Anne Marian Anak Joseph

478, Taman Lee Ling,

Lorong 2B-1, Jalan Matang,
93050 Kuching.
____________________________________________________________________________
Dr Ibrahim Bin Yakub
Programme Coordinator,
Master of Engineering(Energy & Environment) ,
Faculty of Engineering (FENG),
Universiti Malaysia Sarawak,
94300 Kota Samarahan. 18th July 2020

Request Appeal upon entering the Postgraduate studies Coursework mode

Dear, Dr.

My name is ​Anne Marian anak Joseph​, and I’m an alumnus of UNIMAS graduate of class
2018, would like to appeal to you and the board of the Engineering faculty to allow me to enter
the postgraduate programme via coursework mode on the ​Master of Engineering in Energy
and Environment​.

My credibility as per requirement of the programme is that I am a graduate of ​Bachelor in

Science Resource Biotechnology​, with the ​CGPA 2.93​ and according to the requirement
stated on the prospectus of the programme, I am eligible but preferably to be an Engineering
graduate instead. Allow me to prove my credibility into entering this programme.

Back in ​2018​, I was the representative of UNIMAS and one of the few selected ones from
Malaysia to represent the country to become one of the Youth ASEAN leaders where we were
presenting to the other representatives of the ASEAN countries on the Environmental issues
that was happening at the time in Vietnam and Malaysia. We had a collaboration with the Youth
ASEAN leaders of Vietnam where I had received the honorary ​Outstanding Leader Award​.

Other than that, I’ve also aided one of the researchers in the ​Faculty of Resource Science
and Technology​, on the ​Isolation and Characterisation of ​ABCC1 ​promoter sequence in
Danio rerio.​ In this research, we were doing bioinformatics to identify and characterise the said
gene in the GenBank Database. It was a success knowing that we have identified it using wet
laboratory work as well as calculations retrieved from NCBI (National Center for Biotechnology
Information).

Currently, I am a ​part time Science teacher​ at ​St Joseph’s Private Secondary School​ in
Kuching. I have been in the past months, teaching students via physical and online school as of
during the pandemic. I am also a​ STEM club teacher​ monitoring students in ​Robotics and
Programming​ for the school.
 Therefore, I implore to you that you as well the rest of the board of lecturers in the
Faculty of Engineering may reconsider to take me in as your student as I, in my humblest
opinion, am able to cope with the programme structure of the course. Attached to this letter are
my pictures from the Asian Youth Leader and Travel Camp 2018, and my research thesis.

With sincerity,
Anne Marian Joseph.
Asian Youth Leaders and Travel Camp 2018
 Isolation and Characterisation of ABCC1 promoter sequence from Danio rerio

Anne Marian Anak Joseph

Resource Biotechnology Programme
Faculty of Resource Science and Technology
University Malaysia Sarawak

ABSTRACT
The ABCC1 promoter sequence is one of the collectively mediates the ATP-dependent
transmembrane efflux of multiple anticancer drug and other xenobiotics. It is also a transportation
for the hydrophobic and anionic molecules such as glucuronide and glutathione (GSH)
conjugation. By using isolation and cloning principle, this research is able to clone the ABCC1
promoter sequence into the pZsGreen 1-1 plasmid for it to be microinjected into the Danio rerio
to observe at which developmental stage of the Danio rerio is expressed. By using a pair of
-TTTGGAACCACTTTAGGTTG- -
AACCACTGCTGTGTGTTATG-
where the product is able to derive 1442 bp in length. Sequencing result of 96% similarity to the
Zebrafish DNA sequence from clone DKEYP-72E1 in linkage group 3 with E-value of 0.0. In
which also, fluorescence was obtained at 144 hpf at the heart of the zebrafish. These results may
suggest that the promoter gene expression starts at the protruding mouth developmental stage of
the fish which is beneficial to future cancer treatment studies in the later years.
Keywords: ABC transporters, ABCC1 promoter sequence, Danio rerio, PCR

ABSTRAK
Susunan promoter ABCC1 adalah salah satu yang mengantarkan secara kolektif efflux
transmembran yang bergantung kepada ATP ubat antikanser dan xenobiotik lain. Ia juga
merupakan pengangkutan untuk molekul hidrofobik dan anionik seperti konjugasi glucuronide
dan glutathione (GSH). Dengan menggunakan prinsip pengasingan dan pengklonan, penyelidikan
ini dapat mengklonkan jujukan promotor ABCC1 ke plasmid pZsGreen 1-1 agar ia dimasukkan
ke Danio rerio untuk melihat di mana tahap perkembangan Danio rerio dinyatakan. Dengan
menggunakan sepasang primer, maju 5'-TTTGGAACCACTTTAGGTTG-3' dan terbalik 5'-
AACCACTGCTGTGTGTTATG-3' yang direka untuk mengasingkan kawasan promoter urutan
gen, di mana produk dapat memperoleh 1442 bp panjang. Keputusan urutan 96% kesamaan
dengan urutan DNA Zebrafish dari clone DKEYP-72E1 dalam kumpulan hubungan 3 dengan E-
nilai 0.0. Di mana juga, pendarfluor diperoleh pada 144 hpf di tengah-tengah zebrafish.
Keputusan ini mungkin menunjukkan bahawa ekspresi gen promoter bermula pada tahap
perkembangan mulut yang menonjol ikan yang bermanfaat untuk kajian rawatan kanser masa
depan pada tahun-tahun kemudian.
Kata kunci: Transporter ABC, ABCC1 promotor, Danio rerio, PCR
CHAPTER 2: INTRODUCTION

2.1 Background

The advancements of science these days have led to many scientific breakthrough and one of them

is the study of ABCC1 in the medical sciences. The main function of ABCC1 gene is collectively

mediates the ATP-dependent transmembrane efflux of multiple anticancer drug and other

xenobiotics. Other than that, ABCC1 also functions in transportation of hydrophobic and anionic

molecules such as glucuronide and glutathione (GSH) conjugation, whereby it also transports

vincristine and other various anti-cancer drugs. Vincristine is an anti-cancer chemotherapy drug

where it treats various cancers as well as some blood disorders. Other than that, ABCC1 is

responsible in the conjugation of GSH where it prevents the oxidative stress where at the cellular

level being regulated by the said gene. It also conjugate GSH, oxidised GSH and the cysteinyl-

leukotriene (cys-LT) leukotriene

C4(LTC4).

In other studies, it is found that if ABCC1 gene is knocked out, it will display a high levels

of glutathione content as the mechanism for the drug efflux is absent and thus spiralling towards

imbalance of drug toxification.

According to Winter et al. (2013), in acute lymphoblastic leukemia (ALL), the multidrug

resistance is usually assisted by ATPase Binding Cassette (ABC) proteins. In this experiment, they

have used Vincristine (VCR) which plays an important role where it overexpressed the ABCC1

nearly 30-fold. For the intended experiment, the main goal is to find out how and what made the

ABCC1 to be expressed within the promoter region which leads us to the transcription factors of

the said gene.

 In other words, the transcription factor are the main cellular components in gene expression

control as their activities determine how cells function as well as respond to the environment. In

this era, where the genetic studies are commonly conducted, many scientists are racing against

time as well as each other to determine the functionality of the transcription factor in gene

expression at specific tissues (Vaquerizas et al., 2009). Likewise, this study is also aimed to

provide an insight look on how to tackle overexpression of ABC transporters playing a

contributing role in mediating treatment failure of various chemotherapy.

2.2 Problem Statement

In this study, the promoter sequence of ABCC1 is studied for its functionality and verification of

its function within the zebrafish Danio rerio as well as its aid in the advancements of anticancer

treatment.

2.3 Objectives

In this study, aimed:

To isolate ABCC1 promoter region.

To identify the transcription factors which regulate the promoter region.

To study the functionality of the promoter region through in vivo approach.

CHAPTER 3: LITERATURE REVIEW

3.1 ABC superfamily

The ABC are known as the ATP-binding cassette transporter which coincides as the integral

membrane proteins as well as one of the largest superfamily pervasively present in the phyla world

(Aryal et al., 2015). Majority of the ABC proteins functions as primary active transporters which

is required in the binding and hydrolysis of ATP for the transportation of numerous substrates: -

originally from the cytosol to intracellular or extracellular regions (Dermauw et al., 2014; Liu et

al., 2013).

Figure 3.1 Overview of ABC transporters and their functions. (Adaptation from Aye et al., 2009)

According to Figure 1, there are eight subfamilies branching from the ABC superfamily

from ABCA through ABCH with each group are identified by their degree of homology in amino

acid. With all ABC members are found in mammals excluding ABCH (Popovic et al., 2010). Three

of the eight subfamilies of the ABC subfamilies, specifically ABCB/Abcb, ABCC/Abccand

ABCG/Abcg known to contain drug transporters, as well as proteins having roles unrelated to drug

transport (Lukenbach et al., 2014). In humans, the most important ABC drug efflux pumps are

ABCB1, ABCC1, ABCC2 and ABCG2 (Schinkel and Jonker, 2003; Leslie et al., 2005).

For ABCB subfamily, they possess both full transporters (FT) and half transporters (HT)

of which the latter are in the intracellular membranes and have evolutionarily conserved

physiological roles unrelated to drug transport (Abele &Tampé, 2006; Burke and Ardehali, 2007;

Herget and Tampé, 2007). For ABCC subfamily, it is known as the drug efflux in human as well

as being known to be a large complex, containing both FT and HT. ABCC1 and ABBC2 are well

studied drug efflux transporters (Schinkel & Jonker, 2003; Leslie et al., 2005). For ABCG

subfamily, they contain the drug transporter ABCG2 as well as members involved in sterol

metabolism (Wang et al., 2004; Hazard & Patel, 2007).

3.2 General mechanism of ABC transporters

ABC transporters are classified into exporters and importers where the importers are further

aggregated into two classes (I and II), imposed on details of their architecture and mechanism

(Reese, Johnson, & Lewinson, 2009; terBeek, Guskov, & Slotboom, 2014; Holland & Blight,

1999). ABC transporters are required to pump transport substrates against a chemical gradient, a

modus operandi that depends upon ATP hydrolysis as an incentive (Wilkens, 2015). The ABC

transporters functions in a single direction under physiological condition (either import or export),

although the drug efflux pump (LmrA) has been known to be reversible under certain situations

(Balakrishnan et al., 2014) meaning that the membrane domain must function in one or more

- -binding

domain (NBD).
 The mechanism is also associated by the major facilitator superfamily (MFS) of secondary

transporters, in which case the driving force is provided by the potential energy of the chemical

s and sodium ions as an example (Reddy

et al., 2012).

Figure 3.2(a) Structure mechanism of ABC transporters - Part 1 (Adaptation from Wilkens, 2015)

As shown in Figure 3.2(a), the inward-

the cytoplasm or the inner leaflet of the bilayer. Two molecules of MgATP are bound, the NBDs

are then dimerised and switched the transmembrane domain (TMDs) from the inward-facing

exporter to the outward-facing conformation, followed by the release of the drug to the

extracellular milieu. ATP hydrolysis, ADP/Pi release and NBD dissociation resets the transporter

to the inward-facing conformation.

Figure 3.2(b) Structure mechanism of ABC transporter - Part 2 (Adaptation from Wilkens, 2015)

In Figure 3.2(b), the substrate containing periplasmic binding protein binds with the

inward-facing type I transporter (e.g., MalFGK2) as well as two molecules of MgATP NBDs

dimerise and results in the outward-facing conformation. The substrate leaves the binding protein

and binds to the transmembrane domain (TMDs) mid-membrane. The ATP is hydrolysed and

products was released, altogether with the NBD dissociation resetting the transporter to the inward-

facing conformation.

Figure 3.2 (c) Structure mechanism of ABC transporters - Part 3 (Adaptation from Wilkens, 2015)

Based on Figure 3.2(c), the outward-facing type II importer (i.e. BTUCD) binds to the substrate

binding protein as well as two molecules of MgATP. Dimerization of the NBDs results in the
occluded conformation with substrate confined to a sealed cavity mid-membrane. With ATP

hydrolysis ever ensuing and NBD dissociation allowing the substrate to escape into the cytoplasm.

A fourth, asymmetric, conformation as seen for BtuCDF is not shown.

3.3 ABCC1 gene

The ABCC subfamily is made up of 12 proteins, whereby at least nine of which are

collectively mediate the ATP-dependent transmembrane efflux of multiple anticancer drug and

other xenobiotics, their metabolites and an assortment of bioactive organic anion (OAs), including

multiple key signalling molecules (Slot et al., 2011). The focus of this experiment is the ABCC1

gene also known as multiple resistance protein 1 (MRP1). Its main function in vertebrates is that

it exports chemotherapeutic agents and organic anions, such as I leukotriene C(4) (LTC(4)), 17

beta-estradiol 17- (beta-d-glucuronide) (E(2)17betaG), estrone 3-sullfate, methotrexate (MTX),

and glutathione (GSH) (Haimeur et al., 2002).

Figure 3.3 ATP-dependent MRP1/ABCC1-mediated transport of endogenous and xenobiotic

solutes. (Adaptation from Cole, 2014)

The diagram illustrates the diversity of molecules effluxed by MRP1/ABCC1 across the plasma

membrane in an ATP-dependent manner. The transportation of ABCC1 is powered by the binding

as well as the hydrolysis of ATP, which aids the necessary protein conformation changes that

enable the solute translocation.

3.4 Transcription factors that regulate gene expression of ABC transporter

Transcription factors functions as a large part in gene regulatory network connection not to

mention the quantification level if a gene expression. It also gives an intense regulation in

conducting post-translational modifications of transcription factor or binding of co-regulators.

Researches have been made that the transcriptional regulation of the human ABC transporter

highly dependent on the function of the efflux of chemotherapeutic agents from the cells itself

mainly cancer cells.

Various efforts have been made over the years, where the fate of the gene is found to be under the

complexity and accessibility of the response within the promoter. Other than that, the dynamic of

the multiprotein complexes the form, therefore, the nature of it is hugely dictated by the

architecture of the promoter and yet subtly influenced by various signals (Neeley and Workman,

2002).

3.5 Cyprinidaefamily

According to Nelson, 2006; the most manifold freshwater fish family covering of over 220

genera with at least 2,420 species known is the Cyprinidae family. The Cyprinids are native to

Africa, Eurasia, and North America. Beneath the freshwater of Borneo, they are also found with

the exemptions of Sulawesi regions (Berra, 2007). With their restricted capability to migrate across
the seawater as well as their distribution range, the Cyprinids have attracted the interest of the

biogeographical field on the landscape geological evolution (Durand et al., 2002).

According to Sharma et al. (2014), an alignment if monophyletic group of Cyprinids were

conducted via phylogenetic analysis based on their morphology. Thus, splitting the Cyprinidae

family into two main lineages: the Cyprinine (barbine) and Leuciscine (Wang et al., 2012). By the

basis of their barbal distribution, the Cyprinine can be subdivided into Gobioninae, Cyprininae

and Danioninae subfamilies.

The zebrafish Danio rerio, a member of the subfamily Danioninae is one of the most

significant vertebrate model organisms for various toxicity and developmental biology

experiments up-to-date.

3.6 Zebrafish, Danio rerio

The zebrafish, Danio rerio is a tropical freshwater fish where it is an important and widely

used vertebrae model organism in scientific research, where it was one of the first vertebrates to

be cloned. It is known that the mouse and human genomes share large blocks of chromosomal

structure where it would resemble that of the human (Postlethwait et al., 1998). This assisted in

the positional cloning of the zebrafish genes, which can utilise information from the Human

Genome Project. One of the reasons of why zebrafish is the most appropriate candidate for this

experiment is: It is one of the simplest vertebrate with good genetics where the genome analysis

is well under way, the embryological manipulations are made possible.

With continued development of genomic tools for the zebrafish system, there is a greater likelihood

of the identification of the function of newly discovered genes and determination of relevance to

human disease (Streisinger et al., 1981; Streisinger et al., 1986).

CHAPTER 4: MATERIALS AND METHODS

Materials:

0.1M CaCl2
10X Easy Taq Buffer

2.5 mM dNTPs

2X Rapid Ligation Buffer T4 DNA Ligase

Agarose powder

Easy Taq Polymerase

EasyPure PCR Purification Kit (TransGen, China)

Glycerol solution

Isopropanol

LAIX (LB agar/Ampicillin/IPTG/X-Gal)

pGEM-T Easy Vector (50 ng)

T4 DNA Ligase (3 weiss units/µL)

TAE (Tris-acetate EDTA) buffer

ddH2O
Methods:

PART A: Promoter Sequence ligation into pGEM T-Easy Vector

4.1 Maintenance of Danio Rerio Fish

Danio rerio

under 12 hours dark and light photoperiod in the laboratory fish tank.

4.2 Total DNA Extraction

The Danio rerio zebrafish was harvested and killed in a humane way by placing it in a

beaker filled with ice. The fish was then cut and placed into a 2 mL microcentrifuge tube. Then,

the tube containing the fish tissue sample was then lysed using 910 µL of lysis buffer prepared

50 minutes in water bath where occasionally

5 10 minutes interval the tissue was inspected to make sure it has fully lysed. After it is fully

lysed, it was then centrifuged at 13 000 rpm for 10 minutes where the supernatant collected will

be isolated and placed into a new 2 mL microcentrifuge tube.

Next, the new 2 mL microcentrifuge tube containing the supernatant was then filled with

Phenol Chloroform Isoamyl (PCI) solution of 25:2:1 volume where it was then mixed properly by

gently inverting. It was then left for 10 minutes for the precipitation of proteins and nucleic acids

to occur. About 10 minutes later, the microcentrifuge tube was then centrifuged for 10 minutes at

13 000 rpm. After centrifuging, the contents in the microcentrifuge where an aqueous top layer

present was transferred into a new 1.5 mL tube where an equal amount of isopropanol for DNA

precipitation was added. It was then left for about 10 minutes to set.
 About 10 minutes later, the tube was then centrifuged at 13 500 rpm for 10 minutes where

after, the supernantant was discarded by pouring gently out of the tube leaving the DNA pellet in

the tube. The pellet was then washed using 70% ethanol that was chilled before the tube was

centrifuged again at 12 500 rpm for 5 minutes where after, the supernatant was discarded. The

pellet was air dried for about 30 minutes. Finally, the DNA pellet was resuspended with 20 µL.

4.3 Agarose Gel Electrophoresis

1.5% of agarose gel was prepared using 0.375 g of agarose powder and 25 mL 1X TAE buffer.

The mixture was heated in a microwave until it was boiled partially and the powder dissolves. The

into the gel tray; whilst

avoiding bubble formation. The comb was inserted into the gel tray and it was left to solidify for

30 minutes. 2 µL of 6X loading dye and 5 µL of genomic DNA sample was added to load into the

gel. The gel was run at 80V for 40 minutes in 1X TAE buffer. The gel was post stained with

ethidium bromide for 45 minutes and the band was visualised under the UV transilluminator.

4.4 Primer Design and Synthesis

ABCC1 gene Danio

rerio

Its promoter region was determined in the sequence where 2 pairs of short sequence was retrieved

to be used in the Primer BLAST where the 10 pairs of primers were given. The selection of the

primers was done according to the designated size of the PCR product.
4.5 Temperature Optimisation Via Gradient PCR

A primer pair of ABCC1 gene of Danio rerio

determine the optimum annealing temperature for the primers. PCR was performed in a 20 µL

TTTGGAACCACTTTAGGTTG - -

AACCACTGCTGTGTGTTATG - M).

Table 4.5 (a) Components of PCR master mix for ABCC1 gene
Components Final 1X Concentration 3.5X Concentration
Concentrations (µL) (µL)
ddH2O N/A 14.6 51.1
10X Easy Taq Buffer 1X 2.0 7.0
2.5 mM dNTPs 0.2 mM 1.6 5.6
10 µM ABCC1 forward 0.2 µM 0.4 1.4
primer
10 µM ABCC1 reverse 0.2 µM 0.4 1.4
primer
Genomic DNA As required 0.8 2.8
extraction
Easy Taq Polymerase 2.5 units 0.2 0.7
Final Volume - 20.0 70.0

Table 4.5 (b) Thermal Cycling parameters for 35 cycles

Stage Temperature (°C) Duration

Pre-denaturation 95.0 3 mins
Denaturation 95.0 30 secs
Annealing 50.0 - 55.0 30 secs
Extension 72.0 1.30 mins
Final Extension 72.0 5 mins
After the polymerase chain reaction was run, it was tested for presence and verification via Agarose

Gel Electrophoresis where it was confirmed.

4.6 PCR Purification

After the PCR product has finished its cycle in the thermocycler, the PCR product was then

purified using TRANSGEN EasyPure® PCR Purification Kit. In a 1.5 mL microcentrifuge tube,

where 75 µL of Binding Buffer (5 volumes) was added to 15 µL of PCR products (1 volumes).

The sample was then mixed by vortexing.The mixture was then transferred into the Spin Column

included with a collection tube slowly avoiding the membrane from the pipette tips touching the

membrane. It was then centrifuged at 10 000 rpm for 1 minute. Soon after, the flow through was

discarded.

After, 650 µL of wash buffer (WB) was added into the column where it was centrifuged at

10 000 rpm for 1 minute where the flow-through was discarded after it was centrifuged. The empty

column was centrifuged again at 10 000 rpm for 1-2 minutes to remove any residual WB. After,

the spin column was then placed into a clean microcentrifuge tube, where 30 µL of Elution Buffer

(EB) was placed directly to the centre of the column matrix. The column was then incubated for 1

minute at room temperature before it was centrifuged at 10 000 rpm for 1 minute to elute the DNA.

To confirm its presence, an AGE test was done to determine its presence and confirming

its size.

4.7 Escherichia Coli XL1-BLUE Competent Cell Preparation

10 µL of cells were harvested from Escherichia coli XL1-Blue stock where it was

subcultured in 10 mL of Luria Bertani

day, 1 mL of the overnight cell culture was transferred into 20 mL fresh LB broth. The tube was

then vigorously shaken for an hour before 1 mL of cells was aliquoted into sterile ice-cold
was then decanted from cell pellets using micropipette until it turns sufficiently dry, before

inserting it back on ice.

The pellets were then resuspended in 160 µL of ice cold 0.1M CaCl2 and insert back into ice for

decanted from cell pellets until it becomes sufficiently dry before inserting it back into the ice. The

pellets was then resuspended in 80 µL ice cold 0.1M CaCl2 before adding 80 µL of 40% glycerol

solution to protect the competent cells for a long-term storage. The competent cells were then

stored in

4.8 Ligation and Bacterial Transformation of Escherichia Coli XL1-BLUE Competent Cell

Ligation mixture is prepared according to the table below:

Table 4.8 (a) Components for Ligation mixture for ABCC1

Components Standard Reaction

2X Rapid Ligation Buffer, T4 DNA Ligase 5 µL

pGEM-T Easy Vector (50 ng) 1 µL

PCR product (purified) 3 µL

T4 DNA Ligase (3 weiss units/µL) 1 µL

TOTAL VOLUME 10 µL

After the ligation mixture is prepared, 5 µL of the ligation mixture is transferred into a 1.5 mL

microcentrifuge tube where 80 µL of freshly thawed competent cells are added using a cold sterile

r 50 seconds, followed by replacing it

back on ice for 2 minutes. Then, 900 µL of ice cold LB medium was added into the tube and was

placed at a room temperature.

 f cell

suspension was then transferred using micropipette and was spread onto a prepared LAIX plates

4.9 Secondary Colony Plating

In the following day, the white colonies are then picked for the secondary colony plating which

was divided into 9 sections that was drawn, where only 5 white colonies were present to be streak

onto the designated sections. LAIX plates were prepared before each colony.
4.10 Colony Polymerase Chain Reaction (PCR)

A primer pair of ABCC1 gene of Danio rerio

determine the optimum annealing temperature for the primers. PCR was performed in a 20 µL

microce -

TTTGGAACCACTTTAGGTTG - -

AACCACTGCTGTGTGTTATG -

Table 4.10 (a) Components of PCR master mix for ABCC1 gene
Components Final 1X Concentration 5.5X Concentration
Concentrations

N/A 15.4 µL 84.7 µL

10X Easy Taq Buffer 1X 2.0 µL 11.0 µL

2.5 mM dNTPs 0.2 mM 1.6 µL 8.8 µL

10 µM ABCC1 0.2 µM 0.4 µL 2.2 µL

forward primer

10 µM ABCC1 reverse 0.2 µM 0.4 µL 2.2 µL

primer

Colony unit As required - -

Easy Taq Polymerase 2.5 units 0.2 µL 1.0 µL

Final Volume - 20.0 µL 110.0 µL

After the polymerase chain reaction was run, it was tested for presence and verification via AGE

where it was confirmed.

4.2.11 Subculture Luria Bertani Broth

10 mL of LB broth was placed into the universal bottle with 10 µL of Ampicillin. Then, the selected

colony that the presence of the ligation was confirmed based on the AGE result was picked and

placed into the bottle by using a micropipette tip where it was left inside the bottle for 16 hours

4.2.12 Miniprep Plasmid Preparation

The overnight cultured bacterial suspension was added into the microcentrifuge tube where it was

centrifuged at 11 000 rpm for 1 minute until the contents of the universal bottle was emptied. After

the contents were obtained, 250 µL of resuspension buffer (RB) was added to the microcentrifuge

tube with the contents. The mixture was resuspended by using a micropipette until the contents are

mixed thoroughly in the microcentrifuge tube.

Then, 250 µL of Lysis buffer was added immediately where it was mixed thoroughly by

inverting the tube 4-6 times. After mixing, the tube was left for 5 minutes before adding 350 µL

of neutralisation buffer into the microcentrifuge tube where it was mixed thoroughly by inverting

the tube 4-6 times, the lysate turned to yellow when the neutralisation was completed and a

yellowish precipitate was formed. The lysate was then incubated at room temperature for 2

minutes. Then, it was centrifuged at 13 000 rpm for 5 minutes. The supernatant was then

transferred into a spin column.

The spin column was then centrifuged at 13 000 rpm for 1 minute. The flow through was

then discarded. 650 µL of wash buffer WB (ethanol included) was added to the column. It was

then centrifuged at 13 000 rpm for 1 minute. The flow through was discarded. The empty spin

column was then centrifuged again at 13 000 rpm for 1-2 minutes to remove the residual WB
completely. Agarose Gel Electrophoresis was then done for confirmation of the presence of the

plasmid.

PART B: Promoter Sequence Ligation into pZsGreen 1-1 Vector

4.13 Plasmid pZsGreen 1-1 Culture

The bacterial plasmid pZsGreen 1-1 stock was cultured into the LB broth with addition of

Kanamycin as selectable marker followed by the plasmid mini prep procedure.

4.14 Restriction Enzyme Digestion (RE)

The isolated pGEM-T Easy vector with DNA insert and the isolated plasmid pZsGreen 1-

1 was placed intoseparate microcentrifuge tubes. The restriction digestion mixture was prepared

by using the components listed in Table 4.14 beginning with enzyme SacI prior to adding the

enzyme EcoR1. Subsequently, the mixture was gently mixed and spun for a few seconds.

SacI digestion,

EcoRI r 1 hour, followed by incubation at

analysed using 1.5% AGE analysis. The pZsGreen 1-1 was then purified after the AGE

confirmation.
Table 4.14 Components for Restriction Digestion mixture for ABCC1
Components Standard Reaction

Sterile 8 µL

10x assay buffer 2 µL

Plasmid DNA 8 µL

Restriction Enzymes 1 µL (SacI) + 1 µL (EcoRI)

TOTAL VOLUME 20 µL

4.15 Gel Cut and Purification

The DNA fragment from the agarose gel was excised using a scalpel. The gel slice was

weighed and placed into the 1.5 mL microcentrifuge tube. 207 µL of Gel solubilisation Buffer was

added into the microcentrifuge tube. It was -10 minutes until the gel

slice has completely dissolved. It was mixed by vortexing the tube every 2-3 minutes in order to

dissolve the gel during the incubation. Once the gel was completely dissolved, the colour of the

solution was observed.

To increase the yield of the DNA, 69 µL of isopropanol was added to the gel solution. After

the temperature of the solution returns to room temperature, the solution was then transferred into

a spin column. It was incubated for 1 minute at room temperature before being centrifuged at 11

000 rpm for 1 minute. The flow through was discarded.

650 µL of WB was added into the spin column before being centrifuged at 11 000rpm for

1 minute. The flow through was discarded. The empty spin column was then centrifuged again at

11 000 rpm for 1-2 minutes to remove the residual WB. The spin column was then placed into a

clean microcentrifuge tube, where 30-50 µL of EB was added directly to the centre of the column
matrix. The column was then incubated at room temperature for 1 minute. The column was then

centrifuged at 11 000 rpm for 1 minute to elute the DNA. The DNA is now purified ready to be

used.

4.16 Cloning of Promoter Into pZsGreen 1-1

Ligation mixture is prepared according to the table below:

Table 4.16 Components for Ligation mixture for ABCC1 gene with pZsGreen 1-1 vector.
Components Standard Reaction

2X Rapid Ligation Buffer, T4 DNA Ligase 5 µL

pZsGreen 1-1 plasmid 1 µL

DNA insert (purified) 3 µL

T4 DNA Ligase (3 weiss units/µL) 1 µL

TOTAL VOLUME 10 µL

After the ligation mixture is prepared, 5 µL of the ligation mixture is transferred into a 1.5 mL

microcentrifuge tube where 80 µL of freshly thawed competent cells are added using a cold sterile

pipette tips and was hea

back on ice for 2 minutes. Then, 900 µL of ice cold LB medium was added into the tube and was

placed at a room temperature.

aker for 90 minutes. After, 80 µL

of cell suspension was then transferred using micropipette and was spread onto a prepared LAIX

plates in addition of Kanamycin using a sterile spreader stick. The plates are then left to incubate

llowing day, the colonies goes through a secondary plating using

then run through a colony PCR on the following day to confirm the presence of the plasmid insert

via AGE analysis.

After confirming its presence via AGE analysis, the colonies confirmed with the presence

of the plasmid insert were then cultured in LB broth in addition to Kanamycin for 16 hours at 37

smid preparation was done via using the

EasyPure® Plasmid MiniPrep Kit (TransGen, China) to obtain the plasmid.

CHAPTER 5: RESULTS

5.1 Total DNA Extraction

1 2 3 4 5

10kb

1kb

Figure 5.1 AGE results for ABCC1 genomic DNA

As shown in Figure 5.1, DNA extraction using SDS lysis buffer was successfully isolated genomic

DNA from whole fish of Danio rerio (zebrafish). The approximate size of the genomic DNA band

was larger than 10 kb as compared the the 1kb ladder (Lane 1). Slight smearing was observe for

each of the lane.

5.2 Primer Design Analysis

Table 5.2 Characteristics of the forward and reverse primer of ABCC1 promoter gene.

Primer - Position Tm GC% Self Length

(bp) complimentary
Forward TTTGGAACCACTTTAGGTTG 62-81 53.6 40.00 3.00 20
Reverse AACCACTGCTGTGTGTTATG 1503- 56.26 45.00 0.00 20
1484

The primers generated by the NCBI Primer BLAST gave 10 pairs of primers of which the 8 th

primer pair was selescted with having the forward primer at the position between 62-81 bp
self complimentary. Though, the reverse primer at the position between 1503-1484 bp possessing

5.3 Temperature Optimisation Via Gradient PCR

L 1 2 3

1 500 bp
1 000 bp

500 bp

Figure 5.3 AGE results for gradient PCR for ABCC1 gene. Lane L represents the 1kb ladder

(Thermo Scientific GeneRuler 1kb DNA ladder). Lane 1 (54.0°C), 2 (52.4°C) and 3 (49.1°C).

The optimum annealing temperature of the forward and reverse primers of ABCC1 gene were

on 1.5% agarose gel at 80V for 40 minutes. As shown in Figure 5.2, the amplicon size obtained is

in the range of 1400 1500 bp which near to the approximat size of the expected amplicon
5.4 PCR Purification and verification via Agarose Gel Electrophoresis

L 1

1 500 bp 1 400 bp 1 500 bp

PCR purication was conducted to prepare the amplicon for cloning purpose. The result of PCR

purification is shown in Figure 5.4. In the figure above, one single discreet band was observed

indicating the success of the purification. Subsequently, this purified amplicon will be used for

cloning into pGEMT-Easy vector (PROMEGA)

5.5 Transformation of pGEM T-Easy Vector with Insert DNA

(a) (b)

Figure 5.5 (a)LAIX primary culture and (b) LAIX secondary culture with colonies present after

After ligation of the insert DNA with the pGEM T-Easy, it was then cultivated onto the

LAIX plates with ampicillin, IPTG and X-gal where there were colonies present onto the plates on

the following day. The Blue colony represents that there is not DNA insert in the plasmid. The

white colony represents that the DNA insert is present in the plasmid. A secondary plating was

done to culture the white colonies to increase the yield of the insert DNA with the plasmid as

according to the Figure 5.5 (b).

5.6 Colony Polymerase Chain Reaction

L 3 4 7 8 L

Figure 5.6 (a) The figure shows the Agarose Gel Electrophoresis results for the colony PCR that

has been done from the colony picked from the secondary plating.

Colonny PCR was done to confirm the product length of the plasmid and the insert DNA where

by the product length is 1442 base pairs. The plasmid was then cultured in LB broth to increase

its yield. This is followed by miniprep plasmid preparation kit TransGen, China in the Figure 5.6

(b).

L 4

Figure 5.6 (b): AGE result for the (4) plasmid miniprep to ensure its presence before sequencing.
5.7 Plasmid Sequencing Result

The plasmid pGEMT-Easy Vector containing the insert DNA was sent to First BASE for

sequencing to make sure the insert DNA was of ABCC1 gene from Danio rerio. Therefore, after

the plasmid was sent to First BASE the sequencing results was sent back with the information of

the plasmid sequence alongside the control of the plasmid. From then, FinchTV, a software to

view the sequence was used. The chromatogram was used to observe the signal intensity of each

of the nucleotide base whilst comparing with the raw data that was kept from when the primers of

the gene was sent.

Figure 5.7 Analysis from the sequence obtain from the First BASE results.

Based on Figure 5.7, BLAST was done via NCBI database to retrieve information on

identities similarities, gaps, E-value and scores for the sequencing results retrieved. From the

BLAST, it is found that it has 96% of the identities are similar between the sequence that was sent

to First BASE with the sequence available in the NCBI database. The score of 2208 bits with gaps

of 17/1380 which is approximately 1% of the overall percentage.

5.8 Restriction Digestion and Gel Cut for the preparation pZsGreen 1-1 ligation with insert

DNA.

1500 bp

Figure 5.8 (a): Before gel cut Figure 5.8 (b): After gel cut

Based on the figures above, the pGEMT- Easy Vector with the Insert DNA were then

separated via AGE where the insert DNA is at the bottom at 1500 bp based on the VC 1kb

ladder. Which is then cut with the aid of a UV transilluminator for a clearer vision.

Subsequently, the cut gel was then dissolved to be ligated into the pZsGreen 1-1 vector.
5.9 Cloning of pZsGreen 1-1 with promoter DNA insert

(a) (b)

Figure 5.9 (a) Transformation of pZsGreen 1-1 with insert DNA being ligated together.

Based on Figure 5.9 (a), LB agar plating with Kanamycin for the cultivation of the plasmid

colonies to be obtained. Colonies are present within the plating after 16 hours of cultivation at 37

of the plasmid with DNA insert.

Figure 5.9 (c) AGE analysis for the plasmid miniprep

5.10 Microinjection and Fluorescence Microscopic Viewing

Fluorescence
present

Figure 5.10 Microinjected Zebrafish embryo at 144 hpf as view under fluorescence microscope

(a) dorsal and (b) ventral.

Figure 5.10 Wildtype zebrafish embryo at 144 hpf as view under fluorescence microscope (c)

ventral and (d) dorsal.

There is a small fluoresce in Figure 5.10 (b) where the heart is situated fluoresce as per

ventral view compared to the wildtype in Figure 5.10 (d). This may be the fluoresce governed by

the pZsGreen 1-1 plasmid with the ABCC1 promoter gene. The fluorescence shown in the

figures where the yolk is present are known for autofluorescence. Where it fluoresce from the

yolk area up to the intestinal tract.

CHAPTER 6: DISCUSSION

6.1 ABCC1 promoter gene

ABCC1 gene was first found in doxorubicin-selected lung cancer cell line H69AR back in

1992, where the discovery was made where it was like most tumor samples from individuals with

lung cancer, it does not overexpress P-glycoprotein, to which a conclusion was made that a

transmembrane transport protein that is dependent on adenosine triphosphate (ATP) was

associated with multidrug resistance. It is highly expressed in lung, spleen, testis, kidney, placenta,

thyroid, bladder and adrenal gland, but low or no expression in some cells of circulatory system,

such as eosinophils, helper T-cells and erythrocytes in humans.

Based on the curated Zebrafish Model Organism Database (ZFIN), the ABCC1 gene was

found to be expressed in several organs of the Danio rerio, namely the brain, eyes, gills, heart,

intestines, kidney, liver, muscle, ovary, and testis (The Zebrafish Model Organism Database,

2018). The main functions of this protein it to multispecific organic anion transporter, with

oxidized glutatione, cysteinyl leukotrienes, and activated aflatoxin B1 as substrates. This protein

also transports glucuronides and sulfate conjugates of steroid hormones and bile salts. It remains

intriguing since 1992 from in silico evaluation of the promoter, it was found to be in parallel to

what has been previously reported.

There are a few approaches that can be used into studying this promoter. They are, in silico,

immuno precipitation, genome walking and cloning.

In silico analysis are techniques derived particularly as an alternative to animal

experimentation. It requires extensive development methodology including databases, quantitative

structue-activity relationships, similarity searching, pharmacophores, homology models as well as

other molecular modelling, machine learning, data mining, network analysis tools and data

analysis tools that requires a computer. This project has been using in silico in aiding the

completion of this project as extensive research was done before the start of experimentation.

Though, this approach might take long hours of researching as well as time consuming on what

proper software to use and also ethical questioning on the animal model used for the

experimentation.

Other than that, immunoprecipitation is also another approach into studying promoter gene

expression. Immunoprecipitation is a technique used to isolate a specific antigen from a mixture,

using the antigen-antibody interaction. The antigens are isolated by immunoprecipitation are then

analysed by SDS-PAGE or Western blotting. Though it is a good approach, the technique requires

special technical skills to obtain functional results.

Genome walking is also another approach to study promoter gene expression. Genome

walking is a method for determining the DNA sequence of unknown genomic regions flanking a

region of known DNA sequence. It is ideal for identifying gene promoter regions where only the

coding region.

Last but not least, a way to approach the study of promoter gene expression is cloning.

Cloning, isolation and characterisation of replication of through complex plasmid genomes. The

physical proximity between the plasmid replication functions as generally applicable for the

identification and isolation of designated regions.

6.2 Sequence Analysis

The pGEMT-Easy and DNA insert plasmid was sent to First BASE for sequencing. The

results were then viewed on FinchTV to observe the chromatogram to decipher its peaks as well

as its signal intensity via the four bases of different colours. It was compared with the raw data

that was in possession to ensure the similarities between the two sequences. There was an unknown

nucleotide present within the analysis as it occurs occasionally due to the software not being able

to identify the identity of the entity present within the plasmid.

Alongside that, when it was BLAST again for confirmation, there were gaps present of 17

out of 1380 which was about 1%. This is due to the space introduced into an alignment to

compensate for insertions and deletions in one sequence relative to another. It is used to prevent

the accumulation of too many gaps in an alignment, introduction of a gap causes the deduction of

a fixed amount (the gap score) from the alignment score. Extension of the gap to encompass

additional nucleotides or amino acid is also penalized in the scoring of an alignment. The sequence

was aligned with the sequence available within the NCBI database.

6.3 Microinjection fluorescence analysis

Microinjection was done in this project where the plasmid was injected into the embryo

supposedly at 4-cell stage but was unsuccessful due to the fish breed duration in which the

microinjection was done at 1000-

already difficult to penetrate at that time. The embryo was then viewed at 144 hpf where

fluorescence was seen under the microscope where a fluorescence was found. At 144 hpf, this is

where the zebrafish has reached its stage of the protruding mouth where its organs particularly the
heart develops further. Therefore, the presence of the promoter gene has fluoresced gave a

confirmation that it is present within the developmental stage.

The natural fluorescence is usually caused by due in large part tosubstances like flavins

and porphyrins. These compounds are generallyextracted by solvents and aren't much of a problem

in fixed, dehydrated sections. This is due to most biological specimens containing a large number

of fluorescent molecules that produces autofluorescence. Each species has a unique absorption and

emission depending on the excitation wavelength of the microscopy light emission. To tackle the

problem of autoflourescence is to have an idea of the source of the fluorescence. Identification of

the species likely responsible for autofluorescence would enable the optimisation of experimental

conditions to reduce its concentration or suppressing its ability to fluoresce. According to Table

6.3, these are usually the elements that are responsible in autofluorescence according to the species,

typical emission wavelength, and typical excitation emission wavelength.

Autofluorescent Source Typical Emission Typical Excitation

Wavelength (nm) Wavelength (nm)

Flavins 520 560 380 490

NADH & NADPH 440 470 360 390

Lipofuscins 430 670 360 490

Advanced Glycation end- 385 450 320 370

products (AGEs)

Elastin and collagen 470 520 440 480

Lignin 530 488

Chlorophyll 685 (740) 488

Table 6.3 Common Sources of Autofluorescence

CHAPTER 7: CONCLUSION
In conclusion, the ABCC1 promoter gene had been successfully extracted from Danio rerio by

Total DNA extraction. Successfully generating PCR amplification of 1442 bp PCR amplicons at

TTTGGAACCACTTTAGGTTG - -AACCACTGCTGTGTGTTATG -

After the retrieval of sequencing results of 1328/1380 identities which is 96% similarities to the

Zebrafish DNA sequence clone DKEYP-72E1 of 2208 bit score.

The promoter sequence gene was successfully ligated into the pZsGreen 1-1 vector from

the pGEM T-Easy vector with the aid of SacI and EcoRI restriction enzyme after. Possessing

fluorescence of the heart organ at 144 hpf after being microinjected at 1000-cell stage. Although,

it could have shown more fluorescence if it were to be microinjected at 4-cell stage where the

plasmid could have been absorbed more by the dividing cells.

The objectives of this research have been achieved following the completion of the

isolation and cloning process. The hypothesis of this research has been accepted that ABCC1

promoter gene expression timeline was found at which stage of the development of the Danio

rerio.

CHAPTER 8: REFERENCES
Aye, I. L. M. H., Singh, A. T., & Keelan, J. A. (2009). Transport of lipids by ABC proteins:

Interactions and implications for cellular toxicity, viability and function. Chemico-

Biological Interactions. 180, 327 339.

Balakrishnan, L., Venter, H., Shilling, R.A., & van Veen, Hendrik, W. (2004). Reversible transport

by the ATP-binding cassette multidrug export pump LmrA: ATP synthesis at the expense

of downhill ethidium uptake. The Journal of Biological Chemistry. 279, 11273 11280.

Berra, T. M. (2007). Freshwater fish distribution (2nd ed.). San Diego, CA: Academic Press.

Chung, H. H. (2013). Ontogenic expression and functional characterisation of FADS2, an enzyme

for long-chained unsaturated fatty acid desaturation in zebrafish. University Sains

Malaysia.

Dermauw, W., & Van Leeuwen, T. (2014). The ABC gene family in arthropods: comparative

genomics and role in insecticide transport and resistance. Insect Biochemistry Molecular

Biology. 45, 89 110. pmid:24291285.

Durand, J. -D., Tsigenopoulos, C. S., Unlü, E., &Berrebi, P. (2002). Phylogeny and biogeography

of the family Cyprinidae in the Middle East inferred from cytochrome b DNA:

Evolutionary significance of this region. Molecular Phylogenetics and Evolution. 22(1),

91 100.

Haimeur, A., Deeley, R. G., & Cole, S.P. (2002). Charged amino acids in the sixth transmembrane

helix multidrug resistance protein 1 (MRP1/ABCC1) are critical determinants of transport

activity. Journal of Biological Chemistry. 277, 413 26 33.

Hazard, S.E., & Patel, S.B. (2007). SterolinsABCG5 and ABCG8 regulators of whole body dietary

sterols. Pflugers Archive. 453, 745 752.

Holland, I.B., & Blight, M.A. (1999). ABC-ATPases, adaptable energy generators fuelling

transmembrane movement of a variety of molecules in organisms from bacteria to humans.

Journal of Molecular Biology. 293, 381 399.

Kirschner, M. & Gerhart, J. (1998). Evolvability. Proceedings of the National Academy of

Sciences. USA. 95, 8420 8427.

Leslie, E. M., Deeley, R.G., & Cole, S.P.C. (2005). Multidrug resistance proteins: role of P-

glycoprotein, MRP1, MRP2 and BCRP (ABC2) in tissue defense. Toxicology Applied

Pharmacol. 204, 216 237.

Liu S.K., Li Q., & Liu Z.J. (2013). Genome-Wide Identification, Characterization and

Phylogenetic Analysis of 50 Catfish ATP-Binding Cassette (ABC) Transporter Genes.

Plos One. 8(5). ARTN e63895 WOS:000319081900061. pmid:23696857.

Luckenbach, T., Fischer, S. & Sturm, A. (2014). Current advances on ABC drug transporters in

fish. Comparative Biochemistry and Physiology. Part C 165, 28 52.

Neely, K. E., & Workman, J. L. (2002). The complexity of chromatin remodelling and its links to

cancer. Biochimica et BiophysicaActa (BBA) - Reviews on Cancer. 1603, 1, 19 29.

Nelson, J. S. (2006). Fishes of the world (4th ed.). New York, NY: John Wiley and Sons Inc.

Popovic, M., Zaja, R., Loncar, J., &Smital, T. (2010). A novel ABC transporter: The first insight

into zebrafish (Daniorerio) ABCH1. Marine Environmental Research. 69(1), 11 13.

Postlethwait, J., Yan, Y., Gates, M., Home, S., Amores, A., Brownlie, A., Donovan, A., Egan, E.,

Force, A., & Gong, Z. (1998). Vertebrate genome evolution and the zebrafish gene map.

Nat Genes.18, 345 349.

Reddy, V.S., Shlykov, M.A., Castillo, R., Sun, E.I., &Saier, M.H. (2012). The major facilitator

superfamily (MFS) revisited. The FEBS journal. 279, 2022 35.

Rees, D.C., Johnson, E., &Lewinson, O. (2009). ABC transporters: the power to change. Nature

reviews. Molecular cell biology. 10, 218 27.

Schinkel, A.H., Jonker, J.W. (2003). Mammalian drug efflux transporters of the ATP binding

cassette (ABC) family: an overview. Advanced Drug Delivery. Rev. 55, 3 29.

Scotto, K. W., & Johnson, R. J. (2001). Molecular Interventions 1. 117 125.

Sharma, U., Singhal, V., Gupta, D. P., & Mohanty, P. S. (2014). Phylogenetic analysis among

Cyprinidae family using 16S rRNA. International Journal of Fisheries and Aquatic

Studies. 1(6), 66 71.

Slot, A. J., Molinski, S. V., & Cole, S. P. C. (2011). Mammalian multidrug resistance proteins

(MRPs). Essays Biochemistry. 50, 179 207.

Streisinger, G., Singer, F., Walker, C., Knauer, D., & Dower, N. (1986). Segregation analyses and

gene-centromere distances in zebrafish. Genetics. 112, 311 319.

Streisinger, G., Singer, F., Walker, C., Knauer, D., Dower, N. (1981). Production of clones of

omozygous diploid zebrafish (Brachydaniorerio). Nature. 291, 293 296.

terBeek, J., Guskov, A., &Slotboom, D.J. (2014). Structural diversity of ABC transporters. The

Journal of general physiology. 143, 419 435.

Wang, N., Lan, D., Chen, W., Matsuura, F., & Tall, A.R. (2004). ATP-binding cassette transporters

G1 and G4 mediate cellular cholesterol efflux to high-density lipoproteins. Proceedings of

the National Academy of Sciences. U.S.A. 101, 9774 9779.

Wang, X. Z., Gan, X. N., Li, J. B., Mayden, R. L., & He, S. P. (2012). Cyprinid phylogeny based

on Bayesian and maximum likelihood analyses of partitioned data: Implications for

Cyprinidae systematics. Science China Life Sciences. 55(9), 761 773.

Wilkens, S. (2015). Structure and mechanism of ABC transporters. F1000 Prime Reports. 7, 14

(doi:10.12703/P7-14).

Chang, X. B. (2007). A molecular understanding of ATP-dependent solute transport by

multidrug resistance-associated protein MRP1. Cancer Metastasis Rev. 26(1):15-37.

Jiye, Y., & Jianting, Z. (2011). Multidrug resistance-associated protein 1 (MRP1/ABCC1)

polymorphism: from discovery to clinical application. Zhong Nan Da Xue Xue Bao. Yi

Xue Ban = Journal of Central South University. Medical Sciences, 36(10), 927 938.

http://doi.org/10.3969/j.issn.1672-7347.2011.10.002.

Shapter, F. M., & Waters, D. L. (2014). Genome walking. Methods Mol Biol.1099:133-46. doi:

10.1007/978-1-62703-715-0_12.

Murray, D. , Doran, P. , MacMathuna, P. , & Moss, A. C. (2007). In silico gene expression

analysis: An Overview. Mol Cancer. 6 : 50.

CHAPTER 9: APPENDIX

9.1 Appendix A
The sequencing result obtained from First BASE Company.

>1st_BASE_3012298_P__ABCC1__CHH___21_12_Anne_M_J__T7_PROMOTER
ATCGCACTCCATGCTCCGGCGCCATGGCGGCCGCGGGAATTCGATTTTTGGAACCAC
TTTAGGTTGAGTAAATAGTGAGTAAATAAAATTATTTTTGGTTGAACTATGCCTTTA
ACTATGCCAATGGTTAGCCTTCAAAACAAAAACAACAACAAAAACTCTAAAAACCG
TTGAGTTATTGATTTAACCCAATGGTTGAGTTATACCTATTTGGTGCTCTGTTTTTATT
TTATTATTATTATTATTATTATTATTATTATTATTATTATTATTATTATTATTATTATTA
TTTTTATTTTTATTTTTATTTTTAACCTTTATTAGGTTATTTATTTAATAACTTAATCAG
TTGGGTTAAATATTTGGTTCTTTGTTGGGTTATTTTTAACCTTTATTTGGTTATTTTTT
AAATAACTCAACCAGTTGGGTTTAACAACTTTAATTTCATCAGTCAACTGATTTAAC
TGACAAAGAACAGCTGTATCAGAATCAGAACAGCTGATTCTATATTTATTTACATAC
ATTTATATACATACAATTTAAGTCAGAATTATTAGCCCCATTGAATTATTAGCCCCCT
GTTTATTTTTTCCCCAATTTCTGTTTAATAGAGAGAACACATTTCAACACATTTCTAA
ACATAATAGTTTTAATGACTCATCTTTAATAACTGATTTATTTTATCTTTTCATGATG
ACAGTAAATAGTATTTGACTAGATATTTTTCAAGACACTTCTATACAGCTTAAAGTG
ACATTTAAAGGCATAACTAGGTTAATTAGGTTAACTAGGCAGGTTAGGGTAATTAGG
CAAGATATTGTATAATGATGTTTTTTTCTGTAGACTATCGAAAAAAAAAATAGCTTA
AAGGGGCCTTAAAATGGCTTTAAAAAATAATAACTGCTTGTATTGTGGCAAAAATA
AAACAAATAAGAATTTCACCAGAAGAAAAAAATACTATCAGACATACTGTGAAAAT
TTTCTTGCTCTATTAAACATCATTTAGGAAATATTTAAAAAAGGAAAAGAAAATTCT
AAGGGGGGCTAATAATTCTGACTTCAACTGTACATAATGTTGTTGTTTTTGATACAT
GTTTTGTTGGTATTGTATTTGTAAAATTGATTATTATTAGTTGATTAAATTTTATGTTA
TTCAACAACTAATATTTAAGGGAAAAACATTTTAATGGGCACTTTTAAAATACACTG
GAAGTAAGGTTAATACAGGGGTTGAAAACCAAATAAACCCAAAAGCTTGAACTTTA
GCTTGAGTTAACCTATCTAGGGTGGGAAAAATATAAAAAGCCTACTTACTTTCCCCT
TGGTAAATTTAACAACTAGGTTTAAACTTTTAAAAAAAACCTTGGCCAGGGTGGTCC
TGGCCGGGACTTTCCGTNACGTCAATAGTTAAAATCCAATGAAACCAACATCGCTCC
CTTTATTGGTGGC

9.2 Appendix B
Genomic sequence generated to derive primer selection
Reverse complement
GGTTACAAGTTTTCAACTTCAAAGCCTCTTTTGTTTTTAACAGAAAAAATAAACTCA

AAGGTTTGGAACCACTTTAGGTTGAGTAAATAGTGAGTAAATAAAATTATTTT

TGGTTGAACTATGCCTTTAACTATGCCAATGGTTAGCCTTCAAAACAAAAACA

ACAACAAAAACTCTAAAAACCGTTGAGTTATTGATTTAACCCAATGGTTGAG

TTATACCTATTTGGTGCTCTGTTTTTATTTTATTATTATTATTATTATTATTATT

ATTATTATTATTATTATTATTATTATTATTATTATTTTTATTTTTATTTTTATTTT

TAACCTTTATTAGGTTATTTATTTAATAACTTAATCAGTTGGGTTAAATATTTG

GTTCTTTGTTGGGTTATTTTTAACCTTTATTTGGTTATTTTTTAAATAACTCAA

CCAGTTGGGTTTAACAACTTTAATTTCACCAGTCAACTGATTTAACTGACAAA

GAACAGCTGTATCAGAATCAGAACAGCTGATTCTATATTTATTTACATACATT

TATATACATACAATTTAAGTCAGAATTATTAGCCCCATTGAATTATTAGCCCC

CTGTTTATTTTTTCCCCAATTTCTGTTTAATAGAGAGAACACATTTCAACACAT

TTCTAAACATAATAGTTTTAATGACTCATCTCTAATAACTGATTTATTTTATCT

TTTCATGATGACAGTAAATAATATTTGACTAGATATTTTTCAAGACACTTCTA

TACAGCTTAAAGTGACATTTAAAGGCATAACTAGGTTAATTAGGTTAACTAG

GCAGGTTAGGGTAATTAGGCAAGATATTGTATAATGATGTTTTTTTCTGTAGA

CTATCGAAAAAAAAAATAGCTTAAAGGGGCCTTAAAATGGCTTTAAAAAATA

ATAACTGCTTGTATTGTGGCAAAAATAAAACAAATAAGAATTTCACCAGAAG
AAAAAAATACTATCAGACATACTGTGAAAATTTTCTTGCTCTATTAAACATCA

TTTAGGAAATATTTAAAAAAGGAAAAGAAAATTCTAAGGGGGGCTAATAATT

CTGACTTCAACTGTACATAATGTTGTTGTTTTTTGTATACATGTTTTGTTGGTA

TTGTATTTGTAAAATTGTATTATTATTAGTTGTATTAAATTTTATGTTATTCAA

CAACTAATATATAAGGAAAAAACATTTAAAGGGCACTTTATAAATACACTGC

AAGTAGGTTAATACAGGGTTGAAAACCAAATAAACCAAAAGCTAGAACATT

AGCTGAGTTAACCTATCTAGGCTGGTAAGATTATAATAGCCTACTTACTTCCT

CTTGTTAATTTACAAACTAGTTTTAACATTTAAAAAACACTTGTCATGCTGTC

GTGCGTGACTTTCGTTACGTCAATAGTTAAATCAATGAAGCAGCAGCGCCCTC

TATGTGTGACCACATGTGTGGCATTTGTACACAGGTCCCCATCACCATAACAC

ACAGCAGTGGTTATGAAACGGCGGCAGTGTAAACTCAGCACACTTAATTAGA

CCTTTCCTGGGGCGA