Smart Computing

Smart Innovation, Systems and Technologies 224
Suresh Chandra Satapathy

Vikrant Bhateja
Margarita N. Favorskaya
T. Adilakshmi Editors
Smart Computing
Techniques and
Applications
Proceedings of the Fourth International
Conference on Smart Computing and
Informatics, Volume 2
Smart Innovation, Systems and Technologies
Volume 224
Series Editors
Robert J. Howlett, Bournemouth University and KES International,
Shoreham-by-Sea, UK
Lakhmi C. Jain, KES International, Shoreham-by-Sea, UK
The Smart Innovation, Systems and Technologies book series encompasses the
topics of knowledge, intelligence, innovation and sustainability. The aim of the
series is to make available a platform for the publication of books on all aspects of
single and multi-disciplinary research on these themes in order to make the latest
results available in a readily-accessible form. Volumes on interdisciplinary research
combining two or more of these areas is particularly sought.
The series covers systems and paradigms that employ knowledge and intelligence
in a broad sense. Its scope is systems having embedded knowledge and intelligence,
which may be applied to the solution of world problems in industry, the environment
and the community. It also focusses on the knowledge-transfer methodologies and
innovation strategies employed to make this happen effectively. The combination of
intelligent systems tools and a broad range of applications introduces a need for a
synergy of disciplines from science, technology, business and the humanities. The
series will include conference proceedings, edited collections, monographs, hand-
books, reference books, and other relevant types of book in areas of science and
technology where smart systems and technologies can offer innovative solutions.
High quality content is an essential feature for all book proposals accepted for the
series. It is expected that editors of all accepted volumes will ensure that
contributions are subjected to an appropriate level of reviewing process and adhere
to KES quality principles.
Indexed by SCOPUS, EI Compendex, INSPEC, WTI Frankfurt eG, zbMATH,
Japanese Science and Technology Agency (JST), SCImago, DBLP.
All books published in the series are submitted for consideration in Web of Science.
More information about this series at http://www.springer.com/series/8767

Suresh Chandra Satapathy · Vikrant Bhateja ·
Margarita N. Favorskaya · T. Adilakshmi
Editors
Smart Computing
Techniques and Applications
Proceedings of the Fourth International
Conference on Smart Computing
and Informatics, Volume 2
Editors
Suresh Chandra Satapathy Vikrant Bhateja
School of Computer Engineering Department of Electronics
KIIT University and Communication Engineering
Bhubaneswar, Odisha, India Shri Ramswaroop Memorial Group
of Professional Colleges (SRMGPC)
Margarita N. Favorskaya Lucknow, Uttar Pradesh, India
Informatics and Computer Techniques
Dr. A.P.J. Abdul Kalam Technical
Reshetnev Siberian State University
University
of Science and Technologies
Lucknow, Uttar Pradesh, India
Krasnoyarsk, Russia
T. Adilakshmi
Department of Computer Science
and Engineering
Vasavi College of Engineering
Hyderabad, India
ISSN 2190-3018 ISSN 2190-3026 (electronic)

Smart Innovation, Systems and Technologies
ISBN 978-981-16-1501-6 ISBN 978-981-16-1502-3 (eBook)
https://doi.org/10.1007/978-981-16-1502-3
© The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Nature
Singapore Pte Ltd. 2021
This work is subject to copyright. All rights are solely and exclusively licensed by the Publisher, whether
the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse
of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and
transmission or information storage and retrieval, electronic adaptation, computer software, or by similar
or dissimilar methodology now known or hereafter developed.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication
does not imply, even in the absence of a specific statement, that such names are exempt from the relevant
protective laws and regulations and therefore free for general use.
The publisher, the authors and the editors are safe to assume that the advice and information in this book
are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or
the editors give a warranty, expressed or implied, with respect to the material contained herein or for any
errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional
claims in published maps and institutional affiliations.
This Springer imprint is published by the registered company Springer Nature Singapore Pte Ltd.
The registered company address is: 152 Beach Road, #21-01/04 Gateway East, Singapore 189721,
Singapore
Conference Committees
Chief Patrons
Sri. M. Krishna Murthy, Secretary, VAE

Sri. P. Balaji, CEO, VCE
Patron
Dr. S. V. Ramana, Principal, VCE
Honorary Chair
Dr. Lakhmi Jain, Australia
General Chair
Dr. Suresh Chandra Satapathy, KIIT DU, Bhubaneswar
Organizing Chair
Dr. T. Adilakshmi, Professor and HOD, CSE, VCE
v
vi Conference Committees
Publication Chairs
Dr. Nagaratna P. Hegde, Professor, CSE, VCE

Dr. Vikrant Bhateja, SRMGPC, Lucknow, UP, India
Program Committee
Dr. S. Ramachandram, Former Vice Chancellor, OU

Dr. Banshidhar Majhi, Director, IITDM, Kancheepuram
Dr. Siba K. Udgata, Professor, HCU
Dr. Sourav Mukhopadhyay, Associate Professor, IIT Kharagpur
Dr. P. Radha Krishna, Professor, CSE, NIT Warangal
Dr. M. M. Gore, Professor, MNNIT, Allahabad
Dr. S. M. Hegde, Professor, NIT Surathkal
Dr. Bapi Raju S., Professor, IIIT Hyderabad
Dr. Rajendra Hegadi, Associate Professor, IIIT Dharwad
Dr. S. Sameen Fatima, Former Principal, OU
Dr. K. Shyamala, Professor, OU
Dr. Naveen Sivadasan, TCS Innovation Labs, Hyderabad
Dr. Badrinath G. Srinivas, Research Scientist—III, Amazon Development Center,
Hyderabad
Dr. Ravindra S. Hegadi, Professor, PAH Solapur University
Dr. S. P. Algur, Professor and Chairman, CSE, Rani Channamma University, Belgavi
Dr. R. Sridevi, HOD, Department of CSE, JNTUH
International Advisory Committee/Technical Program

Committee
Dr. Rammohan, South Korea

Dr. Kailash C. Patidar, South Africa
Dr. Naeem Hanoon, Malaysia
Dr. Vimal Kumar, the University of Waikato, New Zealand
Dr. Akshay Sadananda Uppinakudru Pai, University of Copenhagen, Denmark
Dr. K. C. Santosh, the University of South Dakota
Dr. Ayush Goyal, Texas A&M University, Kingsville
Dr. Sobhan Babu, Associate Professor, IIT Hyderabad
Dr. D. V. L. N. Somayajulu, Director, IIIT, Kurnool
Dr. Siba Udgata, Professor, HCU
Dr. R. B. V. Subramaanyam, Professor, NITW
Dr. S. G. Sanjeevi, Professor, NITW
Conference Committees vii
Dr. Sanjay Sengupta, CSIR, New Delhi

Dr. A. Govardhan, Rector, JNTU Hyderabad
Prof. Chintan Bhatt, Chandubhai Patel Institute of Technology, Gujarat
Dr. Munesh Chandra Trivedi, ABES Engineering College, Ghaziabad
Dr. Alok Aggarwal, Professor
Dr. Anuja Arora, Jaypee Institute of Information Technology, Noida, India
Dr. Divakar Yadav, Associate Professor, MMMUT, Gorakhpur, India
Dr. Kuda Nageswar Rao, Andhra University, Visakhapatnam
Dr. M. Ramakrishna Murthy, ANITS, Visakhapatnam
Dr. Suberna Kumar, MVGR, Vizianagaram
Dr. J. V. R. Murthy, Director Incubation and IPR, JNTU Kakinada
Dr. D. Ravi, IDRBT, Hyderabad
Dr. Badrinath G. Srinivas, Research Scientist–III, Amazon Development Center,
Hyderabad
Dr. K. Shyamala, Professor, OU
Dr. P. V. Sudha, Professor, OU
Dr. M. A. Hameed, Assistant Professor, OU
Dr. B. Sujatha, Assistant Professor, OU
Dr. T. Adilakshmi, Professor and HOD, CSE, VCE
Dr. Nagaratna P. Hegde, Professor, CSE, VCE
Dr. V. Sireesha, Assistant Professor, CSE, VCE
Organizing Committee
Dr. D. Baswaraj, Professor, CSE, VCE

Dr. K. Srinivas, Associate Professor, CSE, VCE
Dr. V. Sireesha, Assistant Professor, CSE, VCE
Mr. S. Vinay Kumar, Assistant Professor, CSE, VCE
Mr. M. Sashi Kumar, Assistant Professor, CSE, VCE
M. Sunitha Reddy, Assistant Professor, CSE, VCE
R. Sateesh Kumar, Assistant Professor, CSE, VCE
Mr. T. Nishitha, Assistant Professor, CSE, VCE
Publicity Committee
Dr. M. Shanmukhi, Professor, CSE, VCE

Mr. C. Gireesh, Assistant Professor, CSE, VCE
Ms. T. Jalaja, Assistant Professor, CSE, VCE
Mr. I. Navakanth, Assistant Professor, CSE, VCE
Ms. S. Komal Kaur, Assistant Professor, CSE, VCE
Mr. T. Saikanth, Assistant Professor, CSE, VCE
viii Conference Committees
Ms. K. Mamatha, Assistant Professor, CSE, VCE

Mr. P. Narasiah, Assistant Professor, CSE, VCE
Website Committee
Mr. S. Vinay Kumar, Assistant Professor, CSE, VCE

Mr. M. S. V. Sashi Kumar, Assistant Professor, CSE, VCE
Preface
This volume contains the selected papers presented at the 4th International Confer-
ence on Smart Computing and Informatics (SCI 2020) organized by the Depart-
ment of Computer Science and Engineering, Vasavi College of Engineering
(Autonomous), Ibrahimbagh, Hyderabad, Telangana, during October 9–10, 2020.
It provided a great platform for researchers from across the world to report, delib-
erate, and review the latest progress in the cutting-edge research pertaining to smart
computing and its applications to various engineering fields. The response to SCI
2020 was overwhelming with a good number of submissions from different areas
relating to artificial intelligence, machine learning, cognitive computing, computa-
tional intelligence, and its applications in main tracks. After a rigorous peer review
with the help of technical program committee members and external reviewers, only
quality papers were accepted for presentation and subsequent publication in this
volume of SIST series of Springer.
Several special sessions were floated by eminent professors in cutting-edge
technologies such as blockchain, AI, ML, data engineering, computational intel-
ligence, big data analytics and business analytics, and intelligent systems. Eminent
researchers and academicians delivered talks addressing the participants in their
respective fields of proficiency. Our thanks are due to Prof. Roman Senkerik, Head
of AI Lab, Tomas Bata University in Zlin, Czech Republic; Shri. Shankarnarayan
Bhat, Director Engineering, Intel Technologies India Pvt. Ltd.; Ms. Krupa Rajendran,
Assoc. VP, HCL Technologies; and Mr. Aninda Bose, Springer, India, for delivering
keynote addresses for the benefit of the participants. We would like to express our
appreciation to the members of the technical program committee for their support
and cooperation in this publication. We are also thankful to the team from Springer
for providing a meticulous service for the timely production of this volume.
Our heartfelt thanks to Shri. M. Krishna Murthy, Secretary, VAE; Sri. P. Balaji,
CEO, VCE; and Dr. S. V. Ramana, Principal, VCE, for extending support to conduct
this conference in Vasavi College of Engineering. Profound thanks to Prof. Lakhmi
C. Jain, Australia, for his continuous guidance and support from the beginning of the
conference. Without his support, we could never have executed such a mega event. We
are grateful to all the eminent guests, special chairs, track managers, and reviewers
ix
x Preface
for their excellent support. A special vote of thanks to numerous authors across the
country as well as abroad for their valued submissions and to all the delegates for
their fruitful discussions that made this conference a great success.
Editorial Board of SCI 2020
Bhubaneswar, India Suresh Chandra Satapathy

Lucknow, India Vikrant Bhateja
Krasnoyarsk, Russia Margarita N. Favorskaya
Hyderabad, India T. Adilakshmi
List of Special Sessions Collocated with SCI-2020
SS_01: Next-Generation Data Engineering

and Communication Technology
Dr. Suresh Limkar, AISSMS Institute of Information Technology, Pune
SS_02: Artificial Intelligence and Machine Learning

Applications (AIML)
Dr. Sowmya V., CEN, Amrita Vishwa Vidyapeetham, Coimbatore

Dr. Anand Kumar M., NIT Karnataka
Dr. M. Venkatesan, NIT Karnataka
Prof. Soman K. P., Amrita Vishwa Vidyapeetham, Coimbatore
SS_03: Advances in Computational Intelligence and Its

Applications
Dr. C. Kishor Kumar Reddy, Stanley College of Engineering and Technology for
Women, Hyderabad
P. R. Anisha, Stanley College of Engineering and Technology for Women, Hyderabad
xi
xii List of Special Sessions Collocated with SCI-2020
SS_04: Blockchain Technology: Foundations, Challenges,

and Applications
Prof. Sandeep Kumar Panda, Faculty of Science and Technology, ICFAI Foundation
for Higher Education, Hyderabad
Prof. Santosh Kumar Swain, School of Computer Engineering, KIIT (Deemed to be)
University, Bhubaneswar
SS_05: Application of Machine Learning for Intelligent

System Design
Dr. Minakhi Rout, KIIT (Deemed to be) University, Bhubaneswar
SS_06: Advances in Big Data Analytics and Business

Intelligence
Dr. Vijay B. Gadicha, G. H. Raisoni Academy of Engineering and Technology,

Nagpur
Dr. Ajay B. Gadicha, P. R. Pote College of Engineering and Management, Amravati
SS_07: Recent Advances in Artificial

intelligence-Applications, Challenges, and Future Trends
Dr. S. Velliangiri, CMR Institute of Technology, Hyderabad

Dr. P. Karthikeyan, Presidency University, Bengaluru
Dr. Iwin Thanakumar Joseph, KITS, Coimbatore
Contents
An Intelligent Tracking Application for Post-pandemic . . . . . . . . . . . . . . . 1

V. Roopa, R. Vasikaran, M. Sriram Karthik, S. Sindhu, and N. Vaishnavi
Investigation on the Influence of English Expertise on Non-native
English-Speaking Students’ Scholastic Performance Using Data
Mining . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9
Subhashini Sailesh Bhaskaran and Mansoor Al Aali
Machine Learning Algorithms for Modelling Agro-climatic
Indices: A Review . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15
G. Edwin Prem Kumar and M. Lydia
Design of Metal-Insulator-Metal Based Stepped Impedance
Square Ring Resonator Dual-Band Band Pass Filter . . . . . . . . . . . . . . . . . . 25
Surendra Kumar Bitra and M. Sridhar
Covid-19 Spread Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31
Srinivas Kanakala and Vempaty Prashanthi
Social Media Anatomy of Text and Emoji in Expressions . . . . . . . . . . . . . . 41
Shelley Gupta, Ojas Garg, Radhika Mehrotra, and Archana Singh
Development of Machine Learning Model Using Least
Square-Support Vector Machine, Differential Evolution and Back
Propagation Neural Network to Detect Breast Cancer . . . . . . . . . . . . . . . . . 51
Madhura D. Vankar and G. A. Patil
Distributed and Decentralized Attribute Based Access Control
for Smart Health Care Data . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 67
B. Ravinder Reddy and T. Adilakshmi
Dynamic Node Identification Management in Hadoop Cluster
Using DNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 75
J. Balaraju and P. V. R. D. Prasada Rao
xiii
xiv Contents
A Scientometric Inspection of Research Based on WordNet Lexical

During 1995–2019 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 87
Minni Jain, Gaurav Sharma, and Amita Jain
Sentiment Analysis of an Online Sentiment with Text and Slang
Using Lexicon Approach . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 95
Shelley Gupta, Shubhangi Bisht, and Shirin Gupta
Fuzzy Logic Technique for Evaluation of Performance of Load
Balancing Algorithms in MCC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 107
Divya, Harish Mittal, Niyati Jain, Bijender Bansal, and Deepak Kr. Goyal
Impact of Bio-inspired Algorithms to Predict Heart Diseases . . . . . . . . . . 121
N. Sree Sandhya and G. N. Beena Bethel
Structured Data Extraction Using Machine Learning from Image
of Unstructured Bills/Invoices . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 129
K. M. Yindumathi, Shilpa Shashikant Chaudhari, and R. Aparna
Parallel Enhanced Chaotic Model-Based Integrity to Improve
Security and Privacy on HDFS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 141
B. Madhuravani, N. Chandra Sekhar Reddy, and Boggula Lakshmi
Exploring the Fog Computing Technology in Development of IoT
Applications . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 149
Chaitanya Nukala, Varagiri Shailaja, A. V. Lakshmi Prasuna, and B. Swetha
NavRobotVac: A Navigational Robotic Vacuum Cleaner Using
Raspberry Pi and Python . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 159
Shaik Abdul Nabi and Mettu Krishna Vardhan
A Hybrid Clinical Data Predication Approach Using Modified PSO . . . . 169
P. S. V. Srinivasa Rao, Mekala Srinivasa Rao, and Ranga Swamy Sirisati
Software Defect Prediction Using Optimized Cuckoo Search Based
Nature-Inspired Technique . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 183
C. Srinivasa Kumar, Ranga Swamy Sirisati, and Srinivasulu Thonukunuri
Human Facial Expression Recognition Using Fusion of DRLDP
and DCT Features . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 193
M. Avanthi and P. Chandra Sekhar Reddy
Brain Tumor Classification and Segmentation Using Deep Learning . . . . 201
Manohar Madgi, Shantala Giraddi, Geeta Bharamagoudar, and M. S. Madhur
A Hybrid Approach Using ACO-GA for Task Scheduling in Cloud . . . . . 209
Simran Shrivas, Sonika Shrivastava, and Lalit Purohit
K-Means Algorithm-Based Text Extraction from Complex Video
Images Using 2D Wavelet . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 219
Divya Saxena and Anubhav Kumar
Contents xv
Opinion Mining-Based Conjoint Analysis of Consumer Brands . . . . . . . . 227

Kumar Ravi, Aishwarya Priyadarshini, and Vadlamani Ravi
Task Scheduling in Cloud Using Improved Genetic Algorithm . . . . . . . . . 241
Shyam Sunder Pabboju and T Adilakshmi
Sentiment Analysis for Telugu Text Using Cuckoo Search Algorithm . . . 253
G. Janardana Naidu and M. Seshashayee
Automation of Change Impact Analysis for Python Applications . . . . . . . 259
T. Jalaja, T. Adilakshmi, and P. S. R. Abhishek
Enhancing Item-Based Collaborative Filtering for Music
Recommendation System . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 269
M. Sunitha, T. Adilakshmi, and Mir Zahed Ali
Deep Learning-Based Enhanced Classification Model
for Pneumonia Disease . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 285
S. Jeba Priya, S. Joshua Jaistein, G. Naveen Sundar,
and T. Raja Sundrapandiyanleebanon
Automatic Fake News Detector in Social Media Using Machine
Learning and Natural Language Processing Approaches . . . . . . . . . . . . . . 295
J. Srinivas, K. Venkata Subba Reddy, G. J. Sunny Deol,
and P. VaraPrasada Rao
A Novel Method for Optimizing Data Consumption by Enabling
a Custom Plug-In . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 307
Vijay A. Kanade
An Effective Mechanism for the Secure Transmission of Medical
Images Using Compression and Public Key Encryption Mechanism . . . . 317
T. K. Ratheesh and Varghese Paul
A Systematic Survey on Radar Target Detection Techniques in Sea
Clutter Background . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 327
R. Navya and R. Devaraju
An Ensemble Model for Predicting Chronic Diseases Using
Machine Learning Algorithms . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 337
B. Manjulatha and Suresh Pabboju
COVID-19 Face Mask Live Detection Using OpenCV . . . . . . . . . . . . . . . . . 347
Anveshini Dumala, Anusha Papasani, and Sireesha Vikkurty
Chest X-Ray Image Analysis of Convolutional Neural Network
Models with Transfer Learning for Prediction of COVID Patients . . . . . . 353
M. Shyamala Devi, P. Swathi, N. Pavan Kumar, Ravi Varma Tungala,
Saranya Vivekanandan, and Priyanka Moorthy
xvi Contents
Predicting Customer Loyalty in Banking Sector with Mixed

Ensemble Model and Hybrid Model . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 363
Jesmi Latheef and S. Vineetha
Design Patterns and Microservices for Reengineering of Legacy
Web Applications . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 373
V. Dattatreya, K. V. Chalapati Rao, and M. Raghava
A Comparative Study on Single Image Dehazing Using
Convolutional Neural Network . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 383
Poornima Shrivastava, Roopam Gupta, Asmita A. Moghe, and Rakesh Arya
Plasmodium falciparum Detection in Cell Images Using
Smaranjit Ghose, Suhrid Datta, C. Malathy, and M. Gayathri
An Online Path Planning with Modified Autonomous Parallel
Parking Controller for Collision Avoidance . . . . . . . . . . . . . . . . . . . . . . . . . . 403
Naitik M. Nakrani and Maulin M. Joshi
Real-Time Proximity Sensing Module for Social Distancing
and Disease Spread Tracking . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 415
Sreeja Rajesh, Varghese Paul, Abdul Adil Basheer, and Jibin Lukose
Automatic Depression Level Analysis Using Audiovisual Modality . . . . . 425
Aishwarya Chordia, Mihir Kale, Mukta Mayee, Preksha Yadav,
and Suhasini Itkar
A Notification Alert System with Heartbeat and Temperature
Sensors for Abnormal Health Conditions . . . . . . . . . . . . . . . . . . . . . . . . . . . . 441
V. Sireesha, M. S. V. Sashi Kumar, S. Vinay Kumar, and R. M. Shiva Krishna
Recommender System for Resolving the Cold Start Challenges
Using Classification . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 451
Chandrima Roy, Siddharth Swarup Rautray, and Manjusha Pandey
A Skyline Based Technique for Web Service Selection . . . . . . . . . . . . . . . . . 461
Yamini Barge, Lalit Purohit, and Soma Saha
Novel Trust Model to Enhance Availability in Private Cloud . . . . . . . . . . . 473
Vijay Kumar Damera, A. Nagesh, and M. Nagaratna
Feature Impact on Sentiment Extraction of TEnglish Code-Mixed
Movie Tweets . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 487
S. Padmaja, M. Nikitha, Sasidhar Bandu, and S. Sameen Fatima
Linear and Ensembling Regression Based Health Cost Insurance
Prediction Using Machine Learning . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 495
M. Shyamala Devi, P. Swathi, M. Purushotham Reddy,
V. Deepak Varma, A. Praveen Kumar Reddy, Saranya Vivekanandan,
and Priyanka Moorthy
Contents xvii
An Adaptive Correlation Clustering-Based Recommender System

for the Long-Tail Items . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 505
Soanpet Sree Lakshmi, T. AdiLakshmi, and Bakshi Abhinith
Plant Leaf Identification Using HOG and Random Forest Regressor . . . 515
Jyotisagar Bal, Manas Kumar Rath, and Prasanta Kumar Swain
Deep Learning Based Facial Feature Detection for Ethnicity
Recognition . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 527
Sujitha Juliet Devaraj, R. Catherine Joy, I. Santhosh, and I. C. Kevin
Scanning Array Antenna Radiation Pattern Design Containing
Asymmetric Null Steering Based on L-ASBO . . . . . . . . . . . . . . . . . . . . . . . . 535
Anitha Suresh, C. Puttamadappa, and Manoj Kumar Singh
A Modified Novel Signal Flow Graph and Memory-Based Radix-8
FFT Processor Design . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 545
A. Anitha, B. Triveni, Pinninti Kishore, and Makkena Madhavi Latha
Vouch augmented Program Courses Recommendation System
for E-Learning . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 555
K. B. V. Rama Narasimham, C. V. P. R. Prasad, J. Jyothirmai, and M. Raghava
Heart Disease Prediction Using Extended KNN (E-KNN) . . . . . . . . . . . . . . 565
R. Sateesh Kumar and S. Sameen Fatima
Prediction Analysis of Diabetes Using Machine Learning . . . . . . . . . . . . . . 573
Srikanth Bethu, G. Charles Babu, B. Sankara Babu, and V. Anusha
Enhanced Goodput and Energy-Efficient Geo-Opportunistic
Routing Protocol for Underwater Wireless Sensor Networks . . . . . . . . . . . 585
V. Baranidharan, B. Moulieshwaran, V. Karthik, R. Sanjay,
and V. Thangabalaji
Early Detection of Pneumonia from Chest X-Ray Images Using
Deep Learning Approach . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 595
Prateek Sarangi, Pradosh Priyadarshan, Swagatika Mishra,
Adyasha Rath, and Ganapati Panda
Detection of Network Anomaly Sequences Using Deep Recurrent
Neural Networks . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 605
R. Ravinder Reddy, K. Ayyappa Reddy, C. Madan Kumar, and Y. Ramadevi
Driver Drowsiness Detection Using Convolution Neural Networks . . . . . . 617
P. Ravi Teja, G. Anjana Gowri, G. Preethi Lalithya, R. Ajay,
T. Anuradha, and C. S. Pavan Kumar
Glaucoma Detection Using Morphological Filters and GLCM
Features . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 627
Babita Pal, Vikrant Bhateja, Archita Johri, Deepika Pal,
and Suresh Chandra Satapathy
xviii Contents
Analysis of Encryption Algorithm for Data Security in Cloud

Computing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 637
Arijit Dutta, Akash Bhattacharyya, Chinmaya Misra,
and Sudhangshu Sekhar Patra
A Machine Learning Approach in Data Perturbation
for Privacy-Preserving Data Mining . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 645
Jayanti Dansana and Adarsh Singh
IoT Service-Based Crowdsourcing Ecosystem in Smart Cities . . . . . . . . . . 655
Arijit Dutta, Ruben Roy, Chinmaya Misra, and Kamakhya Singh
On Interior, Exterior, and Boundary of Fuzzy Soft Multi-Set
Topology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 663
S. A. Naisal and K. Reji Kumar
Early Prediction of Pneumonia Using Convolutional Neural
Network and X-Ray Images . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 673
C. Kishor Kumar Reddy, P. R. Anisha, and K. Apoorva
Predicting the Energy Output of Wind Turbine Based on Weather
Condition . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 683
P. R. Anisha, C. Kishor Kumar Reddy, and Nuzhat Yasmeen
A Study and Early Identificatıon of Leaf Diseases in Plants Using
R. Madana Mohana, C. Kishor Kumar Reddy, and P. R. Anisha
Distributed and Energy Balanced Routing for Heterogeneous
Wireless Sensor Network . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 711
Shivani S. Bhasgi and Sujatha Terdal
ESRRAK-Efficient Self-Route Recovery in Wireless Sensor
Networks Using ACO Aggregation and K-Means Algorithm . . . . . . . . . . . 719
Abhijit Halkai and Sujatha Terdal
An Explanation of Personal Variations on the Basis of Model
Theory or RKT . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 729
K. Reji Kumar
Fingerprint Enhancement Using Fuzzy Logic and Deep Neural
Network . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 735
Sridevi Sarraju and Franklin Bein
Gaussian Filter-Based Speech Segmentation Algorithm
for Gujarati Language . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 747
Priyanka Vishwas Gujarathi and Sandip Raosaheb Patil
Smart Farming Technology with AI & Block Chain: A Review . . . . . . . . . 757
Deepali Jawale and Sandeep Malik
Contents xix
Design and Development of Electronic System for Predicting

Nutrient Deficiency in Plants . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 765
Amruta Chore and Dolly Thankachan
Classification of Hyperspectral Images with Various Spatial
Features . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 773
Sandhya Shinde and Hemant Patidar
Detecting and Classifying Various Diseases in Plants . . . . . . . . . . . . . . . . . . 781
Rashmi Deshpande and Hemant Patidar
Offline Handwritten Dogra Script Recognition Using
Reya Sharma, Baijnath Kaushik, and Naveen Kumar Gondhi
“Device Design of 30 and 10 nm Triple Gate Single Finger Fin-FET
for on Current (ION ) and off Current (IOFF ) Measurement” . . . . . . . . . . . . 799
Sarika M. Jagtap and Vitthal J. Gond
Fact Check Using Multinomial Naive Bayes . . . . . . . . . . . . . . . . . . . . . . . . . . 813
Madhavi Ajay Pradhan, Ankita Shinde, Rohan Dhiman,
Shreyas Ghorpade, and Swapnil Jawale
Author Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 825

About the Editors
Suresh Chandra Satapathy is currently working as Professor, KIIT Deemed to

be University, Odisha, India. He obtained his Ph.D. in Computer Science Engi-
neering from JNTUH, Hyderabad, and master’s degree in Computer Science and
Engineering from National Institute of Technology (NIT), Rourkela, Odisha. He has
more than 27 years of teaching and research experience. His research interest includes
machine learning, data mining, swarm intelligence studies and their applications to
engineering. He has more than 98 publications to his credit in various reputed inter-
national journals and conference proceedings. He has edited many volumes from
Springer AISC, LNEE, SIST and LNCS in the past, and he is also the editorial
board member in few international journals. He is a senior member of IEEE and a
life member of Computer Society of India. Currently, he is National Chairman of
Division-V (Education and Research) of Computer Society of India.
Vikrant Bhateja is Associate Professor, Department of ECE in SRMGPC,

Lucknow. His areas of research include digital image and video processing, computer
vision, medical imaging, machine learning, pattern analysis and recognition. He has
around 160 quality publications in various international journals and conference
proceedings. He is associate editor of IJSE and IJACI. He has edited more than 30
volumes of conference proceedings with Springer Nature and is presently EiC of IGI
Global: IJNCR journal.
Dr. Margarita N. Favorskaya is Professor and Head of the Department of Infor-

matics and Computer Techniques at Reshetnev Siberian State University of Science
and Technology, Russian Federation. Professor Favorskaya is a member of KES
organization since 2010, the IPC member and Chair of invited sessions of over 30
international conferences. She serves as Reviewer in international journals (Neuro-
computing, Knowledge Engineering and Soft Data Paradigms, Pattern Recogni-
tion Letters, Engineering Applications of Artificial Intelligence), Associate Editor
of Intelligent Decision Technologies Journal, International Journal of Knowledge-
Based and Intelligent Engineering Systems and International Journal of Reasoning-
based Intelligent Systems, Honorary Editor of the International Journal of Knowl-
edge Engineering and Soft Data Paradigms, Reviewer, Guest Editor and Book Editor
xxi
xxii About the Editors
(Springer). She is the author or the co-author of 200 publications and 20 educational
manuals in computer science. She co-authored/co-edited seven books for Springer
recently. She supervised nine Ph.D. candidates and is presently supervising four
Ph.D. students. Her main research interests are digital image and videos processing,
remote sensing, pattern recognition, fractal image processing, artificial intelligence
and information technologies.
Dr. T. Adilakshmi is currently working as Professor and Head of the Department,

Vasavi College of Engineering. She completed her Bachelor of Engineering from
Vasavi College of Engineering, Osmania University, in the year 1986, and did her
Master of Technology in CSE from Manipal Institute of Technology, Mangalore,
in 1993. She received Ph.D. from Hyderabad Central University (HCU) in 2006 in
the area of Artificial Intelligence. Her research interests include data mining, image
processing, artificial intelligence, machine learning, computer networks and cloud
computing. She has 23 journal publications to her credit and presented 28 papers at
international and national conferences. She has been recognized as a research super-
visor by Osmania University (OU) and Jawaharlal Nehru Technological University
(JNTU). Two research scholars were awarded Ph.D. under her supervision, and she
is currently supervising 11 Ph.D. students.
An Intelligent Tracking Application
for Post-pandemic
V. Roopa, R. Vasikaran, M. Sriram Karthik, S. Sindhu, and N. Vaishnavi
Abstract The Global Pandemic has created a huge impact in the country at a tremen-
dous rate affecting 3,794,314 people, snatching the lives of 66,678 people. This has
created a huge impact on the county’s economy and socioeconomic and psycholog-
ical status of the citizens of the country. This health also created a situation which
altered the lifestyle of the people. Due to the prevailing conditions of India the govern-
ment has been liberalizing the lockdown and implementing unlock provisions in the
country as a result it is difficult to track people movements and migrations which is
the only preferable means to control the spread of the disease and to find the suspect
able positive cases. A tracking system with a mobile-based application can be imple-
mented which tracks the users of the application’s travel history and movements on a
daily basis in the society which keeps the records of the user along with physiological
parameters (Temperature) so that the changes, suspects can be easily tracked.
1 Introduction
In September 17, 2019, a strange man admitted with an unknown disease in Wuhan,
Hubei province, in China, which turns out to be a reason for global pandemic called
COVID-19 which drastically changed and affected the whole human lifestyle in the
world. It had a direct impact on people’s health made them fall sick, increase the
suffering rate, ultimately end up in the number of the causality, according to WHO
reports COVID-19 affects in different ways for different people, dry cough, fever
and tiredness are the most common symptoms of COVID-19. Based on their immune
V. Roopa (B) · R. Vasikaran · M. Sriram Karthik · S. Sindhu · N. Vaishnavi

Department of Information Technology, Sri Krishna College of Technology, Coimbatore, India
e-mail: v.roopa@skct.edu.in
R. Vasikaran
e-mail: 18tuit155@skct.edu.in
M. Sriram Karthik
e-mail: 18tuit144@skct.edu.in
© The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd. 2021 1
S. C. Satapathy et al. (eds.), Smart Computing Techniques and Applications,
Smart Innovation, Systems and Technologies 224,
https://doi.org/10.1007/978-981-16-1502-3_1
2 V. Roopa et al.
system strength, a person recovers from the disease with or without hospitalization,
the pandemic has not only affected people’s health but also devasted every country’s
economy, made socialization a forbidden word and had indirect effect on people’s
mental health too. Unfortunately, the world has to run amid of this pandemic problem.
India has gone through lockdown from past April 2020 which put the whole country
into universal lockdown to ensure the reduction of spreading of coronavirus, yet
people will suffer even huge if they put to stay in lockdown for long time as we said
the world has to run for all the people’s basic needs and to ensure their economy, so
month by month the grip has been loosened on this lockdown scenario, since then
the COVID-19 cases are reaching its peak which is inevitable.
The COVID-19 tracking charts boosted exponentially after the stage by unlock
programs taken by the government of India. The government has taken huge efforts
to reduce the spread of COVID-19 and educating people about social distancing
and asking them to maintain it. The government has closed every other economic
business other than grocery shops for basic needs and hospitals for the health care
in the beginning of the country’s lockdown and it also closed the borders of the
states, districts and cities and made transportation only allowed for daily needs of
people making them to stagnant over a particular area but when the unlock of all this
happened people are when made available to move from one place to another, the
breakdown of virus also became unstoppable and the healthcare sector is struggling
to track the patients movement because it helps to track and predict the people who
are more prone to catch the disease because COVID-19 spreads through contact.
And tracking of people is hard so. It is hard to predict the person who might be an
active spreader of COVID-19 which will result in more patients without any contact
history which ultimately result in social spread which is even more dangerous.
Currently in India, 3.77 M people are affected by COVID-19; at the same time,
we cannot keep the people, so there has to be measure to ensure social distancing
and that is just a promise which should be kept! but daily, we see news that it is not
followed properly, so every shops, restaurant, supermarkets and places where people
gather now asked to use a infra-red thermometer to check the customers and their
temperatures are written down with their name and contact number, and this is the
manual way the normal grocery, shopkeepers to big trading companies and other
industries, but this is only useful for detecting if the person’s temperature is high
or low, but it cannot say its coronavirus or not and neither it seems to be useful for
tracking only few that also in rare cases, so we see that there is no good solution to
track the people who visit the places and trace them, so we came up with a solution
that will be tremendously useful for the post lockdown scenario where the people
came back to their new normal with facemasks and social distancing the project we
took will be useful to track them and intimate them and also the shop owner and
maintain the stats on who all come to their shops. For example, let us take a person
is going to a coffee shop and then going to mall then to a restaurant after this post
lockdown period then reaches home and this continues for about 2 weeks then he was
diagnosed by COVID-19 at this time when the health department asks him where he
been during all this period his memory cannot keep up all the details about where
he visited and can barely remember if he misses anything it is going to end up as
An Intelligent Tracking Application for Post-pandemic 3
social spread so many of people will affect by the disease and we cannot able to
track people who are more prone to catch the disease so here comes in the game
changer is our product which can be useful for tracking during post-pandemic time.
The system works based on global positioning system to locate and track the users!
first and foremost we are creating a mobile app so it will reach people easy and will
have a good engagement. The system designed will have two provision: one for the
users and another for the commercial user aka the shop owners and business. First
comes the registration phase where give your details like name, age and address for
basic information and you will be logged in to the application so whenever you enter
any commercial center you have to show the device a QR code it is created by the
work of RSA algorithm which appears in the app and the setup of IR thermometer
which is interfaced with application using Bluetooth so that data will be automatically
available in database through the commercial province of application it also shows
up in your application for your own personal tracking for example if you have gone
to a coffee shop you will show up the QR code then IR thermometer will detect your
body temperature sends it to both you and the shop keeper and shows the name,
the place at present aka coffee shop, body temperature at that time and these data’s
will keep on stacking. In the application, so in case, if you unfortunately affected
by COVID-19, we will have a track of visits and able to warn them who visited the
same coffee shop and also it is easier to detect where to track people and where not
to track people and it can also show up areas which is more prone the disease thus
helping other people to stay safe and lead a well-being post-pandemic life.
2 Literature Survey
Due to pandemic of COVID-19, all countries are looking toward mitigation plan to
control the spread with the help of some modeling techniques [1]. Modeling tech-
niques include wearing N95 mask with valves and to sanitize properly and to maintain
distance between the wards. COVID-19 can be spread through respiratory droplets
or due to close contact with the infected patients. SARS-CoV-2 was isolated from
fecal samples of infected patients, which supports the significance of fecal-oral route
in the transmission of SARS-CoV-2, but a WHO-China joint commission report
has denied this route of transmission [2]. When a person affected by coronavirus
knowingly or unknowingly makes contact with another person who is not affected
by the virus despite any age groups. There is at most chance for the virus to prolif-
erate. In comparison with traditional physical or hard sensors, MCS is inexpensive,
since there is no need for network deployment, and its spatio-temporal coverage is
outstanding. Two different approaches of MCS have been distinguished; they are
(i) mobile sensing, which leverages raw data generated from the hardware sensors
that are embedded in mobile devices (e.g., accelerometer, GPS, network connectivity,
camera, or microphone, among others); and (ii) social sensing (or social networking),
which leverages user-contributed data from OSN. The latter considers participants
as ‘social sensors’, i.e., agents that provide information about their environment
4 V. Roopa et al.
through social media services after the interaction with other agents [3]. Information
provided by the current situation regarding the pandemic should be updated properly
through social media because majority of the population are accessing social media
sites.
Social lockdown and distancing measures are the only tools available to fight the
COVID-19 outbreak [4]. Prevention is always better than cure. Instead of suffering
from the virus is good to stay away from the virus that can be done by distancing
ourselves from others as of now social distancing is the only way to control this
virus spread between wards until the arrival of vaccine. Early identification of non-
compliance with the measures decreed in law RD 463/2020 and its subsequent exten-
sions, such as (i) limitation of the freedom of movement of persons, (ii) opening to
the public of unauthorized premises, establishments, areas of worship, etc., and (iii)
agglomerations, among others. Social networks are an increasingly common way of
reporting such events, and their identification can be used by authorities for resource
planning [5]. People who do not follow rules and regulations given by the govern-
ment to bring this spread to control should be punished in the name of advice and
make people understand the seriousness behind every rules.
For instance, to make people know about the seriousness of this virus attack and to
educate them about the death rate and recovery rate and to make them self-prepared
if suppose they are prone to coronavirus. Its mission is to help citizens self-assess
the probability of suffering the infectious disease COVID-19, to reduce the volume
of calls to the health emergency number, informing the population, allowing an
initial triage of possible cases and a subsequent follow-up by the Health Authorities
[6]. If suppose, a ward is not feeling good and has all symptoms like fever, dry
cough, tiredness or difficulties in breathing. Then it is always advisable to consult
the nearby clinic and take necessary requirements to control the coronavirus spread.
Smartphone-based contact-tracing applications are shown as a promising technology
to finish or reduce the lockdown and quarantine measures. The technology of these
mobile apps is based on the results of several years of research efforts on Mobile
Computing, and particularly on Opportunistic Networking (OppNet) and MCS [7].
We are put under certain circumstances like where we are not allowed to roam
around and to self-quarantine ourselves, We also cannot be without knowing the
outside situation and condition about this virus spread at those situations. Smartphone
technologies come in hand. For instance, we have several applications that give us a
clear depiction about instant scenarios about the nation with its pandemic. It exhibits
the data generation rate which can be calculated in time or frequency domain.
Data like death rate recovery and rate provided by healthcare should be updated
properly to make people aware. Developing a novel vaccine is very crucial to
defending the rapid endless of global burden of the COVID-19 pandemic. Big data
can gain insights for vaccine/drug discovery against the COVID-19 pandemic. Few
attempts have been made to develop a suitable vaccine for COVID-19 using big data
within this short period of time [8]. We do not have a suitable vaccine developed
for this virus. So, Big data plays a vital role in collecting information and control
the spread to the maximum count and to control the spread until vaccine arrives.
Conventional medicine alternatively called as allopathic medicine, biomedicine,
mainstream medicine, orthodox medicine and Western medicine, medical doctors

and other professional healthcare providers such as nurses, therapists, and pharma-
cists use drugs, surgery or radiation to treat illnesses and eliminate symptoms [9].
Presently, there’s no licensed medical medication for COVID-19 so people acquire
some home remedies like drinking hot water, and having all rich nutritious food to
improve immunity and perusing healthy lifestyle.
3 Proposed System
The system provides two user login: one for the common user and other for the busi-
ness/commercial center; both are connected to the backend database. Both sides have
a connection established between database and application. The user side application
constantly tracks the location of the user using GPS (Global Positioning System)
and updates in the database. This makes the continuous data tracking possible.
The communication between the infra-red (IR) thermometer and the Commer-
cial/business side application is made possible by interfacing the IR thermometer
with the application via Bluetooth. At first when the user arrives at an any busi-
ness/commercial center, the user’s unique ID is scanned and detected by the commer-
cial center side application as it can access user data from the database using a QR
code. Then the user’s body temperature is detected using the IR thermometer which
is then sent to the business side user application via Bluetooth and it is automatically
communicated to the database that gets updated for both the common user and busi-
ness/commercial side user. Thus, the user activities and movements in such critical
situation can be easily tracked and detected.
People have needs and duties which they had to fulfill which creates a necessity for
them to move around in the society due to these indispensable needs the government
issues social unlocks in the country which creates a difficulty in social distancing and
tracking which is the source of blocking the spread of the disease and the only way to
strategize the testing of susceptible cases. The proposed system focuses on tracking
the movement of the user through a mobile-based application which is GPS enabled
using unique ID and QR’s for the users from one end and maintaining the user records
at the business centers (restaurants, malls, supermarkets, garments, salon, etc.) at the
other end so that the user and the backend database will be having the complete
data of the user’s activity and the business centers will be having the whole data and
physiological parameter (temperature) of the customers which can be further used
for tracking.
The system works by tracking the users of the application by tracking the user’s
activity using GPS (Global Positioning System), the users will be provided with a
unique ID (QR in this case). The business centers will be provided separate login
provisions to store the data of the customers including physiological data. When
the users arrive at certain spot such as business centers the QR will be scanned by
the business centers using the application for correct identification and their body
6 V. Roopa et al.
Fig. 1 Working of intelligent AI tracking application
temperature will be checked using an infra-red (IR) thermometer which will be inter-
faced with the mobile app using the Bluetooth so that the data will be automatically
sent to the database using the business center’s application. The dataset will be safely
stored in the databases which can be used for further tracking that can play a vital role
during the unlocking process. This system has two separate provisions one for the
common users and another for the business and commercial centers. The provision
provides for the common users features QR code (which can be generated using RSA
algorithm), tracking using GPS and data storage (Fig. 1).
The provision provided for the commercial centers features Bluetooth interfacing
between the IR Thermometer and the application, QR detection and data storage.
Thus, these features make the tracking of the users at the social centers at ease and effi-
cient. RSA(Rivest-Shamir-Aldeman) is an algorithm used to encrypt and decrypt
messages. It is an asymmetric cryptographic algorithm. There are two different keys
used in this algorithm. This method is called public-key cryptography. One of the
keys can be given to anyone. The other key must be kept private. It is based on finding
factors of a large composite number is difficult when the factors are prime numbers.
It is called prime factorization and the key is also called key pair (public and private
key) generator. The flow of application here first the customer enters a shop he will
show up the QR code generated by the RSA algorithm thus the data transfers from
user side to the commercial side which also includes the data of the individual’s body
temperature which is detected by the infra-red thermometer and all these data are
stored in the database, thus this application will be enormously helpful for tracking
the individual’s movement in case of unfortunately getting affected by the pandemic
virus and also will play a major role in warning the user’s who visited the same place
as the patient. This application is simple, efficient and easy to deploy and we need
not rely on any new system or hardware since it is available as an application, we
can use it in mobile which most of them have in their hands.
4 Result and Discussion
As coronavirus is a contagious disease that spreads through social interaction between

humans, Bluetooth tracing is vital for spread. Devices like mobile and tablets, it
presents an ideal platform to introduce Bluetooth tracing software due to their ease of
use and personalized usage. Therefore, several smartphone apps have been developed
by governments, international agencies and other parties to mitigate the virus spread.
In this paper, we analyze the large set of Bluetooth tracing with respect to different
security and privacy metrics. We analyze Bluetooth tracing apps permission analysis,
privacy analysis the security of the apps and review of the users. This approach has
the benefit of not requiring network effects, because single individuals can track their
locations without needing their contacts to have the app. The approach of logging
location history is less private than direct tracing, but that may possibly be resolved
with appropriate safeguards and redactions. Further, hybrid approaches involving
both GPS data and Bluetooth proximity networks may prove to be useful to public
health officials in modeling disease spread beyond just tracing. In Fig. 2 the Image
1 and 2(QR code) shows the QR code in the user side application being scanned by
the commercial user application to access the user data and to record the body vital
signs in the database to keep up to date records of the health conditions of the user
this step is made automatic using the IR temperature interfaced via Bluetooth with
the application and QR code to access the user database and directly storing them.
In Fig. 2, the Image 1 and 2(map) shows the person being tracked at each and every
location they are traveling and every place they have visited at this situation, and this
helps the government to track people in this post-pandemic situation to suspect the
infectious places and infected persons so that we could avoid the spread of diseases.
The application overall helps the government in keeping track of people who have
been tested positive for the virus. It is also an excellent way to alert people about
the number of infected cases in their area that have been identified as coronavirus
positive or if they accidentally came in contact with a person suffering from COVID-
19. The application requires being in running mode at all times to continue tracing
individuals actively. The application can be used in such a way that it enables your
smartphone to exchange the tracing keys periodically. This will help to locally store
the unique ID of the people who have come into contact with the user. If later a user
is tested positive for coronavirus, this method of cryptography will also ensure the
privacy and the safety of your data. In addition to showing the data of the number of
users who have been identified as positive, a map can be shown of the nearby area
where people have been identified as positive for COVID-19.
8 V. Roopa et al.
Fig. 2 Implementation of tracker on smart devices—cluster analysis
References
1. Mahalle, P.N., Sable, N.P., Mahalle, N.P., Shinde, G.R.: Predictive analytics of COVID-19 using
information, communication and technologies (2020)
2. Ying, S., et al.: Spread and control of COVID-19 in China and their associations with population
movement, public health emergency measures, and medical resources, p. 24 (2020) [Online].
Available: https://doi.org/10.1101/2020.02.24.20027623
3. Li, R., Rivers, C., Tan, Q., et al.: The demand for inpatient and ICU beds for COVID-19 in
the US: lessons from Chinese cities. medRxiv, 1–12 (2020). https://doi.org/10.1101/2020.03.
09.20033241
4. Du, J., Vong, C.-M., Chen, C.L.P.: Novel efficient RNN and LSTM like architectures: recurrent
and gated broad learning systems and their applications for text classification. IEEE Trans.
Cybern. (2020). https://doi.org/10.1109/TCYB.2020.2969705
5. World Health Organization: Critical preparedness, readiness and response actions for COVID-
19: interim guidance (2020)
6. Guo, B., Wang, Z., Yu, Z., et al.: Mobile crowd sensing and computing: the review of an emerging
human-powered sensing paradigm. ACM Comput. Surv. (CSUR) 48(1), 1–31 (2015)
7. International Labour Organization: The socioeconomic impact of COVID-19 in fragile settings:
peace and social cohesion at risk. https://www.ilo.org/global/topics/employment-promotion/rec
overy-and-reconstruction/WCMS_741158/langen/index.htm. Accessed 30 Apr 2020
8. Doran, D., Severin, K., Gokhale, S., et al.: Social media enabled human sensing for smart cities.
AI Commun. (2015)
9. Adolph, C., Amano, K., Bang Jensen, B., et al.: Pandemic politics: timing state-level social
distancing responses to COVID-19. medRxiv (2020)
Investigation on the Influence of English
Expertise on Non-native
English-Speaking Students’ Scholastic
Performance Using Data Mining
Subhashini Sailesh Bhaskaran and Mansoor Al Aali
Abstract This investigation reports about an understanding of the connection

between English skill and scholastic accomplishment of science students in Bahrain.
Data from student information system were investigated by applying data mining
techniques mainly decision tree algorithm. The results demonstrated a signifi-
cant effect of English expertise on students’ final cumulative grade point average
(CGPA). These discoveries demonstrate that the English expertise of graduate
students in a non-western polyglot scholastic background is significant for their
scholarly accomplishment. Results from this investigation affirm the requirement for
colleges in polyglot backgrounds to put resources into non-native English-speaking
(L2) graduate students’ English expertise toward the beginning of their scholastic
projects. Instructional proposals are made, alongside recommendations for additional
investigation.
1 Related Literature
1.1 Language Expertise and Scholastic Accomplishment
The acknowledgment that language helps in science and mathematics learning has
prompted an expanded interest for substance territory expertise guidance [1–4]. Some
research has created solid link between expertise and scholastic execution in science
and arithmetic training (CCAAL 2010, p. 22). Disciplinary education, or substance
territory explicit expertise, comprises of expertise aptitudes and learning that help
graduate students’ comprehension of ideas identified with a specific field of study,
for example, science and arithmetic. Exceptional concern for disciplinary expertise
in science and arithmetic instruction is significant for various reasons. Science writ-
ings are frequently testing to graduate students and require additional endeavors to
S. S. Bhaskaran (B) · M. Al Aali

Ahlia University, Manama, Bahrain
e-mail: sbhaskaran@ahlia.edu.bh
https://doi.org/10.1007/978-981-16-1502-3_2
10 S. S. Bhaskaran and M. Al Aali
process. They are useful commonly and normally present thick and dynamic ideas,
utilize new phrasing and language that graduate students are not likely to encounter
in their day by day language use [5]. The expositive and specialized nature of science
writings puts levels of popularity on graduate students’ language aptitudes. The last
incorporate knowing particular vocabulary; translating logical images and graphs;
perceiving and understanding hierarchical examples regular to science writings;
deriving principle thoughts, utilizing inductive and deductive thinking abilities; and
perceiving circumstances and logical results connections [6]. Significant dominance
of language skills and perusing expertise are in this way imperative for graduate
students who are contemplating science and arithmetic, regardless of whether at
essential, auxiliary or at tertiary level. This is considerably more so for graduate
students in polyglot or bilingual backgrounds, who are not educated in their primary
language but rather in a subsequent language (L2). Tooth (2006) contends that the
particular semantic highlights that make science messages progressively thick and
dynamic can cause perusing perception issues particularly for English L2 students.
Because of a worldwide expanding relocation and development of individuals, bilin-
gual and polyglot backgrounds are developing. It is assessed that half of the total
populace utilizes more than one language or lingo in their regular day-to-day exis-
tence [7]. This extension of polyglots legitimizes more consideration for the expertise
practices of L2 students in science and arithmetic training (cf. [8], Rhodes and Feder
2014). Most research into literacy practices in science and mathematics education
comes from the richer western world. Unexpectedly, L2 examination into the rich
polyglot backgrounds is scarce [9, 10]. The current paper is enlivened by the scarcity
of research in the remainder of Middle East in regard to the job of language in science.
It is an endeavor to fill this research gap, and specifically to all the more likely compre-
hend the job of graduate students’ English expertise on scholarly accomplishment
in a non-western, polyglot instructive background. It reports on a conceptual model
that gives knowledge into the relationship between English expertise and scholastic
performance of science college graduate students in Bahrain, and an experimental
trial of that model.
This study analyzes the following questions:
(a) Is there a direct relationship between non-native English-speaking students’
scholastic English expertise and their scholastic accomplishment in science
and mathematics instruction in Bahrain?
(b) With respect to the level of English language expertise if there is noteworthy
difference in the scholastic accomplishment of students in Bahrain?
2 Data Mining Process
The steps of Data Mining data preparation, data selection, transformation, modeling
and evaluation are discussed below to unearth hidden information in the dataset that
was used to relate English scores and CGPA of students.
Investigation on the Influence of English Expertise … 11
3 Data Preparation
Student dataset of a higher education offering different degrees at the undergraduate

level was extracted from the student information system. The dataset pertains to
graduated students belonging to 12 programs between 2003 and 2014. The size of
the dataset is 646.
4 Data Selection
Being the second step data selection encompasses the method of gathering necessary
data supported by transformation of data which is the method of transforming data
into the necessary layout necessary for modeling (Fayyad 1996). Data was obtained
from the database using SQL queries related to English GPA and overall CGPA.
Following the extraction several tables were clubbed into a single table. Cleaning
was done by tackling missing values and variables were coded properly to allow the
use of classification algorithms. A Few variables were obtained directly from the
database. Certain features were computed or inferred based on other items present
in various tables. Using feature selection, variables were extracted. These features
were utilized in the following stage.
5 Modeling
Modeling algorithms are used for the discovery of knowledge. Classification is used
for categorizing data into different groups according to some conditions. A decision
tree uses a tree of choices and their probable outcomes, involving opportunity incident
outcomes, resource expenses, and efficiency. In order to find the relationship between
English results and final GPA of science students decision tree was applied.
The main aim of such a tree is to find the performance achieved by a student
in terms of CGPA based on the performance in English courses. This tree helps in
finding if English grades affect the overall GPA of the students. Such a knowledge
could help the students and advisors to know if there is an impact of the English
courses on the overall GPA and if there is an impact to coach the students on English
courses. It can be seen from the decision tree output that when the GPA of English
courses are lesser the final GPA of all courses is also lesser. Likewise when the GPA
Investigation on the Influence of English Expertise … 13
of the English courses is higher, then it is the case of final GPA of all courses. When
the English GPA is between 0 and 2.5, then the final GPA is between 2 and 2.5.
When the English GPA is more than 2.5, then the final GPA falls between 3.5 and 4
showing a direct relationship between the performance of English courses and final
GPA.
6 Discussion and Conclusion
This examination explored the job of English expertise on the scholastic accomplish-
ment in an example of science and mathematics graduate students. Utilizing deci-
sion tree examinations, the investigation showed that students’ scholastic English
expertise is important for their scholarly accomplishment in a polyglot scholastic
background. Consolidating two universally perceived perusing perception tests took
into account an expansive estimation of graduate students’ perusing abilities. A solid
impact was found between graduate students’ scholastic accomplishment and English
results.
The added value of the research is threefold. Our research broadens the focus
of L2 reading research in science and arithmetic instruction in a Bahraini polyglot
background. As argued in the paper, essential research into perusing in developing
nations is rare. Moreover, our investigation added considerably to our comprehension
of the connection between L2 graduate students’ English expertise and their science
and arithmetic accomplishment at tertiary level. The examination substantiates past
discoveries of the job of language in the science and arithmetic educational plan
(displayed in the presentation), in light of information from a Middle Eastern back-
ground. Finally, by adopting a longitudinal strategy, it shows that even after 4 years
of study, there is an indirect mediation connection between expertise and scholastic
accomplishment. These discoveries have significant instructional ramifications. Our
information affirms the requirement for colleges to put resources into L2 graduate
students’ expertise toward the beginning of their scholastic degrees. A Few univer-
sities in Bahrain have launched a mandatory Communicative program, orientation
in English program where students are trained in language and interaction skills.
This consideration ought to go past building vocabulary and dominance of word-
perusing abilities, since this is not an assurance that graduate students can under-
stand science writings (CCAAL 2010). Explicit thoughtfulness regarding preparing
science content is along these lines required. A second instructional ramification
has to do with the embodiment of creating perusing aptitudes: the more individ-
uals read, the better they become at it [11–13]. Notwithstanding the CS courses,
graduate students ought to take part in perusing widely as a feature of their scholarly
courses. Despite the fact that college graduate students in Bahrain guarantee to esteem
their reading material, they want to take in course content from different assets, for
example, addresses and address notes [14, 15]. This conduct, joined with restricted
access to perusing assets, confines graduate students’ perusing improvement. It is in
this way fundamental that college courses incorporate perusing assignments and give
adequate access to perusing materials. The finding that 10.3% of the graduate students
revealed utilizing English in their home condition is in accordance with Bahrain being
viewed as an ESL nation [16, 17]. The profoundly heterogeneous population, as far
as age (from 17 to 35 years of age), and utilization of home language (speaking
to 20 distinct dialects) demonstrates the requirement for establishments to cater to
enormous disparities regarding age and language aptitudes inside their homerooms.
References
1. Carnegie Council on Advancing Adolescent Literacy. Time to act: An agenda for advancing
adolescent literacy for college and career success. New York, NY, Carnegie Corporation of
New York (2010)
2. Fang, Z., Lamme, L., Pringle, R., Patrick, J., Sanders, J., Zmach, C., Henkel, M.: Integrating
reading into middle school science: What we did, found and learned. Int. J. Sci. Edu. 30(15),
2067–2089 (2008). https://doi.org/10.1080/09500690701644266
3. Hand, B.M., Alvermann, D.E., Gee, J., Guzzetti, B.J., Norris, S.P., Phillips, L.M., . . . Yore,
L.D.: Guest editorial. Message from the Bisland group: what is literacy in science literacy? J.
Res. Sci. Teach. 40(7), 607–615 (2003)
4. Norris, S.P., Phillips, L.M.: How literacy in its fundamental sense is central to scientific literacy.
Sci. Edu. 87, 224–240 (2003)
5. Palinscar, A.: The next generation science standards and the common core state standards:
Proposing a happy marriage. Sci. Children 51(1), 10–15 (2013)
6. Barton, M.L., Jordan, D.L.: Teaching reading in science. A supplement to teaching reading in
the content areas: If not me, then who? McREL, Aurora, CO (2001)
7. Ansaldo, A.I., Marcottea, K., Schererc, L., Raboyeaua, G.: Languagetherapy and bilingual
aphasia: clinical implications of psycholinguistic and neuroimaging research. J. Neurolinguis-
tics 21, 539–557 (2008)
8. Barwell, R., Barton, B., Setati, M.: Multilingual issues in mathematics education: introduction.
Educ. Stud. Math. 64(2), 113–119 (2007)
9. Paran, A., Williams, E.: Editorial: reading and literacy in developing countries. J. Res. Read.
30(1), 1–6 (2007)
10. Pretorius, E.J., Mampuru, D.M.: Playing football without a ball: language, reading and
academic performance in a high-poverty school. J. Res. Read. 30(1), 38–58 (2007)
11. Cox, K.E., Guthrie, J.T.: Motivational and cognitive contributions to students’ amount of
reading. Contemp. Edu. Psychol. 26, 116–131 (2001)
12. Mullis, I. V. S., Martin, M. O., Kennedy, A. M., Foy, P.: PIRLS 2006 international report; IEA’s
progress in international reading literacy study in primary schools in 40 countries. Boston, MA:
International Association for the Evaluation of Educational Achievement (IEA) (2007)
13. Organisation for Economic Co-operation and Development. PISA 2009 assessment framework,
key competencies in reading, mathematics and science. Paris, France, Author (2009)
14. Owusu-Acheaw, M., Larson, A.G.: Reading habits among students and its effect on academic
performance: A study of students of Koforidua polytechnic. Lib. Phil. Practice, Paper 1130,
1–22 (2014)
15. Stoffelsma, L.: Short-term gains, long-term losses? A diary study on literacy practices in Ghana.
J. Res Read. (2018). https://doi-org.ru.idm.oclc.org/10.1111/1467-9817.12136
16. Ahulu, S.: Hybridized English in Ghana. Engl. Today: Int. Rev. Engl. Lang. 11(4), 31–36
(1995). https://doi.org/10.1017/S0266078400008609
17. Kachru, B.B.: Standards, codification and sociolinguistic realism: The English language in the
outer circle. In: Quirk R., Widdowson H.G. (eds.) English in the world: teaching and learning the
language and literatures pp. 11–30. Cambridge, England, Cambridge University Press (1985)
Machine Learning Algorithms
for Modelling Agro-climatic Indices:
A Review
G. Edwin Prem Kumar and M. Lydia
Abstract Modelling lays a solid platform to assess the effects of climate variability
on agricultural crop yield and management. It also aids in measuring the effectiveness
of control measures planned and to design optimal strategies to enhance agricultural
productivity and crop intensity. Models that aid in predicting drought, soil quality,
crop yield, etc. in the light of climate variabilities can go a long way in enhancing
global food security. Efficient modelling of agro-climatic indices will simplify the
upscaling of experimental observations and aid in the implementation of climate-
smart agriculture. This paper aims to present a comprehensive review of the use
of machine learning algorithms for modelling agro-climatic indices. Such models
find effective application in crop yield forecasting, crop monitoring, and manage-
ment, soil quality prediction, modelling evapotranspiration, rainfall, drought, and
pest outbreaks. The research challenges and future research directions in this area
have also been outlined.
1 Introduction
The impact of weather and climate on agricultural yield has been significant. It has
been proven that variability in climate-related parameters can have worse effects on
food security on a global scale. The El-Nino Southern Oscillation (ENSO) being the
lead player in causing inter-annual climate mode changes results in droughts and a
significant reduction in crop yield. Variability in climatic conditions has significantly
affected cropping area and intensity as well [1]. Hence, modelling of agro-climatic
indices will be of great advantage to farmers to plan well in advance. The challenges
involved in developing models for agriculture incorporating climate change involve
the development of biophysical and economic models, discrete-event models, and
models for dynamic change, interactions, management, and uncertainties [2].
Agro-climatic indices are defined based on the relationships between crop
yield/management etc. to variation in climate. They are used to measure the optimal
G. Edwin Prem Kumar (B) · M. Lydia

Sri Krishna College of Engineering and Technology, Coimbatore, India
https://doi.org/10.1007/978-981-16-1502-3_3
16 G. Edwin Prem Kumar and M. Lydia
climatic conditions required for desired agricultural performance in terms of yield,

intensity, etc. The agro-climatic indices include parameters related to growing season,
frost conditions, and multicriteria climate classification (MCC) system [3]. Parame-
ters related to the growing season for viticulture include growing season temperature,
precipitation, length, the number of dry and wet days. Frost conditions are depicted
by mean data of first frost fall and last spring frost, number of days with frost and
days with minimum temperature less than −15 °C. Furthermore, the MCC system
includes parameters like heliothermal index, dryness index and cool night index.
Crop simulation models (CSMs) are process-based models that describe crop
growth and development as a function of weather and soil conditions [4]. CSMs
played a critical role in bioeconomic modelling, integrating the land use and agri-
cultural productivity, both at regional and global scales. However, statistical models
are known to scrutinize the relationship between agricultural crop yield and climate
variables much better than CSMs as they capture the impact of many variables both
directly and indirectly. These models outperformed CSMs by discovering relation-
ships and modelling mechanisms of stressed biotic environments better. Though
statistical models are severely limited by the availability of sufficient, quality data
pertaining to weather, yield, agricultural management, etc., it has been found that
hybrid statistical and CSMs can enhance the performance of statistical models [4].
In recent years, machine learning (ML) has emerged in a big way as a technique
to revolutionize several areas of research including agriculture (Fig. 1). ML tech-
niques along with big data, the Internet of Things (IoT), and several other advanced
hybrid algorithms can handle complicated non-linear models and produce accurate
Fig. 1 Machine learning

applications in agriculture
Crop yield
forecasting
Crop
Pest outbreak
monitoring &
model
management
ML
applications
in
Agriculture
Modelling
Evaluating
rainfall and
soil quality
drought
Evapo-
transpiration
model
Machine Learning Algorithms for Modelling … 17
results. ML models like regression, clustering, artificial neural networks (ANN),

Bayesian models, support vector machines (SVM), ensemble learning, etc. find appli-
cation in several agricultural processes like crop yield prediction, rainfall and drought
prediction, crop management, pest outbreaks, etc. [5, 6].
This paper aims to provide an exhaustive review of the ML techniques used to
model various agro-climatic indices, which are in turn useful in the estimation of key
parameters in crop management. The ML techniques-based agro-climatic models
used for several agricultural applications have been described in Sects. 2 and 3. The
further research directions and challenges in this area have been suggested in Sect. 4
and the conclusions drawn from this survey are presented in Sect. 5.
2 Machine Learning for Crop Yield Forecasting
Machine learning-based agro-climatic models have been used for forecasting crop
yield, monitoring, and management of crop. This section outlines the recent research
work carried out in these areas. Annual crop yield is significantly determined by
the climatic conditions. Regression-based models can be used to assess crop yield
based on agro-climatic indices like Standardized Precipitation-Evapotranspiration
Index (SPEI). Mathieu and Aires developed models to make annual estimation and
seasonal prediction of crop yield using more than fifty agro-climatic indices [7].
Elavarasan and Vincent proposed a deep reinforcement learning model using agro-
climatic indices for crop yield prediction and compared it with other ML models like
ANN, Long Short-Term Memory (LSTM), gradient boosting, random forest (RF),
etc. The accuracy of the model was evaluated using suitable evaluation metrics [8].
Mkhabela et al. predicted the crop yield of barley, canola, field peas and spring
wheat using regression models in different agro-climatic zones, which included sub-
humid, semi-arid and arid regions [10]. Johnson et al. used ML techniques and
vegetation indices for crop yield forecasting. The vegetation indices used as predic-
tors for crop yield include, the Normalized Difference Vegetation Index (NDVI) and
Enhanced Vegetation Index (EVI) derived from the Moderate-resolution Imaging
Spectro-radiometer (MODIS), and NDVI derived from the Advanced Very High-
Resolution Radiometer (AVHRR) [11]. ANN is the most common ML algorithm used
and convolutional NN (CNN) is the most widely used DL algorithm for predicting
crop yield. The most common features used for prediction of crop yield include
temperature, rainfall and soil type [17]. Table 1 outlines the recent research carried
out in crop yield forecasting.
Table 1 Models for crop yield forecasting

Authors Agro-climatic indices ML technique
Mathieu and Aires [7] SPEI and 49 other parameters Regression model
Elavarasan and Vincent [8] 38 parameters Deep Recurrent Q-Network
(DRQN)
Mishra et al. [9] Rainfall, temperature, humidity Linear regression (LR), Ridge
regression, Lasso regression,
Support Vector Regression
(SVR) with linear, polynomial
and Radial Basis Function
(RBF) kernels
Johnson et al. [11] Vegetation indices Multiple linear regression
(MODIS-NDVI, MODIS-EVI, (MLR), Bayesian neural
AVHRR-NDVI) networks, Model-based
recursive partitioning
Chen et al. [12] Photosynthetically Active MLR
Radiation (PAR), Radiation Use
Efficiency (RUE), vegetation and
meteorological indices
Folberth et al. [13] Annual climate indices, growing Extreme gradient boosting, RF
season climate indices, monthly
climate indices
Mathieu and Aires [14] SPEI, average temperature NN Classifier
Mupangwa et al. [15] Big data from simulated Logistic regression, Linear
cropping systems discriminant analysis,
K-nearest neighbour (K-NN),
Classification and Regression
trees, Gaussian naïve Bayes,
SVM
Bai et al. [16] Landsat 8 vegetation index and SVM, NN, Mahalanobis
phenological length Distance, Maximum
Likelihood
Feng et al. [18] Daily climate data Hybrid modelling approach
Agricultural Production
Systems sIMulator
(APSIM)-RF, APSIM-MLR
Feng et al. [19] In-situ climate data, remote APSIM-RF, APSIM-MLR
sensing data, wheat trial data,
soil hydraulic properties
Kamir et al. [20] NDVI time series, climate time Regression, SVR with RBF
series, Yield maps, crop yield
statistics
Cai et al. [21] Satellite data, climate data Least Absolute Shrinkage and
Selection Operator (LASSO),
NN, RF, SVM
(continued)
Table 1 (continued)
Authors Agro-climatic indices ML technique
Zarei et al. [22] United Nations Environment Simple and multiple
Programme (UNEP) aridity Generalizes Estimation
index, Modified De-Martonne Equation
index
Xu et al. [23] Meteorological data RF, SVM
Gumuscu et al. [24] Air temperature, daily minimum k-NN, SVM, decision trees
air temperature, daily
precipitation
Huy et al. [25] 12 climate indices D-vine quantile regression
model
Wang et al. [26] Southern Oscillation Index RF
(SOI), SOI phase, NINO3.4,
Multivariate ENSO Index (MEI)
3 Machine Learning for Crop Monitoring

and Management
Machine learning-based agro-climatic models prove to be of great advantage in

crop monitoring and management (Table 2). Agro-climatic indices along with high-
resolution remote sensing data can be an effective tool for crop monitoring. Balles-
teros et al. employed two agro-climatic indices namely reference evapotranspiration
(ETo) and growing degree days (GDD) and few other vegetable indices for monitoring
crop [27]. ML algorithms and vegetation indices were used to characterize and map
cropping patterns [28]. The robustness of Landsat-based fraction of absorbed photo-
synthetically active radiation (fAPAR) models was assessed using ML algorithms
[29].
4 Research Directions and Challenges
Accuracy in agricultural modelling is a very critical parameter to be satisfied. Effec-

tive models need a large amount of quality data, which is indeed a big challenge
in this research. The performance of predictive modelling improves significantly if
there is a substantial increase in the sample size in both spatial and temporal distri-
butions [21]. Climate variability directly and indirectly affects several agricultural
processes and the yield, making the modelling process a challenging one. Since the
cropping area and intensity keeps changing, the use of static or historic data is likely
to have potential errors. Annual mappings of crop area obtained from the satellite
will aid in improved accuracy. The use of passive or active remote sensing data
improves the accuracy of models as it incorporates parameters like canopy biomass
and water content. ML algorithms that model the non-linearity better and capture
Table 2 Models for crop monitoring and management

Authors Objective ML technique
Ballesteros et al. [27] Crop monitoring MLR
Feyisa et al. [28] Map cropping patterns SVM, RF, C5.0
Muller et al. [29] Assess the fidelity of models MLR, Decision tree, RF
Vindya and Vedamurthy [30] Crop selection Naïve Bayes Classification
Kale and Patil [31] Decision support system Data mining, Fuzzy logic
Shi et al. [32] Ascertain change in NDVI RF Regression with residual
analysis
Lee et al. [33] Projection of life-cycle Boosted regression tree
environmental impacts
Macedo et al. [34] Estimation of crop area Convolutional LSTM models
Young et al. [35] Seasonal forecasting of daily Regularized Extreme Learning
mean air temperatures Machine
Sharma et al. [36] Sustainable agriculture supply ANN, Bayesian network,
chain performance clustering, DL, Ensemble
learning, regression, SVM
Jakariya et al. [37] Assessment of vulnerability LR, Bayesian ridge regression,
index XGB regression, RF regression,
Extremely randomized trees
regression
well the relationship between the input and output variables are the need of the hour.
The algorithms need to respond to variabilities at all levels and should ensure quicker
convergence with higher computational speed.
5 Conclusion
Climate is both a resource and a restraint for agriculture. Early and consistent fore-
casting models play a critical role in farmer’s decision-making pertaining to crop
selection, yield, pest occurrence, irrigation needs, etc. Agro-climatic indices are
indicators of climate characteristic which has definite agricultural significance. The
spatial characteristics and temporal distribution of agro-climatic indices can be inves-
tigated and modelled to understand the growing seasonal parameters of different
crops like wheat, maize, etc. This paper presented an exhaustive review on ML
algorithms for crop yield forecasting, crop monitoring and forecasting based on
agro-climatic indices. Research challenges and directions have also been presented.
References
1. Iizumi, T., Ramankutty, N.: How do weather and climate influencing cropping area and
intensity? Glob. Food Sec. 4, 46–50 (2015)
2. Kipling, R.P., Topp, C.F.E., Bannink, A., Bartley, D.J., Penedo, I.B., Cortignani, R., del Prado,
A., Dono, G., Faverdin, P., Graux, A.I., Hutchings, N.J., Lauwers, L., Gulzari, S.O., Reidsma, P.,
Rolinski, S., Ramos, M. R., Sandars, D.L., Sandor, R., Schonhart, M., Seddaiu, G., Middelkoop,
J.V., Shrestha, S., Weindl, I., Eory, V.: To what extent is climate change adaptation a novel
challenge for agricultural modellers? Environ. Model. Softw. 120, 104492 (2019)
3. Ruml, M., Vukovic, A., Vujadinovic, M., Djurdjevic, V., Vasic, Z.R., Atanackovic, Z., Sivcev,
B., Markovic, N., Matijasevic, S., Petrovic, N.: On the use of regional climate models: impli-
cations of climate change for viticulture in Serbia. Agric. For. Meteorol. 158–159, 53–62
(2012)
4. Rotter, R.P., Hoffman, M.P., Koch, M., Muller, C.: Progress in modelling agricultural impacts
of and adaptations to climate change. Curr. Opin. Plant Biol. 45(B), 255–261 (2018)
5. Liakos, K.G., Busato, P., Moshou, D., Pearson, S., Bochtis, D.: Mach. Learn. Agric. Rev. 18,
2674 (2018)
6. Priya, R., Ramesh, D.: ML based sustainable precision agriculture: a future generation
perspective. Sustain. Comput. Inf. Syst. 28, 100439 (2020)
7. Mathieu, J.A., Aires, F.: Assessment of the agro-climatic indices to improve crop yield
forecasting. Agric. For. Meteorol. 253–254, 15–30 (2018)
8. Elavarasan, D., Vincent, D.: Crop yield prediction using deep reinforcement learning model
for sustainable agrarian applications. IEEE Access 8, 86886–86901 (2020)
9. Mishra, S., Mishra, D., Santra, G.H.: Adaptive boosting of weak regressors for forecasting of
crop production considering climatic variability: an empirical assessment. J. King Saud Univ.
Comput. Inf. Sci. (2017)
10. Mkhbela, M.S., Bullock, P., Raj, S., Wang, S., Yang, Y.: Crop yield forecasting on the Canadian
Prairies using MODIS NDVI data. Agric. For. Meteorol. 151, 385–393 (2011)
11. Johnson, M.D., Hsieh, W.W., Cannon, A.J., Davidson, A., Bedard, F.: Crop yield forecasting
on the Canadian Prairies by remotely sensed vegetation indices and machine learning methods.
Agric. For. Meteorol. 218–219, 74–84 (2016)
12. Chen, Y., Donohue, R.J., McVicar, T.R., Waldner, F., Mata, G., Ota, N., Houshmandfar,
A., Dayal, K., Lawes, R.A.: Nationwide crop yield estimation based on photosynthesis and
meteorological stress indices. Agric. For. Meteorol. 284, 107872 (2020)
13. Folberth, C., Baklanov, A., Balkovic, J., Skalsky, R., Khabarov, N., Obersteiner, M.: Spatio-
temporal downscaling of gridded crop model yield estimates based on machine learning. Agric.
For. Meteorol. 264, 1–15 (2019)
14. Mathieu, J.A., Aires, F.: Using neural network classifier approach for statistically forecasting
extreme corn yield losses in Eastern United States. Earth Space Sci. 5, 622–639 (2018)
15. Mupangwa, W., Chipindu, L., Nyagumbo, I., Mkuhlani, S., Sisito, G.: Evaluating machine
learning algorithms for predicting maize yield under conservation agriculture in Eastern and
Southern Africa. SN Appl. Sci. 2, 952 (2020)
16. Bai, T., Zhang, N., Mercatoris, B., Chen, Y.: Jujube yield prediction method combining Landsat
8 Vegetation Index and the phenological length. Comput. Electron. Agric. 162, 1011–1027
(2019)
17. Klompenburg, T.V., Kassahun, A., Catal, C.: Crop yield prediction using machine learning: a
systematic literature review. Comput. Electron. Agric. 177, 105709 (2020)
18. Feng, P., Wang, B., Liu, D.L., Waters, C., Yu, Q.: Incorporating machine learning with
biophysical model can improve the evaluation of climate extremes impacts on wheat yield
in south-eastern Australia. Agric. For. Meteorol. 275, 100–113 (2019)
19. Feng, P., Wang, B., Liu, D.L., Waters, C., Xiao, D., Shi, L., Yu, Q.: Dynamic wheat yield
forecasts are improved by a hybrid approach using a biophysical model and machine learning
technique. Agric. For. Meteorol. 285–286, 107922 (2020)
20. Kamir, E., Waldner, F., Hochman, Z.: Estimating wheat yields in Australia using climate
records, satellite image time series and machine learning methods. ISPRS J. Photogram. Remote
Sens. 160, 124–135 (2020)
21. Cai, Y., Guan, K., Lobell, D., Potgieter, A.B., Wang, S., Peng, J., Xu, T., Asseng, S., Zhang,
Y., You, L., Peng, B.: Integrating satellite and climate data to predict wheat yield in Australia
using machine learning approaches. Agric. For. Meteorol. 274, 144–159 (2019)
22. Zarei, A.R., Shabani, A., Mahmoudi, M.R.: Comparison of the climate indices based on the
relationship between yield loss of rain-fed winter wheat and changes of climate indices using
GEE model. Sci. Total Environ. 661, 711–722 (2019)
23. Xu, X., Gao, P., Zhu, X., Guo, W., Ding, J., Li, C., Zhu, M., Wu, X.: Design of an integrated
climatic assessment indicator (ICAI) for wheat production: a case study in Jiangsu Province,
China. Ecol. Indic. 101, 943–953 (2019)
24. Gumuscu, A., Tenekeci, M.E., Bilgili, A.V.: Estimation of wheat planting date using machine
learning algorithms based on available climate data. Sustain. Comput. Inf. Syst. 100308 (2019)
25. Huy, T.H., Deo, R.C., Mushtaq, S., An-Vo, D.A., Khan, S.: Modeling the joint influence of
multiple synoptic-scale, climate mode indices on Australian wheat yield using a vine copula-
based approach. Eur. J. Agron. 98, 65–81 (2018)
26. Wang, B., Feng, P., Waters, C., Cleverly, J., Liu, D.L., Yu, Q.: Quantifying the impacts of pre-
occurred ENSO signals on wheat yield variation using machine learning in Australia. Agric.
For. Meteorol. 291, 108043 (2020)
27. Ballesteros, R., Ortega, J.F., Hernandez, D., Campo, A.D., Moreno, M.A.: Combined use of
agro-climatic and very high-resolution remote sensing information for crop monitoring. Int. J.
Appl. Earth Obs. Geoinf. 72, 66–75 (2018)
28. Feyisa, G.L., Palao, L.K., Nelson, A., Gumma, M.K., Paliwal, A., Win, K.T., Nge, K.H.,
Johnson, D.E.: Characterizing and mapping cropping patterns in a complex agro-ecosystem:
an iterative participatory mapping procedure using machine learning algorithms and MODIS
vegetation indices. Comput. Electron. Agric. 175, 105595 (2020)
29. Muller, S.J., Sithole, P., Singels, A., Niekerk, A.V.: Assessing the fidelity of Landsat-based
fAPAR models in two diverse sugarcane growing regions. Comput. Electron. Agric. 170,
105248 (2020)
30. Vindya N.D., Vedamurthy H.K.: Machine learning algorithm in smart farming for crop iden-
tification. In: Smys, S., Tavares, J., Balas, V., Iliyasu A. (eds.) Computational vision and bio-
inspired computing, ICCVBIC 2019. Advances in Intelligent Systems and Computing, vol.
1108. Springer, Cham (2020)
31. Kale, S.S., Patil, P.S.: Data mining technology with Fuzzy Logic, neural networks and machine
learning for agriculture. In: Balas, V., Sharma, N., Chakrabarti, A. (eds.) Data management,
analytics and innovation. Advances in Intelligent Systems and Computing, vol. 839. Springer,
Singapore (2019)
32. Shi, Y., Jin, N., Ma, X., Wu, B., He, Q., Yue, C., Yu, Q.: Attribution of climate and human activ-
ities to vegetation change in China using machine learning techniques. Agric. For. Meteorol.
294, 108146 (2020)
33. Lee, E.K., Zhang, W.J., Zhang, X., Adler, P.R., Lin, S., Feingold, B.J., Khwaja, H.A., Romeiko,
X.X.: Projecting life-cycle environmental impacts of corn production in the U.S. Midwest under
future climate scenarios using a machine learning approach. Sci. Total Environ. 714, 136697
(2020)
34. Macedo, M.M.G., Mattos, A.B., Oliveira, D.A.B.: Generalization of convolutional LSTM
models for crop area estimation. IEEE J. Sel. Top. Appl. Earth Obs. Remote Sens. 13,
1134–1142 (2020)
35. Young, S.J., Rang, K.K., Chul, H.J.: Seasonal forecasting of daily mean air temperatures using
a coupled global climate model and machine learning algorithm for field-scale agricultural
management. Agric. For. Meteorol. 281, 107858 (2020)
36. Sharma, R., Kamble, S.S., Gunasekaran, A., Kumar, V., Kumar, A.: A systematic literature
review on machine learning applications for sustainable agriculture supply chain performance.
Comput. Oper. Res. 119, 104926 (2020)
37. Jakariya, Md., Alam, Md.S., Rahman, Md.A., Ahmed, S., Elahi, M.M.L., Khan, A.M.S., Saad,
S., Tamim, H.M., Ishtiak, T., Sayem, S.M., Ali, M.S., Akter, D.: Assessing climate-induced
agricultural vulnerable coastal communities of Bangladesh using machine learning techniques.
Sci. Total Environ. 742, 140255 (2020)
Design of Metal-Insulator-Metal Based
Stepped Impedance Square Ring
Resonator Dual-Band Band Pass Filter
Surendra Kumar Bitra and M. Sridhar
Abstract In this paper, a metal–insulator metal (MIM) based plasmonic stepped

impedance square ring resonator (SI-SRR) band-pass filter (BPF) is designed and
analyzed for dual-band applications. The MIM-based SI-SRR is investigated using
commercially available CST studio suite. The proposed SI-SRR is compact and low
power requirements suitable for Photonic Integrated Circuits (PICs). The SI-SRR is
operated in the wavelengths of 1317 nm (227.6 THz) and 1640 nm (182.8 THz) with
appropriate reflection and transmission parameters. The stepped impedance stubs
are used in the ring resonator for tunable operating bands. The proposed SI-SRR has
wide applications in PICs
1 Introduction
The waves that are produced at Metal and Insulator region when light is interacting
are the Surface Plasmon Polarities (SPPs) [1]. These are high-speed electromagnetic
waves traveling on the metal–insulator regions. MIM is one of the popular waveguides
used for designing most of the optical devices [2]. MIM-based components are
suitable for PICs. Recently, MIM-based components like stub ring resonators [3, 4],
triangular resonators [5], rectangular ring resonator [6], square ring resonators [7],
and circular ring resonators [8]. Different excitation schemes of ring resonators are
briefly analyzed [9]. The ring resonators provide the dual-band operating wavelengths
discussed in [8, 9].
In this work, first investigate the MIM-based plasmonic SI-SRR dual-band BPF for
the O and L optical bands. The transmission performance of the filter is analyzed using
CST studio suite. The SI-SRR improves the bandwidth and produces a more confine-
ment nature. The concurrent plasmonic ring resonators and filters are operating in
two or more frequency bands simultaneously. Several multi-band components are
proposed in [9].
S. K. Bitra (B) · M. Sridhar

Department of ECE, KLEF, Guntur, Andhra Pradesh, India
https://doi.org/10.1007/978-981-16-1502-3_4
26 S. K. Bitra and M. Sridhar
Table 1 Design parameters

S. No. Parameter Value in nm
of SI-SRR
1 L1 1000
2 L2 900
3 L3 200
4 W3 50
5 L4 200
6 W4 60
7 d 50
8 g 10
The paper organization is as follows: Sect. 2 describes the SI-SRR dual-band BPF
design procedure and optimized parameters using MIM waveguide. The simulation
results and field distributions are included in Sect. 3. Finally, the paper ends with the
conclusion.
2 Stepped Impedance SRR Design
The proposed filter consists of coupled line feed and square ring resonator with stub
loaded on one side of the ring forms the stepped impedance square ring resonator
(SI-SRR) is shown in Fig. 1. The basic MIM characteristics and SRR dual-band char-
acteristics are investigated in [10]. The enhancement of previous work is included in
the stub to form the SI-SRR to give the better notching characteristics. The dimen-
sions of the proposed SI-SRR dual-band BPF are represented in Table 1. The filter is
designed and simulated in commercially available CST studio suite. The mesh sizes
were taken as 5 nm × 5 nm. The dimensions of the SRR are calculated using [11]. The
SI-SRR is suitable for optical O band (1260–1360 nm) and U band (1625–1675 nm).
The filter is easily fabricated using lithographic techniques. For designing purpose,
the metal is taken as silver and insulator is silica.
3 Simulation Results
The SI-SRR is designed using the CST studio suite using the above-optimized dimen-
sions. By applying the coupled mode excitations, the reflection and transmission
coefficients are observed and represented in Fig. 2. The reflection coefficient is high-
lighted in the red color, operated in dual bands are 1317 and 1640 nm with the power
of approximately −15 dB for both the bands. The transmission coefficient is repre-
sented in green color with the power of −3 dB approximately. Due to the stub in
Design of Metal-Insulator-Metal Based Stepped Impedance Square … 27
` W4
Port 1 L4
Port 2
L3
W3 `
L2
d
L1
Fig. 1 Proposed SI-SRR dual-band BPF

dB
Fig. 2 Reflection and transmission coefficient of SI-SRR dual-band BPF
the ring resonator, improving the bandwidth at O and U bands is observed. PML
boundary conditions are used to simulate the SI-SRR filter.
Figure 3 represents the field distributions of the SI-SRR filter at 1317 and 1640 nm.
The field distributions show the power confinement of the given power at the metal
and insulator region.
4 Conclusion
The MIM-based plasmonic SI-SRR is suitable for optical O (1260–1360 nm) and
U band (1625–1675 nm) dual-band applications. The Reflection and transmission
coefficient of SI-SRR with resonant behavior is numerically analyzed. The center
28 S. K. Bitra and M. Sridhar
Fig. 3 Field Distributions at a 1317 nm (227.6 THz) and b 1640 nm (182.8 THz)
operated wavelength of the SI-SRR is 1317 and 1640 nm with −15 dB reflection coef-
ficient. The SI-SRR is easily fabricated using semiconductor fabrication procedure
techniques. SI-SRR filter is best suitable for photonic integrated circuit applications.
References
1. Barnes, W.L., Dereux, A., Ebbesen, T.W.: Surface plasmon subwavelength optics. Nature 424,
824–830 (2003)
2. Ozbay, E.: Plasmonics: merging photonics and electronics at nanoscale dimensions. Science
(80) 311, 189–193 (2006)
3. Taylor, P., Li, C., Qi, D., Xin, J., Hao, F.: Metal insulator metal plasmonic waveguide for low
distortion slow light at telecom frequencies. J. Mod. Opt. 61, 37–41 (2014)
Design of Metal-Insulator-Metal Based Stepped Impedance Square … 29
4. Zafar, R., Salim, M.: Analysis of asymmetry of fano resonance in plasmonic metal insulator
metal waveguide. J. Photonics 23, 1–6 (2016)
5. Oh, G., Kim, D., Kim, S.H., Ki, H.C., Kim, T.U., Choi, T.: Integrated refractometric sensor
utilizing a triangular ring resonator combined with SPR. IEEE Photonics Tech. Lett. 26, 2189–
2192 (2014)
6. Yun, B., Hu, G., Cui, Y.: Theoretical analysis of a nanoscale plasmonic filter based on
rectangular metal insulator metal waveguide. J. Phys. 43, 385102 (1–8) (2010)
7. Liu, J., Fang, G., Zhao, H., Zhang, Y.: Plasmon flow control at gap waveguide junctions using
square ring resonators. J. Phys. 43, 055103 (1–6) (2009)
8. Setayesh, A., Miranaziry, S.R., Abrishamian, M.S.: Numerical investigation of tunable band
pass\band stop plasmonic filters with hollow core circular ring resonators. J. Opt. Soc. Korea
43, 82–89 (2011)
9. Vishwanath, M., Khan, H.: Excitation schemes of plasmonic angular ring resonator based band
pass filters using MIM waveguide. Photonics 6, 1–9 (2019)
10. Bitra, S.K., Sridhar, M.: Design of nanoscale square ring resonator band pass filter using metal
insulator metal. In: Chowdary, P., Charkravarthy, V. (eds.) ICMEET Conference 2020, vol.
655. Springer, Singapore (2020)
11. Yun, B., Hu, G., Cui, Y.: Theoretical analysis of nanoscale plasmonic filter based on a
rectangular metal insulator metal waveguide. J. Phys. D Appl. Phys. 43, 385120 (2010)
Covid-19 Spread Analysis
Srinivas Kanakala and Vempaty Prashanthi
Abstract Based on the public datasets afforded by John Hopkins University and
Canadian health authorities, we developed a forecasting model of Covid-19 after
analyzing the spread. Data related to the cumulative amount of definite cases, per
day, in each country and another dataset consisting of various life factors, scored
by the people living in each country around the globe. We are going to merge these
two datasets to see if there is any relationship between the spread of the virus in
a country by preprocessing, merging and finding correlation between datasets we
will calculate needed measures and prepare them for an analysis, then we will try to
predict the spread of cases by using various methods. Time series data tracking the
number of people affected by the coronavirus globally, including confirmed cases
of the coronavirus, the number of people who have died due to the coronavirus and
the number of people who have recovered from the deadly infection. Data science
can give accurate pictures of coronavirus outcomes and also helps in tracking the
spread. Secondly using Covid-19 data, we can make supply chain logistics decisions
in spreadsheets supplies of personal protective equipment and ventilators to hospi-
tals and clinics across the world. An analysis of the country, by state and region,
identifying locations of highest need for supplies and ventilators according to the
dataset collected. This is called a supply plan. Finally, create a set of visualizations
and then add these visualizations to a presentation so that we can report on findings.
1 Introduction
The tale Covid that began in Wuhan, China, has spread to practically all nations and
was announced as pandemic [1]. The degree of this flare-up is fast. It is difficult to
precisely survey the lethality of this infection and it has all the earmarks of being
S. Kanakala (B)
VNR Vignana Jyothi Institute of Engineering and Technology, Hyderabad, India
V. Prashanthi
Gokaraju Rangaraju Institute of Engineering and Technology, Hyderabad, India
https://doi.org/10.1007/978-981-16-1502-3_5
32 S. Kanakala and V. Prashanthi
unmistakably more deadly than the Covid that caused SARS and MERS. Researchers
[2] have recognized two new strains of the Covid, demonstrating it is now been
changed at any rate once. The greatest test is an obscure number of individuals have
been contaminated by the infection without getting indicative. These individuals
are transporters of the infection without themselves giving any indications. At first,
individuals who gave no indications of disease were not isolated and this prompts
the spread of the infection at a gigantic rate. The infection is additionally appeared to
influence its hosts lopsidedly. Youngsters appear to be less inclined to be tainted while
the moderately aged and more seasoned grown-ups are mysteriously contaminated.
Men are bound to kick the bucket from the contamination contrasted with ladies,
and furthermore individuals with a more fragile safe framework, Type 2 diabetes and
hypertension. Be that as it may, as of late numerous alive and well youthful people
have kicked the bucket from the contamination making it much harder to comprehend
the impact of Covid-19 [3, 4].
2 Literature Survey
Coronavirus Fig. 1 is the overwhelming illness brought about by and was called
Covid. This new virus was vague before and started in Wuhan, China, in December
2019. Coronavirus is a pandemic affecting many countries.
Fig. 1 Coronavirus
Covid-19 Spread Analysis 33
2.1 Symptoms
The indications of Covid-19 [5] are general influenza like and a few patients increase
an great kind of pneumonia. Patients have fever, muscle pain and body throbs, hacks
and sore throat about following six days of getting the contamination. The huge
people feel truly desperate and frail and improve all alone, yet a minority of patients
will deteriorate following 5–7 days of ailment and the patients have windedness and
exacerbating hack. The hack is dry and not wet. It is even observed that patients have
solid cerebral pains. Furthermore, the side effects are somewhat unique in relation to
influenza. People tainted from the infection might not have a virus. However, a few
people do not become ill while being contaminated and are spreading the infection
to new has. These individuals ought not to be all over town spreading the illness.
Individuals who got tainted and have been effectively restored have likewise got
contaminated by the Covid-19 once more. Making it much harder to contain the
episode. There is no anti-microbial to treat the Covid-19 and it may not be accessible
until the spring of 2021. This makes it much more imperative to take preventive
activities.
2.2 No Symptoms
Coronavirus is basically extended with respiratory beads detached by somebody

who is hacking or has other effects, like fever or sluggishness [6]. Many people who
have coronavirus experience just mellow indications. These are the symptoms in the
beginning. Most as of late it has been indicated that elevated levels of the infection
are available in respiratory discharges during the “presymptomatic period that can a
days ago to over seven days” before the fever and hack normal for Covid-19. This
capacity of the infection to be communicated by individuals without side effects is a
significant purpose behind the pandemic. Some news show that persons who are not
having any manifestations can communicate the virus.
2.3 Coronavirus Modes of Spread
The Covid spreads principally from one person to other [7]. This occurs among
peoples who are close to each other. Beads which are created when a contaminated
individual hacks or wheezes may land in the mouths or noses of individuals who are
close by, or potentially be breathed in into their lungs. An individual contaminated
with Covid—even one without any side effects may emanate vaporizers when they
talk or relax. Mist concentrates are irresistible viral particles that can buoy or float
around noticeable all around for as long as three hours. One can be affected by Covid-
19 when he touches an item which has virus and then touches their own mouth, nose,
or conceivably eyes.
2.4 Importance of Social Distance and Self-isolation
Every person should maintain social distancing of about 6 ft or more from others.
Schools, gatherings, occasions, malls, etc. do not maintain any social distancing.
Therefore, these are closed during Covid. This will help the society from virus, as
the spread will be controlled. Self-isolation is an important measure that should be
taken by the people who is affected by coronavirus. He or she should be isolated in
separate room, even from family members. These people should not go to crowdie
places like schools, etc. Take clinical assistance. If you do not live in a region with
intestinal sickness or dengue fever kindly do the accompanying.
3 Existing System
Aarogya Setu: It is an Indian Covid-19 APP. “Contact following, Syndromic plan-

ning and Self-evaluation” computerized administration, fundamentally a portable
application, created by the National Informatics Center under the Ministry of Elec-
tronics and Information Technology (MeitY). The cause for this application is to
make people familiar with Covid-19 for well-being of people. It is an app which
needs the mobile phone’s GPS and Bluetooth to follow the Covid contamination.
The app can be accessed from Android and iOS versatile frameworks. With the help
of Bluetooth, it indicates danger when one comes close (inside six feet of) to you
who is with coronavirus, by viewing the database of cases around India. With the
help of GPS, it can detect whether the region is a place with contaminated zone.
Drawbacks of Existing System:
• It is forced through leader request with no legitimization.
• Recently, Robert Baptiste has tweeted that safety weaknesses in Aarogya Setu
permitted programmers to realize who is tainted or not well in their preferred
region. He additionally gave subtleties of what number of individuals were unwell
and contaminated at the PM’s Office, the India Parliament and the Home Office.
• The application’s Terms of Service (TOS) gives restricted obligation to the admin-
istration. In this way, there is no administration responsibility in the event of
information burglary of clients.
4 Proposed System
We developed a new model of Covid-19 after analyzing the spread. Data related to
the cumulative no of confirmed cases, per day, in each Country and another dataset
consisting of various life factors, scored by the people living in each country around
the globe. We are going to merge these two datasets to see if there is any relationship
between the spread of the virus in a country by preprocessing [8, 9], merging and
finding correlation between datasets we will calculate needed measures and prepare
them for an Analysis, then we will try to predict the spread of cases by using various
methods. Time series data tracking the number of people affected by the coronavirus
globally, including confirmed cases of the coronavirus, the number of people who
have died due to the coronavirus and the number of people who have recovered from
the deadly infection. Data preprocessing [10, 11] is a data mining technique which
is used to transform the raw data in a useful and efficient format.
Steps Involved in Data Preprocessing:
1. Data Cleaning: The information may have numerous insignificant and missed
parts. To deal with such things, information cleaning is finished. This includes
treatment of missed information, boisterous information and so on.
(a) Missing Data: This condition comes when some information is not
present. This can be obtained from different techniques such as:
(i) Ignore the Tuples: This method is appropriate when the dataset is
huge and different qualities are not present in a tuple.
(ii) Fill the Missing Qualities: There are many methods to fill this.
One can do this physically, by characteristic mean or the most likely
worth.
(b) Uproarious Data: Noisy information is a negligible information that
cannot be deciphered by machines. It tends to be produced because of
flawed information assortment, information section mistakes and so on.
It very well may be dealt with in following manners.
(i) Binning Method: This strategy chips away at arranged information
so as to smooth it. The entire information is isolated into portions of
equivalent size and afterward different strategies are performed to
finish the errand. Each fragmented is dealt with independently. We
can supplant information of section by the mean or limit esteems
could be utilized to finish the errand.
(ii) Relapse: Here information is turned smooth by fitting it into relapse
function. The relapse utilized might be straight or various
(iii) Bunching: This methodology bunches the comparative informa-
tion in a group. The anomalies might be not detected or else it
comes under outside the bunches.
2. Data Transformation: This progression is taken so as to change the information

in fitting structures appropriate for mining measure. This includes Normaliza-
tion, Attribute Selection, Discretization, Concept Hierarchy Generation.
3. Data Reduction: Since information mining is a method that is utilized to deal
with colossal measure of information. While working with gigantic volume of
information, examination got more diligently in such cases. So as to dispose of
this, we utilize information decrease method. It means to expand the capacity
effectiveness and decrease information stockpiling and investigation costs. The
different strides to information decrease are Data Cube aggregation, Attribute
Subset Selection, Numerosity Reduction, Dimensionality Reduction.
5 Proposed System
The supply logistics from the USA are considered. This set is cleaned by removing
the unnecessary columns. It narrows down the data to information we need the most.
This prevents distraction and enables a clear idea of what needs to be analyzed.
Calculating the vent creating a pivot table in python. Since the values are extremely
clumped, we can sort by a required filter such as region like MidWest. We use a legend
to depict this. We have shown a pie chart representation to give a clear picture of the
distribution in Fig. 2 since we have many states and matplotlib does a rudimentary
view of the analysis. Calculating the ventilator requirements for each state in the US.
Fig. 2 Covid crisis pie chart

We take the number of patients hospitalized and the number of cumulative ventilators
available to get the required number.
A specific case study to observe the number of cases in China, India and Japan
show in Fig. 3. We can see that the rate of cases in the origin country of the virus
has the maximum cases and since the other two countries are in close proximity, the
cases have spread and also on a similar level in India and Japan.
The spread of the virus in India can be seen by the 21st day where the sudden
spike is evident shown in Fig. 4. The government issued lockdown to flatten this
spike of increase shown in Fig. 5.
Fig. 3 Specific case study to observe the number of cases in China, India and Japan
Fig. 4 Spread of the virus in India can be seen by the 21st day
Fig. 5 For first 21 days coronavirus spread
Corona cases versus GDP: Does the wealth of a country mean less corona cases?
It does not seem so. In fact, developing countries have a lesser risk than developed
countries as per our studies shown in Fig. 7. We have tried to correlate the number
of cases and the development of a country. This can be due to various reasons like
climatic conditions, etc. However, this is not due to lack of testing kits on the contrary
in developing countries (Fig. 6).
Fig. 6 Corona cases versus GDP

Fig. 7 Future spread based on cases and GDP per capita
6 Conclusion
In this digital world, new data and information on the coronavirus and the progress
of the occurrence have become accessible at an exceptional pace. Even though,
tough questions stay without answer and exact answers to predict the dynamics of
the situation will not receive in such stage. Analyzing and predicting the spread of
viruses with the existing data will help us to have a better understanding to prevent
the spread and to take preventive measures. To fight with coronavirus, we have to
take care of ourselves and follow all the safety measures and rules that have been
given by the government. Everyone can play a part in helping scientists to fight the
coronavirus.
References
1. Novel, Coronavirus Pneumonia Emergency Response Epidemiology: The epidemiological

characteristics of an outbreak of 2019 novel coronavirus diseases (COVID-19) in China.
Zhonghua liu xing bing xue za zhi= Zhonghua liuxingbingxue zazhi 41.2, 145 (2020)
2. Perlman, S.: Another decade, another coronavirus, 760–762 (2020)
3. Abroug, F., et al.: Family cluster of Middle East respiratory syndrome coronavirus infections,
Tunisia, 2013. Emerg. Infect. Dis. 20.9, 1527 (2014)
4. Van Der Hoek, L., et al.: Identification of a new human coronavirus. Nat. Med. 10.4, 368–373
(2004)
5. Guan, W.-j., et al.: Clinical characteristics of coronavirus disease 2019 in China. New England
J. Med. 382.18, 1708–1720 (2020)
6. Schoeman, D., Fielding, B.C.: Coronavirus envelope protein: current knowledge. Virol. J.
16(1), 1–22 (2019)
7. Song, F., et al.: Emerging 2019 novel coronavirus (2019-nCoV) pneumonia. Radiology 295.1,
210–217 (2020)
8. Kamiran, F., Calders, T.: Data preprocessing techniques for classification without discrimina-
tion. Knowl. Inf. Syst. 33(1), 1–33 (2012)
9. Prashanthi, V., Kanakala, S.: Plant disease detection using Convolutional neural networks. Int.
J. Adv. Trends Comput. Sci. Eng. 9(3), 2632–2637
10. García, S., Luengo, J., Herrera, F.: Data preprocessing in data mining. Springer International
Publishing, Cham, Switzerland (2015)
11. Prashanthi, V., Kanakala, S.: Generating analytics from web log. Int. J. Engi. Adv. Technol.
9(4), 161–165
Social Media Anatomy of Text and Emoji
in Expressions
Shelley Gupta, Ojas Garg, Radhika Mehrotra, and Archana Singh
Abstract Social Media is a burgeoning platform where a person or a group can

interact to collaborate and share their ideas through online mediums. Nowadays,
social media content of Twitter, Facebook, Instagram, WhatsApp, online blogs,
forums, etc. consists of text and emoji. Emoji are pictorial representation used in
electronic media, which a user can or cannot combine with a text to express their
sentiments. However, there is still too little work related to emoji in sentiment anal-
ysis. These emoji assist in extensive analysis of the opinions and sentiments of the
public by means of Sentiment Analysis. Due to availability of large quantity of
opinion-rich digital data, much of the current research is focusing on the area of
the sentiment analysis. In this paper, the anatomy of social online media content is
analyzed. Here, nearly 1.7 lac comments are analyzed. Also, the sentiments expressed
by the end users on various popular products, delight events, etc., are analyzed to
determine the usage of text and emoji on social online media like Facebook.
1 Introduction
In recent years, the number of people using social online media to share their opinions
and emotions have increased enormously [1, 2]. Social online media like Facebook,
Twitter and Instagram plays an important role in day to day life to communicate
and to share opinion of the user without any restrain [3]. Facebook is one of the
most popular social online media. It encloses the posts uploaded by the users which
S. Gupta (B) · O. Garg · R. Mehrotra

ABES Engineering College, Ghaziabad, Uttar Pradesh, India
e-mail: shelley.gupta@abes.ac.in
O. Garg
e-mail: ojas.17bit1122@abes.ac.in
A. Singh
Department of Information Technology, Amity School of Engineering and Technology, Noida,
India
e-mail: asingh27@amity.edu
https://doi.org/10.1007/978-981-16-1502-3_6
42 S. Gupta et al.
consist of comments having both text and emoji. By this means the analysis can be
done more extensively. Now the challenge is to frame a technology to identify and
outline the sentiments.
Sentiment analysis is the automated process of visualizing and categorizing the
opinions or sentiments expressed about a given subject or spoken language. In a world
where 2.5 quintillion [4] bytes of data is generated every day; sentiment analysis has
become a vital tool for making the data legitimate. Sentiment analysis can be useful
in several ways. For example, in marketing, it helps in determining the popularity
of the product, success rate of the product and helps in improving the quality of the
product [5, 6]. Text and Emoji combination has provided the world a new way to
express their emotions in a colorful manner.
The main objectives of the paper are:
• To evaluate online social media pages of multiple popular categories involving
events (sport and movie), automobiles, brands, OTT platform, ecom platforms,
etc.
• To evaluate and determine the total count of comments having both text and emoji
along with the total count of emoji used.
• Comparative study among categories to determine among them the usage of
Emoji.
• Comparative study among categories to determine among them the usage of
Comments with Text and Emoji both.
• Study the aggregated anatomy of categories.
We use particularly Facebook because of the following reasons:

• Facebook is used by different people to express their opinion about different
subjects; thus, it is a prominent source of people’s sentiments.
• Facebook contains an enormous number of comments having both text and emoji
and it grows every day.
Facebook’s audience varies from regular users to celebrities, company repre-
sentatives, political leaders, and even top brands have their profiles on Facebook.
Therefore, it is possible to collect sentiments and opinions from different categories.
2 Literature Review
In recent years, Sentiment Analysis has become a prominent research topic in the
field of Natural Language Processing [2]. With the rapid development of online
networking sites and digital technologies, sentiment analysis is becoming more
reputable than before. Sentiment Analysis has two approaches Machine Learning
approach [6, 7] and Lexicon-based approach [5].
Machine Learning approach, is a technique to categorize the contextual data
into predetermined categories without being explicitly programmed [7]. Machine
Social Media Anatomy of Text and Emoji in Expressions 43
Learning approach can be divided into two methods [8, 9]. First, Supervised Learning
which contains two sets of documents which are training set and a test set. Training
set is used to study the data by the classifier. Test set is used for validating the data.
Second, Unsupervised Learning, which involves the unlabeled data, for this, the algo-
rithm recognizes the learning patterns in input and gives the specific output values.
It also not requires prior training to mine data [10].
Lexicon-based approach, label the polarity (can be positive, negative, or neutral)
of a textual content by aggregating the polarity of each word or phrase [11]. It is
divided into two methods-Dictionary-based approach, which uses WordNet [12, 13],
SentiWordNet [14] or any other dictionary to find suitable words of the sentiment
word to determine the polarity. Second is Corpus-based approach, this helps in finding
context-specific orientated sentiment words from a huge corpus [15].
Emoji have become competent aid of sentiment analysis as they are widely used in
expressing feelings and emotions [2]. The meticulousness of recognizing emotions
can increase and improve with the analysis of emoji. Emoji first originate in Japanese
mobile phones in 1997 [16], and it became progressively popular worldwide in 2010s
after being added to several mobile operating systems.
Most of the research are done with text [6, 7] only or with emoji [16] only but not
involving the both. The objective of the paper is to determine the utilization of both
text and emoji on social platform to express sentiments.
3 Proposed Approach
User’s sentiments and opinions are the major criterion for the improvement of the
quality and services. Overall, 117,000 online sentiment of 8 popular categories across
the world have been downloaded as shown in Table 1. Sentiments or opinions of a
person cannot be determined by only investigating the text. For definite and metic-
ulous results, evaluation of both text and emoji should be done. The steps of the
approach adopted are shown in Fig. 1.
Step 1: Identify some of the famous categories like Events (Sport and Movie),
Ecommerce Platforms, Automobiles, etc. These categories are further
divided into segments like Events (Sport and Movie) into IPL, FIFA,
Filmfare, etc.
Step 2: The posts and comments of most popular categories on Facebook are
downloaded using Facepager [17].
Step 3: The data set is pre-processed to remove videos and images.
Step 4: Each segment category is analyzed to determine:
• Total count of comments having both text and emoji and emoji count.
• Comparative study among 8 categories is done to determine among
them the usage of emoji along with text and emoji both.
• Aggregated Anatomy of Categories.
44 S. Gupta et al.
Table 1 Statistics of post and comments under each category

S No. Categories Total segments in Total posts in Total posts in Total comments
each category each segment each category
1 Events (Sport 7 200 1400 17,510
and Movie)
2 Ecommerce 7 200 1400 22,420
Platforms
3 Automobiles 7 200 1400 21,198
4 Online 7 200 1400 23,775
Platforms
5 OTT Platforms 7 200 1400 18,029
6 Gadgets 7 200 1400 18,701
7 Broadcasters 7 200 1400 29,319
8 Skin Care 7 200 1400 20,669
Brands
TOTAL 56 1600 11,200 171,621
Fig. 1 Proposed approach
Step 5: The result of each segment is exhibited using charts.

Based on this analysis we determine the popularity of emoji among online users,
Table 1 shows the statistics of post and comments under each category.
4 Implementation and Results
The dataset has been collected from Facebook and downloaded using Facepager.
The module of Python called emoji is used to analyze emoji in dataset. Some of
Python library used involves: Openpyxl to read and write in excel, Pathlib to work
with file paths, re, workbook, etc. The results of (1) category-segment (2) category
comparative study (3) aggregated anatomy of categories are listed below:
4.1 Category-Segment Analysis
Figure 2, shows the graphical representation of comment count, emoji count, and
comments with text and emoji of various segments analyzed under different 8
categories.
4.2 Category Comparative Analysis
Table 2, shows that 6 categories out of 8 i.e. 75% of categories have total number
of emoji, i.e., emoji count, greater than 40% of the total number of their respective
comments considered i.e. comment count. Therefore, the total number of comments
with text and emoji cannot be ignored. Thus, clearly reflecting the greater use of
emoji by online users to express their sentiments.
Figure 3 shows that category of automobile incorporates maximum use of
comments with text and emoji. Figure 4 shows that the usage of emoji is maximum
in skin care brand and events (sports and movies).
4.3 Aggregated Anatomy of Categories
Figure 5 shows the following results:

• The emoji count is more than the 50% of the total number of comments considered.
• The count of comments with text and emoji both is nearly 25% of the total number
of comments considered.
• The count of comments with text and emoji both is nearly 47% of the total number
of emoji used.
46 S. Gupta et al.
a b
c d
e
f
g h
Fig. 2 a Events (Sport and Movie), b Ecommerce Platform, c Automobile, d Software Application,
e OTT Platform, f Gadget, g Broadcaster, h Skin Care Brand
5 Conclusion
Our findings are based on the popular pages of Facebook and analyzing the total count
of emoji and total count of comments with both text and emoji. From the analysis,
we observe that these days, people are utilizing more emoji as a means of expressing
their sentiments and opinions on social media. Thus, the sentiment analysis can be
Table 2 Category comment count, emoji count, and comments with text and emoji
S. No. Category Comment count Emoji count Comments with text and
emoji
1 Event (Sport and Movie) 17,510 15,456 4604
2 Economic Platform 22,420 12,126 4511
3 Automobile 21,198 12,070 15,833
4 Online Platform 23,775 8835 2709
5 OTT Platform 18,029 8645 3277
6 Gadget 18,701 5573 2212
7 Broadcaster 29,319 12,663 4185
8 Skin Care Brand 20,669 15,772 5362
Total 171,621 91,140 42,693
Fig. 3 Categories comparison of comments with text and emoji
done more extensively when both emoji and text are considered. It provides us the
direction for future work.
48 S. Gupta et al.
Fig. 4 Categories emoji count
Fig. 5 Aggregated anatomy of categories
References
1. Suman, C., Saha, S., Bhattacharyya, P., Chaudhari, R. S.: Emoji helps! A multi-modal Siamese
architecture for Tweet user verification. Cogn. Comput., 1–16 (2020)
2. Gupta, S., Singh, A., Ranjan, J.: Sentiment analysis: usage of text and emoji for expressing
sentiments. In: Advances in Data and Information Sciences, pp. 477–486. Springer, Singapore
(2020)
3. Anjaria, M., Guddeti, R.M.R.: A novel sentiment analysis of social networks using supervised
learning. Soc. Netw. Anal. Min. 4(1), 181 (2014)
4. Marr, B.: How much data do we create every day? The mind blowing stats everyone should read
(2020). Retrieved 21 June 2020, from https://www.forbes.com/sites/bernardmarr/2018/05/21/
how-much-data-do-we-create-every-day-the-mind-blowing-stats-everyone-should-read/
5. Dey, A., Jenamani, M., Thakkar, J.J.: Senti-N-Gram: an n-gram lexicon for sentiment analysis.
Expert Syst. Appl. 103, 92–105 (2018)
6. Tripathy, A., Agrawal, A., Rath, S.K.: Classification of sentiment reviews using n-gram machine
learning approach. Expert Syst. Appl. 57, 117–126 (2016)
7. Tripathy, A., Anand, A., Rath, S.K.: Document-level sentiment classification using hybrid
machine learning approach. Knowl. Inf. Syst. 53(3), 805–831 (2017). https://doi.org/10.1007/
s10115-017-1055-z
8. Ayyadevara, V. K.: Word2vec. In: Pro Machine Learning Algorithms, pp. 167–178. Apress,
Berkeley, CA (2018)
9. Asghar, M.Z., Khan, A., Bibi, A., Kundi, F.M., Ahmad, H.: Sentence-level emotion detection
framework using rule-based classification. Cogn. Comput. 9(6), 868–894 (2017). https://doi.
org/10.1007/s12559-017-9503-3
10. Schrauwen, S.: Machine learning approaches to sentiment analysis using the Dutch Netlog
Corpus. Computational Linguistics and Psycholinguistics Research Center, pp. 30–34 (2010)
11. Da Silva, N.F.F., Hruschka, E.R., Hruschka, E.R.: Tweet sentiment analysis with classifier
ensembles. Decis. Support Syst. 66, 170–179 (2014). https://doi.org/10.1016/j.dss.2014.07.003
12. Miller, G.A.: Nouns in WordNet. WordNet: an electronic lexical database, pp. 23–46 (1998)
13. Lee, Y., Ke, H., Yen, T., Huang, H., Chen, H.: Combining and learning word embedding with
WordNet for semantic relatedness and similarity measurement. J. Am. Soc. Inf. Sci. 71(6),
657–670 (2019). https://doi.org/10.1002/asi.24289
14. Denecke, K.: Using SentiWordNet for multilingual sentiment analysis. In: 2008 IEEE 24th
International Conference on Data Engineering Workshop (2008). https://doi.org/10.1109/
icdew.2008.4498370
15. Hardeniya, T., Borikar, D.A.: Dictionary based approach to sentiment analysis—a review. Int.
J. Adv. Eng. Manage. Sci. 2(5) (2016)
16. Fernández-Gavilanes, M., Juncal-Martínez, J., García-Méndez, S., Costa-Montenegro, E.,
González-Castaño, F.J.: Creating emoji lexica from unsupervised sentiment analysis of their
descriptions. Expert Syst. Appl. 103, 74–91 (2018)
17. Facepager 3.6 Download (Free)—Facepager.exe (2020). https://facepager.software.informer.
com/3.6/
Development of Machine Learning
Model Using Least Square-Support
Vector Machine, Differential Evolution
and Back Propagation Neural Network
to Detect Breast Cancer
Madhura D. Vankar and G. A. Patil
Abstract Recently death rate among women increases due to Breast Cancer. Breast
Cancer diagnosis system has been implemented with the help of Different Machine
learning algorithms. Out of those, in our present work, we have used DE, LSSVM,
and BPNN algorithms for developing Machine learning models. Here the training
dataset is taken from UCI repository. In this system, we compare results of LS-SVM
and backpropagation neural networks to generate accurate results at an early stage.
Early detection increases the chances of treatment which helps to save women Life.
It will be helpful to medical field because it avoids loss of data.
1 Introduction
Machine learning provides capability to computers for learning without being

programmed. Machine learning algorithms are used to develop models with the
help of training data. It includes two phases i.e. Training and Testing phase. Mostly
Medical field utilizes different machine learning tools because it uses concepts such
as classification and recognition systems.
This paper focuses on the breast cancer diagnosis at early stage, conducted
using least square support vector machine (LS-SVM) classifier algorithm and back-
propagation neural network algorithm (BPNN). Early diagnosis is necessary to
increase survivability of women. Here we perform demonstration on Wisconsin
Breast Cancer Dataset (WBCD) taken from UCI repository. System will use a Differ-
ential Evolution algorithm to optimize parameters of LS-SVM classifier which helps
to enhance the accuracy. Here we use Supervised Learning mode of Neural Network
which helps to train the neural network with a training dataset. Subsequently, it helps
in the backpropagation algorithm to minimize the errors by adjusting interconnec-
tions weights. Here, the performance of the system is evaluated by using a tenfold
cross validation method.
M. D. Vankar (B) · G. A. Patil

Computer Science and Engineering Department, D. Y. Patil College of Engineering and
Technology, Shivaji University, Kasaba Bawada, Kolhapur, Maharashtra, India
https://doi.org/10.1007/978-981-16-1502-3_7
52 M. D. Vankar and G. A. Patil
2 Literature Survey
Singh and Parveen [1] have proposed a hybrid methodology for classification with
the help of support vector machine (SVM) and fuzzy c-means clustering. It provides
accurate results to detect the brain tumor. It requires large memory space.
Lin et al. [2] have developed CAD system for characterizing breast nodules as
either benign or malignant by using ultrasonic images. This paper uses classifier
such as fuzzy cerebellar model neural network (FCMNN). It follows trial and error
criteria to decide its all analysis parameters.
Vijay and Saini [3] have proposed system for detection of breast cancer using
Image Registration Techniques. System describes features of Feed-forward back-
propagation Artificial Neural Network (ANN) model. Mean Square Error (MSE) is
used as analysis criteria to evaluate system performance. It is more time-consuming,
because it follows trial and error method to compute number of neurons.
Utomo et al. [4] have used Extreme Learning Machine Neural Networks (ELM
ANN) for developing decision support systems. ELM algorithm helps to generate
accurate results and high sensitivity rate. This system requires more time to train the
network than other methods. It provides low specificity rate.
Saini et al. [5] have developed a model using an adaptive neural network to detect
cancer. It requires more training time. It provides better accuracy as compared to the
fuzzy system. It uses clustering features which allows to create number of clusters
depends upon the problem size.
There was a need felt to develop a Machine Learning Model to optimize training
time and enhance performance by using Least Square-Support Vector Machine,
Differential Evolution and Back Propagation Neural network, so as to help detect
more accurately breast cancer in the patients. The followings are the main objectives
of this research work:
• To develop Machine Learning Model.
• To replace missing value in the dataset using a suitable algorithm.
• To optimize training time by Merging Differential Evolution with LS-SVM.
• To obtain Accurate detection results by comparing LS-SVM and BPN.
• To evaluate performance of the system with the help of a tenfold cross validation
method.
3 System Architecture
Our proposed system will be used for developing machine learning model with the
help of big data. System will process Dataset by using missing value replacement
method to improve the performance. Then ‘Feature Scaling’ is used to convert data
into binary format. After completion of conversion, the dataset will be transferred
towards the machine learning model to train neural network by using two classifiers
such as LS-SVM and BPN. Further, the focus is to compare the results of two
Development of Machine Learning Model … 53
Fig. 1 System architecture
classifiers and provide accurate results to the end-user with the help of analysis
parameters (Fig. 1).
4 Methodology
4.1 Dataset Attributes
The given algorithms are implemented on the Wisconsin Breast Cancer Dataset
(WBCD) taken from UCI repository of machine learning databases [13, 14]. Total
Dataset consists of 10 Attributes. Out of those, nine attributes indicate as input
variables and remaining one as output (2, 4). The value 2 indicates benignancy and
4 indicates that it is of malignant type of breast cancer. The dataset also contains
another attribute such as ‘sample code number’ which is discarded, because it is not
required for the classification process.
Table 1 provides information about attributes along with its range.
The functioning of the system has been divided into the following modules.
Table 1 Attributes to be
S. no. Attributes Domain
considered from the WBCD
1 Clump thickness 1 … 10
2 Cell size—uniformity 1 … 10
3 Shape of cell—uniformity 1 … 10
4 Marginal adhesion 1 … 10
5 Cell size—single epithelial 1 … 10
6 Bare nuclei 1 … 10
7 Bland chromatin 1 … 10
8 Normal nucleoli 1 … 10
9 Mitoses 1 … 10
10 Class 2 shows benignancy, 4
shows malignancy
5 Module 1: Missing Value Replacement and Feature

Scaling of Attributes
This module is used to make a dataset ready for training neural network using
the following methods. Here, Data owner authentication, User authentication, and
Missing value replacement mechanisms have been implemented.
(A) Data Owner Authentication:
In Data owner authentication, the owner will sign in into the system by
providing his/her username and password. If a new user wants to upload a
testing database file into the system, he has to register giving his username,
password, mobile number, address, and other details required. Once the data
owner is authenticated, he can browse and load the Wisconsin Breast Cancer
Training Dataset into the system for processing.
(B) Litwise Deletion Algorithm to Ignore the Tuples Containing Missing Data:
This method helps to remove missing values within a given dataset. Dataset
consists of attributes as mentioned in Table 1. To delete the subjects that have
missing value is the simplest way of handling missing data. If any row contains
a missing value for one attribute which represents ‘?’ symbol, then that entire
row is deleted.
(C) Feature Scaling of Attribute:
After completion of litwise deletion method, dataset will be forwarded towards
Feature Scaling. The Feature Scaling of attribute is carried out to convert
dataset values into binary format except last attribute i.e. class (2-benign,
4-malignant). The following formula is used to obtain scaling.

X = [x − min(x)] [max(x)− min(x)]
Use the following considerations to obtain new values:

(i) 0–5 values are converted to 0

(ii) 6–10 are converted to 1.
6 Module 2: Training Neural Network using LS-SVM

and DE
This module is focusing on the training of neural network using Least-Square Support
Vector Machine and Differential Evolution merged with LS-SVM to improve the
system’s accuracy.
(A) Least Squares Support Vector Machine (LS-SVM):
Figure 2 shows the role of LS-SVM to classify all training vectors in two classes
with the help of hyperplane and to select the best hyperplane that leaves the maximum
margin from both classes.
LS-SVM Concept:
LS-SVM classifier is used to obtain suitable a hyper plane, which separates various
classes. It is an extended version of SVM. As compared to other techniques, LS-SVM
is very simple and faster.
LS-SVM Algorithm:
Step 1: Load the training vector of n data points, where X i represents the input
vector and Y i represents the corresponding ith target with values {2,4}.
Step 2: For each input data point find out random weights
x ) = x · w
g( + wo
Fig. 2 Concept of LS-SVM

Step 3: Obtain the value of the bias term b and initialize the error e for each point
randomly.
x) ≥ 1
g( ∀ x ∈ Class 1
x ) ≤ −1
g( ∀ x ∈ Class 2
Step 4: Minimize the objective function with the help of e, w and b values. Calculate
the value of total margin.
Minimize w term which helps to maximize separability between two
classes.
Step 5: To satisfy the Karush-Kuhn-Tucker (KKT) conditions in the set of
equations by developing the Lagrangian function with the solution

N
−
→
=
w λi yi xi
i=0

N
λi yi = 0
i=0
Step 6: Find out the number of support vectors.

Step 7: Use RBD kernel functions for classification of Training data.Use RBD
kernel functions for classification of Training data.
(B) Differential Evolution (DE):

It is simple optimization Technique.
DE-Based Optimization Technique:

Figure 3 shows idea behind DE-LSSVM algorithm which helps to utilize developed
model to predict test data.
DE has standard phases like initialization, mutation, crossover, and selection. DE
improves its accuracy by merged it with LS-SVM classifier. Differential Evolution is
used to optimize kernel parameters of LS-SVM. It will create a new fitness function
which act as a classifier evaluation criteria, i.e., accuracy, mean absolute error, and
root mean squared error.
7 Module 3: Training Neural Network Using Back

Propagation Neural Network (BPNN)
The Back Propagation algorithm is quite simple and easy to program. It is used
for performing many tasks such as Classification, Clustering. Here we use a Super-
vised Learning model to train the neural network. It includes two phases such as
Fig. 3 The flowchart of the DE-LSSVM algorithm
Feed Forward Computation and Backpropagation. Feed Forward Neural Network

phase helps to calculate output then it will be checked against actual output. If calcu-
lated outputs are not satisfactory then connections between layers are modified by
using Backpropagation algorithm. This procedure is performed again and again to
minimize error which is calculated at Feed forward neural network phase (Fig. 4).
Four Phases of the Training Process:
1. Initialization of weights: It is used to assign some small random values.
2. Feed forward approach: In this phase, network has fixed synaptic weights. It
is used to calculate error by using the following formula.
Error Signal = Calculated Output − Desired Output
3. To calculate the propagated error: It focuses on minimization of error by

adjusting synaptic weights of network. Forward and backward passes are
repeated until error is minimized.
Fig. 4 Working of BPNN
∂ E2
WAB(new) = WAB(old) − η
∂ WAB
∂ E2
where n represents the learning rate parameter, ∂ WAB
represents the sensitivity.
4. To update weights in the neural network.
8 Module 4: Tenfold Cross Validation Method:
It mainly focuses on evaluation of system performance with the help of LS-SVM

and BPN. Steps of tenfold cross validation performance evaluator are:
• First divide the given dataset into 10 sets.
• Then out of 10 sets, Training is performed on 9 sets and testing is performed on
remaining 1 set.
• Take its mean accuracy by repeating this procedure 10 times.
9 Module 5: Experimental Results and Analysis
For experimentation net beans IDE has been installed.

Figure 5 shows Data owner authentication page, where owner will sign in into the
system by providing his/her username and password.
Fig. 5 Data owner authentication
After data owner authentication process, data owner can browse and load the
Wisconsin Breast Cancer Training Dataset into system for processing. Here we will
perform demonstration on 600 records of WBCD.
Figure 6 shows the Data Owner screen which is used to load training dataset for
development of machine learning model.
Figure 7 shows the dataset after replacing missing values by using Litwise deletion
method.
Figure 8 shows the dataset values in binary format except the last attribute that is
being obtained after performing feature scaling.
Figure 9 shows a Data Owner screen with DE-LS-SVM Training results that
include correctly and incorrectly classified instances which will help to calculate
evaluation parameters of the system.
1. Accuracy = It represents percentage of correctly classified data.
Fig. 6 Load dataset for training
Fig. 7 Litwise deletion method

c
c
= (No. of correctly classified data in class m)/ (Total No. of data in class m)
m=1 m=1
= (386/600) ∗ 100 = 64.3333%.
2. Mean Absolute Error = It measures error between observations using the

following formula.
Fig. 8 Feature scaling of attributes
Fig. 9 Train dataset using DE and LS-SVM
1
n
MAE = y j − ŷ j
n j=1
1
= {prediction − Actual observation}
n
1
= {600 − 386} = 0.3566
600
where, n = total number of instances within the dataset.

Fig. 10 Train dataset using BPNN
3. Root Mean Squared Error (RMSE) = It shows the value i.e. square root of
the MAE.

1 n √
RMSE = |y j − ŷj| = 0.3566 = 0.5971
n j=1
Figure 10 shows a Data Owner screen with BPNN Training results that include
correctly and incorrectly classified instances.
1. Accuracy = (573/600)*100 = 95.5%.
2. Mean Absolute Error (MAE) = 600
1
{600–573} = 0.0522
√
3. Root Mean Squared Error = 0.0522 = 0.1998.
Tables 2, 4 and 5 contain calculated values of Accuracy, Mean Absolute Error,
and Root Mean Squared Error of DE-LSSVM and BPNN algorithms with respect to
number of records given by end-user.
From Table 2, we can easily calculate the average of accuracy for DE-LSSVM
and BPNN algorithms with respect to the number of records within the dataset.
Table 3 gives clear idea that BPNN algorithm provides more accurate results as
compared to DE-LSSVM algorithm.
Figure 11 shows that accuracy of BPNN is higher than DE-LSSVM algorithm. It
is being observed that when number of records within dataset increases then accuracy
of DE-LSSVM algorithm goes on decreasing.
Figure 12 shows that all analysis parameters of DE-LSSVM algorithm with respect
to number of records within dataset.
Figure 13 shows that all analysis parameters of BPNN algorithm with respect to
number of records within the dataset. From Fig. 11, it is being observed that when the
Table 2 Accuracy between

Number of records Accuracy (%)
DE-LSSVM and BPNN
algorithm DE-LSSVM BPNN
10 90 90
20 75 95
30 70 90
40 67 97.5
50 62 94
100 56 94
200 58 94.5
300 56.33 94.667
400 58.25 93.75
500 61.8 95
600 64.33 95.5
Table 3 Average accuracy of

Algorithm DE-LSSVM BPNN
DE-LSSVM and BPNN
algorithm Average accuracy (%) 65.34 93.99
Table 4 Mean absolute error,

Number of records Mean absolute error Root mean squared
Root mean squared error
error
values of DE-LSSVM
algorithm 10 0.1 0.3162
20 0.25 0.5
30 0.3 0.5477
40 0.325 0.5701
50 0.38 0.6164
100 0.44 0.6633
200 0.42 0,6481
300 0.4367 0.6608
400 0.4175 0.6461
500 0.382 0.6181
600 0.3566 0.0522
number of records within a dataset increases then accuracy of BPNN algorithm goes
on increasing which means number of records within dataset is directly proportional
to the accuracy of BPNN algorithm.
Table 5 Mean absolute error,

Number of records Mean absolute error Root mean squared
Root mean squared error
error
values of BPNN algorithm
10 0.1503 0.3222
20 0.1419 0.265
30 0.1079 0.2416
40 0.0668 0.1738
50 0.0944 0.2401
100 0.0728 0.2159
200 0.0609 0.2104
300 0.0651 0.2156
400 0.0679 0.2295
500 0.0603 0.2152
600 0.5971 0.1998
Fig. 11 Accuracy between DE-LSSVM and BPNN algorithm
Fig. 12 Evaluation parameters of DE-LSSVM algorithm

Fig. 13 Evaluation parameters of BPNN algorithm
10 Conclusion
In this paper, Machine learning model has been developed for breast cancer patients
with the help of DE-LSSVM and BPNN classification algorithms. Here missing
values are handled by using Litwise deletion method under Dataset Preprocessing
module which enhances system performance. DE is combined with LS-SVM which
helps to improve system’s accuracy and minimize the training time. Therefore it
helps to generate results at early stage which increases chance of survivability of
women. As mentioned in Table 3: BPNN gives 93.99% of average accuracy and
LS-SVM gives 65.34% of average accuracy with respect to the available records in
the given dataset. Therefore from the results of all analysis parameters, it is observed
that BPNN algorithm provides more accurate results as compared to DE-LSSVM
algorithm. This accuracy probably will go on increasing for large dataset. There is a
further scope to go for implementation with solo classification techniques to improve
the efficiency. Adding other features will help the system to handle and test more
than one dataset at a time.
References
1. Parveen and Singh, A.: Detection of brain tumor in MRI images, using combination of Fuzzy
C-Means and SVM. In: IEEE Paper on Signal Processing and Integrated Networks (SPIN)
(2015)
2. Hou, Y.-L., Lin, C.-M., Chen, K.-H., Chen, T.-Y.: Breast nodules computer-aided diagnostic
system design using Fuzzy Cerebellar model neural networks. IEEE Trans. Fuzzy Syst. 22(3)
(2014)
3. Saini, S., Vijay, R.: Optimization of artificial neural network breast cancer detection system
based on image registration techniques. Int. J. Comput. Appl. 105(14) (2014)
4. Utomo, C.P., Kardiana, A., Yuliwulandari, R.: Breast cancer diagnosis using artificial neural
networks with extreme learning techniques. Int. J. Adv. Res. Artif. Intel. 3(7) (2014)
5. Singh, S., Saini, S., Singh, M.: Cancer detection using adaptive neural network. Int. J. Adv.
Res. Technol. 1(4) (2012)
6. Al-Anezi, M.M., Mohammed, M.J., Hammadi, D.S.: Artificial immunity and features reduction
for effective breast cancer diagnosis and prognosis. IJCSI Int. J. Comput. Sci. Issues 10(3)
(2013)
7. Jouni, H., Issa, M., Harb, A., Jacquemod, G., Leduc, Y.: Neural network architecture for breast
cancer detection and classification. In: IEEE International Multidisciplinary Conference on
Engineering Technology (IMCET) (2016)
8. Menaka, K., Karpagavalli, S.: Breast cancer classification using support vector machine and
genetic programming. Int. J. Innovative Res. Comput. Commun. Eng. 1(7) (2013)
9. Fiuji, H.H., Almasi, B.N., Mehdikhan, Z., Bibak, B., Pilevar, M., Almasi, O.N.: Automated
diagnostic system for breast cancer using least square support vector machine. Am. J. Biomed.
Eng. (2013)
10. Usha Rani, K.: Parallel approach for diagnosis of breast cancer using neural network technique.
Int. J. Comput. Appl. 10 (2010)
11. Sharma, A., Mehta, N., Sharma, I.: Reasoning with missing values in multi attribute datasets.
Int. J. Adv. Res. Comput. Sci. Softw. Eng. 3(5) (2013)
12. Kaushik, K., Arora, A.: Breast cancer diagnosis using artificial neural network. Int. J. Latest
Trends Eng. Technol. (IJLTET) 7(2) (2016)
Web Links for Accessing Information About Breast Cancer

Dataset
13. https://archive.ics.uci.edu/ml/index.php
14. https://archive.ics.uci.edu/ml/datasets/breast+cancer+wisconsin+(original)
Distributed and Decentralized Attribute
Based Access Control for Smart Health
Care Data
B. Ravinder Reddy and T. Adilakshmi
Abstract Most access control solutions today provide the ability for centralized
authorities, whether governments, manufacturers, or service providers to gain unau-
thorized access to and control devices by collecting and analyzing user’s data. Data
owners (DO) experience a necessity to concentrate on their own medical data and
manage them. As an alternative, Blockchain promotes healthcare, including health
care data, which actually may cause legal and privacy issues and solves the problem of
sharing with third parties. Blockchain technology provides data owners with compre-
hensive, immutable records, and access to Smart Health Care (SHC) data free from
service providers and websites. This paper presents a scheme, in which the data
owner endorses the message based on attributes without leaking data other than the
appended proof. The proposed model is Distributed and Decentralized scheme for
Access Control.
1 Introduction
Smartwatches are ultimate medical sensors well suited for bringing essential medical
monitoring into home which are easy to use, always running, and continuously in
contact with our bodies. The major issue is when someone updates or modifies data
without knowledge that lead to a a major damage. Access Control of Smart Health
Care (SHC) data can be an alternative solution for securing and providing privacy
for data owners. SHC data stores the health-related personal data gathered from
wearable devices like Fitbit. Some incorrect alteration of any such sensitive data
B. Ravinder Reddy (B)

Department of CSE, UCE (A), OU, Hyderabad, India
e-mail: ravinderreddycse@cvsr.ac.in
Department of CSE, Anurag Group of Institutions (A), Hyderabad 500088, India
T. Adilakshmi
Department of CSE, Vasavi College of Engineering (A), Hyderabad 500089, India
e-mail: t_adilakshmi@staff.vce.ac.in
https://doi.org/10.1007/978-981-16-1502-3_8
68 B. Ravinder Reddy and T. Adilakshmi
can be harmful. Thus, privacy becomes an important aspect for a SHC system. The
proposed model designates the patients to generate, share and manage data with
e-healthcare providers by storing access rights of data collected on blockchain.
2 Literature Survey
2.1 Access Control
According to Zyskind et al. [1] blockchain can handle many real-time issues at large
like. Currency and Transaction support, cloud storage, supply chains, and public
charity.
Generally, in an organization, evaluation of access control policy to determine
whether the requested access to a warehouse can be performed is done by a party
that cannot be trusted at times. Attribute-Based Access Control (ABAC) policies are
one of the common approaches to express access policy.
It combines a set of rules with conditions over a set of attributes assigned to
subjects or resources. For instance, consider the resource, A, an object that controls
the defined policy to resources, number of subjects, Pi, and number of resources Xj.
Pi holds the rights to perform on actions like transfer of rights specified by defined
policies on Xj. Hence, the approach needs A & Pi to perform actions which are
independent from one another. The policy issuer and subject have no role to play
while in the process of exchange. As coined by Di Francesco Maesa et al. [2] a policy
creation transaction (PCT) is to be performed by A to transfer the access rights to a
new subject in Pi. At last, after the policy is created, which is updated by resource
owner A, is revoked.
Any Access control policy is defined based on Access Rights. An access right
defined as permission for access of resource that is granted and which can allow a
program or person to identify the ideal data. Digital access rights play crucial role
in data security and compliance. These permissions control the ability of the users
to view, read, write, change, navigate, and execute the contents of the file system.
Table 1 represents the access rights.
Table 1 Representation of access rights for different user types

User User type Type of access Access control File
Demo Admin Create different Read, write execute All files
Users
Demo 1 Data owner (DO) Create users and Read, write execute Uploaded file
share access rights
Demo 2 User As allowed by DO As allowed by DO As allowed by DO
Distributed and Decentralized Attribute Based … 69
2.2 Blockchain
On the other side, the invention of Bitcoin [3] by a person (or group of people)
using the name Satoshi Nakamoto in 2008 has inspired blockchain and many other
applications. Block chain contains three basic elements. The first is a distributed
ledger, but it is centralized. The second element consensus algorithm is a way to
make sure that all the ledger copies are the same for everyone and the process is
called mining. The third, encryption and distribution of block, which contains data
stored, and the result is a Hash code, which indicates the location of the block and
its contents, and then links it with rest of the chain [4].
The blockchain-based Access Control is beneficial for, Easy of transfer access
rights from one user to other, anytime validation can be done by any user to know
who is having currently the access, and Proof of Existence of access rights is possible.
Certain properties or capabilities of blockchain ensure the highest security to
transaction. Some of the terminology and core components of Blockchain are: Peer-
to-Peer Network (P2P) [5], in which the users are connected to one another with no
central control. Hash Pointer [6], which points to the next block of transaction, Digital
Signatures [7], used for authenticating users. The two digital signature schemes which
work on Elliptic and Edward curve respectively are Elliptic Curve Digital Signature
Algorithm (ECDSA) and Edwards-curve Digital Signature Algorithm (EdDSA) [8].
Consensus [9] avoids intermediaries, Merkle Tree [10] is a technique that separates
data and applies hash functions till a single hash value is achieved. Proof of Work
(PoW) [11], a consensus algorithm used in the network to provide security and
decision making, Proof of Stake [12], in bitcoin it is a collection of coins to win.
Byzantine Fault Tolerance [1], system is used to identify issues related to various
components in the network.
For example, Bob needs to upload a file and share it with someone like spark.
1. Bob: Uploads the file to cloud server.
2. Bob: gives access rights to spark for the file.
3. Spark: Initially can see the file but cannot read or download.
4. Spark: uses the private key generated by bob while giving attributes.
5. Spark: Finally, downloads the file.
In this using Blockchain and encryption can create two levels of security for the
access control. Figure 1 represents the communication among patients, hospitals,
and doctors.
2.3 Smart Health Care on Cloud
Deploying the SHC system on cloud ecosystem provides several opportunities like
accessibility, computational elasticity, greater fault tolerance, and interoperability
[13, 14]. As per HIPPA [15], the cloud providers are under non-covered entities. Thus,
Fig. 1 Communication among patients, doctors, and hospital
the service providers have no obligation to ensure the integrity, confidentiality and
to provide proper access to the consumers [16]. Consequently, the privacy becomes
an important concern to adapt the medical system.
The health data is managed and controlled by the data owner or patient, unlike the
other digital health records [17, 18]. Owners can selectively share their health-related
data with third parties while hiding some data in private. The cloud can allow access
the medical data anytime from anywhere. It can also support the system to prepare
for appointments and maintain a more sophisticated view of personal health to share.
The cloud on the other side may have business interest in analyzing the health
care data, and may also have malicious employees or sometimes even cloud may be
hacked. As a result, the medical system will communicate with different users, and
the given access control policy should support accountability and revocation features.
Thus, the smart health care system must offer a tamper-proof feature and protect the
data owner’s privacy. In our proposed model, the underlying cloud infrastructure of
the SHC system is considered as untrusted, and Blockchain used to provide security.
2.4 Limitations of Existing System
The existing system comes with various limitations like:

• ABAC is based on Central Authority and is not distributed.
• Creation or Configuring of ABAC is not so simple.
• Blockchain implementation of access control may be slow.
• Memory Utilization, Transaction time, Energy Consumption are high for

blockchain.
3 Proposed Methodology
The proposed model in Fig. 2 works by collecting the data from wearable devices
stores it on the cloud and assigns the data with access rights based on Attribute
Based Access Control (ABAC) policies. The generated attributes and access rights
or logs are stored on blockchain nodes which in turn can reduce the burden of over-
load, storage utilization on cloud, and improving performance making blockchain
lightweight.
This system will provide high-quality preventive mechanisms for accessing smart
health records. The Proposed model can also improve the efficiency in terms of power
consumption, improves processing and execution time.
The benefits of this approach is secure sharing of patient information by providing
decentralized access, improved patient and service provider interaction and safe-
guarding privacy. Both the general ABAC and Blockchain based ABAC schemes uses
User, resource, object and environment as attributes. Table 2 depicts a comparison
of Attribute based access control (ABAC) and blockchain ABAC.
Fig. 2 Architecture of proposed model

Table 2 Comparison of ABAC and blockchain based ABAC

S. no. Parameter ABAC Blockchain based ABAC
1 Access rights Granted based on policies Granted by re-encryption
framed using attributes using a hash key, based on
attributes
2 Access control Created by direct Created by specified
encryption attributes
3 Computational process Expensive based on file size Only access rights are stored
4 User tracing Anonymous Can be traced
Table 3 Results of the proposed model

S. no. Parameter On-premise Cloud Cloud and blockchain
1 Energy consumption 40% less efficient than 10% higher 40% More efficient than
cloud and blockchain without cloud and 10%
and 50% less efficient less efficient than cloud
than cloud
2 Execution time 3s 2s 40% More efficient than
without cloud and 10%
less efficient than cloud
3 File size 16 MB 16 MB 16 MB
4 Memory utilization 90% 96% Improved
5 CPU load 93% 95% Improved
4 Results
The proposed methodology can be implemented by considering the minimum hard-

ware requirements that can be considered are 4 GB RAM, 100 GB Storage, and
Processor-i7 and if tested on different environments like cloud, cloud and Blockchain
and On-Premise, the expected results can be achieved as shown in Table 3.
5 Conclusion
The proposed model allows Data Owners get the control to generate, share and
manage patient’s data with healthcare providers by storing access rights of Cloud
stored data on blockchain. Storing the access policies on blockchain can increase
the security and avoid unauthorized access. The paper emphasized on shortfalls of
existing system that can be avoided on further implementation of the proposed model.
The proposed Architecture for SHC data can improve the Efficiency, Execution time
by lowering the storage and finally improving the overall data access.
6 Future Scope
In the future we tend to implement the model using private blockchain. As an alter-
native solution Hyperledger Fabric, which reduces the overhead involved in mining
and that supports 10,000 transactions/second can be considered for implementing.
We feel that a comprehensive study is still a need for defining the fine grained Access
Control using a light weight Blockchain.
References
1. Zyskind, G., Nathan, O., Pentland, A.: Decentralizing privacy: using blockchain to protect
personal data. In: 2015 IEEE Security and Privacy Workshops, San Jose, CA, pp. 180–184
(2015). https://doi.org/10.1109/SPW.2015.27
2. Di Francesco Maesa, D., Mori, P., Ricci, L.: Blockchain based access control. Lecture Notes
in Computer Science, pp. 206–220 (2017). https://doi.org/10.1007/978-3-319-59665-5_15
3. Nakamoto, S.: Bitcoin: a peer-to-peer electronic cash system (2008)
4. Nguyen, Q.K.: Blockchain—a financial technology for future sustainable development. In:
Green Technology and Sustainable Development (GTSD), pp. 51–54 (2016)
5. Pappalardo, G., Di Matteo, T., Caldarelli, G., et al.: Blockchain inefficiency in the Bitcoin peers
network. EPJ Data Sci. 7, 30 (2018). https://doi.org/10.1140/epjds/s13688-018-0159-3
6. Ajao, L.A., Agajo, J., Adedokun, E.A., Karngong, L.: Crypto Hash Algorithm-based blockchain
technology for managing decentralized ledger database in oil and gas industry. J. 2(3), 300–325
(2019). https://doi.org/10.3390/j2030021
7. Martínez, V.G., Hernández-Álvarez, L., Hernandez Encinas, L.: Analysis of the cryptographic
tools for Blockchain and Bitcoin. Mathematics 8, 131 (2020). https://doi.org/10.3390/math80
10131
8. Wang, L., Shen, X., Li, J., Shao, J., Yang, Y.: Cryptographic primitives in blockchains. J. Netw.
Comput. Appl. (2018). https://doi.org/10.1016/j.jnca.2018.11.003
9. Ismail, L., Materwala, H.: A review of blockchain architecture and consensus protocols: use
cases, challenges, and solutions. Symmetry 11, 1198 (2019). https://doi.org/10.3390/sym111
01198
10. Lee, D., Park, N.: Blockchain based privacy preserving multimedia intelligent video surveil-
lance using secure Merkle tree. Multimedia Tools Appl. (2020). https://doi.org/10.1007/s11
042-020-08776-y
11. Gervais, A., Karame, G.O., Wüst, K., Glykantzis, V., Ritzdorf, H., Capkun, S.: On the security
and performance of proof of work blockchains. In: Proceedings of the 2016 ACM SIGSAC
Conference on Computer and Communications Security—CCS’16 (2016). https://doi.org/10.
1145/2976749.2978341
12. King, S., Nadal, S.: Ppcoin: peer-to-peer crypto-currency with proof-of-stake, self-published
paper, pp. 1–6 (2012)
13. Kaufman, L.M.: Data security in the world of cloud computing. IEEE Secur. Priv. 7(4), 61–64
(2009)
14. Zhang, Y., He, D., Choo, K.R.: BaDS: blockchain-based architecture for data sharing with ABS
and CP-ABE in IoT. Wirel. Commun. Mob. Comput. 2018, 9 (2018)
15. WhatisHIPAA, https://www.dhcs.ca.gov/formsandpubs/laws/hipaa/Pages/1.00WhatisHIPAA.
aspx, 2018.
16. Dwyer III, S.J., Weaver, A.C., Knight Hughes, K.: Health insurance portability and account-
ability act. Security Issues in the Digital Medical Enterprise, Society for Computer Applications
in Radiology, 2nd edn (2004)
17. Baird, A., North, F., Raghu, T.S.: Personal Health Records (PHR) and the future of the
physician-patient relationship. In Proceedings of the 2011 iConference, New York, NY, USA,
pp. 281–288 (2011)
18. Wangthammang, M., Vasupongayya, S.: Distributed storage design for encrypted personal
health record data. In: Proceedings of the 8th International Conference on Knowledge and
Smart Technology, KST 2016, Thailand, pp. 184–189 (2016)
Dynamic Node Identification
Management in Hadoop Cluster Using
DNA
J. Balaraju and P. V. R. D. Prasada Rao
Abstract The distributed system is gambling a vital position in storing and

processing big data and information era is speedily increasing from various resources
every minute. Hadoop has a scalable, and efficient disbursed machine supporting
commodity hardware with the aid of combining specific networks within the topo-
graphical locality. Node support inside the Hadoop cluster is unexpectedly growing in
one-of-a-kind versions which can be dealing with issues to control clusters. Hadoop
does no longer offers node management, including and deletion Node futures. Node
identification in a cluster absolutely depends on DHCP servers that handles IP
addresses; hostname is based totally at the physical address (MAC) address of every
node. There is a scope for the hacker to theft the information using IP or hostname and
developing a disturbance in a dispensed gadget by using adding a malicious node by
assigning replica IP or hostname. This paper proposing novel node management for
the disbursed machine the usage of DNA hiding and producing a completely unique
key by way of combing a completely unique Physical address (MAC) of node and
hostname. This mechanism is supplying higher node control for the Hadoop cluster
offering adding and deletion node mechanism through the use of constrained compu-
tations and providing better node security from hackers. the main objective of this
paper is to design a set of rules to put in force node touchy records hiding using DNA
sequences and supplying safety to the node and its data from hackers.
1 Introduction
Distributed Computing (DC) [1] furnishes a sensible area work with productive
execution of a reply on a number PCs related with a system. For conveyed Computing
DC, large undertakings are partitioned into littler troubles which would then be
capable to be carried out on more than a few PCs concurrently free of one another.
In the route of current years, the intermixing of software program engineering and
J. Balaraju (B) · P. V. R. D. Prasada Rao

Department of Computer Science and Engineering, Koneru Lakshmaiah Education Foundation,
Vaddeswaram, Andhra Pradesh, India
https://doi.org/10.1007/978-981-16-1502-3_9
76 J. Balaraju and P. V. R. D. Prasada Rao
the multifaceted nature of science has lead to the affluent subject of bioinformatics.
Bioinformatics [2] is one of the greater up-to-date territories and has made us totally
conscious of a definitely special universe of science. Deoxyribonucleic Acid (DNA)
[3] association investigation can be a protracted cycle going from a few hours to
several days. This paper manufactures a dispersed framework that offers the reply
for some bioinformatics-associated applications. The widely widespread goal of
this paper is to bring together a Distributed Bioinformatics Computing System for
hereditary succession examination of DNA. To process, we put away a big no. of
DNA succession using different lengths of DNA preparations have been utilized
for the sequential and nonconsecutive instance search to suppose about the frame-
work’s response time received using single and several PCs. Furthermore, quite a
number lengths of DNA preparations had been likewise utilized for the instance ID
to assume about its response time watched utilizing a solitary PC and several PCs.
The specific goal of the proposed disseminated calculation for investigation of DNA
successions are (1) Build up a potential disseminated DNA association examination
calculations for diagram coordinating of DNA Gene grouping and sub-successions
recognizable proof. (2) Execute them on an about coupled appropriated system, for
example, widely wide-spread local and broad territory prepare utilizing fashionable
programming language. The principal focus of this paper is to propose a calculation
to actualize information covering up in DNA groupings to expand the multifaceted
nature and making disarray to the programmers.
2 Hadoop Cluster
Hadoop [4] is an Apache open supply machine written in java that lets in dispersed
making ready of massive datasets throughout bunches of PCs utilizing easy program-
ming models. The Hadoop shape utility works in a scenario that offers dispersed
potential and calculation throughout businesses of PCs. Hadoop is meant to scale
up from single employee to a top-notch many machines, every supplying nearby
calculation and capacity. In small Hadoop Cluster (HC) [5] have a solitary ace Node
Server and a range of patron hubs. In a larger HC, HDFS hubs are overseen via a dedi-
cated NameNode employee to have the record framework record, and an optionally
available NameNode that can produce depictions of the namenode’s reminiscence
structures, as a consequence forestalling record framework debasement and loss
of data The dimension of HC’s are shortly extended from 2005, the inventors is
constrained to simply 20 to forty nodes in a groups. At that factor, they understood
two issues, they are no longer accomplish its manageable till it ran dependably on
the better groups. In the second stage, Yahoo efficaciously tried Hadoop on a one
thousand hub bunch and start using it later yippee and Apache Software Foundation
correctly tried a 4000 hub crew with Hadoop. HC bunch improved 4000–10,000+ in
quite a number of deliveries.
Dynamic Node Identification Management in Hadoop Cluster … 77
3 DHCP
DHCP [6] is a conference that offers snappy, programmed, and focal administration
for the dispersion of IP addresses [7] internal a system. DHCP is moreover used
to organize the subnet cover, default entryway, and DNS employee statistics on the
device. Media Access Control (MAC) Address is a novel identifier of the Network
Interface Controller (NIC). A gadget hub can have distinctive NIC but every with
novel MAC. A device chairman saves a scope of IP addresses for DHCP, and each
DHCP patron on the LAN is organized to demand an IP tackle from the DHCP
employee at some stage in gadget introduction. The solicitation and-award measure
makes use of a lease thinking with a controllable timeframe, allowing the DHCP
employee to get better and later on reallocate IP tends to that are now not recharged.
The DHCP employee continually appoints an IP tackle to a bringing up purchaser
from the vary characterized via the executive. The DHCP employee offers a personal
IP address subordinate upon each’s consumer identity established on predefined
planning via the overseer.
4 DNA
Deoxyribonucleic Acid (DNA) cryptography [8], the utilization of the characteristics

of DNA affords new probabilities and heading to statistics stowing away. This work
will use the herbal traits of DNA successions. The units of DNA capacity, for example,
imperative blending, and DNA document provide any other layer of safety to the
proposed technique. So as to tightly close refined statistics thru unstable structures
like the Internet, utilizing special kinds of facts insurance plan is fundamental. One
of the famous strategies to invulnerable data thru the Internet is data protecting up.
In view of the increasing quantity of Internet clients, the use of data stowing away or
Stenographic strategies [9] is unavoidable. Before utilizing natural houses of DNA
arrangements, generally implanting a thriller message into the host pics used to be
the traditional technique of facts protecting up. The most enormous ones had been
the attention of the mutilations of the photograph when the host image was modified
to positive degrees. The key bit of their work is, the usage of natural attributes of
DNA arrangements.
5 Literature Survey
Alabady et al. [10] is carried out a Network Security Model for Cooperative
Network delivered a machine protection model. The creator has examined weak-
nesses, dangers, assaults, association shortcomings, and protection methods with
device assurance.
Balaraju et al. [11] have examined large information advances and their advances
for improved massive information. Information safety is a chief difficulty in the
administration part, science, exploration, and commercial enterprise ventures. They
likewise examined statistics stockpiling, handling, and safety territory and find out the
challenges via making use of normal protection units for Hadoop. They encouraged
a solitary DNA-based totally impenetrable hub for verification and metadata of the
board for Hadoop which is the high-quality reply for strengthening statistics and
dispose of NNSE blocks for protection metadata in the Namenode in Hadoop.
Bin Ali et al. [12] developed a Secure Campus Network have configured. The
developed hierarchical structure of the campus community thinking about one-of-a-
kind sorts of protection problems that make sure the exceptional of service.
Pandya et al. [13] are developed a Network Structure and mentioned 5 primary
community topologies like Bus, ring, Star, Tree, and Mesh.
Balaraju et al. [14] are constructed up an Algorithm Built-in Authentication
Based on Access (BABA) as a safety incidence coordinated as Hadoop hub for
making positive about statistics in HDFS and straight away metadata safety for
evading customers statistics in Hadoop. The instrument contributes a made certain
about Hadoop Cluster barring making use of different safety sport plans which like-
wise lessens operational cost, calculations, expands data security, and giving steady
safety solutions for Hadoop Cluster. The enhancement of this work is to reduce the
computational weights of the proposed calculation.
Kennedy et al. [15] are carried out a Structured Network for a Small system.
Creators have reenacted prepare configuration making use of the Cisco Packet Tracer
programming and Wire Shark conference analyzer.
Balaraju et al. [16] had accomplished a solely new protection component, a
Secure Authentication Interface (SAI) layer over the Hadoop Cluster. As a Single
Security convention, this interface offers consumer verification, metadata security,
and get admission to control. Contrasted the modern instruments, SAI can provide
safety a much less computational weight. Creators focused on protection challenges
and tended to for making certain about Big Data in a Hadoop Cluster thru a solitary,
restrictive protection gadget known as Secure Authentication Interface. SAI made a
confided in situation inner HC via confirming the two customers and their cycles.
All the above papers that are surveyed have proposed a number parts of allotted
gadget structure, geographies, and execution but they have now not examined troubles
seemed in possible usage. Numerous Authors are concentrating a made certain about
the appropriation framework in Hadoop and finally which is treasured to data in the
Hadoop crew have now not examined DHCP and MAC officers in element.
6 Problem Statement
In any distribution system including Hadoop distribution structures linked a central-

ized community switch. each node in the network has a unique IP cope with this
is dynamically assigned through the DHCP server by accumulating the bodily cope
with of every related node and assigning static IP each node is hard for administrator
in larger networks. IP cope with and hostname can seem any consumer working
in a dispensed device and they’ll access any node with suitable permissions. The
problem with acting IP and hostname, the hacker may additionally vicinity repro-
duction hostname and replica IP deal with for disturbing or malfunctioning network
by using placing a malicious node within the community. On the grounds that there
may be scope dropping essential facts from a dispensed system by using IP cope
with and it could be a safety hazard.
7 Related Work
The present invention relates to distributed computing systems and is more particu-
larly directed to architecture and implementation of a scalable distributed computing
environment which facilitates communication between independently operating
nodes on a single network.
The primary objective of the research work is to create a layer on top of the
distributed system especially for the Hadoop distributed system, so every node
appears in the layer. For setting the environment we configured a centralized DHCP
server and 250 nodes in the network with a different configuration. Multinode HC
[17] configured, the master node configured within the DHCP server as Namenode,
Fig. 1 Existing Hadoop cluster by configuring DHCP server

and the remaining nodes are data nodes. Figure 1 shows default distribution environ-
ment. The developed security layer is also configured within the DHCP Server for
collecting the hostname and IP addresses which are stored itself.
The DNA algorithm within the proposed layer is converting the IP address, the
hostname in different level and producing a unique key which appears for the user
including the physical address (MAC) of NIC. The key generation is generating
by using a highly secured DNA hiding [10] methodology for creating confusion
hackers to access any node from the network and finally it becomes a highly secured
distributed system.
Key generating Process:
Start:
1. Gathering Host, MAC, IP.
2. Merging Host, MAC, IP as UNIQ_Key.
3. Translating UNIQ_Key into BINARY Form.
4. Translating Binary form to DNA.
5. Assign a digit to DNA into a Number // a= 0, c= 1, g= 2, t= 3.
6. Translating Number to Hexadecimal.
7. Making UNIQ_Key from Hexadecimal.
Stop.
Table 1 is displaying special key technology processes in extraordinary ranges for
growing confusion to the hackers. The hostname of the node is eight characters, it
dynamically assigning from generated special key and altering every 7 days, it can
be up to date robotically central table. Table 2 is displaying the hostname and fame
of node information. So, the hackers get confusions to get admission to a unique
node the usage of hostname from the dispensed system. The essential gain of the
proposed technique is no longer having everlasting hostname to get entry to node
and it shared data.
The secured layer additionally includes nodes facts with the aid of preserving
central desk alongside hostname. Internally each and every node linked with different
nodes with the aid of performing hostname managed via the protection layer. All
these hostnames in the community are maintained by means of a invulnerable layer
which include the storage status, processing configuration by way of periodically
updating in the central table. Figure 2 is showings the impenetrable layer within
DHCP, Namenode server alongside with special hostnames for every node. The
impervious layer is updating the central desk when a new node is introduced or
putting off of a node from the allotted system.
8 Result Analysis
Overall performance analysis is analyzed with small disbursed system with proposed
comfortable layer all the prevailing security techniques aren’t concentrated to cover
Table 1 Procedure for hiding system information using DNA
Steps Description MAC_Address IP Address Hostname
01 Node sensitive data 10:78:D2:55:95:A8 10.50.4.8 HD_DN01
02 Merged data 10:78:D2:55:95:A8-10.50.4.8- HD_DN01
03 Binary form 00,110,001 00,110,000 00,111,010 00,110,
111 00,111,000 00,111,010 01,000,100 00,110,
010 00,111,010 00,110,101 00,110,101 00,111,010 00,
111,001 00,110,101 00,111,010 01,000,001 00,
111,000 00,101,101 00,110,001 00,110,000 00,101,
110 00,110,101 00,110,000 00,101,110 00,110,100 00,
101,110 00,111,000 00,101,101 00,100,000 01,001,000 01,
000,100 01,011,111 01,000,100 01,001,110 00,110,000 00,110,001
04 DNA form ATACATAAATGCATGTATGAATGGCACAATAGATGGATCCATCCATGGATGCATCCAT
GGCAACATGAAGTCATACATAAAGAGATCCATAAAGAGATCAAGAGATGAAGACAGAA
CAGACACACCTTCACACATGATAAATAC
05 A = 0, C = 1, G = 2, T = 3 0301 0300 0321 0323 0320 0322 1010 0302 0322 0311 0311 0322 0321 0311 0322
Dynamic Node Identification Management in Hadoop Cluster …
1001 0320 0231 0301 0300 0202 0311 0300 0202 0310 0202 0320 0201
0200 1020 1010 1133 1010 1030 0300 0301
06 Decimal to Hexa 5CC3148053C4906F901A54B4DE8225FD8071B87BA02E51C8E7B2C2BDE75CC314
7A2CCCD09B85CEA1AB7E9E03DF1AEC6D5947237BCFA358FB2DED
05 Unique Key 5CC3148053C4906F901A54B4DE8225FD8071B87BA02E51C8E7B2C2BDE75CC3147A2CCC
D09B85CEA1AB7E9E03DF1AEC6D5947237BCFA358FB2DED
81
Table 2 Nodes status information in central server

MAC Node_Hostname Status Joined/removed
A4-1F-72-58-BB-01 A1AB7E9E0 Active 14-MAR-2020
F5-10-72-58-BB-01 3DF1AEC6D Active 14-MAR-2020
C4-1F-B2-58-BB-01 5947237BC Active 14-MAR-2020
A4-1F-72-58-BB-01 FA358FB2D Removed 23-JUN-2020
A4-1F-72-58-BB-01 47237BCFA Active 14-MAR-2020
A4-1F-72-58-BB-01 CC3147A2C Active 14-MAR-2020
A4-1F-72-58-BB-01 BDE75CC31 Active 14-MAR-2020
A4-1F-72-58-BB-01 2E51C8E7B Removed 05-JUL-2020
Fig. 2 Proposed Hadoop cluster by dynamic hostnames
nodes data. Table 3 is showing the nodes user get right of entry to information in
configured environment. Parent three is about assessment of nodes and person facts
in present and evolved gadget (Figs. 3 and 4).
Table 3 Nodes and users

Existing Proposed (Security layer)
information
Nodes 250 250
Users 207 252
Nodes accessed 225 9
Results (data access 180 0
nodes)
Nodes and Users InformaƟon.
300
250
200
150
100
50
0
Nodes Users Nodes Accessed by Results (data Access
users Nodes)
ExisƟng Proposed
Fig. 3 Nodes and user data existing and proposed
Security Perfomance Existing and Proposed.

300
250
200
150
100
50
0
Existing Proposed
Nodes Users Nodes Accessed by users Results (data Access Nodes)
Fig. 4 Performance evolution of existing and proposed
This safety layer possibly offers 24 × 7 securities for HC which may be very
beneficial for small allotted system to keep their statistics securely. Determine 4 is
indicates the overall performance extended safety for above-configured surroundings.
This will increase the facts protection, unique operational, and decrease preservation
hassle.
9 Conclusion
The research studies of this work, we’ve got carried out a secured distributing system
with the help of DHCP server, IP, Host, and MAC aggregate. The unique allotted
machine network allotted a dedicated unique ID to each node for securing commu-
nity at the side of information. the administrator best has entire privileges to get
entry to all of the nodes such as the server and the others cannot get right of entry
to any node in the network without knowing IP or Host. The performance of the
community management and distributed System is improved in the long run data
security is superior. The complete community is deliberate to be automatic which
entails minimal person intervention. The destiny scope of this work is to beautify the
same security layer to use to the wan community placed in special places.
References
1. Yang, H., Lee, J.: Secure distributed computing with straggling servers using polynomial codes.
IEEE Trans. Inf. Forensics Secur. 14(1), 141–150 (2019). https://doi.org/10.1109/TIFS.2018.
2846601
2. Khanan, A., Abdullah, S., Mohamed, A.H.H.M., Mehmood, A., Ariffin, K.A.Z.: Big data
security and privacy concerns: a review. In: Al-Masri, A., Curran, K. (eds.) Smart technologies
and innovation for a sustainable future. Advances in Science, Technology & Innovation (IEREK
Interdisciplinary Series for Sustainable Development). Springer, Cham (2019). https://doi.org/
10.1007/978-3-030-01659-3_8
3. Roy, M., et al.: Data security techniques based on DNA encryption. In: Chakraborty, M.,
Chakrabarti, S., Balas, V. (eds.) Proceedings of International Ethical Hacking Conference
2019. eHaCON 2019. Advances in Intelligent Systems and Computing, vol. 1065. Springer,
Singapore (2020). https://doi.org/10.1007/978-981-15-0361-0_19
4. Samet, R., Aydın, A., Toy, F.: Big data security problem based on Hadoop framework. In:
2019 4th International Conference on Computer Science and Engineering (UBMK), Samsun,
Turkey, pp. 1–6 (2019). https://doi.org/10.1109/UBMK.2019.8907074
5. Akhgarnush, E., Broeckers, L., Jakoby, T.: Hadoop: A standard framework for computer cluster.
In: Liermann, V., Stegmann, C. (eds.) The Impact of Digital Transformation and FinTech on
the Finance Professional. Palgrave Macmillan, Cham (2019). https://doi.org/10.1007/978-3-
030-23719-6_18
6. Rajput, A.K., Tewani, R., Dubey, A.: The helping protocol “DHCP”. In: 2016 3rd International
Conference on Computing for Sustainable Global Development (INDIACom), New Delhi,
pp. 634–637 (2016)
7. Mohsin, M., Prakash, R.: IP address assignment in a mobile ad hoc network. In: MILCOM
2002. Proceedings, Anaheim, CA, USA, vol. 2, pp. 856–861 (2002). https://doi.org/10.1109/
MILCOM.2002.1179586
8. Sajisha, K.S., Mathew, S.: An encryption based on DNA cryptography and steganography.
In: 2017 International Conference of Electronics, Communication and Aerospace Tech-
nology (ICECA), Coimbatore, pp. 162–167 (2017). https://doi.org/10.1109/ICECA.2017.821
2786https://doi.org/10.1109/ICECA.2017.8212786
9. Kar, N., Mandal, K., Bhattacharya, B.: Improved Chaos-based video steganography using
DNA alphabets. ICT Express 4(1), 6–13 (2018). ISSN 2405-9595. https://doi.org/10.1016/j.
icte.2018.01.003
10. Alabady, S.: Design and implementation of a network security model for cooperative network.
Int. Arab J. Technol. 1(2) (2009)
11. Balaraju, J., Rao, P.V.V.P.: Recent advances in big data storage and security schemas of HDFS:
a survey (2018)
12. Bin Ali, M.N., Hossain, M.E, Masud Parvez, Md.: Design and implementation of a secure
campus network. Int. J. Emerg. Technol. Adv. Eng. Website 5(7) (2015). www.ijetae.com
(ISSN 2250-2459. ISO 9001:2008 Certified Journal
13. Pandya, K.: Network structure or topology. Int. J. Adv. Res. Comput. Sci. Manage. Stud. 1(2),
6 (2013)
14. Balaraju, J., Prasada Rao, P.V.R.D.: Designing authentication for Hadoop cluster using DNA
algorithm. Int. J. Recent. Technol. Eng. (IJRTE) 8(3) (2019). ISSN: 2277-3878. https://doi.org/
10.35940/ijrte.C5895.0983
15. Offor, Kennedy, J., Obi, Patrick, I., Nwadike Kenny, T., Okonkwo II: Int. J. Eng. Res. Technol.
(IJERT) 2(8) (2013)
16. Balaraju, J., Rao, P.: Innovative secure authentication interface for Hadoop cluster using DNA
cryptography: a practical study (2020).https://doi.org/10.1007/978-981-15-2475-2_3
17. Gugnani, S., Khanolkar, D., Bihany, T., Khadilkar, N.: Rule based classification on a multi node
scalable Hadoop cluster. In: Fortino, G., Di Fatta, G., Li, W., Ochoa, S., Cuzzocrea, A., Pathan,
M. (eds.) Internet and distributed computing systems. IDCS 2014. Lecture Notes in Computer
Science, vol. 8729. Springer, Cham (2014). https://doi.org/10.1007/978-3-319-11692-1_15
18. Demidov, V.V.: Hiding and storing messages and data in DNA. In: DNA beyond Genes.
Springer, Cham (2020). https://doi.org/10.1007/978-3-030-36434-2_2
A Scientometric Inspection of Research
Based on WordNet Lexical During
1995–2019
Minni Jain, Gaurav Sharma, and Amita Jain
Abstract The purpose of this study is to conduct a scientometric inspection for the
research based on WordNet lexicon. WordNet is a lexical database for the English
Language developed by George A. Miller and his team at Princeton University in
1985. This study reviews WordNet-based research mainly published in the Web of
Science (WoS) database from 1995 to 2019. The publication data has been analyzed
computationally to present year-wise publications, publications growth rate, country-
wise research publications, authors who published a large number of papers in this
field. The results have been shown in the form of figures. The present study will be
useful for a better understanding of the trajectory of the research work done in the
field of WordNet during the last 25 years and shall highlight the prominent research
areas and categories in the field of WordNet.
1 Introduction
WordNet is a lexical resource for the English language. It groups English phrases
into units of synonyms known as synsets. WordNet has been widely used in the field
of Natural Language Processing (NLP), Artificial Intelligence (AI), Text Analysis,
Machine Translations, Information Retrieval, etc. in the recent past [1]. A common
use of WordNet is to determine the similarities between words. It was developed in
the Princeton University under the direction of prof. George A. Miller in 1985. Since
then, a lot of research has been done to strengthen the WordNet using semantic rela-
tions between different components. It is a combination of dictionary and thesaurus
M. Jain · G. Sharma (B)

Department of Computer Science and Engineering, Delhi Technological University, Delhi
110042, India
M. Jain
e-mail: minnijain@dtu.ac.in
A. Jain
Department of Computer Science and Engineering, Ambedkar Institute of Advanced
Communication Technologies and Research, Delhi 110031, India
https://doi.org/10.1007/978-981-16-1502-3_10
88 M. Jain et al.
because unlike dictionary it also found the meaningful relations between words.
WordNet allows the different lexical categories such as noun, verbs, adverbs, and
adjectives however it ignores the propositions and determiners [2]. It will generate
the valid meaningful sentence for the use of a set of synsets to link with the semantic
relations. WordNet includes mainly two terms word forms and sense pairs. Word
forms is a string over the finite alphabets and sense pair is the set of meanings. This
word forms with a particular sense is known as “word” in the English language [1].
So more than 166,000 word forms and sense pairs are used in the WordNet [3].
Semantic relations are the relations between meanings or relations between two
sentences or relations between two words [4]. Some semantics relations are given
below:
• Synonymy is the set of synonyms (synsets) to represent word senses.
• Antonymy is the set of opposite names of word forms.
• Hyponymy is the inverse of hypernymy (super-name), so the hyponymy is (sub-
name). It is a transitive relation.
• Meronymy is the inverse of holonymy (whole-name), so the meronymy is the
(part-name). It shows the member parts.
• Troponymy (manner-name) is used for verbs. Entailment is showing the relations
between verbs.
These semantics relations are represented by pointers in between word forms
or synsets. More than 116,000 pointers are used in WordNet. Semantic relations in
WordNet is an open-source and freely available for everyone on the Internet. WordNet
3.11 is the latest version. The increasing growth of research work on WordNet since
the period of inception inspires us to analyze the progress of research work on
WordNet. In this paper, a scientometric analysis has been made computationally to
highlight the role of WordNet in the development of language. The present study shall
be helpful to understand the trajectory of the research work done on WordNet during
a large span that is from 1995 to 2019. The resource data on the WordNet research
publications has been taken from the Web of Science (WoS). We have analyzed the
data so, obtained from the Web of Science (WoS) computationally to identify the
year-wise research publications on WordNet and represented graphically for better
understanding. The WordNet research publications data have also been analyzed to
identify author-wise publications.
This information we are representing in the form of graphs for better under-
standing. Thus, the aim of the present study is to provide the analytic account of
the progress of the research work for example the major areas of research work,
major concepts, and major approaches to research on WordNet during the period
of time 1995–2019 [5–19]. This study shall be useful to understand how and why
the research work on WordNet has grown over time and which countries, organi-
zations/Institutions, authors have contributed more substantially. It will also help to
understand the major potential research areas and applications of WordNet. Section 2
1 https://wordnetweb.princeton.edu/perl/webwn.
A Scientometric Inspection of Research Based on WordNet … 89
describes the data and methodology; Sect. 3 highlights the results of the study with
corresponding visualizations, and conclusions are given in Sect. 4.
2 Data and Methodology
For the scientometric analysis of WordNet the data is retrieved from Web of Science
(WoS). The total number of papers retrieved is 947 but out of these 104 papers
are filtered. The collected data was based on the time span 1995–2019 [5–19].
Web of Science (WoS) is the large database for the different documents, articles,
reviews, proceeding papers, editorial materials, etc. [5]. So, the study in this paper
is about 25 years of work on WordNet to be analyzed using tables and graphical
representations.
3 Analytical Study
This section describes the details of various important indicators computed through
the analysis of data.
3.1 Year-Wise Publications
First of all, we have measured the number of published papers on WordNet for each
of the years 1995–2019. Figure 1 shows the number of published papers in WordNet
Fig. 1 Year-wise publications graph

90 M. Jain et al.
on a year-wise plot. We have a column about NOP (No. of publications) and total
citations and average citations per year. We can observe that this graph has been
more or less flat till 2002, after which there is a steep rise. From 2006 to 2007, there
is a drastic fall in the number of papers in this time period. After that, the graph is
consistently increasing and slightly up and down was happened in between year by
year.
3.2 Country-Wise Publications
We have analyzed the country-wise contributions of WordNet research during

25 years of the period from 1995 to 2019. The research paper publications can
be seen in the terms of record count in Web of Science (WoS). The topmost countries
according to the research paper record count, as listed above are illustrated in the
graph in Fig. 2. The graph is explained by different colors, these colors are indi-
cating the “Countries”, and the values are “Record Count”. The highest number of
published papers or record count about WordNet is on the account of the USA.
After that many countries come, China is the second topmost country who has
a high number of published papers on WordNet. Spain is just comparatively low
than China. After that Spain, there is a huge difference between the other countries.
The other major countries from where WordNet work is reported to include Italy,
South Korea, England, Canada, Germany, France, India, etc. These are the only top
10 countries which we included in this paper.
Fig. 2 Country-wise publication graph

3.3 Top Organization Publications
After analyzing WordNet research publications to extract the county-level results, we

tried to understand the organization-level research output. First, we have to identify
the top organization’s contributions significantly to WordNet work during the 1995–
2019 period. We list the top 10 organizations in descending order of the number
of publications originating from them. The table indicates four different indicators,
namely NOP (Number of Papers), TC (Total Citations), ACPP (Average Citations
Per Paper) and h-index for the WordNet research output originating from various
organizations. The values of NOP, TC, ACPP, and h-index are computed from the
Web of Science (WoS). ACPP values is calculated as:
TC
ACPP = (1)
NOP
The h-index metric is the author-level metric which is measured both the produc-
tivity and the impact of the citations published work of a scientist or scholar. The
h-index is calculated for individuals, institutions, journals, etc. We can observe that
the Universitat D Alacant has the highest number of research papers on the topic
of WordNet. This is following by the Chinese Academy of Science which is in the
second position by few numbers of papers (Fig. 3).
We have selected only the top 10 organizations, in which Universitat D Alacant
having the largest number of papers (18 papers) after that Chinese Academy of
Science has the second-highest papers (13 papers) there have 4 organizations [Chosun
university, Consiglio Nazionale Delle Ricerche Cnr, Universitat Politecnica De
Valencia, Universitat Rovira I Virgili] who have the same number of papers (12
papers) Now the last 4 organizations [Centre National De La Recherche Scientifique,
Instituito Politechnico National Mexico, Princeton University, University of Basque
Country] also have the same number of papers (11 papers).
Fig. 3 Area graph for organization-wise publications

92 M. Jain et al.
Fig. 4 Treemap of author-wise publications
3.4 Author-Wise Publications
We have also analyzed the WordNet research publication data to identify the most
productive and most cited authors. We are defining here highly productive authors
who produce a high amount of research papers published during the period of 1995–
2019. We present the list of top 15 most productive authors, in this table we indicate
the four indicators again are NOP (Number of papers), TC (Total Citations), ACPP
(Average Citations Per Paper), and h-index. We can observe that Kim P is the most
productive author on WordNet research during 1995–2019. He published 12 papers
on WordNet, his total citations are 88, his ACPP is 7.33 and h-index is 6. This is
followed by the Rosso P he published 11 papers, his total citations are 77, ACPP is
7, and h-index is 4. But if the most productive author is also the most cited author is
not compulsory. Sanchez D. published 10 papers, his total citations are 488, ACPP is
48.8, and h-index is 10. According to the Web of Science (WoS) using this table the
most productive author is Kim P. with 12 papers published on WordNet, highest total
citations having author is Weikum G. with 521 citations, the most average citations
per paper author is Weikum G. with 74.43 and the highest h-index author is Sanchez
D. with h-index 10. Here for the better understanding, we make the treemap chart in
Fig. 4, which shows the top 15 most productive authors with their NOP.
4 Conclusions
The paper presents an analytical study in the field of WordNet research. We analyzed
the research publications on WordNet research and extract the data from Web of
Science (WoS) in the time span 1995–2019. The analytical study helped to identify the
year-wise publications, country-wise contributions, top organization publications,
and top author-wise publications. In this paper, we used the figures which result for
better understanding of the research work done in the field of WordNet. From the
figures, we conclude that the USA, China, and Spain are the most productive countries
with the record count of more than 100 in the field of WordNet research while India
has been placed on number 10 with 32 record count. It representing the year-wise
publications that the highest number of research papers have been published in the
year 2016. But the remarkable growth in the research publications has been found
from 2003. It appears that extensive use of WordNet as a tool has attracted computer
science researchers and software developers. Author-wise treemap shows that the
authors Kim P., Rosso P., and Sachez D. are the only authors who published the
research papers in double digits. Universitat D Alacant is the topmost organization
who published the highest number of research papers in the field of WordNet while
Chinese Academy of Science and Chosun University are the topmost second and
third organizations in the production of research papers on WordNet. organization
of the WordNet is at the 9th place in the list of top 10 organizations of the research
on WordNet. The analysis has predicted to provide an analytical study to researchers
working in this domain in exploring the discipline. This paper will also be helpful
for the beginners who are new in this field and wants to do research in the WordNet.
In the upcoming time, the country-wise contributions, year-wise publications, and
author-wise publication will change when the research will continue in this field with
time because this paper analyzed only for 25 years (1995–2019) of time span.
References
1. Miller, G.A.: WordNet: a lexical database for English. Commun. ACM 38, 39–41 (1995).
https://doi.org/10.1145/219717.219748
2. Miller, G.A., Hristea, F.: WordNet nouns: classes and instances. J. Comput. Linguist. 32, 1–3
(2006). https://doi.org/10.1162/coli.2006.32.1.1
3. Miller, G.A., Beckwith, R., Fellbaum, C., Gross, D., Miller, K.: WordNet: an on-line lexical
database. Int. J. Lexicogr. 3, 235–312 (1993)
4. Wei, T., Lu, Y., Chang, H., Zhou, Q., Bao, X.: A Semantic approach for text clustering using
WordNet and lexical chains. Expert Syst. Appl. Int. J. 42, 2264–2275 (2015). https://doi.org/
10.1016/j.eswa.2014.10.023
5. Mah, T., Ben Aouicha, M., Ben Hamadou, A.: A new semantics relatedness measurement
using WordNet features. J. Knowl. Inf. Syst. 41, 467–497 (2014). https://doi.org/10.1007/s10
115-013-0672-4
6. Montoyo, A., Palomar, M., Rigau, G.: Interface for WordNet enrichment with classification
systems. Database Expert Syst. Appl. 2113, 122–130 (2001)
7. Gomes, P., Pereira, F.C., Paiva, P., Seco, N., Carreiro, P., Ferreira, J.L., Bento, C.: Advances in
Artificial Intelligence, vol. 2671, pp. 537–543 (2003)
8. Miller, G.A., Fellbaum, C.: WordNet then and now. Lang. Resour. Eval. 41, 209–2214 (2007).
https://doi.org/10.1007/s10579-007-9044-6
9. Christiane Fellbaum Vossen, P.: Challenges for multilingual WordNet. Lang. Resour. Eval. 46,
313–326 (2012). https://doi.org/10.1007/s10579-012-9186-z
10. Otegi, A., Arregi, X., Ansa, O., Agirre, E.: Using knowledge based relatedness for information
retrieval. Knowl. Inf. Syst. 44, 689–718 (2015). https://doi.org/10.1007/s10115-014-0785-4
94 M. Jain et al.
11. Gomes, P., Pereira, F.C., Paiva, P., Seco, N., Carriero, P., Ferreira, J.L., Bento, C.: Noun sense
disambiguation with WordNet for software design retrieval. Advances in Artificial Intelligence,
vol. 2671, pp. 537–543 (2003)
12. Sonakshi, V.I.J., Tayal, D., Jain, A.: A machine learning approach for automated evalua-
tion of short answers using text similarity based on WordNet graphs. Wirel. Pers. Commun.
(2019).https://doi.org/10.1007/s11277-019-06913-x
13. Rudnicka, E., Piasecki, M., Bond, F., Grabowski, L., Piotrowski, T.: Sense equivalence in
PLWordNet to Princeton WordNet mapping. Int. J. Lexicogr. 32, 296–325 (2019). https://doi.
org/10.1093/ijl/ecz004
14. Jiang, Y.C., Yang, M.X., Qu, R.: Semantic similarity measures for formal concept analysis
using linked data and WordNet. Multimedia Tools Appl. 78, 19807–19837 (2019). https://doi.
org/10.1007/s11042-019-7150-2
15. Zhu, N.F., Wang, S.Y., He, J.S., Tang, D., He, P., Zhang, Y.Q.: On the suitability of WordNet
to privacy management. Wirel. Pers. Commun. 103, 359–378 (2018). https://doi.org/10.1007/
s11277-018-5447-5
16. Cai, Y.Y., Zhang, Q.C., Lu, W., Che, X.P.: A hybrid approach for measuring semantic similarity
based on IC-weighted path distance in WordNet. J. Intel. Inf. Syst. 51, 23–47 (2018). https://
doi.org/10.1007/s10844-017-0479-y
17. Ehsani, R., Solak, E., Yildiz, O.T.: Constructing a WordNet for Turkish using manual and
automatic annotation. ACM Translations on Asian and Low-Resource Language Information
Processing, vol. 17 (2018). https://doi.org/10.1145/3185664
18. Guinovert, X.G., Portela, M.A.S.: Building the Galician WordNet: methods and applications.
Lang. Resour. Eval. 52, 317–339 (2018). https://doi.org/10.1007/s10579-017-9408-5
19. Vij, S., Jain, A., Tayal, D., Castillo, O.: Fuzzy logic for inculcating significance of semantic
relations in word sense disambiguation using a WordNet graph. Int. J. Fuzzy Syst. 20, 444–459
(2018). https://doi.org/10.1007/s40815-017-0433-8
Sentiment Analysis of an Online
Sentiment with Text and Slang Using
Lexicon Approach
Shelley Gupta, Shubhangi Bisht, and Shirin Gupta
Abstract Sentiment analysis is a technique that helps data analysts to analyze the
various online users’ opinions about a particular product or service. There are various
approaches for performing sentiment analysis. Lexicon-based approach uses senti-
ment lexicons to calculate the polarity of the sentences. It is observed that nowadays
online lexicons consist of text and online slang as well. The proposed approach
calculates the polarity of the sentence by evaluating a polarity score of sentiments
with text and slang. The sentiment polarity of tweets is also evaluated using the
machine learning classification techniques like SVM, Random Forest, and Linear
regression with accuracy, recall, precision, and F-score parameters. The accuracy
of the proposed approach has been evaluated to 96% for Twitter dataset containing
17,452 tweets and 97% for other social media sentiments.
1 Introduction
Sentiment analysis is an excellent way to get to know the reaction and feelings of
people (particularly consumers) about any product, topic or idea [1, 4] expressed on
review sites, e-commerce sites, online opinion sites, or social media like Facebook,
Twitter, etc. Sentiment analysis is employed using three broad techniques: Lexical
based [3, 9, 10, 17], machine learning based [9, 10, 17] and hybrid/combined [2].
Lexicon-based analysis is governed by matching the new tokens with pre-defined
dictionaries that have existing tagged lexicons as positive, negative, or neutral [11]
polarity and score. Machine Learning approach as stated in [2, 9, 17] is the most
popular approach for sentiment analysis due to its accuracy and ease of adaptability.
Generally labeled and sizable datasets are used which requires human annotators
that are expensive and time-consuming. Hybrid/combined [2] approach combines
S. Gupta (B) · S. Bisht · S. Gupta

ABES Engineering College, Ghaziabad, Uttar Pradesh, India
e-mail: shelley.gupta@abes.ac.in
S. Bisht
e-mail: shubhangi.16bit1027@abes.ac.in
https://doi.org/10.1007/978-981-16-1502-3_11
96 S. Gupta et al.
the accuracy of machine learning approach with the speed of lexicon-based approach
with the aim to make it more accurate.
The use of slangs for expressing one’s opinion saves time and space within the
word limit using slangs and abbreviations. Most of the existing sentiment anal-
ysis approaches remove the slangs during the pre-processing of the dataset. Thus,
removing the impact of online slangs in sentiment score evaluation. Although
our belief is inclusion of slang in determining the polarity and score of senti-
ment at sentence and document level, can enhance the sentiment score of different
approaches.
Our distinct contributions for the paper can be summarized as follows: (i) Our
approach is a rule-based approach that deals with slang by replacing their meaning
in an online sentiment and then calculating the sentiment score at the sentence level.
(ii) The approach determines the average score of the total number of positive and
negative sentences to evaluate the sentiment score and polarity of an online document.
(iii) Our approach outperforms the existing approaches as it calculates the sentiment
score using online slang dictionary at sentence and document level.
The paper is organized as follows: Sect. 2 describes the literature review to
Sentiment analysis and the background of this work. Section 3 demonstrates the
proposed approach. Section 4 demonstrates the score calculation and result eval-
uation. Sections 5 and 6 represent the conclusion and limitations with future
work.
2 Literature Review
A large proportion of the population uses the fast medium of English vocabulary of
slang and abbreviations while expressing their emotions on a social media platform.
Very few existing sentiment analysis techniques have considered commonly used
slangs while calculating the polarity of the sentences.
General Inquirer (GI) [12] is a text mining approach that uses oldest manually
constructed lexicons. This approach has classified a large number of words (11 k) into
a few categories (183 or more). GI has been widely used to automatically determine
the properties of text.
LIWC discovers the feature of speaking and writing language. It works by
revealing the patterns in the speech by calculating recurrence with which words
of different categories are used with respect to the total number of words in the
sentence [13].
SentiWordnet 3.0 [5] is an enriched version of SentiWordNet 1.0 [8] which
supports sentiment classification. The whole process of SentiWordNet 3.0 [5] uses
semi-supervised and random walk processes instead of manual glosses.
Vader [6] has successfully calculated the overall polarity of sentences by taking
into consideration the score of each word of the sentence and performing a qualitative
analysis to identify those properties of text which affect the intensity of the sentence.
Sentiment Analysis of an Online Sentiment with Text and Slang … 97
It tells about how positive or negative the sentiment is. However, the only shortcoming
of Vader [6] was the use of a very limited number of slangs.
Senti-N-Gram [11] extracts the n-gram scores from a customer-generated data
using a ratio-based approach which depends on the number of positive and negative
sentences in a given dataset. It worked on n-gram lexicons with successfully handling
the cases of intensifiers and negation.
However, the above approaches have not mentioned anything about slangs.
Thus, this paper aims at suggesting an approach that deals with sentiment anal-
ysis suggesting with the abilities of Vader [6] and slang at sentence and document
level as well.
3 Proposed Approach
The steps of proposed approach are elaborated below and shown in Fig. 1. Figure 3
elaborates the definitions of symbols used in algorithm Fig. 2.
1. Initialization: A slang dictionary is initialized considering near about 300 most
commonly used slangs. The keys correspond to the slang and the values corre-
spond to the meaning of the respective slang. Every slang is considered in
lowercase and uppercase letters as well, e.g. lol: laugh out loud, LOL: laugh
out loud. The existing Vader [6] dictionary of common lexicons created by
using well-established word-banks, LIWC [13], ANEW [18] and GI [12] is
also initialized.
2. Pre-processing of Dataset: The links of various images and emojis are removed
from the dataset. The tweets with only image links were replaced by a numeric
data type NaN (Not a Number).
3. Slang Replacement: The above pre-processed dataset as any slang is determined
it is replaced with its meaning. E.g.: The sentence “The joke you cracked was
funny!!! hahaha lol.” will become “The joke you cracked was funny!!! hahaha
laugh out loud.”
4. Score Calculation (Sentence Level): The score of each sentence is calculated
on the basis of the lexicons [6]. This provided a polarity to each sentence as
positive, negative, or neutral considering the following five cases of punctuation,
capitalization, degree modifiers, contrastive conjunction, and negation [6].
5. Final Score Calculation Normalisation: The sentiment score of each sentence
lies between −4 and +4. Then a Normalization function is applied to map each
score to a value between −1 and +1. The normalization function used is Hutto
Normalization function [6].
6. Score Calculation (Document Level): Suppose an online document consists of
‘n’ number of tweets. The score and polarity of the document are determined
on the basis of the average score of positive sentences or negative sentences.
If the average score of positive sentences is greater than the average score of
negative sentences, the polarity of the document is positive or vice versa.
98 S. Gupta et al.
Fig. 1 Proposed approach
4 Demonstration for Score Calculation
Table 1 contains online sentiments covering all five cases of quantitative analysis, i.e.,
punctuation, negation, capitalization, intensifiers, and contrastive conjunction. The
polarity score of these comments are the same for our proposed approach and Vader
Fig. 2 Symbols used in algorithm
[6] for online sentiments ‘without slang’. Although, the polarity score of proposed
approach and Vader [6] is considerably different for online sentiments ‘with slangs’.
100 S. Gupta et al.
# Step 1: Initialization
dict := {slang0: meaning0, slang1:meaning1, slang2:meaning2, …………… slangl: meaningl};
df := sheet[“Tweets”];
# Step 2: Eliminating images and emojis
for i: = 0 to n-1 do:
text:= df. iloc[i]; text1 :=strip_image(text);
df [“Tweets without image”] := text1;
end
for i =0 to n-1 do:
text2 = df. iloc [i, “Tweets without image”]; text3 = strip_emoji(text2);
df [“Tweets without emoji”]: = text3;
end
# Step 3: Replacing Slangs
for i =0 to n-1 do:
sentence = df. iloc [i,” Tweets without emoji”]
if word in sentence == dict[slang] then:
sentence =replace_slangs ();
else do:
sentence =sentence;
end
df[“Tweets with replaced slangs”] =sentence;
end
# Step 4: Score Calculation (Sentence Level)
for i =0 to n-1 do:
text4 = df. iloc [i,” Tweets with replaced slangs”];
score=average_score(text4);
end
# Step 5: Applying Normalization Function
for i =0 to n-1 do:
norm_score=score / math. sqrt ((score*score) +alpha);
end
# Step 6: Score calculation (Document Level)
asns=avg_neg (); asps=avg_pos () ;
if (ASPS > ASNS): document_score = ASPS;
else document_score = ASNS;
end
Fig. 3 Proposed algorithm

Table 1 Demonstration of score calculation

Without slangs Proposed/Vader With slangs Proposed Vader approach
approach scores approach score score
LOVED your 0.6841 TBH LOVED 0.8964 0.6841
work your work gw
The joke you 0.7163 The joke you 0.9077 0.8617
cracked was cracked was
funny!!! funny!!! hahaha
lol
I love you!! 0.6988 I Love you!! 0.9059 0.8684
xoxo
You were my −0.1444 You were my −0.8387 0.6542
friend but after friend but after
the stunt you the stunt you
pulled i do not pulled I do not
like you like you gth
I hope both of 0.7964 I hope both of 0.9062 0.7964
you are having you are having
best time best time ILYF
The service here 0.3832 SRSLY The 0.2280 0.3832
is marginally service here is
good marginally good
I do not like your −0.2755 I do not like your −0.7098 0.2755
tone tone, it is vb
Kobe Bryant was 0.729 Kobe Bryant was 0.8730 0.7034
a GREAT a GREAT and
basketball player awsm basketball
player
Food was −0.6571 The food was −0.6877 −0.6571
horrible!!! ABS horrible !!!
Your outfit was 0.4926 Your outfit was 0.6239 0.4926
good! good amz !
4.1 Experimental Setup
To implement the proposed approach, we use Python and Vader a lexicon and rule-
based sentiment analysis tool [6, 15]. (i) Tweets of various most followed personali-
ties of Twitter are downloaded to conduct various experiments [14, 16]. The dataset
consists of 16,000 tweets of 80 personalities across the world, 40 males and 40
females. The tweets of different personalities are stored as a document. (2) Comments
on Facebook consists of 1452 online sentiments downloaded using facepager [7].
102 S. Gupta et al.
4.2 Results Evaluation
The tweets of each personality are stored as a document in a single excel. The scores
of each tweet are evaluated at sentence level. At document level, the average score of
all the tweets of personalities is taken to determine polarity and sentiment score of the
tweets of various personalities. The experiment results at sentence level are illustrated
in Tables 2 and 3. Table 2 clearly shows our proposed approach outperforms existing
[6] for Twitter dataset, for SVM, Random Forest, and Linear Regression. Table
3 demonstrates that our approach shows accuracy of 97% for SVM and 98% for
Random Forest for Facebook dataset. Thus, it is observed that our proposed approach
gives better accuracy when text dataset with different slangs are evaluated.
5 Conclusion
The proposed approach attempts to calculate the polarity of online sentiments by

considering the slangs used by the users in their online sentiments. It evaluates the
sentence as negative, positive, or neutral by successfully replacing the slangs with
their meanings to produce the correct score. The proposed approach is a further
extension of the existing approach Vader [6] by overcoming its limitation i.e. usage
of only common slangs.
6 Limitations and Future Work
Limitations of this approach are: (1) Exaggerated slangs such as “looooool”, “rofl!!!!”
etc. are not captured. (2) Use of emoticons such as , etc. in sentiments are
very common but our approach doesn’t consider them. (3) We have considered only
300 slangs however more could be considered. This paves the way for future work
of proposing a framework for sentiment analysis that considers exaggerated slangs,
emojis, much more slangs than 300 for better and accurate results.
Table 2 Comparative results on Twitter dataset (Sentence level)
ML techniques SVM Random forest Linear regression
Evaluation metrics P R F A P R F A P R F A
Without Slang (Vader) 0.94 0.94 0.94 0.94 0.94 0.94 0.94 0.99 0.93 0.923 0.93 0.93
With Slang (Proposed Approach) 0.95 0.965 0.96 0.95 0.94 0.95 0.96 0.95 0.95 0.95 0.95 0.95
Sentiment Analysis of an Online Sentiment with Text and Slang …
103
104
Table 3 Comparative results on Facebook dataset (Sentence level)

ML techniques SVM Random forest Linear regression
Evaluation metrics P R F A P R F A P R F A
Without Slang (Vader) 0.96 0.96 0.969 0.96 0.95 0.95 0.95 0.97 0.96 0.96 0.96 0.95
With Slang (Proposed Approach) 0.98 0.98 0.979 0.975 0.96 0.96 0.96 0.98 0.98 0.97 0.97 0.97
S. Gupta et al.
References
1. Liu, B., Zhang, L.: A survey of opinion mining and sentiment analysis. In: Mining Text Data,
pp. 415–463. Springer, Boston, MA (2012)
2. Nagamanjula, R., Pethalakshmi, A.: A novel framework based on bi-objective optimization
and LAN2FIS for Twitter sentiment analysis. Soc. Netw. Anal. Min. 10(34), 34 (2020)
3. Taboada, M., Brooke, J., Tofiloski, M., Voll, K., Stede, M.: Lexicon-based methods for
sentiment analysis. Comput. Linguist. 37, 267–307 (2011). https://doi.org/10.1162/COLI_a_
00049
4. Anjaria, M., Guddeti, R.M.R.: A novel sentiment analysis of social networks using supervised
learning. Soc. Netw. Anal. Min. 4(1), 181 (2014)
5. Baccianella, S., Esuli, A., Sebastiani, F.: SentiWordNet 3.0: an enhanced lexical resource for
sentiment analysis and opinion mining. In: Proceedings of LREC, 10 (2010)
6. Gilbert, C.H.E., Hutto, E.: Vader: a parsimonious rule-based model for sentiment analysis of
social media text. In: Eighth International Conference on Weblogs and Social Media (ICWSM-
14), vol. 81, p. 82. (2014). Available at (20/04/16). https://comp.social.gatech.edu/papers/icw
sm14.vader.hutto.pdf
7. Facepager. Get the software safe and easy. (2020). Retrieved 8 June 2020, from https://facepa
ger.software.informer.com/3.6/
8. Esuli, A., Sebastiani, F.: Sentiwordnet: a publicly available lexical resource for opinion mining.
In: LREC, vol. 6, pp. 417–422 (2006)
9. Korayem, M., Aljadda, K., Crandall, D.: Sentiment/subjectivity analysis survey for languages
other than English. Soc. Netw. Anal. Min. 6(1), 75 (2016)
10. Wang, Z., Lin, Z.: Optimal feature selection for learning-based algorithms for sentiment
classification. Cogn. Comput. 12(1), 238–248 (2020)
11. Dey, A., Jenamani, M., Thakkar, J.J.: Senti-N-Gram: an n-gram lexicon for sentiment analysis.
Expert Syst. Appl. 103, 92–105 (2018)
12. Stone, P.J., Bales, R.F., Namenwirth, J.Z., Ogilvie, D.M.: The general inquirer: a computer
system for content analysis and retrieval based on the sentence as a unit of information. Behav.
Sci. 7(4), 484–498 (1962)
13. Pennebaker, J.W., Francis, M.E., Booth, R.J.: Linguistic inquiry and word count: LIWC 2001,
71(2001) (2001). Lawrence Erlbaum Associates, Mahway
14. Gupta, S., Singh, A., Ranjan, J.: Sentiment analysis: usage of text and emoji for expressing
sentiments. In: Advances in Data and Information Sciences (2020)
15. VaderSentiment (2020). Retrieved 7 June 2020, from https://pypi.org/project/vaderSentiment/
16. Find out who’s not following you back on Twitter, Tumblr, & Pinterest (2020). Retrieved 7
June 2020, from https://friendorfollow.com/twitter/most-followers/
17. Han, H., Zhang, J., Yang, J., Shen, Y., Zhang, Y.: Generate domain-specific sentiment lexicon
for review sentiment analysis. Multimedia Tools Appl. 77(16), 21265–21280 (2018)
18. Nielsen, F.Å.: A new ANEW: evaluation of a word list for sentiment analysis in
microblogs. arXiv preprint arXiv:1103.2903 (2011)
Fuzzy Logic Technique for Evaluation
of Performance of Load Balancing
Algorithms in MCC
Divya, Harish Mittal, Niyati Jain, Bijender Bansal, and Deepak Kr. Goyal
Abstract Mobile Cloud Computing (MCC) is considered next-generation applica-

tions. One most important issue in MCC is Load Balancing. Uniform distribution of
load among all the virtual servers can provide a better response time. Users demand
more services with better results. Many algorithms are proposed to address this
issue. Analysis of prevalent load balancing algorithms in cloud computing is done
using various parameters like throughput, resource utilization, response time, etc.,
To compare the existing algorithms in a much better way and to compare their perfor-
mance, a fuzzy logic technique is evolved in this paper. The technique is illustrated
using a suitable numerical example. Evaluation of performance of 8 Algorithms is
carried out on the basis of four metrics throughput, response time, migration time,
and overhead. Using this technique Gradation of prevalent algorithms may be done
easily in terms of their performance on the basis of desired metrics.
1 Introduction
Cloud computing is pay-per-use computing model. Mobile Cloud Computing is

considered next-generation applications. One most important issue in Mobile Cloud
Computing is Load Balancing. Uniform distribution of load among all the virtual
servers can provide a better response time. It has gained much attention these days.
Users demand more services with better results. Many algorithms are proposed
to address this issue. Analysis of prevalent load balancing algorithms in cloud
computing is done using various parameters like throughput, resource utilization,
response time, etc., To compare the existing algorithms in a much better way and to
compare their efficiency, a fuzzy logic technique is evolved in this paper. In future
experimental study will be done so that gradation of prevalent algorithms may be
Divya · N. Jain · B. Bansal · D. Kr. Goyal

Department of CSE, Vaish College of Engineering, Rohtak, India
H. Mittal (B)
BM Institute of Engineering and Technology, Sonepat, India
https://doi.org/10.1007/978-981-16-1502-3_12
108 Divya et al.
done in terms of their efficiency. Literature Review and Analysis of some prevalent
algorithms of Load Balancing Algorithms are described in Sect. 2. The proposed
model is described in Sect. 3 followed by concluding remarks and future work in
Sect. 4.
2 Literature Review
2.1 Software Quality Assessment Based on Fuzzy Logic
Mittal Harish et al. “Software Quality Assessment Based on Fuzzy Logic Technique”,
[5]. Provides fuzzy logic based precise approach to quantify quality of software
modules on the basis of inspection rate and error density. TFNs were used to represent
inspection rate and error density of the software. Software modules are given quality
grades using fuzzy logic.
2.2 Deriving Quality Metris for Cloud Computing Systems
Matthias Beker, Sebastian Lehrig, Steffen Becker, proposed “Systematically

Deriving Quality Metrics for Cloud Computing Systems” [1], 2015. They derived
and classified metrics according the goal question in a top-down fashion by defining
the goal to analyze cloud systems and questions that help achieving goals.
2.3 Dynamic Round Robin (DRR)
Lin et al. [3] proposed for energy-aware virtual machine scheduling and consolida-
tion. They analyzed the problem of power consumption problems in data centers.
DRR reduce a significant amount of power consumption. Performance Parameters
considered Throughput, Overhead, Fault tolerance, Migration time, and Resource
Utilization.
2.4 Load Balancing in Cloud Computing
Power-Based Load Balancing for Cloud Computing PALB. Galloway et al. [2]
presented a load balancing approach to laaS cloud Architecture. The approach main-
tains the state and decides the number of compute nodes that should be operating.
Fuzzy Logic Technique for Evaluation of Performance … 109
They considered Throughput, Overhead, Fault tolerance, Migration time, Response

Time, and Resource utilization.
Max–Min Task Scheduling Algorithm for Load Balance [4], Mao et al. (2014)
in Cloud Computing is required to distribute the dynamic local workload evenly
across all the nodes to achieve high user satisfaction and resource utilization. Perfor-
mance Parameters Throughput, Overhead, Response Time, and Resource utilization
were studied.
Mishra et al. [19] described various load balancing techniques in homoge-
neous and heterogeneous cloud computing environments. A system architecture,
with distinct models for the host, VM is described. They proposed taxonomy for
the load balancing algorithm in the cloud environment. To analyze the performance
of heuristic-based algorithms, simulation is carried out in CloudSim simulator.
Afzal and Kavitha [20] presents a comparative study on load balancing
approaches. They framed a set of problem-related questions and discussed them
in the work. The data collected for this study had been gathered from five potential
databases. A multilevel taxonomy-based classification was proposed by considering
five criteria. The study revealed that task scheduling is important in both proactive
and reactive approaches.
2.5 Quality Metrics
Table 1 illustrates Scalability Metrics, Elasticity Metrics, and Efficiency Metrics.
Table 1 Quality metrics

Metric Unit Example
Scalability metrics Scalability Range (ScR) Max The system scales upto 100
req./min
Scalability Speed (ScS) Max, rate The system scales upto 100
req./min, with linear
increase rate 1 req/month
Elasticity metrics Number of Service Level 1/time unit 40 SLO violations/hour
Objectives (SLO) violations
(NSLOV)
Mean time to Quality repair Time unit 30 s for an additional 10
(MTTQR) requests/hour
Efficiency metrics Resource Provisioning [0,∞] 5 more resources than
Efficiency (RPE) actual resource demand
Marginal Cost (MC) Monetary unit $2 for an additional 100
requests/hour
110 Divya et al.
3 Proposed Model for the Evaluation and Comparison

of Load Balancing Algorithms
Load Balancing is reassigning the total load to the individual lodes of the collec-
tive system that facilitates networks to provide maximum throughput with minimum
response time. Load Balancing Algorithms are of two types static and dynamic.
Static algorithm divides the load equally on servers and is called round-robin algo-
rithm, while dynamic algorithm uses weights on servers. Static algorithm creates
imbalanced traffic while dynamic algorithm tries to balance the traffic.
In 2019 Afzal and Kavihta, Journal of Cloud Computing Advances Systems and
Applications, investigated that in existing literature there are 16 major Metric in Load
Balancing, which are given in Table 2.
In order to evaluate performance of load balancing algorithms, one must first
identify performance parameters/Metrics that strongly influence the performance.
Such metrics are
• Throughput-High throughput is necessary for overall system performance.
Generally, it is measured in MB/s.
• Overhead—It should be low.
• Fault Tolerance—It should be high.
• Response Time—is the time interval between sending a request and receiving its
response. It should be low. It is measured in ms.
Table 2 Metrics in load

S. no. Metric Contribution%
balancing
1 Throughput 7.87
2 Overhead 7.09
3 Migration time 3.93
4 Response time 13.39
5 Execution times 11.81
6 Resource utilization 11.02
7 Scalability 9.45
8 Waiting time 2.36
9 Execution cost 8.66
10 Makespan 9.45
11 Degree of balance 4.72
12 Power consumption 3.14
13 Service level violation 0.78
14 Task rejection ratio 1.50
15 Fault tolerance 4.72
16 Migration cost 0.11
others Respons Time
Migration
Time
Fault Execution
Tolerance Time
Overhead
resource
utilization
Throughput
Execution Cost Scalability

Makespan
Fig. 1 Metrics that strongly influence the performance of Load Balancing Algorithms
• Resource Utilization—is the proper utilization of the resources. It should be

high. It is usually measured in milliseconds (ms).
• Scalability—is the ability to perform uniform load balancing. It should be high.
• Migration Time—is the time required in migrating the jobs or resources from
one node to another. It should be low (Fig. 1).
Assumption: Number of concurrent users should be the same for each Algorithm
The metrics are of two types—Metric for which performance increases with increase
in the value of metric e.g., throughput, fault tolerance, resource utilization, scalability,
and metric for which performance decreases with decrease in the value of the metric
e.g., response time, migration time, and overhead. We take the metrics as Triangular
Fuzzy Number (a, m, b) and suppose that m divides the line joining the points a and
b in the ratio 1:1, so that
a+b b−a b−a

m= F= =
2 2m b+a
For b > a

m−x b−x
µ(x) = =0, x ≤ a = ,a ≤ x ≤ m = , m ≤ x ≤ b = 0, x ≥ b
m−a b−m
(1)
For b < a
112 Divya et al.

x −m x −b
µ(x) = =0, x ≥ a = ,a ≤ x ≤ m = , m ≤ x ≤ b = 0, x ≤ b
a−m m−b
(2)
Fuzzification
(a) For metric whose performance is directly proportional to performance (Table
3)
where, a, b, c, d, w1 , w2 , w3 , and w4 are real constants, w1 < w2 < w3 < w4 .

A value of x may have two membership functions. For a+b 2
≤ x ≤ b, it has
membership function µ as low and 1 − µ for medium. For b ≤ x ≤ b+c 2
, it has
membership function µ as medium and 1 − µ for low (Fig. 2).
(b) For metric whose performance is indirectly proportional to performance (Table

4).
where a, b, c, d, w1 , w2 , w3 , and w4 are real constants and w1 < w2 < w3 < w4

(Fig. 3).
Table 3 Linguistic Variables

Information interval Linguistic variable Weights
for Metric for which
performance is directly [a, b] Low w1
proportional to the value of [b, c] Medium w2
metric
[c, d] High w3
[d,∞] Very high w4
μ(x)
Low Medium High
1
w1 w2 w3 w4
0 a a+b/2 b b+c/2 c c+d/2 d x
Fig. 2 TFNs when performance is directly proportional to the value of the metric
Table 4 Linguistic Variables

Information interval Linguistic variable Weights
for Metric for which
performance is indirectly [0, d] Very high w4
proportional to the value of [d, c] High w3
metric
[c, b] Medium w2
[b, a] Low w1
μ(x) V.High High Medium Low

1
w4 w3 w2 w1
0 d c+d/2 x c b+c/2 b a+b/2 a x
Fig. 3 TFNs when performance is indirectly proportional to the value of the metric
A value of x may have two membership functions. For a+b

2
≥ x ≥ b, it has
membership function µ as high and 1 − µ for medium. For b ≥ x ≥ b+c
2
, it has
membership function µ as medium and 1 − µ for high.
Defuzzification
After evaluating membership for the value of metric, find its contribution in the
performance as marks for this metric, using the following rules.
Equation 3 for Metric for which performance increases with increase in the value
⎧
⎪ µi
⎪
⎪
∗ w1 , a ≥ x ≥ a+b
2
⎪
⎪ µi ∗ w1 + (1 − µi ) ∗ w2 , a+b ≥x ≥b
⎪
⎪
⎪
⎪
2
⎨ µi ∗ w2 + (1 − µi ) ∗ w1 , b ≥ x ≥ b+c
2
m = µi ∗ w2 + (1 − µi ) ∗ w3 , b+c ≥x ≥c (3)
⎪
⎪
2
⎪ µi
⎪ ∗ w3 + (1 − µi ) ∗ w2 , c ≥ x ≥ c+d
⎪
⎪ 2
⎪
⎪ µi ∗ w3 + (1 − µi ) ∗ w4 , c+d ≥x ≥d
⎪
⎩ 2
µi ∗ w4 , x <d
Equation 4 for Metric for which performance decreases with increase in the value.
⎧
⎪
⎪ µi ∗ w1 , a ≥ x ≥ a+b
⎪
⎪
2
⎪
⎪ µ ∗ w1 + (1 − µi ) ∗ w2 , a+b ≥x ≥b
⎪
⎪µ
i 2
⎪
⎨ i ∗ w2 + (1 − µi ) ∗ w1 , b ≥ x ≥ b+c
2
m i = µi ∗ w2 + (1 − µi ) ∗ w3 , b+c ≥x ≥c (4)
⎪
⎪
2
⎪
⎪ µi ∗ w3 + (1 − µi ) ∗ w2 , c ≥ x ≥ c+d
⎪
⎪ 2
⎪
⎪ µi ∗ w3 + (1 − µi ) ∗ w4 , c+d ≥x ≥d
⎪
⎩ 2
µi ∗ w4 , x <d
If we take w1 = 10, w2 = 20, w3 = 40, w4 = 50, Mi are marks out of 50.

Let Total Marks is Sum of marks of all the metrics (taking MAX value as 100).
Then Grade of Algorithm is calculated as (Table 5).
114 Divya et al.
Table 5 Classification of
Total marks (100) Grade
grades
0 ≤ M total < 5 1
5 ≤ M total < 10 2
10 ≤ M total < 20 3
20 ≤ M total < 30 4
30 ≤ M total < 40 5
40 ≤ M total < 50 6
50 ≤ M total < 60 7
60 ≤ M total < 70 8
70 ≤ M total < 80 9
M total ≥ 80 10
Table 6 Values of
Algorithm Response time in ms Throughput in MB/s
throughput and response time
of various algorithms A 2600 17
B 1700 26
C 800 37
D 2700 38
E 2650 27
F 1800 44
G 850 18
H 3400 17
Table 7 Weights for

Throughput in MB/s Complexity Weights
throughput
[15,25] Low 10
[25,35] Medium 20
[35,45] High 40
[45,∞] Very high 50
Illustrative Example: We take a simple case by taking into consideration only

four metrics.
Inputs: Throughput, Response time, Migration Time and Overhead. But the result
can be extended to any desired number of Metrics.
Output: Grade of Algorithm.
The values of throughput and response time of various algorithms are given in
Table 6.
Fuzzification
Taking, n = no. of concurrent users, Complex Matrix for Throughput (Table 7 and
Fig. 4).
⎧
⎪
⎪ µthr ∗ 10, 15 ≤ x ≤ 20
⎪
⎪
⎪
⎪ µthr ∗ 10 + (1 − µthr ) ∗ 20, 20 ≤ x ≤ 25
⎪
⎪
⎪
⎨ µthr ∗ 20 + (1 − µthr ) ∗ 10, 25 ≤ x ≤ 30
Mthr = µthr ∗ 20 + (1 − µthr ) ∗ 40, 30 ≤ x ≤ 35 (5)
⎪
⎪
⎪ µthr ∗ 40 + (1 − µthr ) ∗ 20,
⎪ 35 ≤ x ≤ 40
⎪
⎪
⎪
⎪ µthr ∗ 40 + (1 − µthr ) ∗ 50, 40 ≤ x ≤ 45
⎪
⎩
µthr ∗ 50, x > 45
Value of weights for low, medium and high, and very high are 10, 20, 40, and 50,
respectively. The calculated values of µthr are given in Table 8
μ(x)
Low 10 Medium 20 High 40 V.High 50
0 15 25 35 45 x
Fig. 4 TFNs for throughput
Table 8 Calculated values of marks for throughput

Algorithm Throughput in MB/s µthr 1 − µthr Marks out of 50
A 17 0.4 0.6 4
B 26 0.2 0.8 12
C 37 0.4 0.6 28
D 38 0.6 0.4 32
E 27 0.4 0.6 14
F 44 0.2 0.8 48
G 18 0.6 0.4 6
H 17 0.4 0.6 4
116 Divya et al.
Response Time
⎧
⎪
⎪ µres ∗ 10, 3500 ≥ x ≥ 3000
⎪
⎪
⎪
⎪ µres ∗ 10 + (1 − µres ) ∗ 20, 3000 ≥ x ≥ 2500
⎪
⎪
⎪
⎨ µres ∗ 20 + (1 − µres ) ∗ 10, 2500 ≥ x ≥ 2000
Mres = µres ∗ 20 + (1 − µres ) ∗ 40, 2000 ≥ x ≥ 1500 (6)
⎪
⎪
⎪
⎪ µres ∗ 40 + (1 − µres ) ∗ 20, 1500 ≥ x ≥ 1000
⎪
⎪
⎪
⎪ µres ∗ 40 + (1 − µres ) ∗ 50, 1000 ≥ x ≥ 500
⎪
⎩
µres ∗ 50, x < 500
Value of weights for high, medium and low and very low are 10, 20, 40, and 50,
respectively (Table 9). The calculated values of µres are given in Table 10 (Fig. 5).
Table 9 Calculated values of marks of response time

Algorithm Response time (ms) µres 1 − µres M res (Out of 50)
A 2600 0.2 0.8 18
B 1700 0.4 0.6 32
C 800 0.6 0.4 44
D 2700 0.4 0.6 16
E 2650 0.3 0.7 17
F 1800 0.6 0.4 28
G 850 0.7 0.3 43
H 3400 0.2 0.8 2
Table 10 Calculated values of marks of migration time

Algorithm Migration time in ms µmgr 1 − µmr M mgr (Marks are out of 50)
A 2400 0.2 0.8 12
B 1600 0.2 0.8 36
C 900 0.2 0.8 48
D 2900 0.2 0.8 18
E 2850 0.7 0.3 13
F 3400 0.2 0.8 2
G 550 0.1 0.9 49
H 3300 0.4 0.6 4
μ(x) Very Low Low Medium High

1
50 40 20 10
0 500 1500 2500 3500 x
Fig. 5 TFNs representing response time using Fig. 3
⎧
⎪
⎪ µmig ∗ 10, 3500 ≥ x ≥ 3000
⎪
⎪
⎪
⎪ µmig ∗ 10 + 1 − µmig ∗ 20, 3000 ≥ x ≥ 2500
⎪
⎪
⎪
⎨ µmig ∗ 20 + 1 − µmig ∗ 10, 2500 ≥ x ≥ 2000
Mmgr = µmig ∗ 20 + 1 − µmig ∗ 40, 2000 ≥ x ≥ 1500 (7)
⎪
⎪
⎪
⎪ µmig ∗ 40 + 1 − µmig ∗ 20, 1500 ≥ x ≥ 1000
⎪
⎪
⎪
⎪ µmig ∗ 40 + 1 − µmig ∗ 50, 1000 ≥ x ≥ 500
⎪
⎩
µmig ∗ 50, x < 500
⎧
⎪ µovr ∗ 10,
⎪
⎪
10 ≥ x ≥ 9
⎪
⎪ µovr ∗ 10 + (1 − µovr ) ∗ 20, 9≥x ≥8
⎪
⎪
⎪
⎪
⎨ µovr ∗ 20 + (1 − µovr ) ∗ 10, 8≥x ≥7
Movr = µovr ∗ 20 + (1 − µovr ) ∗ 40, 7≥x ≥6 (8)
⎪
⎪
⎪ µovr ∗ 40 + (1 − µovr ) ∗ 20,
⎪ 6≥x ≥5
⎪
⎪
⎪
⎪ µovr ∗ 40 + (1 − µovr ) ∗ 50, 5≥x ≥4
⎪
⎩
µovr ∗ 50, x <4
Value of weights for high, medium and low, and very low are taken 10, 20, 40,
and 50, respectively. The calculated values of µovr are given in Table 11
Grades of Algorithms are calculated in Table 12 using Tables 8, 9, 10 and 11
(Fig. 6).
4 Conclusion and Future Work
Analysis of prevalent load balancing algorithms in cloud computing is done using

various parameters like throughput, resource utilization, response time etc., To
compare the existing algorithms in a much better way and to compare their perfor-
mance, a Fuzzy Logic Technique based Model is proposed. The Model is explained
by a suitable Numerical by taking 4 metrics Throughput, Response Time, Migration
118 Divya et al.
Table 11 Calculations for overhead

Algorithm Overhead in million Rs µovr 1 − µovr M ovr (Marks are out of 50)
A 7.5 0.5 0.5 15
B 6.5 0.5 0.5 30
C 4.5 0.5 0.5 45
D 8.5 0.5 0.5 15
E 8.50 0.5 0.5 15
F 9.5 0.5 0.5 5
G 4.5 0.5 0.5 45
H 9.5 0.5 0.5 5
Table 12 Grades of algorithms

Algorithm M res M thr M mgr M ovr Total marks (100) Grade
Out of 50
A 18 4 12 15 24.5 4
B 32 12 36 30 55 7
C 44 28 48 45 82.5 9
D 16 32 18 15 41 5
E 17 14 13 15 29.5 4
F 28 48 2 5 41.5 6
G 43 6 49 45 71.5 9
H 2 4 4 5 7.5 2
Fig. 6 Comparison of 10
performance of various
algorithms 8
0
Time and Overhead. In future experimental study of the existing realistic algorithms
can be done using this model so that gradation of prevalent algorithms may be done
in terms of their performance on the basis of desired metrics. Present MCC Architec-
tures are not up to the mark for the present requirements. There is an immense need
to tackle the issues of the MCC environment. There is vast scope for this study in
the fast-emerging field of Healthcare Monitoring. Fuzzy logic has vast capabilities
to address the challenges; hence effort is to evolve fuzzy-based Models.
References
1. Becker, M., Lehrig, S., Becker, S.: Systematically deriving quality metrics for cloud computing
systems. In: Proceedings of the 6th ACM/SPEC international conference on performance
engineering, pp. 169–174 (2015)
2. Galloway, J.M., Smith, K.L., Vrbsky, S.S.: Power aware load balancing for cloud computing.
In: Proceedings of the World Congress on Engineering and Computer Science, vol. 1, pp. 19–21
(2011)
3. Lin, C.C., Liu, P., Wu, J.J.: Energy aware virtual machine dynamic provision and scheduling for
cloud computing. In: 2011 IEEE International Conference on Cloud Computing, pp. 736–737.
IEEE (2011)
4. Mao, Y., Chen, X., Li, X.: Max–Min task scheduling algorithm for load balance in cloud
computing, pp. 457–465
5. Harish, M., Pardeep, B., Puneet, G.: Software quality assessment based on fuzzy logic
technique. Int. J. Soft Comput. Appl. (3), 105-112 (2008). ISSN: 1453-2277
6. Fernando, N., Loke, S.W., Rahayu, W.: Mobile cloud computing: a survey. Future Generat.
Comput. Syst. 29(1), 84–106 (2013)
7. Jia, W., Zhu, H., Cao, Z., Wei, L., Lin, X.: SDSM: a secure data service mechanism in
mobile cloud computing. In: Proceedings of IEEE Conference on Computer Communications
Workshops (INFOCOM), pp. 1060–1065 (2011)
8. Kosta, S., Aucinas, A., Hui, P., Mortier, R., Zhang, X.: Unleashing the power of mobile cloud
computing using Thinkair, pp. 1–17. CoRR abs/1105.3232 (2011)
9. Liang, H., Huang, D., Cai, L.X., Shen, X., Peng, D.: Resource allocation for security services in
mobile cloud computing. In: Proceedings of IEEE Conference on Computer Communications
Workshops (INFOCOM), pp. 191–195 (2011)
10. Naz, S.N., Abbas, S., et al.: Efficient load balancing in cloud computing using multi-layered
Mamdani fuzzy inference expert system. (IJACSA) Int. J. Adv. Comput. Sci. Appl. 10(3) (2019)
11. Ragmani, A, et al.: An improved Hybrid Fuzzy-Ant Colony Algorithm applied to load balancing
in cloud computing environment. In: The 10th International Conference on Ambient Systems,
Networks and Technologies (ANT) April 29–May 2, LEUVEN, Belgium (2019)
12. Shiraz, M., Gani, A., Khokhar, R., Buyya, R.: A review on distributed application processing
frameworks in smart mobile devices for mobile cloud computing. IEEE Commun. Surv.
Tutorials 15(3), 1294–1313 (2013)
13. Sanaei, Z., Abolfazli, S., Gani, A., Buyya, R.: Heterogeneity in mobile cloud computing:
taxonomy and open challenges. IEEE Commun. Surv. Tutorials 16(1), 369–392 (2014)
14. Sethi, S, et al.: Efficient load Balancing in Cloud Computing using Fuzzy Logic. IOSR J. Eng.
(IOSRJEN) 2(7), pp. 65–71 (2012). ISSN: 2250-3021
15. Zadeh, L.A.: From computing with numbers to computing with words-from manipulation of
measurements to manipulation of perceptions. Int. J. Appl. Math. Comput. Sci. 12(3), 307–324
(2002)
16. Zadeh, L.A.: Fuzzy sets. Inf. Control 8, 338–353 (1965)
120 Divya et al.
17. Zadeh., L.A.: The concept of a linguistic variable and its applications to approximate
reasoning—part I. Inf. Sci. 8, 199–249 (1975)
18. Zhou, B., Dastjerdi, A.V., Calheiros, R.N., Srirama, S.N., Buyya, R.: A context sensitive
offloading scheme for mobile cloud computing service. In: Proceedings of the IEEE 8th
International Conference on Cloud Computing (CLOUD), pp. 869–876 (2015)
19. Mishra, S.K., Sahoo, B., Parida, P.P.: Load balancing in cloud computing: a big picture. J. King
Saud Univ. Comput. Inf. Sci. 32.2, 149–158 (2020)
20. Afzal, S., Kavitha, G.: Load balancing in cloud computing—a hierarchical taxonomical
classification. J. Cloud Comput. 8.1, 22 (2019)
Impact of Bio-inspired Algorithms
to Predict Heart Diseases
N. Sree Sandhya and G. N. Beena Bethel
Abstract Optimization techniques are employed to deal with dynamic, difficult,

and robust problems. Most of the Machine learning algorithms are implemented to
predict heart diseases. Classification techniques are one of the methods that is highly
used in machine learning for prediction. Some classification methods predict accu-
racy with acceptable range, but others may not. In this paper, we streamline two
different bio inspired algorithms, Ant and Bat are used for heart disease prediction.
Here, we extracting the key features from heart disease attributes using these two bio-
inspired algorithms. Then these extracted features are implemented to the different
classifiers. In this research, we examine the bio inspired algorithms optimized with
Random Forest and SVM classifiers and compared the results. Ant colony opti-
mization and Bat colony optimization give better results with SVM classifier than
Random Forest classifier. When comparing the results in this research, Bat algorithm
is better-optimized algorithm than ant algorithm.
1 Introduction
Most of the people in the world are suffering from heart diseases, which leads to death
frequently. According to mortality statistics, it is proven that the main origin of death
in the world is because of heart diseases. As per WHO (World Health Organization)
four out of 5 cardiovascular diseases (CVD) deaths are due to heart strokes and
heart attacks [1]. Heart plays a major role in functioning of our body and it is a
very important organ. It pumps blood throughout the body. Whenever heart disease
occurs, all the functionalities of heart is not properly worked. So, it is important to
predict heart diseases with an intelligent approach for better results. In this research,
we implemented smart optimization algorithms like bio inspired algorithms for heart
disease prediction.
Bio inspired algorithms are nature-inspired algorithms developed to resolve
complex complications. With huge data, it became more challenging to provide
N. Sree Sandhya (B) · G. N. Beena Bethel

CSE Department, GRIET, Hyderabad, Telangana, India
https://doi.org/10.1007/978-981-16-1502-3_13
122 N. Sree Sandhya and G. N. Beena Bethel
optimum solution [2]. At these times, bio inspired algorithms are recognized to
solve complex problems with the novel approaches. The objective of this paper is to
enhance the attributes of dataset for better prediction. By extracting the features of bio
inspired algorithms, the attribute class labels are analyzed for further process. These
class label values are generated by considering the remaining attribute values with
the extracted bio inspired algorithm features. Then respective classifier is applied on
this dataset for predicting the accuracy.
2 Related Work
In healthcare, the patient’s data is increasing day-by-day with extra medical informa-
tion. To predict any disease, it is important to collect related information of various
scenarios of patient’s data. Different techniques and tools are depending on this
data for prediction of a disease. The key aim of this paper is to analyze the patient’s
records and extract the main features and implementing the bio inspired algorithms to
predict the heart disease. Kora and Ramakrishna [3] presented a method for predicting
myocardial infarction based on the changes in ECG signals. Myocardial infarction
is predicted by using the proposed method called improved bat algorithm. But for
implementation of improved bat algorithm they just taken 13 patient records. Out
of 13, 7 are myocardial infarction patients records and remaining 6 are normal indi-
vidual records. Four methods like Support Vector Machine, K-Nearest Neighbors,
Levenberg–Marquardt Neural Network, and Conjugate Gradient Neural Network
are implemented in both normal bat and improved bat algorithms. They concluded
that improved bat algorithm gives better results when compared with normal bat
algorithm.
Dubey et al. [4] diagnosed heart diseases in the early stage by combining the Ant
optimization algorithm with data mining techniques (DMACO). They considered the
pheromone value of ant and recognized the risk level. Whenever pheromone value
increases the risk also increases. Then Ant algorithm with data mining techniques
are applied to generate the detection rate of the heart disease and concluded that
DMACO develops the pheromone intensity and improves the detection rate of the
disease.
From the above-discussed works, it is clear that all the techniques used for heart
disease prediction are hybrid classification methods. But the work in this research
is different from the above-discussed works in a way that, here we implemented
two different optimization techniques with two different classifiers. In this study, we
analyze the efficiency by combining optimization techniques with classifiers.
Impact of Bio-inspired Algorithms to Predict Heart Diseases 123
3 Methodology
The system architecture used in this research for predicting the heart disease is shown
in Fig. 1.
Here, Heart data means dataset which contains related data of heart disease
patients. Heart Disease Dataset used in this research is taken from UCI Machine
Learning Repository. UCI Repository contains different datasets from different
domains. David Aha was developed this UCI repository by in 1987 [5]. In this
research, we used Cleveland (Cleveland clinic Foundation) data, which contains 303
instances with 76 raw attributes. Out of 76, we used only 14 attribute values. Out of
14, the last value is the predicted attribute based on these 13 attribute values. We are
considering the Cleveland dataset because it has less amount of missing data.
3.1 Optimization Techniques
3.1.1 Ant Colony Optimization
Marco Dorgio was presented Ant Algorithm in 1992. This Ant algorithm was
designed based on the real ants’ inspiration. It is highly used to resolve complex
difficulties. Ant algorithm finds optimal solution by performing iterations [6]. The
main goal is to select the finest features with lowest redundancy.
Let us assume ‘m’ ants develop solutions from a finite set of components ‘C’.
Consider an empty solution sx = φ, at each iteration it is extended by adding new
possible solution from the set of neighbors N(sx ) ⊆ C. The path of the graph can
be designed by constructing these partial solutions [7]. At construction step, these
solution components are formed by using probabilistic approach. Then

β
Tiαj · η i j
P C|s x = β (1)
C ∈ N (S x ) Tiαj · ηi j
Fig. 1 Architecture
where C = {cij }, i = 1, 2, 3, …, m and j = 1, 2, 3, …, n; and ∀cij N (S x ).

T ij is a pheromone value and ηi j is heuristic value. Both T ij and ηi j are accom-
panying with the component cij . α and β are determining pheromone and heuristic
information and these are real positive parameters. By using this probability rule ants
are constructing solutions is called a tour [8]. To find the best solutions, we have to
update the pheromone values. Here we are gathering good solutions associated with
pheromones and avoid bad ones. This is achieved through pheromone evaporation.

Ti js ← (1 − ρ) · Ti j + ρ · F(s) (2)
s ∈ S|ci j ∈ s
where S is the solutions used for update, ρ is evaporation rate and it lies between (0,
1], F(s) is fitness function and F:S → R+ is a function then f (s) < f (sc ) ⇒ F(s) ≥
F(sc ), ∀ s
= sc ∈ S.
The algorithm is as follows:
Ant Algorithm
Step 1 create the initial parameters like N nodes and M arcs. Then constant amount
of pheromone is assigned to all arcs.
Step 2 Ant k uses the pheromone trail at node i to compute the next node j by using
probabilistic approach. It is calculated using (1).
Step 3 When ants are traversed in between the arc (i, j) the pheromone value is
updated, which are called local trails. These changes are done using the
following equation.
Tij ← Tij + Tk
Step 4 When ant k moved to the next node, the pheromone evaporation is done
using the following equation.
Tij ← (1 − ρ) · Tij , ∀(i, j) ∈ A
Step 5 Repeat step 2 until ant target point reached. This is called iteration cycle
and it involves ant’s movements, pheromone evaporation and deposits.
Step 6 Whenever ants reach the target, they will update the pheromone using global
trails and finds the optimal solution. These global trails are done using (2)
Step 7 This process repeats until termination condition is satisfied. If so, it will
generate the output otherwise repeat above steps once again.
Step 8 End.
3.1.2 Bat Colony Optimization Algorithm
In 2010, Xin-She Yang developed bat algorithm. It is developed based on the behavior
of micro bats communication [9] using echolocation. Generally, bats using echo-
based location to search food and travel from one place to another. During this
search of food bats, change their velocity, frequency, and sound accordingly. The bat
algorithm is presented as follows.
Bat Algorithm
Step 1 Define the objective function or fitness function of a bat.
Step 2 Initialize the bat parameters like frequency (fi), Loudness (A) and pulse
emission rate (ri).
Step 3 Randomly generate the bat population.
Step 4 Sort the current population values (preferably in descending order).
Step 5 Generate new frequency, velocity and position values using (3), (4), (5)
respectively until maximum iteration criteria is done.
Step 6 Generate the best solution as a local solution in step 5.
Step 7 New solutions should be stored in a resource log.
Step 8 Update the values of loudness and pulse emission rate using the (6) and
(7).
Step 9 Fitness of new solution is tested w.r.t. A and r then rank the bats and find
the current best position.
Step 10 Repeat the process until termination criteria is satisfied.
Step 11 End.
Bats fly randomly with the velocity vi at position x i with different frequency
ranges f [min, max], varying wavelength λ and loudness A0 to search for prey. The
wavelength is adjusted automatically and pulse emission rate can be varied in between
[0,1] and it depends on the target of proximity. Loudness value lies between [A0 ,
Amin ]. Here the bat is randomly assigned the frequency between [f min , f max ], hence
it is called frequency-tuning algorithm. Each bat is associated with velocity vi t and
position x i t in search space at each iteration t, with respect to assigned frequency
f i . Hence at each iteration, we need to update f i , vi and x i and along with these
parameters loudness and pulse emission rate also be updated. To do this, we use the
following equations
f i = f min + ( f max − f min )β (3)

vit = vit−1 + xit−1 − x ∗ f i (4)
xit = xit−1 + vit (5)
Ai (t + 1) = α Ai (t) (6)

ri (t + 1) = ri 0 1 − e−γ t (7)
where f i is the existing frequency, vit is the existing velocity and X i is the existing
position. Ai is the loudness and r i is the pulse emission rate.
vit − 1 is the previous velocity, xit − 1 is the previous position.
α, β are random values and lies between [0,1] and 7 is a constant value and 7 > 0.
x* is the present best position.
3.2 Classification
Heart Disease Prediction can be perceived as a clustering problem or classification

problem [10]. In contrast, we have a tendency to fashioned a model on the immense
set of presence and absence data. So, we can turn it to classification once we extract
the features from the respective bio inspired algorithm. In this research, we comparing
the updated dataset using two classifiers namely random forest and support vector
machines.
4 Experiments and Results
Here, we confer the heart disease dataset researches and evaluations in python envi-
ronment. The objective of this project was to test which optimization technique
organizes the heart disease the best with a specific classifier. We use tenfold valida-
tion to evaluate the performance of classification methods for predicting the heart
disease. To avoid uneven operation consequences, each trial was run 10 times, and
the optimized classification accuracy was chosen for assessment. Then the accuracy
comparison of ant and bat algorithms with both the classifiers is as described in
Fig. 2.
From Fig. 2, it is observed that irrespective of the classifier the order of the
optimization algorithms which gives the best accuracy is Bat and Ant algorithms
respectively. When we compare these two algorithms in the view of feature extraction,
Fig. 2 Accuracy
comparison graph of Ant and
Bat algorithm using Random
Forest (RF) and SVM
classifiers
Ant algorithm takes the least priority and Bat Algorithm gives better results in both
the cases. In this research, With Random Forest classifier, Ant gives 70.96% and bat
algorithm gives 80.64% accuracy. With SVM Classifier, Ant gives 74.2% and Bat
algorithm gives 83.87%. Both the algorithms give better results with SVM classifier.
5 Conclusion and Future Scope
In this paper, we mainly focus the two bio inspired algorithms feature extraction
using two classifiers Random forest and SVM. Optimized SVM classifier gives better
results in each case than Optimized Random Forest classifier. Bat algorithm gives
better accuracy with both classifiers. So, we conclude that Bat algorithm is better
than Ant algorithm implemented in this research. Similarly, in the case of classi-
fiers it is also clear that SVM gives better prediction results than Random Forest.
Because both classifiers applied on same bio algorithm but classification results vary.
In Future works, there is a large scope for more bio algorithms with multiple classi-
fiers. Whenever we implement multiple classifiers on a single bio algorithm will give
better clarity of that respective feature extraction quality and increases the scope for
better results.
Reference
1. Khourdifi, Y., Bahaj, M.: Heart disease prediction and classification using Machine Learning
Algorithms Optimized by particle swarm optimization and Ant Colony Optimization. Int. J.
Intell. Eng. Syst. (2019)
2. Darwish, A.: Bio-inspired computing: algorithms review, deep analysis, and the scope of
applications. Future Comput. Inf. J. (2018)
3. Kora, P., Ramakrishna, K.S.: Improved Bat Algorithm for the detection of myocardial
infarction. Springer Plus 4(1), 666 (2015)
4. Dubey, A., Patel, R., Choure, K.: An efficient data mining and Ant Colony Optimization
Technique (DMACO) for heart disease prediction. Int. J. Adv. Technol. Eng. Explor. (IJATEE)
1(1), 1–6 (2014)
5. Dataset, UCI Machine learning Repository [online]; https://archive.ics.uci.edu/ml/datasets/
Heart+Disease
6. Rao, P., et al.: An efficient approach for detection of heart attack using Noble Ant Colony
Optimization concept of data. IJESRT (2018)
7. Dorigo, M.: Ant Colony optimization. Scholarpedia 2(3), 1461 (2007)
8. Nasiruddin, I., Ansari, A.Q., Katiyar, S.: Ant Colony Optimization: a tutorial review,
Conference Paper (2015)
9. Hinduja, R., Mettildha Mary, I., Ilakkiya, M., Kavya, S.: CAD diagnosis using PSO, BAT,
MLR and SVM. Int. J. Adv. Res. Ideas Innovations Technol. (2017)
10. Kotsiantis, S., Pintelas, P.E., Zaharakis, I.D.: Machine learning: a review of classification and
combining techniques. Artif. Intell. Rev. 26(3), 159–190 (2006)
Structured Data Extraction Using
Machine Learning from Image
of Unstructured Bills/Invoices
K. M. Yindumathi, Shilpa Shashikant Chaudhari, and R. Aparna
Abstract The identification and extraction of unstructured data have always been
one of the most difficult challenges of computer vision. Parsing this sort of large data is
very challenging; however, recent advancements in computer vision technology help
make this feasible. A ubiquitous commonplace item that many consumers receive is
difficult to be transformed into raw data. Receipts contain a dense amount of data
that can be useful for future analysis, but there exists no widely available solution for
transforming receipts into structured data. Existing solutions are either very costly or
inaccurate. This paper introduces a data pipeline for the identification, cropping, and
extraction of unstructured data within healthcare bills/invoice images. This pipeline
outperforms existing solutions by a large margin, and offers the ability to automati-
cally pull out semantic data such as description and unit price from an image of a bill.
It achieves this success by using Logistic Regression, KNeighbours, and OpenCV
Scikit to crop the image. Optical Character Recognition (OCR) is applied to detect
chunks of text and process the image. The accuracy observed is approximately 93%
for Logistic Regression and 81% for KNeighbours.
1 Introduction
Recent years have seen a growing interest in harnessing advances Machine Learning
(ML) and Optical Character Recognition (OCR) to translate physical and handwritten
documents into digital copies. It appears to be difficult to create digital documents
from scratch. Ultimately, a solution to get the simplicity of documents generation
K. M. Yindumathi (B) · S. S. Chaudhari · R. Aparna

Department of Computer Science and Engineering, M.S. Ramaiah Institute of Technology,
Bengaluru 560054, India
e-mail: kmyindumathi@gmail.com
S. S. Chaudhari
e-mail: shilpasc29@msrit.edu
R. Aparna
e-mail: aparna@msrit.edu
https://doi.org/10.1007/978-981-16-1502-3_14
130 K. M. Yindumathi et al.
while ensuring the ease of digital documents usage is today’s need. Identification of
text characters generally deals with the identification of optically formed characters
and is often called OCR. OCR’s simple concept is to turn any hand-written or typed
text into data files that can be interpreted and read by computer. Any document or
book can be scanned with OCR, and the editable text file can then be translated from
a computer. The OCR program has two main benefits which include the potential to
improve efficiency by successfully reducing staff participation and processing data.
Most broadly, the fields of implementation of this system are postal offices, banks,
publishing sector, government agencies, education, banking, health care.
The universal OCR system consists of three main steps which are image acquisi-
tion and preprocessing, feature extraction, and classification [1]. Image preprocessing
phase cleans up and enhances the image by noise removal, correction, binarization,
dilation, color adjustment and text segmentation, etc. Feature extraction is a tech-
nique for extracting and capturing certain pieces of information from data. In the
classification phase, the portion of the divided text in the document image will be
mapped to the equivalent textual representation. The original invoice image is initially
pre-processed by secondary rotation and edge cutting to eliminate the unnecessary
background information. The region of the critical information in the normal image
obtained is then derived by following the pattern, which is the focal point of the
recognition of the material. OCR is used to translate image information into text and
enable easy use of the interpreted content. The principle point is to analyze certain
ML algorithms and process text using categorization and classification.
In particular, this paper is interested in the processing of unstructured bill image
data and converting it into a simple-to-use, analyzable structured data format. It helps
to resolve some of the fundamental difficulties and inconsistencies associated with
parsing this sort of unstructured data. We use a combination of bill image datasets
and custom receipt data collected over the past few months by a small group of
people to train and evaluate the effectiveness of this system. Our aim is to be able
to process and parse receipt data from most standard use cases, which involves
steps such as correcting the input image orientation, cropping the receipt to remove
the background, running OCR to pull text from the image, and using algorithm to
determine relevant data from the OCR result. A good, satisfactory system handles
the above characteristics and further edge cases by pulling the description and unit
price from image inputs. The paper demonstrates how this result was achieved and
provides both a quantitative and qualitative evaluation with respect to the success of
this system.
2 Related Works
This section discusses related papers concerning the specific task of analyzing and
classifying receipt-data using machine learning. Researchers mostly focused on
developing techniques to improve the recognition and extraction of text from unstruc-
tured data whereas industry has focused on creating commercial systems to reduce
Structured Data Extraction Using Machine Learning … 131
manual labor costs for inputting receipt image data for analysis or reporting. However,
neither produces an optimal system due to degradations in either accuracy or cost.
One commonly used extraction mechanism for text detection is a Convolutional
Neural Network (CNN) [1, 2]. This class of OCR utilizes a Long Short Term Memory
(LSTM) to propose regions of interest where text may exist as well as a CNN to
determine the likelihood of text appearing at that location. These systems all provide
end-to-end for text identification—from localizing and recognizing text in images to
retrieving data within such text. Deep learning based method for bank serial number
recognition system consistently achieved state-of-the-art performance on bank serial
number text detection benchmarks [1]. Some research work has also been done
on graph neural networks to define the table structure for text extraction. Canny
edge detector for image data identification [3] is proposed for utilizing all kinds of
images, failed for handwritten bills. Table 1 presents summary of the text extraction
techniques in various fields along with experimentation.
3 Proposed Structured Data Extraction
This section describes the process leading up to classify and extract information from
receipts (typed bills and handwritten bills) using machine learning.
A text segmentation technique defines the first character in the line and then tries to
interpret the whole line according to the position of the first character, and in the case
of handwritten text, the flow is not within. And those characters aren’t remembered
well. If the picture includes an object that is not a bill or other rectangular piece of
paper or entity, the job then classifies the entity and recognizes it as the bill required
to retrieve the material. Further text analysis can be done to determine whether the
collected information is from a bill.
The process of structured data extraction from the unstructured image data of
the bill involves data pipeline that starts with collecting the receipts in the form of
unstructured image data, converting the receipts into image format, correcting the
image orientation, cropping the receipt to remove the background, running OCR
to pull text from the image, and training machine learning algorithms to determine
relevant data from the OCR result, writing a custom made algorithm to extract specific
fields of data from the receipts that we are interested in and finally evaluating the
classifiers performance. To eliminate the useless context information, the origin bill
image is preprocessed to get grayscale image for to accelerate the processing. The
image quality is calibrated to a better angle and view for easier retrieval of the
data. Next, the region of the necessary information in the normal image obtained
is extracted by matching the prototype, which is the center of identification of the
information. Recognized optical character is used through subsequent use of the
derived information to translate the image information into text. Initially, OpenCV
is used to detect bills from the image, and to remove unnecessary noise from the
image. Then, the Tesseract OCR engine is used to transfer intermediate images for
further processing. Tesseract tries to apply Segmentation of Text to catch written text
Table 1 Comparison of text extraction from bills

Paper Metrics Algorithm Results
[3] Convert binary text object OCR Extract all kinds of blur
into ASCII images
[2] Canny edge detector for Open CV, Tesseract OCR Extract all kinds of
image data identification images, failed for
handwritten bills
[1] Number and letter Tanimo to measure theory Rate of numeral
segmentation recognition 99% and
letter recognition 92%
[4] Detecting and filtering Definition evaluation Detect low-quality image
images with low quality algorithm based re-blur and screen out
undesirable image
[5] Secondary rotation, rotate OCR data is exerted as The accuracy of this
image, degree of rotation excel format method can be reached
upto 95.92%
[6] Various documents formats Combination of heuristic Best result with an
filtering and OCR average accuracy of 92%
[7] Block level image into Softmax CNN classifier Best result with an
individual characters accuracy of 99.92%
[8] Image accuracy for a OCR based CNN The accuracy rate is 95%
selected text region for taken at a distance of
10 km
[9] CNN to remove the visual Entity –aware mechanism The accuracy for model
portrayals, entity-aware for feature extraction and trained over real data is
network to decrypt EoIs LSTM as input about 95.8%
[10] Graph Neural Network to graphlet discovery Accuracy related to table
define the table structure algorithm detection is about 97%
[11] Denomination based Tesseract for text extraction Accuracy rate is 93.3%
K-means clustering framework
[12] Bounding box is designed OCR Accuracy after
for specific elements pre-processing is about
87.5%
[13] FCNN and LSTM for text Text detection Tesseract 4. Best result with an
classification 0 and EAST detector accuracy 83.3%
[14] Dense Nets and CTC for Area extraction- YOLOv3 Average accuracy of
text conversion recognition is about 0.96
[15] Entity extraction by OCR Arabic text is cursive
labelling Regexp patterns difficult to determine
accuracy
[16] BPN predict text or non-text OCR Recognition accuracy
area block wise 99.24%
[17] Column based character Text recognition with OCR Character recognition
segmentation accuracy 89% and table
recognition 98%
Bill/invoice identification
Data Image pre- Bill/invoice region Identification of
collection processing identification corners for region
Structured Data preparation using Data extraction Image

Machine learning algorithm using OCR cropping
Fig. 1 Data pipeline phases for extracting structured data from unstructured image data
in various fonts and languages. Figure 1 shows sequential phases of data pipeline for
extracting structured data from unstructured image data. Each step can be executed
in pipeline for multiple images as each phase can be independent.
Phase 0: Data collection: The data set we are using for this project is 40 healthcare
bills. Those receipts are divided into 2 major categories, normal health care bills and
covid health care bills. All the receipts are less than a year old. Healthcare bills are
the biggest major categories with amount of variance while covid related healthcare
bills are highest amount and hence the dataset have more mixed types of healthcare
bills. We made sure that the backdrop wasn’t too loud, and that the contrast between
the receipt was good. The receipts were guided more or less vertically, without
too much coercion than required. Nevertheless, most of the receipts were crumpled
during transportation so that they had folds and creases and some had also washed
out letters to make the job not so straightforward at all.
Phase 1: Pre-processing Image: We converted the images to grayscale that conve-
niently reduces the data by two-thirds and accelerates the subsequent processing
process. We have normalized global illumination by using an old image processing
trick to remove gradients of slow illumination: slow gradients lead to modulation
of image intensity at low frequencies, so filtering the image with a high-pass filter
render the global illumination clear. The filter is implemented effectively using the
discrete cosine transform (DCT): convert the image into frequency space, cancel
the low-frequency components and convert the image back into the space domain.
Usage of DCT instead of the discrete Fourier transform avoids dealing with complex
numbers.
Phase 2: Healthcare bills identification: The healthcare bills is usually a rectangular
piece of paper, defining the area using a quadrilateral with the four-vertex {p1, p2, p3,
p4}. The vertices are selected such that the polygon occupies as much of the receipt
as possible and as little of the background as possible. The preprocessed images is to
segment the image into pixels representing the receipt and those not. In particular, blur
the image to eliminate noise and add a 60% resolution level for initial segmentation.
There we apply binary closure to remove small false detections in the past and fill
flaws along the contour. Finally, it discards all but the largest blob in the image. The
process of bill identification is 6-step as follows. (1) Identify bill receipt based on
four-vertex polygon. (2) Convert image into grayscale using Gaussian blurring. (3)
Remove noise and set threshold with 60% resolution. (4) Extract the features from
the image using edge detection. (5) Measure the receipt end-points in the image. (6)
Outline the end-points with green blobs.
Phase 3: Corner Identification: Putting the vertices in the corners make the polygon
clip. The lower left corner has a very obtuse angle which gives an impression that
accurate corner detection cannot be as simple as internal angle calculation. In other
cases, the receipt may be distorted, rounded or even corners caused by an irregular
tear in odd locations. We depend on the receipt edges for a more robust solution. We
measure the receipt outlines from the foreground mask (using binary morphology)
and then apply a probabilistic transformation to get the start and end points of the
line segments into the image. Instead, we calculate the intersection of each pair of
horizontal and vertical segments (green blobs) to produce a list of corner candidates,
which we reduce with average change (red crosses) to more than a reasonable number.
We tried different methods of finding the receipts, each with varying success rates.
Phase 4: Cropping, de-skewing and enhance: Next steps are to strip it out of the
picture and boost the contrast of what is written on the receipt. Both are standard
image processing operations, and scikit-image provides transforming wrap using a
mapping of pixel input and pixel output positions to do them in one step. We simply
calculate the quadrilateral edge-lengths for the output shape and create a rectangle
with width and height equal to the full length of the segments top and bottom and
left and right, respectively. Gray thresholds and corresponding pixel filter, where we
have removed all blobs that crossed the boundary of the pixel in the right direction.
Threshold effectively suppresses many of the luminous variations while keeping the
text intact. Nevertheless, several characters, particularly the small ones, are hard to
distinguish in the binary image. Therefore by Gaussian blurring, we first feather
the mask out and replace it with the original image (receipt). It essentially protects
all hidden areas but with soft rather than sharp edges. The process of Cropping, de-
skewing and enhance is 5-step as follows. (1) Load the necessary XML classifiers and
load input images. (2) Image can be resized to 500 pixels, cropped, blurred, de-skew.
(3) Convert image into grayscale using Gaussian blurring. (4) Image segmentation
based on words, characters. (5) Extract the features from the image using edge
detection.
Phase 5: Extraction of Data: The most-free alternative is the Tesseract OCR engine.
We used pytesseract fundamental, which is a simple wrapper around Tesseract: call
image_to_string to transform the image to a single formatted string. Call image to
data for assured recognition and other useful information for individual fragments
of the text. The underlying OCR engine uses Long Short-Term Memories (LSTM)
network. Tesseract architecture includes adaptive thresholding to convert image into
binary images, component analysis to extract OCR image with a black background
and white text, line/word finding using contours and blobs, recognize words using
machine learning classifier two-pass process to extract text from image. We must
strip out detections of low trust and those that are simply too poor to be text for
performance boosting. The default output is in a tab separate values (TSV) format.
Pytesseract can automatically convert TSV into a data-frame using pandas. The
data extraction process is 5-step process as follows. (1)Apply Tesseract OCR for
image. (2) Differentiate word counters associated with image. (3) Differentiate letter
counters associated with word counter image. (4) Preprocess letter images and TSV
data is generated. (5) Consolidate associated data to text then to excel file as shown
in Fig. 2.
Phase 6: Data preparation: Until feeding the data into any algorithm, there are
several measures that need to be taken to prepare the data by transforming it in such
structured sample data set used into this method is described as seen in Fig. 3. The
vectorization and tokenization act is the principal steps of this process. We decided
to differentiate these modules and left it this way to other preparation phases to make
PPE KIT 45000

BED CHARGES 72500
DIETICIAN 300
DOCTOR FEES 45600
DRESSING 360
DRUG ADMINISTRATION
7384.5
ECG 330
LABORATORY 5384
.txt file
Input Image .excel File
Fig. 2 OCR processing of proposed system
Fig. 3 Dataset of healthcare bills

the testing and optimization as close as possible. We also tried to study whether
we could use machine learning to retrieve the receipt from different data points. In
this sense, when referring to a data point, it is assumed to be a particular form of
token which contains a value that varies between transactions, in our case the unit
price and definition. The token may contain different formatting or style in different
documents in our solution, the only constraint that is required is that it is a special
token that in most situations makes it ideal for extracting data points.
We used tools offered by scikit-learn libraries them to suit the classifiers’ specific
implementation advice. The process of extracting specific data points is very different
from classifying the receipts. We could not use the same algorithms or classifiers for
this task. We opted to use the following classification models for evaluation based on
that text extraction. (1) Logistic Regression and (2) Kneighbors Classifier. We then
continued with the best of those models for tuning and maximizing hyper-parameters
before progressing with a second round of benchmarking. Evaluation to be able to
achieve similar outcomes over different runs with the same random seed was used for
the data shuffling process when comparing different algorithms. The benchmarking
software was a basic python script that supplied the pipeline with a new classifier for
a round of checking against the data collection. The classifier was then replaced by
the next classifier, and it repeated the process.
To parse a given OCR output, words are first tokenized using sklearn libraries and
then keywords for each given category identified. Once each keyword is identified,
we ran a spatial search for all given text inputs nearest to the text input containing the
keyword for insightful information. For example, for parsing pricing data, keywords
such as “price”, “total”, “description” and “amount” are first identified from the
OCR output. For each given positive keywords match, a nearest-neighbor search
is conducted to look for text bounding boxes containing pricing information. The
keyword-price pair is selected for the bounding boxes that are furthest down on the
page. Once the unit-price and description information are found, this information is
returned as output and a plot containing the individual images generated during the
pipeline combined with the parsed information.
The extracted text data set is divided into a training set (80%) and a test set (20%).
Both sets are divided into two parts, one part containing the OCR extracted receipt
text and the other one containing the value for the data point referred to as the label.
The model has access to the labels during training to know what it is looking for
while the prediction function only has access to the document text. The labels for
the test data is instead used after the predictions have been made by the model to
compare against. The Fig. 3 is a graphical representation of the actual dataset.
4 Results Analysis
The development environment used for this project includes PYTHON version 3 as
language to develop the software in order to meet the project requirements. For the
initial development and exploration, we have used SPYDER as an IDE and then later
we have shifted to PYCHARM, which supports Python and makes the task comple-
tion ease. Various other libraries and pre-trained models used include Pytesseract,
numpy, imutils, cv2, pandas, sklearn, etc. These Programming algorithms have well
defined models that are trained with some samples to increase the accuracy of the
result. The result depends on the amount of training given to the model. The receipts
accuracy statistic is measured as the number of correct tokens divided by the overall
tokens count. The cumulative number of tokens in the record generated by the OCR
algorithm is the sum of tokens in it. This is because noise is seen incorrect tokens
generated by the OCR algorithm. The classification efficiency metric is the mean of
the product of carrying out a cross-validation test of three folds on the data collection.
While relating to the consistency of going forward algorithms it is the mean value of
this cross validity to which it applies. The accuracy increases by a small margin after
running the optimization test. The default values were found to be strongly efficient,
and accurately identified the gap in precision between the optimized algorithms. In
the case of KNeighbours, the variance area corresponds to the difference in time
being expressed in Fig. 4 against the Logistic Regression while Fig. 5 represents the
accuracy. The final results for the accuracy and time is presented in Table 2.
The final results for the accuracy and time is presented in Table 2.
With approximately 93% precision, we find this to be very fair though bearing
in mind the relatively limited data collection analyzed. With the assessed model,
subcategories which are much smaller subsets with less variation between categories
also have very high accuracy. There were several classifiers managed to score 81% or
more in the cross-validation test, which may mean that classifying receipts is a very
simple task that machine learning is very suitable to start with, particularly because
the optimization of the hyper parameter did not see any major improvements and
compared to the Kneighbors we outperformed them with great margins. We assume
these findings are very positive, but as these findings derive only from principle
solution verification, a wider analysis will be required to validate them.
Fig. 4 Algorithm validation

time
Fig. 5 Algorithms accuracy
Table 2 Algorithm accuracy

Algorithm Accuracy (%) Time (min)
and time
Logistic regression 93 24.3
KNeighbours 81 37.5
This is an experiment requiring estimation of a numerical value. Running the

python script describes the data set structure first, then matches the pattern and tests
it on the test dataset. Finally, on Logistic Regression we got 93% accuracy and on
KNeighbours 81% accuracy. This was achieved with a basic custom-made approach
that has tremendous room for development, and predicted to do even better with
more complex solutions. As such, we find these findings to be very positive and they
could require time and work to determine a more complicated approach.
5 Conclusion
The paper describes the analysis of different text extraction methodologies based on
Machine learning algorithms. The research is to separate the content from imprinted
invoice. The downside of the inspection is that, even though the picture consist a
document that is not a bill, a rectangular slip to paper or an object, the inspection will
recognize the object and find it to be necessary bill, the substance of which will be
deleted. The applied algorithm is Logistic Regression and the Kneighbours for the
extracted information to predict the accuracy. The sample images taken for imple-
mentation and the accuracy observed is approximately 93% for Logistic Regression
and 81% for KNeighbours. The effort is to make people understand their bills and to
bring about some level of transparency in the market. We think these results are very
promising, but as these results only stem from a proof of concept solution, a larger
study might be needed to verify them. The findings of this work indicate that there
are many ways to enhance the efficiency of automated processing of receipts. The
program will be successful in detecting bills that are mutilated because experiment
findings suggest that there are reasonably strong outcomes from local thresholding
techniques. The binarization methods require adaptation of the brightness. This trans-
lation is particularly necessary for the identification of characters. We need to analyze
the speed-up of goal character recognition.
Acknowledgements We are grateful to Vadivel Karuppannan and Shailesh Prabhu of VB Ideas

Private Limited, Bangalore for their assistance in problem formulation and periodic reviews.
References
1. Umam, A., Chuang, J.-H., Li, D.-L.: A Light Deep Learning Based Method for Bank Serial
Number Recognition (2018)
2. Rahmat, R.F., Gunawan, D., Faza, S., Haloho, N., Nababan, E.B.: Android-Based Text Recog-
nition on Receipt Bill for Tax Sampling System. Department of Information Technology,
Universitas Sumatera Utara, Medan, Indonesia (2018)
3. Sidhwa, H., Kulshrestha, S., Malhotra, S., Virmani, S.: Text extraction from bills and
invoices. In: International Conference on Advances in Computing, Communication Control
and Networking, pp. 564–568 (2018)
4. Mizan, C.M., Chakraborty, T., Karmakar, S.: Text recognition using image processing. Int. J.
Adv. Res. Comput. Sci. 8(5), 765–768 (2017)
5. Song, W., Deng, S.: Bank bill recognition based on an image processing. In: 2009 Third
International Conference on Genetic and Evolutionary Computing, pp. 569–573 (2009)
6. Jiang, F., Zhang, L.-J., Chen, H.: Automated image quality assessment for certificates and bills.
In: 1st International Conference on Cognitive Computing, pp. 1–5 (2017)
7. Sun, Y., Mao, X., Hong, S., Xu, W., Gui, G.: Template matching-based method for intelligent
invoice information identification. In: AI-Driven Big Data Processing: Theory, Methodology,
and Applications, vol. 7, pp. 28392–28401 (2019)
8. Holt, X., Chisholm, A.: Extracting structured data from invoices. In: Proceedings of
Australasian Language. Technology Association Workshop, pp. 53−59 (2018)
9. Guo, H., Qin, X., Liu, J., Han, J., Liu, J., Ding, E.: EATEN: Entity-aware Attention for Single
Shot Visual Text Extraction. Department of Computer Vision Technology (2019)
10. Riba, P., Dutta, A., Goldmann, L., Fornes, A., Ramos, O., Llados, J.: Table Detection in Invoice
Documents by Graph Neural Networks. Computer Vision Center (2018)
11. Abburu, V., Gupta, S., Rimitha, S.R., Mulimani, M., Koolagudi, S.G.: Currency recogni-
tion system using image processing. In: Tenth International Conference on Contemporary
Computing, pp. 10–12 (2017)
12. Raka, P., Agrwal, S., Kolhe, K., Karad, A., Pujeri, R.V., Thengade, A., Pujeri, U.: OCR to read
credit/debit card details to autofill forms on payment portals. Int. J. Res. Eng. Sci. Manag. 2(4),
478–481 (2019)
13. Kopeykina, L., Savchenko, A.V.: Automatic privacy detection in scanned document images
based on deep neural networks. In: International Russian Automation Conference (2019)
14. Meng, Y., Wang, R., Wang, J., Yang, J., Gui, G.: IRIS: smart phone aided intelligent reim-
bursement system using deep learning. In: College of Telecommunication and Information
Engineering, vol. 7, pp. 165635–165645 (2019)
15. Rahal, N., Tounsi, M., Benjlaiel, M., Alimi, A.M.: Information extraction from Arabic and
latin scanned invoices. In: IEEE 2nd International Workshop on Arabic and Derived Script
Analysis and Recognition, pp. 145–150. University of Sfax (2018)
16. Umam, A., Chuang, J.-H., Li, D.-L.: A Light Deep Learning Based Method for Bank Serial
Number Recognition. Department of Computer Science (2018)
17. Xu, L., Fan, W., Sun, J., Li, X.: A Knowledge-Based Table Recognition for Chinese Bank
Statement Images, pp. 3279–3283. Santoshi Naoi Fujitsu Research and Development Center,
Beijing (2016)
Parallel Enhanced Chaotic Model-Based
Integrity to Improve Security
and Privacy on HDFS
B. Madhuravani, N. Chandra Sekhar Reddy, and Boggula Lakshmi
Abstract This article presents how to provide security to large chunk of data. Data
be the crucial in all areas, is to be protected during storage and retrieval. The
large volumes of data called Big Data will be stored in HADOOP in HDFS file
systems. This research helps in understanding the Big Data and provides a model
which improves security and efficient storage of data onto HDFS. This paper uses
an enhanced Quadratic Chaotic Map in the process of generating keys to improve
integrity. The model is implemented in parallel manner to reduces time in the process
of verifying integrity. The model is implemented and tested with HADOOP Cluster
which improved security and minimized time.
1 Introduction
Data being fundamental in all areas be protective and manageable. As data is

increasing day by day with emerging trends Internet of Things IoT, it should be
processed and managed in efficient manner. The emerging technology in Computer
Science field, the Big Data manage data sets whose size is impractical and unimage-
able. The data can be in various forms like structure, semi-structure and un structure
(Fig. 1) [1].
1.1 Data-Information-Knowledge-Wisdom-Decision
(DIKWD) Pyramid
The computer systems are processing machines for data which accepts input, stores
data in disks, process and produces result in the form of output. The data can be of
different representations, which is given as DIKWD Pyramid (Fig. 2) [2].
B. Madhuravani (B) · N. Chandra Sekhar Reddy · B. Lakshmi

Department of Computer Science and Engineering, MLR Institute of Technology, Dundigal,
Hyderabad, Telangana, India
https://doi.org/10.1007/978-981-16-1502-3_15
142 B. Madhuravani et al.
Fig. 1 Types of data
Fig. 2 DIKWD pyramid
DATA
INFORMATI
ON
KNOWLEDGE
WISDOM
DECISION
Data is un-processed, un-organized and un-structured data. Which is available as

raw. Where information is processed and structured data. Knowledge is an infor-
mation gained through study and analysis. The experience and knowledge helps to
make wise decisions.
1.2 Big Data
Big Data—large volumes of data, an emerging trend in the field of computer science.
In wireless sensor networks in real world are connected with large number of devices
and storing and producing of large volume of data. Hence there is a large demand in
storing and processing of large data. One solution to this is Big Data. Hence there is
a need for parallel processing of data and also the security issues are boosted up for
Bid Data.
Parallel Enhanced Chaotic Model-Based Integrity to Improve … 143
Fig. 3 Three V’s
The Big Data characteristics are defined as Three V’s (Fig. 3) [3]—V-Volume,
V-Variety, and V-Velocity.
1.3 Hadoop
A solution to Big Data problem is Hadoop (Fig. 4) [4]. It’s the combination of Map
Reduce and HDFS. Where Map Reduce does processing and HDFS used for storage.
2 Enhanced Quadratic Map
The general equation for Quadratic Map [5, 6] is given as
xn+1 = pxn2 + qt
Let p = 1 and q = 1
xn+1 = xn2 + t
2
x (1) = x (1) + t
Fig. 4 HADOOP
2
x (1) − x (1) + t = 0
√
x2(1) = 0.5 1 ± 1 − 4t
xn+2 = xn+12
+t
2 2
xn+2 = xn + t + t
xn+2 = xn4 + t xn2 + t xn2 + t 2 + t
xn+2 = xn
x 4 + 2x 2 − x + t x 2 + t = x 2 − x + t x 2 + x + 1 + t = 0
√
x y(2) = 0.5 ∗ 1 ± −3 − 4t
Let p = −x q = 1 t = s
xn+1 = pxn2 + qt
xn+1 = s−t xn2

s e (0, 2) and t e (0, 1)
Algorithm Enhanced_Qudratic(upper_bound,lower_bound)
{
for 1 to n do
{
Calculate point = (Random_Value * (upper_bound-
lower_bound)) + lower_bound;
s = point;
t = Random_Value;
x = Random_Value;
plotting = s – power(x,2);
}
}
Plotting data is presented in Table 1 and its corresponding plotting is given in

Fig. 5.
3 Proposed Model
3.1 Big Data Security System
The Big Data Security system [7] is depicted in Fig. 6. The model takes input from
different big data sources. Process the input data in storing and retrieving from
HDFS. The HDFS uses privacy and security services to overcome several security
challenging issues.
Table 1 Plotting data

X Y X Y X Y X Y X Y
1 0.232875 21 0.058198 41 0.195583 61 0.024572 81 0.072284
2 0.166929 22 0.080503 42 0.068599 62 −0.06414 82 0.339254
3 0.025129 23 0.31357 43 0.096259 63 0.312608 83 0.414752
4 0.344497 24 0.294245 44 0.278975 64 0.23461 84 0.072936
5 0.215562 25 0.001356 45 −0.10992 65 0.021318 85 0.236616
6 0.162311 26 0.217931 46 0.361283 66 −0.22555 86 0.345707
7 0.047713 27 0.410416 47 0.057775 67 0.136593 87 0.177242
8 0.209773 28 0.040958 48 0.494532 68 0.362841 88 0.152431
9 0.26003 29 0.289463 49 −0.06218 69 0.124408 89 0.322687
10 0.099767 30 0.123042 50 0.291799 70 0.153504 90 0.298568
11 −0.18155 31 0.301667 51 −0.00484 71 0.108776 91 0.216872
12 0.290262 32 0.004594 52 0.13529 72 0.45248 92 0.110915
13 0.268044 33 −0.10173 53 0.275352 73 −0.17845 93 0.165477
14 −0.16444 34 −0.03964 54 0.162848 74 0.063284 94 0.335702
15 0.002755 35 0.470395 55 0.139831 75 0.301267 95 0.056919
16 0.389281 36 −0.08801 56 −0.05347 76 0.178351 96 0.275423
17 −0.02248 37 −0.03638 57 0.117242 77 0.36466 97 0.285088
18 0.259248 38 0.247029 58 −0.07157 78 −0.08031 98 0.065591
19 0.282307 39 0.301248 59 −0.13844 79 0.116092 99 0.102762
20 −0.05414 40 0.257316 60 0.367234 80 −0.08216 100 0.295698
Fig. 5 Enhanced quadratic map plotting
3.2 Proposed Parallel Processing Authentication Model
The proposed authentication model uses the enhanced quadratic chaotic in the gener-
ation of pseudorandom numbers based on system/node identity. The data from Big
Data Sources will be stored and retrieved from HDFS using proposed authentication
model, where the storage and processing can be performed parallelly which in turn
improves the security and storage efficiency [8] (Fig. 7).
Fig. 6 Big data security

system
Fig. 7 Proposed parallel processing authentication model
4 Experimental Results
The system is implemented and analyzed in Java platform for comparative analysis in
terms of time taken to perform and verify the integrity with traditional hash functions
and proposed quadratic chaotic hash function. The results (Table 2, Fig. 8) proved
the proposed model is taking less time for integrity verification, in turn, improves
the life time of sensor nodes and improves energy.
Table 2 Comparative
Integrity algorithm Execution time (ms)
analysis
MD 5 8963
SHA 256 7924
SHA 384 7612
SHA 512 7419
Proposed parallel enhanced quadratic 6854
chaotic hash function
Fig. 8 Comparative analysis in terms of execution time
5 Conclusion
This paper presented a model which improved security and lifetime through parallel
enhanced quadratic chaotic hash model. Obviously, the execution time of the system
is improved with parallel processing approach. The files should encode before storing
data into HDFS. The experimental results proved that the system is efficient in terms
of execution time.
References
1. https://www.datamation.com/big-data/structured-vs-unstructured-data.html
2. https://en.wikipedia.org/wiki/DIKW_pyramid
3. https://www.zdnet.com/article/volume-velocity-and-variety-understanding-the-three-vs-of-
big-data/
4. Hadoop, W.T.: The Definitive Guide: The Definitive Guide. O’Reilly Media (2009), 2. Borthakur,
D.: HDFS architecture guide. HADOOP APACHE PROJECT https://hadoop.Apach
5. Kanso, A., Yahyaoui, H., Almulla, M.: Keyed hash function based on a chaotic map. Inf. Sci.
186, 249–264 (2012)
6. Madhuravani, B., Murthy, D.S.R.: A hybrid parallel hash model based on multi-chaotic maps
for mobile data security. J. Theor. Appl. Inf. Technol. 94(2), (2017). ISSN: 1992-8645
7. Sai Prasad, K., Chandra Sekhar Reddy, N., Rama, B., Soujanya, A., Ganesh, D.: Analyzing and
predicting academic performance of students using data mining techniques. J. Adv. Res. Dyn.
Control Syst. 10(7), 259–266 (2018)
8. Chandra Sekhar Reddy, N., Chandra Rao Vemuri, P., Govardhan, A., Navya, K.: An implemen-
tation of novel feature subset selection algorithm for IDS in mobile networks. Int. J. Adv. Trends
Comput. Sci. Eng. 8(5), 2132–2141 (2019). ISSN 2278-3091
Exploring the Fog Computing
Technology in Development of IoT
Applications
Chaitanya Nukala, Varagiri Shailaja, A. V. Lakshmi Prasuna, and B. Swetha
Abstract In the 21st era, IoT is assuming a significant part in creating Smart urban
communities. With the development of IoT, information is developing with increasing
speed. As the information is developing the need to store information is likewise
expanding. More the information, the dormancy will be high to store and recover
information from the cloud. The idea of mist processing was started to reduce the
inertness for getting to information to and from the cloud. Haze processing gives
the capacity, figuring just as systems administration administrations toward the end
purpose of the system. Haze hubs likewise have restricted computational abilities.
Because of certain shortcomings, haze figuring and distributed computing can’t
continue alone, so both these advances are coordinated to fabricate keen IoT foun-
dation for Smart city. Mist figuring have a significant job and preeminent duty being
developed of a Smart city. This paper examines different utilization of mist regis-
tering and their usage in Smart urban areas. It additionally proposes a model for
Waste administration framework in a city. Mist figuring can assist with overseeing
the waste assortment of the city in a keen manner. Based on our survey, a few open
concerns and difficulties of mist processing are examined, and the bearings for future
analysts have additionally been talked about.
C. Nukala (B)
Department of CSE, RGM College of Engineering and Technology (Autonomous), Nandyal,
Andra Pradesh 518501, India
V. Shailaja
Department of IT, Gokaraju Rangaraju Institute of Engineering and Technology, Hyderabad,
Telangana 500090, India
A. V. Lakshmi Prasuna · B. Swetha
Department of IT, Mahatma Gandhi Institute of Technology, Gandipet, Hyderabad, Telangana
500075, India
https://doi.org/10.1007/978-981-16-1502-3_16
150 C. Nukala et al.
1 Introduction
A creating number of physical articles are being related with the IoT [1]. It is the
interconnection of different physical elements that pass on and exchange data the
sensors, shrewd meters, telephones and vehicles, radio-recurrence distinguishing
proof (RFID) labels, and actuator [2]. The interconnection of these devices enables
shrewd IoT applications like following on the web trucked merchandise, condition
observing, medical services keen home and savvy framework, and so forth.
IoT devices make a great deal of data, which procure tremendous figuring office,
stockpiling zone, and correspondence information move limit. Cisco said 50 billion
gadgets could be associated by Internet in 2020 [3], and it will build 500 billion by
2025 [4].
The idea of mist figuring was presented by Cisco in the year 2012 [5]. The begin-
ning objective of haze registering is to upgrade the profitability and to diminish
volume of information which is moved to cloud for preparing. For ease, the board
of all assets haze layer go about as a middle among gadgets and cloud server farms.
Haze processing can offer types of assistance in different zones i.e. observation,
transportation division, clever urban areas, medical services, and keen structures.
Mist figuring can be utilized in various kinds of IoT administrations [5–7]. To start
with, Smart E-Health Gateway can be utilized for patients to checking their wellbeing
status [8]. Crisis caution can be enacted and send the alerts to the proprietor [9]. A
haze based Electronic Data Interchange (EDI) is an exhaustive virtualized device
outfitted with the capacity, transmission and registering limit [5].
Further segments of the article are clarified as follows: Sect. 2 contains Moti-
vation of the investigation, Sect. 3 explains the Layered design of IoT and mist
processing and how it can function for keen utilizations of IoT, Sect. 4 examines
uses of IoT and haze registering, Sect. 5 clarifies load adjusting in mist figuring
condition, Sect. 6 examine the proposed philosophy, Sect. 7 has been regarding open
issues and supportive gestures lastly Sect. 8 finish up the paper and clarifies the
opportunity of Future.
2 Motivation
This manuscript provides gives a short conversation of the application territories of

IoT and FC. The fundamental ideas of IoT and FC are talked about that incorporates
points of interest, hindrances, and engineering of FC.
Mist layer requires load adjusting to accomplish asset productivity, stay away
from over-burden in the system, to improve framework execution, and furthermore
to ensure the framework against disappointments. The inspiration of this paper is
to investigating the keen waste administration framework which incorporates load
adjusting on the haze layer. This paper likewise talks about different open issues and
difficulties looked in mist conditions.
Exploring the Fog Computing Technology in Development … 151
Fig. 1 Layers of IoT architecture [10]
3 Layered Framework of IOT and FC
3.1 Layered Framework of IOT
IoT has been arrangement of devices that send, share, and use data from the physical
condition to offer types of assistance to individuals, endeavors, and society. The
essential three-layer engineering is appeared in Fig. 1 [10].
(a) Layer of Sensors: This detect and collecting information from nature. Sensors,
scanner tag marks, RFID labels, GPS, camera, and actuator are available in
this layer
(b) Layer of Network: This utilized to assemble the information from sensor and
sends to the web. Liable for organize layer is interfacing with other savvy things,
arrange gadgets, and workers. Its features are moreover used for communi-
cating and handling sensor data. Utilizing various advancements, different
kinds of conventions and heterogeneous systems are accumulated.
(c) Layer of Middleware: This gets information from layer Network. Its inspiration
is administration the board, information stream the executives, and security
control. It moreover performs information taking care of and takes decisions
normally taking into account results.
(d) Layer of Application: It gets information from the Middleware layer and gives
overall administration of the application.
3.2 Layered Architecture of FC
The class of CC for example FC have three layer engineering. The lower layer
contains IoT gadgets. Mist layer is the center layer. IoT gadgets are coupled to cloud
Fig. 2 Architecture of Fog computing
layer through mist layer. Entire gadgets store their information on the cloud. The
haze layer channels information, and the information which isn’t quickly needed is
diverted to the cloud. The every now and again got to information is put away on the
mist layer. Layered design of FC is clarified as beneath: Fig. 2 shows the engineering
of FC.
• Brilliant IoT gadgets: The a great many sensors hubs and implanted frame-
works having low transfer speed and low inertness are utilized at this layer. Savvy
gadgets like brilliant structures, advanced cells, workstations, shrewd power bulbs,
keen vehicles, and so forth can be considered as IoT gadgets which gather the
information and send this information to the haze layer [14].
• Haze Layer: Network layer of haze is additionally partitioned into two sections:
Fog system and Core organize.
Network of Fog: It incorporates 3G/4G/5G/LTE/Wi-Fi and so forth multi-edge
benefits that are utilized to interface distinctive detecting gadgets with the haze hubs.
Haze hubs are utilized to channel information assembled by method of IoT gadgets
and not regularly utilized information is diverted to the upper layer for example cloud
layer.
Network of Core: QoS, manifold protocol Label Switching (MPLS), manifold-
cast, and security were deliberated at this phase [11].
• Layer of Cloud: It incorporates a great deal of server farms and cloud facilitating
IoT investigation. The colossal information accumulated through various IoT
gadgets are put away in the huge server farms situated at different areas on the
planet.
4 Applications of FC and IOT
Haze works in dispersed condition. It offers types of assistance to the last client at the
edge gadget. FC have different application regions where we can incorporate with
IoT that can be examined as follows:
a. Meticulous Healthcare: In view of dirtied condition different sorts of micro-
scopic organisms have been being spread noticeable all around which causes
different ailments.
Each individual has occupied today as a result of quick ways of life. Shrewd
healthcare has the brilliant IoT which monitors exercises of individuals and
measures different boundaries of their body and continues transferring the infor-
mation on the haze hubs, which have been being seen by the specialists. The
information put away on the haze hubs have been being utilized by specialists
to treat the patients inside time. The individuals have been wearing insightful
gadgets and these have been additionally connected to mist hubs which have
been ceaselessly sending the estimations of body boundaries (temperature,
pulse, and so on.) so as to the mist hubs. These wise wearable gadgets help
to monitor individuals’ wellbeing [7].
b. Meticulous Parking: Because of much increment in transportation in the urban
communities, all the more parking spots have been required. Individuals need to
meander to a great extent to locate the fitting parking spot for them. FC presented
a novel thought of Meticulous stopping. With the utilization of FC the stopping
spaces can be introduced with the sensors which continue following climate the
parking have been a has vacant or full [12].
c. Meticulous Agriculture: Agribusiness has the wide territory to be given consid-
eration since has zone has from where all the urban communities have been
getting food. Brilliant agribusiness idea has been introduced in most recent
couple of years. Shrewd detecting and figuring have been playing a critical
obligation in keen agribusiness. A couple of savvy agribusiness approaches
have been imagined around there. Brilliant water system frameworks have been
given. Shrewd sensors have been being repaired in the fields [13]. FC gives a
stage to working the sensors in the fields, which have been ceaselessly watching
the yields. The sensors identify necessities of the harvests and persistently store
information in the haze hubs which send the cautions to the ranchers about the
prerequisites of the yields. The shrewd farming assumes an essential function
for building a brilliant city.
d. Meticulous Waste administration: The earth has corrupting step by step, and
to moderate the planet we require sharp consideration towards the normal assets.
Presently days, day by day developing waste and water exhaustion from the earth
looks for more consideration. Keen trash the board framework can be named
the answers for improvement of condition in this time. Such keen frameworks
will be created with the assistance of cloud just as FC to gather and deal with
the waste all the more proficiently [8].
Fig. 3 Balancing of load in network
5 Load Balancing in FC Environment
In a system, scarcely any frameworks stay under-stacked sooner or later stretch, while
the others convey the whole heap of the system. To keep up the heap in a reasonable
plan, “Burden Balancing” gets vital. “Burden Balancing endeavors to disperse the
heap in indistinguishable extents all through assets relying upon response capacity
all together that each valuable asset isn’t over-burden or underutilized in a cloud
device” [14]. Burden adjusting additionally needed to be done to dodge halt and
diminish the worker flood issue. Figure 3 shows the heap adjusting.
A portion of the objectives of mist based burden adjusting are talked about as
underneath:
• In instance of failure of system, the balancing of load offers plans for backup.
• Consequently, performance could be enhanced.
6 Projected Methodology
The novel waste administration network has been projected in this manuscript by
modifying the load at the layer of mist. Here, projected method comprises of three
phases: mist, datacenters of cloud, gadgets related to sensor. It could be stated that
comprise of sensors. Moreover, these canisters smart would tied up further over the
layer of mist that data of channels have to be transferred towards cloud. The balancer
of burden would adapt mist hubs heap. Moreover, it might distinct the similar heap
on entire hubs.
These hubs of haze would readily create the messages for advising the transporters
of trash for waster gathering. The sensors of security would established in canisters
that lighten regarding receptacles. Further, in instance, anybody might try for canis-
ters tempering, where these sensors would start signal clamoring that might spare
by considering receptacles. Further, the containers smart would be linked by 3G or
Fig. 4 Load balancing model
4G towards layer of mist. The application would be formed for contributing overall
circumstance. The ensuing Fig. 4 shows the proposed model of burden adjusting
framework.
7 Open Issues and Encouragements
There were divergent open issues, which could be worked in an addition. Here,
accompanying could be examined further:
• Interaction among hubs: further, it might be examined in addition to explore the
engineering by which hubs of haze might interact over one another.
• Recognition devices: the gadgets that are smart were exorbitant than another
fundamental market components. Here, these could be deliberated deprived of
any issue.
• It could be a significant issue in this contemporary world. FC pre-requisite more
computations of security for real-time practice.
• It shall be in condition of mist. As it causes challenges when pair of workers have
been loaded very much, while other workers would be stacked beneath.
• Effectiveness of energy: The effectiveness of energy could a prominent in FC test.

The mist utilizing force has to be lessened.
The objective of this manuscript portrays joining of IoT and FC for assisting divergent
implementations. What’s more, load adjusting has been proposed. Next to, a couple
of uses, including the brilliant farming, keen medical services, shrewd stopping, and
savvy squander the executives showed. The basic purpose behind this survey is to give
a significant perception and preferences of IoT and its fuse with mist/edge processing
and how burden adjusting should be possible when FC incorporated with IoT. There
are still more open regions for future analysts, for example, Haze organizing, asset
provisioning, greater headway in transportation.
References
1. Al-Fuqaha, A., Guizani, M., Mohammadi, M., Aledhari, M., Ayyash, M.: Internet of things:
a survey on enabling technologies, protocols, and applications. IEEE Commun. Surv. Tutor.
17(4), 2347–2376 (2015)
2. Gubbia, J., Buyyab, R., Marusica, S., Palaniswamia, M.: Internet of things (IoT): a vision,
architectural elements, and future directions. Futur. Gener. Comp. Syst. 29(7), 1645–1660
(2013)
3. Evans, D.: The Internet of Things: How the Next Evolution of the Internet is Changing
Everything. Cisco White Paper (2011)
4. Camhi, J.: Former Cisco CEO John Chambers Predicts 500 Billion Connected Devices by
2025. Business Insider (2015)
5. Luan, T.H., Gao, L., Xiang, Y., Li, Z., Sun, L.: Fog Computing: Focusing on Mobile Users at
the Edge. arXiv preprint arXiv:1502.01815 (2015)
6. Emilia, R., Naranjo, P.G.V., Shojafar, M., Vaca-cardenas, L.: Big Data Over SmartGrid—A
Fog Computing Perspective Big Data Over SmartGrid—A Fog Computing Perspective (2016)
7. Khan, S., Parkinson, S., Qin, Y.: Fog computing security: a review of current applications and
security solutions. J. Cloud Comput. 6(1) (2017)
8. Mahmud, R., Kotagiri, R., Buyya, R.: Fog Computing: A Taxonomy, Survey and Future
Directions, pp. 1–28 (2016)
9. Desikan, K.E.S., Srinivasan, M., Murthy, C.S.R.: A novel distributed latency-aware data
processing in fog computing—enabled IoT networks. In: Proceedings of the ACM Workshop
on Distributed Information Processing in Wireless Networks—DIPWN’17, pp. 1–6 (2017)
10. Chi, Q., Yan, H., Zhang, C., Pang, Z., Xu, L.D.: A reconfigurable smart sensor interface for
industrial WSN in IoT environment. IEEE Trans. Ind. Inform. 10(2) (2014)
11. Chiang, M., Zhang, T.: Fog an IoT: an overview of research opportunities. IEEE Internet Things
J. 3(6), 854–864 (2016)
12. Perera, C., Qin, Y., Estrella, J.C., Reiff-Marganiec, S., Vasilakos, A.V.: Fog Computing for
Sustainable Smart Cities: A Survey (2017)
13. Varshney, P., Simmhan, Y.: Demystifying Fog Computing: Characterizing Architectures, Appli-
cations and Abstractions. In: Proceedings—2017 IEEE 1st International Conference of Fog
Edge Computing ICFEC, pp. 115–124 (2017)
14. Dastjerdi, A.V., Gupta, H., Calheiros, R.N., Ghosh, S.K.: Fog Computing: Principles,
Architectures, and Applications, pp. 1–26 (2016)
NavRobotVac: A Navigational Robotic
Vacuum Cleaner Using Raspberry Pi
and Python
Shaik Abdul Nabi and Mettu Krishna Vardhan
Abstract Human life is becoming more advanced day by day and the use of tech-
nology is making our lives easier. By this consideration, one of our daily task is
to keep our surroundings clean by natural way using a broomstick, as technology
is increasing day by day we came with manual vacuum cleaners and then moved
to robotic vacuum cleaners. In robotic vacuum cleaner there exist many different
methods which are used to clean in home or hotels. In NavRobotVac (Navigational
Robotic Vacuum cleaner) model, we consider the science of architecture (vastu) and
implemented using python programming with Raspberry Pi. It automatically scans
area around and starts cleaning. In this model, IoT sensors are used to read real-time
data thus it gives technical efficiency and economic efficiency.
1 Introduction
Vacuum cleaners were developed in mid-1920 and then we came up with different
designs and features [1]. In 1996 the 1st robotic vacuum cleaner was developed using
programming. NavRobotVac cleans your home even when you are out of your home,
reduces work, and saves more time for the household [2]. There are many companies
who develops vacuum cleaners using different methods with very high cost [3]. For
developing a robotic vacuum cleaner there are mainly two different tasks, firstly
scanning the area which needs to be cleaned, we scan the area in a ground level
using sensors surrounded by the robot then processed in a raspberry pi using python
language, followed grid mechanism where each cube in a grid is based on the size
and distance moved by robot, vacuum fan and two sweeping motors are turned off
while scanning using a relay module. Secondly by using scanned data robots start the
cleaning process from its initial position, remembers the area it already cleaned so
S. A. Nabi (B)
Department of CSE, Sreyas Institute of Engineering and Technology, Hyderabad, Telangana, India
e-mail: dr.nabi@sreyas.ac.in
M. K. Vardhan
Sreyas Institute of Engineering and Technology, Hyderabad, Telangana, India
https://doi.org/10.1007/978-981-16-1502-3_17
160 S. A. Nabi and M. K. Vardhan
that no redundant cleaning takes place of same location, stores the dust in a removable
bin. Scanning and cleaning both follow different algorithms depending upon input
given by sensors. Developed a better algorithm for an efficient cleaning process as
we are making it cheap by using ultrasonic sensor, raspberry pi, micro gear motors,
line tracking sensor, compass sensor, relay module, and DC motor.
Robotic vacuum cleaners have reached a good amount of success within the
domestic market. The iRobot Corporation (one of the most popular players) claims
to sold 6 million units of their products within one decade [4].
According to the statistics of the International Federation of Robotics [5], about 2.5
million personal and service robots were sold in 2011, an increase of 15% in numbers
(19% in value) compared to 2010 [6]. This statistical figures clearly highlights the
increasing demand of domestic robots at our homes, which encourages to creates new
interaction patterns. In addition to this, the demand for the operation of many new
cleaning robots will follow the same tendency. Because of that, we have designed
our robot with effectively in terms of price and time.
2 Related Work
An existing robotic [7] vacuum cleaner had some drawbacks like colliding with
obstacles and stopped at a shorter distance from walls and other objects. It was not
able to reach all corners and edges of the room and left those areas unclean [8].
A design and implementation of a smart floor cleaning robot uses a microcontroller
[9] where data cannot be stored, it is difficult to find the place which is not cleaned
and which is cleaned, action will be performed only based on the current data read
by sensors.
In existing vacuum cleaner, robot doesn’t have any idea about its current position
and direction in which it is moving, if any obstacle occurs robot turns to the direction
with higher free space even though the robot already cleaned that location.
3 NavRobotVac Design
NavRobotVac uses a grid mechanism for the virtual view of a robot, the size of each
grid depends upon dimensions of body and wheels, the robot length and width is
30 × 30 cm and 1.5 cm radius of a wheel from which each grid is considered as
10 × 10 cm. Grid mechanism of NavRobotVac is shown in Fig. 1. The robot uses a
compass sensor to know the direction for easy scanning stores the area and performs
the next operation based upon direction and data given by ultrasonic sensors.
The proposed system is designed in such a way that it is targeted to meet the user
needs and also reaches more number of users. It consists of two wheels of radius
1.5 cm which are placed exactly in the center, for one complete rotation of wheels
it moves 10 cm distance which is considered the size of a cube in a grid. A line
NavRobotVac: A Navigational Robotic Vacuum Cleaner … 161
Fig. 1 Grid mechanism of

NavRobotVac
detecting sensor is used to identify one complete rotation of a wheel by sensing a

white line on black wheel and based on the movement the current location of the
robot is updated continuously. The robot rotates very smoothly for the turn in the
same place. A 360° rotatable wheel is fixed at the back for balancing the robot. Speed
of the wheel varies based on the function it performs. If the robot decides to turn
left or right then wheels are rotated in the opposite direction to each other so that the
robot stays in the same position and only direction gets changed. Robot stops only
if it completes its task or if the pause button is pressed. The design of NavRobotVac
is shown in Fig. 2.
The robot consists of seven ultrasonic sensors on each side except back, compass
sensor is fixed facing the north direction, line detecting sensor is fixed beside a wheel,
along with relay module all the sensors are connected to raspberry pi for the power
supply and to transfer the data with which the data is processed to give instruction to
wheels connected to micro gear motors along with the fan connected to DC motor to
suck the dust and rotational brushes fixed to micro gear motors. A 12 V power supply
is given to the relay and 5 V is supplied to the motor driver by reducing voltage using
a voltage regulator. The detailed circuit diagram of NavRobotVac is shown in Fig. 3.
Robot contains start, pause buttons, and a switch for main power supply. When
the switch is on all the sensors and processor gets turned on. When the start button is
pressed by placing the robot at the center of the room for the first time, the robot starts
scanning in a spiracle pattern in an anti-clockwise direction. Once the scanning is
done scanned data is stored in raspberry pi memory. Immediately after the scanning
robot starts the cleaning process, cleaning is done for every 24 h (fixed in a program).
Pause button is used to stop the cleaning or scanning process until it is pressed again.
Fig. 2 Robot design
Fig. 3 Circuit diagram of NavRobotVac

4 Functionality
It mainly consists of two functionalities. The first one is scanning and second is
cleaning. If any obstacle appeared in the process of scanning or cleaning, the robot
performs operation based on the current input and previous data if present (NPY file)
and continues its operation. The detailed descriptions of these two functionalities are
defined as follows.
4.1 Scanning Algorithm
A matrix is created and saved in NPY file before the scanning process begins to
record the area of the location, then the robot turns towards the north direction and
starts moving until it reaches a wall, then it turns towards left i.e. west and begins
scanning using ultrasonic sensors, process the data in raspberry pi and updates the
file. Robot initially completes scanning borders of the location and scans inside the
scanned area. We followed the spiral pattern for the scanning process. The algorithm
reads the file if there is any area which is not scanned and moves towards the location
if it finds any, if not the scanning process stops. Then all the extra rows and columns
in a matrix which are useless are removed from the file and store only the scanned
area.
4.2 Cleaning Algorithm
Cleaning algorithm uses the NPY file saved by the scanning algorithm of the location
that needs to be cleaned, make a copy of the file to note the place which is already
cleaned while cleaning. To start the cleaning process the robot needs to go to its
initial position which is the south west corner. A method is executed to find the
initial position and move to the location. Then the robot starts cleaning the west wall
from south to north, after reaching north wall the robot turns east, moves front and
turns towards south, using the same method cleaning process is done from west to
east. Cleaning algorithm is done in a parallel pattern. The process begins after the
scheduled time is completed.
NavRobotVac is implemented using python programming language; execution
is done in raspberry pi containing processor and raspbian operating system. The
program is kept in bash location for the auto start of execution as soon as the power
turns on. The basic functionality of the product is shown in Fig. 4.
Fig. 4 Functionality of
NavRobotVac
4.3 Obstacles Avoidance
In the process of scanning when any obstacle comes, robot considers it as a non-
cleaning area. As the scanning pattern is spiracle in an anti-clockwise direction the
robot moves towards its left and continues scanning.
When the process of cleaning is going on, if any object appears in front of the
robot, it will pass the obstacle from its right side and updates that area as a non
cleaning area. In the next turn when the same area is free then the robot moves
towards that area and updates to the empty space in NPY file which needs to be
cleaned.
5 Results and Discussions
NavRobotVac model aim is to strive the advance homemade robotic vacuum cleaners
for domestic needs with reference to numerous features: usability, apparent conve-
nience, and style. These are the basic factors to meet the domestic needs for the
adoption of advanced technology. Based on users need and time to time to meet
their prospects and their methods of employing a robotic vacuum cleaner, we can
reach their expectations and meet their true needs and take them under consideration
while the process of evolving these types of systems with advanced technologies.
The resultant of our proposed system is shown in Fig. 5.
The proposed system considered a sample area with five corners to test the robot
as shown in Fig. 6. It starts with north direction and ends with after scanning the
entire blocked area. The result can be seen in a NPY file which contains 0, 1, and
2’s, 0 says that area is out of border, 1 represents empty area to be cleaned and 2
represents obstacle in the field. An example for output of proposed model is shown
in Fig. 7.
In an existing system robot works on a microcontroller as a central unit which only
works on a present input it leads to a redundant cleaning of same location. Whereas
in NavRobotVac, it uses Raspberry pi as a central unit which gives the instruction
by taking present input and previous data given by sensors.
Fig. 5 NavRobotVac
Fig. 6 Sample area with 5

corners
Fig. 7 Sample area output
While comparing with existing system, Robots store mapped area in a file which
requires additional memory whereas in proposed system the mapped area is stored
in a NPY format which consumes less memory and it is the fastest method of loading
in data. This robot is designed in octagon shape to minimize the size and for easy
movement of robot. Also it is designed in a minimum price as there is no extra
equipment like camera etc.
Due to revolution in the technologies, robots which are used for domestic purpose
are transformed from the straight forward “random-walk” methodology to further
advanced navigation systems, comprising a domestic technology for a reasonable
cost.
With this user-friendly approach, the developed product efficiently ensures Scan-
ning of a new area which needs to be cleaned and stores the scanned area as a NPY
file in a memory present in raspberry pi. Cleaning process executes after every time
period completed, simultaneously updating the area file if any obstacles are found.
By implementing this system a user is free from keeping his home clean as that
work is done by a robotic vacuum cleaner. Users need to keep a time gap to activate
the cleaning process. After cleaning is done the user takes a dustbin from the robot,
cleans it and fixes it back for the next clean.
In future, the vacuum cleaner NavRobotVac can be added with many features like
moping, carpet cleaning, and an application can be designed for the robot to make
track of it.
Acknowledgements We would like to thank everyone, who has motivated and supported us for
preparing this Manuscript.
References
1. Mitchel, N.: The Lazy Person’s Guide to a Happy Home: Tips for People Who (Really) Hate
Cleaning, 9 Jan 2016 [Online]. Available: https://www.apartmenttherapy.com/thelazy-personsgu
ide-to-a-happy-home-cleaning-tips-forpeople-who-reallyhate-cleaning-197266. Accessed 22
June 2016
2. Prassler, E., Munich, M.E., Pirjanian, P., Kosuge, K.: Domestic robotics. In: Springer Handbook
of Robotics, pp. 1729–1758. Springer International Publishing (2016)
3. Hong, Y., Sun, R., Lin, R., Shumei, Y., Sun, L.: Mopping module design and experiments of
a multifunction floor cleaning robot. In: 2014 11th World Congress on Intelligent Control and
Automation (WCICA), pp. 5097–5102. IEEE (2014)
4. C.o. iRobot: iRobot: Our History, 29 May 2015. [Online]. Available: https://www.irobot.com/
About-iRobot/CompanyInformation/History.aspx
5. Adkins, J.: ‘History of Robotic Vaccum Cleaner, 21 June 2014 [Online]. Available: https://prezi.
com/pmn30uytu74g/history-ofthe-robotic-vacuum-cleaner/. Accessed 14. 04. 2015
6. Kapila, V.: Introduction to Robotics (2012). https://engineering.nyu.edu/mechatronics/smart/
pdf/Intro2Robotics.pdf
7. Shashank, R., et al.: Shuddhi—Acleaning Agent. Int. J. Innov. Technol. Explor. Eng. (IJITEE)
9(2S) (2019). ISSN: 2278-3075
8. Frolizzi, J., Disalvo, C.: Service robots in the domestic environment: A study of Roomba vacuum
in the home. In: International Conference on Human Robot Interaction HRI, pp. 258–265 (2006)
9. Appliance, C.: How to Choose the Best Vacuum Cleaner, 23 Feb 2016 [Online]. Available:
https://learn.compactappliance.com/vacuum-cleaner-guide/. Accessed 22 June 2016
A Hybrid Clinical Data Predication
Approach Using Modified PSO
P. S. V. Srinivasa Rao, Mekala Srinivasa Rao, and Ranga Swamy Sirisati
Abstract Enhancement of diagnostic predictive mechanisms in Clinical Decision

Support Systems (CDSS) is performed through improving disease staging predic-
tions, illness progression prediction, and reducing the number of features in high
dimensional clinical data sets. All the works in this paper uses benchmark datasets
from University of California Irvine machine learning repository for verification.
Clinical datasets are obtained through various diagnostics procedures, and the data
from different sources was transformed into a single format before the start of the
analysis. Since there are many diagnostics procedures, the transformed data usually
has a large number of features. Preliminary data cleaning procedures like duplicate
removal, noise dismissal, and filling up of missing data are performed initially. Data
reduction techniques are applied over this cleaned data. A dataset is mainly due to
two main reasons: too many instances or too many attributes. Once the noisy and
duplicate instances are removed, having too many instances usually generates an
accurate classifier. However, having too many features is a negative aspect of data
analytics because the dataset’s unimportant features tend to bring down the classi-
fier’s accuracy that has produced using the dataset. Reducing the number of features
to an optimal level to enhance the classifier’s accuracy is the aim of feature reduction
algorithms. Every disease has various stages of severity. In this paper, an effective
DSS support system for the Clinical Data predication Approach was proposed based
the combination of Hybrid technique using C4.5, decision tree with Particle Swarm
Optimization (PSO) evaluated for various diseases.
P. S. V. Srinivasa Rao (B)

Vignan’s Institute of Management and Technology for Women, Kondapur, Ghatkesar Mandal,
Telangana, India
M. S. Rao
Department of CSE, Lakireddy Bali Reddy College of Engineering, Mylavaram, Andhra Pradesh,
India
R. S. Sirisati
Department of CSE, Vignan’s Institute of Management and Technology for Women, Kondapur,
Ghatkesar Mandal, Telangana, India
https://doi.org/10.1007/978-981-16-1502-3_18
170 P. S. V. Srinivasa Rao et al.
1 Introduction
Every country in the world needs healthy individuals in order to have an efficient
human resource. Improving the health care field does not only requires personnel
support. With the active support of software tools, hardware equipment, and rich
information, healthcare domains could see an unprecedented change. In recent years,
Data predication Approaches designed primarily to help during the treatment phase
is gaining momentum, but the Data predication Approaches to support during the
diagnosis phase is still in its rudimentary form. Since the sophistication of machine
learning and other data analytics algorithms are getting real in the market place, Data
predication Approaches research in clinical diagnosis is gaining ground. With that
in mind, the problem statement objectives are formulated [1, 2]. The Clinical Data
predication Approach (CDPA) assists physicians and other healthcare professionals
in their decision-making process. According to Robert Hay ward, Clinical Data
predication Approaches link with health care domain to effect health. CDPA uses
Computational Intelligence (CI) techniques as a means to make decisions. CDPA uses
various types of patient data during the process of decision making. CDPA promi-
nently finds its usage mainly in the treatment phase. It is used as an alerting/alarming
system. Integrating with the Internet of Things (IoT) technologies, CDPA supports
treating personnel during the hospitalization period like rule-based drug delivery,
emergency vital alert systems, and continuous sensing and monitoring systems. The
CDPA is used to give correct information to the necessary personnel at the right
time through technology supporting automation. Thus as of now, the role of CDPA
is mostly pertained to sensing and alerting. Now the time is ripe enough to apply
CDPA extensively during the diagnosis phase, as there are too many advancements
in machine CI. Some of the prominent applications of CDPAes are CO [3–5] (Fig. 1).
i. Tracking the progression of diseases.
ii. Suggesting suitable diet needs for patients.
iii. Suggesting an effective treatment procedure.
iv. Staging of diseases.
v. Predicting the causality of diseases.
vi. Pharmacological decision support.
vii. Estimating the outcome of a treatment procedure.
viii. Estimating the outcome of a surgery.
ix. Early warning systems in the ICU-intensive care unit.
x. Diagnosis of diseases.
The effectiveness of CDPA is decided by way of handling the two main challenges,
such as data handling and data analytics.
from different sources got transformed into a single format before the start of the
A Hybrid Clinical Data Predication Approach Using Modified PSO 171
Fig. 1 DSS support system for clinical data predication approach
reduction techniques are applied over this cleaned data. A dataset is mainly due to
two main reasons: too many instances or too many attributes. Once the noisy and
duplicate instances are removed, having too many instances usually generates an
accurate classifier. However, having too many features is a negative aspect of data
analytics because the dataset’s unimportant features tend to bring down the classifier’s
accuracy that has produced using the dataset. Reducing the number of features to
an optimal level to enhance the classifier’s accuracy is the aim of feature reduction
algorithms [4–6].
2 Related Work
from different sources got transformed into a single format before the start of the
reduction techniques are applied over this cleaned data. A dataset is mainly due
to two main reasons: too many instances or too many attributes. Once the noisy
and duplicate instances are removed, having too many instances usually generates
an accurate classifier. However, having too many features is a negative aspect of

data analytics because the dataset’s unimportant features tend to bring down the
classifier’s accuracy that has produced using the dataset. Reducing the number of
features to an optimal level to enhance the classifier’s accuracy is the aim of feature
reduction algorithms. The main challenge is that the sequence’s prediction is made
with a trained entity that is not trained with the transition data. Continuous-time
series clinical data corresponding to individual patients is not available in enormous
quantity than the current data severity levels. So in the proposed work, we have used
the clinical dataset having current severity levels to detect the transition sequence
[7–9].
Patient-centric disease sequence prediction is performed in all of the previous
researches use time-series data. No research work addresses the prediction of possible
transition stage of disease for a patient without the availability of that patient’s time-
series data in Fig. 2. The availability of time-series data, such as ICU data, is compara-
tively low. So the previous works using time series data do not have many benchmark
data sets to verify, so the reliability of the proposed Algorithm can not be verified
to the fullest. Previous works that focus on time series data assume that the disease
Fig. 2 Data preprocessing

phases
Fig. 3 Attribute considered DSS in clinical data
progression takes a sequential route, which is not necessarily the default case. The
disease can jump stages, and it does not refer to passing through the stages in a
fast manner. There is a deficiency in research works that can redefine clinical test
data mapping with new disease stages. All the research mentioned above gaps is
addressed. The proposed solution uses nontime series data and predicts the patient-
centric disease transition stage. The solution provided can even redefine the staging
pattern of the disease [2, 10] (Fig. 3).
3 Proposed DSS Support System for Clinical Data

Predication Approach Using C4.5 with PSO
After reducing the features form the equation formulated as part of this proposed
work using C4.5 decision tree and PSO technique for Algorithm 1, are mentioned
below [9, 11, 12]. The density of the cluster is found out using the Equations. clusteri
= 1 Density of Cluster, P-cluster where p is the particles (Fig. 4).

pkt = pk 1, pk 2t , . . . , pk D t (1)
Fig. 4 DSS phases of hybrid C4.5 decision tree with PSO

p1t = p1 1, p1 2t , . . . , p1 D t (2)

Va_id t = w ∗ Va_id t−1 + c1r1 pid t − xid t

+ c2 r2 pgd t − xid t , m = 1, 2, . . . , M (3)
xid t+1 = xid t + Va_, d = 1, 2, . . . , D (4)
Here, each decision tree can be treated as a particle for Swarm Optimization. The
Eq. 1 represents best solution tree particle, Eq. 2, with the population l, and Eqs. 3
and 4 deliberates velocity and updated dynamic position.
Algorithm: 1: DSS support system for Clinical Data predication Approach

i. Calculate cluster = Li = 1” Cluster – DPti cluster.and F_cluster
ii. Assign medial diseases Data Set of all cluster M × N
iii. Training Set cluster nodes of diseases
iv. Test Samples Examples
v. Apply C4.5 and Decision Tree with using Eqs. 1 and 2
vi. Apply Current Decision Level using PSO with Eqs. 3 and 4
vii. Assign the final Particle as Decision parameter
A unified model for feature selection is also proposed, significantly to reduce

features in massive datasets. It does reduction by selecting features appearing in both
the set of feature subsets selected through MBPSO and other existing Binary Genetic
Algorithm based methods and the model. An evaluation parameter for wrapper-based
feature selection methods is called the Trade-off factor (TF). The following are the
highlights of the proposed work. Wrapper-based methods are used in this work, and
feature selection is in every step of the Algorithm through the creation of the SVM
classifier. The existing Binary Genetic Algorithm (BGA) is used along with in unified
approach. A comparison of various feature selection models is performed using a
neural network classifier.
Particle Swarm Optimization technique (PSO) is one of the evolutionary optimiza-
tion algorithms. It is a heuristic algorithm. It has proved its mettle in optimization;
PSO has been considered to provide a solution in this work. Binary Particle Swarm
Optimization (BPSO) technique is a version of PSO, which uses particles having
binary digits. An updated version called Mutated Binary Particle Swarm Optimiza-
tion (MBPSO) is proposed in this. BPSO is used in feature selection problems. Every
digit in a particle used in BPSO is either 0 or 1. If there is a dataset having n number
of features, then the particles will be having n number of binary digits. Each feature
corresponds to each digit in a particle’s binary string. The features corresponding to
1’s are all congregated, which is considered a derived data set. Once every particle
had its fitness value found, the particle with the highest fitness value is the global best
particle. Then every other particle will update its velocity and position towards the
global best particle. During the movement, binary digits of particles will be updated.
Again the process is repeated till the fitness of the global best particle is lesser than
a threshold value, which is the preset or specific number of iterations are fixed, so
that after completing the present iteration, the features of the dataset corresponding
to the global best particle is considered as the reduced feature subset. The move-
ment of particles in search space is said to be an exploration phase of PSO, and the
movement of particles towards the global best particle is said to be the exploitation
phase. PSO algorithm is proved to be good to have acceptable exploitation. That is,
it tends to converge fast. However, it has a problem with exploration. The proposed
method called MBPSO aims to alleviate the problem of exploration by introducing
a mutation mechanism, which is usually associated with genetic algorithms. The
workflow diagram is shown in Fig. 2. The idea is to selectively apply the mutation
process, which is defined as a random update of particles’ digits. Last k particles with
the least fitness values are subjected to mutation, thereby the process of exploita-
tion is not disturbed, and the process of exploration is enhanced through making
the last k fittest particles scrambled through the search space. Thus, the proposed
method called MBPSO aims at enhancing the exploration phase of BPSO. The eval-
uation of finished selection using the neural network uses random sampling without
replacement of both random samplings without replacement of random sampling
without replacement during training and testing. There is only one hidden layer with
ten neurons in evaluating neural networks. For every method, the count of input
neurons varies with the outcome of feature selection, and the count of neurons in
the input layer is equal to the count of features selected. All datasets used evaluate
have only one class, so there is only one neuron in the neural network’s output layer.
Genetic Algorithms (GA) are evolutionary optimization algorithms. GA algorithms
are heuristic algorithms. The GA components are population generation, selecting
fit members from the population to perform a cross over. After cross-over opera-
tion, the members are subjected to the next process called a mutation. Members are
called genetic strings. A string can be a sequence of integers or real numbers. If a
string is composed of binary numbers, then it is called a binary string. GA, which
uses binary strings, is said to be Binary Genetic Algorithm (BGA). The meaning of
cross-over between two strings is that both of the two strings undergoing the process
will lose certain parts of it, and the lost part fill be filled with part from other strings.
This process of marriage between two strings is said to be cross-over. The resultant
modified strings are said to be offspring. A mutation is a process where a string’s
digits are randomly chosen and assigned with a random value (binary string 0 or
1). BGA finds its use in feature subset selection. The process starts with population
generation, meaning, and creation of strings. N number of strings are created. Each
string will have m number of binary digits, equal to the high dimensional dataset’s
total count of features. Once strings are generated, then the fitness of every string
is computed. Features corresponding to 1 alone in strings are congregated, and the
resultant dataset is called derived dataset. A derived dataset, a classifier is created,
and that classifier is evaluated. The classifier’s accuracy is set as the fitness value
of that string. If the classifier’s accuracy is more, then the fitness of the string will
also be more. Thus every string of the entire generated population finds its fitness
value. This kind of methodology where a classifier is generated to fix the fitness value
is called wrapper-based methodology. Once every string had its fitness found, then
the first k strings are chosen to be part of the reproductive pool. In the reproductive
pool, pairs of strings are chosen randomly, and they are subjected to cross-over and
mutation. BGA used in work uses a single point cross over.
4 Experiments and Result
There are many dark areas in clinical data analytics, like genomic data analytics,
which can solve genetic and hereditary diseases. These diseases data set is considered
from the UCI ML standard repository. We can now identify a genetic disease occur-
rence, but the cure can not be given. However, once the genomic data research/bio-
informatics unfolds the secrets of genetic code, then wonders can be done in curing
incurable diseases, and many unknown areas like the one that is mentioned in our
research that is the randomness in disease progression, the key for this riddle might be
in the genetics field. Nowadays, computation infrastructure is very much ready, and
there is the availability of fast processing systems like supercomputing and cluster
computing, and the platform to share the enormous data is also getting shape through
the cloud and sample data storage. The advancement of big data analytics is in the
budding phase, and once this reaches a matured phase, with high computing powered
machines along with efficient big data analytics algorithms with enormous support
data available, most of the health care problems can be solved which helps people
lead a more happy life. Every symptom that is detected during suffering from the
disease is due to some parameters going wrong. The flaw in a specific parameter is
caused due to various reasons. The entity which brings flaw to a specific parameter
is said to be a causal entity. All the entities which are causal for a specific param-
eter are called Concepts. Many flawed parameters characterize the disease, and each
parameter has its own set of concepts. The concept sets of vital parameters may
intersect. If we represent the concept dependencies, we end up getting a map data
structure, which depicts interdependencies of concepts, and it is called a cognitive
concept map. In order to set right the parameters, the concepts have to be provoked.
The weigh of involvement of concepts in deciding the parameters is patient-centric.
It can be taken as a problem statement, and a solution can be provided for accurate
prediction of the percentage of involvement of concepts in tweaking the features
of vital parameters. For example, if red blood cells count is said to be a parameter
and this count can be altered through tweaking one or more concepts, how much to
tweak is patient-centric. If this can be done, patient-centric targeted treatment can
be provided. In today’s scenario, time-series data is available in abundant quantities
both for in and outpatients. Every hospital has electronic medical records for all of
their patients. These data are now getting shared in cloud platforms. Even though
there is no standardized mechanism to share the data is not available currently due to
various privacy data laws, the data can be shared with patients’ consent, But the time
series data corresponding to fetal development is very scarce. Not much research
has been done in capturing many vitals or parameters during the fetal development
phase. Currently, the data being captured development phase is very minimal, and
it is of non-invasive type. If there is a safe and commonly usable minimal inva-
sive technology is developed for fetal analysis, many genetic disorders can be out.
The fetus’s presently morphological structure is set as a benchmark to analyze the
genetic disorders, which has a very high error rate. If extensive data is collected
during fetal development, through minimal safe invasive and non-invasive methods,
a good repository of sequential data would be obtained to analyze using Computa-
tional Intelligence techniques. Many genetic disorders can be prevented or mutated
upon if they are detected at the correct time, or the decision to abort the fetus can be
taken based on the severity of the genetic disorder. Diseases such as down syndrome,
Huntington disease, fragile x syndrome, hearing loss, sickle cell disease, turner’s
syndrome, Fragile X syndrome, and many more can be detected more accurately.
As per Figs. 5, 6, 7, 8, 9 and 10 describes various parameters predicted using
proposed C4.5 and PSO. The behavioral and social communication pattern data and
fetal development data can be correlated by analyzing autism and Asperger syndrome.
In the previous idea, analyzing fetal data, a genetic disease of morphological disor-
ders can be identified. However, in this case, intellectual ability can be predicted
through fetal time series data if the current intellectual disability is successfully
correlated with fetal clinical data. Intelligent prosthesis or learning limbs: Presently,
much research has brought good results in designing sophisticated weightless arti-
ficial limbs or prosthesis. Nevertheless, still much more can be done to make a
prosthetic limb more intelligent. For example, if the pattern of ordinary people’s
movements and activities are captured, having parameters such as pressure in the
joints, angular velocity and stress-induced angle changes, vibrations, flexibility. The
Fig. 5 Disease support with

frequency
Fig. 6 Various Disease with

level parameter-1
Fig. 7 Various Disease with level parameter-2

level parameter-3
relation between the patterns can be understood, and the prosthetics can also adjust
the parameters, just like a normal limb. For example, the parameter changes during
running are captured well, and then the training can come out to be fair and so the
prosthetics leg can even be designed to run in the same manner with which an average
person run. This knowing can be utilized in developing humanoid robots too.
Sensory organ functionality is dependent on neurological structure. With the
advancement in neural and deep learning methodologies, a sensory organ function
can be emulated artificially. Artificial and efficient sensory organs are the theme

level parameter-4
Fig. 10 Various Disease with level parameter-5
of the future. Imagine an artificial eye capable of seeing than a normal eye and
ear, hearing more than its natural counterpart. Artificial sensory organs using neural
networks need needs a long way to go. However, proper funding and much research
coordination in this domain will revive many special people’s lives. Drug suggestion
is another area where computational intelligence algorithms can be applied. Drug
sensitiveness varies from patient to patient.
Moreover, the effect of drugs to vary from patient to patient. Using cognitive maps
and weight optimization algorithms, patient-centric drug-related decisions such as
what type of drug, quantity, duration, and mode of delivery can be decided. The
proposed objectives to improve diagnostic prediction in clinical Data predication
Approaches are achieved through improving upon accurate staging, progression
prediction, and efficient preprocessing of data through feature selection. The research
work of the paper is summarized as follows. This work also used coronary heart
disease as a reference to verify the Algorithm. The proposed method’s highlight is to

arrive at a patient-centric possible disease stage transition sequence using nontime
series data. Unlike most of the methods, which predicts the next stage for a patient
having a specific disease using clinical time-series data, the proposed Algorithm
uses nontime series data corresponding to different persons. The proposed method
uses a novel approach rooted in vector algebra, gravitational force-based, and nearest
neighbor property.
5 Conclusions
The proposed algorithm gives a solution to the problem statement’s third objective:
feature subset selection using a wrapper-based method with heuristic optimization
algorithms such as modified particle swarm optimization algorithm and Genetic
Algorithm. However, some previous works on this field use heuristic algorithms that
did not address exploring and exploiting heuristic algorithms together. The proposed
work hybrid methodology based on the C4.5 decision tree with PSO enhances both
exploration and expletory processes through genetic Algorithm and modified particle
swarm optimization algorithms. An evaluation parameter called the trade-off factor
is proposed, which is used to evaluate the selected features.
It has been found that computational intelligence algorithms are indispensable
in health care applications. In the further coming years, computational intelligence
algorithms will rise only because of its efficient functioning mechanisms due to
much energy is getting into research in these domains. The research on clinical data
analytics holds the key to future diagnostics and treatment. Clinical data analytics
is in the starting stage from where it will revolutionize the health care industry.
Technology support in the health care industry pertains to clinical tests, and in the
last five decades, the use of technology in testing has grown, but the application of
technology in the diagnostics phase is still not reliable. Extensive research is needed
to come out with concrete results to be trusted upon the technology in the decision.
Some of the future research works that can be taken up to enhance clinical Data
predication Approaches are discussed in the next section.
References
1. Herland, M., Khoshgoftaar, T.M., Wald, R.: Survey of clinical data mining applications on
big data in health informatics. In: Proceedings of ICMLA ’13—vol. 02, pp. 465–472. Google
Scholar Digital Library Physionet-MIMICIII [n.d.]. https://archive.physionet.org/physiobank/
database/mimic3cdb/
2. Cai, X., Perez-Concha, O., Coiera, E., Martin-Sanchez, F., Day, R., Roffe, D., Gallego, B.: Real-
time prediction of mortality, readmission, and length of stay using electronic health record data.
J. Am. Med. Inf. Assoc. 23(3), 553–561 (2016). https://doi.org/10.1093/jamia/ocv110
3. Li, L., Cheng, W.-Y., Glicksberg, B.S., Gottesman, O., Tamler, R., Chen, R., Bottinger, E.P.,
Dudley, J.T.: Identification of type 2 diabetes subgroups through topological analysis of patient
similarity. Sci. Trans. Med. 7, 311 (2015)
4. Sirisati, R.S.: Machine learning based diagnosis of diabetic retinopathy using digital fundus
images with CLAHE along FPGA Methodology. Int. J. Adv. Sci. Technol. (IJAST-2005-4238)
29(3), 9497–9508 (2020)
5. Purushotham, S., Meng, C., Che, Z., Liu, Y.: Benchmark of deep learning models on large
healthcare MIMIC Datasets. CoRR abs/1710.08531 (2017). https://arxiv.org/abs/1710.08531
6. Sirisati, R.S.: Dimensionality reduction using machine learning and big data technologies. Int.
J. Innov. Technol. Explor. Eng. (IJITEE-2278–3075) 9(2), pp 1740–1745 (2019)
7. Pai, S., Bader, G.D.: Patient similarity networks for precision medicine. J. Mol. Biol. (2018)
8. Pai, S., Hui, S., Isserlin, R., Shah, M.A., Kaka, H., Bader, G.D.: netDx: Interpretable patient
classification using integrated patient similarity networks. bioRxiv (2018)
9. Kanungo, T., Mount, D., Netanyahu, N., Piatko, C., Silverman, R., Wu, A.: An efficient K-means
clustering algorithm analysis and implementation. IEEE TPMAI 24(07), 881–892 (2002)
10. Mao, Y., Chen, W., Chen, Y., Lu, C., Kollef, M., Bailey, T.: An integrated data mining approach
to real-time clinical monitoring and deterioration warning. In: Proceedings of SIGKDD’12,
pp. 1140–1148 [n.d.]
11. Ma, T., Zhang, A.: Integrate multi-omic data using affinity network fusion (ANF) for cancer
patient clustering. In 2017 IEEE International Conference on Bioinformatics and Biomedicine
(BIBM), pp. 7–10. IEEE (2017)
12. Yu, Shi.: Multiclass spectral clustering. In: Proceedings Ninth IEEE International Conference
on Computer Vision, vol. 1, pp. 313–319 (2003). https://doi.org/10.1109/ICCV.2003.1238361
Software Defect Prediction Using
Optimized Cuckoo Search Based
Nature-Inspired Technique
C. Srinivasa Kumar, Ranga Swamy Sirisati, and Srinivasulu Thonukunuri
Abstract These days, software systems are very complex and versatile. Therefore
it is essential to identify and fix the software error. Software error assessment is
one of the most active areas of research in software engineering. In this research,
we are introducing soft computing methods to assess software errors. Our proposed
technique ts software gives errors and accurate results. In our proposed method, the
error database is first extracted, which acts as an input. After that, the collected input
(data) is clustered by the clustering technique. For this purpose, we use the modified
C-Mean Algorithm. Therefore, the data is clustered. An efficient classification algo-
rithm then groups clustered data. For this reason, we use a hybrid nervous system.
Therefore, there are software bugs, and these errors are optimized using the MCS
algorithm. Our proposed method for software error assessment is implemented on the
Java platform. Performance measurement is measured by various parameters such
as execution rate and execution time. Our proposed Cuckoo search based strategy
is comparable to many existing strategies. Graphical representation of comparison
results from our proposed strategy for identifying software proposals is one that
effectively evaluates profitable strategy and reasonable reference rates.
1 Introduction
Software Defect Prediction (SDP) plays an essential part in reducing software devel-
opment costs and maintaining Achilles’ and others’ high quality (2017). When there
is a recurring software failure in the system, it automatically causes a software
error. Software error is a bug introduced by software developers and shareholders.
A software vulnerability assessment’s primary purpose is to improve the quality,
C. Srinivasa Kumar (B) · R. S. Sirisati

Department of CSE, Vignan’s Institute of Management and Technology for Women, Kondapur,
Ghatkesar Mandal, Telangana, India
S. Thonukunuri
Department of Mathematics, Vignan’s Institute of Management and Technology for Women,
Kondapur, Ghatkesar Mandal, Telangana, India
https://doi.org/10.1007/978-981-16-1502-3_19
184 C. Srinivasa Kumar et al.
marginal cost, and time of software products. For high-performance error assess-
ment, researchers and others have been working on selecting consistent features and
experimental learning algorithms since the 1990s (2014). To assess the error-ability
of those who support software testing activities. Software errors are a significant
cause of failure for large engineering projects, causing significant financial damage
in the twenty-first century. In software quality, various error assessment methods are
proposed. The strategy is used on various assumptions, including source code metrics
(e.g., alignment, coordination, size) by. Software vulnerability assessment helps to
test resources through software modules to address their vulnerability effectively.
Current software error assessment models for estimating the number of errors. The
software module may fail to provide an appropriate command because accurately
estimating the number of errors in a software module due to noise data is chal-
lenging. Each software error arises in different conditions and environments and
therefore differs in its specific characteristics. Software errors can have a substantial
negative impact on software quality. Therefore, error assessment in software quality
and software reliability is exceptional. Comparative Software Quality Engineering is
a new area of research in the distorted assessment (2014). Current Error Assessment
Function (1) Calculate the number of errors remaining in the software system, (2)
Identify the error associations, and (3) Classify the error-characteristic features of the
software components that are generally error-free and error-free. The reference result
can be used as a necessary step by the software developer can control the software
process (2009). Software Error Prediction (SDP) empirical studies are very biased
with data quality suffer from widely limited generalizations (1986). False assump-
tions can help improve software quality and reduce the distribution cost of those
software systems. In 2005, SDP research overgrew. It allows researchers to collect
error assessment data sets from real-world projects for public use and create repetitive
and comparable models throughout the study. To date, many SDP based works have
done extensive research on matrix and learning algorithms that describe code modules
for designing prediction models (2014). Therefore software vulnerability assessment
plays an essential role in improving software quality. This software can help reduce
testing time and cost. Therefore, it is used in many organizations to save time, improve
software quality, software testing, and project resources. Assessing software vulner-
abilities for errors in historical databases. In the real world, lumbering elephants are
exposed by the aggression of speeding dwarfs. As software projects grow in size,
defective assessment technology plays an essential role in supporting developers and
speeding up the time to market with more reliable software products [2] (Fig. 1).
2 Parallel Works
The general software error assessment procedure follows the machine learning
methods. The first step is to find examples from the software. An example of code,
function, class or method. These examples arise from various problem tracking
systems, version control systems, or e-mail archives. For example, the software has
Software Defect Prediction Using Optimized Cuckoo Search … 185
Fig. 1 Software defect prediction model block diagram
different dimensions. These examples can be classified as Bug B or Bug Number,

Clean C or Clean. After identifying examples using ranges and dimensions, the first
step of machine learning pre-processing methods is used to create new examples.
Pre-processing is applied to capture features, measure data, and mute noise (2014)
[3, 4]. It is not mandatory to apply to all types of error assessment models. After the
pre-processing, examples were created to practice the error assessment model. The
model of the model causes distorted events and pure events. The number of errors
in the example is called regression. This event only gives false or altered results
for both, so it is called binary classification. There are many applications for soft-
ware bug prediction. Its primary purpose is to allocate resources to test software
products effectively. Error Assessment Model produces error encounter software,
and its scope. Once the reference model is built, its performance should be eval-
uated. Performance is usually measured in two ways: power presents energy and
descriptive energy. Pride Dimensions Predictive power: power measures a model’s
accuracy for injecting software artifacts with absent power defects. Accuracy, recall,
F-measurement, AUCRC, false-positive rates on X-axis, and reasonable favorable
rates on Wi-axis are all used in the classification range and are commonly used
in error assessment studies. Diffusion Dimensions Diffusion Energy: In addition
to measuring power dissipation energy, descriptive energy is also used in distorted
studies. The descriptive power model measures how well one understands the differ-
ence in data. The measurements described for R2 or standard deviation are commonly
used to determine the descriptive strength [5–9].
3 Proposed Modified Cuckoo Search Technique.
Yang and Deb recently introduced all Cuckoo search optimization methods. Cuckoo
has an aggressive breeding strategy. The female lays her fertile eggs in another
species’ cage, so surrogate parents inadvertently raise brother Atul Bisht and others
(2012) [10]. Coconut eggs are sometimes found in the nest, and surrogate parents
either throw it or throw it into the nest or start their flock elsewhere. Cuckoo Search
Optimization Algorithm considers various design parameters and controls based on
the three main compatibility rules of Azim et al. (2011) (1) Each Cuckoo lays one egg
at a time and lays it randomly in the selected nest. (2) Good nests with high-quality
eggs are passed on to the next generation; (3) The number of host nests available is
determined, and the hockey bird’s ability determines the number of Cuckoo eggs. In
this case, the host bird can lay eggs or build a new nest. This straw finally selected
can be calculated using the n furnace fraction of the current frequency for simplicity.
It needs to replace with a new chamber (using new random solutions) in the next
cycle. This method has been successfully demonstrated in some benchmarking tasks.
The particle optimization method is better than other methods, including manual
(2007). Cuckoo Search Algorithm is a metaheuristic algorithm inspired by Cuckoo’s
reproductive nature and is easy to implement. There are plenty of places for cocaine.
Each egg represents a solution, and the nasal egg represents a new solution. The
parasites of some species of chickens are unusually attractive. These birds can lay
eggs in the host nest and mimic external features such as the host egg’s color and
color. If this strategy is not successful, the host may throw an egg out of the nose or
leave the nest, leading Azimuth to others (2011) [11–13]. Based on this situation, the
researchers developed an evolutionary optimization algorithm called Cuckoo Search
(CS) and collected CS using their own rules:
Coockoo Search Optimization cost function
Min CS(S) = Min[cs1(S), cs2(S), . . . , csM(S)] (1)
Inequality Constrains
gb (S) ≥ 0, b = 1, 2, . . . , c (2)
h l (S) = 0, l = 1, 2, . . . , a (3)
Here Eq. (1) represents Coockoo Search cost optimization function for software
predictive parameters, Eqs. (2), and (3) represents constraints to make inequalities
for searches. The new solution satisfies the N-Dimensional Boolean lattice. The
solutions are updated in the corners of the hypercube. Additionally, suppose a given
attribute is selected or not. In that case, the solution uses a binary vector, where an
attribute is selected to create the new dataset and if not 0. In our particular way,
the solution represents the value of the attribute. Weight optimization used in the
modified Cuckoo search algorithm. The Cuckoo search algorithm refers to a meta-
heuristic algorithm that attributes its origin to Cuckoo’s reproductive behavior and
is easy to implement. There are many nests for the nose. Each egg signals a solution,
and a Cuckooed egg matches the new solution. Novel and best solutions instead of
the nest’s terrible solutions. As a modified nervous system, we have modified the
standard Cuckoo search algorithm to include the gas supply during the upgrade phase
levy uses the flight equation.

Sb t = Sb(t) + 0.01 × α × L(β) × (P1(t) − P2(t)) × m
Optimization in gas supply is better than usual. The methods of the optimization
process are shown as follows (Fig. 2):
Fig. 2 Flow of modified

Cuckoo search algorithm
Algorithm-1: Modified Cuckoo search algorithm (Phase-I)

1. Each Cuckoo randomly selects a N host nests to lay eggs Xi
2. The number of host nests available is determined randomly hops i
3. The nests containing the best quality eggs Xi are passed on to the next generation fitness (Fi)
4. Select n randomly j
5 If Fi < = Fj (the host finds an egg in the bird’s nose, it may lay eggs or leave it.)
4. Early stages j be solution
5. Let and j new step
Replace j. Evaluate fitness performance Pα
7. Modify using the Levy flight equation
8. Find best the result
9. Stop
Algorithm-2: Modified Cuckoo search algorithm (Phase-II)

Step 1: Get started
The host nest population (MI, where i = 1, 2, n) begins unilaterally
Step 2: Creating a new cocaine step
With the help of Levi’s aircraft, Cuckoon was randomly selected to create new solutions. It is
assessed to determine the dominance of carved Cuckoo solutions
Step 3: Fitness Assessment iterations 9 and 10 best assess fitness here by choosing the following
equations. Fitness Maximum popularity
SP - TP refers to the selected population - refers to the total population
Step 4: Restore step
Initially, the levy is applied by planes, resolving the cautionary transition. The
quality of the novel solutions is assessed, and one of them is selected arbitrarily.
Suppose the quality of the novel solution in the selected niche is better than the
previous solution. It replaces using a new solution (Cuckoo). Otherwise, the previous
solution is considered the best solution.
4 Results and Discussion
Software error assessment is a recent research topic; Many researchers have focused
on providing efficient technology by providing software quality. Various technolo-
gies have been suggested and used before, but all have some limitations. Improving
software quality is the primary goal of our specific software vulnerability assessment
method (Table 1).
Improves software performance and efficiency. The targeted software is imple-
mented in Java using the error prediction platform, Netbeans 8, and JDK 1.8. This
section examines our performance based on various performance steps and provides
sample results of the experiments. The reference method’s effectiveness is evaluated
in our specific software using evaluation metrics such as software execution time and
reference rate. The evaluation metric evaluates our specific software, shows the eval-
uation methods’ effectiveness, and justifies these systems’ theoretical and practical
Table 1 Evaluated parameters for software defect prediction in Cuckoo based search
Automation_scope Brd_availability Build_quality Change_in_schedule Complexity Criticality Dependencies_criticality
No Yes 3 No High High Medium
No Yes 3 No High High Medium
No No 3 No Medium Medium Medium
No No 3 No Medium Medium Medium
Development_methodology Documentation_quality Environment Environment_downtime Fs_availability No_of_defects No_of_requirements
Waterfall 5 Dev,SIT, UAT Yes Yes 10 3
and Production
Waterfall 5 Dev,SIT, UAT Yes Yes 100 38
and Production
Hybrid Agile 4 Integration, Yes Yes 12 24
Regression,
Production
Hybrid Agile 4 Integration, Yes Yes 6 15
Regression,
Software Defect Prediction Using Optimized Cuckoo Search …
Production
No_of_test_cases No_of_test_scenerio Release_duration Requirement_validation Technology Type_of_requirement Unit_test_defects
150 25 12 Yes Java 8, Oracle 12 g, Thick Non Functional 5
client
700 70 24 Yes Java 8, Otracle 12 g, Thick Functional 70
client
167 0 8 Yes . NET Functional 0
130 0 7 Yes . NET Functional 0
189
Fig. 3 Number of complexity versus No. of defects
Fig. 4 Number of defects and No. of defects
development. Compares with the algorithm of the future. A specific task’s execution
time is defined by how long the system performs that task, including runtime or
system service execution time.
Prophecy is the announcement of an unexpected event. It is often, but not always,
based on experience or knowledge. There is no agreement with the exact difference
between the two terms; Different authors and categories explain different meanings
(Figs. 3, 4, 5 and 6).
5 Conclusion
Software quality depends entirely on reliable and error-free software. Therefore,

it is necessary to find a solution to fix software errors. Define a software error or
Cuckoo based Prediction of Test Cases
750
700
563 550
Test cases
525
413
150 167 130 150 180

113 125 98 113 135
25 15
19 11
1 2 3 4 5 6 7 8 9 10
Technologies
Number of Test Cases (Original)
Number of PredictedTest Cases Proposed (Advanced Cuckoo based)
Fig. 5 Cuckoo based prediction of test cases
Cuckoo based Prediction of Software Defects
255
235
Faults/Bugs
200 191
176 174
150
120 131
100 90
75
10 12 6 29
22
8 9 5
1 2 3 4 5 6 7 8 9 10
Software Platforms
no_of_defects Number of Predicted Defects
Fig. 6 Cuckoo based prediction of software defects
bug that could lead to an error, bug, error, and bug, error in a computer program or
system or lead to a planned result. Some methods for assessing software damage are
widely adopted, including Bayesian networks, SVMs, Innocent BIOSes, and other
methods. Here, for clustering, we use the modified Cat-fish Algorithm (MFCM) in our
recommended technology. In the future stage estimation process, the hybrid neural
network and the MCS algorithm are used for the best estimation rate. In addition,
we improve the efficiency of software error detection methods using MFCM and
HHN with MCS. We analyzed the literature survey to find some software flaws in
the software industry assessment process. Here, some of them have been greatly
improved. Several strategies have been observed for improved efficiency; However,
it has several limitations.
References
1. Balogun, A.O., et al.: Performance analysis of feature selection methods in software defect
prediction: a search method approach. Appl. Sci. 9(13), 2764 (2019)
2. You, X., Ma, Y., Liu, Z.: An improved twin support vector machine based on multi-objective
cuckoo search 291. An improved artificial bee colony algorithm for solving parameter
identification problems. Int. J. Comput. Sci. Math. 8(6), 570–579 (2017)
3. Sirisati, R.S.: Dimensionality reduction using machine learning and big data technologies. Int.
J. Innov. Technol. Explor. Eng. (IJITEE-2278-3075) 9(2), 1740–1745) (2019)
4. Sirisati, R.S.: Machine learning based diagnosis of diabetic retinopathy using digital fundus
images with CLAHE along FPGA methodology. Int. J. Adv. Sci. Technol. (IJAST-2005-4238)
29(3), 9497–9508 (2020)
5. Malhotra, R.: A systematic review of machine learning techniques for software fault prediction.
Appl. Soft Comput. 27, 504–518 (2015). https://doi.org/10.1016/j.asoc.2014.11.023
6. Rong, X., Cui, Z.: Hybrid algorithm for two-objective software defect prediction problem. Int.
J. Innov. Comput. Appl. 8(4), 207–212 (2017)
7. Yang, W.-H., Liu, J.-R., Zhang, Y.: A new local-enhanced cuckoo search algorithm. Int. J.
Comput. Sci. Math. 8(2), 175–182 (2017)
8. Yang, X.S., Deb, S.: Cuckoo search via levy flights. In: NaBIC 2009: World Congress on Nature
and Biologically Inspired Computing, Coimbatore, India, pp. 210–214 (2010)
9. Yang, X.S., Deb, S.: Multiobjective cuckoo search for design optimization. Comput. Oper. Res.
40(6), 1616–1624 (2013)
10. AL-Saati, N.A., Abd-AlKareem, M.: The Use of Cuckoo Search in Estimating the Parameters
of Software Reliability Growth Models. arXiv preprint arXiv:1307.6023 (2013)
11. Cai, X., et al.: An under-sampled software defect prediction method based on hybrid multi-
objective cuckoo search. Concurrency Comput. Pract. Exp. 32(5), e5478 (2020)
12. Cao, Y., et al.: An improved twin support vector machine based on multi-objective cuckoo
search for software defect prediction. Int. J. Bio-Inspired Comput. 11(4), 282–291 (2018)
13. Han, W., et al.: Cuckoo search and particle filter-based inversing approach to estimating defects
via magnetic flux leakage signals. IEEE Trans. Magnet. 52(4), 1–11 (2015)
Human Facial Expression Recognition
Using Fusion of DRLDP and DCT
Features
M. Avanthi and P. Chandra Sekhar Reddy
Abstract Recognition of facial expressions is a major challenge in the field of

computer vision. Using single-function models, the level of acknowledgment even
in controlled capture conditions is considerably small. This paper proposed a method
for facial emotion classification with the fusion of dimensionality reduced local
directional pattern and discrete cosine transform features using SVM classifier. Local
characteristics are extracted utilizing DRLDP, and global characteristics are extracted
from facial expression images using DCT. SVM is used to classify the face images
into six emotions (surprise, smile, sad, anger, fear and disgust). This method is
experimented on JAFFE database and compared with existing approaches shows
higher classification rate.
1 Introduction
Facial expression recognition plays an important role in computer vision-based appli-

cations like human–computer interaction, video interaction, cataloging, biometrics,
including image recovery, with security, etc. Facial expression was its adjustments in
the face in support of the inner emotional states as well as intentions of an individual
person. Emotion is a familiar word used at a given moment for a person’s feelings
like surprise, smile, sad, anger, fear and disgust. Generally, emotions are identified
with very little attempt of the human intelligence. Facial emotions machine iden-
tification and classification are cumbersome to realize people’s feelings. An algo-
rithmic methodology of classification is used for the labeling in one of the predefined
sequences of provided input data. A classification algorithm is a template which
executes the input data category.
One is the geometric methods of extraction based on features, while the other is the
technique for extraction of features based on appearance. Geometric characteristic
methods [1] derive the position but structure of facial components includes nose,
eyes, mouth but eyebrows. The remaining part of the paper is organized as follows.
M. Avanthi (B) · P. Chandra Sekhar Reddy

CSE Department, GRIET, Hyderabad, Telangana, India
https://doi.org/10.1007/978-981-16-1502-3_20
194 M. Avanthi and P. Chandra Sekhar Reddy
Section 2 proposed the methodology adopted; experimental results are given in Sect. 3
and conclusion in Sect. 4.
2 Methodology
After acquisition, the next sequence is to extract the information from input data,
attributes such as eyes, nose, cheek, mouth, in case of geometric feature-based
technique. Two main methods are used for the production of facial expressions
(Fig. 1).
2.1 Local Directional Pattern
The local directional pattern is an 8-bit code representing edge responsiveness value.
Kirsch masks (M0, …, M7) shown in Fig. 2 are used to find edge response value in
eight directions. LDP is computed considering only three prominent edge responses.
Fig. 1 Architecture of facial expression

Human Facial Expression Recognition Using Fusion … 195
Fig. 2 Edge response masks of Kirsch in eight directions
2.2 Facial Expression Recognition Using DRLDP
In this, human face reorganization method is shown in Fig. 3. The input images
are preprocessed to decrease the noise, lighting recompense plus resizing. Then
DCT is utilized to extract the feature vector. DRLDP [2] is utilized to diminish the
measurements of extracted features. Features be particular as input to SVM classifier
pro training the model. Then knowledge information base is updated. SVM classifies
the test image into six different expressions such as shock, fear, sadness, joyfulness,
vexation and disgust.
2.2.1 Dimensionality Reduced Neighborhood Directional Examples
The suggested size reduced neighborhood positional example (DRLDP) is an eight-

piece code assigned to each size three to three sub-districts. That software speaks
to the square’s textural instance. LDP is a single eight-piece code by each 18 a 3/3
square pixel. Both for square, the suggested DRLDP estimates a single eight-piece
script. Models such as that of LDP are the suggested DRLDP statistics; however,
differences arise in view of the fact which post handling of LDP design elements
acquired for a square reduces the illustrations to a solitary eight-piece code.
For example, believe a picture I of size A × B. Let p = A/t, and q = B/u.
For the picture I, the number of sub-images shaped is = A × B t × u ≡ p × q.
The size of every sub-picture is ai = A/p × B/q ≡ A × B/a pixels. We describe
the RR as the ratio of the no. of pixels in the input picture mapped onto the no. of
pixels in the reduced image.
No. of pixel in the input image

Redundancy Ratio(RR) =
No. of pixel in reduced image
Fig. 3 Detected features
A×B
For an image I, RR = A·B
= p×q =a
p×q
On the basis of two parameters t and u, the generalized DRLDP is supported. The
general practice is to describe filters of size n × n, i.e., a square mask. Therefore, it
is unspecified that t plus u are equal.
2.3 Discrete Cosine Transformation
Two-dimensional DCT is used mainly to exclude the worldwide highlights from the
exterior presence studies. The full face image is provided as a submission to DCT.
From the start, the image is divided into sub-image squares (8 × 8), and then subse-
quently discrete cosine transformation is used to extract the coefficients from each
square. DCT produces one coefficient of DC as well as sixty-three coefficients were
also dissimilar by each sub-square. Appropriately, it is registered again from above,
and it left coefficients. Every sub-squares separated coefficients include ordinary
vitality including recurrence information of under-square picture variety. Addition-
ally, the upper as well as left sub-square districts speak to the information on the
edge as well as directional substrate.
2.4 Support Vector Machine
Support vector machine—similarly, it is a convincing AI technique or data charac-

terization process; it introduces knowledge visualization into an elevated directional
element space, as well as later finds a straight separation of the hyperplane some
of the most extreme edges to differentiate data in the specified higher-dimensional
space. SVM makes parallel choices, because of that multi-class grouping is capable,
and this method teaches double classifiers to split one articulation as a whole, but
also produces the largest yield of dual scheme class.
2.5 Classification
For instance, upbeat, shock, outrage, tragic, dread, appall and unbiased will be used
for intonation orders, and so on, and multi-class SVM is obtained. Seven categories
are used for characterizing knowledge here. SVM is used for the conversion of Gabor
highlights into vector structure. At the stage where the photo is provided as details
again for test, Gabor is rendered on the direction of such an image, but instead
transformed into a vector afterward. The information is isolated in two sections in
SVM—training set and testing set, each involving the outline of the property. Each
model is containing one objective method class name and a few traits.
2.6 Fusion
By suggesting a detailed design clustering technique, the component vectors disen-

tangled from either the input images are entangled. Straight, presently, permutation
combination strategy is 20 used to intertwine the component vectors through using
DCT as well as DRLDP, which have been removed again from data images. A mixture
is used to enhance precision, increase efficiency and extend the power of the frame.
Currently, combination schemes for summation as well as PCA are being used to
intertwine the neighborhood as well as the worldwide illustrates extracted from facial
images.
See Figs. 3 and 4.

See Figs. 5 and 6.
See Fig. 7.
Fig. 4 Result of the DRLDP
Facial expression recognition results with LDP
Fig. 5 Accuracy of the input image

Fig. 6 Accuracy of the Input Image
Facial expression recognition results with DRLDP
Fig. 7 Accuracy of the input image
The need for identification of facial expressions is rising rapidly. This approach is
based on the combination of local and global significant features. This paper proposed
a method for facial emotion classification with the fusion of dimensionality reduced
local directional pattern and discrete cosine transform features using SVM classifier.
Local characteristics are extracted utilizing DRLDP, and global characteristics are
extracted from facial expression images using DCT. These features with SVM have
classified considered database images for emotions with higher classification rate.
Reference
1. H.-B. Deng, L.-W. Jin, L. Zhen and J. C. Huang, A New Facial Expression Recognition Method
Based on Local Gabor Filter bank and PCA plus LDA International journal of Information
Technology, vol. 11, (2005).
2. R. S.P., P.V.S.S.R. C.M.,Dimensionality reduced local directional pattern (DRLDP) for face
recognition, Expert Systems with Applications, (2016) 63 , pp. 66–73.
Brain Tumor Classification
and Segmentation Using Deep Learning
Manohar Madgi, Shantala Giraddi, Geeta Bharamagoudar,

and M. S. Madhur
Abstract The brain is human body’s most powerful organ and is responsible for
regulating and maintaining all the body’s essential life capabilities. Tumors are the
outcome of anomalous and uninhibited cell division. A tumor is an aggregation of
tissue that is formed by tremendous cell growth, which continues to grow. A brain
tumor is produced in the brain itself or is grown and relocated in another place. No
distinguishing cause for the growth of brain tumors has been recognized till date.
Although tumors are not very common in the brain (worldwide brain tumors account
for just 1.8% of total tumors recorded), the mortality rate of malignant brain tumors
is very high due to criticality of the organ. Early detection of brain tumor is a diffi-
cult job for doctors. In this paper, authors introduced and implemented a method
for classifying brain images with magnetic resonance as normal or abnormal. The
abnormal images are further segmented to detect the brain tumor. Classification accu-
racy achieved is 100%. For segmentation, sensitivity achieved is 85%. Segmentation
helps physicians to decide the course of treatment.
1 Introduction
The brain is a complex organ as it is made out of different cells. It includes 50–100
billion neurons. A Brain tumor can impact individuals of all ages. Tumors affected
approximately 80,271 people in India in the year 2007. The National Cancer Institute
(NCI) determined that in 2009 22,070 cases of brain tumor and the other disease of
the central nervous system (CNS) were reported in the USA.
M. Madgi · G. Bharamagoudar · M. S. Madhur (B)

Department of Computer Science and Engineering, KLE Institute of Technology, Hubballi,
Karnataka 580027, India
S. Giraddi
Department of Computer Science and Engineering, KLE Technological University, Hubballi,
Karnataka 580031, India
e-mail: shantala@kletech.ac.in
https://doi.org/10.1007/978-981-16-1502-3_21
202 M. Madgi et al.
Brain Magnetic resonance images without tumor
Brain Magnetic resonance images with tumor
Fig. 1 Magnetic resonance images of brain without and with tumor
There are generally two forms of brain tumor, primary and secondary. A main brain
tumor is a tumor that originates in the brain. Secondary tumors begin at other parts of
the body and spread to the brain. The main tumor can be harmless or injurious. The
healthy brain tumor is referred to as benign, while the dangerous tumor is referred to
as malignant tumor. The benign kind of tumor grows bit by bit, and it rarely spreads
to various regions of the body. It has distinct boundaries. Ultimately, this sort of
tumor can be eliminated by operation and there are fewer chances to return. The
malignant sort of tumor rapidly increases than the benign kind of tumor. Healthy
brain cells also get affected by this sort of tumor. Such a tumor can appear back
extensively after a clinical method. It can spread to various regions of the brain or
spinal line. Detection of brain tumor is a challenging task. Diagnosis begins with
MRI. Even though other modalities like computed tomography (CT) and ultrasound
exist, MRI is the most appropriate for brain tumor detection. MRI plays an important
role, as mode of treatment depends on the nature of the tumor. Type of tumor can be
determined with a biopsy. Figure 1 shows brain MRI without and with tumor.
1.1 Mask R-CNN Architecture
Mask R-CNN uses the region proposal network (RPN) to spot items that divide
the image into anchors where the image is traversed by sliding windows and areas
of interest. The groundwork of this architecture is a ResNet101-CNN, in which
initial layers detect low-level and higher-level characteristics recognized by next
layers. Mask R-CNN uses function pyramid network (FPN) to raise the regular
element extraction pyramid by unveiling an extra pyramid that takes suggestive-
level highlights and transfers them down to the lower tiers, allowing all levels to
address highlights at both upper and lower levels.
Mask R-CNN is a continuation of faster R-CNN, and it consists of a further-
more fully convolution network FCN. Faster R-CNN performs object detection by
Brain Tumor Classification and Segmentation Using Deep Learning 203
Fig. 2 Faster R-CNN extended by FCN to form mask R-CNN
providing a bounding box over the object in a scene. Faster R-CNN comes with two
outputs, class label for the object and bounding box over the object. Fast R-CNN is
extended by FCN which performs the segmentation by classifying each pixel. The
working of mask R-CNN is shown in Fig. 2.
FCN: Using different convolution blocks and max pool layers, this model first
decompresses an image up to 1/32 of its original size. At this point of granularity, it
then makes a class prediction. Finally, it resizes the image to its original dimensions
using sampling and deconvolution layers.
2 Related Work
Malati et al. [1] have suggested completely automated brain tumor segmentation
using neural convolution network. The suggested research performs brain tumor
segmentation using tensor flow, in which high-level mathematical functions are
implemented using the anaconda frameworks. Patient survival rates are improved
through early diagnosis of brain tumor. Brain tumor segments are classified into four
groups such as edema, non-enhancing tumor, tumor enhancement and necrotic tumor.
The result shows that the approach applied only helps to identify tumor enhancement
and assign tumor to the specific area of the tumor.
Talo et al. [2] have presented an approach to classify abnormal brain MR images
using pre-trained deep transfer learning. ResNet34 model is used with data increase,
optimum learning rate finder and fine-tuning. It achieved classification accuracy of
100%.
Wang et al. [3] have suggested the use of cascade of CNNs for brain tumor segmen-
tation. They have proposed a 2.5D network which is a trade-off between memory
requirement and model complexity. It has low memory requirements. Authors
204 M. Madgi et al.
have also employed run time augmentation which has yielded better segmentation
accuracy.
He et al. [4] have presented an approach, called mask R-CNN for object segmen-
tation. The approach detects the object as well as generates a segmentation mask.
The design of mask R-CNN is a continuation of faster R-CNN. To train mask R-CNN
is easy and straightforward.
Chinmayi et al. [5] using Bhattacharya coefficient explored a method for segmen-
tation and classification of brain tumor MRI. They removed the unwanted parts of
the skull using anisotropic diffusion filter. Further, a fast-bounding box of algorithms
extracts the tumor region. They used CNN’s deep learning to train the MRI brain
images. Compare the effects of the proposed approach in terms of precision, simi-
larity, index, PSNR and MSE. The findings will assist the radiologist in determining
a tumor’s size and location.
Dong et al. [6] have suggested noninvasive magnetic resonance techniques as a
brain tumor screening method for detecting brain tumors without ionizing radiation.
Manual segmentation of the volumes of the 3D MRI requires longer, and the output
is focused mainly on the experience of the operator. So, the author suggested a deep
convolution network focused on u-net. They perform this segmentation on BRATS
2015 datasets, which involves 220 high-grade brain tumor glioma and 54 low-grade
cases of tumor. They compared the efficiency of our proposed approach to the deep
neural network based on manual delineated ground truth. U-net provides the excellent
results for key tumor areas.
Havaei et al. [7] have proposed a segmentation of brain tumor using deep neural
networks to glioblastomas MRI image. This form of brain tumor occurs anywhere
in the brain and has every shape, size and contrast as well. The article makes use of
the convolution neural network as an algorithm for machine learning. It utilizes both
local and global characteristics for segmentation of tumors. For research work, the
author uses the BRATS dataset.
Cui et al. [8] developed a novel, automatic segmentation based on cascaded
deep learning convolution neural networks. It has two subnetworks: tumor loca-
tion network (TLN) and intra-tumor classification network (ITCN). The tumor region
from the MRI brain slice is segregated by helping to mark the identified tumor region
into multiple subregions using tumor localization, network and ITCN. The research
was performed on a sample with 220 cases of high-grade glioma (HGG) and 54 cases
of low-grade glioma (LGG), multimodal brain tumor segmentation (BRATS, 2015).
The measurement can be achieved by coefficient of dice, positive predictive value
(PPV) and sensitivity.
Shantala et al. [9] have carried out the analysis on exudate detection in retinopathy
images using DBSCAN clustering and fuzzy classifiers. Accuracy of 90% is obtained
with image-based evaluation.
Shantala et al. [10] have conducted study to detect retinopathy images using
DBSCAN clustering and neural networks that spread the back. The authors performed
image-based as well as lesion-based result analysis. Accuracy of 100% is obtained
with image-based performance analysis.
3 Methodology
Dataset Description: For conducting the brain tumor detection, Kaggle Brain MRI
Images dataset is used. It has 253 images, 98 normal images and 155 anno-
tated abnormal or deceased images. The proposed method was implemented using
Python TensorFlow version 1.15.0 and Keras libraries version 2.2.5. The tests were
performed on processor Intel(R) Core(TM) i3-5005U CPU @ 2.00 GHz, RAM
4.00 GB, operating system 64 bits, a processor based on ~64. The images are resized
to 256 × 256. Eighty percentage images are used for preparation, evaluation 10%
and checking 10%. The training parameters are learning rate is 0.0001 and epoch’s
number is 15.
Transfer Learning: Deep learning requires a large number of samples. Mask R-
CNN requires high time for training where weights are initialized randomly. To
overcome both these drawbacks, we can use transfer learning. In transfer learning,
pre-trained models serve as initial points for training our model. We have used a pre-
trained model mask_rcnn_coco.h5 which has been trained on MS COCO dataset.
MS COCO dataset is object detection and segmentation dataset.
The approach suggested is shown in Fig. 3. The dataset consists of images of
various sizes.
Fig. 3 Proposed methodology of classification and segmentation

206 M. Madgi et al.
Dataset is cleaned by finding the extreme points of the image and crops them into
rectangular shape. Then, images are annotated using the VIA tool, and annotated
data is stored in a JSON file. After this, we copy the mask R-CNN archive which has
the design for mask R-CNN model along with annotated data files. Mask R-CNN
uses ResNet101 architecture to select the component outline from the images. These
outlines of the components are then transferred through a region proposal network
(RPN) that outputs the bounding boxes for the image. Over these image bounding
boxes, we then put a RoI aligned layer to deliver all images to the same size. These
regions are then transferred across a fully connected network to predict the class
mark and bounding boxes. Next, we will measure the region of interest in order to
reduce the calculation time. We measure the intersection over union (IoU) with the
boxes of ground truth for all of the predicted regions. IoU is computed with Eq. 1:
Area of intersection
IoU = (1)
Area of union
Now, we regard that as an area of interest whose IoU value is higher than or
equivalent to 0.5. Otherwise, we are unconcerned about that specific region. We are
doing this for all regions and then consider only one set of regions under which the IoU
has been greater than 0.5. We can add a mask branch to the current architecture when
we have the RoIs centered on the IoUs values. It returns the mask for segmentation
for each area that contains an object. For each region, it returns a mask of size 28 ×
28 which is then scaled up for inference.
In this section, we illustrate the outcomes the proposed framework has achieved. The
device provided is validated using 10% of images. Figure 4 shows the sample images
of classification/segmentation results along with the accuracy. The first column shows
the original images, second column displays the segmented images, third column
indicates whether the images is normal or abnormal, and last column displays the
confidence score. A classifier is assigned to each segmented region of a class label
and a confidence score indicating the “confidence of the classifier” that the label is
right. The method of segmentation and classification where the input of the classifier
is used to achieve a final “stable” segmentation.
5 Conclusion
Brain tumor classification and segmentation using deep learning is achieved through
an innovative technique. In this paper, we exhibit the mask R-CNN design which is
mainly used for object detection, object localization and instance segmentation of
Original Image Segmented Classification Confidence Score

Image
Abnormal 94%
Abnormal
99%
Abnormal
92%
Abnormal 85%
Abnormal 96%
Abnormal 97%
Fig. 4 Segmentation results of mask R-CNN
brain MRI images. Segmentation is a challenging task, and mask R-CNN is applied
to attain extreme excellence results. The exhibited technique has invariant character-
istics in terms of dimension, separation and magnitude of brain tumor. Experimental
growth shows that the exhibited technique works fine in improving, separating and
getting the brain tumor from MRI images. There are various very much alike jobs
in medical image analysis for which probably mask R-CNN-based technique could
be not difficult to enhance the efficiency without major alteration or customization.
The procedure used for selecting right characteristics improves to categorize the
fundamental work into normal and abnormal tissue which may decrease the compli-
catedness. In the end, it is accomplished that the performed analysis is of notable
significance in brain tumor classification and segmentation using deep learning which
is one of the challenging assignments in medical image treatment. This work will
be beneficial for creating modernized collection of designs for brain tumor detection
208 M. Madgi et al.
which may support higher effective results than current technique. Occurrences here
include the practice of separating the brain’s left ventricle, where correct division
can be used to measure the ejection fraction of a heart patient to render better results
or division of the liver to tumor. Future implementation will analyze the effective-
ness and efficiency of mask R-CNN established designs for a collection of specific
assignments.
Acknowledgements We would like to express our thanks to Dr. Basavaraja S. Anami, Principal,
K. L. E. Institute of Technology, Hubballi, Karnataka, India, for his valuable suggestions.
References
1. Malathi, M., Sinthia, P.: Brain Tumor segmentation using convolutional neural network with
tensor flow. Asian Pac. J. Cancer Prev. 20, 2095–2101 (2019)
2. Talo, M., Baloglu, U.B., Yıldırım, O., Rajendra Acharya, U.: Application of deep transfer
learning for automated brain abnormality classification using MR images. Cogn. Syst. Res. 54,
176–188 (2019)
3. Wang, G., Li, W., Vercauteren, T., Ourselin, S.: Automatic brain tumor segmentation based on
cascaded convolutional neural networks with uncertainty estimation. Front. Comput. Neurosci.
13, 56 (2019)
4. He, K., Gkioxari, G., Dollár, P., Girshick, R.: Mask r-cnn. In: Proceedings of the IEEE
International Conference on Computer Vision, pp. 2961–2969 (2017)
5. Chinmayi, P., Agilandeeswari, L., Prabu Kumar, M., Muralibabu, K.: An efficient deep learning
neural network based brain tumor detection system. Int. Pure Appl. Math. 117, 151–160 (2017)
6. Dong, H., Yang, G., Liu, F., Mo, Y., Guo, Y.: Automatic brain tumor detection and segmentation
using U-net based fully convolutional networks. MIUA 3, 1–12 (2017)
7. Havaei, M., Davy, A., Warde Farley, D.: Brain tumor segmentation with deep neural networks.
Med. Image Anal. 35, 18–31 (2017)
8. Cui, S., Mao, L., Jiang, J., Liu, C., Xiong, S.: Automatic semantic segmentation of brain gliomas
from MRI images using a deep cascaded neural network. J. Healthcare Eng. 1–14 (2018)
9. Giraddi, S., Pujari, J.: Automated detection of exudates using DBSCAN clustering and fuzzy
classifier. Int. J. Adv. Res. Comput. Sci. 3(6), 129–133 (2012)
10. Giraddi, S., Pujari, J., Giraddi, S.: Exudates detection with DBSCAN clustering and back
propagation neural network. Int. J. Comput. Appl. 86(19), 16–20 (2014)
A Hybrid Approach Using ACO-GA
for Task Scheduling in Cloud
Simran Shrivas, Sonika Shrivastava, and Lalit Purohit
Abstract Cloud computing is a fast-growing technology in today’s world that offers

a wide variety of services based on the need of its users. Cloud provides services like
computing, storage, and networking which are accessible through the Internet. In the
computing cloud, task scheduling plays a vital role in optimizing resource utilization
and providing quality of service (QoS) to the customer. Efficient task scheduling
is needed to fulfill the user requirement and system performance. Traditional task
scheduling algorithms in a cloud platform like max–min, shortest job first, and round-
robin are not so effective in reducing makespan and cost. The main motive behind
this research is to apply a combination of the genetic algorithm for task scheduling in
a cloud environment and analyzes its effect, as the genetic algorithm can efficiently
solve NP-hard problems. This paper proposes a hybrid approach task that combines
the advantages of the two most widely used evolutionary algorithms: genetic algo-
rithm (GA) and ant colony optimization (ACO) for improving the scheduling in the
cloud using hybrid approach to overcome the limitation of unnecessary diversity.
The experimental result conclusively proved that there is an 18% to 20% reduction
in cost and makespan by ACO-GA-based task scheduling in the cloud as compared
to simple GA and ACO.
1 Introduction
In this rapidly developing world, the use of a cloud computing environment is

inevitable. The demand for computation and storage is fulfilled with the help of
a cloud platform. Cloud provides all types of resources, including servers, storage,
networking, etc., over the Internet based on the pay-as-you-go pricing model [1].
Cloud services are divided into three categories: infrastructure as a service (IaaS),
platform as a service (PaaS), and software as a service (Saas) model, and those
service models provide access to the computing, storage, and networking resources
at minimum cost and also provide a platform for programmers and developers to
S. Shrivas (B) · S. Shrivastava · L. Purohit

Shri Govindram Seksaria Institute Technology and Science, Indore, Madhya Pradesh, India
https://doi.org/10.1007/978-981-16-1502-3_22
210 S. Shrivas et al.
deploy, run, and develop the software. Many industries such as banking, health care,
and education are using the cloud on daily basis. Cloud is a parallel and distributed
computing platform that dynamically provides computing resources based on SLA
established between the CSP and users. With the increasing usage of this business
computing model, proper scheduling of tasks is an important issue [2]. The main aim
of the task scheduling (TS) technique is to assign the incoming task to the possible
resources efficiently [3]. Mainly, task scheduling processes are employed in infras-
tructure as a service model for offering a high QoS [4]. A proper task scheduling
algorithm is needed for efficient system performance. In the past few years, several
research activities had been carried out to optimize the task scheduling (TS) algo-
rithms [5] and they proposed algorithms such as max–min [6], genetic algorithm
(GA) [6], ant colony optimization (ACO) [7], and particle swarm optimization [8].
The main problem with previous applied evolutionary algorithms in the TS domain
is that while reducing the total cost and computational time, they stuck in local
optimum and result in slow convergence. So, the main aim of this paper is to address
the above-mentioned problems and to reduce makespan and cost for task distribution
in the cloud environment.
The rest of the paper is organized as follows. The overview of genetic-based TS
in the cloud is covered in Sect. 2. Section 3 explains the proposed algorithm and
followed by Sect. 4 which provides the detail of performance evaluation with the
experimental results. Conclusion and future work are summarized in Sect. 5.
2 Evolutionary Algorithm for Task Scheduling (TS)

in Cloud
In a dynamic environment such as the cloud, allocation of the task requires some
good strategy to get better performance [9]. The detailed study of a different genetic
algorithm and ant colony optimization algorithm applied in the cloud environment
is covered in this section.
2.1 Genetic Algorithm (GA) for Task Scheduling (TS)
GA is an evolutionary algorithm that is inspired by biological evolution and uses

genetic operators for better results [10]. In the simple GA, population is a subset
of all the possible solutions in the given problem, the chromosome indicates task
allocation information, and the length of the chromosome is the same as the number
of input tasks. Individual is a set of genes, and that gene represents each task id of
the chromosome [11]. Figure 1 shows the basic steps of simple GA in the cloud
environment. In [12], Duan et al. proposed the adaptive incremental genetic algo-
rithm (AIGA) that uses the probability of mutation and crossover operator to change
A Hybrid Approach Using ACO-GA for Task Scheduling in Cloud 211
Fig. 1 Genetic algorithm for task scheduling
the genetic operator’s results according to the individuals. Standard genetic algo-
rithm (SGA) [12] uses biological concepts but has some limitations like infeasible
solutions.
In [13], the multi-agent GA (MAGA) uses two types of methods. For the first
phase, it uses self-learning operators and in the second phase uses min–min and
genetic algorithm. It gives superior results as compared to traditional genetic algo-
rithms. This algorithm handles high-dimensional function. It provides an effective
solution but is stuck in slow convergence.
2.2 Ant Colony Optimization (ACO) for Cloud TS
ACO is a heuristic algorithm to find an optimal solution for complicated problems.

In this algorithm, the ant moves on the problem space, searches for better computing
resources for a required task, and releases a pheromone to build a solution; the
values may be modified during run time by the ant. Artificial ant has its memory to
save the path [14]. In Kumar [15] proposed the best choice resource allocation for
all tasks dynamically and reduce task completion time, but there is no precedence
constraints between task and required more computation time. In [16], slave ant used
to attain global optimization by ignoring long paths and also use minimal prepro-
cessing overhead for slave ants and uses machine learning technology to optimize
the performance of the system. Table 1 shows the comparative analysis of different
evolutionary algorithms used for TS.
3 Proposed Hybrid ACO-GA Approach for Task

Scheduling (TS) in Cloud
The problem of mapping tasks on cloud computing resources comes in the category
of the NP-hard problem [17]. To get a better result in terms of time and space, there
are various meta-heuristic algorithms used in TS, but they have some drawbacks
Table 1 Comparative study

Author Methods Objective Limitation
of evolutionary algorithm for
TS in cloud Pande [4] Task Makespan and Work on
partitioning cloud communication
algorithm resources time
Yiqiu [3] Improved Load Only work in
genetic balancing, set static scheduling
algorithm of resources
Yin [9] Task Local Accuracy is
allocation balancing, required
model execution cost
Zhu [13] Multiple Multiple QoS Premature
agent constraints convergence
algorithm
Gang [15] Hybrid Cost Not independent
heuristic GA
like premature convergence, infeasible solution, and trap in a local optimum [18]. In
this work, the ACO-GA hybrid approach is used with the help of ACO, it finds out
superior solutions for TS, and GA will control the problem of ACO, i.e., gradually
increase in running time with every generation, which reduces the overall makespan
and cost of TS in the cloud. The flowchart of the proposed approach is explained in
Fig. 2.
Phase I: Initialization Population
In this hybrid ACO-GA algorithm, first iteration is initialized by the random
population method.
Apply ACO over the population
ACO works on the whole population. It is applied such that every ant finds the path
in each iteration when their previous iteration is complete. The pheromone matrix of
every ant updates the global pheromone using the matrix model as shown in Eq. (1).
In this phase, population is generated based on the total number of iteration of an ant
and it is denoted in the equation by MAX_GEN; as the previous iteration is complete,
every ant releases pheromone which is denoted by deltaT as given in Eq. (2).
Phase II: Apply GA over the population
GA uses genetic operators over the generated population given by phase I. In the
selection step, tournament selection method is used to select the best chromosome
from a group of the chromosome [15]. Cross over operator, select a random number,
and return the offspring chromosome that contain both gene and VM [19]. In the
mutation operator occurrence is based on the mutation rate variable. After some iter-
ation, the fitness function gradually improved. The idea of the ACO-GA algorithm
is that first run the ACO and then GA for intermediate result and then calculate the
fitness value according to the specified objective. In the existing algorithm, if same
Fig. 2 Flowchart of ACO-GA algorithm
individual is used for finding an optimal solution, they affect unnecessary diver-
sity [20], but using a combination of the proposed approach improves the existing
drawback. The implementation of the proposed algorithm is shown in algorithm 1.
⎡⎛ ⎞⎤
p0 · · · pn
⎢⎜ ⎟⎥
P = Phermone⎣⎝ ... . . . ... ⎠⎦ ∗ ∗(1 − r ho) (1)
pk0 · · · pkm
Q
DeltaT = (2)
Max(CVm)
⎧ ⎫
⎨ [Ti j (t)]α . ri j (t) β β ⎬
α
Pikj (t) = l∈AllowTask(t),h∈vm [Ti j (t)] . ri j (t) (3)
⎩ ⎭
Q
Fitness = (4)
r ∗ max(CVm) + (1 − r ) ∗ D

D = pe ∗ cPe ∗ CVm(t) + Cpe ∗ mem + CpeS ∗ size + CpeB ∗ bw (5)
Algorithm 1 For ACO-GA-based TS in cloud

Input: Cloudlets (Task: T1, T2…..) and set of resources [VM1, VM2, VM3…]
Output: Best Solution. // allocate over the VM
For i = 0 to p
Popu(p) ← randomi ze() in Eq. 1 // initialize population
End For
While not reach half of n do //n is number of iteration
While not reach MAX_GEN do
Calculate DeltaT in Eq. 2
At each iteration every ant find path and calculate Pheromone Pikj (t)
Repeat
Repeat
Set Generatedpopulation j as chromosome // j is the index
Initialize generated chromosome and apply GA operators
Chr omosomei ← tour nament( popu) // selection operator
Chr omosome j ← tour nament( popu)

o f f spring_chr omosome j ← cr ossover chr omosome j , chr omosomei

Generatedpopulation j ← mutation o f f springchr omosomej
Repeat
Various parameters computed are used for ACO-GA discussed in Eqs. (1)–(5),
where Q is common, r is control weight, and Pe is the number of processing elements
in a single virtual machine. CPe is the cost of a single element. CpeS is storage
cost, CpeB is the cost of bandwidth, bw is the amount of bandwidth in Eq. (5) [19],
and Rho is denoted as a weight parameter.
4 Implementation and Result Analysis
The proposed algorithm is implemented using a CloudSim simulator [21, 22]. For this
experiment, three scenarios are consider with varying number of tasks. The algorithm
starts with the 20 random tasks called ants. The algorithm uses a trail step to update
the pheromone values and calculate the fitness function; beta is the influence of the
virtual machine instance. The count of ants is twice as the allocation of the VM. So
that, generation controlled in the first stage is double. In the GA algorithm phase use,
ACO generated a solution called population. The crossover method and the mutation
rate operator in the GA phase are defined in Table 2.
Furthermore, the workload data used a different number of tasks (20–1000) for
evaluating the algorithm with various scenarios. In the ACO-GA algorithm, number
of iterations is used to reach the optimal solutions. The experiments are repeated
more than 30 times given the average values of results compared with other similar
approaches. The size of data is changed to check the ability of the ACO-GA to reduce
makespan and cost.
Table 2 ACO-GA-based TS
Parameter Value
parameters
Population size 50
Alpha 0.3
Mutation rate 0.05
Crossover Single point
Iteration 10–100
For each scenario, the number of tasks and the number of iterations used are
shown in Table 3. In the first scenario, it has a small search space and gives a fast
and optimal result as compared to other existing approaches. ACO-GA algorithm
performs better in the second and third scenario as compared to other approaches
[21]. The third scenario represents the worst-case scenario. Experiment was done
in all the three scenarios to evaluate the effect on cost and time as compared with
individual approach based on ACO and GA as shown in Table 4. These experiments
are carried out with gradually increasing the number of iteration and number of tasks
with the allocation on different virtual machines.
At last, the comparative graph for makespan and cost is shown in Figs. 3 and 4. It
is observed that with the increase in the iteration time, more is the cost-saving. The
experimental result conclusively has proven that there is the reduction in cost and
makespan by ACO-GA-based TS in the cloud as compared to simple GA and ACO
and also this approach avoids unnecessary diversity and randomness.
Table 3 ACO-GA algorithm

Scenario Task Iteration
parameters
First 20 10
Second 40 30
Third 100 50
Table 4 Result of ACO-GA-based task scheduling in different scenarios

Approach Scenario first Scenario second Scenario third
based on Makespan (s) Cost ($) Makespan Cost ($) Makespan (s) Cost ($)
(s)
ACO-GA 22.9 17.06 24.6 24.3 183.3 35.05
GA 30.4 20.3 44.6 28.6 230.2 61.3
ACO 35.2 23.4 39.3 30.4 216.3 52.3
Fig. 3 ACO-GA makespan

compared with simple GA
and ACO over a different
number of tasks
Fig. 4 ACO-GA cost

compared with simple GA
and ACO over a different
number of tasks
5 Conclusions
The GA-based algorithms used for task scheduling in the cloud environment were
only considering single objective function, and they were affected with poor resource
utilization and local optimal solution. The proposed ACO-GA-based task scheduling
algorithm in the cloud takes into consideration both cost and makespan and imple-
ments the ACO-GA with different fitness functions. The experimental results state
that proposed ACO-GA algorithm obtains 18–20% better results in terms of cost and
makespan as compared to simple GA and ACO.
References
1. Buyya, R., Yeo, C., Broberg, J.: Cloud computing and emerging IT platforms: vision, and
reality for delivering computing. In: 5th utility, Future Generation Computer Systems, vol. 25,
pp. 599–616 (2009)
2. Purohit, L., Kumar, S., Kshirsagar, D.: Analyzing genetic algorithm for web service selection.
In: 1st International Confer Next Generation Computing Technologies (NGCT, Dehradun),
pp. 999–1001 (2015)
3. Arunarani, A., Manjula, D.: Task scheduling techniques in cloud computing a literature survey.
In: Future Generation Computer Elsevier, vol. 91, pp. 407–415 (2019)
4. Pande, S.K., Pande, S.K., Das, S.: Task partitioning scheduling algorithms for heterogeneous
multi-cloud environment. Arab J. Sci. Eng. 43, 913–933 (2018)
5. Padhy, R.P., Patra, M.R., Satapathy, S.C.: Cloud computing: security issues and research
challenges. IRACST Int. J. Comput. Sci. Inf. Technol. Secur. 1(2), 136–145 (2011)
6. Yiqiu, F., Xia, X., Junwei, G.: Cloud computing task scheduling algorithm based on
improved genetic algorithm. In: IEEE 3rd Information Technology, Networking, Electronic
and Automation Control Conference (ITNEC), Chengdu, China, pp. 852–856 (2019)
7. Gupta, A., Garg, R.: Load balancing based task scheduling with ACO in cloud computing. In:
International Conference on Computer and Applications (ICCA), Doha, pp. 174–179 (2017).
https://doi.org/10.1109/COMAPP.2017.8079781
8. Gawali, M., Shinde, S.: Task scheduling and resource allocation in cloud is using a heuristic
approach. J. Cloud Comput. Adv. Syst. Appl. 7(4), 1–16 (2018)
9. Yin, S., Ke, P., Tao, L.: An improved genetic algorithm for task scheduling in cloud computing.
In: 13th IEEE Conference on Industrial Electronics and Applications, Wuhan, pp. 526–530
(2018)
10. Purohit, L., Kumar, S.: A study on evolutionary computing based web service selection
techniques. Artif. Intell. Rev. (2020). https://doi.org/10.1007/s10462-020-09872-z
11. Kairong, D., Fong, S., Weng, S., Wei, S., Sheng-Uei, G.: Adaptive incremental genetic algorithm
for task scheduling in cloud environments. Symmetry 10, 168 (2018). https://doi.org/10.3390/
sym10050168
12. Jang, S., Young, T.: The study of Genetic algorithm based task scheduling for cloud computing.
Int. J. Control Autom. 5(4) (2012)
13. Zhu, K., Song, H., Liu, L., Gao, J., Cheng, G.: Hybrid genetic algorithm for cloud computing
applications. In: IEEE Asia-Pacific Services Computing Conference, Jeju Island, pp. 182–187
(2011)
14. Verma, P., Shrivastava, S., Pateriya, R.K.: Enhancing load balancing in cloud computing by
ant colony optimization method. Int. J. Comput. Eng. Res. 6, 277–284 (2017)
15. Purohit, L., Kumar, S.: Replaceability based web service selection approach. In: IEEE 26th
International Conference on High Performance Computing, Data, and Analytics (HiPC),
Hyderabad, India, pp. 113–122 (2019). https://doi.org/10.1109/HiPC.2019.00024
16. Gang, L., Zhijun, W.: Ant colony optimization task scheduling algorithm for SWIM based on
load balancing. In: Future Internet (2019)
17. Moon, Y., Yu, H., Gil, J.: A slave ants based ant colony optimization algorithm for task
scheduling in cloud computing environments. Hum. Cent. Computer. Inf. Sci. 7, 28 (2017)
18. Abualigah, L., Diabat, A.: A novel hybrid antlion optimization algorithm for multi-objective
task scheduling problems. In: Cloud Computing Environments”. Cluster Computing (2020).
https://doi.org/10.1007/s10586-020-03075-5
19. Ahmad, M.M., Hanan, B.A.: Workflow scheduling using hybrid GA-PSO algorithm in cloud
computing. In: Hindawi Wireless Communications and Mobile Computing, pp. 1–17 (2018)
20. Tawfeek, M.A., El-Sisi, A., Keshk, A.E., Torkey, F.A.: Cloud task scheduling based on ant
colony optimization. In: 8th International Conference on Computer Engineering and Systems,
pp. 64–69 (2013)
21. Kumar, P., Verma, A.: Scheduling using improved genetic algorithm in cloud computing for
independent tasks. In: International Conference on Advances in Computing, Communications
and Informatics, ICACCI, India, pp. 137–142 (2012)
22. Shrivastava, S., Pateriya, R.K.: Efficient storage management framework for software defined
cloud. J. Internet Technol. Secur. Trans. 7(4), 317–3291 (2017)
K-Means Algorithm-Based Text
Extraction from Complex Video Images
Using 2D Wavelet
Divya Saxena and Anubhav Kumar
Abstract In this paper, the K-means algorithm for information extraction in the
form of text from complex video images using 2D wavelet is presented. Haar wavelet
and K-means algorithm-based simple hybrid approach are proposed in this paper.
Haar wavelet is used to efficiently convert grayscale image to edge image. K-means
algorithm is used for the information localization and segmentation process to split
the background pixels from the text images. Large non-text background interrupts
to extract the text information from any video images, so that non-text background
can be identified and eliminated from the text images with the help of the hybrid
approach. This algorithm is evaluated on the complex background video frames.
The recall rate and the precision rate are obtained 99.01 and 95.75% of the proposed
algorithm in video images.
1 Introduction
Digital technologies are gaining new dimensions every day, in which image
processing has made valuable contributions to digital technologies. Extracting text
and information from digital images is a critical system, and it is a very impor-
tant application of multimedia communication in the digital era. In present years,
researchers and companies have been active on text and information extraction. The
contrast area of images, including text, can be extracted from the edge of the images.
To extract text and information from video frames or images, the text area has to
be segmented for which the segmentation process is used, but eliminating the non-
text background in the text and information extraction is a complex process, with
which the size of the small non-text element is equal to the text area, making the
text extraction complex. In-text and information extraction from images and video
D. Saxena (B)
Applied Science and Humanities, ABES Engineering College, Ghaziabad, Uttar Pradesh, India
A. Kumar
Department of Electronics and Communication Engineering, Raj Kumar Goel Institute of
Technology and Management, Ghaziabad, Uttar Pradesh, India
https://doi.org/10.1007/978-981-16-1502-3_23
220 D. Saxena and A. Kumar
images are used by different text segmentation, localization and edge-based methods
such as differential evolution, machine learning, rotation proposals, block projec-
tions, character segmentation, edge-based, Gabor filter, connected component, and
morphological approach [1–9].
Research in machine learning is coming forward very fast in this digital era.
Although the K-means algorithm was known since the mid-1960s, the K-means
algorithm has contributed a lot in fields such as clustering [6], medical imaging [7],
and text extraction from images [8]. K-means machine learning algorithm is a popular
and efficient unsupervised algorithm in machine learning. K-means clustering can
work quickly on unlabeled data with shortcomings such as the number of repetitions.
In this paper, the 2D Haar wavelet is used to extract the contrast edge of the text and
images, while the text is extracted from the morphological process after using the
K-means algorithm to segment the images.
After the introduction, text extraction is illustrated as follows. The proposed
approach and outcome analysis are briefly discussed in Sect. 2 and Sect. 3. The
conclusion is elaborated in the last section.
2 Proposed Algorithm
The proposed algorithm is divided into 4 parts, which include preprocessing, Haar
wavelet-based edge conversion, text segmentation from K-means algorithm, and text
extraction with morphological approach in the last. The proposed algorithm flowchart
with all steps is shown in Fig. 1.
In preprocessing, the color image has been changed to the grayscale image, and
the grayscale image is shown in Fig. 2. After that, Haar wavelet is used to determine
the text edge from the images. Large coefficients of wavelet are closely related to
edges in the images with irregular texture in the images [9]. Concentrations of any
edge pixels in any text are around the text itself, so that the edges can be correctly
extracted with wavelet. The Haar wavelet can be represented as
⎧
⎨ 1 if 0 ≤ t < 1/2
ψ(t) = −1 if 1/2 ≤ t < 1 (1)
⎩
0 otherwise
2D Haar wavelet decomposed the original images into sub-band, which include
the LL, LH, HL, and HH coefficients. HL and LH sub-bands are representing the
vertical edge coefficient and the horizontal coefficient. The concentration of the edge
of the text is determined from its horizontal and vertical coefficients. Vertical and
horizontal components have been combined to found the edges of the text efficiently,
which gives a highly focused edge image, and the text or non-text element can be
separated in the next parts of the algorithm.
K-Means Algorithm-Based Text Extraction from Complex Video … 221
Fig. 1 Proposed
K-means-based text
extraction algorithm
Fig. 2 Edge image after 2D Haar wavelet

It is necessary to remove the non-text edge of the image, so that text information
can be extracted successfully. K-means [10] algorithm is used to eliminate the non-
text element and segment of the actual text area. So that, apply the K-means algorithm
on the edge image. In this, k = 2 value is taken for initial centroid. K-means algorithm
is based on the initial centroid value of k. A cluster-based edge component is found by
this algorithm. The edge image after the K-means algorithm is shown in Fig. 3.
The intensity of the edge pixels is also regulated by the centroid and by adjusting
the value of k. The large non-text background and non-text elements are elimi-
nated from the K-means algorithm. 8 by 8 median filtering applied in to edge image,
so that small noise, non-text, and non-cluster element are removed. Figure 4 displays
the edge picture after 8 by 8 median filter.
Fig. 3 Edge image after

K-means algorithm
Fig. 4 Edge image after 8 by 8 median filter

After small edge removal, the morphological approach is applied to the edge
element so that edge text words are connected. The area-based segmented image
after morphological approach is shown in Fig. 5. Multiplication property [3–5] is
applied between the segmented image and the binary component of the original text
image for text extraction. Final text extracted process from the image is shown in
Fig. 6.
Fig. 5 Image after morphological approach
Fig. 6 Final text extraction process

3 Simulated Result Analysis
In simulation and result analysis, 20 text images with complex background and
different types of videos such as news, live shows, and movies have been taken
from the Internet randomly. MATLAB software is used to analyze the proposed
algorithm. A total of 204 words are extracted from 20 text images. According to
Fig. 7, proposed algorithm extracted correctly text words from news and movies text
images. The recall rate and the precision rate are used to analyze as per Eqs. (2) and
(3).
Correctly detected words

Recall Rate = ∗100 (2)
Correctly detected words + False Nagetives
Correctly detected words
Precision Rate = ∗100 (3)
Correctly detected words + False Positives
In Table 1, comparative analysis with the proposed algorithm is evaluated

with existing algorithms. In this analysis, the proposed text extraction algorithm
has a 99.01% recall rate with a 95.75% precision rate. Recall rate is almost equal
to other similar approaches, but the precision rate is higher due to non-text pixel
removal using the K-means segmented approach. This algorithm can be applicable
as a text and information retrieval in digital and multimedia technology.
Fig. 7 Original image and text extraction image

Table 1 Analysis of
Algorithm Recall rate (%) Precision rate (%)
proposed K-means text
extraction algorithm with Proposed 99.01 95.75
existing algorithm Karpagam [1] 77 78
Kumar [2] 99.61 96.20
Kumar et al. [3] 95.3 –
Kumar [5] 99.11 94.67
Kumar [11] 96.20 87.54
4 Conclusion
In this paper, text extraction from complex video images is done using a hybrid
approach of the Haar and K-means algorithm. Effectively, non-text is removed from
complex video images so that the false alarm of the algorithm is decreased. The recall
rate and precision rate of the proposed algorithm are 99.01 and 95.75%. The recall
rate and precision rate evaluated the effectiveness of the presented algorithm, and it
can be used in digital communication for text and information retrieval algorithms.
References
1. Karpagam, A.V., Manikandan, M.: Text extraction from natural scene images using Renyi
entropy. J. Eng. 8, 5397–5406 (2019)
2. Kumar, A.: An efficient text extraction algorithm in complex images. In: 2013 Sixth
International Conference on Contemporary Computing (IC3), pp. 6–12. IEEE (2013)
3. Kumar, A., Kaushik, A.K., Yadav, R.L.: A robust and fast text extraction in images and video
frames. In: International Conference on Advances in Computing, Communication and Control,
pp. 342–348. Springer, Berlin (2011)
4. Kumar, A., Awasthi, N.: An efficient algorithm for text localization and extraction in complex
video text images. In: 2013 2nd International Conference on Information Management in the
Knowledge Economy, pp. 14–19. IEEE (2013)
5. Kumar, A.: An efficient approach for text extraction in images and video frames using gabor
filter. Int. J. Comput. Electr. Eng. 6(4), 316 (2014)
6. Mustafi, D., Sahoo, G.: A hybrid approach using genetic algorithm and the differential evolu-
tion heuristic for enhanced initialization of the k-means algorithm with applications in text
clustering. Soft Comput. 23(15), 6361–6378 (2019)
7. Jaroš, M., et al.: Implementation of K-means segmentation algorithm on Intel Xeon Phi and
GPU: application in medical imaging. Adv. Eng. Softw. 103, 21–28 (2017)
8. Akter, S., et al.: An extractive text summarization technique for Bengali document(s) using
K-means clustering algorithm. In: 2017 IEEE International Conference on Imaging, Vision
and Pattern Recognition (icIVPR). IEEE (2017)
9. Mallat, S.: A Wavelet Tour of Signal Processing, Elsevier (1999)
10. Arthur, D., Vassilvitskii, S.: K-means++: the advantages of careful seeding. In: SODA ‘07:
Proceedings of the Eighteenth Annual ACM-SIAM Symposium on Discrete Algorithms,
pp. 1027–1035 (2007)
11. Kumar, A., Kaushik, A.K., Yadava, R.L., Saxena, D.: An edge-based algorithm for text extrac-
tion in images and video frame. In: Advanced Materials Research, vol. 403, pp. 900–907. Trans
Tech Publications Ltd. (2012)
Opinion Mining-Based Conjoint Analysis
of Consumer Brands
Kumar Ravi, Aishwarya Priyadarshini, and Vadlamani Ravi
Abstract Nowadays, online customer reviews in the form of feedback and ratings
are available for a large number of product or service-based categories. These product
reviews signify individually perceived strengths and shortcomings of a given product
category, which can essentially provide design engineers and market researchers with
invaluable insights into product design. In order to analyze the available individual
customer opinions and turn them into aggregate consumer preferences that can be
used in the product development and improvement process, we proposed a hybrid
of sentiment analysis and conjoint analysis to determine the best brand among a
list of brands for a specified product category. The outcome of this hybrid model is
compared with the hybrid of sentiment analysis and multi-criteria decision making.
The proposed framework estimates the relative effect of product attributes and brand
names on the overall preference of consumers. We demonstrated the effectiveness
of our approach using product review data taken from the literature. Our proposed
approach turned out to be useful in determining the best of market availability.
1 Introduction
Conjoint analysis is a statistical technique used in market research to determine how

the potential customers assess different attributes (feature, function, benefits) that
make up an individual product or service-based category. The objective of conjoint
analysis is to analyze the e-customer reviews and determine what combination of
K. Ravi
IoTWoRKS, HCL Technologies Ltd, Plot 3A, SEZ, Noida 201301, Uttar Pradesh, India
A. Priyadarshini
Department of Computer Science and Engineering, IIIT Bhubaneswar, Bhubaneswar 751003,
India
V. Ravi (B)
Center of Excellence in Analytics, Institute for Development and Research in Banking
Technology, Castle Hills Road No. 1, Masab Tank, Hyderabad 500057, India
e-mail: vravi@idrbt.ac.in
https://doi.org/10.1007/978-981-16-1502-3_24
228 K. Ravi et al.
a limited number of attributes is most significant and essentially influences respon-

dent’s choice of product category. Conjoint analysis is evolved in the form of linear
programming for rank-ordered data, self-explicated research, adaptive conjoint anal-
ysis (ACA), choice-based approaches, best–worst scaling, etc. This mathematical
model is used by design engineers and market researchers to visualize, extract the
underlying relationships among the attributes and the utilities of the attributes that a
potential consumer associates with it. A great deal of market research commissioned
is largely descriptive, which is beneficial to illustrate demographics, usage patterns,
feelings, and preferences of the individuals or the e-customers. So, in the competi-
tive market, the design engineers and researchers require tools, which can be used to
predict what customers will purchase when faced with a variety of available brands
and myriad product characteristics.
Individuals apply an assortment of heuristics while assessing and selecting product
alternatives in the marketplace. Many product concepts consist of a huge array of
features largely differentiated by brand, packaging, and prices. To decide which
products to trade, executives may use their intuition or the recommendation of design
engineers, or they may also analyze the present-day market trends. However, these
strategies are short-termed and reactive.
In consumer-oriented firms, the potential products are often evaluated majorly
via market assessments. Voluminous online customer reviews offer tremendous
prospects for generating surveys or questionnaires without spending a lot of time in
formulating product specific surveys. Instead of applying combinatorics to prepare
questionnaires, anyone can obtain the real requirements of live customers/consumers.
Consumers are shown a few product concepts and asked relevant questions
concerning their purchase interests. The process provides essential information
about the consumers’ perception about certain features of brand profiles and their
expectations out of the product category expressed as low rated reviews.
In this study, we proposed a hybrid of sentiment analysis and conjoint anal-
ysis to determine preference of customers regarding different attributes of digital
camera and mobile phone brands. In addition, the obtained preference rankings are
compared with those of Ravi and Ravi [1]. To apply conjoint analysis, we considered
the economic preference model proposed in Decker and Trusov [2]. They considered
the distribution of words taken from cons and pros of review, whereas we computed
sentiment score for a set of identified aspects using dictionary approach in a system-
atic manner. Further, they did not compare their results with any method that yields
ranks, whereas we compared our results with that of [1], where sentiment analysis
and MCDM hybrids were developed. These are our significant contributions.
The remainder of this paper is organized as follows. We presented literature
survey related to conjoint analysis and aspect-based sentiment analysis in Sect. 2.
The proposed approach is presented in Sect. 3. Experiment setup is presented in
Sect. 4. The results and discussion are presented in Sect. 5. Finally, conclusion and
future directions of research are presented in Sect. 6.
Opinion Mining-Based Conjoint Analysis of Consumer Brands 229
2 Literature Review
Aspect-level sentiment analysis can been performed mainly using three approaches
involving machine learning [3], lexicon-based approaches [4], and a hybrid of both
[5]. Murthy et al. [6] reviewed literature available for text classification. Al-Smadi
et al. [7] considered morphological, syntactic, and semantic features to perform
aspect-based sentiment analysis in the domain of hotel industry. They worked on three
tasks, namely aspect category identification, opinion target expression extraction, and
sentiment polarity identification. Ma et al. [8] proposed a position attention mech-
anism to determine sentiment expressed on multiple aspects in the same sentence.
The position attention is able to model the explicit position context between the
aspect and its context words. Along the same lines, Zhao et al. [9] proposed a hybrid
model based on graph convolutional networks (GCN). First, they employed bidirec-
tional encoder representations from transformers (BERT) with position encoding to
capture embedding based on aspect and its context. Second, they employed GCN
to model the sentiment dependencies between different aspects in one sentence.
Nguyen and Nguyen [10] considered intra-attention and interactive-attention along
with sentiment lexicon to perform aspect-level sentiment analysis. They considered
lexicon-aware attention to be fused with deep neural networks, which can capture
sentiment context conditioned on the informative aspect words. Chen et al. [11]
proposed multi-source data fusion considering aspect-level corpora, sentence-level
corpora, word-level sentiment lexicons, and BERT. BERT was considered to generate
aspect-specific sentence representations for sentiment classification. Murty et al. [12]
proposed a similarity measure for clustering problems.
Fan et al. [13] reviewed available literature on information fusion for ranking
products using online reviews. Mokonyama and Venter [14] determined the pref-
erence of customers for public transport contracts in South Africa. They observed
that reliability, security, staff respect, and service frequency are major attributes of
contracts. Wu et al. [15] computed part-worth for six attributes, viz. power, appear-
ance, safety, fuel efficiency, price, and gadgets for eight sub-compact cars in Thai-
land. The order of preference for attributes obtained as appearance, fuel efficiency,
price, safety, power, and gadgets. Dauda and Lee [16] evaluated the perceptions
of Nigerian banking customers’ on bank service quality. They applied a discrete
choice-based method on 1245 survey-based data samples. They recommended to
reduce transaction errors, transaction costs, waiting time, and initial online learning
time. Yang et al. [17] fused fuzzy sets and graph models to determine review helpful-
ness. Using 1158 online reviews, they presented different applications of fusion, viz.
product recommendation, market analysis, customer satisfaction analysis, product
defect identification, and consumer preference analysis. Anand et al. [18] employed
conjoint analysis to determine the preference of attributes of cell phones as brand,
price, features, and colors. They forecasted probable sales for the next ten periods
using the choice probabilities-based forecasting diffusion model.
Kodapanakkal et al. [19] employed conjoint analysis approach to understand
people’s preference in accepting big data technologies in six sectors, namely criminal
230 K. Ravi et al.
investigations, crime prevention, citizen scores, health care, banking, and employ-
ment. They found data protection and outcome favorability as prime factors in
technology adoption. Wang et al. [20] proposed inconsistent ordered choice model
(IOCM) based on online review and review rating. They categorized a list of features
of auto cell into four categories, viz. indifferent features, must-have features, exciting
features, and performance features. Most recently, Mitra and Jenamani [21] proposed
Online Brand IMage (OBIM) score by computing sentiment and co-word network
analysis of product features like favorability, strength, and uniqueness. They applied
OBIM for SWOT analysis and sentiment concept mapper.
3 Proposed Approach
In this study, we developed a hybrid of preference economic-based conjoint methods

and sentiment analysis to rank a set of brands based on electronic word of mouth.
The obtained rank is compared with the rank obtained using the hybrid of senti-
ment analysis and multi-criteria decision-making (MCDM) methods. The proposed
approach, whose schematic is depicted in Fig. 1, has six stages, viz. data collection,
text preprocessing, aspect determination, aspect-level sentiment score computation,
applying conjoint analysis or economic preference models and finally ranking the
brands. The detailed steps of applying MCDM methods are available in [1]. In this
study, we presented the steps involved in the hybrid approach of sentiment analysis
and conjoint analysis. The proposed approach yields a ranking for a set of brands
which are compared with those obtained for the same set of brands by Ravi and Ravi
[1].
Fig. 1 Schematic of the

proposed approach Text Prepro- Aspect Determi-
Customer Reviews
on Brands cessing nation
Aspect-level sen-
timent score com-
putation
Conjoint
Analysis Applying economic
preference models
Selecting the best

Identifying the
fitted model
best feature set
based on AIC
Rank the brands
The details of data collection and text preprocessing are presented in Sects. 4.1
and 4.2, respectively. Based on the frequency of occurrence, we considered a set of
aspects to compare a set of brands. Based on the corpus prepared for one brand, we
computed the sentiment score for each combination of aspects and product brand.
For each aspect, we obtained aggregate sentiment score with respect to negative and
positive polarity.
For conjoint analysis, we considered different econometric preference models
proposed in [2]. We applied Poisson regression (PR) and negative binomial regres-
sion (NBR) as represented using Eqs. (1) and (3), respectively. For modeling the
homogeneous preferences, we applied PR with conditional mean, λ > 0, which is
presented in Eq. (1). Here, let k = 1…K in the subscript denote the individual product
reviews, l = 1…L denotes the subscript of the functional product attributes, and h ∈
{1, 2} are the respective levels or attributes of l. Using these notations, the opinion
data can be converted into binary data using

1 if the functional attribute l takes level h in review k
xklh =
0 otherwise
Therefore, xkl1 +xkl2 ≤ 1, ∀k, l. For denoting the brand name effects, we introduce
another variable

1 if product discussed in review belongs to brand m
x̃km =
0 otherwise
where m = 1…M, and M represents the number of brands considered for computation
which in our case is 4, irrespective of the dataset (digital camera or mobile phones) and
M ∼
m=1 x km = 1, ∀k. Hence, the observed rating yk of the product in a certain review k
has been defined in the function below by Poisson regression with conditional mean,
λ > 0.

λ y (−λ) L M
∼
Prob (Y = y) =
PR
e with λ = exp α + (βl1 xl1 + βl2 xl2 ) + δm x m
y! l=1 m=1
(1)
The above equation determines the probability of observing product rating y given
∼
a certain pos/neg summary coded by means of explanatory variables x and x. Simi-
larly, for modeling the heterogeneous preferences, we applied the NBR approach,
because a certain amount of variation in the observed data can be credited to unfa-
∼
miliar sources (apart from variables x and x), the use of an appropriate statistical
distribution for demonstrating this “unobserved” heterogeneity seems promising. Let
ε be a random variable that denotes the “unobserved” heterogeneity in the dataset
∼
to be studied and that is not correlated with x and x but satisfies E(ε) = 0. The
conditional mean λ is replaced with a random variable Λ as presented in Eq. (2)
232 K. Ravi et al.
∼
= λ.eε = λ. ε with E() = λ (2)
The probability of observing a certain value y can then be computed using the
following mixture distribution with γ > 0.

y+γ −1 λy γ γ
ProbNBR (Y = y) = . with γ > 0 (3)
y (λ + γ ) y+γ
Here, γ represents the scale parameter and as well as the shape parameter for
convenience of computation [2].
Ducker and Trusov [2] demonstrated that these models can yield competitive
results as conjoint analysis techniques. Employed economic preference model esti-
mates parameters associated with a set of criteria selected for a set of brands. The
parameters reflect the consumer preference of one brand over another, which can be
converted in the form of brand ranking. As user reviews are considered to develop the
model, it can help us understand the heterogeneity of users’ preferences for evalua-
tion of the product brands. We considered the Akaike Information Criterion (AIC) to
compare the performance of different economic preference models. AIC tests for the
goodness of fit for all the statistical models, thereby indicating their quality. These
statistical models can be employed to estimate the relative preference of brands and
functional attributes using Eqs. (4) and (5) [2]:

φ Attribute (xl ) = (exp β̂l1 + exp β̂l1 − 2 × 100% (4)
φ Attribute is called as the “backlog of impact”, which measures the average sensi-
tivity of the product evaluation to variations of the quality of functional attributes.
The relative strength of effect between two brands m1 and m2 allows for tentative
inferences
∼ ∼

φ Brand x m 1 , x m 2 = (exp δ m 1 + exp δ m 2 ) × 100% (5)
about the relative brand value or power from the consumer’s perspective.
4 Experimental Setup
4.1 Data Details
For experimental purposes, we considered reviews on the digital camera and mobile
phone brand collected from Twitter and www.amazon.com. The distribution of
reviews of two different datasets considered for experiments is presented in Table 1.
Table 1 Dataset details

Digital No. of reviews Cell phone No. of reviews
camera brand brand
Canon (D1) 676 Apple 722
iPhone (M1)
Nikon (D2) 676 HTC One 870
(M2)
Panasonic 676 Nokia Lumia 699
(D3) (M3)
Sony (D4) 676 Samsung 873
Galaxy (M4)
We considered reviews or tweets containing at least one aspect. Further details about
the dataset are presented in [1].
4.2 Text Preprocessing and Sentiment Score Computation
We performed text preprocessing like tokenization, length-based token filtering, stop

word removal, POS tagging, lemmatization, and parsing. For criteria determination,
we obtained the frequency of all tokens. Based on the highest frequency and context
of the domain, we selected nine product features as criteria for both datasets. We
also considered the synonyms of each aspect to better capture sentiment concerning
an aspect. For sentiment score computation, we considered all opinion words, viz.
nouns, verbs, adjectives, and adverbs associated with an aspect. To determine the
association, we considered the parse graph approach as explained in [1]. A set of
opinion words that appeared in the neighborhood of an aspect were considered as
associated opinion words. The neighborhood of 1 was decided based on the length
of the shortest path. The sentiment score was obtained using three sentiment dictio-
naries, viz. SentiWordNet [20], SenticNet 3.0 [21], and SO-CAL [22]. We considered
positive and negative sentiment scores separately for each combination of an aspect
and a review for our conjoint analysis experiment. To determine the target variable
for regression purpose, we obtained summation of sentiment of all aspects appeared
in one review together. The sentiment sum was bucketed into five categories based
on quintile. In [2], the positive and negative sentiment were added together to obtain
final sentiment.
The parameters obtained for different economic preference models on the digital
camera and the cell phone dataset are presented in Tables 2 and 3, respectively. We
can observe that a relatively large number of attributes contribute significantly toward
234 K. Ravi et al.
Table 2 Model goodness of fit measure for digital camera dataset

Fitting parameter PR NBR (Link = log) NBR (link = sqrt)
AIC 6820.0 6822.0 6784.0
Residual deviance and degree of 876.79 and 2035 876.77 and 2035 838.73 and 2035
freedom (DF)
Table 3 Model goodness of fit parameters for mobile phone dataset

Fitting parameter PR NBR (Link = log) NBR (link = sqrt)
AIC 5179.5 5181.5 5133.0
Residual deviance and DF 600.8 and 1574 600.79 and 1574 552.35 and 1574
the customer preference of a given product. Akaike Information Criterion (AIC) is

an estimator of the relative quality of the statistical models for a given set of data.
PR is employed to model homogenous preferences, whereas NBR is employed to
model heterogeneous preferences.
We can observe that the different parameter vectors reveal significant information
about the aspects. For both datasets, the intercepts that are significant in each case are
of approximately the same magnitude. For the digital camera dataset, PR yielded the
best AIC value of 6820 and residual deviance of 876.79 as presented in Table 2. All
aspects are having a significant coefficient at least at the 5% level (two-tailed p values)
except batterypos, batteryneg, dslrneg, priceneg, and pricepos. We can observe that
the signs of coefficients are associated with the polarities of the sentiment. Based on
positive sentiment, the order of importance of different aspects turned out to be in
the decreasing order as picture, brand, lens, processor, appearance, flash, and dslr.
It implies that increasing sentiment of these aspects would increase the favorability
of the digital camera brand. Based on negative sentiment, the order of importance for
features is picture, processor, brand, lens, flash, appearance, and battery. It indicates
that increasing these parameters would lead to a decrease in the reputation of the
brand. To model heterogeneous preferences, we employed NBR with different link
function as presented in Tables 2 and 4. NBR yielded the best residual deviance.
Hence, we considered NBR to rank different digital camera brands. As per NBR
parameters, all aspects are having significant coefficients except batterypos, dslrneg,
priceneg, and pricepos.
According to Eqs. (3) and (4), we estimated parameters β l1 …β l9 and δ m 1 . . . δ m 4

for both datasets. Contribution of D1 is exp (δ m 1 ) = exp (0.055) = 1.06, which is
strongest in the brand name. The D4 has a relatively negative impact with exp (δ m 4 )
= 0.96. In terms of features, the highest contributing feature is picture with effect of

exp (β l7 ) = exp (0.33) = 1.39. The least contributing feature is processor with effect

of exp (β l7 ) = exp (−0.246) = 0.78. Based on this calculation, the decreasing order
of importance for positive sentiment is obtained as picture, brand, lens, processor,
flash, appearance, and dslr. It implies that the picture quality is the prime feature
for a camera as per user opinion. For the negative sentiment, the decreasing order
Table 4 Parameter estimates for digital camera dataset

PR NBR (link = sqrt)
Estimate Std. error p-value Estimate Std. error p-value
(Intercept) 0.757317 0.035833 *** 1.400368 0.030714 ***
D4 −0.059292 0.040058 0.14 −0.04382 0.033549 0.19
D1 0.066757 0.038735 . 0.055238 0.033587 0.1
D3 0.003552 0.036236 0.92 0.003378 0.0319 0.91
D2 – – – – − –
appearanceneg −0.191914 0.06717 ** −0.1728 0.053007 **
appearancepos 0.181764 0.033988 *** 0.192088 0.0318 ***
batteryneg −0.116208 0.074134 0.12 −0.10389 0.062966 .
batterypos 0.076922 0.051426 0.13 0.077162 0.047475 0.1
brandneg −0.276698 0.084856 ** −0.23066 0.062921 ***
brandpos 0.245555 0.032339 *** 0.253249 0.029507 ***
dslrneg −0.124558 0.114923 0.28 −0.12252 0.092608 0.19
dslrpos 0.113197 0.038341 ** 0.127156 0.034837 ***
flashneg −0.22955 0.10967 * −0.19649 0.085358 *
flashpos 0.183707 0.05924 ** 0.193795 0.057589 ***
lensneg −0.26253 0.073393 *** −0.20528 0.053552 ***
lenspos 0.20377 0.030294 *** 0.204311 0.027234 ***
pictureneg −0.368778 0.074283 *** −0.23874 0.04914 ***
picturepos 0.353881 0.029309 *** 0.332494 0.025313 ***
priceneg −0.431763 0.380227 0.26 −0.4307 0.290668 0.14
pricepos 0.128494 0.185898 0.49 0.093189 0.179303 0.6
processorneg −0.327797 0.07395 *** −0.24605 0.051862 ***
processorpos 0.192479 0.030343 *** 0.196781 0.027615 ***
Significance levels (two-tailed p values): *** = 0.001, ** = 0.01, * = 0.05, . = 0.1
of importance of attributes is battery, appearance, brand, flash, lens, picture, and

processor. So, based on the above information, the decreasing order of the brand for
the digital camera is Canon → Nikon → Panasonic → Sony.
For the mobile phone dataset, NBR with link sqrt yielded the best AIC of 5133.0
and residual deviance of 552.35 as presented in Tables 3 and 5, respectively. All
aspects are significantly contributing to the model except appearanceneg, memo-
rypos, and processorneg. Based on the coefficients obtained in Table 5, HTC One is
the strongest mobile brand as per user opinions. The decreasing order of importance
for positive sentiment is obtained as camera, screen, brand, processor, price, appear-
ance, sound, battery, and memory. It indicates that the camera is one of the major
aspects while selecting a mobile phone. These coefficients yield the decreasing order
of the brand as HTC One → Nokia Lumia → Apple iPhone → Samsung Galaxy.
236 K. Ravi et al.
Table 5 Parameter estimates for mobile phone dataset

PR NBR (link = sqrt)
Estimate Std. error p-value Estimate Std. Error p-value
(Intercept) 0.86674 0.03892 *** 1.47364 0.03524 ***
M4 −0.08026 0.04253 . −0.06187 0.03657 .
M1 −0.07585 0.04422 . −0.05997 0.03835 0.11
M3 −0.04025 0.04361 0.36 −0.03035 0.03811 0.42
M2 – – – – – –
batteryneg −0.37091 0.0791 *** −0.28312 0.05621 ***
batterypos 0.17309 0.04917 *** 0.19129 0.04589 ***
brandneg −0.4799 0.10929 *** −0.3282 0.07112 ***
brandpos 0.29148 0.03914 *** 0.30607 0.03588 ***
cameraneg −0.41724 0.0937 *** −0.30319 0.06379 ***
camerapos 0.30339 0.0343 *** 0.31193 0.03203 ***
appearanceneg −0.15581 0.12057 0.2 −0.1103 0.09475 0.244
appearancepos 0.233 0.04646 *** 0.25578 0.04417 ***
memoryneg −0.53205 0.10449 *** −0.33998 0.06652 ***
memorypos −0.03825 0.0615 0.53 0.00904 0.05239 0.86
priceneg −0.3292 0.09916 *** −0.24204 0.06817 ***
pricepos 0.24336 0.04007 *** 0.2591 0.0364 ***
processorneg 0.06132 0.1883 0.74 0.06571 0.14106 0.64
processorpos 0.25638 0.0552 *** 0.27574 0.05372 ***
screenneg −0.35304 0.091 *** −0.24957 0.06044 ***
screenpos 0.30285 0.03346 *** 0.31143 0.03071 ***
soundneg −0.38759 0.11267 *** −0.30421 0.07924 ***
soundpos 0.23772 0.04583 *** 0.24481 0.04364 ***
Significance levels (two-tailed p values): *** = 0.001, ** = 0.01, * = 0.05, . = 0.1
As per Eq. (4), the percentage backlog impact of digital camera brand and their
aspects are presented in Tables 6 and 7, respectively. Similarly, the percentage backlog
impact of digital camera brands and their aspects are presented in Tables 8 and
9, respectively. The first row of Table 6 indicates that D1 has the highest relative
Table 6 Percentage backlog of impact (digital camera brands)

D1 D2 D3 D4
D1 0 5.65 5.31 9.96
D2 −5.65 0 −0.34 4.3
D3 −5.31 0.34 0 4.65
D4 −9.96 −4.3 −4.65 0
Table 7 Percentage backlog of impact (digital camera aspects)

Aspect Relative strength Aspect Relative strength
Price −25.2 Lens 4.11
Battery −1.85 Appearance 5.31
Processor −0.06 Brand 8.22
dslr 2.03 Picture 18.2
Flash 3.55
Table 8 Percentage backlog of impact (mobile phone brands)

M1 M2 M3 M4
M1 0 −5.82 −2.83 0.18
M2 5.82 0 2.99 6
M3 2.83 −2.99 0 3.01
M4 −0.2 −6 −3.01 0
Table 9 Percentage backlog

Aspect Relative strength Aspect Relative strength
of impact (mobile phone
aspects) Memory −27.91 Camera 10.45
Battery −3.58 Screen 14.45
Sound 1.5 Appearance 18.7
Brand 7.83 Processor 38.5
Price 8.08
strength among all brands. It implies that brand D1 highly influences the perception
of consumers toward digital camera brand. Hence, the brand D1 is suitable for well-
directed image campaigns and brand image transfers in new product introduction
processes. Among the backlog of digital camera aspects, a picture has 18.2% more
effect on positive sentiment compared to a negative one. On the other hand, the price
has a relative strength of –25.2%, which indicates that an impairment with respect to
the attribute, price, has a higher influence on product evaluation than an improvement
of the same magnitude. The first row of Table 8 indicates that M2 has the highest
relative strength compared to the rest. From Table 9, we can infer that the processor
is highly sensitive to positive sentiment whereas memory is highly sensitive to the
negative sentiment.
By applying MCDM techniques, the order of brands for the digital camera is
Panasonic → Nikon → Canon → Sony, while the order for the mobile phone
brands is HTC One → Nokia Lumia → Apple iPhone → Samsung Galaxy
[1]. As per the preference model, the order of the digital camera brand is Canon →
Panasonic → Nikon → Sony. The order of the mobile phone brand is HTC One →
Nokia Lumia → Apple iPhone → Samsung Galaxy. Here, both approaches yielded
238 K. Ravi et al.
the same ranking for mobile phone brand but not for digital camera brand. In some
techniques of MCDM, we could not obtain same rankings for a set of alternatives
due to compensation features of multi-criteria decision-making methods. That is, if
one brand is ranked lower with respect to a criterion, then it may be compensated by
another criterion. Thus, the trade-off occurs, and the brands get ranked with respect to
an unknown utility function comprising the criteria used by the users while selecting
the brands. Further, the philosophy and underlying theory of conjoint analysis are
different from that of MCDM methods. Therefore, the different ranks are expected.
6 Conclusions and Future Directions
In this study, we applied a hybrid of sentiment analysis and conjoint analysis to deter-
mine preferences of consumers regarding different consumer brands. By employing
different preference models, we computed the relative strength of different product
aspects which contribute to determine the preference. The ranks obtained using
conjoint analysis models are compared with those obtained by using a hybrid of
sentiment analysis and MCDM methods. We observed that the obtained ranks are
identical for one dataset and partially similar for the other dataset. In future, we apply
such hybrids on a huge corpus of reviews to understand the aggregate opinions of
consumers. Further, we can combine different quantitative and qualitative features
to apply conjoint analysis to rank the products and services of commercial banks and
insurance companies. Conjoint analysis needs to be redesigned before applying to
some related fields like political research communication [23].
References
1. Ravi, K., Ravi, V.: Ranking of branded products using aspect-oriented sentiment analysis and
ensembled multiple criteria decision-making. Int. J. Knowl. Manag. Tour. Hosp. 1, 317–359
(2018)
2. Decker, R., Trusov, M.: Estimating aggregate consumer preferences from online product
reviews. Int. J. Res. Mark. 27, 293–307 (2010). https://doi.org/10.1016/j.ijresmar.2010.09.001
3. Do, H.H., Prasad, P.W.C., Maag, A., Alsadoon, A.: Deep learning for aspect-based sentiment
analysis: a comparative review. Expert Syst. Appl. 118, 272–299 (2019)
4. Mowlaei, M.E., Abadeh, M.S., Keshavarz, H.: Aspect-based sentiment analysis using adaptive
aspect-based lexicons. Expert Syst. Appl. 148, 113234 (2020)
5. Ravi, K., Ravi, V.: A survey on opinion mining and sentiment analysis: tasks, approaches and
applications. Knowl. Based Syst. 89, 14–46 (2015)
6. Murty, M.R., Murthy, J.V.R., Reddy, P.P., Satapathy, S.C.: A survey of cross-domain text catego-
rization techniques. In: 2012 1st International Conference on Recent Advances in Information
Technology (RAIT), pp. 499–504 (2012). https://doi.org/10.1109/RAIT.2012.6194629
7. Al-Smadi, M., Al-Ayyoub, M., Jararweh, Y., Qawasmeh, O.: Enhancing Aspect-Based Senti-
ment Analysis of Arabic Hotels’ reviews using morphological, syntactic and semantic features.
Inf. Process. Manag. 56, 308–319 (2019). https://doi.org/10.1016/j.ipm.2018.01.006
8. Ma, X., Zeng, J., Peng, L., Fortino, G., Zhang, Y.: Modeling multi-aspects within one opinion-
ated sentence simultaneously for aspect-level sentiment analysis. Futur. Gener. Comput. Syst.
93, 304–311 (2019). https://doi.org/10.1016/j.future.2018.10.041
9. Zhao, P., Hou, L., Wu, O.: Modeling sentiment dependencies with graph convolutional networks
for aspect-level sentiment classification. Knowl.-Based Syst. 193, 105443 (2020). https://doi.
org/10.1016/j.knosys.2019.105443
10. Nguyen, H.-T., Nguyen, L.-M.: ILWAANet: an Interactive Lexicon-Aware Word-Aspect Atten-
tion Network for aspect-level sentiment classification on social networking. Expert Syst. Appl.
146, 113065 (2020). https://doi.org/10.1016/j.eswa.2019.113065
11. Chen, F., Yuan, Z., Huang, Y.: Multi-source data fusion for aspect-level sentiment classification.
Knowl.-Based Syst. 187, 104831 (2020). https://doi.org/10.1016/j.knosys.2019.07.002
12. Murty, M.R., Murthy, J.V.R., Reddy, P.P., Naik, A., Satapathy, S.C.: Homogeneity separateness:
a new validity measure for clustering problems. In: ICT and Critical Infrastructure: Proceedings
of the 48th Annual Convention of Computer Society of India, vol I, pp. 1–10. Springer (2014)
13. Fan, Z.-P., Li, G.-M., Liu, Y.: Processes and methods of information fusion for ranking products
based on online reviews: an overview. Inf. Fusion. 60, 87–97 (2020). https://doi.org/10.1016/
j.inffus.2020.02.007
14. Mokonyama, M., Venter, C.: Incorporation of customer satisfaction in public transport
contracts—a preliminary analysis. Res. Transp. Econ. 39, 58–66 (2013). https://doi.org/10.
1016/j.retrec.2012.05.024
15. Wu, W.Y., Liao, Y.K., Chatwuthikrai, A.: Applying conjoint analysis to evaluate consumer
preferences toward subcompact cars. Expert Syst. Appl. 41, 2782–2792 (2014). https://doi.
org/10.1016/j.eswa.2013.10.011
16. Dauda, S.Y., Lee, J.: Quality of service and customer satisfaction: a conjoint analysis for the
Nigerian bank customers. Int. J. Bank Mark. 34, 841–867 (2016)
17. Yang, S.-B., Shin, S.-H., Joun, Y., Koo, C.: Exploring the comparative importance of online
hotel reviews’ heuristic attributes in review helpfulness: a conjoint analysis approach. J. Travel
Tour. Mark. 34, 963–985 (2017). https://doi.org/10.1080/10548408.2016.1251872
18. Anand, A., Bansal, G., Aggrawal, D.: Choice based diffusion model for predicting sales of
mobile phones using conjoint analysis. J. High Technol. Manag. Res. 29, 216–226 (2018).
https://doi.org/10.1016/j.hitech.2018.09.008
19. Kodapanakkal, R.I., Brandt, M.J., Kogler, C., van Beest, I.: Self-interest and data protec-
tion drive the adoption and moral acceptability of big data technologies: a conjoint analysis
approach. Comput. Human Behav. 108, 106303 (2020). https://doi.org/10.1016/j.chb.2020.
106303
20. Wang, A., Zhang, Q., Zhao, S., Lu, X., Peng, Z.: A review-driven customer preference measure-
ment model for product improvement: sentiment-based importance–performance analysis. Inf.
Syst. E-bus. Manag. 18, 61–88 (2020). https://doi.org/10.1007/s10257-020-00463-7
21. Mitra, S., Jenamani, M.: OBIM: a computational model to estimate brand image from online
consumer review. J. Bus. Res. 114, 213–226 (2020). https://doi.org/10.1016/j.jbusres.2020.
04.003
22. Baccianella, S., Esuli, A., Sebastiani, F.: SentiWordNet 3.0: an enhanced lexical resource for
sentiment analysis and opinion mining. In: LREC, pp. 2200–2204 (2010)
23. Cambria, E., Olsher, D., Rajagopal, D.: SenticNet 3: a common and common-sense knowl-
edge base for cognition-driven sentiment analysis. In: Proceedings of the twenty-eighth AAAI
conference on artificial intelligence. pp. 1515–1521. AAAI Press (2014)
24. Taboada, M., Brooke, J., Tofiloski, M., Voll, K., Stede., M.: Lexicon-based methods for
sentiment analysis. Comput. Linguist. 37, 267–307 (2011)
25. Knudsen, E., Johannesson, M.P.: Beyond the limits of survey experiments: how conjoint designs
advance causal inference in political communication research. Polit. Commun. 36, 259–271
(2019). https://doi.org/10.1080/10584609.2018.1493009
Task Scheduling in Cloud Using
Improved Genetic Algorithm
Shyam Sunder Pabboju and T Adilakshmi
Abstract Cloud computing usually needs to process a large number of computing

tasks, and task scheduling strategies play a key role in determining the efficiency
of cloud computing. How to allocate computing resources reasonably and schedule
task operations effectively so that the time and cost required to complete all tasks are
shorter is an important issue. This paper proposes an Improved Genetic Algorithm
(I-GA) that considers time and cost constraints. The result of scheduling by this
algorithm can not only make the task completion time shorter, but also cost less.
Through experiments, I-GA is compared with Genetic Algorithm (T-GA) considering
time constraints and Genetic Algorithm (C-GA) considering cost constraints. The
experimental results show that this algorithm is an effective task scheduling algorithm
in cloud computing.
1 Introduction
Since the concept of cloud computing was put forward, it has become a hot research
direction. Paper [1] summarizes the current technology used in cloud computing,
analyzes the technical meaning behind it and the current cloud computing imple-
mentation solutions adopted by participating companies in cloud computing, and
provides three specific cloud computing examples in the industry, including Google’s
GCP that Cloud computing platform, Amazon’s EC2 and Microsoft’s Azure. Paper
[2] defines the concept of cloud computing, and analyzes and describes the problems
and opportunities faced by the development of cloud computing.
Cloud computing provides infrastructure, platform, and software services. Its
basic principle is to divide the computing processing work into multiple smaller
S. S. Pabboju (B)
Department of CSE, MGIT Hyderabad, Telangana, India
e-mail: pshyamsunder_cse@mgit.ac.in
T. Adilakshmi
Department of CSE, Vasavi College of Engineering, Hyderabad, Telangana, India
https://doi.org/10.1007/978-981-16-1502-3_25
242 S. S. Pabboju and T. Adilakshmi
subtasks through the internet, and then a huge system consisting of various servers
will be searched for, calculate and analyze the results, finally return to the user [3].
Cloud computing popularly known for the development of distributed, grid, and
parallel computing. Which can be used in the business model as pay for use. Authors
in [4] comprehensively compare grid computing and cloud computing, and points
out the business model of cloud computing as “on demand, pay for use”.
Due to the higher number of computing tasks faced by cloud computing, task
scheduling and resource allocation are the key and difficult points that determine
the efficiency of cloud computing. At present, there is not much research on task
scheduling and resource allocation in cloud computing, while grid computing has
conducted extensive research on related issues [5–8]. To a certain extent, the two
are similar. A task scheduling algorithm in grid computing, the main goal is to
minimize the time required to complete all tasks. Most task scheduling algorithms
optimize task scheduling with this goal. However, in the cloud computing model,
the cost required for task execution is also a factor that cannot be ignored. Resources
with different computing capabilities have different usage costs. For time-sensitive
applications, provide resources with strong processing capabilities, so that the task is
completed in a shorter time. For cost-sensitive user applications, provide resources
with lower processing costs, so that the cost of task completion is lower. In this
research work, by studying how to schedule task so that it allocates resources in
cloud computing reasonably and efficiently, this work came up with GA-based task
scheduling algorithm named Improved Genetic Algorithm (I-GA) that considers time
and cost constraints Genetic Algorithm. Further, through simulation experiments, the
efficiency of this work is verified.
2 Task Scheduling Problem in Cloud
In the present situation, most of the cloud computing platforms adopt the Map/Reduce
programming model proposed by Google for parallel processing of large-scale data
sets. Through the two stages of Map and Reduce, the larger task is divided into
multiple smaller subtasks, and then allocated to multiple computing resources for
parallel execution, and the final running result is obtained. Under the Map/Reduce
programming model, how to divide more number of subtasks is the major problem
to be considered. Cloud service providers need to extend services to various users
at given instance of time, taking into account the response time of each user, and
at the same time, considering the cost of the service. The available task scheduling
algorithms focus primarily on optimization as one of the major concerns, which tends
to result in a shorter task completion time and a higher cost. Therefore, this paper
proposes IGA to improve scheduling of tasks and allocation of resources in cloud
computing in order to enhance efficiency of cloud computing.
Resources in cloud computing include processors, storage, networks, etc. The use
of resources is used on-demand and paid for by usage. This paper treats the resources
in cloud computing as computing resources and makes the following assumptions:
Task Scheduling in Cloud Using Improved Genetic Algorithm 243
1. The input of a task is a batch of subtasks that are decomposed into multiple larger
computing tasks, and the granularity of subtasks is uniform, that is the required
running time is not much different.
2. The number of subtasks is far greater than the number of resources.
3. The time needed by the subtask to run on each cloud computing resource is
known.
4. The cost of task running unit time on each computing resource node is known.
Here we will be using N to represent the number of subtasks, M to indicate required
no. of cloud computing resources, and it makes use of M × N ’s ETC (Expect Time to
Complete) matrix [9] (ETC(i,j) which indicates the time required by the j-th subtask
is completed on the i-th computing resource) to calculate the time required for the
task queue to run on each computing resource. Use RCU(i) (Resource Cost per Unit)
to represent the cost of running tasks in each computing resource unit. The subtask is
represented by T j , and the computing resource is represented by Pi . Then the subtask
instance can be described as (T j , Pi , ETC(i, j), RCU( j)), i ∈ [1, M], j ∈ [1, N ].
Under the above assumptions, the resource scheduling issue in cloud computing
may be defined as the best way to allocate subtasks to different cloud computing
resources effectively such that the time taken to complete the task is less and the cost
is lower.
3 Improved Genetic Algorithm (I-GA) for Scheduling
Genetic Algorithm (GA) is an adaptive probability optimization technology that is

suitable for complex system optimization based on biological genetics and evolution
mechanisms inspired by biological simulation technology by Professor Holland. In
short one can rate this as an efficient, parallel, and global search method, which
implicitly inherits and accumulate knowledge regarding problem search space when
using search mechanism, and is adaptive control search process to find the best
possible optimal solution [10].
3.1 Encoding and Decoding of Chromosomes
There are many ways to encode chromosomes, either direct encoding (encoding
the execution status of the task) or indirect encoding. This work makes use of the
resource-task indirect coding method proposed in [8] to code the resources occupied
by subtasks. The chromosome length is determined by the number of subtasks, and
expected value of individual gene in the chromosome is the resource number occupied
by the subtask corresponding to that position, as shown in Fig. 1. Among them, Ti
represents the task number, and Pi represents the resource number occupied when the
task Ti is executed. When generating the initial population, the resource number Pi
Fig. 1 Task code
in each chromosome is randomly generated. After crossover and mutation operators,

the subtask Ti may occupy any available resource, so the optimal solution must
correspond to a certain chromosome code. Assuming there are 10 subtasks and 3
available resources, chromosome length is 10 and individual gene value is a random
number between 1 and 3. For example, the following chromosome code is randomly
generated: {2, 1, 2, 1, 3, 1, 3, 3, 2, 3}.
First subtask will be represented by this chromosome that runs on second cloud
resource, the second subtask runs on the first cloud resource, and so on, the tenth
subtask runs on the third resource.
After the chromosome is generated, it must be decoded to get the distribution of
subtasks which runs on different resources. The subtasks are classified according to
the occupied resources, and multiple sets of subtask sequences classified according
to resource numbers are generated. Decode the above chromosome as:
P1 : {T2 , T4 , T6 } , P2 : {T1 , T3 , T9 } , P3 : {T5 , T7 , T8 , T10 }
The sequence of subtasks allocated to each computing resource is obtained by

decoding, and the time taken for each computing resource to finish the sequence
of subtasks can be calculated using the ETC matrix. Due to the characteristics of
concurrent processing among various computing resources in cloud computing, the
threshold value of the above calculation results is considered as the time when all
subtasks are completed:

n
sumTime(i) = Time(i, j), i ∈ [1, M] (1)
j=1
completeTime (I ) = max(sumTime(i)) (2)
In the above equation, n represents the number of individual subtasks allocated

to each computing resource, and T ime(i, j) indicates the time required to complete
the execution of the j-th subtask allocated to the cloud computing resource Pi. At
this point, using the sumTime(i) obtained above, combined with RCU(i), the cost
required to complete all subtasks can be obtained:

M
complete cost(I ) = sum Time(i) × RCU(i) (3)
i=1
The task scheduling algorithm proposed in this paper needs to consider the time
and cost of all subtasks at the same time. Here, using the greedy algorithm, the
maximum time and maximum cost constraints required for the completion of all
subtasks are:
MaxTime = completeTimeMIN +
(4)
t × completeTimeMAX − completeTimeMIN
MaxCost = completeCostMIN +
(5)
c × completeCostMAX − completeCostMIN
Among them, completeTimeMIN and completeCostMIN are the results of greedy

selection based on the possible minimum time and minimum cost needed for the
subtasks to be get executed on each cloud computing resource. completeTimeMAX
and completeCostMAX are just the opposite, which are based on the subtasks running
on each computing resource. The maximum time and maximum cost required to
complete the results obtained by greedy selection. The t ∈ [0, 1] in the formula (4) is
the time factor, and the c ∈ [0, 1] in the formula (5) is the cost factor. Their values are
specified by the user according to their needs, and t and c are inversely proportional.
For time-sensitive applications, t should be specified as the smaller value between
[0.2, 0.5], and c should be specified as the larger value between [0.5, 0.8]. For cost-
sensitive applications, c should be specified as the smaller value between [0.2, 0.5],
and t should be specified as the larger value between [0.5, 0.8].
3.2 Generation of Initial Population
If the population size is considered to be S, where M indicates the number of resources

and N indicates number of subtasks, then the initialization description is: S chromo-
somes are generated by the system randomly, N is the length of chromosome, and
the gene value lies in [1, M] and it is a random number.
3.3 Fitness Function
The selection of the fitness function of the genetic algorithm is very important, which
directly affects the convergence speed of the genetic algorithm and the search for
the optimal solution. Individuals with greater fitness are more likely to be inherited
to the next generation. Individuals with less fitness are less likely to be inherited to
the next generation. Task scheduling needs to consider the time and cost required to
complete all subtasks.
The fitness function of the defined time is:
1
Ftime (I ) = × u LB (6)
complete Time (I )
M
i=1 sumTime(i)
u LB = (7)
M × completeTime(I )
The u LB in formula (6) is defined as the load factor of balancing tasks, and its value
can be obtained by formula (7), which represents the utilization of each computing
resource. The larger the value of u LB , the greater the utilization of cloud computing
resources, and the smaller the value of completeTime(I ) will be.
The fitness function that defines the cost is:
1
Fcost (I ) = (8)
complete cost(I )
In the fitness function that only considers time constraints, the greater the uti-
lization of cloud computing resources and the time will be proportionately less to
complete all subtasks, further fitness value will be high. In the fitness function that
only considers cost constraints, as the cost of completing all subtasks is less, the
greater is the fitness value. Accordingly, the fitness function considering the time-
cost constraint can be defined as:
Fitness (I ) = α × Ftime (I ) + β × Fcost (I ) (9)
In above equation α ∈ [0, 1], β ∈ [0, 1], α + β = 1. When α = 1, β = 0, the

result of algorithm scheduling is the shortest time scheduling to complete all sub-
tasks. When α = 0, β = 1, the result of algorithm scheduling is the minimum cost
scheduling of all subtasks.
3.4 Genetic Manipulation
3.4.1 Selection Operation
Selection operation is the process of selecting individuals with strong adaptability

in a population to generate a new population. As per the principle of “survival of
the fittest”, if the fitness of an individual is high, then greater will be the probability
of being selected and inherited to the next generation, so that the fitness value of
the individual in the population is constantly reaching the optimal solution. I-GA
makes use of roulette selection as the selection operation operator and determines
the probability of an individual being selected by the fitness calculation formula (9).
Fitness(i)
P(i) = S (10)
j=1 Fitness( j)
The fitness function takes into account the time and cost constraints of task
scheduling. Through the above selection operations, there are both individuals with
shorter task finish time and individuals with less task finish cost in the population.
3.4.2 Crossover and Mutation
Crossover is termed as operation in the main method to produce new generation

individuals, which can be used as a global search item of a given genetic algorithm.
Mutation operation will be used to enhance local search the ability of the given
genetic algorithm, which preserves the diversity of the population, and premature
phenomena will be prevented. I-GA uses the adaptive genetic algorithm (AGA)
proposed in [11], and improves the calculation formulas of crossover probability
and mutation probability, and adaptively adjusts the probability of crossover and
mutation operations.

Pcl − (Pcl − Pc2 ) × f max − f / f max − f avg , f f avg
Pc = (11)
Pc1 , f ≺ f avg

Pm1 − (Pm1 − Pm2 ) × ( f max − f ) / f max − f avg , f f avg
Pm = (12)
Pm1 , f ≺ f avg
In the formula, f max indicates the maximum fitness value in the group. f avg indi-
cates the average fitness value of each generation of the group. f indicates the larger
fitness value of the two individuals to be crossed. f indicates the fitness value of the
muted individual [11].
3.5 I-GA Reschedule
After each generation of genetic operations ends, I-GA uses the MaxTime and Max-
Cost constraints obtained at the beginning of the algorithm to compare with the chro-
mosomes of the optimal subtask scheduling results. If the optimal subtask scheduling
result generated by the running of the I-GA algorithm does not satisfy the constraint
condition that completeTime(I) is less than or equal to MaxTime, or completeCost(I)

is less than or equal to MaxCost, the I-GA algorithm needs to be rerun to generate a
new optimal subtask scheduling result.
Work implemented in this paper is based on CloudSim [12–15] platform. The same
is used to simulate the cloud environment. Under the same conditions, I-GA, T-GA
(Time constraints Genetic Algorithm) and C-GA (Cost constraints Genetic Algo-
rithm) are used for comparative experiments. The values of various parameters used
for this work are shown in Table 1.
The first and foremost condition of the algorithm: S is 60, M is 5, N is 1000,
further the system generates ETC matrix and RCU array.
Algorithm Termination condition: Taking into account the overhead of using
genetic algorithm to schedule tasks, set the maximum evolution algebra (MaxGn) to
100, and the algorithm terminates without waiting for the algorithm to converge.
The experimental results are shown in Figs. 2 and 3.
It can be seen from Fig. 2 that in the early phase of genetic algorithm evolution,
the total task finish time required for the optimal subtask scheduling results generated
by I-GA and T-GA and C-GA operations are not much different. With the growth of
evolutionary algebra, I-GA, and T-GA scheduling results have become more obvious
in the optimization of the total task completion time, while C-GA scheduling results
have no obvious optimization effect on task completion time in total.
One can observe from Fig. 3 that in the early phase of genetic algorithm evolution,
the total task completion cost required for the optimal subtask scheduling results pro-
duced by I-GA and T-GA and C-GA operations is not much different. With the growth
of evolutionary algebra, I-GA and C-GA scheduling results have become more and
more obvious in the optimization of the total task completion time, while T-GA
scheduling results have no obvious optimization effect on the total task finish time.
Table 1 Simulation parameters

Major Parameters I-GA T-GA C-GA
t 0.5 − −
c 0.5 − −
α 0.3 1 0
β 0.7 0 1
Pc1 − 0.9 −
Pc2 − 0.61 −
Pm1 − 0.1 −
Pm2 − 0.01 −
Fig. 2 Comparison of total task completion time
In summary, the subtask scheduling results obtained by T-GA can achieve the
shortest total task completion time, but the effect of optimizing the task completion
cost is not obvious. The subtask scheduling results obtained by C-GA can achieve the
smallest total task completion cost, but The optimization effect of task completion
time is not obvious. I-GA also considers the constraints of time-cost on the algorithm,
so the result of subtask scheduling obtained makes the total task finish time shorter
and cost involved will be less.
5 Conclusion
Task scheduling algorithms usually use the total time taken for the process to complete
the task as the standard to schedule tasks. This paper combines the characteristics
of cloud and proposes an improved scheduling algorithm for cloud based on GA
considering time-cost constraints. The algorithm combines the total time taken for
task to complete its work with the total cost of task completion is also used as a
standard to schedule tasks. Experimental results show that this algorithm can achieve
a more reasonable task scheduling in the cloud computing platform and produce ideal
task scheduling results. In future work, we will focus on resource load balancing
Fig. 3 Comparison of total task completion cost
for dynamic task scheduling in cloud computing, and consider the impact of other
resources in cloud computing, such as network service quality, data distribution, and
other factors on task scheduling results.
References
1. Jakobik et al.: Non-deterministic security driven meta scheduler for distributed cloud organi-
zation. Simul. Model Pract. Theory 67–81 (2017)
2. Douglas et al.: Experimental assessment of routing for grid and cloud. In: 10th International
Conference on Networks pp. 341–346 (2011)
3. Alhakami et al.: Comparison between cloud and grid computing: review paper. Int. J. Cloud
Comput. 2(4) 1–21 (2012)
4. Hao, Y, et al.: An adaptive algorithm for scheduling parallel jobs in meteorological Cloud.
Knowl. Based Syst. (2016) 226–240
5. Khorandi et al.: Scheduling of online compute-intensive synchronized jobs on high performance
virtual clusters. J. Comput. Syst. Sci. 1–17 (2017)
6. Chongdarakul et al.: Efficient task scheduling based on theoretical scheduling pattern con-
strained on single I/O port collision avoidance. Simul. Model. Pract. 171–190 (2016)
7. Cao, Q., et al.: An optimized algorithm for task scheduling based on activity based costing in
cloud computing. In: 3rd International Conference on Bioinformatics and Biomedical Engi-
neering, pp. 34–37 (2009)
8. Guo, L., et al.: Task scheduling optimization in cloud computing based on heuristic algorithm.
J. Netw. 547–553 (2012)
9. Buyya, R., et al.: GridSim: a toolkit for the modeling and simulation of distributed resource
management and scheduling for grid computing. J. Concurr. Comput. 13–15 (2002)
10. Calheiros, R.N., et al.: CloudSim: a novel framework for modeling and simulation of cloud
computing infrastructures and services. Technical Report, GRIDS-TR-2009-1, Grid Computing
and Distributed Systems Laboratory (2009)
11. Buyya, R. et al.: Calheiros, modeling and simulation of scalable cloud computing environments
and the CloudSim toolkit: challenges and opportunities. High Perform. Comput. Simul. 1–11
(2009)
12. Zhong-wen, G., et al.: The Research on cloud computing resource scheduling method based on
Time-Cost-Trust model. In: 2nd International Conference on Computer Science and Network
Technology (ICCSNT), p. 10 (2009)
13. Wu, H., et al.: A priority constrained scheduling strategy of multiple workflows for cloud
computing. In: 14th International Conference on Advanced Communication Technology (2012)
14. Zhang, X., et al.: Locality-aware allocation of multi-dimensional correlated files on the cloud
platform. J. Distrib. Parallel Databases 33(3), 353–380 (2015)
15. Mukundan, et al.: Efficient integrity verification of replicated data in cloud using homomorphic
encryption. In: J. Distrib. Parallel Databases 32(3), 507–534 (2014)
Sentiment Analysis for Telugu Text Using
Cuckoo Search Algorithm
G. Janardana Naidu and M. Seshashayee
Abstract In recent times, most of the microblogging applications have started

allowing people to express their opinions and feeling toward entities in regional
languages. This resulted in good demand for sentiment analysis in regional languages.
Telugu is a morphologically rich agglutinative south Indian language with nearly 100
million native speakers. In this paper, various unsupervised machine learning algo-
rithms are explored for the classification of Telugu text into negative or positive
classes.
1 Introduction
In recent times, most of the microblogging applications have started allowing indi-
viduals to give their feelings and opinions toward products or issues of public interest
in regional languages. As a result, huge volumes of text are made available in regional
languages. This resulted in good demand for sentiment analysis in regional languages
along with other research areas like text summarization, and machine translation.
Telugu is a morphologically rich agglutinative south Indian language with nearly 100
million native speakers. Recently many researchers have started showing interest in
the research area of sentiment analysis for Telugu language. In this paper, we explored
various unsupervised learning algorithms for the classification of Telugu text into
negative or positive classes. The dataset used for the current study is the Annotated
Corpus for Telugu Sentiment Analysis (ACTSA) [1] which is a collection of Telugu
text taken from various e-newspapers. A few changes to the dataset have been made
so has to be appropriate for the study. The modified dataset undergoes a few prelim-
inary steps before the unsupervised algorithms are applied to it. The preliminary
steps the dataset goes through are pre-processing and feature extraction. Two unsu-
pervised algorithms are used, namely K-means and Cuckoo Search algorithm for the
classification of Telugu text into negative or positive classes.
G. Janardana Naidu (B) · M. Seshashayee

Department of Computer Science, GITAM (Deemed to be University), Visakhapatnam, India
https://doi.org/10.1007/978-981-16-1502-3_26
254 G. Janardana Naidu and M. Seshashayee
2 Related Work
Support Vector Machines (SVM) was used by Mullen and Collier [2] to bring together
information from diverse sources and assign values to selected words and phrases so
that texts can be classified as positive or negative. Pandey et al. [3] proposed a method
to find the appropriate cluster heads from Twitter dataset’s sentimental content based
on K-means and cuckoo search. Lee and Cheoah [4] proposed a method to predict
the usefulness of online reviews based on neural networks.
Das and Bandyopadhyay [5] generated SentiWordNets for Indian languages which
include Telugu. Computational techniques for generation of sentiment lexicons for
Indian Languages were proposed by Das and Bandyopadhyay [5]. Dr. Sentiment
a tool which automatically creates the PsycoSentiWordNet an extension of Senti-
WordNet was proposed by Das and Bandyopadhyay 2011 [6]. PsycoSentiWordNet
is created involving the Internet population, and presently sentiment knowledge and
human psychological knowledge on a few aspects.
Mukku et al. [7] explored various supervised learning algorithms for the
classification of Telugu text into negative or positive classes.
3 Dataset
Annotated Corpus for Telugu Sentiment Analysis (ACTSA) [1] has a collection of
Telugu sentences taken from various e-newspapers and preprocessed and manually
annotated by Telugu native speakers using annotated guidelines. Dataset contains
1489 positive sentences, 1441 negative sentences, 2475 neutral sentences and total
5410 sentences.
4 Methodology
This approach involves three steps, pre-processing, feature extraction and clustering.
4.1 Pre-processing
Each sentence is converted into tokens using python regular expression which uses
spaces as a delimiter. As a next step, word embedding is created by using Word2Vec
tool provide by Gensim. Word2Vec model created using 5 windows and 200 feature
dimension vector and vocabulary table was built. As a last step model was trained
and saved for further use.
Sentiment Analysis for Telugu Text Using Cuckoo … 255
4.2 Clustering
K-means
K-means data clustering method groups n points into K groups by iteratively mini-
mizing the distance of the K-cluster heads from the data points. Euclidean distance or
cosine means are used to calculate the distance. Centroids are iteratively calculated
by minimizing the squared sum of distance between data point and centroid. In this
paper, scikit-learn package in python is used to implement K-means algorithm.
Algorithm 1
1. Randomly K-cluster heads are specified

2. Data points are assigned to the cluster to which the distance is minimum
3. Eq. (1) is used to calculate the new cluster head.
1
ci = di , i = 1, 2, 3, 4 . . . (1)
ni di si
4. Continue Step 2 and 3 until it converges
Cuckoo Search Algorithm

The algorithm is based upon the breeding behavior of the cuckoo bird. A few species
of cuckoo engage the obligate brood parasitism by using other species nests to lay
their eggs. There are three idealized rules for the cuckoo search algorithm [8]. The
rules are as follows:
(1) At a given time, a randomly chosen nest is taken and the cuckoo lays one egg
in it.
(2) The nests with best quality eggs are sent to the next generation.
(3) The host nests used in the algorithm are fixed, and the eggs laid by cuckoo are
discovered with a probability pa .
Then generate an initial population of n host nests x i (i = 1, 2,…n). A cuckoo is
selected randomly using levy flight Eq. (2) at each iteration. This process of selection
runs until the convergence is reached.
X i(t+1) = X i(t) + α ∗ LF (2)
where LF is a value from the Levy distribution, α > 0 is the step-size, i = 1, 2, …,

n, n is the number of nests considered.
It is assumed that each nest is a solution and the cuckoo egg represents a new
solution. Then comparison of the fitness of the existing solution (F n ) with the new
solution (F c ) is done. If F c > F n , then replace the solution.
The fitness of the cuckoo is calculated using
256 G. Janardana Naidu and M. Seshashayee
Fig. 1 Architecture for cuckoo search (CS) for sentiment analysis
f i = f (X i ) i = 1, 2, . . . n (3)
And

K
nk
f (k) = (xi − ck )2 (4)
k=1 i=1
5 Result
Two experiments are done. K-mean algorithm is used to verify the sentiment of
Text as first experiment. Second experiment is conducted by using cuckoo search
algorithm to find initial centroid. Cuckoo Search (CS) algorithm provides the best
result in clustering compared to K-means. All the programs are written in python
using scikit-learn,1 genism2 packages (Fig. 1).
6 Conclusion
The results show that the use of Cuckoo Search is better in comparison with the use of
K-means. The reason being the capacity of cuckoo search to identify the centroid of
the cluster is better than K-means. As mentioned, the reason for use of unsupervised
learning algorithms is the lack of annotated datasets for Telugu texts in multiple
domains. Future work can be done to explore more unsupervised algorithms and
1 https://scikit-learn.org/stable/install.html.
2 https://pypi.org/project/gensim/.
Sentiment Analysis for Telugu Text Using Cuckoo … 257
Comparative Chart
120
100
80
60
40
20
0
Accuracy Precision Recall F1 score
K-means CS
Fig. 2 Comparative chart
Table 1 Comparative table

Accuracy Precision Recall F1-Score
K-means 51.2 51.1 99.1 67.4
Cuckoo search 58.1 55.1 95.7 69.9
to identify a suitable algorithm for sentiment analysis of Telugu language (Fig. 2;

Table 1).
Acknowledgements I would like to thank Dr. D. Sasi Raja Sekhar, Assoc. Professor in St. Mary’s
Group of Institutions, Hyderabad, who motivated me toward research in NLP.
References
1. Mukku, S.S., Radhika, M.: ACTSA: annotated corpus for telugu sentiment analysis. In: Proceed-
ings of the First Workshop on Building Linguistically Generalizable NLP Systems, pp 54–58
(2017)
2. Mullen, T., Collier, N.: Sentiment analysis using Support Vector Machines with diverse
information sources. EMNLP 4, 412–418 (2004)
3. Pandey, A.C., Rajpoot, D.S., Saraswat, M.: Twitter sentiment analysis using hybrid cuckoo
search method. Inf. Process Manage. 53, 764–779 (2017)
4. Lee, S., Choeh, J.Y.: Predicting the helpfulness of online reviews using multilayer perceptron
neural networks. Expert Syst. Appl. 41(6), 3041–3046 (2014)
5. Das, A., Bandyopadhyay, S.: SentiWordNet for Indian Languages. In: The 8th Workshop on
ALR, COLING 2010, pp 56–63 (2010)
6. Das, A., Bandyopadhyay, S.: Dr sentiment knows everything!. In: ACL/HLT 2011 Demo Session,
pp. 50–55 (2011)
7. Mukku, S.S., Choudhary, N., Mamidi, R.: Enhanced sentiment classification of Telugu text using
ML techniques. In: 25th International Joint Conference on Artificial Intelligence (2016)
8. Yang, X.-S., Suash, D.: Cuckoo search via levy flight. World congress on nature and biologically
inspired algorithms. EEE Publication, pp 210–214 (2009)
Automation of Change Impact Analysis
for Python Applications
T. Jalaja, T. Adilakshmi, and P. S. R. Abhishek
Abstract Software applications have to be updated on an ongoing basis as per the

requirements of the user or the client or to fix any bugs. The cost of this maintenance
phase of a software application typically costs more than 50% of all other software
development life cycle (SDLC) phases. When a change request (CR) is received
from the client, developers have to work upon the request. It may be possible that as
a result of addressing this CR, it may impact other areas of the existing application
functionality. This mandates that developer working on this CR should have complete
knowledge of the application codebase and working scenarios. Quite often, developer
may be lacking this extensive expertise and also may not have the time required to
spend in doing the detailed impact analysis. There are some change impact analysis
(CIA) tools which can aid developer in finding out almost all impacted elements for a
given CR. But no such tool or prototype exists for Python applications which can aid
developer in finding out impacted elements for a CR. This paper aims at developing
an impact analysis tool (HETeye) which will help the developer to know what all
elements of the Python source code will be affected and the dependencies of affected
elements upon giving a CR and blacklist words which help in filtering the results
even further.
1 Introduction
Software applications will keep evolving for years and decades. For example, Face-
book started as a simple chat application in 2004, and now, it evolved into a widely
adopted social media platform and a tech giant [1] by adding new features and
building services over the course. During the evolution process, there would have
been some code changes and integrations. However, majority of the codebase would
T. Jalaja (B) · T. Adilakshmi · P. S. R. Abhishek

Vasavi College of Engineering, Hyderabad, Telangana, India
e-mail: jalaja.t@staff.vce.ac.in
T. Adilakshmi
https://doi.org/10.1007/978-981-16-1502-3_27
260 T. Jalaja et al.
have remained the same. Over the duration, the code becomes legacy, which makes
it more tedious to maintain as it requires more resources and time to perform any
task on it.
Standards organizations like ISO [2] and IEC [3] mandate to perform change
impact analysis (CIA) prior to making any software changes to the application for
some perilous sectors like railway, aviation, medical and few other sectors. These
standards do not state on how to perform the change impact analysis. In most appli-
cations, it is done manually with help of diagrams and charts like system dependency
graph (SDG). Sometimes, developers will discuss to find out the possible impacted
elements based on their prior knowledge of the codebase. But these methods are
labor-intensive, time consuming and less accurate. In such scenarios, CIA tools aid
the developers in finding out impacted elements with less efforts, thereby improving
the productivity.
There are few existing CIA tools available for languages like JAVA, C and C++.
Some of these tools like ImpRec [4] use information retrieval (IR) and recommenda-
tion system for software engineering (RSSE), where the system is trained on infor-
mation of what files were impacted for a change and start giving recommendations
after training. These methods are inefficient as they take time to train and build a
knowledge base for each application.
Natural language processing (NLP) is a technology that gives the machine ability
to understand and analyze the human languages.
The existing NLP tools can process human language and derive the sentence
meaning and context, in a considerable amount of time. They can also be used to
check the similarities between word and sentences or the relationship of words with
a sentence. Using the parts-of-speech (PoS) tagger, we can get the significance of
the words in a sentence.
Python is one of the languages increasing in popularity over the last decade [5] for
various reasons, and there is no proven CIA tool available for Python applications.
2 Literature Survey
2.1 Change Impact Analysis
A key factor for success of software is that they can be modified with less efforts and
resources compared to other engineering disciplines. But making changes to a part
of code can have impact on other parts of the code related to it, which increases the
failure rate of the software when a change is made. This is referred to as ripple effect
or side effect.
To overcome this, the impacted parts of code should also be modified according
to the changes being made. But understanding the impact of a change on the code
is a tedious and time-consuming task. To reduce the failure rate, the change impact
Automation of Change Impact Analysis for Python Applications 261
analysis is mandated by standards organizations like ISO and IEC in safety-critical

sectors like aviation [2, 3].
Bohner et al. defined CIA as ‘the process of identifying the potential consequences
of a change, or estimate what needs to be modified to accomplish a change’ in the
book Software Change Impact Analysis [6].
2.2 Existing Tools
Software engineering projects constitute of thousands of heterogeneous artifacts, and

the relation between them is even more complex. Analyzing the impact manually
between them is time taking and also requires prior experience with that project.
There is a lot of research being conducted on CIA, to ease the process by building
tools which can aid developer in understanding the impact with less effort.
There are some tools built to perform CIA, and most of them are built using
static code analyzers, information retrieval (IR) systems, recommendation system
for software engineering (RSSE) or with a combination of those technologies.
Though they helped developers in perform CIA, their efficiency can still be
improved.
We can mimic the human process of understanding the purpose of the code element
through its name by using natural language processing (NLP).
With NLP libraries and models like NLTK [7] and Open AI’s [8] offerings, we can
build a tool which can analyze the change request and relevance of a code element
with that change request
3 Methodology
3.1 Proposed Work
In this paper, we aim at developing a CIA tool (HETeye, pronounced as HET-I)

for Python applications which is efficient and faster. The technologies like natural
language processing (NLP) and an enhanced algorithm are used to process the change
request and output the affected elements.
In this section, the HETeye tool is discussed, which takes the change request, path
of the source code and blacklisted words as input. HETeye then processes the change
request based on parts of speech and stop words to identify the word with emphasis.
Then, synonyms of these emphasized words are generated based on the context of
change request.
HETeye computes rank for each class, method, method argument, attribute, deco-
rators and imported libraries, where the rank represents the number of words associ-
ated with user input present in the name of the method, class or other code elements.
The higher the rank, the more it is related to the change request.
Blacklist words is a list of words given by user as input to further filter the results as
per his needs. The classes, methods and attributes with rank 1 will not be considered
if the only word its relative with is in blacklist. This comes in handy to filter out the
results or to filter out other common programming constructs.
HETeye will output the affected elements, file wise with the elements sorted
according to their ranks and their dependencies if any are present.
3.2 Proposed Algorithm
Figure 1 depicts the flowchart of the proposed algorithm.
Fig. 1 Flowchart of
proposed algorithm
3.3 Implementation Steps
Classification of Elements This phase will tokenize the change request and tag the
words using their respective parts of speech which are used to find out the emphasized
words. Then, the synonyms of those emphasized words are generated based on the
context of change request.
Getting Impact Set This phase uses the output of the previous phase to search for
classes, methods and attributes whose names match with any of the words generated
in previous set. It also makes a list of dependencies (abstract tree) of the classes and
methods in the result.
3.4 Performance Metrics
Accuracy and precision are used to evaluate the performance of the HETeye tool.
Confusion matrix depicts how the actual values differ from the predicted values
with four attributes. Figure 2 gives an idea on how the data is categorized under those
four attributes.
Accuracy is the proportion of correct classifications from overall number of cases.
True Negative + True Positive

Accuracy =
True Negative + False Negative + True Positive + False Positive
(1)
Precision is the proportion of correct positive classifications from overall positive

classifications.
True Positive True Positive
Precision = = (2)
True Positive + False Positive Total Positive
Fig. 2 Confusion matrix

Table 1 Sample CRs showing the corresponding TP, TN, FP, FN and accuracy for gensim
Change request TN TP FN FP Accuracy Precision
Improve performance of author model 14012 6 2 5 0.99950 0.545455
Change corpus indexing method 14016 7 1 1 0.99985 0.875
Increase window size while summarization 14017 6 2 0 0.99985 1
Use tidygraph instead of igraph 14024 1 0 0 1 1
Decrease minimum words of article in wiki corpus 14006 10 0 9 0.99935 0.526316
Add functionality to change base dir 14013 7 5 0 0.99964 1
4 Results
The accuracy and precision of the HETeye tool were tested upon three applications
taken from GitHub. Each application was built to serve different purpose. The average
accuracy and precision over these three applications will be considered as the average
accuracy and precision of the HETeye tool.
4.1 Gensim
The first application is Gensim, which is a Python library for topic modeling,
document indexing and similarity retrieval with large corpora [9].
Table 1 shows some of the change requests for this application and their
corresponding TP, TN, FP, FN, accuracy and precision values.
The average for Gensim accuracy is 0.999702911.
The average for Gensim precision is 0.824461722.
4.2 Zulip
The second application is Zulip, an open-source group chat application that

combines the immediacy of real-time chat with the productivity benefits of threaded
conversations. It is developed using Django Framework [10].
Table 2 shows some of the change requests for this application and their corre-
sponding TP, TN, FP, FN, accuracy and precision values. Figure 3 shows accuracy
and precision values of each CR along with average lines.
The average accuracy for Zulip is 0.999187992.
The average precision for Zulip is 0.781900452.
In some change requests, the false positive percentage is a bit higher. Though
those cases are not affected, those elements are still related to the change request,
this trend was not seen in other applications being tested.
Table 2 Sample CRs showing the corresponding TP, TN, FP, FN and accuracy for Zulip
Change date time format 40546 79 15 0 0.99963 1
Remove statsd integration 40555 65 0 20 0.99950 0.764705
Implement ip rate based limiting 40555 45 0 40 0.99901 0.529412
Replace mock path 40406 144 90 0.99778 0.615385
Remove the feature to mute topics 40532 108 0 0 1 1
Fig. 3 Bar chart of Gensim CR’s (right) and bar chart of Zulip CR’s (right)
4.3 Bokeh
The third application is Bokeh, an interactive visualization library for modern Web
browsers built using Python. The majority of the codebase is in Python and typescript
[11]. Figure 4 shows the accuracy and precision of few Bokeh change requests.
Table 3 shows some of the change requests for this application and their
corresponding TP, TN, FP, FN, accuracy and precision values.
The average accuracy for Bokeh is 0.999929766.
The average precision for Bokeh is 0.986666667.
4.4 Result
The average accuracy and precision of the tool are 0.99960 and 0.86434, respectively.
Figure 5 shows the accuracy and precision value of all CR’s of all applications.
Figure 6 shows how the output of the impact analysis tool looks like, file-wise
classification of elements along with their ancestors and sorted according to their
rank. The number of lines affected depicts the number of occurrences of affected
items in that file.
Fig. 4 Bar chart of Bokeh

CR’s
Table 3 Sample CRs showing the corresponding TP, TN, FP, FN and accuracy for Bokeh
Replace setter_id with better mechanism 48221 195 15 0 0.99969 1
Replace yaxis, ygrid with y_axis, y_grid 48221 391 0 0 1 1
Replace xaxis, xgrid with x_axis, x_grid 48221 512 0 0 1 1
Redesign set_dataset_visual 48221 28 0 2 0.999959 0.933333
Fig. 5 Bar chart of CR’s

results
Results
2
0
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
Accuracy Precision
The developed software tool displays the impacted set of classes, methods, attributes
and other elements like imports and arguments with an average accuracy of 99.96%
and average precision of 86.43% which was calculated by comparing the manual
result to output given by the tool. This tool was developed using Python and takes
only Python applications as input.
It can be further improved by generating some blacklist words automatically
based on the context of the change request and by listing the elements associated
Fig. 6 Example output (snippet)
with library methods whose implementation cannot be altered. The Open AI’s GPT
[8] is developed for conversation generation but, it can be used to get the in-depth
meaning and context of a sentence. This API can be used to understand CR better,
thus improving the accuracy.
References
1. Britannica–Facebook: https://www.britannica.com/topic/Facebook
2. International Organization for Standardization: ISO 26262-1:2011Road Vehicles—Functional
Safety (2011)
3. IEC 61511-1 ed 1.0, Safety Instrumented Systems for the Process Industry Sector (2003)
4. Borg, M.,Wnuk, K., Regnell, B., Runeson, P.: Supporting change impact analysis using a recom-
mendation system: an industrial case study in a safety-critical context. In: IEEE Transactions
on Software Engineering (2016)
5. https://stackoverflow.blog/2017/09/06/incredible-growth-python/
6. Bohner S., Arnold R.: Software change impact analysis. (IEEE Computer Society Press, Los
Alamitos, 1996)
7. Nltk: https://www.nltk.org/
8. Language Models are Few-Shot Learners: https://arxiv.org/abs/2005.14165
9. Gensim: https://github.com/RaRe-Technologies/gensim
10. Zulip: https://github.com/zulip/zulip
11. Maps Model Importer: https://github.com/eliemichel/MapsModelsImporter
Enhancing Item-Based Collaborative
Filtering for Music Recommendation
System
M. Sunitha, T. Adilakshmi, and Mir Zahed Ali
Abstract Music recommendation system is a tool designed to help users to find

interesting music from huge volumes of digital collections. Content-based filtering
method and collaborative filtering method are the most used by researchers in the
field of music recommendation. The objective of the paper is to enhance generic item-
based CF. In item-based CF, items are grouped into clusters based on their similarity.
The item clusters thus formed are used in recommendation process. As the numbers
of items in clusters are very large, framing recommendation vector based on only
item-based CF might not result in a very successful and accurate recommendation
system. This paper proposes a research work to enhance generic item-based CF,
by combining with K-nearest neighbor method. Music taste of a user varies based
on the time of a day. To include this parameter in generic item-based CF, context
information is defined for each item based on the time of the day. Context information
is combined with item-based CF to further enhance the proposed system. Proposed
methods to enhance the item-based collaborative filtering are experimentally verified
by using a standard benchmark dataset Last.fm which is obtained from million song
dataset. Results show an improvement over generic item-based CF model.
1 Introduction
Due to the availability of open sources on the Internet, a greater number of users
started using the Web and contributing content to the Web. This led to the exponential
growth of information on the Web. However, this prompted two important issues as
follows:
Data collection: Availability of different types of data allowed users to use different
tools to work on unstructured and semi-structured data.
M. Sunitha (B) · T. Adilakshmi · M. Z. Ali

CSE Department, Vasavi College of Engineering, Hyderabad, India
e-mail: m.sunithareddy@staff.vce.ac.in
https://doi.org/10.1007/978-981-16-1502-3_28
270 M. Sunitha et al.
Searching time: Because of the huge amount of data, users find it difficult to search
the items useful and interesting. This is known as information overloading.
Recommendation systems are designed to solve the problem of users with respect
to searching time. They work as information filtering tools and provide suggestions to
the users with less/no user intervention. There are many fields such as books, movies,
and news where recommendation systems are playing a vital role. This research paper
addresses a recommendation system in music field. Music is such a vibrant item, and
with the increased usage of Internet, music service providers such as Amazon music,
Gaana, and Wink music are using music recommendation systems to understand the
user behavior, and thereby, increase their business. Music recommendation system
is an information filtering tool which predicts the songs interesting to a user based on
the past history of the users. Because of the recommendation systems, music industry
is able to handle huge volumes of data available via digital platforms and satisfy the
needs of different users.
Most of the music recommendation systems are based on popularity of an item,
i.e., recommend popular songs to users. Even though it is very simple and basic
recommendation method, it does not add any personalization to a specific user. The
proposed music recommendation system in this paper understands user behavior and
recommends songs interesting to the user.
The other commonly used approaches for music recommendation are content-
based and collaborative filtering. The limitation with content-based approach is
availability of content information for the items. Collaborative filtering method faces
challenges like cold start, sparsity, and long tail [1].
The rest of the paper is organized as follows: Sect. 2 describes related work;
Sect. 3 showcases various methods to enhance item-based collaborative method, and
results are given in Sect. 4. Section 5 explains about conclusion and future scope.
References are given in the next section.
2 Related Work
The objective of a music recommendation system is to suggest music interesting to

the users and help users in discovering new artists, songs based on their interest.
Music service providers such as Allmusic, Pandora, Audiobaba, Mog, Musicovery,
Spotify, and Apple Genius collected millions of users’ behavior and suggested music
based on their interest. Music is different from other items such as books, movies,
and restaurants. Recommendation systems need data about the users to perform
recommendations. The framework for recommendation system consists of a set of
users represented as {U 1 , U 2 , … U n } and a set of items represented as {I 1 , I 2 , …
I m }. Based on the users and items, the framework constructs the basic data structure
used in the process of recommendation system known as user-item rating matrix.
Users are on rows, and items are on columns used to form the user-item matrix. In
music recommendation system, users are the listeners, and songs are the items as
shown in Fig. 1.
Enhancing Item-Based Collaborative Filtering … 271
Users/Songs S1 S2 S3 S4
U1 2 0 0 3
U2 0 0 6 4
U3 3 4 0 3
U4 0 5 6 1
U5 4 8 0 0
U6 0 0 4 3
Fig. 1 Sample user-song matrix in music recommendation system
Most of the research in this field focused on suggesting a list of artists and a
sequence of songs (playlist addressing personal interest of user). Demographic-
based model, collaborative filtering model, and content-based model are used by
the researchers in the field of music recommendation.
2.1 Demographic-Based Model
It is one of the basic models to include demographic information related to user or

item for recommendation. Most used information about items is title of the song,
artist’s name, and lyrics to find the recommendation list for the target users. This
method looks very easy and fast, but this model requires user to know about the
information of the items. The major drawback of this method is that users will never
get a chance to listen to novel songs.
2.2 Collaborative Filtering (CF) Model
CF model is one of the most popular models used for music recommendation. The
basic working principle of a CF-based model is when two users agree in the past, then
they will agree in the future also, i.e., if two users like similar kind of songs in the
past, then we might use the list of songs listened by one of the users to prepare recom-
mendation list for other user. Nearest neighbors are used as one of the most common
approach in CF-based methods to provide recommendations. Memory-based, model-
based, and hybrid collaborative filtering are the three different varieties into which
most of the research work done in music recommendation system based on CF can be
categorized [1, 2]. Memory-based collaborative filtering predicts the items based on
the entire collection of previous ratings. Nearest neighbors are one of the commonly
used memory-based method. As the name suggests, it finds the nearest neighbors of
a target user or item for recommendations. Model-based collaborative filtering, in

contrast to memory-based CF, uses machine learning and data mining algorithms to
build a model which captures the underlying relation between users and items. Based
on the known model, the recommendation system makes recommendations for target
users. Features of both model-based and memory-based methods are combined into
a hybrid collaborative filtering model. The literature proves that hybrid CF model
performs better compared to individual methods [1].
2.3 Content-Based Model
These methods are based on the metadata related to songs such as timbre and rhythm
[3, 4]. For any target user, finding and recommending list of songs similar to the songs
listened by her/him is done. Similarities between the songs are identified based on the
features or content of it. Thus, the name is given as content-based recommendation
system.
3 Enhancing Item-Based Collaborative Model
Item-based CF is a model-based CF. It uses clustering algorithm to group items into

clusters and build a model represented in terms of item clusters. The clusters thus
formed are used in framing recommendation vector as shown in [5]. But due to a
large number of items in the dataset, recommendations based on only item clusters
were not that accurate. So, to improve the performance of generic item-based CF, it is
combined with the nearest neighbors and context information. This section explains
different methods to enhance item-based model.
3.1 Combining KNN with Item-Based-CF Model
To enhance the accuracy of the music recommendation system, item-based CF is

combined with K-nearest neighbor method. Item-based clusters address the scala-
bility issue faced by most of the collaborative filtering methods. It builds a model in
the form of finite and manageable item clusters from huge user-item rating matrix.
But most of the research work in the music recommendation system is based on KNN
with implicit or explicit rating matrix obtained from user experience. Let us consider
the following user-item rating matrix of four users about bollyhood top songs in
the year 2019 as shown in Table 1 to illustrate the working of a simple KNN-based
recommendation system.
In order to provide recommendations for the user Alice, let us consider K-nearest
neighbor algorithm with K = 1. Alice already liked S1, so with KNN, we need to
Table 1 Top-4 bollyhood songs of 2019

User/song O Saki Saki (S1) Dheeme Dheeme (S2) Bala Bala (S3) Gunghroo (S4)
Christ 2 0 2 1
Bob 3 1 0 3
Suji 0 2 1 0
Alice 3 ? ? ?
Table 2 Euclidean distance

Song/distance S2 S3 S4
from S1 to other three songs √ √
S1 12 5 1
find the nearest neighbors of S1. As per the data given in Table 1, the song vectors
are formed for S1 as [2,3,0], S2 as [0,1,2], S3 as [2,0,1] and S4 as [1,3,0]. Euclidean
distance is used to find the nearest neighbors for S1.
From Table 2, it can be seen that the first nearest neighbor for S1 is S4. As K
is given as 1, so S4 is recommended to Alice. The major issue with simple KNN
algorithm is the run time complexity of the algorithm to provide recommendations.
There is no model building in KNN. Hence, it is called lazy learner. For each test
user, the algorithm needs to find the nearest neighbors during the recommendation
process in order to frame recommendation vector.
In the process of music recommendation with the user-item matrix of size 200 ×
14,458, simple KNN algorithm takes a lot of time to provide recommendations for
the test users as there 14,458 unique items. To handle this issue with simple KNN,
in generic item-based CF, a model is built from the user-item matrix of size 200 ×
14,458 [5, 6]. Item clusters serve as the basic model to provide recommendations.
Even with item-based CF, where the numbers of item clusters are finite and small
in number, it sometimes fails to identify the items interesting for a test user. So, to
capture the interest of a test user accurately and recommend the items interesting to
test users are proposed in this paper. To enhance the performance of item-based CF
recommendation system, other parameters and additional information are added in
this research work.
The first approach to enhance generic item-based CF is to take advantage of KNN
in case small-size data. As in item-based CF, items are grouped into item clusters.
Each item cluster contains small number of items compared to overall items in the
dataset. So, KNN is brought into work after a test user is mapped with the nearest item
cluster. Instead of recommending all items from the mapped item cluster as shown
in item-based CF [5, 6], KNN is used to find the items that really satisfy the needs
of a test user. For a test user, 5% of the items already present in the test user-item
vector are considered as seed to find nearest neighbors. For the items present in 5%
of test users, mean vector is computed to aggregate the past history of the test user.
Mean item vector is used to find nearest neighbors from mapped item cluster for any
test user as shown by algorithm in Fig. 2.
Algorithm ITEM_CF_KNN_Mean()
Input: Item clusters, test users
Output: Recommendation of songs to test users
Method:
Begin
1. Let m is the number of item clusters given as SC1, SC2,………..SCm
2. Let Ut € { U1,U2,………..U200} be a test user
3. Compute the mean_Vector(Ut) for each test user from 5% of items present in
test user item vector
4. Find the distance (Ut, SCv) where SCv € { SC1, SC2,………..SCm }
5. Let SCv be the nearest item cluster for the test user Ut
6. Let SCv= {S1,S2,…………..Sl}
7. Find Euclidean distance between mean_vector(Ut) and each S €
{ S1,S2,…………..Sl}
8. Arrange the songs {S1,S2,…………..Sl} in the ascending order of distance
from test user Ut
9. Add first K items from the list obtained in step 8 to the recommendation vec-
tor for test user Ut
10. Goto step 2 and select a new test user. Repeat steps 3 to 9 for all the test users
End
Fig. 2 Combining KNN with item-based CF
In the process of enhancing music recommendation system, item-based CF is

combined with KNN by considering top 5% of items from the test user-item vector
as the seed to find the nearest neighbors from a mapped item cluster as shown by
the algorithm in Fig. 3. The nearest neighbor for each item present in the top 5% of
items of a test user is added to the recommendation vector.
3.2 Combining Item-Based CF with Context
The context in recommendation systems refers to the time of a day, location, age,
etc. In the process of music recommendation system, context information is obtained
from the time of a day. The rational for considering context from the time of the day
is that users will have different music tastes at different times of the day. So, by
considering context based on the time will enhance the performance of the recom-
mendation system. The dataset obtained from Last.fm [7] for conducting this research
work consists of the attributes given as userID, timestamp, AlbumID, AlbumName,
TrackID, and Trackname as shown in Fig. 4. Timestamp which is mentioned in a
24-hour clock is used to obtain context information. Timestamp is divided into three
different slots to define context information as given in Table 3.
Consider the data from Table 4 as an example to obtain the context of a song.
Context of S1 is evening, S2 is morning, S3 is evening, and S4 is afternoon as they
Algorithm ITEM_CF_KNN_Top_items()
Input: Item clusters, test users
Output: Recommendation of songs to test users
Method:
Begin
3. Compute the mean_Vector(Ut) for each test user
6. Let SCv= {S1,S2,…………..Sl}
7. Find top 5% of items listened by test user Ut
8. Find the distance between ((each song € top 5% of Ut), (each item € SCv)
where SCv € { SC1, SC2,………..SCm }
9. Arrange the songs {S1,S2,…………..Sl} in the ascending order of distance
from the top 5% of test user Ut listened items
10. Add first K songs from the list obtained in step 9 to the recommendation vec-
tor for test user Ut. (remove the duplicates while adding K items from each
test user song)
11. Repeat the steps from 8 to 10 for all the items in top 5% for all the test users
End
Fig. 3 Combining KNN for top items with item-based CF
have been heard more number of times during that time of the day. This context
information is included in the user-item matrix as shown in Table 5.
In the process of including context information into music recommendation
system, user-item matrix is modified to include the context information as shown
in Table 5. Algorithm defined in Fig. 5 is used to combine context information with
item-based CF.
Context information is used to filter items for a test user from a mapped item
clusters as shown in Fig. 5. For any test user, the list of items from the mapped item
cluster should be found. This should match the context of the test user seed items to
form recommendation vector.
Context-based recommendation system is further enhanced by combining KNN.
The steps are shown in the algorithm as given in Fig. 6.
4 Results
Proposed enhancements for music recommendation system are evaluated using the
evaluation measures from Information retrieval systems known as precision and
recall. Precision shows the accuracy of the proposed recommendation system as
shown in Eq. (1), and recall shows the exhaustiveness of the music recommendation
Fig. 4 Sample user logs
Table 3 Defining context

Time duration Name of the context
based on the timestamp
4.00 am to 10.00 am Morning
10.00 am to 6.00 pm Afternoon
6.00 pm to 4.00 am Evening
Table 4 Obtaining the

Song Morning Afternoon Evening
context of a song
S1 3 0 12
S2 5 2 3
S3 2 1 6
S4 0 6 2
system as given in Eq. (2). Precision and recall are obtained from true positives (TP),
false positives (FP), true negatives (TN), and false negatives (FN). F-measure as
shown in Eq. (3) represents hormonic mean of precision and recall.
Table 5 User-item matrix with context information

User/item S1 Context S2 Context …. S14458 Context
U1 12 Evening 5 Morning …. 6 Afternoon
U2
….
U200
Algorithm ITEM_CF_ Context()

Input: User-item matrix with context, Item clusters
Output: Recommendation vector for test users
Method:
Begin
4. Find the distance (Ut, SCv) where SCv € {SC1, SC2,………..SCm }
6. Let SCv= {S1,S2,…………..Sl}
7. Find top 5% of songs listened by test user Ut
8. Obtain the context of each song in top 5% from user-item matrix with context
9. Find the context of the songs in the nearest cluster
10. Add the songs with the same context as the context of top 5% songs of test
users to the recommendation vector
End
Fig. 5 Combining context with item-based CF
No. of songs listened by a test user from the recommended list

P(Ui ) =
Total no. of recommendations
TP
= (1)
TP + FP
No. of songs listened by a test user from the recommended list
R(Ui ) =
Total no. of songs listened by a test user
TP
= (2)
TP + FN
2 × (P(Ui ) + R(Ui ))
F-measure(Ui ) = (3)
(P(Ui ) × R(Ui ))
The research work proposed in this paper has been experimentally verified by
examining with the benchmark dataset obtained from Last.fm. The dataset is a
collects behavior of 999 users for about three years. Information about users listening
Algorithm ITEM_CF_ Context_KNN()

Input: User-item matrix with context, Item clusters
Output: Recommendation vector for test users
Method:
Begin
6. Let SCv= {S1,S2,…………..Sl}
7. Find top 5% of songs listened by test user Ut
8. Obtain the context of each song in top 5% from user-item matrix with context
9. Find the context of the songs in the nearest cluster
10. Find the K nearest neighbour songs of top 5% songs of test users
11. Add the songs from K nearest neighbours with the same context as the songs
in top 5% of test user to the recommendation vector
End
Fig. 6 Combine context with KNN for item-based CF
history is maintained in dataset with attributes given as UserID, Timestamp, ArtistID,

ArtistName,TrackID, and TrackName. Another dataset is used to give information
about user demographic information with attributes given as UserID, age, gender,
location, and registration date. Sample datasets screenshots are shown in Figs. 1 and
7, respectively.
In the process of enhancing item-based CF, KNN is combined to find items more
similar to the items preferred by test user. KNN is implemented in different variations.
Fig. 7 Sample user profile data

Fig. 8 Performance evaluation of K-nearest neighbor item mean with item-based CF
First method of KNN implementation is to find cumulative mean of 5% items listened

by a test user. The mean vector is used to find the nearest neighbors from the mapped
item cluster. The second method of KNN implementation is to consider individual
items of 5% of a test user and find the neighbors from the mapped item cluster. The
last and third method of KNN implementation is to find 5% of the top items preferred
by the test user and find the nearest neighbors from the mapped item cluster.
Results obtained for cumulative KNN are shown in Fig. 8. The results show a very
good improvement over generic item-based CF in all cases. The recommendation
system of the top-10 items performs well compared to other methods.
KNN with individual items of test user with only one nearest neighbor is shown
in Fig. 9. This variation of KNN method is performed better compared to cumulative
KNN.
KNN with individual items of test user sorted by frequency with only one nearest
neighbor is shown in Fig. 10. This variation of KNN method is performed better
compared to individual item-based KNN as shown in Fig. 9.
Context information combined with generic item-based CF and results obtained
are shown in Fig. 11. Precision of the proposed system is better compared to item-
based CF but not as good as KNN-based enhancement. Context-based system is
further improved by including KNN, and the results obtained are shown in Fig. 12.
These results are good compared to only context combined with item-based CF.
Results obtained with generic item-based CF along with proposed enhancements
are compared and shown in Fig. 13, and it proved that the proposed enhancements
increased the precision of resulting recommendation systems.
Fig. 9 Performance evaluation individual K-nearest neighbor with item-based CF
Fig. 10 Performance evaluation individual K-nearest neighbor for top items with item-based CF
This research work enhances generic item-based CF. In item-based CF, item clusters
are formed to build a model. Due to the size of dataset, item-based CF alone has
not given good precision value. So, it is enhanced by combining KNN with item
clusters. Once a test user is mapped to nearest item cluster, KNN is used to filter
items from the mapped cluster and recommend only the items that satisfy the taste
Fig. 11 Performance evaluation of context-based recommendation with item-based CF
Fig. 12 Performance evaluation of context-based recommendations using K-nearest neighbor with

item-based CF
of the test user. KNN is implemented by considering 5% of the items present in test
user-item vector. Randomly, 5% items are considered, and mean vector is computed
to find the nearest neighbors. Another variation is considered randomly 5% of test
user items as seed and find the individually nearest neighbor of each seed. Finally,
KNN is implemented with top 5% of items as to form seed for test user and find
the recommendations. The results thus obtained show that all methods performed
Fig. 13 Comparison of precision for item-based CF with different enhancements proposed
with KNN enhanced the performance of generic item-based CF. Later, the research
work proposed in this paper also included context as an additional parameter to
recommend songs based on the time of a day. Context is obtained for an item based
on the maximum number of times, and an item has been heard during a particular
time of the day. Results show the improvement over generic item-based CF
Future scope:
The clustering algorithms used in item-based CF can be manipulated to the specific
needs of the user and result in appropriate groupings of items. Regression analysis
can be performed on the dataset to extract the user’s mood and serve as a valuable
parameter in music recommendation process.
References
1. Elahi, M., Ricci, F., Rubens, N.: A survey of active learning in collaborative filtering
recommender systems. Comput. Sci. Rev. 20, 29–50 (2016)
2. Elahi, M., Ricci, F., Rubens, N.: Active learning in collaborative filtering recommender systems.
In: Hepp, M., Hoffner, Y. (eds.) E-Commerce and Web Technologies, Lecture Notes in Business
Information Processing, vol 188. Springer, pp 113–124 (2014). https://doi.org/10.1007/978-3-
319-10491-1_12
3. Ebrahimi Kahou, S., Michalski, V., Konda, K., Memisevic, R., Pal, C.: Recurrent neural networks
for emotion recognition in video. In: Proceedings of the 2015 ACM on International Conference
on Multimodal Interaction, ICMI’15. ACM, New York, NY, USA, pp 467–474 (2015). https://
doi.org/10.1145/2818346.2830596
4. Navya Sri, M., Ramakrishna Murty, M., et al.: Robust features for emotion recognition
from speech by using gaussian mixture model classification. In: International Conference and
Published Proceeding in SIST Series, Springer, vol. 2, pp. 437–444 (2017)
5. Sunitha, M., Adilakshmi, T., Ali, M.Z.: Enhancing item based collaborative filtering with item
correlations for music recommendation system. Int. J. Recent Technol. Eng. (IJRTE) 9(1) (2020).
ISSN-2277-3878
6. Sunitha, M., Adilakshmi, T.: Comparison of user-based collaborative filtering model for music
recommendation system with various proximity measures. Int. J. Innov. Technol. Explor. Eng.
8(6S2), 15–21 (2019). ISSN: 2278–3075
7. Last. FM: A Popular Music Web Portal. http://www.last.fm
Deep Learning-Based Enhanced
Classification Model for Pneumonia
Disease
S. Jeba Priya, S. Joshua Jaistein, G. Naveen Sundar,

and T. Raja Sundrapandiyanleebanon
Abstract Pneumonia is an infectious disease in the lung which results in inflamma-

tion of the lung tissues and eventually leads to death of several millions worldwide.
This paper aims to detect and classify the pneumonia using deep learning-based algo-
rithm by examining the chest X-ray or computed tomography (CT) or combination
of both. The field experts or clinical experts utilized the chest X-ray for diagnosing of
pneumonia. This paper investigates the convolutional neural network (CNN) model
for feature extraction and optimized the algorithm by increasing the number and
layers. The proposed model performed in this study improved the average accuracy
of 91% and with some other metrics that surpass the existing models in medical
imaging.
1 Introduction
Image processing is used for object detection in the field of biomedical imaging to
localize, identify and verify the target entity. In contrast to machine learning algo-
rithms, convolutional neural networks (CNN) are inclined due to their multi-layered
architecture. Deep learning models have accomplished robust results in many sectors
[1–4]. Annually, about a tenth of the world’s population is infected by pneumonia, out
of which millions of patients face fatal risks [5]. Pneumonia has become one of the
top causes of mortality in children and the elderly worldwide [6]. In fact, pneumonia
is indeed a main cause of mortality from stroke, especially in patients with acute
S. Jeba Priya (B) · S. Joshua Jaistein · G. Naveen Sundar · T. Raja Sundrapandiyanleebanon

CSE Department, Karunya Institute of Technology and Sciences, Coimbatore 641114, Tamil
Nadu, India
e-mail: jebapriya@karunya.edu
S. Joshua Jaistein
e-mail: joshuajaistein@karunya.edu.in
G. Naveen Sundar
e-mail: naveensundar@karunya.edu
https://doi.org/10.1007/978-981-16-1502-3_29
286 S. Jeba Priya et al.
ischemic stroke (AIS) [7]. The main objective of this paper is to automatically clas-
sify pneumonia-infected individuals from their chest X-ray images. The commonly
used methodology to detect pneumonia bacterial infection worldwide is X-rays and
computed tomography. Chest X-ray is one of the most popular, painless and non-
invasive form of diagnosis. However, detection of pneumonia from X-rays is chal-
lenging even for experienced radiologists and is a time-consuming process [5]. This
research paper depends on X-ray images rather than CT scans. Pneumonia typically
occurs as a zone or field of increased opacity [8]. Therefore, an AI-driven program
would be promising to enable doctors detect pneumonia correctly and in a timely
manner and save more lives. Performance of the model is measured with accuracy,
precision, recall and F1-score. Computer-aided diagnosis (CAD) for medical imaging
has become more accurate and robust due to the advances in computational power and
deep learning algorithms. Stunning level performance which surpass human intelli-
gence is achieved by these algorithms, especially the convolutional neural networks
(CNN) on encountering computer vision problems in medical imaging domain. In
this research paper, an efficient method is suggested using appropriate dataset to train
an efficient neural network such that the learned parameters can be used to detect
pneumonia cases.
2 Literature Review
The development of deep learning and broad datasets allows algorithms to accom-
plish a broad variety of applications and spectacular results in the practice of radi-
ology and medical imaging. Deep learning models are now commonly adopted in
medical imaging systems because they can automatically extract features or by using
certain pre-trained networks. Liang and Zheng [9], to anticipate one or more of four-
teen potential diseases, a deeply related convolutionary neural network was deployed
(Fig. 1).
Anthimopoulos et al. [10] used a transfer learning with deep residual network
for pediatric pneumonia diagnosis. Elhoseny and Shankar [11] used deep neural
Fig. 1 Illustrates the differences in lungs of a normal versus pneumonia infected individual
Deep Learning-Based Enhanced Classification … 287
model cluster for localizing pneumonia for a large-scale chest X-ray dataset. Sirazit-
dinoz and Kholiavchenko [12] presented a double CNN that automatically identifies
huge front and transverse chest X-ray images mostly on MIMIC-CXR dataset and is
currently the biggest dataset for chest X-ray scans. Varshini et al. [13], deep CNN was
qualified to automatically identify respiratory infections via the ultrasound images.
For class prediction, AlexNet and GoogLeNet, dual CNNs were used. Ref. [14],
Mask RCNN-based recognition algorithm was adopted for pixel-wise segmenting
and also integrated global and local characteristics.
Jain [15], to recognize intracellular respiratory disease trends, a CNN model was
developed. Whose model incorporated five convolutionary layers, using a leaky acti-
vation feature of ReLU, average max pooling and triple thick layers and made crucial
improvements throughout the training period by combining bounding box coordi-
nates from different models. Rubin and Sanghavi [16], using chest X-ray pictures,
the AG-CNN model technique was developed to diagnose thorax disorder. This study
was performed on the dataset for Chest X-ray. He et al. [17], the topic of the highest
recognition timescale to ANNs was concerned about.Two versions, MCPN but also
MKNN, were introduced, classifying iteration-free MR high-resolution image preci-
sion. Tolerance and precision were used as success metrics for their models. It is
evident that deep learning model can attain significant outcomes for pneumonia
classification using chest X-ray images. Additional variation and tuning of hyperpa-
rameters can further improve the efficiency of the deep learning model. Therefore,
the development of a more accurate deep learning-based pneumonia-affected patient
classification model is the motivation for this work. Successive session elaborates
the dataset and model succeeded by the experiment results and discussions. Finally,
the section concludes the study.
3 Proposed Model
The image data is translated into the form of a matrix. The feature map is formed
as a result of the operation between [18]. This method decreases the aspect ratios,
making it simpler to process the frame. The feature detector preserves the essential
portions of the image. The model contains of five convolutional layers and a pooling
layer in-between each of them. These convolutional layers learn the characteristic
representations of their images which have been fed into the neural net. Each neuron
in a feature map has a field of reception. New feature maps are formed when the inputs
are convoluted. At each position, maximal amount of features should be extracted for
efficiency, so various feature maps within the same convolutional layer have different
weights (Le Cun et al. 2015). Figure 2 describes feature detector pictorially.
Recently. the rectified linear units (ReLU) have become more popular. The recti-
fied linear activation function removes the dilemma of the vanishing gradient, helping
models to understand more easily and perform better. Xavier Glorot et al. in their
milestone 2012 paper highlighted some of the benefits of the ReLU titled “Deep
Sparse Rectifier Neural Network”. Mathematically, ReLU is defined as the following
Fig. 2 Feature detector
formula.
f (x) = max(0, x) (1)
In order to decrease the spatial resolution of the feature maps, the pooling layers
are introduced. It significantly reduces the number of parameters to learn and the
amount of computation performed. The size of the pooling operation or filter is
smaller than the feature map. In this paper, max pooling is performed, where the
largest of the pixel values of an image segment is taken to be processed. The feature
detector analyzes any pixel whether this pixel has an attribute.
Each neuron is bound to each and every neuron in another layer using the fully
connected layer. It goes the final probabilities for each label.
Figure 3 represents the proposed architecture. The input image undergoes prepro-
cessing, and the model contains a series of convolutional and pooling layer and finally
to the fully connected layer which leads to the output of the neural network.
4 Result and Discussion
The dataset used is accessible on Kaggle under the name “Chest X-Ray Images
Pneumonia Challenge” which contains images in grayscale. The 80:20 train-test
scheme is used to train the chest X-ray pneumonia image classification model. We
train our model on training data, gather the output and fine-tune the hyperparameters
and use the testing data to measure the overall efficiency of the model proposed.
For this paper, through measuring first-order moment projections and second-order
moment projections of the gradient moment, Adam optimizer constructs separate
adaptive learning thresholds for varying factors. When the accuracy of the model
tends to show property of being overfit, the learning rate is decreased by three times.
The training is finished until 150 epochs are constantly trained by the network. All
the deep learning algorithms including the proposed model are deployed using the
Fig. 3 Proposed architecture
Keras framework with Tensorflow-GPU backend on a Linux machine with NVIDIA

GeForce GTX 1060 with 6 GB of dedicated graphics memory running CUDA 10.
To test the model response in a two-class challenge, evaluation metrics such as
accuracy, precision, recall and F1-score are measured. In order to further assess the
classification impact of the proposed model in this paper, we contrasted the five
most frequently used CNN medical imaging architectures—VGG16, DenseNet121,
XceptionNet and InceptionV3.
Accuracy = TP + TN/TP + FP + FN + TN (2)
Figure 4 plots the different accuracy and loss of the model with respect to epochs.
The model showed a sudden increase in the accuracy and remained almost constant
after 20 epochs. The loss tended to be very low.
A total of 6398 images of patients with and without pneumonia were considered
for the prediction of pneumonia using chest X-ray scans. The various metrics are
contrasted in Fig. 5. The medical prediction results achieved a respectable accuracy
of 0.9102 (or) 91%.
Precision = TP/TP + FP (3)
Precision can be defined as the ration of positive observations correctly determined

to the total positive observations predicted. The highest precision of 0.9247 was
obtained in this experiment
Fig. 4 Model training accuracy and loss
Fig. 5 Evaluation metrics—comparison table
Recall = TP/TP + FN (4)
Recall is the number of accurately predicted positives of all results, the highest
recall 0.9553.
F1 Score = 2 ∗ (Recall ∗ Precision)/(Recall + Precision) (5)
F1-score is a measure of a test’s accuracy. A high F1-ranking means you have

low false positives and low false negatives, and a respectable F1-score of 0.9324 was
obtained in this experiment.
Figures 6, 7, 8 and 9 contrast the performance of the proposed model versus other
popular neural networks with respect to four evaluation metrics, namely accuracy,
precision, recall and F1-score.
Fig. 6 Model performance

comparison with
DenseNet121

comparison with
InceptionV3

comparison with
XceptionNet

comparison with VGG16
In this paper, we present an automatic diagnostic method that classifies X-ray images
of pneumonia-affected individuals vs healthy individual. In the future research, we
will continue to optimize the work by making the neural net perform it tasks on MRI
and CT scans. The best way to expose the health effects of an algorithm in real time is
by medical trials including AI and DL treatments with detailed systematic monitoring
protocols. Figure 10 shows the confusion matrix of the proposed classifier model.
On recognition of the excellent results against certain performance metrics, the
suggested model could be successfully included in the medical testing by health
professionals for advanced diagnosis of pneumonia in patients.
Increase in the number of neural layers and convolutional layers certainly increases
the computational complexity of the algorithm. The authors of this research paper
plan to enhance the model by following the methods proposed by Maji and Mullins
[19] to decrease the computational complexity of deep convolutional neural networks.
We have taken permission from competent authorities to use the images/data as given
in the paper. In case of any dispute in the future, we shall be wholly responsible.

References
1. Del Fiol, G., Michelson, M., Iorio, A.: A Deep Learning method to Automatically Iden-
tify Reports of Scientifically Rigorous Clinical Research from the Biomedical Literature:
Comparative Analytic Study. https://doi.org/10.2196/10281
2. Comert, Z., Fetal Kocamaz, A.F.: Hypoxia Detection Based on Deep Convolutional Neural
Network with Transfer Learning Approach. Springer International Publishing, Berlin (2019),
pp. 239–248
3. Budak, U., Comert, Z., Cibuk, M., Sengur, A.: DCCMED-net: Densely Connected and Concate-
nated Multi Encoder-Decoder CNNs for Retinal Vessel Extraction from Fundus Images (2019).
https://doi.org/10.1016/j.mehy.2019.109426
4. Budak, U., Comert, Z., Rashid, Z.N., Sengur, A., Cibuk, M.: Compter-aided diagnosis
system combining FCN and Bi-LSTM model for efficient breast cancer detection from
histopathological images. Appl. Soft. Comput. https://doi.org/10.1016/jhmas/jrr047
5. Lavine, M.: The early clinical X-ray in the united states. Patient experiences and public
perceptions. J. Hist. Med. Allied Sci. (2011). https://doi.org/10.1093/jhmas/jrr047
6. Shen, Y., Tian, Z., Lu, D., Huang, J., Zhang, Z., Li, X.: Impact of Pneumonia and Lung Cancer
on Mortality of Women with Hypertension (2016). https://doi.org/10.1038/s41598-0160023-2
7. Ge, Y., Wang, Q.: Predicting post-stroke pneumonia using deep neural network approaches.
Int. J. Med. Inform. https://doi.org/10.1016/j.ijmedinf.2019.103986
8. Rubin, J., Sanghavi, D.: Large Scale Automated Reading of Frontal and Lateral Chest X-rays
Using Dual Convolutional Neural Networks (2018). arXiv preprint arXiv:1804.07839
9. Gaobo, L., Zheng, L.: A transfer learning method with deep residual network for pediatric
pneumonia diagnosis. Comput. Methods Progr. Biomed. 187 (2019)
10. Anthimopoulos, M., Christodoulidis, S., Ebner, L.: Lung pattern classification for interstitial
lung diseases using a deep learning neural network. IEEE Trans. Med. Imag. 35(5), 1207–1216
(2016)
11. Elhoseny, M., Shankar, K.: Optimal bilateral filter and convolutional neural network based
de-noising method of medical image measurements. Measurements 143(2019), 125–135 (2019)
12. Sirazitdinoz, I., Kholiavchenko, M.: Deep Neural Network Ensemble for Pneumonia Local-
ization from a Large-Scale Chest X-Ray Database
13. Varshini, D., Thakral, K., Agarwal, L.: Pneumonia detection using CNN based feature
extraction. In: IEEE International Conference on Electrical, Computer and Communication
Technologies (ICECCT), pp. 1–7 (2019)
14. RSNA Pneumonia Detection Challenge. Kaggle. https://www.kaggle.com/c/rsna-pneumonia-
detection-challenge
15. Jain, R.: Pneumonia detection in chest x-ray images using convolutional neural networks and
transfer learning. Measurement 165, 108046 (2020). https://doi.org/10.1016/j.measurement.
2020.108046
16. Rubin, J., Sanghavi, D.: Large Scale Automated Reading of Frontal and Lateral Chest X—Rays
Using Dual Convolutional Neural Networks (2018). arXiv preprint arXiv:1804.07839
17. He, K., Zhang, X., Ren, S., Sun, J.: Deep learning for image recognition. In: Proceedings of
the IEEE Conference on Computer Vision and Pattern Recognition, pp. 770–778 (2016)
18. Lakhani, P., Sundaram, B.: Deep learning at chest radiography: automated classification of
pulmonary tuberculosis by using convolutional neural networks. Radiology 284(2), 574–582
(2017)
19. Maji, P., Mullins, R.: On the reduction of Computational Complexity of Deep Convolutional
Neural Networks. ICANN-2017 (2017)
Automatic Fake News Detector in Social
Media Using Machine Learning
and Natural Language Processing
Approaches
J. Srinivas, K. Venkata Subba Reddy, G. J. Sunny Deol,

and P. VaraPrasada Rao
Abstract The definition of fake news is a cooked-up story with an objective to

fool or to cheat people. The current research aims to detect fake news in social
media like Twitter, Watsapp and Facebook by studying the responses of the proposed
model on posts acquired from Reddit online news store. Automatic fake news detec-
tion is a complex activity as it involves the model to implement natural language
processing concepts in-tandem with machine learning approaches. Two feature
extraction algorithms, namely CountVectoriser (CV) and term frequency-inverse
document frequency (TFIDF), were employed separately for extracting the most
relevant features from the dataset. These features were fed to multinomial naive
Bayes (MNB), random forest (RF), support vector classifier (SVC) and logistic
regression (LR) classifiers for classifying fake news creating a total of eight classifi-
cation models. A solitary CV-based model was considered as the baseline model for
predicting fake news in r/theonion and r/nottheonion datasets. GridsearchCV was
also implemented for finding the testing and training scores for the selected param-
eters. Out of these models, TFIDF with MNB achieved an accuracy of 79.05% and
is considered as the best.
1 Introduction
According to a survey conducted by Gartner [1], by 2022 the volume of fake news
circulated in the society will be more than genuine news. This can be attributed to
the fact of the exponential growth of social media users. Fake news is generally
defined as synthesised news containing misinformation, rumour and falsified facts
J. Srinivas (B)
SR University, Warangal, India
K. Venkata Subba Reddy · G. J. Sunny Deol
Kallam Haranadha Reddy Institute of Technology, Guntur, India
P. VaraPrasada Rao
Gokaraju Rangaraju Institute of Technology, Hyderabad, India
https://doi.org/10.1007/978-981-16-1502-3_30
296 J. Srinivas et al.
circulated over traditional media and even social media [2]. The general motive of
a fake news propagator is to mislead readers, character assassinate an individual or
to capitalise from sensationalism fake news which creates [3]. Attributes like spread
rate, convenience and strong user base make social media the first choice of any
fake news propagator. This causes a lot of chaos and distress among individuals as
well as societies in a short span of time. Just detecting whether the news is fake or
genuine will not be sufficient. To tackle this problem, early detection of fake news is
necessary [4]. Existing methodologies are not so capable of detecting fake news and
stop its rapid propagation in articles published in the internet, blogs, tweets, posts in
social media apps like Watsapp and Facebook [5]. Click bait is also one form of fake
news that lures the user by putting some attractive content and encouraging them to
click on the news for gaining some offers or gifts [6].
A popular research proposed that in 2017, 67% of U.S. citizens above the age
greater than 18 consumed news mainly from social media [7]. In comparison with
genuine news, the fake news propagates relatively swifter, deeper into the society
according to some researchers [8]. Therefore, it is necessary to detect and restrict
the genesis and circulation of fake news through social media. Fake news detec-
tion is a challenging process to execute as it involves cross-checking the news item
with credible third parties like newspapers, media houses and government agencies.
Researchers can use the methodologies like artificial intelligence (AI) and natural
language processing (NLP) for developing automatic models that can categorise
news as fake or genuine.
This paper developed eight pipeline models by combing feature selection algo-
rithms like CountVectoriser (CV) and term frequency-inverse document frequency
vectoriser (TFIDFV) with machine learning algorithms like random forests (RF),
multinomial naive Bayes (MNB), support vector classification (SVC) and logistic
regression (LR). A baseline model by taking CV as the classifier was also considered.
This paper attempts to differentiate between fake news and real news by developing
a classification model trained on subreddit posts from r/theOnion and r/nottheonion
datasets. The method of transforming words in documents into numbers so that the
machine learning model interprets the words in the news articles is called vector-
ization. This a popular NLP technique used for extracting best features from the
datasets.
The rest of the paper is organised as follows. Section 2 highlights the related work
present in the literature. Section 3 gives an overview of the model architecture and
briefly explains the components of the model. Section 4 will describe the experimental
set-up. Section 5 will evaluate the developed model using performance metrics, and
finally, Sect. 5 will list out the conclusions, limitations and future scope of the research
demonstrated by this paper.
Automatic Fake News Detector in Social Media … 297
2 Related Work
A variety of approaches have been developed in the past by many researchers to

detect fake news automatically in social media [8]. Many studies conducted in
the past stressed upon the fact that there is a need for automation of fake news
classification rather than handcrafted techniques like crowdsourcing, hiring human
employees [9, 10]. The authors of [11] proposed a novel process termed as influence
mining using TextBlob NLP, SciPy tool kits. In this paper, a Bayesian ML model
was developed, and it achieved an accuracy of 63.33% in predicting whether the
news article is fake or genuine. A headline stance-based technique was proposed
by a group of researchers for fake news classification using NLP techniques [12].
A substantial amount of research was done in the past on the topic of computer
bots generating and propagating fake news on social media [13, 14]. The process of
creating computer programs for generating and spreading rumours is very econom-
ical and safe for rumour mongers instead of hiring people to create fake news. Some
researchers also studied the role of cyborg accounts in disseminating fake news
in social media [15]. A new approach was developed that specifically investigated
the credibility of the content published on Twitter social networking application
using manual feature extraction techniques [16]. Regular expression-based rumour
detection technique was developed for classifying information as fake or genuine on
Twitter [17]. In another popular study, recurrent neural networks were employed to
study and analyse the text-temporal relationship in Twitter posts for making accurate
classifications about rumours and fake news [18]. Some researchers in the past have
studied the comments related to fake news for analysing the structures of rumour
cascades in Facebook posts [19]. The approach proposed in [20] presented an optimi-
sation model for identification of spammers using matter in the posts and the network
parameters. The next section of the paper presents the system design and explains
the key components of the architecture.
3 System Design
In this section, system design is presented. This paper implemented the workflow
system design technique for designing the system architecture. Data gathering, data
pre-processing, developing the classification model and predicting are the various
stages in the workflow pipeline.
3.1 Workflow Model
Figure 1 depicts the various stages of the workflow model that this paper followed
for classifying fake news.
Fig. 1 Workflow model for fake news classification
Data Gathering This paper used pushshift.io application programming interface

wrapper for gathering data from Reddit posts. A total of 29,867 posts were scraped
that included fifteen thousand posts from r/nottheOnion and 14,867 r/theonion
datasets.
Data Pre-processing In this stage, duplicate records, punctuation marks and

numbers were removed. Double spaces were converted to single space. Missing
values were normalised, and the whole text was transformed into lower case. A
total of 3592 duplicate records were found in the dataset. A clean r/nottheonion and
r/theonion dataset was obtained as the output of this step.
Exploratory Data Analysis (EDA) EDA was performed on r/nottheonion and

r/thonion datasets. This analysis helps in optimum design of the classification models.
Generally, NLP techniques were implemented to perform the data analysis. For this
purpose, the datasets will be concatenated into one dataset. The next step is to bina-
rise the target, 1 is assigned to posts retrieved from r/theonion, and 0 is assigned to
posts retrieved from r/nottheonion dataset. CV technique was used for this purpose.
Analysis was performed to find out the top five unigrams, bigrams and stop words
in the datasets taken. Table 1 represents the results of the EDA performed. The
analysis suggests to remove the words ‘man’, ‘new’, ‘old’, ‘people’, ‘say’, ‘trump’,
‘woman’, ‘year’ from the dataset due to their high frequency in the posts. Tables 2
and 3 visualise the results obtained from the EDA performed.
Train/Test Split Usually, there are two methods for training and testing a model. In
the first method, two separate datasets are used, one for training the model and the
other for testing the model. In the second method, only one dataset is considered.
This dataset is split into two segments, namely train data segment and test data
segment. The train data segment is used for training the model, whereas the testing
Table 1 Results of the exploratory data analysis performed using NLP

S. no. n-gram class Output
1. Top 5 unigrams of r/onion ‘Trump’, ‘new’, ‘man’, ‘coronavirus’, ‘onion’
2. Top 5 unigrams of r/nottheonion ‘Trump’, ‘man’, ‘peace’, ‘noble’, ‘says’
3. Top 5 bigrams of r/onion ‘Onion presents’, ‘presents topical’, ‘topical
episode’, ‘topical ep.’, ‘year old’
4. Top 5 bigrams of r/nottheonion ‘Noble peace’, ‘peace prize’, ‘donald trump’,
‘trump nominated’, ‘nominated nobel’
5. Common words in both datasets ‘Man’, ‘new’, ‘old’, ‘people’, ‘say’, ‘trump’,
‘woman’, ‘year’
Table 2 Column graphs showing the top 5 unigrams and bigrams of r/theonion and r/nottheonion
datasets
150 150
100 100
50 50
0 0
Table 3 Column graphs showing the top 5 bigrams of r/theonion and r/nottheonion datasets
60 60
50 50
40 40
30 30
20 20
10 10
0 0
data segment is employed to validate the model. This paper uses the train/test split
technique. The dataset is split into two halves 70% for training and 30% for testing.
Classification Model In this phase of the workflow, the model is developed and
trained with the dataset. Afterwards, it is tested with the test data segment. This
paper created six different pipeline models for classifying fake news. Model 1, 2, 3
and 4 were created by a pipeline of CV and LR, CV and GNB, CV and SVC, CV
and RF. Similarly, model 5, 6, 7 and 8 were created by using a pipeline of TFIFD
and LR, TFIFD and MNB, TFIFD and SVC, TFIFD and RF. These eight models
were trained using the training segment of the datasets. A baseline CV model was
also considered.
Prediction After vigorous training, the models were tested using the testing
segment. The predictions were validated using performance metrics like accuracy,
precision, recall, specificity and misclassification rate. This paper analysed the
best model by comparing the performance metrics achieved by the models while
classifying fake news over social media.
3.2 Process Flow
Figure 2 represents the system architecture of a fake news classifier with CV and
TFIFD as feature extractors, respectively. The flow of process is listed in this section.
1. Scrape the data from Reddit posts into r/theonion and r/nottheonion datasets.
2. Apply data cleaning techniques over the gathered data repository.
3. Perform EDA using NLP techniques on the pre-processed data by combining
the r/theonion and r/nottheonion posts into one dataset.
4. CountVectoriser feature extraction.
A. Apply CV technique and TFIDF on the dataset separately to extract the
relevant features. Split the feature vector set into training and testing sets
using the train/test split approach.
B. Now, train the classifiers LR, MNB, SVC and RF separately with the
training set.
Fig. 2 System architecture of the models using CV, TFIDF and classifiers
C. After training is completed, test the models by feeding them with the
testing set.
D. Find out the best model by analysing the performance of each model with
the help of performance metrics achieved.
5. Identify the fake news detection model using the performance metrics.
3.3 Dataset
Data was collected from Reddit. It is a social networking website where people
publish information continuously. Reddit maintains two threads r/theonion and
r/nottheonion. r/theonion contains satirical news articles, whereas r/nottheonion
contains articles about true stories posted by people which look like posts from the
r/theonion. This dataset contained the following attributes, namely title, subreddit,
comments, author, # sub, score, domain and date. The title is used as the predictor,
and the subreddit is the target.
3.4 Vectorisation
The process of transforming a large corpus of text data into numbers is called vectori-
sation. This process helps in speeding up the training and testing procedures of the ML
model. This paper employed two vectorisation techniques, namely CountVectoriser
and term frequency-inverse document frequency for converting the words present in
the text data into numbers. CV counts the number of times a word is appearing in a
text document related to a text corpus. TFIDF is a statistical metric that reflects the
relevance of a word to a document in a text corpus. Term frequency represents local
relevance of a word by its appearance in a document. Inverse document frequency
detects the signature words, whose frequency is relatively low across the documents.
3.5 Modelling the Classifiers
In this paper, eight fake news detection models are created by combining two
vectorisers and ML classifiers. Pipeline technique is used for modelling the fake
news detectors. In pipeline technique, the intended methods are stacked together and
executed one after the other. These methods are called as transformers. Table 4 lists
out the various models that were created as part of research done by this paper. Here,
the best model from both the groups is identified.
Table 4 Proposed fake news detection models

Group Name Feature extractor Classifier
A Model 1 CountVectoriser Logistic regression
Model 2 CountVectoriser Multinomial naive Bayes
Model 3 CountVectoriser Support vector classifier
Model 4 CountVectoriser Random forest
B Model 5 Term frequency-inverse document Logistic regression
frequency
Model 6 Term frequency-inverse document Multinomial naive Bayes
frequency
Model 7 Term frequency-inverse document Support vector classifier
frequency
Model 8 Term frequency-inverse document Random forest
frequency
C Baseline CountVectoriser CountVectoriser
4 Experiments and Results Discussion
Initially, a baseline model is set up using CountVectoriser to find out the prediction
score. The model achieved a prediction score of 53.57 and 46.42% on r/theonion and
r/nottheonion datasets, respectively. These scores will be considered as the baseline
for the rest of the models developed. Table 5 lists the results of GSCV method on the
models created. After creating the pipeline and training them, GridSearchCV was
employed to acquire the best parameter scores. The results clearly suggest that all the
models are overfitting and clearly need fine-tuning of parameters. After fine-tuning
the parameters of the model, test dataset was fed to the models. For each model,
accuracy, precision, recall, specificity and misclassification rates were calculated
based upon the confusion matrices generated for each models. Table 6 depicts the
performance metrics achieved after feeding the test set. In terms of accuracy, Model
5 (TFIDF and LR) is the best, and Model 8 (TFIDF and RF) performs the worst.
Table 5 Results of the GSCV on the models

Model Best score Training Testing Status
1 74.15 99.94 78.25 Overfit
2 75.74 99.52 79.20 Overfit
3 71.61 94.86 73.01 Overfit
4 71.45 99.52 73.33 Overfit
5 73.94 93.43 78.09 Overfit
6 71.02 85.48 75.07 Overfit
7 72.67 90.41 75.07 Overfit
8 71.45 99.52 73.33 Overfit
Table 6 Performance metrics of the eight models

Accuracy Precision Recall Specificity Misclassification rate
Model 1 78.25 77.99 82.84 72.95 24.33
Model 2 78.10 77.32 83.73 71.58 24.82
Model 3 75.08 78.91 73.08 77.40 25.78
Model 4 73.17 72.18 81.36 63.70 31.24
Model 5 79.05 75.25 90.83 65.41 25.68
Model 6 77.14 71.95 94.08 57.53 30.00
Model 7 77.94 75.32 87.57 66.78 26.28
Model 8 72.22 74.62 73.08 71.23 29.61
Similarly, Model 1 (CV and LR) achieves 77.99% precision rate and stands first
while Model 6 (TFIFD and MNB) achieves 71.95% and stands last. On the other
hand, when recall metric is considered, Model 6 (TFIFD and MNB) achieves the
highest value of 94.08%, and Model 3 (CV and SVC), 8 (TFIDF and RF) achieve the
lowest 73.08%. Model 1 achieves 72.95% specificity and stands first, whereas Model
6 achieves a low specificity of 63.70%. With a value of 24.33%, Model 1 has the best
misclassification rate, and with a 31.24%, Model 4 has the worst misclassification
rate. According to the analysis, Model 5 (TFIDF and LR) is the best model because
of its accuracy
and satisfactory performance metrics. All the proposed models performed better
than the baseline model. Table 7 depicts the confusion matrices achieved from the
experiments conducted by this research.
5 Conclusions and Future Scope
This paper clearly explained the problems caused by fake news and ascertained the
need of early detection of fake news in social media. For this purpose eight ML
models were proposed. Various NLP techniques were implemented on the real-time
dataset collected from the Reddit website. Eight confusion matrices were generated
for calculating the accuracy, precision, recall, specificity and misclassification rate
of the proposed models. Based upon the analysis, model created by pipeling TFIDF
and MNB was the best with an accuracy of 79.05%. In future, the same work can be
implemented on Facebook, Twitter and Watsapp datasets. In future, novel models that
employ neural networks and deep learning techniques can be designed and applied
for early fake news prediction in social media websites.
Table 7 Confusion matrices of the proposed eight models
Model 1 Model 2
Model 3 Model 4
Model 6
Model 5
Model 8
Model 7
References
1. Titcomb, J., Carson, J.: What exactly is it—and how can you spot it? Fake News. www.telegr
aph.co.uk
2. Thota, A., Tilak, P., Ahluwalia, S., Lohia, N. Fake news detection: a deep learning approach.
SMU Data Science Review 1(3), Article 10 (2018)
3. Liu, Y.: Early Detection of Fake News on Social Media. PhD Thesis, NJIT, USA (2019)
4. Allcott, H., Gentzkow, M.: Social Media and Fake News in the 2016 Election. Technical report,
National Bureau of Economic Research (2017)
5. Bourgonje, P., Schneider, J.M., Georg Rehm from clickbait to fake news detection: an approach
based on detecting the stance of headlines to articles. In: Proceedings of the 2017 EMNLP
Workshop: Natural Language Processing meets Journalism, pp. 84–89 (2017)
6. http://www.journalism.org/2017/09/07/news-use-across-social-media-platforms-2017/acc
esed. 10th September 2020
7. Vosoughi, S., Roy, D., Aral, S.: The spread of true and false news online. Science 359(6380),
1146–1151 (2018)
8. Conroy, N.K., Rubin, V.L., Chen, Y.: Automatic deception detection: methods for finding fake
news. Association for Information Science and Technology 52(1), 1–4 (2015)
9. Chen, Y., Conroy, N.K., Rubin, V.L.: News in an online world: the need for an “automatic crap
detector”. In: Proceedings of ASIST 2015 (2015)
10. Kim, J., Tabibian, B., Oh, A., Schölkopf, B., Gomez-Rodriguez, M.: Leveraging the crowd to
detect and reduce the spread of fake news and misinformation. In: 11th ACM International
Conference on Web Search and Data Mining, pp. 324–332 (2018)
11. Traylor, T., Straub, J., Gurmeet, Snell, N.: Snell classifying fake news articles using natural
language processing to identify in-article attribution as a supervised learning estimator. In:
IEEE 13th International Conference on Semantic Computing (2019). https://doi.org/10.1109/
icsc.2019.00086
12. Bilal, G., Rosso, P., Rangel, F.: Stance detection in fake news a combined feature representation.
In: 1st Workshop on Fact Extraction and Verification (FEVER), pp. 66–71 (2018)
13. Bessi, A., Ferrara, E.: Social bots distort the 2016 US Presidential election online discussion.
First Monday 21(11-7) (2016)
14. Ferrara, E., Varol, O., Davis, C., Menczer, F., Flammini, A.: The rise of social bots. Commun.
ACM 59(7), 96–104 (2016)
15. Chu, Z., Gianvecchio, S., Wang, H., Jajodia, S.: Detecting automation of twitter accounts: are
you a human, bot, or cyborg? IEEE Trans. Dependable Secure Comput. 9(6), 811–824 (2012)
16. Castillo, C., Mendoza, M., Poblete, B.: Information credibility on twitter. In: 20th International
Conference on World Wide Web, pp. 675–684 (2011)
17. Zhao, Z., Resnick, P., Mei, Q.: Enquiring minds: early detection of rumours in social media
from enquiry posts. In: 24th International Conference on World Wide Web, pp. 1395–1405
(2015)
18. Ma, J., Gao, W., Mitra, P., Kwon, S., Jansen, B.J., Wong, K.F., Cha, M.: Detecting rumors from
microblogs with recurrent neural networks. 3818 (2016)
19. Cheng, J., Adamic, L.A., Kleinberg, J.M., Leskovec, J.: Do cascades recur? In: 25th
International Conference on World Wide Web, pp. 671–681 (2016, April)
20. Hu, X., Tang, J., Liu, H.: Online social spammer detection. In: 28th AAAI Conference on
Artificial Intelligence
A Novel Method for Optimizing Data
Consumption by Enabling a Custom
Plug-In
Vijay A. Kanade
Abstract In an era of technology, digital marketing has evolved many folds. Digital
marketing involves advertising delivered via digital channels such as search engines,
websites, social media, email, and mobile apps. Digital marketing is a method opted
by companies that endorse goods, services, and brands by using online media chan-
nels. In addition to digital marketing, personalization is another area of e-commerce
that has taken the world of advertisement with storm. However, both these marketing
gimmicks have impacted the bandwidth consumption of the Internet users signifi-
cantly. Internet data usage has soared high in recent times as the users are blinded
by digital marketing methods. The research paper proposes a novel custom plug-in,
to be used on portable computing devices for keeping Internet data consumption in
check, thereby eliminating the economic overhead for the end users.
1 Introduction
Personalization has been widely explored in outbound marketing, which is applied

across all dynamic websites. The very objective of personalization is to deliver target
advertisements that are customized for specific customers. Such personalization
allows websites to evaluate the reason for the customer’s visit to their webpage
and in future target them in order to achieve high conversion goals, wherein the
customer ends up buying the product facilitated via targeted advertisement.
The search window on the website alone provides a lot of customer centric infor-
mation, which is used to deliver dynamic content on the websites. Say, an individual
searches for “swimming pool nearby me.” The individual will be shown a page with
the header “swimming pool” and matching pictures plus texts. Now, if the customer
looks for a “swimming pool along with the playground,” he will be shown the same
page, but the content will focus on the nearby playground. The images provided in
the search results are linked using Google’s AI technology, which has a good amount
of accuracy, about 93%. This personalization of websites can further be linked to
V. A. Kanade (B)
Intellectual Property Research, Pune, India
https://doi.org/10.1007/978-981-16-1502-3_31
308 V. A. Kanade
customer’s click behavior information or online activity characteristics along with

customer profile information.
Once the customer’s necessary data is collected, the advertisers need to make
strategic decisions on what kind of product information is to be shown to the customer.
Further, such targeted advertisements also consider groups of individuals, wherein
demographic characteristics of diverse individuals are collected, and customers are
delivered with profile-specific advertisement [1] (Fig. 1).
However, with such personalization comes the inevitable demand for bandwidth at
the customer end—it may be a PC, smartphone, laptop, tablet, or any other device that
the user may be using. When such personalized content is delivered to the customers,
the dynamic nature of the content causes a heavy toll on the data consumption for
the users. Say, the user searches for a YouTube video on his PC—YouTube not only
provides the search video in its results but it also delivers the user-specific customized
advertisements, along with related social media posts, trending news/blog articles,
user’s location information, and plenty more of dynamic content that gets updated
in real time. These dynamic websites consume a lot of Internet data of the user, and
Fig. 1 Dynamic website [2]

A Novel Method for Optimizing Data Consumption … 309
the user is forced to endure situations, wherein data is exhausted in minimum time.
Therefore, there seems to be a long pressing need to contain the dynamic content
of these dynamic websites by providing a customization option at the customer end,
wherein the user is able to manually control and monitor its data usage on the Web
content delivered via diverse vendors or e-commerce giants.
2 Dynamic Content
While it is true that smart content delights its customers, it plays a crucial role in
burning out the data consumption for the customers. Let us understand what dynamic
content really means.
Dynamic content creates a customized experience for the visitor at that very
time instance. Common examples may include Amazon’s recommendation engine,
wherein the customers are recommended with additional products when the customer
visits their website, based on the profile information or customer online behavior.
Some other forms include personalization fields in emails that deliver customer-
specific content. Consider, for example, a customer visits an e-commerce site for
the first time. During this first visit, the customer browses around and clicks the
“like” button on a few products and maybe purchases some products. Say, the same
customer comes back and revisits the same e-commerce website a couple of weeks
later, and the home site has now changed to say “Welcome back!” and further, the
website also recommends items that the customer may like based on his history
(Fig. 2).
The same dynamic content functions on cross-platforms. Consider a scenario
where one morning a customer browses a cosmetics site for the first time and after
a while the customer closes the website and opens up Facebook. The customer
observes that all the ads surfacing on Facebook are from the cosmetic site that he
just visited. Facebook chooses ads to show users based on their browsing history
Fig. 2 Dynamic content [3]

310 V. A. Kanade
Fig. 3 Database-driven website
and interests. This implies that personalization happens over cross-platforms, and
customer’s activity is tracked all the while as he stays online.
3 Mechanism of Dynamic Content
For personalization to work, important factor is data collection, wherein customer’s

profile information (such as an email address, first name), shopping history, usage
behavior data are collected by the websites. This data is organized and stored in
database-driven websites with associated values—think of this as a filing system.
The data collection works by scripts in a webpage’s HTML that changes to make the
page relevant to the user. Now, when the customer visits any website, that website
then assesses the need of the page and shows the viewer content that is relevant to
the user based on the collected data (Fig. 3).
4 Statistics for Internet Data Usage
As per the recent statistics, application vs approximate Internet data usage is disclosed
in Table 1 [4]:
Table 1 Application versus Internet data usage

S. no. Application ≈ Data usage
1 Web browsing ≈ 60 MB/h
2 YouTube streaming (SD video quality) ≈ 6 MB/min or 360 MB/h (480p)
(a) YouTube content (high quality) (a) ≈ 150 MB/min or 900 MB/h (1080p)
3 Netflix streaming ≈ 250 MB–1 GB/h
(a) Low quality (a) ≈ 5 MB/min or 300 MB/h
(b) Medium quality (b) ≈ 9 MB/min or 450 MB/h
(c) High quality (c) ≈ 17 MB/min or 1 GB/h
4 Social media (scrolling) ≈ 2 MB/min
(a) Facebook (video content) (a) ≈ 120 MB/h or 160 MB/h
5 Music streaming ≈ 150 MB/h
6 Online gaming ≈ 3 MB/h to a 1 GB/h
7 FaceTime (Apple) ≈ 90 MB per h
Now, the above data usage is specific to the application that is used by the user,
thereby ruling out the data consumed by the dynamic content rendered via person-
alized ads, feeds, trending posts, etc. Now, if we imagine a situation where multiple
data streams from varied sources run parallelly along with the intended application
in the name of dynamic content, then it is evident that dynamic content is the real
reason behind excessive data usage. In such cases, although the user does not perform
any data-centric activity over the Internet but still the data consumption exceeds the
intended data usage of the user—which leads to data overhead.
5 Custom Plug-In
The excessive data usage can be controlled by deploying a custom plug-in that
keeps a check on data consumption. The disclosed custom plug-in acts as a piece of
software that provides an add-on to a Web browser and gives the browser additional
functionality, wherein the user or visitor is able to customize the window size on the
website that he wishes to view. This plug-in allows the Web browser to display only
the content within the customized window opted by the user (Fig. 4).
Consider an example where a user is viewing a YouTube video on a PC. As the user
searches for the desired video on YouTube website/channel, the results displayed to
the user include the list of videos that are related to the searched video. Now, the user
can select any one of the videos from the list. As the user plays the video content, the
background dynamic content such as targeted ads, e-commerce products, and social
media posts comes into play and gets displayed parallelly on the website along with
the video frame.
Now, the custom plug-in disclosed in the research allows the user to select a
window frame on the website that he wishes to view. This window is manually
312 V. A. Kanade
Fig. 4 Generalized plug-in

[5]
controllable, and the user can resize the window as per the need. The content played
within the window frame acts as dynamic content, thereby allowing the user to view
it in its original form, as streamed by the service provider. In addition, the content
external to the window frame becomes dormant or static, thereby consuming zero
data. Therefore, the custom plug-in puts a check on the data that is hogged by the
background content such as ads, social media posts, and blogs that run simultaneously
on the website along with the user intended content (Fig. 5).
The below snapshots disclose the custom plug-in framework for a YouTube video.
Snapshot-I discloses a YouTube video running on a PC of the user.
Fig. 5 Snapshot-I
Fig. 6 Snapshot-II
Snapshot-II: With the custom plug-in, the user can customize the window frame (i.e.,
active window) on the website as shown in the below image. The plug-in disables the
content running external to the window. Thus, the content outside the active window
becomes dormant or static, thereby saving the data usage.
Snapshot-III: Similar to Snapshot-II, Snapshot-III discloses the customized window
active area along with dormant or static window where the data consumption is
stalled (Figs. 6 and 7).
6 Advantages
The custom plug-in disclosed in the research proposal has following advantages over
the conventionally running dynamic website model:
1. Reduction in Internet data consumption occurring due to personalization.
2. Custom plug-in is manually controllable, thereby allowing the user to resize the
window frame as per user’s choice or need.
3. Effective economic solution for the end customers.
4. Plug-in is compatible with any portable computing device such as PC,
smartphone, and palmtop.
314 V. A. Kanade
Fig. 7 Snapshot-III
7 Conclusion
Digital marketing and personalization have played a significant role in the high
volume of data traffic over the Internet. Data consumption is reaching new highs
every year, with more smart devices cropping up every day and more users adopting
such devices. The research paper proposes a unique solution for controlling the high
data consumption, by employing custom plug-ins within user computing devices that
essentially manage the flow of data traffic by providing manual controls in the hands
of the end user.
8 Future Work
The custom plug-in may be enabled with an indicator that displays the data consump-
tion within the customized window frame chosen by the user. This will allow the
user to keep track of the data usage in real time.
Acknowledgements I would like to extend my sincere gratitude to Dr. A. S. Kanade for his
relentless support during my research work.
Conflict of Interest The authors declare that they have no conflict of interest.
Declaration We have taken permission from competent authorities to use the images/data as given
in the paper. In case of any dispute in the future, we shall be wholly responsible.
References
1. Manola, S.: What is Personalization in Digital Marketing. 27 May 2019

2. Approx World, Bansdroni, Kolkata, West Bengal, Dynamic Website Design
3. BTI Admin: Search Engine Optimization, Tips and Tricks. Dynamic Content: Making Big Data
Work for Your Website, 22 February 2017
4. Seph, amaysim’s tech geek: Internet Data Usage Guide: What Uses the Most Data?” 8 May
2020
5. Plug-in (computing), Wikipedia
An Effective Mechanism for the Secure
Transmission of Medical Images Using
Compression and Public Key Encryption
Mechanism
T. K. Ratheesh and Varghese Paul
Abstract In medical image applications, the diagnostic observations of a patient

are transmitted to a remote location through internet. Since the information being
transmitted is really sensitive as far as the diagnosis is concerned, the security of the
image is a major concern. The size of the image being transmitted is another major
concern in the scenario. We propose a methodology to mitigate problems relating to
both security and size of image. The proposed mechanism first compresses the image
to reduce its size using a lossless compression mechanism. The compressed image
is then encrypted using the well-known public key cryptography algorithm ECC to
ensure its security. The encrypted cipher image is transmitted to the remote center
where the image undergoes decryption and decompression mechanisms to generate
the actual image. The performance analysis shows that the system works well and is
effective in ensuring the security of the image.
1 Introduction
Internet has become an inevitable part of human life these days. As the communica-
tion technology has improved a lot, the use of interactive multimedia in communica-
tions has increased to a great extent. Images occupy a greater fraction of multimedia
communication, for example, military applications, medical application, security
agencies, etc. These images may carry highly confidential and important information
which is not supposed to get compromised or lost during its transit.
In medical image applications, a patient’s medical diagnostic observations are
transmitted from a medical institutions to a medical practitioner located in a remote
place through Internet. Two major constraints that exist for transmitting medical
images through Internet are its scale and privacy. Medical images are usually large
sized files which require larger space and time for transmission. One solution to
resolve this issue is the use of compression technique with which the size of the
T. K. Ratheesh (B) · V. Paul

Division of Information Technology, CUSAT, SoE, Kochi, India
https://doi.org/10.1007/978-981-16-1502-3_32
318 T. K. Ratheesh and V. Paul
Fig. 1 Public key encryption
image can be reduced. There are mainly two approaches for image compression—
lossless and lossy compression. As the medical images contain sensitive information
the approach, we can adopt lossless compression where the size of the file is reduced
without compromising its quality. The second constraint is the privacy of the image
being transmitted. As the medical images contain confidential medical information,
it needs protection against various security attacks. The confidentiality, integrity
and authenticity of the image data must be protected during its transit. The popular
technique for securing images in cryptography which involves an operation called
encryption in which the image is transformed into a cipher image at the sender side. A
reverse operation called decryption is done at the receiver side to retrieve the original
image.
Public key encryption mechanism is one of the cryptographic mechanism for
securing images which involves the use of two district keys for performing encryp-
tion and decryption operations. The process is shown in Fig. 1. The plain image is
encrypted by the sender with the help of the public key of the receiver, forms the
cipher image and is transmitted to the receiver. The receiver uses his own private key
to decrypt the cipher image to generate the original plain image.
The popular public key algorithms for ensuring the confidentiality of data being
transmitted are AES and ECC.
Lossless compression is a compression technique which reduces the size of a file
with no loss of quality, i.e., lossless compression packs the data into smaller file
without losing any data during the process of compression. The process is depicted
in Fig. 2. It is seen from the figure that the original file is compressed to a smaller
size, but upon decompression process, the restored image will be more or less the
same as that of the original image.
In this paper, we propose a mechanism that compresses the image first to reduce
its size and then encrypts the compressed image to protect its confidentiality. Oper-
ations of decryption and decompression are performed at the receiver side in order
to regenerate the original image.
The rest of the paper is organized in six sections and is as follows. Section 2
describes the available systems in the literature regarding image security and
An Effective Mechanism for the Secure Transmission of Medical … 319
Fig. 2 Lossless
compression: original,
compressed and restored
compression. Section 3 gives an overview of the popular public encryption algo-

rithm ECC. Section 4 describes the proposed system. The performance analysis of
the proposed system is described in Sect. 5. The paper concludes in Sect. 6.
2 Related Works
Several image encryption and compression techniques are presented in the literature.
These techniques depict the need as wells as the method of encryption and compres-
sion of image data. This section describes a few of them. Even though these methods
are not specifically designed for medical images, it shows the scope and need of
encryption and compression on images.
Narendra K. Pareek, Vinod Patidar and Krishan K. Sud have proposed a gray image
encryption scheme [1] in which the image is partitioned into key-dependent dynamic
blocks and then undergoes a key-dependent diffusion and substitution processes of
16 rounds. A mixing process is performed before the partitioning. The system is
claimed to have high encryption rate.
The method proposed by Shihua Zhou, Bin Wang, Xuedong Zheng and Changjun
Zhou used the concept of DNA computing [2]. They introduced two concepts named
one-dimensional DNA cellular automata and T-DNA cellular automata. Reversible
T-DNA cellular automata are defined and used for the encryption process. The authors
claimed that the proposed method is capable of resisting several attacks like brute-
force attacks, statistical attacks and differential attacks.
An elliptic curve and chaotic system-based image encryption scheme is proposed
by Yuling Luo, Xee Ouyang, Junxiu Liu and Lvchem Cao [3]. The proposed system
generates a scrambled image using the chaotic system concept. Elliptic curve and
EI Gamal algorithms are then used to improve the security of the image. DNA
sequencing is also employed to generate the final cipher image. The authors claimed
that the proposed method has high security and good efficiency when compared to
the benchmarked system.
Alireza Arab, Mohammad Javad Rostami and Behnam Ghavami proposed an
image encryption mechanism using chaotic system and AES encryption system [4].
Arnold chaos sequence is used for generating the encryption key. The encryption
is performed using the AES algorithm using the key generated with the chaotic
sequence. The system is proved to be resistant to differential attacks, brute-force
attack and statistical attacks.
Yinghua Li, He Yu, Bin Song and Jinjun Chen proposed an encryption mechanism
for images for a cloud computing scenario [5]. The method is based on single-
round dictionary and chaotic sequences. The system uses two chaotic functions. A
unique dictionary is maintained for each image with which the images are encrypted
adaptively and reconstructed.
Shaou-Gang Miaou, Fu-Sheng Ke and Shu-Ching Chen proposed a method for
image compression in which JPEG-LS and interframe coding with motion vectors
are combined [6]. In this method, the interframe coding is activated when and only
when there found high interframe correlation. The proposed method achieves a
compression gain of 13.3% and coding gain of 77.5% for MRI image sequence.
Ali Al-Fayadh, Abir Jaafar Hussain, Paulo Lisboa and Dhiya Al-Jumeily proposed
an adaptive lossy image compression technique for the compression of medical drain
images [7]. They used classified vector quantizer and singular value decomposition
for compression of the image. The authors claimed that their system could regenerate
the images with high PSNR compared to the bench marked technique.
Tushar Shinde have proposed an approach for image compression [8]. The
approach uses an efficient clustering, fast direction-oriented motion estimation algo-
rithm along with a minimum predictive cost image reordering scheme that gives a
better level of compression.
Tony Leung, Michael W. Marcellin, Ali Bilgin have proposed an approach for
visually lossless image compression mechanism [9] in which a visually lossless
representation after adjustments to the window level is done and then compressed.
The systems proposed in [1–5] are designed for securing images using encryption
methods where systems in [6–9] are designed for compressing images. All the papers
mentioned above are pointing out the need for encrypting and compressing the images
for transmission over an insecure and bandwidth-sensitive channel. The literature
shows the need for a single system for ensuring security as well as for reducing size
for transmission, and the proposed architecture concentrates on both of these aspects.
3 Elliptic Curve Cryptography
An elliptic curve E P is a set of points that satisfies a cubic function in two variables
over a finite field and are represented by the Weierstrass equation,
y 2 = x 3 + ax + b(mod p) (1)
where a and b are two constants which satisfy 4a3 + 27b2 = 0, p is a prime [10].
Addition of two elliptic curve points P(x 1 , y1 ) and Q(x 2 , y2 ) resulting in R(x 3 , y3 )
is given as
x3 = t 2 − x1 − x2 (2)
y3 = t(x1 − x3 ) − y1 (3)
where t = [(y2 − y1 ) / (x 2 –x 1 )] if P = Q and t = [(3x 1 2 + a)/2y1 ] if P = Q.

An interesting fact of elliptic curve is that the resultant point of the point addition
will also be on the same elliptic curve.
By combing the point addition law on elliptic curve with the discrete logarithm
operations, a public key cryptosystem could be established. Generation of keys for
the communicating parties, the encryption process at the sender and the decryption
process at the receiver can be defined because of the irreversible property of ECDLP.
4 Proposed System
The proposed system is an effective mechanism to transfer images with solutions

to the constants of scale and privacy. Figure 3 shows the overall architecture of the
system.
The architecture is divided into two phases send phase which describes the
processes a sender does before sending the plain image file and receive phase that
describes the processes a receiver does when receiving the cipher image file.
4.1 Send Phase
The plain medical image is given to the compression block where the image under-
goes compression to reduce its size. Since the medical images contain information
Fig. 3 Proposed system architecture

which are very sensitive for medical diagnosis the compression method must ensure
that no information is lost during the compression. So a lossless compression mech-
anism is used for reducing the size of the image. The compressed image is then given
to encryption block. The encryption block encrypts the compressed image and forms
the cipher image for transmission. The popular public key encryption method ECC
is used for the purpose in which the public key of the receiver is used to generate the
cipher image. The cipher image is then transmitted to the receiver.
4.2 Receive Phase
The receive phase in contrast to the send phase performs a series of operations to
retrieve the plain image from the received cipher image. The cipher image undergoes
a decryption process in the decryption block where the image is transformed to a
pseudo plain image. The pseudo plain image is then processed by the decompression
block where the pseudo image undergoes a decompression operation and generates
the plain image as send by the sender.
The simulation and result analysis is presented in this section. The proposed archi-
tecture is implemented in Python. The inputs and outputs of the system are shown in
Fig. 4. The original image at sender side is shown in (a). The image after decryption
and decompression at receiver is shown in (b). It is clear from the pictures that the
receiver could regenerate the original image without errors.
5.1 Performance Analysis
Histogram analysis is used for illustrating the substitution and diffusion proper-
ties of the proposed method. The histograms of several test plain images and their
corresponding regenerated images are shown in Fig. 5. The section (a) of the figure
shows the histogram of the original plain image and (b) shows the histograms of the
corresponding image regenerated at the receiver side.
It can be concluded from the histogram analysis that the regenerated images have
the same pixel distribution as that of the original image. The PSNR and MSE values
calculated between the original and regenerated images show that both images are
same and no noise has been introduced or no bits have missed after the compression
and encryption process. Since the image is encrypted, the image does not provide
any clue to attacker for performing any statistical attack on the proposed scheme.
This makes the statistical attacks difficult in the images.
Fig. 4 Plain and regenerated

images
6 Conclusion
The transmission of content-sensitive images like medical images through the

Internet is popular these days. As far as the medical images are concerned changes
in content, it will lead to wrong diagnosis of diseases. So a system was proposed for
the secure transmission of medical images using public key encryption mechanism.
The system also uses a lossless compression method in order to reduce the size of
the image before the transmission. The algorithm ECC is used for the encryption,
and 7zr is used for compression. The performance analysis shows that the system
works well and is effective in ensuring the security of the image. The histogram
analysis, PSNR and MSR calculations, shows that the system is able to regenerate
the data without any missing. Since the image is encrypted, it is secure and free from
statistical attacks.
Fracture
Lungs
Cyst
(a) (b)
Fig. 5 Histograms of original and regenerated images
References
1. Pareek, N.K., Patidar, V., Krishan, K.: Diffusion–substitution based gray image encryption
scheme. In: Digital Signal Processing, Elsevier, pp 1–8 (2013)
2. Zhou, S., Wang, B., Zheng, X., Zhou, C.: An image encryption scheme based on DNA
computing and cellular automata. Hindawi Publishing Corporation, Discrete Dynamics in
Nature and Society, vol. 2016 (2016)
3. Luo, Y., Xee, O., Liu, J., Cao, L.: An image encryption method based on elliptic curve ElGamal
encryption and chaotic systems. IEEE Access 4 (2016)
4. Arab, A., Rostami, M.J., Ghavami, B.: An image encryption method based on chaos system
and AES algorithm. Springer J. Supercomput. 75, 6663–6682 (May 2019)
5. Li, Y., Yu, H., Song, B., Chen, J.: Image Encryption Based on a Single-Round Dictionary and
Chaotic Sequences in Cloud Computing. Wiley, Hoboken (2019)
6. Miaou, S.-G., Ke, F.-S., Chen, S.-C.: A lossless compression method for medical image
sequences using JPEG-LS and interframe coding. IEEE Trans. Inform. Technol. Biomed. 13(5),
818–821 (2009)
7. Al-Fayadh, A., Hussain, A.J., Lisboa, P., Al-Jumeily, D.: An Adaptive hybrid Image
Compression method and its application to Medical images. In: 2008 IEEE, pp. 237–240
(2008)
8. Shinde, T.: Efficient image set compression. In: 2019 IEEE, pp. 3016–3017 (2019)
9. Leung, T., Marcellin, M.W., Bilgin, A.: Visually lossless compression of windowed images.
In: IEEE Data Compression Conference, IEEE Computer Society, p. 504 (2013)
10. Vasundhara, S., Durgaprasad, D.K.V.: Elliptic curve cryptosystems. Math. Comput. 48(177),
203–209 (1987)
A Systematic Survey on Radar Target
Detection Techniques in Sea Clutter
Background
R. Navya and R. Devaraju
Abstract Sea clutter is an unwanted return or echo signal which exhibits non-
linearity and disarray and is random in nature. The reliable way of detecting the
moving targets in the presence of clutter background has always been a setback
in radar signal processing. The unwanted sea clutter greatly influences the target
detection, which biases its characteristics and increases the difficulty of radar detec-
tion. With the development of advanced radar processing methods, the sea clutter
can be suppressed considerably and targets can be detected reliably. In this paper,
we report a review on current development in clutter suppression, clutter modeling
based on the statistical modeling of sea clutter, which covers amplitude features of
sea clutter, i.e., Rayleigh distribution, Log-Normal distribution, Weibull distribution,
and K-distribution. The current developments in radar target identification methods
are also conferred, within the framework of these clutter models. This review article
provides a systematic comparison of various methods to suppress the clutter and to
detect the target in a sea clutter environment.
1 Introduction
The target detection in marine environment has been one of the major challenges
in radar technology due to presence of sea clutter. Research on sea clutter has
received more attention in the study of ocean aspects. The characteristics of sea
clutter and the target can be used to distinguish the false echo, which is used in
the military and non-military applications. Radar is widely used for Coastal and
National Security, which includes detection of low-flying, submarine periscopes,
missiles, aircraft, small marine vessels and small pieces of ice, etc. These Radars are
also used for marine traffic management, marine navigation, Finding Oil spilling,
R. Navya (B) · R. Devaraju

Dayananda Sagar University, Bangalore 560068, Karnataka, India
e-mail: navya-ece@dsu.edu.in
R. Devaraju
e-mail: devaraju-ece@dsu.edu.in
https://doi.org/10.1007/978-981-16-1502-3_33
328 R. Navya and R. Devaraju
Detecting Marine debris, Sea patrolling, detection of small fishing vessels, and harbor
surveillance.
Radars that are operating in a marine environment consequently experience
backscattering, which is usually referred to as sea clutter or sea echo. The backscatter
from the sea is an unwanted echo that may disrupt the radar’s operation. Sea clutter
characteristics vary widely depending on predominant conditions of environment
and geographical location. By understanding the clutter characteristics, a suitable
signal processing strategy has to be developed by radar system designers to revise
performance under different conditions. This well-defined statistical model devel-
oped has to eliminate the clutter return is an imperative step. The temporal and spatial
properties of the sea echo should be incorporated while designing the models, by
considering the wide range of viewing geometries for different weather conditions.
Traditionally, modeling of sea clutter has been a random presumptive method,
with a radar range resolution unit being a model basis of the stochastic method, for
high grazing angles, low-resolution and large number of scattered cells in traditional
radars which exhibits range resolution units that have the characteristics of random
transformation. For these types of sea clutter Rayleigh distribution is frequently used
to describe amplitude distribution. However, with a lot of developments in radar
technologies like high-frequency, high-resolution, and low-grazing angles, and sea
clutter exhibits non-Gaussian, long trailing phenomenon with significant deviations
from Rayleigh distribution. For sea clutter with these characteristics Weibull, Log-
Normal, and K-distribution are used to describe sea clutter amplitude distribution.
2 General Model Blocks of Target Detection
In general, the implementation blocks of target detection as shown in Fig. 1, involves

the raw data acquisition from radar, then applying clutter suppression methods to
achieve better signal-to-noise ratio. The processed data is streamed through different
statistical clutter modeling techniques to differentiate the target from clutter influ-
ence. By applying the required threshold on the processed data target can be detected
and tracked.
Fig. 1 Implementation blocks of target detection

A Systematic Survey on Radar Target Detection … 329
3 Review of Related Work
A literature survey is carried out on various methods for suppressing the sea clutter to
detect the target. Various procedures, techniques are being used by many researchers
for detecting slow and fast-moving targets by suppressing sea clutter. In this section,
we summarize the methods used by various authors, with the merits and demerits
to improve the target detection more efficiently under the clutter background, and
comparisons of various review work are as shown in Table 1.
Parsa [1], proposed a method for detecting fast-moving targets by suppressing the
sea clutter using a non-coherent X-band radar, by considering antenna rotation as the
main criteria. A large set of data was collected from two X-band radars by operating
Radar#1 with more antenna rotation (rpm) and then Radar#2 which are horizontally
polarized [2] simultaneously and installed on a moving vehicle. By using recorded
data, the two antenna rotation speeds for a fast motile target are analyzed using a
scan-to-scan integration procedure. On analysis, the performance data was obtained
on detection of the target by considering its antenna speed, range, and the number
of scans by scan averaging method. By considering the different scanned averaged
data, the probability of detection was obtained. So the author concludes increasing the
rotation speed of the antenna, improves the performance of detection of fast-moving
targets by integrating the fixed number of scans in moderate sea state.
Liu et al. [3] elaborate sea clutter production and its effect. For the suppression of
sea clutter and target detection, the authors proposed a new α–β–γ filter. Analysis of
performance with the real data is provided and standards to choose the parameters
are given. Further, they list the limiting factors which severely affect the detection
capability of radar such as operating frequency, polarization mode, antenna visual
angle, wind direction, and sea state.
Authors claim that traditional stochastic modeling of sea clutter like Rayleigh
distribution, Weibull, Log-Normal, and K-distribution would not provide much
support in understanding of physical or analytical characteristics. So to understand the
sea clutter features, characteristics, authors use the fractal concept for description and
modeling of sea surface roughness [4, 5]. The confused state behavior of sea clutter
is challenging to design a new filter for target detection. Further includes techniques
like extinction pulse and time–frequency. The neural network and wavelet-based
approach were also considered. Using X-band non-coherent radar the cluttered data
is recorded, which is installed in the East China Sea was used for analysis. This is an
azimuth and range surveillance radar and concerning each azimuth repetition pulse
data has been recorded. The proposed technique is a Kalman filter based on new α–β–
γ filter, to separate clutter from a target in the frequency domain instead of designing
a clutter model adaptable to every situation of varying sea and weather conditions.
It is observed that using low pass filter theory the low-frequency component creates
a large-scale structure of sea clutter and it governs sea echo for a maximum portion,
then that of the high-frequency component. As a result of detailed analysis, the band-
width and signal-to-clutter ratio improvement are affected by three parameters α, β,
and γ. A system function of the filter has been evaluated for the optimal parameter
Table 1 Comparison of review work

Reference Aim Contribution Future scope/Research
direction
1 Analysis based on a When the target looks When there is a strong sea
fast-moving target using stationary above 0.8 for an clutter region the target
scan-to-scan integration aerial target, by using detectability decreases for
by the sigma S6 radar scan-to-scan integration (0–2 Nm) range
processor the detection efficiency is
increased
2 α–β–γ filter is used to Kalman filter is used for High-frequency
decrease the sea clutter clutter suppression and components are not
influence on the target target detection with the eliminated;
best accuracy low-frequency large-scale
structure of sea clutter is
only eliminated
Small targets immersed in
sea clutter with negative
power are not eliminated.
This is a flaw to be
amended
3 The statistical Log-logistic distribution The commonly used data
distributional modeling of fits the data to the best and fitting results showed that
sea clutter at very with a good local fit distribution like Weibull,
low-grazing angles used to Log-Normal underfit the
fit the data tail region by giving an
underestimated detection
threshold
If the target is
non-fluctuating the
probability of detection
varies with less SCR,
while fluctuating target
with high signal-to-noise
ratio (SCR)
4 CFAR detection using On experimental analysis, Clutter is better estimated
orthogonal projection the total time spent to and suppressed in HH
suppress clutter is 0.016 s polarization than in VV
using orthogonal polarization mode
projections then SVD
5 Correlation characterstics, Extreme learning machine ELM can be applied only
amplitude characterstic is effective method when for lower sea state
vectors and Hurst compared with SVM For higher sea state, the
exponent in the fractional accuracy rate is less
Fourier transform are
considered to distinguish
the target and sea clutter
(continued)
Table 1 (continued)
Reference Aim Contribution Future scope/Research
direction
6 Panjer Probability Tracking accuracy is Tracking error is more
Hypothesis Density filter maintained for temporally when the number of
is used to classify the true sparse radar scans scanning interval is
object from clutter increased
True targets are
recognized by their
motion (speed) and
measurement models
7 Eigenvalue-based To distinguish the target The method is applied
detection scheme used to from the clutter, maximum only when the pulse train
suppress clutter with short eigenvalue of the length is small
pulse covariance matrix is
adopted
8 CFAR- Temporal X-band temporal Average Detection
sequence of consecutive sequences of navigation precision is 72%
navigation radar imaging radar images were
method is used to suppress exploited to describe the
the clutter proposed method
combination of α = 0.01, β = 0.0033, γ = 0.6. The experimental result conducted

on one-way and round scanning real data shows that a large part of the strong sea
clutter with high power is suppressed, which resulted in a better distinction between
target and sea clutter. In this method, small targets can submerge within the sea,
since experimental results showed that both the power of clutter and target has been
reduced.
Song et al. [6] aims on finding the statistical modeling of sea clutter and to identify
best-fitting distribution with emphasis on statistical modeling of sea clutter. Authors
used the clutter data from X-band high-resolution coastal radar operating at low-
grazing angles for statistical modeling [7] of sea clutter. Since detection probability
depends on the region of distribution and the tail region mainly contributing to a
threshold.
Authors derive a common method for calculating the expected detection proba-
bility to evaluate how detection probability calculation is affected by global fit. By
using maximum likelihood estimation and least-squares estimation the recorded data
is fitted to the following distributions like Weibull, K, Log-Normal, Pareto + noise, K
+ Rayleigh, KK [8] distribution, and also Log-logistic distribution. The fitting results
exhibit that Weibull, K, and Log-Normal distribution fits the clutter distribution at the
tail region, which results in an underrated threshold for detection. The experimental
result shows that the Log-logistic distribution is ideal to model the entire region of
sea clutter, while the lately developed K + Rayleigh distribution, which is superlative
for thermal noise, fits the tail region to best. Authors also demonstrate that for non-
fluctuating targets, considering the global fit the clutter distribution has a constant
impact on the expected probability of detection calculation. For fast-moving targets

with a high SCR, the detection probability is less.
Yang et al. [9] propose an Orthogonal Projection (OP) scheme to detect the target
by suppressing the sea clutter. The authors combine OP with a Constant False Alarm
Rate (CFAR) of cell averaging to design a new detector. They conduct experiments
to compare and demonstrate the clutter suppression averaging and the complexity
of OP with singular value decomposition (SVD). To experiment on the data, the
authors construct the clutter subspace using the data vectors of cells under tests
(CUT) neighboring range cells. The observed signal of CUT is projected to the
orthogonal subspace of clutter by suppressing the sea clutter of the CUT.
Authors investigate the methods suggested by scholars to improve the signal-
to-clutter ratio (SCR). They emphasize mainly on suppressing clutter rather than
increasing target echo. The singular value decomposition (SVD), block-adaptive
filter, adaptive fractional Fourier transform, knowledge-aided reconstruction, and
range distribution [10] via feature-based detector are some of the clutter suppression
techniques discussed by the authors. McMaster University collected experimental sea
clutter data from IPIX radar, which is available online for download and analysis. The
operating frequency of IPIX radar is 9.39 GHz and it operates in staring mode when
the radar is stationary and looks at the target scene with pulse repetition frequency
of 1 kHz. The range resolution of the sampled data is 30 m which is sampled at
every 15 m. They used sea clutter data for experimental analysis in the MATLAB
environment.
The computational efficiency is found to be about 0.016 s for orthogonal projection
and 3.047 s for singular value decomposition to perform clutter suppression. The
experimental result indicates that OP methods computation efficiency is better than
that of SVD. The like-polarized (HH, VV) signals are more preferred than the cross-
polarized (HV, VH). More specifically clutter suppression and target estimation are
better when HH polarized signals are used in most cases. Radar signal processing
mostly uses sea clutter modeling to suppress the echoes, reflections by the sea to find
the target. and using OP detection performance is improved. OP has the advantage
of easy implementation while combining it with cell averaging CFAR is simple and
its computational complexity is much less than that of SVD.
Jing et al. [11] proposed a new algorithm called Extreme Learning Machine [ELM]
for target finding in presence of sea clutter by classifying its features. Firstly, the
authors analyze the problem by considering the correlation characteristics of sea
clutter which is further divided into temporal correlation and spatial correlation. But
temporal correlation for target detection mainly uses a feature vector and clutter fluc-
tuation features are returned on the time measurement in the same resolution unit.
Secondly, the amplitude characteristics of sea clutter, an important part of statistical
characteristics, are considered and analyzed using K-distribution. The most extensive
range of fitting parameters is exhibited by K-distribution, so that target and unwanted
echo can be effectively separated. Another characteristic of sea clutter that differenti-
ates that from the target is fractal property which possesses self-similarity properties
of target used to increase the efficiency. Hurst exponent in the fractional Fourier trans-
form (FrFT) domain [12, 13] is another method that increases the signal-to-clutter
ratio (SCR) to achieve the target detection effectively. Finally, the extreme learning
machine (ELM) is used in pattern classification of these features and concluded
that the extreme learning machine can separate the target echo from sea echo very
efficiently.
Schlangen and Charlish [14] discuss an approach that concurrently tracks the echo
from the object and correlates clutter echoes. The target and clutter are distinguished,
based on their profile history in precise dynamic models. To conduct experimental
analysis, authors use the dataset from the finest trial database conducted by the
Council for Scientific and Industrial Research (CSIR), which is recorded at a coastal
area close to Cape Agulhas in South Africa in 2006. For the target like small vessels,
the Radar cross section of the target is very small compared to that of sea clutter. As
a result, intensity-based clutter modeling may either remove a lot of false targets or
accept a lot of clutter echo by simple thresholding.
Authors use a Bayesian approach for the classification of target and clutter. In
this approach, the processor interprets the related false returns to a separate class
of objects in parallel to correlation to target. Plot extraction is achieved, firstly by
applying a rough intensity threshold across each range cell, then creating a connected
component followed by extracting coordinates from each component. After accepting
more false detections, classification of clutter and target is done by considering target
dynamics for multiple intervals. The Bayesian multi-object filter is used to estimate
two groups of objects simultaneously, i.e., objects of type target (vessel) and clutter
(wave). Classification between both the clusters is based on previous information of
origin-motion model, probability of detection existence, and measurement accuracy.
Panjer Probability Hypothesis Density (PHD) filter [15] is selected for multi-target
classification. Two independent object groups are estimated and the same group of
measurements is used for updating and correcting steps.
Authors conclude that suppressing the echo in a frame-by-frame manner may
lead to failed target detection in case of low RCS targets or more false alarms in
case of low threshold. By using a Panjer Probability Hypothesis Density (PHD) filter
for classification between two populations, i.e., target object and clutter object, the
number of false tracks is significantly reduced.
Zhao et al. [16] propose a detection scheme to identify moving objects or targets
in sea clutter background for short-pulse operating radars. The proposed scheme is a
combined algorithm, combining an eigenvalue with sub-band decomposition. They
used a discrete Fourier transform-modulated-based filter bank for sub-band decom-
position which can effectively suppress sea clutter and also increases the coherent
integration time. The target spectrum can be separated from the clutter spectrum by
transforming the original scenario into a scene where the target spectrum overlays
with that of clutter. An eigenvalue detector cascade is performed in each sub-band
to detect the target.
The advantage of using the linear-phase DFT modulated finite-impulse response
(FIR) filter bank is, it maintains the value of the phase structure of the target echo
unaffected and it has high stop-band rejection. Further, the authors compare by deter-
mining the frequency-domain characteristics of each finite-impulse filter separately
and the Discrete Fourier Transform (DFT) modulated method. They found that the
Discrete Fourier Transform (DFT)-modulated method is simple to implement and

can reduce the consumption of hardware and computation load.
In the target sub-band, the usage of a non-coherent technique which uses ampli-
tude difference is more advantageous for detection. This is mainly because of the
non-obvious phase difference produced due to the overlapping of the target and
the clutter spectrums. The covariance matrices maximum eigenvalue is embraced to
distinguish the target from the clutter because the maximum eigenvalue will reflect
the signal intensity and it seizes the signal correlation very well. Authors prove with
the simulation outcomes that the proposed cascade algorithm with an eigenvalue
detector gives better detection of targets in short-pulse operation. It is also better than
the adaptive normalized matched filter (ANMF) [17] and sub-band decomposition-
based adaptive normalized matched filter (SANMF) methods when the short-term
coherent accumulation and availability of radar reference cells are limited.
Ding et al. [18] proposed a method for sea clutter suppression by using sensors
designed for radar navigation to obtain a temporal sequence of radar images, which
specifically works in X-band and they used in coherent radars of horizontal polariza-
tion. By using a time-based sequence of navigation images for the CFAR method to
reduce clutter influence on target, the effective 5 steps which include raw data acqui-
sition from radar, noise suppression, calculation of threshold, applying the threshold,
and removal of a false alarm from detection were proposed to reduce the effect of sea
clutter on target. In data acquisition or cumulative steps, firstly, k (k > 1) temporal
repeated radar images are improved to increase the target signal strength to sepa-
rate that from sea clutter. Secondly, in background depression, sea clutter intensity
variation is fitted with range after every scan of the cumulative image and then the
sea clutter strong intensity is detracted from the cumulative image for every pixel.
In threshold calculation, using Constant False Alarm (CFAR) [19] the detection of
a target is done using an adaptive algorithm method to distinguish target returns
from noise in radar systems, clutter, and interference. By considering the probability
density function and its probability distribution function [20], CFAR is calculated
on giving the threshold value. The Probabilistic Neural Networks (PNN) model is
used to approximate the sea clutter probability density function in radar images.
Finally, the resulting image obtained a greater threshold as compared with the refer-
ence threshold, then it is considered as a target. Finally, false alarm is removed
to obtain the associated size of the area of possible target by flood fill algorithm.
An experimental test was carried out using X-band navigation radar images with
approximately 250 temporal sequences, 7.5 m is considered as distance resolution,
and 0–360° of azimuth angle variation. After conducting the experimental test, the
proposed method is capable of reducing the sea clutter significantly from navigation
images of radar and to detect the ship efficiently which is immersed in the sea clutter.
Finally, the authors conclude based on experimental results that 72% of detection
accuracy is obtained.
4 Conclusion
In this paper, we have reviewed recent literature on sea clutter suppression tech-
niques used for radar target detection in the presence of sea clutter background.
Non-coherent X-band radars are used more commonly for suppressing the sea clutter.
Signals with two orthogonal components are chosen and like-polarized (HH, VV)
signals are preferred than the cross-polarized (HV, VH). More specifically clutter
suppression and target estimation are better when HH polarized signals are used in
most cases. Radar signal processing mostly uses sea clutter modeling to suppress the
echoes, reflections by the sea to find the target. From the prospect of the statistical
properties, the measured data are fitted to a suitable model to obtain the desired target
spot. Distribution information processing and high-detectable adaptive technology
have to be combined by cascading the base algorithms such as K + Rayleigh distri-
bution, sub-band decomposition with an eigenvalue. Finally, issues with existing
models and further research challenges were presented to provide guidelines for
future research trends.
References
1. Parsa, A.: Fast moving target detection in sea clutter using non-coherent X-band radar. IEEE
Natl. Radar Conf. Proc. 2, 1155–1158 (2014). https://doi.org/10.1109/RADAR.2014.6875770
2. Parsa, A., Hansen, N.H.: Comparison of vertically and horizontally polarized radar antennas
for target detection in sea clutter—An experimental study. In: IEEE Radar Conference, Atlanta,
GA, pp. 0653–0658 (2012). https://doi.org/10.1109/RADAR.2012.6212220
3. Liu, J., Meng, H., Wang, X.: Radar sea clutter suppression and target detection with α-β-γ
filter. In: 9th International Conference on Signal Processing, Beijing, pp. 2376–2379. https://
doi.org/10.1109/ICOSP.2008.4697627(2008)
4. Martorella, M., Berizzi, F., Mese, E.D.: On the fractal dimension of sea surface backscattered
signal at low grazing angle. IEEE Trans. Anten. Propag. 52, 1193–1204 (2004)
5. Berizzi, F., Dalle-Mese, E., Martorella, M.: A sea surface fractal model for ocean remote
sensing. Int. J. Remote Sens. 25, 1265–1270 (2004)
6. Song, D., Sarikaya, T.B., Serkan, S.T., Tharmarasa, R., Sobaci, E., Kirubarajan, T.: Heavy-
tailed sea clutter modeling for shore-based radar detection. IEEE Radar Conf. Radar Conf.
pp. 1504–1509 (2018). https://doi.org/10.1109/RADAR.2018.8378789
7. Hu, J., Tung, W., Gao, J.: Detection of low observable targets within sea clutter by structure-
function based multifractal analysis. IEEE Trans. Anten. Propag. 54(1), 136–143 (2006)
8. Rosenberg, L., Crisp, D.J., Stacy, N.J.: Analysis of the KK-distribution with medium grazing
angle sea clutter. IET Radar, Sonar Navig. 4(2), 209–222 (2010)
9. Yang, Y., Xiao, S.P., Wang, X.S.: Radar detection of small target in sea clutter using orthogonal
projection. IEEE Geosci. Remote Sens. Lett. 16(3), 382–386 (2019). https://doi.org/10.1109/
LGRS.2018.2875705
10. Shi, Y., Xie, X., Li, D.: Range distributed floating target detection in sea clutter via the feature-
based detector. IEEE Geosci. Remote Sens. Lett. 13(12), 1847–1850 (2016)
11. Jing, W., Ji, G., Liu, S., Wang, X., Tian, Y.: Target detection in sea clutter based on ELM. In:
Li, J. et al. (eds.) Wireless Sensor Networks. CWSN 2017. Communications in Computer and
Information Science, vol. 812. Springer, Singapore (2018). https://doi.org/10.1007/978-981-
10-8123-1_3
12. Hu, J., Tung, W.-W., Gao, J.: Detection of low observable targets within sea clutter by struc-
ture function based multifractal analysis. IEEE Trans. Anten. Propag. 54(1), 136–143 (2006).
https://doi.org/10.1109/TAP.2005.861541
13. Chen, X., Guan, J.: A fast FRFT based detection algorithm of multiple moving targets in sea
clutter. In: IEEE Radar Conference, Washington, DC, pp. 402–406 (2010). https://doi.org/10.
1109/RADAR.2010.5494587
14. Schlangen, I., Charlish, A.: Distinguishing small targets from sea clutter using dynamic models.
In: IEEE Radar Conference, pp. 1–6 (2019). https://doi.org/10.1109/RADAR.2019.8835683
15. Schlangen, I., Delande, E.D., Houssineau, J., Clark, D.E.: A second-order PHD filter with mean
and variance in target number. IEEE Trans. Signal Proces. 66(1), 48–63 (2018)
16. Zhao, W., Chen, Z., Jin, M.: Subband maximum eigenvalue detection for radar moving target
in sea clutter. IEEE Geosci. Remote Sens. Lett. 1–5 (2020). https://doi.org/10.1109/lgrs.2020.
2971589
17. Shui, P.-L., Shi, Y.-L.: Subband ANMF detection of moving targets in sea clutter. IEEE Trans.
Aerosp. Electron. Syst. 48(4), 3578–3593 (2012)
18. Ding, X., Huang, W., Zhou, C., Chen, P., Liu, B.: Ship detection in presence of sea clutter from
temporal sequences of navigation radar images. MIPPR, Autom. Target Recognit. Image Anal.
7495, 74954I (2009). https://doi.org/10.1117/12.832882
19. Hu, W., Wang, Y., Wang, S., et al.: A robust CFAR detector based on ordered statistics. In:
Proceedings of 2006 CIE International Conference on Radar, pp. 1–4 (2006)
20. Jiang, Q., Aitnouri, E., Wang, S., Ziou, D.: Automatic detection for ship target in SAR imagery
using PNN-model. Can. J. Remote Sens. 26(4), 297–305 (2000). https://doi.org/10.1080/070
38992.2000.10874780
An Ensemble Model for Predicting
Chronic Diseases Using Machine
Learning Algorithms
B. Manjulatha and Suresh Pabboju
Abstract Correct diagnosis of a disease plays a vital role in today’s environment.

Diabetes and liver are one such chronic diseases which are the most hazardous ailment
that affects a large number of individuals which may lead to death. Machine learning
algorithms help to predict the diseases early which saves many lives of mankind in the
world. Datasets like Pima Indian diabetes dataset (PIMA), Indian liver patient data
(ILPD) and cardiovascular disease (CVD) are taken from UCI repository to compare
the results by applying various well-known algorithms. Every algorithm gives its
output independently but knowing the highest accuracy is difficult as each algorithm
gives different result, i.e., may be less or more according to their dimensions. In this
system, accuracy is increased by combining individual algorithms such as decision
tree, SVM, logistic regression, ANN, random forest classifier, KNN to construct an
ensemble hybrid model which gives more accurate, accuracy.
1 Introduction
Detecting the disease is the first and most critical step in today’s infectious disease
control world. Some people do not have any symptoms or they did not even recognize
them for few chronic diseases, and they will assume that they are healthy. Diabetes
Mellitus [1] is a chronic disease which causes high blood sugar. It is of two types,
namely Type 1 diabetes, Type 2 diabetes and gestational diabetes. Type-2 diabetes
is most dangerous which has a huge increase in blood glucose and may lead to heart
disease and even death. Genes may play a major role, i.e., family members share their
genes. If it is not treated that make them more likely to get diabetes properly within
specified time, it may damage our nerves, eyes, kidneys and other organs of our body.
Even youngsters are suffering from this hazardous disease without the knowledge
B. Manjulatha (B)
OU Scholar, Hyderabad, India
e-mail: manjulatha@vbithyd.ac.in
S. Pabboju
Information Technology, CBIT, Hyderabad, India
https://doi.org/10.1007/978-981-16-1502-3_34
338 B. Manjulatha and S. Pabboju
of the person depending upon their weight, genes, eating habits and many more. So,
here machine learning plays a crucial role in predicting the disease early so that it
can stop deaths of many people.
Liver [2] is moon-shaped organ which weighs around 3 lb in adults. It manufac-

tures proteins, fats and carbohydrates by eliminating waste products. It is majorly
caused by consuming excess alcohol and smoking. Types of liver disease are hepatitis,
cirrhosis, liver cancer, liver failure etc. Symptoms of this disease may include edema,
fatigue, jaundice, etc. [3].
Cardiovascular disease [4] is otherwise called as heart disease. It is the major

organ in our body which pumps blood to all parts of the body. The major risk factors
of this disease include obesity, hypertension and consumption of tobacco, eating
unhealthy diet and smoking and results in death.
An Ensemble Model for Predicting Chronic Diseases Using … 339
These three chronic diseases cause a great damage to our body if not detected
early. The main objective of this paper is to predict the diseases early in order to
increase the life span of every individual. Current research also confirmed that there
will be huge recovery chances if diseases are discovered early.
With the rise in big data machine learning has become a key technique for solving
disease detection, face recognition, etc. It is a tool to collect the data, analyze and
finally predict. Section 1 of this paper is Introduction; Sect. 2 describes machine
learning algorithms. Section 3 discusses about related work of various researchers.
Section 5 describes the datasets used and its results. At last, Sect. 6 concludes with
conclusion and future scope.
2 Machine Learning Algorithms
Machine learning algorithms are categorized into five types.

Most widely supervised algorithms are linear regression, logistic regression,

random forest, gradient boosting, support vector machine, decision tree, nearest
neighbor, etc.
Unsupervised algorithms are K-means clustering, PCA, association rule, etc.
Reinforcement learning algorithms are Q-learning, temporal difference, Monte
Carlo tree search, asynchronous actor-critic agents.
3 Related Work
Analysis done by various authors by using different machine learning algorithms
Author Dataset Algorithm/methodology Conclusion /future

used scope
Kamrul Hasan [5] PIMA Hybrid model (AB + Hybrid algorithm
XB) gives high accuracy
Roopa [6] PIMA Principal component Achieved highest
analysis accuracy of 82%
Komal Kumar [7] CVD KNN, RF, LR, SVM and Accuracy is 85%
DT
Yahyaoui [8] PIMA DT, SVM and RF High accuracy and
automatic extraction
can be done for
better fitting model
Neelaveni [9] Alzheimer DT, SVM Future work results
in predicting the
disease using brain
MRI scans
Bhavana [10] PIMA KNN, Naïve Bayes, Hybrid algorithm
Random Forest, J48 gives high accuracy
Al-Zebari [11] PIMA Decision tree, logistic Achieved highest
regression, SVM, KNN, accuracy of 77%
Discriminant Analysis
Kumar [12] MPRLPD and SMOTE algorithm Performs better
ILPD liver datasets accuracy
Sai Prakash [13] Heart disease Random forest, vector SVM and logistic
support, logistic regression performs
regression and high accuracy
XG-Boost
Singh [14] Heart disease KNN, SVM, LR, DT KNN perform high
accuracy
Dahiwade [15] Symptoms of the KNN, CNN CNN performs high
patients accuracy with 84.5%
(continued)
(continued)
Author Dataset Algorithm/methodology Conclusion /future
used scope
Harimoorthy [16] Diabetes, heart, SVM-radial bias Performs better
kidney diseases accuracy for all
disease types
Pethunachiyar [17] Diabetes SVM-linear kernel Achieved 100%
accuracy
Verma [18] Skin disease Bagging and boosting SVM provides best
techniques result of 99.67%
George Amalarethinam Diabetes Data mining techniques Performs better
[19] accuracy
Kalipe [20] Malarial disease Machine learning and Deep learning
deep learning techniques approach performs
better accuracy
4 Methodology
Initially we take disease dataset from UCI or Kaggle repository. After that pre-
processing of data is done which cleans the data without any noisy data and missing
data. Missing values can be removed by applying various pre-processing techniques.
Here, standard scaler is used. Then applying machine learning algorithms to predict
the disease accurately. The dataset is being splitted into train data and test data in
the ratio of 80:20. The proposed work is carried out in Google colab which is a
free online cloud based jupyter notebook environment that allows to perform various
machine learning and deep learning models on CPUs, GPUs and TPUs and doesn’t
require any software to be installed In this study, three chronic diseases like ILPD,
PIMA, Heart disease are used for building and testing the models.
For all experiments, training set is taken as 80%, and testing test is taken as 20%. The
performance parameters for the proposed system are taken as accuracy, ROC AUC
score, precision, recall, F1-score, accuracy on training set and testing set (Tables 1,
2, 3 and 4).
Table 1 Classification report for PIMA dataset

Classifier Classification report for PIMA dataset ROC AUC score
Precision Recall F1-score
0 1 0 1 0 1
Decision tree 0.70 0.48 0.78 0.37 0.74 0.42 0.57
SVM 0.78 0.71 0.88 0.54 0.83 0.61 0.70
Random forest 0.76 0.7 0.89 0.48 0.82 0.57 0.68
Logistic 0.78 0.71 0.88 0.54 0.83 0.61 0.70
regression
MLPClassifier 0.76 0.70 0.89 0.48 0.82 0.57 0.68
KNN 0.59 0.62 0.46 0.73 0.52 0.57 0.68
Our proposed 0.5 0.69 0.89 0.46 0.82 0.56 0.68
system
Table 2 Classification report for liver dataset

Classifier Classification report for liver disease dataset ROC AUC score
0 1 0 1 0 1
Decision tree 0.32 0.72 0.36 0.68 0.34 0.7 0.52
SVM 0 0.71 0 1 0 0.83 0.5
Random forest 0.75 0.73 0.64 0.82 0.69 0.77 0.73
Logistic 0 0.71 0 1 0 0.83 0.5
regression
MLPClassifier 0.3 0.71 0.21 0.8 0.25 0.76 0.5
KNN 0.36 0.74 0.36 0.74 0.36 0.74 0.55
Our proposed 0.38 0.73 0.24 0.84 0.3 0.78 0.54
system
Table 3 Classification report for heart disease dataset

Classifier Classification report for heart disease dataset ROC AUC score
0 1 0 1 0 1
Decision tree 0.53 0.57 0.36 0.73 0.43 0.64 0.54
SVM 0.75 0.73 0.64 0.82 0.69 0.77 0.73
Random forest 0.75 0.73 0.64 0.82 0.69 0.77 0.73
Logistic 0.75 0.73 0.64 0.82 0.69 0.77 0.73
regression
MLPClassifier 0.75 0.73 0.64 0.82 0.69 0.77 0.73
KNN 0.59 62 0.46 0.73 0.52 0.67 0.59
Our proposed 0.5 0.69 0.89 0.46 0.82 0.56 0.68
system
Table 4 Accuracy of datasets

Classifier PIMA ILPD Heart disease
Decision tree 64 59 56
SVM 76 71 74
Random forest 75 71 74
Logistic regression 76 71 74
MLPClassifier 75 63 74
KNeighborsClassifier 72 72 72
Our proposed system 80 73 80
This study gives a comparative result of machine learning algorithms [21] for
diabetes, liver disease and heart disease dataset. The results show that the classi-
fication accuracy is reached to 80% for ensemble hybrid model. In the future, we
would like to improve the accuracy by applying deep learning algorithms.
Reference
1. https://www.mayoclinic.org/diseasesconditions/diabetes/symptoms-causes/syc-20371444.
2. https://www.healthline.com/health/human-body-maps/liver#structure.
3. https://www.mayoclinic.org/diseases-conditions/liver-cancer/symptoms-causes/syc-203
53659.
4. https://www.webmd.com/heart-disease/guide/diseases-cardiovascular#1.
5. Kamrul Hasan, M.D.: Diabetes prediction using ensembling of different machine learning
classifiers. In: IEEE-Special Section on Deep Learning Algorithms for Internet of Medical
Things, vol. 8 (2020)
6. Roopa, H.: A Linear model Based on Principal Component Analysis for Disease Prediction,
vol. 7. IEEE Access. https://doi.org/10.1109/ACCESS.2019.2931956 (2019)
7. Komal Kumar, N.: Analysis and prediction of cardio vascular disease using machine learning
classifiers. In: 2020 6th International Conference on Advanced Computing & Communication
Systems (ICACCS). IEEE (2020)
8. Yahyaoui, A.: A Decision Support System for Diabetes Prediction Using Machine Learning
and Deep Learning Techniques. IEEE (2019)
9. Neelaveni, J.: Alzheimer disease prediction using machine learning algorithms. In: 2020 6th
International Conference on Advanced Computing & Communication Systems (ICACCS).
IEEE (2020)
10. Bhavana, N.: A review of ensemble machine learning approach in prediction of diabetes
diseases. Int. J. Fut. Revolut. Comput. Sci. Commun. Eng. 4(3), 463–466. ISSN: 2454-4248
(2018)
11. Al-Zebari, A.: Performance Comparison of Machine Learning Techniques on Diabetes Disease
Detection. IEEE (2019)
12. Kumar, P.: Early detection of the liver disorder from imbalance liver function test datasets. Int.
J. Innov. Technol. Explor. Eng. (IJITEE) 8(4). ISSN: 2278-3075 (2019)
13. Sai Prakash, C.: Data Science Framework—Heart Disease Predictions, Variant Models and
Visualizations. IEEE (2020)
14. Singh, A.: Heart disease prediction using machine learning algorithms. In: 2020 International
Conference on Electrical and Electronics Engineering (ICE3-2020) (2020)
15. Dahiwade, D.: Designing disease prediction model using machine learning approach. In:
Proceedings of the Third International Conference on Computing Methodologies and Commu-
nication (ICCMC 2019). IEEE Xplore Part Number: CFP19K25-ART; ISBN: 978-1-5386-
7808-4 (2019)
16. Harimoorthy, K.: Multi-disease prediction model using improved SVM-radial bias technique
in healthcare monitoring system. J. Amb. Intell. Humanized Comput. (2020)
17. Pethunachiyar, G. A.: Classification of diabetes patients using kernel based support vector
machines. In: 2020 International Conference on Computer Communication and Informatics
(ICCCI-2020), 22-24 Jan 2020. Coimbatore, INDIA (2020)
18. Verma, A.K.: Skin disease prediction using ensemble methods and a new hybrid feature
selection technique. Iran J. Comput. Sci.(2020)
19. George Amalarethinam, D.I.: Prediction of diabetes mellitus using data mining techniques: a
survey. Int. J. Appl. Eng. Res. 10(82). ISSN 0973-4562 (2015)
20. Kalipe, G.: Predicting malarial outbreak using machine learning and deep learning approach:
a review and analysis. In: International Conference on Information Technology (ICIT), IEEE
(2018)
21. Manjulatha, B., Pabboju, S.: Big data analytics and its applications. Int. J. Recent Technol.
Eng. (IJRTE) 8(4), 10928–10931. ISSN: 2277-3878, Nov 2019
COVID-19 Face Mask Live Detection
Using OpenCV
Anveshini Dumala, Anusha Papasani, and Sireesha Vikkurty
Abstract Severe acute respiratory syndrome coronavirus (SARS-CoV) is recog-

nized, and very first person infected is from the Guangdong province of southern
China in 2002 while the virus that causes COVID-19 (Corona VIrus Disease-2019)
is known as SARS-CoV-2. World Health Organization (WHO) named it as “COVID-
19” on February 11, 2020. Currently, the COVID-19 has frightened the whole world
of human beings and pushed into the pandemic. This coronavirus affects the respi-
ratory system by entering into the human body through the droplets of saliva and
mucus. It takes 14 days to observe the symptoms of the virus attack. In the meantime,
the virus affected person may spread the virus to the coexisting people in the abode
unknowingly. Also, it takes 48 h to confirm if a person is virus attacked after the test
sample is collected. So, there is a serious need to wear a face mask that covers the
nose and mouth besides maintaining the social distance to break the chain of massive
increase. This paper attempts to detect if an individual wears a mask, using OpenCV.
The accurate identification of landmarks of face in the image is an imperative chal-
lenge. Being instinctive it is simple for a human to detect the object, but it took years
of research to raise the accessibility of quality datasets and a remarkable progress.
The purpose of the paper is identifying the count of faces with the mask in the image
and count of faces without a mask on live webcam.
1 Introduction
The word “image segmentation” in computer vision is dividing the image into pixels
with respect to color, pattern, etc. These groups of pixels are regularly termed as
super-pixels, whereas the goal of “instance segmentation” is to identify specified
objects in the image and highlight the object of interest. In contrast to the semantic
A. Dumala (B) · A. Papasani

Vignan’s Nirula Institute of Technology and Science for Women, Guntur, Andhra Pradesh, India
S. Vikkurty
Vasavi College of Engineering, Hyderabad, Telangana, India
https://doi.org/10.1007/978-981-16-1502-3_35
348 A. Dumala et al.
segmentation, ‘instance segmentation” does not aim at labeling pixel in the image.
The precise identification of definite facial features and landmarks is an initial step
which simplifies the complicated image analysis like face detection, expression, age
estimation, gender categorization [1, 2], facial paralysis, palsy, and sleep apnoea [3,
4]. Several researchers have investigated if any association [5] lies in between facial
1andmarks and the sleep apnoea masks [6].
The face mask recognition in OpenCV has a trainer and a detector. It is even possible
to create and train our own classifier for any applications related to the cars, plane,
etc. OpenCV already contains many pre-trained classifiers for face, eyes, etc. Now,
in this proposed method, we detect the face wearing a mask. Those XML files are
related to mask faces stored in opencv/data/haarcascades/folder. The proposed model
has three different steps.
a. Defining the objective.
b. Selecting a suitable dataset.
c. Mark the regions of interest in the image.
Defining the objective
The objective of the proposed model is to identify the nose and mouth in the facial
image so that the model identifies the count of faces that have no face mask.
Selecting suitable dataset
The proposed model considers the live data using webcam. Video is the collection
of fames. For this, the images should be collected from the live web video and import
the images into OpenCV. The process of importing the images has the following steps
involved. Read in the image using the imread function and import the necessary
libraries. Use the multi-scaling factors, the image can be resized as required for the
purpose of analysis.
OpenCV is one of the libraries available in Python that deliberately solves the
computer vision problems. The method cv2.rectangle() is used to mark a square
or a rectangle around the object in the image. It has different arguments used as
cv2.rectangle (image, start_point, end_point, color, thickness) where “image” is the
image on which rectangle/square is marked as shown in Fig. 2. “start_point” is the
initial coordinates of rectangle. The coordinates are the tuples of X coordinate value
and Y coordinate value. end_point is the ending coordinates of rectangle. Color is
the color of border line of rectangle. For BGR, a tuple, e.g., (255, 0, 0) is passed for
blue color as shown in Fig. 1.
COVID-19 Face Mask Live Detection Using OpenCV 349
Fig. 1 Conversion of the grayscale image into color image
Fig. 2 Coordinates to form

a rectangle
2.1 Extract the Region of Interest
All the faces in the image are identified using the coordinates (x, y). Using those
coordinates, a square is formed as shown in Figs. 2 and 3. In the square region of the
image, the other facial landmarks are also identified.
In this paper, the proposed model mainly focuses on the nose and mouth. The
model identifies the nose and mouth in the square region. If the nose and mouth are
covered with the mask, then it identifies the mask region as shown in Fig. 4.
3 Results and Analysis
Initially, the model is proposed to identify the face in the image. Later, the proposed
model is enhanced that it takes the images from the live stream from the webcam
Fig. 3 Identification of face in the image
Fig. 4 Identification of a face green and b mask red in the image
and identifies the count of faces without a mask. The model displays the message
“without mask-*.”
In Fig. 5, the proposed model identified the nose and mouth of faces in the image
and gives the count “without mask-1.” The faces with the mask are not identified.
In Fig. 6, the proposed model identified the nose and mouth of faces in the image
and gives the count “without mask-2.” The faces with the mask are not identified.
In Fig. 7, the proposed model identified the nose and mouth in the faces in
the image and gives the count “without mask-3.” The faces with the mask are not
identified.
This paper attempts to detect if an individual wears a mask, using OpenCV. The
accurate identification of landmarks of face in the image is an imperative challenge.
Being instinctive it is simple for a human to detect the object, but it took years of
research to raise the accessibility of quality datasets and a remarkable progress. The
COVID-19 Face Mask Live Detection Using OpenCV 351
Fig. 5 Identification of
“faces without a mask”
purpose of the paper is identifying the count of faces with the mask in the image and
count of faces without a mask on live webcam. In the future, a framework can be
designed that embeds sensors on the inside of a mask or develop a module that can
be attached to any over-the-counter mask.
References
1. Chellappa, R., Wu, T., Turaga, P.: Age estimation and face verification across aging using
landmarks. IEEE Trans. Inf. Forensic Secur. 7(6), 1780–1788 (2012)
2. Biswaranjan, K., Devries, T., Taylor, G.W.: Canadian Conference on Computer and Robot Vision,
pp. 98–103. IEEE Montreal (2014)
3. Jowett, N., Dusseldorp, J., Hadlock, T.A., Guarin, D.L.: A machine learning approach for
automated facial measurements in facial palsy. JAMA Facial Plast. Surg. 20(4), 335 (2018)
4. Guoliang, X., Jiaxin, S., Anping, S., Xuehai, D., Gang, X., Wu, Z.: Assessment for facial nerve
paralysis based on facial asymmetry. Australas. Phys. Eng. Sci. Med. 40(4), 851–860 (2017)
5. Balaei, T., Sutherland, K., Cistulli, A.P., de Chazal, P.: Automatic detection of obstructive sleep
apnea using facial images. In: International Symposium on Biomedical Imaging, pp. 215–218
(2017)
6. McEwan, A., Johnston, B., de Chazal, P.: Semi-automated nasal PAP mask sizing using facial
photographs. In: International Conference of the IEEE Engineering in Medicine and Biology
Society (EMBC), pp. 1214–1217 (2017)
Chest X-Ray Image Analysis
of Convolutional Neural Network Models
with Transfer Learning for Prediction
of COVID Patients
M. Shyamala Devi, P. Swathi, N. Pavan Kumar, Ravi Varma Tungala,

Saranya Vivekanandan, and Priyanka Moorthy
Abstract The COVID-19 pandemic grounds a major outbreak around the world,
having a severe impact on the health and life of many people globally. The crit-
ical step in fighting COVID-19 is the capability to identify the infected patients
during initial stages and situate them under extraordinary care. Detecting COVID-
19 disease from radiography and radiology images is one of the effective way to
detect the infected patients. Inspired by the chest radiograms of patients infected with
COVID-19, we study the application of machine learning and convolutional neural
network models to detect COVID-19 patients from their chest radiography images.
We first prepare a dataset of chest X-rays from the publicly available ieee8023/covid-
chestxray-dataset. This paper aims to provide the following contributions. Firstly, the
dataset is preprocessed and segregated as healthy, COVID-19, bacterial pneumonia
and viral pneumonia. Secondly, the dataset is processed to form the initial trained
layers of base model and is fitted with several convolutional neural network models
like VGG, ResNet, Xception and DenseNet to extract the high-level general features.
Thirdly, the base model of several convolutional neural network models are added
to the custom layers developed with transfer learning deep learning approach to
M. Shyamala Devi (B) · P. Swathi · N. Pavan Kumar · R. Varma Tungala

Computer Science and Engineering, Vel Tech Rangarajan Dr. Sagunthala R&D Institute of
Science and Technology, Chennai, Tamil Nadu, India
e-mail: shyamaladevim@veltech.edu.in
P. Swathi
e-mail: vtu10552@veltechuniv.edu.in
N. Pavan Kumar
R. Varma Tungala
S. Vivekanandan
Infologia Technologies, Chennai, Tamil Nadu, India
P. Moorthy
RedBlackTree, Chennai, Tamil Nadu, India
https://doi.org/10.1007/978-981-16-1502-3_36
354 M. Shyamala Devi et al.
analyze the performance of prediction of COVID-19 patients. Fourth, the perfor-

mance of the convolutional neural network models along with transfer learning is
analyzed with the metrics like model loss, precision, accuracy, recall and F-Score.
The project is implemented with Python in Spyder under anaconda navigator. Exper-
imental results show that Xception CNN model is found to experience 95% accuracy
with the available chest X-ray images.
1 Literature Review and Shortcomings
CXR image classification approaches in medical image analysis [1] were done to
analyze the cardiomegaly using deep convolutional activation feature, and advancing
the CAD is needed to improve the quality of radiologists’ tasks. Validation and
adoption of early developed neural networks are used for the classification of chest
X-ray images [2] by achieving 93% precision. CAD system [3] for disease prediction
(pulmonary nodules, tuberculosis and interstitial lung diseases), focusing on basic
algorithm principles of the algorithm, and the results show that manifestations of
tuberculosis and cavities with accuracy ranging from 92 to 95%. The techniques
of bone suppression with hand-crafted features could have errors that affect the
classification performance [3]. The neural network models [4] are trained and tested
on chest X-ray database with CNN having accuracy of 92.4%. The different CNN
architectures on the NIH “ChestX-ray 14” are done, performing the comparison
of manual ground truth labels versus NLP labels which is unrealistic due to the
unavailability of annotation [5].
Various problems based on lung diseases that affects children are provided with
the diagnostic tool that classifies a chest X-ray image that shows if it is under
the normal or pneumonia category [6]. The process of CNN algorithm on a chest
X-ray dataset is attempted to classify pneumonia [7]. It requires further transfer
learning, training a fine-tuned deep neural network and stabilizing training process.
The optimal solution for classifying abnormal and normal chest X-ray images [8] is
achieved with the substantive features provided by DenseNet followed by optimal
hyperparameter values of SVM classifier. The medical imaging analysis involves
with COVID-19, including image acquisition, segmentation, diagnosis and follow-
up along with the training and testing of AI algorithms are still not efficient and
quality of datasets are not sufficient [9]. Support vector machine [10] methodology is
used for detecting the coronavirus infected patient using X-ray images. Mask-RCNN
is used for global, local features for pixel-wise segmentation for identification and
localization of pneumonia in chest X-rays images [11].
Chest X-Ray Image Analysis of Convolutional Neural Network … 355
2 Overall Architecture
2.1 Dataset Preparation
The dataset of chest X-rays from the publicly available ieee8023/covid-chestxray-

dataset is used for implementation. The overall workflow is shown in Fig. 1. The
contributions of this paper are given below.
Chest X-Ray image Dataset
Reading the X-Ray Image Data
Data Preprocessing
Setting up the data drive for Healthy, Covid-19, Bacterial Pneumonia and
Viral Pneumonia Images.
Splitting Training and testing Images
Exploratory Data Analysis of X-Ray images
Building various CNN models

Xception, VGG, Resnet and
DenseNet
Building Transfer Learning
Analysis of Precision, Recall, Accuracy and Confusion Matrix
Predicting the COVID -19
Fig. 1 Overall workflow of this paper

(i) Firstly, the dataset is preprocessed and segregated as healthy, COVID-19,

bacterial pneumonia and viral pneumonia.
(ii) Secondly, the dataset is processed to form the initial trained layers of base
model and is fitted with CNN models like VGG, ResNet, Xception and
DenseNet to extract the high-level general features.
(iii) Thirdly, the base model of CNN models are added to the custom layers devel-
oped with transfer learning approach to analyze the performance of prediction
of COVID-19 patients.
(iv) Fourth, the performance of the CNN models along with transfer learning is
analyzed with metrics model loss, precision, accuracy, recall and F-Score.
3 Convolutional Neural Network
3.1 CNN Models
The convolutional neural network models used in this paper are VGG, ResNet,
Xception and DenseNet to extract the high-level general features. The VGG model
was proposed by Karen Simonyan and Andrew Zisserman of the Visual Geometry
Group (VGG) Laboratory of Oxford University. VGG19 is one model from CNN that
contains 19 layers comprising of 16 convolution layers, 3 fully connected layer, 5
MaxPool layers and 1 SoftMax layer. This method uses spatial padding to preserve the
image spatial resolution. The ResNet is the residual neural network that is designed
to overcome the vanishing gradient problem and consists of group of convolutional
layers together with skip connections followed by average pooling and finally ended
up with fully connected output layer. In DenseNet, all the convolutional layers are
connected directly with each other. Here, the input of every convolution layer consists
of previous layer feature maps, and the output is directed to forthcoming layer, where
the depth concentration of the image is aggregated with the feature maps. There is no
intermediate ReLU nonlinearity associated with the modified depthwise separable
convolution in the Xception CNN model. It is 71 layer deep CNN model that has
pointwise convolution followed by a depthwise convolution.
3.2 Dataset Exploratory Analysis
The extracted dataset is fragmented with separated folders for testing and training
data with chest X-ray images of folder containing 0: ‘normal,’ 1: ‘COVID-19,’ 2:
‘bacterial pneumonia,’ 3: ‘viral pneumonia’ and is shown in Fig. 3.
4.1 Implementation Setup
The dataset of chest X-ray images is fragmented with the required implementation
and is arranged with separate folder for normal, COVID, viral infected and bacterial
infected patients. The dataset is loaded, and the analysis is extracted to find the
number of images. The image generator is used to generate tensor images data and
to perform normalization process like shuffling and image resizing. The 20% of the
dataset is used for cross-validation. The labeling of names is done for all the images
in the training dataset, and the grid of images is displayed and is shown in Fig. 2.
Fig. 2 Dataset information with 360 images belonging to four classes as 0: ‘normal,’ 1: ‘COVID-
19,’ 2: ‘bacterial pneumonia,’ 3: ‘viral pneumonia’
Fig. 3 Model loss and accuracy progress [top] (left) VGG (right) ResNet [bottom] (left) Xception
(right) DenseNet
The base layer are designed with CNN models like VGG ResNet, Xception and
Densenet. The base layer model is imported with the pre-trained weights, and the
first layers are used to extract the high-level general features of the image. The last
layers are used to perform the classification. Transfer learning is performed for the
testing dataset. The base model is trained with specified CNN models with the pre-
trained weights, and the same functionality is enforced for the newly given dataset
to perform like the trained model.
The model loss and accuracy progress of the VGG ResNet, Xception and Densenet
CNN models is shown in Fig. 3. The model loss analysis of VGG ResNet, Xception
and Densenet CNN models is shown in Fig. 4.
The model accuracy analysis of VGG ResNet, Xception and Densenet CNN
models is shown in Fig. 5.
The Prediction details of the VGG ResNet, Xception and Densenet CNN models
is shown in Figs. 6 and 7. The performance analysis is shown in Table 1.
Fig. 4 Model loss analysis [Top] (left) VGG (right) ResNet [Bottom] (left) Xception (right)
DenseNet
Fig. 5 Model accuracy analysis [Top] (left) VGG (right) ResNet [Bottom] (left) Xception (right)
DenseNet
Fig. 6 Prediction of CNN models (left) VGG (right) ResNet
Fig. 7 Prediction of CNN models (left) Xception (right) DenseNet
Table 1 Performance analysis of CNN model toward COVID prediction

Features VGG Resnet Xception DenseNet
Total params 20,024,384 23,587,712 20,861,480 18,321,984
Trainable params 20,024,384 23,534,592 20,806,952 18,092,928
Non-trainable params 0 53,120 92,528 229,056
Test accuracy 0.54838 0.633870 0.97838 0.831612
Precision 0.60 0.61 0.97 0.81
Recall 0.52 0.60 0.96 0.83
F-Score 0.55 0.58 0.92 0.82
Accuracy 0.51 0.59 0.95 0.80
5 Conclusion
This paper attempts to explore the chest X-ray image feature analysis by designing
the convolutional neural network model as the base model. The last layers of the
model are used to perform the classification task. The base models are trained with
predefined weights, and the functionalist of the base model designed with VGG,
ResNet, DenseNet and Xception is then transferred to the new target model to achieve
the transfer learning. Experimental results show that Xception CNN model has the
high precision of 0.97, recall of 0.96, F-Score of 0.92, accuracy of 95% and test
accuracy of 97% toward prediction of COVID-19 patients.
References
1. Aliman, S., Ismail, A., Rahmat, T.: Chest X-rays ımage classification in medical ımage analysis.
Appl. Med. Inf. 40, 63–73 (2018)
2. Asmaa, A., Mohammed, M., Abdelsamea, M.M.G.: Classification of COVID-19 in chest X-ray
images using DeTraC deep convolutional neural network. Appl Intell 1–9 (2020)
3. Qin, C., Yao, D., Shi, Y., et al.: Computer-aided detection in chest radiography based on artificial
intelligence: a survey. BioMed. Eng. 17, 113 (2018)
4. Abiyev, R.H., Ma’aitah, M.K.S.: Deep convolutional neural networks for chest diseases detec-
tion. J. Healthcare Eng. 1–11. Article ID 4168538 (2018). https://doi.org/10.1155/2018/416
8538
5. Tang, Y.-X., Tang, Y.-B., Peng, Y., Yan, K., Bagheri, M., Bernadette, A.R., Brandon, C.J., Lu, Z.,
Han, M., Xiao, J., Summers, R.M.: Automated abnormality classification of chest radiographs
using deep convolutional neural networks. npj Digit. Med. 3, 70 (2020)
6. Tobias, R.R.N.M.I., et al.: CNN-based deep learning model for chest X-ray health classification
using tensorflow. In: 2020 RIVF International Conference on Computing and Communication
Technologies (RIVF), Ho Chi Minh, Vietnam, pp. 1–6 (2020)
7. Yadav, S.S., Jadhav, S.M.: Deep convolutional neural network based medical image classifica-
tion for disease diagnosis. J. Big Data 6, 113 (2019)
8. Varshni, D., Thakral, K., Agarwal, L., Nijhawan, R., Mittal, A.: Pneumonia detection using
CNN based feature extraction. In: IEEE International Conference on Electrical, Computer and
Communication Technologies, Coimbatore, India, pp. 1–7 (2019)
9. Shi, F., Wang, J., Shi, J., Wu, Z., Wang, Q., Tang, Z., He, K., Shi, Y., Shen, D.: Review of
artificial ıntelligence techniques in ımaging data acquisition, segmentation and diagnosis for
COVID-19. IEEE Rev. Biomed. Eng. (2020). https://doi.org/10.1109/RBME.2020.2987975
10. Sethy, P.K., Gehera, S.K., Ratha, P.K., Biswas, P.: Detection of coronavirus disease (COVID-
19) based on deep features and support vector machine. Int. J. Math. Eng. Manag. Sci. 643–651
(2020). https://doi.org/10.33889/IJMEMS.2020.5.4.052
11. Meraj, S.S., Yaakob, R., Azman, A., Rum, S.N.M., Nazri, A.S.A., Zakaria, N.F.: Detection
of pulmonary tuberculosis manifestation in chest X-rays using different convolutional neural
network (CNN) models. Int. J. Eng. Adv. Technol. (IJEAT) 9(1) (2019). ISSN: 2249-8958
Predicting Customer Loyalty in Banking
Sector with Mixed Ensemble Model
and Hybrid Model
Jesmi Latheef and S. Vineetha
Abstract Customer Relationship Management systems are used to enable organi-

zations to acquire new customers, develop a continuous relationship with them, and
increase customer retention for more profitability. Customer Loyalty is also known
as Customer Churn. The main intention of churn prediction is to classify and find
customers into churner and non-churner. A churned customer means there is more
chance that the customer is about to leave the organization. So in order to find the
churn customers will give more benefits to the organization. Thus, churn prediction
can avoid the loss of revenue by retaining the existing customers. There are several
techniques are available with ensemble and hybrid models. This paper aims to predict
customer loyalty in banking sector with a novel method named mixed ensemble
model and hybrid model. Ensemble acts as a wrapper for group of machine learning
or deep learning methods. This paper proposes two methods to predict customer churn
using ensemble method with a mixed group containing XGB Classifier, LightGBM
Classifier, and MLP model. And also build a hybrid model with the combination
of Multilayer Perceptron (MLP) model and Convolutional Neural Network (CNN)
model. Toward this, churn data of banking sector is used and build the systems then
compare the performance of two. Thus, the system with more accuracy is termed
more useful for organizations to find the customers with more chances to become
churn. The results of experiments showed that the two proposed systems for churn
prediction perform with an accuracy of 86% to 87%.
1 Introduction
Organizations in the competitive market mainly believe in the gains which come from
their valuable customers. So CRM (Customer Relationship Management) includes
J. Latheef (B) · S. Vineetha

Rajiv Gandhi Institute of Technology, Kottayam, India
e-mail: jesmilatheef@gmail.com
S. Vineetha
e-mail: svineetha@rit.ac.in
https://doi.org/10.1007/978-981-16-1502-3_37
364 J. Latheef and S. Vineetha
the concepts like customer acquisition, maintenance, and satisfaction. As from the
previous studies, it is clear that acquiring new customer is more expensive than main-
taining the old customers. Customer churn is an elementary obstacle for enterprises
and it is interpreted as the mislaying of customers because they move out to other
services. By predicting customer churn behavior in advance, it gives a high valuable
insight in terms of revenue in order to retain and increase their customer base. To
minimize customer churn, the company or organization should be able to predict the
conduct of customer correctly and establish relationships between customer attrition
and keep factors under their control.
Moreover, Churn prediction is a task of binary classification, which differentiates
churners from non-churners. In order to reduce customer churn rate, one must follow
the steps, and thus, loss of revenue can also be reduced. Hence, the aim of customer
churn prediction is to detect customers with high tendency to leave. For that, the
industry must know the reasons, which can be reflected from the gathered data.
There are several attempts are existing for churn prediction in banking sector using
machine learning techniques like unsupervised, semi-supervised, and supervised.
Deep learning models can also be very effective for this job [1, 2]. In this paper, a
mixed ensemble model was used from the family of Ensemble algorithms and a hybrid
model is presented for a more accurate prediction of customer churn. Therefore, in
this paper, two different combination methods are examined in terms of customer
churn prediction.
The remainder of this paper is organized as follows. Section 2 reviewed the
literature related to customer churn and modeling technique used in this paper.
Section 3 describes the system architecture, and Sect. 4 presents the implementation
and experimental results. Finally, conclusion is provided in Sect. 5.
2 Literature Survey
Machine learning techniques have been widely used for evaluating the probability
of customer to churn. Most of the literatures are discussed various machine learning
algorithms, deep learning algorithms, and a brief of the literatures is describing here.
2.1 Data Mining Techniques
In order to develop effective and accurate customer churn prediction model, many
data mining methods have been used. Data mining is used for hidden, valid, and
potentially useful pattern extraction in datasets. However, it is all about finding
previously unknown relationships among the data. Also data mining can be used for
prediction which involves using some variables or fields in the database to predict
unknown or future values of other variables of interest. Data mining methods include
classification, clustering, regression, and so on [3–13].
Predicting Customer Loyalty in Banking Sector … 365
2.2 Ensemble Algorithms
Ensemble learning helps improve machine learning results by combining several

models. This approach allows the production of better predictive performance
compared to a single model. Ensemble methods are meta-algorithms that combine
several machine learning techniques into one predictive model in order to decrease
variance (bagging), bias (boosting), or improve predictions ( stacking) [14–17].
2.3 Artificial Neural Network
Predict customer churn in a financial institution using Multilayer Perceptron of Arti-

ficial Neural Network architecture. In [18] churn and non-churn customers were
predicted using ANN and different performance metrics are used for finding the
effectiveness of the system. MLP is an architecture of the artificial neural network
that consists of multiple layers where each layer is fully connected with the next layer
in a feed-forward direction. The first layer and the last layers represent the inputs
(independent variables) and outputs (target variables) of the system, respectively.
Connections between the nodes are represented as weights. The more the numbers
of hidden layers in the network, the more the complexity of the network [19].
2.4 Hybrid Models
A hybrid model is termed as a combination of two or more basic models. There are
several attempts on churn prediction using this hybrid model. In [20], it uses a combi-
nation of bagging, boosting and LOLIMOT algorithms and is named as Ordered
Weighted Averaging (OWA) technique. Another hybrid method is presented that
predicts customers churn more accurately, using data fusion and feature extraction
techniques. Two algorithms, LOLIMOT and C5.0, were trained then the outputs of
the individual classifiers were combined with weighted voting [21–23].
3 System Architecture
The proposed system architecture of churn prediction using mixed ensemble model
and hybrid model are discussed. Figure 1 shows the entire architecture of the system.
The system begins with importing the churn data of bank and the following steps are
performing.
Fig. 1 Overview of system architecture
3.1 Data Pre-processing
The first step is to clean and arrange the raw data. That is removal of null value,
irrelevant feature removal and also find statistical summary of the dataset. In this step,
identify and remove irrelevant features that effect the algorithm. Find any columns
that have a single unique value. A feature with only one unique value cannot be
useful for machine learning because this feature has zero variance. Thus, irrelevant
feature can be regarded as noise whose presence will affect the final result adversely.
3.2 Feature Engineering
To improve the performance of the models that going to create, it is important to do

feature engineering. In this step, preparing the dataset to make compatible with the
machine learning algorithm requirements.
3.3 Model Creation
After completing the above steps the data is ready for modeling. In this paper,
proposed a mixed ensemble algorithm and a hybrid model for customer churn
prediction in banking sector.
As ensemble learning helps improve machine learning results by combining
several models, that is try to ensemble both machine learning technique and deep
learning technique. Here, the deep learning technique used is specific to MLP (Multi-
layer Perceptron). This approach allows the production of better predictive perfor-
mance compared to ordinary ensemble model and all other single models. By this
way, combined the predictions from multiple machine learning algorithms and one
deep learning algorithm. Voting classifier is not an actual classifier but a wrapper
for set of different ones that are trained and evaluated in parallel in order to exploit
the different abnormalities of each algorithm. Here, combined different algorithms
as ensemble and train the model, then to predict the final output. The final output on
a prediction is taken by majority vote according to two different strategies of either
soft voting or hard voting. In this model, soft voting is used. The multiple algorithms
that are going to ensemble are of the following:
1. eXtra Gradient Boost (XGB)
2. LightGBM
3. Multilayer Perceptron (MLP)
Next model used is a kind of hybrid model. A hybrid model is simply integrating
or combining different individual prediction models and that leads to overcoming
certain limitations with the use single model and also improve the performance of the
system. In this paper, integrating two or more deep learning models by cumulating the
results of the models and predict the final output based on the result. Here, proposed
to make a hybrid model with cumulating the outputs of Multilayer Perceptron (MLP)
and Convolutional Neural Network (CNN).
3.4 Evaluation of Models
Evaluation models are used to quantify model performance. In case of supervised

learning problems, such as classification and regression, they focus on evaluation
metrics. There are several evaluation metrics are exist. Among them, confusion matrix
and ROC curve-based evaluations are the most common methods. They are used for
analyzing the performance of the created model.
4 Implementation and Evaluation
The system is implemented in Colab platform provided by Google and Pyhton3

is used for implementation. The proposed model is deployed by selecting a
dataset which should be simple and understandable, that contains information about
customer information of banking sector and should be an adaptable dataset for
churn prediction of banking sector. So importing a bank churn modeling dataset
from Kaggle with 14 features and 10,000 records. The system starts with data
pre-processing. In the pre-processing step, null values and irrelevant features were
removed. Irrelevant features can be removed based on checking unique characters
Table 1 Accuracy and

Model Accuracy AUC-ROC
AUC-ROC of different
models with mixed ensemble XGB 86 0.87
model LightGBM 85 0.87
MLP 83 0.83
Mixed ensemble 86 0.87
of the corresponding category. In this work, checked for three unique characters and
if the feature has greater than 3 unique characters, it is not relevant for the model
and it should be removed. Here, to know how the correlation of features, Correlation
Matrix is used. After understanding the trends and distribution of data, it is time to
prepare the data for modeling, this is done by feature engineering.
Next step is to make the numerical feature that is different in terms of ranges they
are represented. After completing the data preparation next is the modeling phase.
In the proposed system, modeling includes two modules. First, a mixed ensemble
model was created and then implemented second model which is a hybrid model.
Table1 shows a comparison of individual model accuracies and mixed ensemble
model accuracy. From the table, it is clear to imply that the mixed ensemble model
predicts the class based on the probabilities. Hence, the overall accuracy of the mixed
ensemble model 86%.
In order to increase the accuracy, the next model in our system is a hybrid model.
Here, building a hybrid model with the integration of Convolutional Neural Network
(CNN) and Multilayer Perceptron (MLP). CNN takes inputs in the form of matrices
and vectors, and thus, converting the inputs into three-dimensional format will give
a higher accuracy. In this model, output of CNN model is cumulating with the output
of MLP model. Combing the model will get benefits of both models. Thus, the model
is trained and validated, and it shows an accuracy of 87%.
To evaluate the system confusion matrix and AUC—ROC curves were used.
Confusion matrix is a summary of prediction results of the classification problem.
Classification rate or accuracy of the system can be evaluated from the confusion
matrix. In AUC—ROC curves, the two parameters true positive rate (TPR) and false
positive rate (FPR) are plotted. Figure 2 shows the ROC curves of individual models
and mixed ensemble model. In the figure, the area under highlighted (red) color
curve shows the performance efficiency of the ensemble algorithm. Figure 3 shows
the AUC-ROC curve of the hybrid model, and it points out the measure of model
performance.
In this system, the churn data of banking sector is used to predict whether the customer
is churned or not by using voting classifier of mixed ensemble method. Voting clas-
sifier is one of the most powerful techniques for wrapping the methods, because in
Fig. 2 ROC curves of individual models and mixed ensemble model
Fig. 3 ROC curves of individual models and hybrid model
case of a classification problem in machine learning, it is really good to make use of

multiple models before taking any decision. The main advantage of ensemble is, if
the data is dynamic then the accuracy of different learning algorithms may vary. So by
using ensemble technique, it will consider the predictions of collection of algorithms
and take decisions based on that. Deep learning techniques are also more accurate
for these kinds of problems. Hence, the novel method of mixed ensemble model
have greater performance than ordinary ensemble models. Along with this model, a
hybrid model is created, and the experimental results indicate that the hybrid model
outperforms other models in terms of prediction accuracy. Therefore, it concluded
that the hybrid model by combining CNN and MLP can perform better than the base-
line models and the mixed ensemble model. In addition, the CNN + MLP hybrid
model performs more stable than the other models. Thus, customer loyalty or churn
can be effectively find using mixed ensemble modeling and hybrid model.
For future work, the models can be extended to other prediction techniques such
as fuzzy, genetic algorithms, and ANFIS. Also new aspects of experimental tuning
can be introduced such as multiple objective optimizations, explanatory variables
selection, transformation process, and also other evaluation measures.
Acknowledgements I would like to acknowledge the contribution and support from the Computer
Science and Engineering Department of Rajiv Gandhi Institute of Technology, Kottayam.
References
1. Sabbeh, S.F.: Machine-learning techniques for customer retention: a comparative study. Int. J.
Adv. Comput. Sci. Appl. 9(2) (2018)
2. Khan, A.A., Jamwal, S., Sepehri, M.M.: Applying data mining to customer churn prediction
in an Internet Service Provider. Int. J. Comput. Appl. 9(7) (2010)
3. Dalvi, P.K., Khandge, S.K., Deomore, A., Bankar, A., Kanade, V.A.: Analysis of customer
churn prediction in telecom industry using decision trees and logistic regression. In: 2016
Symposium on Colossal Data Analysis and Networking (CDAN), Indore, pp. 1–4 (2016)
4. Wu, L., Li, M.: Applying the CG-logistic regression method to predict the customer churn
problem. In: 2018 5th International Conference on Industrial Economics System and Industrial
Security Engineering (IEIS), Toronto, ON, pp. 1–5 (2018)
5. Bharadwaj, S., Anil, B.S., Pahargarh, A., Pahargarh, A., Gowra, P.S., Kumar, S.: Customer
Churn prediction in mobile networks using logistic regression and multilayer perceptron
(MLP). In: 2018 Second International Conference on Green Computing and Internet of Things
(ICGCIoT), Bangalore, India, pp. 436–438 (2018)
6. Islam, M., Habib, M.: Data mining approach to predict prospective business sectors for lending
in retail banking using decision tree. arXiv preprint arXiv.1504.02018 (2015)
7. Kumar, G.R., Tirupathaiah, K., Krishna Reddy, B.: Client Churn prediction of banking and
fund industry utilizing machine learning techniques. IJCSE 7(6), 842–846 (2019)
8. Kumar, A.S., Chandrakala, D.: An optimal churn prediction model using support vector
machine with Adaboost. Int. J. Sci. Res. Comput. Sci. Eng. Inf. Technol. 2(1), 225–230 (2017)
9. Mahajan, D., Gangwar, R.: Improved customer Churn behaviour by using SVM. Int. J. Eng.
Technol. 2395–0072 (2017)
10. Kumar, S., Viswanandhne, S., Balakrishnan, S.: Optimal customer Churn prediction system
using boosted support vector machine. Int. J. Pure Appl. Math. 119(12), 1217–1231 (2018)
11. ApurvaSree, G., Ashika, S., Karthi, S., Sathesh, V., Shankar, M., Pamina, J.: Churn prediction
in Telecom using classification algorithms. Int. J. Sci. Res. Eng. Dev. 5, 19–28 (2019)
12. Prajapati, D., Dubey, R.K.: Analysis of customer Churn prediction in telecom sector using
random forest.
13. Jaisakthi, S.M., Gayathri, N., Uma, K., Vijayarajan, V.: Customer Churn prediction using
stochastic gradient boosting technique. J. Comput. Theor. Nanosci. 15(6–7), 2410–2414 (2018)
14. Mishra, A., Reddy, U.S.: A comparative study of customer churn prediction in telecom industry
using ensemble based classifiers. In: 2017 International Conference on Inventive Computing
and Informatics (ICICI), Coimbatore, pp. 721–725 (2017)
15. Idris, A., Khan, A.: Prediction system for telecom using filter wrapper and ensemble
classification. Comput. J. 60(3), 410430 (2017)
16. Vijaya, J., Sivasankar, E.: Computing efficient features using rough set theory combined with
ensemble classification techniques to improve the customer churn prediction in telecommuni-
cation sector. Computing 100(8), 839–860 (2018)
17. Wang, X., Nguyen, K., Nguyen, B.P.: Churn prediction using ensemble learning. In:
Proceedings of the 4th International Conference on Machine Learning and Soft Computing
(2020)
18. Amuda, K.A., Adeyemo, A.B.: Customers Churn prediction in financial institution using
artificial neural network. arXiv preprint arXiv: 1912.11346 (2019)
19. Khan, Y., et al.: Customers Churn prediction using artificial neural networks (ANN) in Telecom
Industry. Editorial Preface from the Desk of Managing Editor 10.9 (2019)
20. Basiri, J., et al.: A hybrid approach to predict churn. In: 2010 IEEE Asia-Pacific Services
Computing Conference. IEEE (2010)
21. Hemalatha, P., Amalanathan, G.M. (2019). A hybrid classification approach for customer churn
prediction using supervised learning methods: banking sector. In: 2019 International Confer-
ence on Vision Towards Emerging Trends in Communication and Networking (ViTECoN)
(pp. 1–6). IEEE, Mar 2019
22. Tsai, C.-F., Lu, Y.-H. (2009). Customer churn prediction by hybrid neural networks. Exp. Syst.
Appl. 36(10), 12547–12553 (2009)
23. Jamalian, E., Foukerdi, R.: A hybrid data mining method for customer churn prediction. Eng.
Technol. Appl. Sci. Res. 8(3), 2991–2997 (2018)
Design Patterns and Microservices
for Reengineering of Legacy Web
Applications
V. Dattatreya, K. V. Chalapati Rao, and M. Raghava
Abstract Financial management system (FMS) is a software application that

enables any organization to manage its income and expenses with the goal of max-
imizing profits and making the system long-lasting. FMS performs business activ-
ities like invoicing and billing with minimal accounting errors. In this research
work, we have taken up Andhra Pradesh Government legacy FMS package as a
case study for the diagnosis of its rudimentary code and its characterization for
the poor performance. Our investigation revealed various design anomalies that are
spread across multiple modules of FMS. In order to fix the performance problems,
we have adapted the Mikado graphs-driven sprint methodology and reengineering
approach to redesign the codebase. The fundamental goal of this research is to identify
and incorporate suitable design patterns to improve the reliability and extendability
parameters. The other major contribution of this research work is about modern-
izing the FMS through refactoring and restructuring. Strangler fig pattern-driven
microservices architecture is implemented, and the resulting product is referred to as
pattern-oriented FMS(PoFMS). The solution offered by this research work reduces
the CAPex and OPex components of the FMS project and improved its business
capabilities.
1 Introduction
Many business organizations are still driving their operations through Web appli-
cations developed based on outdated technologies and older versions of software
libraries. Legacy systems have large codebase [1] and clumsy functionalities. A
small modification in one module may lead to possible unknown changes in other
modules that end up with bugs and erroneous results. Most of the legacy systems do
V. Dattatreya · K. V. Chalapati Rao · M. Raghava (B)

CVR College of Engineering, Hyderabad, India
e-mail: raghava.m@cvr.ac.in
V. Dattatreya
e-mail: v.dattatreya@cvr.ac.in
https://doi.org/10.1007/978-981-16-1502-3_38
374 V. Dattatreya et al.
Server
Receipts
User
Interface Payments Database
Reports
Fig. 1 Legacy FMS
not even have proper design and documentation and operate under special environ-
ment. Moreover, such legacy systems do not encourage diversified data persistence
models. However, conversion of legacy system data into the most recent data types
is also time consuming and almost impractical. Software systems often depend upon
third-party APIs to feature the latest capabilities. Thus, migrating a legacy system
that does not live up to the expectations of the modern requirements of the stake-
holders essentially demands an intelligent methodology and a disciplined approach.
In addition, the end product must be built from small codebase and must offer a
luxury to include future functional and architectural reorganizations. Reengineer-
ing plays a significant role in transformation of legacy systems. Nevertheless, the
legacy software systems have played a role in catering to business requirements for
various industry sectors over the past few decades, and abrupt deprecation of them
leads to financial losses to the organization. Hence, reengineering of legacy soft-
ware which consumes smaller time-frames is critical for a success. As opposed to
discarding the existing software, a solution must be identified that allows us to fit
the existing software into the new system and slowly replace the old system. In this
context, reengineering plays a significant role in transformation of legacy system.
Reengineering is defined as examining the existing software in order to figure out
its specifications, with subsequent modifications to develop a new version of the
improved software. In this work, we present the diagnosis of legacy code and apply
intuitions into reengineering the codebase and refactoring of user interfaces. The
combined effect of design patterns with agile methodology helped us to redesign
and develop financial management system (FMS)—an enterprise application, within
shorter times. This FMS is currently deployed on Andhra Pradesh Comprehensive
Financial Management System (APCFMS). Legacy APCFMS application, shown in
Fig. 1, had been developed to implement the client–server model comprising three
modules, namely receipts, payments and reports. In all the three modules, there is
a communication between client and server in turn with the database and resulting
in the 3-tier architecture. Each module establishes an independent database connec-
tion to pull and aggregate the data and displays the response results. The following
sections detail the pitfalls and functional vagaries of the system and address them
through the proposed combined approach of design patterns and agile methodologies.
Design Patterns and Microservices for Reengineering of Legacy Web Applications 375
2 Performance Scaling Using Singleton Pattern-Based

Reliable Database Connections
Designing a Web application typically uses a database connection object. In Legacy

Andhra Pradesh Financial Management Systems (APFMS), the department-specic
applications that are accessing the associated data models could create independent
database connections on to different data models. In a regular scenario, multiple
applications could connect to the same database technology with their own database
schema in isolation leading to memory overhead and reduced system performance.
This design overhead is addressed by implementing singleton pattern at database
connection level which can be shared by multiple applications. The singleton pattern
[2] is a design pattern that controls the creation of a database connection object.
Thus, FMS ensures that one instance of a singleton database connection object is
shared by multiple applications and implemented in a single sprint, by using private
constructor and synchronized method. The role of singleton pattern is to create a
database instance that can be shared by all the Web pages designed in a codebase.
In order to implement this pattern, the connection manager rst checks whether the
connection pointer is null or not. If it is found to be null, then only it creates database
object on the y by using private constructor. This design philosophy is referred to
as lazy instantiation and ensures a reliable database connection for each application.
This is shown in Fig. 2a.
3 Providing Uni ed Interface for Multiple Remittence

Options Using Facade Pattern
Legacy FMS allowed only one remittance option through bank. The recent e-
commerce standards expect multiple payment options such as net banking, credit
card and debit card through a well-dened payment gateway. The code redesign is
implemented through a facade pattern with unied interface [ 3] for different options
for payment systems. The users can select any one of the payment options, and
based on the payment option, the corresponding interface appears. After completion
of the task, we process the payment details, and the amount is credited into APCFMS
account and is communicated to user as a conrmation of payment. Facade design
pattern follows the principle called composition rulecompose programs in order
to connect to other programs. The architectural diagram shown in Fig. 2b highlights
the seem identication and implementation of new facade pattern.
(a) Singleton Pattern (b) Facade Pattern
(c) Strategy Pattern (d) Factory Pattern

Fig. 2 Adapted patterns into FMS
4 Saving the Result Sets in Various File Formats Using

Strategy Pattern Ensuring Extendibility
FMS was lacking reporting tools to generate reports for a specific purpose in different
formats. We designed a reporting tool for PFMS containing three types of formats,
namely Excel sheets, PDF files and Web forms by applying strategy pattern. Consid-
ering first Web view, the database results based on the user’s request are displayed in
HTML file with database fields as column names in HTML Table, and the database
records are displayed as rows. Next one is PDF view, in which we generate a general
PDF template using PDF engine. The SQL query results are inserted into PDF file
and displayed as PDF document in Web browser. In Excel sheet, the user selects
some columns, and based on his selection, we retrieve data from the database and
create new Excel file using Excel engine. This engine dynamically creates a general
template and inserts the results into Excel sheet and displays it on the Web browser
with open and download options. Strategy pattern [4] for PFMS is shown in Fig. 2c.
5 Keeping Only One Database Active Using Factory

Method Ensuring Extendibility
The Web application accesses various database tables by executing SQL scripts,
stored procedures and retrieves the results in the form of records. Subsequent to han-
dling race conditions, the resulting inconsistencies in the state of database factory
methods are implemented while creating database objects. This pattern helped to
maintain one database connection active, in the context of the application irrespec-
(a) Singleton Pattern Java (b) Factory Pattern Java

Code Code
Fig. 3 Adapted design patterns Java code
tive of database objects created. The factory design pattern [5] generates a generic
database object. The database factory class is to instantiate the specific database
connection object. Factory design pattern instantiates the concrete database provider
dynamically based on application, thereby ensuring extendibility. The factory method
design pattern is shown in Fig. 2d. Singleton design pattern Java code and factory
design pattern Java code are shown in Fig. 3a, b.
6 Integration of Agile Programming Into Pattern-Oriented

FMS
Combining agile programming and design patterns results in a synergy with their
integration being more effective than the sum of the two. One of the essential steps of
agile methodology is refactoring [6]. The refactoring feature supports the developers
without modifying the external behaviour, but it improves the overall performance
of the application by changing the internal behaviour. It is a way to clean up the
Fig. 4 Mikado graph for FMS
code that reduces the occurrence of bugs. A good design comes first and then coding.
Refactoring is contrary to this approach. With refactoring, we can find that the balance
of work changes in terms of interfaces. The ensuing interaction gives rise to a program
with a design that produces good results as development progresses. In APFMS, the
rudimentary user interface implemented using legacy software libraries is refactored
using Mikado graphs [7]. In receipts home page, all the fields related to departmental
codes are replaced with a string, and all the field data are separated by using regular
expressions. This is shown in Fig. 4.
7 Microservices
Microservices are autonomous and small, and their purpose is clearly defined.
Microservices are very popular architectural patterns nowadays as a viable alter-
native to monolith applications. In microservices, the software application is divided
into components that can be developed, tested and deployed independently [8]. Since
they communicate via messaging, they are not dependent on the same programming
language. So, developers can use the programming language that they are most
familiar with and they can communicate with each other without difficulty. Since
teams are working on smaller applications and are more focused on specific problem
domains, their projects tend to be more agile. The development teams can iterate
faster, address new features on a shorter schedule, add new features and turn around
bug fixes immediately. Another advantage of microservice is to deploy any service
independent of others. This feature leads to faster implementation of new features.
A further advantage is scalability, since new functionality can be added on demand.
Finally, easy maintainability is also another feature for microservices, since develop-
ers can modify or replace a microservice with a new one without effecting the entire
application.
Service Registry
Desktop
Client Edge
Receipts Receipts
Server
DB
Client
side API
UI Gateway Payments Payments
Composition DB
Load
Balancer Reports Reports
Mobile DB
Client
Database Per Service
Fig. 5 Microservices for PoFMS
8 Migrating Legacy Financial Management Systems into

Modernization
Let us consider PoFMS application that takes care of receipts from customers, pay-
ments to all the pensioners and generating reports. The application consists of several
components including the user interface (UI) for customers, along with some back-
end services such as withdrawing the amount from their accounts. In PoFMS, there
is no separate mechanism for write and read operations in a synchronized manner to
update the reports module. To achieve this, we use some set of microservices. The
flow diagram of PoFMS microservice architecture is shown in Fig 5.
9 Strangler Fig Application
When the system has a technique of using rewritings of data frequently, is called
strangler fig application [9]. Martin Fowler proposed this pattern, inspired by a some
type of fig that seeds itself in the upper branches of trees. The fig then grows subside
towards the ground to take root, gradually wrapping the original tree. The existing
tree becomes originally a support structure for the new fig, and if taken to the final
stages, the original tree will be losing its life, leaving the new fig. The new fig is
now self-supporting fig in its place. In the context of modern Enterprise applications,
the objective here is to have a new system to wrap all the legacy functionalities into
the features of modern application. The idea is that legacy and modern application
can coexist, giving the new system time to grow and potentially replace the old
system. The vital benefit to this pattern is that it supports by allowing incremental
migration to a new system. We execute this methodology for our software, to not
only take incremental steps, but also ensure that each step is simply reversible. We
will consider the nature of the calls being made into the existing system. A protocol
such as HTTP is very amenable to redirection. The strangler fig pattern is shown in
Fig. 6.
The architecture of HTTP reverse proxy [10] is shown in Fig. 7.
Customers Customers Customers
Existing
Monolith
Dispatcher Dispatcher
Receipts
Module
Payments
Module
Reports New
Module Receipts Receipts Module
Existing
Payments Module Monolith
Module
Reports
Module
New New
Reports Module Payments Module
Fig. 6 Strangler fig pattern
Proxy Server Web Server
HTTP Request
HTTP Request
HTTP Response HTTP Response

Client
Own Network
Fig. 7 HTTP reverse proxy architecture
10 Results
The reengineering of FMS into a microservice-based application is realized by

API Builder. The functional modules of PoFMS are separated into three different
microservices of independent databases, and their interaction is significantly pro-
moted by the API gateway. The main screen of API is shown in Fig. 8a. The API
endpoints screen is shown in Fig. 8b. The API builder getter and setter for models is
shown in Fig. 8c. The API Builder Mysql Tables are shown in Fig. 8d. API Database
Table Count refers to the number of rows in a table as shown in the Fig. 8e. API
Database Table Count the number of Rows in a Table is shown in Fig. 8f.
(a) API Builder Home Screen (b) API Builder End Points (c) API Getter and Setter
Screen Methods
(d) API Builder List of MySql (e) API Mysql Database Re- (f) API Mysql Users Count
Tables Screen sults Screen
Fig. 8 Microservices using API gateway
11 Conclusions and Future Work
In legacy FMS, the department-specific applications that are accessing the associ-
ated data models could create independent database connections on to different data
models. Multiple applications could be connected to the same database technology
with their own database schemas in isolation, thereby leading to memory overhead
and reduced system performance. This design overhead is addressed by implement-
ing singleton pattern. Thus, FMS ensures that one instance of a singleton database
connection object is shared by multiple applications implemented by using private
constructor and synchronize method. The factory design pattern generates a generic
database object. The database factory class is to instantiate the specific database
connection object. Legacy FMS was lacking reporting tools to generate reports for
a specific purpose in different formats. We designed a reporting tool for APFMS
containing three types of formats, namely Excel sheets, PDF files and Web forms by
applying strategy pattern. Further, the server side business logic is reengineered with
microservice architecture based on strangler fig pattern. The resulting application
has got three services, namely receipts, reports and payments with their independent
databases. In future work, a few more services such as event sourcing and cloud
deployment are planned.
Acknowledgements I thank V.M.Rayudu, Senior Operations Manager, APCFMS for giving his
immense support in implementing this project.
References
1. Andhra Pradesh Comprehensive Financial Management Systems. https://cfms.ap.gov.in/

2. Lyon, D., Castellanos, F.: The parametric singleton design pattern. J. Object Technol. 6, 13
(2007)
3. Schmidt, D.C: Wrapper facade, a structural pattern for encapsulating functions within classes.
C++ Report Magazine (1999)
4. Christopoulou, A., Giakoumakis, E.A., Zafeiris, V.E., Soukara, V.: Automated refactoring to the
strategy design pattern. Inf. Softw. Technol. 54, 12021214 (2012)
5. Ireno, D.R.: Dynamic factoryNew possibilities for factory design pattern. In: 28th European
Conference on Modelling and Simulation, 2730 May 2014. ISBN 978-0-9564944-8-1
6. Hodgetts, P.: Refactoring the development process: experiences with the incremental adoption
of agile practices. In: Agile Development Conference (2019)
7. Birchall, C.: Re-engineering Legacy Software. Manning Publications, Shelter Island, NY (2016)
8. Lewis, J., Fowler, M.: Microservices. https://martinfowler.com/articles/microservices.html
(2017)
9. Newman, S.: Monolith to Microservices-Evolutionary Patterns to Transform Your Monolith.
Oreilly Media Inc., Sebastopol, CA (2019)
10. Yan, F., Wang, Y.: A security web gateway based on HTTP reverse proxy. DEStech Trans. Eng.
Technol. Res. (2017)
A Comparative Study on Single Image
Dehazing Using Convolutional Neural
Network
Poornima Shrivastava, Roopam Gupta, Asmita A. Moghe, and Rakesh Arya
Abstract In many computer vision tasks, dehazing is an important preprocessing

step such as in various application areas of tracking and object recognition. Dehazing
is the task of removing haze content or haze effect from the image under consid-
eration. Nowadays, learning-based methods are used widely for dehazing. Among
them, a convolutional neural network is one such method. After the successful use of
CNN in different fields of image processing, it is being applied with modifications in
various algorithms for dehazing as well. Deep CNNs are good at obtaining feature
information automatically in a data-driven manner. In this paper, we have discussed
various methods that use CNN for dehazing and their performance is measured by
PSNR and SSIM.
1 Introduction
The weather conditions like snow, rain, mist, haze, hail that occur in day-to-day life
play a major role in deteriorating the image quality [1]. These particles suspended
in the atmosphere, either scatter the light or absorb the reflected air light. Due to
this scattering, the outdoor images captured in foggy or hazy weather suffer from
unsatisfactory visual effects like very low visibility distance, color paling of objects,
and less contrast [2] of images as shown in Fig. 1. Many applications like remote
sensing, driving assistance, visual surveillance smartphone camera, and autonomous
P. Shrivastava (B)
Department of Electronics and Communication, UIT, RGPV, Bhopal, India
R. Gupta · A. A. Moghe
Department of Information Technology, UIT, RGPV, Bhopal, India
e-mail: roopamgupta@rgtu.net
A. A. Moghe
e-mail: Aamoghe@rgtu.net
R. Arya
Madhya Pradesh Council of Science and Technology, Bhopal, India
https://doi.org/10.1007/978-981-16-1502-3_39
384 P. Shrivastava et al.
(a) Hazy Image (b) Haze Free Image
Fig. 1 Deep hazy and haze-free image [6]
driving [1, 2] strictly require clear images and removal of haze that is why dehazing
has become an important research area. For dehazing an image, the formation of a
hazy image is taken into consideration so, in atmospheric optics [3], the problem of
haze formation is deeply studied [4]. By the combination of the atmospheric light and
scene radiance, a hazy image is formed [5]. As the scene depth keeps on increasing,
more atmospheric light and less scene radiance are captured by the camera.
Researchers have proposed many dehazing methods in the past and based on
problem formulation, these are categorized into (i) restoration-based approaches
(ii) enhancement-based approaches, and (iii) fusion-based methods, some of the
traditional image enhancement techniques are histogram equalization, Retinex algo-
rithms, wavelet transform [2]. Due to haze, image contrast degrades, so the above
methods try to improve it. In fusion-based methods, two images that are contrast
enhancement and white balance type are derived for fusion and used when a hypoth-
esis or prior is invalid [4, 7]. Due to the absence of a physical model and not
considering the degradation process of the image, these methods do not remove
fog completely. Hence, the restoration-based methods put forth to consider the
degradation process, and by inverting it, a clean image is obtained [2].
Dehazing methods according to its features are classified into [a] single image [b]
multi-images [1]. Earlier most of the restoration methods were based on reference
models similar to physical or geometrical models which require information from
user apart from additional information. These methods fail when wrong input is
given by the user or when the information is inaccurate [7]. Other limitations are
that it required additional information and tools and all these occur due to the lack
of technology and hardware device [1]. So multiple image-based methods were
proposed in which more than one ordinary camera is required and the methods under
this are classified into three categories that are RGB/near-infrared images, different
weather conditions-based, and different polarization degrees-based[7]. It is difficult
to obtain all this additional information, and in practice, these methods are typical.
Thus much work is done on haze removal on a single image due to its flexibility and
practicality [2]. Most of the methods for single image fog removal are based on the
atmospheric scattering model (ASM) [7] proposed by [8] shown in Eq. (1).
A Comparative Study on Single Image Dehazing Using … 385
I (x) = J (x)t(x) + [1 − t(x)]A (1)
where I(x) describes the image with haze content, J(x) is the radiance of scene,
[7] which is to be retrieved from the foggy image that is I(x), [5, 7] the haze removal
process shown in Eq. (2) is derived from Eq. (1) [5]:
J (x) = I (x) − A(x)(1 − t (x))/t (x) (2)
where A is considered as horizon radiance, it is the illumination created by atmo-

spheric scattering, t(x) is its medium transmission, depth of scene point x, and it
shows the amount of radiance of the scene that reaches at the camera without being
dispersed, as shown in Eq. (3).
t (x) = e − β · d(x) (3)
where β is a scattering coefficient [2, 7]. “Dehazing processes can be further

decomposed into three subproblems (1) Compute atmospheric light A(x), (2) Forecast
transmission t(x), (3) Retrieve scene radiance J(x)” [1, 4]. This model considers that
hazy weather is the reason for the degradation of images. This model is a collection
of mathematical equations with two parameters, i.e., A(x) and t(x) [9]. Some of the
methods of prior and learning-based used this type of model for dehazing.
2 Multiple Images-Based Dehazing Methods
Some of the work in multiple image-based methods are Narasimhan [9] proposed
a chromatic model of a numerous image approach in which two or more than two
images of a similar type of scene in distinct haze situation are used to remove effects
of weather, and it recovered the scene color by additional information provided by
users under different weather conditions after investigating visual manifestations.
Schechner [10] Schwartz [11] proposed a dehazing method based on polarization to
estimate the depth of the image using two or more than two images taken from distinct
angles by a polarizer. Chen [12] proposed a technique in which they estimated the
depth of the image by using image pairs taken on a sunny and foggy day. Schaul [13]
and Feng [14] restored an image by obtaining an infrared image and an RGB image
at the same time. [7].
3 Single Image Dehazing by Prior-Based Methods
He et al. [15] put forward a dark channel prior (DCP) which declares that in a hazy
image, there exists no less than one color channel for each pixel which should have a
low value of intensity. Tang et al. [16] put forth a new method of machine learning for
haze removal in which a regression model gets trained by four multiple handcrafted
features, i.e., local maximum saturation, local maximum contrast, dark channel, and
a regression model for transmission prediction. Luan et al. [17] proposed a method
that combines seven types of haze features by using the support vector regression
(SVR). Galdran et al. [18] improved the scene contrast by an extended perception-
inspired variational framework. Fattal [19] put forth a method for clear images that
utilized local color lines prior to independent component analysis (ICA). Berman
et al. [20] worked on a non-local haze-line prior technique. Zhu et al. [21] worked on
color attenuation prior to single image dehazing. Kratz and Nishino [22] estimated
the transmission by assuming that depth and albedo are statistically independent
and formulated a factorial Markov random field. Sulami et al. [23] estimated an
appropriate global constant atmospheric light vector by applying the color lines
prior. Wang and Fan [24] approached to mix details of multi-level chromaticity priors
by proposing a method called multiscale depth fusion (MDF) with “local Markov
regularization” [1]. Meng et al. [25] dealt with the boundary constraint to efficiently
remove the haze contextual regularization. All these priors have been used for the
estimation of the transmission coefficient for dehazing and for achieving impressive
performance [1]. Some images often do not meet for each prior, and some hazy
images, it is not sufficient to capture intrinsic attributes and also have limitations like
“halos, distortion of colors, underestimating the thickness of haze content, etc. [5].
System framework of Fig. 2 gives an idea about various methods based on CNN’s
basic dehazing method. It mainly includes the following steps. (1) Take a hazy image
and then obtain global atmospheric light from it, (2) Build a modified network using
the CNN model, (3) Train the network, optimize the network parameters, for prior
knowledge of image dehazing, (4) Use a model based on CNN, i.e., convolutional
neural network for the estimation of transmission map, (5) For training purposes,
build the data set required, (6) Input a natural close and long-range hazy image and
test the standard of the output image. Finally, a clear image is recovered.
Fig. 2 A de-hazed model by atmospheric scattering method by simple CNN-based method

4 Work on DeHazing on Deep Neural Networks
Several works on CNN have been done but they were not capable to capture the
intrinsic attributes of hazy images [3] so modifications have been done in the CNN
network to get the desired result. Some of the recent works done in this area are as
follows.
Wang et al. [1] put forward an atmospheric illumination prior (AIP) network which
is an image-to-image mapping, and it considered the luminance channel of YCrCb
color space including a fusion network and dehazing network in which the dehazing
network recognizes features of haze and restores the lacking details in luminance
channel, and in fusing network, a different attribute of three channels is fused in
the color space. According to them, the atmospheric illumination has a major effect
on the luminance channel than on the chrominance channel but limited in a way
that in YCrCb color space, unbalanced problems H(x) have not been considered.
Ling [2] proposed a deep network using CNN for calculating the transmission map of
three channels that automatically learn features of haze relevant and in a joint manner
used a local patch color channels of RGB type and discover that the most informative
haze pertinent features are three color channels and information of local spatial type.
Huang et al. [5] put forward a hybrid model based on a single image that combines
the supervised and unsupervised model called Deeptrans Map to get the correct
transmission map. Unsupervised learning leads to the learning of the hazy features
showing details of a hazy image that contains image color, brightness, and structure
and is used for learning the extraction of features. With haze-relevant features of
multiscale type, image details can be represented by modifying the number and size
(i.e., scale) of invisible layers and transmission map is achieved through supervised
learning but this method does not apply to unevenly distributed haze images and
night time hazy images. You et al. [26] proposed CNN-RNN that is a convolutional
neural network and recurrent neural network which acts as a bridge to connect coarse
type-to-fine type module in which CNN takes control of the view of global, which is
local-to-global and RNN captures the local view, which is global-to-local. Jinjiang
et al. [27] proposed a deep CNN using a residual network where atmospheric light
is not estimated for dehazing. It is subdivided into two network parts wherein the
first part of the transmission map is estimated by using a foggy image as input, and
in the second part, haze is removed by using a ratio of the hazy or foggy image and
transmission map as the input. Wang et al. [28] put forward the “Deep Residual Haze
Network (DRHNet), which is a generalized end-to-end dehazing model because it
can be used for the de-raining purpose as well. Here the image is restored from haze by
subtracting the foggy or image from the learned negative residual map. To effectively
aggregate the contextual information, a context-aware feature extraction module is
proposed. To accelerate its convergence and to improve its representation ability, a
nonlinear activation function is proposed, which is called reverse parametric rectified
linear unit (RPReLU). Li et al. [29] reconstructed the latent de-haze image through
perception-inspired haze removal subnetwork that is deep CNN for a single image,
and then in another subnetwork, refinement was done to improve the properties like
color and contrast of the outcome by optimizing the joint multiterm loss. Cameron
Hodges et al. [30] proposed a CNN model which was trained from unmatched data
with the help of Siamese network architecture to learn haze-relevant features in which
two learning-based architectures, i.e., dehazing and discriminator subnetwork are
combined, trained, and tuned for better dehazing performance and if the performance
of dehazing network is good then discriminator will give low output.
Ren et al. [31] proposed a network that maps between images of haze content and
their transmission maps. It is a multiscale deep or intense neural network consisting
of two nets that are, a coarse-scale type net in which a holistic transmission map is
calculated and another one is fine-scale type net which locally redefines the de-haze
results and its edges. Liu et al. [32] proposed a non-optimized generic method for
haze or fog removal from the image which is a simple CNN model based on residual
learning because this technique does not need the knowledge of parameters of ASM
that is transmission map t(x) and atmospheric light A(x) and still, it overcomes
the limitations of excessive edge sharpening and color darkening. A CNN-based
encoder–decoder network is used with residual learning on local and global levels.
Xiao et al. [33] proposed a new haze layer-based model through end-to-end mapping
in which a hazy image from the hazy layer is de-hazed to get a residual image using
CNN based network. Yin et al. [34] proposed a new “parallel spatial/channel-wise
attention block” for haze removal which is applied to the encoder’s end to guide the
decoder and reconstruct clear images. The important spatial position of features is
highlighted by the spatial attention module which is connected in parallel with the
channel-wise attention module and with the help of residual learning, the model’s
dehazing capability is further enhanced but the performance for night time hazy
images was not satisfactory. Haouassi et al. [35] proposed a two-stage dehazing
network in which the first stage labeled as a-Est calculates an exact atmospheric
light algorithm that includes a quadtree decomposition and blurry effect due to hazy
image and the second stage further consists of two subnetworks, in which one is
used for computing rough transmission maps (CMCNNtr) and another one is for its
refinement (CMCNNt). It considers atmospheric light along with transmission map
estimation.
5 Discussion and Analysis
There are various applications of deep learning techniques in image processing like
contrast-enhancing, deblurring, de-raining, enhanced resolution, and so on. Simi-
larly, with the popularity of deep learning in the area of image denoising, semantic
segmentation, object detection, and image classification/annotation, researchers tried
to use CNN for dehazing using a single image.
Here various methods of dehazing have been discussed. Much emphasis has been
given to learning-based single image dehazing methods. The analysis of methods
and algorithms describe several advantages and limitations qualitatively and quanti-
tatively. The platform used in these methods is MATLAB, PYTHON, TensorFlow,
Fig.3 Different stages comes under dehazing
etc. Some of the deep learning methods are based on end-to-end dehazing techniques,
i.e., mapping between a hazy image to a de-hazed image without estimating any addi-
tional parameters. Another one is based on the usage of additional parameters for the
removal of haze. So deep neural network methods based on CNN that are discussed
in Table 2 are categorized into two classes, and based on Fig. 3, many steps need to
be considered for the choice of proper dehazing model. While using neural networks
for dehazing purposes, some of the problems that occur in the original scene are the
loss of structural integrity, and due to this, the value of SSIM decreases which leads
to unrealistic visual results [36, 37].
Results from Table 1 in [28] shows that DRHNET [28] performs better than some
prior-based methods and some popular deep or intense learning-based methods. It
is based on residual learning in which mapping is quite straightforward. Prior-based
methods that consider the physical model as a basis sometimes perform similar to
learning-based methods, and their performance is comparable. Some algorithms in
deep learning-based methods performed well in the restoration of a hazy image
using CNN within the values of the parameter of PSNR, SSIM. This shows the sign
of good restoration. Another method is an end-to-end generalized CNN which does
not require knowledge of the ASM. Here the estimation of parameters is completely
avoided and has the benefits of overcoming some of the common pitfalls, like dark-
ening of color and excessive sharpening of edges but for improving performance
further, various refinements can be made [32]. Multiscale convolutional networks
(MSCNN) are trainable deep CNNs which are also an image-to-image system. It
is considered a YCrCb color space that can automatically detect foggy regions, can
restore the lacking texture information, lightweight system framework, and enhances
visual contrast with the natural color of the scene but the unbalanced problem in
YCrCb color space was not studied [1]. An alternative to generative adversarial
390
Table 1 Result of quantitative evaluation in average PSNR (dB) and SSIM [28]
DCP BCCR GRM CAP NLD DEHAZENET MSCNN AODNET GMAN DRHNET
PSNR 18.87 17.87 20.44 21.31 18.53 22.66 20.01 21.01 27.94 31.39
SSIM 0.794 0.770 0.823 0.824 0.702 0.833 0.791 0.837 0.897 0.974
P. Shrivastava et al.
networks is the Siamese network (discriminator) which has also been discussed. The
advantage with GAN-based method is that it removes more haze but fine details
are not covered, like in parameter estimation of ASM. Methods based on feature
learning mostly learn haze related features of low level [30]. All these networks are
end-to-end type. Better results can be obtained from deep neural networks, and in
this direction, there is much to be explored further.
6 Conclusion
Most of the techniques discussed in this paper remove haze by taking into consid-
eration the calculation of the depth map and transmission map which are complex
parameters to be computed properly. Due to this, the computational complexity and
time of these algorithms increase. Some of the techniques under CNN-based model
do not use any sort of parameter estimation, and they directly mapped the hazy
image to the dehazy image. This has reduced computational complexity. This paper
discusses the advantages and shortcomings of these dehazing methods both quantita-
tively and qualitatively. PSNR and SSIM are the comparative metrics used here. The
analysis shows that some of the intense learning-based methods of single image haze
removal technique are residual multiscale convolutional networks, trainable model
end-to-end type, the system architecture of image-to-image, YCrCb color space
considered [1] type, DRHNET, AIPNET, and AODNET performed in the direction
of a better outcome in terms of PSNR and SSIM in the synthetic hazy image and
sometimes in real images also.
References
1. Wang, A., Wang, W., Liu, J., Gu, N.: Image-to-image single image dehazing with atmospheric
illumination prior. IEEE Trans. Image Process. 28(1), 381–393 (2019)
Table 2 Recent of dehazing methods its advantages and disadvantages

Methods Advantages Limitations
Multiscale convolutional Hazy regions identified Unbalance problem in YCrCb
networks, trainable model automatically, deficient color space, more
end-to-end type, the system texture information restored, optimizations to be done
architecture of image-to-image, the lightweight system
YCrCb color space considered increases contrast, lacking
[1] texture information. scene
intrinsic color is restored
Three-channel transmission Information of color and local The color difference from
map [2] spatial, video dehazing input frames
(continued)
Table 2 (continued)
Methods Advantages Limitations
Hybrid model, combined Transmission estimation There are still many problems
learning of unsupervised and model’s accuracy and to be further addressed
supervised [5] robustness improved
CNN-RNN, recurrent neural Limited scenario predicts Fine-tuning on the model of
network[26] absolute visibility, performs natural images is slightly
well in predicting relative effective due to the
visibility for different non-encoding of visibility
situations, model accurately information
adjusted in case of less data
where true visibility data are
available less
Deep CNN, residual-based, Atmospheric light estimation To improve performance, the
atmospheric light value trained is avoided and improves the network training strength
by the residual network, t(x) dehazing efficiency, no color should be increased
through deep CNN.[27] distortion, image blur
Negative residual map, Used in both de-raining and To handle white scenes, it
end-to-end model, dehazing does not consider particular
context-aware feature parts
extraction [28]
Deep end-to-end type, Used in high-level vision Should improve performance,
PDR-Net, i.e., problems accelerates network
perception-inspired dehazing convergence
subnetwork, new refinement
subnetwork,[29]
Trained from unmatched Compare unmatched images Subjective testing by human
images, Siamese network for learning hazy features that observers, resources required
architecture deep CNN model, are not changeable to some of to use these methods
to learn hazy features, the image variable like scene,
end-to-end method[30] lightening, and pose
End-to-end generalized model, Overcome some common Optimize the design of the
CNN, ASM is not used, and pitfalls, like darkening of network is not done, other
estimation of the parameter is color, excessive sharpening of refinements can be made
completely avoided [32] the edge further
Residual images, end-to-end High learning rate, low Should improve running
mapping, convolutional neural computation, consume less speed for a common
network, guided filter, learn computation time, speedy computing platform
directly residual image[33] convergence process.
An end-to-end model, parallel Good accuracy, visual results, Unsuitable for night hazy
spatial/channel-wise attention competitive running time images
block, pyramid pooling with performance
encoder–decoder [34]
The two-stage system, i.e., Efficient estimation of AL and
“A-Est”, cascaded multiscale t, accurate algorithm for ASM
CNN[35]
2. Ling, Z., Fan, G., Gong, J., et al.: Learning deep transmission network for efficient image
dehazing. Multimed. Tools Appl. 78, 213–236 (2019)
3. Timofeev, Y.M., Vasilev, A.V.: Theoretical Fundamentals of Atmospheric Optics. Cambridge
International Science Publishing, 200
4. Song, Y., Li, J., Wang, X., Chen, X.: Single image dehazing using ranking convolutional neural
network. IEEE Trans. Multimedia 20(6), 1548–1560 (2018). https://doi.org/10.1109/TMM.
2017.2771472
5. Huang, J. Jiang, W. Li, L. Wen, Y. Zhou, G.: DeeptransMap: a considerably deep transmission
estimation network for single image dehazing. Multimedia Tools Appl. 78, (2018). https://doi.
org/10.1007/s11042-018-6536-x
6. Wang, W., Yuan, X.: Recent advances in image dehazing. IEEE/CAA J. Automatica Sinica
4(3), 410–436 (2017)
7. Yunan, L., Miao, Q., Liu, R., Son, J., Quan, Y., Huang, Y.: A multi-scale fusion scheme based on
haze-relevant features for single image dehazing. Neurocomputing 283(2018), 73–86 (2018)
8. McCartney, E.J.: Optics of the Atmosphere: Scattering by Molecules and Particles. Wiley, New
York (1976)
9. Narasimhan, S.G., Nayar, S.K.: Interactive (de)weathering of an image using physical models.
In: IEEE Workshop on Color and Photometric Methods in Computer Vision. Conjunction with
ICCV (2003)
10. Schechner, Y.Y., Narasimhan, S.G., Nayar, S.K.: Polarization-based vision through the haze.
Appl. Opt. 42(3), 511–525 (2003)
11. Shwartz, S., Namer, E., Schechner, Y.Y.: Blind haze separation. In: IEEE Conference on
Computer Vision and Pattern Recognition, Vol. 2, pp. 1984–1991. IEEE, (2006)
12. Chen, G., Wang, T., Zhou, H.: A novel physics-based method for restoration of foggy day
images. J. Image Graph. 5(13), 887–893 (2008)
13. Schaul, L., Fredembach, C., Süsstrunk, S.: Color image dehazing using the near-infrared. In:
IEEE International Conference on Image Processing, pp. 1629–1632 (2009)
14. Feng, C., Zhuo, S., Zhang, X., Shen, L., Süsstrunk, S., Near-infrared guided color image
dehazing. In: IEEE International Conference on Image Processing, pp. 2363–2367 (2013)
15. He, K., Sun, J., Tang, X.: Single image haze removal using dark channel prior. In: IEEE
Conference on Computer Vision and Pattern Recognition (CVPR), pp 1956–1963 (2009)
16. Tang, K., Yang, J., Wang, J.: Investigating have relevant features in a learning framework for
image dehazing. In: IEEE Conference on Computer Vision and Pattern Recognition, pp. 2995–
3002 (June 2014)
17. Luan, Z., Shang, Y., Zhou, X., et al.: Fast single image dehazing based on a regression model.
Neurocomputing 245, 10–22 (2017)
18. Galdran, A., Vazquez-Corral, J., Pardo, D. et al.: A variational framework for single image
dehazing. In: Proceedings of European Conference on Compututing Vision (ECCV), pp. 259–
270 (Sep. 2014)
19. Fattal, R.: Dehazing using color-lines. ACM Trans. Graphics 34(1), 13:1–13:14 (2014)
20. Berman, D., Treibitz, T., Avidan, S.: Non-local image dehazing. In: IEEE Conference on
Computer Vision and Pattern Recognition, pp. 1674–1682 (2016)
21. Zhu, Q., Mai, J., Shao, L.: A fast single image haze removal algorithm using color attenuation
prior. IEEE Trans. Image Process. 24(11), 3522–4353 (2015)
22. Kratz, L., Nishino, K.: Factorizing scene albedo and depth from a single foggy image. In: IEEE
International Conference on Computer Vision, pp. 1701–1708 (Sept. 2009)
23. Sulami, M., Geltzer, I., Fattal, R., Werman, M.: Automatic recovery of the atmospheric light
in hazy images. In: IEEE International Conference on Computational Photography (2014)
24. Wang, Y., Fan, C.: Single image defogging by multiscale depth fusion. IEEE Trans. Image
Process. 23(11), 4826–4837 (2014)
25. Meng, G.F., Wang, Y., Duan, J., Xiang, S., Pan, C.: Efficient image dehazing with boundary
constraint and contextual regularization. In: Proceedings of IEEE International Conference on
Computer Vision (ICCV), pp. 617–624 (2013)
26. You, Y., Lu, C., Wang, W., Tang, C.: Relative CNN-RNN: learning relative atmospheric visi-
bility from images. IEEE Trans. Image Process. 28(1), 45–55 (2019). https://doi.org/10.1109/
TIP.2018.2857219
27. Li, J., Li, G., Fan, H.: Image dehazing using residual-based deep CNN. IEEE Access 6, 26831–
26842 (2018). https://doi.org/10.1109/ACCESS.2018.2833888
28. Wang, C., Li, Z., Wu, J., Fan, H., Xiao, G., Zhang, H.: Deep residual haze network for image
dehazing and deraining. IEEE Access 8, 9488–9500 (2020). https://doi.org/10.1109/ACCESS.
2020.2964271
29. Li, C., Guo, C., Guo, J., Han, P., Fu, H., Cong, R.: PDR-Net: perception-inspired single image
dehazing network with refinement. IEEE Trans. Multimedia 22(3), 704–716 (2020). https://
doi.org/10.1109/TMM.2019.2933334
30. Hodges, C., Bennamouna, M., Rahmani, H.: Single image dehazing using deep neural networks.
Pattern Recogn. Lett. 128, 70–77 (2019)
31. Ren, W., Pan, J., Zhang, H., et al.: Single image dehazing via multi-scale convolutional neural
networks with holistic edges. Int. J. Comput. Vis. 128, 240–259 (2020). https://doi.org/10.
1007/s11263-019-01235-8
32. Xiao, J., Shen, M., Lei, J., Zhou, J., Klette, R., Sui, HaiGang: Single image dehazing based on
learning of haze layers. Neurocomputing 389(2020), 108–122 (2020)
33. Liu, Z., Xiao, B., Alrabeiah, M., Wang, K., Chen, J.: Single image dehazing with a generic
model-agnostic convolutional neural network. IEEE Signal Process. Lett. 26(6), 833–837
(2019). https://doi.org/10.1109/LSP.2019.2910403
34. Yin, S., Wang, Y., Yang, Y.-H.: A Novel Image dehazing Network with a Parallel Attention
Block. Pattern Recogn. 102, 107255 (2020)
35. Haouassi, S., Wu, D.: Image dehazing based on (CMTnet) cascaded multi-scale convolutional
neural networks and efficient light estimation algorithm. Appl. Sci. 10, 11 (2020)
36. Teixeira Gonçalves, L., de Oliveira Gaya, J.F., Lilles Drews Junior, P.J., da Costa Botelho,
S.S.: GuidedNet: single image dehazing using an end-to-end convolutional neural network. In:
2018 31st SIBGRAPI Conference on Graphics, Patterns and Images (SIBGRAPI), pp. 79–86.
Parana (2018). https://doi.org/10.1109/SIBGRAPI.2018.00017
37. Wang, Z., Bovik, A.C., Sheikh, H.R., Simoncelli, E.P.: Image quality assessment: from error
visibility to structural similarity. IEEE Trans. Image Process. 13(4), 600–612 (2004)
Plasmodium falciparum Detection in Cell
Images Using Convolutional Neural
Network
Smaranjit Ghose, Suhrid Datta, C. Malathy, and M. Gayathri
Abstract Malaria is one of the major burdens to global health, which results in
countless deaths every year. It is caused by a group of Plasmodium parasites which
spreads through the bite of the female anopheles mosquito. The infected mosquito
first bites the host, and the parasite enters the bloodstream which proceeds to go to
the liver. From the liver, the parasites grow and multiply in the red blood cells. The
infected red blood cells eventually burst and release more parasites. The diagnosis
of malaria is done by doing a blood test where the count of the parasite is found
by examining thin blood smears under a microscope. This method is also used for
testing drug resistance, measuring drug effectiveness, and classifying disease sever-
ity. Microscopic diagnostic methods are cumbersome and thus require a lot of skill
and experience to execute. In this study, we propose the use of a deep convolutional
neural network to detect the presence of red blood cell images. This would assist
in automating the detection of malaria from red blood cell images and aid in early
diagnosis.
1 Related Works
Unsupervised and supervised learning methods can be used for performing cell image
analysis. Supervised learning methods such neural networks were used for making a
classification tool to differentiate between parasitized and uninfected cell images [1].
Machine learning methods were used for content-based image retrieval and to dis-
cover new clinicopathological relationships from pathological images [2]. K-nearest
neighbours are used for both classification and regression tasks, this method was used
S. Ghose · S. Datta (B) · C. Malathy · M. Gayathri

Department of Computer Science and Engineering, SRMIST, Kattankulathur, India
e-mail: smaranjitghose@protonmail.com
C. Malathy
e-mail: cmalathyc@srmist.edu.in
M. Gayathri
e-mail: gayathrm2@srmist.edu.in
https://doi.org/10.1007/978-981-16-1502-3_40
396 S. Ghose et al.
for classifying and diagnosing malaria from cell images from a given set of features,
and other methods such as linear regression and decision trees can also be used for
diagnosing malaria [2]. Support vector machine (SVM) is used for both classification
and regression problems, and therefore, SVMs were used for classifying and diag-
nosing of malaria by using features as input that were extracted from the images [3].
Resnet50 is a convolutional neural network that consists of 50 layers, and it can be
used as an image classification model to classify between parasitized and uninfected
cell images [4]. VGG19 is a 19-layer deep convolutional neural network which is
made up of 19 layers and can be used to make an image classification model to clas-
sify between parasitized and uninfected images [5]. Restricted Boltzman machine is
a deep belief network that is an undirected bigraph model, and this can be used for
the detection of parasites from the thin blood smears [6].
2 Introduction
Malaria is caused by the protozoan parasites belonging to the Plasmodium genus [7].
The carriers of this parasite are female anopheles mosquito. The mosquito bites the
host, which infects the red blood cells. According to the World Health Organisation,
almost 3.2 billion people over 95 countries are at a risk of being infected by the
parasite and suffering from malaria [8]. The most common types of Plasmodium
parasites are as follows:
• Plasmodium falciparum: This group of protozoan parasites is found in Africa and
is the cause of most of the deaths caused by malaria.
• Plasmodium vivax: This group of protozoan parasites is mostly found in South
America and Asia. The symptoms are much milder as compared to Plasmodium
falciparum, but these groups of Plasmodium parasites generally stay in the liver
for up to 3 years.
• Plasmodium ovale: This group of protozoan parasites is found in the western part
of Africa and generally lives in the liver for a long time without producing any
type of symptoms.
• Plasmodium malariae: This group of protozoan parasites has an incubation period
of 16–59 days. They cause chronic infection which in severe cases last a lifetime.
• Plasmodium knowlesi: This group of protozoan parasites is generally found in
southeast Asia and causes very high levels of parasitemia which proves to be fatal.
The early diagnosis of malaria is important as it leads to proper treatment and
prescribing of proper medications. The current procedure of diagnosing malaria is
performed by a microscopic examination in which blood smears are inspected and
checked for the presence of infected erythrocytes [9]. At first, the bloodstains are
stained using Giemsa staining. The staining method is used for highlighting the
parasites, white blood cells, and also the platelets. This is then examined under a
microscope to check for the shape, size, and characteristics of the red blood cells.
This procedure is also used for testing drug resistance, drug effectiveness [10],
Plasmodium falciparum Detection in Cell Images Using Convolutional … 397
and also, for knowing the severity of the disease. The diagnosis procedure is not
standardized and therefore is heavily dependent on the experience and skill level of
the pathologist. In rural areas where clinics and testing centres are in scarcity, there
is always a dire need for pathologists for performing the tests required [3].
Therefore, in this study, we propose a deep learning [11]-based solution for the
detection of malarial parasites, Plasmodium falciparum, in red blood cell images.
This is done by using a deep convolutional neural network (DCNN) for classifying
blood cell images containing and not containing Plasmodium falciparum parasite.
3 Methods
3.1 Dataset Description
For our study, we used the dataset provided by the National Institutes of Health
(NIH) [12]. The dataset consists of red blood cell images of which 13,779 images
were parasitized blood cells and 13,779 images were uninfected cells. The images are
of segmented cells of thin blood smear slides. All images were Giemsa-stained [13],
and this staining method is used for the thinning of both thick and thin smeared blood
for malaria screening. The infected red blood cells contained Plasmodium falciparum
which is a common malarial parasite [14]. The images in 1 and 2 are two sample
images of infected and uninfected red blood cell images from the dataset.
3.2 Model Architecture
Deep convolutional neural networks (DCNNs) [15] are a class of neural networks.
DCNNs are used for various image-related tasks such as image classification, image
Fig. 1 Infected cell image

398 S. Ghose et al.
Fig. 2 Uninfected cell

image
segmentation and also to perform object detection. They consist of three layers which
are convolutional, pooling, and fully connected layers. The convolutional layers
perform edge detection, and therefore, DCNNs are suitable for the use of images.
The convolution layer is followed by a pooling layer, and an activation function is used
for introducing nonlinearity. The activation function is used after each convolution
layer. The results obtained from the convolution and pooling layers are then fed to
the fully connected layer, and softmax is used for classifying the images according
to labels.
To make use of knowledge obtained from training a DCNN on Imagenet [16],
we make use of transfer learning. Transfer learning allows us to leverage the feature
maps that were obtained from training the DCNN on millions of images. At first,
the layers of the model are taken and are frozen. The layers are frozen to prevent the
loss of any knowledge that may happen during any future training. Then, the new
trainable layers are added on the top of frozen layers to perform predictions.
We make use of EfficientNet B1 [17] for our experiment. The architecture of
EfficientNet optimizes flops by using a multi-neural search architecture. The convo-
lution layers of EfficientNet are divided into two parts, namely pointwise convolution
and depthwise convolution, and this helps in reducing calculation time while having
a minimum loss for accuracy. The MBconv block in EfficientNet first extends to the
channels of the images and then compresses them which results in lesser number of
skipped connections.
EfficientNet also utilizes compound scaling, and in compound scaling, the length,
breadth, and width of the network are increased with respect to the baseline architec-
ture of EfficientNet as seen in Fig. 3. The layers in EfficientNet have been increased
by keeping a fixed constant ratio, and this helps in increasing the accuracy of the
model.
At first, the EfficientNet B1 is instantiated which is pre-loaded with weights
trained on ImageNet. After that, we freeze the convolutional base, and this prevents
the weights in a given layer from being updated during training. Further, we add layers
on the top to perform predictions according to the labels of the image. The first layer
that is added on top is an average pooling layer where the input is downsampled by
Fig. 3 Synopsis of the Stage Operator Resolution Channels Layers

proposed architecture 1 Conv3x3 224x224 32 1
2 MBConv1 112x112 16 1
3 MBconv6 112x112 24 1
4 MBconv6 56x56 40 2
5 MBconv6 28x28 80 3
6 MBconv6 14x14 112 3
7 MBconv6 14x14 192 4
8 MBConv6 7x7 320 1
a kernel of size 4×4. The output obtained from the average pooling layer is fed to a
flatten layer for converting the feature values in the matrix into vectors. The vector
values are then passed through a dense layer. In the last layer, a two-way softmax
activation is used for classifying the images into two classes.
The table in the 3 shows the baseline architecture of EfficientNet. The operator
column shows the exact orientation of blocks, the resolution represents the input
resolution that is going to be utilized by the blocks, the channels represent the number
of output channels of the blocks, and the layers represent the number of times the
blocks were repeated.
4 Result
We used Tensorflow 2.0 as the framework for training our model. The batch size of
the model was set to 32, and the learning rate of 0.00001 was used. Steps per epoch
is a function of training length and batch size, and this was set to 5000. After training
the model for a cycle of 30 epochs, a training accuracy of 96% and a test accuracy
of 94% were obtained. The images in 4 and 5 are the accuracy and loss curves
obtained from the model.
Fig. 4 Accuracy curve

400 S. Ghose et al.
Fig. 5 Loss curve
To assess the performance of our model, we calculated the following scores:

• True positives (TP) are defined as the cell images that were predicted to be malaria
positive were actually malaria positive.
• False positives (FP) are defined as the cell images that were predicted to be malaria
positive with malaria were actually malaria negative.
• True negatives (TN) represent that the images of the malaria that were malaria
negative are actually malaria negative.
• False negatives (FN) represent that the cell images that were malaria negative are
actually malaria positive.
• Precision: It represents number of correct malaria positive predictions. The preci-
sion score obtained was 0.9.
Precision = TP/(TP + FP) (1)
• Recall: It gives the number of correct malaria negative predictions. The recall score
obtained was 0.9.
Recall = TP/(TP + FN) (2)
• F1 score: The F1 score is defined function of precision and recall. This helps us
to find the number of instances our model was accurately able to classify without
missing a significant number of instances. The F1 score obtained was 0.98.
F1 score = 2.[(Precision × Recall)/(Precision + Recall)]
• Specificity: It refers to the percentage of cell images that had cells that were actually
classified as uninfected. The score obtained was 90%.
• Sensitivity: It refers to the percentage of cell images that were malaria positive
were actually classified as malaria positive. The score obtained was 90%.
Furthermore, the confusion matrix was also calculated as seen in Fig. 6 where
label 0 is malaria positive, and 1 is malaria negative
5 Conclusion
In this endeavour, we present a deep learning approach to identify the presence of

Plasmodium falciparum in the cell images. In the current procedure, it requires to
count the number of infected red blood cells with the help of a microscope. This
makes the process very time consuming and cumbersome to execute. This same
process is even used for testing the effectiveness of any kind of medicine of malaria
and also for checking the severity of malaria. We used the dataset provided by the
NIH which comprised of segmented cells from the thin blood smear slide images and
were magnified using a microscope. After that, we trained a classification model on
the dataset and achieved a test accuracy of 94% and a validation of 95%. Additionally,
we observed a recall of 0.9 and a precision score of 0.9. Thus, our work proves that
convolutional neural networks can be used for the detection of malaria and hope that
in future assist pathologists.
References
1. Kan, A.: Machine learning applications in cell image analysis. Immunol. Cell Biol. 95(6),
525–530 (2017)
2. Komura, D., Ishikawa, S.: Machine learning methods for histopathological image analysis.
Comput. Struct. Biotechnol. J. 16, 34–42 (2018)
402 S. Ghose et al.
3. Das, D.K., Ghosh, M., Pal, M., Maiti, A.K., Chakraborty, C.: Machine learning approach for
automated screening of malaria parasite using light microscopic images. Micron 45, 97–106
(2013)
4. Reddy, A.S.B., Juliet, D.S.: Transfer learning with ResNet-50 for Malaria cell-image classifi-
cation. In: 2019 International Conference on Communication and Signal Processing (ICCSP),
pp. 0945–0949. IEEE (2019)
5. Var, E., Tek, F.B.: Malaria parasite detection with deep transfer learning. In: 2018 3rd Interna-
tional Conference on Computer Science and Engineering (UBMK), pp. 298–302. IEEE (2018)
6. Bibin, D., Nair, M.S., Punitha, P.: Malaria parasite detection from peripheral blood smear
images using deep belief networks. IEEE Access 5, 9099–9108 (2017)
7. Coluzzi, M.: Malaria vector analysis and control. Parasitol. Today 8(4), 113–118 (1992)
8. Organization, W.H.: Malaria Microscopy Quality Assurance Manual-Version 2. World Health
Organization (2016)
9. APPENDIX A Microscopic Procedures for Diagnosing Malaria
10. Bloland, P.B., Organization, W.H., et al.: Drug Resistance in Malaria. World Health Organiza-
tion (2001)
11. LeCun, Y., Bengio, Y., Hinton, G.: Deep learning. Nature 521(7553), 436–444 (2015)
12. Kaggle Malaria dataset
13. Umlas, J., Fallon, J.N.: New thick-film technique for malaria diagnosis. Am. J. Trop. Med.
Hyg. 20(4), 527–529 (1971)
14. Tilley, L., Dixon, M.W., Kirk, K.: The Plasmodium falciparum-infected red blood cell. Int. J.
Biochem. Cell Biol. 43(6), 839–842 (2011)
15. LeCun, Y., Bottou, L., Bengio, Y., Haffner, P.: Gradient-based learning applied to document
recognition. Proc. IEEE 86(11), 2278–2324 (1998)
16. Deng, J., Dong, W., Socher, R., Li, L.J., Li, K., Fei-Fei, L., Imagenet: a large-scale hierarchical
image database. In: IEEE Conference on Computer Vision and Pattern Recognition (pp. 248–
255). IEEE (2009)
17. Tan, M,. Le, Q.V.: Efficient net: rethinking model scaling for convolutional neural networks
(2019). arXiv preprint arXiv:190511946
An Online Path Planning with Modified
Autonomous Parallel Parking Controller
for Collision Avoidance
Naitik M. Nakrani and Maulin M. Joshi
Abstract In recent years, investigation of algorithms for autonomous vehicle design

is one of the significant fields of research. Autonomous parking is a challenging issue,
especially where traffic density is high, and people have to opt for parallel parking
than garage parking. The design of an autonomous parking controller generally does
not take into consideration nearby obstacles presence while maneuvering. The addi-
tion of an online path planning module can significantly improve the usability of
such a controller for real-time applications. In this paper, an angle correction mod-
ule is introduced that improves the standalone parking controller using ultrasonic
sensor information to generate optimized path planning and avoid collision. Simu-
lations results show the efficacy of the proposed work and support the design of the
angle correction module. This type of intelligent correction module will surely ease
the parking problem in a dense area and make parking safer, being collision-free
solutions.
1 Introduction
Parallel parking is one of the most challenging issues of maneuvering for the human
driver. The design of an autonomous parallel parking system for vehicles is even chal-
lenging because of many uncertainties present in the real world. It is tough to learn
human-like expertise for machines. Though research work is available on design-
ing a parallel parking controller, clear scope exists for a fully autonomous parking
algorithm using a machine learning approach that can mimic human intelligence.
In the literature generally, autonomous parking is termed as a standalone problem
where inputs are given to the controller from the current state, i.e., orientation or
location. It starts from a preplanned starting point and finishes within the parking
N. M. Nakrani (B)
Uka Tarsadia University, Bardoli, India
M. M. Joshi
Sarvajanik College of Engineering and Technology, Surat, India
e-mail: maulin.joshi@scet.ac.in
https://doi.org/10.1007/978-981-16-1502-3_41
404 N. M. Nakrani and M. M. Joshi
slot with endpoint and target orientation. However, the addition of extrasensory
information to such a system may promise safety and intelligence. Our work is
primarily focused on the improvement of typical path planning with the help of
additional ultrasonic sensors’ distance information. With this, a collision-free parallel
parking system can be visualized.
The most important part of the autonomous parking system is proper path planning
along which vehicle can move and reach to parking space. Many authors [1–13]
have discussed offline and online path planning. They have trained their system with
different types of curvilinear trajectory with non-holonomic constraints. Generally,
online path planning is a better choice because of its ability to adapt with continuous
environment sensing. Once path planning is properly designed, the next task is to
track along through path. Such steering action generally gets completed with machine
learning algorithms. A fuzzy logic theory provides a good choice as it has the capacity
to translate human linguistic intelligence into a rule base. In [14, 15], a fuzzy-based
parallel parking controller is developed and implemented with fifth-order polynomial
path planning. They have simulated reference path with multiple start points and
tested their fuzzy rule base for forward and reverse manner parking. However, the
drawback is that environment is assumed free from any possible collision with any
other objects. These make parking feasible with only fixed initial starting points for
parking and collision free. On the other hand, the practical world may have nearby
parked vehicles, infrastructure walls besides parking space. Such existing systems
can be improved with the integration of sensor information.
In our earlier work [16, 17], we discussed the autonomous parallel parking con-
troller and sensor-based navigation module for car-like mobile robots. In this paper,
a new steering angle correcting module is attached with a typical parking controller
which can start parking from any point and can reach to parking space without col-
lision and completes its parking once a feasible initial point for parking has arrived.
For environment sensing, ultrasonic, infrared, vision, sonar, LIDAR, etc. sensors are
used. Among them, ultrasonic sensing is an accurate and low-cost solution. It also
reduces the computational burden to controllers, LIDAR, etc. In our work, the ultra-
sonic sensor information is used by our angle correction module to make intelligent
decisions.
The organization of this paper is as follows: Typical path planning-based park-
ing controller limitation is discussed in Sect. 2. In Sect. 3, a distance-based angle
correction controller is introduced. The novel part of our work is also discussed in
this section. In Sect. 4, various scenarios are simulated in a confined environment to
visualize the application of work. Finally, the conclusions are given in Sect. 5.
2 Problem Description
Parallel parking is a type of autonomous parking where vehicle parks itself parallel
to the roadside, curb, and in between two parked vehicles. Generally, for any parking
algorithm, prerequisite is proper path planning between the initial and final location
An Online Path Planning with Modified Autonomous … 405
of a parking vehicle. It can be done in two ways: offline and online path planning.
In offline mode, the role of path planning begins from a point where the vehicle
has full knowledge of: its obstacle environment, its initial location, and its final
target. The task of offline path planning simply connects the initial position to the
final position, and then, the created path is followed by the vehicle. Path planning
is carried out simultaneously in online mode when (a) moving toward the target and
(b) perceiving the environment, including its modifications. For a static condition (or
slowly changing), offline path planning is often used. However, online path planning
must be used for dynamic environments, as the route must be adjusted according
to environmental changes. This method is sometimes important for traveling under
partially known environmental conditions, as the vehicle explores its parking area
when traveling and has to adjust the path according to any new information.
The typical scenario for autonomous parallel parking with fifth-order polynomial
path planning for forward and reverse parking is shown in Fig. 1a, b, respectively. The
reason for addressing the fifth-order polynomial path is that it generates nonlinear
paths taking care of non-holonomic constraints found in vehicle dynamics and found
suitable for parallel parking. Any machine learning approach using soft computing
technique generally takes care of the vehicles present state, i.e., postures, including
location and orientation. To accomplish path tracking for parking, it can work in a
free space environment, but practically, it has to take care of all the obstacles like
objects like a curb, corner, and side or other parked vehicles or infrastructure sides.
This fact points out the fact that just giving the only start and endpoints for parking
may result in a collision of the vehicle for specific environmental conditions.
A typical scenario visualized in Fig. 1 demonstrates justification for the problem
at hand (i.e., the requirement of environmental sensing) where a typical fifth-order
path is shown for two different start points for a vehicle and the same endpoint inside
the parking space. As shown, path I indicates that vehicle starts its parking from the
parking space. When it tries to execute its parking without the help of any sensing
mechanism, there may be chances that it will collide, as shown in the figure. At the
(a) (b)
Fig. 1 Typical scenario for a forward parallel parking, b reverse parallel parking
same time, a slightly different start point, e.g., path II as shown in Fig. 1, may give a
collision-free path. These cases highlight a limitation of the path planning approach
where typical start points will work well for a parking controller, which should not
be the case for practical implementation.
To overcome this limitation, we propose an online path planning mechanism incor-
porating the vehicle’s surroundings’ general sensing element and feedback mecha-
nism. This information can modify or correct the controlled output of the planned
parking controller to lead the vehicle to a posture from where all conditions for park-
ing are matched and make parallel parking feasible. This approach can eliminate the
limitation of a selection of starting point can be used for any start point selection.
In this paper, an online path planning approach, along with an ultrasonic sensor, is
discussed. An angle correction module is integrated with a parking controller so that
vehicle can change its motion path when the curb is present and parked itself without
collision.
3 Sensor-Based Online Parking System
In this section, we describe the development of an individual sensor-based feedback

module that can correct the steering angle of the vehicle computed by the parallel
parking controller. A general block diagram of such a modified system is shown in
Fig. 2.
Here, the core part of our system is a parallel parking controller, which is 2 input 1
output fuzzy system. It takes two distinct angle information, an angle with respect to
target and an orientation angle as an input for the controller. The output of the parking
controller is steering angle (φ1 ). In our earlier work [16, 17], the detailed design and
working of a parallel parking controller are already discussed. In addition to that con-
troller, an angle correction module is introduced with an ultrasonic sensor model as
shown in the block diagram. This angle correction module is a 3 input 1 output fuzzy
control system whose inputs are steering angle (φ1 ) computed by a parallel parking
controller and two sensor information, as shown in Fig. 1. Its output is the corrected
version of the steering angle (φ2 ), which is given to the vehicle for steering action.
Fig. 2 Block diagram of parallel parking with angle correction module

(a) (b)
Fig. 3 Sensor grouping for a forward parking, b reverse parking
The angle correction module used ultrasonic information to sense the map and
make an intelligent decision for the vehicle for appropriate change in the motion path.
To overcome the nature of the problem discussed in Fig. 1, the typical utilization of
sensors that is assumed to be mounted on the perimeter of the vehicle is shown in
Fig. 3. A total of nine ultrasonic sensors are presumed to be mounted for sensing
parking side map. As shown in Fig. 3a, only five sensors are utilized in the forward
way of parking, and similarly, another set of five sensors is being used in case of
reverse parking as per Fig. 3b.
To use this sensor information as an input for angle correction fuzzy system, these
ultrasonic sensors are grouped into two distances d1 and d2 . Here, the minimum
distance is considered as a grouped distance d1 and d2 . To cater specific need by
exploring the nature of parking, grouping can be modified as per requirement. The
detailed algorithm for calculating and grouping sensor information is also discussed
in our earlier work [16, 17].
These distances d 1 and d 2 are fuzzified into three membership functions near,
medium, and far as shown in Fig. 4a, and the steering angle as an output of a parallel
parking controller and angle correction module is having seven membership functions
like negative big (NB), negative medium (NM), and zero (ZE). The shape and range of
steering angle membership function are shown in Fig. 4b. Based on these membership
functions, a total 63 rule base is generated for angle correction fuzzy module.
Few samples from a behavior-based rule base based on different conditions are
given in Table 1. These rules are implemented for the angle correction module. It can
be observed that whenever distances measures obstacles are at a far distance, it keeps
the parking controller’s output unchanged. Hence, the vehicle continues to move as
per its parking path. At the same time, when any sensor detects any obstacle, say
d1, then depending upon the type of parking, it will correct the output of the parking
controller, as shown as collision avoidance in Table 1. Such fuzzy laws are structured
so that the car primarily changes its course of motion and drives smoothly to the
target if no collision is likely. If sensor data shows that there are obstacles in the
vicinity of the car, it must attempt to adjust its course in order to prevent collisions.
Fig. 4 a Distance membership functions, b steering angle membership function
Table 1 Fuzzy rule base for angle correction module

If Then
Fuzzy behavior Distance (d1 ) Distance (d2 ) Steering angle Steering angle
(φ1 ) (φ2 )
Target steer Far Far NS NB
Target steer Far Far ZE ZE
Target steer Far Far PS PS
Collision Near Med, far NB NS
avoidance
Collision Near Med, far NS PS
avoidance
Collision Near Med, far PS NS
avoidance
Collision Near Med, far PB PS
avoidance
To show the efficacy of our proposed angle correction module, simulation is pro-
vided in MATLAB software. A car-like mobile robot model used for our simulation
is discussed in this section. Also, parallel parking like environment is generated
that represents the challenge discussed earlier. An environment setup is thoroughly
discussed in a later section.
4.1 CLMR Model
As shown in Fig. 5, a car-like mobile robot model (CLMR) for simulation is con-
sidered. It has a four-wheeled system that is compatible with actual vehicles. The
Fig. 5 CLMR model
steering and the front side of the car are marked by the dotted circle between the
front wheels. The control parameters for this model are steering angle and rear-wheel
speeds. A car is limited to turning left and right on its front wheels, but they can stay
parallel.
The kinematics equations of the CLMR model are as follows:
θnew = θold + θ̇ × dt (1)
xnew = xold + v × cos(θnew ) × dt (2)
ynew = yold + v × sin(θnew ) × dt (3)
Equations (1), (2), and (3) are used to obtain a new position of the vehicle at each
instance.
4.2 Environment Simulation
In this section, simulation results are provided to support the angle correction fuzzy
system. A 20 m by 20 m MATLAB-based environment is created to similar to the
scenario shown as per Fig. 1. A car-like mobile robot (CLMR) with Length = 2.4 m
and width = 1.6 m is assumed. Total nine sensors are assumed and grouped into two
distances with minimum value into d1 and d2 as shown in Fig. 3. Single parking slot
scenario is assumed, and parking space is taken enough so that CLMR able to park
itself. The steering angle is assumed with respect to X-axis. The speed of CLMR
is assumed constant, and the environment surface is taken flat. The defuzzification
method used for all fuzzy systems is the centroid. Different case scenarios for forward
and reverse parallel parking is discussed.
Case 1: Feasible start point and success of typical parallel parking Figure 6a
shows the start and finish point for a vehicle to do a forward parallel park. Here, as
the vehicle starts very near to parallel parking, it will able to park itself very easily
without the use of an angle correction module. Figure 6b shows a continuous path
taken by CLMR during the case described in Fig. 6a. A similar scenario for reverse
parallel parking is shown in Fig. 7a, b.
(a) (b)
Fig. 6 a A case represents initial and final location of CLMR for forward parking, b a continuous
run sequence of CLMR in forward parking
(a) (b)
Fig. 7 a A case represents initial and final location of CLMR for reverse parking, b a continuous
run sequence of CLMR in reverse parking
(a) (b)
Fig. 8 Failed run sequence of CLMR with given start and finish point for a forward parking, b
reverse parking
Case 2: Failure of parallel parking (in absence of proposed angle correction

module) Figure 8 shows a different start point and the same final endpoint for forward
and reverse parallel parking. Here, the initial start point for CLMR is far away from
the parking space, and due to that, a path planned by the parking controller is also
stretched compared to the previous case. It is clearly visible that if the traditional
offline parking module (without the use of proposed module) is used for this case, it
will collide with the side of an obstacle that can be a curb or other parked vehicle.
Such failure continuous path for forward parking is also shown in Fig. 8.
Case 3: Parking along with angle correction module In this case, simulation results
are given for the case, described in Fig. 8 with the angle correction module. Because
here sensor information is incorporated to be used for angle correction module at
any instance vehicle will be very near to collision boundary, angle correction module
will correct its steering action temporarily as per the rules described in Table 1. When
CLMR approaches toward parking and one of the sensors detect the parking space,
angle correction module will allow parking to finish the rest of the task.
Figure 9a, b represents continuous sequence run of CLMR for forward and reverse
parking with modified path using angle correction module as per the scenarios taken
in Fig. 8a, b, respectively. It can be observed that using the angle correction module,
CLMR does not deviate much from the finish point. So the chance of malfunction
during path correction is very rare. It can be generalized for different dimensions of
vehicles.
5 Conclusion
In this paper, a new fuzzy-based angle correction is introduced to the existing solu-
tions with a standalone parking controller designed. Details of the idea and use of
ultrasonic sensor information are also presented. Simulation results show that the
(a) (b)
Fig. 9 Continuous run sequence of CLMR with angle correction module for (a) forward parking
(b) reverse parking
proposed work gives satisfactory results for forward as well as reverse parking sce-
narios. Results also demonstrate that introduction of correction of angle to CLMR
is able to modify its path during runtime and results in collision avoidance. This
makes the performance of parallel parking better, and in the future, one can work
with optimization of the number of sensors to improve the performance.
References
1. Lyon, D.: Parallel parking with curvature and nonholonomic constraints. In: IEEE Intelligent
Vehicles Symposium, pp. 341–346 (1992). https://doi.org/10.1109/IVS.1992.252283
2. Murray, R.M., Sastry, S.S.: Nonholonomic motion planning. Steering using sinusoids. IEEE
Trans. Automat. Contr. 38(5), 700–716 (1993). https://doi.org/10.1109/9.277235
3. Liu, W., Li, Z., Li, L., Wang, F.Y.: Parking like a human: a direct trajectory planning solution.
IEEE Trans. Intell. Transp. Syst. 18(12), 3388–3397 (2017). https://doi.org/10.1109/TITS.
2017.2687047
4. Jing, W., Feng, D., Zhang, P., Zhang, S., Lin, S., Tang, B.: A multi-objective optimization-based
path planning method for parallel parking of autonomous vehicle via nonlinear programming.
In: 2018 15th International Conference Control Automation Robot Vision, ICARCV 2018, pp.
1665–1670 (2018). https://doi.org/10.1109/ICARCV.2018.8581195
5. Zou, R., Wang, S., Wang, Z., Zhao, P., Zhou, P.: A Reverse Planning Method of Autonomous
Parking Path, pp. 92–98 (2020). https://doi.org/10.1109/acirs49895.2020.9162616
6. Laumond, J.P., Jacobs, P.E., Taïx, M., Murray, R.M.: A motion planner for nonholonomic
mobile robots. IEEE Trans. Robot. Autom. 10(5), 577–593 (1994). https://doi.org/10.1109/70.
326564
7. Paromtchik, I.E., Laugier, C.: Autonomous parallel parking of a nonholonomic vehicle. In:
Proceedings of Conference on Intelligent Vehicles, no. 33, pp. 13–18 (1996). https://doi.org/
10.1109/IVS.1996.566343
8. Paromtchik, I.E., Laugier, C.: Motion generation and control for parking an autonomous vehi-
cle. In: Proceedings of IEEE International Conference Robotics Automation, vol. 4, pp. 3117–
3122 (1996). https://doi.org/10.1109/robot.1996.509186
9. Gorinevsky, D., Kapitanovsky, A., Goldenberg, A.: Neural network architecture for trajectory
generation and control of automated car parking. IEEE Trans. Control Syst. Technol. 4(1),
50–56 (1996). https://doi.org/10.1109/87.481766
10. Müller, B., Deutscher, J., Grodde, S.: Continuous curvature trajectory design and feedforward
control for parking a car. IEEE Trans. Control Syst. Technol. 15(3), 541–553 (2007). https://
doi.org/10.1109/TCST.2006.890289
11. Kim, J.M., Il Lim, K., Kim, J.H.: Auto parking path planning system using modified Reeds-
Shepp curve algorithm. In: 2014 11th International Conference Ubiquitous Robotics Ambient
Intelligent. URAI 2014, no. Urai, pp. 311–315 (2014). https://doi.org/10.1109/URAI.2014.
7057441
12. Vorobieva, H., Glaser, S., Minoiu-Enache, N., Mammar, S.: Automatic parallel parking in tiny
spots: path planning and control. IEEE Trans. Intell. Transp. Syst. 16(1), 396–410 (2015).
https://doi.org/10.1109/TITS.2014.2335054
13. Du, X., Tan, K.K.: Autonomous reverse parking system based on robust path generation and
improved sliding mode control. IEEE Trans. Intell. Transp. Syst. 16(3), 1225–1237 (2015).
https://doi.org/10.1109/TITS.2014.2354423
14. Chang, S.J., Li, T.H.S.: Design and implementation of fuzzy parallel-parking control for a
car-type mobile robot. J. Intell. Robot. Syst. Theory Appl. 34(2), 175–194 (2002). https://doi.
org/10.1023/A:1015664327686
15. Li, T.-H.S., Chang, S-H.: Autonomous fuzzy parking control of a car-like mobile robot. IEEE
Trans. Syst. Man, Cybern. Part A Syst. Hum. 33(4), 451–465 (2003). https://doi.org/10.1109/
TSMCA.2003.811766
16. Nakrani, N., Joshi, M.: Fuzzy based autonomous parallel parking challenges in real time sce-
nario. In: Advances in Intelligent Systems and Computing, pp. 789–802 (2016)
17. Nakrani, N., Joshi, M.: An intelligent fuzzy based hybrid approach for parallel parking in
dynamic environment. Procedia Comput. Sci. 133, 82–91 (2018). https://doi.org/10.1016/j.
procs.2018.07.011
Real-Time Proximity Sensing Module
for Social Distancing and Disease Spread
Tracking
Sreeja Rajesh, Varghese Paul, Abdul Adil Basheer, and Jibin Lukose
Abstract Low energy proximity sensing devices are being used in our daily life for
various purposes. The concept of making a dedicated hardware module for measuring
the distance arose from this concept, so as to provide reliable and accurate measure-
ments for various applications. Analysing the need and severity of the present situa-
tion due to the spread of COVID-19, the proposed hardware and software architecture
can be tuned for the efficient practice of social distancing. It also provides an effec-
tive measure to track the disease spread by the integration of a secure database.
NTSA—a cryptographic algorithm that is specifically designed and developed to
run on low energy microcontrollers can protect the identity of every user. Since the
encryption is done by the embedded device, NTSA can ensure enhanced privacy
protection compared to any algorithm run on the server. This also ensures the reli-
ability of the collected data. The hardware module actively transmits and receives
signals from similar hardware modules. The proximity or distance between the two
modules is measured by analysing the signal strength received by each module. To
achieve disease spread tracking the users can track their status or level of exposure
on a scale of 4 and hence would provide a metric for having external interactions
like first-hand contact with COVID-19 patients, secondary contact, tertiary contact,
and so on.
1 Introduction
In the present age, rapid development is happening in the fields of augmented reality
and virtual reality applications. Generally, the spatial geometry of the environment
S. Rajesh (B)
Bharathiar University, Coimbatore 641046, India
V. Paul
CUSAT, Kochi, Kerala, India
A. A. Basheer · J. Lukose
Beurokrat Business Management Solutions, Thrissur, Kerala, India
https://doi.org/10.1007/978-981-16-1502-3_42
416 S. Rajesh et al.
is generated by the computer by applying machine learning or deep learning algo-

rithms to infer data from two-dimensional images. However, most of these algorithms
give unreliable results. The signal strength measured in decibels (dB) is converted to
metric units of length (cm) by calibration methods. For the purpose of effective social
distancing, thresholds are set at 200 and 150 cm. If the distance between 2 modules
is measured to be less than 200 cm and greater than 150 cm, an alert is triggered by
the module. If the distance is less than 150 cm and remains within this area for over
10 seconds, the NTSA encrypted ID of the hardware modules are exchanged and
stored in respective databases. The proposed NTSA algorithm is resistant to attacks
like brute force attack, equivalent key attack and exhibited Avalanche property, a
desired feature of a good security algorithm. The hardware module can be paired
with any mobile device by means of Bluetooth and the supporting software applica-
tion. The software application maintains the database of every interaction registered
by the hardware module. Data is stored as a graph, which makes it easier to identify
the level of exposure of the user to a COVID-19 patient. The entries have a lifetime
of 14 days after which the data is discarded protecting the privacy as well as making
sustainable use of resources. The proposed NTSA algorithm is a block symmetric
encryption algorithm. As we are aware that cryptography is an art of hiding secret
information from unauthorized users, it came into existence way back in 1900 BC and
was found inscribed in the main chamber of a tomb in Egypt [1]. The advancement
in technology and the drastic usage of the Internet led to many new cryptographic
algorithms for secure transmission of information. Symmetric and Asymmetric cryp-
tographic algorithms are the two-broad classification of cryptography [2]. Symmetric
algorithm is faster, less complex when compared to an asymmetric encryption algo-
rithm. This paper is structured as follows: Section 2 depicts the different literature
that helped in shaping the proposed work. Section 3 discusses the methodology of
the proposed system and the experiment results are discussed in Section 4. Section 5
concludes and gives light to the future scope of the system.
2 Literature Survey
With the drastic increase in the utilization of the Internet in our day-to-day life, the
importance of secure transmission of information has become our priority. Various
cryptographic algorithms were developed and the tiny encryption algorithm was
most widely used for more than a decade for its simplicity and ease of implementa-
tion. But TEA [3] suffered from equivalent key attack. Even though its descendants
XTEA [4] and XXTEA [5] could address the issues to some extent but resulted in
more complexity than TEA. Also TEA had better performance than other symmetric
encryption algorithms like DES [6], AES [7], IDEA [8], SEA [9], LEA [10], WAKE
[11], HIGHT, MARS, SERPENT, RC5, Blowfish, 3DES to name a few. The proposed
cryptographic algorithm NTSA is resistant to the attacks suffered by tiny encryp-
tion algorithms in addition to the improvement in terms of implementation and
performance.
Real-Time Proximity Sensing Module for Social … 417
3 Methodology of the Proposed System
3.1 Hardware
Real-time proximity sensing module, it is a compactly designed, low energy

consuming hardware system equipped with a microcontroller unit powered by a
Li-Po cell. The system holds an inbuilt storage/memory unit for data logging and
a transceiver module for wireless data transmission and reception. The transceiver
unit helps to broadcast the data and also scans for any other broadcasted data in the
vicinity of the device. The architecture of the device-hardware is depicted in Fig. 1.
Figure 2 is the graphical representation of transmission of signal and thresholds
at various perimeters. Say, ID1/User1 stays in the centre of a hall. ID2, ID3, ID4 and
ID5 users enter into the same hall. The concentric coloured rings around each user
represent the device signal range and the colorimetric representation is to convey and
alert on how close each user is with each other, when in their signal scan range. Green
coloured perimeter represents the safe distance and when moved closer towards the
user—enters yellow, orange and red zones accordingly. When in the orange zone
the users get notified regarding each other’s presence in their perimeter and red zone
marks that person has moved so close to the other person beyond the permissible
social distance to be maintained. This triggers the devices of users within threshold
distance, causing the device to generate an audio or visual output signal to catch
the attention of the user; and the necessary details of the users gets logged into the
memory and cloud database making record of the interaction. Later, if any of the
users updates the status as ‘infected with the disease’, the graph is traversed to find
and notify the users who made contact with the infected person.
It’s the compact, low power consuming design of the device makes it very much
suitable for the purpose of real-time proximity sensing and tracking, as the device
could be a wearable gadget. The device runs on 2.7–5 V with a current consump-
tion of a few milliAmps. The energy-efficient operating capability of both the data-
processing unit and the transceiver unit makes this happen, to have a long run in a
single charge.
3.2 NTSA Algorithm Integrated to MCU
The proposed NTSA (Novel Tiny Symmetric encryption Algorithm) is a block

symmetric encryption algorithm designed for secure transmission of information
through insecure medium. NTSA has a very simple structure and can be imple-
mented in both hardware and software. The inputs accepted by NTSA are 64-bit
plaintext and 128-bit keys. It uses 32 cycles where 2 rounds make one cycle hence
there are 64 rounds. The plaintext is split into two 32-bit blocks v0 and v1. The key
is partitioned into four 32-bit subkeys k0 through k3. Throughout 64 rounds subkeys
Fig. 1 Hardware architecture
k0 and k2 are kept constant wherein k1 and k3 are recomputed in each cycle. The
steps carried out while performing NTSA encryption are:
Step 1: Splitting the plaintext.
Step 2: Key partitioning.
Step 3: Initialization of key constant kc.
Step 4: Computation of Key schedule constant ksc.
Step 5: Computation of 32-bit v0.
Fig. 2 Depiction of devices signal strength and proximity scan perimeter overlapping
Step 6: Recomputation of partial key k1.

Step 7: Recomputation of kc.
Step 8: Computation of 32-bit v1.
Step 9: Recomputation of partial key k3.
Step 10: Repetition of steps 5 to 9 for 32 cycles or 64 rounds.
Step 11: return k1 and k3.
During step 1 of NTSA encryption process, the 64-bit plaintext is split into two
32-bit blocks v0 and v1, respectively. Step 2 involves partitioning a 128-bit key into
4 subkeys k0 through k3 each of size 32-bit. There are two constants involved in the
algorithm key constant kc and key schedule constant ksc. Key constant kc is initialized
to 0 in step3. Step 4 involves computation of key schedule constant wherein ksc =
(231 )/, where represents golden ratio whose value is 1.618033988749895. Steps
from 5 until 9 are repeated for 32 cycles or 64 rounds. In step 5, v0 is recomputed as
shown in Eq. 1.
v0+ = ((v1 4) AND k0) XOR (v1 AND kc) XOR ((v1 5) AND k1) (1)
In step6, keeping k0 constant, subkey k1 is computed as.
k1+ = k0 X O R xtract(v0)
where xtract() function returns value of array indexed by v0.

Step 7 involves computation of key constant kc = kc + ksc and Step 8 involves
computation of 32-bit v1 block as shown in Eq. 2
v1+ = ((v0 4) AND k2) XOR (v0 AND kc) XOR ((v0 5) AND k3) (2)
In step 9, keeping k2 constant, subkey k3 is computed as
k3+ = k2 X O R xtract(v1)
where xtract() function returns value of array indexed by v1.

The final value of k1 and k3 generated after the completion of 64 rounds will be
used for decryption. The NTSA Decryption process is the reverse of encryption.
The NTSA encryption and decryption incurs very less time when compared to
other symmetric encryption algorithms and due to the less memory utilization, it can
be easily incorporated in hardware devices with limitations in storage.
3.3 Software Architecture
Initially, the hardware module has to be paired with a particular user. The user details
along with the device ID are stored in a database. This process is achieved by means
of a mobile application which uses the Bluetooth of the smartphone to pair with the
proposed proximity sensing module. Once paired, the application prompts the user to
enter the user details which will be validated for authenticity. After successful regis-
tration or pairing, the module will show indication to notify the user that the device
has been successfully linked. Figure 3 shows device pairing and user registration. The
real-time application of the device specifies that the device actively monitors as well
as broadcasts a signal with the encrypted device ID. A protocol is established among
the proximity devices in order to communicate or recognize the signal received from
Fig. 3 Device pairing and user registration
a similar module. On detecting another proximity device, the firmware running on

the microcontroller initiates the distance measurement.
Three functions are specified in the firmware at three different threshold levels
based on the distance or proximity. The first 2 functions are triggered when the
module crosses 200 and 150 cm radius boundaries, respectively. These two functions
are handled at the client level, by providing visual, audio and haptic feedback in order
to alert the user. When the proximity crosses a threshold of 100 cm and stays within
the zone for over 30 seconds, the encrypted user IDs are exchanged and registered on
individual storage memory. This remains in the local storage of the hardware until
the device is synced with the smartphone and later it is erased from the local memory
as depicted in Fig. 3. Upon syncing the device, the information related to the device
interactions is uploaded to the cloud, where the secure information is decrypted and
displayed at the client side by means of the graphical user interface of the smartphone
application. This information is also logged in the cloud as a graph, for tracking the
interactions as depicted in Fig. 4.
Fig. 4 Data logged on the server stored in a graph

Every interaction is wiped from the cloud storage so as to reduce the consumption
of resources, hence making sure sustainable use of storage resources which would in-
turn cater to less energy consumption. For the purpose of disease tracking, a Breadth
First Traversal (BFT) algorithm is implemented as the priority is given for immediate
or primary contacts and the graph is traversed at a depth 5. The traversal is triggered
when the status of a node changes status from negative to positive, hence alerting
every node their level of exposure. Information about the patient is confidential and
will not be shared with any other users. This path can also be analysed to study the
behaviour patterns of the disease spread which will be very useful to take adequate
measures or develop new technologies to control disease spread.
Tiny Encryption Algorithm was used for many years to securely transmit information
through the insecure medium. It was found very efficient in terms of performance,
memory and resource utilization, etc. until it suffered from equivalent key attack.
The proposed algorithm NTSA had all the features of TEA and additionally was
resistant to all the attacks suffered by TEA. Also, NTSA was more efficient than
XTEA and XXTEA which are the successors of TEA. NTSA exhibits good avalanche
property which is a desirable feature for a good security algorithm wherein a small
change in the input shows a significant change in the generated cipher. Various
experiments were performed on TEA, XTEA, XXTEA and NTSA algorithms by
providing varying plaintext or key, and the time taken to perform encryption and
decryption was monitored. Figure 5a, b shows the encryption and decryption time
of inputs (plaintext: varying, key: 128 bits). It was observed that the time taken for
NTSA is less compared to other symmetric algorithms for performing encryption
and decryption, respectively.
Further Fig. 6a, b depicts the encryption and decryption time taken for NTSA
algorithm on 64-bit plaintext and 128-bit key.
Fig. 5 a Comparison of encryption time of NTSA with TEA. XTEA and XXTEA for key size of
128 bits. b Comparison of decryption time of NTSA with TEA. XTEA and XXTEA for key size
of 128 bits
Fig. 6 a Encryption time of NTSA with plain text 64 bits and key 128 bits, b decryption time of
NTSA with plain text 64 bits and key 128 bits
5 Conclusion
An effective measure to track the disease spread at a personal level hasn’t been imple-
mented yet. This may be due to the general stigma or the privacy issues faced by
the patients. Our primary focus was to address this problem by securing the personal
information with a novel cryptographic algorithm NTSA, which is designed to work
at embedded level. The device is a low-cost, power-efficient gadget that will aid
the users in maintaining effective social distancing and helps track the spread of
any kind of contagious disease. All the database updation and data sharing will
be through a secured cryptographic process to prevent breach on data privacy and
enhance security. Proper measures to structure and collect data of the human inter-
action and disease spread have been implemented, so as to provide some more data
for the research community to work with. The mentioned technology can have a
wide variety of applications. However, our primary focus was to work for a socially
relevant application.
References
1. Stalling, W.: Text Book: Cryptography and Network Security, Principles and Practices (2006).
Retrieved on 8 Dec 2006
2. Schneier, B.: Applied Cryptography, 2nd edn. Wiley, New York (1996)
3. Wheeler, D., Needham, R.: TEA, a tiny encryption algorithm. https://www.cl.cam.ac.uk/ftp/pap
ers/djw-rmn/djw-rmn-tea.html; https://www.cix.co.uk/~klockstone/tea.pdf. Accessed 21 May
2007
4. Needham, R.M., Wheeler, D.J. (1997). TEA extensions. Technical Report, Computer Labora-
tory. Cambridge: University of Cambridge
5. Wheeler, D., Needham, R.: XXTEA: correction to XTEA. Technical Report, Computer
Laboratory. University of Cambridge (1998)
6. Tang, H., Sun, Q.T., Yang, X., Long, K.: A Network coding and DES based dynamic encryption
scheme for moving target defense. IEEE Access 6, 26059–26068 (2018). https://doi.org/10.
1109/ACCESS.2018.2832854
7. Banik, S., Bogdanov, A., Regazzoni, F.: Atomic-AES: a compact implementation of the aes
encryption/decryption core. In: Dunkelman, O., Sanadhya, S.K. (eds) INDOCRYPT 2016,
10095. LNCS. Springer, Heidelberg, pp. 173–190 (2016). https://doi.org/10.1007/978-3-319-
49890-4_10
8. Hoffman, N.: A simplified IDEA algorithm. Cryptologia 31(2), 143–151 (2007)
9. Standaert, F.X., Piret, G., Gershenfeld, N., Quisquater, J.J.: SEA: a scalable encryption algo-
rithm for small embedded applications. In: Workshop on RFID and Light weight Crypto, Graz,
Austria (2005)
10. Choi, J., Kim,Y.: An improved LEA block encryption algorithm to prevent side-channel attack
in the IoT system. In: 2016 Asia-Pacific Signal and Information Processing Association Annual
Summit and Conference (APSIPA), Jeju, pp. 1–4 (2016). https://doi.org/10.1109/APSIPA.
2016.7820845
11. Abdullah, D., et al.: Super-encryption cryptography with IDEA and WAKE algorithm. In: 1st
International Conference on Green and Sustainable Computing (ICoGeS) 2017. J. Phys. Conf.
Ser. 1019, 012039 (2018)
12. Ramakrishna Murthy, M., Murthy, J.V.R., Prasad Reddy, P.V.G.D, et al.: Homogeneity sepa-
rateness: a new validity measure for clustering problems. In: International Conference and
Published the Proceedings in AISC and Computing. Springer (indexed by SCOPUS, ISI
proceeding DBLP etc), vol. 248, pp. 1–10 (2014). ISBN 978-3-319-03106
Automatic Depression Level Analysis
Using Audiovisual Modality
Aishwarya Chordia, Mihir Kale, Mukta Mayee, Preksha Yadav,

and Suhasini Itkar
Abstract Depression is a mental disorder which is quite common in today’s mod-

ern world. Depression has a severe impact on a person’s mood, feelings and health.
For early detection and recognition of depression, use of the computer-vision field
is found to be prominent. We have proposed an automated system using ML tech-
niques to automate the process of depression analysis. The system is able to predict
depression on Beck Depression Inventory (BDI-II) scale ranging from 0 to 63 by
using audio-visual expressions. The video is segregated into two streams: visual
and audio. In the visual stream, all the frames are extracted from the video and are
preprocessed according to the pre-trained VGG-Face model. Further, the existing
Feature Dynamic History Histogram (FDHH) algorithm is modified to capture all
the patterns and applied on consecutive frames to extract dynamic features from the
feature vector. Singular Value Decomposition (SVD) is applied for dimensionality
reduction followed by regression to predict the depression level for visual stream.
Mel-frequency cepstral coefficients (MFCCs), zero-crossing, and short-term energy
features are extracted from the audio. Dynamic features are extracted by subtracting
the components of the consecutive frames. The final feature vector is obtained by
making short audio segments and regression is applied on each segment to predict the
depression level of the audio stream. Finally, predictions from both the streams are
combined by applying decision level fusion technique to predict the final depression
level. This system has the best performance on depression level prediction on AVEC
2014 dataset, in comparison with all the existing methods.
1 Introduction
Depression is a mental disorder which is quite common in today’s modern world [1].
Any mental or behavioural pattern which leaves a person in torment can be referred
to as a mental or psychiatric disorder. The distinct causes of depression are biological
causes, stress, social factors and lifestyle, influence of family, sociocultural factors
and drug or alcohol addiction.
A. Chordia (B) · M. Kale · M. Mayee · P. Yadav · S. Itkar

PES Modern College of Engineering, Pune, Maharashtra, India
https://doi.org/10.1007/978-981-16-1502-3_43
426 A. Chordia et al.
Recent study [2] indicates that for non-fatal health loss, depressive disorders are
the single largest contributor. 322 million people in the world suffer from depres-
sion, out of which South-East Asia Region and Western Pacific Region contributes
to almost half of them. According to Global Burden of Disease Study 2017 [3]
depressive disorders were one of the leading causes for both male and female in
2017.
Although depression has severe effects on a person’s life, it can be cured in sev-
eral ways such as medication, physical therapy and psychotherapy. As the number of
patients with depressive disorders increases, it puts an excessive load on doctors to
diagnose the patients with accurate degrees of depression, therefore lack of long-term
follow-up can be considered as a serious limitation for this diagnosis. In order to deal
with this limitation, need for an automated and rigorous diagnosis is necessary. Even
after diagnosis of depression, recognizing the need of treatment is important. Accord-
ing to [4], high-income countries (64.9%) have greater recognition as compared to
upper-middle-income countries (52.2%) and low-/lower-middle-income countries
(34.6%) have significantly lower recognition of need for treatment. They stated that
only a few people with major depressive disorder (MDD) received minimally ade-
quate treatment.
Recently, a lot of research has been going on for the study of automatic assess-
ment of mental health. For early detection and recognition of depression, use of the
computer-vision field is found to be prominent. Lately, to automate the assessment
of depression, machine learning and deep learning methods are being used to learn
human behaviour related to depression. Face is a vital part of the human body to
express emotions. Research was done on facial movements and it was found that
the face depicts accurate information about the emotional aspects [5]. A system was
developed for expression recognition on the upper face based on FACS using Hid-
den Markov Models(HMM) [6]. Research states that not only the face, but also the
body movements can be used in detection of depression. The process involved in
the recognition includes relative orientation and radius of the body parts which was
detected using the pictorial structured framework [7].
For automating the process of depression analysis, deep learning methods are
popularly being used nowadays. The most common deep learning method used for
visual modality is Convolutional Neural Network (CNN) [8]. CNN is considered to
be a class of deep neural networks which is used to handle spatial data such as images.
Applications of CNN are largest image classification dataset (ImageNet), computer
vision, natural language processing (NLP), face recognition, etc. Pre-trained CNN
is a network which is trained on large dataset for specific purposes. Example of
pre-trained CNN model is VGG-Face which is used for recognition [9].
Audio/Visual Emotion Recognition Challenges (AVEC) is a competition in which
they provide a dataset to participants for analyzing depression and emotion recog-
nition. Participants provide solutions by using machine learning methods for auto-
matic audio-visual emotion analysis. Till date, AVEC has conducted nine challenges (
AVEC 2013 [10], AVEC 2014 [11], AVEC 2015 [12], AVEC 2016 [13], AVEC 2017
[14], AVEC 2018 [15], AVEC 2019 [16]), AVEC 2019 being the recent one. The
aim of this paper is to implement an artificial intelligent system that can achieve the
Automatic Depression Level Analysis . . . 427
best performance on depression level prediction, in comparison with all the existing
methods on the AVEC 2014 dataset. This system has many applications such that it
can incorporate cognitive capability in robots to automatically recognize a human’s
mental state.
The main contributions of this paper are : (1) Deep features using VGG-Face
and dynamic features using Feature Dynamic History Histogram (FDHH) algorithm
are extracted from visual data followed by feature selection which are then given to
regression for prediction. (2) Audio features using Mel-frequency cepstral coefficient
(MFCC), zero-crossing, and short-term energy are extracted from audio data. From
these audio features, dynamic audio features are extracted using the proposed method
Audio Dynamic Feature Extraction (ADFE). Separate regression is applied on each
segment to predict the BDI level. (3) Prediction level fusion is applied on both the
modalities to predict the final BDI level.
2 Related Work
In the last 10 years, various methods and approaches for automatic depression assess-
ment based on visual cues have been proposed. In the research field of machine vision,
automatic recognition of facial features is becoming an intense area of interest in the
field of computer vision. In order to recognize facial expressions from static face
images, an automated system is developed by Pantic and Rothkrantz [17]. Contours
of facial components like eyes and mouth are extracted and from the extracted con-
tours, feature points of the contours are extracted. 32 AU (Action Units) which appear
either in combination or alone are recognized. Behavioral changes can be seen dis-
tinctly in depressed patients. Changes in facial movements are proven effective in
depression detection. A study was undertaken by Al-Gawwam et al. [18] to detect
depression according to the eye blink feature. In the proposed system features such
as eye blink per minute, blink amplitude and blink duration are extracted. These
features are then classified to classify the subject to be depressed or non-depressed.
The system was tested on datasets such as AVEC 2013, AVEC 2014. The above
have achieved good accuracy on both the datasets. Various algorithms for visual
feature extraction, dimensionality reduction and approaches of classification and
regression are implemented. A quantitative analysis of these methods is done by
Pampouchidou et al. [19], and accordingly, the results are shown. During the visual
feature extraction, features are extracted from full face, AUs ( Action Units), facial
landmarks mouth/eyes and heart rate. Feature landmarks are extracted. Variability of
facial expressions is measured using AU. Features extracted individually from mouth
and eyes contribute greatly. Blinking rate and pupil dilation are reported for the eye
region. Out of various classification algorithms, SVM gave the best performance,
whereas SVR (Support Vector Regression) gave the best accuracy.
A study was conducted by Dr. Venkataraman and Parameshwaran et al. [20] to
detect depression among students using facial features. In this study, the frontal faces
of students are captured and facial features are extracted from each frame while they
are answering different questionnaires. These facial features are classified into happy,
contempt and disguised faces using SVM classifier. The face detection required for
this study was done with the Viola-Jones face detection algorithm. To achieve this
system was developed by Meng and Pears al. [21] to overcome the limitations of
Motion History Image (MHI). They proposed a new method called Motion History
Histogram (MHH) to capture dynamic information of the video. The classification
was improved with a combination of MHH and MHI and further processed by a
support vector machine (SVM) to give the final result. The proposed representation
is improvisation of the previous method, the improvising is done by storing additional
frequency information at every pixel. The study has a good performance over a large
public human action database.
Audio can also be used for depression level analysis. Yang et al. [22] studied
the effect of quantitative features of vocal prosody on depression severity. They
concluded that change in depression severity divulged by combination of F0 and
switching pauses. As vocal prosody is a powerful measure not just that but other
vocal features are also useful. Mitra et al. [23] explored various features such as
estimated articulatory trajectories during speech production, acoustic characteristics,
acoustic-phonetic characteristics and prosodic features. Support vector regression, a
Gaussian mixture model and decision trees are applied on the above features. They
showed comparative results of effects of various features on depression analysis.
According to them, Damped Oscillator Cepstral Coefficients showed better results.
For extracting handcrafted features a large amount of effort in terms of domain
knowledge and labor is required which is quite time-consuming. Recently, deep learn-
ing techniques provide solutions to the above difficulties. For improving the method
of automatic depression analysis using audio features He and Cao [24] proposed
a method which combined deep learning and traditional methods. Deep Convolu-
tional Neural Networks (DCNN) is implemented to extract deep learning features
from spectrograms and raw speech waveforms. Median robust extended local binary
patterns (MRELBP) are extracted manually from spectrograms. For enhancing the
depression recognition performance, Joint fine-tuning layers are created to combine
the handcrafted features and deep learning-based features. Lang He also stated that
this method showed better performance on both AVEC 2014 and AVEC 2013 dataset
of depression analysis.
Further research proved that systems consisting of both audio and visual features
helped advance the computer vision field and one of the methods was proposed by
Jan et al. [25] in which Motion History Histogram (MHH) was used along with
the audio features. The dataset used in the system was AVEC 2014 which provides
several audio features like spectral low-level- descriptors and MFCC 11-16. For
visual processing a new method, MHH for 1D features was proposed based on a
previous MHH for 2D feature. The combined features of audio and visual are tested
on Partial Least Square regression and linear regression separately and combined to
give the final depression level. The combined method achieves good results on the
used dataset.
Deep learning techniques are also used for extracting visual features which are
beneficial for recognizing depression level. Chao et al. [26] proposed a model for
depression analysis for both the modalities. They extracted facial features using CNN,
face shape features using OpenCV Viola-Jones and audio features using YAAFE tool-
box. SVD dimensionality reduction technique is applied on the individual features
and then combined at a multimodal fusion layer. The multimodal feature sequence
is then provided to LSTM-based neural network.
Jan et al. [27] proposed an automated artificial intelligent system, which uses two
modalities audio and visual for depression level prediction. They used a VGG-Face
pre-trained model for visual feature extraction. They proposed a method, Feature
Dynamic History Histogram(FDHH) to extract dynamic features for visual. And for
audio, they extracted Mel-frequency cepstral coefficients (MFCC) features. These
features are then combined using feature level fusion techniques. They applied Prin-
cipal Component Analysis(PCA) Dimensionality technique to reduce dimensions of
fused feature vectors and performed Partial Least Square (PLS) and Linear regres-
sion (LR) to map it with BDI level. This system achieved good performance on the
AVEC 2014 dataset.
Although this system is efficient, few drawbacks of this approach are, for visual
processes, the patterns considered are not sufficient enough to make an accurate
prediction. The results can be further improved if more such patterns are taken. In
the above approach of the audio process, mean of the segments were taken which does
not take into consideration the change in features for each segment. They extracted
only MFCC features which are considered for the predictions, but incorporating other
features can improve the results. The motive of this paper is to develop an automated
system which can achieve better performance than all the existing ones on AVEC
2014 Dataset. Improvement will be made in both audio-visual streams as well as
fusion and prediction techniques.
3 Framework
According to the study, it is observed that there is a significant change in human’s

facial and vocal expressions of a depressed person than that of a normal person. These
human expressions can effectively contribute towards depression level prediction. A
new method is developed which utilizes dynamic visual and vocal features of a person
to automatically predict his depression level.
3.1 Overview
For the visual process, the video is broken down into frames and each frame is
preprocessed. Visual features are extracted using the deep learning technique for
every frame. After normalization, FDHH algorithm is applied to get the patterns.
Then the patterns are converted into one single vector to get the final feature vector
for a single video sample. The dimensionality of the features is reduced using SVD
and linear regression is applied to get BDI value. For the audio process, audio data
in which audio is separated from the video. Audio features are extracted followed by
dynamic features. These features are converted into various segments and on each
segment regression is applied. Final audio BDI value is obtained. Then both the
streams predictions are combined by applying prediction level fusion to get the final
BDI prediction.
3.2 Visual Module
Figure 1 demonstrates the extraction of visual features using deep learning tech-
nique after which dynamic features are extracted and reduced using dimensionality
reduction technique and given to regression to predict BDI level.
Pre-processing Pre-Processing of data is a vital technique that involves transform-
ing raw data into an understandable format. In order to improve the performance
of machine-learning algorithms, pre-processing offers solutions which help to accu-
rately detect the outliers and missing values in all kinds of large datasets [28]. So
necessary preprocessing steps are applied on the dataset.
Deep Features Extraction VGG-Face: We have utilized VGG-Face, a pre-trained
model for feature extraction. VGG-Face is one of the most popular and widely
used networks for face recognition in which 2.6 M facial images are trained for
the application of face recognition. VGG-Face is more suited for depression analysis
tasks as compared to other networks because here, we are dealing with facial images
as opposed to objects from the ImageNet dataset. VGG-Face [9] contains a total of
36 layers. For facial feature extraction, we have used layer 32 as it gives the best
results with 4096 dimensions.
Modified FDHH algorithm FDHH(Feature Dynamic History Histogram) has been
used previously for dynamic feature detection [27]. A new special condition is added
which was missed by the previous algorithm. As the algorithm counts the pattern
only if ‘0’ is encountered, there is a condition such that if the count of CT ≥ M and
the sequence is completed the algorithm will move on to the next sequence without
counting the last pattern. To overcome this limitation a new condition is added, that
is if the component in the last frame is scanned to be ‘1’ then CT is checked, if CT
≥ M then Pm is updated else the algorithm is skipped to the next sequence.
Feature Selection Feature selection is used to reduce the features. It can be done by
removing irrelevant noisy and redundant features from the feature space and selecting
Fig. 1 Architecture diagram

a subset of features with which best performance can be achieved. As proclaimed by

Blum and Langley [29] Feature selection comprise of four main components which
are:
• Starting point of feature selection
• Search procedure
• Evaluation function
• Criterion for stopping search.
In the proposed system, the patterns are extracted up to M = 10. Features are selected
according to their single and combined performance on the data. From the experi-
mental results, the subset of features consisting of features 2, 6, 9 and 10 is found to
be the best subset to achieve the maximum accuracy on the system.
Singular Value Decomposition Dimensionality reduction helps to improve the per-
formance of the system by reducing the features or representing the features in a
lower dimensional space. Singular value decomposition is the technique that can be
used to reduce the dimensionality in which higher dimensional data is represented
into a lower dimensional space while retaining important information. SVD also has
a feature of restoring the original matrix M which was decomposed into U, S and
V. Each of the singular values in diagonal matrix S can be used to understand the
amount of variance. This is used in the proposed system to represent the final feature
vector of the visual process in lower dimensional space and decorelate the features.
99 dimensions are retained in the data.
Regression Linear regression finds its use in various practical applications because
models which depend linearly on their unknown parameters are easier to fit than
models which are non-linearly related to their parameters. We have performed linear
regression on both the modalities, that is audio and visual and prediction level fusion
is done to predict the final depression level.
3.3 Audio Module
Figure 2 demonstrates the process for audio data in which audio is separated from
the video. Features such as Mel-frequency cepstral coefficients, zero-crossing, and
short-term energy are extracted from the audio data. Dynamic features are extracted
by taking difference of the 2 consecutive frames. These features are converted into
various segments and on each segment regression is applied.
Features Extraction An individual’s voice speaks a lot about their emotions, person-
ality, mood, identity and other unique factors which are useful for voice recognition
and other audio signal processing tasks. These audio features can also be useful in
depression level analysis tasks [30]. For audio modules, audio is separated from the
video provided by AVEC2014 dataset. According to the comparative study of several
combined audio features and MFCCs in [27], their results show that MFCC is the
Fig. 2 Architecture diagram
most dominant feature which is individually sufficient for recognizing depression.

Our experiment shows that combining MFCCs with few more audio features such
as zero-crossing rate and short-term energy will enhance the overall performance.
• MFCCs:
The most used feature in audio processing is MFCCs [31], Which are based on
human ear scale and lower dimensions. These coefficients use a nonlinear frequency
scale which is based on human auditory perception, that is Mel scale. MFCC usually
provides 0-20 coefficients from which for our experiment we selected 16 coefficients.
• Zero-Crossing Rate:
When the sign of a mathematical function changes from positive to negative it is
said to be a zero-crossing point. Zero-crossing rate is a count of the number of times
the signal waveform crosses the amplitude line. ZCR is used to distinguish between
audio classes such as noise, silence and speech [32]. For each analysis window, ZCR
can be calculated using Eq. (1) :
N −1
1
ZCR = |sgn [xi (n)] − sgn [xi (n − 1)]| (1)
2N n=0
where, N is total number of samples in a processing window, x(n) is the value of

nth sample, sgn() is the sign function, i.e., Eq. (2)

1 if xi (n) ≥ 0
sgn [xi (n)] = (2)
−1 if xi (n) ≤ 0
• Short Time Energy (STE):

Energy is the notable attribute according to human Auditory perception. Energy of
speech signals vary over time in nature. It is also referred to as volume, loudness,
intensity of speech signal [43]. The total energy is evaluated using Eq. (3):
∞

STE = s 2 (n) (3)
n=−∞
Dynamic Feature Extraction While extracting above audio features frames are
generated. These frames are with respect to time domain so considering adjacent
frames will provide useful emotional characteristics which are changing over time.
All these changes which are the dynamic features are beneficial for predicting depres-
sion level of the speaker. To enhance the results we calculated dynamic features using
previously extracted features MFCC, ZCR, STE.
The Dynamic Feature Extraction process is as follows:
• Step 1: Read the extracted MFCC, ZCR and STE features of audio.
• Step 2: Combine these extracted features and form a final feature vector
• Step 3: Calculate the difference of all the features from the combined feature vector
of Adjacent frames.
• Step 4: Perform normalization at different scales on each feature of above differ-
ence output vector.
Segment-Wise Regression The next step after dynamic feature extraction is applying
regression to map the extracted features with given BDI-II scales. Dataset provided
videos are of different length, so while converting feature vectors into same dimen-
sions, we may lose certain important features. So instead of using full feature vector,
we divide the vector into small segments containing a particular number of frames of
each feature. We considered different numbers of frames per segment for evaluating
results of regression. According to these results, we selected an optimal value 16 as
the number of frames per segment. We generated a number of segments consisting
of 16 frames of each feature according to length of videos. Every single segment is
given as a sample to the linear regression for mapping it with respective BDI-II scale.
All the predictions generated are then aggregated to generate a single BDI value for
a video.
Prediction Level Fusion As a system output we require a single depression level
to get this we used a technique for prediction level fusion. As we want to keep the
efforts of both audio and visual modalities they are linearly fused together using
weighted sum rule to aggregate their predictions. The Rule applied is as shown in
Eq. (4)
Sfusion = w1 s1 + w2 s2 (4)
where, w1 w2 are weights for each modality, s1 are predictions from visual modality,
s2 are predictions from audio modality
4.1 AVEC 2014 Dataset
The approaches we have proposed are performed on the Audio/Visual Emotion Chal-
lenge (AVEC) 2014 dataset, a subset of audio-visual depressive language corpus
(AViD-Corpus) which is used for depression sub-challenge [16]. AVEC2014 uses
only 2 tasks for evaluation of depression which are referred as Freeform and North-
wind tasks. The task includes 2 human-computer interaction tasks recorded by micro-
phone and web-cam. Some subjects appear in more than one clip and the length of
these clips is between 6 s to 4 min and 8 s. The participants are recorded between one
to four times with a gap of two weeks between each recording. For both the tasks,
the recorded videos are split into 3 partitions: training, development and test of 50
videos each, thus a dataset containing a total of 300 video clips. In our system, we
merge the training and development set from both Freeform and Northwind data as
one training set. The performance is measured for video clips from the test set. The
BDI-II depression scale ranges from 0 to 63 where
• 0–10—normal mood
• 11–16—mild mood disturbance
• 17–20—mild depression
• 21–30—moderate depression
• 31–40—severe depression
• Over 40—extreme depression.
4.2 Experimental Setting
The experiment is tested on a dataset provided by AVEC challenge. The baselines

are provided by [11]. The aim is to predict the BDI level by using the given dataset.
Data Pre-processing As the data is given to a pre-trained model, the pre-processing
steps are necessary in order to ensure the optimal features. The features are extracted
by inputting a single frame at a time to VGG-Face pre-trained network. The frames
were resized to 227 * 227 * 3 before giving them as input. Also the mean image
is subtracted. After following these steps, the frame is inputted to the network. In
order to extract audio from video provided by AVEC2014, we used FFmpeg software
suite. Librosa is a library used for extracting audio features that requires a wav file
as input. Wav file is generated.
Feature Extraction The deep features for the visual process are extracted with the
help of a pre-trained model which is provided by rcmaill on GitHub. The library and
the related information will be available on the specified GitHub repository [33]. For
each frame in the video deep features are extracted. Total 4096 features are extracted
from the 32nd layer of the VGG-Face network.
While extracting the dynamic features the value for M is taken to be M = 10. The
threshold value is set to T = 0.00392. Feature selection is applied on the respective
patterns. The number of patterns is chosen according to their individual performance
on the system and analyzing experimental results. According to the output of feature
selection, patterns 2, 4, 6, 9 are chosen for the further process. The dimensions for
each pattern is 1 * 4096, 4096 being the number of components therefore the total
dimensions of the 4 patterns would be 4 * 4096 = 16,384 features per single video
sample. As each subject has 2 videos (northwind and freeform) total 32,768 features
are extracted for the final feature vector.
Librosa Library is the most preferred python package for audio analysis. It contains
feature extraction as a submodule which includes low level feature extraction such
as MFCC, ZCR, STE and many more methods. It also provides feature manipulation
methods.
As the video provided by the AVEC2014 is recorded at a sample rate of 44,100 Hz
and hop size of 512. So for every 1 s 86 frames are generated by using formula
(sec * sample rate)/Hop size, so for 1 s 1 * 44,100/512 = 86 frames. For every feature
total frames are generated depending upon video length. As we extracted 3 different
features that are 16 MFCCs, ZCR, and STE, so total dimension of feature vector
for 1 video is 18 * frames. As mentioned earlier dataset has two tasks freeform and
northwind so the combined feature vector will be of 18 * (frames of Freeform +
frames of Northwind) dimensions.
For dynamic feature extraction, every consecutive frame is subtracted for each
feature, So the resultant feature vector will be of 18 * (frames of Freefrom + frames
of Northwind − 1) dimensions. To eliminate the differences in numerical value in
each feature of the final feature vector of differences, it is then normalized.
Before applying regression we generated segments containing 16 frames per fea-
ture. So the segment dimension will be 18 * 16 (i.e., 16 MFCCs, ZCR and STE).
Every individual segment is considered as a sample for regression. All segments of
that video are mapped with the same BDI-II scale. For obtaining the best result the
weights are optimized by observing the performance of audio and visual modalities.
4.3 Performance Comparison
For measuring accuracy of a system, two most common metrics used are Mean
Absolute Error and Root Mean Square Error.
Starting with best performing Uni-modal audio, Table 1 demonstrates the per-
formance of dynamic features (DF) of Mel-frequency-cepstrum coefficients fea-
tures (MFCC), zero-crossing rate (ZCR), and short-term energy (STE) followed by
segment-wise linear regression (LR) to map the feature vector with provided BDI-II
scale. Results show that audio modules RMSE and MAE are 9.9 and 9.7 on the
development set and 9.3 and 9.0 on the test set, respectively.
Table 2 depicts the performance of visual modality by applying modified FDHH
algorithm on deep features extracted from VGG-Face (denoted by VGG-F) and
Table 1 Performance measure of audio stream

Method Develop Test
RMSE MAE RMSE MAE
DF (MFCC + ZCR + STE) + LR 9.9 9.7 9.3 9.0
Table 2 Performance measure of visual stream

Method Develop Test
RMSE MAE RMSE MAE
FDHH(VGG- 9.22 7.14 9.4 7.7
Face) +
LR
Table 3 Performance measure of combined model (Audio + Visual)

Method Develop Test
RMSE MAE RMSE MAE
Visual + Audio 9.11 7.42 8.88 7.18
features are selected based on their individual performance, RMSE of individual

pattern were used for evaluation and the best performing patterns were selected and
then linear regression (LR) was applied on it to map it with BDI-II scale.
Fig. 3 Comparison graph

Table 4 System performance using audio and visual modality

Method System Testdata
RMSE MAE
System (Visual + Audio) 7.7 5.2
Table 5 Performance comparison against other approaches of audio stream

Method Develop Test
RMSE MAE RMSE MAE
Baseline [11] 11.52 8.93 12.567 12.567
Jan [27] 10.92 8.86 10.28 8.07
Mitra et al. [23] 7.71 6.10 11.10 8.83
Jan et al. [25] 10.69 8.92 11.30 9.10
Chao et al. [26] 11.16 8.94 10.61 8.70
Our method 9.9 9.3 9.7 9
These two models audio and visual are then combined using prediction level
fusion technique, i.e., weighted sum rule. The results for the same are shown in
Table 3.
Figure 3 illustrates the system performance by comparing the predicted depression
level from combined audiovisual modality and the actual depression level values
provided by the dataset.
Table 4 shows the performance of the proposed standalone system which was
trained using 90% of the AVEC4014 Dataset (i.e., training set, development set and
some of test set). The system is tested on the remaining 10% of the dataset and the
results are remarkable in terms of RMSE and MAE both.
Table 5 shows performance comparisons of performance of audio modality with
other paper’s performance on only audio modality including baseline. We can con-
clude by the comparison that our proposed audio modality gives better results in
terms of RMSE for both development and test set.
5 Conclusion
In this paper, an automatic system is proposed to predict the depression level in

human beings according to their visual and vocal features extracted from the video
recordings. The system consists of two modalities. In visual processing, deep features
are extracted from the facial expressions. Modified FDHH algorithm is applied to
extract the dynamic features. SVD is used to reduce the dimensionality of the dynamic
features, and finally, regression is applied to predict the final BDI level. In audio
processing MFCC, zero-crossing and energy features are extracted and dynamic
features are obtained from them. The extracted dynamic features are divided into
smaller segments which are further given for regression separately to predict the
BDI level. Output for all the segments is combined to give a single final predicted
value for the audio stream. Predicted values from both the streams are combined
by decision level fusion and single value for each subject is predicted. The results
for the multimodal approach were better than most of the existing systems. The
results of audio approach were remarkable in comparison with the existing unimodal
approaches.
A multimodal system is developed which gives better performance on the devel-
opment set than the baseline result and the previous state of art result. There are
certain limitations of this system which can be improved to further increase the per-
formance of the system. The basic limitation of the system is, the BDI level given
by the dataset is the response to a certain questionnaire and therefore the scale can
certainly be related to the questions itself and may not be the present depression level
of the patient.
The performance of the system can be further improved if the VGG-Face network
is re-trained by adding more data. Other dimensionality reduction techniques can be
considered to improve the results.
References
1. Marcus, M., et al.: Depression: A global public health concern (2012)

2. Depression and Other Common Mental Disorders (2017)
3. Global, regional, and national incidence, prevalence, and years lived with disability for 354
diseases and injuries for 195 countries and territories, 1990–2017: a systematic analysis for the
Global Burden of Disease Study 2017. vol. 392 (2018)
4. Thornicroft, G. et al.: Undertreatment of people with major depressive disorder in 21 countries.
Br. J. Psychiat. (2017)
5. Girard, J.M., et al.: Social risk and depression: Evidence from manual and automatic facial
expression analysis. In: IEEE International Conference on Automatic Face and Gesture Recog-
nition (2013)
6. Lien, J.J., et al.: Automated facial expression recognition based on FACS action unit. IEEE
(1998)
7. Kaletsch, M., et al.: Major depressive disorder alters perception of emotional body movements.
Frontiersin (2014)
8. Al-Zawi, S., Albawii, S., Mohammed, T.A.: Understanding of a convolutional neural network.
ICET (2017)
9. Zisserman, A., Parkhi, O.M., Vedaldi, A.: Deep face recognition. Visual Geometry Group
Department of Engineering Science University of Oxford (2015)
10. Valstar, K.M., Schuller, B.: AVEC 2013—The continuous audio/visual emotion And depression
recognition challenge. ACM (2013)
11. Valstar, M., et al.: AVEC 2014—3D dimensional affect and depression recognition challenge.
ACM (2014)
12. Ringeval, F., et al.: AVEC 2015—The 5th International Audio/Visual Emotion Challenge and
Workshop. ACM (2015)
13. Valstar, M., et al.: AVEC 2016—Depression, Mood, and Emotion Recognition Workshop and
Challenge. ACM (2016)
14. Valstar, M., et al.: AVEC 2017—Real-life Depression, and Affect Recognition Workshop and
Challenge. ACM (2017)
15. Valstar, M., et al.: AVEC 2018 Workshop and Challenge: Bipolar Disorder and Cross-Cultural
Affect Recognition. ACM (2018)
16. Ringeval, F., et al.: AVEC 2019 Workshop and Challenge: State-of-Mind, Detecting Depression
with AI, and Cross-Cultural Affect Recognition. ACM (2019)
17. Pantic, M., Rothkrantz, L.J.M.: Facial Action Recognition for Facial Expression Analysis From
Static Face Images. IEEE (2004)
18. Al-Gawwam, S., Benaaissa, M.: Depression Detection From Eye Blink Features IEEE (2018)
19. Pampouchidou, A., et al.: Automatic assessment of depression based on visual cues: a system-
atic review. IEEE (2017)
20. Venkataraman, D., Parameshwaran, N.S.: Extraction of facial features for depression detection
among students. Int. J. Pure Appl. Math. 118(7) (2018)
21. Meng, H., Pears, N.: Descriptive temporal template features for visual motion recognition.
Pattern Recogn. Lett. (2019)
22. Fairbairn, C., Yang, Y., Cohn, J.F.: Detecting depression severity from vocal prosody. IEEE
Trans. Affect. Comput. 4(2) (2013)
23. Mitra, V., et al.: The SRI AVEC-2014 Evaluation System. ACM (2014)
24. He, L., Cao, C.: Automated depression analysis using convolutional neural networks from
speech. Elsevier (2018)
25. Jan, A., et al.: Automatic depression scale prediction using facial expression dynamics and
regression. IEEE (2014)
26. Tao, J., Chao, L., et al.: Multi task sequence learning for depression scale prediction from
video. IEEE (2015)
27. Jan, A., et al.: Artificial intelligent system for automatic depression level analysis through
visual and vocal expressions. IEEE (2017)
28. Saleem, A., et al.: Pre-Processing Methods of Data Mining, 7th International Conference on
Utility and Cloud Computing. IEEE and ACM (2014)
29. Langley, P., Blum, A.L.: Selection of relevant features and examples in machine learning.
Elsevier (1997)
30. Alías, F., Socoró, J.C., Sevillano, X.: A review of physical and perceptual feature extraction
techniques for speech, music and environmental sounds. Appl. Sci. MDPI (2016)
31. Ranjan, R., Thakur, A.: Analysis of feature extraction techniques for speech recognition system.
Int. J. Innov. Technol. Explor. Eng. (IJITEE) (2019)
32. Bachu, R.G., et al.: Separation of voiced and unvoiced using zero crossing rate and energy of
the speech signal. In: Conference ASEE Regional Conference (2008)
33. Keras-Vggface: https://github.com/rcmalli/keras-vggface (2017)
A Notification Alert System
with Heartbeat and Temperature Sensors
for Abnormal Health Conditions
V. Sireesha, M. S. V. Sashi Kumar, S. Vinay Kumar,
and R. M. Shiva Krishna
Abstract Generally, we go to a hospital for two reasons, that is, for a regular check-
up for aged people and the other is during health issues. For some cases, we need
an Ambulance or any means of transport to reach the hospital when the condition
becomes critical. Unfortunately, in such cases, we don’t have any predictive systems
which keep track of the health conditions of the people and notifies when the situation
becomes abnormal. Therefore, in our paper, we have addressed this issue with the
help of a system which keeps track of our health and raises an alert notification to our
relatives and the doctors of the nearby hospitals or maybe a family doctor who knows
our condition well, in case of any abnormal health condition. The proposed system
consists of device trackers and sensors to keep track of data and uses a messaging
service to send alert notification. This work can further be improvised to suit the
current pandemic situation (COVID—19) which can be used as a tracker for tracing
the COVID patients. We can place all the required sensors like temperature sensor,
heartbeat sensor, pressure sensor, wearable sensors.
1 Introductions
A wireless sensor network is a large node of small wireless sensor nodes. There
are small batteries, limited power, and a limited microprocessor at the sensor nodes.
These sensor nodes primarily aim to collect and transfer the collected information
from all sensors to a base station.
V. Sireesha (B) · M. S. V. Sashi Kumar · S. Vinay Kumar · R. M. Shiva Krishna

Department of CSE, Vasavi College of Engineering, Hyderabad, Telangana, India
e-mail: v.sireesha@staff.vce.ac.in
M. S. V. Sashi Kumar
e-mail: m.sashikumar@staff.vce.ac.in
S. Vinay Kumar
e-mail: s.vinaykumar@staff.vce.ac.in
https://doi.org/10.1007/978-981-16-1502-3_44
442 V. Sireesha et al.
If we consider the present situation, the person who has any health issues, needs
to get admitted in the hospital and get treated till it gets cured. If the case is not
too severe, they will follow the medical prescription prescribed by the doctors. But
there are few health issues which persists for a longer time like Blood Pressure,
Diabetes, Thyroid issues and others. So for these kinds of problems, the treatment
should be taken regularly, and the seriousness of the case may go to any extent. The
patient condition cannot be judged at any time. Such patients should be admitted in
the hospital for a longer time and get treated, which may not be feasible for them
economically as private hospitals charge higher costs for those treatments. Therefore,
if the person is at home, and once we connect the sensors to him, his or her health
can be monitored minute to minute. Once the condition becomes critical, instead of
calling for emergency services like Ambulance, the notification would be sent to the
nearby doctor along with the location of the patient so that the doctors can send the
Ambulance to the site.
This paper mainly focuses on tracking user data and sending an alert notification
to concerned people to alert about the condition of the patient. The message sent
includes the values of the heartbeat and temperature of the person. So the patients
need not be in the hospital all the time. The regular check-up and monitoring can be
done at home, which is an economically feasible solution from the patients’ point
of view. Also during this pandemic this system is beneficial to most of the people
and it may become the new norm for treatments. The paper is further organized as
follows. Literature survey included in Sect. 2; Proposed system included in Sect. 3.
Implementation details included in Sect. 4 and Results and Discussion in Sect. 5.
Finally, the Conclusion and future scope included in Sect. 6.
2 Literature Survey
The rapid increase in the emergence of new technologies have paved the way for
the introduction of many smart notification systems for the convenience of the users.
The authors in [1–3], have proposed an intelligent alert system in case of accidents
or emergencies. In [4], the authors have developed a smart alert system for waste
management and issuing an alert when the bin is full. The authors in [5–8] have
proposed smart notification systems for different health care applications. These
smart alert system approaches have motivated us to think in the direction of the
proposed method.
3 Proposed System
Sending alert notification in case of emergency is the key concern in this system. The
registered users can only opt for this service. The sensors used in this design are
A Notification Alert System with Heartbeat and Temperature … 443
1. LM35 Temperature Sensor

2. Heartbeat sensor
3. Breadboard
4. 10 K Ohm Resistors
5. 9 V battery (power supply)
6. Esp8266 NodeMCU with in-built Wi-Fi module.
The technologies required in developing this system are Arduino IDE, Web
Application (000webhost.in), and SQL Database.
3.1 Launching of System
The heartbeat and the temperature sensors aforementioned are connected to the
human body, and the other terminals are connected to the breadboard along with
the resistors. The breadboard is, in turn, connected to the power supply from the
battery. The temperature sensor records the body temperature and displays it on the
User Interface. The heartbeat sensor also tracks the heartbeat of the patient and shows
in the UI.
The Arduino IDE has code which collects the readings from sensors and sends
it to the web page. The web page has the threshold value calculated based on the
medical history given by the user during sign up. Therefore, the computed value is
taken as the threshold value. Now the current heartbeat values are compared to the
threshold, and a grace value of a random integer is taken. If the value crosses the
total reading, then the counter starts to increment continuously. Once it reaches the
threshold, then the messaging service is triggered, and an alert is sent to the registered
contact numbers.
This system is useful for people of all the ages instead of focusing on a specific
age group. The sensors data is read and compared with the threshold, and a counter
is maintained. Once the counter reaches a particular count, the alerts would be sent
because we consider any case to be abnormal or critical if it exists, for a considerable
amount of time. For example, when a person runs or walk for a few seconds, their
heartbeat increases. This condition doesn’t mean the person is suffering from a heart
attack. So a counter is used to handle these kinds of exceptions.
3.2 Algorithm Description
Step 1: Initially, the setup is made to connect the NodeMCU module to Wi-Fi so that
it can send the readings to the web page where the user is signed in.
Step 2: Import packages such as ESP8266HTTPClient.h, ESP8266Wifi.h. Puls-
eSensorPlayground.h packages to capture the heartbeat and temperature from the
sensors.
Step 3: The pulse readings are captured and compared against the threshold value,
and the counter is incremented based on the value.
Step 4: Once the counter reaches the value of 20, SMS service is triggered, and the
alert is sent to the concerned authorities and family members.
Step 5: Once the alert is sent, the counter resets itself and starts re-recording the
values, and the alerts would be sent continuously till the patient is in contact with
those sensors.
3.3 Flow Chart
The proposed system, as shown in Fig. 1, has been developed as there is no kind of
system currently available so that the patient can be treated at home and can be taken
to hospital only in case of emergency. The present systems suggest the patients to
get admitted into a hospital over a random reading of these vitals, which could very
well be a false positive.
This work can also be considered as an instant notification system as the alert goes
immediately, and the patient needs not respond or call anyone. The proposed setup
has a limitation of sending a limited number of messages. It can be replaced with
any paid services like Twilio, Vonage, and TextLocal to be able to send messages
from time to time. Within the time interval, if the messages reach the count, they
stop sending messages. This is handled as the counter resets itself and starts sending
again after the time interval. This counter value is based on the service provider. For
a free service, the cost is less, but if users opt for a premium service and pay monthly
charges, the messages count would be larger considerably.
4 Implementation
There is a web application hosted on the server where the user who wants to use
this server needs to register first. There is a login portal and sign up page where
the user needs to give necessary details like name, age, gender and medical history.
So once the user logs in, he or she can see the details (heartbeat, temperature) on
the User Interface in the website. Based on the details provided, the system predicts
the functionalities of the body parts of the patient. It foretells the heartbeat and
temperature of the person based on medical history. These defaults are considered
as a threshold value and beyond that and below values are cases of abnormalities.
There are sensors connected to the human body, and they always track the heartbeat
and temperature. The platforms used to build this system is Arduino IDE [9] which
is used to collect data from sensors, 000webhost platform to host the website for the
users to login to use this system and IFTTT [10] services to send messages.
Fig. 1 Flow chart of the

proposed system
IFTTT is a specific service which is open source and can be opted once you sign
up. It is a kind of platform where there are many services available of which we can
opt based on our requirement. IFTTT stands for if-this-then-that. It is a triggering
service which is triggered based on the counter, which counts the abnormal heartbeat
values. IFTTT has many services available like messaging service, calling service,
email service, reminder service, and many more.
The service is triggered using an URL which is provisioned the subscribed users.
For an account, a limited number of messages can be sent, and after a specific period,
the service starts automatically. It resets itself after a particular period. If it crosses
the limit of the messages, the service stops itself, but the counts are considerably
large.
4.1 Setup of NodeMCU
This section deals with connecting nodemcu module to wifi by providing username
and password.
#include <ESP8266WiFi.h>
void setupWifi()
{
WiFi.mode(WIFI_STA);
status = WiFi.begin(ssid, password);
Serial.print("Attempting to connect to SSID: ");
Serial.println(ssid);
// Wait for connection
while (WiFi.status() != WL_CONNECTED) {
delay(1000);
Serial.print(".");
}
Serial.println("Connected to wifi");
}
4.2 Pulse Monitoring
This section deals with using in-built libraries in Arduino IDE to get the heart beat
values. The inbuilt function getBeatsPerMinute() reads the value from sensor.
#include <PulseSensorPlayground.h>
int bpm=0;
PulseSensorPlaygroundpulseSensor;
void loop() {
if (WiFi.status() != WL_CONNECTED)
{
setupWifi();
}
if (pulseSensor.sawNewSample()) {
if (--samplesUntilReport == (byte) 0) {
samplesUntilReport = SAMPLES_PER_SERIAL_SAMPLE;
// pulseSensor.outputSample();
bpm=pulseSensor.getBeatsPerMinute();
if (pulseSensor.sawStartOfBeat()) {
bpm= pulseSensor.getBeatsPerMinute();
}
}
4.3 Evaluation
This section deals with comparing the heartbeat with threshold values and increment
the counter. Once the counter reaches a specific value, the messaging service is
triggered through get_http2 function.
int j=0;
if(bpm>150||bpm<40)
{
j++;
if(j==20)
{
get_http2(String(bpm));
j=0;
}
}
}
4.4 Messaging Service
This section of code deals with invoking the messaging service and send the values
to the server.
#include <ESP8266HTTPClient.h>
int get_http2(String state)
{
HTTPClient http;
int ret = 0;
Serial.print("[HTTP] begin...\n");
// conFig.ifttt server and url should be HTTP only..not
https!!! (http://)
http.begin("http://heart-beat-project.000webhostapp.co
m/updateHeart.php?id=2"+"status="+state); //HTTP
http.begin("http://maker.ifttt.com/trigger/HeartAttack
/with/key/h0CbltIVx2s_b9L4pBIeq96OyiKLpQSAZTIi8dMNaMF?val
ue1="+state); //HTTP
// start connection and send HTTP header

int httpCode = http.GET();
// httpCode will be negative on error
if(httpCode> 0) {
// HTTP header has been send and Server response header
has been handled
Serial.printf("[HTTP] GET code: %d\n", httpCode);
if(httpCode == HTTP_CODE_OK) {
String payload = http.getString();
Serial.println(payload);
}
} else {
ret = -1;
Serial.printf("[HTTP] GET failed, error: %s\n",
http.errorToString(httpCode).c_str());
delay(500); // wait for half sec before retry again
}
http.end();
return ret;
}
The alerts would be sent in the form of a message to the family members and doctors,
as shown in Figs. 2 and 3. The heartbeat values change instantly from time to time,
and thereby the alerts also have different values.
The messaging service name varies every time it sends an alert. Here the service
rendering message is received from BT-620270.
Fig. 2 Notification alert-1
Fig. 3 Notification alert -2

The proposed system explained in this paper is helpful for the people who are
suffering from genetic diseases and the problems which don’t have a permanent cure
but only control. It is also useful mostly for aged people who can’t visit the hospitals
frequently for regular check-ups. Also, as the entire system would be present in the
home itself, the patient can self-monitor his health conditions and react accordingly.
The instruments present in the hospital are not affordable for everyone, and this
system is very economical and beneficial. More additions can be made to this system
where we can set the SMS service based on the periods for the patients to take
medicines, including exercises related to their problems.
References
1. Sharma, S., Sebastian, S.: IoT based car accident detection and notification algorithm for
general road accidents. Int. J. Electr. Comput. Eng. 9(5), 4020–4026 (2019). ISSN: 2088-8708,
https://doi.org/10.11591/ijece.v9i5.pp4020-4026
2. Soujanya, K.L.S., Rajasekhar Gutta, S.S.: Accident alert system with IoT and mobile
application. Int. J. Recent Technol. Eng. 7(5), S2 (2019). ISSN: 2277-3878
3. Pattikonda, M.R., Reddy Pottipati, S., Senduru, S.: Automated emergency rescue alert system.
Int. J. Recent Technol. Eng. 8(2), S11 (2019). ISSN: 2277-3878
4. Hisham Che Soh, Z., Azeer Al-Hami Husa, M., Afzal Che Abdullah, S., Affandi Shafie, M.:
Smart waste collection monitoring and alert system via IoT. In: 2019 IEEE 9th Symposium
on Computer Applications & Industrial Electronics (ISCAIE), (pp. 50–54). Malaysia (2019)
https://doi.org/10.1109/ISCAIE.2019.8743746
5. Valliappan, S., Mohan, B.P.R., Kumar, S.R.: Design of low-cost, wearable remote health moni-
toring and alert system for elderly heart patients. In: 2017 International Conference on IoT and
Application (ICIOT) (pp. 1–7), Nagapattinam (2017). https://doi.org/10.1109/ICIOTA.2017.
8073612
6. Ameta, D., Mudaliar, K., Patel, P.: Medication reminder and healthcare—an android applica-
tion. Int. J. Manag. Public Sector Inf. Commun. Technol. (IJMPICT) 6(2) (2015)
7. Cook, D.A., Enders, F., Caraballo, P.J., Nishimura, R.A., Lloyd, F.J.: An automated clinical alert
system for newly-diagnosed atrial fibrillation. PLoS One 10(4), e0122153 (2015). Published
2015 Apr 7. https://doi.org/10.1371/journal.pone.0122153
8. Mauney, J., Furlough, C., Barnes, J.: Developing a better clinical alert system in EHRs. 4(1),
29–36, Article firstonline: August 13 2015; Issue published: (2015)
9. https://en.wikipedia.org/wiki/Arduino_IDE
10. https://en.wikipedia.org/wiki/IFTTT
Recommender System for Resolving
the Cold Start Challenges Using
Classification
Chandrima Roy, Siddharth Swarup Rautray, and Manjusha Pandey
Abstract Recommender Systems are quite popular and very useful for predictions
of various products to consumers by providing recommendations. It deals with the
definite type of items and produces the recommendations that are personalized to
deliver effective and valuable suggestions to the consumer. The cold-start problem
is one of the challenges in recommender systems. The cold-start situation arrives
when products added to the collection have either no experiences, or very little. This
causes a challenge for collaborative filtering algorithms mainly because they rely
on the interactions of the item to make recommendations. In general, it is much
harder to ask new user about their personal information (users don’t want to answer
too many questions). But it is easier to ask a lot of information about a new item
(people who add it are interested in filling in this information to make their products
recommended to the customers). The proposed system delivers the recommendation
of new items to existing users with high consistency and precision.
1 Introduction
Cold start means the system doesn’t have sufficient knowledge to make recommen-
dations for a new user, or a new item [18]. Any Recommendation system will face
cold start problems with the introduction of new client, product, or software. A new
product registry or an introduction of new products makes it impossible to introduce
an item to a customer as less information is available. The collective filtering cannot
efficiently make recommendations for new user and new object event. Collaborative
C. Roy (B) · S. S. Rautray · M. Pandey

School of Computer Engineering, Kalinga Institute of Industrial Technology (KIIT) Deemed To
Be University, Bhubaneswar, Orissa, India
S. S. Rautray
e-mail: siddharthfcs@kiit.ac.in
M. Pandey
e-mail: manjushafcs@kiit.ac.in
https://doi.org/10.1007/978-981-16-1502-3_45
452 C. Roy et al.
filtering is suffering from the “cold start problem”. It is difficult to recommend item to
new users or suggest a new item to any user. This drawback can be approached in a
different way: A system can recommend random items to novel users or new items to
any random users (random approach), It can also recommend popular items to new
users or new items to existing users (highest expectation approach), recommending
a collection of different items to new users or a new item to a set of different users
(exploratory approach) or, eventually, using a non-collaborative approach [1]. Any
rule-based similarity requirements can be established for a new item. For example,
to estimate a new listing, Airbnb used the average of three geographically closest
listings of the same kind and price range.
Recommended systems should not exploit the data that means overfitting past user-
item preference data in order to avoid getting trapped in the small neighborhood.
Training data set should not be fully collided by past recommendations. YouTube
contains videos embedded for training at other websites [2]. The videos viewed
outside of YouTube’s platform are not from the recommendation framework, and
can potentially generate new content. Injecting randomness into the framework can
also be considered that means the system can make random recommendations).
Simple guidelines may be added to the System to expand the variety of recom-
mendations. Methods are also available from multi-armed bandits. Uber eats applied
the upper confidence bound to improve the variety of suggested restaurants/dishes.
The upper confidence bound uses the upper bound of the estimated success rate.
The confidence interval is large when a new item enters the system without any
previous information, and thus the upper bound is high. As the item gets more views,
the estimate would be more precise and closer to its actual value. The content-based
recommendation method [3] is the solution to this problem since it does not rely on
the ranking of products. Another way is to identify visitors as browsers that are only
there to search items. Two basic types of cold start problem are:
1.1 New User Cold Start Problem
The term cold start means that the program does not have sufficient information to
suggest a new user or a new object. With the addition of new user, an object or a
program, any Recommendation program will face cold start problem [4]. Limited
number of information is available which makes it problematic to recommend an
item to a user. The issue of cold start is linked to the sparseness of information (i.e.
for users and items) available in the algorithm recommendation.
The theory is that people with a common culture would most possibly have similar
preferences. A model will be implemented from the training data. The goal is to find
a neighborhood where the neighbors are users that belong to the same group as the
group predicted by the model [5]. After this step, Similarity index will be calculated
that combines similarity from the neighbors. Finally, the similarity measure and
neighbors’ ratings are combined to get predictions.
Recommender System for Resolving the Cold … 453
1.2 New Item Cold Start Problem
The issue with the item cold-start will cause the new item to miss the opportunity
to be recommended and stay “cold” all the time. The proposed model would like
to suggest new products to potentially interested users—for which no interests have
been expressed so far [6].
The method employs interrelationships mining. It can derive functionality based
on a comparison of various attribute values. One of the main concepts of interrelation
mining is to reflect similar characteristics based on a comparison of new attributes
called interrelated attributes between values of different attributes [7]. First, most
similar item will be chosen to include a new item’s neighborhood, and neighborhood
rating information will be used to estimate the new item’s rating value. Lastly, highest
rating product will be recommended to a target customer.
2 Proposed Work
This research will try to mitigate the New item cold start problem issue. For a case
study, this paper will analyze the efficiency and predictive ability of a model; trained
and evaluated on data gathered from homes in Boston, Massachusetts suburbs trained
model on this data could then be used as a good fit to make various predictions about a
newly enlisted house on that particular suburb, specially its market price. This model
will be beneficial for users who are in real estate business, so that they can make
use of such knowledge in their daily work cycle. Some websites like housing.com,
MagicBricks or 99 acres can use this technique when some mew house or flat enters
the system with no ratings. This framework will help to recommend the new houses
to the existing user.
2.1 Dataset Description
The UCI Machine Learning Repository is the source of the data set for this project.
The data for the Boston housing was obtained in 1978 and the 506 entries reflects
demographic information on 14 features for houses from different neighborhoods in
Boston, Massachusetts.
2.2 Data Exploration
The findings are provided by a brief survey of the Boston housing data. Since the
proposed system will create a working model which can predict the value of houses,
454 C. Roy et al.
Table 1 MEDV statistics calculation

Maximum Minimum Mean Median Standard deviation
$1,024,800.00 $105,000.00 $454,342.94 $438,900.00 $165,171.13
we will need to split the dataset into features and the target component. The features,
‘PTRATIO’, ‘RM’, and ‘LSTAT’ provide us quantitative data point details. The target
component, ‘MEDV,’ would be the one we are trying to forecast. These are stored in
respective features and prices.
where,
MEDV: Median value of houses occupied by the owner in $1000s
LSTAT: Percentage of lower-income group of the population
PTRATIO: Student–teacher ratio of the neighborhood
RM: Average number of rooms per house.
2.3 Statistics Calculation
Maximum, minimum, mean, median, and standard deviation of ‘MEDV’ has been
calculated and stored in prices (Table 1).
2.4 Feature Observation
I have taken three features from this dataset such as ‘RM’, ‘LSTAT’, and ‘PTRATIO’
for every single neighborhood. Figure 1 shows how frequently each distinct value
occurs in a data set.
2.5 Train-Test Splitting
The method consists of taking a dataset and separating it into two subsets. The
first subset is used for model fitting and is called the training dataset. The second
subset will not be used to train the system; instead, the model is provided with
the input element of the dataset, then predictions are made and compared with the
expected values [6]. This second dataset is called test dataset. The goal is to estimate
the model’s output on new item. In this case study, I have taken 80% of the data for
training purposes and the remaining 20% for testing the model. Rows in train set is
404 whereas rows in test set: 102 train/test split provides a high variance estimate
since it can significantly change the accuracy of testing. It can change depending
Fig. 1 Histogram of RM, PTRATIO, and LSTAT
on observation in the test. Therefore, to solve this problem this research used k-fold
cross-validation [8].
2.6 Correlation Coefficient
The effectiveness of linear connection between two or more variables is quantified

by the coefficient of correlation. The correlation coefficient often takes a value of −
1 to 1, with 1 or −1 suggesting perfect correlation (in this case, all points will lie in
a straight line). 1 Represents that the two variables shift in equilibrium. They move
up and down together and the correlation is fine. −1 Implies the two variables are
in absolute contrast. One keeps increasing and the other decrease, in a completely
negative way. If any two variables aren’t correlated then the correlation value would
be 0 [9].
2.6.1 Equation
To measure the Pearson product-moment correlation, the covariance of the two vari-
ables have to calculate first, then standard deviation for each variable is calculated.
The correlation coefficient is measured by dividing covariance of two variables by
the product of standard deviations of the two variables [10].
456 C. Roy et al.
Table 2 Correlation
MEDV 1.000000
coefficient with MEDV
RM 0.680857
B 0.361761
ZN 0.339741
DIS 0.240451
CHAS 0.205066
AGE 0.364596
RAD 0.374693
CRIM 0.393715
NOX 0.422873
TAX 0.456657
INDUS 0.473516
PTRATIO 0.493534
LSTAT 0.740494
Cov(x, y)
ρx y =
σ xσ y
where
ρ xy = Pearson product-moment correlation coefficient
Cov(x, y) = covariance of variables x and y
σ x = standard deviation of x
σ y = standard deviation of y.
Standard deviation is a metric of data dispersal from its average [11]. Covari-
ance measure, how two variables evolve together, but its magnitude is infinite, so the
analysis is difficult [12]. The normalized version of the statistics can be determined
by dividing covariance by the dividing of the two standard deviations. This is the
Coefficient of Correlation.
From Table 2 we can see that RM has the highest correlation with MEDV whereas
PTRATIO and LSTAT has the lowest correlation with MEDV respectively. Figure 2
Represent the scatter plot of RM and TAXRM with MEDV.
Prices rise as RM’s value rises linearly. There are few outliers and it appears that
the data is limited to 50. With a rise in TAXRM the prices begin to decrease. Although
it doesn’t appear to exactly follow a linear pattern.
3 Result Analysis
Our aim is to find the neighborhood of each new entry of house in the list. This
research will use C4.5 Algorithm to find the similar neighbors. This algorithm aims
Fig. 2 Scatter plot of RM and TAXRM with MEDV
to match the category of the new houses and category of the old houses whose price
already has been evaluated. The outcome of this algorithm is the set of neighbors.
C4.5 algorithm is a classification algorithm that can be used to produce a decision
based on a certain data set represented in Fig. 3.
There are different phases in the decision-making process with C4.5 algorithm,
namely:
Fig. 3 Proposed model for mitigating cold start item issue

458 C. Roy et al.
1. The training data can be obtained from the data that has not been Classified into
certain groups.
2. Determining a tree’s root by calculating the highest Gain value for every
attribute, or from the index of the
Lowest entropy value.

c
Entropy(s) = − pi log2 pi
i=1
C: Total Number of entities

Pi : Positive/Negative entity of given dataset
3. Calculate the Information Gain
Sv
Gain(S, A) = Entropy(S) − Entropy(Sv )
|S|
v∈values(A)
C4.5 has benefits over other Decision Tree systems. Inherently the algorithm uses
Single Pass Pruning Mechanism to prevent overfitting. It can function for discrete,
as well as continuous data. C4.5 can manage incomplete data issue very well.
3.1 Evaluation Metrics
Root mean squared error (RMSE) is a quadratic scoring method which calculates
the average error magnitude. It is the square root of the square differences average
between prediction and real observation.

n
(Pi − Oi )2
RMSE = i=1
n
Final RMSE while testing the model is 2.9382073149269416.
3.2 Comparison with Different Models
I also performed Linear Regression and Random Forest Regression on this dataset.
Table 3 represent C4.5 algorithm performed best in this dataset.
Table 3 Mean and SD for

Model Mean Standard deviation
different models
C 4.5 3.494650261111624 0.762041223886678
Random forest 3.945666155289214 0.757829838438667
regression
Linear 4.221894675406022 0.7520304927151625
regression
4 Conclusion
This research is based on similarity factor that overcomes Conventional Collabora-

tive Filtering disadvantages. Collaborative Filtering fails when a new item, in this
case, mew building, with no ratings is added to the system. This paper presents a
framework to mitigate the new item cold Start Issue. This research proposed to imple-
ment a method which takes the demographic data and based on similarity measure
techniques discover items with similar characteristics with the new item. Item with a
similar features and common characteristics can be recommended to users who have
similar likings. So, with addition of new items in the system, the old user will get
the recommendation.
References
1. Ramzan, B., et al.: An intelligent data analysis for recommendation systems using machine
learning. Scientific Programming (2019)
2. Fu, M., et al.: A novel deep learning-based collaborative filtering model for recommendation
system. IEEE Trans. Cybernet. 49(3), 1084–1096 (2018)
3. Zhang, Y.: GroRec: a group-centric intelligent recommendation system integrating social,
mobile and big data technologies. IEEE Trans. Serv. Comput. 9(5), 786–795 (2016)
4. Shu, J., et al.: A content-based recommendation algorithm for learning resources. Multimed.
Syst. 24(2), 163–173 (2018). https://doi.org/10.1007/s00530-017-0539-8
5. Rohit, et al.: Proposed approach for book recommendation based on user k-NN. Adv. Comput.
Computat. Sci. 554, 543–558 (2017). https://doi.org/10.1007/978-981-10-3773-3_53
6. Wei, J., et al.: Collaborative filtering and deep learning based recommendation system for cold
start items. Expert Syst. Appl. 69, 29–39 (2017)
7. Chen, J., et al.: Attentive collaborative filtering: multimedia recommendation with item-and
component-level attention. In: Proceedings of the 40th International ACM SIGIR Conference
on Research and Development in Information Retrieval (2017)
8. Correlation Coefficient, AKHILESH GANTI, https://www.investopedia.com/terms/c/correlati
oncoefficient (2020)
9. Lam, X.N., et al.: Addressing cold-start problem in recommendation systems. In: Proceed-
ings of the 2nd International Conference on Ubiquitous Information Management and
Communication (2008)
10. Vartak, M., et al.: A meta-learning perspective on cold-start recommendations for items. In:
Advances in Neural Information Processing Systems (2017)
11. Roy, C., Rautaray, S.S., Pandey, M.: Big data optimization techniques: a survey. Int. J. Inf. Eng.
Electron. Bus. 10(4) (2018)
460 C. Roy et al.
12. Roy, C., Barua, K., Agarwal, S., Pandey, M., Rautaray, S.S.: Horizontal scaling enhancement
for optimized big data processing. In: Abraham, A., Dutta, P., Mandal, J., Bhattacharya, A.,
Dutta, S. (eds) Emerging Technologies in Data Mining and Information Security. Advances in
Intelligent Systems and Computing, vol. 755. Springer, Singapore (2019)
A Skyline Based Technique for Web
Service Selection
Yamini Barge, Lalit Purohit, and Soma Saha
Abstract Service-Oriented Architecture (SOA) proves to be the primary reason

behind the advancements of web platforms. Therefore, an enormous quantity of
web services with similar functionalities has evolved over the web. However, wide-
ranging web services which possess Quality of Service (QoS) with varying dimen-
sionality may be inefficient in terms of performance due to web service selec-
tion strategy with traditional service selection methods. Skyline technique yields
to improve the efficiency of web service selection. Skyline is based on a domina-
tion theory in which only those services can survive which are better than the other
services available in the set. The concept of Web Service Selection using Skyline
mainly tends to satisfy the user experience and user requirements. The participation
of QoS is considered to be a base criterion for the selection of the most favorable
services. The presented paper represents the work in the direction of Web Service
Selection for composite web services using the Skyline technique.
1 Introduction
The advantages in SOA have accelerated the focus on the core functionalities associ-
ated with web services to provide more convenient options. Convenient options tend
to facilitate better web services to the user in the context of desired factors satisfac-
tion that leads the better user experience and satisfaction of the user requirements
while utilizing the web service. Web services are propagators between the software
entities that evolved in a full or partially different environment. At present, almost
ten thousand web services are available over the web. Advancement and techno-
logical revolution has standardized web services and created a competition among
the service providers to provide better web services to the users according to their
demands. In a nutshell, service selection becomes a vogue in research area and grabs
up user satisfaction.
Y. Barge (B) · L. Purohit · S. Saha

Shri Govindram Seksaria Institute of Technology and Science, Indore 452003, India
https://doi.org/10.1007/978-981-16-1502-3_46
462 Y. Barge et al.
To fulfill the requirements and offer a value-added service, many times web
services need to be composed. The composition of services is directly associated
with web service selection because selecting the set of services and to compose into
a single web service is a crucial task. Thus to pick the most eligible set of these
services, QoS is considered as base criteria. Every web service is associated with
some quality parameters. Quality of Service is taken as the base criterion of service
for web service selection. The main research focuses on selecting a web service for
composite services using the Skyline technique. The selection of web services on
the basis of QoS parameters can be cast as a multi-objective problem. Consequently,
Skyline technology is opted to solve the different tradeoffs easily [1]. Skyline assists
to apply a dominance check over a set of web services and abandon those services
from the pursuit of being better which are not better in terms of selection criteria.
Section 2 provides a detailed review of related works. In Sect. 3, the background
details and terminologies are discussed. Performed experiments are elaborated in
Sect. 4 and the obtained results are explained in Sect. 5. The conclusion is delivered
in Sect. 6.
2 Related Work
Web service selection has pulled plenty of focus from researchers. Apart from
Skyline, many other techniques have been involved in the web service selection.
Approaches formulated based on the concepts of linear programming intended to find
the optimal solution for QoS-aware web services. A global optimization approach
based on a linear program to find the best service component was introduced [2,
3]. Heuristic algorithm based on linear programming is also employed to identify
optimum services for making runtime decisions [4]. Although linear programming
proved better to small datasets, but could not able to do justice with large datasets
and has to suffer from poor stability and efficiency. QoS levels were extracted with
the help of a greedy approach [5]. For the most preferential QoS, this approach lacks
potential dependencies and correlations due to handling each QoS dimensions inde-
pendently. The service selection problem was modeled as a combinatorial problem
and employed a multi-objective optimization technique to meet the optimal solutions
among the available services. The experimentation involved the use of the NSGA-II
algorithm for achieving the desired results [6]. The problem of web service selec-
tion can be solved efficiently by applying classification before selection [7]. Thus
to overcome the problem of handling large datasets with better efficiency, Skyline
was introduced [8]. Skyline is very good at handling large datasets. Extensive work
has been done in the direction of proving efficiency of Skyline technique. Along
with Skyline, some well-known problems are also associated with skyline queries
like NN-query, Top-N problems, contour problem, convex hulls, and multidimen-
sional indexing [9]. Many problems have been addressed using the skyline technique
for optimizing service selection such as handling frequent requests through lottery
scheduling [10]. Multicriteria decision-making approach was adopted for effective
A Skyline Based Technique for Web Service Selection 463
selection of skyline services using Best–worst, TOPSIS, and PROMETHEE method

[11]. Skyline with k-means is also used to prefilter the explored web services [12].
The authors experiment Block Nested Loop (BNL) algorithm which is a Skyline
algorithm for the service selection. The advantages of the BNL algorithm have been
discussed along with the best quality attribute parameters.
3 Background
1. Web Service: Web Service establishes communication between the software

entities that are developed in their respective environment. Web services use
four standard pillars to establish communication with other services, named;
SOAP, XML, UDDL, and WSDL.
2. Composite Service: A composite service is a combination of multiple atomic
services. The functionality of the entire composite services is fulfilled by the
completion of functionalities of all its constituent atomic services. The Abstract
Web Service (AWS) explains the task functionality which is responsible for
Fig. 1 Web service selection for web service composition

464 Y. Barge et al.
service composition [13]. Figure 1 depicts the role of service composition in

Web Service Selection.
3. Skyline: Skyline is based on the concept of dominance in which the services
are applied a dominant check so that the dominated solutions are pruned to
reduce the unimportant services from the race. Computing Skyline services is
similar to determine the maximal vector problem in computational geometry
[14]. Non-dominant and dominant are two base pillars of the Skyline technique.
Dominance: Consider a service class S, and services x, y ∈ S, characterized by
a set of Q, QoS attributes. x dominates y, denoted as x ≺ y, if x is as good or
better than y in all parameters in Q and better in at least one parameter in Q, i.e.
∀k ∈ [1, |Q|]: qk(x) ≤ qk(y) and ∃k ∈ [1, |Q|]: qk(x) < qk(y) [6].
Skyline Services: Let the service class S represents Skyline services. These
Skyline services are represented as SS and include the services in S which are
not dominated through another service, i.e., SS = {x ∈ S|¬∃y ∈ S: y ≺ x} [8].
There exists multiple solutions in the dimension space. These solutions are
compared with each other through a dominance check to find non-dominant
solutions which are better among the available solutions based on considered
parameters. Skyline can be defined as “The solution is said to be Skyline Solution
if all the dimensions of the solution have better values than other solutions
or have a strictly better value at least in one dimension” [6]. Skyline can be
considered as the pruning process to reduce the underrated solutions which are
not important. Skyline concept is used to provide better web services to extend
the good performance in all considered parameters. Skyline does not consider
user preferences [15]. Skyline of a given set Ds of the point is that any set of
evaluation criteria that arises from user’s preferences can be modeled in the
form of the monotone scoring function f : Di → R , like L1 norm f (x, y) = x +
y or Euclidian form [14]. The goodness or badness of any solution is checked
through the Skyline operator. The categorization of Skyline algorithms is based
on Index-based and Non-Indexed based approaches in which other categories
have been covered.
1. Index-based: Index-based Skyline algorithms demand the access to certain
unique data structure like R-tree and B-tree. The following are the algorithms
based on Index-based approach.
2. Bitmap: Bitmap is a progressive algorithm. It does not need to scan the complete
dataset to return results. Bitmap algorithm is based on the bitmap structure that
encodes all the required information to examine those data points which belong
to Skyline family.
3. Nearest Neighbor (NN): The algorithm uses R* -tree data structure. This algo-
rithm cuts off the redundant dominant checks and eliminates massive non-
skyline points. The algorithm starts with searching for the nearest neighbor
from the origin point defined.
4. Branch and Bound Skyline (BBS): It is an improved version of NN algorithm.
BBS overcomes the recursive searching effort which was the main problem of
NN. BBS requires a single search of R*-tree. In the R*-tree, the data points are
arranged in such a way that each internal R*-tree node consists of maximum
tree nodes and each leaf can also have maximum three entries.
5. Non-Index-based: It is more generic approach than Index-based. This approach
does not require any special access to a data structure like R*-tree. The approach
does not require any pre-processing on the underlying dataset. Algorithms based
on Non- Index approach that have been used in particular for Web Service
Selection and described are as follows:
6. Block Nested Loop (BNL): The algorithm reads the input data and each point
is retrieved and compared against the points in the buffer. BNL proves to be
efficient and results in better performance if the resulted size of Skyline is
small. The algorithm terminates in single iteration when the best case fits into
the window.
7. Short Filter Skyline (SFS): The data points are checked on the basis of their
score, arranged in ascending order and kept in-memory buffer. This algorithm
ensures a reduction in the pairwise comparison between the points. Exhaustive
search is performed on existing skyline points for the dominance test.
8. Divide and Conquer (D&C): The D&C algorithm recursively divides the input
dataset into m partitions P1 … Pm (m-way partitioning), to fit values in the main
memory. The partition boundaries are determined by computing the q-quintiles
of the dataset which results in the division of the dataset into q − 1 equal subsets.
Figure 2 represents the Skyline algorithms particularly employed in the web
service selection. Algorithms belong to the particular category are mentioned
in the square box and the arrows depict the extended variation of the algorithms.
1. BNL Algorithm: BNL is certainly like the Naïve-Nested Loop algorithm. The
algorithm repeatedly reads the set of tuples and eliminates points by finding other
points in the dataset that dominate them. BNL allocates a buffer (window) in the
main memory that contains several points to sequentially track the dominance
between them [14]. The algorithm reads the input data and each point is retrieved
and compared against the points in the buffer. In the first run of the algorithm,
no point will exist in the buffer so it is trivial to insert the first point in the buffer.
For the next runs, if the point retrieved is dominated by at least one point in
the buffer there is no need to continue the comparison with the other points
Fig. 2 Skyline algorithms

for web service selection
466 Y. Barge et al.
that may already exist in it and the point is discarded. Otherwise, if the point is
incomparable or dominates one or more points in the buffer, those points that
are dominated are removed from the buffer and the new point is inserted.
Algorithm: BNL Algorithm

Step 1: Use the normalized values of the dataset
Step 2: Checks for dominating values.
Step 3: If value y is dominated by others then, eliminate y from buffer.
Step 4: If value x is dominating other values then, keep x in the buffer.
Step 5: If the value is incomparable then it is inserted in the memory buffer.
Step 6: Check for the dominance status.
Step 7: If status = −1, found dominant; remove the value from Skyline.
Step 8: If status = 1, dominating other values. Add to the Skyline service.
Step 9: Return the indices of the Skyline points.
Step 10: Print Skyline services.
Normalization: It is a pre-processing stage. This step requires data points asso-
ciated with the particular attribute can have the values that lie in the range of [0,
1]. Normalization tends to manipulate the data points which can be used for further
calculations or observations. Min_Max normalization is used over the data points for
further calculations. Linear transformation which is performed on the original data
can be depicted by the following Eq. (1)
v − max(A)
v= (new_max(A) − new_min(A) + new_min(A)) (1)
max(A) − min(A)
where, v’ is the current value, v is the previous value, new_max(A) = max value
of range, new_min(A) = min value of range.
Figure 3 depicts basic flow of Skyline for Web Service Selection at different levels.
4 Experiment
In this paper, authors have performed the BNL algorithm for the Web Service Selec-
tion which is a Non-Indexed based Skyline algorithm. BNL algorithm is more generic
than other algorithms. The experiment has been performed using Java language.
The proposed experiment is conducted on PC with Intel (R) Core (TM) i3 CPU @
2.00 GHz and 4 GB RAM memory. The dataset that has been used for the experi-
ment is contained of 365 real web services with measurement of nine QoS param-
eters per services and additional attributes. The dataset is recovered as a text file.
The dataset also contained name of services, the URL of its WSDL file. Figure 4
represent the implementation diagram for the proposed work.
Fig. 3 Algorithmic flow chart
The experimental result shows that 174 skyline web services are obtained out of
365 web services. The computational time of the resultant services is recorded as
471 µs on an average. According to the further experiment on QoS, Attribute Selec-
tion methods are applied on the datasets. Further experiments are performed on
the datasets to deeply analyze the result patterns and to check the relevancy of the
attributes. Attribute selection methods have been used to extract the ranking of the
specified attributes. By using Classifier AttributeEval and Ranker method, Latency
is determined as the best QoS parameter while Response time as worst. Similarly,
as a result of using Correlation AttributeEval and Ranker method, Response Time
is shown as the best parameter while Reliability as worst. Further, by using CFSub-
setEval and Best first method of feature selection, three QoS parameters are selected
468 Y. Barge et al.
Fig. 4 Implementation diagram
to be best among 8 parameters and they are Throughput, Successability, and Relia-
bility. Using these three parameters as the base QoS, results were totally different.
Experimentation with these three QoS parameters results in less number of Skyline
services. It indicates that number of attributes plays an important role in generation
of Skyline services. Besides this, there is one more attentive point need to be focused
on is that even if the number of attributes remain same in quantity but the number of
services are increased or decreased also affects the Skyline results. Figure 5 shows the
Fig. 5 Skyline growth with

number of web services
Table 1 Computational
S. No Number of web Number of QoS Execution time
efficiency
services (µs)
1 365 8 459
2 365 3 396
3 2507 8 1728
4 2507 3 1309
Table 2 Runtime comparison of skyline

S. No. of services Runtime of selection of web services (in µs)
No. Dynamic programming [16] Pisinger’s [16] Skyline
1 10 1395 116 48
2 100 35,668 304 242
3 1000 7 s 67,617 3240 1046
4 2000 – – 1817
graph plotted for number of web services. Different quantity of web services gener-
ates different figures of Skyline points. It can be observed that larger the number of
services, larger the number of Skyline points will generate. The growth of Skyline
points increased exponentially with larger number of web services.
QoS parameters also make an observable difference in the results. Relevancy of
QoS attributes has an impact on the generated Skyline results. This is because the
Skyline uses the concept of Pareto Accumulation. Pareto Accumulation tends to give
equal importance to all the QoS parameters. This means that all QoS parameters are
treated equally while the selection of web services. Due to which a large number of
Skyline web services are produced as output. This reason is enough for Skyline to
grow exponentially with a large number of attributes. The computational efficiency
of the BNL algorithm is depicted in Table 1
The runtime performance of Skyline is compared with similar traditional
approaches like Dynamic Programming and Pisinger’s algorithm [16]. The depic-
tion of Table 2 clearly points out the performance difference of Skyline and other
similar approaches. Skyline performs better in terms of computing better services as
compared to other techniques. The performance of Skyline has been calculated in
µs.
6 Conclusion
As Skyline offers the best services from the available collection of web services,
Quality of Service has a vital role in the selection aspect of these Skyline services.
It is observed that in the mentioned work, efforts have been made to improve the
470 Y. Barge et al.
web service selection criteria through Skyline by employing various hybrid or mixed
approaches. It is concluded that the user-defined constraints are still needed to be
on an efficient track to deal with user preferences and satisfy the Quality of user
experience. However, Skyline becomes a little vulnerable when it comes to deal with
more constraints conditions. Further, most of the traditional techniques including
linear programming, Greedy approach, Genetic Algorithm suffer from insufficient
capabilities to handle large datasets. Skyline with its potential capability of handling
large datasets has solved much of the Service Selection dilemma. According to our
work the Skyline services exponentially grow with the increase in the number of
services this is because Skyline uses Pareto accumulation due to which the attributes
are considered to be equally important and as a result of dataset comes out with large
Skyline points.
References
1. Borzsony, S., Kossmann, D., Stocker, K.: The Skyline operator proceedings. In: International
Conference on Data Engineering (pp. 421–430) (2001) https://doi.org/10.1109/ICDE.2001.
914855
2. Zeng, L., Benatallah, B., Dumas, M., Kalagnanam, J., Sheng, Q.: Quality driven web services
composition (2003). https://doi.org/10.1145/775152 775211
3. Sun, Q., Wang, S., Zou, H., Yang, F.: QoS-aware web service selection with the skyline (2010).
https://doi.org/10.1109/ICBNMT.2010.5705226.
4. Ardagna, D., Pernici, B.: Adaptive service composition in flexible processes. IEEE Trans Softw
Eng 33(6), 369–384 (2007). https://doi.org/10.1109/TSE.2007.1011
5. Torkashvan, M., Haghighi, H.: A greedy approach for service composition. In: 2012 6th Inter-
national Symposium on Telecommunications, 929–935, IST 2012 (2012). https://doi.org/10.
1109/ISTEL.2012.6483119
6. Claro, D.B., Albers, P., Hao, J.: Selecting web services for optimal composition. SDWP@ICWS
(2005)
7. Purohit, L., Kumar, S.: Web services in the internet of things and smart cities: a case study on
classification techniques. IEEE Consum. Electron. Mag. 8(2), 39–43, (2019). https://doi.org/
10.1109/MCE.2018.2880808
8. Alrifai, M., Skoutas, D., Risse, T.: Selecting skyline services for QoS-based web service compo-
sition. In: Proceedings of the 19th International Conference on World Wide Web, WWW (2010).
‘10. https://doi.org/10.1145/1772690.1772693
9. Mourad, F., Asaidi, H., Bellouki, M.: Comparative study of skyline algorithms for selecting
web services based on QoS. Procedia Comput. Sci. 127, 408–415 (2018). https://doi.org/10.
1016/j.procs.2018.01.138
10. Wang, Y., Song, Y., Liang, M.: A skyline-based efficient web service selection method
supporting frequent requests, 328–333 (2016). https://doi.org/10.1109/CSCWD.2016.7566009
11. Serrai, W., Abdelli, A., Mokdad, L., Hammal, Y.: An efficient approach for Web service
selection, 167–172 (2016). https://doi.org/10.1109/ISCC.2016.7543734
12. Purohit, L., Kumar, S.: Clustering based approach for web service selection using skyline
computation. In: IEEE International Conference on Web Services (ICWS), (pp. 260–264).
Milan, Italy (2019). https://doi.org/10.1109/ICWS.2019.00052
13. Kumar, S., Purohit, L.: Exploring K-means clustering and skyline for web service selection,
603–607 (2016). https://doi.org/10.1109/ICIINFS.2016.8263010
14. Kalyvas, Tzouramanis, T.: A Survey of Skyline Query Processing (2017)
15. Purohit, L., Kumar, S.: Replaceability Based Web Service Selection Approach, 113–122 (2019).
https://doi.org/10.1109/HiPC.2019.00024
16. Yu, T., Lin, K.-J.: Service selection algorithms for web services with end-to-end QoS
constraints. Inf. Syst. e-Bus. Manage. 3, 129–136 (2004). https://doi.org/10.1109/ICECT.2004.
1319726
Novel Trust Model to Enhance
Availability in Private Cloud
Vijay Kumar Damera, A. Nagesh, and M. Nagaratna
Abstract The benefits of cloud computing for companies are numerous. However,
among all the advantages, high availability in the cloud is one of the factors that
draws the attention of most of cloud users. High availability, as the name suggests,
ensuring that IT resources are available at all times. For this, it is necessary to
implement processes to detect single points of failure in your system and reduce the
chances of their occurrences through strategies such as redundancy and/or replication.
Widely accepted solution for enhancing availability in cloud is replication. However,
deciding on minimum number of replicas and where to place replica is a major
research concern in cloud. Hence, where to keep replicas in the system to satisfy
availability requirement is a matter of concern. To address above issue, this paper
proposes a novel trust model which helps in selecting appropriate node for replica
placement.
1 Introduction
Cloud computing technology appeared relatively recently and became very popular
among companies of all types and sizes. This rapid expansion is not surprising when
we stop to analyze all the benefits that this technology can offer. One of its flagships,
without a doubt, is high availability in the cloud [1, 2].
High availability is ultimately the holy grail of the cloud. It incorporates the idea
of accessing services, tools ,and data anywhere and anytime and is the foundation
of modern companies. Availability is also related to reliability: a service that works
24/7, but is constantly unstable is not considered good. To have true high availability
V. K. Damera (B)
JNTU Hyderabad, Hyderabad, Telangana, India
A. Nagesh
Department of CSE, MGIT Hyderabad, Hyderabad, Telangana, India
M. Nagaratna
Department of CSE, JNTUCEH Hyderabad, Hyderabad, Telangana, India
https://doi.org/10.1007/978-981-16-1502-3_47
474 V. K. Damera et al.
in the cloud, your services need to not only be always active, but also have 99.2%
availability [3–5].
In general, high availability means eliminating all points of failure and creating
redundancy in processes and equipment. Thus, if a server fails for any reason, there
is another one to continue the operation. The change is made instantly (failover) and
the user does not even notice the change [6, 7].
The cloud computing service creates redundancy in the different layers of opera-
tion. The data center, for example, has two power supply systems and two different
forms of cooling to ensure that everything works correctly in any situation. Not to
mention the fact that there are at least two telephone operators to guarantee com-
munication between the data center and traffic collection points such as ix.br for
example.
At the hardware layer, there are redundant servers available to take over the oper-
ation in the event of a hardware failure. Thus, if one presents a problem, the other is
immediately activated to continue operations. Likewise, high network availability is
guaranteed with redundant switch and edge routers [8].
In the third layer, that of IaaS, where the servers are virtualized, it is also possible
to implement high availability. The load balancer manages the load and directs it to
the application servers that are active. Thus, it is possible to perform maintenance on
the virtual servers, stopping one server at a time, without interrupting the operation
of the application [9].
In short, high availability guarantees the operation of a service 365 d a year ,
regardless of the number of people who are connected or an incident in the com-
pany. Therefore, you can continue with business activities even if the workspace
suffers from a flood or fire [10].
Trustworthiness, as a basic requirement of Internet-based application systems,
faces many new challenges in new computing environments and application models.
How to effectively manage trust in the Internet environment to adapt to the needs
of the development of computing environment and application mode has become a
hot issue. Under the background of a variety of trust problems in cloud computing
environment, in this paper, an attempt is made to present a trust evaluation models
to enhance availability in private cloud.
1.1 Availability in Cloud Computing
Availability refers to the proportion of the time that the software system normally
works in a given time to the total time, usually measured as a percentage. In tradi-
tional data centers, factors that affect service availability include abnormal server
downtime, service attacks, operating system crashes, software crashes, power out-
ages, and network interruptions. Data center administrators need to use redundancy
and disaster backup to ensure service availability. However, the introduction of these
redundant or disaster backup systems has brought new problems, such as the problem
of copy consistency caused by redundant backup, higher procurement, and manage-
Novel Trust Model to Enhance Availability in Private Cloud 475
ment overhead. The cloud environment can minimize the impact of unavailability of
resources on business systems and create a highly available computing environment.
In cloud computing, providing uptime guarantees and service-level agreements has
become a standard requirement for most cloud computing providers. Most of these
cloud computing platforms claim to provide 99.999% availability. But in fact, the
existing cloud computing environment has also experienced availability problems.
When a physical failure occurs, the server hardware shuts down in a short time, and
recovery from the backup state often takes longer. A tiny cloud computing failure
may lead to a chain reaction of software failures, causing a software service that
depends on cloud computing to be interrupted for hours, dozens of hours, or even
days. This means that the availability of the overall cloud computing environment
may be able to reach 99.999%, but the availability of individual services or applica-
tions that users are concerned about cannot reach 99.999%. In order to provide truly
high-availability services, cloud computing providers are studying common failure
analysis and prediction models. Based on the research of these models, cloud com-
puting service providers hope to be able to anticipate possible availability problems
and avoid these failures or reduce the losses caused by failures by preparing copies
in advance, resolving failures in advance and notifying users.
2 Trust
2.1 Definition of Trust
As a basic factor in human society, trust plays a decisive role in social organization.
For example, at a traffic intersection, we always believe that cars in the other direction
will follow the instructions of the signal lights to make our decisions and travel
smoothly. It is precisely because of the importance of trust that trust research has
received attention in various fields, including psychology, sociology, philosophy,
etc. [9, 11, 12]. With the development of the times, it has been integrated into
business management, economic theory, engineering, computer science, and other
application fields. Knowledge. Due to the complexity and multi-faceted nature of
trust, there is currently no precise and widely accepted definition of trust in academia
and industry, which is often understood as an intuitive concept. There are various
definitions around trust. Trust in the Oxford Dictionary is defined as “a belief in the
reliability, authenticity, ability, and strength of someone or something”ž. Hwang et
al. [8] define trust as “based on the prediction of a certain behavior of the believer, the
relying party is willing to accept the risk of believing the other party, regardless of
whether it can monitor or control the trusted party”. This definition emphasizes the
risk of trust, indicating that trust is essentially an assessment of the risk of acceptance.
As shown in Fig. 1, Huang [13] et al. define “trust is a state of mind, which includes
three aspects: (1) expectation: the service that the trustee wants to obtain from the
trusted person, and (2) the belief: Based on the judgment of the ability and will of
Fig. 1 Composition of trust

elements
the trusted person, the trustee believes that the expectation is correct, (3) the risk
willingness: the trustee is willing to bear the possible failure of the belief”.
2.2 Nature of Trust
The dynamics of trust are the biggest challenge of trust evaluation and trustworthi-
ness prediction. It is determined by the natural attributes of the entities in the trust
relationship. This section summarizes the nature of trust as follows:
1. Subjective Uncertainty: refers to the fact that the trustee cannot clearly judge
the dynamic change of the trustee as the context and time change. The trust can
only be evaluated according to the previous interaction history; trust is credit.
The party has a subjective judgment on the recipient, and different entities will
have different criteria. Even for the same trusted party, the same context, the
same time period and the same behavior, the difference of the creditors, the
given quantitative judgment is likely to be different.
2. Context-Dependent: The specific state of trust is closely related to the context.
It is meaningless to discuss the trust issue from the specific context.
3. Time Asynchrony: It means that the evaluation result of trust relationship
between entities has time asynchrony. The solution to the problem is to average
the time slot; trust will decay with time, and the most direct performance is: The
longer the trust evaluation, the worse its persuasiveness.
4. Multi-Objectivity: Trust is often associated with multiple attributes of the
trusted party and is influenced by multiple attributes. It is a concept of multi-
attribute interaction. Taking online shopping as an example, customer evaluation
of the seller may include evaluations of the quality, price, service attitude, and
speed of the delivery.
2.3 Principles of Trust
To guarantee a maximum level of confidence certain principles must be followed:
1. Trust transitivity, if entity A trusts entity B and entity B trusts entity C, then we
can come to the conclusion that A can trust entity C by referring to the trust of
entity B;
2. Trust is a function of perception of risk, it represents a belief in a person for his

correct actions. Thus, trust must also assess the uncertainty that the other party
is acting properly and incorporate the associated risks;
3. Trust is determined by time, it is built over time based on past experiences;
4. The trust can be measured, it is measurable by a numerical value, generally in
the interval [0 – 1];
5. Formal and social tools are necessary for the evolution of trust, trust can be
modeled according to various formal models.
2.4 Trust in Cloud Computing
Trust is initially an idea that rises in humanism, and ideas in human science are
frequently obscure. Trusted computing guides the idea of trust to the field of software
engineering. Trusted Computing Group (TCG) characterizes trust as: a substance
that can generally accomplish the ideal objective in the normal way, at that point the
element is trustable. That is, trust underlines the desire for the element’s conduct,
while likewise focusing on the security and dependability of the system [14–16].
Trust is basically derived from a twofold relationship. One can express this rela-
tionship in one among the following forms: one-to-one, many-to-many, one-to-many,
and many-to-one. Different mechanisms to evaluate trust are: direct trust, recom-
mended trust, multi-level recommendation trust, and hybrid trust [15, 16].
In majority of e-commerce applications, trust is achieved through a belief that
the opposite party is reliable and is able accomplish all its promises. Smooth online
transactions will be achieved when the participating entities trust each other. This
shows the significance of trust for online transactions. In cloud environment, trust
value for entities will be evaluated using either of two mechanisms: direct or indirect
trust. Direct trust is evaluated based on past experiences between entities where as
indirect trust is by the recommendation of other entities.
3 Trust Evaluation Models for Cloud
Cloud computing is an emerging computing model with the advantages of large

scale, high reliability, and extremely low cost. At present, there have been a large
number of public cloud service providers at home and abroad, such as Google’s
GFS (GoogleFileSystem), IBM’s blue cloud computing platform. On the one hand,
different cloud service providers may provide some of the same basic services and
also provide some unique services; on the other hand, the service quality of different
cloud computing vendors also differs greatly. With the further popularization and
development of cloud computing, users will face an increasingly important issue
called How to choose a service provider that best suits users’ needs from many cloud
service providers? In order to solve this problem, trust evaluation models for cloud
Fig. 2 Trust models in cloud
computing must be used. The credibility of the service quality of the business is
evaluated. The trust evaluation in the existing cloud computing environment can be
used for service quality transactions [1, 3], secure storage [4], resource allocation [5,
6], access control [8], cloud environment security [8, 9], and other aspects. Service
quality is an important factor affecting the development of cloud computing.
Before opting any cloud service consumer always depends on trust evaluation
model to select the services of a CSP and outsources its confidential sensitive data
to the cloud environment. Trust is highly subjective and context-sensitive. Due to
this nature, the service selection from a cloud provider becomes most challenging
task. Further trust value may change with time based on the experiences of user with
provider. The trust level may also vary with feedback from other cloud users getting
cloud services from the same provider [17–19]. Organizations basically evaluate
trustworthiness of different CSPs whenever they wants to migrate its sensitive data on
to the cloud environment. The trust level of that CSP is evaluated using a trust model.
A trust model can be defined as “a coded implementation that relies on concepts of
trust in order to assign a trust value for a CSP, based on which the interactions with
that specific cloud provider are restricted and controlled [11, 20, 21]. Categorization
of different trust models is presented in [12, 22–25].
Based on the evaluation criteria, trust evaluation models are categorized into
four different models as shown in Fig. 2 namely: agreement-based, certificate-based,
feedback-based, and domain-based.
4 Proposed Trust Model
Cloud data center administrators need to use redundancy and disaster backup to
ensure service availability in cloud. Selecting appropriate node in data center for
replication is a challenging task. To solve this, a trust model is proposed. Based on
the trust value, a node will get selected for replication which ultimately enhances
availability in cloud.
4.1 Methodology
For this work, we opted for simulation method for evaluating the trust value of
data center node using Eclipse IDE. This work is done in two phases: In the first
phase design of algorithm for trust model and in the second phase simulating the
model using CloudSim. The simulation is conducted for selected trust issues like
confidentiality, availability, and security. For performing simulations, we have used
open-source cloud environment modeling and simulation tool called CloudSim.
4.2 Model Framework
The trust model used for evaluating trust score for this work consists of five modules
namely: Cloud Service Provider (CSP), Cloud User as Service Requestor, Cloud
Services Trust Management Center (CSTMC), Dynamic Trust Update Mechanism,
and Cloud Service Registration Center as shown in Fig. 3.
Fig. 3 Trust evaluation model

4.3 Trust Evaluation Process
The entire trust evaluation is process is shown in Fig. 4. The evaluation process
considers the direct trust, recommendation trust, and reputation trust. The direct
trust indicates the historical data related to direct interactions between user and
the CSP node. In absence of direct interactions, the evaluation process makes use
of recommended trust. The reputation trust represents the feedback collected from
cloud users regarding service quality of various service attributes provided by CSP
node.
4.4 Trust Evaluation Algorithm
The process of calculating trust value using the proposed model is shown in Fig. 5.
The simulation work is presented to show which node has to be selected for replication
in the given data center. This model is effective in implementing trust issues for cloud
computing environment. This simulation work is conducted on an Intel system with
the following configuration: 1.60 GHz with 2 GB of RAM running a Java version
8.0.2 and JDK 1.8.
The proposed algorithm was run on simulated cloud computing environment using
CloudSim. The virtual environment is created with two data centers, a broker and
a user with series of requests. For each trust issue, a separate experiment is con-
ducted. For each simulation, we took a data center consisting of hosts varying in the
range of 100–1000. And each host with the following configuration: single-core CPU
with processing capacity of 1000 MIPS, 512 MB RAM and 1 GB storage capacity.
Scheduling policy used for VMs was time-shared. Users of cloud are modeled in
such a way to request creation of 5 VMs. Each VM with the following configuration
and constraints: single-core CPU, 1GB storage, and 512 MB physical memory. The
application unit is designed in such way it consists of 5 task units. Each task unit
requiring 1000 MIPS.
Simulation results are shown in Figs. 6, 7 and 8.
Figure 6 shows the comparison of trust evaluation of confidentiality when imple-
mented the proposes algorithm under different trust evaluating classes like domain-
based, certificate-based, feedback-based, and agreement-based trust models using
workload traces in homogeneous environment. The x-axis is being used to represent
the number of cloudlets and the y-axis is being used to represent confidentiality.
The simulation results show that the proposed model gives maximum confidentiality
when compared with other trust models.
Fig. 4 Trust evaluation process

Fig. 5 Proposed trust model
Fig. 6 Comparison of confidentiality

Figure 7 shows the comparison of trust evaluation of detection of malicious behav-

ior when implemented the proposed model along with the algorithm under different
classifications of trust evaluation models namely certificate-based, agreement-based,
feedback-based, and domain-based. Horizontal line indicates number of cloudlets
and vertical line indicates malicious behavior. The simulation result shows that the
proposed model provides better behavior than other models.
Fig. 7 Comparison of malicious behavior
Fig. 8 Comparison of availability

Figure 8 shows the comparison of trust evaluation of data availability when imple-
mented the proposed algorithm under different trust evaluating classes like domain-
based , certificate-based, feedback-based, and agreement-based trust models. In the
figure, x-axis is represented with number of cloudlets and the y-axis is represented
with availability. Simulation shows that if the numbers of cloudlets are less, domain-
based models give enhanced availability. When a number of cloudlets are more, the
proposed model gives better availability.
6 Conclusions
In this paper, a detailed classification of trust evaluation models for cloud namely:
agreement-based, certificate-based, feedback- based, and domain-based are given.
This paper presented a trust evaluation model for selection of better data center node
for replica placement which ultimately helps in providing enhanced availability in
cloud. The proposed trust model is based on combining direct trust, recommended
trust, and reputation together to form a comprehensive trust, which gives accurate
overall trust value of the data center node. The simulation results of proposed model
have shown that the node selected for replication under this model provides enhanced
availability. Further a detailed comparison of proposed model with existing trust
models under parameters like security, confidentiality, and availability is given.
References
1. Ardagna, D., et al.: Cloud and multi-cloud computing: current challenges and future applica-
tions. In: 7th IEEE International Workshop on Principles of Engineering Service-Oriented and
Cloud Systems, Piscataway, Page: 1–2 (2015)
2. Wang, Y., et al.: Trust and reputation model in peer-topeer networks. In: 3rd IEEE International
Conference on Peer-to-Peer Computing, Piscataway, pp. 150–157 (2003)
3. Tang, W., et al.: Z. Research on a fuzzy logic-based subjective trust management model. J.
Comput. Res. Dev., 1654–1659 (2005)
4. Liu, Y., et al.: The Research of Dynamic Trust Evaluation in Mobile AdHoc Networks. Anhui
University (2012)
5. Zhang, Y., et al.: Research of Trust Relationship in Multi-domain Access Control. South-Central
University for Nationalities (2010)
6. Dellarocas, C., et al.: Immunizing online reputation reporting systems against unfair ratings and
discriminatory behavior. In: The 2nd ACM Conference on Electronic Commerce, pp. 150–157.
New York (2000)
7. Zhou, Q., et al.: ’Defense system model based on trust for cloud computing. J. Comput. Appl.
1531–1535 (2000)
8. Hwang, K., Kulkareni, S., et al.: Cloud security with virtualized defense and reputation-based
trust management. In: IEEE 8Th International Conference on Dependable, Autonomic and
Secure Computing, Piscataway, pp. 717–727 (2009)
9. Alhamad, M., et al.: Conceptual SLA framework for cloud computing. In: the 4th IEEE Inter-
national Conference on Digital Ecosystems and Technologies, pp. 606–610. Piscataway (2010)
10. Alhamad, M., et al.: SLA-based trust model for cloud computing. In: 13th IEEE International
Conference on Network-Based Information Systems, pp. 321–324, Piscataway (2010)
11. Noor, T.H., et al.: Cloud Armor: A Platform for Credibility-Based Trust Management of Cloud
Services, pp. 2509–2511 (2013)
12. Asadullah, A., Oyefolahan, I.O., Bawazir, M.A.: Factors influencing users’ willingness to use
cloud computing services: an empirical study. 769, 227–236 (2019)
13. Huang, et al.: Trust mechanisms for cloud computing. J. Cloud Comput. Adv. Syst. Appl. 2(1),
1–14 (2013)
14. Liu, X., et al.: Performance analysis of cloud computing services considering resources sharing
among virtual machines. Int. J. Super Comput. 357–374 (2014)
15. Celesti, A., et al.: Adding long-term availability, obfuscation, and encryption to multi-cloud
storage systems. J. Netw. Comput. Appl. 208–218 (2016)
16. An, K., et al.: ’A cloud middleware for assuring performance and high availability of soft
real-time applications. J. Syst. Archit. 757–769 (2014)
17. Tjang, C., et al.: Research on evaluation of SaaS SP service quality based on SLA. J. Comput.
Eng. 31–36 (2013)
18. Dantas, J., et al.: Eucalyptus-based private clouds: availability modeling and comparison to the
cost of a public cloud, pp. 1130–1140 (2017)
19. Damera, V.K., et al.: Trust issues in cloud computing. Int. J. Recent Technol. Eng. 8(4), 8303–
8308 (2019) ISSN: 2277-3878
20. Cho, J., et al.: A Survey on Trust Modeling. ACM Comput. Surv. 48(2), 1–40 (2015)
21. Lansing, J., Sunyaev, A.: Trust in cloud computing: conceptual typology and trust-building
antecedents. Data Base Adv. Inf. Syst. 47(2), 58–96 (2016)
22. Tang, M., Dai, X., Liu J., Chen. J.: Towards a trust evaluation middleware for cloud service
selection. Futur. Gener. Comput. Syst. 74, 302–312 (2017)
23. Zhang, P.Y., et al.: Security and trust issues in Fog computing: a survey, Futur. Gener. Comput.
Syst. 88, 16–27 (2018)
24. Lins, S., et al.: Trust is good control is better: creating secure clouds by continuous auditing.
IEEE Trans. Cloud Comput. 6(3), 890–903 (2018)
25. Damera, V.K., et al.: Trust evaluation models for cloud computing. Int. J. Sci. Technol. Res.
9(2), 1964–1971 (2020)
Feature Impact on Sentiment Extraction
of TEnglish Code-Mixed Movie Tweets
S. Padmaja, M. Nikitha, Sasidhar Bandu, and S. Sameen Fatima
Abstract Sentiment extraction is a natural language processing task dealing with

the detection and classification of sentiments in various monolingual and bilingual
texts. In this context, the automation of extracting sentiments from social media text
is one of the pertinent areas of research as there is an enormous noisy multilingual
content. This work focuses on extracting sentiments for code-mixed Telugu–English
(TEnglish) bilingual Roman script movie tweets extracted using Twitter API. Ini-
tially, every tweet in the dataset was annotated with the source language of all the
words present and also the sentiment expressed in the code-mixed tweet. The anno-
tated data was automated for sentiment extraction through machine learning-based
approach. Sentiment classification was accomplished with features like character
N-grams, emoticons, repetitive characters, intensifiers, and negation words using
support vector machine classifier with radial basis function as it performs efficiently
in high-dimensional feature vectors. The study was to focus on identifying the type
of feature which has more impact in capturing sentiments. The results show that
character N-grams, emoticons, and negation words are the features that affect the
accuracy most.
1 Introduction
Sentiment extraction is a part of natural language processing that investigates the

automatic deduction for opinion mining of textual data [1]. The ongoing develop-
ment of Web-based life made people utilize multiple languages in social networking.
Yet there are different tasks conducted on code-mixed texts, the task of sentiment
S. Padmaja · M. Nikitha (B)

Keshav Memorial Institute of Technology, Hyderabad, India
e-mail: padmaja@kmit.in
S. Bandu
Prince Sattam Bin Abdul Aziz University, Al-Kharj, Saudi Arabia
S. Sameen Fatima
Anurag University, Hyderabad, India
https://doi.org/10.1007/978-981-16-1502-3_48
488 S. Padmaja et al.
extraction, particularly, has been rarely explored for multilingual code-mixed texts
[2].
It is thus normal for the speakers in multilingual societies to mix and switch
codes according to certain personal and social conditions of the communication
they are involved in. The process of code alternation is called code mixing and code
switching. Code switching describes the switch of languages at a level of either block
of speech, sentences, or words. Further code mixing describes at word level mixing
of two languages [3]. Speakers of more than one language tend to mix their language
during communication. In the context of a single conversation, code switching refers
to alternating between two or more languages or language varieties [4].
Code mixing is utilizing one language in another language, the mixing of at least
two or more languages or language categories in content [5]. The below example
(e.g. 1) is a mix of two languages, namely Telugu transliterations and English. This
frequently happens when the utilization of two languages or two cultures cannot be
separated from the components of one language well and frequent overlap between
the two systems. Code mixing can happen with bilingual or multilingual community
society. Its importance of meaning hidden in the the language cannot be clearly
separated [2].
eg 1: ‘#RaviTeja Sir you are great. #Touchchesichudu movie chala bagundhi. Chala
ante chala bagundhi.... Movie ante ila undali...’
The remaining paper is as discussed. In Sect. 2, previous works on sentiment
analysis of code-mixed text have been discussed. Section 3 focuses on the building
of corpus and the process of its annotation. Section 4 elaborates on the extraction
of different key features from annotated data. Section 5 describes the implementa-
tion of ML technique using SVM classifier and the impact of different key features
when eliminated while extracting sentiments in TEnglish code-mixed data. Section 6
concludes with future work.
2 Related Work
Sentiment extraction became difficult as social media text contains informal text,
bilingual or multilingual text of different scripts, or within a script, so sentiment
extraction is a major task in processing the text for future applications. There are few
authors who worked on these lines.
Ghosh et al. in [6] had worked on Facebook posts and utilized altered information
from ICON—2015 to automatically extract positive and negative opinions for the
English–Hindi and English–Bengali code-mixed information. To perform this task,
he used machine learning approaches. But the use of arbitrary emoticons was not
taken care of. This work also did not deal with handling negation in data.
Sarkar et al. in [7] presented their work as a part of the shared task at the ICON
2017 challenge. Hindi–English and Bengali–English code-mixed online networking
text were labelled with positive, negative, and neutral classes using ML technique.
They built a model by training multinomial Naive Bayes classifier only with n-gram
Feature Impact on Sentiment Extraction of TEnglish … 489
and sentiwordnet as features. But they did not handle machine learning algorithms
like SVM which is one of the most efficient ML algorithms for such complex data.
Jhanwar et al. [8] proposed an ensemble of only character tri-grams-based long
short-term memory model and word n-grams-based multinomial Naive Bayes model
to identify the sentiments of Hindi-English code-mixed data with an accuracy of
70.8% and F1 score proved to be 0.661. But our work is more focused on the impact
of various features in code-mixed data.
3 Corpus Creation and Annotation
3.1 Corpus Creation
The proposed work was focused on TEnglish code-mixed tweeter data on movie
reviews which was online posted in the last 3 years. 54,109 tweeter data was scrapped
using the Twitter Python API.1
Semi-automated extensive pre-processing was carried out to remove all the noisy
tweets. All those tweets which were without movie-related keywords like movie,
casting, lyrics, entertainment, celebrity, actor, actress wrote either in pure Telugu
or in pure English language were removed considering them as noisy, thus keeping
only the code-mixed movie tweets. As a result, out of 54,109, only 22,085 TEnglish
code-mixed movie tweets were left for further processing.
3.2 Data Annotation
Following two phases were used to annotate the text:

Language Annotation: For each word, three kinds of tags, namely ‘other’, ‘en’, and
‘te’, were assigned to its source language by bilingual speakers.
The tag ‘en’ was assigned to English vocabulary words such as ‘amazing’, the tag
‘te’ was assigned to Telugu vocabulary word such as ‘Aavesham’ (anger), and the tag
‘other’ was given to symbols, acronyms, punctuations, emoticons, named entities,
and URLs as shown in e.g. 2.
eg 2: ‘Aavesham||te movie||en is||en really||en amazing||en :)||other
Sentiment Label: Each tweet is labelled with its respective sentiment labels ref-
erenced in Table 1. The data is manually annotated by two bilingual authors with
prescribed guidelines.
Annotation guidelines For annotation, we adopted the approach taken by Moham-
mad [9], and each sentence was annotated according to the following schema:
1 https://pypi.org/project/twitterscraper/0.2.7.
Table 1 Labels used for sentiment

Sentiment polarity Class label used
Positive class 1
Negative class −1
Neutral class 0
• Positive class: There is an implicit or explicit clue within the text suggesting that
the speaker is in a positive class, i.e. relaxed, forgiving, happy, and admiring.
• Negative class: There is an implicit or explicit clue within the text suggesting that
the speaker is in a negative class, i.e. anxious, violent, sad, and angry.
• Neutral class: There is an implicit or clue in the text suggesting that the speaker
is experiencing both negative and positive feelings of neither of them which is
labelled as neutral: Comparing two movies or there is no implicit or explicit indi-
cator of the speaker’s emotional state. For example, asking for like or subscription
or questions about the release date or movie dialogue. This is neither positive nor
negative, and hence, the statement can be labelled as neutral class.
3.3 Inter Annotator Agreement
To identify sentiment in the tweets, two human annotators who have linguistic back-
ground and proficiency in both Telugu and English have carried out the annotation of
dataset. In order to validate the quality of the annotation, the inter annotator agree-
ment was calculated between the two annotation sets each of 22,085 code-mixed
tweets using Cohen’s Kappa coefficient. It was found that the agreement is 0.801
which is significantly high. This implies that the presented schema and quality of the
annotation are productive.
4 Machine Learning-Based Approach
Feature Extraction To train our supervised machine learning model, the work has
been carried out with the following feature vectors.
Character N-grams: They are language independent and very efficient in text clas-
sification. These are also additionally helpful in situations when the text suffers from
errors such as incorrect spellings. In the code-mixed language, groups of characters
can help in capturing semantic meaning where there is an informal use of words.
Character n-grams has been used as one of the features with n varying from 1 to 5.
Emoticons: Emoticons in the form of symbols represent textual portrayal of a writer’s

emotion. For example, ‘:o’ and ‘:(’ express sadness, and ‘:)’ and ‘;)’ express happi-
ness. A list of western emoticons were used from Wikipedia.2
Repetitive Characters: To stress upon a particular emotion, users on social media
often repeat some characters in a word. For example, ‘lol’ (abbreviates laughing out
loud) can be written as ‘lool’, ‘loooool’. ‘Happy’ can be written as ‘happyyy’ and
‘haaaappyy’. Storage of such words in which a particular character is repeated more
than two times in a row is used them as one of the features.
Intensifiers: Intensifiers are used by users to lay out emphasis on sentiments. For
example, ‘Movie chaala disappointing ga undi because the casting was too bad.’,
Translation : ‘Movie was very disappointing because the casting was too bad.’ Here,
‘chaala’ and ‘too’ are used to emphasize on the movie to be bad. English intensi-
fiers’ list was extracted from Wikipedia.3 For creating the list of Telugu intensifiers,
English intensifiers were transliterated to Telugu. The list of Telugu intensifiers were
incorporated which were found in the corpus. The number of such intensifiers was
counted as feature in a tweet.
Negation Words: Negation words were selected to address variance from the desired
sentiment caused by negated phrases like ‘not sad’ or ‘not happy’. For example,
though the tweet ‘Emaina chepu, I did not like the movie!’ has a like unigram, it
should be classified as a sad tweet. Thus, to encounter this problem, negation was
defined as a separate feature. Christopher Pott’s list of English negation words was
used for this purpose.4 Telugu negation words were selected manually from the
corpus. The count of feature was used as the number of negations in a tweet.
Feature Experiment In order to determine the effect of each feature on classification,
several experiments were performed by eliminating one feature at a time. In all the
experiments, tenfold cross-validation was carried out. Experiments were performed
using SVM classifier with radial basis function as they are efficient in case of high-
dimensional feature vectors. For training the system classifier, Scikit-learn was used.
5 Results
22,085 TEnglish code-mixed movie tweets were tested and evaluated using precision,
recall, F-measure, and accuracy.
Further, experiments were performed after eliminating one feature at a time and
using SVM classifier with radial basis function are as shown in Table 2. The results
show that the accuracy of features like character N-grams, emoticons and negation
words affected the most. An accuracy of 77.63% was able to achieve using the
character N-grams, emoticons, repetitive characters, intensifiers, and negation words
as features trained with SVM classifier.
2 https://en.wikipedia.org/wiki/List_of_emoticons.
3 https://en.wikipedia.org/wiki/Intensifier.
4 http://sentiment.christopherpotts.net/lingstruc.html.
Table 2 Impact of each feature when eliminated while extracting sentiments from TEnglish code-
mixed data
Feature eliminated Precision Recall F-measure Accuracy
(%)
None 0.771 0.716 0.726 77.63
Character N-grams 0.711 0.721 0.720 71.84
Emoticons 0.719 0.763 0.727 72.22
Repetitive characters 0.701 0.711 0.721 77.01
Intensifiers 0.714 0.712 0.701 76.71
Negation words 0.729 0.731 0.737 73.15
Character N-grams, emoticons 0.681 0.641 0.630 69.84
Character N-grams, repetitive 0.699 0.701 0.720 71.02
characters
Character N-grams, intensifiers 0.704 0.701 0.701 71.01
Character N-grams, negation words 0.609 0.631 0.601 69.15
Repetitive characters, emoticons 0.709 0.703 0.710 71.22
Repetitive characters, intensifiers 0.729 0.769 0.772 71.22
Repetitive characters, negation words 0.705 0.712 0.703 71.09
Emoticons, intensifiers 0.706 0.693 0.692 71.07
Emoticons, negation words 0.619 0.663 0.627 69.22
Intensifiers, negation words 0.704 0.705 0.733 71.21
Character N-grams, emoticons, 0.612 0.625 0.638 69.06
repetitive characters
negation words
intensifiers
characters, intensifiers
characters, negation words
Character N-grams, intensifiers, 0.603 0.629 0.641 69.01
negation words
Emoticons, repetitive characters, 0.637 0.622 0.652 69.71
intensifiers
Emoticons, repetitive characters, 0.632 0.618 0.629 69.08
negation words
Emoticons, intensifiers, negation 0.621 0.628 0.625 69.07
words
Repetitive characters, intensifiers, 0.651 0.661 0.682 69.78
negation words
In this work, a machine learning approach was used to build a model using TEnglish
code-mixed annotated data. Sentiment classification was accomplished with key
features like character N-grams, emoticons, repetitive characters, intensifiers and
negation words using support vector machine classifier with radial basis function as it
performs efficiently in high-dimensional feature vectors. The study has been focused
on identifying the type of feature which has more impact in capturing sentiments.
The results show that with an accuracy of 77.63 %, character N-grams, emoticons,
and negation words are the features which affect the accuracy most.
This work can be extended further by adding more features to enhance perfor-
mance of the sentiment extraction model. It can further be extended to improve and
refine the techniques to resolve ambiguous words related to movie domain and to
sarcasm. Domain-specific sentiment lexicons are to be created pertaining to movie
domain.
References
1. Padmaja, S., Sameen Fatima, S.: Opinion mining and sentiment analysis-an assessment of peo-
ples belief: a survey. Int. J. Ad Hoc Sens. Ubiquit. Comput. 4(1), 21 (2013)
2. Padmaja, S., Bandu, S., Sameen Fatima, S.: Text processing of Telugu–English code mixed
languages. In: International Conference on E-Business and Telecommunications, pp. 147–155.
Springer (2019)
3. El-Saghir, K.: Code-Switching in Sociolinguistic Studies: Review and Analysis. LIN 5770–
Sociolinguistics, 1–7 (2010)
4. Muysken. , P.C.: Code-switching and grammatical theory (1995)
5. Ranjan, P., et al.: A comparative study on code-mixed data of Indian social media vs formal text.
In: 2016 2nd International Conference on Contemporary Computing and Informatics (IC3I), pp.
608–611. IEEE (2016)
6. Ghosh, S., Ghosh, S., Das, D.: Sentiment Identification in Code-Mixed Social Media Text In:
arXiv preprint arXiv:1707.01184 (2017)
7. Sarkar, K.: JUKS@ SAILCodeMixed-2017: Sentiment Analysis for Indian Code Mixed Social
Media Texts (2018). In: arXiv preprint arXiv: 1802.05737 (2018)
8. Gopal Jhanwar, M., Das, A.: An Ensemble Model for Sentiment Analysis of Hindi-English
Code-Mixed Data (2018). In:arXiv preprintarXiv:1806.04450
9. Mohammad, S.: A practical guide to sentiment annotation: challenges and solutions. In: Pro-
ceedings of the 7th Workshop on Computational Approaches to Subjectivity, Sentiment and
Social Media Analysis, pp. 174–179 (2016)
Linear and Ensembling Regression
Based Health Cost Insurance Prediction
Using Machine Learning
M. Shyamala Devi, P. Swathi, M. Purushotham Reddy, V. Deepak Varma,

A. Praveen Kumar Reddy, Saranya Vivekanandan, and Priyanka Moorthy
Abstract The health insurance is an important big eye-openers during the emer-
gency need during accidents and disease pandemic situations. Many of the people
will lag to hit financially and to bear the operational expenses during treatment. the
need for health insurance changes from youth to old age depending on your lifestyle
and genetics. Due to the change in lifestyle and diseases, the health insurance is
much needed for each individual. Since it is uncertain that a medical emergency can
attack anyone, anytime that impact the person so emotionally and financially. With
all this background, this paper attempts to predict the Health cost insurance based
on the accessible parameters like age, sex, region, Smoking, Body Mass Index, Chil-
dren with the following contributions. Firstly, the Health Cost Insurance dataset is
extracted from UCI machine repository and the data is preprocessed along with
exploratory data analysis. Secondly, the anova test is applied to verify the features
with Probability of F-Statistic PR(>F) < 0.05 that highly influence the Target. Thirdly,
the raw dataset and the feature scaled dataset is applied to all the Linear Regression
models and the performance is analyzed. Fourth, the raw dataset and the feature
scaled dataset is applied to all the Ensembling Regression models and the perfor-
mance is analyzed through intercept, MAE, MSE, R2Score, and EVS. Anova Test
Reults shows that the variable ‘region’ does not influence the target as the F-statistic
value is 0.14. Experimental results show that polynomial regression is achieving
88% of R2Score before and after feature scaling. The Random Forest regression is
achieving 86% of R2Score before and after feature scaling.
M. Shyamala Devi (B) · P. Swathi · M. Purushotham Reddy · V. Deepak Varma ·

A. Praveen Kumar Reddy
Computer Science & Engineering, Vel Tech Rangarajan Dr. Sagunthala R&D Institute of Science
and Technology, Chennai, Tamil Nadu, India
e-mail: shyamaladevim@veltech.edu.in
S. Vivekanandan
Infologia Technologies, Chennai, Tamil Nadu, India
P. Moorthy
RedBlackTree, Chennai, Tamil Nadu, India
https://doi.org/10.1007/978-981-16-1502-3_49
1 Literature Review and Shortcomings
Predictive machine learning models [1] were used to forecast the expenditures, espe-
cially for high-cost, high-need (HCHN) patients. It demonstrates temporal correlation
and predicts future health care expenditures using machine learning and observes
that variables with limited predictive accuracy, population-level models that offer
limited information at patient-level [2, 3]. The model demonstrates the transforma-
tional power of machine learning and artificial intelligence in care management,
which would allow healthcare payers and providers to introduce care management
programs [4, 5]. Interpretable regression method based on evidence Regression
model to predict the cost for insurance [6, 7]. Machine learning models identify and
predict potential high-cost patients and explore the key variables of the forecasting
model, by comparing differences in the predictive performance of variable sets [8].
An exploratory data analysis was performed on the claims data set [9]. The EDA
study aimed at understanding the data properties, inspecting qualitative features, and
discovering new patterns and associations in the data through summarization and
visualization [10]. The risk in building the automated health risk prediction model
have the inability to directly ascertain clinical phenotypes, potential utility in disease
risk prediction, when combined with data-driven machine learning [11].
2 Overall Architecture
2.1 Dataset Preparation
The Health Insurance Cost Prediction dataset is used from UCI Machine Repository
with independent variable such as age, sex, region, Smoking, Body Mass Index,
Children, and dependent variable as Charges. The overall workflow is shown in
Fig. 1. The contributions of this paper is given below.
1. Firstly, the Health Cost Insurance dataset is preprocessed along with exploratory
data analysis.
2. Secondly, the anova test is applied to verify the features with Probability of
F-Statistic PR(>F) < 0.05 that highly influence the Target.
3. Thirdly, the raw dataset and the feature scaled dataset is applied to all the Linear
Regression models and the performance is analyzed.
4. Fourth, the raw dataset and the feature scaled dataset is applied to all the Ensem-
bling Regression models and the performance is analyzed through intercept,
MAE, MSE, R2Score, and EVS.
Linear and Ensembling Regression Based Health Cost … 497
Fig. 1 Overall workflow of

Health Cost Insurance Dataset
this paper
Data Preprocessing
Splitting Training and testing Dataset
Exploratory Data Analysis of Dataset for all features
Building various Linear and Ensembling

Regression Models and fitting with the Dataset
Analyzing performance before and after Feature Scaling
Analysis of Intercept, EVS, MSE, MAE and RScore
Insurance Cost Prediction
3 Feature Analysis
3.1 Anova Test Analysis
Anova test is applied to dataset features and results shows that “Region” have value
of PR(>F) > 0.05 as 0.14 and does not contribute to target as in Table 1.
Anova test is used to analyze the features of the dataset by comparing both the
null and alternate hypothesis. If the P value associated with the Fstatistic is less than
0.05, then the existence of that feature highly influence the target.
Table 1 Anova test analysis with the dataset features

Features Sum_sq df F PR(>F)
Age 1.753019E + 10 1 131.174013 4.88669E−29
Sex 6.4359021E + 8 1 4.3999702 0.036133
bmi 7.7133911E + 9 1 54.709308 2.459086E−13
Children 9.0659991E + 8 1 6.206037 0.012852
Smoker 1.2151999E + 11 1 2177.6148 8.271436E−28
Region 3.0555127E + 8 1 2.084934 0.148993
Fig. 2 Distribution of health cost with children, sex, and smoking
3.2 Dataset Exploratory Analysis
The extracted dataset is analyzed inorder to extract the relationship of each of the
independent variables with respect the dependent variable health cost charges and the
distribution of the health cost with respect to children, sex, and smoking are shown
in Fig. 2. The distribution of charges with the dataset independent variables is shown
in Figs. 3 and 4.
4.1 Implementation Setup
The Health Insurance Cost Prediction dataset is used from UCI Machine Repository
with independent variable as age, sex, region, Smoking, Body Mass Index, Children,
and dependent variable as Charges. The Anaconda IDE is used to implement python
in Spyder editor for predicting the health cost. Dataset is fitted with linear regression
models and Training VS testing data is shown in Fig. 5.
The dataset is fitted with ensembling regression models and anlaysis of Training
and testing data is in Fig. 6.
The performance analysis of the ensembling models before and after feature scaling
is done with EVS, MAE, MSE, and R2Score and is shown in Figs. 7 and 8.
The performance analysis of the Linear models before and after feature scaling is
done with EVS, MAE, MSE, and R2Score and is shown in Figs. 9 and 10.
Fig. 3 Relationship of charges and bmi based on [Top] (left) smoker (right) children. [Bottom]
(left) sex (right) region
Fig. 4 Relationship of charges with (left) sex (right) region
5 Conclusion
This paper attempts to explore the prediction of health cost insurance by applying
to linear and ensembling regression models before and after feature scaling. Anova
test is applied to dataset and results show “Region” have F-statistic value of PR(>F)
Fig. 5 Training data versus testing data prediction analysis for linear regression models
>0.05 as 0.14 and does not contribute to target. The dataset is applied to linear regres-
sion models like Linear, Ridge, RidgeCV, ElasticNet, ElasticNetCV, Lars, LarsCV,
Lasso, LassoCV, LassoLars, LassoLarsCV, LassoLarsIC, BayesianRidge, Polyno-
mial, Linear Support vector, and NuSupport Vector Regression models before and
after feature scaling. The dataset is applied to ensembling regression models like
Decision Tree, Extra Tree, Ada Boost, Bagging, Gradient Boosting, Random Forest,
and Partial Least Square Regression models before and after feature scaling. Experi-
mental results show that polynomial regression is achieving 88% of R2Score before
Fig. 6 Training data versus testing data prediction analysis for ensembling regressions
Fig. 7 Performance analysis of ensembling regression models before feature scaling
Fig. 8 Performance analysis of ensembling regression models after feature scaling

Fig. 9 Performance analysis of linear regression models before feature scaling
Fig. 10 Performance analysis of ensembling regression models after feature scaling

and after feature scaling. The Random Forest regression is achieving 86% of R2Score
before and after feature scaling.
References
1. Yang, C., Delcher, C., Shenkman, E., et al.: Machine learning approaches for predicting high
cost high need patient expenditures in health care. Bio. Med. EngOnLine 17, 131 (2018)
2. Maisog, J., Li, W., Xu, Y., Hurley, B., Shah, H., Lemberg, R., Borden, T., Bandeian, S., Schline,
M., Cross, R., Spiro, A., Michael, R., Gutfraind, A.: Using massive health insurance claims
data to predict very high-cost claimants: a machine learning approach (2019)
3. Sethi, P., Jain, M.A.: Comparative feature selection approach for the prediction of healthcare
coverage. Commun. Comput. Inf. Sci. 54, 392–403 (2010)
4. Panay, B., Baloian, N., Pino, J., Peñafiel, S., Sanson, H., Bersano-Méndez, N.: Feature selection
for health care costs prediction using weighted evidential regression. Sensors 20 (2020)
5. Luo, L., Li, J., Lian, S.: Using machine learning approaches to predict high-cost chronic
obstructive pulmonary disease patients in China. Health Inf. J. 26(3), 1577–1598 (2020)
6. Xie, Y., Schreier, G., Chang, D., Neubauer, S., Liu, Y., Lovell, N.: Predicting days in hospital
using health ınsurance claims. IEEE J. Biomed. Health Inf. (2015)
7. Park, J.H., Cho, H.E., Kim, J.H.: Machine learning prediction of incidence of Alzheimer’s
disease using large-scale administrative health data. npj Digit. Med. 3, 46 (2020)
8. Dhieb, N., Ghazzai, H., Besbes, H., Massoud, Y.: A secure AI-driven architecture for automated
insurance systems: fraud detection and risk measurement. IEEE Access 8, 58546–58558 (2020)
9. Blough, D.K., Ramsey, S.D.: Using generalized linear models to assess medical care costs.
Health Serv. Outcomes Res. Method. 1, 185–202 (2000)
10. Lysaght, T., Lim, H.Y., Xafis, V., et al.: AI-Assisted decision-making in healthcare. ABR 11,
299–314 (2019)
11. Boodhun, N., Jayabalan, M.: Risk prediction in life insurance industry using supervised learning
algorithms. Complex Intell. Syst. 4, 145–154 (2018)
An Adaptive Correlation
Clustering-Based Recommender System
for the Long-Tail Items
Soanpet Sree Lakshmi, T. AdiLakshmi, and Bakshi Abhinith
Abstract This is the study of long-tail problem of a recommender systems. The long
tail has few ratings and is therefore difficult to use in recommendation systems. The
approach presented in this paper separates the items according to their popularities.
The head items are recommended based on their popularities. Long-tail items are
correlation clustered according to their similarities. This method is applied on a
subset of real-life dataset, and accuracy of rating prediction is studied. The diversity
of recommendations is also ensured by including popular items from head part and
also niche items from the long-tail part.
1 Introduction
There are various recommender systems like news recommender, movie recom-
mender, music recommender to name a few. Such recommendations tend to improve
user experience. They also help the organizations to improve their businesses through
targeted marketing [1]. The various issues of recommendation systems are addressed
in [2–4]. Many recommendation systems are ratings based, and most of them often
give less importance to unpopular items. These items have lesser ratings compared to
the popular items. However, in most real-life datasets, the number of popular items
is far less compared to these niche items in the long tail [5]. The long-tail items
have great potentiality to improve businesses, enabling personalization [6]. Various
approaches are proposed in the literature to improve recommendations of the items
in the long tail [7–9]. This work is based on adaptive clustering method proposed
in [9]. The approach divides the items based on their popularity into head and tail
sets. The head items are recommended based on conventional each item. Method.
The items in the tail are then clustered based on their popularities. The author of
[9] proposed that such a method reduces the computation overhead of head part and
improves performance in the tail part of the dataset.
S. S. Lakshmi (B) · T. AdiLakshmi · B. Abhinith

Vasavi College of Engineering, Hyderabad 500031, India
https://doi.org/10.1007/978-981-16-1502-3_50
506 S. S. Lakshmi et al.
We propose an adaptive recommender approach focussing on correlation clus-

tering of the items in the long tail while keeping the recommendation in the head
part simple.
The rest of this paper is organized into five sections:
Section 2 explains related work.
Section 3 presents the experimental settings.
Section 4 describes the adaptive correlation clustering-based recommendation.
Section 5 presents the experimental results, and finally, concluding remarks are
described in Sect. 6. The distribution of movie ratings for considered dataset is
included in the Appendix.
2 Related Work
2.1 Adaptive Clustering
The clustering method proposed in [9] showed that it outperformed many conven-
tional recommendation systems by employing different recommendation approaches
in head and tail part. Hence, the approach proposed is chosen for recommendation
for long-tail items.
2.2 Correlation Based Clustering
The clustering technique used in proposed method is based on a similar approach

proposed by Bohm et al. [10]. The authors propose a correlated connected clustering
to improve clustering accuracy. In their paper, density-based clusters were generated,
and the next point in the neighbourhood is included in the cluster only if it has desired
correlation similarity with core point.
2.3 Proposed Adaptive Correlation Clustering
The proposed solution is recommendation system based on adaptive correlation

clustering technique. This paper implements the adaptive approach where popular
genre-based recommendation is applied for the head part of the data, and correlation
clustering-based recommendation is chosen for the tail part. By applying correlation
clustering to the items in the tail part, we propose to fine-tune the recommenda-
tions. The items can thus be suitably grouped, thereby improving the quality of
recommendation.
An Adaptive Correlation Clustering-Based Recommender System … 507
3 Experimental Settings
The method proposed is applied to a subset of popular dataset: Movielens [11]. The
movielens dataset contains movie-related tags information and the user movie ratings.
It originally contained 20,000,263 ratings and 465,564 tag applications across 27,278
movies. The user demographics information is not included in the given dataset. The
ratings are given on a scale of 1 to 5 from 138,493 users. The tag genome is a data
structure that contains tag relevance scores for movies. The tag genome encodes how
strongly movies exhibit particular properties represented by tags in genome scores.
From this data, a subset of first 1000 users was considered. The movies rated by
these 1000 users were extracted. The movie was considered only if it had a minimum
of 25 ratings. The total number of movies rated by these users all together is 1490.
Splitting point (α) for head and tail distribution was chosen to be 100. Distribution
of ratings for the 1000 users—1490 movies subset of movielens is shown in the
Appendix.
3.1 The Derived Variables
User related
1. User_fav_genre: the favourite genre of the user based on ratings.
2. User_genre_avg: the average rating given by user for the movies genre wise.
3. User_fav_cluster: cluster of movies with more than average ratings given by
user.
Movie Related
1 Movie_avg_rating: the average ratings value given by the users.
2 Movie_count: number of ratings for a movie.
3 Movie_genre: the genre to which the movie associates itself to is calculated.
4 The Proposed Method
4.1 Method to Predict Rating Value for a Given UserId

and MovieId (Fig. 1)
4.2 o Generate Recommendation List for a Given UserId

(Fig. 2)
The recommendation list generation list is based on:

(i)Adaptive_CorrClus (userId, movieId)
Step1:
Calculate user -related and Movie related derived variables User_fav_genre, User_genre_avg, Movie_avg_rating, Movie_count, Movie_genre
Step 2: depending on movie_count , a criterion (α) is chosen to split the movies data into 2 parts : head, tail . these are used for adapve
recommendaon.
(a) If the movie_count>(α), go to step 3

(b) else if movie_count<=(α) go to step 4.
Step 3: Predict rating based on User_genre_avg calculated for input value of userId and movieId.
Step 4 : predict rating based on clustered movies rating.
(a) the movies are clustered based on correlaon connectedness

(b) find the cluster to which the movieId belongs to.
(c) Predict the rating based on the average of user_genre_ratings for movies of same genre in this cluster.
Step 4: calculate error between actual rating and predicted rating .
Step 5: Calculate MAE and RMSE
Fig. 1 Method to predict rating value for a given userId and movieId
(ii) recommend_movies(userId)
Step1: Calculate user -related and Movie related derived variables- User_fav_genre, User_fav_cluster, User_genre_avg, Movie_avg_rating, Movie_count,
Movie_genre
Step2: compute the User_fav_genre and User_fav_cluster
Step3: depending on movie_counts, a criterion (α) is chosen to split the movies data into 2 parts: head part, tail part.
Step4: generate movie_clusters based on correlation clustering.
Step 4: The recommendation list is generated for userId with 10 movies. the list consists of two sublists of 5 movies each.
a) sublist_h composed of five popular movies from the head part based on user_fav_genre
b) sublist_t is composed of movies chosen from user_fav_cluster
Step 5: display the list with sublist_h and sublist_t.
Fig. 2 To generate recommendation list for a given userId
1. Head part recommendation:

The recommendation of movies in head part is straight forward. The movies in
the head part are sorted in the descending order of ratings. The fav_genre of user
is extracted, and the top five movies of the users’ favourite genre are chosen for
this sublist_h, and the recommendation ensures that the movies already seen by
the user will not be included in this sub list.
2. Tail part recommendation:
The movies are clustered based on correlation connectedness. The clusters thus
formed are used for the recommendation of movies in the long tail. Each movie
is described in 1128 tags. These movies were correlation clustered based on their
corresponding tags value.
The movies thus extracted were all assigned to the appropriate cluster.
An Adaptive Correlation Clustering-Based Recommender System … 509
When a user id is provided as input, the user_fav_genre is extracted based on the

users rating patterns. The top five ratings values are considered for recommendation
of genre that is most liked by a user. From this list, the maximum—preferred genre
is extracted and assigned to the user as the User_fav_genre. For the given userId,
the movies from the User_fav_cluster are extracted and corresponding clusterId is
identified.
Five popular movies are extracted randomly from this cluster, and the other sub-
list is generated. The recommendation ensures that the movies already seen by the
user will not be included in both the sub-lists.
Sample Outputs:
5.1 Rating Prediction for 105 Users (Userids 751–855)
105 users were chosen for testing prediction of rating. These users watched 5017
movies altogether. The MAE and RMSE are calculated for these 5017 predictions
(Table 1).
5.2 Rating Prediction for 20 Movieids
20 MovieIds were chosen for testing prediction of rating. These movies have 740
ratings altogether. The MAE and RMSE are calculated for these predictions (Table
2).
5.3 Recommendation List
Recommendation list is generated for two users; sample list for user userId 751 and
994 is generated. Ten movies are recommended for each user (Fig. 3).
6 Conclusion
In this paper, we employed the adaptive correlated clustering technique, and the MAE
and RMSE were calculated. In calculation of predicted ratings, the next highest rate
Table 1 Output_screen_snip-Calculated MAE and RMSE for user 751-855
value is considered. Further, the items in the recommendation list were based on
combination of popular items and niche items. Thus, diversity in recommendation
is ensured. However, the performance of recommender system improves further if
user demographics are considered.
An Adaptive Correlation Clustering-Based Recommender System 511
Table 2 Output_screen_snip for movie specic recommendation 20 sample movies

uid movid predic Actua1 rat error MAE RMSE
f rat
9 4369 3.063 4 0.94 0.706459 0.90677
24 4369 3.185 3 0.19
96 4369 3.164 3 0.16
116 4369 2.579 1 1.58
131 4369 2.623 0.5 2.12
156 4369 3.361 4 0.64
206 4369 3.328 3.5 0.17
247 4369 3.19 3 0.19
258 4369 3.172 4 0.83
294 4369 3.172 3 0.17
313 4369 3.034 2.5 0.53
337 4369 3.488 3.5 O.Ol
367 4369 3.05 2.5 0.55
369 4369 3.36 3.5 0.14
383 4369 2.632 3 0.37
388 4369 2.599 1 1.6
422 4369 3.033 5 1.97
430 4369 3.329 4.5 1.17
462 4369 3.285 3.5 0.22
469 4369 2.666 0.5 2.17
489 4369 3.104 2.5 0.6
520 4369 3.585 5 1.41
MAE 0.707
RMSE 0.907.
Fig. 3 Sample
recommendation lists
Appendix
Distribution of ratings for the 1000 users—1490 movies subset of movielens:

An Adaptive Correlation Clustering-Based Recommender System 513
References
1. Adomavicius, G., Tuzhilin, A.: Toward the next generation of recommender systems: a survey
of the state -of-the art and possible extensions IEEE Trans. Knowl. Data Eng. 17(6), 734749
(2005)
2. Sree Lakshmi, S., Adi Lakshmi, T.: The survey of recommender systems. Int. J. Eng. Trends
Technol. (IJETT) Special Issue (2017)
3. Ramakrishna Murty, M., Murthy, J.V.R., Prasad Reddy, P.V.G.D., Sapathy, S.C.: Performance of
teaching learning based optimization algorithm with various teaching factor values for solving
optimization problems. In: International Conference FICTA-13 at Bhuveneswar, Springer AISC
(indexed by SCOPUS, ISI proceeding DBLP etc), vol. 247, pp. 207216 (2013). ISBN 978-3-
319-02931-3
4. Ramakrishna Murty, M., Murthy, J.V.R, Prasad Reddy, P.V.G.D., Satapathy, S.: Homogeneity
separateness: a new validity measure for clustering problems. In: International Conference and
Published the Proceedings in AISC and Computing, pp. 110. Springer, (indexed by SCOPUS,
ISI proceeding DBLP etc) vol. 248 (2014). ISBN 978-3-319-03106
5. Cremonesi, P., Garzotto, F., Pagano, R., Quadrana, M.: Recommending without Short Head,
www 14 companion, April 711, 2014
6. Anderson, C.: The Long Tail. Hyperion Press (2006)
7. Yin, H., Cui, B., Li, J., Yao, J., Chen, C.: Challenging the long tail recommendation. In:
Proceedings of the VLDB Endowment, vol. 5(9)
8. Park, Y.J., Tuzhilin, A.: The long tail of the recommender systems and how to leverage it. In:
Proceedings of ACM Conference Recommender Systems, pp. 1118 (2008)
9. Park, Y.J.: The adaptive clustering method for the long tail problem of recommender systems.
IEEE Trans. Knowl. Data Eng. 25(8) (2013)
10. Bohm, C., Kailing, K., Kroger, P., Zimek, A.: Computing clusters of correlation connected
objects. In: Proceedings of ACM International Conference on Management of Data (SIGMOD),
pp. 455466. Paris, France
11. https://les.grouplens.org/datasets/movielens/ml-20m-README.html
12. https://les.grouplens.org/papers/tag_genome.pdf
Plant Leaf Identification Using HOG
and Random Forest Regressor
Jyotisagar Bal, Manas Kumar Rath, and Prasanta Kumar Swain
Abstract According to Indian state of Forest Report 2019, the total forest in India
is 712,249 km2 which is 22% of total geographical area of India. India is rich in
biodiversity which includes more than 40,000 species of plants. It is very difficult to
distinguish between different plant species. Botanist can identify these plants using
the characteristic of leaf but the process is very difficult and time taking. So, in this
paper, we proposed a method to recognize plants on the basis of its leaf pattern. Here,
Histogram of Oriented Gradients (HOG) and Random Forest Regressor techniques
are used for plant leaf image classification and recognition. Experimental results
show that the proposed model achieves accuracy up to 99% in leaf recognition.
1 Introduction
Plants play a vital role in sustaining life on Earth. Ecosystem plants are the primary
producer as they can only convert solar energy to chemical energy through the process
of photosynthesis. Plants also play an important role in curbing pollution and release
fresh oxygen to atmosphere. Plants contain medicinal properties which help us to
cure many diseases. AYUSH organization of India has identified over 8000 herbal
remedies. World health organization (WHO) in its survey told that 80% of people
worldwide rely on herbal medicine for their primary healthcare needs. Plants have
also economic significance as it produces wood, timber, flower, fruit, etc. Many
flowering plants are used as a source of raw material for perfume manufacturing
industry. Horticulture is also helpful in creating employment in India. Tribal people
depend upon minor forest products for their livelihood.
India is rich in its biodiversity. India has four biodiversity hotspots, i.e., Eastern
Himalaya, Western Himalayas, Western Ghats and Andaman and Nicobor Island.
J. Bal · P. K. Swain (B)

North Orissa University, Baripada, India
M. K. Rath
KIIT Deemed University, Bhubaneswar, India
https://doi.org/10.1007/978-981-16-1502-3_51
516 J. Bal et al.
India is home for more than 40,000 species of plant including a variety of endemics.
Therefore, it is important to identify different plant species to know their medic-
inal and other economic benefits so that appropriate steps could be taken for their
preservation. But unfortunately, due to limited research and time taking process,
small number of plants have been identified. Although plant species may resemble
morphologically, each plant has a distinct leaf shape. Therefore, proper study of leaf
pattern can pave a way for easy and fast identification of plant species. Hence, we
used HOG and Random Forest Regressor [1–3] to analyze leaf shape and identify
different plant species.
Remaining of the paper is organized as follows. Section 2 represents literature
review. Overview of image identification method is given in Sect. 3. Dataset creation
and experiment is done in Sect. 4. Performance study is presented in Sect. 5, and
Sect. 6 concludes the paper.
2 Literature Review
After a deep literature review of papers based on wood identification, human identifi-
cation, plant leaf identification using several methods like HOG, CNN, visual system
and algorithms like SVM, Linear SVM, GoogleNet, Random Forest Regressor, we
followed the following three papers as they have higher relevance to the proposed
work.
Ecosystem consists of hundred numbers of trees and it is very difficult to distin-
guish between them. While working with plants and leaves it is believed that infor-
mation can be obtained from plant leaf images [4] are sufficient to identify different
plant species. For classification of images, better accuracy, faster execution, a proper
feature descriptor, and suitable classifier are very much essential. So, HOG as feature
descriptor and algorithm of image feature extraction by Navneet Dalal and Bill Triggs
is applied on the ICL database to make the model [5]. HOG feature extraction is
done on the basis of calculating well-normalized HOG in the detection window. The
features are extracted based on these steps:
1. Counting histograms of oriented gradient cell.
2. Segment images into cell.
3. Normalization of histograms on overlapping blocks.
The dataset used here is ICL public database, in which all the images are taken by
cameras or scanners in a white background under various illumination conditions.
All the images are of uniform size and colorful. The database includes 200 species of
plant and a total of 6000 images. A series of experiment is done by changing the cell
size and block size of image, increasing and decreasing the number of orientation
bins, changing the block stride size and found that it affects the final result in a great
way.
Identifying humans in an image is also a challenging task. To detect a human in
an image, first it needs to separate him from the background which can contain a
Plant Leaf Identification Using HOG and Random … 517
thousand number of data and information. Human beings can also have a wide range
of poses for which we need a powerful and advanced model to identify. Navneet
Dalal and Bill Triggs made a model using HOG as feature descriptor and Linear
SVM algorithm for classification purpose [6].
The MIT pedestrian dataset containing 509 training and 200 testing images and
“INRIA” dataset containing 1805 of 64 × 128 images of humans cropped from
several photos is used for experimentation. In the preprocessing step, image is normal-
ized into gamma and color, and the number of gradients is calculated. Then the
contrast of overlapping spatial blocks is normalized to reduce the noise. After that,
HOG feature is collected over detection window, and then linear SVM algorithm is
applied to classify persons from other objects. This experimental result shows that
normalized HOG features similar to SIFT descriptors in a dense overlapping grid
and gives very good result. Machine learning is a growing technique and advanced
hardware with big data made this more practical. Convolutional Neural Network
(CNN), which is more often used for deep learning is applied to check its robustness
over plant leaves [7].
CNN model works more likely visual systems in humans. When a human sees an
object, the edges of the object are detected on the basis of light intensity difference
and then this information is transferred to lateral geniculate nucleus (LGN). The
LGN neurons compress the entire shape around the corner and send it to primary
visual cortex (v1). It identifies corners, contour and direction and difference between
the objects, and the result is sent to secondary visual cortex (v2). Then v2 neuron
identifies overall shape and sends the result to visual cortex (v3). V 3 neuron identifies
the color of whole object and overall shape and color of the object is re-identified in
lateral optical cortex (LOC). CNN has several simple computing units of artificial
neuron, and every unit is connected to each other through weight connectors. These
weights are calculated of the given input to produce the desired output. Here, CNN
and GoogleNet are used together for training and testing of the dataset.
3 Overview of Image Identification Method
In this paper, we have implemented HOG and Random Forest Regressor to develop
the image identification system. It mainly consists of three phases as shown in Fig. 1.
1. Preprocessing of the sample image.
Fig. 1 An overview of image identification system with HOG and Random forest
518 J. Bal et al.
2. Feature extraction [8] using HOG method.

3. Classification [9] of the plant species using Random Forest Regressor.
In preprocessing step, the leaf images are resized and set to a ratio of 1:2 of
width and height for further processing. At the second step, the HOG is used to
extract features from the leaves. In the last step, Random Forest is used to classify
the species of the plant.
3.1 Histogram of Oriented Gradients (HOG)
Mostly for computer vision and object detection, feature extraction from a captured
or live image is done after defining HOG feature description. From Fig. 2, it is
clearly visible that the image has the information like object shape, color, edges
and background. But, Fig. 3 has only limited information; still, it is easy to identify
because it has only the essential information that we want to recognize that object.
This is the main task of a feature descriptor [10]. For this purpose, HOG is used in
our research so that it not only identifies the object but also reduces the complexity
and processing time.
3.1.1 Working Principle of HOG
HOG scans the image bit by bit, and it mainly focuses on the shape or structure of the
image. It can also give the edge direction by mapping the orientation and gradient
of the image. The whole image is divided into small regions, and for every region,
Fig. 2 Ballot paper
Fig. 3 Histogram of ballot

paper
the orientation and gradients are calculated. Then HOG is created for each block
separately. The histogram is created using orientations and gradients of each pixel
value for this it is named as HOG.
3.1.2 Steps to Calculate HOG
The image given below is of (6000 * 8000) size. Let’s calculate HOG for this image:
(i) Preprocess the data:
While working on images with machine learning, preprocessing [11] of the
data is very much important. In the first step, we have to balance the ratio to 1:2
between width and height that means balancing to the size of (64 × 128). Such
size is due to the division of the image block wise into (8 × 8) or (16 × 16)
for feature extraction. Image with a particular size will make our calculations
very simple. Figure 4 is the sample of a china leaf from our proposed dataset
and Fig. 5 is the resized image (64 × 128) of china leaf.
(ii) Calculating the gradients (direction x and y):
Subsequent step involves the calculation of gradient value of each image pixel.
Let us take a table and calculate the gradients.
Let’s, calculate the gradient for the colored pixel. The gradient is calculated in X
direction by subtracting the left pixel value from the right pixel intensity value and
in the same way the gradient is calculated in Y direction by subtracting the below
Fig. 4 A china leaf
Fig. 5 Resized china leaf

520 J. Bal et al.
Fig. 6 Pixel values of small

patch of an image
Fig. 7 Pythagoras formula
pixel value from the above pixel intensity value. The result is shown in Figs. 6 and
7.
Change in X direction (Gx) = 178–156 = 22.
Change in Y direction (Gy) = 128–112 = 16.
Now, we have two resultant matrices, first one stores the X direction gradients
and the other stores the same in Y direction. After that similar process is iterated for
each image pixel. The next step is to calculate the orientation and magnitude with
the help of gradients that we have calculated in the previous step. Here Pythagoras
theorem will be used to calculate the orientation.
Previously, we got that Gx = 22 and Gy = 16. Applying Pythagoras theorem, the
total gradient magnitude is calculated
√ as:
Total gradient magnitude = √[(Gx)2 + (Gy)2 ]
Total gradient magnitude = [(22)2 + (16)2 ] = 27.2
Further, pixel orientation can be calculated by taking the tangent for the angles:
Tan(Ø) = Gy/Gx
So, the angle value would be,
Ø = atan(Gy/Gx) = 72.
Now, the histogram can be created using the orientations and gradients. With the
generated frequency table (as shown in Fig. 8), HISTOGRAM with angle is created
on X-axis and the Y-axis frequencies. After HOG is carried out to decrease the noise
of the image.
50 70 81 93 23
79 85 128 125 48
25 156 170 178 93
33 59 112 81 110
37 135 127 89 75
FREQUENCY 1
ANGLE 1 2 3 .. 70 71 72 73 74 .... 177 178 179 180
Fig. 8 Pixel and frequency table for HOG calculation
3.2 Random Forest Algorithm with Python and Sci-Kit-Learn

Library
Random forest algorithm undergoes supervised machine learning based on ensemble

learning. In ensemble learning, different types of algorithms can be joined or same
algorithms joined multiple times to build a more powerful prediction model. In
random forest algorithm, multiple decision trees combined multiple times resulting
in a forest of trees that is why it is known as “Random Forest”.
How Random Forest works
Firstly, it picks N number of random records from the given dataset, and then it builds
a decision tree. Then the numbers of trees are chosen according to required model
and size of the dataset. Then the above steps are repeated again. If the user adds a
new data and regression problem [12, 13] occurs then each tree in the forest predicts
a value for the output. Then the final value is calculated by taking the average of all
values.
4 Dataset and Experiment
The dataset containing leaves of 11 different plant species is collected (shown in

Fig. 9) from rural areas of Odisha which includes 1100 leaf images. All these images
are taken by mobile camera under several lighting conditions. After leaves are plucked
from plant it placed on a white piece of paper for background. Only upper part of
the leaf images is taken. All the images are of uniform size. Some damaged leaves
are also taken in the dataset for more complexity and to make a better and powerful
model.
Throughout the experiment, it is seen that several factors like number of orientation
bins, number of trees in Random Forest and image size affect the final result as well
as computing time also as shown in Figs. 10 and 11.
522 J. Bal et al.
Fig. 9 Several types of leaf samples from dataset
Fig. 10 Effect of no. of

orientation bins
Fig. 11 Effect of block size

and cell size
5 Performance Study
See Table 1.
6 Conclusion
In this paper, we have proposed a technique to identify plant leaves based on their
color and structure using HOG and Random Forest Regressor. A dataset of 1100
different types of leaf images has been created. The experimental result shows that
our model performs very well with 99% accuracy when all the variables are set in
Table 1 Comparative study of the proposed method with different methods used in the literature
Paper name Algorithms Accuracy Dataset Pros and Cons
Plant leaf HOG 85–97% ICL dataset Pros:
recognition using • Independent of
histogram of algorithm
oriented gradients • Great result
[5] Cons:
• Third party data
• Images captured
with white
background
• Noisy data
affecting the
accuracy
HOG for human HOG and linear 84–89% MIT pedestrian Pros:
detection [6] SVM test dataset • Work tested on
several large and
complicated
dataset
• Works fine with
a great result
Cons:
• Needs a
powerful
processor with
more RAM for
computation
Plant leaf CNNVisual 94% with good Flavia dataset Pros:
recognition using a system and data and 90% • Achieves
convolution neural Google Net with noisy data accuracy even
network [7] when 30% of the
images are
destroyed
Cons:
• Computation
level is high
• Generalization is
difficult due to
dependency on
specific data
(continued)
524 J. Bal et al.
Table 1 (continued)
Paper name Algorithms Accuracy Dataset Pros and Cons
Our work: Plant HOG and 99% Own dataset Pros:
leaf identification Random Forest • Great accuracy
using HOG and Regressor • Faster than other
Random Forest models
Regressor • Own dataset,
model predicts
well even for
damaged leaves
and noisy data
• Real-world
implication is
possible
proper values. Further, we are working on how to identify leaves attached to plant
without plucking it and also without any white background.
Reference
1. Tsolakidis, D.G., Kosmopoulos, D.I., Papadourakis, G.: Plant leaf recognition using Zernike
moments and histogram of oriented gradients. In: Hellenic Conference on Artificial Intelli-
gence, pp. 406–417. Springer, Cham (2014)
2. Liu, J., Lv, F., Di, P.: Identification of sunflower leaf diseases based on random forest algorithm.
In: International Conference on Intelligent Computing, Automation and Systems (ICICAS),
pp. 459–463. IEEE (2019)
3. Chaki, J., Parekh, R.: Plant leaf recognition using shape based features and neural network
classifiers. Int. J. Adv. Comput. Sci. Appl. (IJACSA) 2(10) (2011)
4. Raut, S.P., Bhalchandra, A.S.: Plant recognition system based on leaf image. In: 2nd Interna-
tional Conference on Intelligent Computing and Control Systems (ICICCS), pp. 1579–1581.
IEEE (2018)
5. Xia, Q., Zhu, H.D., Gan, Y., Shang, L.: Plant leaf recognition using histograms of oriented
gradients. In: International Conference on Intelligent Computing, pp. 369–374. Springer, Cham
(2014)
6. Dalal, N., Triggs, B.: Histograms of oriented gradients for human detection. In: IEEE Computer
Society Conference on Computer Vision and Pattern Recognition (CVPR’05), vol. 1, pp. 886–
893. IEEE (2005)
7. Jeon, W.S., Rhee, S.Y.: Plant leaf recognition using a convolution neural network. Int. J. Fuzzy
Logic Intell. Syst. 17(1), 26–34 (2017)
8. El Massi, I., Es-Saady, Y., El Yassa, M., Mammass, D., Benazoun, A.: Automatic recognition
of the damages and symptoms on plant leaves using parallel combination of two classifiers.
In: 13th International Conference on Computer Graphics, Imaging and Visualization (CGiV),
pp. 131–136. IEEE (2016)
9. Lukic, M., Tuba, E., Tuba, M.: Leaf recognition algorithm using support vector machine with
Hu moments and local binary patterns. In: 15th International Symposium on Applied Machine
Intelligence and Informatics (SAMI), pp. 485–490. IEEE (2017)
10. Es-saady, Y., El Massi, I., El Yassa, M., Mammass, D., Benazoun, A.: Automatic recognition
of plant leaves diseases based on serial combination of two SVM classifiers. In: International
Conference on Electrical and Information Technologies (ICEIT), pp. 561–566. IEEE (2016)
11. Ali, R., Hardie, R., Essa, A.: A leaf recognition approach to plant classification using machine
learning. In: IEEE National Aerospace and Electronics Conference (NAECON), pp. 431–434.
IEEE (2018)
12. Srivastava, V., Khunteta, A.: Comparative analysis of leaf classification and recognition by
different SVM classifiers. In: International Conference on Inventive Research in Computing
Applications (ICIRCA), pp. 626–631. IEEE (2018)
13. Elhariri, E., El-Bendary, N., Hassanien, A.E.: Plant classification system based on leaf features.
In: 9th International Conference on Computer Engineering & Systems (ICCES), pp. 271–276.
IEEE (2014)
Deep Learning Based Facial Feature
Detection for Ethnicity Recognition
Sujitha Juliet Devaraj, R. Catherine Joy, I. Santhosh, and I. C. Kevin
Abstract In the study of ethnical group recognition, facial feature discovery is one of
the essential tasks. Specially, with the recent development of deep learning methods,
significant evolution has been made in computer-based facial recognition. In this
paper, we proposed a deep learning model for ethnicity recognition, considering the
facial features. At first, we gathered the dataset for ethnical group which includes
Southeast Asian, East Asian, Black, White, Latin, Indian and Middle Eastern. Also,
we have collected real-time face images to recognize the ethnicity group. Every
ethnicity group has its own characteristics and facial features. Therefore, we consid-
ered the particular ethnical groups and intended to find the similar categorization.
Since human facial information will vary based on the geographical location, we
have collected data from various regions to achieve better results for our experiment.
In this analysis, deep leaning-based ethnicity identification has been exploited for
various details in human faces. This study is proposed to understand and analyze the
relation between the ethnicity and ethnical groups, by considering the images with
different intensity and registered range. We trained 85,000 images and managed to
give a precise result. The research work on ethnicity recognition with facial features
helps in the study of facial features evolution in anthropology (the study of human
societies and cultures and their development).
S. J. Devaraj (B) · R. Catherine Joy · I. Santhosh · I. C. Kevin

Karunya Institute of Technology and Sciences, Coimbatore, India
e-mail: sujitha@karunya.edu
R. Catherine Joy
e-mail: catherinejoy@karunya.edu
I. Santhosh
e-mail: santhoshi@karunya.edu.in
https://doi.org/10.1007/978-981-16-1502-3_52
528 S. J. Devaraj et al.
1 Introduction
In recent years, facial feature-based analysis of race, nation, and ethnical groups has
become a popular field of research in face recognition society [1]. Especially, with
a swift development in human globalization, facial identification and recognition
methods have great demand in providing security to public, monitoring the country
borders and regulating the movement of people across the border, and also in customs
check.
Generally, the factors like gene, environment and society will greatly influence
the facial features of a person. Out of which, gene is one important factor which
has very important role in ethnical groups. It is hardly unique and it’s very hard to
analyze it from other ethnical groups. The only possible way is by understanding the
various gene systems and analyzing the similarities between them. This analysis is
significant to find the similarity between facial features for different ethnicities.
In the study of ethnicity recognition, the group of people is distinguished based on
their language, genes, culture and their geographical location [2]. Race and ethnicity
terms are strongly correlated although they have dissimilarity. Few examples for
ethnical groups are American Indian, African American, Black American, Indian,
Asian, Native Hawaiian, White America and Pacific Islander.
Face recognition system detects, recognizes and verifies a person from the given
digital image. Using this technology, various ranges of ethnical groups can be easily
studied and the person’s ethnicity also can be recognized. In general, ethnicity is
identified through facial features such as face texture, geometrical alignment, eyes,
hair and physical structures. This research work will be helpful to Anthropologist who
is mainly engaged in the study of human societies, cultures and their development.
In recent years, there has been a remarkable investigation carried out on deep
learning-based algorithms for Computer vision applications. These algorithms are
effectively used for feature extraction, image classification, and image recognition
purposes. A major breakthrough in deep learning models has been achieved by
Convolutional Neural Network (CNN). CNN is presently considered as the pref-
erence of neural networks for classification of images since it detects patterns in tiny
parts of an image, for instance, a small curve of an eyebrow. It extracts more detailed
and higher-level information from the given image progressively. In this work, we
have proposed CNN-based model to extract facial features from the ethnical group
consists of Asian, Black, Indian and Latin faces and to recognize ethnicity.
2 Related Works
In the recent past, the field of ethnicity recognition has gained extensive considera-
tion and significant development. Researchers have proposed remarkable techniques,
which can perform viably and accomplish a better accuracy. All the methods are
commonly designed with two important parts: Feature extraction, and Classification.
Deep Learning Based Facial Feature Detection … 529
Wang et al. [3] proposed a face feature analysis method for ethnicity identification.
They built an ethnical face dataset with Chinese Uyghur, Korean and Tibetan. They
proved that if the feature is dependent on entire face image, the sparse approach is
not suitable for ethnical class recognition. They considered three ethnical classes and
analyzed the individuality of each class to predict the common classification for the
three classes. In this recognition method, the comprehensive facial features are end up
being incapable for ethnicity examination. The proposed “T” region for ethnic char-
acteristic description via data mining technique was investigated and concluded that
this method is effective to recognize for ethnicity, however, not for face recognition.
Very recently, Gao et al. [4] have proposed a recognition model for Chinese ethnic
class using transfer learning from deep convolution network. The model achieved an
accuracy of 80.5% with better generalization performance. They also investigated
the feasibility of the model for ethnicity recognition and proved its effectiveness. The
technique proposed by Achkar et al. [5] extracted geometric features from images,
including the nostril width, nose tip, lips width, brow width and coloration with
the aid of the Viola-Jones method, followed by the execution of artificial neural
networks. The system is executed through 3 steps: face detection, segmentation and
ethnicity categorization. The final classified output facilitates to conclude the race of
the individual.
Wang et al. [6] proposed a solution for ethnicity recognition using deep convo-
lution neural networks. In this model, the feature extraction and classification are
done at the same time. This recognition model was analyzed in different scenarios
such as the categorization of white and black, Chinese and Non-Chinese, and classi-
fication of Han, Uyghurs and Non-Chinese people. Experimental results verified the
usefulness of the model.
Hui Lin et al. [7] have proposed recognition system that includes Gabor filtering,
AdaBoost learning and SVM classifier for face-processing application. Kernel Class-
dependent Feature Analysis method proposed by Xie et al. [8] handles the ethnicity
recognition on huge database with face images. It deals with the periorbital areas
rather than the whole face district and achieves better accuracy for Caucasian,
Asian and African American ethnicity group. Liu et al. [9] have given a review
on Cross-ethnicity Face Anti-spoofing Recognition Challenge based on the CASIA-
SURF CeFA dataset and presented the overview of the challenge with the design
methodology and experimentation analysis.
To sum up, despite the fact that these techniques have increased a high recognition
rate for ethnicity groups, there is still a room for improvement. Therefore, this paper
proposes deep learning-based model for ethnicity recognition by analyzing the facial
features.
CNN is presently considered as the preference of neural networks for classification of

images since they detect patterns in tiny parts of an image, for instance, a small curve
Fig. 1 Basic CNN architecture
of an eyebrow. CNN consists of convolution layer, subsampling and fully connected

layers as revealed in Fig. 1. CNN understands any two-dimensional images as input,
providing an exclusive gain for image recognition applications.
Figure 1 illustrates a basic CNN model where it receives 2D images as input and
convolutes with a number of modifiable convolution kernels to produce the subse-
quent feature map function. This function forms the Convolutional layer. Further, the
mapping function is down-sampled to eliminate the size of the data and generates
the Subsampling layer. In general, the pooling size of 2 × 2 is preferred. The same
process is continued in subsequent convolution and subsampling layers.
Following the extraction of adequate feature variables, the image pixels in two
dimensions are regressed toward one-dimensional information and geared up for
neural network classifier. In general, Softmax regression function is favored as the
ultimate multiple classifier for practical applications. Later, the top feature map layer
is separated into a huge number of narrow regions and convolved with intelligent
kernels. Afterward, the convolutions are handled with activation functions and the
novel attribute maps are generated.
The subsampling layer consists of two basic and commonly used methods such
as mean-pooling and max-pooling. The final fully connected layer calculates the
class scores on the whole image. The majority of the deep learning methods [10]
have tailored CNN for face emotion identification. The CNN algorithm is composed
of a number of basic essentials, which fulfills the purpose of facts entry, training
and testing specifications. Finally by evaluating and comparing the experimental
investigations of training records by the testing labels, the recognition accuracy is
calculated. Figure 2 shows the proposed block diagram for CNN-based ethnicity
recognition with facial features.
In the proposed work, we have considered FairFace dataset, a huge dataset which
contains 85 K train images and 14 K test images. The different ethnical groups
are Southeast Asian, East Asian, Black, White, Latino-Hispanic, Indian and Middle
Eastern. To avoid confusion, both East Asian and Southeast Asian races are combined
into a single Asian race. The input images are observed based on the file names and the
image pixels are stored as a column. Each image has 3 channels and of the size 224 ×
224 × 3. The steps that have been followed in the proposed ethnicity recognition are:
Preprocessing of the input images, detection of facial points from the given input
images, extraction of facial features, classification and finally, recognition of features
for ethnicity identification.
At first, the input face image is preprocessed with gray-scale conversion, face
detection, face alignment, normalization and then cropping steps. After selecting
Fig. 2 Proposed block diagram for CNN-based ethnicity recognition
the facial points from the given input image, the facial distances between head to
chin, the width of head, eye centers, nose tip, and mouth corners are calculated for
face alignment. Later, they are normalized and cropped to the size of 64 × 64 by
excluding the background. Now the CNN model which contains three convolutional
layer and two fully connected layers and Softmax layer is trained with cropped image
to envisage the ethnicity group.
In the proposed work, FairFace dataset and UTKFace dataset are used to effectively
classify the individuals according to their ethnicity. FairFace is a large-scale dataset
with 108,501 face images, in which 85 K images are considered for training and 15 K
images for testing. In order to have fair race composition, there are seven ethnical
groups such as Southeast Asian, East Asian, Black, White, Latino-Hispanic, Indian
and Middle Eastern [11]. The dataset is tagged as race, gender, and age groups.
UTKFace dataset is again a face dataset with age group from 1 to 116 years. It
consists of 20,000 images with observations of gender, age and ethnicity.
In addition, real-time facial images of Indian ethnical group, captured by
ourselves, are also used. Figure 3 shows the arbitrary samples taken from FairFace
and UTKFace datasets.
The model is trained with the above-mentioned datasets. After preprocessing the
input image, the CNN model is used to predicate the ethnicity class. The average
accuracy achieved by the proposed method is 88%, and thus we declare the robustness
of the proposed model
Fig. 3 Face samples from a FairFace and b UTKFace datasets
The experiments are conducted on a laptop with i7 processor and NVIDIA

GeForce GTX 1650 UHD graphics, and 32 GB memory. The model is implemented
in Keras framework, an open-source neural network library written in Python and the
proposed method takes around 3.12 ms to process one face image. Figure 4 shows
sample screenshots of ethnicity recognition for Middle Eastern, Black, White, Asian
ethnicity group and finally the real-time ethnicity recognition for Indian face.
5 Conclusion
This paper mainly focuses on extracting the facial features for ethnicity recognition
using CNN-based recognition method. The proposed model is experimented with
different ethnical group dataset which consists of Southeast Asian, East Asian, Black,
White, Latin, Indian and Middle Eastern. Also, we have tested our model with real-
time face images to recognize the ethnicity group. The average accuracy achieved by
the proposed method declares the robustness of the model. In future, this algorithm
may be helpful for detecting the missing children, search investigations and refugee
crisis.
a) Middle eastern ethnicity b) Asian ethnicity
c) White ethnicity d) Indian ethnicity
e) Black ethnicity f) Real time ethnicity recognition
Fig. 4 a–f Sample screenshots of ethnicity recognition for Middle Eastern, Black, White, Asian
and the real-time ethnicity recognition for Indian face
References
1. Chenlei, L., Zhongke, W., Dan, Z., Xingce, W., Mingquan, Z.: 3D Nose shape net for human
gender and ethnicity classification. Pattern Recogn. Lett. 126, 51–57 (2019)
2. Ding, H., Huang, D., Wang Y., Chen, L.: Facial ethnicity classification based on boosted local
texture and shape descriptions. In: 10th IEEE International Conference and Workshops on
Automatic Face and Gesture Recognition (FG), Shanghai, pp. 1–6 (2013)
3. Wang, C., Zhang, Q., Liu, W., Liu, Y., Miao, L.: Facial feature discovery for ethnicity
recognition. WIREs Data Mining Knowl. Discov. 9, e1278, 10(5), 1–17 (2019)
4. Gao, S., Zeng, C., Bai, M., Shu, K.: Facial ethnicity recognition based on transfer learning
from deep convolutional networks. In: 2020 3rd International Conference on Advanced Elec-
tronic Materials, Computers and Software Engineering (AEMCSE), Shenzhen, China, 310–314
(2020)
5. Achkar, R., Haidar, G., Assal, M., Habchy, D., Ashi D., Maylaa, T.: Ethnicity recognition
system using back propagation algorithm of an MLP. In: 2019 Fourth international conference
on advances in computational tools for engineering applications (ACTEA), Beirut, Lebanon,
1–5 (2019)
6. Wang, W., Feixiang H., Zhao, O.: Facial ethnicity classification with deep convolutional neural
networks, biometric recognition. Biometr. Recogn. 176–185 (2016)
7. Lin, H., Zhang, L.: A new automatic recognition system of gender, age and ethnicity. In: 6th
World Congress on Intelligent Control and Automation, vol. 2, 9988–9991 (2006)
8. Xie, Y., Luu, K., Savvides, M.: A robust approach to facial ethnicity classification on large
scale face databases. In: 2012 IEEE Fifth International Conference on Biometrics: Theory,
Applications and Systems (BTAS), Arlington, VA, pp. 143–149 (2012)
9. Ajian L., Li, X., Wan, J., Escalera S.: Cross-ethnicity face anti-spoofing recognition challenge:
a review. IET Res. J. 1–12 (2020)
10. Siyue, X., Haifeng, H., Yongbo, W.: Deep multi-path convolutional neural network joint with
salient region attention for facial expression recognition. Pattern Recogn. 92, 177–191 (2019)
11. Kimmo, K., Jungseock, J.: FairFace: face attribute dataset for balanced race, gender, and age.
Comput. Vis. Pattern Recogn. 1–11 (2019)
Scanning Array Antenna Radiation
Pattern Design Containing Asymmetric
Null Steering Based on L-ASBO
Anitha Suresh, C. Puttamadappa, and Manoj Kumar Singh
Abstract The involvement of heuristic computational design for an antenna array

in the field of electromagnetic application has improved the quality and cost of the
solution significantly. In this paper, a learning form of adaptive social behavior opti-
mization has been presented to obtain the radiation pattern of the scanning array
antenna which carried the high gain for the main lobe and satisfied the constrained
of null steering in the different directions by controlling the phases of current in
the array elements. The existing form of ASBO does not use the relevant infor-
mation of the solution which has been explored by the previous population in the
first stage. In the proposed form of modification, the best-explored information in
past has been utilized by the current population under a probabilistic environment.
The proposed modification has improved the quality of the solution as well as the
rate of convergence. The obtained performances of radiation patterns through the
proposed method has been compared with results obtained through particle swarm
optimization available in the literature.
1 Introduction
An antenna array is considered one of the finest ways to detect the signal originated
from various directions. The purpose of array synthesis is to configure the array
elements geometrically and electrically to obtain the desired radiation pattern. Many
important characteristics can be associated with radiation patterns like reducing the
level of sidelobe without compromise in the gain of the main lobe, nullify the effect of
interference, and jamming appeared from a certain direction. There are appreciable
benefits like coverage, signal quality, and enhancement of spectrum efficiency that
can be observed with the use of antenna arrays in various applications as a requirement
A. Suresh · C. Puttamadappa
Department of Electronics and Communication, Dayananda Sagar University, Bangalore, India
M. K. Singh (B)
Manuro Tech Research Pvt. Ltd, Bangalore 560097, India
e-mail: mksingh@manuroresearch.com
https://doi.org/10.1007/978-981-16-1502-3_53
536 A. Suresh et al.
or cost-effectiveness or both by providing the steerable beams and maintaining higher

directivity. It is well known that in any wireless communication system, the quality of
system performance is heavily decided by the design quality of the antenna. For most
of the long-distance coverage applications, the characteristics of radiation pattern
need should carry high directivity and small beam width along with satisfying the
constraints of low sidelobes and nulls have to appear in the interferential directions.
The desired objectives of radiation patterns of an array antenna have been achieved
by controlling the various structural and electrical parameters values. In a broad
way, synthesis of desired array pattern can be considered as an optimization problem
and various possibilities of structural and electrical optimization exist like geometric
optimization approach in terms of defining the proper spacing between elements,
electrical characteristics optimization approach by providing the proper amplitude
and phase of the current in each element. Practically, the needed pattern characteristic
depends upon applications. In many cases, there is a need for high gain in the main
lobe and minimum level of side lobes while in some other cases there is a demand
for interference reduction from unwanted directions by placing the nulls.
The uses of null steering to minimize the interferences are very common in the
application areas of radar and sonar. In comparison with geometrical parameters,
controlling electrical parameters like amplitude and phase of the current in the array
elements are more effective in the placement of nulls. There is a possibility exist of
controlling the amplitude and phase in combination or individually and have their
advantages and limitations. Null steering problems can be solved more efficiently
by considering the problem as a nonlinear optimization model consisting of the
optimization parameters like excitation amplitudes, phases, and/or array element
positions. The cost of the phase shifter and variable attenuators provides the constraint
in the design; hence to make the solution cost-effective to control the nulls, the
research community prefers to focus on either phase only or amplitude only. In this
paper, null synthesis of the phased array antenna has been achieved by controlling
phase one. There is considerable complexity that exists in the development of an
optimal solution of having high directivity and multiple null steering with phase
adjustment; however, the proposed solution L-ASBO has handled this challenge
efficiently.
2 Literature Survey
The standard form of ASBO has been discussed in [1]. Based on PSO, the synthesis
of various patterns has been presented in [2]. To obtain the desired radiation pattern
through an array, antenna in the past several different approaches have been applied.
The conformal phased array antenna radiation pattern has been analyzed in [3] using
field vector synthesis. In [4], real-coded GA has been applied to optimize the geomet-
rical (space between elements) as well as electrical parameters (weight of elements
current amplitude). To diagnose the array elements of PAA, reflected signal from
radiator-free space junction has been applied in [5]. RGA [6] has also been used to
Scanning Array Antenna Radiation Pattern Design … 537
obtain the optimal weight value of the array element to reduce the level of sidelobe
for uniformly spaced array elements geometry. There were various ways that PSO
has been used in [7, 8] to obtain the desired radiation pattern. For a large phased array,
a fixed beamwidth has been maintained in [7] when the direction of the main lobe is
away from the direction of the broadside. For different configurations of hexagonal
array [8] in which each element is excited with the same current value, PSO has
been applied to achieve a directive beam, and side lobe level also has minimized.
Taguchi’s method has been used in [9] to obtain the reduction in SLL for linear array
antenna. For a linear array antenna, the null placement and SLL reduction using
ant colony optimization have been discussed in [10]. Microstrip technology-based
hardware implementation has been used in [11] to develop the array antenna which
carried the benefit of low SLL value. The design of the circular array antenna using
the firefly algorithm [12] and using symbiotic organisms search (SOS) algorithm
[13] has been discussed. A deterministic approach has been applied in [14] to design
an a-periodic antenna array.
3 Linear Array Antenna
In this work, a linear array antenna has been considered a set of 2N elements
where each element is represented as an infinitesimal dipole. All elements have been
arranged along the X-axis and maintained the uniform distance from their neighbor
elements on either side as shown in Fig. 1. The total far-field of such array antenna is
defined as the multiplicative result of the field generated by one element positioned
at the center and the array factor.
Assuming any two consecutive elements separated by distance is ‘d’ and the
center position of the considered linear array formation as a reference point, the
array factor (AF) in normalized form for such a linear array can be obtained by Eq.
(1) and assumption has made about constant amplitude value and odd symmetry of
phase shifts.
1
N
AFnorm (θ ) = Cos[(n − 0.5)ψ + βn ] (1)
N n=1
Fig. 1 Geometry structure

of linear array antenna with y
2N elements
θ
x
2
1 2 N
d

where ψ = 2λ d Sin(θ ) = kd Sin(θ ), N is the total number of array element one
side of reference point; βn is the ‘nth’ array element phase shift weight, and θ is the
desired direction angle.
To obtain the desired radiation pattern, the objective function has been developed
by combining the different normalized array factors in an additive or subtractive
manner depends upon their needs. The objective function has to optimize by obtaining
the optimal values of array antenna parameters.
In this work, considering the phase of elements excitation as variable parameters,
the number of asymmetrical nulls and placement of the major lobe in any direction
have obtained by a modified form of meta-heuristic ASBO called learning ASBO
(L-ASBO) algorithm.
4 Objective Function Definition
In this work, objectives of maximize the gain over the desired direction and
minimize the level of interference over specified directions have been considered
simultaneously and formulated as a maximization problem as given in Eq. 6.

p

p
F = |AFd |2 − AFN 2 × wi × pv (2)
i
i=1 i=1
where first term AFd is the array factor in the direction of the major lobe while the
second term carried the sum of all array factors where nulls have to place. Weighted
penalty (pv) has been assigned according to the difference between the obtained and
expected level of nulls (wi ).
5 Proposed Method
Based on the social evolutionary process, in [1] a heuristic algorithm called adaptive
social behavior optimization (ASBO) has been proposed. It has been observed that
there is faster change occurred in the social entities through social evolution instead of
genetic evolution; hence, same can help in designing the more powerful mathematical
model for the optimization algorithms. Considering the abstract model of society
where a number of inspiring factors like the leader, neighbors’ and self-motivation
control the change of an individual in a dynamic manner, ASBO has also taken
the same factors in the improvement of individual fitness. To capture the dynamic
nature of the influence of influencing parameters, in ASBO there are two populations
exist, one exists as the solution population while the other ones carried the influence
depth. The benefit of phenotype representation of solution provides the easing in
the implementation. The criteria to be the neighbors of an individual are based upon
the next higher fitness while the present population best has considered as leader–
member. The best performance obtained in the past by an individual becomes a
self-motivation factor for that individual in the current iteration.
Equations (3) and (4) define the change in ith dimension of the individual solution
where Cg , Cs , Cn are positive constant. Rg , Rs , Rn are the random numbers generated
through U[0 1]. Gb , Sb , and Nc are the positions of the leader, self-best, and neighbor
center.
X (i + 1) = [ C g Rg (G bi − X i )
+Cs Rs (Sbi − X i ) (3)
+Cn Rn (Nci − X i ) ]
X (i + 1) = X i + X (i + 1) (4)
The dynamic behavior of influencing factors have achieved through a self-adaptive

mutation strategy of progress constant values as given by Eqs. 5 and 6

pi ( j) = pi ( j) + σi ( j)N (0, 1) (5)

τ N (0,1)+τ N j (0,1)
σi ( j) = σi ( j)e ,
∀ j {1, 2, 3} (6)

where pi ( j), pi ( j), σi ( j), σi ( j) denote the jth component of the vectors

pi , pi , σi , σi , respectively, and N(0,1) a is Gaussian distributed random number and
will be same for a solution while Nj (0,1) is a new random number generated for jth
attribute under a solution using Gaussian distribution. τ’ and τ are problem dimension
depend constants.
Mimicking the development behavior of human social development, ASBO has
evolved the solution under two stages. In the 1st stage, the number of independent
random populations evolved, and in the 2nd stage, a new population formed by some
of the fittest members available in the different populations at the end of the 1st stage.
5.1 L-ASBO: Learning ASBO
In the existing form of ASBO, in the first stage, each population evolved indepen-
dently and later they combined to form a pool from where the fittest members were
selected to form the population for the second stage. The independence of each popu-
lation can cause to reduce the speed of convergence as well as may cause the end of
the result which can improve further. Under the 1st stage, when the first population has
completed its evolution, it has a certain level of exploration of the solution domain,
P1 P2 P3 Pn
PLE
PLE PLE
Fig. 2 Process flow in L-ASBO
while when the second population started the exploration, previously explored infor-
mation by the first population does not use. Similarly, the third population does not
use the information explored by the 1st and 2nd population. This process continued
for all the population. In other words, issue with the existing model of ASBO 1st
stage is not having any inspirational factor to improve the quality of search from
previously completed evolution of the population under different trials.
There may be very good possibilities that the previous population explored infor-
mation can help to guide the next population, particularly when the current best
solution has lesser fitness in comparison with the past population explored solution
fitness. But if considered blindly, the past explored solution by the previous solution
can behave like a strong attractor particularly in the beginning which may cause loss
of diversity immediately. Hence, a probabilistic model has been applied in which
rather than continuous interference, an occasional interference of the previous popu-
lation explored information has been utilized by the current population. The process
has shown in Fig. 2 while algorithmic steps have shown in Fig. 3. In Fig. 2, Pi is the
populations while PLE is the probabilistic learning environment as given in Fig. 3.
To synthesizes the different patterns and understanding the quality behavior of the
proposed algorithm L-ASBO, in the simulation three different cases of desired pattern
(PS1, PS2, and PS3) synthesis have been considered as given in Table 1. Pattern PS1
has one null while pattern PS2 has two nulls on the same side of the major lobe while
nulls for pattern PS3 have distributed on either side of the major lobe. As desired
pattern characteristics have variability in their complexity, there were a different
number of array elements have considered and were 10, 20, and 50 for PS1, PS2,
and PS3 correspondingly. Each element assigns a phase value; hence, the dimension
of the problem varied accordingly. To obtain the optimal phase of elements in all
the three different cases, L-ASBO has uses the population size as 100. There was 10
independent population that have been considered in the 1st phase of L-ASBO, and
each population has evolved up to the 100 iterations. For the 2nd phase, 100 best
members have been selected from the different populations evolved in the 1st stage
N: Total number of population which has to evolve.

st
If Population is 1
Evolve population by standard ASBO till last iteration;
Pgp = Best evolved solution at the last iteration.
Else
For j=2 : N
For i=1 : Allowed iteration

th
• Apply standard ASBO process to create new population in i itr
• Pgc = Current best solution
•Generate a random number Rn U[0 1]
•Compare the fitness of current best in the present population
with the best explored by previous population.
If f (Pgc)< f(Pgp)
If Rn <Thr
Pgc=Pgp
End
End
End
Pgc = Best solution explored by jth population
If f (Pgc) > f(Pgp)
Pgp =Pgc
End
End
End
Fig. 3 Algorithmic steps for proposed L-ASBO
Table 1 Desired pattern

Pattern Desired Null direction Elements
characteristics
synthesis direction number
PS1 −60° 30° 20
PS2 −60° [−20°, 40°] 40
PS3 −20° [−40°, 1°, 30°, 100
60°]
and allowed to evolve for the 1000 iterations. The search region of solution bounded
in [-π, π] radians and any violation forced to randomly bound within limit range.
The fitness value has estimated by Eq. 2 where the penalty factor has considered as a
high value of 1000. The whole simulation setup has been developed in the MATLAB
environment. To observe the variability in performances with different trials, 20
independent trials have given over each problem, and obtained performances have
shown in Tables 2, 3, and 4. The statistical performances over 20 trials have given
in terms of mean and standard deviation along with confidence intervals. It is clear
that for all the cases L-ASBO performed very well and always more than -50 dB
gain has achieved for the position of null. For the pattern problem PS2, the obtained
convergence characteristic has shown in Fig. 4. The desired pattern PS3 is very
Table 2 Obtained pattern

−60° 30°
characteristics by L-ASBO
over PS1 Mean (dB) −0.0210 −53. 22
Std.Dev (dB) 0.0000 0.0000
CI (95%) (dB) ∓0.0002 * 10–6 ∓0.5637* 10–6
CI (99%) (dB) ∓0.0002 * 10–6 ∓0.7437* 10–6
Table 3 Obtained pattern

−60° −20° 40°
characteristics by L-ASBO
over PS2 Mean (dB) −0.0082 −58. 83 −77. 57
Std. Dev (dB) 0.0001 0.0358 0.0761
CI (95%) (dB) ∓0.0000 ∓0.0143 ∓0.0305
CI (99%) (dB) ∓0.0000 ∓0.0201 ∓0.0404
Table 4 Obtained pattern characteristics by L-ASBO over PS3

−20° -40° 1° 30° 60°
Mean (dB) −0.0007 −81.878 −82.024 −68.451 −59.23
Std.Dev (dB) 0.0000 1.183 0.1454 0.566 0.0723
CI (95%) (dB) ∓0.0000 ∓0.7209 ∓0.0849 ∓0.3281 ∓0.0471
CI (99%)(dB) ∓0.0000 ∓0.9203 ∓0.1202 ∓0.4642 ∓0.0624
1.2
1.1
0.9
Fitness value
0.8
0.7
0.6
0.5
0.4
0 100 200 300 400 500 600 700 800 900 1000
Iteration
Fig. 4 L-ASBO convergence in a trial over pattern synthesis of PS2
difficult to achieve but it can observe from Table 4 that L-ASBO performed very well
and the obtained radiation pattern has shown in Fig. 5. In [2] over the pattern, PS1
-20
Relative power pattern (dB)
-40
-60
-80
-100
-120
-140
-100 -80 -60 -40 -20 0 20 40 60 80 100
Theta (degree)
Fig. 5 Radiation pattern for pattern synthesis PS3 by L-ASBO
Table 5 Performance
PS1 −60° 30°
comparison for PS1
VAT [2] −0.0347 dB −57.1472 dB
L-ASBO −0.0223 dB −51.7636 dB
Table 6 Performance
PS2 −60° −20° 40°
comparison for PS2
VAT [2] (dB) −0.4975 −58.0635 −70.5191
L-ASBO (dB) −0.0093 −54.0090 −80.0149
and PS2 in PSO have been applied and comparative performances against L-ASBO
have shown in Table 5 and Table 6 correspondingly.
It was observed that over simple pattern synthesis PS1, PSO performance is
somehow acceptable but as the complexity increased in PS2, performances degraded.
Unlike PSO, L-ASBO has shown consistency in performances over different problem
complexity.
7 Conclusion
Based on the previous exploration by the previous population, a modified version of

ASBO has been presented. The past explored information learned by the current
population in the probabilistic environment. By controlling the phase of array

elements, asymmetrical patterns containing various nulls have been synthesized.
The proposed solution has delivered a better and efficient radiation pattern, what it
was obtained with particle swarm optimization. The proposed method of solution is
having the capability to deliver a global solution with faster convergence.
Reference
1. Singh, M.K.: A new optimization method based on adaptive social behavior: ASBO. AISC
174, pp. 823–831. Springer (2012). https://doi.org/10.1007/978-81-322-0740-5_98
2. Zuniga, V., Erdogan, A.T., Arslan, T.: Adaptive radiation pattern optimization for antenna
arrays by phase perturbations using particle swarm optimization. In: NASA/ESA Conference
on Adaptive Hardware and Systems 2010
3. Zeng, G., Li, S., Wei, Z.: Research on conformal phased array antenna pattern synthesis. In:
Proceedings of the 2012 International Conference on Information Technology and Software
Engineering, pp. 13–21
4. Goswami, B., Mandal, D.: A genetic algorithm for the level control of nulls and side lobes in
linear antenna arrays. J. King Saud Univ. Comput. Inf. Sci. 25(2), 117–126 (2013)
5. Manichev, A.O., Balagurovskii, V.A.: Methods for diagnostics of an array antenna by the
signals reflected from radiator-free space junctions in the presence of mutual coupling of array
elements. J. Commun. Technol. Electron. 58(4), 307–317 (2013)
6. Zhang Z., Li T., Yuan F., Yin L. (2014) Synthesis of Linear Antenna Array Using Genetic
Algorithm to Control Side Lobe Level. In: Wong W.E., Zhu T. (eds) Computer Engineering
and Networking. Lecture Notes in Electrical Engineering, vol 277. Springer, Cham
7. Yang, S.-H., Kiang, J.-F.: Adjustment of beam width and side-lobe level of large phased-arrays
using particle swarm optimization technique. IEEE Trans Antennas Propag. 62(1), (2014)
8. Bera, R., Mandal, D., Kar, R., Ghoshal, S.P.: Application of particle swarm optimization tech-
nique in hexagonal and concentric hexagonal antenna array for side lobe level reduction. In:
Mandal, D., Kar, R., Das, S., Panigrahi, B. (eds.) Intelligent Computing and Applications.
Advances in Intelligent Systems and Computing, vol 343. Springer (2015)
9. Kumar, R., Mohanty, S.K., Mangaraj, B.B.: Side lobe level and null control design of linear
antenna array using Taguchi’s method. In: Jain, L., Patnaik, S., Ichalkaranje, N. (eds.) Intelligent
Computing, Communication and Devices. Advances in Intelligent Systems and Computing,
vol 309. Springer (2015)
10. Saxena, P., Kothari, A.: Ant lion optimization algorithm to control side lobe level and null
depths in linear antenna arrays. AEU Int. J. Electron. Commun. 70(9), 1339–1349 (2016)
11. Hussein, A.H., Metawe’e, M.A., Abdullah, H.H.: Hardware implementation of antenna array
system for maximum SLL reduction. Eng. Sci. Technol. Int. J. 20(3), 965–972 (2017)
12. Singh, G.N., Rattan, M., Patterh, M.S.: A non-uniform circular antenna array failure correction
using firefly algorithm. Wirel. Pers. Commun. (1), (2017)
13. Dib, N.: Design of planar concentric circular antenna arrays with reduced side lobe level using
symbiotic organisms search. Neural Comput. Appl. 30(12), 3859–3868 (2018)
14. Caratelli, D., Toso, G.: Deterministic constrained synthesis technique for conformal aperiodic
linear antenna arrays—Part I: theory. IEEE Trans. Antennas Propag. 67(9), 5951–5961 (2019)
A Modified Novel Signal Flow Graph
and Memory-Based Radix-8 FFT
Processor Design
A. Anitha, B. Triveni, Pinninti Kishore, and Makkena Madhavi Latha
Abstract The Fourier Transform is a noteworthy calculation in digital signal

processing region. An enhanced signal flow graph is required for FFT processor
structures, whose sources of information and outputs are in normal order. In this
paper, a memory-based conflict-free FFT processor design by utilizing a modified
radix-8 DIF (Decimation-In-Frequency) signal flow graph is proposed. The number
of iterations is decreased, and therefore, the execution time is low when compared
with memory-based radix-4 FFT. The architecture is implemented on Xilinx Virtex-
6 FPGA platform. The proposed FFT processor with radix- 8 has reported lower
processing time when compared with radix-4 FFT processor.
1 Introduction
An important algorithm within the area of signal and image processing is Fast
Fourier Transform (FFT). Two categories of architectures are available to imple-
ment FFT processors. The first one uses pipelined architecture [1–4] with indepen-
dent butterfly unit and memory elements in each section and, the later one is the
memory-based architecture [5–9], but this will operate with identical memory and
butterfly unit in each section. Unique memory-based radix-2 DIF FFT architecture
[7] reported reduced computation complexity with respect to number of clock cycles
and improved utilization of the Processing Element (PE) for a Real Fast Fourier
Transform (RFFT) as results of bit reversal order of the output. Architecture for a
4096-point radix-4 memory-based FFT using DSP slices [10] is aimed to improve
the utilization of DSP Slices and reduce the utilization of distributed logic with a
A. Anitha (B) · B. Triveni

V. R. Siddhartha Engineering College, Vijayawada, India
P. Kishore
V. N. R. Vignan Jyothi Institute of Engineering and Technology, Hyderabad, India
M. Madhavi Latha
J. N. T. University, Hyderabad, India
https://doi.org/10.1007/978-981-16-1502-3_54
546 A. Anitha et al.
conflict-free strategy. A low power Split Radix FFT(SRFFT) [8] processor using
radix-2 Butterfly units is introduced which reported 20%, lower power consumption
compared to other FFT algorithm with address conflicts and output is in bit reversal
order as a demerit. An efficient memory organization for memory-based FFT archi-
tectures [11, 12] is demonstrated using an 8192-point radix-2 Cached Memory (CM)
FFT processor. CM can lead faster operation and low dissipation, which consumes
10.1–29% less area and 9.6–67.9% less power.
Majority of the literature concentrated on radix-2 and radix-4 memory-based
FFT architectures. This work considers a memory-based architecture to implement
a FFT processor using a modified radix-8 signal graph. A memory conflict strategy
that aligns with the proposed flow graph is employed. The rest of the document is
organized as follows. In Sect. 2 the modified radix-4 graph of signal flow is discussed.
Section 3 discusses the proposed modified Signal Flow Graph (SFG) and memory
based radix-8 FFT processor design. Finally in Sect. 4, the results are presented and
followed by Sect. 5 concludes the discussion.
2 Modified Signal Flow Graph of Radix 8 FFT
Figure 1 shows conventional SFG for a 64-point radix-8 DIF FFT. The input and
output samples are in regular and bit reversal order respectively. Therefore, in order
to achieve a regular output sample order, a bit reversal operation must be performed
which adds to additional computation time.
A modified SFG with input and output samples in regular order for a 64-point
radix-8 FFT is presented in Fig. 2. To achieve output in regular order, the output node
and twiddle factors are adjusted accordingly. The butterfly operation performed in
both conventional SFG and modified radix-8 SFG as shown in Fig. 3a. The corre-
sponding architectural design of radix-8 computation unit is shown in Fig. 3b. Posi-
tion of the input of the butterfly unit in each stage of the modified SFG is identical
to the conventional one. The conventional one is different from the position of the
result of the butterfly unit in modified SFG. The modified SFG results are stored in
the consecutive locations of n, n + (N/8), n + (2*N/8), n + (3*N/8), n + (4*N/8),
n + (5*N/8), n + (6*N/8), n + (7*N/8) where ‘N’ represents the number of points
of FFT ‘n’ represents the butterfly unit executed.
3 Memory-Based FFT Architecture
Single butterfly and memory units are used in each stage of memory-based FFT
architecture. Hence, it utilizes less area and power consumption comparative to other
conventional architectures. The FFT architecture, shown in Fig. 4, contains the radix-
8 butterfly computation unit, two number of single port memories each consisting
of 8 banks, interface multiplexer network, data multiplexer networks, ROM used for
A Modified Novel Signal Flow Graph and Memory-Based Radix-8 … 547
Input First stage Second stage Output

0 0
1 32
2 16
3 48
4 8
5 40
6 24
7 56
8 4
9 36
10 20
11 52
12 12
13 44
14 28
15 60
16 2
17 34
18 18
19 50
20 10
21 42
22 26
23 58
24 6
25 38
26 22
27 54
28 14
29 46
30 30
31 62
32 1
33 33
34 17
35 49
36 9
37 41
38 25
39 57
40 5
41 37
42 21
43 53
44 13
45 45
46 29
47 62
48 3
49 35
50 19
51 51
52 11
53 43
54 27
55 59
56 7
57 39
58 23
59 55
60 15
61 47
62 31
63 63
Fig. 1 Conventional radix-8 signal flow graph for a 64-point FFT
storing the twiddle factors and two control units used to control different states of
memory banks and each module in FFT processor respectively. To store the input
data and/or intermediate/final results of the butterfly unit will be done the memories.
These memories work in ping-pang mode among each stage and to avoid the address
conflicts in memories three multiplexers are used.
3.1 Conflict-Free Address Strategy
Each memory is organized as number of banks depending on the radix. Data is stored
in the memory within the specified addresses corresponding to the modified SFG.
The bit reversal operation is not necessary as results are directly obtained in the
stage 2. To have efficient memory organization for input and output in regular order,
conflict-free addressing strategy should be used.
Input First stage Second stage Output

0
0
1
1
2
2
3
3
4
4
5
5
6
6
7
7
8
8
9
9
10
10
11
11
12
12
13
13
14
14
15
15
16
16
17
17
18
18
19
19
20
20
21
21
22
22
23
23
24
24
25
25
26
26
27
27
28
28
29
29
30
30
31
31
32
32
33
33
34
34
35
35
36
36
37
37
38
38
39
39
40
40
41
41
42
42
43
43
44
44
45
45
46
46
47
47
48
48
49
49
50
50
51
51
52
52
53
53
54
54
55
55
56
56
57
57
58
58
59
59
60
60
61
61
62
62
63
63
Fig. 2 Modified radix-8 signal flow graph for a 64 point FFT
Conventional Modified
Result1
A + + + Result1
A Result1
B Result5 Result2
C Result3 Result3 B * + + + Result2
D Result7 Result4
Result5 C + ̶ + Result3
E
F
Result2
Result6 Result6
*
G Result4 Result7 D + + Result4
Result8 * ̶
H Result8
A Result1 E ̶ + ̶ Result5
B
-1
Result5
*
-1
C
-1 -1
Result3 F * ̶ + ̶ Result6
D Result7
-1
E Result2 ̶
F
-1 -1
Result6 G * ̶ ̶ Result7
-1 -1
G -1
Result4
H -1 -1 Result8 H * ̶ ̶ ̶ Result8
(a) (b)
Fig. 3 a Radix-8 butterfly computation, b architecture of radix-8 computation unit

Fig. 4 Architecture of the

Interface multiplier network
memory based FFT
Memory1 Memory2
Control
(8 banks) (8 banks)
Data multiplexer network
Control
Radix-8
unit
Twiddle
factor
Data multiplexer network
3.1.1 The First Stage of FFT
Stage I of 64-point radix -8 FFT is shown in Fig. 5, where, the input samples are
stored in sequential order in eight banks of RAM Ping. The data in each bank is
stored in incremental addresses of banks. For example, data 13 is stored in bank2 at
address 5, data 26 is stored in bank4 at address 2, and so on. After the computation,
the corresponding output results are generated in RAM Pang.
In order to avoid memory conflict, Table 1 represents the pattern for storing the
results of butterfly unit in every stage of 64-point FFT processor. First column of
S0S1S2
RAM Ping
Bank 1 RAM Pang
8 7 6 5 4 3 2 1
8-2 7-3 6-4 5-3 4-6 3-7 2-8 1-1
Bank 2
16 15 14 13 12 11 10 9
8-3 7-4 6-5 5-6 4-7 3-8 2-1 1-2
Bank 3
24 23 22 21 20 19 18 17 8-4 7-5 6-6 5-7 4-8 3-1 2-2 1-3
Bank 4
32 31 30 29 28 27 26 25 8-5 7-6 6-7 5-8 4-1 3-2 2-3 1-4
Radix -8
Unit
Bank 5 8-6 7-7 6-8 5-1 4-2 3-3 2-4 1-5
40 39 38 37 36 35 34 33
Bank 6 8-7 7-8 6-1 5-2 4-3 3-4 2-5 1-6

48 47 46 45 44 43 42 41
8-8 7-1 6-2 5-3 4-4 3-5 2-6 1-7

Bank 7
56 55 54 53 52 51 50 49
8-1 7-2 6-3 5-4 4-5 3-6 2-7 1-8

Bank 8
64 63 62 61 60 59 58 57
Fig. 5 Stage I of 64-point radix-8 FFT

Table 1 Conflict-free memory addressing strategy for radix-8 FFT

Address Selection Bank 1 Bank 2 Bank 3 Bank 4 Bank 5 Bank 6 Bank 7 Bank 8
(cycles)
000 (1) 0 1_1 1_2 1_3 1_4 1_5 1_6 1_7 1_8
001 (2) 1 2_8 2_1 2_2 2_3 2_4 2_5 2_6 2_7
001 (3) 2 3_7 3_8 3_1 3_2 3_3 3_4 3_5 3_6
011 (4) 3 4_6 4_7 4_8 4_1 4_2 4_3 4_4 4_5
100 (5) 4 5_5 5_6 5_7 5_8 5_1 5_2 5_3 5_4
101 (6) 5 6_4 6_5 6_6 6_7 6_8 6_1 6_2 6_3
110 (7) 6 7_3 7_4 7_5 7_6 7_7 7_8 7_1 7_2
111 (8) 7 8_2 8_3 8_4 8_5 8_6 8_7 8_8 8_1
Table 1 indicates the address of the butterfly computation, second column indicate
the address selection and remaining columns expressed as x_y, indicate the results of
radix-8 butterfly computations. x represents which iteration of butterfly computation
and y represents which results of the butterfly computation.
In Table 1, the eight-butterfly computation results are 1_1, 1_2, 1_3, 1_4, 1_5,
1_6, 1_7, and 1_8 are produced during the first cycle, and the initial result 1_1 from
the first butterfly computation are stored in bank 1 first address. The multiplexer
selects one of the eight results from the radix-8 butterfly unit.
3.1.2 Second Stage of FFT
The last/second stage of 64-point FFT processor is shown in Fig. 6. In this stage, the
output results are in the natural order because of the modified SFG. The computation
time for this processor is reduced and iteration time decreased.
4 Results and Comparison
A 4096-point radix-8 FFT is designed to verify the performance, and resource

utilization of the proposed architecture. The design is simulated using Verilog HDL
for Virtex 6 XC6VCX75T FPGA device. The theoretical comparison of hardware
resources and processing time is presented in Table 2.
It can be noticed that resources have increased with increase in radix while the
total processing time has decreased by a factor of 3. Table 3 shows the timing report of
radix-8 FFT and existed method, the computation time required for the radix-8 FFT
is 14.020 us, and existed method is 73.519 us. The total processing time of proposed
method is less compared to existed method. The macro utilization is summarized in
Table 4. It is observed that macro utilization is higher for radix-8 due to increase
in logic operations per iteration. Similar increase is reported in device utilization
RAM Pang S0S1S2

Output 1 RAM Ping
8-2 7-3 6-4 5-3 4-6 3-7 2-8 1-1
8 7 6 5 4 3 2 1
Output 2
8-3 7-4 6-5 5-6 4-7 3-8 2-1 1-2
16 15 14 13 12 11 10 9
Output 3
8-4 7-5 6-6 5-7 4-8 3-1 2-2 1-3
24 23 22 21 20 19 18 17
Output 4
8-5 7-6 6-7 5-8 4-1 3-2 2-3 1-4
32 31 30 29 28 27 26 25
Output 5 Radix -8
8-6 7-7 6-8 5-1 4-2 3-3 2-4 1-5
Unit
40 39 38 37 36 35 34 33
Output 6
8-7 7-8 6-1 5-2 4-3 3-4 2-5 1-6
48 47 46 45 44 43 42 41
Output 7
8-8 7-1 6-2 5-3 4-4 3-5 2-6 1-7
56 55 54 53 52 51 50 49
Output 8
8-1 7-2 6-3 5-4 4-5 3-6 2-7 1-8
64 63 62 61 60 59 58 57
Fig. 6 Stage II of 64-point radix-8 FFT
Table 2 Performance
Radix-8(proposed) Radix-4 [13]
estimation of radix-4 and
radix-8 processor Parallel process Single Single
Memory size 2N 2N
Memory bank 8 4
Iteration (log8N ) (log2N )/2 − 1
Cycles per iteration N/8 N/4
Total processing time N (log8N )/8 N (log2N )/8 − N /4
Complex adders 24 8
Complex multiplier 7 3
Table 3 Performance
Memory-based FFT Radix-8 (proposed) Radix-4 [13]
estimation of radix-8 and
Processor
radix-4 processor
Delay per cycle 6.846 ns 11.966 ns
Total computation 14.020 us 73.519 us
time
of radix 8 FFT memory-based processor over radix-4 FFT processor. The device
utilization summary for Virtex 6 XC6VCX75T FPGA device is reported in Table. 5.
Table 4 Macro utilization

Radix-8 (proposed) Radix-4
summary
RAM’S 2 4
Multipliers 22 12
Adders/Substractors 93 40
Registers 162 99
Multiplexers 65 4
Table 5 Device utilization

Logic utilization Radix-8 (proposed) Radix-4
No. of registers 1330 556
No. of LUT’s 1279 1795
No. of fully used LUT’S-FF pair 537 295
No. of bonded IOB’s 152 65
No. of BUFGS 1330 556
5 Conclusion
A novel modified signal flow graph and memory-based Radix-8 FFT processor
design has been presented in this work, which implemented with 4096-point. The
experimental results show the proposed design achieves reduced iterations and lower
computation time for realization of FFT processor that is 80.7% less compared to
existing processor design. Our proposed method also achieves lower address conflicts
but more hardware utilization. The design is mostly used in communications and
signal processing for lower computation time processors.
References
1. Garrido, M., Huang, S.J., Chen, S.G., Gustafsson, O.: The Serial Commutator FFT. IEEE Trans.
Circ. Syst. II Exp. Briefs 63(10), 974–978 (2016)
2. Yin, X.B., Yu, F., Ma, Z.G.: Resource-efficient pipelined architectures for radix-2 real-valued
FFT with real data paths. IEEE Trans. Circ. Syst. II Exp. Briefs 63(8), 803–807 (2016)
3. Liu, J.Q., Xing, Q.J., Yin, X.B., Mao, X.B., Yu, F.: Pipelined architecture for a radix-2 fast
Walsh-Hadamard-Fourier transform algorithm. IEEE Trans. Circ. Syst. II Exp. Briefs 62(11),
1083–1087 (2015)
4. Hazarika, J., et al.: Energy efficient VLSI architecture of real-valued serial pipelined FFT. IET
Comput. Digital Tech 13(6), 461–469 (2019)
5. Xing, Q.J., Ma, Z.G., Xu, Y.K.: A novel conflict-free parallel memory access scheme for FFT
processors. IEEE Trans. Circ. Syst. II Exp. Briefs 64(11), 1347–1351 (2017)
6. Mao, X.B., Ma, Z.G., Yu, F., Xing, Q.J.: A continuous-flow memory-based architecture for
real-valued FFT. IEEE Trans. Circ. Syst. II Exp. Briefs 64(11), 1352–1356 (2017)
7. Ma, Z.G., Yin, X.B., Yu, F.: A novel memory-based FFT architecture for real-valued signals
based on a radix-2 decimation-in-frequency algorithm. IEEE Trans. Circ. Syst. II Exp, Briefs
62(9), 876–880 (2015)
8. Qian, Z., Margala, M.: Low-power split-radix FFT processors using radix-2 Butterfly units.
IEEE Trans. Very Large Scale Integr. (VLSI) Syst. 24(9), 3008–3012 (2016)
9. Tian, Y.H., Hei, Y., Liu, Z.Z., Di, Z.X., Shen, Q., Yu, Z.H.: A memory-based FFT processor
using modified signal flow graph with novel conflict-free address schemes. IEICE Electron.
Express 14(15), 1–11 (2017)
10. Garrido, M., Sanchez, M.A., Vallejo, M.L.L., Grajal, J.: A 4096-point radix-4 memory-based
FFT using DSP slices. IEEE Trans. Very Large Scale Integr. (VLSI) Syst. 25(1), 375–379
(2017)
11. Xia, K.F., Wu, B., Xiong, T., Ye, T.C.: A memory-based FFT processor design with generalized
efficient conflict-free address schemes. IEEE Trans. Very Large Scale Integr. (VLSI) Syst.
25(6), 1919–1929 (2017)
12. Luo, H.F., Liu, Y.J., Shieh, M.D.: Efficient memory-addressing algorithms for FFT processor
design. IEEE Trans. Very Large Scale Integr. (VLSI) Syst. 23(10), 2162–2172, 2015
13. Tian, Y., Hei, Y., Liu, Z., Shen, Q., Di, Z., Chen, T.: A modified signal flow graph and corre-
sponding conflict-free strategy for memory-based FFT processor design. IEEE Trans. Circ.
Syst. II Express Briefs 66(1), (2019)
Vouch augmented Program Courses
Recommendation System for E-Learning
K. B. V. Rama Narasimham, C. V. P. R. Prasad, J. Jyothirmai,

and M. Raghava
Abstract In the realm of remote working and online living, it is imperative for edu-
cational institutions to steer their teaching learning process toward virtual classrooms
and online evaluations. However, the existing learning management systems offer
online video conference tools and facilitate the stakeholders with recommendations
based on hard coded rules. As a result, the participating students also are failing to
consolidate the theoretical concepts and started shying away from the critical core
courses which are highly an unwanted situation for the next generation knowledge
building. This paper aspires to propose developing a cognizant system which con-
tinually collects the multi-modal data from diversified sources, integrate them with
the emotions of the students, intuitions of the torch bearers of various fields and
evolve authentic recommendations to the students. The proposed vouch augmented
learning management system, which we refer as vLMS, offers a framework that does
a deep poll in the background on various data sources, derives the semantic relations
into cognizance and offers hard as well as soft recommendations for a student to
rediscover himself. Finally, the article presents the detailed architecture, the suitable
soft-computing models and the technology stack support for implementing the vLMS
framework.
K. B. V. Rama Narasimham
Career Point University, Aalniya, India
C. V. P. R. Prasad
Malla Reddy Engineering College for Women, Hyderabad, India
J. Jyothirmai
VNRVJIET, Secunderabad, India
e-mail: jyothirmai_j@vnrvjiet.in
M. Raghava (B)
CVR College of Engineering, Hyderabad, India
e-mail: raghava.m@cvr.ac.in
https://doi.org/10.1007/978-981-16-1502-3_55
556 K. B. V. Rama Narasimham et al.
1 Introduction
A sprawling undergraduate college campus offers well-crafted curriculum, necessary

classroom and computing infrastructure and recreation facilities for students. Stu-
dents from various backgrounds, learning habits, career ambitions, once poured into
new academic environment, tend to take time to adapt to the learning environment
and better utilize the facilities. The parents also show lot of concern on performance
of their wards in the competitive environment. However, neither the students nor the
parents share their ambitions and concerns with the college due to the absence of
single point of contact. Many a time, these interactions could not extract the inhibi-
tions of the students and anxiety of the parents leading to administrative vagaries.
On the other hand, the electronic learning, E-Learning [1], conditioned by Internet,
is aspired to unleash the education systems in delivering the content to the remote
learners in virtual mode [2]. The facilitator presents the contents or demonstrates
the program models either synchronously or asynchronously [3] through networks
and smart devices. This paradigm shift has prompted academicians to evolve novel
methodologies in content dissemination and sharing in various formats. However,
the students community with varied societal positions and skills set tend to take time
to embrace the emerging teaching-learning models. queryPlease check the clarity
of the sentence ‘The latest Web 5.0 [4] standard which can cater to emotions of
the...’.The latest Web 5.0 [4] standard which can cater to emotions of the students
involved with E-Learning through ultra-intelligent electronic agents. More interest-
ingly, these agents can place the anonymity of the user into a question and can capture
the emotions of individuals and turn the Web platform as emotive Web. Andre [5] ana-
lyzed the significant role played by the micro loops in flipped class-based learning.
Many authors modeled teaching-learning process as an optimization problem [6] and
exploited the merits of swarm intelligence to get better outcomes. The recent National
Educational Policy-2020 (NEP-2020) [7] approved by the Government of India fos-
ters the skill and code-based education that is going to become the game changer in
the academics of India. The NEP-2020 emphasizes the importance of mother tongue
as the first language during primary education, and the pedagogy must make the
learning environment enjoyable which will essentially expand the mental horizon of
the students. Implementation of this policy is possible only through integrating the
technology ecosystem with the learning environments. However, the exaggeration of
agent-based Web intelligence can end up as a hype-cycle and doom to fail if adapted
in its native form for E-learning [8]. Please check the clarity of the sentence ‘In
this direction, this research article proposes a new methodology and framework that
hand holds the...’.In this direction, this research article proposes a new methodology
and framework that hand holds the students and help them realizing their potentials.
Along with that, it also presents the future prospects of its implementation. Owing to
its complexity, we restrict our discussions to circuit branches of engineering program
at undergraduate level offered in India. Further works gradually aspire to accommo-
date the other disciplines of education. The following sections are organized into the
pitfalls of the existing LMS platforms and the features of the proposed comprehen-
Vouch augmented Program Courses Recommendation System for E-Learning 557
sive vLMS model. Finally, it also explores the agility gained by the model from the
developments in the entire ecosystem.
2 Shortcomings of the Existing LMS
The conventional teaching-learning(T-L) systems are purely class room-based and

facilitate the students to learn the content in class rooms and laboratories. The pitfalls
of the conventional teaching-learning process and its relevance in the online learning
scenario are detailed below.
– The success stories of the classroom-based teaching process rooted in the proven
practices: eye-to-eye contact, chalk-and-talk, flipped models, learning while doing,
etc. However, these practices are conspicuous for their absence in online learning
scenarios.
– The existing T-L process evaluation models utilize the measures either absolute
or derivable from the data collected from the theory and practical exams, typi-
cally, spread over a period of 16 weeks. However, students are also encouraged
to participate in group events that foster their dynamics, and the outcomes are not
accounted for in any course outcome evaluations.
– Due to the virtual nature, the concentration levels of student greatly get affected in
online scenario, and hence, there is a need to remodel the content delivery process,
consolidation of learning outcomes to ensure the success of the online learning
model.
– The online T-L process casts a bug-bear to the teachers as they are evaluated in the
open house. It is imperative for the teachers to equip themselves with new content
delivery skills and display new balanced reasoning skills which are absent in the
LMS.
– Perhaps, this new online realm is an unwanted situation for the ambivalent teachers
who doubt the safe delivery of the contents as a myth, and further, the loss of per-
sonal relations might lead to isolated and self-centered individuals which are really
unwantedqueryPlease check the clarity of the sentence ‘Off late the revolutions
in the Web Technologies stack driven by Web 5.0 standard compelled researchers
to...’..
Off late the revolutions in the Web Technologies stack driven by Web 5.0 standard
compelled researchers to support the LMS with lot of functional capabilities. Veselina
and Snejana [9] attempted to develop an intelligent system in Web searching, docu-
ment management and organizational control in the form of webOS. Knowing which
category a student–learner belongs to can help the instructor to resolve what infor-
mation to discuss and how to deliver the content. Dunn and Kennedy [10] assessed
the delivery of the technology in enhancing the learning curve of the students. How-
ever, these models serve as recommendation systems that process the data collected
by the model and offer advisory rules to the learners. Also, they do not evaluate the
efficacy of the suggested rule and its impact on the learner. Hence, this article intro-
duces vouch augmented course recommendation system which learns in a reinforced
manner and assures the student and the teacher with the expected outcome.
3 Objectives of the Proposed Research
The proposed research work aspires to address all the concerns specified above by
leveraging the latest technologies and aitificial Intelligence models that are capable
of extracting the latent semantics and establish effective logistics with the following
expected outcomes:
– To develop an intelligent cyber-physical model which enhances the capabilities of
self-learning in the students.
– To increase the contents complexity dynamically that adjust to the learning curve
of the aspirant learner who goes beyond the expectations.
– To qualitatively model the interaction scenarios between the host and the partici-
pant for realizing the program outcomes.
– To quantify the level of focus a learner is maintaining in a time series.
– To design and develop a technology fabric to offer wide variety of use cases for
all the actors. and finally,
– To evolve an agent-based model that retrospects and reenforces its recommenda-
tions on the time line and offers a symbiotic ecosystem for both the learners and
patrons. Hence, the LMS with self-evaluation feature is referred to as vouching-
based LMS (vLMS) which is coined for the first time in the literature of recom-
mendation systems. The self-accountable and self-reformable features are realized
by exploiting the technology platform and to extract suitable metrics (standards)
and measures.
3.1 To Quantify the Level of Focus (LoF) for a Learner in a

Time Series
Here, the student activity can be framed as supervised learning [2] which focuses
on the learner’s active [5] participation in learning the content or the completion of
the course within the time-bound. The model will also resolve if the participant was
not that active and sends an alert notification to the learner through various channel
to complete the course. For example, if x is the learner who got registered with the
LMS application (y) and got registered for a particular course for about 40 h, here the
course can be completed in two days or he may complete the course in 10 days also
by spending at 4 h per day in learning the content. Here, the machine (supervises)
records the entry of the learner, the log-in and exit activities and analyzes using time
series models.
3.2 To Enhance the Capabilities of Self-learning in the

Students
This is a difficult task for the machine to make the learner to be self-learning [11]. As
of now, all the learners might have been learning the content in the form of spoon-
feeding, when it comes to self-learning, the learner will face a difficult task as he/she
needs to focus on the content and needs to solve the problems on their own. Here,
the machine learning algorithm manifested by virtual reality can enable the learner
to solve the obtained problems. For that, the system has to be designed in such way,
a sample or the similar problem has to be solved step by step in a diagrammatic way,
by seeing the process, the learner can understand how to solve the problem, and in
the next step, the learner by himself can able to solve the problem which enables
self-learning.
3.3 To Fiddle the Complexity of the Course Contents with the

Learning Curve of the Aspirant Learner
This is one of the interesting points the proposed machine learning algorithms focus
upon and add a value to the system. This can be done based on the active participation
of the learner if the learner has registered for a particular course through LMS, if
he is completing each and every module, supervised machine learning algorithm
will play a vital role, and here, the supervised machine learning algorithm would
like to assess the participant how far he/she has learned the content by putting some
random questions dynamically in the form of the quiz so as to get the information
about the participant how far he/she following the content through LMS. By this,
if he/she answered the questions properly, then also, we can consider he/she is the
active participant, i.e., testing the participant from easy to complex mode, as the
participant moving ahead in learning the course.
3.4 To Qualitatively Model the Interaction Scenarios

Between the Host and the Participant for Realizing the
Program Outcomes
The learner should be able to understand the content and the outcomes clearly, in
addition to that, the learning can be considered as a dynamic process in which the
learner actively “constructs” new knowledge as he or she is engaged and immersed
in a learning activity, and along the other side, there should be a keen focus on
two factors, i.e., behaviorism and cognitive psychology, where these things can be
evaluated by using different machine learning algorithms for the better results.
3.5 To Design and Develop a Technology Fabric to Offer

Wide Variety of Use Cases for All the Actors
A necessary design should be made where all kinds of interfaces are developed where
a layman can also understand and have some kind of interaction between the learner
and the instructor, where the learner requirements could be fulfilled.
3.6 To Evolve a Vouching-Based Online Teaching Learning

Technology Platform with Suitable Metrics and Measures
This objective clearly focuses on how the assessment of the student is taking place,
rather than the traditional assessment like physical evaluation of the student in the
form of marks [7]. This feature of the system assesses the level of understating of
the student and the additional efforts required by the student to meet the essential
rubrics. Along sides, the vLMS also evaluates the strength and outcome of the rec-
ommendation and reinforces itself by consuming additional input from the system.
4 Proposed Agent-Based Reinforced Learning Model

(vLMS)
The vLMS offers a comprehensive solution to all the stakeholders of the system and
is composed of two functional modules, namely SPSS and smart vouching agent. It
is proposed to foster the outcome-based learning model of the students with a joyful
learning environment on the campus by developing smart student profiling system
(SSPS). The vouching module observes and analyzes the recommendations of SPSS
and offers a reinforced learning capability. This research work is proposed to aug-
ment the existing student monitoring and mentoring process adopted by an academic
institute with smart technologies. The fundamental idea behind this research is to
evolve a smart mentoring system which relieves the students from intangible stress
caused by the various factors such as strict submission deadlines, nearing last dates,
changing industry trends, peer-pressure, temporary setbacks and other distractions.
Also, it pushes the event-based messages to the parents and generates the summary
sheets useful for many accreditation agencies. The unique feature of SSPS is to serve
as an oracle to parents and students in quashing all misgivings.
The proposed SSPS model is a distributed computing model which utilizes cut-
ting edge technologies to process data collected from various sources and formats,
offers a analytics prism and fills the semantic gap between the ambitions of the
students and capabilities of the system. The sources include the day-to-day class
room attendance, assignment submission due dates, course registration deadlines,
regular classwork reading hours, experiences and observations in lab sessions, the
summary of mentoring reports, performance in internals of theory and lab examina-

tions and outlook of experts on fast changing industry trends. The value derivation
from such a data is accomplished by various mathematical and statistical models
available in predictive and prescriptive data analytics libraries. SSPS also serves as
a recommendation system on professional electives and open electives to the stu-
dents. Along with the data available in the documents generated, visual data from
IP-enabled cameras is collected seamlessly without hampering the privacy of the stu-
dents. This data throws light on behavioral dynamics and pedagogy effectual aspects
of the students on the campus. It is imperative to install an IoT-based visual sensor
networks to deploy the service model of this functional requirement. The openCV
libraries and Python API available in the public domain can be utilized. SSPS offers
a interactive chat box as a frontend to all the stakeholders and dispenses the most
relevant and artificial intelligence-driven information flakes, measures and metrics.
The salient features of this interactive model are to offer personalized prescriptive
analytics model, to raise the future spirits of the students and to repose confidence
in the parents on the prospects of the students, by employing natural language pro-
cessing, applied machine learning and deep learning models. Yet another usecase
of SSPS is to generate summary sheets and attainment measures. Overall the SSPS
helps ingest management of all the data resources and present visual analytics to all
the stakeholders. The vouching system which is a reinforced learning-based module
constantly observes the recommendations of the SPSS and compares the actual out-
come with the expected outcome and suggests new recommendations. We propose to
employ a genetic programming-based methodology to solve the inference problem
of the vouching agent.
5 Technology Stack to Implement the vLMS
Figure 1 gives the schematic diagram of the proposed vLMS along with the building
blocks. The agent-based vLMS can primarily augment the mission of an academic
institute to realize its vision statement. It is intended to collect data from various
sources and interprets it to derive actionable intelligence. It also generates new learn-
ing scenarios for the students and also accelerates the decision agility of a teacher.
Further, it offers nudge factors to the students to elevate his spirits. Vitara module in
Fig. 1 offers a data integration pipeline that ingests the data into the Adhiitam, the
cognitive engine of the system. The legacy databases, teaching learning process out-
comes (TLP), flat files (mentoring sheets, survey forms), API (social media channels)
serve as the sources of the data. This module is responsible for data customization
and integration of interpretations available in the data sources. The Adhiitam module
offers a data analytics prism and is capable of solving multi-subjective optimization
problems and suggests some actionable items. Vachaspathi module offers the inter-
faces to users to have interactions with vLMS leading to conversational experiences
for all the end users. It dispenses some bonafied recommendations for trivial queries
and extracts the latent semantics while handling complex and involved questions.
Smart Agent
Vachaspati Adhiitam Vitara

(Intercation) (Interpretation) (Integration)
Fig. 1 vLMS
Fig. 2 Technology stack
It also serves appraisals and recommendations to the end user. The composition of
Vachaspati, Adhiitam and Vitara implements the SSPS, and the smart agent which
offers the vouchers through genetic programming and deep learning models turns
SSPS into vLMS. The smart system agent is capable of implementing the sequence
models and gains insights of the teaching learning events.
Figure 2 presents the technology support to implement the vLMS along with the
building blocks. The Web 5.0, AI, IoT and big data ecosystems play a vital role in
implementing the vLMS. Web 5.0 communication mechanisms, Digital Aura and the
entertainment API 5 senses can be used to offer better user experiences and immersion
features. The AR/VR libraries help to implement visualization and presentations
capabilities. The big data and AI-based tools process the time series data, and the
NLP packages bridge the semantic gap between the student and the system. Overall
the vLMS improves the operational efficiency of T-L process by evolving new set of
standard operational procedures. The AR and VR technology can be used in taking
the e-Learning or vouching learning management system (vLMS) to another level.
6 Conclusions
This article discussed the imperatives of new online learning models, and a self-
accountable vouching-based LMS is proposed. The technological feasibilities are
elaborated along with the architecture of vLMS. The future work aspires to implement
the model and evaluate it on industry workbench data sets. This research work is going
to offer a tech conclave for implementing NEP-2020.
References
1. Sunita, A., Lobo, M.J.R.: A framework for recommendation of courses in e-learning system
(2011)
2. Hwang, G-J., Lai, C-L., Wang, S.-Y.: Seamless flipped learning: a mobile technology-604
enhanced flipped classroom with effective learning strategies. J. Comput. 605 Educ. 2(4),
449–473 (2015)
3. Castillo, G., Millan, E.: Discovering Student Preferences in E-Learning (2007)
4. Benito-Osorio, D., Peris-Ortiz, M., Armengot, C.R., et al.: Web 5.0: the future of emotional
competences in higher education. Glob. Bus. Perspect. 1, 274–287 (2013)
5. Mastmeyer, A.: Quantitative and Qualitative Evaluation of Transforming to Flipped-Classroom
from Instruction Teaching using Micro Feedback (Version 0.5), Aug 2020
6. Suresh, S.C., Naik, A.: Modified teaching–learning-based optimization algorithm for global
numerical optimization—A comparative study. Swarm Evol Comput (2014)
7. NEP: www.mhrd.gov.in/sites/upload_files/mhrd/files/NEP_Final_English_0.pdf (2020)
8. Romn, P.E., Torres, E.O., Hernndez, R.L.: Virtual learning environments as a continuous assess-
ment tool in university students, Chap. 12, pp. 229–252. IGI Global (2019)
9. Veselina, N., Snejana, D.: Intelligent e-Learning with New Web Technologies. ICVL (2015)
10. Dunn, T., Kennedy, M.: Technology enhanced learning in higher education; motivations,
engagement and academic achievement. Comput. Educ. 137, 104–113 (2019)
11. Zaiane, O.R., Luo, J.: Towards evaluating learners’ behaviour in a web-based distance learning
environment (2001)
Heart Disease Prediction Using Extended
KNN (E-KNN)
R. Sateesh Kumar and S. Sameen Fatima
Abstract The WHO estimates that deaths due to heart disease are the number one
cause worldwide, accounting for around 30% annually taking an estimated 1.5 crores
who die due to this disease. In this study, an extension of KNN algorithm known as
E-KNN is used and compares with the results of different machine learning methods
such as K-Nearest Neighbor (KNN), Support Vector Machine (SVM), and Classifi-
cation and Regression Trees (CART) (Kumar and Thomas in Int J Recent Technol
Eng (IJRTE) 9(1) [1]) in the prediction of heart disease. To improve the efficiency of
the proposed system, the most important features are selected using chi-square test.
The performance and efficiency of the algorithms are evaluated and compared on the
basis of accuracy, recall, precision, and F1 score. The results of the proposed algo-
rithm were more accurate with lesser attributes than all attributes. The performance
of E-KNN by using 11 attributes has an accuracy value of 90.10%. It is followed by
SVM with 89% accuracy.
1 Introduction
WHO estimated that there are 17 million people die of heart diseases (CVD) every
year. These death rates can be reduced with early diagnosis and informed to the
patients. Common cardiovascular diseases include coronary heart disease, cardiomy-
opathy, hypertensive heart disease, heart failure, etc. Smoking, diabetes, lack of phys-
ical activity, hypertension, high cholesterol diet are some of the common causes of
heart diseases.
R. Sateesh Kumar (B)

Department of Computer Science and Engineering, Vasavi College of Engineering, Hyderabad,
Telangana, India
e-mail: sateeshramatenki@staff.vce.ac.in
S. Sameen Fatima
Osmania University, Hyderabad, Telangana, India
https://doi.org/10.1007/978-981-16-1502-3_56
566 R. Sateesh Kumar and S. Sameen Fatima
Research leading to the sciences of cardiovascular diseases using machine learning

and data mining has been an endeavor encompassing optimum treatment plans, expe-
dited and disease prognosis, identification of risk factors. Numerous CVD surveys
have been conducted with the primary dataset as Cleveland dataset. Recommending
the parameters from this dataset proposes a predictive system to apply logistic regres-
sion model, random forests, SVM, and KNN to obtain predictions from several
learners which are in turn used in meta models. The results of each ensemble modeling
are then compared on the basis of several evaluation parameters.
In this paper, we are proposing extension of KNN algorithm, namely, Extended
K-Nearest Neighbor algorithm (E-KNN). The results of this algorithm compared
with K-Nearest Neighbor algorithm, Decision Tree algorithm, and Support Vector
Machine algorithm. The specified data set is used to train these algorithms. With
enough data and time, it is good to all the attributes or features including the irrelevant
features to train the classification algorithm. The problems of using the irrelevant
features are that it leads to lesser accurate results and it may also lead to overfitting.
Feature subset selection is a dimensionality reduction method that is used to select
the most relevant attributes from the dataset [1]. In this paper, the Chi-square test
is used as the feature subset selection method. The selected features are fed to the
algorithms as input.
2 Literature Review
Revathi et al. [2], provides an analysis of various data mining methods for prediction
of heart disease. Decision tree, Back-propagation algorithm, and Nave Bayes are
used. The system used 14 parameters including blood pressure, chest pain, choles-
terol, and heart rate to enhance the system accuracy. A comparison of the performance
of the three algorithms is done. Study shows that the neural network performs best
to predict heart disease and has the accuracy of 100%. It has outperformed the other
two algorithms.
Shinde et al. [3], using the data mining methods introduced a system for predicting
heart disease. K-means clustering algorithm and Nave Bayes were used in this
system. For prediction, a combination of both techniques has been used. The K-
means clustering algorithm is used to enhance overall system efficiency. It is used
to group the different attributes present in the dataset and the prediction is done by
the Nave Bayes algorithm. The system used 10 attributes. Compared with the other
algorithms, the system produces better results.
Sateesh et al. [1], used ensemble learning method to predict the heart disease.
They used KNN, SVM, CART algorithms and designed an ensemble using these
algorithms.
Heart Disease Prediction Using Extended KNN (E-KNN) 567
Fig. 1 Approach
3 Approach
The methodology used.

Figure 1 shows the approach used in this paper. The study uses dataset which
has 300 records of patients. The original dataset contains thirteen attributes. From
the dataset, the required attributes using the statistical measure (Chi-square test) are
identified.
4 Dataset
Table 1 describes the data set used in this study. It is an openly available dataset and
can be found at the UCI Machine Learning Repository. The original data set consists
of 76 features. We used 13 features from them. The features are described in the
following table. The disease attribute is the class label which specifies whether the
patient is suffering from heart disease or not.
Table 1 Dataset description [1]

Feature No. Name of feature Feature description
1. age_years Age of the patient
2. Gender 1 Male
0 Female
3. cpain_type Chest pain {0, 1, 2, 3}
4. rest_bp This feature represents the value of the blood sugar in
rest
5. serum_chol Measure the serum cholesterol
6. fb_sugar Measure fasting blood sugar {0 if fb_sugar < 120, 1 if
fb_sugar > 120}
7. rest_ecg ECG in resting {0, 1, 2}
8. max_heartrate maximum heart rate
9. ex_angina It takes {0, 1}
10. ex_ST_depression ST depression during exercise
11. peak_slope Takes the value s{0, 1, 2}
12. Number of vessels Indicates number of vessels blocked {0, 1, 2, 3}
13. defect_type Heart defect type {1, 2, 3}
14. disease Identification of heart disease
1 Suffering from disease
0 No disease
4.1 Chi-Squared Value
Sometimes our dataset may contain both relevant and irrelevant features. It is very
important to find and discard the unimportant features that do not contribute to the
outcome to be predicted by the system. There are various methods to identify the
relevant features from our input attributes. The methods to select the relevant features
are called Feature Selection Methods. Chi-squared test applies the statistical method
to identify the relation between the input variable and the target variable.
The following are the steps to determine the Chi-squared value.
Create a contingency table for two attributes. The values present in the table are
called as observed values (O).
Calculate the expected frequency (E) value for each of the cell present in the table.
E = (row total ∗ column total)/overall sum
Calculate the chi-squared value
n
(Oi − E i )2
χ2 =
i=1
Ei
Arrange the chi-squared value in the descending order.

Select the top-ranked attributes from the above list.
4.2 Extended K-Nearest Neighbor
The KNN classifier uses polling to assign the class label to the new data item.
This leads to the missclassification. In order to overcome this problem, the E-KNN
is implemented. In KNN, a new data item belongs to certain class C1 which is
surrounded by classes C2 data points. The new data point is misclassified as class
C2 because of the majority of class. To avoid this problem in E-KNN, the selection
of top k neighbors is varied. To reduce the class C2 neighbors, it skips 3 Neighbors
and select the next 3 Neighbors, i.e., 3 + k Neighbors and also assign the weight to
the each neighbor based on the distance from the new data item. Class label to the
new data item is selected based on the k + 3 neighbors and their weights.
E-KNN Algorithm steps
1. Divide the data set in training and testing
2. Choose the K values based on the requirements
3. For every new data item compute the following:
3.1 Find the Distance from the new data item to all the data items in the
training set using distance measure
3.2 Sort the distances in descending order and identify the K nearest data
points
3.3 Assign the weights to all the K nearest neighbors (Weight w = 1/d where
d is the distance from the new data point to its neighbor)
3.4 To obtain the top k rows from the above-sorted distance array, calculate
the following two valuestart = k / 2, end = k + start
3.5 The top k rows are obtained by adding k = sorted distance (0: start) +
sorted distance(k-1: end) and based on the weights
3.6 The most frequent class from the sorted rows and their weights
4. Stop
4.3 K-Nearest Neighbor
1. Divide the data set in training and testing

2. Choose the K values based on the requirements
3. For every new data item compute the following:
3.1 Find the Distance from the new data item to all the data items in the
training set using distance measure
3.2 Sort the distances in descending order and identify the K nearest data
points
3.3 The most frequent class from the sorted rows and their weights
4. Stop
This section provides the results of implementing the various above-discussed algo-
rithms on the heart disease dataset. Table 2 indicates the top 11 attributes ranked
from the Chi-square test.
Comparison of algorithms according to the number of attributes used show in
Tables 3 and 4 (Figs. 2, 3 and 4; Table 5).
Table 2 Top 11 attributes

Attribute Rank
selected by chi-squared test
A1 max_heartrate
A2 ex_ST_depression
A3 num_vessels
A4 cpain_type
A5 ex_angina
A6 serum_chol
A7 Age
A8 rest_bp
A9 peak_slope
A10 Gender
A11 defect_type
Table 3 The comparison of algorithm result with 13 attributes

EKNN (%) KNN SVM Decision Tree
Accuracy 89.10 86 87 79
Precision 89 86 86.5 79
Recall 89 86 86.5 79
F1 score 89 86 86.5 79
Table 4 The comparison of algorithm result with selected attributes

EKNN (%) KNN (%) SVM (%) Decision tree (%)
Accuracy 92.31 91.21 92.31 87.91
Precision 92 87.72 90.20 84.21
Recall 93.88 94.04 94.83 93
F1 score 92.93% 92.59% 92.93% 89.72%
Fig. 2 Shows the results 90.00%

with 13 attributes 85.00%
80.00% Accuracy
75.00% Precision
70.00% Recall
F1 score
Fig. 3 Shows the results 100.00%

with selected attributes 95.00% Accuracy
90.00%
85.00% Precision
80.00% Recall
75.00%
EKNN KNN SVM Decision F1 score
Tree
Fig. 4 Shows the accuracy 95.00%

of all algorithms
90.00%
Accuracy
85.00% value with 13
aributes
80.00%
75.00%
Accuracy
70.00% value with
Selected
aributes
Table 5 Comparison of
Algorithm Accuracy value with
accuracy according to the
number of attributes used 13 attributes (%) Selected attributes (%)
EKNN 89.1 92.31
KNN 86 91.21
SVM 87 92
Decision tree 79 87.91
6 Conclusion
The Chi-squared test was used as a feature selection method. This helps in identifying
the suitable attributes for this study. In this paper, we used E-KNN, KNN, SVM, and
Decision Tree algorithms. The overall objective of this project was to predict more
accurately the presence of heart disease. The performance of four data mining classi-
cation techniques, namely, Extended KNN (E-KNN), K-Nearest Neighbor (KNN),
Support Vector Machine (SVM), and Decision tree algorithm (CART) compared.
The performances of the models were evaluated using the standard metrics of accu-
racy, precision recall, and F1-score. There is also a decrease in the misclassication
rate in E-KNN when compared to KNN.
The overall work showed that E-KNN predicts heart disease more accurately
compared to base classiers. Finally, it is concluded that the algorithms efciently
predict heart disease with less number of attributes.
Acknowledgements Authors would like to express gratitude to Vasavi College of Engineering (A),
Hyderabad for their constant supervision as well as for providing necessary information regarding
this research and also their support in completing this endeavor.
References
1. Sateesh Kumar, R., Thomas, A.: Heart disease prediction using ensemble learning method. Int.
J. Recent Technol. Eng. (IJRTE) 9(1) (2020) ISSN: 2277-3878
2. Jabbar, M.A., Deekshatulu, B.L., Chandra, P.: Classication of heart disease using K-Nearest
Neighbor and genetic algorithm. Procedia Technol. 10, 8594 (2013)
3. Kalaiselvi, C.: Diagnosing of heart diseases using average k-nearest neighbor algorithm of data
mining. In: 3rd International Conference on Computing for Sustainable Global Development
(INDIACom), New Delhi, pp. 30993103 (2016).
Prediction Analysis of Diabetes Using
Machine Learning
Srikanth Bethu, G. Charles Babu, B. Sankara Babu, and V. Anusha
Abstract Prescient frameworks are the frameworks that are wont to foresee some
result based on some example, acknowledgment. Diabetes illness discovery is that
the technique by which a patient’s determination is performed based on indica-
tions examined, which may cause trouble while foreseeing infection influence. For
instance, fever itself could be a manifestation of the numerous scatters that do not
tell the human services proficient what precisely the sickness is. Since the outcomes
or feelings fluctuate from one doctor to an alternate, there is a necessity to help a
restorative doctor, which will have comparative assessment positively side effects
and clutters. It may finish by breaking down the data created by medicinal infor-
mation or therapeutic records. In this way, applying the AI calculations to foresee
diabetes ought to be completed.
1 Introduction
The human body needs significance for approval. The sugars are separated into
glucose, which is the significant centrality hotspot for human body cells. Insulin
is dependent upon to convey the glucose into body cells—the blood glucose given
insulin and glucagon hormones made by the pancreas. Insulin hormones produced
by the beta cells of the islets of Langerhans and glucagon hormones are passed on by
the alpha cells of the islands of Langerhans in the pancreas. Exactly when the blood
glucose grows, beta cells are invigorated, and insulin given to the blood. Insulin
empowers blood glucose to get into the cells, and this glucose utilized for vitality. In
this way, blood glucose kept in a tight range.
Inherent Diabetes [1] happens in humans because of the natural flaws of insulin
release, cystic fibrosis-related Diabetes, and large fragments of glucocorticoids brief
S. Bethu (B) · B. Sankara Babu · V. Anusha

Department of Computer Science and Engineering, GRIET, Hyderabad 500090, India
G. Charles Babu
Department of Computer Science and Engineering, MREC, Hyderabad 500100, India
https://doi.org/10.1007/978-981-16-1502-3_57
574 S. Bethu et al.
steroid diabetes. As a result, concerning the human, our bodies glitch as indicated
by produce insulin and requires the person between an impersonation of supplement
insulin and raise an insulin siphon [2, 3]. This class is once recently shown as much
permanency “Insulin-Dependent Diabetes Mellitus.” The second classification about
DM is perceived to be specific “Type II DM” along these lines a result as respects
insulin encounter, a circumstance of any cells are ineffectual of agreement with
endeavor insulin properly, incidentally combined all in all with an outright insulin
deficiency. At last, “gestational diabetes” happens when considered ladies without
a before. The prior finding of Diabetes, the danger of the intricacies can be evaded.
Diabetic patients endure different infections, and it influences different pieces of
various organs. Subsequently, successful measures must be taken to anticipate the
sickness at the most punctual and control.
These days data mining [2] devices and methods are generally utilized in pretty
much every field like social insurance frameworks, promoting, climate determining,
E-business, retails, and so on. The medicinal services system is one of the new
developing exploration territories where information mining methods and appara-
tuses can be adequately connected. Our therapeutic services frameworks are wealthy
in data. However, they are deficient in learning, so there is a considerable need for
having strategies and devices for removing the data from the sizeable informational
collection with the goal that restorative analysis should be possible.
Numerous natural frameworks [4] are on a fundamental level nonlinear, and their
parameters restrictively reliant. Various necessary physical structures are straight,
and their settings are free. Achievement in AI is not ensured continuously. Similarly,
as with any strategy, an excellent comprehension of the issue, and a valuation for the
confinements of the information are significant. On the off chance that an AI exam-
ination appropriately planned, the students effectively actualized and the outcomes
vigorously approved, at that point, one more often than not, has a decent possibility
at progress. Whether the information is of low quality, the outcome will be of low
quality (trash in = trash out).
2 Literature Survey
Evaluation of Glycaemic Control, Glucose Variability and Hypoglycaemia on Long-

Term Continuous Subcutaneous Infusion vs. Multiple Daily Injections: Observa-
tional Study in Pregnancies With Pre-Existing Type 1 Diabetes, Aleksandra Jotic,
Diabetes Therapy, 11, pages 845–858 (2020)—This paper clarifies the assessment
of the adequacy of long haul persistent subcutaneous insulin imbuement (CSII)
contrasted and numerous everyday insulin (MDI) infusions for glycaemic control
and fluctuation, hypoglycaemic scenes and maternal/neonatal results in pregnant
ladies with previous sort 1 diabetes (pT1D).
Impact of Simultaneous Versus Sequential Initiation of Basal Insulin and
Glucagon-like Peptide-1 Receptor Agonists on HbA1c in Type 2 Diabetes: A Retro-
spective Observational Study, Vivian Fonseca, Diabetes Therapy, 11, pages 995–1005
Prediction Analysis of Diabetes Using Machine Learning 575
(2020)—This paper determines When and how to strengthen treatment in patients

with type 2 diabetes (T2D) not accomplishing glycated hemoglobin (HbA1c) focuses
with oral antidiabetic drugs (OADs) in clinical practice stays a matter of clinical
inclination. This pilot study was directed utilizing the review observational informa-
tion from such patients to assess the effect on HbA1c of three treatment groupings:
synchronous inception of basal insulin (BI) and a glucagonlike peptide-1 receptor
agonist (GLP-1 RA; Cohort 1); BI followed by GLP-1 RA commencement inside a
90-day time span (Cohort 2); or BI followed by GLP-1 RA inception past 90 days
(Cohort 3).
Foresee The beginning of Diabetes Disease Using Artificial Neural Network
(ANN) by Manaswini Pradhan, Dr. Ranjit Kumar Sahu—This paper speaks to 8.8%
of the absolute ladies grown-up populace of the 18 years old or more in 2003, and this
is almost a two overlap increment from 1995 (4.7%). Ladies of minority racial and
ethnic gatherings have the most noteworthy predominance rates with two to multiple
times the prices of the white populace. With the expanded development of minority
populaces, the number of ladies in these gatherings who are analyzed will increment
essentially in the coming years.
(2018) Prediction of diabetes using classification algorithms. Procedia computer
science, by Deepti Sisodia and Dilip Singh Sisodia—This investigation work bases
on pregnant women encountering diabetes. In this work, Naive Bayes, SVM, and
Decision Tree AI request counts are used and surveyed on the PIDD dataset to find
the figure of diabetes in a patient. The preliminary execution of all three estimations
is pondered on various measures and achieved extraordinary precision.
In this work, WEKA gadget is used for playing out the preliminary. The principal
purpose of this examination is the desire for the patient impacted by diabetes using
the WEKA mechanical assembly by using the therapeutic database PIDD.
(2019) Comprehensive Review of Artificial Neural Network Applications to
Pattern Recognition—The assessment outfits per users with an all the more precise
understanding of the current and new example in ANN models that effectively
addresses Pattern Recognition troubles to investigate focus and subjects. Likewise,
the sweeping review reveals the different zones of the achievement of ANN models
and their application to PR. In this paper, we have used ANN models to generate
results and compared the remaining Machine Learning algorithms with it.
3 Methodology
3.1 Proposed Method
In this paper, we talked about how the Artificial Intelligence [5] method helps foresee
diabetes and its significance in social insurance applications. Proposed a human
services framework utilizing brilliant dress for maintainable wellbeing checking [6].
I had altogether examined the various structures. I accomplished the best outcomes
576 S. Bethu et al.
for cost minimization on tree and primary way cases for different frameworks. Here
we use utilize A.I. methodologies to recognize the prevalent parts causing diabetes in
individuals. In the beginning, factors that are accepted to be colossal like age, B.M.I.,
High Cholesterol, Hyperthyroid, Hypertension, Age, and Skin Thickness are consid-
ered. Among these, the most basic ones provoking diabetes are perceived. Charac-
teristics of each essential factor are analyzed in diabetic and non-diabetic individuals
provoking learning disclosure of particularly essential explanations behind diabetes
with everything taken into account. The entire educational gathering is moreover
subject to portrayal using four A.I. computations [7], and a close examination of the
strategies is similarly grasped.
3.2 Algorithms
In Supervised learning, the structure must “adjust” inductively a limit called target
work, which is an outpouring of a model depicting the data. The objective limit
used to envision the estimation of a variable [8], called a subordinate variable or
yield variable, from a lot of elements, called self-sufficient parts or information
components or characteristics or features.
The Modules are divided based on various steps involved in the determination of
best algorithms are Feature Selection and Performance Evaluation.
(a) Feature Selection [9]: AI AI and measurements, include choice, otherwise
called variable determination, trait choice, is the procedure of choosing a subset
of applicable highlights for use in model development. There are numerous
strategies for highlight determination; we are utilizing univariate include choice
technique in this structure. There are two various primary methodologies in
the component determination process.
The first is to make an independent appraisal, given general qualities of infor-
mation. Strategies have a place with this methodology called channel tech-
niques because the list of capabilities is sifted through before model develop-
ment. The last calculation will be utilized at last to construct a prescient model.
Strategies in this class are called wrapper techniques, which wraps the entire
element determination process.
(b) Performance Evaluation [10]: Exhibitions of all classifiers are assessed by
various estimation factors as precision (ACC), affectability (SE), particularity
(SP), positive prescient worth (PPV), negative prescient worth (NPV), and so
forth. These estimation variables are determined by utilizing genuine positive
(TP), genuine negative (TN), false positive (FP), and false negative (FN).
Accuracy, it is the extent of the entirety of the genuine positive and genuine
negative against absolute number of populace. It very well may be communicated
numerically as pursues:

TP + TN
ACC(% ) = ∗ 100 (1)
TP + FN + FP + TN
Sensitivity, it is the extent of the positive condition against the anticipated

condition is sure. It very well may be communicated scientifically as pursues

TP
SE(% ) = ∗ 100 (2)
TP + FN
Specificity, it is the extent of the negative condition against the anticipated

condition is negative. It tends to be communicated numerically as pursues

FP
SP(% ) = ∗ 100 (3)
FP + TN
Positive prescient worth, the positive prescient worth is the extent of the antici-
pated positive condition against the genuine condition is sure. It very well may be
communicated scientifically as pursues

TP
PPV(% ) = ∗ 100 (4)
TP + FP
Negative prescient worth, it is the extent of the anticipated negative condi-

tion against the genuine condition is negative. It very well may be communicated
mathematically as pursues

TN
NPV(% ) = ∗ 100 (5)
FN + TN
Genuine constructive (TP): Those Sick individuals who are accurately analyzed
as debilitated. False constructive (FP): The Healthy individuals who are mistakenly
recognized as debilitated. Genuine adverse (TN): The Healthy individuals who are
accurately recognized as sound. False pessimistic (FN): The Sick individuals who
are inaccurately distinguished as solid.
4 Implementation
4.1 Technologies Used
Operating System was Windows, Technology was Python, Libraries are pandas,
numpy IDE was Jupyter notebook, Google Colobaratory are used for experimental
environmental setup.
578 S. Bethu et al.
Fig. 1 Functional diagram
In Fig. 1, supervised machine learning algorithms like KNN, Logistic regres-

sion, SVM and ANN are compared to identify classification and feature selection.
Figure 1 also shows the functional process of results prediction using machine
learning algorithms.
4.2 Logistic Regression
Logistic Regression [11] is another methodology gotten by AI from the field of bits
of knowledge. It is the go-to methodology for the twofold request (issues with two
class regards). The determined limit, in like manner called the sigmoid limit, was
made by examiners to depict properties of people improvement in nature, rising
quickly and augmenting at the passing on the point of confinement of the earth. It’s
an S-encircled bend that can take any affirmed respected number and guide it into
an inspiration some spot in the extent of 0 and 1, at any rate never precisely at those
cutoff centers.

1 b0+b1∗x
X= Y = e 1+ebo+b1∗x (6)
1 + e−VALUE
From Eq. (6) Calculated relapse utilizes a condition as the portrayal, particularly
like straight relapse. Information esteems (x) are joined directly utilizing loads or
coefficient esteems to anticipate a yield esteem (y). Where y is the predicted yield,
b0 is the propensity or catch term and b1 is the coefficient for the single information
respect (x). Each fragment in your information has a related b coefficient that must
be grabbed from your arranging information. The veritable delineation of the model
that you would store in memory or in a record is the coefficients in the condition.
4.3 Support Vector Machine
In SVM [12], we take the yield of the straight capacity, and if that yield is more
noteworthy than 1, we distinguish it with one class, and if the return is—1, we
recognize it with another type. Since the limit esteems are changed to 1 and—1 in
SVM, we acquire this fortification scope of values([−1, 1]), which goes about as
edge. In the SVM calculation in Eq. (7), we are hoping to amplify the edge between
the information focuses and the hyperplane. The misfortune work that boosts the
edge is pivot misfortune.

0
C(x, y, f (x)) = if y = f (x) ≥ 1 else
1 − y = f (x),
C(x, y, f (x)) = (1 − y ∗ f (x)) (7)
Pivot misfortune (work on left can be spoken to as a capacity on the right). The
expense is 0 if the anticipated worth and the genuine worth are of a similar sign.
In the event that they are not, we at that point figure the misfortune esteem. We
likewise include a regularization parameter for the cost capacity. The goal of the
regularization parameter is to adjust the edge augmentation and misfortune. In the
wake of including the regularization parameter, the cost capacities look as beneath
in Eq. (8).

n
minw τ w2 + (1 − Y iXi, w) (8)
i=1
Since we have the misfortune work, we take incomplete subsidiaries as for the
loads to discover the angles. Utilizing the slopes, we can refresh our loads in Eq. (9).
δ
λ|w|2 = 2λW k
δW k

δ 0
1 − Y iXi, W = if Y iXi, W ≥ 1 (9)
δW k 1 − Y i Xik
580 S. Bethu et al.
Table 1 sample data are used for prediction of accuracy scores and selecting the
best accurate model. We used Jupyter notebook to work on this dataset. We first go
with importing the necessary libraries and import our dataset to Jupyter notebook.
In the proposed system, we utilized machine calculations with Artificial Neural

Network, K-Nearest Neighbor, Support Vector Machine, and Logistic Regression
[8] for diabetes expectation. The analyses performed on the information dataset
(Diabetes Dataset) given the proposed method. From Table 2, it examined that Artifi-
cial Neural Network appears the greatest exactness. So the Artificial Neural Network
AI classifier can anticipate the odds of diabetes with more accuracy when contrasted
with other classifiers. Better test precision of 80.5% gotten alongside other measur-
able execution parameters for the Diabetes forecast model. Table 2 gives algorithm
results.
Figure 2, shows the variables spotting after applying the data measures on algo-
rithms. The main variables like Glucose, Insulin, BMI are considered to identify
sickness. The above plotting values are ranged from minimum rate 0% to maximum
rate 100%. Figure 2, also shows the outcome values as 0 to define mellitus in blue
color as negative and green color value as 1 as positive. The outcome values are used
to identify diabetes mellitus and insulin, so that risk factor is also identified for better
treatment. The graph is generated separately for all the modules Glucose, Insulin,
BMI. The individual comparison of all the results suggests the patient to identify
side effects and clutters in the body. Visualizing all attributes given as below.
6 Conclusion
The diabetes forecast framework was created utilizing four information mining
order demonstrating systems. These models are prepared and approved against a
test dataset. Every one of the four models can concentrate designs in light of the
anticipated states. The best model to foresee understanding with diabetes gives off
an impression of being ANN trailed by KNN and Logistic relapse. The following
restriction was that we did not straightforwardly gauge drug adherence. At last, our
information was, for the most part, dependent on patient data. Nonetheless, this inves-
tigation represents a potential utilization of the information mining strategy. In the
medicinal field, exactness in expectation of the ailments is the most significant factor.
In the examination of information mining systems, the ANN classifier gives 80% of
the most noteworthy exactness utilizing the Jupyter scratchpad instrument. Future
works may address crossover order models utilizing KNN with different methods of
AI.
Table 1 Data set design description using pandas
S. No. Pregnancies Glucose Blood pressure Skin thickness Insulin BMI Diabetes pedigree function Age Outcome
Count 767.000000 767.00000 767.000000 767.000000 767.000000 767.000000 767.000000 767.000000 767.000000
Mean 3.847458 121.598641 72.431749 29.113796 156.938543 32.443489 0.471742 33.203390 0.348110
Std 3.371117 30.359639 12.113731 8.547994 88.900636 6.882979 0.331524 11.721879 0.476682
Min 0.00000 44.00000 24.0000 7.0000 14.00000 18.20000 0.07800 21.0000 0.00000
25% 1.00000 99.50000 64.0000 25.00000 121.0000 27.50000 0.243500 24.0000 0.00000
Prediction Analysis of Diabetes Using Machine Learning
50% 3.00000 117.0000 72.0000 28.00000 130.827879 32.0000 0.371000 29.0000 0.00000
75% 6.00000 141.0000 80.0000 32.631285 206.846154 36.60000 0.626500 41.0000 1.00000
Max 17.000000 199.0000 122.0000 63.00000 846.0000 67.10000 2.242000 81.0000 1.00000
581
582 S. Bethu et al.
Table 2 Algorithm
S. No. Algorithm Accuracy
comparison based on given
data 1 ANN 80.519480
2 KNN 77.922077
3 Logistic regression 77.656384
4 SVM 64.767885
Fig. 2 Dataset attributes visualization

References
1. Osarech, A., Shadgar, B.: A computer-aided diagnosis system for breast cancer. Int. J. Comput.
Sci. Issues 8(2) (2011)
2. Krawczyk, B., Galar, M., Jelen, L., Herrera F.: Evolutionary undersampling boosting for imbal-
anced classification of breast cancer malignancy. Article in Appl. Soft Comput., Elsevier B.V.,
pp. 1–14 (2016)
3. Vijayan, V., Ravikumar, A.: Study of data mining algorithms for prediction and diagnosis of
diabetes Mellitus. Int. J. Comput. Appl. 95(17) (2014) (0975-8887)
4. Huang, J., Ling, C.X.: Using AUC and accuracy in evaluating learning algorithms. IEEE Trans.
Knowl. Data Eng. 17(3), 299–310 (2005)
5. Devi, M.R., Maria Shyla, J.: Analysis of various data mining techniques to predict diabetes
Mellitus. Int. J. Appl. Eng. Res. 11(1), 727–730 (2016)
6. Kaur, G., Chhabra, A.: Improved J48 classification algorithm for the prediction of diabetes.
Int. J. Comput. Appl. 98(22). (0975-8887) (2014)
7. Wang, H., Yoon, S.W.: Breast cancer prediction using data mining method. In: IEEE Conference
paper (2015)
8. Fonseca, V.: Impact of simultaneous versus sequential initiation of basal insulin and glucagon-
like peptide-1 receptor agonists on HbA1c in Type 2 diabetes: a retrospective observational
study. Diab. Ther. 11, 995–1005 (2020)
9. Pradhan, M., Sahu, R.K.: Foresee The beginning of Diabetes Disease Using Artificial Neural
Network (ANN) (2011)
10. Lakshmi, K.R., Premkumar, S.: Utilization of data mining techniques for prediction of diabetes
disease survivability. Int. J. Sci. Eng. Res. 4(6) (2013)
11. Wajid, S.K., Hussain, A., Huang, K., Bonilla, W.: Local energy-based shape histogram feature
extraction technique for breast cancer diagnosis (2015)
12. Bagdi, R., Patil, P.: Diagnosis of diabetes using OLAP and data mining integration. Int. J.
Comput. Sci. Commun. Netw. 2(3), 314–322.
Enhanced Goodput and Energy-Efficient
Geo-Opportunistic Routing Protocol
for Underwater Wireless Sensor
Networks
V. Baranidharan, B. Moulieshwaran, V. Karthik, R. Sanjay,

and V. Thangabalaji
Abstract The acoustic transmission in the aquatic environment is inherent for

communications in underwater wireless sensor networks (UWSN). These acoustic
waves based underwater wireless sensor networks are having many challenges due to
their large propagation delay, energy consumption is also comparitively high and the
available bandwidth is also very less. The major disadvantage of this UWSN is high
latency due to its channel impairments. In this paper, the geo-opportunistic routing
protocols are proposed for maximizing the goodput and to improve the residual
energy range. In these routing protocols, we proposed the new metric called EEFL
to ensure at least one forwarder of F i to receive the packets successfully without
loss. The proposed routing protocols formulates the OR problem based on the non-
linearization model. In order to solve these issues, we proposed a multi-step heuristic
algorithm that is implemented and composed in each and every node for calculating
the forwarding set determination and prioritization. The proposed routing protocols
are evaluated by analyzing its performance metrics and it shows that this proposed
scheme is outperforming than the existing geo-opportunistic routing protocols in
terms of energy and energy costs.
V. Baranidharan (B) · B. Moulieshwaran · V. Karthik · R. Sanjay · V. Thangabalaji

Department of Electronics and Communication Engineering, Bannari Amman Institute of
Technology, Sathy, India
B. Moulieshwaran
e-mail: moulieshwaran.ec18@bitsathy.ac.in
V. Karthik
e-mail: karthik.ec18@bitsathy.ac.in
R. Sanjay
e-mail: sanjayr.ec18@bitsathy.ac.in
V. Thangabalaji
e-mail: thangabalaji.ec18@bitsathy.ac.in
https://doi.org/10.1007/978-981-16-1502-3_58
586 V. Baranidharan et al.
1 Introduction
Underwater Wireless Sensor Networks are encompassing various number of appli-

cations are formed for long-term gradients obtained from the seawater or underwater
scenarios. There are a large number of sensornodes are employed over the oceanic
environments and terrestrial areas in the underwater scenario [1]. Knowledge should
be gathered from all the counterparts of the sensors, terrestrial networks (ie. Classical
Wireless sensor Networks), those sensor networks are cannot be directly used in the
field of Underwater acoustic environment based research because the transmission
media and the type of signals used are not supports in underwater environment. In
all other networks, there is more number of critical applications in different envi-
ronments such as pollution monitoring. Submarines detection, weather forecasting,
etc. the underwater channels are not reliable because of the path loss, noise, data rate
is very low, multipath and high probability for occurring the error in the received
signals [2].
A good, novel, and effective design of energy-efficient routing protocol will
enable the effective monitoring of the underwater environment and route the data
packets effectively in UWSN. Enhanced Goodput and Energy Efficient based Geo-
Opportunistic Routing protocol (UWWOR) is one of the promising approach to
provide eth reliable data communication to route the data packets in underwater
environments. These OR protocols select the suitable neighbors as forwarding sets
and enables them to route the packets to its neighbors. This will improve the one-hop
reliability by more than employing even a single node and this will be delivered the
data to the respective sink node in the monitoring stations. The major issues in this
OR protocols are,
1. Forwarding set selection—To choose the proper forwarding node from its
neighbor node based on its distance.
2. Relay Prioritization—Based on its distance, the next forwarder node has a high
prioritization in the forwarder set.
The performance of this proposes high delay and energy cost-sensitive OR routing
protocol to address these two issues. In this proposed work, the Geo-opportunistic
routing schemes are used to maximize the good-put of the effective data recieved
and it also satisfies the end to end latency related issues and its requirements for the
routing protocols [3, 4]. The number of deadlines in the deployed sensor nodes are
also minimized the energy consumption of sensor nodes. This modified UWOR is
focused on the delay and Energy cost in terms of energy consumption. EEFi metric
was introduced in this method. This metric will select the appropriate sensor node
in the data forwarder set to choose the best neighbors and it also ensures the packets
will be forwarded to at least one of its neighboring node. This routing protocol will
have proposed the heuristic routing algorithm to compose the forwarding of the set
neighbor effective nodes determination and data packet forwarding and assigning
the various prioritization. The results of the performance metrics are shows that this
proposed scheme outperforms more effective than the existing systems in terms of
the network good-put and energy costs.
Enhanced Goodput and Energy-Efficient Geo-Opportunistic Routing … 587
The research articles are organized as follows, Sect. 2 gives the details about the
UWSN routing protocols by reviewing the related papers. Next, in Sect. 3 explains the
mathematical modeling of the optimized objective function and the heuristic solution
of the correlated algorithms is discussed. The performance metrics are evaluated in
Sect. 4 and comparison with other existing routing protocols is discussed. The paper
is concluded with future scope in Sect. 5.
2 Related Work
There are many different routing algorithms and schemes are designed to deal with
the unique characteristics of the Underwater Wireless Sensor Networks including
very high propagation delay in the received signals, it has a very low data rate (up to
100 kHz), and high error probability. Some of the researches are discussed here,
VBF routing protocol was proposed from the geographic information based
routing approach for UWSN. It uses the geographic routing algorithm; this algo-
rithm will do not requires any type of the state information about all other deployed
sensors. This routing involves and allowed to deploy the very limited number of the
sensor nodes. This routing has more energy consumption of the sensor nodes for
transmission based on its geographic position [5]. In an energy-efficient layer-based
routing protocol [6, 7] is proposed to find the position of the relay and intermediate
nodes and this will also improve the transmission energy of the sensor network, the
maximum probability of effective and successful data transmission of information
packets, and it will improvise the energy consumption over the deployed region.
The relay nodes are used for the route the data packets from the source node to its
destination node deployed in the UWSN. The major disadvantages of this routing
protocol will increase the end-to-end delay.
The Depth Based Routing protocol (DBR) [8] is proposed to continuing the chal-
lenge in UWSN for obtaining the location information of underwater sensor nodes.
The DBR routing protocol is requiring only the local depth information of the sensor
nodes. This information can be easily obtained at the time of the localization process
(i.e. Beaconing). The sonobuoy is floated over the sea surface in the ocean. The sink
or monitoring stations are drifted over the surface of the underwater or oceanic envi-
ronments and the sender node (ie. The node in which the event occurs) will select the
next hop forwarder by using greedily method based on the lowest pressure among the
neighbors. The modified algorithm is beside the process of this modified algorithm is
to find and select the forwarding nodes in the UWSN. The IDBR algorithm proposed
can be easily computed and obtains the location information of the neighbors with
the calculated depth of the deployed sensors. The receiving node or sink or moni-
toring stations node are always a sonobuoy which is get drifted over the environment
surface, and after the calculation of depth, the sensor information is transmitted to a
sender node greedily to select the forwarder node by calculating the lowest pressure
values among the neighbors in the sensor networks. This proposed mechanism will
develop to predefined size of the data packet and redundancy or duplication of the
packets are also reduced in the underwater communications [9, 10].
In this paper, the author employs the pressure information from the deployed
sensors in order to develop the anycast data transmission based routing algorithm.
This algorithm is called as a Hydro cast routing algorithm [11]. This routing protocol
is based on the dead-end data recovery method which is widely used to enhance the
data packets delivery rate by avoiding the retransmissions of the data under the unre-
liable, complex, constraints over the underwater communication environments. Even
though, this routing protocol will get effects the coordination delay with end-to-end
latency. In this MPT (Multi-path Control Transmission) routing protocol scheme
which will combine all the power control strategies based on the multipath routing
protocols [12, 13]. The sensor nodes on the multi-path to its destination to adjust the
transmission power to adjust its transmission and reception power for data packets
aggregation in center nodes or sink. The major disadvantage of these routing proto-
cols is that having high end-to-end latency for the delay-sensitive applications. This
will focus to adjust its power in the transmission power in order to minimize the end
to end delay. This paper exploits the Geo-opportunistic routing for the UWSN for the
QoS provisioning because of its end-to-end reliability, delay and power consump-
tion constraints with Underwater wireless sensor networks. The routing optimization
problem is formulated which is changed into a multi-objective multi-constraint opti-
mization problem that is addressed in the EGOR. These protocols will consider the
coordination of the delay among the forwarder to reduce the end-to-end delay and
guaranteed the packet delivery ratio.
3 Geo-Opportunistic Routing Protocol Design
Consider the network model which consists of the various sensors consisted nodes
that are placed randomly over the entire deployment region of the underwater envi-
ronment. The sensor nodes are represented as S N = {S 1 , S 2 , …, S N } having the
N represents the total number of sensor node deployed in the underwater environ-
ments. Whenever the sensor nodes are receiving the data packets, it will compute the
forwarding the data packets to its sensor nodes and priority values of the relay nodes
F i = {fi1 ,fi2 , …, fijN }, where fij is always represents the data forwarder node of the
jth level of the highest priority. So, the Td is denoted the total time remaining before
the data packet deadline at the destination and the allowable time. (ie. The ratio of
data packets good-put is increased). This routing protocol is first used to determine
its relay priorities from the given set of forwarders. Here, a cluster-based forwarding
set selection algorithm is used to choose the best neighbor in its consideration set
[14, 15]. This will include an iterative prioritization scheme for priority-based data
transmission schemes. In this last step, the next hop sensor node data forwarding
set algorithm is always chosen with the best hop among the deployed various sensor
nodes in one-hop by hop reliability from these data aggregated clusters or centered
node from actual forwarding set for its neighboring nodes.
3.1 Packet Forwarding Prioritization
The geo-opportunistic routing protocol EELS (F i ) is defined as an objective function

of the relay prioritization F i value and adjacent sensor nodes prioritization values.
These relay priorities are maximizing this metric. The data forwarding set of sensor
nodes F i values are always given at the time of simulation, the terms of the perfor-
mance metric values are do not change among the candidate nodes [16, 17]. In order
to achieve the goal, the packet forwarding the priority, to maximize the Pdi → F i .
The metric values can be effectively simplified by ignoring the constant values in
the objective functions in terms of the error probability value occurences of the jth
forwarder relays as shown below,
⎛ ⎞
|F−1|
|F|

EELi = ⎝EELi + d(i, j) + (d(i, j)+) f k−1 ⎠ ∗ p[ f wd = f j ] (1)
j=0 j=0
According to the relay or sensor nodes priority, this algorithm is always possess
highly probability values for the p[fwd = f ] is always larger than the p[fwd =
f j j+1 . The EEFF of the higher order prioritized more suitable data forwarders node
which has a great impact value on EEL− (F i ). the higher relays or sensor nodes the
priority values should be assigned randomly or based on the distance between the
data forwarding nodes in which has the smaller value of the total energy cost and
time for consumed over the propagation delay to the pre-forwarder and the value the
EEL+ having the algorithms in the UWMGOR relay prioritization procedure.
3.2 Forwarding Set Determination Algorithm
The proposed routing protocols are optimized by the objective function problem, the
objective function is always maximized by the one-hop reliability. The forwarding
set can be improved for this routing protocol for this performance based on adding
the sensor nodes. This forwarding the data packets to its neighbor nodes through
the relay nodes to prevent the packet duplication. For finding the forwarding data
set, the optimization-based objective problem in a comprising of NP value variation
over the optimized objective problem. The clique and the most important problem
is the special case of the optimized problem in which EEFl of the sensor nodes and
the propagation delays. The distance value is determined to calculate the difference
between the two successive next hop forwarders or sensor nodes should be taken into
the close proximity values to avoid its excessive latencies coordination in the sensor
nodes. Therefore, the cluster heuristic algorithm is used to determine the forwarding
set for each sensor nodes is used. The algorithm 2 is used to expansion of C j which
will proceeds to no node left until the EELi (Success) will exceeds the dead line.
After this, the cluster is formed to next hop reliability is selected to the ith node.
4 Performance Metrics Evaluation of the Proposed Routing

Protocols
In this section, the performance metrics of this proposed novel routing schemes are
compared with the existing routing protocol for UWSN. The sensor is having the
hardware parameters both acoustic and RF modems. The transmission and reception
powers are initially given as 50 and 20 W. We apply and generate different topologies
and its average performance is analyzed by using NS2 simulator. For each run, select
N events to generate packet from the source nodes to its destination through eh
intermediate nodes. There are 100 sensor nodes are employed randomly over the
entire region. The deployment region is 5000 × 5000 m. The packet size is 32 Bytes
and its transmission range is 200 m. The most important performance metrics are
evaluated in this work.
In order to understand the more energy consumption of the geo-opportunistic
routing algorithm schemes of isolating the effects of the deadline constraints. In
order to evaluate our proposed algorithm, the performance metrics of these methods
are achieved by the other methods of some other existing routing protocols. The
proposed Geo-opportunistic Routing algorithm which is used to jointly considered
with deadline and delays produced during the propoagation of the transmitted or
the recieved signal for the various delay-sensitive of the UWSN applications. The
parameters are analyzed with the end-to-end latency value estimated of the pre-
processing as 0.95. In order to analyze the performance of the proposed algorithm
affects the behavior of the wireless sensor networks.
4.1 Network Goodput
Network Goodput is defined as the amount of useful data packets received by the
total packets transmitted across the networks. In this, proposed routing protocol
outperforms than the existing routing protocol is equal to 1.2 times than the existing
systems. This proposed routing protocol gives almost 80% than the existing routing
protocols of underwater wireless sensor networks. It also reduces the latency across
the networks reaching up to 3.2 times than the existing routing protocols. This is
because of the less propagation delay between the nodes and having good coordina-
tion among the sensor nodes. This is due to the proper choosing of the coordination
of the forwarding nodes and set of relay priorities over the existing routing protocols
which is depicted in Fig. 1. The existing protocols are applied to avoid retransmission.
latencies in the networks. In order to analyse the performance metrics of the existing
routing protocols systems, the various node densities in this proposed routing proto-
cols ability to scale the large-scale dimensions. The number of the sensor nodes from
the 600 to 2400. This improved routing protocol yields 50–68% having high good
put than the existing systems to improve the Geo-opportunistic routing to handle the
wireless communications.
Fig. 1 Network goodput given network density
4.2 Energy Consumption
The energy consumption is defined as the total energy consumed by the sensor
nodes over the entire network. There are N number of the sensor nodes are deployed
across the entire network. After varying the high-density networks into the low-
density network (i.e., the density of the network), we evaluate the performance of
the proposed routing protocols in both the small and large areas to maintain the
density of the nodes. By rapid increasing of the sensor node density values, this
will directly affect the number of nodes to forward the data packets from the source
node to its destination node based on the position inormation. As the number of
packets increase this will improve the consumption of the energy of each and every
sensor node. The transmission or communication range of the sensors will imply
the correlation between the number of hops and its distances of the sensor nodes.
After the initial high performance for very small regions, the performance results
will extend to wider the range and it will outperform than the existing schemes.
Figure 2 shows that the size of the packet increases it will be increasing the energy
consumption of the sensor nodes and it will decrease the effect of the data packets in
which it will reach the monitoring station or the sink before the deadline. The size
of the data packet is 64 bytes is every good option for successful data packets at the
sink.
Fig. 2 Energy cost given network density
5 Conclusion
The paper discusses the data transmission problem in the Underwater Wireless sensor
networks (UWSN): One in which the data packets is useful only as to arrives its desti-
nation or sink node before the expenditure allotted time. The energy expenditure is
a key factor of any network of the Underwater scenario so it will be often deployed
randomly in extremely harsh and highly dense underwater environments to access the
battery charges. The geo-opportunistic routing is used to select the packet forwarders
each sensor nodes with the neighbor’s nodes in a reliable manner in terms of the
energy cost and goodput. The performance metrics are analyzed with the existing
protocols in many scenarios. The results will show the results is outperforming than
the existing routing protocols. In this routing protocols, the time between the mainte-
nance and its simply increase the network lifetime. This proposed routing protocols
will improve the residual energy by letting them to progress for selecting the ore
sutiable forwarding path will be discarded that to reach the sink node. The simulated
results show that the proposed routing protocol will have energy-s decongest the
data packets would automatically increase the expectation of successful data packet
reception in a very dense environment of the underwater wireless sensor networks.
References
1. Jiang, M., Guo, Z., Hong, F., Ma, Y., Luo, H.: OceanSense: a practical wireless sensor
network on the surface of the sea. In: Proceedings IEEE International Conference on Pervasive
Computing and Communications (PerCom), pp. 1–5 (2019).
2. Noh, Y., Wang, P., Lee, U., Torres, D., Gerla, M.: DOTS: a propagation delay-aware oppor-
tunistic MAC protocol for underwater sensor networks. In: Proceedings 18th IEEE International
Conference on Network Protocols (ICNP), pp. 183–192 (2010).
3. Pompili, D., Melodia, T., Akyildiz, I.F.: Routing algorithms for delay-insensitive and delay-
sensitive applications in underwater sensor networks. In: Proceedings 12th ACM Annual Inter-
national Conference on Mobile Computing and Networking (MobiCom), 2006, pp. 298–309
(2006).
4. Hsu, C.-C., Lai, K.-F., Chou, C.-F., Lin, K. C.-J.: ST-MAC: spatialtemporal MAC scheduling
for underwater sensor networks. In: Proc. 28th IEEE International Conference on Computer
Communications (INFOCOM), April 2009, pp. 1827–1835 (2009).
5. Xie, P., Cui, J.-H., Lao, L.: VBF: vector-based forwarding protocol for underwater
sensor networks. In: Proceedings 5th International IFIP-TC6 Networking Conference
NETWORKING, 2006, pp. 1216–1221 (2006).
6. Hsu, C.-C., et al.: Delay-sensitive opportunistic routing for underwater sensor networks. IEEE
Sens. J. 15(11) (2015).
7. Gopi, S., Govindan, K., Chander, D., Desai, U.B., Merchant, S.N.: E-PULRP: energy optimized
path unaware layered routing protocol for underwater sensor networks. IEEE Trans. Wirel.
Commun. 9(11), 3391–3401 (2010)
8. Yan, H., Shi, Z.J., Cui, J.-H.: DBR: depth-based routing for underwater sensor networks.
In: Proceedings of the 7th International IFIP-TC6 Networking Conference Ad Hoc Sensor
Networks, Wireless Networks, Next Generation Internet (NETWORKING), 2008, pp. 72–86
(2008).
9. Yu, H., Yao, N., Gao, Z., Lu, Z., Chen, B.: Improved DBR routing protocol for underwater
acoustic sensor networks. Sens. Lett. 12(2), 230–235 (2014)
10. Coutinho, R.W.L., Boukerche, A., Loureiro, A.A.F.: PCR: A power control-based opportunistic
routing for underwater sensor networks. In: Proceedings of the 21st ACM International Confer-
ence on Modeling, Analysis and Simulation of Wireless and Mobile Systems, pp. 173–180
(2018).
11. Rahman, Z, Hashim, F, Rasid, M.F.A., Othman, M.: Totally opportunistic routing algorithm
(TORA) for underwater wireless sensor network. PLoS ONE 13(6) (2018).
12. Moradi, M., Rezazadeh, J., Ismail, A.S.: A reverse localization scheme for underwater acoustic
sensor networks. Sensors 12(4), 4352–4380 (2012)
13. Lee, S., Kim, K.: Localization with a mobile beacon in underwater acoustic sensor networks.
Sensors 12(5), 5486–5501 (2012)
14. Baranidharan, V., Sivaradje, G., Varadharajan, K.: Void node recovery based geographic-
opportunistic routing for underwater sensor networks. J. Adv. Res. Dyn. Control Syst. 5,
323–332 (2018)
15. Baranidharan V., Varadharajan, K.: Secure localization using coordinated gradient descent
technique for underwater wireless sensor networks. ICTACT J. Commun. Technol. 9(01),
1716–1720 (2018).
16. Baranidharan V., Sivaradje G., Varadharajan, K., Vignesh, S.: Clustered geographic-
opportunistic routing protocol for underwater wireless sensor networks. J. Appl. Res. Technol.
18, 62–68 (2020).
17. Shakeel, U., Jan, N., Khizar, Qasim, U., Khan, Z.A., Javaid, N.: DRADS: depth and reliability
aware delay sensitive routing protocol for underwater WSNs. 10th International Conference
on Innovative Mobile and Internet Services in Ubiquitous Computing, pp. 78–83 (2016).
Early Detection of Pneumonia from
Chest X-Ray Images Using Deep
Learning Approach
Prateek Sarangi, Pradosh Priyadarshan, Swagatika Mishra, Adyasha Rath,

and Ganapati Panda
Abstract With an objective to save the lives of children from pneumonia, many
efforts are being made by doctors and medical practitioners. Early detection and
subsequent appropriate care will reduce the number of deaths of the pneumonia
affected children. In recent past, machine learning and artificial intelligence-based
methods have been introduced for decision making in various applications including
health care. With this motivation, the research work in mind this paper has been car-
ried out, and an efficient deep learning model is developed for classification between
healthy and pneumonia patients. Using standard database comprising of chest x-ray
images, the proposed model is trained and tested. The validation results reveal that
the proposed model provides consistent performance in terms of classification accu-
racy. The analysis of the simulation-based results reveals that for a batch size of 16
and for two number of hidden layers in the classification stage of the CNN model
yields highest validation accuracy of 93.73%.
1 Introduction
The World Health Organization (WHO) has reported that pneumonia kills maxi-
mum number of children and elderly people across the globe. The fatality rate due
to pneumonia is nearly four millions. The pneumonia causes inflammation in lungs
which may lead to death, if the diagnosis is not done in time. Proper examination of
chest x-ray is an important diagnosis method which is being followed worldwide.
Detection of pneumonia by examination of chest x-ray is time consuming as well as
P. Sarangi (B) · P. Priyadarshan · S. Mishra

Veer Surendra Sai University of Technology, Burla, Odisha 768016, India
A. Rath
Department of Computer Science and Engineering, Siksha O Anusandhan (Deemed to be)
University, Bhubaneswar, Odisha 751030, India
G. Panda
Department of Electronics and Tele Communication, C. V. Raman Global University,
Bhubaneswar, Odisha 752054, India
https://doi.org/10.1007/978-981-16-1502-3_59
596 P. Sarangi et al.
less accurate. In addition, the analysis of x-ray images is a tedious and critical task.
To alleviate this problem, computer-based diagnosis tools have been developed to
analyze the chest x-ray images. But these tools are also not very effective as well
as less informative. In the recent past, many machine learning techniques have been
successfully applied for diagnosis of diseases and other healthcare problems. Appre-
ciable numbers of research articles have been reported on detection and diagnosis of
pneumonia using images of chest x-rays. Deep learning and convolution neural net-
work have emerged as promising methods for many engineering application, finance,
manufacturing and health care. Mostly, the deep learning approach is employed for
classification, forecasting and detection purpose. It is observed that many articles
have been reported in the literature on the diagnosis of pneumonia.
In the next section, a review of articles on machine learning-based pneumonia
detection is presented.
2 Review of Literature
A texture-based identification scheme of interstitial pneumonia from multi-detector

CT is presented in [1]. A KNN classifier is employed to identify normal, ground class
and reticular categories. It is reported that the proposed system can detect, charac-
terize and quantify interstitial diffuse parenchymal lung disease (DPLD). In [2], the
authors have proposed evolutionary fuzzy cognitive maps for forecasting of pneu-
monia infection. The proposed approach has provided better accuracy of prediction
of the infection using real-life patient data. For diagnosis of childhood pneumonia,
cough analysis has been reported [3] using wavelet-based features. The authors have
employed logistic regression classifier and have used Mel cepstral coefficients as
input to the classifier for clinical decision. The simulation performance using real-
life data is reported to be better than the WHO criteria. In another interesting paper
[4], the authors have suggested a deep learning approach for identification of pneu-
monia. The chest x-ray images are used in the Mask-RCNN model for obtaining
global and local features and subsequently identifying the pneumonia. Improved
identification performance is obtained by the method developed in the paper. The
ECG signal is used along with statistical evaluation of myocardial enzyme for treat-
ing pneumonia patients [5]. It is reported that abnormal changes in ECG show that
myocardium is affected after pneumonia. The detection of creatine kinase, isozyme
as well as troponin level in pneumonia patient shows high sensitivity and specificity.
A deep learning model has been developed in [6] which can screen the CT images of
COVID patients automatically. This model also classifies COVID, influenza-A viral
pneumonia (IAVP) or healthy cases. An overall accuracy of 86.7% has been achieved
by this model. For diagnosis of pediatric pneumonia, a deep residual network using
transfer learning method is suggested [7]. The proposed method is reported to iden-
tify the appropriate area of image which indicates the presence of pneumonia. The
test results using real-life datasets show higher accuracy and F1-score compared to
other reported articles. In [8], a multi-dilation CNN-based model is developed for
Early Detection of Pneumonia from Chest X-Ray Images … 597
the detection of pneumonia and COVID-19 using chest x-ray images. In this paper,
the authors have employed transferable multi-receptive approach for optimization of
the features. It is reported that the suggested approach provides satisfactory detec-
tion performance with high accuracy. The combined CNN and transfer learning are
used [9] for detection of pneumonia from chest x-ray images. Six different models
have been suggested by the authors. It is observed that model 2 and VGG 19 net-
works provide the best performance and hence can be used by medical practitioners.
Finally, in [10], a systematic review and analysis of detection of pneumonia from
chest x-ray images using deep learning-based approach is presented. The exploratory
meta-analysis shows that the deep learning approach can reliably classify pneumonia
as well as can distinguish between bacterial and viral pneumonia.
3 Research Gap, Motivation of Research, Research

Objective and Organization of the Paper
3.1 Research Gap
The review of related articles on prediction and diagnosis of pneumonia reveals

that many researchers across the globe are working on early detection and proper
diagnosis of pneumonia particularly from images obtained from chest x-ray. It is also
observed that many recent articles in this area employ deep learning and CNN-based
approaches for prediction of this disease. Even though many acceptable results have
been reported on the prediction of this disease, there is a further scope improvement in
improving the accuracy of classification between healthy as well as patients suffering
from pneumonia infections. Further, there is a need to suggest and validate a robust
CNN prediction model to provide reliable and robust performance of pneumonia
detection by varying the batch size at the input as well as varying the number of
hidden layers associated with the CNN.
3.2 Motivation of Research
Identifying the above-stated needs has motivated the authors to develop a well-
performing CNN-based classification model which would provide consistent and
reliable performance of detection of pneumonia. This model can be recommended
to be used for Web-based application which can be conveniently used by doctors for
prediction of pneumonia.
3.3 Research Objective
Based on the motivation of the research, the work of the proposed paper is carried
out to fulfill the following objectives:
• To identify and develop an appropriate CNN model which would provide consistent
detection performance.
• To train and validate the CNN model using standard datasets pertaining to chest
x-ray images from standard datasets.
• To use an augmentation method to scale all images to a standard size of 150*150
pixel values to be used in the CNN.
• To investigate on the effects of batch sizes as well as the number of hidden layers of
the CNN. So that a best possible CNN model can be chosen which would provide
the best validation accuracy.
• To outline the major contributions of the proposed deep learning-based detection
model of pneumonia from standard chest x-ray images.
3.4 Organization
Keeping the above-cited research objectives in view, the organization of paper pro-
ceeds as follows: In Sect. 4, the methods and materials related to the investigation
are presented. This section deals with the method employed for detection, details of
the dataset and the pre-processing of the data. In Sect. 5, the details of the develop-
ment of CNN model comprising of both training and validation are presented. This
section also outlines the details of the CNN model and the purpose of using different
layers. The details of the simulation-based experiments are explained in Sect. 6. This
section also presents the various experimental results obtained from the simulation
study using x-ray images of both healthy and pneumonia patients. In Sect. 7, the anal-
ysis of the results is presented and the contribution of the paper is outlined. Finally,
the conclusion of the paper is presented which includes the weakness of the work as
well as the scope of further extension of the current work.
4 Methods and Materials
4.1 Method Used
To develop and implement the proposed pneumonia detection model, the convolution
neural network has been chosen as the basic classification model. If the dataset is
either huge or comprises of signals and images, then CNN or deep learning-based
models are better candidate for classification and prediction purpose. It has been
reported that CNN-based technique has been successfully applied for classification
of skin cancer, hemorrhage identification, arrhythmia detection, diabetic retinopa-
thy and pulmonary tuberculosis. In the present case, an appropriate CNN model is
chosen for two primary purposes: features extraction through series of convolution
operations and classification by employing few layers of fully connected artificial
neural network.
4.2 Materials Used
The materials required in the present paper are the chest x-ray images comprising
of normal and pneumonia patients. These images are standards and have been taken
from Kaggle. The details of the data are: A total of 5856 x-ray images of anterior–
posterior chest have been taken from child patients between 1 and 5 years old. The
entire image data have been grouped into training and validation groups. Out of total
images, 3722 images have been used for training purpose and the remaining 2134
x-ray images have been employed for validation purpose. As an illustration, the chest
x-ray images of four normal children are displayed in Fig. 1. Figure 2 shows the chest
x-ray images of four pneumonia affected patients.
4.3 Pre-processing of the Data
The images have been scaled appropriately using data augmentation method. The
scaling has been carried out to bring all chest x-ray images to have equal sizes of
Fig. 1 X-ray chest images of four patients without pneumonia
Fig. 2 X-ray chest images of four patients with pneumonia

150*150. The standardized images have been enabled the training in a single model,
and hence the training process becomes faster. The image data of equal sizes are then
fed to the proposed CNN model for training and validation purposes.
5 Development of CNN Detection Model
The overall proposed architecture of the CNN detection model is presented in Fig. 3.
The CNN model essentially performs two key tasks: (i) extraction of features (ii)
classification or detection of disease. The raw equal-sized chest x-ray images are fed
to the CNN model. In the features extraction stage, each layer takes the output of
the preceding layer as its input. The output of one layer is passed as an input to the
succeeding layers. Such processing of image data in CNN is called sequential pro-
cessing. The architecture for the CNN model consists of convolution, max pooling
and then classification layer. The feature extractor contains 32 layers of Gaussian
filters each of size 3*3. It is then followed by max pooling block of size 2*2, con-
volution block of 32 layer of Gaussian filter of size 3*3, max pooling of size 2*2,
64 layers of Gaussian filter and finally the max pooling block of size 2*2. After the
feature extraction stage, the output is flattened to form a single layer. It is then fol-
lowed by a classification layer consisting of 64 densely connected hidden neurons.
A random dropping of 50% of the neurons is used to deal with regularization in
the classification layer. The ReLu activation function is used to generate the desired
output class. In the next section, the simulation-based experiments have been carried
out, and the classification results obtained are tabulated and analyzed.
Fig. 3 Architecture of CNN model used for detection of pneumonia of children

6 Simulation-Based Experiments
In this section, the block diagram of CNN model as shown in Fig. 3 is simulated.
The detailed architecture of the CNN detection model is dealt in Sect. 5. The chest
x-ray images obtained from the Kaggle pneumonia datasets are used as inputs to the
model after the images are scaled to the same size of 150*150. As discussed in the
material, Sect. 4.2, a total of 5856 chest x-ray images are available in the dataset out
of which 3722 number of images were used for training purpose. The remaining 2134
images were employed for the purpose of model validation. The training image sets
comprising of both normal and pneumonia patients are fed to the model sequentially
till the estimated class is achieved. The images are transformed into the desired
features after passing through series of convolution layers followed by max pooling
alternatively. The extracted and flatten features are passed through the classification
layers comprising of 64 numbers of densely connected hidden neurons. Adopting the
strategy of 50% dropouts and passing through ReLu activation function, the estimated
class of each child is obtained. As mentioned earlier, the output is divided into two
classes as healthy and having pneumonia disease. During the training phase, the
accuracy of classification is evaluated with variation in number of epochs. RSMProp
weight optimization is used in the model. The corresponding plot obtained from the
simulation is plotted in Fig. 4. In the similar way, the loss function at the output during
training phase is determined by varying the number of epochs. The corresponding
plot is displayed in Fig. 5.
The performance of the model is also evaluated during testing or validation phase.
In the present case, 2134 chest x-ray images have been used as input to the model
Fig. 4 Plot of accuracy achieved by the CNN model during training phase
Fig. 5 Plot of model loss obtained during training phase
Table 1 Effect of batch size on the accuracy of classification during training and validation phase
Batch size Training accuracy Validation accuracy
4 93.72 89.47
8 94.22 91.64
16 95.31 93.73
32 91.75 87.21
Table 2 Effect of the number of neurons in the hidden layer of the classification stage on the
accuracy of classification
Number of hidden layers Training accuracy Validation accuracy
1 92.41 90.42
2 95.31 93.73
3 91.75 86.56
4 88.27 84.72
to find its output class. The validation accuracy as well as the training accuracy has
been found for different batch sizes varying from 4 to 32. The accuracy performance
in percentage both during training and validation periods are presented in Table 1.
In addition, the numbers of hidden layers of the classification stage of the model
have been varied from 1 to 4. In each case, the training and validation accuracy of
classification is determined and listed in Table 2.
7 Analysis of the Results
It is observed from the plot of Fig. 4 that at around 35 epochs the accuracy obtained
during training phase almost remains constant for input batch size of 16. The train-
ing accuracy at this stage is 95.31%. However, it is observed from Table 1 that the
classification accuracy is lowest for batch size of 32. So in terms of percentage of
accuracy, the batch sizes are 16, 8, 4 and 32, respectively. Similar observation is also
made in case of validation accuracy. In other words, batch size of 16 yields highest
accuracy of 93.73%. It is then followed by batch sizes of 8, 4 and 32. It is, in general,
observed that the relation between training and validation accuracy with the number
of batch sizes is consistent. Another interesting observation is that the validation
accuracy for each batch size is less than training accuracy.
This is because the number of input test patterns used in the study is less. This
difference can be reduced if the number of training input images is increased. Fur-
ther, k-validation scheme can be adopted to assess the robustness of the proposed
CNN model. It is observed from Table 2 that when the number of hidden layers is
two then both the training and validation classification accuracy are the highest. The
corresponding percentages of accuracy are 95.31 and 93.73%. In this case also the
validation accuracy is lower than the training accuracy. To find the consistent per-
formance of the proposed model, testing can be made using other similar standard
datasets. In general, it is found that the highest validation accuracy from the proposed
CNN model is 93.73% achieved for a batch size of 16. Similarly, when the number
of hidden layers is two, the validation accuracy is found to be the highest. Since the
validation accuracy is high, the model is not overfitted.
8 Conclusions
This paper has investigated on the development of a CNN-based model for detection
of pneumonia using chest x-ray images of healthy and pneumonia affected children.
The paper has employed standard chest x-ray images of children belonging to age
group 1–5 years old comprising of healthy and diseased children. After successful
training of the proposed model, the validation of the model has been carried out
using test images. The effects of both batch size and number of hidden layers on the
accuracy of classification have been investigated. It is demonstrated that with two
hidden layers the validation accuracy is the highest (93.73%). Also, it is observed
that the developed model offers the same highest validation accuracy when the batch
size is 16. The robustness of this model can be determined by evaluating the per-
formance of the model using other datasets as well as larger datasets. In this paper,
the classification stage comprises of artificial neural networks. The performance of
the model can also be determined by using LSTM or other classification techniques
combined with convolution layers and the accuracy of classification can be obtained
and compared.
References
1. Korfiatis, P.D., Karahaliou, A.N., Kazantzi, A.D., Kalogeropoulou, C., Costaridou, L.I.:
Texture-based identification and characterization of interstitial pneumonia patterns in lung
multidetector CT. IEEE Trans. Inf. Technol. Biomed. 14(3), 675–680 (2009)
2. Papageorgiou, E.I., Froelich, W.: Application of evolutionary fuzzy cognitive maps for predic-
tion of pulmonary infections. IEEE Trans. Inf. Technol. Biomed. 16(1), 143–149 (2011)
3. Kosasih, K., Abeyratne, U.R., Swarnkar, V., Triasih, R.: Wavelet augmented cough analysis for
rapid childhood pneumonia diagnosis. IEEE Trans. Biomed. Eng. 62(4), 1185–1194 (2014)
4. Jaiswal, A.K., Tiwari, P., Kumar, S., Gupta, D., Khanna, A., Rodrigues, J.J.: Identifying pneu-
monia in chest X-rays: a deep learning approach. Measurement 145, 511–518 (2019)
5. Li, Z., Li, X., Zhu, Z., Zeng, S., Wang, Y., Wang, Y., Li, A.: Signal analysis of electrocardiogram
and statistical evaluation of myocardial enzyme in the diagnosis and treatment of patients with
pneumonia. IEEE Access 7, 113751–113759 (2019)
6. Xu, X., Jiang, X., Ma, C., Du, P., Li, X., Lv, S., Yu, L., Ni, Q., Chen, Y., Su, J., Lang, G.: A deep
learning system to screen novel corona virus disease 2019 pneumonia. Engineering (2020)
7. Liang, G., Zheng, L.: A transfer learning method with deep residual network for pediatric
pneumonia diagnosis. Comput. Methods Progr. Biomed. 187, 104964 (2020)
8. Mahmud, T., Rahman, M.A., Fattah, S.A.: CovXNet: A multi-dilation convolutional neural
network for automatic COVID-19 and other pneumonia detection from chest X-ray images
with transferable multi-receptive feature optimization. Comput. Biol. Med. 122, 103869 (2020)
9. Jain, R., Nagrath, P., Kataria, G., Kaushik, V.S., Hemanth, D.J.: Pneumonia detection in chest
X-ray images using convolutional neural networks and transfer learning. Measurement 165,
108046 (2020)
10. Li, Y., Zhang, Z., Dai, C., Dong, Q., Badrigilan, S.: Accuracy of deep learning for automated
detection of pneumonia using chest X-Ray images: a systematic review and meta-analysis.
Comput. Biol. Med. 123, 103898 (2020)
Detection of Network Anomaly
Sequences Using Deep Recurrent Neural
Networks
R. Ravinder Reddy, K. Ayyappa Reddy, C. Madan Kumar, and Y. Ramadevi
Abstract The enormous growth of the Internet and its usage creates many vulnera-
bilities, so network anomaly detection becomes a crucial problem these days. With
this tremendous growth of the internet applications makes the security is a top priority
for everyone. An attack might cause loss of valuable information/assets to any indi-
vidual or the organization, attacker may be insider or outsider of the organization. The
challenging part is to identify the attack real-time and act accordingly to prevent the
losses, either in the form of data or money. In the early age of the network intrusion
detection systems (NIDS) statistical and data mining techniques are used to detect
the intrusions. These techniques have the limitations, these approach can’t perform
well with the huge data. Deep learning approaches performance increases with the
data size. These techniques can predict the occurrence of the attack more accurately.
With the availability of huge processing capability and enormous network data deep
learning algorithms are become more flexible in detection of these anomalies accu-
rately. In this work, the recurrent neural network algorithm and its variants are used
to detect the network anomalies.
1 Introduction
The network anomaly detection frequently change their pattern and more dynamic in
nature, the attacker always changes pattern every time prior to attack. The dynamic
nature of this behavior is difficult in the existing systems, like statistical and data
mining approaches. To capture these dynamics of the anomaly more number of
R. Ravinder Reddy (B) · K. Ayyappa Reddy · Y. Ramadevi

Chaitanya Bharathi Institute of Technology, Hyderabad, India
e-mail: rravinderredddy_cse@cbit.ac.in
Y. Ramadevi
e-mail: yrd@cbit.ac.in
C. Madan Kumar
KITSW, Warangal, India
https://doi.org/10.1007/978-981-16-1502-3_60
606 R. Ravinder Reddy et al.
combinations have to be identified in the system with the available data. The deep
learning approaches with the increased number of hidden layers can identify these
patterns in more promptly in the system environment. With the deep learning appli-
cations, network anomaly detection approaches become an effective among the other
intrusion detection systems. It searches for a specific pattern of anomaly, and that
pattern does not match the other profiles. As of now, because of the tremendous devel-
opment in PC systems and applications, numerous difficulties emerge for digital secu-
rity research. Assaults can be characterized as a lot of occasions which can bargain
the standards of PC frameworks, trading off the accessibility, authority, secrecy, and
trustworthiness of the framework in any way. The firewalls are utilized to recog-
nize the principal level of assaults just, these frameworks can’t identify present-day
assault situations and can’t examine arrange parcels inside and out. To safeguard
these assaults we required a powerful framework which will shield the framework
from the assaults. On account of these reasons, IDSs are created to accomplish high
insurance for the security foundation. Interruption recognition frameworks are the
guard dogs of data frameworks [1]. IDSs are frameworks planned and modified to
mechanize the way toward observing occasions occurring in a PC framework or
arrange and examining them for potential security issues.
Network Intrusion Detection System (NIDS) frameworks become hot examina-
tion issues. As system practices and examples change and interruptions advance,
it has especially gotten important to move away from static and one-time datasets
toward all the more powerfully created datasets which not just mirror the traffic
arrangements and interruptions of that time, but at the same time are modifiable,
extensible, and reproducible. Preparation of such suitable data many network moni-
toring labs has released different datasets which contain the required information
about the attacks. Captured Raw data of the network contains few attributes only.
Most of the data is available in the hexa-decimal format only. Retrieving the features
from the raw network is difficult. Some of the labs have simulated the networks and
generated the dataset for intrusion detection. Some of the datasets like NSL-KDD,
UNSW_NB15, and ISCX contain information about different patterns of different
attacks. The KDDCUP99 dataset is so famous but it is the old dataset as compared
with ISCX and UNSB. In this work, we mainly focused on training Deep Learning
Models like LSTM, RNN, GRU, and FNN with UNSW_NB15 dataset to classify
the network data by analyzing different patterns in it as normal and anomaly [2].
One of the primary issues is the plenitude of information in contemporary cyber-
security datasets which requires insightful calculations, for example, Deep Learning
calculations, for removing important data [2]. In particular, its application to IDS
includes the requirement for a high measure of highlights with the target to choose
the best approach and identify the chance of an assault. The issue is significant, in
light of the fact that a high number of qualities in a dataset lead to a model over
fitting, thus transforming into helpless outcomes on the approval datasets. In this
paper, we are going to utilize a benchmark dataset UNSW_NB15 which is created
by Australian Center for Cyber Security (ACCS) utilizing IXIA Perfect Storm device
in their Cyber Range Lab.
Detection of Network Anomaly Sequences Using Deep Recurrent … 607
The KDD98, KDDCUP99, and NSL-KDD were benchmark datasets created and
utilized 20 years back; be that as it may, late investigations have demonstrated that
these datasets have matured, implying that these datasets no longer comprehensively
reflect cutting edge organize traffic, henceforth this work utilizes UNSW-NB15 [3].
This dataset comprises 49 segments including the normal and the assault class.
It comprises of the 9 assaults, to be specific, Fuzzers, Analysis, Backdoors, DoS,
Exploits, Generic, Reconnaissance, Shell code, and Worms.
This work mostly centers on preparing the Deep Learning models like LSTM,
RNN, GRU [4] with the UNSW_NB15 Dataset. The Dataset comes in two sets
preparing and testing. The preparation comprises of 175,341 records and the testing
comprises of 82,332 records. A definite exploratory examination is done on the
dataset utilizing T-SNE (t-disseminated Stochastic Neighbor Embedding) which
shows the conveyance of assaults in two-dimensional planes.
2 Related Work
In the literature of the network anomaly detection, most of the works are done based
on the signature-based approaches. Many of the researchers proposed statistical
approaches in the initial days of the intrusion detection techniques. But later on
with the machine learning and data mining approaches used to build the dynamic
approaches like anomaly detection for adaptive models [5]. Later on, many of the
techniques are used in this field, but significantly artificial neural networks show
considerable improvement in the detection process. The success of deep learning
techniques in image processing and other applications, motivated us to apply this for
anomaly detection [6, 7].
With the huge success of artificial neural networks in different applications, it
is applied to computer security. The main focus on the detection of intrusions in
a network environment. The deep artificial neural networks are considered as an
efficient approach these days for pattern classification and prediction. The main issue
in these approaches are required high calculations and the long training cycles. But
with the revolution in the hardware technologies like GPU, TPU’s the artificial neural
become popular in almost all applications. With the availability of high computing
processing hardware given the scope for more research in the deep neural network
techniques. The use of artificial neural networks systems to the security is for the
most part centered around the discovery of interruptions in a system since neural
network systems are viewed as an effective way to deal with design arrangement.
The deep learning approaches are considerable good in network anomaly detection
process [8–10].
The deep learning techniques require huge amounts of data, which is available
from the public network. The nature of anomaly detection is dynamic, to extract
the appropriate patterns from the system require huge learning data and suitable
approach. The deep learning technique like recurrent neural networks works on the
sequences in the data. These sequences identifies the appropriate anomaly patterns
Fig. 1 Heat map of the UNSW_NB15 dataset
and shows significance growth in detection rate. The recurrent neural network is
used to represent the sequences in the communication entities and is used to identify
the anomalies [11]. The variant of recurrent neural network of Gated Recurrent Unit
Recurrent Neural Network (GRU-RNN) is used to detect the anomalies in software-
defined networking (SDN) [12]. Hybrid intrusions and their corresponding signature
are detected using the deep neural networks [13].deep learning approaches are used
for automatic intrusion detection, it is very important to outline the security feature of
the system [14]. Anomaly detection is common in cyberphysical systems, to detect
these anomalies also RNN is used [15]. The hierarchical approach of IDS is used in
the deep learning to detecting the anomalies in various levels of the detection process
[16], in the hierarchy processes convolution neural network is also used to detect the
anomalies [17].
The network intrusion detection problem existed from a long back, but there is no
standard dataset till now, because of the dynamic nature of the problem. In the litera-
ture of the NIDS, there are three different datasets are available for network anomaly
detection are KDDCUP99, ISCX, and UNSW. To train the model appropriate datasets
are required. Even though different cyber security proposals are depended on old open
datasets, their outcomes are not similar because of various causes: various calcula-
tions think about various highlights, usage of pre-shifting activity, and the utilization
of various parts among test and train dataset preparing informational collection. The
UNSW_NB15 Dataset is available in the split sets consisting of training and testing
records. The heat map of the Dataset is shown in Fig. 1 which shows the correlation
of the attributes which lead to detection of anomaly class.
3 Pre Processing
The existing anomaly detection datasets are using the different kinds of datasets,
in the early age of the intrusion detection systems have used the feature selection
approaches to identify the appropriate features for anomaly detection. In this work,
the correlation of the features identified and mapped with the heat map. To reduce
some dimensionality we adopted this approach in this work.
By observing the heat map in Fig. 1 we can see {sloss, sbytes}, {dloss, dbytes},
{is_ftp_login, ct_ftp_cmd} are correlated with each other. So removing any one of
the elements from one set will not affect the results. The following are the columns
that are affecting the label with positive correlation values (Table 1).
The exploratory analysis of the UNSW_NB15 is also done using the t-SNE by
projecting data onto the 2-D planes. Because of high dimensionality (41) of the
UNSW-NB15 dataset, picturing the information is troublesome undertaking. In this
manner, we utilize a method known as t-SNE (t-appropriated Stochastic Neighbor
Embedding) to extend the highlights to a lower dimensional space by limiting the
Kullback–Leibler uniqueness between the conveyance of higher dimensional high-
lights and circulation of lower dimensional anticipated highlights as appeared in
Fig. 2. T-SNE consequently endeavors to discover designs in the information by
recognizing groups dependent on closeness of information focuses with various high-
lights. The dataset contains the various kinds of values, all these are encoded and
scaled.
Table 1 Table showing the

Attribute name Correlation value
correlation values with the
label column sttl 0.692741
ct_state_ttl 0.577704
state 0.497685
ct_dst_sport_ltm 0.357213
rate 0.337979
ct_src_dport_ltm 0.305579
ct_dst_src_ltm 0.303855
ct_src_ltm 0.238225
ct_dst_ltm 0.229887
ct_srv_src 0.229044
ct_srv_dst 0.228046
Fig. 2 T-SNE plot of UNSW_NB15 dataset
4 Methodology
As the detection process of anomaly is novel and finding the zero- day attacks is
crucial with the increase of the network data. To detect these insight relations of the
data to detect these attacks require more complex models. The Deep Learning (DL)
models are designed using neural network architecture are more suitable to detect
these attacks. Deep neural networks perform effective results in anomaly detection.
The model will perform more combinations to find the anomaly patterns. Anomaly
is happened on the sequence of events, to detect these sequences recurrent networks
models are used. In the implementation process, we consider the recurrent neural
network and its variants, each variant of the model has shown improved performance.
In this work, we begin the implementation with the feed forward neural network and
compared with the RNN, LSTM, and GRU [13, 14]. The models were built and run
with the various parameters tuning. The implementation of the work is done in the
following steps.
A. Preprocessing the Dataset and converts the categorical data with Minmax scaler
and Label encoder.
B. Feed forward NN with 2 hidden layers.
C. Feed forward NN with 14 hidden layers.
D. Recurrent Neural Network (RNN).
E. Long Short Term Memory (LSTM).
F. Gated Recurrent Unit (GRU).
G. Compare the performance measures of these models along with the ROC plots.
A. Preprocessing the Dataset with Minmax scalar and Label encoder:

While processing the data in the neural network, first the data has to be trans-
formed properly. In the UNSB dataset contains some categorical data, it will
be transformed to numeric. The columns ‘label’ and ‘attack_cat’ are text labels
which consist of Normal/Anomaly and Type of the attack. They are converted to
integers using label encoder. The other columns whose ranges are varying from
other are normalized using the minmax scalar. Some columns which contains
missing values, which are replaced with ‘mean’ of the column value.
B. Training and Testing the Feed forward NN with 2 hidden layers:
Initial stage of the model for testing purpose, we build a normal Feed forward
neural network with 2 hidden layers each of 100 nodes is built. The activation
function ‘relu’ is used.
C. Training and Testing the Feed forward NN with 14 hidden layers:
Gradually we increase the model complexity further by adding the additional
layers. A normal Feed forward neural network with 14 hidden layers each of
100 nodes is built with ‘relu’ as activation function. It is trained with 175,341
samples and tested with 82,327 samples each of 43 columns for 50 epochs.
D. Training and Testing with RNN:
A Recurrent Neural network with 4 Simple RNN layers of 64 nodes each and
a dropout layer of 0.1 with the ‘Adam’ optimizer and ‘binary_crossentropy’ is
used as a loss function.
E. Training and testing with Long Short Term Memory (LSTM):
A LSTM Neural network with 4 Simple LSTM layers of 32 nodes each and a
dropout layer of 0.1 and ‘Adam’ optimizer is used and ‘binary_crossentropy’
is used as a loss function.
F. Training and Testing with Gated Recurrent Unit(GRU):
A GRU Neural network with 5 Simple GRU layers of 32 nodes each and a
dropout layer of 0.1 with ‘Adam’ optimizer is used and ‘binary_crossentropy’
is used as a loss function.
All these models are run with the UNSW_NB dataset, and it contains the 175,341
training samples and tested with 82,327 samples each of 43 columns. Each of the
model has run for 50 epochs.
After the pre-processing of the UNSW_NB15 dataset, it is given to the model to

verify the test and train accuracies along with the time consumed for each model.
The results are shown in Table 2, which shows the considerable increase in accuracy
of the models. These accuracies outperformed when it compared with NSL-KDD
dataset as shown in Table 3.
As we can see from Tables 3 and 4, that the Feed forward neural network with 14
hidden layers has the highest accuracy. Apart from the Feed forward neural networks
Table 2 AUC score and Accuracies of different models

S. No. Model name AUC score Accuracy Time to train (min)
1 Feedforward with 2 hidden 93.98 82.07 <3
layers
2 Feedforward with 14 hidden 97.75 87.62 <8
layers
3 RNN with 4 RNN layers 93.97 82.43 <10
4 LSTM with 4 LSTM layers 95.52 83.92 <15
5 GRU with 5 GRU layers 97.63 85.59 <10
Table 3 Comparing accuracies obtained with NSL-KDD & UNSW_NB15

S. No Model name Accuracy with NSL-KDD Accuracy With
UNSW_NB15
1 Feedforward with 2 hidden 74.97 82.07
layers
2 Feedforward with 14 hidden 78.29 87.62
layers
3 RNN with 4 RNN layers 75.62 82.43
4 LSTM with 4 LSTM layers 76.22 83.92
5 GRU with 5 GRU layers 78.93 85.59
the GRU stands in the next place. The roc graphs are plotted for all the models shown
in Figs. 3, 4, 5 and 6, the AUC score of GRU is the highest compared to the remaining
models. All the classification algorithms take AUC score as the main criteria i.e. to
reduce the false positive rates or increase the True positive rates so that obtained
results are reliable.
Fig. 3 ROC for NN

Fig. 4 ROC curve LSTM
Fig. 5 ROC for RNN
Fig. 6 ROC for GRU

In this work, The UNSW_NB15 dataset is used to train different Deep Learning
models to find the anomalous behavior in the network. Initially, the Exploratory data
analysis of the dataset inferred that the attacks have some patterns which resulted in
the formation of clusters in the t-SNE scatter plot. The observed patterns are trained to
the Deep Learning models so that any similar pattern observed is marked as Anomaly.
Concluding the work by saying that GRU got the Highest AUC score compared with
all the other models which are trained. The accuracy can be further increased by
using some feature selection and feature extraction methods with Regularization
methods. Different optimizers like SGD and RMSPROP can also be used to increase
the accuracy.
The future scope of the work is to extend the service to real-time network and
divert the anomaly traffic to the honey pots to ensure cyber security by using more
complex and well-trained networks with the real-time network traffic.
References
1. Larriva-Novo, X.A., et al.: Evaluation of cyber security data set characteristics for their appli-
cability to neural networks algorithms detecting cyber security anomalies. IEEE Access 8,
9005–9014 (2020)
2. Moustafa, N., Slay, J.: UNSW-NB15: a comprehensive data set for network intrusion detection
systems (UNSW-NB15 network data set). In: 2015 Military Communications and Information
Systems Conference (MilCIS). IEEE, 2015.
3. Bagui, S., et al.: Using machine learning techniques to identify rare cyber-attacks on the UNSW-
NB15 dataset. Securi. Priv. 2(6), e91 (2019)
4. Le, T.-T.-H., Kim, Y., Kim, H.: Network intrusion detection based on novel feature selection
model and various recurrent neural networks. Appl. Sci. 9(7), 1392 (2019)
5. Aydın, M.A.: Halim Zaim, A., Gökhan Ceylan, K.: A hybrid intrusion detection system design
for computer network security. Comput. Electr. Eng. 35(3), 517–526 (2009)
6. Fu, Y., et al.: An intelligent network attack detection method based on rnn. In: 2018 IEEE Third
International Conference on Data Science in Cyberspace (DSC). IEEE, 2018.
7. Ponkarthika, M., Saraswathy, V.R.: Network intrusion detection using deep neural networks.
Asian J. Sci. Technol. 2(2), 665–673 (2018)
8. Aldosari, M.S.: Unsupervised anomaly detection in sequences using long short term memory
recurrent neural networks. Diss, 2016.
9. Yin, C., et al.: A deep learning approach for intrusion detection using recurrent neural networks.
Ieee Access 5, 21954–21961 (2017)
10. Naseer, S., et al.: Enhanced network anomaly detection based on deep neural networks. IEEE
Access 6, 48231–48246 (2018)
11. Radford, B.J., et al.: Network traffic anomaly detection using recurrent neural networks. arXiv
preprint arXiv:1803.10769 (2018).
12. Tang, T.A., et al.: Deep recurrent neural network for intrusion detection in sdn-based networks.
In: 2018 4th IEEE Conference on Network Softwarization and Workshops (NetSoft). IEEE,
2018.
13. Kaur, S., Singh, M.: Hybrid intrusion detection and signature generation using deep recurrent
neural networks. Neural Comput. Appl. 1–19 (2019).
14. Elsherif, A.: Automatic intrusion detection system using deep recurrent neural network
paradigm (2018).
15. Goh, J., et al.: Anomaly detection in cyber physical systems using recurrent neural networks. In:
2017 IEEE 18th International Symposium on High Assurance Systems Engineering (HASE).
IEEE, 2017.
16. Wang, W., et al.: HAST-IDS: Learning hierarchical spatial-temporal features using deep neural
networks to improve intrusion detection. IEEE Access 6, 1792–1806 (2017).
17. Kwon, D., et al.: An empirical study on network anomaly detection using convolutional neural
networks. In: 2018 IEEE 38th International Conference on Distributed Computing Systems
(ICDCS). IEEE, 2018.
Driver Drowsiness Detection Using
Convolution Neural Networks
P. Ravi Teja, G. Anjana Gowri, G. Preethi Lalithya, R. Ajay, T. Anuradha,
and C. S. Pavan Kumar
Abstract According to Central Road Research Institute, more than 30% of the road
accidents in India are happening because of driver drowsiness especially in the early
hours of the day. This is observed in most of the countries which is a serious threat to
the society and has to be addressed at the earliest. The ratio of accidents due to driver
drowsiness can be reduced if a drowsiness detection mechanism is in continuous
active state in the vehicle, which helps drivers to get an alert and go back to a normal
driving mode. The proposed approach focuses on building a drowsiness detection
mechanism to alert the driver to avoid the catastrophe. In this work, the detection
system can identify whether the driver’s eyes were closed or open even in low light
or dim light and how much time the eyes were in closed state. Based on the time the
system will generate an alert. The proposed system which is built using convolution
neural network achieved 89% accuracy in normal light and 78% accuracy in dim
light conditions.
1 Introduction
Across the globe, each year, 1.35 million people are killed due to road accidents.
Everyday almost 3700 people are killed in road traffic crashes. Out of these, around
20–30% of accidents happen due to the driver’s fatigue and drowsiness. Single vehicle
accidents such as hitting the divider, bumping into a tree, all these happens due to
the driver hypo vigilance. According to the current studies, these road crashes can
be reduced by using driver face monitoring system [1]. India is one of the busiest
countries in the world in terms of road traffic. With rapid increase in the road traffic,
road safety has become an important issue to be subjected. Road accidents are one of
P. Ravi Teja · G. Anjana Gowri · G. Preethi Lalithya · R. Ajay · T. Anuradha (B) ·

C. S. Pavan Kumar
Department of Information Technology, Velagapudi Ramakrishna Siddhartha Engineering
College, Vijayawada, AP, India
C. S. Pavan Kumar
e-mail: pavanchitturi@vrsiddhartha.ac.in
https://doi.org/10.1007/978-981-16-1502-3_61
618 P. Ravi Teja et al.
the major causes of death in India [2]. On an average, more than 1214 crashes happen
on a daily basis. There are various reasons which cause road accidents. Some of them
are distracted driving, bad road conditions, tailgating, drunk driving, etc. Apart from
the bad roads and non-functional street lights, continuous driving for several hours
during the night is riskier. Driver fatigue makes the driverís responding capacity
weak. He eventually feels drowsy and looses control over the vehicle. Generally, the
driver gets exhausted after 2 h of continuous driving. Drowsiness generally arises
at the early hours, after eating lunch, at midnight, etc. In addition to this, alcohol
consumption, drugs intake, and using any kind of hypnotic medicines also lead to
fatigue. According to WHO fact sheet, around 1.35 million die because of road
accidents every year and it has set the target of reducing them by 50% by 2030
[3]. A solution to this problem is to alert and wake up the driver when he/she is
feeling drowsy and falling asleep. Lot of research is happening on this issue using
face monitoring system, eye blink ratio, etc. So, to prevent these accidents we will
be making a driver drowsiness detection system. The existing algorithms provide
most important bene ts such as interpretability. The proposed research focuses on
identifying driver drowsiness using Haar cascade features and convolution neural
networks with increased correctness in drowsiness detection rst by identifying the
drivers face. The system is able to perfectly identify whether driverís eyes are closed
or opened even if the driver wore spectacles.
2 Existing Approaches
Drowsiness detection based on driving patterns and deviation of the vehicle from
actual line position is done in [4]. Drowsiness identi cation based on whether the
eyes or opened or closed and by detecting whether the driver is yawning or not
is done in [5]. Here drowsiness is detected with high accuracy even in low light
conditions by rst detecting face and then eyes and mouth parts. Driver drowsiness
detection in real-time by using deep learning methods in light weight model for
android applications is done in [6]. Identifying the face region using Haar based
features and classi cation of face images using adaboost algorithm is proposed in
[7]. Drowsiness is detected by identifying the corners of eye lid and eye blinking
and by using Harris corner detection algorithm in [8]. Drowsiness detection using
convolution neural networks by classifying the face image as drowsy or non-drowsy
is done in [9]. A review on drowsiness detection system of automobile drivers using
soft computing techniques is done in [10]. Identi cation of facial features in real time
and classi cation of facial images using SVM is done in [ 11]. A system called Dricare
is proposed to identify drowsiness detection based on difference in facial features like
yawning and eye blinking in [12]. Identifying Driver fatigue through eye blinking
using signal processing techniques and CMOS technology is done in [13]. Usage
of image processing techniques and Haar cascade samples for detecting eye blink
and drowsiness is done in [14]. From the existing literature, it was observed that
most of the researchers concentrated on identifying drowsiness but not concentrated
Driver Drowsiness Detection Using Convolution Neural Networks 619
on alerting the driver when he/she feels drowsy. The proposed approach focuses
on building a drowsiness detection mechanism to alert the driver by using a buzzer
sound after identifying drowsiness condition.
3 Proposed Approach
The proposed method for drowsiness detection is done using the camera installed in
the vehicle. It continuously gets video of driver. The video is divided into frames. In
each frame, face is detected using HAAR cascade. After detecting the face, drowsi-
ness is observed based on the eye open or close. The eye detection is done with the
help of HAAR cascade features. If eye closing is continuous more than a threshold
value, drowsiness will be detected. Figure 1 shows the block diagram of the proposed
approach.
The entire work can be divided into 5 steps.
Step 1—Capture the images as an input using a camera

The classifier used to classify the images in the proposed research work is convolution
neural network which require a lot of training data. The training data contains the
face images of the driver in different angles with eyes open and closed. The images
of the face and eyes are captured by the webcam installed in front of the driver seat.
Step 2—Detect the face and eyes from the image and create a region
of Interest (ROI)
After having the image, the second step is to identify the face from image. This is
done using Haar cascade classifier proposed by Viola Jones in his research work on
object detection [15]. In this classifier shown in Fig. 2, convolution like kernel is used
to detect different features. Each feature is represented in the form of a value which is
the difference between pixels under white and black regions. As the face is detected
from image, in the same way, eyes are detected from the face. While implementing
with OpenCV, the region of interest is detected with a bounding box around it.
Step 3—Detecting the eye state

Here the eye blinks are estimated using facial land mark algorithm [16] which calcu-
lates Eye Aspect Ratio (EAR) value to identify how far the eye is opened in each
Fig. 1 Block diagram of

proposed approach Face Dividing Extract
Detection Video into Video
Frames
Alarm
Eye Drowsiness
Sound
detection Detection
Fig. 2 Haar cascade

classifier with white and
black regions
image. EAR value is calculated using Eq. 1 where p1, p2, p3, p4, p5 and p6 are
different positions around the 2D image of the eye when it is closed and opened as
shown in Fig. 3. The graph of EAR values for a single eye blink is shown in Fig. 4.
EAR = ( p2 − p6 + p3 − p5)/|| p1 − p4|| (1)
Step 4—Classification of eye blinks using CNN

Drowsiness can be detected by observing the duration of eye closure and number
of eye blinks. A person’s eye close duration in the wakeup state during eye blink
generally will be 100–400 ms and in the sleepy state, it will be more. In the facial land
mark algorithm [16], the eye blink patterns were classified using SVM algorithm. In
the proposed approach, Convolution neural network (CNN) algorithm [17] was used
for classification. CNN algorithm contains a sequence of convolution and pooling
layers followed by fully connected layer and softmax layer and uses RELU activation
function as shown in Fig. 5. The major operations in CNN are the convolution and
pooling operations. In convolution operation, the values in input matrix are multiplied
Fig. 3 2D image of eye

when open and closed with
positions p1–p6
Fig. 4 Plot of Eye Aspect

Ratio values for a single eye
blink
by the values in kernel matrix element by element. The kernel matrix will be moved
over the entire input matrix to cover all columns and then all rows to generate output
matrix as shown in Fig. 6. In max pooling, the input matrix will be considered as
different square parts, and the maximum value from each of the square will be taken
in output as shown in Fig. 7.
Step 5—Score calculation for Drowsiness detection and alerting the driver
To determine the duration of eye closure, a counter is set which increases when
both eyes closed and decreases when eyes are open. If the score is beyond a certain
Fig. 5 CNN architecture
0 1 1 0 0 1 0 1 3 3 4
0 1 1 1 0 0 1 0 2 4 3
X =
0 0 1 1 1 1 0 1 2 3 4
0 0 1 1 0
0 1 1 0 0
Fig. 6 Convolution operation of 5 × 5 input with 3 × 3 kernel
Fig. 7 Max pooling 3 × 3

image with 2 × 2 kernel
1 4 2 3
8 5
8 5 1 5
9 6
6 9 3 6
3 1 2 2
threshold value, it indicates driver is in drowsy mood. Then a buzzer sound is created
in the program which alerts the driver when he/she feels sleepy.
The score is basically a value we will use to determine how long the person has
closed his eyes. So if both eyes are closed, we will keep on increasing score and
when eyes are open, we decrease the score. We are drawing the result on the screen
which will display real-time status of the person. The average blink duration of a
person is 100ñ400 ms (i.e. 0.1ñ0.4 of a second). Hence if a person is drowsy his eye
closure must be beyond this interval. We set a time frame of 1 s. If the eyes remain
closed for one or more seconds, drowsiness is detected and alert pop regarding this
is triggered.
4 Experimental Work
In experimental work, images of a person were collected using the built-in web
camera of the laptop. The images of the persons who sit in front of the camera in
different angles were taken as input data. To get continuous images, in nite loop
was taken in programming using OpenCV which captures each and every frame. As
OpenCV works better with grey scale images, before using Haar cascade ampli er,
the image was converted to grey scale and resized to 24 * 24 pixels as our model
was trained on 24 * 24 pixel images. After detecting the face using Haar classi er,
EAR value was calculated in each frame to know how far the eye was closed. The
CNN model architecture used in the experiment consists of the following layers:
1st Convolutional layer; 32 nodes, kernel size 3, 2nd Convolutional layer; 32 nodes,
kernel size 3, 3rd Convolutional layer; 64 nodes, kernel size 3, Fully connected
layer; 128 nodes, The nal layer is also a fully connected layer with 2 nodes. In all
the layers, a Relu activation function is used except the output layer where a softmax
layer is used. Score is calculated based on how much time eyes are closed. In the
experimentation, test score is a numerical value which is used to identify the duration
of eye closure. If both eyes are closed, we will keep on increasing score and when
eyes are open, we decrease the score and reset every time when eye closes. If the
score reaches a threshold value, beep sound was generated. Here the threshold was
taken as 20.
For experimentation, a person is sitting in front of the laptop on which the proposed
experimental work is implemented in python and OpenCV. Figure 8 shows the rect-
angle box around the face after it was detected as ROI using Haar classi er. It returned
the 2D coordinates and height and width of the object selected as ROI in the form
of bounding box. Then the same procedure was used to detect eyes from face and
Fig. 8 Displaying bounding

box around face
this left and right eyes image data was given to CNN as input. Figure 9 shows the
bounding boxes around left and right eyes separately.
Fig. 9 Detecting eyes from

ROI
Fig. 10 Classifying the

image as open when eyes
were open
Fig. 11 Classifying the

image as closed when eyes
were closed
Figure 10 shows the output of CNN classifier. Here the image was classified as
open when the person’s eyes were open and here the score was 0. Figure 11 shows the
image was classified as closed when eyes were closed. Here the score was increased
starting from the classifier identified image as closed. When score reaches 20, an
alarm sound was generated.
The experimentation was done in conditions like, when the driver wore the spec-
tacles and in low light conditions. Figure 12 represents the image was classified
correctly as open when the driver worn the spectacles in low light condition. Figure 13
shows image was classified correctly as closed when driver worn the spectacles in
low light conditions. Table 1 shows the accuracies obtained in different experimental
conditions. It was observed that the proposed work obtained considerable accuracies
of more than 75% even when the driver having spectacles, when face turned sideward
and in low light conditions also.
Fig. 12. Classifying image

correctly as open with
spectacles and in low light
condition
Fig. 13. Classifying image

correctly as closed with
spectacles in low light
condition
Table 1 Accuracies obtained

S. No. Condition Accuracy obtained (%)
in different conditions
1 Normal 89
2 Face turned sideward 86
3 Wearing glasses normal 84
condition
4 Low light condition 78
5 Wearing glasses low light 76
condition
6 Face turned sideward low 75
light condition
6 Conclusions
An automatic driver drowsiness detection and alerting mechanism were developed

using convolution neural networks and Haar cascade classifiers. The experimental
setup created using OpenCV and Python programming correctly identified whether
eyes were closed or opened even in low light conditions and if the person wore
spectacles. It also correctly classified the images even if the person’s face is turned
side wards. The proposed system achieved 89% accuracy in normal light and 78%
accuracy in dim light conditions.
References
1. Sigari MH, Fathy M, Soryani M. A driver face monitoring system for fatigue and distraction
detection. International journal of vehicular technology. 2013;2013.
2. Dandona, R., Kumar, G.A., Gururaj, G., James, S., Chakma, J.K., Thakur, J.S., Srivastava, A.,
Kumaresh, G., Glenn, S.D., Gupta, G., Krishnankutty, R.P.: Mortality due to road injuries in
the states of India: the Global Burden of Disease Study 1990–2017. the Lancet Public Health.
5(2), 86–98 (2020)
3. Road Traffic Injuries, 7 February 2020 [online] https://www.who.int/news-room/fact-sheets/
detail/ road-traffic-injuries accessed on: 15th Feb 2020
4. Krajewski J, Sommer D, Trutschel U, Edwards D, Golz M. Steering wheel behavior based
estimation of fatigue. The fifth international driving symposium on human factors in driver
assessment, training and vehicle design 2009;118–124.
5. W. Tipprasert, T. Charoenpong, C. Chianrabutra and C. Sukjamsri, A Method of Driver’s Eyes
Closure and Yawning Detection for Drowsiness Analysis by Infrared Camera. In: 2019 First
International Symposium on Instrumentation, Control, Artificial Intelligence, and Robotics
(ICA-SYMP), Bangkok, Thailand, 2019, pp. 61–64, https://doi.org/10.1109/ICA-SYMP.2019.
8646001
6. Jabbar, R., Al-Khalifa, K., Kharbeche, M., Alhajyaseen, W., Jafari, M., Jiang, S.: Real-time
driver drowsiness detection for android application using deep neural networks techniques.
Procedia Computer Science. 1(130), 400–407 (2018)
7. Manu BN. Facial features monitoring for real time drowsiness detection. In2016 12th Inter-
national Conference on Innovations in Information Technology (IIT) 2016 Nov 28 (pp. 1–4).
IEEE.
8. Rahman A, Sirshar M, Khan A. Real time drowsiness detection using eye blink monitoring.
In2015 National Software Engineering Conference (NSEC) 2015 Dec 17 (pp. 1–7). IEEE.
9. Dwivedi K, Biswaranjan K, Sethi A. Drowsy driver detection using representation learning.
Advance Computing Conference (IACC), IEEE 2014;995–999
10. Edison, T., Ulagapriya, K.: Saritha A Prediction of Drowsy Driver Detection by using Soft
Computing. Journal of Critical Reviews. 7(6), 2020 (2019)
11. Mundra, P & Todwal, V. (2018). Design Simulation and Performance Analysis of Real
Time Facial Features Monitoring for Drowsiness Detection Using Support Vector Machine.
IJIREEICE. 6. 53–56. https://doi.org/10.17148/IJIREEICE.2018.688.
12. Deng, W., Wu, R.: Real-time driver-drowsiness detection system using facial features. IEEE
Access. 21(7), 118727–118738 (2019)
13. Yassine, N., Barker, S., Hayatleh, K., Choubey, B., Nagulapalli, R.: Simulation of driver fatigue
monitoring via blink rate detection, using 65 nm CMOS technology. Analog Integr. Circ. Sig.
Process 95(3), 409–414 (2018)
14. Jayadevappa, Suryaprasad & D, Sandesh & V, Saraswathi & D, Swathi & S, Manjunath.
(2013). Real Time Drowsy Driver Detection Using Haarcascade Samples. Computer Science
& Information Technology. 3. 45–54. https://doi.org/10.5121/csit.2013.3805.
15. Viola P, Jones M. Rapid object detection using a boosted cascade of simple features. InProceed-
ings of the 2001 IEEE computer society conference on computer vision and pattern recognition.
CVPR 2001 2001 Dec 8 (Vol. 1, pp. I-I). IEEE
16. Tereza Soukupova and Jan ´ Cech, Real-Time Eye Blink Detection using Facial Landmarks,
21st Computer Vision Winter Workshop, February 3–5, 2016
17. Sumit Saha, A Comprehensive Guide to Convolutional Neural Networks-- The ELI5 way,
Dec 15, 2018, [online] https://towardsdatascience.com/a-comprehensive-guide-to-convoluti
onal-neural-networks-the-eli5-way-3bd2b1164a53 [accessed]: Nov, 2019
Glaucoma Detection Using
Morphological Filters and GLCM
Features
Babita Pal, Vikrant Bhateja, Archita Johri, Deepika Pal,

and Suresh Chandra Satapathy
Abstract Glaucoma, a neuropathic disorder occurs due to change in shape of optic

disk, cup and increase in eye pressure, etc. If Glaucoma is not diagnosed in its
initial stages, then it leads to permanent vision loss. Diagnosis of Glaucoma involves
various steps including pre-processing or automated processing, features extraction,
and classification. Results obtained after automated processing are further used for
identification of various properties that has to be analyzed during features extraction.
Features or characteristics extraction is used for reducing the image to the various
features used for further analysis. Further, classification has been used for differenti-
ating between Glaucomatous and non-Glaucomatous eye. Combination of statistical
features and gray level co-occurrence matrix (GLCM) is used for features extrac-
tion. Classifier used for differentiating the two classes is support vector machine
(SVM), K-nearest neighbor (KNN), and artificial neural network (ANN). Accuracy
of classification for KNN, SVM, and ANN is 82.5%, 85%, and 93.7%, respectively.
1 Introduction
Computer-aided diagnosis (CAD) has been introduced in the field of biomedical

imaging. CAD acts as aid to the medical professional to analyze and study the various
diseases. CAD improves the method of diagnosis, as it reduces human intervene,
thereby reducing the chances of error associated to it. CAD approach also helps
to analyze large dataset in less interval of time. CAD has been proposed to easily
diagnose Glaucoma. Glaucoma is one of the major ophthalmic diseases causing
permanent vision loss if not treated in time. Its symptoms are quite common to that
B. Pal · V. Bhateja (B) · A. Johri · D. Pal

Department of Electronics and Communication Engineering, Shri Ramswaroop Memorial Group
of Professional Colleges (SRMGPC), Faizabad Road, Lucknow, UP 226028, India
Dr. APJ Abdul Kalam Technical University, Lucknow, UP, India
S. C. Satapathy
KIIT Univeristy, Bhubaneswar, Odisha, India
https://doi.org/10.1007/978-981-16-1502-3_62
628 B. Pal et al.
of any other retinal disorder; hence, its diagnosis is difficult. Various parameters have
to be considered during diagnosis of Glaucoma such as if not the disease is genetic.
Other diseases such as hyperthyroidism, diabetes, etc., are possessed by the suspect
[1]. Features extraction has been used for extracting various properties of retinal
images. The purpose for features extraction is to reduce input to significant features
for further analysis of the problem. It acts as an aid to reduce the complexity of the
system. Various features for the measurement of several properties have been carried
out. Classifiers are used for differentiation between various classes in the diagnosis
of the outlined disease [2].
CAD of Glaucoma has been presented by various medical professionals. Cup to
disk (CDR) ratio is calculated using diameter of cup to that of disk. The vertical
diameter of OC and OD is calculated separately considering their shape similar to
that of an ellipse; then their ratio is considered. The increase in CDR is an indicative
of retinal diseases. Eye has four regions that are ISNT ratio is areas of blood vessels
in inferior and superior regions to that of nasal and temporal regions. ISNT ratio
is an important aspect for various retinal problems [3]. Various features considered
by other researchers for analysis as CDR and ISNT were extracted. Texture and
high order spectrum features that is correntropy were analyzed, and classification
was performed using least square SVM. Correntropy features were estimated using
Student t test algorithm [4]. Image projection features were presented. Both hori-
zontal and vertical projection features were considered for the analysis [5]. CDR
has been extracted and classified using SVM [6]. Contextual features along with
mean and median were extracted, and fisher discriminant analysis was presented for
classification by [7]. VCDR and FFT had been used with generalized matrix LVQ
[8]. There were various flaws in these features used for further analysis. In order to
combat the various problems, here in this paper, approach of GLCM features has
been proposed. The rest of the paper is organized in the following sections: Sect. 2
describes the overview of CAD of Glaucoma, Sect. 3 discusses the obtained results,
and Sect. 4 discusses the conclusion of the work.
2 Proposed Framework for Diagnosis of Glaucoma
CAD of Glaucoma proposes pre-processing of retinal images involving contrast

enhancement of retinal images and segmentation and localization of ROI. Features
extraction from the segmented ROI has been presented. Further testing and training
of dataset have been proposed using SVM, KNN, and ANN classifiers to differentiate
between Glaucomatous and non-Glaucomatous retinal images.
Glaucoma Detection Using Morphological Filters and GLCM Features 629
2.1 Pre-processing
Pre-processing is the process of improvement of quality of the images or ROI. Some-

times due to dark background, overlapping of blood vessels or presence of unwanted
noise in retinal images creates hindrance in detection and processing of ROI. Hence,
pre-processing is used to remove the noise from the images, and it improves the visi-
bility of an image which is being used for further processing steps. Segmentation is
the conversion of images into true and false pixels, i.e., binary images. There are two
pre-processing steps which is given in following subsections. In order to obtain ROI,
true pixels are considered, and rest unwanted components of the image are removed.
Image enhancement takes major role in pre-processing step which improves the
visibility of an image. Morphological filters are easier and shape selective filter which
makes the enhancement process easier and more accurate. Top-hat and Bottom-hat
transform is the combination of basic operations which takes vital role for contrast
enhancement. Image quality assessment (EME) is used for the quantitative measure
of an enhanced image [9]. In order to easily detect ROI (optic cup and optic disk),
localization and segmentation are necessary for both optic cup and optic disk extrac-
tion. Segmentation of ROI has been performed using combination of global thresh-
olding and morphological operations. Ellipse fitting has been applied for localization
of optic cup and optic disk [10].
2.2 Features Extraction and Classification
Features are defined as the features are a set of different quantifiable entity which is a
function of one or more objects. All features could be categorized into two level which
are low-level features and high-level features. Pixel values and pixel co-ordinates are
the characteristics of texture. Harlicks features come up with fourteen texture features
which are extracted from co-occurrence matrix. Texture features could be catego-
rized into first-order texture measures and second-order texture measures. First-order
texture measures describe the statistical features which could be calculated by indi-
vidual pixels of an image without using the pixel’s neighbors’ relationship, while
second-order measures consider the relationship among the neighbors [11]. Clas-
sification is the process to differentiate between various classes that may or may
not be differentiable in normal means. Differentiation of different classes in diag-
nosis of any particular disease is crucial step. Sometimes there are many similarities
between ophthalmic diseases; hence, it may take more time or become difficult for
the medical expert to diagnose the specific disease. Hence, classifier that has to be
considered has capability to differentiate between classes even with minute varia-
tions. Classifier that had been considered for differentiating between Glaucomatous
and non-Glaucomatous is SVM, KNN, and ANN [12–15].
A. First Order Texture Features
630 B. Pal et al.
Table 1 First-order texture features [17, 18]

Features Formulae Key points
L−1
Mean (μ) μ = i=1 ki p(ki ) It is used to find gray values of
pixels
Standard deviation (SD) L−1 2 Measure the scattering in GLCM
SD = i=1 ki p(ki )2 −
2 and also explain the level of
L−1
i=1 ki p(ki ) intensity in an image
Variance (V ) V = S12 = Measures the second central
2 moment and also describes the
1 L−1
N i=1 ki − μ sameness within the region of an
image
L−1
Skewness (S k ) Sk = 1
S2 i=1 (ki − μ)3 Skewness is measured as third
central moment. Used to show the
asymmetry of data which occurs
around the sample
Kurtosis (K) K = Kurtosis could be explained as
1 L−1 fourth central moment. Acuteness
S4 i=1 [ki − μ]4 p(ki ) − 3
of gray level histogram
Where k denotes the gray value of ith pixel, P (k i ) denotes the normalized histogram, and L denotes
the number of gray levels in an image
It is used to define the pixels value of an image. It gives the information about
how pixel intensities is varied according to the position of texture. First-order
calculation includes the intensity histogram and intensity features. Statistical
features consist mean, standard deviation, variance, and skewness. Here, mean
and standard deviation bothered with the properties of individual pixels [16]
(Table 1).
B. Second-Order Texture Features
It describes the texture, color, and contrast of an image. Second-order texture

features include GLCM features [21]. Gray level co-occurrence matrix (GLCM) is
a type of matrix in which number of gray level in an image is same as the number of
rows and columns.
In co-occurrence matrix, each individual pixel’s intensity of an image could
compared in four directions (0°, 45°, 90° and 135°) with its neighbor pixels. These
features determine the texture, shape, color, and contrast of an image. It consists
various features which are contrast, correlation, energy, homogeneity, and entropy
which is shown in Table 2.
Table 2 Second-order texture features [17, 18]

Features Formulae Key points
L−1
Contrast (C) C= i=1 pi j (i − j)2 Local abnormalities of an image
could be measured by contrast. 0
value indicates constant image
L−1 pi j (i−μ)( j−μ)
Correlation (Co) Co = i=1 σx σ y It is used to define the relation
between pixels with its
neighborhood. For the gray tone
linear dependencies in an image,
correlation is being used
L−1
Energy (E)/angular Second E= i, j=0 ( pi )2 It depicts the uniformity in a
Moment (ASM) gray level region. If the energy
value comes 1, it seems as
constant image
p(i, j)
Homogeneity (H) H= i, j (1−|i− j|) Homogeneity feature defines the
closeness of pixels.
Homogeneity is 1 for diagonal
GLCM
Entropy (E) En= Entropy feature predicts the
n
− i=0 P(xi )(log2 P(xi )) complexities presents in the
intensities of an image
where
μi and μj denote mean
σ x , σ y denotes standard deviation
p(i, j) denotes (i, j)th entity in normalized GLCM
p(x i ) denotes partial probability density function
n is the total number of pixels in an image
3.1 Automated Processing of Retinal Images
CAD of Glaucoma has been performed on the retinal images obtained from publicly
available database DRISHTI-GS [19]. Contrast enhancement and segmentation have
been discussed earlier in [9, 10]. The simulated results for contrast enhancement,
segmentation, and localization have been displayed in Fig. 1.
Contrast enhancement leads to improvement in visually of ROI observed in Fig. 1b
and d. After pre-processing segmented ROI so obtained Fig. 1c and e, further features
reextracted from them, and further classification is carried out.
632 B. Pal et al.
Fig. 1 Pre-processing of retinal images a Original retinal image, b green channel enhanced image
c segmented localized OC, d red channel enhanced image, e segmented localized OD
3.2 Characteristic Extraction
Different features are extracted for the optic disk and optic cup which is being used
for the further analysis or which will be used for the classification of Glaucomatous
and non-Glaucomatous images. Total ten features and CDR [11] are extracted for
OD and OC individually. Training and testing features of optic cup (OC) for some
cases are shown in Table 3.
Similarly, training and testing features of OD are shown in Table 4. The features,
which are extracted, are the sum-up of statistical feature and texture features. Total
101 images (Drishti GS-1 data se which is publicly available) features are extracted.
Table 3 Features of OC
C CO E HO M SD V Sk K EN
0.00156 0.94982 0.96706 0.99924 0.01592 0.12376 0.00163 1.8293 10.0535 0.1169
0.00158 0.95136 0.96506 0.9992 0.0169 0.1276 0.00172 2.10186 11.54212 0.12278
0.00164 0.9522 0.96348 0.99918 0.01768 0.13146 0.00182 1.908 9.75016 0.12442
0.0069 0.94774 0.97186 0.9993 0.01352 0.11346 0.00134 1.93496 11.00832 0.10208
0.00142 0.95232 0.96876 0.9993 0.01508 0.12162 0.00146 2.06756 10.36268 0.11264
Table 4 Features of OD
C CO E HO M SD V Sk K EN
0.003 0.93734 0.9459 0.99852 0.0262 0.15858 0.00258 3.4403 26.58494 0.1739
0.00278 0.9325 0.94326 0.9986 0.02786 0.1576 0.00286 3.01196 24.31004 0.17786
0.0163 0.95344 0.92616 0.99838 0.03654 0.18724 0.00382 4.05008 36.3416 0.22578
0.00464 0.92944 0.93038 0.99772 0.0337 0.178044 0.00348 3.346436 26.96898 0.20999
0.00306 0.94086 0.94396 0.99848 0.02714 0.16204 0.00272 3.64554 19.38016 0.17942
Fig. 2 Simulated neural network
3.3 Performance Analysis of Classifiers
Performance evaluation of classifier accuracy, specificity, precision, and sensitivity

parameters has been used [20]. Using TP, FP, TN, and FN, all the performance
are evaluated for testing and training images. Total 100 images are taken for the
simulation results of ANN classifier in which 80 images are used for training and
rest of them are used for testing. Figure 2 shows the simulated neural network. A
matrix with size of 21 × 100 is taken as input for the classifier. 21 denotes number
of features considered, and 100 denotes the total number of images.
ANN classifier used confusion matrix which is used to plot the training, testing,
validation, and overall performance of the system. Confusion matrix is obtained by
plot of actual and experimented value of training and testing images using extracted
features. Figure 3 depicts the overall performance of ANN classifier, in which accu-
racy is obtained 70%, sensitivity is 28.7%, specificity is 84.62%, and precision is
50% for SVM.
Performance parameter obtained for KNN is 65% accuracy, 14.29% sensitivity,
specificity is 92.31%, and the precision is 50%. Accuracy is obtained via ANN 93.7%,
sensitivity 98.6%, specificity 80%, and precision 92%.
634 B. Pal et al.
Fig. 3 Confusion matrix for

overall performance of ANN
4 Conclusion
Early detection and diagnosis of glaucoma are necessary to avoid permanent vision
loss. For early detection, it is necessary to follow all the steps. Features extraction
plays a vital role to define the individual features of an image. It categorizes features
into two parts as follows: the texture features and statistical features. Here, gray level
co-occurrence matrix is used. To classify the Glaucomatous and non-Glaucomatous
images, classifier is used. From the result analysis, it is clear that ANN classifier
gives more accuracy in comparison to the other classifiers.
References
1. Kavitha, S., Zebardast, N., Palaniswamy, K., Wojciechowski, R., Chan, E.S., Friedman, D.S.,
Venkatesh, R., Ramulu, P.Y.: Family history is a strong risk factor for prevalent angle closure
in a South Indian population. Ophthalmology 121(11), 2091–2097 (2014)
2. Bhateja, V., Gautam, A., Tiwari, A., Satapathy, S.C., Nhu, N.G., Le, D.N.: Haralick features-
based classification of mammograms using SVM. In: Proceedings of 4th International
Conference on Information Systems Design and Intelligent Applications, India, pp. 787–795
(2018).
3. Nayak, J., Acharya U.R., Bhat, P.S., Shetty, N., Lim, T.C.: Automated diagnosis of glaucoma
using digital fundus images. J. Med. Syst. 33, 337–346 (2008)
4. Maheshwari, S., Pachori, R.B., Acharya, U.R.: Automated diagnosis of glaucoma using empir-
ical wavelet transform and correntropy features extracted from fundus images. IEEE J. Biomed.
Health Inf. 21(3), 803–813 (2016)
5. Mahfouz, A.E., Fahmy, A.S.: Fast localization of optic disc using projection of image features.
IEEE Trans. Image Process. 19(12), 3285–3289 (2011)
6. Cheng, J., Liu, J., Xu, Y., Yin, F., Kee Wong, D.W., Tan, N.-M., Tao, D., Cheng, C.Y., Aung, T.
Wong, T.Y.: Superpixel classification based optic disc and optic cup segmentation for glaucoma
screening, IEEE Trans. Med. Imaging 10(10), 1–15 (2013)
7. Zhou, W., Wu, C., Yi, Y., Duet, W.: Automatic detection of exudates in digital images using
superpixel multi-feature classification. IEEE Access 5(9), 17077–17088 (2017)
8. Guo, J., Azzopardi, G., Shi, C., Jansonius, N.M., Petkov, N.: Automatic determination of
vertical cup to disc ratio in retinal fundus images for glaucoma screening. IEEE Access 7(1),
8527–8541 (2019)
9. Johri, A., Pal, D., Bhateja, V., Pal, B.: Enhancement of retinal filters using morphological filters.
In: Proceedings of 4th International Conference on Intelligent Computing and Communication,
pp. 1–9 (2020)
10. Johri, A., Pal, B., Pal D., Bhateja, V.: Computer aided diagnosis of glaucoma using optic
cup-disc ratio. In: Proceedings of 4th International Conference on Intelligent Computing and
Communication, pp. 1–10 (2020).
11. Anuradha, K., Sankaranarayanan, K.: Statistical feature extraction to classify oral cancers. J.
Glob. Res. Comput. Sci. 4(2), 8–12 (2013)
12. Sheeba, O., George, J., Rajin P.K., Thomas, N., George, S.: Glaucoma detection using artificial
neural network. IACSIT Int. J. Eng. Technol. 6(2), 158–161 (2014).
13. Bhateja, V., Tiwari, A., Gautam,A.: Classification of mammograms using sigmoidal transfor-
mation and SVM. In: Smart Computing and Informatics, pp. 193–199. Springer, Singapore
(2018)
14. Belgacem, R., Malek, I.T., Trabelsi H., Jabri, I.: A supervised machine learning algo-
rithm SKVMs used for both classification and screening of glaucoma disease. New Front.
Ophthalmol. 4(4), 1–27 (2018)
15. Khassabi, Z., Shanbehzadeh J., Mahdavi, K.N.: A unified optic nerve head and optic cup
segmentation using unsupervised neural networks for glaucoma screening. In: Proceedings
of 40th International Conference of the IEEE Engineering in Medicine and Biology Society,
Honolulu, HI, USA, pp. 5942–5945 (2018)
16. Kavya, N., Padmaja, K.V.: Glaucoma detection using texture features extraction. In: Proceed-
ings of IEEE 51st Asilomar Conference on Signals, Systems and Computers, Pacific Grove,
USA, pp. 1471–1475 (2017).
17. Haralick, R.M., Shanmugam, K., Dinstein, Textural features for image classification. IEEE
Trans. Syst., Man Cybern. SMC-3(6), 610–621 (1973)
18. Chaudhari, P., Agarwal, H., Bhateja, V.: Data augmentation for cancer classification in
oncogenomics: an improved KNN based approach. J. Evol. Intell., pp. 1–10 (2019)
19. Sivaswamy, J., Krishnadas, S.R., Joshi, G.D., Jain M., Tabish A.U.S.: DRISHTI-GS: retinal
image dataset for optic nerve head (ONH) segmentation. IEEE 11th International Symposium
on Biomedical Imaging, Beijing, China, pp. 1–4 (2014).
20. Roychowdhury, S., Koozekanani, D.D., Kuchinka S.N., Parhi, K.K.: Optic disc boundary and
vessel origin segmentation of fundus images. IEEE J. Biomed. Health Inf. 20(6), 1562–1574
(2015)
21. Tiwari, A., Bhateja, V., Gautam A., Satapathy, S.C.: ANN-based classification of mammograms
using nonlinear pre-processing. In: Proceedings of 2nd International Conference on Micro-
Electronics, Electromagnetics and Telecommunications, Singapore, pp. 375–382 (2018).
Analysis of Encryption Algorithm
for Data Security in Cloud Computing
Arijit Dutta, Akash Bhattacharyya, Chinmaya Misra,

and Sudhangshu Sekhar Patra
Abstract Cloud computing offers various types of resources to its users. In recent
years with the development of Cloud Computing, there has been an increase in
the use of storage service from the cloud service providing organizations. However,
there are still active issues regarding security, privacy, interoperability and reliability,
which needs to be solved fast. Among these issues the issue regarding the security of
cloud storage and how the same can be provided easily. This paper has helped in the
study and proposal of a simple and secure as well as privacy-preserving design and
architecture to cloud data sharing. The architecture has been based on the process of
encryption and decryption algorithms for the protection of data stored in the cloud
servers from unauthorized and illegal access.
1 Introduction
Cloud computing providers providing the customers with virtualized resources

accompanied by various technologies like multi-tenancy, virtualization and web
services. This makes the use of web applications for the cloud services one of the
most important components of cloud computing [1]. The process gives rise to the
concept of multi-tenancy in the process of cloud resources being shared. However,
even with the provision of the right number of resources, there is the inclusion of
exclusive risks among which the security risks being of the topmost priority [2].
The models are designed along with the characteristics and the proper technologies.
The main characteristics, which needs to be present for a proper cloud environment,
are multi-tenancy and virtualization [3]. Cloud services along with the technologies
and deployment models are responsible for the introduction of cloud-related security
risks and vulnerabilities. Similarly, it has been found that the virtual environment
A. Dutta · A. Bhattacharyya
School of Computer Engineering, KIIT Deemed To Be University, Bhubaneswar, India
C. Misra (B) · S. S. Patra
School of Computer Applications, KIIT Deemed To Be University, Bhubaneswar, India
https://doi.org/10.1007/978-981-16-1502-3_63
638 A. Dutta et al.
gives rise to their own set of risks and various vulnerabilities including malicious
interaction between virtual machines and virtual machine escape [4]. The imple-
mentation of multi-tenancy accessing the same data sector in the cloud also gives
rise to the same issues with the security of data on the cloud. To provide dedicated
resources for the users of the cloud is a complex work and would thus require a large
amount of security. The following section is dedicated to the discussion of the security
challenges that are currently being faced by the cloud computing environment.
2 Literature Survey
Rimal et al. [5] have been able to provide a classification of various cloud computing
system. The main aim set forward by the author for this paper was to create a proper
disciplined process for the scattered resources which will be incurring the least expen-
sive with the highest throughput to achieve the best comfort in cloud computing. Jain
[6] in his paper discusses the various cloud computing models, the research challenges
cloud computing faces, as well as the security challenges of cloud computing. Padhy
[7] has discussed the overview of the effect of the cloud computing environment and
the various cloud services available.
Advanced encryption standard (AES) is a widely used symmetric block cipher.
Asymmetric cryptographic key of 128 bit is used for this algorithm. AES has been
seen to be able to be working in most of the cloud environment to provide security.
The users first decide on the CSP and provide a requirement list to the CSP. The
requirement is the service requirements of the user. During the migration of the
data, all the data being uploaded would be encrypted with the AES algorithm. After
encryption, the data is forwarded to the CSP for storage. A request for the reading
of the data would be sent to the CSP; the data would be decrypted and then sent to
the user.
The data encryption standard (DES) encryption methodology is a block cipher
algorithm that uses a block size of 64 bits each. A block of 64-bit plain text is
encrypted using a symmetric key algorithm to produce 64-bit ciphertext. The key
used in this algorithm is 56 bits long even though a 64-bit key is provided.
One of the most common forms of public-key encryption key algorithms is RSA.
The algorithm follows asymmetric key cryptography. The public key is used for the
encryption method and is shared over the network with all. The private key is used for
the decryption of the ciphertext and is not shared with anyone. Blowfish is another
encryption algorithm, which uses symmetric key encryption methodology. The algo-
rithm encrypts a 64-bit block of plain text with a key value of the variable length
of 128–448 bits. Blowfish algorithm is best suited for applications and environment
where the key value remains constant for a long period (communications linking
encryption) and not for the applications where the key changes frequently (packet
switching method of data interchange) (Table 1).
Analysis of Encryption Algorithm for Data Security … 639
Table 1 Comparative study of AES, DES, RSA and blowfish algorithm

Characteristics AES RSA DES Blowfish
Platform Cloud Cloud Cloud Cloud
environment environment environment environment
Scalability Positive Negative Positive Positive
Security Both user and Only users are Both user and Both user and
providers are secured providers are providers are
secured secured secured
Data encryption The large Small data only Lesser than AES Lesser than AES
capacity quantity of data
Authentication Best Robust Less than AES Almost similar
type authentication authentication to AES
process
Memory usage RAM required is Highest Required more Can be executed
low requirement than AES within 5 KB
Execution time Fastest Slowest Same as AES Less time for
execution
3 Proposed Method of Hybrid Encryption Model
This section discusses a proposed hybrid encryption algorithm, which would be

able to provide a high amount of data security in the cloud environment. Based on
the theory, two models have been proposed: two-tier model comprised of RSA and
blowfish, three-tier model comprised of RSA, blowfish and DES algorithm. The three
methods have been selected for the following reasons:
1. Fast working of DES algorithm with short key generation
2. Increased security with long key generation in blowfish
3. RSA has high compatibility with Internet processing and higher security.
The use of the proposed hybrid model would be able to reduce the complexity of
the data encryption when the data is at rest as well as during transmission. The model
makes use of both asymmetric key cryptography and symmetric key cryptography
algorithms to provide a higher amount of data security to the cloud environment.
3.1 Two-Tier Hybrid Model
The two-tier architecture model has been designed based on the theory of providing
stronger strength to the users’ data protection and security in the cloud environment.
In the model, the process follows a simple collection of steps as discussed (Fig. 1):
1. The sender initiates the algorithm and invokes both the encryption algorithms:
RSA and blowfish
640 A. Dutta et al.
Fig. 1 Encryption and decryption algorithm for the two-tier hybrid model (Source [6])
2. RSA algorithm generates the public and private keys for the algorithm
3. Blowfish generates the secret key for the models’ encryption system
4. The sender chooses the file to be encrypted
5. Blowfish algorithm first encrypts the file with the secret key generated
6. The RSA public key generated is then encrypted with the help of the blowfish
secret key
7. Both the file and the encrypted key are stored in the cloud storage until requested.
During the decryption process, the model uses the following process:
1. The client requests the file to be read
2. The model has already stored the blowfish secret key as well as the RSA keys
in the cloud system during encryption
3. The RSA private key is used to decrypt the blowfish secret key
4. The secret key is then used to decrypt the file which the client has requested.
The security lies with the RSA private key, which is present only with the client.
Without the proper private key, the blowfish secret key cannot be decrypted (Fig. 2).
3.2 Three-Tier Hybrid Model
The proposed method of a three-tier model is based on a study where DES and
RSA were separately used to provide data security. The three-tier hybrid model is
considered to be an improved version of the two-tier architecture. When a file is to
be uploaded to the cloud, the model follows the following steps (Fig. 3):
1. Invoke all the three algorithms to generate the keys: blowfish secret encryption
key, RSA public and private keys and DES secret encryption key
2. The file is first encrypted with the blowfish secret key
3. The output is again encrypted with the DES secret key
4. The blowfish secret key and DES secret key are encrypted with the help of RSA
public key
Fig. 2 Flowchart for

START
two-tier hybrid model
DATA FILE
INITIATE
ENCRYPTION / SENDER/RECIEVER
DECRYPTION TASK
INVOKE RSA AND

ENCRYPTION OR
DECRYPTION?
ENCRYPTION BLOWFISH FOR
KEYS
DECRYPTION
ENCRYPT DATA USING

REQUEST KEYS BLOWFISH KEY
DECRYPT BLOWFISH ENCRYPT BLOWFISH

KEY USING RSA PRIVATE KEY USING RSA PUBLIC
KEY KEY
DECYPRT DATA
WITH BLOWFISH STORE DATA
KEY
5. The two files are then stored in the cloud environment.

The process for the decryption method is similar to the two-tier architecture as
follows:
1. As all the keys are already present in the cloud, the files are collected for
decryption
2. The blowfish secret key and DES secret key are decrypted with the help of RSA
private key of the client
3. The DES key is used to first decrypt the file requested
4. The output file is then decrypted with the help of blowfish secret key to obtain
the original file uploaded by the client.
642 A. Dutta et al.
Fig. 3 Flowchart for

START
three-tier hybrid model. (
Source Made by Author)
DATA FILE
INITIATE
ENCRYPTION / SENDER/RECIEVER
DECRYPTION TASK
INVOKE RSA,
ENCRYPTION OR
DECRYPTION?
ENCRYPTION BLOWFISH AND
DES FOR KEYS
DECRYPTION
ENCRYPT DATA USING

REQUEST KEYS BLOWFISH KEY AND
THEN WITH DES KEY
DECRYPT BLOWFISH ENCRYPT BLOWFISH

KEY AND DES KEY KEY AND DES KEY
USING RSA PRIVATE KEY USING RSA PUBLIC KEY
DECRYPT
BLOWFISH KEY STORE DATA
WITH DES
DECYPRT DATA
WITH BLOWFISH
KEY
4 Empirical Evaluation of the Method and Results
This section discusses the performance analysis of the two proposed hybrid model.
The attributes selected for the analysis of the performance are security provision
strength, time consumption calculated based on the encryption and decryption time
on various file sizes of texts, image and video. Along with these, the size of the file
was calculated before and after the encryption as well as after decryption. Several
iterations were conducted to ensure the consistency of the results found.
The computation was completed based on three types of data files: text, image
and video. The main objective was to determine which model would be the most
time-efficient. The three files when encrypted or decrypted, the time required was
Fig. 4 Encryption and decryption algorithm for the three-tier hybrid model (Source [6])
found to be directly proportional to the size of the file being used. It was found
that the time required for the completion of the process in the two-tier model was
less compared to the three-tier model. This is due to the use of the three-encryption
algorithm (Fig. 4).
The most security was found to be in the three-tier architecture due to the following
three factors:
1. Three computational steps of encryption increase the security factor largely. The
use of RSA has been proven the most secured in the recent encryption history.
As the encryption process is conducted before the transmission of the files, the
symmetric keys are well-secured during the transmission process.
2. RSA and blowfish have been found to provide larger key blocks. Thus when
the encryption of the blowfish secret key with RSA would result in a larger key
size, which is harder to break.
3. DES has a smaller key size, which compensates with the larger key size of the
other two algorithms.
5 Conculsion
Based on the above three factors, the three-tier hybrid model can be considered to
be the most secured algorithm than the two-tier model.
644 A. Dutta et al.
References
1. Duan, Q., Yan, Y., Vasilakos, A.V.: A survey on service-oriented network virtualization toward
convergence of networking and cloud computing. IEEE Trans. Netw. Serv. Manage. 9(4),
373–392 (2012)
2. Guan, B., Wu, J., Wang, Y., Khan, S.U.: CIVSched: a communication-aware inter-VM
scheduling technique for decreased network latency between co-located VMs. IEEE Trans.
Cloud Comput. 2(3), 320–332 (2014)
3. Xiao, Z., Xiao, Y.: Security and privacy in cloud computing. IEEE Commun. Surv. Tutorials
15(2), 843–859 (2013)
4. Tari, Z.: Security and privacy in cloud computing. IEEE Cloud Comput. 1(1), 54–57 (2014)
5. Rimal, B.P., Choi, E., Lumb, I.: A taxonomy and survey of cloud scheming systems. In: IEEE
Fifth International Joint Conference on INC, IMS, and IDC, vol. 10, No. 2, pp. 44–51 (2009)
6. Jain, P.: Security Issues and their Solution in Cloud Computing. Int. J. Comput. Bus. Res. 3(1),
1–7 (2010)
7. Padhy, R.P., Patra, M.R., Satapathy, S.C.: Cloud computing: security issues and research
challenges. Int. J. Comput. Sci. Inf. Technol. Secur. 1(2), 136–146 (2011)
8. Menzel, M., Ranjan, R., Wang, L., Khan, S.U., Chen, J.: CloudGenius: a hybrid decision support
method for automating the migration of web application clusters to public clouds. IEEE Trans.
Comput. (2014). https://doi.org/10.1109/TC.2014.2317188
9. Latif, R., Abbas, H., Assar, S., Ali, Q.: Cloud computing risk assessment: a systematic literature
review. In: Future Information Technology, pp. 285–295. Springer, Berlin, Heidelberg (2014)
10. Fernandes, D.A.B., Soares, L.F.B., Gomes, J.V., Freire, M.M., Inácio, P.R.M.: Security issues
in cloud environments: a survey. Int. J. Inform. Sec. 13(2), 113–170 (2014)
11. Khan, A.N., Kiah, M.L.M., Ali, M., Madani, S.A., Shamshirband, S.: BSS: block-based sharing
scheme for secure data storage services in mobile cloud environment. J. Supercomput. 70(2),
946–976 (2014)
12. Rong, C., Nguyen, S.T., Jaatun, M.G.: Beyond lightning: a survey on security challenges in
cloud computing. Comput. Electr. Eng. 39(1), 47–54 (2013)
13. Subashini, S., Kavitha, V.: A survey on security issues in service delivery models of cloud
computing. J. Netw. Comput. Appl. 34(1), 1–11 (2011)
14. Modi, C., Patel, D., Borisaniya, B., Patel, A., Rajarajan, M.: A survey on security issues and
solutions at different layers of cloud computing. J. Supercomput. 63(2), 561–592 (2013)
15. Hashizume, K., Rosado, D.G., Fernndez-Medina, E., Fernandez, E.B.: An analysis of security
issues for cloud computing. J. Internet Serv. Appl. 4(1), 1–13 (2013)
16. Che, J., Duan, Y., Zhang, T., Fan, J.: Study on the security models and strategies of cloud
computing. Proc. Eng. 23, 586–593 (2011)
A Machine Learning Approach in Data
Perturbation for Privacy-Preserving
Data Mining
Jayanti Dansana and Adarsh Singh
Abstract Data mining is a process where we can extract relevant information or

patterns from the collection of data. In this era of big data, every organization aims
to handle huge amounts of data and perform data mining techniques in order to extract
pieces of information or patterns for various work and decision making. To protect
privileged data and leakage of private information, the clients use different privacy-
preserving techniques such as perturbation that protects client’s data from revealing
private information. The job of perturbing data on the client side is a herculean task,
and it gets more difficult with the increase in the size of data. In this paper, we
proposed a machine learning regression model that has been trained in such a way
that it predicts the perturb data from original data and it even contains a comparative
study of different regression models and their accuracy in perturbing the data.
1 Introduction
Data come with huge complexity and size, and in order to bring out necessary pieces
of information or patterns, different techniques are used. Organizations today not only
face problems in application of different information extracting techniques but also
face problems in collecting the relevant datasets from different clients. Therefore, it
makes up a distributed system where the data from different parties are collected at
the server side, and the collected data are then fed to different information extracting
techniques for getting the needed information. During this process of sharing data
over distributed system, the parties face the problem of preserving its privacy since
the private data that the parties share with the other parties can get misused. In
order to avoid such situations, privacy-preserving techniques were developed that
can preserve the privacy of data getting shared on a distributed system, and these
techniques are divided into three major categories such as cryptography, perturbation,
and anonymization. Data perturbation techniques have widely been used by various
J. Dansana (B) · A. Singh

KIIT Deemed To Be University, Bhubaneswar, Odisha, India
e-mail: jayantifcs@kiit.ac.in
https://doi.org/10.1007/978-981-16-1502-3_64
646 J. Dansana and A. Singh
parties for perturbing their data before sending it to the server side. To preserve their
privacy and to avoid unnecessary threats to any individual, perturbation technique
includes various methods for preserving the privacy. In this paper, we have studied the
noise addition schema used for privacy preservation, which has widely been accepted,
but the implementation bringing a huge workload over to the client-side which by
design increases as we increase the size of data that needs to be perturbed. By using
the machine learning approach, the workload on the client-side can drastically be
reduced.
The rest of the paper is organized as follows: Sect. 2 recapitulates the various works
in this area. Section 3 explains the proposed algorithm and its usage in distributed
architecture. Section 4 explains the experimentation carried out using regression
models. Finally, the paper is concluded with its contribution in the field of privacy-
preserving data mining and its future work.
2 Literature Survey
2.1 Related Work
In previous years, distributed data collection came into the picture, and with the rise
of the threat to privacy for client’s data, different privacy-preserving algorithms have
been developed which have been found to be really useful and effective in preserving
the privacy of any data but surely with a trade-off between accuracy and privacy.
These different approaches of preserving privacy data mining (PPDM) in a distributed
scenario studied extensively by the author in [1]. This approach has been implemented
and experimented, and its relevance has also been calculated in [2]. These different
approaches of preserving privacy data mining (PPDM) in a distributed scenario
has been studied extensively by the author in [1, 3] and been implemented and
experimented with by [2]. These privacy-preserving techniques consist of different
methods such as oblivious transfer—a protocol in which a sender sends one of the
relevant pieces of information to the accepter but remains oblivious to the whole
information sent to the accepter, this methodology has been well implemented by
Ding and Klein [4]. Secure multi-party computation is a type of protocol which does
not reveal any data other than the result, and this model of privacy preserving has
been well implemented by Dansana et al. [5] has been analyzed. Secure multi-party
computation — a protocol that does not reveal any data other than the result, and this
model of privacy-preserving has been well implemented by Dansana et al. [5] and
has been analyzed by Teo et al. [6].
Perturbation is a simple yet effective technique to preserve the privacy of data as
this approach deals with manipulation, randomization, distortion, or deformation of
data in such a way that it creates a great trade-off between the preserving privacy and
getting accuracy results on the server size, and the technique of privacy-preserving
involves different methods as discussed involves modification by means of noise
A Machine Learning Approach in Data Perturbation … 647
addition [9–12], data accretion [13, 14], data exchange [15, 16], repression [17, 18],
original transformation [19, 20], and randomization [21].
Anonymization is a type of information suppressing technique involving steps
like encryption of data or removal of identifiable information, comparatively studied
by Rashid and Hegazy [22].
2.2 Overview of Noise Addition Schema in Decision Tree
The machine learning regression model proposed in this paper is trained by using
the manually calculated perturbed data obtained from the noise addition perturbation
technique [16] as the target class of the training dataset, with a set of engineered
features.
This approach of perturbation [12] uses noise addition technique by adding
specific noise to the numeric attributes after obtaining the decision tree of the original
data. It involves different algorithms for noise addition in numerical attributes and
categorical attributes, and it first checks if the attribute is numerical or categorical and
then uses perturbation techniques for leaf reaching path attributes (PTLRPA) [16] and
perturbation techniques for leaf wrong path attributes (PTLWPA) [16] for numerical
data or categorical attribute perturbation technique (CAPT) [16] for categorical data
(Table 1).
This was an Naive overview of noise addition schema which has been used manu-
ally to perturb the individual attribute in order toconstruct the target class of our
training dataset upon which the regression model will be trained and eventually
generate the predicted perturbed value of the testing dataset, and thereafter, this
model will work in a distributed system where multiple parties will be using the
models to perturb their data and then sending it to the server where the collected data
will be used for data mining (Table 2).
Table 1 Perturbed data

Kyphosis Age Number Start
Absent 61.931577 2.931577 17.931577
Absent 37.876281 3.876281 16.876281
Absent 113.437496 2.437496 16.437496
Present 59.078497 6.078497 12.078497
Present 82.068515 5.068515 14.068515
Absent 148.380582 3.380582 16.380582
Absent 18.593798 5.593798 2.593798
Absent 1.635813 4.635813 12.635813
Absent 168.380032 3.380032 18.380032
Absent 1.87747 3.87747 16.87747
Table 2 Unperturbed data

Kyphosis Age Number Start
Absent 61 2 17
Absent 37 3 16
Absent 113 2 16
Present 59 6 12
Present 82 5 14
Absent 148 3 16
Absent 18 5 2
Absent 1 4 12
Absent 168 3 18
Absent 1 3 16
3 Privacy-Preserving Perturbation
In order to obtain the training data, we have used the noise addition schema in
decision trees for privacy-preservation [12] for which we trained the CART decision
tree algorithm on the diabetes dataset and went on calculating the perturbed form
of each attribute through base traditional approach [12]. The perturbed data can be
used as the target class whereas the original data will be used as the feature class for
training the model.
3.1 Construction of Training Dataset
The machine learning regression approach needs huge datasets to get trained and
predict values, but for obtaining a good training dataset such that it does not over
fit or under fit the model, we need to have relevant attributes and class label, and to
construct the training data, we have kept four attributes
1. The numeric attribute
2. These three statistical attributes are probabilistic density function (PDF), mean
and standard deviation.
3. Mean of the attribute.
4. The perturbed data manually calculated through noise addition schema [12]
In order to train the model, a large dataset is required. So, each attribute is aligned
with their normal distribution, mean and its perturbed data horizontally in such a
way that it increases the data size and even aligned it in such a way that it will be
able to train the model effectively.
3.2 Model Planning
In this phase, we planned the methods or the workflow we intend to use to construct
the model for getting a feasible perturbation according to the training data and our
problem statement. Based on the problem statement, four regression analyses are
considered for experimentation.
1. Linear regression
2. Lasso regression
3. Random forest regression
4. Decision tree regression.
3.3 Model Building
In the third phase, training will be done with the planned model with the constructed
training data, making sure that it does not over fit or generalize our model and also
considering whether its existing tools will suffice for running the models, or if it
needs a more robust environment for executing the model and workflow. Thereafter,
we used this trained model for finding the perturb value of our testing dataset which
consists of only three attributes. The probabilistic density function (PDF) of each
record for a normal probabilistic density function where mean is the attribute’s mean
and standard deviation is the attribute’s standard deviation.
3.4 Algorithm for Model Perturbation
Let X be the attribute that needs to be perturbed.

Step 1—Construct class label.
Calculate the perturbed data manually for distributing X through noise addition
schema [12].
Step 2—Construction of training data: In this step, we have added new columns
such as mean, standard deviation and probability density function of the records
along with the attribute X in the feature class and the perturbed form of attribute X
obtained from step-1 as the target class.
Step 3—Regression model planning: In this step, we plan to use the regression
model considering the following parameters, i.e., type of problem, size of training
data, accuracy, linearity, and training time.
Step 4—Model training: The model will be trained using the regression model
considering the parameter mentioned in step-3.
Step-5—Predicting perturbation.
This step will generate predicted perturbed form of the original data by feeding
our original dataset in testing data format, into our trained model from Step-4, which
Fig. 1 Training model
now can be sent to the server where it gets integrated with other client’s data, and
finally, data mining tools are applied on the collected data for information extraction
(Fig. 1).
3.5 Distributed Data Mining Architecture
Data mining requires large amount of data in order to extract useful information and
to help in decision making, but these large amount data are usually not available at
one place, therefore, we seek distributed data mining in which the data are collected
from individual parties at the server, where the data mining tools are applied, and this
reduces the complexity, memory cost and preserves privacy through resource sharing
[24]. In our proposed work, we have implemented our trained machine learning
perturbation model to work for distributed data mining. Each party will have their
own individual trained model which will perturb the data that they need to send to
the server.
Fig. 2 Comparison on different classifier accuracy
In the initial phase, we conducted our experiment on test dataset, to find the suitable
model and thereafter with the other dataset. The model is trained on our training
dataset.
Decision tree regression has performed the best out of four algorithms with
minimum accuracy difference. There is a difference between the accuracies of deci-
sion tree classifier [22] on unperturbed dataset and perturbed dataset since it is not
an ideal case, therefore, we cannot accept the perturbed dataset to act same as the
unperturbed, and we need to have a trade-off between our privacy that has been
preserved [23] and the accuracy of the dataset. We have done the accuracy compar-
ison of decision tree classifier when trained [24] upon model’s perturbed data and
the original data on four different dataset mentioned so as to showcase the efficiency
and effectiveness of this approach. Decision tree regressor algorithm has been used
for model building, since it has shown desirable results on the dataset (Figs. 2 and 3;
Tables 3 and 4).
5 Conclusion
The proposed machine learning regression model approach is an efficient way which
reduces the time complexity for perturbation on the client side. This approach makes
sure that the criticism faced by different methods of perturbation does not hold
on when implemented through this technique. Thereafter, this regression model
Fig. 3 Accuracy comparison on different data set
Table 3 Decision tree classifier accuracy

Algorithms Decision tree classifier accuracy Decision tree classifier accuracy
(in %) (Perturbed data) (in %) (Original data)
Linear regression 80 88
Lasso regression 80
Random forest regressor 76
Decision tree regressor 84
Table 4 Comparative accuracy on different data set using Lasso regression

Dataset Decision tree classifier accuracy Decision tree classifier accuracy
(in %) (perturbed data) (in %) (original data)
Brest-cancer dataset 90.05 92.39
Stock-index prediction 52.38 53.19
Iris dataset 97.77 98.06
Heart disease 79.12 80.21
approach can be effectively used for data perturbation and preserving privacy in
a distributed system for data mining. In the context of distributed data mining, this
approach of data perturbation deals with the issues of privacy-preserving data mining.
Future research, this approach of model perturbation can be used for implementing
other better perturbation techniques with better training and hyperparameter tuning
so as to propose a better framework in privacy.
References
1. Shah, A., Gulati R.: Privacy-preserving data mining: techniques, classification and implica-
tion—A survey. Int. J. Comput. Appl. 137(12) (2016)
2. Pinkas B.: Cryptographic techniques for privacy-preserving data mining ACM SIGKDD
Explor. 4(2), 12–19 (2002)
3. Shah, A., Gulati, R.: A survey on cryptographic techniques for privacy-preserving data mining.
Int. J. Data Wareh. Mining 2(1), 8–12 (2012)
4. Ding Y., Klein K.: Model-Driven application-level encryption for the privacy of e-health data.
In: International Conference on Availability, Reliability and Security(2010)
5. Dansana, J., Kumar, R., Dey, D.: Modified Ck secure sum algorithm in horizontally parti-
tioned databases. In: International Conference on Research and Development Prospects on
Engineering Technology, ICRDPET-2013, vol. 5
6. Teo, S.G., Shuguo Han, V.L,: A study of efficiency and accuracy of secure multiparty protocol
in privacy-preserving data mining. In: 26th International Conference on Advanced Information
Networking and Applications Workshops, pp. 85–90 (2012)
7. Zhan, J., Matwin, S., Chang, L.W.: Privacy-preserving collaborative association rule mining,
J. Netw. Comput. Appl. 30(3), 1216–1227 (2007)
8. Kargupta, H., Datta, S., Wang, Q., Sivakumar, K.: On the privacy-preserving properties of
random data perturbation techniques. In ICDM, pp. 99–106. IEEE Computer Society (2003)
9. Agrawal, R., Srikant, R.: Privacy-preserving data mining. In: The Proceedings of the ACM
SIGMOD Conference, pp. 429–450 (2000)
10. Muralidhar, K., Sarathy, R.: A general additive data perturbation method for database security.
J. Manage. Sci. 45(10), 1399–1415 (2002)
11. Agrawal, D., Aggarwal, C.C.: On the design and quantification of privacy-preserving data
mining algorithms. In: ACM PODS Conference, pp. 247–255 (2002)
12. Kadampur, M.A., Somayajulu, D.V.L.N.: A noise addition scheme in decision tree for privacy-
preserving data mining. J. Comput. 2(1), 137–144 (2010)
13. Li, Y., Zhu, S., Wang, L., Jajodia, S.: A privacy-enhanced micro aggregation method. In:
Proceedings of 2nd International Symposium on Foundations of Information and Knowledge
Systems, pp. 148–159 (2002)
14. Iyengar, V.S.: Transforming data to satisfy privacy constraints. In: Proceedings of SIGKDD’02,
Edmonton, Alberta, Canada (2002)
15. Fienberg, S.E., McIntyre, J.: Data swapping: variations on a theme by Dalenius and Reiss. J.
Off. Stat. 2, 309–323 (2005)
16. Muralidhar, K., Sarathy, R.: Data shuffling—A new masking approach for numerical data.
Manage. Sci. Forthcoming 529, 658–670 (2006)
17. Hintoglu, A.A., Saygin, Y.: Suppressing microdata to prevent probabilistic classification based
inference. In: Proceedings of Secure Data Management, 2nd VLDB Workshop, pp. 155–169
(2005)
18. Rizvi, S., Harista, J.R.: Maintaining data privacy in association rule mining. In: Proceedings
of 28th VLDB Conference, Honk Kong China, pp. 682–693 (2002)
19. Mukherjee, S., Chen, S., Gangopadhyay, A.: A privacy-preserving technique for euclidean
distance-based mining algorithms using fourier-related transforms. VLDB J. 293–315 (2006)
20. Xu, S., Lai, S.: Fast Fourier transform based data perturbation method for privacy protection.
In: Proceedings of the IEEE Conference on Intelligence and Security Informatics, pp. 222–225.
New Brunswick, New Jersey (2007)
21. Malik, M.B., Ghazi, M.A., Ali, R.: Privacy-preserving data mining techniques: current scenario
and future prospect. In: Third International Conference on Computer and Communication
Technology, pp. 26–32 (2012)
22. Rashid, A.H. Hegazy, A.: Protect privacy of medical informatics using K-anonymization model.
In: The 7th International Conference on Informatics and Systems (INFOS), pp. 1–10. Cairo
(2010)
23. Rizvi, S., Harista, J.: Maintaining data privacy in association rule mining. In: Proceedings of
28th VLDB Conference, pp. 82–693. Honk Kong, China (2002)
24. Dansana, J., Kumar, R., Rautaray, J.: Techniques for privacy preserving association rule mining
in distributed database. IRACST Int. J. Comput. Sci. Inf. Technol. Secur. (IJCSITS) 2(6) (2012)
IoT Service-Based Crowdsourcing
Ecosystem in Smart Cities
Arijit Dutta, Ruben Roy, Chinmaya Misra, and Kamakhya Singh
Abstract In this information era, online access gives netizens the opportunity to post
or interact with each other. Online crowdsourcing is also known as citizen science.
The rapid increase of service and demand for IoT devices drive the attention towards
crowdsourcing, and the most eye-seeking part is that it involves the participation
of the individual. It also can be stated as receiving services, ideas, or solutions to
problems by getting connected to large groups of people via the Internet. Obviously,
having a huge, well-disciplined network would be of prime importance in this case.
Millions of devices are connected which may congest the network due to heavy
traffic. To deal with the situation, researchers are explored different aspects to handle
the situations. So, in this paper, we propose a reliable fog-based spatial-temporal
crowdsourcing. Here, we try to tinker the data processing that takes place between
fog nodes and cloud. We use the batch processing method for saving energy. However,
how to allocate the tasks to proper fog nodes and eventually improve communication
efficiency are critical.
1 Introduction
The Internet has become such a big thing in our lives; for any information, we look for
Google and most of the time Google point towards Wikipedia where we get to know
almost everything. To build such a platform having a huge amount of information is a
big thing, the concept of crowdsourcing plays a vital role and makes it most compre-
hensive. Thanks to our growing connectivity due to which concepts like crowd-
sourcing come into the picture. It increases productivity and reduces labour expenses.
A. Dutta
School of Computer Engineering, KIIT Deemed to be University, Bhubaneswar, India
R. Roy
Department of IT, Government College of Engineering and Leather Technology, Kolkata, India
C. Misra (B) · K. Singh
School of Computer Application, KIIT Deemed To Be University, Bhubaneswar, India
https://doi.org/10.1007/978-981-16-1502-3_65
656 A. Dutta et al.
It is a sort of invitation of broad communities who are eventually customers and

execute it on a large scale. Anybody can handle crowdsourcing, namely companies,
governments, groups, and even individuals. Crowdsourcing works in four different
ways [1, 2].
Firstly, it enables us to have a huge online labour force for our work. We identify
our workers by some selection criteria or we can let the interested labour find our
work. Secondly, we can post our work online for which we want a solution. Thirdly,
there could be a scenario where we have the knowledge available with us, but in a
much-scattered way. Hence, we would need the help of people to filter and organize
it. Lastly, we also need the crowd to get feedback or opinions and ideas. People use
crowdsourcing for different purposes. When we take the help of the crowd to collect
and organize information, it is termed as accessing distributive knowledge (Fig. 1).
The process of collecting funds from the people believing in our cause is also
facilitated by crowdsourcing and is termed as crowdfunding [3]. Each one can make
small donations which adds up to produce a good sum. When we use crowdsourcing
to get access to an on-demand scalable workforce, it is called crowd labour (Fig. 2).
In this world of information era, the use of different sensors and applications based
on IoT gaining popularity rapidly[3]. By this year end, Cisco companies expecting
that 50 billion devices will send data and this huge data volume may congest our
network. To reduce the load of networking traffic, lots of network management
scheme is introduced so that it can be managed in a better manner. Cloud and fog
architecture provides better data management in this scenario [4, 5].
Fig. 1 Fog-based smart city

architecture
IoT Service-Based Crowdsourcing Ecosystem in Smart Cities 657
Fig. 2 Graphical representation of the workflow of crowdsourcing in IoT solutions
We have observed that cloud computing scheme also facing some issues like QoS
like latency, jitter, and delay or packet loss [6–8]. To improve this QoS, we have
to satisfy the constraints like bandwidth constraint, energy consumption, and delay-
sensitive real-life streaming handling. Fog and edge computing give us some light
to handle these issues, and it has been all accepted by both industries and academics
[9, 10].
Internet of things encounters volatile data streams, and because of obvious reasons,
the situation is going to be more severe, data is to be processed change permanently,
so the computational resources needed to be reconfigured and most importantly fog
provides a better edge towards reducing latency than the cloud-based computation
[2, 11].
From various survey results, it is found that every year we lose 3.1 trillion dollars
due to delay of data and poor quality of data, The security, reliability, scalability,
cost, and response time are some of the areas to keep an eye on. The bandwidth for
the increased data increments by 50% every year. So data filtering is an important
aspect to look after, and real-time-sensitive data are to be processed in fog nodes. We
have different methods to process data like interactive processing, batch processing,
and so on, and all these have their own advantages and disadvantages in different
applications. Here in this paper, we are going to propose a batch processing model
(Table 1).
2 Model Introduction
Let suppose that due to some reasons or deliberately we want a single processor
working in the cloud, with this approach, we have to consider the selection of data
for batch processing, data need to be analysed with a set of pattern, rules, and actions
using recursive or compound analysis. A set of conditions come into the picture for
658 A. Dutta et al.
Table 1 Themes based on

Themes Relevant studies
research in smart cities
Smart mobility Vehicle tracking Lee et al. [7]
Internet of vehicles Zhu et al. [8]
Smart living Public safety Breetzke and
Flowerday [9]
Healthcare Hussain et al.
[10]
Smart environment Air pollution, quality Castelli et al. [11]
Water quality Corbett and
Mellouli [12]
Smart citizens Social interactions, Sproull and
communications Patterson [13]
Smart government Social media Díaz-Díaz and
Pérez-González
[14]
Websites Fietkiewicz et al.
[15]
Smart economy Smart business Johnson et al.
[16]
M-commerce Keegan et al. [17]
Smart architecture Data exchange Aguilar et al. [18]
and technologies Data processing Hashem et al.
[19]
Data storage Huang et al. [20]
the aggregation of data, network definition, and meta information also plays a role
here.
If we use interactive processing here, then there will be a huge amount of data in
queue at waiting status so response time will be more and also energy consumption
will be more because the processor is the active whole time. In the case of batch
processing, the processor will be active only when an amount and type of data will
be gathered from fog layer for final processing.
So according to our requirements, batch processing engines are designed to
process a comparatively larger datasets efficiently. This approach is also feasible
when a different type of data from different devices are processed together. Each fog
node will take care of a specific dataset.
In this section, we have discussed bulk processing for our proposed IoT-based
smart city cloud architecture. We have derived the response time, waiting time in
buffer, and packet loss in the system. When IoT senses data and forwards it to the fog
layer, the fog layer removes noise and reduced redundancy. The fog layer forwards
to cloud layer for further storage.
• The arrivals of IoT data are independent and follow the Poisson distribution and
they ate independently.
• The processing is independent and they follow the first come first serve (FCFS)
basis, and they also follow the Poisson distribution and represented by μ.
• The buffer size is limited and value is N.
• We have considered heterogeneous environment as in real life, the systems have
different speed.
3 Algorithm for Saving Energy
Input: Request from IoT Devices
Output: Acknowledgement after Execution
Start;
If(buffer holding delay sensitive packets)

{
Label:busy_sensitive
/* The IoT Layer Request Fog layer for service*/
Service_Activate_Fog();
/* Fog Layer able to execute Request*/
Acknowledgement= urgentProcessing();
/*Fog sends the acknowledgement to IoT Layer*/
RETURN(Acknowledgement);
If(packet) goto busy_sensitive
else partial_sleep()
}
If(buffer holding delay tolerant packets)
{
Label:busy_tolerant
/* The IoT Layer create buffer of size ‘A’ and Request Cloud layer for
service*/
Service_Activate_Cloud();
/* Cloud Execute Request receive Acknowledgement*/
Acknowledgement= Batchprocessing();
/*cloud sends the acknowledgement to IoT Layer*/
RETURN(Acknowledgement);
If(packet) goto busy_tolerant
else full_sleep();
}
End
660 A. Dutta et al.
3.1 Performance and Cost Matrices
In this section, we have defined the probability of staying busy P(B) or the probability
of staying full sleep mode P(V ) or partial sleep mode P(W ).
∞
∞
∞

P(B) = πi,2 , P(V ) = πi,1 and P(W ) = πi,0
i=1 i=0 i=0
We have derived an average number of data packets present in the buffer (L s ),

the average number of packets in the system (L q ), the average waiting in the system
(W s ), the average waiting time in the queue (W s ) are given by
∞
∞
∞
∞

Ls = i(πi,0 + πi,1 + πi,2 ), L q = (i − 1)πi,0 iπi,1 + (i − 1)πi,2
i=1 i=1 i=1 i=1
Using Little’s algorithm, W s can be defined as
Ws = L a /λ.
3.2 Numerical Results and Analysis
We have simulated our proposed system using Python 3.6-based simulator. In Fig. 3a.
we have shown the impact of η on average waiting time (L q ) of the packets in the
buffer for full sleep mode and partially sleep mode. In the figure, it has been observed
that the average waiting time in the buffer will be less in partial sleep mode compare
to full sleep mode. Hence, it will be handled more effectively with real-time health
Fig. 3 a Impact of η on L q in the buffer residing in IoT plane. b Impact of μ on W q in the buffer
residing in IoT plane
Fig. 4 a Average waiting time in queue for processing 200 MB data using the proposed architecture.
b Packet loss in the system for processing 200 MB data using the proposed architecture
data for processing in fog level and sends an acknowledgement to IoT layer. Delay-
tolerant traffic will accumulate in the buffer and will be transmitted when batch
size will be “A”. Power efficiency will be comparatively better as waiting time in
the buffer is less, and in real life, fog-level service rate is usually less comparative
to cloud level. Less power will be consumed for a lower service rate. The other
parameters are λ = 3.0, μ = 4.0, φ = 0.2, and ψ = 0.1. The effect of service rate
on waiting time in the queue has been depicted in Fig. 3b. From the figure, it can be
observed that when μ is less, the delay for both traffic delay will be less. But with the
increase of service rate, the delay will be more in case of fully sleep mode compared
to partial sleep mode. As it has been stated earlier that delay-tolerant traffic will use
fully sleep mode and real-time urgent health data will incorporate partial sleep mode
for reducing the delay in the buffer.
We have simulated our proposed system using Python 3.6-based simulator, and in
Fig. 4, we have shown the average waiting time in the buffer for transfer of 200 MB
data. We have run the simulator for arrival process 750 jobs per second and processor
can process 700 jobs per sec. We have run the simulator for 2 min 30 s. Similarly in
Fig. 4, we have depicted packet loss in the system.
4 Conclusions
In this era of IoT, there is a tremendous growth of wearable and home or city appli-
cations. All these applications need internet-connected devices which need real-
time low latency services. For further processing and storing the huge data, cloud
computing framework is very popular. To enhance the application’s efficiency, fog
computing is also included. We have study the impact of arrival rate on packet loss
and average waiting time in the queue. In future, we have the plan to handle big data
and health data of enormous sizes. To reduce the waiting time in the queue, we have
to make some changes in the framework.
662 A. Dutta et al.
References
1. Rao, R.M., Fontaine, M., Veisllari, R.: A reconfigurable architecture for packet based 5G trans-
port networks. In: IEEE 5G World Forum, 5GWF 2018—Conference Proceedings, pp. 474–477
(2018)
2. Misra, C., Goswami, V.: Analysis of power saving class II traffic in IEEE 802.16 E with multiple
sleep state and balking. Found. Comput. Decis. Sci. 40(1), 53–66 (2015)
3. Barik, R., et al.: Fog2fog: augmenting scalability in fog computing for health GIS systems. In:
2017 IEEE/ACM International Conference on Connected Health: Applications, Systems and
Engineering Technologies (CHASE). IEEE (2017)
4. Tang, B., Chen, Z., Hefferman, G., Wei, T., He, H., Yang, Q.: A hierarchical distributed fog
computing architecture for big data analysis in smart cities. In: Proceedings of the ASE BigData
& SocialInformatics 2015, p. 28. ACM (2015)
5. Ema, R.R., Islam, T., Ahmed, M.H.: Suitability of using fog computing alongside cloud
computing. In: 2019 10th International Conference on Computing, Communication and
Networking Technologies (ICCCNT), pp. 1–4. IEEE (2019)
6. Goswami, V., Misra, C.: Discrete-time modelling for performance analysis and optimisation
of uplink traffic in IEEE 802.16 networks. Int J Commun Netw Distrib Syst 10(3):243–257
(2013)
7. Lee, G., Mallipeddi, R., Lee, M.: Trajectory-based vehicle tracking at low frame rates. Expert
Syst. Appl. 80, 46–57 (2017)
8. Zhu, W., Gao, D., Zhao, W., Zhang, H., Chiang, H.: SDN-enabled hybrid emergency message
transmission architecture in internet-of-vehicles. Enterp. Inf. Syst. 12(4), 471–491 (2018)
9. Breetzke, T., Flowerday, S.V.: The usability of IVRs for smart city crowdsourcing in
developing cities. Electron. J. Inf. Syst. Dev. Countries 73(1), 1–14 (2016)
10. Hussain, A., Wenbi, R., Da Silva, A.L., Nadher, M., Mudhish, M.: Health and emergency-care
platform for the elderly and disabled people in the smart city. J. Syst. Softw 110, 253–263
(2015)
11. Castelli, M., Gonçalves, I., Trujillo, L., Popovič, A.: An evolutionary system for ozone
concentration forecasting. Inf. Sys. Front. 19(5), 1123–1132 (2017)
12. Corbett, J., Mellouli, S.: Winning the SDG battle in cities: How an integrated information
ecosystem can contribute to the achievement of the 2030 sustainable development goals. Inf.
Syst. J. 27(4), 427–461 (2017)
13. Sproull, L., Patterson, J.F.: Making information cities livable. Commun. ACM 47(2), 33–37
(2004)
14. Díaz-Díaz, R., Pérez-González, D.: Implementation of social media concepts for e-government:
Case study of a social media tool for value co-creation and citizen participation. J. Org. End
User Comput. 28(3), 104–121 (2016)
15. Fietkiewicz, K.J., Mainka, A., Stock, W.G. (2017). eGovernment in cities of the knowledge
society. An empirical investigation of smart cities’ governmental websites. Govern. Inf. Q.
34(1), 75–83.
16. Johnson, P., Iacob, M.E., Välja, M., van Sinderen, M., Magnusson, C., Ladhe, T.: A method
for predicting the probability of business network profitability. Inf. Syst. e-Business Manage.
12(4), 567–593 (2014)
17. Keegan, S., O’Hare, G., O’Grady, M.: Retail in the digital city. Int. J. e-Business Res. 8(3),
18–32 (2012)
18. Aguilar, J., Sanchez, M.B., Jerez, M., Mendonca, M.: An extension of the MiSCi middleware
for smart cities based on fog computing. J. Inf. Technol. Res. 10(4), 23–41 (2017)
19. Hashem, I.A.T., Chang, V., Anuar, N.B., Adewole, K., Yaqoob, I., Gani, A., Ahmed, E.,
Chiroma, H.: The role of big data in smart city. In. J. Inf. Manage. 36(5), 748–758 (2016)
20. Huang, K., Zhang, X., Wang, X.: Block-level message-locked encryption with polynomial
commitment for IoT data. J. Inf. Sci. Eng. 33(4), 891–905 (2017)
On Interior, Exterior, and Boundary
of Fuzzy Soft Multi-Set Topology
S. A. Naisal and K. Reji Kumar
Abstract In this paper, our focus is on the properties of the operations of fuzzy
soft multi-sets. The notions of fuzzy soft multi-open sets, fuzzy soft multi-closed
sets and soft multi-neighborhood on fuzzy sets are included, and some results on
exterior, interior and boundary of fuzzy soft multi-set topology are presented.
1 Introduction
We experience different kinds of vagueness and uncertainties in our daily life. Chang-
ing nature of environment and the subjectivity of human consciousness is an impor-
tant reason for uncertainties or vagueness. The classical set theory, which deals with
exact and accurate concepts, is not enough to model vagueness and uncertainties.
Fuzzy sets, soft sets and multi-sets help us to rectify the inability of the classical
theory.
The concept of fuzzy sets was introduced by Zadeh [1], while soft set was first stud-
ied by Molodtsov [2] and the rough sets [3] by Pawlak. Molodtsov gives parametriza-
tion of soft sets [2]. He applied soft set theory, in many fields, such as the Riemann
integral and game theory. Maji et al. [4] applied the soft sets in problems on decision
making. Chen et al. [5] and Maji et al. [4] have defined and studied fuzzy soft sets
by combining the notions of fuzzy sets and soft sets. Alkhazaleh et al. [6] combined
the concepts of soft sets and multi-sets. Applications of soft multi-set weree given
by Salleh and Alkhazaleh. Alkhazaleh and Salleh [7] also combined the concepts of
fuzzy sets, soft sets and multi-sets.
In this paper, we focus on a detailed study of the concepts explained in [8]. We
need the following definitions for which we owe to [2, 4, 7, 9].
In this discussion, U stands for the universal set. Soft set over U is defined in
[2]. Consider the initial universe U , and the set of parameters E. P(U ) represents
S. A. Naisal
Government Institute of Teacher Education, Alappuzha, Kerala, India
K. Reji Kumar (B)
N.S.S. College, Cherthala, Alappuzha, Kerala, India
https://doi.org/10.1007/978-981-16-1502-3_66
664 S. A. Naisal and K. Reji Kumar
power set. Then the pair (G, B), where B subset of U is a soft set, such that G is a
mapping from B to P(U ). A multi-set M related to the set X , determined by C(M ),
where C(M ) is a function defined from X to N . Here, N represents the set of all
non-negative integers. In the definition of soft sets if we replace P(U ) by I U , then
the pair (G, B) is a fuzzy soft set over U [4].
Let {Ui : i ∈ I } be a collection of universes satisfying the condition that ∩i∈I Ui =
φ and EUi : i ∈ I is a collection of sets of parameters. Also, let U = i∈I P(Ui ),
where P(Ui ) denotes the power set of Ui and E = i∈I EUi and B ⊆ E. Alkhazaleh et
al. [7] defined the pair (G, B) as a fuzzy soft multi-set over U , where G is a mapping
such as G : B → U , for every b in B, G(b) = ({ μG(b)u (u) }; i ∈ I ). Also, in [7], the
union and intersection of two fuzzy soft multi-sets are defined.
2 Some Topological Concepts Related to Fuzzy Soft

Multi-Set Topology
In this section, we discuss the exterior, boundary and interior of fuzzy soft multi-sets
and study some of its properties. We consider the two fuzzy soft multi-topological
spaces (U, E, τ1 ) and (U, E, τ2 ). If τ2 ⊇ τ1 , then τ2 is soft finer than τ1 . If τ2 ⊃ τ1 ,
then τ2 is soft strictly finer thanτ1 . Let (U, E, τ ) be a fuzzy soft multi-topological
space over (U, E), and the elements of τ are termed as fuzzy soft multi-open set in
(U, E, τ ).
Consider (U, E, τ ) as a fuzzy soft multi-topological space over (U, E). Then the
soft set (G, E) over B is termed as a fuzzy soft multi-closed set in B, if the relative
complement of (G, B) belongs to (G, E) . FBe is named as a fuzzy soft multi-point
in (U, E) if we can develop an e ∈ (G, B) where G(e) = 0 also for e ∈ B − {e},
G(e ) = 0.
Example 1 We consider the three universes U1 , U2 , U3 . Suppose P wishes to buy a

home for accommodation, a four-wheeler car and a plot for business. Take a fuzzy
soft multi-set (G, B) which narrates homes, four-wheeler cars and plots that P is
going to take for family accommodation, transportation and to begin a new business.
Consider U1 = {h1 , h2 , h3 , h4 }, U2 = {c1 , c2 , c3 }, U3 = {p1 , p2 } and let {EU1 , EU2 ,
EU3 } be the collection of sets of decision parameters taking in consideration of above
universe, where EU1 = {eU1,1 = expensive, eU1,2 = cheap, eU1,3 = wooden, eU1,4 =
in green surroundings} EU2 = {eU2,1 = expensive, eU2,2 = cheap, eU2,3 = sporty}
EU3 = {eU3,1 = expensive, eU3,2 = cheap, eU3,3 = in town, eU3,4 = in a depth population}

Consider U = 3i=1 GS(Ui ), E = 3i=1 E(Ui ) and A ⊆ E such that A = {a1 =
{eU1,1 , eU2,1 , eU3,1 }, a2 = {eU1,1 , eU2,2 , eU3,1 }}(G 1 , B) = {(a1 , ({ 0.2 , 0.2 , 0.8 , h04 , }, { 0.8
h1 h2 h3 c1
,
p p p p
c2
, , }, { 0.8 , 0.7 })), (a2 , ({ 0.9 , 0.5 , 0.5 , 0.2 }, { 0.7 , 0.8 , 0.5 , }, { 0.5 , 0.5 }))(G 2 , B) =
0.5 0.4
c3 1 2 h1 h2 h3 h4 c1 c2 c3 1 2
{(a1 , ({U1 , U2 , U3 }, (a2 , φ)))}

p1 p2
(G 3 , B) = {(a1 , ({ 0.7 h1
, 0.7 , 0.1 , 0.8
h2 h3 h4
}, { 0.8
c1
, 0.6
c2
, 0.3
c3
, }, { 0.5 , 0.4 })), (a2 , ({ 0.9 , 0.5 , 0.5 ,
h1 h2 h3
p1 p2
h4
0.2
}, { ,
c1 c2
,
0 0.2 0.7
c3
, }, { ,
0.8 0.7
}))} are fuzzy soft multi-sets over (U, E).
On Interior, Exterior, and Boundary... 665
Example 2 In the above example if take (G, B) = {G(e1 ) = (a1 , ({ h01 , h02 , h03 , h04 },{ c01 ,
, , }, { p01 , p02 })), (a2 , ({ 0.1
c2 c3
0 0
h1
, 0.2 , 0.7 , 0.3 }, { 0.2
h2 h3 h4 c1
, 0.3
c2
, 0.5
c3 p1 p2
, }, { 0.5 , 0.4 }))}, were e2 ∈
(G, B), G(e2 ) = 0 and for e ∈ B − {e2 }, G(e ) = 0. Then G eB is a fuzzy soft multi-
point in (U, E).
A fuzzy soft multi-point G eB is said to be in fuzzy soft multi-set (G, B) if A ⊆ B

and for e ∈ A, F(e) ⊆ G(e) In our further discussion, we denote fuzzy soft multi-set
as FSMS
Take a fuzzy soft multi-set (G, B) and a FSMS point G eB ∈ (U, E) in a FSMS
topological spaces(U, E, τ ). Now the open fuzzy soft multi-set (I , C) in (U, E, τ )
an be treated as a neighborhood of FSMS point G eB , if there exist FSM open set
(G, B) such as G eB ∈ (G, B) ⊆ (I , C). The FSMS (G, B) in a FSM topological space
(U, E, τ ) is said to be a FSM neighborhood of the FSMS (G, B) if we can a FSM
open set (H , c) such that (G, B) ⊆ (H , c) ⊆ (I , C).
Example 3 Consider a FSMS (G, B) = {(G(e1 ) = (a1 , ({ 0.1 , 0.7 , 0.8

h1 h2
, 0.7 } { 0.6
h3 h4 c1
, 0.8
c2
,
p1 p2 p1 p2
c3
0.7
, }, { 0.6
, 0.8
}))), (G(e 2 ) = (a 1 , ({ ,
h1 h2
0.2 0.5
, ,
h3 h4
}{ c1
, c2
0.8 0.7 0.8 0.7 0.7
, c3
, }, { ,
0.7 0.8
})))},
Also consider a fuzzy soft multi-set point. Take a fuzzy soft multi-topology τ =
{φ, E, (G, B)}. Now take a fuzzy soft multi-set (H , B) = {(H (e1 ) = (a1 , ({ 0.3 , 0.8 ,
h1 h2
p1 p2
,
h3 h4
0.8 0.8
} { c1
, c2
0.7 0.8 0.8
, c3
}, { ,
0.7 0.9
}))}, (H (e 2 ) = (a1 , ({ ,
h1 h2
, h3
, h4
0.4 0.6 0.9 0.8 0.9 0.8
}{ c1
, c2
,
p1 p2
c3
0.9
, }, { ,
0.8 0.9
})))}. Clearly that soft multi-set point defined in Example 2.6 lies
in (G, B) ⊆ (H , B). Thus (H , B) is the FSM neighborhood of the fuzzy soft multi-
point. Also (G, B) ⊆ (H , c) ⊆ (I , C).
A FSM (G, B) over (U, E) is said to be a FSM closed set in (U, E, τ ) if its
compliment (G, B) is a FSM open set in (U, E, τ ).
p1 p2
Example 4 Consider (F1 , A) = {(a1 , ({ 0.2 , 0.2 , 0.8 , 0 , }, { 0.8
h1 h2 h3 h4
, 0.5 , 0.4
c1 c2 c3
, }, { 0.8 , 0.7 }))},
then (F1 , A) = {(a1 , ({ 0.8
h1
, 0.8 , 0.2 , 1 , }, { 0.2
h2 h3 h4 c1
, 0.5
c2
, 0.6
c3 p1
, }, { 0.2 p2
, 0.3 }))}, is a FSM open
set in (U, E, τ ). Thus, (F1 , A) is a FSM closed set in (U, E, τ ).
Exterior of a FSMS is defined as the complement of the interior of FSM, and it

is denoted by exte(G, B). That is exte(G, B) = inte(G, B)c . Exte(G, B) is a largest
open set contained in (G, B)c . Also bd (G, B) = cl(G, B)c = cl(G, B) ∩ cl(G, B)c .
Theorem 1 Take (U, E, τ ) a FSM topological spaces. Also take two soft multi-sets
(G, A) and (G, B). Then
(i) exte((G, A) ∪ (G, B)) = exte((G, A) ∩ (G, B))
(ii) exte((G, A) ∩ (G, B)) ≥ extee(G, A) ∪ exte(G, B)
(iii) inte(exte((G, A) ∪ (G, B))) = exte (G, A) ∩ ext(G, B)
(iv) inte(exte((G, A) ∩ (G, B))) ≥ exte(G, A) ∪ exte(G, B)
Proof Proof of (i): exte((G, A) ∪ (G, B)) = inte((G, A) ∪ (G, B))c = inte((G, A)c ∩
(G, B)c ) = inte((G, A)c ) ∩ inte((G, B)c )) = exte(G, A) ∩ exte(G, B).
Proof of (ii): exte((G, A) ∩ (G, B)) = inte((G, A) ∩ (G, B))c = inte((G, A)c ∪
(G, B)c ) ≥ inte((G, A)c ) ∪ inte((G, B)c )) = exte(G, A) ∪ exte(G, B).
Proof of (iii): inte(exte((G, A) ∪ (G, B))) = inte(exte(G, A) ∩ exte(G, B)) = inte

(int((G, A)c ) ∩ inte((G, B)c )) = inte((G, A)c ) ∩ inte((G, B)c ) = exte(G, A) ∩ exte
(G, B).
Proof of (iv): inte(exte((G, A) ∩ (G, B))) ≥ inte(exte(G, A) ∪ exte(G, B)) = inte
(exte(G, A)) ∪ inte(ext(G, B)) = inte(inte((G, A)c )) ∪ inte(inte((G, B)c )) = inte
((G, A)c ) ∪ inte((G, B)c ) = exte(G, A) ∪ exte(G, B)
Theorem 2 Take (U, E, τ ) as a FSMS topological spaces. Let (G, A) and (G, B)
be two FSMS. Then
(i) (bd (G, A))c = inte(G, A) ∪ exte(G, A)
(ii) exte((bd (G, A))c ) = exte(exte((G, A))) ∩ exte(inte((G, A))) ≥ φ
(iii) inte(G, A) ∨ bd (G, A) = cl(G, A)
(iv) bd (G, A) = cl(G, A) inte(G, A)
(v) inte(G, A) = (G, A) bd (G, A)
Proof Proof of (i):
(bd (G, B))c = (cl(G, A) ∩ cl((G, A)c ))c

= (cl(G, A))c ∪ (cl((G, A)c ))c
= inte((G, A)c ) ∪ inte(G, A)
= exte(G, A) ∪ inte(G, A)
Proof of (ii):
exte((bd (G, A))c ) = exte(exte(G, A) ∪ inte(G, A))

= exte(exte(G, A) ∩ exte(inte(G, A))
≥ inte(A) ∩ (bd (A) ∪ exte(A))
= inte ∩ (inte(A))c = φ
Proof of (iii):
inte(G, A) ∪ bd (G, A) = inte(G, A) ∪ (cl(G, A) ∩ cl(G, A)c )))

= inte(G, A) ∪ (cl(G, A) ∩ (inte(G, A) ∪ cl(G, A)c ))
= cl(G, A) ∩ (inte(G, A) ∪ (inte(G, A)c )
= cl(G, A).
Proof of (iv): As we have cl(G, A) inte(G, A) = max{cl(G, A) − inte(G, A), 0}.

We have two cases to consider. Case 1: Let there maximum as 0
So we have cl(G, A) = int(G, A). Therefore
bd (G, A) = inte(G, A) ∩ cl(G, A)c

= inte(G, A) ∩ (inte(G, A))c
=φ
Proof of (v): As we know that (G, A) bd (G, A) = max{(G, A) − bd (G, A), 0}

So we have two cases
Case 1: Suppose max{(G, A) − bd (G, A), 0} = 0, then the proof is trivial.
Case 2: Suppose max{(G, A) − bd (G, A), 0} = (G, A) − bd (G, A), then
(G, A) bd (G, A) = (G, A) ∩ (bd (G, A))c

= (G, A) ∩ (inte(G, A) ∪ exte(G, A))
= (G, A) ∩ (inte(G, A) ∪ inte((G, A)c ))
= ((G, A) ∩ inte(G, A)) ∪ ((G, A) ∩ inte((G, A)c ))
= inte(G, A) ∪ φ
= inte(G, A)
Theorem 3 Take (U, E, τ ) as a FSM topological spaces. Let there be a FSMS (G, A)
in (U, E, τ ), then we have (G,A) is open if and only if (G, A) ∩ bd (G, A) = 0.
Proof Take (G, A) as an open FSM. So we have inte(G, A) = (G, A). (G, A) ∩
bd (G, A) = inte(G, A) ∩ bd (G, A) = 0. For the converse part, take a fuzzy open
soft multi-set (G, A) such as
(G, B) ∩ bd (G, B) = 0 ⇒ (G, B) ∩ (cl(G, B) ∩ cl((G, B)c )) = 0

⇒ (G, B) ∩ cl((G, B)c ) = 0
⇒ cl((G, B)c ) ≤ (G, B)c
⇒ (G, B)c is a closed soft multi set
⇒ (G, B)is an open soft multi set.
Theorem 4 Take a fuzzy soft multi-set topological space (X , E, τ ). Then (G, B), a
FSMS, is closed in (X , E, τ ) if and only if bd (G, B) ≤ (G, B)
Proof Take (G, B) as a FSM closed set in (X , E, τ ). Then cl(G, B) = (G, B).
bd (G, B) = cl(G, B) ∩ cl((G, B)c )≤ cl(G, B) = (G, B).
Now let
bd (G, B) ≤ (G, B) ⇒ bd (G, B) ∩ (G, B)c = 0

⇒ bd ((G, B)c ) ∩ (G, B)c = 0
This implies that (G, B)c is FSM open set. Thus we have (G, B) as an FSM closed
set.
Theorem 5 Take (G, B) as an FSMS in an FSM topological space (X , E, τ ). Then
bd (G, B) = 0 if and only if (G, B) is clopen.
Proof We take,
bd (G, B) = 0. ⇒ cl(G, B) ∩ cl((G, B)c ) = 0

⇒ cl(G, B) ≤ (cl((G, B)c ))c ⇒ cl(G, B) ≤ int(G, B) ≤ (G, B)
So we get (G, B) is closed. Again take
bd (G, B) = 0. ⇒ cl(G, B) ∩ cl((G, B)c ) = 0

⇒ cl(G, B) ∩ (int(G, B))c = 0 ⇒ (G, B) ∩ (int(G, B))c = 0
⇒ (G, B) ≤ int(G, B) = 0
Thus (G, B) is open. We now consider the converse part. That is, the FSM set (G, B)
be closed and open. Then we get bd (G, B) = cl(G, B) ∩ cl(G, B)c = cl(G, B) ∩
(int(G, B))c = (G, B) ∩ (G, B)c = 0.
Theorem 6 let (G,B) be a FSM set in (X , E, τ ). Then we have the following.
1. bnd (bnd (G, B)) ≤ bnd (G, B)
2. bnd (bnd (bnd (G, B))) = bnd (bnd (G, B)
Proof Proof of (i): Consider a FSMS (G, B) in (X , E, τ ). bnd (bnd (G, B)) =
bnd (cl(G, B) ∩ cl(G, B)c ) = (cl(cl(G, B) ∩ cl((G, B)c ))) ∩ (cl(cl(G, B) ∩ cl(G,
B)c )c ) ≤ (cl(G, B) ∩ cl((G, B)c )) ∩ (cl(inte(G, B)c ∪ inte(G, B))) = bnd (G, B) ∩
cl(set) = bnd (G, B) ∩ (set) = bnd (G, B)
Proof of (ii): bnd (bnd (bnd (G, B))) = cl(bnd (bnd (G, B))) ∩ cl(bnd (bnd (G, B))c =
bnd (bnd (G, B) ∩ cl(bnd (bnd (G, B)))c . Also(bnd (bnd (G, B)))c = (cl(bnd (G, B))
∩ cl(bnd (G, B))c )c = (bnd (G, B) ∩ cl(bnd (G, B))c )c = (bnd (G, B))c ∪ (cl(bd (G,
B))c )c . Now we take closures on both sides.
Then we have cl(bnd (bnd (G, B)))c = (cl(bnd (G, B))c ) ∪ cl(cl(bnd (G, B))c ) ≥ (cl
(bnd (G, B))c ) ∪ (cl(bnd (G, B))c )c = E.
We know that, bnd (bnd (bnd (G, B))) = cl(bnd (bnd (G, B))) ∩ cl(bnd (bnd (G, B))c
= cl(bnd (bnd (G, B))) ∩ E = bnd (bnd (G, B)).
Theorem 7 Let (X , E, τ ), be an FSM topological space. For any (G, B), FSM set,
bnd (bnd (G, B)) is a closed FSMS.
Proof We will show that cl(bnd (bnd (G, B))) = bnd (bnd (G, B)). cl(bnd (bnd (G,
B))) = cl(cl(bnd (G, B)) ∩ cl(bnd ((G, B)c ))) ≤ cl(cl(bnd (G, B)) ∩ cl(cl(bnd (G,
B)c )))v = cl(bnd (G, B)) ∩ cl(bnd (G, B)c ) = bnd (bnd (G, B)). So the closure of
bnd (bnd (G, B)) is contained in itself and is so bnd (bnd (G, B)) is a closed fuzzy
soft multi-set.
Take two FSM topological spaces (F, A, τA ) and (G, B, τB ). Then (F, A, τA ) is a
product related to (G, B, τB ) if for any FSM set η of (F,A) and ζ of (G,B), λc not
≥ η and μc not ≥ ζ imply λc × I ∪ I × μc ≥ η × ζ , where λ ∈ τA and μ ∈ τB , also
there exist λ1 ∈ τA and μ1 ∈ τB such that λc1 ≥ η and μc1 ≥ ζ and λc1 ≥ η and μc1 ≥ ζ
also λc1 × I ∪ I × μc1 = λc1 × I ∪ I × μc .
Theorem 8 Take (F, A, τA ) and (G, B, τB ) as product related to FSM topologi-

cal spaces. Then for any FSM sets (G, B) and (G, B) in (F, A, τA ) and (G, B, τB ),
respectively, following holds.
1. cl((H , A) × (G, B)) = cl(H , A) × cl(G, B)
2. inte((H , A) × (G, B)) = inte(H , A) × inte(G, B)
3. ext((H , A) × (G, B)) = exte(H , A) × exte(G, B)
Proof Take FSMS (H , A) s in (F, A, τA ) and (G, B) s in (G, B, τB ). Then we have
1. inf{(H , A), (G, B)} = min{inf(H , A), inf(G, B)}
2. inf{(H , A) × I } = inf(G, B) × I
3. inf{I × (H , A)} = I × inf(G, B)
First we will prove that cl((H , A) × (G, B)) ≥ cl(H , A) × cl(G, B). cl((H , A) ×
(G, B)) = inf{((H , A) × (G, B))c /((H , A) ×(G, B))c ≥ ((G, B) × (G, B))} = inf
{(H , A)c × I ∨ I × (H , A)c /(G, B)c ×I ∨ I × (G, B)c ≥ ((G, B) × (G, B))} = inf
{(G, B)c × I ∨ I ×(G, B)c /(G, B)c ≥ (G, B) or (G, B)c ≥ (G, B)} = min(inf{(H ,
A)c ×I ∨ I ×(G, B)c /(H , A)c ≥ (H , A)}, inf{(H , A)c ×I ∨ I × (G, B)c /(H , A)c ≥
(G, B)}). Also
inf{(H , A)c × I ∨ I × (G, B)c /(H , A)c ≥ (G, B)} ≥ inf{(G, B)c × I /(H , A)c ≥
(G, B)} = inf{(H , A)c /(H , A)c ≥ (H , A)} × I = cl(H , A) × I . inf{(H , A)c × I ∨
I × (G, B)c /(G, B)c ≥ (G, B)} ≥ inf{(G, B)c × I /(G, B)c ≥ (G, B)} = I × inf{(G,
B)c /(G, B)c ≥ (G, B)} = I × cl(G, B). So we can have cl((H , A) × (G, B)) ≥ min
(cl(H , A) × I , I × cl(G, B)) = cl(H , A) × cl(G, B). It can be proved by using the
facts that (intα)c = clα c , and (clα)c = intα c
Take (Xi , E, τ ), i = 1, 2, . . . , n as a family of product related FSM topologi-

cal spaces. Let (Fi , A) be a FSMS in (Xi , E, τ ), then we have bd ni=1 (Fi , A) =
(bd (F1 , A) × cl(F2 , A) × . . . , cl(Fn , A)) ∨ (cl(F1 , A) × bd (F2 , A)× . . . , cl(Fn , A))
∨ . . . , ∨(cl(F1 , A) × cl(F2 , A) × . . . , bd (Fn , A)).
Theorem 9 Let f : (X , E, τ ) −→ (Y , E, τ ) be a FS multi continuous function, then

we have bd (f −1 (F, A)) ≤ f −1 (bd (G, B)), for any FSMS α, A in (Y , E, τ ).
Proof Consider f as a FSMS continuous function and take a FSMS (F, A) in

(Y , E, τ ). Then cl(G, B) is a FSM closed set in (Y , E, τ ), ⇒ f −1 (cl(G, B)) is FSM
closed in(X , E, τ ), So we have bd (f −1 (G, B)) = cl(f −1 (G, B)) ∧cl(f −1 (G, B))c ≤
cl(f −1 cl(G, B)) ∧ cl(f −1 cl(G, B)c ) = (f −1 cl(G, B)) ∧(f −1 cl(G, B)c ) = f −1
(cl(G, B) ∧ cl(G, B)c ) = f −1 (bd (G, B)). Thus, bd (f −1 (G, B)) ≤ f −1 (bd (G, B)).
Theorem 10 Consider an FSMS in a soft multi-topological space (X , E, τ ). Then

ext(G, B) is empty if and only if every nonempty open FSMS in (X , E, τ ) contains a
point of (G, B).
Proof Suppose every nonempty open FSMS in (X , E, τ ) contains a point of (G,B).

So every (ei , k/x) ∈ (G, B) ⊆ (X , E, τ ). Then we have
k ≤ cl(G, B) ⇒ set ≤ cl(G, B) if exte(G, B) = φ ⇔ inte(G, B)c = φ ⇔ (cl(G,
B))c = φ ⇔ cl(G, B) a full soft multi-set. But we have cl(G, B) less than or equal
to a full soft multi-set. So exte(G, B) = φ. Conversely, take exte(G, B) = φ. Also
take (G, P) as any open FSMS in (X , E, τ ). We have to show that (G, P) contains a
point of (G, B). Take (ei , k/x) ∈ (G, P). As exte(G, B) is empty, no neighborhood of
(ei , k/x) is contained in (G, B)c . That is, all neighborhoods of (ei , k/x) are contained
in (G, B). Therefore, (G, P) ∩ (G, B) = φ. That is every nonempty open FSMS in
(X , E, τ ) contains a point of (G, B).
3 Conclusion
The research presented here is an extension of the work done on fuzzy soft multi-
topological spaces. In this paper, some properties of fuzzy soft multi-topological
spaces are established. Interior, exterior, boundary and closure for the fuzzy soft
multi-topological spaces are studied and some important results on them are also
presented. The work can be further extended to the important topological notions
like connectedness, separation, nets, filters, etc. Applications of the concepts similar
to that presented in the papers [10–12] are also interesting topic for future research.
References
1. Zadeh, L.A.: Fuzzy sets. Inf. Control 8, 352–378 (1965)

2. Molodtsov, D.: Soft set theory—First results. Comput. Math. Appl. 37, 19–31 (1999)
3. Pawlak, Z.: Rough sets. Int. J. Inf. Comput. Sci. 11, 341–356 (1982)
4. Maji, P.K., Biswas, R., Roy, A.R.: Fuzzy soft sets. J. Fuzzy Math. 9(3), 589–602 (2001)
5. Chen, D., Tsang, E.C.C., Yeung, D.S., Wang, X.: The parameterized reduction of soft sets and
its applications. Comput. Math. Appl. 49, 757–763 (2005)
6. Alkhazaleh, S., Saleh, A.R., Hassan, N.: Soft multiset theory. Appl. Math. Sci. 5(72), 3561–
3573 (2011)
7. Alkhazaleh, S., Salleh, A.R.: Fuzzy soft multi-set theory. Abstract Appl. Anal. Article ID
350603 (2012). https://doi.org/10.1155/2012/350603.
8. Reji Kumar, K., Naisal, S.A.: Interior exterior and boundary of fuzzy soft multi topology
in decision making. In: IEEE control instrumentation and computational techniques (2016).
https://doi.org/10.1109/ICCICCT.2016.7987934
9. Reji Kumar, K., Niasal S.A.: On fuzzy soft multi set topology. Univ. J. Math. Math. Sci. 10(2),
69–93 (2017)
10. Reji Kumar, K., Naisal, S.A.: A mathematical modeling of Ayurveda Doshas: application of
fuzzy soft topology. Int. J. Pure Appl. Math. 106(8), 33–43 (2016)
11. Reji Kumar, K., Naisal, S.A.: A mathematical modeling of Ayurvedic Doshas in connection
with viruses: application of fuzzy soft multi set theory. In: Presented in Kerala Science congress,
Jan 2018
12. Reji Kumar, K., Niasal, S.A.: Intuitionistic fuzzy soft multiset and its application. Int. J. Math.
Combinator. Spec. Issue 1, 155–163 (2018)
Early Prediction of Pneumonia Using
Convolutional Neural Network
and X-Ray Images
C. Kishor Kumar Reddy, P. R. Anisha, and K. Apoorva
Abstract In general, a patient who might be suffering from pneumonia goes to the
hospital to take an X-ray. They then wait for the doctor to tell them the results by
checking the X-ray. The doctor then decides whether the patient has pneumonia or
not. The results are not just concluded based on the X-ray but furthermore, tests were
conducted on the patient to verify the results of the doctor. This process is very time-
consuming and even if the patient has severe pneumonia, he/she has to wait several
days to get the test results. But with the recent development of artificial intelligence,
the computational powers of computers have increased. Thus, a computer can help in
predicting pneumonia by just passing the X-ray image as an input to our model. The
main objective of this paper is to help the doctors predict pneumonia more accurately
using a deep learning model. The objective is not only to help the doctors but also the
patients to help verify whether they have pneumonia or not. A convolutional neural
network (CNN) model is built from scratch using python to extract features from
a given chest X-ray image and classify it to determine if a person is infected with
pneumonia or not. Finally, a web application is built where the user or patient can
upload the X-ray image and view the result on the User Interface (UI).
1 Introduction
Pneumonia is an infection in one or both lungs which can be caused by bacteria, virus.
Pneumonia can cause the lungs to fill up with fluid, which can be life-threatening and
especially dangerous to people over 65 years of age, infants and also children. A large
number of children die due to pneumonia every year worldwide. Some symptoms
include cough, cold, fever, difficulty in breathing, etc. It is often diagnosed using
X-rays. Radiologists often search for white spots in the X-ray of lungs which can be
used as an indicator regarding pneumonia. The objective of this project is to build
a deep learning project which can be used to directly predict whether a patient has
pneumonia or not just by looking at the X-ray. This speeds up the entire process. It
C. Kishor Kumar Reddy (B) · P. R. Anisha · K. Apoorva

Stanley College of Engineering and Technology for Women, Hyderabad, India
https://doi.org/10.1007/978-981-16-1502-3_67
674 C. Kishor Kumar Reddy et al.
can be used by both the doctor or the patient. Few merits of this prediction model
arethe diagnosis is usually pretty quick when compared to a traditional diagnosis,
early diagnosis means that signicant treatment can be started at earlier stages, the
web application can be used by both doctors and patients alike, the User Interface
(UI) is very user friendly. Few demerits of this prediction model areAs the model
is not 100 percent accurate, some wrong predictions can be made, a doctors second
opinion may always be needed.
2 Literature Survey
In this post on Understanding of Convolutional Neural Network (ConvNets or CNN),

the writer explains how convolution layer is provided with input image, how param-
eters are chosen and how lters with strides and padding is applied. It describes the
procedure to reduce dimensionality size by performing pooling, to add sufcient
convolutional layers, to feed a attened output into a fully connected layer, and use
of activation function to output the class and classify images [1].
In this post on A Comprehensive Guide to Convolutional Neural Networks, the
writer describes the need and use of Deep Learning and one of its widely used
algorithm-Convolutional Neural Network. Writer also threw light on the uses of
CNN, description of input image, the Kernel-Convolution Layer, pooling and its
types, Fully Connected Layer (FC Layer), and various architectures of CNN [2].
Seetha et al. presented a paper Brain Tumor Classication using Convolutional
Neural networks; This paper presents the process of efcient automatic brain tumor
classication with low complexity and high accuracy and performance. It shows the
benets of CNN over Fuzzy C Means (FCM). Extraction of raw pixel value with
depth, width, and height feature value is demonstrated. Usage of gradient decent
based loss function for high accuracy is also explained [3].
Rachna Jain et al. presented a paper Pneumonia Detection in Chest X-ray Images
using Convolutional Neural Networks and Transfer Learning; This paper presents
the model building process of Deep learning-based pneumonia detection in x-ray
images is done. Different models of deep learning and transfer learning are analyzed
in this for the image classication application. An extensive analysis is carried out
in this work with several experimental results [4].
In this post on Pneumonia Detection using Convolutional Neural Networks, the
writer has put down the process of detecting pneumonia just by looking at the X-ray
images. Writer explains ways to gathering the dataset (X-ray images from Kaggle),
process of importing libraries needed, and then CNN usage for the dataset in a
stepwise manner to obtain the desired result of predicting pneumonia. Accuracy
increases with the changes in the number of layers used in the network or by changing
the hyperparameters accordingly [5].
Early Prediction of Pneumonia Using Convolutional Neural Network … 675
Fig. 1 Normal X-ray
3 Dataset Description
3.1 Data Collection
Since we are dealing with an image classification problem, we need to collect two
categories of images: normal and pneumonia. In this project, we collected 5216
images for train-data (1341 normal images and 3875 pneumonia images) and 624
images for test-data (234 normal images and 390 pneumonia images).
An example of a normal X-ray and an X-ray suggesting pneumonia is given in
Figs. 1 and 2.
3.2 Data Preprocessing
To preprocess the previously collected X-ray images of lungs, we need to use

the Keras ImageDataGenerator class to perform data augmentation. The Keras
ImageDataGenerator works in the following manner.
1. Accepts a batch of images for training.
2. Takes each batch and applies a series of transformations on it. Transformations
include rotation, shearing, resizing, etc.
3. Replaces the original batch with the new transformed batch.
4. Trains the convolutional neural network with this new batch.
Fig. 2 X-ray suggesting Pneumonia
First, we import the ImageDataGenerator. Then we give the various parameters

or arguments to the ImageDataGenerator class. Each image in a batch is transformed
by many random translations but these translations are based on the parameters or
arguments we give. Then we need to apply the ImageDataGenerator functionality to
both the trainset and testset. Data preprocessing on the images is complete and we
can move on to the next step [6].
A person who wants to know whether they have pneumonia or not should first have
to get an X-ray. However, even after getting an X-ray done, many tests are conducted
on the patient to verify the findings of the X-ray. This can be time-consuming and
some test results may take several days to arrive. This is not an ideal solution for
someone who might be suffering from severe pneumonia and requires immediate
treatment. Instead of waiting to verify the X-ray readings with more tests, a deep
learning (DL) convolutional neural network (CNN) can be built which can take a
X-ray as input and immediately predict whether the patient has pneumonia or not.
The neural network is trained with thousands of normal -rays and X-rays indicating
pneumonia so it can accurately predict the result with a new X-ray. The doctor or
patient can simply upload the image onto the User Interface (UI) and see the result.
A Convolutional Neural Network (CNN) is a Deep Learning algorithm which
takes an input image, assigns importance (learnable weights and biases) to various
aspects/objects in the image and is able to differentiate one from the other. CNN
can successfully capture the Spatial and Temporal dependencies in an image with
the help of necessary filters. The architecture of CNN performs a better fitting to
the image dataset as the number of parameters involved is less and weights can be
reused. Thus, images can be understood in a much better manner.
CNN trains and tests a set of images. Each image has to go through a series of
convolution layers, pooling, and flattening. Convolution extracts the features from
an input image using a filter and gives a feature map as an output. Convolution of an
image with different filters can yield different feature maps. ReLU stands for Rectified
Linear Unit for a non-linear operation. ReLU is used to introduce non-linearity into
the convolutional neural network [7].
The next step is performed by the pooling layers. Pooling is used to reduce the
dimensions or parameters if the image is too large. In our project, MaxPooling is used.
MaxPooling takes the largest element from the rectified feature map of the image [8,
9]. Finally, Flattening is done i.e. the image is converted into a column vector. The
flattened output is then given to the neural network. The neural network then starts
classifying the images using an activation function. Some activation functions are
sigmoid, softmax, ReLU, etc. The proposed architecture is shown in Fig. 3.

4.1 Model Building
1. The first step in model building is importing the libraries needed to form the
layers.
2. The second step involves initializing the model. In this project, we use the
Sequential class for initialization. The Sequential class is generally used to
define a linear initialization of network layers which together constitute a proper
model. We will add layers to the model using the add() method.
3. For our convolutional neural network (CNN), we will be adding three layers.
The three layers are the Convolution layer, the Pooling layer, and finally the
Flattening layer. The Convolution layer is the first layer which is used to extract
features from an input image. It is a mathematical operation that can take two
inputs such as an image matrix and a filter (kernel). The Pooling layer reduces
the spatial size of representation to reduce the number of parameters and compu-
tation in the entire network. In this project, MaxPooling is used. The Flatten
layer allows us to change the shape of the data from a 2D matrix into another
format. This format can be understood by the dense layers.
4. Now, the dense layers are to be added. We initialize the units to 128(64 × 2),
use activation function ReLU, and go for uniform initialization. This layer acts
as the hidden layer. The next dense layer to be added acts as the output layer.
For this layer, we initialize units to be one since we only have two classes or
categories. Initialization is uniform and activation function is sigmoid as it is a
classification situation.
Configuring the Learning Process

5. As model architecture is built, the model can now be compiled. Compi-
lation normally requires three arguments: optimizer, loss and metrics. For
this binary classification problem, the optimizer chosen is adam, the loss is
binary_crossentropy and the metrics is accuracy.
Train the Model

6. After model compilation, we can train the model. The fit_generator() method
is used for this purpose. There are many parameters to be used here.
Steps_per_epoch is calculated by diving the train set size by batch size. The
train size in this project is 5216 and batch size is taken to be 32. So, our calculated
steps_per_epoch would be 163.
Validation_steps is calculated by dividing the test set size by batch size. The
test size in this project is 624 and batch size is taken to be 32. So, our calculated
validation_steps is 20.
Epochs taken is 10.
We finally obtain a model with accuracy 94.48.
Save the Model

7. To use the created model for future prediction purposes on a web applica-
tion or on another notebook file, we can save our model using save() with an
extension.h5.
Prediction
8. Now that the model is saved, we can use it in a notebook to predict for new
X-rays. First, we need to import two new libraries for prediction to load an
image
9. Now, we can use load_model to load the previously saved model. Two
predictions are: One normal X-ray and the other is an X-ray suggesting
pneumonia.
4.2 Application Building
Now that our model is saved and we know that it is giving correct predictions, we
can embed this model into a web application (Flask App). We begin by creating a
main Flask App folder called Pneumonia Prediction Web in which we have many
subfolders. The model pneumonia.h5 is also put in this folder. The main code is a
python program called app.py which contains our main prediction code which deals
with loading the model and the prediction part. The CSS and JavaScript code in the
static folder deals with the design and the display of the image to be uploaded and
the final result to be displayed. The static folder also contains the images we use as
backgrounds in our web application. We also have an empty folder initialized called
uploads.
As soon as an image is uploaded on the web application, that image is also sent
to the uploads folder. In the templates folder, the base.html file handles the entire
design and layout of the web application. CSS is also used to improve the web page
further.
5 Results and Conclusion
The model is trained for 1341 normal X-rays and 3875 pneumonia-affected X-rays.
It has been trained for 10 epochs, where the final accuracy for training is 94.48% and
for validation is 89.26%. The final loss value for training is 0.1448 and for validation
is 0.2985.
Early detection and treatment of pneumonia can reduce mortality rates among
children significantly in countries having a high prevalence. Hence, this trained deep
learning model can be used by doctors and patients since the tests after taking an
x-ray usually takes time, it is not good for patients with severe Pneumonia. Hence
this model is very useful to predict earlier than usual and give a concrete result before
Fig. 4 Prediction for a normal X-ray
Fig. 5 Prediction for an X-ray suggesting pneumonia
the detailed test results arrive. Early treatments due to early diagnosis can save many
lives [10].
When an X-ray is uploaded it either displays “The patient’s X-rays are normal” or
“The patient might be suffering from pneumonia”. The two scenarios are illustrated
in the images in Figs. 4 and 5
References
1. A Medium Corporation Homepage: https://medium.com/@RaghavPrabhu/understanding-of-

convolutional-neural-network-cnn-deep-learning-99760835f148
Early Prediction of Pneumonia Using Convolutional Neural Network 681
2. A Towards Data Science Homepage: https://towardsdatascience.com/a-comprehensive-guide-

to-convolutional-neural-networks-the-eli5-way-3bd2b1164a53#::text=A%20Convolutio
nal%20Neural%20Network%20(ConvNet,differentiate%20one%20from%20the%20other
3. Seetha, J., Raja, S.S.: Brain tumor classication using convolutional neural networks. Biomed.
Pharmacol. J. 11(3), 14571461 (2018)
4. Jain, R., Nagrath, P., Kataria, G., Sirish Kaushik, V., Jude Hemanth, D.: Pneumonia detection
in chest X-ray images using convolutional neural networks and transfer learning. Measurement
165 (2020) (Elsevier Measurement )
5. A Towards Data Science Homepage: https://towardsdatascience.com/pneumonia-detection-
using-convolutional-neural-network-12b94aeb1206
6. Hashmi, M.F., Katiyar, S., Keskar, A.G., Bokde, N.D., Geem, Z.W.: Efcient pneumonia
detection in chest xray images using deep transfer learning. Diagnostics (Basel) 10(6), 417
(2020)
7. Jaiswal, A.K., Tiwari, P., Kumar, S., Gupta, D., Khanna, A., Rodrigues, J.: Identifying
pneumonia in chest X-rays: a deep learning approach. Res. Gate (2020)
8. Kadam, K., Dr. Ahirrao, S., Kaur, H., Dr. Phansalkar, S., Dr. Pawar, A.: Deep learning approach
for prediction of pneumonia. Int. J. Sci. Technol. Res. 8(10):29862989 (2019)
9. El-Solh, A., Hsiao, C.-B., Goodnough, S., Serghani, J., Grant, B.J.B.: Predicting active
pulmonary tuberculosis using an articial neural network. Chest 116(4), 968973 (1999)
10. Abiyev, R.H., Maaitah, M.K.S.: Deep convolutional neural networks for chest diseases
detection. J. Healthcare Eng. (2018)
Predicting the Energy Output of Wind
Turbine Based on Weather Condition
P. R. Anisha, C. Kishor Kumar Reddy, and Nuzhat Yasmeen
Abstract Wind energy plays an increasing role in the supply of energy worldwide.
The energy output of a wind farm is highly dependent on the weather conditions
present at its site. If the output can be predicted more accurately, energy suppliers can
coordinate the collaborative production of different energy sources more efficiently to
avoid costly overproduction. In this paper, we take a computer science perspective on
energy prediction based on weather data and analyze the important parameters as well
as their correlation on the energy output. To deal with the interaction of the different
parameters, we use random forest regression of machine learning algorithms. Our
studies are carried out on publicly available weather and energy data for a wind
farm. We report on the correlation of the different variables for the energy output.
The model obtained for energy prediction gives a very reliable prediction of the
energy output for supplied weather data.
1 Introduction
We predict wind power output using regression algorithm programming. We use

public weather data for predicting energy. We report on a combination of different
variations of wind turbine power output depending on the weather. Our model
provides the most reliable predictions of power output. We predict power outages up
to 95% accuracy [1, 2].
Wind power plays a vital role in the global energy supply. The power output of
a wind turbine depends largely on the weather conditions present in its area. If the
output can be measured more accurately, then energy suppliers can integrate and
co-operate with different energy sources efficiently to avoid cost overproduction. In
this paper, we have taken a computer science perspective on wind turbine power
forecasts based on weather data and analysis of key parameters and their interactions
in energy output. To deal with the interaction of different parameters, we use a variety
P. R. Anisha · C. Kishor Kumar Reddy (B) · N. Yasmeen

Department of CSE, Stanley College of Engineering and Technology for Women, Hyderabad,
India
https://doi.org/10.1007/978-981-16-1502-3_68
684 P. R. Anisha et al.
of regression methods based on genetic planning tools. Our studies are conducted on
publicly available weather and wind turbine power data. We report on the integra-
tion of different power output variables [3]. The obtained power forecasting model
provides the most reliable prediction of the output of newly acquired weather data.
Renewable energy such as wind and solar energy plays a vital role in the global
energy supply. This trend will continue as global energy demand increases, and
the use of nuclear energy and traditional energy sources such as coal and oil is
considered unsafe or lead to significant CO2 emissions. Wind energy plays a key in
the field of renewable energy. The turbine power generation capacity has increased
significantly over the years. In Europe, for example, the volume of power for wind
turbine production has doubled since 2005. However, wind power production is
difficult to predict as it depends on the volatile weather conditions present in the
wind turbine [4].
In particular, wind speed is important for energy production based on wind,
and wind speeds can vary greatly at different times. Energy suppliers are inter-
ested in accurate forecasting, as they can avoid over-negotiating agreements with
the interactive production of traditional power plants and climate-dependent energy
sources. Our goal is to put climate data into energy generation. We want to show
that even the publicly available data of weather stations near the wind turbine can
be used to provide good forecasts of power output. In addition, we are examining
the effect of various weather conditions on wind power. We are particularly inter-
ested in combining various elements that reflect weather conditions such as wind
speed, Theoretical_Power_Curve (KWh), wind direction (°) and weather. On the
other hand, short-term forecasts are often based on meteorological data, and study
methods are used. Often, a person also has an interest in the work itself and the
effect of different variations determining the outcome. We want to study the impact
of different variations on the power output of a wind turbine. Indeed, the wind speed
obtained by a wind turbine is a crucial parameter [5, 6]. Other parameters affecting
energy emissions, for example, wind speed, theoretical power curve (KWh), wind
direction (°) and weather condition. The genetic program is a type of evolutionary
algorithm that can be used to search for tasks that include data mapping data. The
beauty of this approach is that it comes with descriptive climate data that clarifies
energy emissions. This discourse can be further analyzed to study the effect of the
various variables that determine the outcome. To make such a computer, we use
different regression algorithms based on the data we have used. We will also use the
dataset to make national analysis studying the interplay between different variables
and their impact on the accuracy of the forecast [7, 8].
2 Literature Survey
The purpose of this paper is to predict wind turbine emissions depending on the
weather. The main purpose of the current study is to predict wind turbine emissions
according to weather conditions. This can be very helpful in predicting weather
Predicting the Energy Output of Wind Turbine … 685
patterns. Parameters such as wind speed, wind direction, thinking power curve
and weather conditions play the role of important to predict the power of a wind
turbine [9–12].
2.1 Proposed Solution
It is important to analyze the factor using number of well-known approaches of

machine learning algorithms like linear regression, decision tree and random forest
to improve the efficiency of energy of wind turbine. The energy output of wind
turbine is predicted based on the weather conditions like sunny, windy, rainy and
cloudy. By using the machine learning algorithms. By giving the weather condition,
wind speed, wind direction and theoretical power curve we can predict the energy of
the wind turbine. By random forest regression. In this model, we considered various
inputs like wind speed, wind energy, theoretical power curve and weather conditions.
By considering all these inputs, we will get the energy output of the wind turbine. So
one can easily predict the energy of the wind turbine based on the weather conditions.
Our model in the dataset will be trained on different weather conditions, and it should
give us a good estimate for energy of wind turbine (Fig. 1) [13].
3 Theoritical Analysis
step1 Importing libraries: We will be using the following libraries: pandas and
numpy. It offers data structures and operations for manipulating numerical
tables and time series.
step2 Reading the dataset and preparing it for processing. First, we read the csv
using pandas read_csv function. Our energy output depends on input value
weather condition.
Fig. 1 Block diagram

step3 Data preprocessing—taking care of missing values, label encoding, one-hot

encoding, feature scaling, splitting the data into train and test sets.
step4 Model building—training and testing model in various regression algo-
rithms, model evaluation.
3.1 Spyder
step1 building an Index.HTML file

step2 building Python code
step3 flask app—importing libraries—importing flask module in the project, an
python file called app.py, pickle library to load the model. Templates folder
which contains index.HTML file, static folder contains css and which
contains style.css.
step4 routing to the html page, showcasing prediction on UI Anaconda prompt:
To run the app, we navigate to the app.py and type python.py command in
the localhost we can view web page.
4 Experimental Investigation
We have created the dataset which consists of 2999 rows and 5 columns. It consists
of columns such as wind speed (m/s), theoretical power curve (KWh), wind direction
(°), weather condition and energy (j) [14–16].
Wind Speed (m/s): The wind speed at the hub height of the turbine (the wind
speed that turbine use for electricity generation).
Theoretical Power Curve (KWh): The theoretical power values that the turbine
generates with that wind speed which is given by the turbine manufacturer.
Wind Direction (°): The wind direction at the hub height of the turbine (wind
turbines turn to this direction automatically).
4.1 Data Preprocessing
Firstly, we have to import the libraries for numpy, pandas as
import numpy as np
import pandas as pd
Then, we have to read the dataset using csv file. We have to check for any missing
values which are there in the dataset. If there are no missing values, it will give as
Table 1 Comparison of all

S. No. Model Accuracy (%)
algorithm [18–20]
1 Multilinear regression 88
2 Decision tree regression 94
3 Random forest regression 95
4 Polynomial regression 95
5 Support vector regression 78
False for all columns. After checking the missing values, we have split the values
into x and y. ‘X’ consists of the inputs, and ‘Y ’ consists of output.
4.2 Model Building
To build the model, we have to import train_test_split. We should declare x_train,

x_test, y_train, y_test with test size as 0.2, and random state should be zero. We
have to import the multilinear regression, decision tree regression, random forest
regression, polynomial regression and support vector regression. For the dataset, we
used more accuracy is given to the random forest regression. After this, we have to
save the mode with pickle file (Table 1) [17].
4.3 Data Visualization
See Figs. 2, 3 and 4.
Fig. 2 Matplotlib graph between weather condition and energy (j)

Fig. 3 Scatter plot
Fig. 4 Heatmap
5 Proposed Architecture
See Fig. 5.

6 Results and Conclusions
We have used random forest regression algorithm to predict the energy of wind
turbines based on weather conditions and flask app for application building in flask
app. We have used developed Python code and created HTML web pages.
By this, we can predict the energy of the wind turbine based on the weather
conditions. This model predicts the output of energy of wind turbines based on
weather conditions like sunny, cloudy, windy and rainy. The wind energy output
can be predicted from available weather data with accuracy 95% by random forest
regression algorithm. By giving the inputs like wind speed, wind direction, theoretical
power curve and weather conditions, we can predict the output energy of wind turbine.
This is so simple that it can be used by everybody for predicting the energy in wind
turbines by weather conditions.
In the future of wind power, wind turbine energy is a clean, renewable way of
generating electricity (See close-up ‘Harnessing the Wind’). In the future, provided
costs are checked in, and the primary focus will be offshore development.
References
1. Evolved Analytics LLC. DataModeler 8.0. Evolved Analytics LLC (2010)

2. Foleya, A.M., Leahya, P.G., Marvugliac, A., McKeogha, E.J.: Current methods and advances
in forecasting of wind power generation. Renew. Energy 37, 1–8 (2012)
3. Jursa, R., Rohrig, K.: Short-term wind power forecasting using evolutionary algorithms for the
automated specification of artificial intelligence models. Int. J. Forecast. 24, 694–709 (2008)
4. Kotanchek, M., Smits, G., Vladislavleva, E.: Pursuing the Pareto paradigm tournaments, algo-
rithm variations & ordinal optimization. In: Genetic Programming Theory and Practice IV, vol.
5 of Genetic and Evolutionary Computation, Chapter 12, pp. 167–186. Springer, 11–13 May
2006
5. Li, S., Wunsch, D.C., Ohair, E.A., Giesselmann, M.G.: Using neural networks to estimate wind
turbine. J. Guid. Control Dyn. 16(3), 276–282 (2001)
6. Milligan, M., Porter, K., DeMeo, E., Denholm, P., Holttinen, H., Kirby, B., Mille, N., Mills,
A., OMalley, M., Schuerger, M., Soder, L.: Wind power myths debunked. IEEE Power Energy
Soc. (2009)
7. Koza, J.R.: Genetic Programming II: Automatic Discovery of Reusable Programs. MIT Press,
Cambridge, MA (1994)
8. Kramer, O., Gieseke, F.: Analysis of wind energy time series with kernel methods and neural
networks. In: Seventh International Conference on Natural Computation (2011) (to appear)
9. Kramer, O., Gieseke, F.: Short-term wind energy forecasting using support vector regres-
sion. In: International Conference on Soft Computing Models in Industrial and Environmental
Applications, pp. 271–280. Springer (2011)
10. Kusiak, A., Zheng, H., Song, Z.: Short-term prediction of wind farm power: a data mining
approach. IEEE Trans. Energy Convers. 24(1), 125–136 (2009)
11. Poli, R., Langdon, W.B., McPhee, N.F.: A Field Guide to Genetic Programming. lulu.com
(2008)
12. Schmidt, M., Lipson, H.: Age-fitness Pareto optimization. In: Genetic Programming Theory
and Practice VIII, Genetic and Evolutionary Computation, Chapter 8, pp 129–146. Springer
(2010)
13. Chang, C.-C., Lin, C.-J.: LIBSVM: a library for support vector machines. Software available
at https://www.csie.ntu.edu.tw/cjlin/libsvm (2001)
14. Corchado, E., Arroyo, A., Tricio, V.: Soft computing models to identify typical meteorological
days. In: Logic Journal of the IGPL. Oxford University Press (2010)
15. Costa, A., Crespo, A., Navarro, J., Lizcano, G., Madsen, H., Feitosa, E.: A review on the
young history of the wind power short-term prediction. Renew. Sustain. Energy Rev. 12(6),
1725–1744 (2008)
16. Evangelista, P.F., Embrechts, M.J., Szymanski, B.K.: Taming the curse of dimensionality in
kernels and novelty detection. In: Applied Soft Computing Technologies: The Challenge of
Complexity, pp. 431–444. Springer (2006)
17. Herrero, A., Corchado, E., Gastaldo, P., Zunino, R.: Neural projection techniques for the visual
inspection of network traffic. Neurocomputing 72(16–18), 3649–3658 (2009)
18. Kusiak, A., Li, W.: The prediction and diagnosis of wind turbine faults. Renew. Energy 36(1),
16–23 (2011)
19. Lew, D., Milligan, M., Jordan, G., Freeman, L., Miller, N., Clark, K., Piwko, R.: How do
wind and solar power affect grid operations: The western wind and solar integration study. In:
8th International Workshop on Large Scale Integration of Wind Power and on Transmission
Networks for Offshore Wind Farms (2009)
20. Li, G., Shi, J., Zhou, J.: Bayesian adaptive combination of short-term wind speed forecasts
from neural network models. Renew. Energy 36(1), 352–359 (2011)
A Study and Early Identificatıon of Leaf
Diseases in Plants Using Convolutional
Neural Network
R. Madana Mohana, C. Kishor Kumar Reddy, and P. R. Anisha
Abstract This work proposes a method of detection of plant diseases. While flora
and crops are stricken by pests it influences the rural production of the USA.
Normally, farmers or professionals look at the plant life with the naked eye for
detection and identification of ailment. But this technique can be time processing,
luxurious and faulty. Automatic detection using photograph processing strategies
provides fast and correct consequences. This paper makes a speciality of growing
the newest plant disease recognition model, based totally on plant leaf image category,
by means of using deep convolutional networks.
1 Introduction
The fundamental reason for survival of living beings is plants, and they are useful to
every living organism in some or the other way. Moreover, almost every thing that has
existence on earth is directly or indirectly related to plants. Plants play a major role in
food cycle and environmental cycle. Though it has so much importance, not everyone
in concrete houses know the problems that those life savers are facing. Farmers who
actually strive day and night to bring food on our plate face many problems while
cultivating crops. One of the biggest problems in agriculture is diseased plants [1].
Most of the farmers in many countries are not so literate enough to know the
exact illness the plant is suffering with [2, 3]. They have to first collect the sample of
effected plant and then submit to some in laboratory and wait for results. All this is
a lengthy process, and if results are known early, then there is chance of saving the
plant or else one plant may effect whole crop and there might be much bigger lose.
An automated system which can detect the disease in least time and with availability
R. Madana Mohana (B)

Department of Computer Science and Engineering, Bharat Institute of Engineering and
Technology, Hyderabad, India
C. Kishor Kumar Reddy · P. R. Anisha
Department of Computer Science and Engineering, Stanley College of Engineering and
Technology for Women, Hyderabad, India
https://doi.org/10.1007/978-981-16-1502-3_69
694 R. Madana Mohana et al.
to every individual would makes this process of disease detection easier and time
saving so that there will be moderanization as well a better solution for existing
problem [4–6].
1.1 Why no to Manual Detection of Disease? [7]
• Its time taking

• No accuracy
• No guarantee of the exact result.
1.2 How Detection Through Machine Learning Justifies

the Process! [7]
• Time saving
• Full accurate results
• Prediction into healthy and diseased leaf is exact.
2 Literature Review
The type of diseased plant remains using the neural community algorithm k.
Muthukannan and others participated. Leaf spot lesions can be classified based on
the disease and the diseased leaf using different neural community algorithms. The
method of classifying the leaves of diseased plants using the forward neural commu-
nity (FFNN) studies the vector quantization (LVIC) and radial foundation feature
network (RBF) by processing form and shape functions from the affected leaf image
used. The simulation effect shows the effectiveness of the proposed scheme. With
the help of these illustrations, a fully based machine can be built for the first rate
improvement of the crop in the Indian economy [1].
Begin by capturing the Malvikaranjan picks in the paper detection and leaf sick-
ness section using synthetic neural networks. Colors such as Hvv capabilities are
extracted from the end result of function segmentation, and the artificial nervous
system (N) works effectively with the help of selecting function values that can
accurately distinguish between nutrient and disease samples. Experimental results
have shown that the taxonomic performance by the set-taking feature is high with
80% accuracy. In the present work, a method for early detection of cotton leaf diseases
has been proposed and as it should be, several photo processing strategies and the
use of synthetic neural community (N) [2].
The purpose of paper leaf sickness is to classify the use of synthetic neural
networks written by Ciaficahishakis et al. The use of the image processing method
A Study and Early Identificatıon of Leaf Diseases in Plants … 695
is to capture and evaluate facts from leaf picks for the dangerous or dangerous
classification of drugs that have been converted into plant leaf. Through the photo
processing method, an algorithm of adjusted evaluation, segmentation and feature
extraction is used to take the picture, and artificial neural networks are used to get
the data results. Multilayer forceps neural networks multilayer perceptron and radial
foundation feature RBFs are networking systems used for healthy or unhealthy use
of leaves. In the final experiment, the end result indicates that the RBF network is
more active than the MLP community [3].
Srdjansladojevic et al., In a deeply based deep neural network of plant diseases by
classification of leaf images. Through the use of deep hardwood networks, mainly
based on leaf photographic classification, plant disease is associated with a whole
new technology for reputation pattern improvement. The new methods of training
and the anthropology they used contributed to the quick and clean gadget imple-
mentation in practice. The developed model can identify the leaves of 13 different
types of plants with clean leaves, which have the ability to distinguish plant leaves
from their surroundings. All the important steps required to implement this disease
popularity model were fully defined at some point in the paper, starting with the
submission of photographs with the intention of creating a database and assessed
with the help of agricultural experts. Kaif will use the in-depth study framework
developed by the Berkeley Vision and Learning Center to conduct in-depth CNN
education. Experimental results on the advanced model were performed between
91% and ninety-eight%, with an accuracy of 96.3%, for the personal glory test [8].
The use of organizational networks in the plant disease class and the unfavorable
networks of generators and others. Emanuel used a public dataset of 86,147 images
of diseased and nutritious flowers, a deeply mixed network and semi-monitored
methods to raise awareness on crop species and clutter. A well-done experiment with
unwanted data turned into rsnet. It was changed to a rating of more than eighty%
over the school period in 5 ages with 1 e-five tuition fee [9].
In-depth knowledge of specimens for plant disorder identification and prognosis
on this paper, and others. Constantinos p. Fantino Confucius Neural Community
Fashions was developed to diagnose and diagnose plant disease, with in-depth knowl-
edge of the method using simple leaf snapshots of healthy and diseased flora. Fashion
education was completed using an open database of 87,848 photographs, including
25 different flowers in fifty-eight wonderful trainings of [plant, disease] blends,
including healthy flowers. Many model architects are educated, 99. Fifty-three%
of successful price [plant, disease] compounds (or healthy plants) are found in the
overall performance. The highly achieved price model makes it a very useful advice or
early warning tool and a well-suited technology to assist the plant disorder detection
machine involved in working in real farming conditions [10].
Seravark Wallizin et al. The use of soybean plant detectable neural networks within
the paper explains CNN’s potential for plant disorder class for leaf picks taken under
natural environments. The model is mainly based on the linate structure to eliminate
soybean plant disease. Class. The 12,673 specimens contained four references to
leaf snapshots, including healthy leaf images obtained from the Plantvilade base.
Photographs were taken in an unrestricted environment. The demonstrated model
achieves ninety-nine% classification accuracy, which clearly shows that CNN can
capture the required capabilities and classify plant diseases from snapshots taken in
herbal environments [11].
Real-time Tomato Popular Disease and Pest Popularity and Deep Knowledge-
Based Comprehensive Detector for others. We must not forget the three largest houses
of Alvaro Fuels detectors: a strong neurological community (rapid R-NN)-based
primarily in the initial field, region-based and absolutely good network (R-FCN) and
female shot multibox detector (SSD) “meta” for the purpose of this work. It has a
deep knowledge of architecture. “We combine each of these meta-architectures with
the “Deep Trait Extractor,” which includes WagNet and residual network (Resnet)”
[12].
3 Dataset Description
Dataset contains many images of various kinds of healthy and unhealthy leaves
specifically we collected the images of potato, tomato, and pepper leaves, collected
from repository. The entire dataset is divided into training and testing set in 80:20
ratio. This means 80% of the dataset is used for training and 20% of the dataset is
used for testing purpose [13, 14]. The dataset has 15 classes of above mentioned
three plants as follows:
• Potato_healthy
• Potato_early blight
• Potato_late blight
• Pepper_bell healthy
• Pepper_bell bacterial spot
• Tomato_healthy
• Tomato_bacterial spot
• Tomato_leaf mold
• Tomato_septoria leaf spot
• Tomato_early blight
• Tomato_late blight
• Tomato_yellow leaf curl virus
• Tomato_mosaic virus
• Tomato_spider mites_two spotted spider mite
• Tomato_target spot.
Healthy Potatoes
Potato leaves (Ipomoea batatas) are loaded with various nutrients, vitamins, dietary
fiber, and essential fatty acids. It contains a large amount of protein, minerals Vitamin
B, Beta carotene, Lutein, and antioxidants [15].
Fig. 1 Healthy potato leaf
Late Potato Disease

The leaf spots start out as small, pale green, with unusual odd spots. The spots
usually have green to yellow rings around them. Spots are not limited to arteries but
can grow on them. In cool, humid climates, the spots quickly grow brown to beautify
dark areas.
Potatoes The First Leaf Disease

Premature injury (EB) is a potato disease caused by the fungus Alternariasolani. It is
found wherever potatoes are grown. The disease mainly affects leaves and stems, but
under favorable weather conditions, and if left unmanaged, can lead to significant
reductions and improve the risk of tuberculosis [16] (Figs. 1, 2 and 3).
Pepper Bell Healthy Leaf

Pepper plants are the basis of many vegetable gardens. It is easy to grow and add good
taste to countless containers. Medium varieties, such as iron peppers, are essential
for many salads and snacks. Pepper plants are easy to grow, but at the same time, the
problem will arise. It is good to get used to other issues with pepper if this happens.
If you can see the problem, it is easy to find a solution (Figs. 4, 5, 6 and 7).
Pepper bell Bacterial Spot Disease

Leaf spots from the underside of old leaves as small bumps and on the upper part of
the leaf as small water-filled spots are a sign of bacterial habitat. This is an important
case of cholera in Maryland. It also occasionally attacks tomatoes. Eventually, the
spots grow gray to tan centers with black borders. Sores develop in warm, humid
weather. The leaves may turn yellow, turn brown, and fall off. Sores can also grow
Fig. 2 Potato late blight leaf
Fig. 3 Potato early blight

leaf
on the stems. Fruits form small, raised areas that do not affect the quality of the food.
Highly infected leaves will shrink and lead to sunburn of peppers. The bacterial
foliage is still pollinated by the shiny rain and works with wet, infected plants.
Fig. 4 Pepper bell healthy

Leaf
Fig. 5 Pepper bell bacterial

spot leaf
Tomato Healthy Leaf

Tomato leaves have a variety of uses that include more than just harvesting ripe fruit
to eat. Grow these useful plants in your garden to use all of their useful properties.
Tomatoes are used raw and cooked, whole, sliced, and even fresh form to add flavor
and acidity to a variety of kitchens [17].
Fig. 6 Tomato healthy leaf
Fig. 7 Tomato target spot

leaf
Tomato Target Spot Disease

The identified area, or early injury, is one of the most common diseases affecting
the leaves and stems of potatoes and tomatoes. The disease is caused by the fungus
Alternariasolani. In caterpillars, the disease develops from small circles to brownish-
brown to black spots. These areas grow, oval to angular, and are often enclosed within
Fig. 8 Tomato mosaic virus

leaf
the main arteries of the tracts. They reach 6 mm in diameter. Under ideal conditions,
individual spots can grow up to 10–12 mm. They look like skin, and the growth of
the closest rings in each area gives the disease its name, its target location. When the
disease is severe, the spots may come together and cause congestion at the top of the
leaf tips and leaf death.
Tomato Leaf Disease

Symptoms of tomato infection can be found at any stage of growth and all parts of the
plant can be infected. ToMV causes yellow markings on the leaves and fruit of toma-
toes. Symptoms of tomato infection appear as normal height or mosaic appearance
on the leaves (Figs. 8, 9, 10, and 11).
Tomato Curl Virus Disease

Infected tomato plants initially show vertical and vertical or vertical plant growth;
infected plants at the beginning of growth will show greater resilience. However,
the most diagnostic symptoms are those that are leafy. The leaves of infected plants
are small and curved and showed a strong and balanced curve between the oval. The
internodes of infected plants are shortened and, with dry growth, the plants often take
on a hot appearance, sometimes called ‘bonsai’ or broccoli growth. Flowers planted
on infected plants usually do not grow and fall (invisible).
Tomato Bacterial Leaf Disease:
The spots are small, numerous, dipped in the upper leaf of the leaf, and then
slightly raised below. Single spots up to 3 mm; conjunctivitis, especially on leaf tips
and genitals, and the leaves look hot and yellow; sometimes, the lower leaves die
and fall off. The spots on the stalks and stalks are not circular. Dots appear on small
fruits like enlarged scabs.
Fig. 9 Tomato yellow curl

virus leaf
Fig. 10 Tomato bacterial

spot leaf
Tomato Blight Early Blight

Early injuries are a common tomato disease caused by the fungus Alternaria solani.
It can affect almost every part of the tomato plant, including the leaves, stems, and
fruits. The plants may not die, but they will be weak and will produce less tomatoes
than usual.
Fig. 11 Tomato early blight

leaf
Our proposed system is a convolution neural network (CNN). It is a special type

of artificial neural network that uses perceptron. It is a supervised deep learning
technique. It is used for image-based applications. Components of CNN are the
convolution layer, nonlinear layer, pooling layer, and fully connected layer [18].
5 Convolution Layer
It is the first layer on CNN that extracts the features from the input image. In this
layer, a mathematical operation takes place which takes two inputs they are image
matrix and filter (or kernel).
6 Non-Linear Layer
In this layer, activation function will be added to the convolution operation. This
layer will model our class label.
7 Pooling Layer
This layer reduces the number of parameters when the image resolution is too large.
Pooling can be of three types:
• Max pooling
• Average pooling
• Sum pooling.
It also avoids redundant scanning of already identified parts of the image.
8 Fully Connected Layer
In this layer, we will combine all the features to create an output model. Finally,
an activation function like sigmoid or softmax is used to distinguish the output, as
shown in Figs. 12 and 13.
The proposed methodology is shown in the below flowchart.
Fig. 12 CNN architecture

During our development process, we have carried out a series of testing to check the
differences between the given input and the expected output of our system. Finally,
to see whether or not the CNN works, different set of images and labels (other than
the training image) were passed through the CNN, and the output results are seen
and compared to calculate accuracy and loss. Positive and negative test cases are
described below in Tables 1 and table 2, respectively.
The dataset consists of 40,000 images, out of which 32,000 samples are used
for training and remaining 8,000 samples are used for testing, and these selection of
samples is done randomly in order to obtain accurate result. After training the model,
we acquired 96.77% of accuracy in 25 epochs.
Figure 14 shows the confusion matrix for the tomato using F-CNN(Full CNN).
10 Conclusion
Although there are many automated algorithms or models for disease detection of
leaves, they are partially contributing to the purpose they have been designed. Our
proposed CNN model does not include the lengthy procedure of image processing
techniques, and it includes the characteristics of feature extraction which replaces
tedious work of image processing, where the features get extracted which helps in
decision making for output. We hope our model makes a suggestive contribution to
the agricultural sector.
706
Table 1 Positive test cases

Test case ID Test case objective Steps Input data Expected output Actual output Status
TC_01 Test for potato leaf 1. Click on choose file Potato_healthy Potato_healthy Pass
2. Select leaf from the folder
3. Click on detect button
TC_02 Test for tomato leaf 1. Click on choose file Tomato_healthy Tomato_healthy Pass
TC_03 Test for pepper bell healthy 1. Click on choose file Pepper_bell_healthy Pepper_bell_healthy Pass
R. Madana Mohana et al.
Table 2 Negative test cases

Test Test case Steps Input data Expected output Actual Status
case objective output
ID
TC_01 Test for 1. Click Potato_early_blight Unable Fail
potato on to
early choose predict
blight file
leaf 2. Select
leaf
from
the
folder
3. Click
on
detect
button
TC_02 Test for 1. Click Tomato_Bactterial_spot File not Fail
tomato on choosen
bacterial choose
spot file
2. Select
leaf
from
the
folder
3. Click
on
detect
button
TC_03 Test for 1. Click Pepper_bell_bacterial_spot Unable Fail
pepper on to
bell choose predict
bacterial file
spot 2. Select
leaf
from
the
folder
3. Click
on
detect
button

for tomato plant.
Abbreviations: Early blight
(EB), bacterial spot (BS),
healthy (H), septoria leaf
spot (SLS), yellow leaf curl
virus (YLCV), late blight
(LB), target spot (TS), leaf
mold (LM), spider mite
(SM), and tomato mosaic
virus (TMV)
References
1. Muthukannan, K., Latha, P., Pon Selvi, R., Nisha, P.: Diseased plant leaves using neural network
algorithms. ARPN J. Eng. Appl. Sci. (2015).
2. Ranjan, M., Weginwar, M.R., Joshi, N., Prof. Ingole, A.B.: Detection and classification of leaf
disease using artificial neural network international. J. Tech. Res. Appl. (2015)
3. SyafiqahIshaka, M.H.F.R.: Leaf disease classification using artificial neural network. Jurnal
Teknologi (Sci. Eng.) (2015)
4. Shetye, H., Rane, T., Pawar, T., Dandwate, A.: An analysis of methodologies for leaf disease
detection techniques (2016)
5. Ravindra Naik, M., Sivappagari, C.M.R.: Plant leaf and disease detection by using HSV features
and SVM classifier (2016)
6. Ananthi, S., Vishnu, S.: Detection and classification of plant leaf disease (2012)
7. Ramesh Kumar, S.A., Ramesh Kumar, K.: A Study on paddy crops disease prediction using
data mining techniques (2013)
8. Culibrk, D., Stefanovic, D.: Deep Neural Networks Based Recognition of Plant Diseases by
Leaf Image Classification. Hindawi Publishing Corporation Computational Intelligence and
Neuroscience (2016)
9. Plant Disease Classification Using Convolutional Networks and Generative Adverserial
Networks. Emanuel Cortes Stanford University.
10. Soybean Plant Disease Identification Using Convolutional Neural Network SeraworkWallelign-
Jimma Institute of Technology, Ethiopia LAB-STICC, Association for the Advancement of
Artificial Intelligence.
11. Fuentes, A., Yoon, S., Kim, S.C., Sun, D.: Park Sensors, a robust deep-learning-based detector
for real-time tomato plant diseases and pests recognition (2017)
12. Liu, B., Zhang, Y, He, D.J., Li, Y.: Identification of apple leaf diseases based on deep
convolutional neural networks symmetry (2018)
13. Mohanty, S.P., Hughes, D., Salathé, M.: Using deep learning for image-based plant disease
detection (2016)
14. Dhakal, A., Prof. Dr. Shakya, S.: Image-based plant disease detection with deep learning (2016)
15. Ghaiwat, S.N., Arora, P.: Detection and classification of plant leaf diseases using image
processing techniques: a review (2014)
16. Kajale, R.R.: Detection and reorganization of plant leaf disease using image processing and
Android O.S (2015)
17. Deokar, A.S., Pophale, A., Patil, S., Nazarkar, P., Mungase, S.: Plant disease identification
using content based image retrieval techniques based on Android system (2016)
18. Jagadeesh, D., Rajesh, P., Yakkundimath, A.S.B.: Identification and classification of fungal
disease affected on agriculture/horticulture crops using image processing techniques. In: IEEE
International Conference on Computational Intelligence and Computing Research (2014)
Distributed and Energy Balanced
Routing for Heterogeneous Wireless
Sensor Network
Shivani S. Bhasgi and Sujatha Terdal
Abstract Wireless sensor networks are energy constraint. To minimize the energy
usage, data is forwarded through short paths leading to uneven energy usage and
causing network partitioning. Hence, energy balancing should also be considered
along with energy consumption. Recently, energy harvesting nodes have gained
popularity in solving the limited battery life of sensors. Energy harvesting nodes
harvest energy from solar, wind, etc. and replenish their battery. But harvesting is
sporadic and costly. Hence, in this paper, we propose a hybrid network with both
energy harvesting and normal nodes. A distributed routing protocol considering
energy usage and balancing is formed along with fault tolerance. Energy density,
distance between the nodes and residual energy, is considered to choose relay nodes.
Network is rerouted if any node failure is detected in the routing path. The proposed
algorithm is compared with existing method. Results show that proposed DEBH
performs efficiently when compared with previous method.
1 Introduction
Wireless sensor networks have gained a lot of popularity recently. They are used in
diverse applications such as temperature monitoring, battlefield and windmills [3]
but have limited battery. The batteries cannot be changed as the sensors are deployed
in harsh environments [4]. Several protocols have been developed to reduce energy
consumption [6]. But most of these techniques do not consider energy balancing
which leads to uneven energy usage [9]. In this paper, we consider both and propose
an efficient routing protocol using swarm intelligence technique artificial fish swarm
optimization (AFSO) [7]. AFSO is used to select next hop node. A weight function
is formed using density, remaining energy and distance between the nodes.
Energy harvesting nodes have a separate unit which harvests energy from envi-
ronment and recharges its battery. Harvesting helps to improve lifetime of sensors but
have their own disadvantages such as harvesting is sporadic and expensive. Hence,
S. S. Bhasgi (B) · S. Terdal

Poojya Dodappa Appa College of Engineering, Gulbarga, Karnataka, India
https://doi.org/10.1007/978-981-16-1502-3_70
712 S. S. Bhasgi and S. Terdal
we use hybrid nodes consisting of energy harvesting nodes as well as normal sensor
nodes.
These next sections of this paper are organized as follows: Sect. 2 explains previous
works, Sect. 3 explains proposed method, and Sect. 4 the simulation results are
discussed followed by Sect. 5 conclusions.
2 Literature Survey
In papers [5, 9], distributed balanced routing algorithm is implemented using cost
function which considers residual energy of nodes. But the algorithms may select
a node which does not have any other node in its communication range which will
waste energy, and data will not be delivered to sink. Hence, in our paper, while
selecting next hop we consider density of nodes which considers residual energy of
all the neighbors in its communication range.
In [1, 2, 10, 12], artificial fish swarm optimization technique is used, which has
proved to improve the network lifetime [2, 12], improve clustering [1], improve
coverage and enhance lifetime [10].
Using harvesting nodes can cause uneven energy and change in power so there
is need for different network protocol. Extension of LEACH to make it suitable for
harvesting is proposed in [8, 15]. Solar energy-aware wireless sensor nodes are used
in [13, 14]. But energy harvesting is depended on the sun.
Several existing techniques have only considered energy reduction and have
forwarded data through short paths leading to unbalanced energy causing network
partitioning. Faulty nodes are ignored. Energy harvesting nodes are depended on
energies like solar and wind, the absence of these due to climatic changes may cause
failure of nodes. Most of the existing works do not consider hybrid networks which
are cost friendly and effective. In this work, all these issues are considered, and an
effective algorithm is implemented.
3 Proposed Method
We assume a hybrid network with harvesting nodes and normal nodes. All nodes are
stationary. Nodes have information about their neighbors such as residual energy,
distance and hop counts. At the beginning, the sink sends a packet to all the nodes
with counter set to 0. After receiving it, the sensor nodes store the value increment
it by 1 and forward to it neighbors. The data is forwarded by using next hop node
(HN). To select the HN, fish swarm optimization algorithm (AFSO) is used. We use
a weight function weight (nk , nj ) which considers density and residual energy of the
node to balance the energy consumption and short distance nodes to save energy.
The weight function is calculated using the following parameters,
Distributed and Energy Balanced Routing … 713
Energy Density (ED) The data should be forwarded through higher density region
as energy of all the nodes should be balanced. The density is calculated as,

C Ri

Ed(n k ) = REn j (HN(n k ) < HN n j ) + RE(n k ) (1)
j =1
To calculate the density of nk , the residual energy (RE) of all the nodes in commu-
nication range of nk with hop distance to sink less than nk is considered. Density
should be high so,

Weight n k , n j α Ed(n k ) (2)
Residual Energy (RE) If we only consider high density and do not consider RE of
nk and if RE of nk is less, then it will cause uneven energy usage. Hence, residual
energy of nk is equally important as its density. RE should be high so,

Weight n k , n j α RE(n k ) (3)

Distance dist n k , n j For reducing the energy consumption, the distance between
nk and nj should be less.
1
W ei ght n k , n j α (4)
d i st n k , n j
Combining Eqs. (2)–(4)
Ed(n k ) ∗ RE(n k )
Weight n k , n j α (5)
dist n k , n j
Ed(n k ) ∗ RE(n k )
Weight n k , n j = (6)
dist n k , n j
The weight function can be calculated as in Eq. (6). nk selects the node with
highest weight value as next hope node for data transmission.
Algorithm 1: Next Hop Node Selection

1. Start
2.if(dis(nk, sink) ≤ dmax) then // here dmax is the maximum
range of the node nk
3.next hop=sink
else
4.Nj= Neighbour(nk)
5.max=-1.0 // max is the maximum cost
6.while(Nj > 1) do
7. Select a neighbour nk .
8. if( weight(nk nj,) > max) // calculating weight using equa-
tion(6)
9. form next hop node through AFSO
10.next hop= nj
11.max=weight(nk nj,)
12.end if
13.end while
The pseudocode for next hop node selection is written in algorithm 1. If sink is in
range of node, it sends data directly else next hop node is selected by AFSO using
weight function. If any node does not reply to the acknowledgment message of its
neighbor, then it is considered as failed and rerouting is executed.
Algorithm 2: Energy Harvesting
1.Start
2.if (replenish==1) then// i.e if node is energy harvesting node
3. if(NODE_ENERGY[k]< ETH)then// if node energy is
less than threshold value
4. NODE_ENERGY[k] = IE// Then node energy is re-
plenished
else
5.if (replenish==0) then // if node is normal node
6.if(NODE_ENERGY[k]< Ethreshold)then // and its energy
is less than threshold
7. ROUTE_DISCOVERY // rerouting is done
8.end if
9.Stop
Energy harvesting is shown in algorithm 2. If any nodes energy falls below the
given ETH value and if it is an energy harvesting node, then its energy is replenished
or else rerouting is executed. Here, energy harvesting nodes are preferred over normal
nodes for forwarding data.
Performance of the proposed algorithm is compared with existing algorithm [11].

The algorithm is simulated in network simulator 2. The simulation parameters are
listed in Table 1. The graphs are plotted against number of rounds versus lowest
energy node, nodes available for balancing and remaining energy. Here, a round is
considered as time taken from forming route, sensing and forwarding data to sink.
Figure 1 displays graph of lowest energy nodes versus rounds. It can be seen that
the energy of EEBR drops, whereas the lowest energy node of DEBH has higher
energy than EEBR this is because data is forwarded through energy-efficient path
and the proposed algorithm used harvesting nodes.
From Fig. 2, it can be seen that there are more nodes for balancing even after
60 rounds. Tough DEBH and EEBR both considered density, and remaining energy
EEBR has a smaller number of nodes for balancing because it did not use hybrid
network with harvesting nodes.
Table 1 Simulation
Parameters Values
parameters
No. of nodes 50
E initi (initial energy of each node) 2000 J
Transmission power 2J
Receiving power 2J
Dmax (communication range) 100 m
Packet size 512 bytes
Fig. 1 Lowest energy node 4500

versus rounds 4000
3500
Lowest energy
3000
2500
2000
1500
1000
500
0
10 50 100 150 200
DEBH 1994.551 1985.604 1974.806 1960.41 1947.813
EEBR 1994.551 1934.807 1923.054 1903.465 1888
Fig. 2 No. of nodes 40

available for balancing 35
Nodes available
versus rounds 30
25
20
15
10
5
0
0 2 10 20 40 50 60
EEBR 2 2 4 4 3 3
DEBH 2 6 9 15 24 36
Fig. 3 Residual energy 2050

versus rounds 2000
Residual Energy
1950
1900
1850
1800
1750
1700
12 30 54 102 150 180
EEBR 1986.4 1951.4 1900 1890 1856 1800
DEBH 1996.4 1990.7 1982.8 1967.2 1951.5 1941.7
Residual energy is high in DEBH even after 180 rounds (as in Fig. 3) but the
residual energy of EEBR goes on decreasing. DEBH energy is high because hybrid
nodes consisting of harvesting nodes and normal nodes are considered. The energy
harvesting nodes are preferred as relay nodes over normal nodes once the energy
falls below threshold value.
5 Conclusion
In this work, distributed and energy balanced routing for heterogeneous wireless
sensor network is proposed. A hybrid network with harvesting nodes and normal
nodes is considered. The proposed algorithm focuses on reducing energy usage
and balancing the network when selecting route for data transmission. The route
is selected using weight which considers density, remaining energy and distance
between nodes. The density and remaining energy are important in balancing the
network, while distance between nodes will help in reducing energy consumption.
The harvesting nodes energy gets replenished if it falls below threshold value this
helps in extending the network lifetime. The simulation results show that the proposed
method performs better than existing method in terms of residual energy, balancing,
etc.
References
1. Azizi, R., Sedghi, H., Shoja, H., Sepas-moghaddam, A.: A novel energy aware node clustering
algorithm for wireless sensor networks using. 7, 103–115 (2015)
2. Helmy, A.O., Ahmed, S., Hassenian, A.E.: Artificial fish swarm algorithm for energy-efficient
routing technique. 509–519 (2015). https://doi.org/10.1007/978-3-319-11313-5
3. Kandris, D., Nakas, C., Vomvas, D., Koulouras, G.: Applications of wireless sensor networks
: An up-to-date survey (2020)
4. Li, J., Liao, G., Wang, F., Li, J.: Maximum lifetime routing based on fuzzy set theory in wireless
sensor networks. J. Softw. 8, 2321–2328 (2013). https://doi.org/10.4304/jsw.8.9.2321-2328
5. Liu, A., Ren, J., Li, X., Chen, Z., Shen, X.S.: Design principles and improvement of cost
function based energy aware routing algorithms for wireless sensor networks. Comput. Netw.
56, 1951–1967 (2012). https://doi.org/10.1016/j.comnet.2012.01.023
6. Lonare, M.S.: A survey on energy efficient routing protocols in wireless sensor network. 4–8
(2013). 01.0401/ijaict.2014.08.14
7. Maria, A., Rocha, A.C., Martins, T.F.M.C., Fernandes, E.M.G.P.: An augmented Lagrangian
fish swarm based method for global optimization. J. Comput. Appl. Math. 235, 4611–4620
(2011). https://doi.org/10.1016/j.cam.2010.04.020
8. Meng, J., Zhang, X., Dong, Y., Lin, X.: Adaptive energy-harvesting aware clustering routing
protocol for Wireless Sensor Networks. In: 2012 7th International ICST Conference on Commu-
nications and Networking in China, CHINACOM 2012—Proceedings, pp. 742–747 (2012).
https://doi.org/10.1109/ChinaCom.2012.6417582
9. Ok, C., Lee, S., Mitra, P., Kumara, S.: Computers & Industrial Engineering Distributed energy
balanced routing for wireless sensor networks. Comput. Ind. Eng. 57, 125–135 (2009). https://
doi.org/10.1016/j.cie.2009.01.013
10. Rushdy, E„ Attia, M., Abdalla, M.I. Energy aware optimized hierarchical routing. 614–623
(2018). https://doi.org/10.1007/978-3-319-74690-6
11. Singh, D., Kuila, P., Jana, P. K. (2014). A distributed energy efficient and energy balanced
routing algorithm for wireless sensor networks. In: 2014 International Conference on Advances
in Computing, Communications and Informatics, pp. 1657–1663. https://doi.org/10.1109/ICA
CCI.2014.6968288
12. Song, X., Wang, C., Wang, J., Zhang, B.: 2010 International Conference on Computer Design
And Appliations (ICCDA 2010) A Hierarchical Routing Protocol Based on AFSO algorithm
for WSN Y Y, vol. 2, pp. 635–639 (2010)
13. Voigt, T., Dunkels, A., Alonso, J., Ritter, H., Schiller, J.: Solar-aware clustering in wireless
sensor networks. Iscc (2004). https://doi.org/10.1109/ISCC.2004.1358411
14. Voigt, T., Ritter, H.: Utilizing solar power in wireless sensor networks. In: Networks, 2003
LCN’03, pp. 416–422 (2003). https://doi.org/10.1109/LCN.2003.1243167
15. Xiao, M., Zhang, X., Dong, Y. (2013). An effective routing protocol for energy harvesting
wireless sensor networks. In: 2013 IEEE Wireless Communication Network Conference,
pp. 2080–2084. https://doi.org/10.1109/WCNC.2013.6554883
ESRRAK-Efficient Self-Route Recovery
in Wireless Sensor Networks Using ACO
Aggregation and K-Means Algorithm
Abhijit Halkai and Sujatha Terdal
Abstract Designing of the application-specific protocol in WSN leads to several

issues such as energy capacity, network failure, environmental hazards, and energy
unbalancing. WSN nodes are deployed in a very harsh environment which makes
replacing batteries a complicated task; hence, they are prone to energy drainage and
network failure due to continuous data transmission. In this paper, we propose a cross-
layer framework with duty cycling for route recovery due to failures in routing by inte-
grating energy harvesting techniques, ACO, and K-Means. By rigorous simulations,
in NS-2, it proves that our scheme outperforms the existing EECH algorithm.
1 Introduction
Wireless sensor networks (WSNs) are considered as very important in the networking
field because of their salient features like cheaper, efficient sensing, adaptable, and
smaller size. The design of wireless sensor networks is application-specific [1]
due to different applications and topologies. WSN nodes are randomly distributed
in a remote location to sense physical data such as vibrations, pressure, noise,
temperature, and humidity. Wireless sensor networks have several applications such
as process management, healthcare monitoring, environmental sensing, structural
health monitoring (SHM), and target tracking. In structural health monitoring, contin-
uous monitoring of the health is done by the automated system using WSN for reliable
operation. Designing of application-specific protocol in WSN leads to several issues
such as energy capacity, network failure, environmental hazards, and energy unbal-
ancing. WSN nodes are deployed in a very harsh environment which makes replacing
batteries a complicated task; hence, they are prone to energy drainage and network
failure due to continuous data transmission. Wireless sensor network is an emerging
area of research, so it has forced the developers to design algorithms for solving
the above issues. Instead of each sensor sending the data individually to the base
station (BS), which causes depletion of energy, data can be sent in an aggregated
A. Halkai (B) · S. Terdal

Poojya Dodappa Appa College of Engineering, Kalaburagi, Karnataka, India
https://doi.org/10.1007/978-981-16-1502-3_71
720 A. Halkai and S. Terdal
way by clustering. In this paper, a new cross-layer scheme is designed where each
node is equipped with energy harvesting knowledge, a new MAC is designed with
duty cycling, and route recovery is done by clustering through ACO and K-Means.
2 Literature Survey
Sensor networks illustrate substantial advancement when compared to traditional

network. The nodes are randomly deployed in far monitoring regions to record the
changes in environment. Secondly, only the sensors which sense the data can be
deployed in the topology of sensors, and communication is carefully managed [2].
The sensor is a device composed of sensing unit, processing unit, transceiver, and a
power unit; any other device added is based on different applications that are specific
[3]. The power unit is fixed with a rechargeable battery which provides the neces-
sary power for sensing and data transfer; the provided battery has limited power,
wherein there is a need to recharge it continuously. When deployed in harsh envi-
ronments, it becomes impractical for humans to reach and recharge. Techniques that
are energy efficient should be designed on several challenges [4]. Limited energy,
network lifetime, limited abilities, secure communications, cluster formation, cluster
head election, synchronization, data aggregation, repair mechanisms, and QoS are the
main limitations faced during the cluster formation. Hierarchical routing and cluster-
based routing are efficient techniques to maintain the usage of energy in sensor nodes
by involving them in multi-hop communication [5]. A survey of clustering algo-
rithms for WSNs presents taxonomy and classification of typical clustering schemes
and then summarizes different clustering algorithms for WSNs. Different clustering
schemes with special emphasis on their cluster head selection strategies are based on
the classification of the deterministic scheme, adaptive scheme, and combined metric
scheme. The clustering algorithms available for WSNs [6] are classified based on the
cluster formation parameters and cluster head election criteria. Low-energy adaptive
clustering hierarchy (LEACH) [7] is broken up into lots of rounds, where each round
is separated into two phases, the setup phase, and the steady-state phase. In the setup
phase, the clusters are organized, while in the steady-state phase, data is delivered
to the base station, and it considers only energy which is not feasible. In Efficient
hierarchical clustering (EEHC) [8], cluster head with probability “p” and announces
its election to the neighboring nodes within its communication range. All the nodes
that are within “k”-hops distance from a “volunteer” cluster head are supposed to
receive the election message either directly or through intermediate forwarding. The
nature of the ant colony optimization technique of ant nature can also be used for
clustering purpose which is also presented in [9] ANTCLUST algorithm, where the
partial solution for better efficiency is produced based on the pheromone value of
the artificial ant, wherein ants are considered to be WSN nodes. TL-LEACH uses
the following two techniques to achieve energy and latency efficiency: randomized,
adaptive, self-configuring cluster formation, and localized control for data transfers,
and the only locally calculated parameter weight is defined for cluster head election in
ESRRAK-Efficient Self-Route Recovery in Wireless Sensor Networks … 721
DWEHC. Traditional routing protocols are no longer suitable for energy harvesting
wireless sensor networks (EH-WSN). Hence, new duty cycling MAC is designed
with energy harvesting clustering by ACO and K-Means.
3 ESRRAK Design and Implementation
The sensor nodes N 1 , N 2 , …, N N are deployed in the seashore structural monitoring

with heterogeneous energies α and β and energy harvesting capability at base station
with infinite energy. The detailed flowchart of proposed algorithm is given in Fig. 2
3.1 Network Formation
N numbers of sensor nodes are deployed in a two-dimensional M × M area of

interest manually. These nodes communicate through the wireless channel. The
energy harvested node as sink is set to be fixed with instantaneous recharge by
natural sources. The radio range of each node is fixed, wherein the connectivity with
other nodes is established within that range. The formation of network and data
transmission through cluster heads to sink node occurs as shown in Fig. 1
Algorithm 1: Network Formation

• Initializeheterogeneous energy settings for all nodes.
• Calculatedistance and RSSI between each neighboring node.
• If (calculated distance is less than the range).
• Connectivity is possible.
• Elseconnectivity is never established.
Fig. 1 Network formation

Fig. 2 Flowchart of
proposed algorithm
Table 1 Hop count beacon

No. of next hops Previous hop node
message format
3.2 Minimum K-Hop Calculation
When connectivity is established between the nodes, it is measured by true 1 or false

0. The sink node disseminates the beacon message in the network hierarchically from
one level to another calculating the no of k-hops from a sink to cluster head.
All the transactions of the hops calculation are recorded in HCM Table. Initially,
the dissemination starts from the sink where the beacon HCM message contains
0 hops and the previous node as the sink as given in Table 1. This message when
received by the next level node contains 1 hop and the previous node as sink. At each
level, number of hops goes on incrementing, and the least hop to the sink is finally
stored in the HCM Table of the respective node. This process is carried until the last
node is reached. When each node receives an HCM message, transmission energy is
also consumed (Fig. 2).
3.3 Path Repair
Path repair is carried in every transmission until the maximum transmissions T_MAX
is reached. If path repair is set to 1, the node is inserted in the queue where the index
of the queue is decremented excluding the node. In node failure condition, it helps
in reforming the network without network crash.
3.4 Cluster Head Selection
In this clustering approach, sensors with more pheromone values are selected which
is directly proportional to the lifetime of the ants. More the pheromone trails and
visibility, more the chance of choosing as the optimized solution. Visibility is the
parameter that refers to the number of nodes that will be covered if the node is added
into the cluster. Artificial ants are used to find a solution for the best optimization
problems of cluster head selection.
E Residual
Pr = Pr × , pheromone α Pr (1)
E initial
E Residual is energy left in node after each transmission, and E initial is initial energy
of the node in the cluster. The detailed flowchart of ACO clustering is presented in
Fig. 3
Algorithm 2: Ant Colony Optimization (ACO) Cluster Head Selection

• If (event is detected at nodes and connectivity exists).
• Iterate from i to N times /* i = 0 and N = No of Nodes */.
• Select ith node as cluster head based on ant lifetime.
• Select neighbor in the range of ith cluster head with maximum pheromone value
until all nodes are covered reducing more energy utilization on single node.
• Find final set of cluster heads with maximum pheromone trails.
Fig. 3 Flowchart of ACO clustering

3.5 Data Aggregation and Routing
Algorithm 3: Data Aggregation

• If (event is detected at node and is not Head.)
• Transmit data from source Sensing Node to Cluster Head.
Algorithm 4: Data Routing

• Iterate from i to N /* i = 0 and N = No Of Nodes */.
• Get Distance of the relaying node to SINK.
• If (Node Failed).
• Reroute and find new next relaying hop node.
• Else if (connectivity exists).
• Find most optimal least K-hops relaying node considering the least distance with
respect to SINK.
4 Energy Performance Modeling
The nodes in the architecture are defined as the heterogeneous energy nodes from 0
to N. N is the maximum no of nodes in the network. The initial energy of nodes is
defined as E initial , and the total energy of network is given by E Total where i is the
node.

N
E Total = E initial (i) (2)
i=0
E sensing = E initial − E t x (3)
E Ch = E initial − E tx − E rx − E aggre (4)
E Intermediate = E initial − E tx − E rx (5)
E Residual = E sensing for sensing nodes, and E Residual = E Ch for cluster head.
E Residual = E Intermediate for intermediated nodes between cluster head and base
station.

N
Total Energy (TE) in network = E Residual (i) (6)
i=0
E Residual (i) is the remaining energy of node i. E tx is expenditure in one trans-

mission, and E rx is expenditure in one reception. E aggre is energy expenditure in
aggregation of data from neighbor sensing nodes. E Intermediate is energy expendi-

ture for intermediate routing nodes from cluster head to base station. E Ch is energy
expenditure for cluster head.
The efficiency is given as
TE
E ef = × 100 (7)
E initial
TE is the total energy in the network.
The simulation is carried out in NS-2.35, and results are extracted through trace file
(Table 2).
The primary aim of a sensor network is to send the devastating information to
the base station in balanced energy utilization on all cluster heads, and also in an
energy-efficient way, in proposed algorithm, the cluster head is instantaneous change
during all transmissions. In Fig. 4, it shows that in EEHC [8] same cluster head is
elected more than once increasing the energy load. But in proposed algorithm, every
node in cluster gets equal chance of selecting as cluster head reducing more energy
utilization on single cluster head.
As observed in Fig. 5, the network lifetime is compared between two algorithms,
with that the proposed algorithm network lifetime being little higher than EEHC [8].
Network lifetime is measured as the total residual energy of the network. Transmis-
sions are recorded from 1 to 7, and at each transmission, total energy of network is
calculated. In EEHC [8], the energy in the network goes on depleting more when
Table 2 Simulation
No. of nodes (N) 50
parameters
Area 600 × 600 m2
Range 140 m
Initial energy (E initial ) 200 J
Max hops 10
Energy for transmission (E tx ) 3J
Energy for reception (E rx ) 3J
Energy for aggregation (E aggre ) 1J
Max packets 3
Time for transmission (t TX ) 0.01
No. of clusters and size 3, 5
No. of events 7
EEHC Proposed Algorithm

7
Cluster Head Count
8
6
6 5 5 5
4 4
4 3 3 3
2 2
2 1 1
0
1 2 3 4 5 6 7
Rounds
Fig. 4 Rounds versus cluster head count
10000
9500
Network Lifetime
9000
8500
8000
7500
1 2 3 4 5 6 7
Rounds
EEHC 9691.8 9505.5 9201.9 8953.5 8760.3 8259 7879
Proposed Algorithm 9802.2 9740.1 9657.3 9574.5 9491.7 9211.2 9107.7
Fig. 5 Rounds versus network lifetime
compared with proposed algorithm. A comparison of both algorithms shows that

total network lifetime of proposed algorithm is more than EEHC [8] by 6%.
6 Conclusion
In this cross-layer scheme, we propose a framework where the data is transferred

to the base station efficiently without any increased energy load on the cluster head
resulting in more energy consumption. To find the optimal repaired path to the BS,
more pheromone value path is opted by node. The proposed algorithm is capable
of sending information to the base station in energy-efficient and energy-balanced
way. The link failure reorganizing capabilities form more effectiveness. The rigorous
simulations provide the effectiveness and enhancement when compared to EEHC [8].
Shared load on all nodes leads in low energy consumption, thus increasing network
lifetime, establishing chance for every node to be cluster head. In result, ESRRAK
is proved to be more efficient than EECH in network lifetime and cluster load.
Reference
1. Bhende, M., Wagh, S., Utpat, A.: IEEE 2014 International Conference on Communication
Systems and Network Technologies (CSNT), Bhopal, India (2014)
2. Intanagonwiwat, C., Govindan, R., Estrin, D.: Directed diffusion: a scalable and robust commu-
nication paradigm for sensor networks. In: Proceedings of the ACM Mobi-Com’00, Boston,
MA, pp. 56–67 (2000)
3. Akyildiz, I.F., Su*, W., Sankarasubramaniam, Y., Cayirci, E.: Broadband and Wireless
Networking Laboratory, School of Electrical and Computer Engineering, Georgia Institute of
Technology, Atlanta, GA 30332, USA
4. Wei, C., Yang, J., Gao, Y., Zhang, Z.: Cluster-based routing protocols in wireless sensor networks:
a survey. In: 2011 International Conference on Computer Science and Network Technology
5. Kumar, V.: Energy efficient clustering algorithms in wireless sensor networks: a survey. IJCSI
Int. J. Comput. Sci. 8(5), No. 2 1694–0814 (2011). ISSN (Online)
6. Arboleda, L.M.C., Nasser, N.: Comparison of clustering algorithms and protocols for wireless
sensor networks. In: Proceedings of IEEE CCECE/CCGEI, Ottawa, ON, Canada, 7–10 May
2006, pp. 1787–1792
7. Heinzelman, W.R., Chandrakasan, A., Balakrishnan, H.: Energy-efficient communication
protocol for wireless microsensor networks. In: Proceedings of the 33rd Annual Hawaii
International Conference on System Sciences, Maui, HI, USA, pp. 10–19, 4–7 Jan 2000
8. Sabet, M., Naji, H.R.: A decentralized energy efficient hierarchical cluster-based routing algo-
rithm for wireless sensor networks. AEU Int. J. Electron. Commun. 69(5), 790–799 (2015).
ISSN 1434–8411, https://doi.org/10.1016/j.aeue.2015.01.002
9. Mane, S.U.: Nature inspired techniques for data clustering. In: 2014 International Conference
on Circuits, Systems, Communication and Information Technology Applications (CSCITA)
An Explanation of Personal Variations
on the Basis of Model Theory or RKT
K. Reji Kumar
Abstract Human beings show significant variations from person to person. Varia-
tion in human consciousness is one of the reasons for the difference. Human actions
are controlled by mental processes, which involve a comparison of models formed
in the mind. A comparison of models can cause differences in consciousness. In this
paper, using the model-based theory or RKT of consciousness, we analyze the reason
for personal variations in performing different actions or activities and explain the
reasons for the variations.
1 Introduction
Scientists are trying to explain the intriguing phenomenon of consciousness. The

current status of the research is reviewed by Perlovsky, in his article [1]. Mathemati-
cal modeling of consciousness is an important step toward finding a solution to many
problems related to human consciousness. The multifaceted problem of conscious-
ness can be solved only through the collaborative effort of researchers from many
disciplines. All the fundamental ideas in the field need to be defined and explained in
a scientific manner. Some important theories that have been proposed by the pioneers
in the field are mentioned here. Baars et al. proposed the global workspace theory
(GWT) [2, 3], which is based on an interaction between bottom-up and top-down
attentional modulation mechanisms. It allows a specific percept to become conscious
throughout a broadcasting process. The representation theory is another theory that
is mainly of two types—the first order and higher order. The essence of representa-
tion theories is that consciousness is directly associated with mental representations.
Moreover, it has no connection with physical states. Higher-order representation the-
ory is based on the thoughts of Locke and Kant [4]. Dretske [5] and Tye [6] are the
advocates of the first-order theory, which argues that the perceptual representations
formed in the sensory regions determine a conscious mental state.
K. Reji Kumar (B)

Department of Mathematics, N S S College, Cherthala, Kerala, India
https://doi.org/10.1007/978-981-16-1502-3_72
730 K. Reji Kumar
The integrated information theory (IIT), which was introduced by Tononi and col-
laborates [7–9] can measure the level of consciousness of a system using some math-
ematical methods. Quantum theories of consciousness try to explain the conscious-
ness using the hypotheses that implied quantum mechanisms. The four-dimensional
approach to consciousness tries to explain the conscious experiences on the basis of
space–time intervals [10]. Koehler’s mathematical approach is also notable in this
regard [11].
During the period 2008–2010, the author [12] studied the problem of conscious-
ness in a different direction and attempted to set the study of consciousness on the
fundamental units named models. The whole approach proposed uses the methods
of mathematical modeling. A set of axioms of consciousness were suggested (model
axioms) to give the study a mathematical framework [13]. It is also argued that the
whole edifice of consciousness is built with models. To explain it further, the models
are categorized based on their increasing level of complexity. Initially, three types of
models were suggested, which are named α models, β models, and γ models [13,
14]. The α models are very fundamental and are generated in the mind through the
input information received through the sensory organs. But, β models and γ models
are the models generated in our mind due to the complex model processing activities
taking place in our mind. The knowledge of day and night in the mind of a child is
an example of a β model. But, the knowledge of the same concept in the mind of
a scientist is more developed and advanced. So, it can be called a γ model. While
explaining this, it is worth mentioning that there are no precise boundaries between
any model and the next model in the model hierarchy.
The concepts are further subjected to the treatments from mathematics to show
that complex models can be developed using simple models [12]. Using the model
axioms and models as the fundamental units, Reji Kumar explained the phenomenon
of combinatorial complexity of consciousness [15] and the situations leading to
variations in the level of consciousness of two different individuals. A clear and
successful theory of consciousness must explain all the phenomena associated with it
and must be ready to face all types of questions raised in this connection. Moreover,
a theory that puts forward the claim that it is final and complete will contain a
contradiction to its existence, in it. This philosophical aspect was a matter of highest
concern while proposing the theory of models to explain the consciousness. Modeling
theory is used to study various forms of knowledge, and it is used to explain the
difference between Mathematics, Science, and other forms of knowledge [16].
Consciousness is a highly subjective phenomenon. It is related to our experiences.
Consciousness and experience are more or less similar. We experience something
because we have consciousness. Conversely, if we have consciousness, we can expe-
rience objects and events around us and the state of our mind as well. The subjectivity
of consciousness is mathematically explained in [14, 17].
Our explanations of a phenomenon is a kind of representation, which is called a
model in the language of science. A particular phenomenon has a different represen-
tation in a different consciousness. Consciousness is the totality of all representations
in the mind of a person. At the same time, a phenomenon can have different represen-
tations on different occasions in a consciousness. For example, the representation of
An Explanation of Personal Variations on the Basis of Model Theory or RKT 731
a knife until it causes a wound on the body may be different from its representation
after the wound. Some models representing pain will also be added to the representa-
tion. Models of gravity of the earth are different in the consciousness of a physicist at
different stages of the development of his consciousness. More clearly, when he was
a child, he may not have any scientific models in his mind representing gravity, which
gradually develops during his years of education until it gets a meaningful shape as
he becomes a physicist. Still, it can undergo changes according to the changes in the
field of knowledge and his own experiences.
We all know that, as a living organism, we do activities and the activities that we do
can be classified broadly as conscious and unconscious. The unconscious activity is
one that is done without the interference of our consciousness. For example breathing
and sleeping. Even though we can experience breathing, it is very hard to experience
sleep. We can fully experience our conscious activities, and it is completely controlled
by us. In this paper, we develop a mathematical model to explain the interactions
between our consciousness and the activities. It is expected to answer all the related
questions based on the model proposed.
In the next section, the conscious action of an individual is modeled using math-
ematical modeling. We need the following basic concepts in Reji Kumar’s model
theory (RKT) [18] to make the subsequent discussion more clear and understand-
able. C x represents the collection of all models that constitute the consciousness of
an individual, say x and a model in the consciousness by m. The collection of all
models, which generates a model m, is denoted by m c . m c = [m 1 , m 2 , . . . , m n ] rep-
resents the collection of all models m 1 , m 2 , . . . , m n that make a model m. The model
m i is a sub-model of the model m if the model m contains the whole model m i , which
is extended to m by including other models, and the model m i remains without any
change. If m i is a sub-model of the model m, then we write m i ≤ m. At the same
time, the model m is called a super-model of m i , which is denoted by m ≥ m i . An
extension is an operation performed on a model. The model m is a generalization
of the models m 1 and m 2 , if m ≤ m 1 and m ≤ m 2 . The null model (∅) is introduced
in the theory to represent any reality. The universal model (U ) stands for a model
that includes all models. The universal model represents the complete reality. These
two models serve the special purpose that they make the theory meaningful. We can
use capital letters to represent a collection of models that will help us to differentiate
them from single models, which are represented by small letters.
2 Consciousness and Actions
Throughout the foregoing discussion, we assume that our conscious actions are con-
trolled by the three relevant areas in our brain. One is for planning and evaluating the
activities, the second is for developing and transmitting the models of actions, and the
third is for recording the completed actions. It is an extension of a preliminary study
in which only two components—one for planning and the other completed actions—
were considered. The models belonging to the above-mentioned three categories are
732 K. Reji Kumar
represented by the three collections of models. The first collection is (MP ) which
contains all the models of planning for the activity, and the second collection is (MA )
which contains all the models of the activity performed. Signals are transferred from
the portion MP to the muscles to perform the action. Each action performed is stored
in the portion MA for evaluation. The models in MP are compared to the models in
MA , to get an assessment of the level of the activity performed at the planning and
evaluating area. A new set of models (MP ) is generated based on the evaluation, and
it replaces MP in the next level of implementation.
Suppose MP = [ p1 , p2 , p3 , . . . pn ] and MA = [a1 , a2 , a3 , . . . an ]. Here, ai is the
model action performed corresponding to the model pi of action planned. We intro-
duce a function f for comparison. The function f : MP • MA → [0, 1], such that
f ( pi , ai ) = 1 if the models perfectly agree with each other. On the other hand,
f ( pi , ai ) = 0 if they completely disagree. The collection MP • MA = [( p1 , a1 ), ( p2 ,
a2 ), ( p3 , a3 ), . . . , ( pn , an )].
A possible way of comparison of two models and its consequence is described
in [15]. As an example, for comparing MP with MA , each pi is compared to every
model in MA . The relationships that exist among the collection of models are also a
model. Such relationships are also compared to the relationships that are associated
with the models in the collection MA . Next, we give a mathematical explanation
for variations in the level of activities performed by two individuals. Moreover,
differences can be observed if the same activity is performed by the same persons
on different occasions. We can explain all these differences in the context of the
mathematical modeling technique used in this paper.
3 Explanation for the Variations in the Actions Performed
An activity performed by a human being is the totality of the mental preparation,

the physical conditions, and the conditions driven by external factors. In this study,
we limit our attention to the internal activities of the mind. It is further explained
using two sets of assumed
data given in Tables 1 and 2. We define the value of
comparison as V = i f ( pi , ai ). We can call this value the value of agreement.
Depending on the values obtained, by comparison, corrective measures are taken
and modified models are generated to improve the performance of the action. This
is again done by sending signals from the planning area to the area for developing
activities after making necessary changes in the models. A new collection of models
MP is developed and used to replace the existing collection, and this procedure is
repeated continuously.
The value of the agreement for the first comparison is 4.6 and that of the second
comparison is 0.36. So, the first performance is highly efficient than the second. Based
on the method of comparison, we can explain the difference in the performance
of different individuals in completing the same task under similar circumstances.
When two models are compared, the consciousness will not make a comparison of
all constituent models. It will continue the comparison until a certain level, which
An Explanation of Personal Variations on the Basis of Model Theory or RKT 733
Table 1 Data showing high level of similarity

a1 a2 a3 a4 a5
p1 1 0 0 0 0
p2 0 0.8 0 0 0
p3 0 0 0.8 0 0
p4 0 0 0 1 0
p5 0 0 0 0 1
Table 2 Data showing very low level of similarity

a1 a2 a3 a4 a5
p1 0.1 0 0 0 0
p2 0 0 0 0 0
p3 0 0 0.15 0 0
p4 0 0 0 0.1 0
p5 0 0 0 0 0.01
is decided by the consciousness itself. As the number of comparisons increases the

efficiency of the performance also increases. Due to this, the consciousness may take
false judgment that the performance is good even though it is very poor.
In Table 1, slight disagreement is shown by only two comparisons. So, the
corresponding models may get modification in the next level of implementa-
tion. But in Table 2, all sub-models show significant difference. So, all of them
must be modified. Thus, we have MP = [ p1 , p2 , p3 , p4 , p5 ] in the first case and
MP = [ p1 , p2 , p3 , p4 , p5 ] in the second case.
4 Conclusion
In this paper, we have discussed the variations in consciousness due to the difference
in comparison of models related to the performance of activities. It is a commonly
accepted fact that consciousness is highly subjective. But, mathematical modeling
methods can be used to explain the intriguing phenomenon of consciousness because
mathematics is an objective area of knowledge, which allows no room for any level
of ambiguity. The main focus of this paper is to suggest a mathematical technique
to model the mental activities related to the performance of human actions and the
variations exhibited in its accomplishment. The method discussed here is completely
based on the theory of modeling (Reji Kumar’s theory or RKT). As a model based on
some mathematical methods, it can further be modified and improved after having a
comparison with reality.
734 K. Reji Kumar
References
1. Perlovsky, L.I.: Towards physics of the mind, concepts, emotions, consciousness and symbols.
Phys. Life Rev. 5, 2355 (2006)
2. Baars, B.J.: In the theatre of consciousness: global workspace theory, a rigorous scientific
theory of consciousness. J. Conscious. Stud. (1997)
3. Baars, B.J., Franklin, S.: Consciousness is computational: the LIDA model of global
workspace theory. Int. J. Mach. Conscious. 1(1), 2332 (2009). https://doi.org/10.1142/
S1793843009000050
4. Mehta, N., Mashour, G.A.: General and specific consciousness: a first-order representation a
list approach. Front. Psychol. (2013). https://doi.org/10.3389/fpsyg.2013.00407
5. Dretske, F.: Naturalizing the Mind. Bradford/MIT Press, Cambridge, MA (1995)
6. Tye, M.: Consciousness, Color, and Content. MIT Press, Cambridge (2000)
7. Balduzzi, D., Tononi, G.: Integrated information in discrete dynamical systems: Motivation
and theoretical framework. PLoS Comput. Biol. 4(6) (2008)
8. Edelman, G., Tononi, G.: A Universe of Consciousness. Basic Books, New York (2000)
9. Oizumi, M., Albantakis, L., Tononi, G.: From the phenomenology to the mechanisms of con-
sciousness: integrated information theory 3.0. PLoS Comput. Biol. 10(5), e1003588 (2014).
https://doi.org/10.1371/journal.pcbi.1003588
10. Sieb, R.A.: Human conscious experience is four-dimensional and has a neural correlate modeled
by Einsteins special theory of relativity. NeuroQuantology 14, 630644 (2016). https://doi.org/
10.14704/nq.2016.14.3.983
11. Koehler, G.: Q-consciousness: Where is the flow? Nonlinear Dyn. Psychol. Life Sci. 15(3),
335357 (2011)
12. Reji Kumar, K.: Mathematical modeling of consciousness. Project Report Submitted to DRDO,
India (2010)
13. Reji Kumar, K.: Modeling of consciousness—Classification of models. Adv. Stud. Biol. 3,
141–146 (2010)
14. Reji Kumar, K.: Modeling of consciousness—A model based approach. Far East J. Appl. Math.
1, 1–14 (2011)
15. Reji Kumar, K.: How does consciousness overcome combinatorial complexity? Adv. Intell.
Syst. Comput. Springer India 325, 167–172 (2015). https://doi.org/10.1007/978-81-322-2135-
7_19
16. Reji Kumar, K.: Modeling of consciousness: mathematics. Science and other forms of knowl-
edge. Manuscript (2009)
17. Reji Kumar, K.: Mathematical modeling of consciousness: subjectivity of mind. In: Proceedings
of the International Conference on Circuit, Power and Computing Technologies (ICCPCT)
(2016). https://doi.org/10.1109/ICCPCT.2016.7530157
18. Reji Kumar, K.: Mathematical foundation of information processing: a consciousness based
study. I J C T A (International Science Press) 8(5), 1989–1995 (2015)
Fingerprint Enhancement Using Fuzzy
Logic and Deep Neural Network
Sridevi Sarraju and Franklin Bein
Abstract Fingerprint recognition analysis is one of the most leading preferred prodi-
gious biometric advancements which have drawn generous consideration in biomet-
rics. In this work, fingerprint intensification is performed which is defined by fuzzy
logic technique and recognize the matching image with its unique characteristics
extracted and classify the features extracted from a fuzzy enhanced image along
with three major types of neural networks which are feedforward artificial neural
network, neural network, and recurrent neural network in order to classify the unique
features extracted from a fingerprint image. This work efficiently expresses the results
with fuzzy logic enhancement and neural network classifiers. Its principle goal is to
improve the image using fuzzy and extricate the spurious minutiae detected and
classify the different features generated using GLCM and DWT. This work displays
a framework of unique finger impression classification based on characteristics for
extricating different features and three types of neural network for classification.
Fuzzy technique is used for the fuzzy-based image enhancement to urge the clear
see of the unique finger impression.
1 Introduction
Fingerprint image intensification is the procedure to enhance the distorted images to

encourage the recognizable proof. The motivation behind the work is to enrich the
quality of the distorted condition image generated from any fingerprint sensor, as
Images can be corrupted due to various conditions and one of the principle issues is
the resolution of the fingerprint sensor generating noisy images. High-quality pictures
are vital for exact coordinating of unique finger impression pictures. But unique mark
pictures are seldom of idealized refinement. As it may be corrupted or debased due
to varieties of the skin, impression state, and condition. In this way, unique finger
S. Sarraju · F. Bein (B)

School of Computer Science and Engineering, Ulsan National Institute of Science and
Technology, Ulsan, South Korea
e-mail: bien@unist.ac.kr
https://doi.org/10.1007/978-981-16-1502-3_73
736 S. Sarraju and F. Bein
impression images must be improved before utilized. The idea behind this work
fingerprint image intensification process is to improve the quality of distorted and
noisy fingerprint images generated from a low-cost fingerprint sensor. Execution
of current fingerprint acknowledgment frameworks is vigorously influenced by the
precision of their characteristic extraction evaluation. These days, there are more
ways to deal with fingerprint analysis with worthy outcomes. Issues begin to emerge
in low-quality conditions where the dominant part of the conventional strategies
dependent on examining the surface of fingerprint cannot handle this issue so effec-
tively as neural networks. Fuzzy logic technique is implemented first to remediate
the distorted picture and enhance it with the implementation of GLCM and DWT2
algorithm features of an image which is extracted, post to which three types of neural
network classification is performed to analyze the accuracy of the image generated
from the extracted feature parameters and match the test and trained result with
the implementation of neural networks and classify the outcome results. The three
neural networks used are artificial neural network (ANN), neural network (NN), and
recurrent neural network (RNN). This algorithm works efficiently to identify the
fingerprint matching from the predefined trained images from the fuzzy enhanced
image generated.
Experiments are performed on 100 images in MATLAB 2019 to make sure the
extraction process should not get the false minutiae and preserve the true extracted
features fuzzy-based image enhancement method makes sure the feature traits of
the image is intensified. Better improvement proves the quality improvement further
incrementing the highest accuracy determined in the classification further. This work
can be used in wide area of applications in biometrics as it is a combined work of
distorted fingerprints enhancement, false feature removal, true feature extraction,
matching of the images for identification purpose, and classification using neural
networks. Experiments show results which are quite promising and give a direction
of the subsequent further analysis in future work.
1.1 Proposed Method
There have been several researched carried on the topic and one of the traditional
methods is Gabor filter method the most famous and traditional technique in finger-
print enhancement. Distortions of the fingerprint image in low resolution, cost-
effective sensors often lead to the challenge in training the computer interface to
reconstruct the noisy pieces of the information which leads to the following prob-
lems as spurious minutiae will be generated as true minutiae can be lost in the
process, errors in positioning of the extracted features, the ridge and bifurcations are
not always well defined, classification of the extracted features is quite challenging.
Also there are certain drawbacks related to the traditional Gabor filter method as it
is unknown fact that what could be the accuracy of the enhancement and what is
the percentage of the evaluation, classification needs to be performed using different
classifiers to understand the evaluation of the analysis performed on the enhancement
Fingerprint Enhancement Using Fuzzy Logic … 737
and noise reduction which should also extract the true value and should be able to
eliminate the false values.
In order to overcome the drawbacks from the traditional Gabor filter method and
evaluate the percentage of accuracy associated with the enhancement evaluation,
there must be some technique implemented to find the answers of improvement.
Classification is an important stage to classify the test results to compare between the
different classifiers and find out the best possible solution among all the classifiers.
The overall outcome of the results should eliminate the noisy part of information
and preserve the accurate features and in order to do that we need improved feature
extraction techniques to have large part of information which can be evaluated and
analyzed. Matching should be performed between the test and trained data in order to
have the fingerprint identification. Out of all the initial step should be the enhancement
part and the implementation are based on fuzzy logic with GLCM and DWT 2
dimensional as feature extracting algorithms is implemented. Deep neural networks
have been turned out to be used for the classification purposes and the outcome
is estimated measured across different neural networks post to which matching is
performed between the test and results obtained.
1.2 Pre-processing
The pre-processing begins with ROI binary image conversion from the input image
upon which morphological operation takes place which converts the image to thinned
image. Then minutiae and feature extraction are performed, and ridges and bifur-
cations are determined, and then false detection of these features is detected and
removed. Once again true ridge and bifurcation findings are calculated and preserve
the true features and false minutiae filtering is applied to the results of feature extrac-
tion. After the successful completion of all the pre-processing steps, the image is
applied to the fuzzy logic for the enhancement.
1.3 Fuzzy Logic
Fuzzy is a rationale or control arrangement of a n-esteemed rationale framework

which uses the degrees of state “degrees of truth of the information sources and
delivers yields which rely upon the conditions of the data sources and pace of progress
of these states as opposed to the standard thing genuine or fake. It acknowledges
the deliberate factors as info and changes over the numerical qualities to semantic
factors. With the application of fuzzy logic technique, the image is pre-processed
and enhanced first, and features of the minutiae are extracted with morphological
operations in order to identify the matching true minutiae and make comparison
between trained and test fingerprint image from the database and classification is
performed using three types of the neural network. In pre-processing, original image
is taken of a particular size suitable for further pre-processing. Algorithm is explained

in detail (Figs. 1, 2, and 3).
• Pre-processed picture is exposed to the proposed strategy for fuzzy-based upgrade.
– Fuzzy upgrades the nature of the given image by wiping out clamor and
improving the magnitude fragments.
– It works on minute information locales known as tiles, as opposed to working
on the whole picture.
– Each tile differentiation is improved with the goal that the histogram of the
yield area coordinates around to the predetermined histogram.
Pre-Processing
False Minutae Removal

[Ridge &Bifurcation]
Fuzzy Image
Enhancement
Train
Matched
Feature Extraction
Yes
GLCM , DWT2 NN
Result
Threshold
Classification ANN i== 1
Accuracy
RNN No
Unmatched
Test
Fig. 1 Architecture: proposed method
Fig. 2 Algorithm
Fig. 3 Fuzzy enhancement tile operation
– The adjacent tiles are then joined utilizing bilinear insertion so as to dispose
of misleadingly initiated limits. First the input image is specified to a binary
range [0 255] Discover the histogram of the image
• Divide the outcome by number of pixels
• Calculate cumulative sum
• Convert the image into the int value
Example in Figs. 4, 5 and 6 it is noticed that from the original input image the
fuzzy enhanced image has intensified the image and the features which are hidden,
and unseen are clearly visible in the final output and the intensity of the image is also
Fig. 4 Fuzzy enhancement result 1, shows conversion of noisy to enhanced image

Fig. 5 Fuzzy enhancement result 2, enhancement constructs the missed and noisy lines
Fig. 6 Fuzzy enhancement result 2, dark shades are enhanced

improved. Missing ridges and bifurcations are also visible and there is a noticeable
difference seen. In all the images the intensity of the image is improved and brighter.
2 Deep Neural Network Classification
Deep learning is an incredible breakthrough in the field of artificial intelligence. Its

applications have been widely utilized in every one of the fields. In this work, we
have utilized different deep learning neural network Classification technique, which
mainly helps to analyze the computational value and compare the results to find the
best possible outcome using feedforward artificial neural network, neural network,
and recurrent neural network. NNs works well with the enormous data as it can be
Headings. Trained with extra layers unlike machine learning where training can be
performed till a specific degree of extent. The three types of NNs have been utilized
in this work so as to measure the accuracy of the results using different classifiers
and find the best possible solution. The three types of NNs utilized in this thesis work
are artificial neural network (ANN), two-layer neural network (NN), and recurrent
neural network (RNN). Results show considerable amount of improvement in all the
classifiers and also matching of the image is performed to test the accuracy scores
of the trained versus test results.
The neural networks which function as a human brain nervous system have input
layer and output layer where we get the final predicted output. The outcome of the
activation function checks in the event that the specific neuron gets actuated or not
and, at that point enacted neuron transmits information to the neuron of the following
layer over the channels. The output value obtained is usually termed as a probability
value. ANNs operate on the feedforward neural network principle. The reason of
using ANN is especially in pattern recognition since patterns are difficult to charac-
terize. ANNs work well with the distorted data and easy to characterize. Mean Square
error is implemented as a Performance function. Training, testing, and validation are
done and result of test worth is contrasted and the trained evaluation and shows
whether the true parameter estimation of test parameter after the spurious minutiae
removal is matched or not with the trained values. RNN is utilized capriciously to
insinuate two wide classes of frameworks with a similar general structure.
2.1 Feature Extraction GLCM and DWT2
Gray Level Co-occurrence Matrix (GLCM) has been used for strong and exact clas-
sification. This efficient method helps to evaluate the extracted features and removal
of spurious minutiae. One of the most important reasons for using this algorithm is its
distinctive way of summarizing fundamental characteristics. Co-occurrence matrices
are often used for extraction because they are composed of regular texture and its
strong, effective, and distinctive way of characterizing the features. Appropriation
of pixel dark levels can be depicted by second-request insights like the likelihood of
two pixels having specific dim levels at specific spatial connections. This data can
be abridged in two-dimensional dim level co-event grids, which can be processed
for different separations and directions. It calculates the Euclidean distance across
the two centroids of the image and evaluates the features. Discrete wavelet transfor-
mation extracts features using high pass and low pass filter; in this algorithm, single
level-2-dimensional wavelet transformation is been used along with the Haar wavelet
which is a succession of rescaled square molded capacities all together or premise.
DWT2 as a feature extraction algorithm is used due to its n levels of data filtering
technique it receives approximation coefficient and detailed coefficients. Features
extracted from DWT2 coefficients are considered useful to input to classifier.
DWT2 returns the approximation detailed coefficient matrices such as cA, cH,
cV, and cD termed as horizontal, vertical, diagonal, and approximation coefficients.
Various features extracted from the image are subjected to pre-processing part first
upon which it is subdivided such that there are division and subdivision of the blocks
according to the pixelwise operation. The Euclidean distance is what relates to regular
experience and recognitions. That is, the sort of single or multi-level dimensional
direct metric presence where the partition between any two points in space identifies
with the length of a straight line drawn between them. In the wake of figuring the
separation between two sets of focuses, for which there is least separation those will
be coordinated.
3 Results
Results in Table 1 show the percentage of the accuracy obtained by all the classifiers,
artificial neural network scored the highest possible accuracy scoring 96% when
compared to the remaining classifiers, a simple neural network scored the second
highest scoring 93%, and recurrent neural network got the least accuracy of 85%
comparing to the remaining classifiers.
3.1 Receiver Operating Characteristics (ROC)
ROC curve illustrates the effectiveness of the initiated strategy. In classification to

evaluate the execution performance visually this curve comes into picture. The curve
Table 1 Accuracy obtained

Type of classifier Percentage of accuracy (%)
in classification
Artificial neural network (ANN) 96
Neural network (NN) 93
Recurrent neural network (RNN) 85
Fig. 7 ROC curve ANN classifier result
is plotted for all the three classifiers showing the best results in all specially ANN.
For each image we test in MATLAB ROC curve is plotted for all the classifiers. A
good result shows the more value closer to 1, so if the value is close to 1 the higher
is the accuracy to be considered (Figs. 7, 8, and 9).
The formula to measure the false positive rate and sensitivity is described below.
FPR = FP/(FP + TN)

Sensitivity = TP/(TP + FN)
3.2 Equal Error Rate (ERR)
Table 2 describes the EER metrices of all the classifiers and once again ANN proves
to be having the best results when compared to the remaining classifiers. The more
the value close to 0, the more efficient is the performance.
Fig. 8 ROC curve NN classifier result
Fig. 9 ROC curve NN classifier result

Table 2 ERR results

Type of neural networks Equal error rate (EER)
Artificial neural network (ANN) 0.0400
Neural network (NN) 0.0700
Recurrent neural network (RNN) 1.5000
4 Conclusion
The algorithm helps in precise mapping and classification of the fingerprint images.
Utilizing morphological operations false minutiae is removed and true features are
preserved using GLCM and 2-dimensional DWT operational algorithms. Fuzzy
logic-based image enhancement technique ensures good quality fingerprint images
in succession increase the classification and detection of the highest accuracy. The
overall classification is comparatively taken less computational time. A feature
particulars-based matching is utilized to acquire the matching across the training
and the testing images. The process flow begins with pre-processing first and then
filtering which acts as a double filtering technique and operated twice in order to
make sure the spurious part is detected properly and eliminated preserving the true
values characteristics. After performing the morphological function image is set to
fuzzy-based enhancement. Total of 100 images were taken in the dataset for the
training purposes. The feature extraction algorithm like GLCM and DWT2 extracts
different features as the more the features are the better the classification will be
performed. The classification results give the highest result after using ANN classi-
fication. While performing the classification fingerprint matching is been performed
to compare the test versus trained features of the image. The advantages of the work
include Better image enhancement technique ensures high-quality fingerprint images
which will in turn increase the classification and detection accuracy. Precise mapping
and classification of fingerprint images.
Acknowledgements This research was supported by the MSIT (Ministry of Science and ICT),
Korea, under the ITRC (Information Technology Research Center) support program (IITP-
20192017-0-01635) supervised by the IITP (Institute for Information and Communication Tech-
nology Promotion).
Gaussian Filter-Based Speech
Segmentation Algorithm for Gujarati
Language
Priyanka Vishwas Gujarathi and Sandip Raosaheb Patil
Abstract Automatic speech segmentation is a main step in speech signal production

and analysis process. Great advancement in speech synthesis has already been made
using concatenative algorithms. Syllable is most suitable speech unit for concate-
native speech synthesis because it does not require extensive prosodic models and
provide better co-articulations than other sound units. To get natural sounding, output
speech segmentation plays very important role. Speech segmentation is the process
of dividing speech signal in to smaller units of sound. So accurate selection of speech
unit and detection of boundaries are very important. In this research work, Gujarati
language is used for segmentation and database is created. This paper suggests a
method of syllable segmentation to detect boundaries of syllable by means of start
point of syllable and end point of syllable. Performance parameters such as accu-
racy and peak signal to noise ratio (PSNR) are evaluated. Producing natural sounding
speech signal in different Indian languages is a very demanding and ongoing problem.
1 Introduction
Text to speech (TTS) system is a process of converting written raw text data
into spoken speech waveform. The TTS method typically involves two steps: text
processing and speech generation [1]. Segmentation is the process of dividing the
continuous speech signal into a separate sub-word unit, i.e., finding correct bound-
aries of particular signal. Most of the research work is carried out to segment the
speech into units like word, sub-word, syllable and phonemes using various segmen-
tation approaches. Pronunciation duration is very important problem for speech
segmentation, mainly in languages like Tamil [2]. Deterministic annealing expec-
tation–maximization (DAEM) algorithm is used to over EM algorithm [3]. Group
P. V. Gujarathi (B)
JSPM’s Rajarshi Shahu College of Engineering, Tathawade, Pune 411033, India
S. R. Patil
Bharati Vidyapeeth’s College of Engineering for Women, Dhankawadi, Pune 411043, India
https://doi.org/10.1007/978-981-16-1502-3_74
748 P. V. Gujarathi and S. R. Patil
delay-based segmentation and spectral transition measure (STM)-based segmenta-

tion method are used [4]. Gaussian filter-based method is used [5]. Gaussian compo-
nent sequence produces better synthetic speech than EM algorithm [6]. When the
target raw text is given for converting into speech signal, corresponding smaller
units from database are concatenated (String together) to build a continuous speech
waveform. Speech corpus development is the process of converting the human voice
signal into smaller speech units [7]. For database, a raw text data is selected from
text database, which has rich collection sentences. It may be from News bulletins,
story books, novels, magazines, interviews, etc. Then, with the help of a good native
speaker of particular language database is created [7]. Syllable units can capture better
co-articulation than phones. In Indian language about 35 consonants and 18 vowels
are involved [8]. Speech signal is generated by using two components vocal cords
and vocal tract. When we speak, we utter different words. Aksharas are the essen-
tial units of the writing system which is syllabic in nature [9]. For Indian languages,
syllable-like units are a much better than other sound units [10]. Co-articulation effect
and periodic mismatch between two adjacent units given for Telugu language [11].
Basically, word is formed by using vowels, and then, it is combined with consonants
to form syllables which ultimately give a word. For example, the word Gujarati is
composed of four syllables: gu, ja, ra and ti. Usually, a list of VC, CV, VCV or CVC
words is used and for longer words CVVC, VCCV or CCCVCCC combinations
are also required. So producing all syllable combination is difficult. Various criteria
have to be taken into consideration while building the speech database, speaker selec-
tion, optimal text selection and so on [12]. A fraction-based waveform concatenation
technique produces intelligible speech segments [13]. Speech synthesis research is
mostly focused on traditional unit selection, statistical parametric speech synthesis
(SPSS) [14]. Segmentation plays vital role in speech recognition and synthesis
systems. An automatic segmentation of tamil speech into syllable using vowel onset
point (VOP) and spectral transition measure (STM) [15]. VOPs detected using auto-
associative neural network (AANN) [16]. Automatic syllable segmentation of Pumi
speech is done with GABPNN, DWPTMFCC, fractal dimension [17]. To get natural
sounding, output syllable boundaries must be accurately detected. Paper is orga-
nized as database creation for Gujarati language, speech segmentation at syllable
level, experimental results.
2 Methodology
2.1 Gujarati Language
Gujarati is an Indo-Aryan language and spoken mostly by the Gujarati people, and
Gujarati is part of the Indo-European language family. There are about 1652 Indian
languages; 49 million Gujarati speakers are available. Gujarati language is made up
Gaussian Filter-Based Speech Segmentation Algorithm … 749
Table 1 Commonly used Gujarati words and corresponding English word

Guj Word Eng Guj Eng Word Guj Eng Word Guj Word Eng Word Guj Eng Word
Word Word Word Word
એક Ek આ Aa તેને Tene તમે Tame પૈસા paisa
બે Be ચોપડી chopadi તમને tamne કઈ kai જગા Jaga
છ chha કલામ kalam કેટલા ketla તમારું Tamaru દૂ ર Dur
નવ nav મને mane તે Te શું shu નામ Naam
દસ Das મારે mare કેટલી ketali કયો kayo સુઈ Sui
sattar જમણ jaman છે chhe હતા hata સાથે shathe
સાત sat છાપું chapu કેવો kevo ગયા gaya ખોખું khokhu
અિગયાર agiyar કયુ kayu હતો hato આપશો aapsho pariksha
બાર bar ં kya aapya આવશો aavasho લખી lakhi
તેર ter સારું saru પધારો padharo મારી mari પાણી Pani
of 13 vowels and 34 consonants. Table 1 gives some commonly used Gujarati word
along with its English word.
2.2 Syllable Unit
Speech signal in Indian language is based on basic sound units which are from
consonant, consonant vowel, consonant consonant vowel, vowel consonant, conso-
nant vowel consonant combinations. Speech units like syllable perform better for
Indian languages than rest all speech units like diphone, phone and half phone [18].
Syllable is represented as C*VC*, where C is a consonant, V is a vowel, and C*
indicates there may be no or more consonant present.
Some grapheme to syllable conversion rules are given in [11]. Example for forma-
tion of words from syllables is given: For Gujarati word (1) aakho (આખો ) syllable
will be aa + kho = aakho. (2) pancham (પંચમ) = pan + cham
aa(Syllable1) kho(Syllable2) aakho(Word) pancham(word)

pan(syllable1) cham(syllable2)
Example for formation of word from syllables
2.3 Text Database Collection and Speaker Selection (Speech

Database)
Text database (5000 + Words) was collected from newspaper, magazines, story
books, dictionaries, etc. For speech database creation, speech samples were collected
from different speakers, and different parameters were considered like variations in
Word selecƟon Recording of Silence Listening aŌer Saving

from master selected removing from silence recorded audio
database word recording removal file
Fig. 1 Database creation basic blocks
pitch, amplitude, duration and clarity. Audibility test [Mean Opinion Score (MOS)]
was carried out to select speaker, and the speaker with the maximum MOS was
preferred for recording of Gujarati speech database (Fig. 1).
2.3.1 Recording Phoneme ka.wav ( કા .wav) and Silence Part Removal

From Phoneme by Audacity Software
Figure 2 waveform of phoneme (ka.wav) using audacity software phoneme before

silence removal
Figure 3: waveform of phoneme ka.wav using audacity software phoneme after
silence removal
Figure 4 waveform of phoneme (ka.wav) using MATLAB software phoneme
before silence removal
Figure 5: waveform of phoneme ka.wav using MATLAB software phoneme after
silence removal
Fig. 2 Phoneme ka.wav

2.3.2 Recording Word taru.wav ( ) and Silence Part Removal From

Phoneme by Audacity Software
See Figs. 6 and 7.
2.3.3 Manual Segmentation Using Praat Software: For Word taru.wav

Manual Segmentation Is Done
See Fig. 8.
Manual segmentation is very monotonous and lengthy task. It is also difficult to
arrive at a common labeling strategy for speech signal across different researchers
[19]. So to avoid these problems, automatic segmentation is used. Before saving audio
Fig. 6 Word taru.wav before silence removal
Fig. 7 Word taru.wav after silence removal
Fig. 8 Word taru.wav
file to particular location, we must listen to it. Reasons to listen recorded sound file
before saving in proper location: (1) To check clarity of sound. (2) To check silence
removal is made properly or not. (3) To check recorded sound is for selected word
or not. (4) To check correctness of pronunciation. (5) Saving audio file.
2.4 Labeling and Speech Corpus
In this process, given text (syllables) and corresponding speech signals have to be
aligned with each other. All the experiments in this paper are conducted on authors
database of 1000 Gujarati words. Basically, to cover all the possible syllables is very
difficult because number of syllables is not fixed. If sound units are not there in
database, then syllables for those sound units are split into phones. Phone units are
used for concatenation to produce synthesized speech signal [5].
3 Speech Segmentation at Syllable Level
3.1 Speech Segmentation Using Gaussian Filter Method: [5]
Gaussian function is used in numerous research areas. It is a smoothing operator. The

Gaussian filter is a non-uniform low-pass filter (LPF). The Gaussian filter impulse
response is given,
g(t) = e−α
2 2
t
(1)
For a given Gujarati speech input signal, short term energy contour is calculated
using overlapped window. Then, filtered STE contour is calculated using Gaussian
filter. After that locations of the minima’s are indicated by using start point and end
point of syllables in the Gaussian filtered STE contour. Calculation of start point
(SP) and end point (EP) will give boundaries of syllables. According to SP and EP,
calculated syllables are extracted from given input. In figure boundaries are indicated
by red color star.
For Gujarati word “savaek savaek savaek” syllables are extracted using SP and EP
calculation:
1. Speech waveform is plotted for word “savaek savaek savaek” સવાએક સવાએક સવાએક
is given and on x-axis: Time (Sample No), y axis: Amplitude (Fig. 9).
2. Short-term energy contour (STE) is calculated for word “savaek savaek savaek”
(Fig. 10).
3. Using gaussian filtering we get final output, i.e., filtered STE output. Syllables
for word savaek = sava + ek (Fig. 11).
Fig. 9 Gujarati word uttered savaek savaek savaek

Fig. 10 STE For uttered savaek savaek savaek
Fig. 11 Filtered short-term energy
So in our input savaek is uttered three times so we will get three start points and
three end points.
"sava + ek" "sava + ek" "sava + ek" == ‘"savaek" "savaek" "savaek."
Red marks in figure shows start point and end point of syllables. Here, we have
taken example savaek so in this first syllable is started at sample 46,122 and ends at
65,862. So boundaries of syllable is calculated to get proper syllable (Table 2).
4. For validation subjective listening test is carried out with list of questionnaires.
Voice pleasantness: In this test, voice signal is described in terms of voice
pleasantness. Subjective listening test carried out with 20 listeners, and nearly,
4.6 score is obtained out of 5 which means voice was pleasant while listening.
Correctly detected boundaries are a measure of segmentation accuracy, and this
is referred to as the hit rate (HR)
Table 2 Start point and end point of syllables from word savaek, Ekavan
Word uttered Word Syllable Syllable Start point End point
Same word uttered three times: savaek Savaek Syllable 1 Sava 46,122 65,862
savaek savaek સવાએક સવાએક સવાએક Syllable 2 Ek 73,173 85,251
Savaek Syllable 1 Sava 158,143 179,927
Syllable 2 Ek 188,095 198,765
Savaek Syllable 1 Sava 267,044 287,924
Syllable 2 Ek 291,679 300,295
Same word uttered three times: Ekavan Syllable 1 Eka 26,587 31,683
Ekavan Ekavan Ekavan Syllable 2 Van 37,017 59,577
ઍકવાન ઍકવાન ઍકવાન
Ekavan Syllable 1 Eka 124,253 128,491
Syllable 2 Van 134,281 158,595
Ekavan Syllable 1 Eka 212,401 217,829
Syllable 2 Van 222,251 235,689
Nhit = Number of boundaries correctly detected Nref = Total number of

boundaries in the reference
Then,
HR = Nhit/Nref ∗ 100 (2)
The efficiency of the segmented syllable has been evaluated using the PSNR
measure which is defined as follows,

PSNR = 20 ∗ log 10 Max signal Value/ (3)
The PSNR performance is checked on this algorithm, and HR value is obtained in

percentage 79.32. Experimental results shows this method works better for author’s
database as it is recorded taking into consideration proper Gujarati pronunciations.
The speech files those gave incorrect syllables were rerecorded.
5 Conclusion
Segmentation of speech signals into linguistic units has enormous applications in

the fields of speech synthesis. The main purpose of this work is to provide auto-
matic segmentation algorithm for Gujarati speech database at syllable level. Result
is evaluated by subjective listening test (MOS) and PSNR performance. From subjec-
tive listening test (MOS), we can conclude that the produced synthesized speech is
preserving naturalness. The further research work direction still there is the scope
for accurate segmentation at boundaries to improve quality of speech signal.
References
1. Geeta, S., Muralidhara, B.L.: Syllable as the Basic Unit for Kannada Speech Synthesis. IEEE
WiSPNET 2017 Conference
2. Geethaa, K., Vadivel, R.: Syllable segmentation of tamil speech signals using vowel onset point
and spectral transition measure. automatic control and computer sciences (2018)
3. Shah, N.J., Patil, H.A., Madhavi, M.C., Sailor, H.B., Patel, T.B.: Deterministic annealing EM
algorithm for developing TTS system in Gujarati. 2014 IEEE
4. Patil, H.A., Patel, T., Talesara, S., Shah, N., Sailor, H., Vachhani, B., Akhani, J., Kanakiya, B.,
Gaur, Y., Prajapati, V.: Algorithms for speech segmentation at syllable-level for text-to-speech
synthesis system in Gujarati. In: 2013 International Conference on Asian Spoken Language
Research and Evaluation (O-COCOSDA/CASLRE)
5. Talesara, S., Patil, H.A., Patel, T., Sailor, H., Shah, N.: A novel gaussian filter-based automatic
labeling of speech data for TTS system in Gujarati Language. In: 2013 International Conference
on Asian Language Processing
6. Takamichi, S., Toda, T., Shiga, Y., Sakti, S., Neubig, G., Nakamura, S.: Parameter generation
methods with rich context models for high-quality and flexible text-to-speech synthesis. IEEE
J. Sel. Top. Sign. Process. 8(2) (2014)
7. Kiruthiga, S., Krishnamoorthy, K.: Design issues in developing speech corpus for Indian
languages—a survey. In: 2012 International Conference on Computer Communication and
Informatics (ICCCI-2012), Jan. 10–12, 2012, Coimbatore, India
8. Bellur, A., Badri Narayan, K., Raghava Krishnan, K., Murthy, H.A.: Prosody modeling for
syllable-based concatenative speech synthesis of Hindi and Tamil IEEE (2011)
9. Shreekanth, T., Udayashankara, V., Arun Kumar, C.: An unit selection based hindi text to speech
synthesis system using syllable as a basic unit. IOSR J. VLSI Sign. Process. (IOSR-JVSP)
(2014)
10. Kurian, A.S., Narayan, B., Nagarajan Madasamy, Bellur, A., Krishan, R.: Indian language
screen reader and syllable based festival text to speech synthesis system. Assoc. Comput.
Linguist. 63–72 (2011)
11. Saraswathi, S., Geetha, T.V.: Design of language models at various phases of Tamil speech
recognition system. Int. J. Eng. Sci. Technol. (2010)
12. Patil, H.A., Patel, T.B., Shah, N.J., Sailor, H.B., Krishnan, R., Kasthuri, G.R., Nagarajan,
T., Christina, L., Kumar, N., Raghavendra, V., Kishore, S.P., Prasanna, S.R.M., Adiga, N.,
Ranbir Singh, S., Anand, K., Kumar, P., Chandra Singh, B., Binil Kumar, S.L., Bhadran,
T.G., Sajini, T., Saha, A., Basu, T., Sreenivasa Rao, K., Narendra, N.P., Sao, A.K., Kumar, R.,
Talukdar, P., Acharyaa, P., Chandra, S., Lata, S., Murthy, H.A.: A syllable-based framework
for unit selection synthesis in 13 Indian languages. In: 2013 International Conference Oriental
COCOSDA held jointly with 2013 Conference on Asian Spoken Language Research and
Evaluation (O-COCOSDA/CASLRE)
13. Panda, S.P., Nayak, A.K.: A waveform concatenation technique for text-to-speech synthesis.
Speech Technol. (2017)
14. Black, A.W., Zen, H., Tokuda, K.: Statistical parametric speech synthesis. In: IEEE Interna-
tional Conference on Acoustics, Speech and Signal Processing (ICASSP)
15. Geethaa, K., Vadivel, R.: Syllable segmentation of tamil speech signals using vowel onset point
and spectral transition measure. Autom. Control Comput. Sci. (2018)
16. Gangashetty, S.V., Sekhar, C.C., Yegnanarayana, B.: Spotting multilingual consonant-vowel
units of speech using neural network models. In: International Conference on Nonlinear
Analyses and Algorithms for Speech Processing; Lect. Notes Comput. Sci. (2005)
17. Fu, M., Pan, W., Hu, W., Chen, S.: Syllable segmentation of pumi speech with GABPNN based
on fractal dimension and DWPTMFCC. In: 2016 International Conference on Information
System and Artificial Intelligence
18. Kishore, S., Black, A., Kumar, R., Sangal, R.: Experiments with unit selection speech databases
for Indian languages. National seminar on Language Technology Tools: Implementation of
Telugu, October 2003, Hyderabad, India
19. Kamakshi Prasad, V., Nagarajan, T., Murthy, H.A.: Automatic segmentation of continuous
speech using minimum phase group delay functions. Speech Communication 2004
Smart Farming Technology with AI &
Block Chain: A Review
Deepali Jawale and Sandeep Malik
Abstract Agriculture being backbone for the survival of mankind needs proper
facilities with great production to increase the economy of the farmers. In our
proposed System details will be provided by farmer for analyzing details like soil
type (fertility and nutrients), weather conditions, etc. which will help them analyze
and Classify Crop and Provide which pesticide and fertilizer to be used and improve
crop yield by providing information related to crop need. The system will also avoid
data replication using Blockchain technique easing farmers to take better decisions
regarding their farms or growth of crops. Having detailed information about soil,
farmers can cultivate multiple crops in their farms proposed by system. The System
will also give weather prediction to farmers helping them from indulging in any
unwanted situation and have enough yields.
1 Introduction
In the World full of Technology where each field is digitized, agriculture is the
sector which to promoted where minimum efforts yield maximum production. Even
today some farmers lack basic facilities such awareness about soil quality, their
maintenance such as right amount of fertilizers and pesticides using in the fields,
growth of multiple crops using one soil structure, government introduced schemes,
etc.
Rapid climatic changes have been witnessed during the last few years. The indica-
tion is in the form of an irregular monsoon in India. There are unpredictable levels of
rainfall in different parts of the country and farmers are usually unaware. Detecting
nutrient deficiencies will help to deliver correct fertilizers and reduce pesticide use
D. Jawale (B) · S. Malik

Oriental University, Indore, MP, India
S. Malik
e-mail: sandeepmalik@orientaluniversity.in
https://doi.org/10.1007/978-981-16-1502-3_75
758 D. Jawale and S. Malik
as weaker crops are vulnerable to pests. Having Right amount of fertilizers at right
place will lead to increased efficiency in plant growth.
The Farmers need proper guidelines related to their cultivation of crops in their
fields. It can be done based on proper prediction based on classification accurate
parameters and results derived from them.
In our System Based on data the system will suggest which type of crops can be
cultivated in future to increase productivity. Based on classification of parameters
taken results can be derived for farmers helping them to implement into their farms.
The data related to crop will be stored on Blockchain to attain security, avoid redun-
dancy, and predicting accurate results. System will predict the future Multi cropping
pattern and also suggest which pesticides and fertilizer can be used for particular crop.
The System will forecast the weather conditions to avoid any unwanted conditions
for farmers.
2 Literature Review
Many Researchers presented a comprehensive framework of agricultural surveil-

lance, implementation. This segment explains analysis of the literature.
Shirsath Rakesh et al. [1] the proposed decision support system is useful to help
farmers pick a crop for cultivation mapping using different soil parameters such
as soil type, soil PH-value, average weather needed, water consumption required,
temperature range, etc. This method has been used to improve crop production by
providing basic details and the crop list. Their user-friendly android application
suggests most likely seasonal and soil-type matching crops for farmers so that they
can grow more suitable crops and increase the production ratio.
Lambros Lambrinos et al. [2] they also developed a decision support system
for precision/smart farming that uses data from various sources to provide perti-
nent data. More precisely, they combine data from a variety of sensors acquired
through the LoRaWAN network with weather and crop information in order to make
informed decisions that are currently focused primarily on the use of water and crop
safety against adverse weather conditions, which are increasingly troubling farmers
worldwide as a result of climate change.
Md Ashifuddin Mondal et al. [3] the goal of this analysis is to proffer an IoT-based
smart farming framework for tackling adverse situations. Smart agriculture can be
embraced and offers high precision crop manage, useful information mobilization,
and computerized farming techniques. This work introduces an intelligent observing
system which controls temperature and soil humidity for agricultural fields. On the
basis of these, principles it takes necessary action after processing the sensed data
without human intervention.
Konlakorn Wongpatikaseree et al. [4] The propound of this investigation is to
elaborate a traceability process, to compile and present recognized data from a smart
farm. Via the Internet of Things (IoT) was implemented using various sensors to
examine environmental information in the smart farm. All outcome data is measured
Smart Farming Technology with AI & Block Chain: A Review 759
and presented using a method of traceability. More information, especially regarding

the quality of the planting process, is given to customers by scanning the Quick
Response Code (QR) before purchasing an agricultural product.
Eko Ariawan et al. [5] this paper introduced a smart micro-farm model, based on
the IoT concept, designed for information visualization, information acquisition, and
information monitoring. To successfully build device it integrates microcontroller,
sensors, and cloud services. Implementing this observation model in the field will
greatly contribute to increasing the harvested algae yield. The technologies perform
the primary role of connection among digital system and the physical world. Their
analysis has focused primarily on IoT framework design for the smart micro-farm.
The sensors used are capable of observing the environment and of supporting the
automation process.
Aditi Shah et al. [6] This paper focuses on confirmation of macro-nutrients stat-
isfication using picture processing and machine learning technique. This will give
farmers and concept of crop safety and precautionary action taken.
Yemeserach Mekonnen et al. [7] it explains the complete design, dispatch, and
functionality of the systems. The test bed contains distributed WSN which observes
various parameters for agriculture and the environment. Wireless data transmission
and acquisition of sensors are handled via ZigBee protocol via IoT gateway router.
Gumaste et al. [8] they proposed a smart farming approach that would use key
technologies, such as FFT and genetic algorithms. Farmers must be recorded with
an Internet connection, from the web or via the android mobile app. The cloud
warehouse is used to store farmers’ and knowledge about the environment. The
current weather conditions are obtained from the farmer’s position using Internet
and GPS coordinates for coming weather forecasts.
Gandhi et al. [9] this paper provides an application of data mining technology in
decision-making. System consist of, artificial neural networks, bayesian networks,
and vector supporting machines. Techniques are used for providing the relationships
between different climates and other crop production factors. This analysis indicates
that further studies are needed to understand how these techniques can be used with
complex agricultural data sets for crop yield prediction, using GIS technology to
combine seasonal and spatial factors.
Martinez-Ojeda et al. [10] this work has therefore been undertaken to identify
the problems of primer land cultivation and precision agriculture techniques. This
study elaborates the innovation of a self-recommended crop program that tracks soil
quality and provides a database list of chosen general crops. The device utilized
various sensors that measured pH, soil moisture, soil temperature, and soil fertility.
Akshay Sankpal et al. [11] proper nutrient ratios for the crop to grow through
the fertilizers are required. It should be understood which fertilizers are needed to
be applied to the soil. Several researchers are working to classify the key nutrients
of nitrogen (N), phosphorous (P), and potassium (K) in soil. This paper discusses
sensing systems and other portable methods for assessing NPK soil nutrients.
Patil et al. [12] this paper analyzed and evaluated the integration of IOT tech-
nology with sensor technology and wireless networks on the basis of the current
agricultural system scenario. The Remote Monitoring System (RMS) is proposed as
an Internet and wireless communication hybrid solution. The main objective is to

collect data on the real-time agricultural production climate that allows quick access
to agricultural facilities, such as short message service (SMS) alerts and advice on
weather conditions, crops, etc.
Lihua Xu et al. [13] the predictive model of usable nitrogen (AN) and phosphorus
(AP) content was developed using the partial least square (PLS) method based on
the analysis of the laboratory reflectance spectrum of 118 soil samples. The findings
suggested that after continuum removal and re-sampling, the association of soil
nutrients (AN and AP) and soil spectral characteristics were enhanced.
Yoon et al. [14] communication modules for smart farming using low-power
Bluetooth and Low Power Wide Area Networks (LPWAN) were built in this paper,
including the wired communication network used in the actual farm. In addition,
the system uses the MQ Telemetry Transport (MQTT) communication type, which
is a dedicated IoT protocol, to incorporate monitoring and control functions, thus
improving the possibility of developing agricultural IoT.
Pudumalar et al. [15] precision agriculture is a modern farming technique that uses
research data on soil characteristics, soil types, crop yield data collection and suggests
farmers the right crop based on specific parameters for their sites. This reduces the
wrong choice on a crop and increase in productivity. In this paper, this problem is
solved by proposing a recommendation system through an ensemble model with
majority voting technique using Random tree, CHAID, K-Nearest Neighbor, and
Naive Bayes as learners to recommend a crop for the site-specific parameters with
high accuracy and efficiency.
Dabre et al. [16] the developed decision support model combines different environ-
mental factors such as humidity, temperature, pest sound frequency, soil nutrition,
and soil pH to formulate and evaluate individual requirements for crop watering.
System will also provide warning and recommendation on individual crop require-
ments for water-soluble fertilizers and pesticides. Before prediction, soil condition
can be dissected for pre-processing to decide the water retention ratio, soil nutrition
ratio, so that system precision can be elevated.
3 Existing System
Currently as such no system is invented which helps in accurate prediction of crops

based on soil in the farmers. The farmers are unaware about the soil fertility, how to
have more productivity of the crops etc. The Soil in the farms needs proper nutri-
ents and less chemicals and pesticides mixed soil. The goal of every farmer is to
attain maximum production with minimum efforts and proper knowledge, as they
are currently lacking. That crop is suitable for different soils and how multiple crops
can be grown with the help of particular soil needs to be updated with the farmers? If
the weather is inaccurate or is changing continuously then the farmers being unable
able to take proper steps as he is not able to judge the weather forecast. Currently in
market many new fertilizers and pesticides are introduces claiming to be beneficial
for the growth of crops, but lack of knowledge dupes the farmer and they incur heavy
losses.
4 Proposed System
Soil, water, air, and plants are essential natural resources that help human beings
produce food and fiber. We also preserve the habitats that ultimately depend on every
life on Earth. Soil serves as a substrate for growing plants; a drain for food, water,
and chemicals; a filter for nutrients; and a biological medium for waste breakdown.
In the Proposed System farmer will upload the soil details in the system for getting
the prediction regarding the crops needed to be grown on that soil. Maybe multiple
crops can be grown on a particular soil helping farmer in increased productivity.
After uploading the details on system pre-processing is done. Next step is Feature
Extraction where input data are categorized into set of features. These Features help
in discriminating between various categories of input. After Feature Extraction on
data system suggests soil suitable for cultivating multiple crops and the results are
predicted to user.
In the system real-time data will be taken as per the historical record, weather
situation and the artificial intelligence algorithm the prediction related to crop culti-
vation will be made. Weather suggestions will also forecast the future of the crops.
Based on the suggested crop further fertilizers and pesticides will be proposed and
the system will generate a result for the user (Fig. 1).
5 Expected Result
We will evaluate the factors such as temperature, humidity, pesticides, minerals,

and water level present in soil to have better growth of crops in soil. Analysing
these factors help in taking appropriate steps for maintaining moisture of the soil.
Fertilizers to be given in proper method and at proper time. Pesticides should be
minimum as it will hamper the crops Based on these factors we will evaluate the soil
and suggest which crops are best to be grown on soil.
6 Conclusion
We have proposed system details will be provided by farmer regarding the soil in
his farm, weather details helping to develop and predict the type of crop suitable for
farming. System will analyze and Classify Crop for recommending pesticide and
fertilizer to be used for improving crop yield by providing information related to
Fig. 1 Framework of proposed system
crop needs. The system will also provide an alternative for crop growth if case of
failure of enough current yields.
We have proposed system details will be provided by farmer regarding the soil
in his farm, weather details helping to develop and predict the type of crop suitable
for farming. System will analyze and Classify Crop for recommending pesticide and
fertilizer to be used for improving crop yield by providing information related to
crop needs. The system will also provide an alternative for crop growth if case of
failure of enough current yields.
References
1. Shirsath, R., Khadke, N., More, D., Patil, P., Patil, H.: Agriculture Decision Support System
using Data Mining, pp. 1–5. IEEE (2017)
2. Lambrinos, L.: Internet of Things in Agriculture: A Decision Support System for Precision
Farming, pp. 889–892. IEEE (2019)
3. Ashifuddin Mondal, M., Rehena, Z.: IoT Based Intelligent Agriculture Field Monitoring
System, pp. 625–629. IEEE (2018)
4. Wongpatikaseree, K., Kanka, P., Ratikan, A.: Developing Smart Farm and Traceability System
for Agricultural Products using IoT Technology, pp. 180–184. IEEE (2018)
5. Ariawan, E., Makalew, A.S.: Smart Micro Farm: Sustainable Algae Spirulina Growth
Monitoring System, pp. 587–591. IEEE (2018)
6. Shah, A., Gupta, P., Ajgar Y,M.: Macro-Nutrient Deficiency Identification in Plants Using
Image Processing and Machine-Learning, pp. 1–4. IEEE (2018)
7. Mekonnen, Y., Burton, L., Sarwat, A., Bhansali, S.: IoT Sensor Network Approach for Smart
Farming: An Application in Food, Energy and Water System, pp. 1–5. IEEE (2018)
8. Gumaste, S.S., Kadam, A.J.: Future Weather Prediction Using Genetic Algorithm and FFT for
Smart Farming, pp. 1–6. IEEE (2016)
9. Gandhi, N., Armstrong, L.J.: A Review of the Application of Data Mining Techniques for
Decision Making in Agriculture, pp. 1–6. IEEE (2016)
10. Martinez-Ojeda, C.O., Amado, T.M., Dela Cruz, J.C.: In Field Proximal Soil Sensing For Real
Time Crop Recommendation Using Fuzzy Logic Model, pp. 1–5. IEEE (2019)
11. Sankpal, A., Warhade, K.K.: Review of Optoelectronic Detection Methods for the Analysis of
Soil Nutrients, Vol. 02, pp. 26–31 (2015)
12. Patil, K.A., Kale, N.R.: A Model for Smart Agriculture Using IoT, pp. 543–545. IEEE (2016)
13. Xu, L., Xie, D.: Prediction for Available Nitrogen and Available Phosphorus by Using
Hyperspectral Data. IEEE (2016)
14. Yoon, C., Huh, M., Kang, S., Park, J., Lee, C.: Implement Smart farm with IoT Technology,
pp. 749–752. IEEE (2018)
15. Pudumalar, S., Ramanujam, E., Rajashree, R.H., Kavya, C., Kiruthika, T., Nisha, J.: Crop
Recommendation System for Precision Agriculture, pp. 32–36. IEEE (2017)
16. Dabre, K.R., Lopes, H.R., D’monte, S.S.: Intelligent Decision Support System for Smart
Agriculture, pp. 1–6. IEEE (2018)
Design and Development of Electronic
System for Predicting Nutrient
Deficiency in Plants
Amruta Chore and Dolly Thankachan
Abstract Plants require adequate nutrient content for a total as well as natural
life cycle. Six macronutrients, such as nitrogen, calcium, phosphorus, potassium,
sulfur, and magnesium are essential for the natural and healthy rise of plants. Regular
activities with a lack of nutrients in plants lead to transportation difficulties and
ultimately affect crop. Plants show a definite lack of nutrient on their leaves with
notable differences in pattern. Our research suggested is to provide an automated and
economically viable method for detecting defects nutritional conditions. Our system
uses helpful information to forecast performance of crops. The dataset for deficient
leaves and healthy leaves develop with the help of the RGB Color Extraction Analysis
Technique, Disclosure of texture in real time, Identification of bottom edge, etc.
This dataset will allow supervised machine learning to predict and identify accurate
shortages of vitamins and healthy plants to prohibit growth rates.
1 Introduction
Plants required a proper mix of nutrients to reside, growth, and reproduction. It

represents symptoms of being unhealthy when plants are malnourished. Two sources
and micronutrients of plant resources fall into macronutrients. In relatively higher
quantities, macronutrients are the elements needed. These include nitrogen, sodium,
arsenic, calcium, magnesium, and phosphorus; Plants require the micronutrients in
small amounts such as carbon, boron, manganese, zinc, copper, chlorine, and molyb-
denum. Macronutrients as well as microelements typically separate roots from the
earth to get additional requirements plant roots need to obtain nutrients from the
soils. Third, the soil must be proper enough to permit the roots to absorb nutrients
and sustain it. Correcting ineffective methods of irrigation also reduce the symptoms
of deficient nutrients. As Climat differences creates deficiency in various plants.
[1] Fixing ineffective irrigation methods also eliminates symptoms of nutrient defi-
ciencies. The temperature of the soil must decrease with a given range to ensure
A. Chore (B) · D. Thankachan

Oriental University, Indore, Madhya Pradesh 453555, India
https://doi.org/10.1007/978-981-16-1502-3_76
766 A. Chore and D. Thankachan
the absorption of nutrients. The best combination of temperature, pH, and humidity
varies for various species of plants. These nutrients are naturally exists in the soil but
may not be accessible to plants. Information of soil pH, composition, and past can
be very. Effective in determining which nutrients may be decreased. Phosphorus and
copper are the only elements usually absent in soils in Arizona. Most of the others
may be ignored in some situations but the drawbacks are quite unusual.
2 Literature Review
This section explains the literature review. For learning the present system, different
papers have studied.
Susanto et al. [2] this paper found out nutrient content in wheat leaves by defining
color types of leaves pictures taken on field with several lighting circumstances.
They proposed the advancement of DSELM fusion and genetic algorithm (GA) to
regularize plant images and to decrease color disparity produced due to sunlight
intensity. In the picture segmentation, they applied the DSELM to distinguish wheat
leaves from a dynamic background. Mean, variance, skewness, and kurtosis the 4
moments are takeout and used as forecasters in the nutrient approximation. The
results have shown superior quality and processing speed.
Jin et al. [3] precise and high-performance extraction of phenotypic crop char-
acteristics, as a key phase in molecular breeding, is of great significance in that
production. Automatic stem-leaf segmentation, though, remains a major challenge
as a requirement for certain correct extractions of phenotypic traits. Current research
focuses on the analysis of 2-D image-based separation that is adaptive to illumina-
tion. With lively laser scanning and strong penetrating capabilities that pass through
2-D to 3-D phenotyping, precise 3-D information can be obtained through Light
Detection and Ranging (LiDAR).
Noinongyao et al. [4] this paper suggested an image analysis approach to iden-
tify unusual regions that are induced by nutritional shortages on plant leaves. The
suggested solution analyzes a histogram of normal leaf colors for the detection
of irregularities on trees. This is divisible into three main acts. Firstly, the color
characteristics of the leaf area are computed in an input image.
Hosseini et al. [5] presented design of picture deblurring in the appearance of one-
time convolution filtering. Used Gaussian LPF to distinguish the image noise removal
difficulty for image edge deblurring. Proposed an unsighted method to find the PSF
statistics for 2 Gaussian and Laplacian model, planned for testing and authenticate
the competency in given technique using 2054 originally blurred pictures across 6
imaging applications & 7 state-of-the-art de-convolution technique
Mustafa Merchant et al. [6] discussed as Indian national fruit, its leaves are enor-
mance affected by a number of nutrient deficiencies such as nitrogen, phosphorus,
potassium and copper. Mango leaves nutrients alter color. These leaves are consid-
ered defective. This research has found the numerous nutrient deficiencies in mango
Design and Development of Electronic System … 767
leaves. At the beginning, a data set is created by, obtain the various mango leave
features.
Mitsugi et al. [7] suggested the consumption of plasma to eliminate soil-borne
pathogens & worms as a method in least chemicals in farming. Ozone dispersion
handling method used & real farming place for soil disinfection. By calculating the
soil acidity and nitrogen nutrients, the ozone presence in soil measured. After that,
a part of the field infected with the Streptomyces, taken along the ozone dispersion
method. Then, radish seeds planted in the ozone area & control area. The result was
radishes showed improved growth compared to the control & were not contaminated
from outside.
Krithika et al. [8] the aim was to find diseases of the salad cucumber leaf at the
first stage. The natural diseases existing in salad cucumber are Alternaria leaf blight,
Bacterial wilt, Cucumber green mottle montage, Leaf Miner, Leaf spot, Cucumber
Mosaic Virus (CMV) disease, etc. In this work, the use of K-means clustering, an
unsupervised algorithm with Support Vector Machine (SVM) used to provide this
problem.
Salazar et al. [9], this article provided an automatic system for understanding the
root condition of avocado. This method uses k-means to divide leaves from identical
backgrounds from pictures taken in ground under semicontrolled circumstances in
s-v space at the super pixel level & a light neural network for classifying collected
histograms from segmented plants into the following parts: Healthy, Fe insufficiency,
Mg insufficiency, and red spider plague. The presented strategy divides the leaf from
literature with an typical F-score of 0.98 and categorized the leaf state with a total
correctness of 96.8%.
Chouhan et al. [10] the plant is essential for any living organism. Plants suffer
from different kinds of diseases alike a human or other living thing. Such diseases are
detrimental to crops, as they can influence the development of trees, seeds, fruits and
leaves, etc. which can even cause the plant to die. BRBFNN method was designed
to find and grouping of plant leaf diseases. The findings shown higher performance
in diagnosing leaf.
Shaha et al. [11] intended that plants require sufficient nutritional content for
a full and balanced lifecycle. Adequate amounts of six macronutrients such as
Nitrogen, Calcium, Phosphorous, Potassium, Sulphur, and Magnesium are more
essential for natural and balanced plant development. The lack of nutrients causes
problems in plants’ everyday operations and reduces the yield. Surfce based image
processing, CNN is generally is used for finding a nutritional deficiency [12–14].
RNN fusion & genetic algorithm used to remove dificiency from Wheat plants
and increase growth [15]. Also pattern recognition and color property analysis,
picture analysis algorithm found important for different defective images [16,
17]. Venation Pattern also one of the technique to increase the plants vein growth
[18]. Reducing nutrient in the medium shows nutritional absorption by the plant [19].
Biochemical bands also reduces the dificiency in plants [20].
3 Scope of Research
Nitrogen, phosphorus, and potassium are important and essential plant nutrients.
Using the nutrient present in the herb, the machine can predict future crop output
and give suggestions on how to enhance crop quality. Crop production is growing
and has a direct impact on the farmer’s economic life. Our system makes appropriate
decisions on the quantity of pesticide depending on the deficiency of the element.
This system works as a real-time framework to help farmers improve their crop
production without any Collins. This approach is not restricted to any single weed, it
also measures nutrients on any herb or fruit and it will be recommended accordingly.
The various nutrient like magnesium, nitrogen, phosphorus, potassium, copper, etc.
present in the crops, if any one falls down it will badly effect crops, so system helps
to maintain all nutrient according to crops. It predicts the future market rate based
on the previous record and estimates the future product risk.
3.1 Objectives
Following are the objective of the system

• Identify the nutrient in leaf with intensity and suggest how much amount of
fertilizer required for crops.
• With the help of nutrient present in the leaf, system predicts the quality of future
crops and gives suggestion on how to improve quality of crops.
• System provides the yield of crops using previous records and quality of crops.
If crops production increases that directly, affect farmer’s economical life.
• Make appropriate suggestion for quantity of pesticide based on nutrient intensity.
• System work as real-time application to help the farmer to increase their
production of crops without any Collins.
• This system is not limited to any specific leaf only, it detects the nutrient on any
plant or fruits leaf and give suggestion accordingly.
• System forecast the market rate of crops based on previous record with the help
of machine learning approach.
• System predicts the future demanding product that has been demanding in future.
4 Proposed System
Figure 1 shows the Deficiency identification using machine learning approach and
it is explained below:
Fig. 1 Deficiency
identification using machine Input Leaf
learning Image
Image Pre-processing
Feature Extraction
Classification
Healthy Unhealthy
Extract
Prediction of
fertilizer
Result
Image Acquisition
• First, we have to shape the Supervised Machine Learning dataset. Violently 700
photos are needed for the healthy plant and six nutrient absences, around 100 for
each.
• For every defective and stable leaf to take an image of the white background in
usual brilliance, digital camera is used.
Image Pre-processing
The image taken can contain some unnecessary noise or detail. Subtracting the
context brings on the role of meaning. Noise is taken if present & the value portion,
i.e., leaf, is improved for additional isolation & examination of deficiencies. By
using Mean filtration to reduce noise and to provide a smooth picture. Mean filter
eliminates abrupt pixel value shifts by substituting each pixel value with the nearest
usual pixel value. This is center on the kernel that specifies the size and shape of the
region to be verified. Amplitude is measured for Image Improvement using histogram
equalization.
Feature Extraction
Then the already processed image is taken to retrieve the fir feat = extraction. The
characteristics are red (12), green (G), blue (B), G/R, and GB band ratios. As contrast
is firstly dominant on good leaf green is color. It also tests the average color spectrum
of R, G, and B from 0 to 255.
Edge Detection
If the value of the green color in the given input image is not dominant, a nutrient
deficiency is likely in such cases, the area for error detection shall be the edge
detection. Different edge detectors as Laplacian of Caussian, Roberts, Piewitt, Sobel,
Zero crossing, canny, etc. Roberts, Piewitt & Sobel used to discover derivative and
Zero crossing, canny and LoG used to discover second-order derivatives. The gradient
is the derivative of the 1st scale used to calculate changes in the amplitude of the signal
gradient.
Classification
In ML, classification is supervised learning procedure where the input is already
known and the output depends on the output data. Classification is supervise learning
procedure in ML in that data is already known and success is based on feedback from
study, i.e., output is analyzed. We are using decision tree here for deficiency grouping.
Picture will be pipe and the extraction method will be used. Such parameters will
now be compared to the input dataset where the real parameters will fit the data set.
5 Expected Outcome
We will find all types of nutrient deficiencies in any type of plant or fruit leaf and
provides the pesticides and fertilizers suggestions accordingly to have better crop
production and to get good quality of crops. We will also provide the forecasting
of market rate of crop, yield of crop, and future demanding product with the help
of availability of previous records. Along with this system also provides the soil
enrichment so that farmer can produce any crop in any region, which directly affects
economical life of the farmer.
6 Conclusion
It is high time to focus on the highest yield to satisfy the increasing needs of the popu-
lation. This can only happen if plants have enough space to grow. Plant nutrient quality
is often overlooked although the value should be added. This paper emphasizes
macronutrient recognition through image processing as well as machine learning
methods. This will reduce farmer’s work and give time to think on crop production.
This will also useful in vertical farms, where plants are given nutrient supplements.
References
1. Makkar, T.Y.: A computer vision based comparative analysis of dual nutrients (Boron, Calcium)
deficiency detection system for apple fruit. In: 4th International Conference on Computing
Communication and Automation (ICCCA) (2018)
2. Susanto, B.S., Wu, D., Lok Woo, S.S. Dlay: Computational deep intelligence vision sensing
for nutrient content estimation in agricultural automation. IEEE Trans. Autom. Sci. Eng. 1–15
(2018)
3. Jin, S., Su, Y., Wu, F., Pang, S.: Stem-leaf segmentation and phenotype trait extraction of
individual maize using terrestrial LiDAR data. IEEE Trans. Geosci. Remote Sensing 57(3)
(2019)
4. Noinongyao, P., Watchareeruetai, U., Khatiwiriya, P., Waatanapiboonsuk, C.: Separation of
abnormal regions on black gram leaves using image analysis. In: 14th International Joint
Conference on Computer Science and Software Engineering (JCSSE) (2017)
5. Hossein, M.S., Plataniotis, K.N.: Convolutional deblurring for natural imaging. IEEE Trans.
Image Process. (2019)
6. Merchant, M., Paradkar, V.D., Satish Khanna, M., Gokhale, S.: Mango leaf deficiency detec-
tion using digital image processing and machine learning. In: International Conference for
Convergence in Technology, pp. 1–3 (2018)
7. Mitsugi, F.: Practical ozone disinfection of soil via surface barrier discharge to control scab
diseases on radishes. IEEE Trans. Plasma Sci. (2019)
8. Krithika, P., Veni, S.: Leaf disease detection on cucumber leaves using multiclass support vector
machine. In: IEEE International Conference on Wireless Communications, Signal Processing
and Networking (WiSPNET), pp. 1276–1281 (2017)
9. Salazar-Reque, I.F., Pacheco, A., Rodriguez, R.Y., Lezama, J.G., Huamán, S.G.: An image
processing method to automatically identify Avocado leaf state. In: Symposium on Signal
Processing and Artificial Vision (STSIVA) (2019)
10. Chouhan, S.S., Koul, A., Pratap Singh, U., Jain, S.: Bacterial foraging optimization based
Radial Basis Function Network (BRBFNN) for identification and classification of plant leaf
diseases: an automatic Approach towards Plant Pathology. IEEE Access (2017)
11. Shah, A., Gupta, P., Ajgar, Y.M.: Micro nutrient deficiency identification in plants using
image processing and machine learning. In: 3rd International Conference for convergence
in technology (2018)
12. Jae-Won, C., Trung, T.T., Thien, T.L.H., Geon-Soo, P., Van Dang, C., Jongwook, K.: A
nutrient deficiency prediction method using deep learning on development of tomato fruits.
In: International Conference on Fuzzy Theory and Its Applications iFUZZY (2018)
13. Watchareerueti, U., Noinongyao, P.: Identification of plant nutrient deficiencies using convo-
lutional neural networks. IEECON 2018, Krabi, Thailand (2018)
14. Han, K.A.M., Watchareerueti, U.: Classification of nutrient deficiency in black gram using deep
convolutional neural networks. In: 16th International Joint Conference on Computer Science
and Software Engineering IEEE (2019)
15. Sulistyo, S.B., Woo, W.L., Dlay, S.S.: Regularized neural networks fusion and genetic algorithm
based on-field nitrogen status estimation of wheat plants. IEEE Trans. Ind. Inf. (2017)
16. Latteet, M.V., Shidnal, S., Anami, B.S.: Multiple nutrient deficiency detection in paddy leaf
images using color and pattern analysis. In: International Conference on Communication and
Signal Processing, India, 6–8 Apr 2016
17. Wang, H., Li, G., Ma, Z., Li, X.: Image recognition of plant diseases based on backpropagation
networks. In: 5th International Congress on Image and Signal Processing CISP (2012)
18. Arrasco, C., Khlebnikov-Núñez, S., Oncevay-Marcos, A., Beltran-Castanon, C.: Leaf vena-
tion enhancing for texture feature extraction in a plant classification task. In: Latin American
Conference on Computational Intelligence (LACCI), Guadalajara, Jalisco, Mexico, IEEE, 7–9
Nov 2018
19. Jiang, H., Ali, M.D.A., Jiao, Y., Dong, L.: In-situ, real-time monitoring of nutrient uptake on
plant chip integrated with nutrient sensor. In: 19th International Conference on Solid-State
Sensors, Actuators and Microsystems (2017)
20. Van Deventer, H., Cho, M.A., Mutanga, O., Naidoo, L., Dudeni-Tlhone, N.: Reducing leaf-
level hyperspectral data to 22 components of biochemical and biophysical bands optimizes
tree species discrimination. IEEE J. Selected Topics Appl. Earth Observ. Remote Sensing 8(6)
(2015)
Classification of Hyperspectral Images
with Various Spatial Features
Sandhya Shinde and Hemant Patidar
Abstract The remote sensing images cannot be captured via camera as the images
are large in size. So we are introducing a system where the hyperspectral images can
be captured through satellite can be identified and classified. The system will also
identify the objects forbidden to enter in the restricted area. Our system can detect
image from every angle and resolution. Our system can detect any object from earth
observation (EO).
1 Introduction
In the remote sensing world, hyperspectral image (HSI) is often used to take full
advantage of hundreds of distinct stream structures over an inclined picture. Hyper-
spectral picture requires accurate and vigorous recognition technique to acquire the
picture properties. Hyperspectral picture was considered a particularly difficult issue
because of the complicated image scene design (i.e., blended pixels, vast quantities of
information and minimal practice testing), and so, in recent decades, many attempts
have been made to tackle this problem.
The hyperspectral images can identify the images larger in size captured through
satellite. HSIs are defined by hundreds of bands collected in adjacent spectral ranges
and short spectrum intervals. They provide an extensive area of data for proper
identification and classification of objects on the ground. In recent years, analyst has
devoted significant attention to classifying HSIs for different applications.
A spatial background and spectral information should be incorporated to enhance
classification efficiency. It was suggested that a variety of techniques could
incorporate spatial characteristics into the HSI classification.
Detecting object in remote sensing images, in the area of aerial or satellite picture
search, is a fundamental yet challenging problem, enhances a wide range of appli-
cations, and is becoming increasingly important in recent times. Deep learning has
S. Shinde (B) · H. Patidar

Oriental University, Indore, Madhya Pradesh 453555, India
https://doi.org/10.1007/978-981-16-1502-3_77
774 S. Shinde and H. Patidar
made substantial advances in various techniques for image processing, and detec-
tion of objects using deep learning technique has currently attracted much research
interest.
In order to overcome these problems, we are introducing an application-oriented
system which classified all the objects detected through remote sensing imagery
system. The system will first preprocess these images where images will be filtered
and noise will be removed. The feature extraction process includes reducing the
dimensions of the image. The next step will include the classification of images
being categorized accordingly. The results will be displayed in the parameters of
recall rate of the system, precision, accuracy, and confusion matrix of the picture.
2 Literature Survey
This segment gives an overview of various approaches that can be used for the
classification of hyperspectral pictures as well as brief explanations of the algorithms
used by researchers.
Tayeb Alipourfard et al. [1] using subspace dimension reduction techniques, CNN
architectures have been suggested for the classification of HSI with high-quality
characteristics. His benefit of the suggested framework is similar for both datasets,
and the DR approach to preprocessing the traditional number of training pixels is
appropriate for learning parameters. The proposed method has shown considerable
classification efficiency by means of fixed architecture and a potent DR under the
situation of small training sampling.
Shrish Bajpai et al. [2] components were extracted from decomposed signal or
time series to boost the repairing of the initial signal with noise suppression that
makes the pixel value smooth, which results in the process of classification which
increases the parameters of precision.
Zhao Boya et al. [3], a multi-scale method of representation of features known
as BUFPN was implemented to allow full use of the function by linking feature
maps and combining lower-scale feature map and top-scale feature map into one.
Additionally, distinct anchor outline is created on characteristic maps to clarify the
obstacle of objects with various sizes and facet ratios.
Qishuo Gao et al. [4] for the HSI classification, a conservative smoothing algo-
rithm is suggested, using the spatial accuracy of the adjacent pixels in the initial
picture cube. The suggested technique uses the spectral similarities among pixels to
allow weights to various neighboring pixels within a given local area in order to avert
automatic over-smoothing. Under this scheme, it can be disclosed qualitative spatial
details.
Lin He et al. [5], they developed a rapid DLRGF approach for the classifica-
tion of HSI by remotely sensed spectral–space. The proposed approach provides an
effective method for choosing spatial–spectral artifacts and provides important new
Classification of Hyperspectral Images … 775
technology in how Gabor filtering is adapted to the specific characteristics of hyper-

spectral images, which involve spatial texture and spectral differential to support
enhance the accuracy of classification.
Hao Huijun et al. [6], they suggested that the existing networks apply robust
resolution features to small object prediction. They create new function of pyramid
framework to predict the low-level culture that is efficient of complex tasks with
vision. They also focus on the adoption and combination of current developments in
deep learning technology, allowing for the re-formulation of the feature extraction
portion based on the SSD paradigm that maximizes computational efficiency.
Licheng Jiao et al. [7], they propose a novel SAR image recovery method, one of
the EO products, depending on semantic classification and calculation of regional
similarities. They establish the SAR-oriented similarity measure IIRM depending on
the IRM measure of classical similitude.
Ke Li et al. [8], they developed a new deep learning, coherent approach for remote
image sensing detection of objects. The architecture for single object detection inte-
grates the RPN’s contextual functionality with the fusion network to identify the
proposals. The suggested architecture provides compelling output of ten-class object
detection data, which is accessible to the public.
Miaomiao Liang et al. [9], they suggest a new feature extraction technique for
HSIC called deep spectral–spatial fusion (DMS3F2), which learns representative and
discriminatory features by taking full benefit of the spectral–spatial information of
HSI.
Lichao Mou et al. [10], they introduced a new end-to-end ConvDeconv residual
network framework for unregulated spectral–spatial extraction of HSI.
Atif Mughees et al. [11], they have introduced a new SDBN approach to leverage
spatial contextual knowledge through hyper-segmentation for efficient HSI classi-
fication. Every hyper-segment (HS)’s size and shape can be flexibly adapted to the
actual spatial HSI structures, resulting in efficient use of spatial contexts. Then SDBN
uses the multilayer DBN to efficiently exploit the spatial characteristics and spectral
characteristics based on HS within and between segmented hyper segments.
Haodong Pan et al. [12] within the single-shot multibox detector (SSD) system
present the adaptive dense pyramid network (ADFPNet) novel for object detection.
The proposed network would identify historical artifacts by obtaining feature maps
at different scales with complex multi-scale and responsive fields.
Swarnajyoti Patra et al. [13] a novel technique for classifying HSIs with small
labeling samples is presented. The methodology suggested is broken down into two
steps. Phase I generates the corresponding pattern by extracting spectral–spatial char-
acteristics for each HSI pixel. The spectral–spatial patterns developed by EMPs are
used as inputs with a specific number of labeled samples for the Phase II classification
task.
3 Existing System
Currently, the images taken through camera are not adequate to capture larger images
and identify the objects located in sea. The need to accurately identify the objects
and classify them accordingly is important as sometimes suspicious objects cannot
be traced down by radar.
4 Purposed System
In our purposed system, we define the process of our introduced system. The system
will firstly upload the datasets and train them. The datasets are trained and uploaded
into system. These datasets are then preprocessed where they are filtered and the
noise from the image is removed using image denoising approach. Image denoising
refers to the processing of a digital image polluted with noise. Image denoising is
classified further into ICA filter and Gabor filter. Gabor filter is applied for texture
analysis, which means that it originally analyzes whether there is any particular
frequency material in the picture in particular directions in an area around the point
or region of analysis and ICA filter has ICA components that are combined signals
from multiple ECG channels, which means that they serve as spatial filters on the
content (Fig. 1).
After preprocessing, the features of the image are extracted using feature extrac-
tion method. Feature extraction uses method like RFM and CNN for calculating
similarity of two images. The next step is classification of SAR images. The clas-
sification is done by Bayesian relevance feedback and multiple SVM. The selected
pictures are first scaled to different scales and then rotated in different angles so that,
multi-scale-multi-angle dataset is formed of HIS/SAR images. The results will be
displayed in the parameters of recall, accuracy, precision, and confusion matrix.
5 Algorithm
1. Region-based fuzzy matching (RFM) measure
The IIRM divides them into various function spaces, i.e., brightness texture and
edge feature spaces, to test the similarity among two I1 and I2 SAR image patches.
First, IIRM divides a picture patch into a no of non-overlapping blocks to speed up
segmentation for the feature space of the brightness texture. A block here indicates
a fixed-size rectangle field, and the size is 4 × 4 in the IIRM algorithm (Fig. 2).
Each block is defined by a four-dimensional vector [AA, AB, BA, XY] T, where
AA, AB and BA specify the energy of the one-level Daubechies 4 or hair wavelet
transforms on the block, and XY specifies the mean gray value inside the block. The
Fig. 1 Architecture of proposed work
Fig. 2 Architecture of suggested content-based SAR image retrieval technique [14, 15]
adaptive k-means algorithm divides all the feature vectors into several groups, where
every group correlates to a brightness texture field.
2. Multiple SVM Classification
The easiest classification problem SVM can address is the linearly separable
binary classification. Instead of a set of training sampling, {(xi, yi)}Ni = 1, xi xi
Rd, yi = {−1, 1}, SVM divides these sampling into two classes by the ideal hyper
plane, running as wide as possible between the two classes with the gap to the nearest
training sampling.
Pseudocode
1. a do for all labels Class
2. Y →Pictures in class a
3. Sets Picture level labels in Y to 1
4. For all labels in Class c, a = c do
5. R →Select 2 k images randomly from Class c
6. Set image class marks in R to −-1
7. Y+=R
8. end for
9. Build Si using the images in Y for classification of images
10. end for
11. RETURN All Si s
6 Bayesian Relevance Feedback
We set up a structure depending on Bayesian posterior probability which is used for

relevant feedback. For the function of each class, the multivariate normal distribution
is a very common and practical model. Let me be the collection of any and all images
in the database and we’ll say x is a random vector with dimensions d. Relating normal
distribution density, multivariate by:
−1

1 1
p(x) = 1/2 exp − (x − μ)
t
(x − μ) (1)
(2π )d/2 2
where μ is the mean vector and μ is the matrix of covariance.

The consumer has approved n images with function vectors in a given loop (×
1, …, × d). We will measure μ and yes using the samples chosen by the consumer
using the corresponding maximum likelihood estimators.
7 Expected Results
In our system, we will conduct research on the SAR images which will help in
identifying and classifying the images. If some unknown objects enter within the
region, it will also be captured in our radar system. For achieving these results, we
are implementing multiple SVM and Bayesian relevance feedback technique.
8 Conclusion
We proposed an application-oriented method in this paper to identify the SAR

images. The object detection system integrates input from area-based fuzzy matching
test, SVM, and Bayesian relevance to excerpt the characteristics of the HSIs. The
proposed methodology would yield more reliable results than prior techniques. The
suggested network, where multi-scale extraction is used to acquire both the multi-
scale spatial and spectral characteristics, is allocated both spatial information and
relevant neighboring bands simultaneously.
References
1. Alipourfard, T., Arefi, H., Mahmoudi, S.: A novel deep learning framework by combina-
tion of subspace-based feature extraction and convolutional neural networks for hyperspectral
images classification. In: IGARSS 2018, IEEE International Geoscience and Remote Sensing
Symposium, Valencia, pp. 4780–4783 (2018)
2. Bajpai, S., Singh, H.V., Kidwai, N.R.: Feature extraction & classification of hyperspectral
images using singular spectrum analysis & multinomial logistic regression classifiers. In: 2017
International Conference on Multimedia, Signal Processing and Communication Technologies
(IMPACT), Aligarh, pp. 97–100 (2017)
3. Boya, Z., Baojun, Z., Linbo, T., Chen, W.: Multi-scale object detection by bottom-up feature
pyramid network. In: IEEE, vol. 2019, no. 21, pp. 7480–7483 (2019)
4. Gao, Q., Lim, S., Jia, X.: Spectral–spatial hyperspectral image classification using a multiscale
conservative smoothing scheme and adaptive sparse representation. Trans Geosci Remote Sens
57(10), 7718–7730 (2019)
5. He, L., Li, J., Plaza, A., Li, Y.: Discriminative Low-Rank Gabor Filtering for Spectral-Spatial
Hyperspectral Image Classification. Trans Geosci Remote Sens 55(3), 1381–1395 (2017)
6. Huijun, H., Ronghua, Y., Zhongyu, C., Zhonglong, Z: Multi-scale pyramid feature maps
for object detection. In: 2017 16th International Symposium on Distributed Computing and
Applications to Business, Engineering and Science (DCABES), Anyang, pp. 237–240 (2017)
7. Jiao, L., Tang, X., Hou, B., Wang, S.: SAR Images Retrieval Based on Semantic Classification
and Region-Based Similarity Measure for Earth Observation. J Sel Top Appl Earth Obs Remote
Sens 8(8), 3876–3891 (2015)
8. Li, K., Cheng, G., Bu, S., You, X.: Rotation-insensitive and context-augmented object detection
in remote sensing images. Trans Geosci Remote Sens 56(4), 2337–2348 (2018). https://doi.
org/10.1109/TGRS.2017.2778300
9. Liang, M., Jiao, L., Yang, S., Liu, F., Hou, B., Chen, H.: Deep multiscale spectral-spatial feature
fusion for hyperspectral images classification. J Sel Top Appl Earth Obs Remote Sens 11(8),
2911–2924 (2018)
10. Mou, L., Ghamisi, P., Zhu, X.: Fully conv-deconv network for unsupervised spectral-spatial
feature extraction of hyperspectral imagery via residual learning. In: IEEE International
Geoscience and Remote Sensing Symposium (IGARSS), Fort Worth, TX, pp. 5181–5184
(2017)
11. Mughees, A., Ali, A., Tao, L.: Hyperspectral image classification via shape-adaptive deep
learning. In: IEEE International Conference on Image Processing (ICIP), Beijing, pp. 375–379
(2017)
12. Pan, H., Chen, G., Jiang, J.: Adaptively dense feature pyramid network for object detection.
IEEE Access 7, 81132–81144 (2019)
13. Patra, S., Bhardwaj, K., Bruzzone, L.: A Spectral-spatial multicriteria active learning technique
for hyperspectral image classification. J Sel Top Appl Earth Obs Remote Sens 10(12), 5213–
5227 (2017)
14. Sun, X.,Zhang, L.,Yang, H.,Wu, T.,Cen, Y., Guo, Y.: Enhancement of Spectral Resolution for
Remotely Sensed Multispectral Image. J Sel Top Appl Earth Obs Remote Sens 8 (5), 2198–2211
(2015)
15. Tang, X., Jiao, L.,Emery, WJ .: SAR Image Content Retrieval Based on Fuzzy Similarity and
Relevance Feedback. J Sel Top Appl Earth Obs Remote Sens 10( 5), 1824–1842 ( 2017)
Detecting and Classifying Various
Diseases in Plants
Rashmi Deshpande and Hemant Patidar
Abstract In today’s era where production of crops is increasing day-by-day, it is

also seen that harmful disease is also growing increasingly. Some of the disease being
unidentifiable is causing more harm to the production of crops. Such harm not only
causes harms crops but also farmers economical income is affected. To overcome all
these problems, we are providing an overall solution in which all the problems related
to farming which are faced by farmer. In the proposed system, it will identify the
leaf disease harming crop and providing solution along with precautions to be taken.
The system will not be limited to a particular crop leaf rather than it will detect leaf
disease of all crops. The system will also recommend farmer quantity of pesticides
to be used for crops. It will help to increase the production of crops decreasing their
economic loss.
1 Introduction
Nowadays, a new idea of smart farming has been applied where field conditions
are controlled and tracked using the self-operating systems. The disease’s self-
recognition is focused on recognizing the signs of illness. So that knowledge about
the incidence of the disease could be given to the farmers quickly and accurately.
It helps in reducing monitoring of huge fields by farmers. The disease may vary
from crop to crop which includes change in shape, size, color, or texture. The emer-
gence of the disease on the plant will develop in substantial loss agricultural product.
Awareness for disease of leaf is essential for decision-making in crop situations and
decision-making regarding disease managing.
A plant disease is a situation caused by an infectious agent or factor to the
ecosystem. Fungi, bacteria, and viruses are among the species that can cause this
disease. Parasites such as insects and mites can also be found eating the plant tissues
resulting in diseased sections.
R. Deshpande (B) · H. Patidar

Oriental University, Indore, India
https://doi.org/10.1007/978-981-16-1502-3_78
782 R. Deshpande and H. Patidar
Nevertheless, diseases are important cause of agronomic reduction in India.

Farmers face multiple problems controlling crop diseases. The identification of the
illness is crucial part in field of agriculture, and this requires cautious analysis and
careful monitoring to avoid the heavy losses. The disease cannot be passed from a
damaged plant to the uninfected plant. A plant infection is a shift occurring for the
worse of the plant’s normal functioning, or the portion that may be affected by the
disease that causes factors such as bacteria, fungi, nematodes viruses. Some of the
plant illness can be an act of spreading from infected plant to the unaffected plant
over broader parts of the plant.
In this system, we are suggesting a system which will not only identify the leaf
disease but will also recommend precautions regarding it. It will suggest the quantity
of pesticides to the farmers to be utilized for the crops. The proposed system will
identify the intensity of the leaf disease for increasing the production of crops. It will
also help in increasing crop production to reduce the losses for farmers. The will
act as real-time application for helping farmers to increase their production of crops
without any Collins. The system does not restrict itself for a particular crop leaf; it
can detect all types’ leaf disease for all the plants and recommend it precautions.
2 Literature Review
Several researchers had carried out research in this area. The corresponding literature
review of the proposed study follows:
R. Anand et al. [1] this work sets out a system for detecting plant leaf disease
and a cautious disease detection strategy. The proposed research aims at diagnosing
brinjal leaf disease by means of artificial neural techniques and image processing.
Brinjal diseases are a critical issue which results in a sharp decrease in the production
of brinjal.
L. Shanmugam et al. [2] this paper describes automatic disease detection by
means of remote sensing images. Because of various crop diseases, farmers face
losses. Their system has two phases: first part handles training of safe and diseased
data sets. The second phase handles crop observing and illness identification; and
immediately intimates farmers with an initial warning message.
S. D. Khirade et al. [3] this paper examined the methods used to identify plant
diseases using photographs of their leaves. This paper also addressed a certain
segmentation algorithm and extraction function used in the detection of plant disease.
C. G. Dhaware et al. [4] this paper discusses picture preprocessing methods, image
segmentation algorithms used for computerized recognition and works on different
plant leaf illness classification algorithms that can be used for the classification of
leaf disease.
R. P. Narmadha et al. [5] this paper aims at explaining paddy diseases. Some of
the paddy disease involves brown spot disease (BPD), narrow brown spot disease
(NBSD) that impedes expansion and health of paddy. Such technique was designed to
Detecting and Classifying Various Diseases in Plants 783
automatically eradicate noise, human error, and also reduce the time taken to weight
the effect of paddy leaf illness as well as increase precision.
V. Pooja et al. [6] this paper introduces a technique for analyzing and arranging
diseases with assistance of picture processing and machine learning equipment. First
identification and capture of contaminated area is carried out, and the latter image
processing is performed.
A. Devaraj et al. [7] this system is intended to create a reaction to a software
system that regularly recognizes and classifies disease. Disease detection includes
the step such as preprocessing, segmentation, extraction, and classification. The leaf
photographs are taken to classify the diseases of plants.
R. M. Prakash et al. [8] in this paper, the image processing methods are mentioned
for classify plant leaves illness. The aim of this paper is to integrate picture analysis
and classification methods for identifying and classifying leaf illness.
P. Revathi et al. [9] this suggested work is planted on the segmentation method for
picture edge revelation in which the captured pictures are first prepared for enhance-
ment. In order to get specific regions (disease spots), the picture segmentation of
the (R, G, B) color function is then performed. Later, pictures features such as
border, form, light and texture are obtained to identify illness spots and monitor
recommendations for plagues.
Bharat Mishra et al. [10] this paper presents a survey using image processing
method on various leaf disease detection technologies and classifies them related on
the type of investigation tool and appliance. In addition, the prevalent techniques
used in the leaf illness detection process are studied seriously and addressed briefly;
compression and presentation of accessible approaches are inspected.
N. Agrawal et al. [11] this paper develops multiclass SVM algorithms for clas-
sification of grape leaf diseases present in grapes plants. Uses resizing, enhancing,
and smoothing for image preprocessing of the given system.
C. S. Sumathi et al. [12] based on their photographs, they introduced an automated
system for identifying plant leaf. Plant classification depends on recognizing leaves
which are commonly used in medicine and agriculture.
S. G. Wu et al. [13] in this paper, they use probabilistic neural network (PNN)
with picture and data processing techniques to apply a general direction automatic
leaf recognition for the classification of plants.
V. P. Gaikwad et al. [14] the goal of this paper is to establish software clarification
that will automatically inspect and determine plant disease. This comprises four
stages: first stage image acquisition, second step is image preprocessing, third step
is image segmentation, and fourth step is color, form, and size extraction. Here, they
used neural network-based classifier.
Shivani K. Tichkule et al. [15] this paper gives an overview of how various
plant diseases are detected using methods of image processing. The use of image
processing methods for detecting and recognizing illness is useful in agricultural
applications.
Pranjali B. et al. [16] the goal of this paper is to purpose a new progress to
exposure of grape leaf illness using image processing to reduce the damage and
optimize its computerized benefits. In this context, classification is rendered using

various classifications of SVM and the ANN.
3 Existing System
Currently most of the farmers are using are using old methods for cultivating crops
in field. Many crops get destroyed due to improper pesticides mixed in it which
farmers cannot identify them. Sometimes the leaf diseases are not detected by the
farmers reducing the production of crops. Due to decrease in crop production, the
farmers face huge losses economically. Even they are unaware about the quantity of
pesticides to be used for the healthy production of crops. The farmers do not have any
real-time application to monitor and suggest farmers to increase their production of
crops. The farmers cannot detect leaf disease with naked eyes and take precautions
accordingly.
4 Proposed System
In the proposed system, the user will perform the process for identification of infected
leaf disease. The user will give input leaf image to the structure. The input picture
will be preprocessed further (Fig. 1).
With the help of feature extraction, the image functions are extracted after prepro-
cessing. Application plays a very important part in the processing of images. Tech-
niques for extracting features are applied to obtain features that will be useful in image
detection and recognition. The extraction of features is the method of extracting the
most important data from the raw data. Extraction of the function is to find the set of
parameters that specifically and uniquely describe a character’s form. In the extrac-
tion process of features, each character is represented by a vector, which becomes
its identity. The main goal of extracting function is to remove a set of features, opti-
mizing the identification rate with the least amount of elements and producing similar
feature set for the same symbol’s variety of instances. After feature extraction classi-
fication, images are done using NN technique. While using NN technique the leaf is
classified into normal leaf and infected leaf. After detecting the infected leaf, it also
classifies the region which is infected in leaf. Identification not only helps in disease
detection but system will also recommend the precautions to be taken while curing
the infected part of the leaf. The proposed system will be limited to only particular
crop leaf rather than it will detect all types’ leaves and their disease. The system will
be working as real-time application for helping farmers to increase the production of
their crops without collagens. The system will also give appropriate suggestion for
using right amount of pesticides in field. The system will help famers in increasing
crop production to improve their economic condition.
Fig. 1 Proposed system architecture
4.1 Steps Required for Proposed System
4.1.1 Image Acquisition
At each phase of disease evolution, the color picture of the infected leaf was captured
with camera. For image acquisition, a color camera was used. Pictures are stored
in.jpeg format. In the present method, leaves damaged by five types of illness bacterial
leaf spot, Cercospora leaf spot, leaf curl, plant mosaic, powdery mildew were used
for identifying and classification.
4.1.2 Image Preprocessing
All the leaf images were preprocessed which mainly includes resizing and filtering of
images. All leaf images were resized into 256 × 256 pixels. The color transformation
structure was obtained by converting the RGB into HIS color space. Hue–saturation–
intensity (HSI) space is also a common color space, as it is focused on the perception
of human color.
4.1.3 Image Segmentation
“A process that splits the image into meaningful regions” is known as segmentation.
It gives us regions and objects. Segmentation has two classes: foreground and back-
ground. There are many segmentation techniques which are useful for finding region
of interest (ROI). Out of them K-means clustering is choosing for segmentation of
disease-affected image.
4.1.4 Feature Extraction
After segmentation, specific features are extracted from the infected area to classify
the region infected with the disease. Texture, color, and shape-based features are
typically based on definition of infected regions.
4.1.5 Shape-Based
Form is an important visual attribute and one of the basic characteristics for defining
image content. Description of the form content cannot be described precisely because
it is difficult to measure the similarity between shapes.
4.1.6 Color-Based
One of the most commonly used visual features in the classification of images is the
color function. There are many benefits to the images distinguished by color effects.
4.1.7 Texture-Based
Texture can be defined by texel and structure intensity, color. Texture charactertics are
determined in statistical texture analysis from the statistical distribution of detected
sequence of intensities at defined positions relative to each other in the picture.
First order (one pixel)—mean, variance, skewness, kurtosis)
Second order(pair of pixels)—angular second moment, contrast, correlation,
homogeneity, entropy).
Higher order (two or more pixel)—values occur at specific locations relative to
each other.
5 Algorithms
1. GLCM
A GLCM is a matrix where the number of rows and columns in the picture is
equal to the number of gray levels, G. The matrix variable P(i, j, d) is the relative
frequency with which two pixels, separated by distance d and in the direction defined
by the particular angle (nearly), one with intensity I and the other with intensity j.
In this matrix, we preserve symptoms of disease by measuring from the literature
review the function values of correlation, heat, homogeneity, contrast, and entropy.
2. K-Means Cluster Algorithm
K-means is one of the clearly unattended learning algorithms that solve the well-
known clustering problem. The method follows a simple and easy way of classifying
a given set of data through several clusters (assuming k clusters).
6 Expected Results
We will evaluate the system and identify the leaf disease with its intensity of the
disease. The system will help to evaluate and increase the production of crops
reducing the losses of farmers. The system will suggest the quantity of pesticides
for crops based on the disease intensity of crops. The system will also work as real-
time application helping farmer to increase their product without any Collins. The
proposed system will not be limited to a particular crop leaf but will detect any crop
leaf disease.
7 Conclusion
The proposed system has overall solution proposed for farmer giving most benefit
required for increasing crop production and decreasing losses incurred during
farming. The farmers will be getting a real-time system implemented for the proper
production of crops and benefiting the farmer. It will also recommend farmers to use
appropriate pesticides for infected leaves. The system is not limited to a particular
leaf detection rather it can detect all types of leaf disease and suggests the precaution
accordingly.
References
1. Anand, R., Veni, S., Aravinth, J.: An application of image processing techniques for detection
of diseases on brinjal leaves using K-means clustering method, pp. 1–6 (2016)
2. Shanmugam, L., Adline, A.L.A., Aishwarya, N., Krithika, G.: Disease detection in crops using
remote sensing images, pp. 112–115 (2017)
3. Khirade, S.D., Patil, A.B.: Plant disease detection using image processing, pp. 768–771 (2015)
4. Dhaware, C.G., Wanjale, K.H.: A modern approach for plant leaf disease classification which
depends on leaf image processing, pp. 1–4 (2017)
5. Narmadha, R.P., Arulvadivu, G.: Detection and measurement of paddy leaf disease symptoms
using image processing, pp. 1–4 (2017)
6. Pooja, V., Das, R., Kanchana, V.: Identification of plant diseases using image processing
techniques, pp. 130–133 (2017)
7. Devaraj, A., Rathan, K., Jaahnavi, S., Indira, K.: Identification of Plant Disease using Image
Processing Technique, pp. 749–753 (2019)
8. Prakash, R.M., Saraswathy, G.P., Ramalakshmi, G., Mangaleswari, K.H., Kaviya, T.: Detection
of leaf diseases and classification using digital image processing, pp. 1–4 (2017)
9. Revathi, P., Hemalatha, M.: Advance computing enrichment evaluation of cotton leaf spot
disease detection using Image Edge detection, pp. 1–5 (2012)
10. Mishra, B., Lambertm M., Nema, S., Nema, S.: Recent technologies of leaf disease detection
using image processing approach—a review (2017)
11. Agrawal, N., Singhai, J., Agarwal, D.K.: Grape leaf disease detection and classification using
multi-class support vector machine, pp. 238–244 (2017)
12. Sumathi, C.S., Senthil Kumar, A.V.: Neural network based plant identification using leaf
characteristics Fusion. Int. J. Comput. Appl. 89(5), 31–35 (2013)
13. Wu, S.G., Bao, F.S., Xu, E.Y., Wang, Y., Chang, Y., Xiang, Q.: A leaf recognition algorithm
for plant classification using probabilistic neural network, pp. 11–16 (2007)
14. Gaikwad, V.P., Musande, V.: Wheat disease detection using image processing, pp. 110–112
(2017)
15. Shivani, K., Gawali, H.: Plant diseases detection using image processing techniques (2016)
16. Padol, P.B., Sawant, S.D.: Fusion classification technique used to detect downy and powdery
Mildew grape leaf diseases, pp. 298–301 (2016)
Offline Handwritten Dogra Script
Recognition Using Convolutional Neural
Network
Reya Sharma, Baijnath Kaushik, and Naveen Kumar Gondhi
Abstract The handwritten optical character recognition is a challenging and active

branch of pattern recognition. The recognition of Indian scripts is potentially a
complex problem due to several challenging issues like complex shapes of charac-
ters, similar shaped characters, positioning of diacritics, dots, etc. This paper focuses
on the recognition of handwritten Dogra script. This paper also contributes to the
construction of a handwritten Dogra script dataset. The handwritten document images
are manually collected from several sources like archival departments, libraries, and
museums and then pre-processed and segmented in order to obtain the final hand-
written character dataset. The resultant handwritten Dogra dataset is evaluated using
a convolutional neural network classifier, reporting a promising recognition accuracy
of 88.95%.
1 Introduction
Optical character recognition (OCR) is one of the most challenging and fascinating
area of pattern recognition, artificial intelligence and image processing. It is the
study of detecting segments and identifying characters from the input image and
transforming them into corresponding machine understandable format. This field
immensely contributes toward the advancement of man–machine interface. It has
huge variety of applications like zip code reading, finance, taxation, number plate
recognition, education, bank check processing and many more related fields [1].
R. Sharma (B) · B. Kaushik · N. K. Gondhi

Shri Mata Vaishno Devi University, Katra, J&K, India
e-mail: sharmareya327@gmail.com
B. Kaushik
e-mail: baijnath.kaushik@smvdu.ac.in
N. K. Gondhi
e-mail: naveen.gondhi@smvdu.ac.in
https://doi.org/10.1007/978-981-16-1502-3_79
790 R. Sharma et al.
The handwritten text recognition problem is considered potentially more chal-

lenging as compared to the recognition of printed text. The primary challenge
that contributes toward the difficulty handwriting recognition is the variation in
writer specific preferences while drawing and joining the characters. Another factor
contributing to this difficulty is the morphological complexity of cursive scripts [2].
While a huge amount of research has been done on Latin, Roman and Chinese script,
handwritten cursive Indian script recognition is still at its infancy.
From the recognition point of view, a significant research work has been reported
on Indian scripts like Bangla and Devanagari. But no research work has ever been
reported on Dogra script till date. So, this paper is a first attempt in this direction,
and it also provides a standard handwritten Dogra script dataset which can be used
to obtain benchmark results for further research in this field.
The handwritten character recognition process is further classified into following
phases [3]. The first phase of character recognition deals with the acquisition of input
images; after this, we have the pre-processing phase which is further followed by the
segmentation phase. Then the next phase is the feature extraction phase, and finally,
the last phase of character recognition is the classification or recognition phase which
may be further followed by the post-processing phase.
In this work, the convolutional neural network (CNN) is used for the recognition
and classification of handwritten Dogra script. CNN has huge number of applications
[4, 5] in the field of image and computer vision like image classification, natural
language processing, object detection, face, character, speech recognition, etc.
The remainder of this paper is structured as follows: Section 2 describes the signifi-
cant work reported on handwritten Indian scripts. Section 3 gives the detailed descrip-
tion of the dataset and its construction including the pre-processing and segmentation
stage. Section 4 explains the methodology involved in the recognition of handwritten
characters. Section 5 provides the experimental analysis and evaluations of results.
Finally, Sect. 6 concludes the research work and gives the future directions for further
research in this field.
2 Related Work
This section describes some of significant work reported on handwritten Indian

scripts. Desai [6] has presented a feed-forward neural network technique for the
recognition of handwritten Gujrati numerals. In this work, four profile features are
obtained and fed as input to the classifier. Structural features are used along with a
back-propagation network for the classification of handwritten Gurumukhi characters
[7].
Zoning technique was used by Sharma and Jhajj [8] for the classification of hand-
written Gurumukhi characters. In this work, support vector machine (SVM) classifier
and KNN classifier are used for the recognition purpose. It is found that better results
are obtained by using SVM classifier along with the polynomial kernel. Roy et al. [9]
Offline Handwritten Dogra Script Recognition Using … 791
have proposed a new deep CNN model for the recognition and identification of hand-
written Bangla compound characters. A significantly high classification accuracy of
90.33% is obtained by deep CNN architecture.
Shelke et al. [10] have presented a fuzzy-based recognition system for the identi-
fication of handwritten Devanagari characters. In this paper, a two-stage recognition
scheme is designed, in which the first stage has fuzzy inference model and the second
stage uses the structural parameters. A feed-forward neural network is also used for
the final recognition stages, and it provides a recognition accuracy of 96.95%.
KNN classifier is used by Sahare et al. in [11] for the classification of Indian
document images. In this work, character segmentation technique is proposed and
validated using SVM classifier. Geometric features are extracted for the identifi-
cation of characters. These obtained geometric features are then finally fed to the
KNN classifier for the final task of recognition. This combination provides a good
recognition accuracy in comparison to other state-of-the-art results.
Raj et al. [12] have proposed structural and statistical feature extraction methods
for the recognition of handwritten Tamil characters. The structural and statistical
features are represented by PM quad tree in a hierarchical way. The obtained features
are then classified or recognized with the help of SVM classifier.
3 Dataset
The Dogra script is a regional script of India, historically related with Dogri language.
It is a Brahmi-based alpha-syllabary, derived from Takri script [13]. The Dogra script
has 10 independent vowels, 10 dependent vowels and 34 consonants, which are
used in the present work. A significant contribution of this work is the development
handwritten Dogra script database. The handwritten Dogra script documents are
scanned at 200 dpi. The digitized documents are then pre-processed and segmented
in order to obtain the individual character set database for the final recognition.
3.1 Acquisition of Input Image
This step performs the transformation of machine printed or handwritten documents

into digitalized form with the help of electronic devices such as scanners, cameras
or tablets.
The Dogra script was the official script Jammu and Kashmir state during the
regime of Maharaja Ranbir Singh. The Dogra script was used for several adminis-
trative purposes as well as upon postcards, stamp papers, postage stamps, currency
notes and also for literary activities. Therefore, huge amount of data is available for
Dogra script in the form of handwritten ancient manuscripts, temple inscriptions,
etc. Figure 1 depicts some samples extracted from handwritten Dogra documents.
So, we have surveyed several archival departments, libraries and museums of J&K
Fig. 1 Samples extracted from Dogra documents
in order to collect handwritten documents. In this work, the handwritten documents

are scanned and digitized at 200 dpi.
3.2 Pre-Processing
The pre-processing phase plays a significant role in the recognition of handwritten

characters. This crucial step includes several operations like binarization, noise
removal, smoothing, base line detection, skew detection, filtering, skeletonization
or thinning, etc. [14].
The handwritten document images are firstly binarized by converting input rgb
text images into gray-scale images and finally into corresponding binary images.
An appropriate thresholding is used for obtaining the binary images (with level 1
representing background and level 0 representing foreground). The proper threshold
value is selected by using the traditional Otsu algorithm [15]. Figure 2a, b represents
the pre-processing phase.
Fig. 2 a Input image with noise. b Input image without noise

3.3 Segmentation
The segmentation phase is responsible for dividing the pre-processed input data into
sub-components in order to recognize what exactly is contained in the input image
[16]. In the present work, the lines of text are extracted or segmented from the
document image using horizontal histogram projection profile [17] as displayed in
Fig. 3a, b.
After obtaining the segmented lines, the individual characters are obtained by
applying bounding box [18] technique as shown in Fig. 4. Finally, all the individual
character images are normalized to uniform size of 32 × 32 pixels.
Fig. 3 a Horizontal histogram projection profile. b Segmented text lines
Fig. 4 Segmented individual characters

4 Methodology
The convolutional neural network (CNN) is one of the most well-known deep learning
architectures [19, 20]. In this work, we have used CNN for the identification of
handwritten Dogra script. This proposed CNN architecture has two convolutional
layers and with each convolutional layer followed by a max-pooling layer. The final
layer is the soft-max layer as shown in Eq. 1.
ezn
softmax(zn ) = z (1)
ie
i
The first convolutional layer has 64 filters with each filter having size 5 × 5 and
stride of 1. This layer extracts features directly from the handwritten input character
image and ReLu activation function is used as shown in Eq. 2. The output obtained
from the ReLu function is then fed to max-pooling layer.
Relu(z) = max(0, z) (2)
The first max-pooling layer has size 2 × 2, with stride = 2. The output of first
pooling layer has dimension of (14 × 14 × 64), and this output is then passed to
second convolutional layer having size 3 × 3 with stride = 1, and 32 filters. Then,
the second max-pooling has size 2 × 2, with stride = 2. The output features obtained
from second max-pooling layer has dimension (6 × 6 × 32), which is finally fed to
the fully connected layer.
In this architecture, we have two fully connected layers. These fully connected
layers are actually responsible for the final task of classification. In order to prevent
the over-fitting of data dropout is applied at each layer. Dropout basically represents
a regularization technique in which we omit randomly some layer’s units for a given
iteration. The final layer of the proposed model is the softmax layer. The CNN
architecture is presented in Fig. 5.
Fig. 5 CNN model for Dogra character recognition

Fig. 6 Recognition accuracy on Dogra dataset
We have trained our CNN model for 20 iterations on the handwritten Dogra character
dataset. The dataset consists of 10 independent vowels, 10 dependent vowels and 34
consonants; therefore, we have 54 output classes. We have normalized all character
images to uniform size of 32 × 32 pixels, so each character image is represented as
1024-dimensional input.
The dataset has been randomly shuffled and then partitioned into three parts.
The 75% of the handwritten character images are used for training the model. The
remaining 25% character dataset is partitioned into validation set and testing set,
with validation set having 5% of the handwritten character images and rest of the
20% data is used for testing the model. The trained CNN model gives a recognition
accuracy of 88.95% when tested on handwritten Dogra character dataset as shown
in Fig. 6.
6 Conclusion
In this paper, an effective deep learning model, i.e., CNN has been presented in
order to recognize handwritten Dogra characters. This paper also contributes to the
construction of handwritten Dogra script dataset. For constructing the handwritten
Dogra script dataset, we have surveyed various sources like archival departments,
libraries and museums in J&K. The collected handwritten document images are then
pre-processed and segmented in order to obtain final handwritten character dataset.
From the literature, it is evident that no research work has ever been reported
on Dogra script till date. So, this is the first attempt made in this direction. Since
Dogri language is one of the scheduled languages of India, so this research work
will lead to significant movement for the revival of ancient Dogra literature available
in libraries, temple inscriptions and museums. In the future, the handwritten Dogra
character dataset can be used to obtain benchmark results for further research in this
field.
References
1. Boulid, Y., Souhar, A., Ouagague, M.M.: Spatial and textural aspects for Arabic handwritten
characters recognition. Int. J. Interact. Multimedia Artif. Intell. 5(1), 86–91 (2018)
2. Shi, C.Z., Gao, S., Liu, M.T., Qi, C.Z., Wang, C.H., Xiao, B.H.: Stroke detector and structure
based models for character recognition: a comparative study. IEEE Trans. Image Process. 24,
4952–4964 (2015)
3. Sharma, R., Kaushik, B., Gondhi, N.: Character recognition using machine learning and deep
learning-a survey. In: International Conference on Emerging Smart Computing and Informatics
(ESCI), pp. 341–345. IEEE (2020)
4. LeCun, Y., Bengio, Y., Hinton, G.: Deep learning. Nature 521, 436–444 (2015)
5. Zhang, Q., Zhang, M., Chen, T., Sun, Z., Y. Ma, Y., Yu, B.: Recent advances in convolutional
neural network acceleration. Neurocomputing 323, 37–51 (2019)
6. Desai, A.A.: Gujarati handwritten numeral optical character reorganization through neural
network. Pattern Recogn. 43(7), 2582–2589 (2010)
7. Garg, N.: Handwritten Gurumukhi character recognition using neural networks. Master’s thesis.
Thapar University, Patiala (2009)
8. Sharma, D., Jhajj, P.: Recognition of isolated handwritten characters in Gurmukhi script. Int.
J. Comput. Appl. 4(8), 9–17 (2010)
9. Roy, S., Das, N., Kundu, M., Nasipuri, M.: Handwritten isolated Bangla compound character
recognition: a new benchmark using a novel deep learning approach. Pattern Recogn. Lett. 90,
15–21 (2017)
10. Shelke, S., Apte, S.: A fuzzy based classification scheme for unconstrained handwritten Devana-
gari character recognition. In: International Conference on Communication, Information &
Computing Technology, pp. 1–6. IEEE (2015)
11. Sahare, P., Dhok, S.B.: Multilingual character segmentation and recognition schemes for Indian
document images. IEEE Access. 6, 10603–10617 (2018)
12. Raj, R., Antony, M., Abirami, S.: Offline tamil handwritten character recognition using
statistical based quad tree. Australian J. Basic Appl. Sci. 10(2), 103–109 (2016)
13. Pandey, A.: Preliminary proposal to encode the Dogra Script in Unicode. Vol. 2. L2/15-213).
http://www.unicode.org (2015)
14. Yadav, M., Purwar, R.K., Mittal, M.: Handwritten Hindi character recognition: a review. IET
Image Proc. 12(11), 1919–1933 (2018)
15. Otsu, N.: A thresholds election method from gray level histograms. IEEE Trans. Syst. Man
Cybern. 9(1), 62–66 (1979)
16. Sharma, R., Kaushik, B.: Offline recognition of handwritten Indic scripts: a state-of-the-art
survey and future perspectives. Comput. Sci. Rev. 38, 100302 (2020)
17. Singh, N.: An Efficient Approach for handwritten devanagari character recognition based on
artificial neural network. In: 5th International Conference on Signal Processing and Integrated
Networks, pp. 894–897. IEEE (2018)
18. Ha, J., Haralick, R.M., Phillips, I.T.: Document page decomposition by the bounding-
box project. In: Proceedings of 3rd International Conference on Document Analysis and
Recognition, pp. 1119–1122, IEEE (1995)
19. Zeiler, M.D., Fergus, R.: Visualizing and understanding convolutional networks, In: European
Conference on Computer Vision, pp. 813–833, Springer, Cham (2013)
20. Schmidhuber, J.: Deep learning in neural networks: an overview. Neural Netw. 61, 85–117
(2015)
“Device Design of 30 and 10 nm Triple
Gate Single Finger Fin-FET
for on Current (ION ) and off Current
(IOFF ) Measurement”
Sarika M. Jagtap and Vitthal J. Gond
Abstract Nowadays, users need portable gadgets like laptops and cellular phones
with small in size which occupies less area, consumes low power and having low cost.
Justifying Moore’s law by designing the smaller size transistors on the silicon wafer,
more numbers of transistors available on a single wafer help to design complicated
circuits with very low cost. Scaling plays vital role to decide the size of transistor
with high performance. Most attracted multi-gate technology for researchers as well
for industry is Fin-FET for nano-scale design. The nano-scale Fin-FET technology
provides best solution for Moore’s law. This paper focuses on how Fin-FET helps to
reduce short channel effect and also presents design of 30 nm and 10 nm single Fin-
FET with Triple Gate. Leakage current, threshold voltage and drain drive current
evaluated from device design by using high K of dielectric material. Simulation
carried out using COMSOL MULTIPHYSICS Version 5.3
1 Introduction
Scaling has been expected toward smaller size, advanced speed, low stimulus and
higher density of the semiconductor devices. As MOSFET channel thickness is
climbed to the nano-meter regime, the gate cannot handle the position activity
so damage the control action on the channel, and some critical belongings are
occurred like hot carrier things, punch through, mobility degradation and short
channel properties are occurring.
CMOS skill introduces the size of the device reduced to 10 micrometer in 1971
near 90 nanometer, and now in 2020 we avoid thesepossibly, we will shrink the to
below 10 nm (7 nm, 5 nm). Size reductions of transistor cause unwanted technological
effect that is short channel effect. Existing CMOS technology has a big problem of
S. M. Jagtap (B)
MVP Samajs KBTCOE, Nashik, India
V. J. Gond
MET’s Bhujbal Knowledge City, COE, Nashik, India
https://doi.org/10.1007/978-981-16-1502-3_80
800 S. M. Jagtap and V. J. Gond
short channel effect, and second most unwanted effect is leakage current; it introduces
when gate length is reduced. Due to this limitation of CMOS, it cannot use beyond
22 nm reduction.
As MOSFET has planer device technology, it has very grave preventative factors
of high device design cost, power restraints and very sensitive to process vari-
ations [1]. By providing alternative solution to the current technology, Fin-FET
constructed multiple gate quasi-planer devices. To change nano-scale CMOS below
45 nm MOSFET 3-dimensional double gate (DG), triple gate (TG) device called
Fin-FET is good choice. As Fin-FET may be double, triple or more than triple gate,
i.e., multi-finger device, it has well gate action of blocking leakage over the perfect
semiconductor channel, which diminishes short channel result (SCE) [2].
In this research work, we present how the scaling helps to improve device perfor-
mance, and it is observed by designing a sample of 30 nm and 10 nm single Fin-FET
with Triple Gate. From this model design, we observe the long channel and short
channel device output in terms on threshold voltage, leakage current, subthreshold
slope and drain-induced barrier lowering. This paper presents how Fin-FET benefits
to reduce short channel effect by decreasing channel length and also how it helps
to improve the device performance by using multi-gate. Modeling and simulation
of 30 nm and 10 nm TG Fin-FET device design based on geometry is presented.
The conventional MOSFET is in 2D planar structure, and the gate poses flat over the
source and drain, whereas Fin-FET nonplanar is a 3D structure that covers the gate
with gate oxide around the fin-shaped source and drain.
1.1 Review of Literature
Fin-FET technology has been born as a result of the increase in the levels of inte-
gration. The primary multi-gate transistor was distributed by Heida in 1987. As
CMOS-based gadgets are scrambled to nano-meter region, due to scaling, several
complications occur like drain-induced barrier lowering, punch through, mobility
degradation and off current which extremely disturb the device concert.
Narendar and Mishra [1] In this work, researcher group has been analyzing inde-
pendent gate Fin-FET for threshold voltage discrepancies by using work function.
Effective energy of MOSFET count depends on how much area of depletion is
fully charge. For lengthy, i.e., more distance between drain to source called as long
channel devices, silicon material is effectively used as gate terminal supplies. Metal
work function plays important role to change doping. High k dielectrics like HFO2
is better to improve the performance in terms of leakage current.
In paper, [2] main problem associated with the Fin-FET device is higher leakage
and lower threshold voltage. By considering the geometry of Fin-FET like fin thick-
ness, height, width on current and off current is affected. By suitable use of metal work
function and low or high-k dielectrics, entire current of device affected. Advanced
the dielectric asset of gate part, reduced the leakage, and developed the beginning
voltage can be found a improved device appearance.
“Device Design of 30 and 10 nm Triple Gate Single Finger … 801
The blade, i.e., fins breadth of Fin-FET thickness must remain keep a smaller
amount than one-third of channel dimension to reduce effects of short channel. In
planar CMOS, due to long channel length, some harmful effects are occured which
are completely avoided in bulk Fin-FET. [3] Reduction in fin size remains toward
reduction in leakage owing to short channel effects. Variation in work function and
high-k dielectrics centrals to difference in beginning voltage.
The key factor of VLSI-based project is the power requirements, leakage current
and size. Here, [4] author explores how circuits based on Fin-FETs expertize that
is probable to complement bulk CMOS at 22-nano-meter, offer stimulating delay–
power adjustments.
Due to scrambling of metal oxide semiconductor field effect transistor, nonstop
reduction in turn on or operating voltage is detected, and off current or leakage
current, mobility degradation, punch through effects are produced [5]. By suitable
use of metal work function, we avoid these effects. Work function is the lowest energy
desired to eliminate an electron from a solid to a point nearly separated from the solid
surface. By affecting the work function in the Fin-FET modeling, it is possible to set
appropriate operating voltage at same supply voltage and possibly decrease leakage
currents. By varying in metal gate work function from 4.1 eV to 4.4 eV, author offers
direct variation in threshold voltage.
Chopade [6] with silicon dioxide, the thickness of gate oxide is so small that it
can barely produce a gate current. So the use of high-K material as a gate oxide is
preferred. In this study, author proposes a device structure for leakage suppression
using a pile gate with a different work function in the bottom gate electrode. The core
gain of Fin-FET construction is there is no necessity for an extra substrate doping.
By introducing assets of MOSFET like fin thickness, doping concentration, gate
material, and oxide thickness, author represents performance improvements. The
depth of oxide layer is related to square root of oxidation period. From I-V charac-
teristics, it originates that the threshold voltages (Vt) for MOSFETs with changed
oxide layer widths are related to the square root of the (Vgs) [7].
In [8], author concentrates on how to improve the performance parameters like
drain-induced barrier lowering, gate-induced barrier lowering, subthreshold slope,
on current, threshold voltage of CMOS device which is observed by changing doping
concentration of drain and source regime. By designing, author found that the doping
differences releases the threshold voltage of Fin-FET and improves other parameters.
Mohd Radzi andSanudin [9] Author presented the transistor performance by
changing oxide thickness. The imitation grades that the threshold voltage is directly
proportional to oxide thickness. Drain current is mainly related to operating drain
voltage for smallest variation in gate voltage up to the border of its saturation level.
The consequences prove that the leakage current, i.e., off current (IOFF) is improved
as oxide thickness grow into stripper.
Multi-finger Fin-FETs are presented; here [10] fins are parallel to each other as
the device is triple gate. Increase in quantity of fins peaks to upgrading the current
over the device. The breadth of the fin interprets the operative channel length of the
device [10]
By reducing threshold voltage, power gets affected However, as dawn voltage

is reduced, the transistor takes time to change the transition from off to on with
the partial voltage swing offered. Subthreshold leak current is most important issue
of recent high performance [11]. The double, triple or multi-gate MOSFETs are
playing most important role to improve the performance having two gates, triple,
gate all around on any side of the channel. In this work, writer learning the device
sizes things on the presentation of a double gate silicon MOSFET via energy stability
typical with Bohm quantum potential.
In chapter, author does the MOSFET modeling to present gate tunneling for
current measurement. The greater the gate voltage, the bigger the electric fields
created in the substrate, thus growing the probabilities of tunneling.
By using Poisson and quantum transport equations, researcher simulates current
voltage characteristics [13]. Reduction of short channel properties is found in double
gate two-dimensional metal oxide semiconductor field effect transistor with changed
in metal gates.
Threshold voltage measurement done by researcher for the lower power oper-
ating devices. Author designs 10 nano-meter NMOS Fin-FET to achieve low power
requirement. By changing work function, author found off current of devices and
threshold voltage.
Double gate means front and back gate transistors are modeled with completely
depleted silicon layer have a spreading of the electrical potential inside the layer,
where the potential at the center being different from zero [15].
In this effort [16] scholars’ effort on assessment of Fin-FET strategies with bulk
CMOS skill in nano-meter regions. As the device is triple gate (front, back, top), the
channel is bounded in three extents in Fin-FET. High on current and output resistance
are measured from the design.
In this paper, the variation of device characteristics of double gate Fin-FET with
respect to the thickness of oxide and different dielectrics at 14 nm gate length is
presented [17]. Gates wrapped around the vertical channel (or) fin allows ease in
fabrication and compatibility with CMOS fabrication process. This study explains
the sensitivity of Fin-FET performance metrics and short channel metrics to variation
in dielectric constant and thickness of Tox. The oxide layer wrapping the sides of the
fin improves the control over the gate that makes them superior to planar MOSFETs
in reduction of short channel metrics such as operating or device active voltage, pinch
off and drain-induced barrier lowering.
The gate terminal dielectric SiO2 is changed with several high-k dielectric mate-
rials. The author planned gate dielectric k values are varied from 3.9, 7 and 22.
As the k values are varied from 3.9, 7 and 22, the drain current also growths. The
leakage or off current and the drain-induced barrier lowering parameters are start to
decline exponentially which implies that the device has superior short channel effect
suppression capability. The lateral electric field also increases with increase in gate
dielectric value.
Author presents how high-k dielectrics help to control the leakage current and
maintaining the threshold voltage [19].
Researcher investigates the [20] result of collective improving the quantity of

fins affects on drain on–off current methods. Here, the drain current calculation is
demonstrated by seeing the belongings of the depletion charges in the gate region,
i.e., the channel close to the source/drain and substrate boundary.
Here, in [21], author settled a triple gate Fin-FET device for improved threshold
voltage (Vth), subthreshold slope (SS), high on current (Ion) and high Ion/Ioff ratio.
By scrambling down the oxide thickness, author found intensification in on current
and threshold voltage.
Using high-k dielectric, i.e., HfO2 and ZrO2 demonstrates comparatively high
threshold voltage levels due to imperfections at the gate electrode edge. This
decreases drive current [22].
The drawback of the planar transistors the short channel effect when decreasing the
channel length of the device. The idea of Multi-gate FETs became the ideal solution to
the negative effects of channel decreasing of planar MOSFET. The different structures
and their fabrication techniques of Multi-gate devices provide chip makers with
devices with small channel length, and faster switching efficient speed operation
and lower power consumption, due to the much-improved control over the device
channel [23].
Carusone et al. [24] in this study, researcher simulates the changed types of elec-
trical characteristics for dissimilar operating regions and changed gate dimensions
and also for different oxide thickness. Fin-FET routes can reach lesser efficient
voltage supply and optimal energy consumption associated to CMOS circuits.
2 MOSFET and FIN-FET Structure
Metal oxide semiconductor field effect transistor popularly referred to as MOSFET

is most commonly used device for semiconductor circuits. Basic structure of the
device is shown through its cross-section. Device formed in semiconductor material
is referred to as frontend while metallization, contacts and poly-silicon are referred
to as backend [3].
In a typical process, semiconductor may be lightly doped p-type ( p − ). NMOS
device has four terminals namely drain, gate source and body. Drain and source are
formed by n + embedded in p − substrate and separated physically by distance called
gate length (L). The other dimensions of gate are gate width (W). Gate area (WL) is
covered with nonconductive polymorphous silicon (poly-silicon). Metal ion implant
on top surface of poly-silicon makes it conductive. This constitutes gate contact using
conductive poly-silicon. Contacts to drain and source are made by process referred to
as metal lift-off. A MOSFET structure is shown in Fig. 1 which describes the gate and
channel arrangement between source and drain. Different types of dielectric materials
can be used to prepare substrate and channel of device [4]. Trade off in MOSFET
design is that if channel length decreases, leakage current increases which consumes
more power. To reduce this effect, designers use low K dielectric material but this
causes to reduce oxide capacitance which degrades performance of the device.
Fig. 1 MOSFET construction
2.1 Threshold Voltage
Threshold voltage of a device depends on silicon–silicon dioxide interface work

function, also known as metal work function (φSM ), inversion potential (2φ f ), stored
gate charge and gate oxide capacitance( CQOXb ) and ion implant under the gate at silicon–
silicon dioxide interface ( CQOX
SS
). Threshold voltage can be assumed as voltage drop
across ggate and substrate [5]. All the derivations in this section are for unit gate
part. Gate oxide capacitance (COX ) per unit gate area is given by.
εox
COX = (1)
tox
Current flows from drain to source and is modulated by gate voltage (through
control over gate channel depth). For this analysis, we assume that body terminal is
tied to the source and there is no body effect.
μn Cox W
ID = 2(VGS − Vt )VDS − VDS
2
(2)
2 L
2.2 Overdrive Voltage
Voltage required to create gate channel in an enhancement mode MOS device is

called threshold voltage. Gate voltage above the threshold voltage is called overdrive
voltage.
VOV = VGS − Vt (3)

W
I D = μn Cox VOV VDS (4)
L
This is equivalent to resistance.

W
RDS = 1/ μn Cox VOV (5)
L
Gate to source and gate to drain capacitance are equal.
W LCox
Cgs = Cgd = (6)
2
Cox Gate oxide capacitance.
W Width of the channel.
L Gate length.
VOV Overdrive voltage.
Vs Drain source voltage.
The planar MOSFET device has flat channel, i.e., MOSFET is parallel work
whereas, and the Fin-FET channel is a thin steeply effort. Fins are entirely covered
around the gate and channel is shaped between the source and the drain stations as
shown in Fig. 2. The current flows in corresponding to the plane in Fin-FET, whereas
the designed conducting channel is molded everywhere the fin boundaries [4]. With
the similar structure of Fin-FET, the gate is able to abundantly depleted in the channel,
and this formed conducting channel having much-improved electrostatic control over
the channel. Fin-FETs can be classified by gate structure or type of substrate [6].
Fig. 2 MOSFET working in different region

Basically, Fin-FET is classified in two types:

1. Shorted-gate (SG) Fin-FETs
2. Independent-gate (IG) Fin-FETs.
The feature of the Fin-FET is that the leading channel is enfolded through a narrow
semiconductor “fin” that procedures the gate the device and the fin thickness control
the effective channel distance of the device [3].
MOSFET is a planar device, whereas Fin-FET is work as nonplanar device, and
there is a nitride spacer among the gate and the source and drain, which are usually
higher [7].
The Fin-FET structure is built on a perpendicular silicon Fin considered by the
gate length, fin height (HFIN ) and the silicon thickness as shown in Fig. 2.
3 Device Design of FIN-FET
The fin field effect transistor performance depends on the process-induced variation
under systematic value of,
1. Gate length [L g ],
2. Fin height [H fin ],
3. Fin width [W fin ],
4. Gate oxide thickness [t ox ],
5. Channel doping.

eox eox ∗ tsi
λ= 1+ tsi ∗ tox (7)
esi 4 ∗ esi ∗ tox

esi eox Tsi
λHfin = 1+ Hfin Tox (8)
eox4 4esi Tox
1
λc =
(9)
1
λ
2 + λHfin
2
Nis operative amount of gates, esi is permittivity of silicon, eox is permittivity of

gate oxide [8, 9] (Table 1).
t ox is thickness of gate oxide, t si is thickness of fin, H fin is height of fin.
Front view and top view of single Fin-FET structure are shown in Figs. 3 and 4.
Figure 5 shows geometry of 30 nm single Fin-FET (Figs. 6 and 7).
Table 1 Physical parameters used in the design of single Fin-FET with 30 nm Fin width and 30 nm
gate length
S. No Device parameter Symbol N-Fin-FET
1 Height of fin H fin 90 (nm)
2 Width of fin W fin 100 (nm)
3 Fin thickness (depth) L fin 30 (nm)
4 Gate length LG 30 (nm)
5 Gate height H gate 60 (nm)
6 Gate work function Øg 4.1
7 Oxide thickness T ox 1 (nm)
8 Drain voltage Vd 10mv
9 Gate voltage Vg 1V
10 Gate material Si Si
11 Oxide relative permittivity Eins 6.9
11 Channel doping concentration N A0 1e19 (1/cm3 )
12 Source/drain doping concentration for NMOS N D0 1e21 (1/cm3 )
13 Junction depth Dj 1 (nm)
Fig. 3 I–V characteristics of MOSFET—NMOS output characteristics
4 Conclusion
In this paper, we introduced the basic device design of 30 nm and 10 nm fin thickness
for 30 nm gate length single finger Fin-FET using triple gate (front, back and top
gate). Fin thickness and gate length improve threshold voltage to enhance speed of
device by using geometry parameters. Using changed physical geometry parame-
ters, we approach the single Fin-FET, and by varying gate length and fin, thickness
Fig. 4 Fin-FET structure
Fig. 5 Front view of single

Fin-FET and plane geometry
of single Fin-FET
Electron Concentration Hole Concentration
Fig. 6 I–V characterstics of 30 nm Fin-FET
detects effect on Ioff, Vt, SS and DIBL. Their presentation studied in terms of I–V
characteristics and transfer characteristics.
For long channel effect, pinch off rises at overdrive voltage (Vgs-Vt). By falling
the fin thickness, the leakage current decreases which helps to expand the presentation
of the device.
In this , we introduced the basic device design of 30 nm and 10 nm fin thickness for
30 nm gate length on single finger using trigates (top, front, back). Fin thickness and
gate length improve threshold voltage to enhance speed of device by using geometry
parameters.
Electron Concentration of 10nm Fin- Hole Concentration of 10nm Fin-FET

FET
Output Characteristics _10nm Fin-FET Transfer Characteristics 10nm Fin-FET
Fig. 7 I-V characterstics of 10 nm Fin-FET
Acknowledgements I thankfully acknowledge Ni2 Logic Design, Pune, for providing the licensed
tool for implementation of Fin-FET fdesigns.
References
1. Narendar, Mishra, R.: Threshold voltage control schemes in FIN-FETS. Int. J. VLSI Des.
Commun. Syst. (VLSICS) 3(2):175–191 (2012). https://doi.org/10.5121/vlsic.2012.3215
2. Anju, C.: Performance analysis of wavy Fin-FET and optimization for leakage reduction. In:
2016 IEEE International Symposium on Nano electronic and Information Systems, pp 83–85.
https://doi.org/10.1109/iNIS.2016.43
3. Shukla, S., Gill S.S.: Comparative simulation analysis of process parameter variations in 20
nm triangular Fin-FET. Act Passive Electron Compon 2017, 8 pp. Article ID 5947819. https://
doi.org/10.1155/2017/5947819.
4. Mishra, P., Anish, M., Jha, N.K.: Fin-FET circuit design. Nanoelectronic Circuit Design.
Springer Science New York, pp 23–54 (2011)
5. Ranka, D., Rana, A.K.: Performance evaluation of FD-SOI MOSFETS for different metal gate
work function. Int. J. VLSI Des. Commun. Syst. (VLSICS) 2(1), 11–24 (2011)
6. Chopade, S.S., Padole, D.V.: Dual material pile gate approach for low leakage FIN-FET. Int.
J. Technol. (2017). https://doi.org/10.14716/ijtech.v8i1.3699
7. Fan, J.-C., Lee, S.-F.: Effect of oxide layer in metal-oxide-semiconductor systems. In:
MATEC Web of Conferences SMAE 2016, 5 pp. https://doi.org/10.1051/06103 (2016).
[matecconf/2016MATEC Web of Conferences 6SMAE 2016706103]
8. Keerti Kumar, K., Anil, P., Bheema, R.N.: Parametric variation with doping concentration in
a Fin-FET using 3D TCAD. Int. J. Comput. Appl. 3, 21–23. [International Conference on
Microelectronics, Circuits and Systems (MICRO-2014)] 0975 – 8887
9. Mohd Radzi, N., Sanudin, R.: Effect of oxide thickness variation in sub-micron NMOS tran-
sistor. Int. Res. Innov. Summit (IRIS2017) 10. IOP Publishing. https://doi.org/10.1088/1757-
899X/226/1/012145
10. Somra, N., Sawhney, R.S.: 32 nm Gate Length Fin-FET: impact of doping. Research Gate
(2015). Int. J. Comput. Appl. 122(6), 11–14 (2015). 0975 – 8887
11. Hasan, M., Hassan, E.: Study of scaling effects of a double gate silicon MOSFET. In: 10th
International Conference on Electrical and Computer Engineering, 20–22 Dec 2018, pp. 169–
172
12. Chaudhry, A.: Fundamentals of nano-scaled field effect transistors. Nanoscale Effects: Gate
Oxide Leakage Currents. Springer Science New York (2013)
13. George James, T. Joseph, S.: The influence of metal gate work function on short channel effects
in atomic-layer doped DG MOSFET. J. Electron Devices 8, 310–319 (2010)
14. Walke, A.M.: Design strategies for ultralow power 10 nm Fin-FETs. In: 2017 Rochester Institute
of Technology RIT Scholar Works
15. Cerdeira, A., Estrada, M., Alvarado, J.: Review on double-gate Mosfets and Fin-Fets modeling.
Facta Univ. Ser. Electron. Energetics 26(3), 197–213 (2013). https://doi.org/10.2298/FUEE13
03197C
16. Farkhani, H., Peiravi, A., Kargaard, J.M., Moradi, F.: Comparative study of Fin-FETs versus
22 nm bulk CMOS technologies: SRAM design perspective. In: 2014 27th IEEE International
System-on-Chip Conference (SOCC) 2–5 Sept 2014, pp. 449–454
17. Mushahhid Majeed, M.A., Rao, S.: Influence of thickness of oxide and dielectric constant on
short channel metrics in Fin-FETs. J. Adv. Res. Dyn. Control Syst. 9(4), 57–64 (2017)
18. Nirmal, D., Thomas, D.M.: Impact of channel engineering on Fin-Fets using high-K dielectrics.
Int. J. Micro Nano Electron. Cir. Syst. 3(1), 6 (2011)
19. Yin, H., Yao, J.: Advanced transistor process technology from 22- to 14-nm node (2018)
20. Sivasankaran, K., Mallick, P.S.: Impact of device geometry and doping concentration variation
on electrical characteristics of 22 nm Fin-FET. In: 2013 (ICECCN 2013), pp. 528–531
21. Gupta, T.K.: Copper interconnect technology. Dielectric Materials. Springer Science (2009)
22. Shehata, N., Gaber, A.-R.: 3D multi-gate transistors: concept, operation, and fabrication. J.
Electr. Eng. (2015)
23. Hossain, M.Z., Hossain, M.A.: Electrical characteristics of trigate Fin-FET. Glob. J. Researches
Eng. Electr. Electron. Eng. (2011)
24. Carusone, T.C., Johns, D.A., Martin, K.W.: Analog Integrated Circuit Design, 2nd edn. John
Wiley & Sons, Inc. (2012). ISBN 978-0-470-77010-8
Fact Check Using Multinomial Naive
Bayes
Madhavi Ajay Pradhan, Ankita Shinde, Rohan Dhiman, Shreyas Ghorpade,

and Swapnil Jawale
Abstract An easy access to social media platforms has made information available
effortlessly and thus has increased the intricacies to distinguish between true and
falsified information. The credibility or reliability on social media platforms is also
at stake. It is of utmost necessary to address this as a severe issue and act on it
promptly. The extensive spread of counterfeit news has the potential for creating
negative impacts on vast audience. Therefore, fake news detection on social media
has become a very critical agenda in today’s world. This paper proposes a prototype to
detect whether a news is fake or real using the multinomial Naive Bayes algorithm and
its various architectures. Furthermore, the proposed prototype is capable of handling
the unstructured data as the news can be in the form of images. In addition to this, the
use of Django which is a high-level Python framework that allows the development
of UI very easily with multiple designing options. As there was a high need of a
24/7 working server, the system has been deployed on Amazon Web Services EC2
Server as it gave less downtime and is highly reliable. Experimentation was done
on the synthetic COVID news dataset created by collecting COVID news on social
platforms.
1 Introduction
Grouping of any news thing into Fake or Genuine one has offered ascend to an
incredible enthusiasm from scientists around the globe. Different examination con-
templates have been done to watch the impact of distorted or created news content
on masses and reaction of individuals after running over such news things. Coun-
terfeit news and fabricated news can be in either textual or in image format. This
paper addresses the classification of both types. In the twenty-first century, individ-
uals are more into Web-based media as opposed to investing important energy in
perusing the news on approved news sites, they contribute additional time via online
M. A. Pradhan · A. Shinde · R. Dhiman (B) · S. Ghorpade · S. Jawale

Department of Computer Engineering, AISSMS College of Engineering, University of Pune,
Pune, Maharashtra, India
https://doi.org/10.1007/978-981-16-1502-3_81
814 M. A. Pradhan et al.
media, and they doubtlessly accept whatever news going ahead social media will
be valid; however, it is phony news just to conceal reality or misdirect perusers and
have negative effect about the genuine news [1]. Initially, counterfeit news can break
the creativity equilibrium of the entire news environment. Furthermore, counterfeit
news deliberately wins buyers to acknowledge one-sided or false convictions. Coun-
terfeit news is typically controlled by the advertiser to pass on political messages or
impact. Thirdly, counterfeit news changes the manner in which individuals decipher
and react to genuine news [2]. For example, the recent COVID situation has caused
a havoc around the globe. People in order to immune themselves may believe in a
news that talks about a medicine which cures COVID-19 and might consume them
and end up harming themselves, which in reality is just a falsified statement. This
paper explores the use of classification algorithms that can be used to segregate fake
news from real news.
2 Literature Survey
Gilda [3] made the use of TF-IDF along with bigram, syntactical structure and also
various other features to find out the best fit factor for fake news detection. In the
paper, it was found out that bigram and TF-IDF give the models that have a very
high effect in the classification of the articles.
Kim et al. [4]—proposed two different ways: per-document text normalization and
feature weighting method. While these are fairly impromptu strategies, the creator’s
proposed gullible Bayes text classifier performs very well in the standard bench-
mark assortments, rivaling cutting edge text classifiers dependent on an exceptionally
unpredictable learning strategy, for example, SVM. Exploratory outcomes on the two
assortments show that the proposed model is very valuable to construct probabilistic
content classifiers with minimal additional expense as far as existence, compared to
the conventional multinomial classifiers. Relative recurrence or smoothed relative
recurrence is sufficient to standardize term frequencies.
Conroy et al. [5] proposed a hybrid approach that consolidates linguistic cue
and AI, with network-based conduct information for counterfeit news recognition.
Despite the fact that the methodology they utilized gives high exactness arrange-
ment, they are restricted uniquely to printed information and do not investigate the
unstructured information.
Tijare [6] had proposed models for fake news detection utilizing Naive Bayes,
SVM, and long-short term memory (LSTM) which is an augmentation of RNN
and Keras-based neural organization. LSTM-based model gives the most elevated
precision when the content is naturally a serialized object.
Kim et al. [7] used a different approach by using the unified word vector for the
various key sentences of article.
Granik et al. [8] proposed fake news detection model using Naive Bayes classifier
and for their explanation they made the use of Facebook news posts dataset.
Fact Check Using Multinomial Naive Bayes 815
A similar kind of a problem where there are two labels and a classifier was used
to predict the outcome by Pradhan and Bamnote [9] in their research. They proposed
a classifier to find out whether a particular patient is diagnosed with diabetes or not
using support vector machine.
Analyzing all the research done and after a comparison, a suitable algorithm was
selected was moving further with the research.
3 Proposed System
The proposed plan is divided into three main modules

1. Basic textual fact check.
2. OCR functionality for news article in image format.
3. Combining both functionalities 1 & 2 and deploying it to a 24/7 working server
to be accessed by the user anytime.
3.1 Basic Textual Fact Check
A dataset will be first scraped from various news Web site. The dataset will consist
articles divided into two categories fake and real. This dataset will be made to be used
for the training purpose of the model. A Python code will then be developed in which
the use of machine learning model, i.e., multinomial Naíve Bayes will be done. The
dataset will be provided as an input to the algorithm for the training purpose, and
then the trained model will be prepared and saved on the local server. A separate
Python code would be developed in which input would be taken from the user for the
news he or she wants to check the credibility for. The code would take in the input
and predict the value by analyzing it from the model saved by the algorithm. The
output would be displayed in accordance with the reply received from the algorithm.
3.2 OCR Functionalities
Many news articles nowadays that are circulated over the Internet are in the form of
images. So providing the user an option where he or she can upload the news image
consisting of some written news, so that the system predicts and lets them know what
it feels about the news. So the program would make the use of Pytesseract for the
purpose of text extraction, and then providing the extracted text to the algorithm that
would again predict the output from the model in the similar manner of the simple
textual news.
3.3 Combining and Deploying the Program Over a 24/7

Working Server
Both the programs for simple text and OCR will be combined into a single program.
For the users to interact with the software, a UI is needed. So the UI will be built
using Django with the use of the language HTML. The user interface would be kept
simple so that anyone can use the software without any extra knowledge or training.
The whole software will be deployed on Amazon Web Server EC2 instance, with
the aim that the software is accessible to the public 24/7.
3.4 System Goals
1. Provide a simple user interface.

2. Long-term goal for the software is to help people input a particular news and
check its credibility.
3. We are trying to solve the problem of fake news that is being spread all over the
social media.
3.5 Overall Design
The design of the software was kept very simple so that any user can use the software
without any prior training. First, the whole software was deployed over a Web site.
The Web site has a very simple and appealing design. For taking the input from the
user for the textual news, a simple text box is provided where the news article can
be written or pasted and then on a button click the Web site sends the request to the
server, and the algorithm is run in the background and the output is displayed to the
user on the same page of the Web site itself. The second section contains an option
to upload a news article in the image format. After the image is uploaded a button is
made available, on click of which similar to the previous section the request is sent to
the server, the algorithm runs on the server, and the output is displayed on the same
page to the user (Fig. 1).
The algorithms that gave us the best accuracy and an amazing result were multinomial
Naíve Bayes. Multinomial Naive Bayes is one of the specialized versions of Naive
Bayes family that is designed text documents. Multinomial Naive Bayes explicitly
models the word counts and adjusts the underlying calculations to deal with in. The
Fig. 1 Working of the

system
Web site that we built gives the users an option to upload a news image. In order to
verify the truthfulness of this image as a news, the text has to be extracted from the
image. This is done by using optical character recognization. OCR is implemented
by using Python tesseract to “read” the text off an image. The use of Django has been
made as it is a high-level Python Web framework that allows rapid development of
a secure and maintainable Web site. Django mostly takes care of much of the hassle
of Web development, so its easier for us to focus on the accuracy of the system.
Ultimately the system has been deployed on Amazon Web Services EC2 Server to
give us a Web site that runs 24/7 with minimum downtime and maximum reliability.
4.1 Multinomial Naive Bayes
Multinomial Naive Bayes is used to classify discrete features, for example, word
count for text classification. Multinomial Naive Bayes is designed for text docu-
ments. Multinomial Naive Bayes expressly models the word tallies and modifies the
fundamental estimations to manage it. The probability of the input sentence with the
label is calculated and according to the probability attained the result is formulated.
Practical Example Considering a practical example. The user input’s a news “Thor-
ough hand-washing with an ordinary soap is effective in killing coronavirus (COVID-
19) Soap and water alone, when used as per the WHO handwashing guidelines, are
effective and easy for killing coronavirus” and wants to check whether the news is
“REAL” or “FAKE”.
The following example dataset is used for the training purpose (Table 1):
Feature Engineering In the initial step, we will extricate the highlights. We need
mathematical highlights as contribution for our classifier. So we can consider word
frequencies, for example, tallying the event of each word in the record. Thus, we
need to calculate the probability.
Bayes’ Theorem is helpful for managing restrictive probabilities, since it gives an
approach to us to invert them.
P(B|A) × P(A)
P(A|B) =
P(B)
NewsInput = Thorough hand-washing with an ordinary soap is effective in killing

coronavirus (COVID-19) Soap and water alone, when used as per the WHO hand-
washing guidelines, are effective and easy for killing coronavirus.
1. Simple Probability Approach So, in our case the probabilities we will need to
calculate are
P(Newsinput|REAL) × P(REAL)
P(REAL|Newsinput) =
P(NEWS)
P(Newsinput|FAKE) × P(FAKE)
P(FAKE|Newsinput) =
P(NEWS)
Table 1 Sample dataset

News Classification
US and UK have selected PM Modi to lead a coronavirus task force FAKE
14-hour ‘Janta curfew’ will not break the cycle of infection REAL
WhatsApp puts new limits on forwarding of viral messages REAL
No lockdown after 15th April says Maharashtra CM FAKE
Eating stuff like garlic, turmeric can save you from getting corona FAKE
But, here, the problem is that the NewsInput is not present in the dataset, so the
probability for both would come out to be zero. So, a simple probability approach
cannot be followed.
2. Being Naive In the non-Naive Bayes way, we take a look at sentences in totality,
in this manner once the sentence does not appear in the preparation set, we will get
a zero likelihood, making it hard for additional figurings. While for Naive Bayes,
there is a supposition that each word is autonomous of each other. Presently, we
see singular words in a sentence, rather than the whole sentence.
So, now, we can calculate the probabilities as:
P(Newsinput) = P(Through) × P(hand) × P(washing) × P(with) × P(an) × . . .

×P(easy) × P(for) × P(killing) × P(coronavirus)
3. Calculating Final Probabilities So, now, we have to calculate the probabilities

for P(NewsInput—REAL) & P(NewsInput—FAKE) and comparing both to find
the one with the highest probability. But again a problem occurs, i.e., if a certain
word is not present in the dataset so it is probability again rounds up to zero, again
giving us probability as zero for both REAL & FAKE.
4. Overcoming The Problem Using Laplace Smoothing Laplace smoothing is a
strategy for smoothing clear cut information. A little example revision, or pseudo-
tally, will be consolidated in each likelihood gauge. Subsequently, no likelihood
will be zero. This is a method of regularizing Naive Bayes, and when the pseudo-
tally is zero, it is called Laplace smoothing.
Estimator is calculated as follows:

+α
θ̂i = Nxi+αd (i = 1, ..., d),
α = smoothing parameter
d = number of unique words in dataset
N = number of unique words in particular category
Using Laplace smoothing, it eliminates the problem of 0 probability, and so now

the probabilities of individual words can be found out using the formula and then by
calculating P(NewsInput—REAL) & P(NewsInput—FAKE) and comparing them
and selecting the outcome with the higher probability will give the answer to which
category the news belongs.
After calculating for the NewsInput, we get P(NewsInput—REAL) higher than
P(NewsInput—FAKE), so we can come to the conclusion from this that the News-
Input is REAL.
4.2 Improvising the Bayes Classifier
Using few techniques, we can improvise the Bayes classifier, for getting more accu-
rate, precise, and faster results. The methods proposed in this paper are:
1. Removal of stopwords with NLTK
2. Stemming words with NLTK
3. Tokenize.
Removal Of Stopwords With NLTK Stopwords are the words that are used between
sentences, words like “a, an, the, for”. These words can be ignored by the system
or machine for further analysis of the input given to a particular algorithm. So the
stopwords were first removed from the dataset of the news articles created for further
training purpose.
Stemming words with NLTK Stemming of words means to find out a root word for
set of words just in different tenses but having the same meaning. So the stemming
of the words was done then and stored.
Tokenize The rest of the data after the removal of the stopwords and stemming of
the words was then stored as tokens. These tokens were then used as the final dataset
for the training of the model.
The algorithm was tested on Jupter Notebook v6.0.3 and the dataset used for training
and testing was a self-created dataset named “Train COVID” (Tables 2 and 3).
We were able to obtain a classification accuracy of 76.37% with a maximum
accuracy of 85% (Fig. 2).
6 Advantages
• Naive Bayes algorithm is easy to use.
Table 2 Characteristics of the system

S. No. Parameters Value
1 N-grams range 3
2 Population size 640
3 Terminal set 2 attributes of COVID news
dataset
4 Threads in parallel 3
Table 3 Confusion matrix

Predicted Values
REAL FAKE
True Pos- False

ActualREAL itive Negative
Value 52 9
False Pos- True Neg-

FAKE itive ative
21 45
Sensitivity = 71.23% Specificity = 83.33%
Fig. 2 Receiver operating characteristics (ROC) plot

• The end product would be able to access from any device.

• Easy to use UI.
• No extra training or knowledge required
• Fast result prediction.
• Model training can be done daily and the software would be kept up to date.
7 Disadvantages
• Prediction for news containing quantitative data is not possible.

• The result cannot be 100% accurate as the dataset used to train the model cannot
contain all the news articles around the world.
8 Conclusion
Maximum news that we find over the social media nowadays are fake. According to
a daily research, more than 50% of the news that get’s forwarded on WhatsApp is
fake. Many tech giants like Google, WhatsApp, and Facebook are coming forward
with various ways to stop the spread of the viral fake news.
But as in today’s world, people won’t stop creating such fake news and forwarding
them, the system proposed in this paper comes out as a solution to all these problems.
The system proposed here can help people identify which news is trusted and which
is not very accurately, stopping the whole cycle of forwarding of viral fake news at
a greater extent.
References
1. Bedi, A., Pandey, N., Khatri, S.K.: A framework to identify and secure the issues of fake news
and rumours in social networking. In: 2019 2nd International Conference on Power Energy,
Environment and Intelligent Control (PEEIC), Greater Noida, India, pp. 70–73. https://doi.org/
10.1109/PEEIC47157.2019.8976800
2. Pradhan, M.A., Shinde, A., Dhiman, R., Ghorpade, S., Jawale, S.: Fake news detection methods:
machine learning approach. Int. J. Res. Appl. Sci. Eng. Technol. 8(VII) (IJRASET), 971–975.
ISSN: 2321-9653. https://doi.org/10.22214/ijraset.2020.29630
3. Gilda, S.: Notice of violation of IEEE publication principles: evaluating machine learning
algorithms for fake news detection. In: 2017 IEEE 15th Student Conference on Research
and Development (SCOReD), Putrajaya, 2017, pp. 110–115, https://doi.org/10.1109/SCORED.
2017.8305411
4. Kim, S.-B., Han, K.-S., Rim, H.-C., Hyon Myaeng, S.: Some effective techniques for Naive
Bayes text classification. IEEE Trans. Knowl. Data Eng. 18(11), 1457–1466 (2006). https://doi.
org/10.1109/TKDE.2006.180
5. Conroy, N.J., Rubin, V.L., Chen, Y.: Automatic deception detection: methods for finding fake
news. Proc. Assoc. Inf. Sci. Technol. 52(1), 14 (2015)
6. Tijare, P.: A study on fake news detection using Naíve Bayes. SVM, Neural Networks and LSTM
(2019)
7. Kim, N., Seo, D., Jeong, C.-S.: FAMOUS: fake news detection model based on unified key
sentence information. In: 2018 IEEE 9th International Conference on Software Engineering and
Service Science (ICSESS) (2018)
8. Granik, M., Mesyura, V.: Fake news detection using Naive Bayes classifier. In: 2017 IEEE First
Ukraine Conference on Electrical and Computer Engineering (UKRCON) (2017)
9. Pradhan, M., Bamnote, G.R.: Efficient binary classifier for prediction of diabetes using data
preprocessing and support vector machine. In: Satapathy, S., Biswal, B., Udgata, S., Mandal,
J. (eds) Proceedings of the 3rd International Conference on Frontiers of Intelligent Computing:
Theory and Applications (FICTA) 2014. Advances in Intelligent Systems and Computing, vol
327. Springer, Cham (2015). https://doi.org/10.1007/978-3-319-11933-5_15
Author Index
A Bisht, Shubhangi, 95
Aali Al, Mansoor, 9 Bitra, Surendra Kumar, 25
Abhinith, Bakshi, 505
Abhishek, P. S. R., 259
Adilakshmi, T., 67, 241, 259, 269, 505 C
Ajay, R., 617 Catherine Joy, R., 527
Ali, Mir Zahed, 269 Chalapati Rao, K. V., 373
Anisha, P. R., 673, 683, 693 Chandra Sekhar Reddy, N., 141
Anitha, A., 545 Chandra Sekhar Reddy, P., 193
Anjana Gowri, G., 617 Charles Babu, G., 573
Anuradha, T., 617 Chaudhari, Shilpa Shashikant, 129
Anusha, V., 573 Chordia, Aishwarya, 425
Aparna, R., 129 Chore, Amruta, 765
Apoorva, K., 673
Arya, Rakesh, 383
D
Avanthi, M., 193
Damera, Vijay Kumar, 473
Ayyappa Reddy, K., 605
Dansana, Jayanti, 645
Datta, Suhrid, 395
Dattatreya, V., 373
B
Deepak Varma, V., 495
Balaraju, J., 75
Deshpande, Rashmi, 781
Bal, Jyotisagar, 515
Devaraj, Sujitha Juliet, 527
Bandu, Sasidhar, 487
Devaraju, R., 327
Bansal, Bijender, 107
Dhiman, Rohan, 813
Baranidharan, V., 585
Divya, 107
Barge, Yamini, 461
Dumala, Anveshini, 347
Basheer, Abdul Adil, 415
Dutta, Arijit, 637, 655
Beena Bethel, G. N., 121
Bein, Franklin, 735
Bethu, Srikanth, 573 E
Bharamagoudar, Geeta, 201 Edwin Prem Kumar, G., 15
Bhasgi, Shivani S., 711
Bhaskaran, Subhashini Sailesh, 9
Bhateja, Vikrant, 627 G
Bhattacharyya, Akash, 637 Garg, Ojas, 41
© The Editor(s) (if applicable) and The Author(s), under exclusive license 825
to Springer Nature Singapore Pte Ltd. 2021
https://doi.org/10.1007/978-981-16-1502-3
826 Author Index
Gayathri, M., 395 Lukose, Jibin, 415

Ghorpade, Shreyas, 813 Lydia, M., 15
Ghose, Smaranjit, 395
Giraddi, Shantala, 201
Gondhi, Naveen Kumar, 789 M
Gond, Vitthal J., 799 Madana Mohana, R., 693
Goyal, Deepak Kr., 107 Madan Kumar, C., 605
Gujarathi, Priyanka Vishwas, 747 Madgi, Manohar, 201
Gupta, Roopam, 383 Madhavi Latha, Makkena, 545
Gupta, Shelley, 41, 95 Madhuravani, B., 141
Gupta, Shirin, 95 Madhur, M. S., 201
Malathy, C., 395
Malik, Sandeep, 757
H Manjulatha, B., 337
Halkai, Abhijit, 719 Mayee, Mukta, 425
Mehrotra, Radhika, 41
Mishra, Swagatika, 595
I Misra, Chinmaya, 637, 655
Itkar, Suhasini, 425 Mittal, Harish, 107
Moghe, Asmita A., 383
Moorthy, Priyanka, 353, 495
J Moulieshwaran, B., 585
Jagtap, Sarika M., 799
Jain, Amita, 87
Jain, Minni, 87 N
Jain, Niyati, 107 Nabi, Shaik Abdul, 159
Jalaja, T., 259 Nagaratna, M., 473
Janardana Naidu, G., 253 Nagesh, A., 473
Jawale, Deepali, 757 Naisal, S. A., 663
Jawale, Swapnil, 813 Nakrani, Naitik M., 403
Jeba Priya, S., 285 Naveen Sundar, G., 285
Johri, Archita, 627 Navya, R., 327
Joshi, Maulin M., 403 Nikitha, M., 487
Joshua Jaistein, S., 285 Nukala, Chaitanya, 149
Jyothirmai, J., 555
P
K Pabboju, Shyam Sunder, 241
Kale, Mihir, 425 Pabboju, Suresh, 337
Kanade, Vijay A., 307 Padmaja, S., 487
Kanakala, Srinivas, 31 Pal, Babita, 627
Karthik, V., 585 Pal, Deepika, 627
Kaushik, Baijnath, 789 Panda, Ganapati, 595
Kevin, I. C., 527 Pandey, Manjusha, 451
Kishore, Pinninti, 545 Papasani, Anusha, 347
Kishor Kumar Reddy, C., 673, 683, 693 Patidar, Hemant, 773, 781
Kumar, Anubhav, 219 Patil, G. A., 51
Patil, Sandip Raosaheb, 747
Patra, Sudhangshu Sekhar, 637
L Paul, Varghese, 317, 415
Lakshmi, Boggula, 141 Pavan Kumar, C. S., 617
Lakshmi Prasuna, A. V., 149 Pavan Kumar, N., 353
Lakshmi, Soanpet Sree, 505 Pradhan, Madhavi Ajay, 813
Latheef, Jesmi, 363 Prasada Rao, P. V. R. D., 75
Author Index 827
Prasad, C. V. P. R., 555 Shrivas, Simran, 209

Prashanthi, Vempaty, 31 Shrivastava, Poornima, 383
Praveen Kumar Reddy, A., 495 Shrivastava, Sonika, 209
Preethi Lalithya, G., 617 Shyamala Devi, M., 353, 495
Priyadarshan, Pradosh, 595 Sindhu, S., 1
Priyadarshini, Aishwarya, 227 Singh, Adarsh, 645
Purohit, Lalit, 209, 461 Singh, Archana, 41
Purushotham Reddy, M., 495 Singh, Kamakhya, 655
Puttamadappa, C., 535 Singh, Manoj Kumar, 535
Sireesha, V., 441
Sirisati, Ranga Swamy, 169, 183
R Sree Sandhya, N., 121
Raghava, M., 373, 555 Sridhar, M., 25
Raja Sundrapandiyanleebanon, T., 285 Srinivasa Kumar, C., 183
Rajesh, Sreeja, 415 Srinivasa Rao, P. S. V., 169
Ramadevi, Y., 605 Srinivas, J., 295
Rama Narasimham, K. B. V., 555 Sriram Karthik, M., 1
Rao, Mekala Srinivasa, 169 Sunitha, M., 269
Rath, Adyasha, 595 Sunny Deol, G. J., 295
Ratheesh, T. K., 317 Suresh, Anitha, 535
Rath, Manas Kumar, 515 Swain, Prasanta Kumar, 515
Rautray, Siddharth Swarup, 451 Swathi, P., 353, 495
Ravi, Kumar, 227 Swetha, B., 149
Ravinder Reddy, B., 67
Ravinder Reddy, R., 605
Ravi Teja, P., 617
T
Ravi, Vadlamani, 227
Terdal, Sujatha, 711, 719
Reji Kumar, K., 663, 729
Thangabalaji, V., 585
Roopa, V., 1
Thankachan, Dolly, 765
Roy, Chandrima, 451
Thonukunuri, Srinivasulu, 183
Roy, Ruben, 655
Triveni, B., 545
S
Saha, Soma, 461 V
Sameen Fatima, S., 487, 565 Vaishnavi, N., 1
Sanjay, R., 585 Vankar, Madhura D., 51
Sankara Babu, B., 573 VaraPrasada Rao, P., 295
Santhosh, I., 527 Vardhan, Mettu Krishna, 159
Sarangi, Prateek, 595 Varma Tungala, Ravi, 353
Sarraju, Sridevi, 735 Vasikaran, R., 1
Sashi Kumar, M. S. V., 441 Venkata Subba Reddy, K., 295
Satapathy, Suresh Chandra, 627 Vikkurty, Sireesha, 347
Sateesh Kumar, R., 565 Vinay Kumar, S., 441
Saxena, Divya, 219 Vineetha, S., 363
Seshashayee, M., 253 Vivekanandan, Saranya, 353, 495
Shailaja, Varagiri, 149
Sharma, Gaurav, 87
Sharma, Reya, 789 Y
Shinde, Ankita, 813 Yadav, Preksha, 425
Shinde, Sandhya, 773 Yasmeen, Nuzhat, 683
Shiva Krishna, R. M., 441 Yindumathi, K. M., 129

Smart Computing

Uploaded by

Copyright:

Available Formats

Smart Computing

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Smart Computing

Uploaded by

Copyright:

Available Formats

Smart Innovation, Systems and Technologies 224

Suresh Chandra Satapathy

More information about this series at http://www.springer.com/series/8767

ISSN 2190-3018 ISSN 2190-3026 (electronic)

Sri. M. Krishna Murthy, Secretary, VAE

Dr. S. V. Ramana, Principal, VCE

Dr. Lakhmi Jain, Australia

Dr. Suresh Chandra Satapathy, KIIT DU, Bhubaneswar

Dr. T. Adilakshmi, Professor and HOD, CSE, VCE

Dr. Nagaratna P. Hegde, Professor, CSE, VCE

Dr. S. Ramachandram, Former Vice Chancellor, OU

International Advisory Committee/Technical Program

Dr. Rammohan, South Korea

Dr. Sanjay Sengupta, CSIR, New Delhi

Dr. D. Baswaraj, Professor, CSE, VCE

Dr. M. Shanmukhi, Professor, CSE, VCE

Ms. K. Mamatha, Assistant Professor, CSE, VCE

Mr. S. Vinay Kumar, Assistant Professor, CSE, VCE

Bhubaneswar, India Suresh Chandra Satapathy

SS_01: Next-Generation Data Engineering

Dr. Suresh Limkar, AISSMS Institute of Information Technology, Pune

SS_02: Artificial Intelligence and Machine Learning

Dr. Sowmya V., CEN, Amrita Vishwa Vidyapeetham, Coimbatore

SS_03: Advances in Computational Intelligence and Its

SS_04: Blockchain Technology: Foundations, Challenges,

SS_05: Application of Machine Learning for Intelligent

Dr. Minakhi Rout, KIIT (Deemed to be) University, Bhubaneswar

SS_06: Advances in Big Data Analytics and Business

Dr. Vijay B. Gadicha, G. H. Raisoni Academy of Engineering and Technology,

SS_07: Recent Advances in Artificial

Dr. S. Velliangiri, CMR Institute of Technology, Hyderabad

An Intelligent Tracking Application for Post-pandemic . . . . . . . . . . . . . . . 1

A Scientometric Inspection of Research Based on WordNet Lexical

Opinion Mining-Based Conjoint Analysis of Consumer Brands . . . . . . . . 227

Predicting Customer Loyalty in Banking Sector with Mixed

An Adaptive Correlation Clustering-Based Recommender System

Analysis of Encryption Algorithm for Data Security in Cloud

Design and Development of Electronic System for Predicting

Author Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 825

Suresh Chandra Satapathy is currently working as Professor, KIIT Deemed to

Vikrant Bhateja is Associate Professor, Department of ECE in SRMGPC,

Dr. Margarita N. Favorskaya is Professor and Head of the Department of Infor-

Dr. T. Adilakshmi is currently working as Professor and Head of the Department,

V. Roopa, R. Vasikaran, M. Sriram Karthik, S. Sindhu, and N. Vaishnavi

V. Roopa (B) · R. Vasikaran · M. Sriram Karthik · S. Sindhu · N. Vaishnavi

mainstream medicine, orthodox medicine and Western medicine, medical doctors

Fig. 1 Working of intelligent AI tracking application

4 Result and Discussion

As coronavirus is a contagious disease that spreads through social interaction between

Fig. 2 Implementation of tracker on smart devices—cluster analysis

Subhashini Sailesh Bhaskaran and Mansoor Al Aali

Abstract This investigation reports about an understanding of the connection

1.1 Language Expertise and Scholastic Accomplishment

S. S. Bhaskaran (B) · M. Al Aali

2 Data Mining Process

Student dataset of a higher education offering different degrees at the undergraduate

6 Discussion and Conclusion

G. Edwin Prem Kumar and M. Lydia

G. Edwin Prem Kumar (B) · M. Lydia

climatic conditions required for desired agricultural performance in terms of yield,