistance of the EU DG VI.
68
References
Azevedo C. (1989). Fine structure of Perkinsus atlanticus n. sp. (Apicomplexa, Perkinsea) parasite of
clams, Ruditapes decussatus, from Portugal. J. Parasitol., 75, 627-635.
Auffret M. and Poder M. (1985). Recherches sur Marteilia maurini, parasite de Mytilus edulis sur les
côtes de Bretagne nord. Rev. Trav. Inst. Pêches marit. 47 :105-109.
Bannister, C. and Key D. (1982). Bonamia a new threat to the native oyster fishery. Fish. Nat. MAFF
Direct . Fish. Res. 71,7.
Barber, B.J. and Davis C. (1994). Prevalence of Bonamia ostreae in Ostrea edulis populations in
Maine. J. Shellfish Res. 13, 298.
Berthe, F.C.J., Pernas, M., Zerabib, M., Haffner, P., Thébault, A. and Figueras, A.J. (1998). Experimental
transmission of Marteilia refringens with special consideration of the life cycle. Diseases of
Aquatic Organisms 34, 135-144.
Berthe, F.C.J., Le Roux F., Peyretaillade E., Peyret P., Rodriguez D., Gouy M. and Vivarès C.P.
(1999). The existence of the phylum Paramyxea Desportes and Perkins, 1990 is validated by
the phylogenetic analysis of the Marteilia refringens small subunit ribosomal RNA.
Submitted in Molecular and Biochemical Parasitology.
Bonami, J.R., C.P. Vivares and M. Brehelin. (1985). Étude d'une nouvelle haplosporidie parasite de
l'huître plate Ostrea edulis L.: morphologie et cytologie de différents stades. Protistologica
21: 161-173.
Boudry, P., Heurtebise S., Collet B., Cornette F and A. Gérard (1998). Differentiation between
populations of the Portuguese oyster Crassostrea angulata (Lamark) and the Pacific oyster,
Crassostrea gigas (Thunberg), revealed by mtDNA RFLP analysis. J. Exp. Mar. Biol. Ecol.
226, 279-291.
Chagot, D., Bachère, E., Ruano, F., Comps, M. and Grizel, H. (1987). Ultrastructural study of
sporulated instars of a haplosporidian parasitizing the clam Ruditapes decussatus.
Aquaculture 67: 262-263.
Cigarria, J. and Elston, R. (1997). Independent introduction of Bonamia ostreae, a parasite of Ostrea
edulis, to Spain. Dis. aquat. Org. 29, 157-158.
Claver-Derqui A. (1990). Datos sobre Marteiliosis en la provincia de Cadiz. Acta III Congreso Nac.
Acuicult. 885.
Comps M., Grizel H. and Papayanni Y. (1982) Infection parasitaire causée par Marteilia maurini sp.
nov. chez la moule Mytilus galloprovincialis. Cons. Int. Explor. Mer, F:1-3.
Comps, M. and Y. Pichot. (1991). Fine spore structure of a haplosporidan parasitizing Crassostrea
gigas: taxonomic implications. Diseases of Aquatic Organisms 11: 73-77.
Elston, R.A., Farley, C.A., and Kent, M.L. (1986). Occurrence and significance of bonamiasis in
European flat oyster Ostrea edulis in North Amerinca. Dis. aquat. Org. 2, 49-54.
Friedman C.S. (1996). Haplosporidian infections of the Pacific oyster, Crassostrea gigas (Thunberg),
in California and Japan. Journal of Shellfish Research 15 : 597-600.
Friedman C.S., Cloney D.F., Manzer D. and Hedrick R.P. (1991). Haplosporidiosis of the Pacific
oyster, Crassostrea gigas. J. Invertebr. Pathol., 58, 367-372.
Friedman, C.S., and Perkins, F.O. (1994). Range extension of Bonamia ostreae to Maine, U.S.A. J.
Invertebr. Pathol. 64, 179-181.
Grizel H., Comps M., Bonami J.R., Cousserans F., Duthoit J.L., and Le Pennec M.A. (1974).
Recherche sur l'agent de la maladie de la glande digestive de Ostrea edulis Linne. Sci.
Pêche. Bull. Inst. Pêches marit. 240:7-29.
Goggin, C.L. (1994). Variation in the two internal transcribed spacers and 5.8S ribosomal RNA from
five isolates of the marine parasite Perkinsus (Protista, Apicomplexa). Molecular and
Biochemical Parasitology 65: 179-182.
Hamaguchi, M., Suzuki, N., Usuki, H. and Ishioka, H. (1998). Perkinsus protozoan infection in short-
necked clam Tapes (=Ruditapes) philippinarum in Japan. Fish Pathology 33, 473-480.
Hine P.M. (1996). Southern hemisphere mollusc diseases and an overview of associated risk
assessment problems. Rev. Sci. Tech. Off. Int. Epiz., 15(2) 563-577.
69
Kern F.G. (1976). Sporulation of Minchinia sp. (Haplosporida, Haplosporidiidae) in the Pacific oyster
Crassostrea gigas (Thunberg) from the Republic of Korea. J. Protozool., 23, 498-500.
Le Roux, F., Audemard, C., Barnaud, A., and Berthe, F. (1999). DNA probes as potential tools for the
detection of Marteilia refringens. Submitted in Mol. Mar. Biol. Biotechnol
Marteil L. (1976). La conchyliculture française. 2. Biologie de l’huître et de la moule. Rev. Trav. Inst.
Pêches marit., 40, 149-345.
Mc Ardle, J.F., McKiernan, F., Foley, H., and Jones D.H. (1991). The current status of Bonamia
disease in Ireland. Aquaculture 93, 273-278.
Mialhe, E., Boulo, V., Elston, R., Hill, B., Hine, M., Montes, J., Van Banning, P., and Grizel, H.
(1988). Serological analysis of Bonamia in Ostrea edulis and Tiostrea lutaria using
polyclonal and monoclonal antibodies. Aquat. Living Resour. 1, 67-69.
Pichot, Y., Comps, M., Tigé, G., Grizel, H., and Rabouin M.A. (1979). Recherche sur Bonamia
ostreae gen. n., sp. n., parasite nouveau de l’huître plate Ostrea edulis L. Revue Trav. Inst.
scient. tech. Pêch. marit. 43, 131-140.
Stokes, N. A., and Burreson, E. M. (1995). A sensitive and specific DNA probe for the oyster
pathogen Haplosporidium nelsoni. J. Euk. Microbiol., 42 (4) : 350-357.
Tigé G., and Rabouin, M.A. (1976). Etude d'un lot de moules transférées dans un centre touché par
l'épizootie affectant l'huitre plate. Cons. Int. Explor. Mer, K:1-10.
Van Banning, P. (1982). The life cycle of the oyster pathogen Bonamia ostreae with a presumtive
phase in the ovarian tissue of the European flat oyster, Ostrea edulis. Aquaculture 84, 189-
192.
Villalba A., Mourelle S. G., López M. C., Carballal M. J., and Azevedo C. (1993). Marteiliasis
effecting cultured mussels Mytilus galloprovincialis of Galicia (NW. Spain). I. Etiology,
phases of the infection, and temporal and spatial variability in prevalence. Dis. aquat. Org.
16:61-72.
70
Molecular diagnostics for the oyster pathogens Haplosporidium
nelsoni (MSX Disease) and Perkinsus marinus (Dermo Disease)
in Chesapeake Bay, Virginia, USA
Eugene M. Burreson
Haplosporidium nelsoni
The protozoan oyster pathogen Haplosporidium nelsoni, commonly called MSX, has been responsible
for periodic, large–scale oyster mortality in estuaries of the middle Atlantic coast of the United States.
The pathogen appeared in Delaware Bay in 1957 and killed 90–95% of all oysters on planted grounds
within three years. It appeared in the lower Chesapeake Bay in 1959 and was responsible for the death
of about 95% of the oysters in that region by 1962 (Haskin and Andrews, 1988). There have been
additional epizootics during periods of extreme drought, especially 1980–81 and 1987–88. The origin
of H. nelsoni is uncertain, but there has been considerable speculation that the parasite was introduced
with exotic oysters (Andrews, 1984). Although the annual distribution and abundance of H. nelsoni
vary with salinity, its general prevalence and intensity have not decreased since the original epizootics
and the parasite has now spread along most of the Atlantic coast of the United States.
The widespread distribution and high virulence of H. nelsoni have greatly reduced traditional on-
bottom culture and have limited the development of off-bottom oyster aquaculture in high salinity
areas. Early diagnosis of H. nelsoni infection is an essential management tool (Ford and Haskin,
1988). Thus, rapid, sensitive diagnostic assays may be critical in avoiding losses to the pathogen.
Paraffin-based histological examination, the most commonly used diagnostic technique for H. nelsoni,
involves finding parasite cells in one or two 5 µm thick sections through an oyster’s visceral mass,
gills and mantle. There is a period of several weeks between the time early-summer H. nelsoni
infections are heavy enough to be detected histologically and when mortality begins. Therefore, the
earlier infections can be detected, the more time is available for oyster growers to decide whether to
harvest to limit mortality, or whether to move oysters to low salinity to eliminate the parasite (Ford,
1985). Infections of H. nelsoni acquired in late summer or fall remain nonlethal until spring; early
detection would also allow harvest to avoid losses from these late season infections.
Perkinsus marinus
Perkinsus marinus has been a significant cause of mortality of the eastern oyster Crassostrea virginica
along the east coast of the United States since the 1950s (Andrews, 1988; Burreson and Ragone Calvo,
1996). The origin of P. marinus is obscure, but it probably has always been an associate of oysters.
Along the east coast prior to the late 1980s, P. marinus was restricted to high salinity portions of
coastal bays and estuaries south of Delaware Bay, although it apparently was absent from the seaside
bays of the eastern shore of Virginia and Maryland (Andrews, 1988). In the Chesapeake Bay, P.
marinus was prevalent in the lower bay, but was restricted to the mouths of the major tributaries in
Virginia and southern Maryland. There were a few localized concentrations of P. marinus in
Maryland, primarily in Fishing Bay and Eastern Bay. The pathogen was observed sporadically in
Delaware Bay in the mid-1950s, as a result of importing infected oysters from Chesapeake Bay, but it
never caused significant mortality in oysters and appeared to die out as importations stopped in the late
1950s (Ford, 1992). North of Delaware Bay the parasite was absent or at least undetectable. In
71
endemic areas P. marinus has always been responsible for some oyster mortality, but it did not
significantly affect harvest most years. The four consecutive drought years in the middle Atlantic
region from 1985 through 1988 caused elevated salinities throughout the Chesapeake Bay and allowed
P. marinus to spread naturally into areas where oysters were abundant and highly susceptible.
Unusually warm winters during the period also contributed to the spread by allowing higher
overwintering survival of the pathogen and movement of infected oysters into areas where P. marinus
was historically absent also contributed to the problem.
Although drought conditions have abated and rainfall patterns have returned to more or less typical
conditions, with wet winters and springs, P. marinus continues to persist tenaciously in most areas of
the Chesapeake Bay. Unlike H. nelsoni, which is very susceptible to salinity below 10 ppt, P. marinus
can survive in oysters even in areas where salinity drops below 3 ppt for periods of weeks. Thus, even
though P. marinus is not causing oyster mortality in many areas, it is present on all beds and if drought
conditions return and salinity becomes favorable for development, it will be able to quickly multiply
and cause mortality.
Investigators generally rely on Ray’s fluid thioglycollate medium (FTM) culture of Perkinsus marinus
cells from oyster tissue (rectum, gill, and mantle) for the diagnosis of infected oysters (Ray, 1952).
An oyster hemolymph FTM assay was developed to allow monitoring of P. marinus infections
without sacrificing the host and to improve quantitation of systemic infections (Gauthier and Fisher,
1990). Using these FTM methods, quantitation relies on accurate counting and the use of a subjective
scale developed by Mackin (1962) and modified by Craig et al. (1989). Diagnosis based on FTM
methods makes several assumptions. It is assumed that all life stages of P. marinus found in the host
are retrieved and that the number of parasites remains constant during incubation in FTM.
Furthermore, it is assumed that the distribution of P. marinus in the assayed tissues is representative of
the distribution of the parasite throughout the oyster. To overcome this latter assumption, a total body
burden assay was developed (Bushek et al., 1994) which employs a procedure using sodium hydroxide
to digest oyster tissues after incubation in FTM (Choi et al., 1989). The body burden assay is
quantitative and allows enumeration of the total number of parasites in whole oyster homogenates.
FTM culture diagnostic methods are relatively simple to perform; however, insensitivity of the assays
often causes very light infections to be overlooked.
Molecular diagnostics
There has been increasing interest in developing DNA probes and/or PCR primers as tools for
detection of disease agents in aquatic animals. These detection methods have been shown to be more
sensitive and specific than previously developed procedures, such as histological examination or
immunoassays. DNA probe/PCR technology is ideal for specifically recognizing target DNA
regardless of the life history stage present, for identifying cryptic life cycle stages in any potential
host organism and for detecting pathogens early in the infection cycle.
The ability to rapidly and accurately detect parasites of oysters has broad implications for both
research and industry. As rapid diagnostic methods become more sensitive, early detection of disease
agents permits the management of oysters or other cultured species in a manner that is more
responsive to patterns of naturally occurring diseases.
However, caution must be exercised in the interpretation of molecular diagnostic results, especially
from the polymerase chain reaction (PCR). The extreme sensitivity of this technique may allow
amplification of DNA from non-viable or non-pathogenic organisms. A PCR-positive result does not
necessarily mean that viable, pathogenic organisms are present or that mortality will eventually occur.
More research and experience is needed to fully understand the meaning of PCR-positive results for
aquaculture or management. Nonetheless, molecular diagnostic techniques hold great promise for
early diagnosis of disease outbreaks in aquaculture and natural populations.
72
Development of molecular diagnostics for Haplosporidium nelsoni
A sensitive and specific DNA probe and PCR primers have been developed for Haplosporidium
nelsoni at the Virginia Institute of Marine Science (Stokes and Burreson, 1995; Stokes et al., 1995).
One difficulty in developing molecular diagnostics for molluscan pathogens in the phylum
Haplosporidia is that in vitro culture of these organisms has not been accomplished. Thus it is very
difficult to obtain purified organisms for DNA extraction. For our work, plasmodia were concentrated
and purified from hemolymph of infected oysters by panning in petri dishes. This technique involves
settling of hemocytes, which adhere to the petri dish, allowing the H. nelsoni plasmodia to be
decanted. Repeated panning results in an enrichment of plasmodia, although not all hemocytes are
excluded. DNA was extracted from the H. nelsoni plasmodia and the small subunit (SSU) rDNA was
amplified from the H. nelsoni genomic DNA using the universal primers for eukaryotic 16S-like
rDNA.
PCR amplification products were cloned into pCRII and INV F' using the TA Cloning system
(Invitrogen) and subclones were cloned into pUC8 and DH5 . Clones with rDNA inserts were
sequenced via the dideoxy chain termination method
using the Sequenase kit; the collections of putative H.
nelsoni sequence data were assembled into a composite
gene sequence using the Gene Jockey software package
(GenBank acession number U19538). The variable
regions of the SSU rDNA sequence were examined for a
section that could be used as a species–specific probe. A
putative H. nelsoni–specific oligonucleotide probe,
designated MSX1347 (5'–
ATGTGTTGGTGACGCTAACCG–3'), was chosen from
sequence alignment with the SSU rDNA of Minchinia
teredinis, C. virginica, Perkinsus marinus and various
protists from GenBank. The probe was synthesized with
the incorporation of digoxigenin at the 5' end. In situ Figure 1. In situ hybridization with
H. nelsoni DNA probe on histological
hybridizations of this H. nelsoni probe react strongly with section of an oyster infected with H.
H. nelsoni plasmodia (Figure 1) and immature spores, but nelsoni.
weakly with mature spores. The probe does not react with
oyster tissue, Perkinsus marinus or any of the other haplosporidians present in the middle Atlantic
region, including Haplosporidium costale, H. louisiana, or Minchinia teredinis.
The variable regions of the H. nelsoni SSU rRNA gene were examined for areas which appeared to be
species specific and would be appropriate for use as PCR primers. Following identification of suitable
priming regions, the putative oligonucleotide sequences were sent as queries to the BLAST electronic
mail server (blast@ncbi.nlm.nih.gov) to determine whether the primers would anneal to non-target
genes. Two oligonucleotides, designated MSX-A (5’-GCATTAGGTTTCAGACC-3’) and MSX-B
(5’-ATGTGTTGGTGACGCTA-ACCG-3’), were selected and commercially synthesized. The
sequence of the MSX-B primer is the same as the H. nelsoni DNA probe MSX1347 described above.
These primers amplify a 564 base pair region of the SSU rRNA gene. Primer sensitivity was tested in
ten-fold serial dilutions from 1 ng to 1 fg of cloned H. nelsoni SSU rDNA. A PCR product was easily
detectable by agarose gel electrophoresis from a single amplification of 100 fg of cloned H. nelsoni
SSU rDNA. Specificity was tested in PCR reactions using genomic DNA from oysters infected and
not infected with H. nelsoni, and cloned SSU rDNA of three haplosporidians, M. teredinis, H. costale
and H. louisiana. The PCR primers amplified H. nelsoni SSU rDNA from genomic DNA of an
infected oyster, but no product was obtained from uninfected oysters or from the other haplosporidians
tested.
73
Validation of PCR diagnosis for Haplosporidium nelsoni
During May 1995, 400 oysters uninfected with H. nelsoni were imported to the lower York River
estuary, Virginia. These oysters were examined monthly through December for H. nelsoni using three
diagnostic techniques—paraffin histology, the routine diagnostic technique (i.e. gold standard), PCR
of oyster hemolymph and PCR of gill and mantle tissue. A sample of 25 oysters was collected each
month. The oyster shells were notched and 0.5 ml of hemolymph was withdrawn from the adductor
muscle sinus with a needle and syringe for DNA extraction. Each oyster was then shucked and a 0.25
g piece of gill and mantle tissue was removed for DNA extraction. The remaining oyster was
preserved in Davidson’s AFA fixative for histological analysis. Results of the analyses are shown in
Figure 2. PCR of hemolymph detected H. nelsoni infections two months earlier (May) than either
PCR of tissue or histology (July). PCR of both hemolymph and tissue always detected a higher
prevalence of infection that histology, although during November and December, when all infections
are typically systemic, there was little difference in prevalence among the three techniques. Overall,
infections were detected in 129 oysters by one of the three methods. Fifty five infections were
detected by one of the two PCR techniques that were negative by histological examination and two
infections were detected by histology that were negative by PCR.
These results demonstrate that PCR diagnosis is much more sensitive than histology and allowed
infections to be detected much earlier in the natural infection cycle (For another interpretation from a
different perspective see the paper by Dan Fegan in this report). This early detection can be very
important for mitigating mortality from the disease. The decline in prevalence during August is the
result of H. nelsoni-induced mortality that typically occurs during late July as infections intensify.
100
90
80
70
Prevalence
60
50
40
30 Tissue PCR
20 Histology
Hemolymph PCR
10
0
May Jun Jul Aug Sep Oct Nov Dec
Month
74
Limitations of precise quantitation using PCR techniques stem from the lack of consistent initial
exponential increase in product during the amplification reaction. Replicate samples can be subjected
to variations in reaction conditions such as inhibitor concentrations, polymerase integrity, and even
thermal cycler block positions. These differences can result in variation in amplification efficiencies
that may obscure differences in the amounts of DNA or RNA that are being measured and thus
preclude accurate quantitation. In competitive PCR, the standard and target DNA are present in the
same reaction tube. The target DNA and internal standard DNA compete for the same DNA
polymerase and deoxynucleotide triphosphates. In addition, the two DNA templates are equally
affected by tube to tube variations in the PCR conditions including inhibitor effects. Furthermore,
competitive PCR overcomes the need to perform quantitation in the exponential phase since both the
standard and the target are equally affected by the changes in amplification parameters that occur as
the reactions enter the plateau phase. Temperature cycling into the plateau phase, therefore, does not
interfere with quantitation and even increases the sensitivity of the assay.
Ultimately, quantitation by competitive PCR involves a set of reactions that include a constant volume
aliquot of unknown DNA concentration and a dilution series of known concentrations of the standard
competitor DNA. At the point where the molar amounts of the two products are equivalent, the
amount of original target DNA present in the sample is equivalent to the amount of standard initially
added. Thus, quantitation of the unknown DNA is based on the attainment of an equivalence point at
a known concentration of standard competitor DNA. Internal competitive standards for quantitative
PCR typically have sequences that are homologous to the target nucleic acids and amplify with the
same or slightly modified primers. The target and the competitor, therefore, amplify with the same
kinetics. Altering the size of the competitor molecule relative to the target sequence has been shown
to be an excellent method for competitor. This method eliminates the need to use restriction enzymes
with variable digestion efficiencies to cut competitor molecules engineered with unique sites. Using
automated sequencers, a one base pair size difference between PCR products can be detected, allowing
extremely similar competitor molecules to be utilized.
Primers were derived from the published P. marinus DNA sequences for the ribosomal RNA gene
(Fong et al., 1993) and the adjacent internal transcribed spacer (ITS-1) region (Goggin, 1994). The
primers, designated PER-18S (5’CCTA-CGGGATTGGTTGTATCAG3’) and PER-ITS
(5’CATCTCGCAACTCTCTAACA-AAAG3’) specifically amplified a 1210 base pair fragment of
DNA from within the SSU rRNA gene to within the ITS-1 of the ribosomal DNA region. The primers
were tested for sensitivity with cloned SSU rDNA derived from pure cultures of P. marinus. As little
as 0.005 fg of P. marinus DNA was detected. They were tested for specificity with DNA from
cultured cells of P. atlanticus, from cultured cells of a variety of P. marinus isolates from along the
east coast of the United States, and from a variety of cultured dinoflagellates. The primers amplified
DNA from all isolates of P. marinus, but not from P. atlanticus or any of the dinoflagellates.
A competitor DNA molecule was constructed using the PCR primers PER-18S and ITS-MUT
(5’CATCTCGCAACTCTCTAACAAAAGagcaagagagagcGAGACCGC-TG3’). The latter (ITS-
MUT) contained the entire sequence of the PER-ITS primer; however, the ITS-MUT primer created a
gap of thirteen nucleotides in the sequence to be amplified by linking to a region of sequence several
bases upstream, within the ITS-1 region. The PER-18S and ITS-MUT PCR product was and cloned.
The QCPCR assay involved a two-phase approach. Titration spanning a broad range of competitor
dilutions was performed to obtain a rough estimate of the amount of DNA and then a second titration
over a narrower range was performed for precise quantitation. A standard curve was prepared by
extracting DNA from a quantified number of cultured P. marinus cells (102 to 106 cells). The standard
curve related the number of cells to the amount of DNA as determined by QCPCR.
75
Validation of PCR diagnostics for Perkinsus marinus
Target DNA was obtained from oysters collected from the lower Chesapeake Bay, Virginia. Oyster
shells were notched and hemolymph samples were withdrawn with needle and syringe.
Approximately 0.6 ml of hemolymph was divided equally for DNA extraction and for hemolymph
Fluid Thioglycollate (FTM) analysis. Oysters were then shucked and 0.25 g of gill/mantle tissue was
removed for DNA extraction and an equal amount for standard FTM analysis. The remaining oyster
tissue was processed for the total body burden FTM analysis (Fisher and Oliver, 1996). Results are
shown in Table 1. For the QCPCR results, any number >0 but <1 was assigned a value of 1 cell.
Ray's FTM tissue assay diagnosed only 19 infections while the body burden whole oyster tissue assay
diagnosed infections in 24 of the 25 oysters. The FTM hemolymph assay detected 22 infections.
QCPCR with both the gill and mantle tissue and the hemolymph DNA detected 24 infections. The
Total Body Burden analysis (the gold standard) detected infections in 24 of the 25 oysters. The FTM
tissue assay, the assay used routinely by most laboratories, detected infections in only 19 of the
oysters, while FTM of oyster hemolymph detected infections in 22 of the oysters. QCPCR of both
tissue and hemolymph detected infections in 24 of the oysters, equal to the Total Body Burden
analysis. Quantitation of QCPCR compared to Total Body Burden or FTM hemolymph analysis was
generally good. Values were generally within one order of magnitude and were often the same order
of magnitude. Considering that infections ranged over 7 orders of magnitude, the results were
generally comparable.
PCR diagnosis was not more sensitive than the total body burden assay for P. marinus, although it was
equally sensitive. This is undoubtedly because the total body burden assay is an analysis of the
number of P. marinus cells in the entire oyster whereas for PCR only a small piece of tissue or a small
aliquot of hemolymph was used for analysis. Thus, very light or localized infections may be missed in
PCR. Therefore it is perhaps surprising that PCR analysis of both tissue and hemolymph were as
sensitive as the body burden assay.
References
Andrews, J.D. (1984). Epizootiology of diseases of oysters (Crassostrea virginica), and parasites of
associated organisms in eastern North America. Helgoländer Meeresuntersuchungen 37,
149-166.
Andrews, J.D. (1988). Epizootiology of the disease caused by the oyster pathogen Perkinsus
marinus and its effects on the oyster industry. American Fisheries Special Publication 18,
47-63.
Burreson, E.M. and Ragone Calvo, L.M. (1996). Epizootiology of Perkinsus marinus disease of
oysters in Chesapeake Bay with emphasis on data since 1985. Journal of Shellfish Research
15, 17-34.
Bushek, D., Ford, S.E. and Allen, S.K. (1994). Evaluation of methods using Ray’s fluid
thioglycollate medium for diagnosis of Perkinsus marinus infection in the eastern oyster,
Crassostrea virginica. Annual Review of Fish Diseases 4, 201-217.
Choi, K.S., Wilson, E.A., Lewis, D.H., Powell, E.N. and Ray, S.M. (1989). The energetic cost of
Perkinsus marinus parasitism in oysters: quantification of the thioglycollate method.
Journal of Shellfish Research 8, 125-131.
Fisher, W.S. and Oliver, L.M. (1996). A whole-oyster procedure for diagnosis of Perkinsus marinus
disease using Ray’s fluid thioglycollate culture medium. Journal of Shellfish Research 15,
109-117.
Fong, D., Rodrigues, R., Koo, K., Sun, J., Sogin, M.L., Bushek, D., Littlewood, D.T.J. and Ford, S.E.
(1993). Small subunit ribosomal RNA gene sequence of the oyster parasite Perkinsus
marinus. Molecular Marine Biology and Biotechnology 2, 346-350.
Ford, S.E. (1985). Effects of salinity on survival of the MSX parasite Haplosporidium nelsoni
(Haskin, Stauber and Mackin) in oysters. Journal of Shellfish Research 5, 85–90.
76
Ford, S.E. (1992). Avoiding the transmission of disease in commercial culture of molluscs, with
special reference to Perkinsus marinus (Dermo) and Haplosporidium nelsoni (MSX).
Journal of Shellfish Research 11, 539-546.
Ford, S.E. and Haskin, H.H. (1988). Management strategies for MSX (Haplosporidium nelsoni)
disease in eastern oysters. In Disease Processes in Marine Bivalve Molluscs. W. S. Fisher
(ed.). American Fisheries Society Special Publication 18, 249–256.
Gauthier, J.D. and Fisher, W.S. (1990). Hemolymph assay for diagnosis of Perkinsus marinus in
oysters Crassostrea virginica. Journal of Shellfish Research 9, 367-372.
Goggin, C.L. (1994). Variation in the two internal transcribed spacers and 5.8 S ribosomal RNA from
five isolates of the marine parasite Perkinsus (Protista, Apicomplexa). Molecular and
Biochemical Parasitology 65, 179-182.
Haskin, H.H. and Andrews, J.D. (1988). Uncertainties and speculations about the life cycle of the
eastern oyster pathogen Haplosporidium nelsoni (MSX). In: Fisher, W. S. (ed.), Disease
Processes in Marine Bivalve Molluscs. American Fisheries Society Special Publication 18,
5–22.
Mackin, J.G. (1962). Oyster disease caused by Dermocystidium marinum and other microorganisms
in Louisiana. Publication of the Institute of Marine Science, University of Texas 7, 132-229.
Marsh, A.G., Gauthier, J.D. and Vasta, G.R. (1995). A semiquantitative PCR assay for assessing
Perkinsus marinus infections in the eastern oyster, Crassostrea virginica. Journal of
Parasitology 81, 577-583.
Ray, S.M. (1952). A culture technique for the diagnosis of infection with Dermocystidium marinum
(Mackin, Owen, and Collier) in oysters. Science 114, 360-361.
Stokes, N.A. and Burreson, E.M. (1995). A sensitive and specific DNA probe for the oyster pathogen
Haplosporidium nelsoni. Journal of Eukaryote Microbiology 42, 350-357.
Stokes, N.A., Siddall, M.E. and Burreson. E.M. (1995). Detection of Haplosporidium nelsoni
(Haplosporidia: Haplosporidiidae) in oysters by PCR amplification. Diseases of Aquatic
Organisms 23, 145-152.
Yarnall, H.A., Reece, K.S., Stokes N.A. and Burreson. E.M. (1999). A quantitative competitive
polymerase chain reaction assay for the oyster pathogen Perkinsus marinus. Journal of
Parasitology (submitted).
77
Table 1. Diagnosis of Perkinsus marinus infection by five different techniques.
* Denotes a positive result by QCPCR but the below the level of quantitation (<0.005 fg).
† The Mackin scale (0-5) is a subjective rank based on the number of P. marinus cells observed with a
microscope over all fields examined; the higher the Mackin rank, the heavier the infection.
78
Rapid detection and identification of fish pathogens
Alexandra Adams
Antibody-based tests
A variety of antibody-based tests and molecular tests have been developed to detect mainly bacterial
and viral fish pathogens, although tests have also recently been reported for parasites and fungal
agents. The antibody-based tests include slide agglutination, co-agglutination/latex agglutination,
immunodiffusion, direct and indirect fluorescent antibody tests (FAT and IFAT),
immunohistochemistry (IHC) and enzyme linked immunosorbent assay (ELISA), dot blot/dip stick
and western blot (WB) (reviewed by Adams, 1999). The antibody-based test selected for the
identification of pathogens depends on a variety of factors since each method has its merits and
disadvantages. Although such methods are useful for the detection of pathogens in pure culture or/and
in infected fish tissue, their sensitivity thresholds limit use in environmental samples, especially where
pathogen levels are extremely low. DNA detection methods, however, such as polymerase chain
reaction (PCR) and in situ hybridisation are ideally suited.
79
the increased sensitivity of DNA-based methods is required. Again, the method selected depends on a
variety of factors.
The PCR tests developed in our laboratory are capable of detecting the presence of specific pathogen
DNA. As long as the test is optimised, standardised and all the appropriate controls are included, the
results can be interpreted and appear to be consistent. The actual meaning of the results with regard
to disease, however, has not been established as the tests have not been fully validated in the field. It
is important to note that both the antibody and DNA-based methods do not necessarily detect live
pathogen. A positive result will also be obtained with non-viable pathogen (Josephson et al., 1993),
or even only parts of a dead pathogen. Thus, validation of the methods in the field to see how a
positive result correlates with infection and disease is vital. Blind trials need to be conducted to
confirm that a negative is always negative in the test, and comparisons conducted with other methods.
80
Some preliminary work has been conducted on the validation of the F. psychrophilum,
Mycobacterium spp. and PKX tests in our laboratory. There are also many reports of the application
of PCR-based techniques to the detection of fish pathogens and these also require validation (Hiney
and Smith, 1998).
References
Adams, A. (1999) Application of antibody probes in the diagnosis and control of fish diseases. Silver
Jubilee Lecture, Mangalore, India (in press).
Adams, A., and Thompson, K. (1990). Development of an ELISA for the detection of Aeromonas
salmonicida in fish tissue. Journal of Aquatic Animal Health 2, 281-288.
Adams, A., Thompson, K.D., McEwan, H., Chen, S.-C. and Richards, R.H. (1996). Development of
monoclonal antibodies to Mycobacterium spp. isolated from Chevron snakehead and
Siamese fighting fish. Journal of Aquatic Animal Health 8, 208-215.
Adams, A., Thompson, K.D., Morris, D, Farias, C. and Chen, S.C. (1995). Development and use of
monoclonal antibody probes for immunohistochemistry, ELISA and IFAT to detect bacterial
and parasitic fish pathogens. Journal of Fish and Shellfish Immunology 5, 537-547.
Alday-Sanz, V., Rodger, H., Turnbull, T., Adams, A. and Richards, R.H. (1994).
Immunohistochemical identification of Pickirickettsia salmonis in Atlantic salmon, Salmo
salar L. Journal of Fish Diseases 17, 189-192.
Aoki, T., Hirono, I. and Hayashi, A. (1995). The fish pathogenic bacterium Pasteurella piscicida
detedted by polymerase chain reaction (PCR). In Diseases in Asian Aquaculture II. Shariff.,
Arthur, J.R., Subasinghe, R.P. (Eds.). Fish Health Section, Asian Fisheries Society, Manila,
pp. 347-353.
Aoki, T., Ikeda, D., Katagari, T. and Hirono, I. (1996). Rapid detection of the fish-pathogenic
bacterium Pasteurella piscicida by polymerase chain reaction targetting nucleotide
sequences of the species-specific plasmid pZP1. Fish Pathology 32, 143-151.
Bakopoulos, V., Adams, A. and Richards, R.H. (1997). The production and characterisation of
monoclonal antibodies against the fish pathogen Pasteurella piscicida. Journal of Fish
Diseases 20, 307-315.
Brauns, L.A. Hudson, M.C. and Oliver, J.D. (1991). Use of the polymersae chain reaction in detection
of culturable and nonculturable Vibrio vulnificus cells. Applied Envionmnetal Microbiology
57, 2651-2655.
Brown, L.L., Iwama, G.K., Evelyn, T.P.T., Nelson, W.S. and Levine, R.P. (1994). Use of
polymersase chain reaction (PCR) to detect DNA from Renibacterium salmoninarum within
individual salmonid eggs. Diseases of Aquatic Organisms 18, 165-171.
Campbell, R., Adams, A., Tatner, M.F., Chair, M. and Sorgeloos, P. (1993). Investigation of antigen
uptake by Artemia during incubation with Vibrio anguillarum vaccine using enzyme linked
immunosorbent assay (ELISA). Journal of Fish and Shellfish Immunology 3, 451-459.
Cascon, A., Anguita, J., Hernandez, C., Sanchez, M., Fernandez, M. and Naharro, G. (1996).
Identification of Aeromonas hydrophila hybridisation group 1 by PCR assays. Applied
Environmental Microbiology 62, 1167-1170.
81
Hiney, M.P. and Smith, P.R. (1998). Validation of polymerase chain reaction-based techniques for
proxy detection of bacterial fish pathogens: framework, problems and possible solutions for
environmental applications. Aquaculture 162, 41-68.
Hiney , M., Dawson, M.T., Heery, D.M., Smith, P.R., Gannon, F., and Powell, R. (1992). DNA
probe for Aeromonas salmonicida. Applied Environmnental Microbiology 58, 1039-1042.
Hirono, I., Masuda, T. and Aoki, T. (1996). Cloning and detection of the hemolysin gene of Vibrio
anguillarum. Microbial Pthogenesis, 20.
Josephson, K.L., Gerba, C.P. and Pepper, I.L. (1993). Polymerase chain reaction detection of non-
viable bacterial pathogens. Applied Environmnetal Microbiology 59, 3513-3515.
Morris, D., Adams, A. and Richards, R.H. (1997). Studies on the PKX myxosporean in rainbow trout
via immunohistochemistry and immunogold microscopy. Journal of Aquatic Animal Health
8, 219-235.
Morris, D., Adams, A. and Richards, R.H. (1998). In situ hybridisation of PKX, the causative
organism of Proliferative Kidney Disease (PKD). Journal of Fish Diseases (in press).
82
DNA-based studies on Aphanomyces invadans, the fungal
pathogen of epizootic ulcerative syndrome (EUS)
1
Institute of Aquaculture, University of Stirling, FK( 4LA, Scotland, UK, and
2
Aquatic Animal Health Research Institute, Bangkok, Thailand.
Background
Epizootic ulcerative syndrome was defined at the DFID Regional Seminar on EUS in Bangkok in 1994
as “a seasonal epizootic condition of freshwater and estuarine warm water fish of complex infectious
aetiology characterised by the presence of invasive Aphanomyces infection and necrotising ulcerative
lesions typically leading to a granulomatous response” (Roberts et al., 1994). Research requirements
identified from the meeting included work to compare and speciate fungal isolates from EUS
outbreaks, develop diagnostic tests, and study the factors that affect transmission of the disease.
Attempts are being made to apply DNA-based techniques to each of these study recommendations, and
these are discussed here.
Molecular data sets are rapidly becoming an essential part of any detailed fungal taxonomic study.
Previous studies on other Aphanomyces and Saprolegnia species have used restriction fragment length
polymorphism (RFLP) analyses to demonstrate inter-specific relationships (Yeh, 1989; Molina et al.,
1995) and random amplification of polymorphic DNA (RAPD) studies have been used to show detailed
intra-specific lineages (Huang et al., 1994; Malvick et al., 1998).
In studies comparing EUS-Aphanomyces isolates with isolates from mycotic granulomatosis (MG) and
red spot disease (RSD) outbreaks, Hart (1997) analysed the ITS1-ITS4 region of the rRNA gene cluster
using 10 enzymes (Alu I, Dde I, Hae III, Hha I, Hinf I, Hpa II, Hsp92 II, Mbo I, Rsa I and Sau96 I); and
sequenced the NS5-NS6 and ITS1-ITS2 regions (Fig. 1). The isolates had all previously been shown to
be slow-growing and pathogenic to snakehead fish when injected intramuscularly (Lilley and Roberts,
1997). These studies found no differences between any of the EUS, MG and RSD isolates.
A variety of saprophytic Aphanomyces, Achlya and Saprolegnia species isolated from the surface of EUS-
affected fish or from infected waters, and Oomycete fungi involved in other diseases of aquatic animals,
were also included in these analyses. These isolates had previously been shown to have very different
temperature-growth profiles from the pathogens, and were incapable of growth within snakehead fish
(Lilley and Roberts, 1997). The rRNA gene studies succeeded in differentiating all of these isolates from
the EUS, MG and RSD pathogens (Hart, 1997). Dendrograms constructed from the RFLP data showed
that the Aphanomyces pathogens clustered most closely to European isolates of the crayfish plague fungus,
Aphanomyces astaci.
83
Lilley et al. (1997) used RAPD-PCR of genomic DNA to investigate possible intra-specific differences
between the isolates. Twenty pathogenic isolates from several localities in Bangladesh, Thailand,
Indonesia, Philippines, Australia and Japan were compared using 14 ten-mer primers (Fig 2). Also
included in the study were 6 Aphanomyces saprophytes, 4 A. astaci isolates, and 2 Aphanomyces
isolates from fish affected by ulcerative mycosis (UM) off the eastern coast of the USA. A total of 321
bands were used for the analysis. The mean similarity (F ± SD) between all the pathogens was
calculated at 0.95 ± 0.03, whereas the other Aphanomyces species had a mean similarity of only 0.14 ±
0.05 compared with the pathogens. These results show that the EUS, MG and RSD pathogens are not
only con-specific (now listed in the Index of Fungi as Aphanomyces invadans), but also genetically
very similar. This indicates that the isolates are not long-term residents in each locality, but have
spread across Asia relatively recently. In comparison, RAPD studies on A. astaci yielded four
distinguishable groups from 15 European isolates indicating that there have been several introductions
of that fungus to Europe over a number of years (Huang et al., 1994).
Figure 1. Structure of the rRNA gene cluster and positions of fungal PCR primers. The cluster is split
into coding (18S, 5.8S and 28S genes) and non-coding (Internally Transcribed Spacer or ITS) regions.
The positions of the PCR primers and their direction of synthesis are indicated by arrows.
5.8S
18S rRNA gene rRNA 28S rRNA gene
gene
NS6 ITS4
ITS regions
Figure 2. Sequence of 14 random 10-mer Operon primers used for RAPD analyses
A3 5’-AGTCAGCCAC
A4 5’-AATCGGGCTG
A6 5’-GGTCCCTGAC
A7 5’-GAAACGGGTG
A10 5’-GTGATCGCAG
A12 5’-TCGGCGATAG
A18 5’-AGGTGACCGT
A19 5’-CAAACGTCGG
A20 5’-GTTGCGATCC
B1 5’-GTTTCGCTCC
B2 5’-TGATCCCTGG
B4 5’-GGACTGGAGT
B5 5’-TGCGCCCTTC
B10 5’-CTGCTGGGAC
Diagnosis of EUS
Ulcerated fish are diagnosed as EUS-positive by histological demonstration of distinctive mycotic
granulomas in underlying tissues. This is a reliable technique that yields a lot of information about the
disease. As a result of the molecular characterisation work described above, a DNA probe for the
specific detection of Aphanomyces invadans has been developed, and this could be used in a PCR-
based diagnosis of EUS. However, the results of such a test would not give any information on the
84
extent of infection, if indeed the fish is infected and not just carrying propagules of the fungus, or
retaining fungal DNA from a past infection. PCR diagnoses also can suffer from problems of
reliability and reproducibility, and in most EUS-affected areas it is a more expensive procedure than
histology. Therefore, instead of PCR, attempts are being made to develop an in situ hybridisation
technique using the probe. It is hoped this will enable histological sections to be further processed for
the specific detection of A. invadans, and would compliment, rather than replace, histological
diagnosis. The development and application of DNA probes for other agents associated with EUS (e.g.
rhabdoviruses) would also provide further information about the involvement of these agents in EUS
outbreaks.
Molecular detection techniques have been used to assay for Oomycete plant pathogens in
environmental samples (Judelson and Messenger-Routh, 1996; Coelho et al., 1997; Liew et al., 1998)
and DNA probes are presently being developed by researchers studying the toxin-producing
dinoflagellate, Pfiesteria (Greer et al., 1997). Ulcerative disease outbreaks in eastern USA have been
associated with an invasive mycosis as well as with Pfiesteria toxins (Blazer et al., 1998). In these
cases, molecular techniques may be useful in detecting the various agents and determining their role in
each outbreak.
A molecular assay technique has recently been devised to test for the presence of A. invadans DNA in
water samples and other substrates. This is based on the PCR amplification of an A. invadans-specific
98 bp sequence, that was identified during the RFLP work described above. The particular problems of
validating a PCR-based proxy detection method were identified by Hiney and Smith (1998) with
regards to bacterial fish pathogens. They devised a study framework that evaluated quantitative,
qualitative and reliability criteria at 4 levels of experimental complexity: (a) in vitro; (b) using a sterile
seeded microcosm; (c) in a non-sterile incurred mesocosm; and (d) in non-sterile field samples. This
approach can be applied to the study of A. invadans propagules in the environment. The planned study
levels for this work are listed below.
a) The in vitro study aims to assess the specificity and sensitivity (DNA low/high detection limits) of
the PCR assay on DNA extracted from cultured fungal mycelium. A range of A. invadans isolates from
different localities is being studied against a strain panel of related species recovered from EUS-
affected areas.
b) Sterile seeded mesocosm. A procedure is being developed to test the DNA extracted from fungal
zoospores suspended in flasks of sterile distilled water. A. invadans spores will be tested among spores
of fungi from the strain panel. Zoospore detection limits will be assessed by making haemocytometer
counts of the zoospores present.
c) Non-sterile incurred mesocosm. Fungal zoospore suspensions will be induced in tanks containing
pond water. Zoospore detection limits cannot be accurately assessed at this level as fungal species
cannot be identified during haemocytometer zoospore counts. It is hoped the tank study can be used to
85
assess the effect of different variables on the persistence of fungal DNA in the water (e.g. water quality,
presence/absence of fish and other potential substrates, different treatment regimes).
d) The study of non-sterile field samples aims to test for A. invadans DNA in affected areas during non-
outbreak periods, and in unaffected areas.
Conclusions
PCR-based techniques have provided valuable information in the study of the fungal pathogen involved
in EUS outbreaks. In particular, research on the characterisation of A. invadans isolates has benefited
from the use of these techniques, and it is envisaged that information on the ecology of the fungus will
also be obtained with the use of PCR. It is hoped that the outputs from these latter studies will enable
risk factors for the disease to be identified, so that recommendations can be made regarding control
methods. It is not envisaged that PCR will be used in the routine diagnosis of EUS, but DNA-based
methods may compliment histological diagnoses by providing A. invadans-specific stains using in situ
hybridisation.
References
Blazer, V., Phillips, S. and Pendleton, E. (1998). Fish health, fungal infections, and Pfiesteria: The
role of the U.S. Geological Survey. [WWW document] U.S. Geological Survey. (Last
updated: Thursday 1 October 1998 08:07:34 MDT).
http://biology.usgs.gov/pr/newsrelease/1998/9-23d.html.
Callinan, R.B., Paclibare, J.O., Bondad-Reantaso, M.G., Chin, J.C. and Gogolewski, R.P. (1995).
Aphanomyces species associated with epizootic ulcerative syndrome (EUS) in the Philippines
and red spot disease (RSD) in Australia: preliminary comparative studies. Diseases of
Aquatic Organisms 21(3), 233-238.
Coelho, A.C., Cravador, A., Bollen, A., Ferraz, J.F.P., Moreira, A.C., Fauconnier, A. and Godfroid, E.
(1997). Highly specific and sensitive non-radioactive molecular identification of
Phytophthora cinnamomi. Mycological Research 101, 1499-1507.
Fraser, G. and Callinan, R. (1996). A technique for enumeration of propagules of the epizootic
ulcerative syndrome fungus in pondwater. World Aquaculture 1996 Book of Abstracts.
Queen Sirikit National Convention Centre, Bangkok, 29 January - 2 February 1996. P.131.
The World Aquaculture Society.
Greer, J., Leffler, M., Belas, R., Kramer, J. and Place, A. (1997). In: Zohar, Y., Belas, R., Vasta, G.,
Place, A., and Kramer, J. (Organizing Committee), Molecular Technologies and Pfiesteria
Research: A Scientific Synthesis. Report of a workshop held at the Center of Marine
Biotechnology, University of Maryland Biotechnology Institute, 28-30 October 1997. A
Maryland Sea Grant Publication, College Park, Maryland. http://www.mdsg.umd.edu/MDSG/
Hart, D. (1997). Development of diagnostic systems for the study of the molecular epidemiology and
taxonomy of the Aphanomyces fungus associated with EUS of tropical and freshwater fishes.
Final Report of DFID Research Project R5902Cb. 1st October 1993 to 31st March 1997.
Hatai, K. and Egusa, S. (1978). Studies on the pathogenic fungus of mycotic granulomatosis - II.
Some of the note on the MG-fungus. Fish Pathology 13, 85-89. (In Japanese, English
abstract).
Hiney, M.P. and Smith, P.R. (1998). Validation of polymerase chain reaction-based techniques for
proxy detection of bacterial fish pathogens: Framework, problems and possible solutions for
environmental applications. Aquaculture 162, 41-68.
Huang, T.-S., Cerenius, L. and Söderhäll, K. (1994). Analysis of genetic diversity in the crayfish
plague fungus, Aphanomyces astaci, by random amplification of polymorphic DNA.
Aquaculture 126, 1-10.
Judelson, H.S. and Messenger-Routh, B. (1996). Quantitation of Phytophthora cinnamomi in avocado
roots using a species-specific DNA probe. Phytopathology 86, 763-768.
86
Liew, E.C.Y., Maclean, D.J. and Irwin, J.A.G. (1998). Specific PCR based detection of Phytophthora
medicaginis using the intergenic spacer region of the ribosomal DNA . Mycological Research
102, 73-80.
Lilley, J. H. (1997). Studies on the comparative biology of Aphanomyces invadans. PhD thesis,
University of Stirling, Scotland. 228 pp.
Lilley, J.H. and Roberts, R.J. (1997). Pathogenicity and culture studies comparing the Aphanomyces
involved in epizootic ulcerative syndrome (EUS) with other similar fungi. Journal of Fish
Diseases 20, 135-144.
Lilley, J.H., Hart, D., Richards, R.H., Roberts, R.J., Cerenius L. and Söderhäll, K. (1997). Pan-Asian
spread of single fungal clone results in large scale fish kills. Veterinary Record 140, 653-654.
Malvick, D.K., Grau, C.R. and Percich, J.A. (1998). Characterization of Aphanomyces euteiches
strains based on pathogenicity tests and random amplified polymorphic DNA analyses.
Mycological Research 102, 465-475.
Molina, F.I., Jong, S.-C. and Ma, G. (1995). Molecular characterization and identification of
Saprolegnia by restriction analysis of genes coding for ribosomal RNA. Antonie van
Leeuwenhoek 68, 65-74.
Roberts, R.J., Campbell, B. and MacRae, I.H. (1994). Proceedings of the Regional Seminar on
Epizootic Ulcerative Syndrome. The Aquatic Animal Health Research Institute, Bangkok,
Thailand, 25-27 January 1994.
Willoughby, L.G. and Lilley, J. (1992). The ecology of aquatic fungi in Thailand, and the fish disease
relationship. The AAHRI Newsletter 1, 5-6. Aquatic Animal Health Research Institute,
Bangkok.
Willoughby, L.G., Roberts, R.J. and Chinabut, S. (1995). Aphanomyces invaderis sp. nov., the fungal
pathogen of freshwater tropical fishes affected by epizootic ulcerative syndrome (EUS).
Journal of Fish Diseases 18, 273-275.
Yeh, Y. (1989). Inter- and intraspecific restriction fragment length polymorphisms in the genus
Aphanomyces. PhD thesis, Texas AandM University.
87
Importance of standardisation and validation of molecular
diagnostic techniques for aquatic animal pathogens and
diseases for international trade and trans-boundary
movement of aquatic animals and animal products
Barry J. Hill
The Sanitary and Phytosanitary (SPS) Agreement under the auspices of the World Trade Organisation
(WTO) states that animal health requirements established by countries importing live animals or their
products should be based on international standards, guidelines and recommendations, primarily those
developed by the OIE. The Agreement states that animal health measures which conform to the
recommendations of OIE will be presumed to be consistent with the SPS Agreement. Thus, OIE
recommendations should, until further notice, provide the basis for all national animal health
regulations with respect to international trade. However, any country may introduce health conditions
for imports of animals which provide a higher level of health protection than would be achieved by
strict application of the relevant OIE standards, on condition that it can provide scientific justification
(usually based upon a full risk assessment). The fundamental principle involved is that health
certification should be a means of facilitating international trade and should not be used to restrict it
by requiring unjustified health conditions.
The OIE standards applicable to international trade in aquatic animals are laid out in the International
Aquatic Animal Health Code and in the Diagnostic Manual for Aquatic Animal Diseases.
Laboratories involved in the diagnosis and/or health certification for aquatic animal diseases are
recommended to be fully conversant with the technical procedures and protocols in the OIE
Diagnostic Manual. The Manual provides a uniform approach to the detection of the diseases and
pathogens listed in the OIE Code and standardised requirements for health certification in connection
with international trade in aquatic animals and their products. The OIE takes the view that the only
dependable current approach to the diagnosis of aquatic animal diseases lies in the specific
identification of the pathogens using laboratory methods. Health certification programmes aim to
determine, from the results provided by standardised laboratory procedures performed with samples
selected according to defined rules, the health status of aquatic animal stocks from a particular
production site or a geographical zone or an entire country. Thus, the Manual provides a general
basis for health surveillance/control programmes, as well as setting out standard diagnostic methods
which can be applied in any competent laboratory involved in diagnosis of aquatic animal diseases.
The International Aquatic Animal Health Code covers a list of diseases notifiable to the OIE, and a
list of other significant diseases in aquatic animals, which are currently:
88
Diseases notifiable to the OIE
Molluscs Mikrocytosis
Bonamiosis Perkinsosis
Haplosporidiosis
Marteiliosis
Bivalve molluscs
Iridovirosis
Therefore, a total of 14 diseases of fish, 6 diseases of molluscs and 6 diseases of crustaceans are listed
by OIE.
In the current version of the Manual (1997 Ed.), the more sophisticated methods involving molecular
biological techniques such as DNA probes and the polymerase chain reaction (PCR) are
recommended for only a few of the diseases. For the others, such techniques have yet to be adapted
for routine diagnostic purposes and remain largely a research tool. Molecular biological tests for
diagnosis of clinical outbreaks or for identification of pathogens isolated during health surveillance
programmes are described for 5 of the fish diseases (epizootic haematopoietic necrosis, bacterial
kidney disease, piscirickettsiosis, Gyrodactylosis and viral encephalopathy and retinopathy), and 2 of
the diseases of crustacea (nuclear polyhedrosis baculoviroses and white spot disease). For none of the
listed diseases is a molecular biology technique recommended for “screening” of the aquatic animal
population to demonstrate it is free of infection (i.e. for health certification purposes).
89
The task of compiling the Manual is assigned to the OIE Fish Diseases Commission (FDC), who will
continually revise and update it as existing laboratory techniques are improved and more rapid,
sensitive and/or specific methods are developed. It is intended to publish a new edition
approximately every 3 years. The aim of the FDC is to include only those test procedures which have
become standardised through widespread use over several years, or those which are so precisely
described and reproducible that they can effectively be carried out to the same standard in any
laboratory with the necessary facilities. For most of the diseases, a choice of test methods is given for
identification of the specific pathogen, but for screening aquatic animal populations to demonstrate
freedom from a particular pathogen, a single prescribed method is given.
The next revision of the Manual is currently underway and a new edition will appear in the year 2000.
Each chapter will be sent to another leading expert on the disease or pathogen in question for an
independent review prior to submission to the FDC for its approval. When the FDC is satisfied with
all the disease chapters, the OIE will submit them to the national delegates (usually the Chief
Veterinary Officer, or equivalent, of each country) of the 152 Member Countries for national expert
opinion on them. The FDC will then take into account the views and suggested amendments arising
from this wide consultation and, if necessary, will refer these to the relevant author of the chapter for
any final revisions to be incorporated. Formal acceptance of all the methods is by the agreement of
the national delegates at their next annual meeting (held at OIE, Paris, in May each year). On
publication some months later, the methods described in the Diagnostic Manual are regarded by the
WTO as the only international standard methods for the purpose of health certification requirements
attached to international trade in aquatic animals and their products.
A noticeable change in the next edition will be the introduction of molecular diagnostic techniques for
several more of the listed diseases, particularly those of molluscs and crustacea. In most cases, the
chapter for each disease has been written by the nominated OIE expert at the designated OIE
Reference Laboratory for that particular disease. The expert has been appointed on the basis of their
recognised high level of expertise for the disease(s) in question. In some cases, the molecular
diagnostic technique described has been developed at the Reference Laboratory itself, but in others
the method has been developed elsewhere and described in the scientific literature. Whatever the
origins of the molecular diagnostic methods, it is important that they have been standardised by the
laboratory which developed them and preferably validated (see below) in comparison with the
existing conventional methods. Ideally, each molecular diagnostic method should have been
previously published in the peer-reviewed scientific literature and should have been subjected to
independent trials in other laboratories such that it has received scientific and international
acceptance.
The next edition of the Diagnostic Manual will also include chapters on the principles of validation of
diagnostic assays for infectious diseases and on good laboratory practice, quality control and quality
assurance, based on those in the OIE Manual of Standards for Diagnostic Tests and Vaccines.
According to the OIE Standards Commission, validation of a new test “is a complex procedure which
includes the development, evaluation and standardisation of the test method; determining the
repeatability; determining diagnostic and relative specificity and sensitivity; determining
reproducibility; and doing the statistical analysis of the results”. Validation is performed after the
test method has been established and includes the establishment of the cut-off values for negative,
positive and suspected-positive samples with diagnostic sensitivity and specificity being the primary
parameters estimated in the test validation. It is important to establish that the sensitivity is at least as
good as other standardised methods already in use and is of sufficient specificity to avoid false
positive results. A validated test should consistently provide results that identify animals as positive
or negative for a particular pathogen or a specific antigen/genomic sequence characteristic of that
pathogen.
90
It is important to use only standardised and, as far as possible, validated test methods for diagnosing
aquatic animal diseases accurately. This is particularly important for health certification of animals
intended for international trade when the importing country has a requirement that animals are free of
particular diseases. This is to ensure that there is a “level playing field” in disease-free certification,
regardless of the country of origin. Clearly, there will not be a level playing field if the same tests
used in different countries have different levels of reliability and give markedly different degrees of
certainty for the absence of specific infections. To facilitate international trade in aquatic animals, it
is imperative that specific disease-free certification of a farm, zone or country provides the same level
of confidence irrespective of the exporting country. For this purpose, molecular diagnostic tests
should be applied only if they have been standardised and validated. In the Asian Region, there is
increasing use of molecular-based tests for screening of shrimp populations for serious viral diseases.
If these tests are to generate meaningful data on disease distribution and, in particular, the absence of
diseases from particular locations, testing standards will need to improve and provide consistent and
comparable results and a common level of certainty.
91
8 Annex I - List of participants
Dr. Alexandra Adams, Mr. Daniel F. Fegan,
Institute of Aqauculture, National Center for Genetic Engineering and
University of Stirling, Biotechnology (BIOTEC),
Stirling FK9 4LA, Scotland Shrimp Biotechnology Programme,
United Kingdom 18th Fl. Gypsum Building,
Phone: (44) 1786 467910 Sri Ayuthya Road, Bangkok
Fax: (44) 1786 472133 Thailand
E-mail aa2@stir.ac.uk Phone: (662) 261 7225
Fax: (662) 261 7225
Dr. Franck C.J. Berthe E-mail: dfegan@usa.net
IFREMER
Laboratoire de Genetique et Pathologie Professor Timothey W. Flegel
BP 133, 17390 La Tremblade Department of Biotechnology
France Faculty of Science, Mahidol University
Phone: (33) 5 46 36 98 36 Rama 6 Road, Bangkok 10400
Fax : (33) 5 46 36 37 51 Thailand
E-mail : fberthe@ifremer.fr Phone: (662) 245 5650
Fax: (662) 246 3026
Dr. Eugene M. Burreson E-mail: sctwf@mahidol.ac.th
Virginia Institute of Marine Science
College of William and Mary Dr. Barry J. Hill
P. 0. Box 1346 CEFAS – Waymouth Laboratory
Gloucester Point, Virginia 23062 Barrack Road, The Nothe
United States of America Waymouth, Dorset DT4 8UB
Phone: (1) 804-684-7108 United Kingdom
Fax: (1) 804-684-7097 Phone: (44-1) 305 20 66 26
E-mail: gene@vims.edu Fax: (44-1) 305 20 66 27
E-mail: b.j.hill@cefas.co.uk
Dr. Pornlerd Chanratchakool
Aquatic Animal Health Research Institute Dr. Mike Hine
Department of Fisheries, National Institute of Water and Atmospheric
Paholyothin Road, Chatujak, Research Ltd.
Bangkok 10900 PO Box 14901, Kilbirnie, Wellington
Thailand New Zealand
Phone: (662) 5796803, 5796977. Phone: 644-386-0300
Fax: (662) 5613993. Fax: 644-386-0574
E mail: pornlerc@fisheries.go.th E-mail: m.hine@niwa.cri.nz
92
Professor Donald V. Lightner Dr Krishen Rana
Department of Veterinary Science and Fisheries Information Data and Statistics Service
Microbiology Fisheries Department, FAO of the UN
University of Arizona Viale delle Terme di Caracalla, 00100 Rome
Tucson, AZ 85721 Italy
United States of America Phone: (39) 06 5705 2259
Phone: (1) 520 621-8414 Fax: (39) 06 5705 2476
Fax: (1) 520 621-4899 E-mail: kausik.rana@fao.org
E-mail: dvl@u.arizona.edu
Dr. Melba B. Reantaso
Dr. James Lilley Network of Aquaculture Centres in Asia-Pacific
Institute of Aquaculture Suraswadi Building, Department of Fisheries
University of Stirling Kasetsart University Campus, Ladyao, Jatujak
Stirling FK9 4LA Bangkok 10900
Scotland Thailand
United Kingdom Phone: (662) 561-1728-9
Phone: (44) 1786 473171 Fax: (662) 561-1727
Fax: (44) 1786 472133 E-mail: melbar@fisheries.go.th
E-mail: jhl1@stir.ac.uk
Professor Mohamed Shariff
Dr. Sharon E. McGladdery Faculty of Veterinary Medicine
Fisheries and Oceans Canada Universiti Putra Malaysia
Gulf Fisheries Centre 43400 Serdang, Selangor
PO Box 5030 (343 Ave. Université Ave.) Malaysia
Moncton, NB E1C 9B6 (E1C 5K4) Phone: (603) 9431064/9488246
Canada Fax: (603) 9488246/9430626
Phone: (1) 506-851-2018 E-mail: shariff@vet.upm.edu.my
Fax: (1) 506-851-2079
E-mail: McgladderyS@mar.dfo-mpo.gc.ca Dr. Rohana P. Subasinghe
Fisheries Department, FAO of the UN
Dr. Gary Nash Viale delle Terme di Caracalla, 00100 Rome
Shrimp Culture Research and Development Italy
Company Limited. Phone: (39) 06 570 56473
18th Floor Gypsum Metropolitan Tower Fax: (39) 06 570 53020
539/2 Sri-Ayudhya Road E-mail: Rohana.Subasinghe@FAO.Org
Rajdhevee, Bangkok 10400
Thailand Dr. Kamonporn Tonguthai
Phone: (662) 2487541-8 ext. 133, 134 Department of Fisheries
Fax: (662) 6425200 Kasetsart University Campus
E-mail: gnash@asiaaccess.net.th Bangkok, Thailand 10900
Phone: (662) 940-6562
Dr Michael Phillips Fax: (662) 562-0571
Network of Aquaculture Centres in Asia-Pacific E-mail: kamonpot@fisheries.go.th
Suraswadi Building, Department of Fisheries
Kasetsart University Campus, Ladyao, Jatujak Dr. Peter Walker:
Bangkok 10900 CSIRO Tropical Agriculture
Thailand PMB3 Indooroopilly, Queensland 4068
Phone: (662) 561 1728 (to 29) Australia
Fax: (662) 561 1727 Phone: (61) 7 3214 2758
E-mail: NACA@mozart.inet.co.th or Fax: (61) 7 3214 2718
michaelp@fisheries.go.th E-mail: walker@dance.tap.csiro.au
93
In efforts to limit transboundary movement of pathogens and reduce the economic
and socioeconomic impact of disease in aquaculture, there is considerable scope for more
effective use of DNA-based methods of pathogen detection. These technologies offer rapid
results with potentially high sensitivity and specificity, at relatively low cost. However, few,
if any, of the available tests have been assessed appropriately against other diagnostic
methods or standardized and validated for specified applications. Implementation
of standardized practices that produce reliable, useful and comparable data will require
a significant investment in research, training and infrastructure development. This review
recommends the development of programmes of managed cooperative research to assist
more effective use of DNA-based detection tests, focusing on improving the knowledge
base by identification of new and emerging pathogens, relating pathogens in the Asia
region to those described elsewhere, and defining the extent of genetic variation between
related pathogens. The review also recommends the development of a laboratory
accreditation programme in order to achieve standardization of sampling methods and test
procedures complementary to the activities of the International Office of Epizootics (OIE)
in obtaining internationally agreed test standards for molecular diagnostic technologies.