Immunomagnetic capture method for M.

bovis 247
ISSN 0325-7541
ARTÍCULO ORIGINAL Revista Argentina de Microbiología (2010) 42: 247-253

Evaluation of an immunomagnetic capture method followed

by PCR to detect Mycobacterium bovis in tissue samples
from cattle
S. G. GARBACCIO1, A. A. CATALDI2*
1
Instituto de Patobiología. 2Instituto de Biotecnología. CICVyA. Instituto Nacional de Tecnología Agropecuaria (1686),
Hurlingham, Argentina
*Correspondence. E-mail: acataldi@cnia.inta.gov.ar

ABSTRACT
Tuberculosis is one of the most important infectious diseases worldwide. Mycobacterium bovis is the causative agent of
bovine tuberculosis (BTB), an important animal pathogen with public health implications as it is a zoonosis. Currently,
the diagnosis of BTB is based on the caudal fold test of the Tuberculin Skin Test (TST). Post-mortem bacterial culture
is carried out to confirm the diagnosis, and then specific biochemical tests are performed for the characterization of
the etiologic agent. Culture takes at least 4 to 8 weeks to develop. The diagnosis by molecular tests such as PCR
can provide fast and reliable results, significantly decreasing the time of confirmation (from two months to two days),
thus allowing the possibility of taking control actions to prevent the spread of the disease in herds. In this work the
use of an immunomagnetic separation capture followed by PCR (IMS-PCR) based on the IS6110 element showed
a detection threshold corresponding to 10 CFU in M. bovis-spiked PBS. In the case of infected bovine fresh tissues,
after five replicates, the minimum value of detection was 1000 CFU in 100% of the trials (5/5). This paper attempts to
provide a sensitive, rapid and specific technique for the diagnosis of bovine tuberculosis, and opens up the possibility
of a direct application in the control and eradication of this cattle disease.
Key words: Mycobacterium bovis, immunomagnetic capture, PCR, cattle

RESUMEN
Evaluación de un método de captura inmunomagnética seguida de PCR para la detección de Mycobacterium
bovis en tejidos de ganado. La tuberculosis es una de las enfermedades infecciosas más importantes. Mycobacte-
rium bovis es el agente causal de la tuberculosis bovina (TBB), un patógeno animal y zoonótico. En la actualidad, el
diagnóstico de TBB se basa en la prueba intradérmica de la tuberculina. El cultivo bacteriano post mortem se lleva a
cabo para confirmar el diagnóstico y a continuación se realizan pruebas bioquímicas específicas para la caracteriza-
ción del agente etiológico. El cultivo bacteriano toma por lo menos 4 a 8 semanas para su desarrollo. El diagnóstico
mediante pruebas moleculares como PCR puede proporcionar resultados rápidos y robustos, con un considerable
acortamiento hasta la confirmación del diagnóstico (de 2 meses a 2 días). En este trabajo, el uso de captura inmuno-
magnética seguida de PCR (IMS-PCR) dirigida al elemento IS6110 mostró un umbral de detección correspondiente
a 10 UFC en M. bovis diluido en PBS. En el caso de tejidos bovinos inoculados experimentalmente después de 5
réplicas, el valor mínimo de detección fue de 1000 UFC en el 100% de los ensayos. Este artículo aspira a proporcionar
una técnica sensible, rápida y específica para el diagnóstico de la tuberculosis bovina, con el fin de abrir la posibilidad
de una aplicación directa en el control y la erradicación de esta enfermedad en el ganado.
Palabras clave: Mycobacterium bovis, cpatura inmunomagnética, PCR, ganado

Introduction tuberculosis in equatorial Africa), Mycobacterium microtii

and Mycobacterium canetti. Recently, M. tuberculosis
Bovine tuberculosis is a chronic infectious disease and subsp. caprae (2) and Mycobacterium pinnipedii subsp.
also a zoonosis which affects cattle and other species of nov. (3) have been incorporated into this group. The M.
domestic or wild animals. Mycobacterium bovis, the caus- bovis genome which has been recently sequenced is
ative agent of bovine tuberculosis, is a slow growing myco- 99.5% identical to that of M. tuberculosis H37Rv, but
bacterium that belongs to the Mycobacterium tuberculosis smaller due to deletions (5).
complex group. This is a closely related group that is The progress of control and eradication programs in
pathogenic both for humans and animals. This taxonomic many countries, coupled with the widespread implemen-
complex comprises the following species: M. tuberculosis, tation of pasteurization, has led to the reduction in the
M. bovis, which includes the BCG strain (Bacillus Calmette incidence of human infection by M. bovis. In humans, the
Guerin, attenuated mutant of M. bovis), Mycobacterium infection occurs primarily through inhalation of aerosols
africanum (heterogeneous group responsible for human from coughing cattle in abattoirs, or by the consumption
248 Revista Argentina de Microbiología (2010) 42: 247-253

of contaminated non-pasteurized milk (7, 17). However, Dilutions of M. bovis seed lot culture
in many countries where the disease in cattle is endemic, Serial 10-fold dilutions of the seed lot culture were prepared
by vigorous mixing as described in method (c) in the previous
M. bovis still persists in humans. section, using sterile phosphate buffer solution (PBS) with 0.05%
In a work carried out in Argentina, 2.2% of the patients (v/v) Tween 20. Dilutions were aliquoted in 1.5ml tubes and kept
with tuberculosis in the province of Santa Fe and 1% of at -20 °C until inoculation.
the patients in the province of Buenos Aires (4) presented
M. bovis as its causative agent. In most cases, there was Inoculation of tissues
Various organs (retropharyngeal, mediastinal, tracheobron-
an association with occupational exposure. chial, mesenteric and hepatic lymph nodes, lungs, and liver),
Although bacteriological culture is considered the from animals free of bovine tuberculosis were used. A pool was
gold standard test for diagnostic confirmation, it takes made of each organ and placed in a plastic bag with 100 ml of
two months to confirm diagnosis. The direct smear from sterile 1XPBS. The mixture was homogenized using a mecha-
nical grinder (Basic Masticator type 470, IUL Instruments), for 6
sputum examination is considered a fast and easy test for beats (1.5 minutes each) until the formation of a homogenate.
the diagnosis of human tuberculosis. However, it is not This material was aliquoted and kept at -20 °C until experimental
useful in bovine TB because it lacks sensitivity for BTB inoculation.
diagnosis (22).
Several studies have demonstrated the potential of Polyclonal antibody (PA)
PA was provided by the reference laboratory of the University
PCR in clinical samples for the detection of BTB, with re- of Colorado-USA (http://www.cvmbs.colostate.edu/microbiolo-
sults comparable to those obtained from bacterial culture, gy/tb/material.html), and produced in rabbit inoculated with M.
although in shorter times: 2-3 days for PCR versus 4-8 tuberculosis H37Rv (complete cell lysate), and the original titer
weeks for bacterial cultures (1, 11, 26). Different methodo- in Western blot was reported to be 1:24,000. The lyophilized PA
was reconstituted and the titer was tested in Western blot against
logies have been described for extracting and recovering a M. bovis AN5 cell extract (E) and culture supernatant (SB). Both
DNA prior to PCR, ranging from boiling and centrifugation, materials were subjected to PAGE-SDS and four decreasing
boiling and cold, ultrasound, bead beating, enzymatic dilutions of polyclonal sera were used: 1:100, 1,000, 10,000
digestion, immunomagnetic beads, phenol-chloroform and 100,000. The protein concentration of sera was quantified
against a standardized curve of albumin by the Bradford method,
extraction, commercial kits for lysis and purification, and resulting in a total concentration of 107.4 mg/ml, and then diluted
the combination of several of them (1, 24, 26). (1:3) and aliquoted.
The present work aims at developing a PCR techni-
que in fresh tissues, using immunomagnetic separation Evaluation of the optimal concentration of polyclonal sera
to use in the preparation of conjugated beads
(IMS) as a method to capture bacteria. Although this To assess the efficiency of the beads-PA conjugate we worked
IMS-PCR combination has been tested in mycobacteria with 100 and 1,000 CFU, varying the antibody concentration. The
present in different bovine clinical materials such as feces beads were used at a fixed number of 12 µl per milliliter of sample,
or milk (1, 9), there are no reports of its use in tissues. as described by Antognoli et al. (1), who used a concentration
of 8 µg of PA in 120 µl of beads, (i.e. 0.066 mg of PA per ml of
Therefore, this technique could help in the diagnosis of beads). The following scheme was applied in duplicate: dilution 1
special cases, for example, in the event of an outbreak (0.07 µg of PA/µl beads), dilution 2 (0.7 µg/µl), dilution 3 (7 µg/µl)
where immediate intervention is needed or for the rapid and dilution 4 (15 µg/µl). We used fixed values of mycobacteria:
definition of a case having lesions compatible with bovine 100 and 1,000 CFU diluted in 1 ml of PBS 1X containing 0.05%
of Tween 20. The optimal concentration of PA was determined
tuberculosis. by the minimal detection capacity of IMS-PCR.

MATERIALS AND METHODS Determination of the optimal binding time of Mycobacterium

to the conjugate (beads+polyclonal)
Seed lot culture As described by Antognoli et al (1), the infected material
A seed culture was obtained in liquid medium (Middlebrook was incubated with the conjugate for 1.5 h. Taking this value as
7H9 OADC) for growth of M. bovis AN5 (reference strain), in- a reference, incubations were carried out in duplicate at 0.5 h,
cubated at 37 °C for four weeks. Prior to counting, and taking 1, 1.5 and 2 h. The two CFU (100 and 1,000) diluted in 1ml of
into account that a characteristic of mycobacteria is “clumping”, 1X PBS containing 0.05% Tween 20 were used. This step was
different methodologies were established to evaluate which first evaluated by specific Ziehl Neelsen staining and then by
could best separate these formations before loading them on IMS-PCR.
Petri dishes and counting. Three methods used were: Passage
through a 5μm Millipore filter using a tuberculin syringe type (a); IMS Protocol
grinding in a potter homogenizer with 1 ml of culture placed in Paramagnetic beads (Spherotech, Dynal) with attached goat
the container, making 25 up and down movements with the pes- anti-rabbit IgG were incubated with anti-M. tuberculosis H37Rv
tle (b) and repeated tuberculin needle passage: 1 ml of culture lysate rabbit serum. The protocol previously described (1), was
placed in a 15 ml tube, and 30 up and down movements using a adapted with minor modifications. The PA was conjugated to the
tuberculin syringe and needle to disintegrate the mycobacterial beads for 1 h by incubation in constant motion at room tempe-
accumulation (c). rature. Then, 12µl of conjugate was added to 1ml of sample and
To count CFU, 1ml aliquots were taken from the seed lot and incubated for 1.5 h in constant motion at room temperature. The
disaggregated as described. Then, serial 10 fold dilutions were tubes containing samples and beads were left in a magnetic field
poured in duplicate on Petri plates with Middlebrook 7H10 solid (Magnetic particle concentrator and simple mixer-Dynal MPC-S)
medium and incubated at 37 °C until colony development and for 30 minutes. The remaining liquid was removed carefully with
CFU determination at 35 days of culture. a tip, leaving 50µl of liquid in the tube. Then, 1ml of 0.05%, PBS
Immunomagnetic capture method for M. bovis 249

Figure 1. Disaggregation of M. bovis clumps. Ziehl-Neelsen staining was used for observation
after the repeated passage of mycobacteria by a tuberculin needle (method c in Materials and
Methods). Magnification 40x.

Tween was added, and the tube was placed back into the magnet plating and counting after 35 days of development). Three
for 10 minutes. This operation was repeated three times, until methods were tested to break mycobacterial clumps, use
the liquid became transparent. Finally, the beads were resus-
pended in 100 µl of sterile distilled water and subjected to lysis
of a Potter homogenizer followed by filtration through 5
for 15 min at 100 °C for the release of mycobacterial DNA. After µm filter; repeated passages through a tuberculin needle
a centrifugation (13,000 rpm for 5 min) to pellet the beads, the followed by filtration or not. Methods involving filtration
supernatant was used as template for PCR. yielded little clumping by Ziehl Neelsen staining, but a
The amplification conditions were performed according to
Zumarraga et al. (25). A region of the IS6110 insertion sequence
drastic decrease in the number of mycobacteria. The pas-
was amplified using primers previously described (8-20), gene- sage through a needle proved to be simple and suitable
rating a 245-bp amplification product. Master Mix consisted of for the purpose and this procedure was therefore taken
the following reagents: Taq buffer 5 μl, MgCl2 2.5 mm, dNTP 0.2 as standard������������������������
��������������������������������
methodology (Figure 1).
mM, INS1 (cgtgagggcatcgaggtggc) g 1 μM and INS2 (cgtaggcg-
tcggtgacaaa) 1 μM, 34.8 µl sterile water, Taq polymerase (1.25
U) 0.2 μl, and DNA template 2 μl. The final volume was 50 μl. Testing the optimal concentration of PA to
For the amplification process a thermocycler MJ PTC100 was conjugate to the beads
used with the following program: 96 °C for 3 min, 10 cycles of Four dilutions of cell extract and culture supernatants
96°C for 1 min, 72 °C for 1 min decreasing 1 °C / cycle (Touch
Down), 72 °C for 1 min, and 30 cycles of 96 °C for 1 min, 65
were made: 102, 103, 104, and 105. In all but the last
°C for 1 min, 72 °C for 2 min, 72 °C for 8 min. The product was supernatant dilution, a positive reaction of the PA with
detected by electrophoresis in 2% agarose gels at a constant cell extract and culture supernatant was observed by
voltage (120 V).

Detection limit of IMS-PCR in PBS

Duplicate decreasing dilutions of M. bovis AN5 DNA were
performed, from an initial concentration of 3 x 105 followed by
five successive ten fold dilutions in PBS tween 0.5% to a final
volume of 100 µl. The tubes were placed in a water bath at 100
°C for 20 min and the material used as a template for PCR. This
operation was repeated five times on different days.

Detection limit using IMS-PCR in bovine tissues

Tubes containing 1 ml of tissue homogenate were loaded
in duplicate with decreasing amounts of M. bovis AN5, from an
initial concentration of 3 x 105 CFU followed by five successive
ten fold dilutions for a final volume of 1ml. This operation was
repeated five times over different days. Figure 2. Optimal concentration of polyclonal anti-M. tuberculosis
sera to react to M. bovis cell extract and culture supernatants.
RESULTS Western Blot using lyophilized sera was reconstituted and
tested in Western blot against a M. bovis AN5 cell extract (E)
and culture supernatant (SB). Both materials were subjected to
Colony count of seed lot and disaggregation PAGE-SDS and four decreasing dilutions of polyclonal sera were
The seed lot of M. bovis AN5 had an OD650 of 0.658 used, 1:100 (1), 1,000 (2), 10,000 (3) and 100,000 (4). MWM,
corresponding to 3 x 108 CFU/ milliliter (determined by molecular weight marker
250 Revista Argentina de Microbiología (2010) 42: 247-253

Figure 3. IMS-PCR to assess optimal polyclonal antibody conjugated to beads.

Two bacterial loads were used: 1000 and 100 CFU. Four different dilutions of PA
were used: 1 (0.07 µg of PA/µl beads), 2 (0.7 µg/µl), 3 (7 µg/µl) and 4 (15 µg/µl).
Amplifications were carried out in duplicate. MWM, molecular weight marker, C+:
positive control and C-: negative control

Western blot (Figure 2). Therefore, we concluded that the was 10 CFU/ml. According to these results, 100% of the
antiserum was working properly to identify the presence reactions had positive results in dilutions containing 105,
of mycobacteria. 104, 103, 102, and 10 CFU, while in the samples contai-
To assess the efficiency of the antibody conjugation, ning 1 CFU only 40% of the reactions were positive (2 /
two fixed values of 100 and 1,000 CFU were tested varying 5) (Table 1).
the antibody concentration. This experiment was conduc-
ted in duplicate. IMS-PCR was positive at all the dilutions IMS-PCR in tissue samples
(Figure 3). Given these results, we decided to use the In a first attempt, the methodology was tested in ex-
concentration of 0.7 µg /ml of polyclonal beads, as both perimentally contaminated tissue samples, showing only
tests yielded satisfactory results to both mycobacterial negative reactions except for the tubes inoculated with
loads (100 and 1,000 CFU). With regard to the optimization the highest mycobacterial concentration, as observed in
of the time required for a better binding of mycobacteria Figure 5A.
to the beads, no differences were observed between the Because of these results, we then evaluated the pos-
different incubation times (1, 1.5 and 2 hours). For this sible presence of PCR inhibitors in the tissue sample. To
reason, we chose 1 h of incubation time. this end, 900 µl of tissue homogenate were added to each
of the dilutions of the M. bovis seed lot (105, 104, 103, 102,
IMS-PCR technique 10, 1 CFU). In another condition, a lesser amount of homo-
To evaluate the detection limit of the IMS-PCR assay, genate (100 μl), diluted in 900 µl of PBS 1X, was used to
seven dilutions of the original culture (3 x 108) to 106, 105, reduce the possible inhibitors present in the tissue. These
104, 103, 102, 10, and 1 CFU/ml in PBS Tween 0.5% were tubes were contaminated with the same concentrations of
made. Figure 4 shows that the detection limit of the system mycobacteria as detailed above and showed an increase
in the amplification (data not shown), thus indicating a
possible partial inhibition. In order to reduce the burden
of probable inhibitors, we also carried out successive
dilutions of the IMS product (1:2, 1:5, 1:10, 1:20). While

Table 1: Detection limit in PBS

Dilutions 105 104 103 102 10 1

Replicates

1 + + + + + +
2 + + + + + -
3 + + + + + -
4 + + + + + +
Figure 4. Detection limit of the IMS-PCR assay using bacteria 5 + + + + + -
diluted in PBS. MWM, molecular weight marker. C+: positive Total 5/5 5/5 5/5 5/5 5/5 2/5
control and C-: negative control.
Immunomagnetic capture method for M. bovis 251

Figure 5. Detection limit of the IMS-PCR assay using bacteria diluted in bovine tissues, before (A)
and after (B) optimization. MWM, molecular weight marker. C+: positive control and C-: negative
control.

some positive results were achieved, these variables were Table 2: Limit of detection in tissues
not able to establish a clear cause of the lack of sensitivity.
To solve this problem, we decided to include the following Dilutions 105 104 103 102 10 1
Replicates
changes to the procedure originally proposed:
a) increasing the number of washes of magnetic beads
1 + + + - - -
from 3 to 5.
2 + + + + - -
b) increasing the boiling time of post-capture beads
3 + + + - - -
from 15 min to 30 min. This step aims to obtain a better
4 + + + + - -
lysis and release of mycobacterial DNA.
5 + + + + + -
c) increasing the spin time of the post-capture beads
Total 5/5 5/5 5/5 3/5 2/5 0/5
from 5 to 20 min to avoid pipetting magnetic beads with
heavy metals that can interfere with the PCR reaction.
By implementing these changes, we observed a sig-
nificant increase in the positive signals recorded in those and PCR was performed without capture. Under these
samples inoculated with lower concentrations of myco- conditions, only the dilution containing 100,000 CFU
bacteria. Figure 5B and Table 2 show that reactions had resulted positive.
positive results in dilutions containing 100,000, 10,000
and 1,000 CFU in 100% of the cases, while the samples DISCUSSION
that contained 100 and 10 CFU resulted in 60% and 20%
positive amplification respectively. At the 1 CFU dilutions, The present work aimed to improve the molecular
no amplification was observed. As a control, tissue sam- diagnosis of M. bovis in tissue samples, using immu-
ples were artificially contaminated as previously described nomagnetic capture of bacteria and subsequent PCR
252 Revista Argentina de Microbiología (2010) 42: 247-253

amplification. This system has the advantage of being Our findings not only show an advantage in the use of
fast, since it takes only 24 hours. In addition, it is simple IMS but also the possibility to obtain an acceptable detec-
to implement and easy to adapt to any laboratory since tion threshold. It should be emphasized that a detection
it does not require sophisticated equipment or expensive threshold as low as 10 CFU as that found in PBS-infected
reagents. In this way, a single operator can perform 24 tissues, was not reproduced in experimentally infected
samples during the process without major difficulties. tissue samples. After a series of tests in tissues, the de-
The usefulness of this system has been previously tection threshold was 1,000 CFU in 100% of the trials. This
demonstrated by Antognoli et al. (1) in experimentally difference in the detection limit of PBS versus tissues, is
infected milk. Similarly, Romero et al. (15) described that probably due to the presence of amplification inhibitors,
PCR is 28 times more sensitive in the diagnosis of M. as only those samples containing more than 1,000 myco-
tuberculosis complex than traditional culture and direct bacteria were amplified. Although we could not identify
microscopy. These two works confirm the advantage the factors that inhibited the reaction, we demonstrated
of PCR in the diagnosis of M. bovis. In addition, unlike the need to improve several steps (more washes, a longer
Romero et al. (15), who applied the system on samples boiling time and a longer centrifugation time) in order to
from TST-positive animals, Zanini et al. (23) described avoid false negatives. These results reveal a slight diffe-
a more effective use of this diagnostic tool applying the rence in sensitivity as compared to that reported by Wards
system in tissue samples with presence of gross lesions et al. (22), who described a detection limit in the system
compatible with tuberculosis. between 200 and 500 bacteria in tissues experimentally
Numerous works have evaluated the use of PCR as infected with mycobacterial culture. These values differ from
a tool for diagnosing mycobacterial infection in various those recently described by Parra et al. (13), who described
clinical samples. Some have detected M. bovis in milk a detection limit of around 2 to 3 mycobacterial genomes,
samples (1-25), whereas others have detected M. bovis similar to that described previously (14, 16). Although the
directly in bovine tissue (10, 16, 19, 22). Miller et al. (11) experimental sensitivity found by Parra et al. (73.87%) is
demonstrated that PCR is a reliable technique for the slightly higher than that described in other studies (around
identification of M. bovis in tissues embedded in paraffin 70%) (10, 19, 23), it is important to point out that the work
in which M. bovis could not be cultured. Grant et al. (6) by Parra et al. (13) was carried out on TB compatible lesion
developed IMS-PCR for the detection of M. avium subsp. samples, where the sensitivity is directly related to the
paratuberculosis in milk samples. sampling strategy and the type of injuries.
The polyclonal antibody used in the IMS-PCR showed It is known that mycobacteria present difficulties with
recognition of the mycobacterial extract and supernatant, their DNA extraction compared to other bacteria or euka-
suggesting a broad recognition of whole mycobacterial ryotic cells, due to the robust cell wall and “clumping”.
cells. We also evaluated the analytical sensitivity of IMS- Antognoli et al. (1) mentioned “clumping” as a constraint
PCR in PBS infected with decreasing concentrations of to correctly estimating the concentration of mycobacteria
mycobacteria. After repeating several trials, we found used to infect, playing an important role in the lack of result
that the detection limit in this material was 10 CFU/ml reproducibility. For this reason, CFU concentrations should
in 100% of the samples and that it was 40% efficient be considered an approximation to the value described.
when PBS was infected with 1 CFU (Table 1). We thus However, the use of the C method (passages through the
consider it an acceptable system to be applied to bovine Tuberculin syringe) to reduce this property proved to be
tissues. However, it is important to highlight the following: adequate and simple in its application.
although the primers used amplified the IS6110 insertion This test can provide results in 48 hours, i.e. in a much
sequence, this segment is present in a small number of shorter time than bacteriological culture, where 24-48
copies in the M. bovis genome. In spite of this low copy days in conventional Stonenbrink and Lowestein Jensen
number, the primers used here provide a high efficiency medium are needed, or than the BACTEC radiometric
of target amplification PCR (24). Therefore, we decided culture radiometric system (BACTEC) described by Negi et
to base our work on the positive experiences previously al. (12), where 12.8 days are needed or than the BACTEC
described by other authors (10, 11, 21, 23, 25, 26). Our de- MGIT 960 System described by Sorlozano et al. (18), whe-
cision to use IS6110 differs from that made in other studies re 15.3 days are needed. In this respect IMS-PCR might
(19, 22), where the IS1081 insertion sequence present in a appear as an alternative. Therefore, the test presented
higher number of copies (six) in the M. bovis genome was here can be a tool for a national control and eradication
used. In our hands, the sensitivity of IS6110 vs. IS1081 campaign of bovine tuberculosis. This technique could
favored the former, thus justifying its use because of its result in rapid (48 hours) diagnosis, without the limitation
greater potential for amplification of the test (24). We also of keeping the viability of the etiologic agent in the sample
incorporated the cycling variant known as “touch down”, to be analyzed. To improve the sensitivity of this system
according to that described by Zumarraga et al. (25), who and its validation as an alternative tool for diagnosis of
found a two log increase in sensitivity compared with bovine tuberculosis, a test of tissue samples from naturally
conventional PCR. infected animals should be carried out.
Immunomagnetic capture method for M. bovis 253

Acknowledgements: We thank Pablo Huertas and Liliana 12 . Negi SS, Khan SF, Gupta S, Pasha ST, Khare S, Lal S.
Rodriguez from the Institute of Pathobiology (INTA) for their Comparison of the conventional diagnostic modalities,
technical assistance. We also thank Martín Zumarraga and Vir- Bactec culture and polymerase chain reaction test for
ginia Meikle from the Institute of Biotechnology (INTA) and Elida diagnosis of tuberculosis. Indian J Med Microbiol 2005;
Gentilini (University of Buenos Aires) for their advice. This work 23: 29-33.
was supported by grants from INTA. AC is a researcher from the 13. Parra A, García N, García A, Lacombe A, Moreno F, Freire
National Research Council of Argentina (CONICET). F, et al. Development of a molecular diagnostic test applied
to experimental abattoir surveillance on bovine tuberculosis.
References Vet Microbiol 2008; 18; 127: 315-24.
14. Rodriguez JG, Mejia GA, Del Portillo P, Patarroyo ME,
Murillo LA. Species-specific identification of Mycobacterium
1. Antognoli MC, Salman MD, Triantis J, Hernández J, Keefe
bovis by PCR. Microbiology 1995; 141: 2131-8.
T. A one tube nested PCR for the detection of Mycobacte-
15. Romero RE, Garzón DL, Mejía GA, Monroy W, Patarroyo
rium bovis in spiked milk samples: an evaluation of different
ME, Murillo LA. Identification of Mycobacterium bovis in
concentration and lytic techniques for M. bovis. J Vet Diagn
bovine clinical samples by PCR species-specific primers.
Invest 2001; 13: 111-6.
Can J Vet Res 1999; 63: 101-6.
2. Aranaz A, Liébana E, Gómez-Mampaso E, Galán JC,
16. Roring S, Hughes MS, Skuce RA, Neill SD. Simultaneous
Cousins D, Ortega A, et al. Mycobacterium tuberculosis
detection and strain differentiation of Mycobacterium bovis
subsp. caprae. subsp. nov. a taxonomic study of a new
directly from bovine tissue specimens by spoligotyping. Vet
member of the Mycobacterium tuberculosis complex iso-
Microbiol 2000; 70: 227-36.
lated from goats in Spain. Int J Syst Bacteriol 1999; 49:
17. Sequeira MD, Latini OA, López ML. Tuberculosis
��������������������
bovina
1263-73.
en seres humanos. II. Período 1977-1989, Rev Arg Tórax
3. Cousins DV, Bastida R, Cataldi A, Quse V, Redrobe S, Dow
1990; 51: 13-7.
S, et al. Tuberculosis in seals caused by a novel member of
18. Sorlozano A, Soria I, Roman J, Huertas P, Soto MJ, Piedrola
the Mycobacterium tuberculosis complex: Mycobacterium
G, et al. Comparative evaluation of three culture methods
pinnipedii sp. nov. Int J Syst Evol Microbiol 2003; 53-5:
for the isolation of mycobacteria from clinical samples. J
1305-14.
Microbiol Biotechnol 2009; 19: 1259-64.
4. Di Lonardo M, Isola NC, Ambroggi M, Rybko A. Mycobacte-
19. Taylor GM, Worth DR, Palmer S, Jahans K, Hewinson RG.
ria in HIV-infected patients in Buenos Aires. Tubercle Lung
Rapid detection of Mycobacterium bovis DNA in cattle lymph
Dis 1995; 76: 185-9.
nodes with visible lesions using PCR. BMC Vet Res 2007;
5. Garnier T, Eiglmeier K, Camus JC, Medina N, Mansoor
3: 1-12.
H, Pryor M, et al. ��������������������������������
The complete genome sequence of
20. Thierry D, Brisson-Noël A, Vincent-Lévy-Frébault V, Nguyen
Mycobacterium bovis. Proc Natl Acad Sci USA 2003; 100:
S, Guesdon JL, Gicquel B. Characterization of a Mycobac-
7877-82.
terium tuberculosis insertion sequence IS6110 and its appli-
6. Grant IR, Ball HJ, Rowe MT. Isolation of Mycobacterium
cation in diagnosis. J Clin Microbiol 1990; 28: 2668-73.
paratuberculosis from milk by immunomagnetic separation.
21. Vitale F, Capra G, Maxia L, Reale S, Vesco G, Caracappa
Appl Enviromnt Microbiol 1998; 64: 3153-8.
S. Detection of Mycobacterium tuberculosis complex in
7. Haddad N, Masselot M, Durand B. Molecular differentiation
cattle by PCR using milk, lymph nodes, aspirates and nasal
of Mycobacterium bovis isolates. Review of main techniques
swabs. J Clin Microbiol 1998; 36: 1050-5.
and applications. Res Vet Sci 2004; 76: 1-18.
22. Wards BJ, Collins DM, de Lisle GW. Detection of Mycobac-
8. Hermans PW, van Soolingen D, Dale JW, Schuitema AR,
terium bovis in tissues by polymerase chain reaction. Vet
McAdam RA, Catty D, et al. Insertion element IS986 from
Microbiol 1994; 43: 227-40.
Mycobacterium tuberculosis: a useful tool for diagnosis and
23. Zanini MS, Moreira EC, Lopes MT, Oliveira RS, Leão SC,
epidemiology of tuberculosis. J Clin Microbiol 1990; 28:
Fioravanti RL, et al. Mycobacterium bovis: Polymerase chain
2051-8.
reaction identification in bovine lymph node biopsies and
9. Khare S, Ficht TA, Santos RL, Romano J, Ficht AR, Zhang
genotyping in isolates from southeast Brazil by spolygoty-
S, et al. Rapid and sensitive detection of Mycobacterium
ping and restriction fragment length polymorphism. Mem
avium subsp. paratuberculosis in bovine milk and feces by
Inst Oswaldo Cruz 2001; 96: 1-5.
a combination of immunomagnetic bead separation-con-
24. Zumarraga MJ, Cataldi A, Bigi F, Alito A, Romano MI. Apli-
ventional PCR and Real-Time PCR. J Clin Microbiol 2003;
cación de la reacción en cadena de la polimerasa (PCR) en
42: 1075-81.
la detección de micobacterias en leche. Rev Arg Microbiol
�������������������������������������������������������
10. Liébana E, Aranaz A, Mateos A, Vilafranca M, Gomez-
1999; 31 (Supl.1): 4-5.
Mampaso E, Tercero JC, et al. Simple
���������������������������
and rapid detection
25. Zumarraga MJ, Meikle V, Bernardelli A, Abdala A, Tarabla
of Mycobacterium tuberculosis complex organisms in bovine
H, Romano MI, et al. Use of touch-down polymerase chain
tissue samples by PCR. J Clin Microbiol 1995; 35: 33-6.
reaction to enhance the sensitivity of Mycobacterium bovis
11. Miller JM, Jenny A, Rhyan J, Saari D, Suarez D. Detection
detection. J Vet Diagn Invest 2005; 17: 232-8.
of Mycobacterium bovis in formalin-fixed, paraffin-embedded
26. Zumarraga MJ, Paolicchi F, Garbaccio S, Giofree A, Cataldi
tissues of cattle and elk by PCR amplification an IS6110
A. Aplicación de la PCR en la detección de Mycobacterium
sequence specific for Mycobacterium tuberculosis complex
bovis en muestras de tejido de terneros. Vet Arg 2001; 18:
organisms. J Vet Diagn Invest 1997; 9: 244-9.
668-76.

Recibido: 18/05/2010 – Aceptado: 09/08/2010