Theranostics 2020, Vol.

10, Issue 16 7150

Ivyspring
International Publisher
Theranostics
2020; 10(16): 7150-7162. doi: 10.7150/thno.47649
Review

Primer design for quantitative real-time PCR for the

emerging Coronavirus SARS-CoV-2
Dandan Li#1,2, Jiawei Zhang#1,2, Jinming Li1,2,3
1. National Center for Clinical Laboratories, Beijing Hospital, National Center of Gerontology; Institute of Geriatric Medicine, Chinese Academy of Medical
Sciences, Beijing, People’s Republic of China.
2. Graduate School, Peking Union Medical College, Chinese Academy of Medical Sciences, Beijing 100730, People’s Republic of China.
3. Beijing Engineering Research Center of Laboratory Medicine, Beijing, People’s Republic of China.

#These authors contributed equally to this manuscript.

 Corresponding author: Jinming Li, National Center for Clinical Laboratories, No.1 Dahua Road, Dongdan, Beijing 100730, People’s Republic of China. Phone:
86 10 58115053; Fax: 86 10 65212064; E-mail: jmli@nccl.org.cn.

© The author(s). This is an open access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/).
See http://ivyspring.com/terms for full terms and conditions.

Received: 2020.05.01; Accepted: 2020.05.20; Published: 2020.06.01

Abstract
In December 2019, a new coronavirus disease (COVID-19) outbreak occurred in Wuhan, China. Severe
acute respiratory syndrome-coronavirus-2 (SARS-CoV-2), which is the seventh coronavirus known to
infect humans, is highly contagious and has rapidly expanded worldwide since its discovery. Quantitative
nucleic acid testing has become the gold standard for diagnosis and guiding clinical decisions regarding the
use of antiviral therapy. However, the RT-qPCR assays targeting SARS-CoV-2 have a number of
challenges, especially in terms of primer design. Primers are the pivotal components of a RT-qPCR assay.
Once virus mutation and recombination occur, it is difficult to effectively diagnose viral infection by
existing RT-qPCR primers. Some primers and probes have also been made available on the WHO
website for reference. However, no previous review has systematically compared the previously
reported primers and probes and described how to design new primers in the event of a new coronavirus
infection. This review focuses on how primers and probes can be designed methodically and rationally,
and how the sensitivity and specificity of the detection process can be improved. This brief review will be
useful for the accurate diagnosis and timely treatment of the new coronavirus pneumonia.
Key words: coronavirus; SARS-CoV-2; quantitative nucleic acid testing; primer design; sensitivity

Introduction
In December 2019, outbreak of a new genome is arranged in the order of a 5′ untranslated
coronavirus disease (COVID-19), defined by the region (UTR)-replicase complex (open reading frame
International Committee on Taxonomy of Viruses, [ORF] 1ab)-structural protein [Spike(S)-Envelope(E)-
occurred in Wuhan, China. This virus has since been Membrane (M)-Nucleocapsid (N)]−3′UTR and non-
named severe acute respiratory syndrome- structural ORFs [4]. The S-protein has a strong
coronavirus-2 (SARS-CoV-2) [1]. SARS-CoV-2 is binding affinity to human ACE2 [5], and this, along
highly contagious and has rapidly expanded with a long incubation time before manifesting
worldwide since its discovery. As of 12 May, 2020, a symptoms, means that SARS-CoV-2 has high
total of 4,088,848 cases of SARS-CoV-2 infection have transmissibility with a mortality rate of
been confirmed worldwide with 283,153 deaths [2], approximately 3% [6,7]. This also poses considerable
although this may be underestimated due to challenges regarding the timely treatment and
inadequate testing in many countries [3]. effective prevention and control of COVID-19. To
SARS-CoV-2 is an enveloped, positive-sense, better understand the origin of SARS-CoV-2 and its
single-stranded RNA virus. It possesses a genetic relationship with other coronaviruses,
comparatively large genome approaching 30 kb. The phylogenetic analyses of coronavirus sequences from

http://www.thno.org
Theranostics 2020, Vol. 10, Issue 16 7151

various sources can be performed using the decisions regarding the use of antiviral therapy
neighbour-joining method in MEGA X [8]. ORF 1ab, [20-22]. The most recently developed nucleic acid
E, and N genes are highly conserved among testing method is quantitative real-time PCR
sarbecoviruses, which are a subgenus of (RT-qPCR) [23,24], although RT-qPCR assay design
betacoronavirus. The RNA-dependent RNA optimization can be a complicated process. In
polymerase (RdRp; nsp12) positioned on ORF 1ab addition to being rapid, the RT-qPCR assay has the
plays a crucial role in RNA synthesis [9,10] with advantage of a standardized protocol that can be
features of rapid mutation and recombination [11]. As easily adapted for the detection of other respiratory
a result, the conserved regions (ORF 1ab, E, and N viruses. RT-qPCR can be performed under uniform
genes) are usually selected as the standard target amplification conditions; thus, target-specific primer
genes for primer and probe design [12]. and probe sets can be utilized [25]. Moreover, testing
SARS-CoV-2 has been identified as the seventh can also be performed using a high-throughput
coronavirus known to infect humans [13]. The system [26].
previous six coronaviruses were: Human coronavirus However, there are a number of problems
(HCoV)-229E, HCoV-NL63, HCoV-HKU1, HCoV- related to the RT-qPCR assays targeting SARS-CoV-2.
OC43, Middle East respiratory syndrome coronavirus First, the sensitivity of this method is not high in
(MERS-CoV), and severe acute respiratory syndrome clinical application, and studies have reported cases of
coronavirus (SARS-CoV). HCoV-229E and HCoV- positive CT scan results and negative RT-qPCR results
NL63 are human alphacoronaviruses, whereas HCoV- at initial presentation [27]. Some researchers and
HKU1, HCoV-OC43, MERS-CoV, and SARS-CoV are clinicians have argued that CT imaging should be
human betacoronaviruses. SARS-CoV-2 is a novel used to identify SARS-CoV-2 infection, evaluate
betacoronavirus, and is genetically similar to the treatment response and prognosis of COVID-19 [28,
SARS-like bat coronaviruses in the subgenus 29], but a number of cases have shown progressive
Sarbecovirus [14]. A complete genomic comparison multiple peripheral ground-glass opacities in both
showed that the new coronavirus has the highest lungs despite negative RT-qPCR results [30].
homology with Bat SL-CoVZC45 and Bat Furthermore, an accurate detection of SARS-CoV-2
SL-CoVZXC21 coronaviruses, but differs from the virus can be made from oropharyngeal,
currently known SARS with a similarity of just 79.7% nasopharyngeal swabs and/or lower respiratory tract
[15]. Although substantial genetic differences exist samples (sputum or tracheal aspirates) [31]; thus,
between the novel coronavirus and other sampling could also be one of the reasons for low
betacoronaviruses, cross-reactions in RT-qPCR or sensitivity. The primers, probes, and reagents used for
antibody assays for SARS or other betacoronaviruses detection could be another critical factor. Finally,
are possible if the primers and antigenic epitopes are RT-qPCR primers are designed to amplify the target
not carefully selected [16]. Therefore, it is necessary to regions of the SARS-CoV-2 genome. However, the
design specific primers and probes in the regions with novel coronaviruses are RNA viruses, and once
the lowest feasible similarity to other viruses to avoid mutations and recombination occur, RT-qPCR
false detection of SARS-CoV [17]. primers will not be able to effectively amplify the viral
The timely and accurate laboratory testing of sequences. Thus, mutations and recombination can
samples from cases under investigation are essential reduce the sensitivity of the RT-qPCR.
parts of the management of emerging infections. Primers are pivotal components of a qPCR assay.
Molecular techniques have been used successfully to Some primers and probes have also been made
identify infectious diseases for many years. As can be available on the WHO website for reference.
observed from the identification path of SARS-CoV-2 However, no previous review has systematically
[18,19], high-throughput sequencing is a powerful described how to design primers and probes
tool for the discovery of pathogens, changing the way methodically and rationally in the face of a new
we respond to infectious disease outbreaks, coronavirus. Therefore, the focus of the present
improving our understanding of disease occurrence, review is to discuss effective primer designing and
accelerating the identification of pathogens, and improving the sensitivity and specificity of the
promoting data sharing [12,13]. However, the analysis detection process. This review also discusses the need
method is labour-intensive and time-consuming and, for accurate diagnosis and timely treatment of the
thus, cannot be widely used as a detection method or new coronavirus pneumonia.
screening tool.
As sequence information about SARS-CoV-2 has Several typical studies regarding the
recently become available, quantitative nucleic acid detection process of SARS-CoV-2
testing has become the gold standard for clinical At present, gene sequences of the six known

http://www.thno.org
Theranostics 2020, Vol. 10, Issue 16 7152

coronaviruses (HCoV-229E, HCoV-NL63, HCoV- gisaid.org/) from 12 Jan 2020 [32]. Subsequently, a
HKU1, HCoV-OC43, MERS-CoV, and SARS-CoV) number of other SARS-CoV-2 sequences were
have been published, and primers and probes can be released; these sequences were found to be almost
designed based on the available genomic information. identical [17].
When an unknown coronavirus suddenly emerges
and causes a new type of infectious pneumonia, how Table 1. Detailed information of the reference sequence
should we respond? In such a scenario, designing MN908947
effective primers with high specificity and sensitivity
ORF Function Location (nt) Length (bp)
can have immense value for diagnosis, tracking, and 5’ UTR 1-265 265
tracing. The design of SARS-CoV-2 primers and 1ab 266-21,555 21,290
1a Encoded nonstructural proteins (nsp1 to -- --
probes and the step-by-step analysis process to nsp11), essential for viral replication, viral
accurately detect the virus are shown in Figure 1. assembly, immune response modulation,
etc.
Zhang et al. were the first to determine the 1b Encoded nonstructural proteins (nsp12 to -- --
full-length genomic sequence of the SARS-CoV-2 nsp16), essential for viral replication
virus [18]. On 26 Dec, 2019, six days after the onset of S Binding to cell receptor and mediating 21,563-25,384 3,822
virus-cell fusion
disease, a 41-year-old man with fever, unproductive 3a Accessory protein 25,393-26,220 828
cough, pain, and weakness was admitted to the 3b Accessory protein 25,765-26,220 456
E Envelope protein, virus assembly, and 26,245-26,472 228
Central Hospital of Wuhan. Bronchoalveolar lavage morphogenesis
fluid (BALF) was collected to perform deep meta- M Membrane protein, virus assembly 26,523-27,191 669
transcriptomic sequencing. Primers used for RT-qPCR 6 Accessory protein 27,202-27,387 186
7a Accessory protein 27,394-27,759 366
were designed based on the whole genome of 7b Accessory protein 27,756-27,887 132
WH-Human 1 coronavirus (MN908947). The detailed 8 Accessory protein 27,894-28,259 366
reference sequences of the viral RNA (GenBank N Nucleocapsid protein, forms complexes
with genomic RNA, interaction with M
28,274-29,533 1,260

MN908947) are shown in Table 1. The genome protein for viral assembly
sequence of the causative novel coronavirus was 10 Accessory protein 29,558-29,674 117
3’ UTR 29,675-29,903 229
shared through the Global Initiative on Sharing All
Influenza Data (GISAID) platform (http://www.

Figure 1. The analysis process of primer and probe design for SARS-CoV-2 in chronological order. BALF: bronchoalveolar lavage fluid; GISAID: Global Initiative on Sharing All
Influenza Data.

http://www.thno.org
Theranostics 2020, Vol. 10, Issue 16 7153

On 1 Jan 2020, Corman et al. used the close median number of four intra-individual viral variants,
correlation between the SARS-CoV-2 and SARS which is suggestive of the rapid evolution of SARS-
coronavirus genomes to artificially synthesize the CoV-2 [37]. With the increasing number of cases,
2019-nCoV sequence and establish an experimental results from genome sequencing will also increase.
detection process in the absence of virus isolates [33]. Genome sequences of multiple coronaviruses can be
On 10 Jan 2020, Chan et al reported that two patients compared to determine the reference sequence. For
with fever, respiratory symptoms, and pulmonary primer and probe design, it is more reliable and
infiltrates on chest radiographs were enrolled at the scientifically sound to select conserved regions
University of Hong Kong–Shenzhen Hospital. instead of mutation sites.
Subsequently, between 11 to 15 Jan 2020, five other
members of the patients’ family also presented to the Reference sequence and degenerate
hospital for clinical assessment [19]. The first set of primers of SARS-CoV-2
primers targeted 344 bp of the RdRp gene of all Assays are useful only if the correct target has
SARS-related coronaviruses. Next, these positive been identified and used in the assay design.
clinical samples were analysed by Nanopore Therefore, it is necessary to know as much
sequencing, and a second set of primers were information as possible related to the RNA genome
designed from the SARS-CoV-2 genome sequence and sequences. The first step involves obtaining the
targeted a 158 bp region of the Spike (S) gene of this maximum amount of information from sequence
novel coronavirus [19]. Moreover, Won et al. designed databases; it is crucial to refer to the accession or
primers based on the sequence of the first patient individual transcript number of related sequences for
infected with SARS-CoV-2 in Korea [34,35]. On 22 Jan assay design.
2020, the downloaded sequence and those for SARS
coronavirus, bat SARS-like coronaviruses, and other Necessity for the design of a reference
representative coronaviruses among the first publicly sequence
available sequences in GenBank (Accession number: To design a PCR primer set, a reference sequence
MN908947) were edited and aligned. Two sequence is needed to identify the exact sequence being
regions (ORF1b and N) that are highly conserved targeted and from where to select the primer pair
among sarbecoviruses were selected for primer and candidates. Ideally, the reference sequence consists of
probe design in the study by Chu et al. [14]. On 14 Feb not only the regions targeted for amplification, but
2020, 95 full-length genomic sequences of SARS- also all the nucleotide sequences that will be involved
CoV-2 strains from the NCBI and GISAID databases in the amplification process. This is essential to ensure
were retrieved, and a reference sequence was that the designed primers do not amplify non-specific
established. Researchers found that the overall products [38].
variation in the ORF regions was low; 13 variation
sites in the 1a, 1b, S, 3a, M, 8, and N regions were Establishing the reference sequence
identified, among which positions nt28144 in ORF 8 When a new coronavirus is identified, the
and nt8782 in ORF 1a showed mutation rates of genome sequence of the virus can first be obtained
30.53% (29/95) and 29.47% (28/95), respectively [36]. through standard high-throughput sequencing of
There may be selective mutations in SARS-CoV-2, and patient samples, which can be used as a reference
it is necessary to avoid certain regions when sequence. When the coronavirus spreads further, the
designing primers and probes. sequencing results of different coronavirus strains can
Generally, in the face of unknown pathogenic be uploaded to the GISAID (https://www.gisaid.org)
and highly infectious coronaviruses, the first step and NCBI (https://www.ncbi.nlm.nih.gov/)
involves extracting RNA from patient samples and databases. Primer 7.0 can be used to compare the
sequencing the whole genome. However, the whole reference nucleotide sequence with those of related
genome sequencing operation is difficult and costly, human isolates and to analyse the variation at
and it is impossible to use this method for all patients different locations. In addition, the ClustalW program
with suspected infection. Genome sequencing can be of MEGA (7.0.14) and Mafft (7.450) software can be
used as a detection method in a few samples, and the used to conduct homology analyses and multiple
results can be used as a reference sequence to design sequence alignments. These sequences can be
primers and probes targeting the target gene, so that retrieved from experimental data or online databases.
RT-qPCR detection can be achieved. However, RNA In conclusion, the reference sequence is determined
viruses are susceptible to mutations. Shen et al. by selecting the highest frequency nucleotide at each
recently identified a remarkable level of viral position.
diversity in some infected patients, accounting for a

http://www.thno.org
Theranostics 2020, Vol. 10, Issue 16 7154

Necessity for designing degenerate primers Comparison of the target genes: E gene, ORF
Usually, degenerate primers are designed in two 1ab, and N gene
different instances. The first is when the target A conserved region in the structural protein
sequence is unknown or presents variability. In such a envelope E gene is usually selected for the E gene
case, the target sequence can be inferred through the assay, which normally functions as the first line
amino acid sequence. Degenerate primers can screening assay. The E genes of the reference
overcome the uncertainty of the target sequence due (MN908947) and SARS (NC_004718) sequences were
to the redundancy of the genetic code [39]. The second aligned using nucleotide BLAST (https://blast.ncbi.
is when degenerate primers are used to amplify nlm.nih.gov/). The results are shown in Figure 2. The
targeted sequences across multiple genotypes by E gene primer/probe set described by Corman et al.
allowing variant primers to simultaneously amplify was found to be more sensitive than those of the N
multiple sequences. Previous studies have detected gene and RdRp [47]. The position of the primer
five different SARS-CoV-2 haplotypes, and the results targeting the E gene is shown in Figure 2 and
indicated active genetic recombination [40]. The indicated with pink text. From the alignment of the E
mutation regions may reduce the accuracy of gene between the SARS-CoV-2 reference sequence
RT-qPCR detection [41]. Thus, designing degenerate (MN908947) and SARS-CoV (NC_004718), there was
primers and/or probes is an effective method for 94% homology and the mismatch positions are
addressing the challenge of virus mutations. marked in red in Figure 2. Corman et al. selected the
forward and reverse primers in the complete match
Designing degenerate primers position so that both SARS-CoV-2 and SARS-CoV
Primers can be designed as regular or could be detected. It is believed that SARS has been
degenerate. Degenerate primer design requires a set eliminated in humans and the last reported human
of reference sequences. When regular primers are SARS case was detected in 2004 [48,49]. Samples with
synthesised, only two populations of primers are positive SARS-CoV results were considered to be
present in the PCR reaction: the forward and reverse infected by SARS-CoV-2 or its related animal
primer populations. When degenerate primers are coronaviruses. Selecting the common sequence of
synthesized, there may be multiple forward and bat-associated SARS-related viruses is essential to
reverse primers. A good principle for designing ensure broad sensitivity even in the case of multiple
highly efficient degenerate primers is to establish a independent acquisitions of variant viruses.
limit of degeneracy of up to 64 (the number of Therefore, this pancoronavirus assay is a useful tool
different sequences within the mixture primer). It is for screening sample collections for the presence of all
recommended that the degenerate primers contain known and potentially unknown coronaviruses.
R(A/G), Y(C/T), S(C/G), W(A/T), K(G/T), and When designing the specific primer/probe targeting
M(A/C), which have two variants at each position, the E gene, the mismatch position should be
instead of B(C/G/T), D(A/G/T), H(A/C/T), considered (Figure 2).
V(A/C/G), and N(G/A/T/C), which have more than Compared with the E gene length in
two variants at each position [39]. SARS-CoV-2, the gene lengths of ORF 1ab and N are
longer, and more variation points are present.
Analysis of previously reported primers Therefore, regions in the ORF 1ab and N genes are
and probes usually selected for the target-specific forward and
Many institutions have studied primer-probe reverse primers designed for confirmatory testing.
sets for the confirmation of SARS-CoV-2. The Research has shown that SARS-CoV-2 is distinct from
molecular diagnosis of COVID-19 is currently carried SARS-CoV in the phylogeny of the complete RdRp
out by one-step RT-qPCR targeting SARS-CoV-2. gene [17]. As shown in Table 2, tests for the RdRp
Primers and probes have been developed by gene in Germany and ORF1b-nsp14 gene in Hong
researchers at China CDC (China), Charité– Kong used degenerate probes and primers. There are
Universitätsmedizin Berlin Institute of Virology two main reasons for this detection approach. First,
(Germany), The University of Hong Kong (Hong the genetic diversity of 2019-nCoV in humans and
Kong), the National Institute of Health (Thailand), animals is yet to be fully determined. Second, many
and the Centers for Disease Control and Prevention laboratories lack positive controls for SARS-CoV-2.
(CDC, USA) (https://www.who.int/emergencies/ The serially diluted RNA samples extracted from
diseases/novel-coronavirus-2019/technical-guidance SARS-CoV-infected cells usually work as the positive
/laboratory-guidance). The primers and probes control (obtained via the European virus archive
reported for the SARS-CoV-2 RT-qPCR assays are global (EVAg), https://www.european-virus-archive.
shown in Table 2. com) [50]. SARS-CoV-2 isolation is not recommended

http://www.thno.org
Theranostics 2020, Vol. 10, Issue 16 7155

as a routine diagnostic procedure. In vitro transcribed SARS-CoV-2 [52]. Other researchers found that the E
RNA of the target gene of SARS-CoV-2 can be cloned gene primer/probe set described by Corman et al. and
into a plasmid as the RNA standard. On one hand, the the N2 set developed by the CDC were the most
degenerate probes and primers can detect the positive sensitive assays after evaluating seven different
control (SARS-CoV), and on the other hand, they can primer/probe sets (RdRp, E, and N genes in the study
detect SARS-CoV-2. For example, Corman et al. by Corman et al. and N1, N2, and N3 by CDC and
formulated a broad-range probe reacting with SARS- RdRp developed by the University of Washington
CoV and SARS-CoV-2, an additional specific probe Clinical Virology Lab) [47].
that reacts only with SARS-CoV-2. In their study,
RdRp and E genes are more sensitive than N genes, Improving the sensitivity of the RT-qPCR assay
and the RdRp gene assay is recommended as a From the perspective of primers, there are three
confirmatory assay. However, Chu et al. found that main ways to improve the sensitivity of RT-qPCR:
the N gene assay was approximately 10 times more primer concentrations, degenerate primers, and
sensitive than the ORF-1b gene assay in detecting multi-target detection. First, primer concentrations for
positive clinical specimens from two patients via probe-based assays were 300-900 nM [53]. The primer
RT-qPCR [14]; based on their detection performance, concentrations of all tests (Table 2) were within this
the N gene RT-qPCR is recommended as a screening range (data not shown), and increasing the
assay, and the ORF1b-nsp14 assay is recommended as concentration of primers appropriately may improve
a confirmatory assay. Further experimental studies the sensitivity of RT-qPCR. For example, Vijgen et al.
are required to evaluate the sensitivity of the found that primer concentrations increased up to 400
primer/probe set shown in Table 2. For one target nm per reaction can improve the sensitivity of the
gene, there may exist many regions for which the assay [54]. Second, degenerate primers are used to
primer/probe is designed. We believe that it is more cope with the genetic diversity of SARS-CoV-2.
reasonable to compare the primer/probe sensitivity Finally, regarding multi-target detection, screening
for the same target gene among different test regions. assays with a single target region are more vulnerable
However, if the regions of multiple target genes are to sequence variations than dual- or triple-target
different in each study, the comparability among assays [55,56]. Overall, the E gene assay was used for
different studies is lost. Alternatively, the primer/ pan-sarbecovirus detection, and the RdRp assay and
probe sets from different studies can be evaluated the N gene assay may eventually be utilised as
under the same experimental conditions with the confirmatory assays.
same test samples. In addition to sensitivity, specificity is an
The USA CDC designed N1, N2, and N3 genes important indicator when considering primers and
(shown in Table 2) as the target of the SARS-CoV-2 probes. Whether there is cross-reactivity is an
Real-Time RT-PCR Diagnostic Panel. In the SARS- important aspect of evaluating specificity. The
CoV-2 RT-PCR assay, N1 and N2 were designed for proportion of co-infections has been underestimated
the specific detection of SARS-CoV-2, whereas N3 due to either a lack of sensitivity or the limitations of
was designed for the universal detection of SARS-like virus detection technologies [57]. As co-infections can
coronaviruses [51]. Experiments found that the CDC occur, all patients that meet the suspected case
N1 and N2 primer/probe sets performed better than definition should be tested for COVID-19 regardless
the N3 set, and the N3 primer and probe set was of whether another respiratory pathogen is found.
removed from the Diagnostic Panel of revision 2 for However, all tests shown in Table 2 indicate no
the CDC 2019-nCoV Real-Time RT-PCR Diagnostic cross-reactivity with HCoV-229E, HCoV-NL63,
Panel. HCoV-HKU1, HCoV-OC43, MERS-CoV, and other
Researchers in Korea performed experiments to respiratory viruses, indicating that the specificity of
compare the previously reported primer-probe sets the primers and probes listed in Table 2 is high.
from the WHO for molecular diagnosis. Their results
revealed that in the case of targeting the RdRp/ORF1 General principles of primer/probe
region, the ORF 1ab (China) set might be more design strategy
sensitive than others. 2019-nCoV_N2 (USA) and A successful PCR reaction depends on a number
NIID_2019-nCOV_N (Japan) sets may be of factors, most of which are related to the primer
recommended for the sensitive RT-qPCR assay of the design quality. The primer length should be between
N region. Therefore, an appropriate combination of 16 and 28 nucleotides, as shown in Table 2. Primer
the ORF 1ab (China), 2019-nCoV_N2 (USA), and melting temperatures (Tm) should be between 50°C
NIID_2019-nCOV_N (Japan) sets should be selected and 62°C, depending on the GC content. The GC
for sensitive and reliable laboratory confirmation of content of the primer is preferably 45-55%. Moreover,

http://www.thno.org
Theranostics 2020, Vol. 10, Issue 16 7156

the GC content and Tm value of the upstream and polymorphisms in the SARS-CoV-2 genomes, there
downstream primers should be kept close. The Tm may be mismatches in primers or probes that cause
difference between the two primers should be lower false-negative conditions [59]. The significance of the
than 5°C [58], and the annealing temperature should regular examination of primers and probes has been
be 5°C lower than that for the primer with the lowest emphasized [60]. False negative results can be
Tm. Because the target sequence of the primers is reduced by designing primers and probes with
variable for degenerate primers, a good approach is to melting temperatures >60°C and run conditions of the
set annealing temperatures between 50°C and 55°C, assay with annealing temperatures at 55°C to tolerate
although specific primers could be used to estimate one to two mismatches when amplifying a
the PCR conditions more accurately. For the coronavirus gene with higher variability.

Table 2. Information regarding the primers and probes reported for SARS-CoV-2 real-time reverse-transcription PCR assays
Target genes Country Name Sequence (5’ → 3’) Reference sequence Nucleotide position Reference
RdRp China Forward primer: CAAGTGGGGTAAGGCTAGACTTT -- 14961-14983 [19]
Reverse primer: ACTTAGGATAATCCCAACCCAT 15283-15304
RdRp /nCoV Paris Forward primer: ATGAGCTTAGTCCTGTTG SARS-CoV, NC_004718 12621-12727 [42]
IP2 Reverse primer: CTCCCTTTGTTGTGTTGT
Probe Hex-AGATGTCTTGTGCTGCCGGTA-BHQ-1
RdRp/nCoV Paris Forward primer: GGTAACTGGTATGATTTCG SARS-CoV, NC_004718 14010-14116 [42]
IP4 Reverse primer: CTGGTCAAGGTTAATATAGG
Probe FAM-TCATACAAACCACGCCAGG-BHQ-1
RdRp gene Germany Forward primer; GTGARATGGTCATGTGTGGCGG MN908947 15431-15452 [33]
Probe 2; FAM-CAGGTGGAACCTCATCAGGAGATGC-BBQ 15470-15494
Probe 1; FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ 15469-15494
Reverse primer CARATGTTAAASACACTATTAGCATA 15505-15530
(W=A/T; R=A/G; M=A/C; S=G/C)
ORF1a China Forward primer: AGAAGATTGGTTAGATGATGATAGT Alignment of -- [17]
Reverse primer: TTCCATCTCTAATTGAGGTTGAACC sequenced virus
Probe FAM-TCCTCACTGCCGTCTTGTTGACCA-BHQ1 genomes
ORF 1ab China Forward primer: TGATGATACTCTCTGACGATGCTGT MN908947 15704-15728 [18]
Reverse primer: CTCAGTCCAACATTTTGCTTCAGA 15823-15846
Probe ROX-ATGCATCTCAAGGTCTAGTG-MGB 15749-15768
ORF 1ab China Forward primer: CCCTGTGGGTTTTACACTTAA MN908947 13342-13362 [43]
Reverse primer: ACGATTGTGCATCAGCTGA 13442-13460
Probe FAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ 13377-13404
ORF1b-nsp14 Hong Forward primer: TGGGGYTTTACRGGTAACCT MN908947 18778-18797 [14]
Kong Reverse primer: AACRCGCTTAACAAAGCACTC 18889-18909
Probe FAM/ZEN-TAGTTGTGATGCWATCATGACTAG-IBFQ 18849-18872
(W=A/T; Y=C/T; R=A/G)
N gene China Forward primer: GGGGAACTTCTCCTGCTAGAAT MN908947 28881-28902 [43]
Reverse primer: CAGACATTTTGCTCTCAAGCTG 28958-28979
Probe FAM-TTGCTGCTGCTTGACAGATT-TAMRA 28934-28953
N gene Hong Forward primer, TAATCAGACAAGGAACTGATTA MN908947 29145-29166 [14]
Kong Reverse primer, CGAAGGTGTGACTTCCATG 29236-29254
Probe FAM/ZEN-GCAAATTGTGCAATTTGCGG-IBFQ 29179-29198
N1 gene USA Forward primer: GAC CCC AAA ATCAGCGAA AT MN908947 28287-28306 [44]
Reverse primer: TCTGGTTACTGCCAGTTGAATCTG 28335-28358
Probe FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1 28309-28332
N2 gene USA Forward primer: TTACAA ACATTGGCCGCA AA MN908947 29164-29183 [44]
Reverse primer: GCGCGACATTCCGAAGAA 29213-29230
Probe FAM-ACA ATTTGCCCCCAGCGTTAG-BHQ1 29188-29210
N3 gene USA Forward primer: GGGAGCCTTGAA TAC ACC AAA A MN908947 28681-28702 [44]
Reverse primer: TGTAGCACG ATTGCAGCATTG 28732-28752
Probe FAM-AYCACATTGGCACCCGCA ATCCTG-BHQ1 28704-28727
NIID_ Japan Forward primer: AAATTTTGGGGACCAGGAAC MN908947 29125-29144 [45]
2019-nCOV_N_F2 Reverse primer: TGGCAGCTGTGTAGGTCAAC 29263-29282
Probe FAM-ATGTCGCGCATTGGCATGGA-BHQ1 29222-29241
N gene Thailand Forward primer: CGTTTGGTGGACCCTCAGAT MN908947 28320-28339 [46]
Reverse primer: CCCCACTGCGTTCTCCATT 28358-28376
Probe FAM-CAACTGGCAGTAACCA-BQH1 28341-28356
E gene Germany Forward primer: ACAGGTACGTTAATAGTTAATAGCGT MN908947 26269-26294 [33]
Reverse primer: ATATTGCAGCAGTACGCACACA 26360-26381
Probe FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ 26332-26357

Spike China Forward primer: CCTACTAAATTAAATGATCTCTGCTTTACT MN938384 22712-22741 [19]

Reverse primer: CAAGCTATAACGCAGCCTGTA MN975262 22849-22869
RNase P gene (RP) USA Forward primer: AGATTTGGACCTGCGAGCG CDC internal -- [44]
Reverse primer: GAGCGGCTGTCTCCACAAGT control
Probe FAM -TTCTGACCTGAAGGCTCTGCGCG-BHQ-1
GAPDH China Forward primer: TCAAGAAGGTGGTGAAGCAGG internal -- [17]
Reverse primer: CAGCGTCAAAGGTGGAGGAGT control
Probe VIC-CCTCAAGGGCATCCTGGGCTACACT-BHQ1
Abbreviations: E, envelope protein gene; M, membrane protein gene; N, nucleocapsid protein gene; ORF, open reading frame; RdRp, RNA-dependent RNA polymerase
gene; FAM, 6-carboxyfluorescein; BBQ, blackberry quencher; BHQ-1, black hole quencher 1; TAMRA, carboxytetramethylrhodamine; IBFQ, Iowa Black FQ.

http://www.thno.org
Theranostics 2020, Vol. 10, Issue 16 7157

Figure 2. Sequence alignment of the reference (MN908947) and SARS (NC_004718) sequences. Red colour marks the mismatch positions and pink colour marks the forward
primer and reverse complementary sequence of the reverse primer in the study by Corman et al. [33].

The 5′- and 3′-ends of the primers play different the hydrolysis efficiency. However, it should be kept
roles; although the 5′-end contributes marginally, above 3 bp. The 5’ end of the probe cannot start with a
matching the 3′ end is critical for PCR efficiency G base because it can quench the fluorophore [62]. As
amplification. It has been found that a single shown in Table 2, most of the probes do not start with
mismatch in the last three nucleotides counting from a G base except for that for the N gene developed in
the 3′-end is acceptable, but the second impaired Hong Kong.
position drops efficiency below the detectable level on After designing the primer/probe following the
agarose gel electrophoresis [61].The base at the general principle strategy, in silico analysis is
terminal 3' bases of the primer generally does not important for specificity or exclusivity testing. For
require A nucleotide. More attention should be paid example, an alignment was performed with the
to the last five bases; in particular, no more than three oligonucleotide primer and probe sequences of the
G/C residues should be included in the last five bases CDC 2019 nCoV RT-qPCR diagnostic panel with all
and the primer should never end with three publicly available nucleic acid sequences for
consecutive G/C residues, such as GGG or CCC, 2019-nCoV in GenBank. NCBI Primer-BLAST can be
otherwise the complementary, dimer, or hairpin used to confirm primer specificity. It is best to confirm
structure at the 3′ end of the primer may cause the specificity again after primer probe design is
PCR reaction to fail. Multiple pairs of primers in the completed, especially since the primers and probes of
same amplification system can also increase the multiple RT-qPCR need to be mixed together. It has
probability of primer dimer formation, which can be also been suggested that primer/probe sets are
predicted by related software such as Oligo7 [57]. The selected from conserved sequences on stem structures
bases of primers should be randomly distributed, and to avoid loop structures [63], which may be different
it is suggested that there should be no more than four from the general principle that recommends
complementary bases between the forward and designing primers to avoid secondary structure in
reverse primers. As reported in previous studies, templates. As a general principle, this is correct
primer dimers can be prevented by modifying with because the template can be paired to form the stem
2′-O-methyl bases in the penultimate base [26]. The by itself, which may not be conducive to accurate PCR
closer the probe is to the upstream primer, the higher quantification. However, what we want to emphasize

http://www.thno.org
Theranostics 2020, Vol. 10, Issue 16 7158

in this review is that, firstly, SARS-CoV-2 is an RNA bases are on the stem (as shown in Figure 3).
virus, which is unstable and easily degraded by However, further experiments are needed to explore
RNase A [64]. The stem structure is more stable than and verify this.
the loops that are easily cleaved [65,66] and by The secondary structures of the ORF 1ab and N
avoiding loops and targeting stems, the original RNA gene fragments amplified using the forward and
value can be nearly reached, even if the SARS-CoV-2 reverse primers from Table 2 are shown in Figure 3.
RNA is degraded under improper transport and The secondary structures of the target genes were
storage conditions before analysis, resulting in predicted by Mfold (http://mfold.rna.albany.edu/
broader applicability [63]. In addition, during reverse ?qZmfold) using the minimum free energy method.
transcription in the RT-qPCR assay, the temperature The forward and reverse primers designed by each
is mostly set to 55°C, and this temperature is country avoided the loop positions as much as
conducive to the effective opening of RNA secondary possible. Researchers also revealed that if the loop
structures [67]. During the amplification process, size, determined by the distance between paired
through denaturation, the secondary structures will palindrome elements, is less than 11 base pairs and
also be opened. It is important to check that all the stem length, determined by the alignment of the
secondary structures have a Tm (°C) less than the palindrome elements, exceeds 14 hydrogen bonds,
qPCR annealing temperature (normally 55–60°C) to then there may be stem loop interference in the primer
ensure effective amplification [68]. Therefore, we binding site [69]. According to this, there are no stem
suggest that in the primer design for SARS-CoV-2, it is loop interferences observed in the binding sites of
more effective to design the primer targeting position primers developed in each country (Figure 3).
on the stem, at least to make sure that the 3 ' terminal

Figure 3. Secondary structures of the ORF 1ab and N gene fragments amplified using the forward and reverse primers. (A) The forward primer and reverse
complementary sequence of the reverse primer for ORF 1ab from China are indicated in red. (B) The forward primer and reverse complementary sequence of the reverse
primer for ORF1b from Hong Kong are shown in light blue. (C) The forward primer and reverse complementary sequence of the reverse primer for RdRp from Germany are
shown in pink. (D) The forward primer and reverse complementary sequence of the reverse primer for the N1 gene from USA are shown in yellow and the N gene in Thailand
are shown in dark blue. (E) The forward primer and reverse complementary sequence of the reverse primer for the N2 gene from USA are shown in yellow, the N gene from
Hong Kong are shown in light blue, and the N gene from Japan are shown in green. (G) The forward primer and reverse complementary sequence of the reverse primer for the
N3 gene from USA are shown in yellow and the N gene from China in red. Orange represents the overlap. F represents the forward primer and R represents the reverse
complementary sequence of the reverse primer.

http://www.thno.org
Theranostics 2020, Vol. 10, Issue 16 7159

Table 3. List of practical primer design tools

Aim Name Software or Website
Secondary structure prediction Mfold http://mfold.rna.albany.edu/?qZmfold
RNAfold http://rna.tbi.univie.ac.at//cgi-bin/RNAWebSuite/RNAfold.cgi
RNAStructure http://e.informer.com/rna.urmc.rochester.edu/RNAstructure.html
SFold http://sfold.wadsworth.org/cgi-bin/index.pl
Primer design Primer Premier Software

Primer Express Software

DNAMAN Software
Oligo 7 Software
Prime3 Plus http://primer3plus.com/cgi-bin/dev/primer3plus.cgi
QuantPrime https://www.quantprime.de/
Primer Blast https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi
Primer bank https://pga.mgh.harvard.edu/primerbank/
JCVI Primer Designer https://sourceforge.net/projects/primerdesigner/
Test the primer specificity NCBI Primer-BLAST https://www.ncbi.nlm.nih.gov/tools/primer-blast/
Primer Blast https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi

The primer and probe sequences can also be collection, handling, transport, and storage. For the
designed using software tools [70,71]. The commonly analytical procedures, many problems, such as active
used primer design tools are listed in Table 3. Even if viral recombination, a lack of harmonization of
the same tools are used, the same suggested primers primers and probes, and non-specific PCR annealing,
and probes may not always be the same, but this does should be addressed. Finally, the healthcare personnel
not indicate that the quality of primer design is poor. must be educated on the interpretation of RT-qPCR
For example, the primers and probes designed for the results. Despite high sensitivity, negative RT-qPCR
ORF 1ab of SARS-CoV-2 have different sequences results observed at one or two time points are
distributed by the Chinese CDC and the USA CDC. insufficient to exclude SARS-CoV-2 infection in
Indeed, there are many primer and probe patients, especially for those with typical clinical
combinations that can meet the requirements of RT- presentations or clear epidemic indications.
qPCR experiments, so the highest quality combination Therefore, negative results do not preclude SARS-
does not always need to be used. Regardless of how CoV-2 infection and should not be used as the sole
advanced the algorithm of the design tool is, the basis for treatment or other patient management
performance of the probe primer ultimately depends decisions. Negative results must be combined with
on the experimental data and whether there are clinical observations, patient history, and
non-specific products to be confirmed by gel epidemiological information.
electrophoresis after PCR or a dissociation curve Each RT-qPCR run should include both external
(which is recommended). The amplification and internal controls, and laboratories are encouraged
conditions also need to be continuously optimized to participate in external quality assessment schemes
through experiments. For example, the optimal Tm that should be established as soon as possible to
and optimized oligo concentrations were eventually monitor analytical quality and harmonize the assays.
confirmed by temperature gradient experiments. The In many studies [34,44], the internal control primer set
parameters given by the design tool are for reference targeted the human ribonuclease P (RNase P) protein.
only and should never replace the subsequent This protein is an ubiquitous enzyme in all cells and
confirmation process. From an economic point of cellular compartments [72]. The GAPDH gene can
view, it is generally recommended to design a probe also be used as the target gene for the internal control
and three corresponding pairs of primers for a target [17,57]. In order to identify regions of the viral
and determine the best primer combination after genome, further analysis of the molecular targets is
experimental screening. The entire flow of the primer needed to achieve the highest possible diagnostic
design is shown in Figure 4. accuracy. The primer/probe set should be evaluated
It is clear that no diagnostic modality is perfect. with further experiments, so that more sensitive and
In order to obtain RT-qPCR results with high specific primers/probes can be developed. Ordering
accuracy, each step must be performed satisfactorily primers and probes to perform validation testing on
in the preanalytical, analytical, and post-analytical functionality and potential contaminants is also
steps. It is important to avoid sample contamination recommended [73].
and ensure adequate procedures for specimen

http://www.thno.org
Theranostics 2020, Vol. 10, Issue 16 7160

Figure 4. The entire flow of primer design. (A) Establishment of the reference sequence. Different types of samples are collected, RNA is extracted, and then
high-throughput sequencing is performed to determine the reference sequence. Alternatively, after multiple sequencing results are aligned, the reference sequence can be
determined. (B) Identification of the target genes. By comparing the SARS-CoV-2 genome with other bat-associated SARS-related viral genomes, conserved and non-conserved
regions were identified. Conserved regions such as ORF 1ab, E gene and N gene can be used as target genes for designing primers. Primers are designed at the same target region
(E gene) of SARS-CoV-2 genome and bat-associated SARS-related viral genes for pan-sarbecovirus detection. Specific primer probes can be designed for specific target gene
regions of SARS-CoV-2 (ORF 1ab and N gene) for confirmation experiments. (C) Improving the sensitivity of the RT-qPCR assay. Primers are designed according to the general
principles of primers or by using software. Degenerate primers can increase the sensitivity of the reaction. When using primers to detect the target gene, if the target gene is
mutated, the universal primer may amplify, but the degenerate primer can make a false negative result into a positive result (Grey heads indicate that false negative results become
positive results). After considering the secondary structure of the target gene, the target gene on the stem can prevent RNA from being cleaved by RNase A, which can also
increase the detection rate. NCBI Primer-BLAST verifies the specificity of the primers. In the experimental process of the designed primer probe, dual-target detection and
multi-target detection can also improve the sensitivity of the reaction. The probe is labelled with different fluorescent dyes, or each target gene is detected in a separate assay with
the probes labelled with the same fluorescent dye.

foremost prerequisite. This review provides an

Conclusion overview of the most crucial components of a
As RT-qPCR is the current gold standard for the RT-qPCR assay-primer design (summarised in Figure
etiological diagnosis of SARS-CoV-2 infection, the 4). First, it is important to identify the reference
diagnostic accuracy of this technique should be a sequence using a step-by-step process, and eventually

http://www.thno.org
Theranostics 2020, Vol. 10, Issue 16 7161

align the sequence, if required. The gene targets References

include the N, E, ORF 1ab (or RdRP), and S genes. The 1. Coronaviridae Study Group of the International Committee on Taxonomy of
more conserved E gene is the target for the V. The species Severe acute respiratory syndrome-related coronavirus:
classifying 2019-nCoV and naming it SARS-CoV-2. Nat Microbiol. 2020;
pan-coronavirus assay, while N and RdRP genes 10.1038/s41564-020-0695-z.
mainly function as targets for confirmatory assays. 2. WHO. Coronavirus disease 2019 (COVID-19) Situation Report – 113 2020.
3. Bustin SA, Nolan T. RT-qPCR Testing of SARS-CoV-2: A Primer. International
After considering the basic rules of primer/probe journal of molecular sciences. 2020; 21.
design, and degenerate primers/probes against 4. Kandeel M, Ibrahim AA, Fayez M, Al-Nazawi M. From SARS and MERS CoVs
to SARS-CoV-2: moving toward more biased codon usage in viral structural
SARS-CoV can be used as a positive control; and non-structural genes. J Med Virol. 2020; 10.1002/jmv.25754.
5. Xu X, Chen P, Wang J, Feng J, Zhou H, Li X, et al. Evolution of the novel
moreover, primers that account for the variation in coronavirus from the ongoing Wuhan outbreak and modeling of its spike
coronavirus sequences can be developed. The protein for risk of human transmission. Science China Life Sciences. 2020; 63:
457-60.
single-target method is prone to lead to false negative 6. Huang C, Wang Y, Li X, Ren L, Zhao J, Hu Y, et al. Clinical features of patients
results once a site in the target sequence is mutated. infected with 2019 novel coronavirus in Wuhan, China. Lancet. 2020; 395:
497-506.
Thus, dual-target or multi-target detection can be 7. Li Q, Guan X, Wu P, Wang X, Zhou L, Tong Y, et al. Early Transmission
additionally used to improve detection sensitivity. Dynamics in Wuhan, China, of Novel Coronavirus-Infected Pneumonia. N
Engl J Med. 2020; 382: 1199-207.
After multiple pairs of primers are designed, 8. S K, G S, M L, C K. biology TKJM, evolution. MEGA X: Molecular
regardless of whether they are designed manually or Evolutionary Genetics Analysis across Computing Platforms. 2018; 35: 1547-9.
9. Shannon A, Le NT-T, Selisko B, Eydoux C, Alvarez K, Guillemot J-C, et al.
by software, further verification is necessary. In silico Remdesivir and SARS-CoV-2: Structural requirements at both nsp12 RdRp
analysis of primer and probe sequences is needed to and nsp14 Exonuclease active-sites. Antiviral Res. 2020; 178.
10. sciences EAJL. Ribavirin, Remdesivir, Sofosbuvir, Galidesivir, and Tenofovir
analyse the specificity. However, the experimental against SARS-CoV-2 RNA dependent RNA polymerase (RdRp): A molecular
conformation is more important. Only by evaluating 11.
docking study. 2020; 117592.
Su S, Wong G, Shi W, Liu J, Lai ACK, Zhou J, et al. Epidemiology, Genetic
the diagnostic ability of the designed primers and Recombination, and Pathogenesis of Coronaviruses. Trends Microbiol. 2016;
24: 490-502.
probes on a number of samples, we can identify 12. Guan W-D, Chen L-P, Ye F, Ye D, Wu S-G, Zhou H-X, et al. High-throughput
primers/probes with good sensitivity and specificity. sequencing for confirmation of suspected 2019-nCoV infection identified by
fluorescence quantitative polymerase chain reaction. Chin Med J (Engl). 2020;
Furthermore, the reaction conditions of the assay, 10.1097/CM9.0000000000000792.
such as the concentration of the primers and probes, 13. Zhu N, Zhang D, Wang W, Li X, Yang B, Song J, et al. A Novel Coronavirus
from Patients with Pneumonia in China, 2019. N Engl J Med. 2020; 382: 727-33.
Tm, and annealing temperature, must be optimized 14. Chu DKW, Pan Y, Cheng SMS, Hui KPY, Krishnan P, Liu Y, et al. Molecular
for maximum accuracy of the results. Diagnosis of a Novel Coronavirus (2019-nCoV) Causing an Outbreak of
Pneumonia. Clin Chem. 2020; hvaa029.
15. Chen L, Liu W, Zhang Q, Xu K, Ye G, Wu W, et al. RNA based mNGS
Abbreviations approach identifies a novel human coronavirus from two individual
pneumonia cases in 2019 Wuhan outbreak. Emerg Microbes Infect. 2020; 9:
SARS-CoV-2: severe acute respiratory syndrome 313-9.
16. Che XY, Qiu LW, Liao ZY, Wang YD, Wen K, Pan YX, et al. Antigenic
coronavirus 2; MERS-CoV: Middle East respiratory cross-reactivity between severe acute respiratory syndrome-associated
syndrome coronavirus; SARS-CoV: severe acute coronavirus and human coronaviruses 229E and OC43. The Journal of
infectious diseases. 2005; 191: 2033-7.
respiratory syndrome coronavirus; ORF: Open 17. Lu R, Zhao X, Li J, Niu P, Yang B, Wu H, et al. Genomic characterisation and
reading frame; S: Spike; E: Envelope; M: Membrane; epidemiology of 2019 novel coronavirus: implications for virus origins and
receptor binding. Lancet. 2020; 395: 565-74.
N: Nucleocapsid; RT-qPCR: Quantitative real-time 18. Wu F, Zhao S, Yu B, Chen YM, Wang W, Song ZG, et al. A new coronavirus
PCR; RdRp: RNA-dependent RNA polymerase; associated with human respiratory disease in China. Nature. 2020; 579: 265-9.
19. Chan JF, Yuan S, Kok KH, To KK, Chu H, Yang J, et al. A familial cluster of
BALF: Bronchoalveolar lavage fluid; GISAID: Global pneumonia associated with the 2019 novel coronavirus indicating
Initiative on Sharing All Influenza Data; FAM: person-to-person transmission: a study of a family cluster. Lancet. 2020; 395:
514-23.
6-carboxyfluorescein; BBQ: Blackberry quencher; 20. Drexler JF, Kupfer B, Petersen N, Grotto RM, Rodrigues SM, Grywna K, et al.
BHQ-1: Black hole quencher 1; TAMRA: A novel diagnostic target in the hepatitis C virus genome. PLoS medicine.
2009; 6: e31.
Carboxytetramethylrhodamine; IBFQ: Iowa Black FQ; 21. Liu R, Han H, Liu F, Lv Z, Wu K, Liu Y, et al. Positive rate of RT-PCR detection
CDC: Centers for Disease Control and Prevention; of SARS-CoV-2 infection in 4880 cases from one hospital in Wuhan, China,
from Jan to Feb 2020. Clin Chim Acta. 2020; S0009-8981(20)30112-1.
EVAg: European virus archive global. 22. Xu J, Zhao S, Teng T, Abdalla AE, Zhu W, Xie L, et al. Systematic Comparison
of Two Animal-to-Human Transmitted Human Coronaviruses: SARS-CoV-2

Acknowledgments 23.
and SARS-CoV. Viruses. 2020; 12: E244.
Cobb BR, Vaks JE, Do T, Vilchez RA. Evolution in the sensitivity of
quantitative HIV-1 viral load tests. J Clin Virol. 2011; 52 Suppl 1: S77-82.
This work was supported by the “AIDS and 24. Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, et al. The
Hepatitis, and Other Major Infectious Disease Control MIQE guidelines: minimum information for publication of quantitative
real-time PCR experiments. Clin Chem. 2009; 55: 611-22.
and Prevention” Program of China under Grant [No. 25. van Elden LJ, van Loon AM, van Alphen F, Hendriksen KA, Hoepelman AI,
2018ZX10102001]. The funder had no role in the study van Kraaij MG, et al. Frequent detection of human coronaviruses in clinical
specimens from patients with respiratory tract infection by use of a novel
design, data collection, analysis, interpretation, or real-time reverse-transcriptase polymerase chain reaction. The Journal of
writing of the paper. 26.
infectious diseases. 2004; 189: 652-7.
Pfefferle S, Reucher S, Nörz D, Lütgehetmann M. Evaluation of a quantitative
RT-PCR assay for the detection of the emerging coronavirus SARS-CoV-2
Competing Interests using a high throughput system. Euro Surveill. 2020; 25:
10.2807/1560-7917.ES.2020.25.9.2000152.
The authors have declared that no competing 27. Xie X, Zhong Z, Zhao W, Zheng C, Wang F, Liu J. Chest CT for Typical
2019-nCoV Pneumonia: Relationship to Negative RT-PCR Testing. Radiology.
interest exists. 2020; 200343-.

http://www.thno.org
Theranostics 2020, Vol. 10, Issue 16 7162
28. Zhao W, Zhong Z, Xie X, Yu Q, Liu J. CT Scans of Patients with 2019 Novel 60. Kamau E, Agoti CN, Lewa CS, Oketch J, Owor BE, Otieno GP, et al. Recent
Coronavirus (COVID-19) Pneumonia. Theranostics. 2020; 10: 4606-13. sequence variation in probe binding site affected detection of respiratory
29. Liu F, Zhang Q, Huang C, Shi C, Wang L, Shi N, et al. CT quantification of syncytial virus group B by real-time RT-PCR. J Clin Virol. 2017; 88: 21-5.
pneumonia lesions in early days predicts progression to severe illness in a 61. Cha RS, Zarbl H, Keohavong P, Thilly WG. Mismatch amplification mutation
cohort of COVID-19 patients. Theranostics. 2020; 10: 5613-22. assay (MAMA): application to the c-H-ras gene. PCR methods and
30. Fang Y, Zhang H, Xie J, Lin M, Ying L, Pang P, et al. Sensitivity of Chest CT for applications. 1992; 2: 14-20.
COVID-19: Comparison to RT-PCR. Radiology. 2020; 200432. 62. Crockett AO, Wittwer CT. Fluorescein-labeled oligonucleotides for real-time
31. Zou L, Ruan F, Huang M, Liang L, Huang H, Hong Z, et al. SARS-CoV-2 Viral pcr: using the inherent quenching of deoxyguanosine nucleotides. Analytical
Load in Upper Respiratory Specimens of Infected Patients. N Engl J Med. 2020; biochemistry. 2001; 290: 89-97.
10.1056/NEJMc2001737. 63. Chen L, Li W, Zhang K, Zhang R, Lu T, Hao M, et al. Hepatitis C Virus RNA
32. Y S, bulletin MJJEsbEslmtEcd. GISAID: Global initiative on sharing all Real-Time Quantitative RT-PCR Method Based on a New Primer Design
influenza data - from vision to reality. 2017; 22. Strategy. The Journal of molecular diagnostics : JMD. 2016; 18: 84-91.
33. Corman VM, Landt O, Kaiser M, Molenkamp R, Meijer A, Chu DKW, et al. 64. Prats-Ejarque G, Blanco JA, Salazar VA, Nogués VM, Moussaoui M, Boix E.
Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR. Euro Characterization of an RNase with two catalytic centers. Human RNase6
Surveill. 2020; 25: 2000045. catalytic and phosphate-binding site arrangement favors the endonuclease
34. Won J, Lee S, Park M, Kim TY, Park MG, Choi BY, et al. Development of a cleavage of polymeric substrates. Biochimica et biophysica acta General
Laboratory-safe and Low-cost Detection Protocol for SARS-CoV-2 of the subjects. 2019; 1863: 105-17.
Coronavirus Disease 2019 (COVID-19). Exp Neurobiol. 2020; 10.5607/en20009. 65. Villegas J, Burzio V, Villota C, Landerer E, Martinez R, Santander M, et al.
35. Park WB, Kwon NJ, Choi SJ, Kang CK, Choe PG, Kim JY, et al. Virus Isolation Expression of a novel non-coding mitochondrial RNA in human proliferating
from the First Patient with SARS-CoV-2 in Korea. J Korean Med Sci. 2020; 35: cells. Nucleic acids research. 2007; 35: 7336-47.
e84-e. 66. Smith RM, Walton CM, Wu CH, Wu GY. Secondary structure and
36. Wang C, Liu Z, Chen Z, Huang X, Xu M, He T, et al. The establishment of hybridization accessibility of hepatitis C virus 3'-terminal sequences. J Virol.
reference sequence for SARS-CoV-2 and variation analysis. J Med Virol. 2020; 2002; 76: 9563-74.
10.1002/jmv.25762. 67. Baranauskas A, Paliksa S, Alzbutas G, Vaitkevicius M, Lubiene J, Letukiene V,
37. Shen Z, Xiao Y, Kang L, Ma W, Shi L, Zhang L, et al. Genomic diversity of et al. Generation and characterization of new highly thermostable and
SARS-CoV-2 in Coronavirus Disease 2019 patients. Clin Infect Dis. 2020: processive M-MuLV reverse transcriptase variants. Protein engineering,
ciaa203. design & selection : PEDS. 2012; 25: 657-68.
38. Li K, Brownley A. Primer design for RT-PCR. Methods in molecular biology 68. Thornton B, Basu C. Rapid and simple method of qPCR primer design.
(Clifton, NJ). 2010; 630: 271-99. Methods in molecular biology (Clifton, NJ). 2015; 1275: 173-9.
39. Campos MJ, Quesada A. Strategies to Improve Efficiency and Specificity of 69. Li K, Brownley A, Stockwell TB, Beeson K, McIntosh TC, Busam D, et al. Novel
Degenerate Primers in PCR. Methods in molecular biology (Clifton, NJ). 2017; computational methods for increasing PCR primer design effectiveness in
1620: 75-85. directed sequencing. BMC bioinformatics. 2008; 9: 191.
40. Yi H. 2019 novel coronavirus is undergoing active recombination. Clin Infect 70. Rozen S, Skaletsky H. Primer3 on the WWW for general users and for biologist
Dis. 2020. programmers. Methods in molecular biology (Clifton, NJ). 2000; 132: 365-86.
41. Lippi G, Simundic AM, Plebani M. Potential preanalytical and analytical 71. Chen SH, Lin CY, Cho CS, Lo CZ, Hsiung CA. Primer Design Assistant (PDA):
vulnerabilities in the laboratory diagnosis of coronavirus disease 2019 A web-based primer design tool. Nucleic acids research. 2003; 31: 3751-4.
(COVID-19). Clinical chemistry and laboratory medicine. 2020. 72. V G, A V, chemistry ASJTJob. RNase P: variations and uses. 2002; 277: 6759-62.
42. Institut Pasteur P. Real-time RT-PCR assays for the detection of SARS-CoV-2. 73. Laboratory testing for coronavirus disease 2019 (COVID-19) in suspected
2020. human cases. 2020.
43. China_CDC. Specific primers and probes for detection 2019 novel coronavirus.
2020.
44. US_CDC. 2019-Novel Coronavirus (2019-nCoV) Real-time rRT-PCR Panel:
Primers and Probes. 2020.
45. Nao; N, Shirato; K, Katano; H, Matsuyama; S, Takeda M. Detection of second
case of 2019-nCoV infection in Japan. 2020.
46. Health TMoP. Diagnostic detection of Novel coronavirus 2019 by Real time
RT- PCR. 2020.
47. Nalla AK, Casto AM, Huang MW, Perchetti GA, Sampoleo R, Shrestha L, et al.
Comparative Performance of SARS-CoV-2 Detection Assays using Seven
Different Primer/Probe Sets and One Assay Kit. J Clin Microbiol. 2020.
48. M W, M Y, H X, W L, B K, B Z, et al. SARS-CoV infection in a restaurant from
palm civet. 2005; 11: 1860-5.
49. Dennis Lo YM, Chiu RWK. Racing towards the development of diagnostics for
a novel coronavirus (2019-nCoV). Clin Chem. 2020; hvaa038.
50. JL R, CM P, EA G, X dL, R C, B C, et al. The European Virus Archive goes
global: A growing resource for research. 2018; 158: 127-34.
51. Wang P, Anderson N, Pan Y, Poon L, Charlton C, Zelyas N, et al. The
SARS-CoV-2 Outbreak: Diagnosis, Infection Prevention, and Public
Perception. Clin Chem. 2020; hvaa080.
52. Jung YJ, Park G-S, Moon JH, Ku K, Beak S-H, Kim S, et al. Comparative
analysis of primer-probe sets for the laboratory confirmation of SARS-CoV-2.
bioRxiv 20200225964775. 2020.
53. Bustin S, Huggett J. qPCR primer design revisited. Biomolecular detection and
quantification. 2017; 14: 19-28.
54. Vijgen L, Moës E, Keyaerts E, Li S, Van Ranst M. A pancoronavirus RT-PCR
assay for detection of all known coronaviruses. Methods in molecular biology
(Clifton, NJ). 2008; 454: 3-12.
55. Chudy M, Weber-Schehl M, Pichl L, Jork C, Kress J, Heiden M, et al. Blood
screening nucleic acid amplification tests for human immunodeficiency virus
Type 1 may require two different amplification targets. Transfusion. 2012; 52:
431-9.
56. Lee HK, Lee CK, Loh TP, Tang JW, Chiu L, Tambyah PA, et al. Diagnostic
testing for pandemic influenza in Singapore: a novel dual-gene quantitative
real-time RT-PCR for the detection of influenza A/H1N1/2009. The Journal of
molecular diagnostics : JMD. 2010; 12: 636-43.
57. Bellau-Pujol S, Vabret A, Legrand L, Dina J, Gouarin S,
Petitjean-Lecherbonnier J, et al. Development of three multiplex RT-PCR
assays for the detection of 12 respiratory RNA viruses. J Virol Methods. 2005;
126: 53-63.
58. Chuang LY, Cheng YH, Yang CH. Specific primer design for the polymerase
chain reaction. Biotechnology letters. 2013; 35: 1541-9.
59. Gunson RN, Collins TC, Carman WF. Practical experience of high throughput
real time PCR in the routine diagnostic virology setting. J Clin Virol. 2006; 35:
355-67.

http://www.thno.org