Artigo 3

RESEARCH ARTICLE
Nested PCR and the TaqMan SNP Genotyping

Assay enhanced the sensitivity of drug
resistance testing of Mycobacterium leprae
using clinical specimens of leprosy patients
Xiaohua Chen1,2*, Jun He3, Jian Liu1,2, Yuangang You1,2, Lianchao Yuan1,2, Yan Wen ID1,2*
1 Beijing Tropical Medicine Research Institute, Beijing Friendship Hospital, Capital Medical University,
Beijing, China, 2 Beijing Key Laboratory for Research on Prevention and Treatment of Tropical Diseases,
Capital Medical University, Beijing, China, 3 The Center for Disease Control and Prevention of Yunnan
Province, Kunming, China
a1111111111
a1111111111 * hannahchen2003@163.com (XC); weny8@163.com (YW)
a1111111111
a1111111111
a1111111111 Abstract
Background
OPEN ACCESS Although leprosy is efficiently treated by multidrug therapy, resistance to first-line (dapsone,
Citation: Chen X, He J, Liu J, You Y, Yuan L, Wen rifampin) and second-line (fluoroquinolones) drugs has been described worldwide. How-
Y (2019) Nested PCR and the TaqMan SNP ever, the characteristics of drug resistance in Southwest China remain unknown. Further-
Genotyping Assay enhanced the sensitivity of drug more, the sensitivity of polymerase chain reaction (PCR)/sequencing for resistance
resistance testing of Mycobacterium leprae using
clinical specimens of leprosy patients. PLoS Negl
detection is limited, especially for paucibacillary (PB) leprosy patients. The current study
Trop Dis 13(12): e0007946. https://doi.org/ aimed to develop a nested PCR/sequencing and TaqMan SNP Genotyping Assay to
10.1371/journal.pntd.0007946 increase the sensitivity of the method used to detect drug resistance in Mycobacterium
Editor: Ruifu Yang, Beijing Institute of Microbiology leprae and to reveal the nature of M. leprae drug resistance in Southwest China.
and Epidemiology, CHINA
Received: May 22, 2019 Methodology/Principal findings

Accepted: November 23, 2019 Seventy-six specimens, including skin biopsy (n = 64), formalin-fixed paraffin-embedded
Published: December 27, 2019 (FFPE) (n = 11) and skin-slit smear (SSS) (n = 1) samples from multibacillary (MB, n = 70)
Copyright: © 2019 Chen et al. This is an open and PB (n = 6) leprosy patients from Southwest China, were included in this study. The pres-
access article distributed under the terms of the ence of mutations in drug resistance-determining regions (DRDRs) of the rpoB, folP1, and
Creative Commons Attribution License, which gyrA genes, which are associated with rifampicin, dapsone, and quinolone resistance,
permits unrestricted use, distribution, and
respectively, was detected by PCR/sequencing, as recommended by the WHO, and the
reproduction in any medium, provided the original
author and source are credited. nested PCR and TaqMan SNP Genotyping Assay developed in this study. Mutations in the
folP gene were detected in 19 (25.00%) samples, indicating dapsone-resistant M. leprae,
Data Availability Statement: All relevant data are
within the manuscript and its Supporting with one (1.31%) sample showing mutations in two genes, folP and gyrA, reflecting multi-
Information files. drug-resistant strains to dapsone and ofloxacin. However, no rpoB mutation was detected.
Funding: The authors received no specific funding Compared with PCR/sequencing, nested PCR increased the sensitivity of detecting rpoB
for this work. (from 51.39% to 78.94% for leprosy patients and from 0.00% to 50.00% for PB), gyrA (from
Competing interests: The authors have declared 75.00% to 80.26% for leprosy patients and from 50.00% to 66.67% for PB), and folP1 (from
that no competing interests exist. 5.26% to 84.21% for leprosy patients and from 0.00% to 66.67% for PB). Moreover, the
PLOS Neglected Tropical Diseases | https://doi.org/10.1371/journal.pntd.0007946 December 27, 2019 1 / 17

TaqMan for drug resistance of M.leprae
TaqMan SNP Genotyping Assay showed greater sensitivity for folP1 detection (from 5.26%
to 78.94–86.84% for leprosy patients and from 0.00% to 33.33%-83.33% for PB patients)
than the PCR/sequencing method. In addition, the latter method was able to more easily dis-
tinguish heterozygous genotypes and mutant homozygous genotypes from homozygous
genotypes.
Conclusions/Significance
Nested PCR/sequencing and the TaqMan SNP Genotyping Assay are rapid and highly sen-
sitive methods for detecting drug resistance in leprosy cases. The current study revealed
that diamino-diphenylsulfone (DDS; also known as dapsone) resistance in M. leprae, as
indicated by folP1 gene detection, is still the most concerning form of drug resistance in lep-
rosy patients from Southwest China.
Author summary
Despite being a curable disease, leprosy remains a public health problem in more than 100
countries, where over 200,000 new leprosy cases are reported each year. The incidence
rate has remained steady since 2005, indicating continued active transmission of the dis-
ease. Since the 1940s, the strategy for leprosy control has involved diamino-diphenylsul-
fone (DDS) monotherapy and then multidrug therapy (MDT), as recommended by the
World Health Organization in 1982. After 30 years of DDS monotherapy, drug resistance
has been described worldwide, and after 30 years of MDT, drug resistance has unsurpris-
ingly been observed. However, the nature of drug resistance in Southwest China is still
unknown. As the sensitivity of the PCR/sequencing method is limited, especially among
paucibacillary (PB) patients, we developed a nested PCR/sequencing and TaqMan SNP
Genotyping Assay that dramatically increased the sensitivity of detecting drug resistance
among drug resistance-determining regions (DRDRs). According to results, the folP1
mutant is predominant, but rpoB mutants were not found. The results of this study indi-
cate the preliminary characteristics of drug resistance in the DRDRs of leprosy patients
from Southwest China.
Introduction
Leprosy is a chronic human disease caused by the yet-uncultured pathogen Mycobacterium
leprae [1]. Although curable with multidrug therapy (MDT), leprosy remains a public health
problem in South America, Africa, South and Southeast Asia, and Micronesia, where over
200,000 new leprosy cases are reported each year [1]. The incidence rate has remained
steady since 2005 [2], and global statistics of childhood cases show that transmission of lep-
rosy continues to some extent in more than 100 countries [3]. Therefore, surveillance
is needed to ensure that chemotherapy of leprosy remains effective for the foreseeable
future [4].
M. leprae is susceptible to a wide range of antibiotics; diamino-diphenylsulfone (DDS; also
known as dapsone) monotherapy was used to treat leprosy from 1940 to 1981, and multidrug
therapy (MDT) was then implemented worldwide based on recommendations by the WHO
(1982–2000). The components of MDT, comprising rifampicin, dapsone, and clofazimine,

and several second-line drugs, ofloxacin, minocycline, and clarithromycin, are sometimes
employed as therapeutic agents [1]. Resistance to antileprosy drugs in M. leprae has been
observed in several leprosy-endemic regions by the Global Sentinel Surveillance for Drug
Resistance in Leprosy program coordinated by the WHO [5]. The emergence of drug-resistant
(DR) and multidrug-resistant (MDR) M. leprae has also been increasingly reported in other
areas [2, 6–12].
The presence of mutations in drug resistance-determining regions (DRDRs) of the rpoB,
folP1, and gyrA genes is associated with rifampicin, dapsone, and quinolone resistance, respec-
tively. Testing methods include M. leprae DRDR primers and a polymerase chain reaction
(PCR) sequencing method recommended by the WHO [13], GenoType LepraeDR [14], and
qPCR-high-resolution melt analysis [15], among others. However, the use of nested PCR and
the TaqMan SNP Genotyping Assay for this type of testing has not been reported. Nested PCR
is necessary for studies on certain human tissue microbiota because it can amplify the target
DNA with concentrations several-fold lower than those of standard PCR [16]. As new SNP
mutations associated with antibiotic resistance have been detected by M. leprae whole-genome
sequencing [1], the TaqMan SNP Genotyping Assay is a potential molecular method for
detecting drug resistance in M. leprae.
Leprosy is still endemic in 61 counties in the Yunnan, Sichuan, and Guizhou Provinces of
China (prevalence � 1/100,000). Indeed, more than half of the country’s new cases (336/634)
in 2017 were detected in these three provinces, making it the area with the highest leprosy bur-
den in China. In the present study, skin biopsy, formalin-fixed, paraffin-embedded (FFPE),
and skin-slit smear (SSS) samples of new and relapsed cases from multibacillary (MB) and
paucibacillary (PB) patients with leprosy were used. Our aim was to develop an easily accessed
and highly sensitive nested polymerase chain reaction (nested PCR) and Custom TaqMan
SNP Genotyping Assay that easily detects drug resistance in leprosy.
Methods
Ethics statement
This study was approved by the Medical Ethics Committee of Beijing Friendship Hospital,
Capital Medical University, Beijing, P. R. China. Written informed consent was obtained from
all study participants or from their parents or guardians. All of the procedures in the study,
including biological sample collection and testing involving human participants, were per-
formed in accordance with the ethical standards of the institutional and/or national research
committee and with the 1964 Helsinki Declaration and its later amendments or comparable
ethical standards.
Human specimens
This molecular epidemiology study was performed with Chinese patients with leprosy from
2003 to 2011. Seventy-six patients were included, mainly from Yunnan Province, including
the Center for Disease Control and Prevention (CDC) of Wenshan Zhuang and Miao Autono-
mous Prefecture (WS), Honghe Hani and Yi Autonomous Prefecture (HH), and Kunming
(KM) (the capital of Yunnan) and Guizhou, Sichuan, Hunan, and Shandong Provinces; Tian-
jin; and Tibet. In this study, all patients diagnosed with leprosy by clinicians using defined cri-
teria, SSSs and biopsies were appropriately treated with DDS and/or MDT according to WHO
guidelines. Seventy-six clinical specimens were obtained from the patients with leprosy for
routine diagnosis of leprosy in China. These specimens were divided into two groups accord-
ing to disease status: new cases (n = 50) and relapsed cases (n = 26). The specimens were
divided by type into skin biopsy (n = 37), FFPE (n = 38) and SSS (n = 1) groups. The specimens

were also divided based on the bacterial index (BI) value into high BI (BI�2; n = 57) and low
BI (BI<2; n = 16) groups. BI information was not available for three patients.
DNA extraction and quality control

Genomic DNA was extracted from FFPE and skin biopsy specimens using the Qiagen
DNeasy™ Blood and Tissue Kit (Qiagen, Beijing, China) according to the manufacturer’s
instructions. Briefly, paraffin was removed from the FFPE specimens by vortexing and 10 min
of incubation with 1.2 mL xylene, followed by two washes with pure (200 proof) ethanol. The
FFPE and skin biopsy specimens were then incubated with 20 μL proteinase K and 180 μL
ATL lysis buffer overnight in a heat block at 56˚C. The lysed emulsion was further purified
with DNeasy Spin-Column Kit. The DNA was eluted in 100 μl of AE elution buffer provided
in the kit; 1 to 2 μl of DNA was typically sufficient for one PCR.
For DNA yield, the total amount of DNA for clinical samples was assessed using
spectrophotometry (Malcom e-spect, Tokyo, Japan) and a Qubit 4.0 fluorometer with Qubit
dsDNA HS Assay Kit (Life Technologies, Massachusetts, Waltham, USA) according to the
manufacturer’s protocols. The total amount of DNA was obtained in ng/μl.
Simple PCR, nested PCR, and sequencing

The primers used for simple PCR were recommended by the WHO (see Table 1). The 20-μl
reaction mixture contained 1 μl of primer mix (250 nM of each primer for folP1, rpoB, and
gyrA), 10 μl of 2X PCR Mixture (Cat No: MFKIT02 for folP1, MFKIT03 for rpoB, and
MFKIT04 for gyrA, Beijing Jinsheng Lida Technology Trade Co., Ltd., Beijing, China), and
2–50 ng of DNA template (1 μl). Reactions were carried out using a Peltier thermal cycler
(BIO-RAD, California, USA), and the thermal cycling conditions were as follows: 2 min at
95 ˚C, followed by 35 cycles of 15 sec at 95 ˚C, 15 sec at 58 ˚C and 60 sec at 72 ˚C, and a final
extension step of 7 min at 72 ˚C.
The simple PCR primers recommended by the WHO were used as the inner primers for
the nested PCR, and the outer primers of the nested PCR primer were designed using Primer
Express 5.0 (Table 1). The first round of nested PCR was performed as following. The 20-μl
Table 1. Primers for simple PCR/sequencing and nested PCR/sequencing for drug susceptibility testing in M. leprae used in this study.
Target gene Primers Nucleotide sequences (5’-3’) Product length PCR type
folP1 Forward 5’-CTGACAATTCGTTCTCAGATGG-3’ 394 bp� Nested PCR (outer)
Reverse 5’-TAATTCGGAGCCTCATA-3’
Forward 5’-CTTGATCCTGACGATGCT G-3’ 255 bp Simple PCR/Nested PCR (inner)
Reverse 5’-CCCACCAGATCGTTGACG-3’ /Sequencing
rpoB Forward 5’-GTCGGTATGTCGCGGATGGA-3’ 581 bp Nested PCR (outer)
Reverse 5’-CGTGGCGAGACATCCATGTAAT-3’
Forward 5’-GTCGGTATGTCGCGGATGGA-3’ 279 bp Simple PCR/Nested PCR (inner)
Reverse 5’-CGACAATGAACCGATCAGACC-3’ /Sequencing
gyrA Forward 5’-TATACAGCGGGTTGAGCGG-3’ 358 bp Nested PCR (outer)
Reverse 5’-GATGGTCTCAAACCGGTACATC-3’
Forward 5’-ACAATAACGCATCGCTGCCG-3’ 225 bp Simple PCR/Nested PCR (inner)
Reverse 5’-ACCCGGCGAACCGAAATT G-3’ /Sequencing
�
Bp = base pair; PCR = polymerase chain reaction; nested PCR = single-tube nested PCR.
Simple PCR/STNPCR (inner) primers of folP1, rpoB, and gyrA recommended by the WHO;
STNPCR (outer) primers designed by authors through Primer Express 5.0.
https://doi.org/10.1371/journal.pntd.0007946.t001

reaction mixture for nested PCR contained 10 μl of 2× PCR Mixture, 1 μl of outer primer mix
(250 nM), Cat No: MFKIT02 for folP1, MFKIT03 for rpoB, and MFKIT04 for gyrA (Beijing
Jinsheng Lida Technology Trade Co., Ltd., Beijing, China) and 2–50 ng of DNA template (1
μl). The thermal cycling conditions were as follows: 7 min at 94 ˚C, followed by 40 cycles of 30
sec at 94 ˚C, 30 sec at 58 ˚C and 60 sec at 72 ˚C, and a final extension step of 7 min at 72 ˚C.
Products were visualized on a 1.5% agarose gel containing GeneFinder (Zeesan Biotech, Xia-
men, Fujian, China). The second round of nested PCR was performed as the procedure of sim-
ple PCR.
The nucleotide sequences of both strands of the relevant segment of the folP1, rpoB, and
gyrA genes were determined by direct sequencing of the PCR product using an ABI 3730
Automated DNA Sequencer (Sangon Biotech Co., Ltd). The primers used for sequencing are
listed in Table 1. Sequence data were analyzed using the nucleotide database in Basic Local
Alignment Search Tool (BLAST) (http://blast.ncbi.nlm.nih.gov) to identify mutations associ-
ated with drug resistance.
TaqMan SNP genotyping

Genotyping of folP1 drug resistance loci ACC53GCC, CCC55CTC, CCC55CGC, and
ACC53ATC was performed using TaqMan SNP Genotyping Master Mix (Applied Biosystems,
Foster City, CA, USA) and the ABI 7500 fast real-time polymerase chain reaction (PCR) sys-
tem (Applied Biosystems). The final reaction volume for PCR was 10 μl, which contained 1 μl
of 10 ng/μl genomic DNA or 1st PCR products, 5 μl of TaqMan Universal PCR Master Mix,
0.25 μl of 200 nM VIC/FAM-labeled probe, and 3.75 μl double-distilled water. The probes
were designed by Beacon Designer 8.00, synthesized as Custom TaqMan SNP Genotyping
Assays, Nonhuman (Applied Biosystems). The probe sequences are indicated in Table 2. PCR
amplification was carried out in 96-well plates containing unknown genotype samples, wild-
type samples (e.g., 55CCC), heterozygous samples (e.g., 55CCC/CGC), and homozygous sam-
ples (e.g., 55CGC) as positive controls and no-template controls. Thermal cycle conditions
were as follows: 1 cycle of 60 ˚C for 1 min, 95 ˚C for 10 min, 40 cycles of 95 ˚C for 15 sec and
Table 2. Primers and probes of Custom TaqMan SNP genotyping assays for the folP1 loci for drug susceptibility testing in M. leprae.
folP1 ACC53GCC Forward Primer GGCGCGGCGATTGTC
Reverse Primer ACTCGAGGATCGGTCCTAATGG
Probe 1 Wild type [VIC] CCGGGTCGATTCG
Probe 2 Mutant [FAM] CGGGCCGATTCG
folP1 CCC55CTC Forward Primer CGTCGGTGGCGAATCGA
Reverse Primer TCAACTCGAGGATCGGTCCTAA
Probe 1 Wild type [VIC] TGGCACCGGGCCGG
Probe 2 Mutant [FAM] TGGCACCGAGCCGG
folP1 CCC55CGC Forward Primer ACGTCGGTGGCGAATCG
Reverse Primer CAACTCGAGGATCGGTCCTAATG
Probe 1 Wild type [VIC] ACCCGGCCCGGTGC
Probe 2 Mutant [FAM] CCGGCGCGGTGC
folP1 ACC53ATC Forward Primer GGCGCGGCGATTGTC
Reverse Primer ACTCGAGGATCGGTCCTAATGG
Probe 1 Wild type [VIC] CGAATCGACCCGGCCC
Probe 2 Mutant [FAM] CGAATCGATCCGGCCC
bp = base pair; PCR = polymerase chain reaction; STNPCR = single-tube nested PCR.

60 ˚C for 1 min, and 1 cycle of 60 ˚C for 1 min. Reactions were analyzed using Allelic Discrim-
ination Sequence Detection Software from Applied Biosystems.
Statistical analysis
The DNA concentration from different sample types was compared using GraphPad Prism
software version 5.0 (GraphPad Software Inc., San Diego, CA, USA). Following Tukey’s honest
significant difference (HSD) test was used for analysis of the average DNA quantification val-
ues obtained from skin biopsy or FFPE samples by spectrophotometry and Qubit dsDNA HS
Assay. Comparisons of the three molecular assays for drug resistance were performed by Sta-
tistical Package for the Social Sciences (SPSS) version 16.0. Concordance between the results
was determined by kappa values (κ), and p values were calculated. Significant differences
between assays were determined by McNemar’s test, and p values were calculated.
Results
Basic characteristics of leprosy patients
Seventy-six leprosy cases from different regions were included. The basic information for each
study group is summarized in Table 3.
Comparison of DNA yield between skin biopsy and FFPE samples

The DNA concentrations from different sample types were compared by spectrophotometry
and Qubit dsDNA HS Assay. FFPE samples generated a slightly higher DNA yield than did
skin biopsy samples, but this difference was not significant (Fig 1, S2 Table). The DNA concen-
tration of skin biopsy samples measured by the Qubit dsDNA HS Assay method (aver-
age = 53.01 ng/μl, SD = 46.53) was slightly lower than that obtained by spectrophotometry
(average = 65.24 ng/μl, SD = 55.42). In contrast, the DNA concentration of FFPE samples mea-
sured by the Qubit dsDNA HS Assay method (average = 107.9 ng/μl, SD = 72.99) was consid-
erably lower than that obtained by spectrophotometry (average = 58.73 ng/μl, SD = 42.54)
(Fig 1, S2 Table).
Analytical specificity of simple PCR, nested PCR and TaqMan methods

The specificity of the primers/probes was tested by carrying out amplification with purified
genomic DNA from fifteen different mycobacterial species and four nonmycobacterial species.
Regarding the gyrA and folP1 genes, all primer/probe sets produced amplicons when DNA
isolated from M. lepraemurium was used as the template, but no amplicons were observed
when DNA from other species of Mycobacterium or nonmycobacterial species was used (see
Table 4). For rpoB, M. bovis BCG-Pasteur, M. bovis [AFZ/ZZ/97], M. bovis [Ravenel], M. kan-
sasii, and M. ulcerans amplicons were present, as verified by BLAST (https://blast.ncbi.nlm.
nih.gov/Blast.cgi), and the sequencing results were consistent with Mycobacterium species
detected.
Performance of drug resistance testing of clinical samples

PCR to amplify folP1, gyrA and rpoB DRDRs was performed on all samples. PCR amplicons
corresponding to DRDRs in the folP1, gyrA and rpoB genes were investigated by direct
sequencing of the PCR amplicons obtained using a modification of the WHO guidelines for
the Global Surveillance of Drug Resistance in Leprosy [13]. Positive PCR results and informa-
tive sequences were obtained for folP1 in 15/76 (19.73%) and 3/76 (5.26%) cases, for rpoB in

Table 3. Clinical characteristics of the leprosy patients enrolled in this study.

Variables Cases (%)
WHO MB� 70 (92.10%)
Classification PB� 6 (7.89%)
Ridley-Jopling LL�� 26 (34.21%)
Classification BL ��
34 (44.73%)
BB�� 4 (5.26%)
BT�� 9 (11.84%)
TT�� 3 (3.95%)
Sex Female 17 (22.37%)
Male 59 (77.63%)
Age (years) �20 7 (9.21%)
21–39 30 (39.47%)
40–59 28 (36.84%)
�60 11 (14.47%)
Province Yunnan 54 (71.05%)
Guizhou 7 (9.21%)
Sichuan 5 (6.57%)
Hunan 4 (5.26%)
Hubei 1 (1.32%)
Fujian 1 (1.32%)
Shandong 1 (1.32%)
Tianjin 1 (1.32%)
Jiangsu 1 (1.32%)
Tibet 1 (1.32%)
Disease Status New 50 (65.79%)
Relapsed 26 (34.21%)
Specimen Type Skin biopsy 37 (48.68%)
FFPE 38 (50.00%)
SSS 1 (1.32%)
BI �2 58 (76.32%)
<2 18 (23.68%)
�
MB: multibacillary, PB: paucibacillary.
��
TT: tuberculoid tuberculoid, BT: borderline tuberculoid, BB: mid-borderline, BL: borderline lepromatous, LL:
lepromatous lepromatous
44/76 (57.89%) and 39/76 (51.35%) cases and for gyrA in 61/76 (80.26%) and 57/76 (75.00%)
cases, respectively.
Due to initial PCR inhibition, we developed a nested PCR of DRDRs for the three genes.
The positive ratio of nested PCR and sequences increased to 66/76 (86.84%) and 64/76
(84.21%) for folP1, 63/76 (82.89%) and 60/76 (78.94%) for rpoB, and 65/76 (85.52%) and 61/
76 (80.26%) for gyrA. We developed a TaqMan SNP assay for the four DRDR loci in the
folP1 gene. Because the amplification efficiency of genomic DNA was too low to perform the
TaqMan SNP assay, we used the first cycle of the PCR product of nested PCR as the template.
The rate for the TaqMan SNP Assay positivity of the folP1 gene was 60/76 (78.94%) for
CCC55CTC, CCC55CGC, and ACC53ATC loci and 66/76 (86.84%) for the ACC53GCC locus
(Table 5).

Fig 1. DNA concentrations (ng/μl) resulting from M. leprae clinic specimens.

https://doi.org/10.1371/journal.pntd.0007946.g001
Table 4. Specificity of nested PCR, and TaqMan SNP genotyping assay for drug resistance testing of Mycobacterium leprae.
Species rpoB gyrA folP1
Simple PCR Nested PCR Simple PCR Nested PCR Simple PCR Nested PCR TaqMan SNP Genotyping
Mycobacterial species from CSU� and NHDP��
M. lepraemurium# + + + + + + +
M. avium - - - - - - -
M. bovis BCG-Pasteur# - + - - - - -
M. bovis [AFZ/ZZ/97]# - + - - - - -
M. bovis [Ravenel]# - + - - - - -
M. flavescens - - - - - - -
M. intracellulare - - - - - - -
M. kansasii - + - - - - -
M. marinum - - - - - - -
M. phlei - - - - - - -
M. smegmatis - - - - - - -
M. simiae - - - - - - -
M. ulcerans - + - - - - -
Nonmycobacterial species from NHDP��
Streptococcus pyogenes - - - - - - -
Clostridium perfringens - - - - - - -
Escherichia coli - - - - - - -
Staphylococcus epidermidis - - - - - - -
�
CSU = Colorado State University, Fort Collins, Colorado
��
NHDP = National Hansen’s Disease Program
#
: The results of PCR/sequencing and nested PCR/sequencing were consistent with the Mycobacterium species detected.

Table 5. Results of DNA sequencing and TaqMan SNP genotyping in the folP1, rpoB and gyrA genes of Mycobacterium leprae in DRDRs.
Specimens RpoB, n (%) GyrA, n (%) folP1, n (%) folP1, TaqMan�� , n (%)
�
Type n PCR Seq nested Seq PCR Seq nested Seq PCR Seq nested Seq CCC55 CCC55 ACC53 ACC53
PCR PCR PCR CTC CGC ATC GCC
Total 76 44 39 63 60 61 57 65 61 15 4 66 64 60 60 60 66
57.89% 51.35% 82.89% 78.94% 80.26% 75.00% 85.52% 80.26% 19.73% 5.26% 86.84% 84.21% 78.94% 78.94% 78.94% 86.84%
New 48 27 24 40 39 35 33 38 36 10 1 40 39 36 37 39 41
56.25% 50.00% 83.33% 81.25% 72.91% 68.75% 79.16% 75.00% 20.83% 2.08% 83.33% 81.25% 75.00% 77.08% 81.25% 85.41%
Relapsed 28 17 15 24 21 26 24 26 25 5 3 24 23 24 23 21 25
60.71% 53.57% 85.71% 75.00% 92.85% 85.71% 92.85% 89.28% 17.85% 10.71% 85.71% 82.14% 85.71% 82.14% 75.00% 89.28%
Biopsy 64 35 32 54 51 50 48 53 51 12 4 56 55 51 50 52 56
54.68% 50.00% 84.37% 79.68% 78.12% 75.00% 82.81% 79.68% 18.75% 6% 87.50% 85.93% 79.68% 78.12% 81.25% 87.50%
FFPE 11 8 6 8 8 10 8 11 9 3 0 9 9 8 9 7 9
72.72% 54.54% 72.72% 72.72% 90.90% 72.72% 100.00% 81.81% 27.27% 0.00% 81.81% 81.81% 72.72% 81.81% 63.63% 81.81%
SSS 1 1 1 1 1 1 1 1 1 0 0 1 1 1 1 1 1
100% 100% 100% 100% 100% 100% 100% 100% 0% 0% 100% 100% 100% 100% 100% 100%
BI (�2) 58 37 34 48 47 47 44 48 47 15 4 51 49 47 48 46 51
63.79% 58.62% 66.74% 81.03% 81.03% 75.86% 82.75% 81.03% 25.86% 6.89% 87.93% 84.48% 81.03% 87.25% 79.31% 87.93%
BI (<2) 18 6 5 9 13 14 13 16 15 0 0 15 15 13 12 14 15
33.33% 27.78% 50.00% 72.22% 77.78% 72.22% 88.89% 83.33% 0.00% 0.00% 83.33% 83.33% 72.22% 66.67% 77.78% 83.33%
MB 70 44 39 60 57 57 54 61 57 15 4 62 60 55 58 56 62
62.85% 51.42% 85.71% 81.42% 81.42% 77.14% 87.14% 81.42% 21.42% 5.71% 88.57% 85.71% 78.57% 82.85% 80.00% 88.57%
PB 6 0 0 3 3 4 3 4 4 0 0 4 4 5 2 4 4
0.00% 0.00% 50.00% 50.00% 66.67% 50.00% 66.67% 66.67% 0.00% 0.00% 66.67% 66.67% 83.33% 33.33% 66.67% 66.67%
�
Seq: sequencing;
��
TaqMan: TaqMan SNP genotyping.
Comparison of the three molecular assays for drug resistance based on

kappa and McNemar’s tests
The kappa test was used to analyze the concordance of the results collected from the three
molecular assays. Concordance was observed between PCR/sequencing and nested PCR/
sequencing of rpoB and gyrA and between nested PCR/sequencing and TaqMan SNP Assay of
folP1 (ACC53GCC), with index values of 0.439, 0.849 and 0.257, respectively (p values of
0.000, 0.000, and 0.024, respectively) (Table 6). This finding indicates that the two tests showed
high consistency for the detection of drug resistance in leprosy patients.
McNemar’s test showed that the sensitivity of nested PCR/sequencing of rpoB and folP1
was significantly positively correlated with the results of PCR/sequencing of rpoB and folP1
(p < 0.05). McNemar’s test also showed that the sensitivity of the TaqMan SNP assay was sig-
nificantly positively correlated with the PCR/sequencing results, suggesting that the nested
PCR/seq and TaqMan SNP assays were helpful for detecting drug resistance in M. leprae
(Table 6).
In addition, we compared the results regarding mutations in specimens detected by the
TaqMan SNP Assay and by nested PCR/sequencing, and the two results were identical.
Characteristics of patients with mutated strains

Data on the mutations observed in the folP1, gyrA, and rpoB genes are summarized in Table 7.
Mutations were found in folP1 and gyrA in nineteen patients.

Table 6. Comparison of the results of three molecular assays of drug resistance using clinical samples of leprosy patients.
Methods Gene (loci) Kappa test McNemar’s test
value P P
PCR/Seq vs nested PCR/Seq rpoB 0.439 0.000� 0.000�
gyrA 0.849 0.000� 0.125
folP1 0.021 0.374 0.000�
PCR/Seq vs TaqMan SNP Assay folP1 (ACC53GCC) 0.029 0.289 0.000�
folP1 (ACC53ATC) 0.029 0.289 0.000�
folP1 (CCC55CGC) 0.029 0.289 0.000�
folP1 (CCC55CGC) 0.021 0.374 0.000�
�
Nested PCR/Seq vs folP1 (ACC53GCC) 0.257 0.024 0.791
TaqMan SNP Assay folP1 (ACC53ATC) 0.128 0.205 0.503
folP1 (CCC55CGC) 0.041 0.715 0.523
folP1 (CCC55CTC) -0.049 0.667 0.541
�
p<0.05, significant difference.
Regarding the detection of dapsone resistance, nineteen isolates showed mutations in the
folP1 gene, and these mutations were classified into five patterns. Four isolates showed an A to
G mutation resulting in a Thr to Ala at amino acid 53 (ACC-GCC). The ratio of mutant homo-
zygous to mutant heterozygous genotypes was 2 to 2. One isolate showed a C to T mutation
resulting in a Thr to Ile at amino acid 53 (ACC-ATC) without a mutant heterozygous geno-
type. One isolate showed a C to T mutation resulting in a Thr to Ile at amino acid 53 (ACC-A
[C/T][C/T]) with a mutant heterozygous genotype. Seven isolates showed a C to G mutation
Table 7. folP, gyrA, and rpoB gene mutations related to drug resistance in isolates from leprosy patients in China.
Case Mutation (position) of folP1 gyrA
no. Age Sex Province Treatment Status ACC53GCC ACC53ATC CGG54GGG CCC55CGC CCC55CTC
f1-3 69 M Hunan MDT New CCC55CTC
f1-4 55 M Hunan MDT New CCC55CTC
F1-5 31 F Yunnan MDT New CCC55CTC
f1-6 22 F Yunnan MDT New ACC53GCC
f1-7 60 M Yunnan MDT Relapsed CCC55CTC
f1-8 32 F Yunnan MDT New ACC53[G/A]CC CCC55C[T/C]C
f1-9 55 M Yunnan MDT New CCC55C[G/C]C
f1-10 32 M Yunnan MDT New CCC55C[T/C]C
F1-12 45 M Yunnan MDT New CCC55CTC
f1-21 40 M Yunnan DDS/MDT Relapsed ACC53GCC
f-1-2 33 M Jiangsu MDT Relapsed ACC53GCC
f-1-10 50 M Yunnan MDT New CCC55CGC
f-1-21 50 M Sichuan DDS/MDT Relapsed CCC55CGC
f-1-22 43 M Sichuan MDT New CCC55C[G/C]C
F-1-24 68 M Sichuan MDT Relapsed CCC55CTC
f-1-26 32 M Yunnan MDT New CCC55CGC GCA91GTA
f = 1–1 38 F Yunnan MDT Relapsed CCC55C[G/C]C
f = 1–9 34 M Yunnan MDT Relapsed ACC53A CGG54 CCC55C[G/C]C
[C/T][C/T] [C/G]GG
f = 1–27 37 M Yunnan MDT New ACC53ATC

resulting in a Thr to Ile at amino acid 55 (CCC-CGC). The ratio of mutant homozygous to
mutant heterozygous genotypes was 4 to 3. Eight isolates showed a C to T mutation resulting
in a Thr to Ile at amino acid 55 (CCC-CTC). The ratio of mutant homozygous to mutant het-
erozygous genotypes was 6 to 2. In addition, we found a C to G mutation resulting in a Arg to
Gly at amino acid 54 (CGG-[C/G]GG), which was reported previously by Nakata et al. [17]
(Table 7). The chromatogram for the drug susceptibility and resistance loci in the folP1 gene
of M. leprae detected by Sanger sequencing is shown in Fig 2. The drug susceptibility and resis-
tance loci in the folP1 gene of M. leprae detected by the Custom TaqMan SNP assay are shown
in Figs 3 and 4.
Regarding ofloxacin resistance, one isolate showed mutations in the GyrA gene of M.
leprae. The isolates showed a C to T mutation resulting in a Ala to Val at amino acid 91
(GCA-GTA) (Table 7).
No isolates showed mutations in M. leprae rpoB gene DRDRs. One isolate exhibited multi-
drug resistance and carried mutations in the folP1 and gyrA genes, resulting in resistance to
dapsone and ofloxacin.
The mutation ratio of new and relapsed leprosy patients is shown in Table 7. The rates of
mutations detected in folP1, gyrA, folP1/gyrA and rpoB were 25.00% (19/76), 1.31% (1/76),
1.31% (1/76), and 0.00% (0/76), respectively.
The drug resistance mutations of M. leprae in new and relapsed patients with leprosy are
shown in Table 8.
Discussion
In this study, we investigated drug-resistance mutations in new and relapsed cases of leprosy
in Southwest China and developed two molecular biological methods, involving nested PCR/
sequencing and the TaqMan SNP Genotyping Assay, for MB and PB leprosy patients.
Regarding specificity, this study assessed whether the simple PCR/sequencing, nested
PCR/sequencing and TaqMan SNP genotyping methods involved in the testing of M. leprae
drug resistance are capable of detecting other Mycobacterium species or nonmycobacterial
species. The Mycobacterium species expressing the rpoB, gyrA, and folP1 genes retrieved by
NCBI/gene are shown in S2 Table. In this study, no cross-detection was found for any prim-
ers/probes used for gyrA or for folP1. Positive rpoB amplicons can be distinguished as the
appropriate Mycobacterium species using NCBI/BLAST. As the rpoB gene is also expressed
in other mycobacterial species, theoretically, the method can also be performed to detect the
rpoB gene in the other four Mycobacterium species. The results suggested no risk of interfer-
ence from mycobacterial species that might be encountered when testing M. leprae for drug
resistance.
Point mutations at codon 53 or 55 of the M. leprae folP1 gene have been confirmed to result
in dapsone resistance [18]. folP1 mutation rates among relapsed cases have been reported to
be 26% (5/19) in the Philippines (Cebu), 8.3% (2/24) in Myanmar (Yangon), 10% (1/10) in
Indonesia (North Maluku and North Sulawesi) [10], 57% (8/14) in Vietnam (the central and
highland regions) [17], and 9.1% (2/22) in Japan [19]. In this study, the frequencies of dapsone
resistance in new and relapsed cases were 24.00% (12/50) and 26.92% (7/26), respectively. In
this study, the rate of mutation of the folP1 gene in relapsed cases (26.92%, 7/26) was slightly
higher than that in newly detected cases (24.00%, 12/50). These results are different from those
of a previous study in Shandong, China [20], which reported frequencies of dapsone resistance
in new and relapsed cases of 1.6% (1/61) and 0% (0/6), respectively. In addition, a previous
study in Shandong, China, reported that the mutation rate of the rpoB gene in 52 new cases
was 9.6% (5/52), though rpoB mutation was not found in new or relapsed cases in this study.

Fig 2. Sanger sequencing chromatograms indicated drug resistance loci in the folP1 Gene of M. leprae. (A) 53ACC and 55CCC; (B) 53GCC; (C)
53ATC; (D) 55CTC; (E) 55CGC; (F) 53[A/G]CC and 55C[C/T]C; and [G] ACC53A[C/T][C/T], CGG54[C/G]GG and CCC55C[C/G]C in the folP1
gene. (A) Wildtype homozygous; (B-E) mutant homozygous; (F-G) mutant heterozygous.

Fig 3. Multicomponent plot figures indicated drug resistance loci (CCC55CGC) in the folP1 Gene of M. leprae. The DNA samples were genotyped
using the Custom TaqMan SNP Genotyping Assay System. Major (also wildtype) alleles were detected by 2’-chloro-7’-phenyl-1,4-dichloro-6-
carboxyfluorescein (VIC)-labeled probes (green) and minor alleles by 6-carboxyfluorescein (FAM)-labeled probes (blue). (A) Mutant homozygous G/
G. (B) Mutant heterozygous C/G. (C) Wildtype homozygous C/C; (D) Allele discrimination plot showing alleles as wildtype homozygous C/C (lower
right cluster), mutant heterozygous C/G (middle cluster), and mutant homozygous G/G (upper left) for the CCC55CGC loci of folP1 gene by Custom
TaqMan SNP Genotyping Assay using 7500 Software v2.3, Applied Biosystem, USA. SNP indicates a single-nucleotide polymorphism.
These different drug resistance characteristics may be due to differences in demographics

from Southwest China to North China and the small sample size of this study.
Based on the result of an antimicrobial resistance study on leprosy by the WHO surveil-
lance network, skin biopsy specimens from MB leprosy cases at sentinel sites of 19 countries
from the period 2009–2015 were included, and resistance to rifampicin, dapsone and ofloxacin
according to PCR sequencing of rpoB, folP1 and gyrA gene DRDRs was studied [21]. The
PCR/sequencing method has been widely applied in MB leprosy patients; however, drug resis-
tance among PB leprosy patients and the use of FFPE specimens have seldom been discussed
[15]. In this study, we developed a nested PCR and TaqMan SNP Genotyping Assay, which
were used for drug resistance testing in MB and PB patients. The performance of the two
methods was also assessed to detect drug resistance within DRDRs of M. leprae using DNA
obtained from skin biopsy as well as from partially degraded FFPE specimens.

Fig 4. An allele discrimination plot indicated drug resistance loci in the folP1 Gene of M. leprae. (A) ACC53GCC, (B)
ACC53ATC, (C) CCC55CGC, and (D) CCC55CTC. Red, green, and blue dots represent homozygous genotypes, heterozygous
genotypes and mutant homozygous genotypes, respectively, and the cross on the bottom left of the plot indicates the no-template
control or failed PCR.
The three molecular methods were applied to 73 specimens with BI values ranging from 0
(no bacilli visible) to 6 (>1000 bacilli per microscopic field), thereby enabling a comparison of
the efficiency of the methods between the BI�2 and BI <2 groups (Table 4). As expected,
there was a direct correlation between PCR/sequencing positivity and the BI, but surprisingly,

Table 8. The mutation rates of new and relapsed leprosy patients.

Mutation Total New Relapsed
Cases % Cases % Cases %
No mutation 57 75.00% 38 76.00% 19 73.08%
Dapsone (folP1) 19 25.00% 12 24.00% 7 26.92%
Quinolones (gyrA) 1 1.31% 1 2.00% 0 0.00%
Dapsone and quinolones (folP1 and gyrA) 1 1.31% 1 2.00% 0 0.00%
RFP (rpoB) 0 0.00% 0 0.00% 0 0.00%
Total 76 100.00% 50 100.00% 26 100.00%
nested PCR/seq and the TaqMan SNP Genotyping Assay increased the sensitivity dramatically,
and successful detection of drug resistance was achieved with some specimens with a BI as low
as 0. In addition, distinguishing heterozygous genotypes and mutant homozygous genotypes
from homozygous genotypes based on an allele discrimination plot of the TaqMan SNP Geno-
typing Assay was easily accomplished.
Dapsone monotherapy is usually regarded as the reason for drug resistance in relapsed
cases. However, only two relapsed cases with folP1 mutation had previously undergone DDS
monotherapy. Of notable concern was the detection of the folP1 mutation related to drug
resistance in five patients undergoing MDT who had not previously undergone DDS treat-
ment. This may be due to irregular medication use as a result of self-treatment. Despite the
known presence of dapsone resistance mutations, relapsed patients are commonly retreated
with an MDT regimen that contains dapsone in Colombia [22] and China.
Our study has some limitations. It was a retrospective study with a small sample size. Thus,
a prospective study with a standardized sampling method should be performed. The TaqMan
SNP Genotyping Assay can detect only one SNP locus each time, and more effective detection
systems, such as the TaqMan array card (TAC), should be developed. We focused on muta-
tions only within DRDRs. Future studies should focus on additional SNPs related to drug
resistance in M. leprae as well as transmission markers of leprosy.
Conclusion
Overall, our findings highlight a new molecular approach involving nested PCR, and the Taq-
Man SNP Genotyping Assay offers a rapid and highly sensitive tool for testing resistance in
M. leprae. In addition, the TaqMan SNP Genotyping Assay easily distinguishes heterozygous
genotypes and mutant homozygous genotypes from homozygous genotypes.
Using these tools, more information on drug resistance can be obtained from skin biopsy,
FFPE, and SSS specimens from leprosy patients. However, the TaqMan SNP Genotyping
Assay developed in the study can only detect one SNP mutant locus at a time. Thus, new gene
detection systems, such as the TAC, integrating more SNP loci of drug resistance genes into an
effective assay, should be developed. Finally, additional genetic mutations related to first-line
and second-line drug resistance should be considered for incorporation into future gene detec-
tion systems.
Supporting information
S1 Table. DNA concentrations (ng/μl) obtained for Mycobacterium species and M. leprae
clinical specimens, as determined using spectrophotometry and Qubit dsDNA HS assay.
(DOC)

S2 Table. Mycobacterium species expression of the rpoB, gyrA, and folP1 genes, as
reported by NCBI/gene.
(DOC)
Acknowledgments
We thank Colorado State University, Fort Collins, Colorado for providing the M. leprae DNA
samples. We thank T. P. Gillis from the Department of Health and Human Services, Health
Resources and Services Administration, Healthcare Systems Bureau, National Hansen’s Dis-
ease Program, Baton Rouge, Louisiana, United States of America, for providing bacterial DNA
samples from other mycobacterial species and nonmycobacterial species.
We are also grateful to the patients who participated in this study and to the doctors and
clinical staff from each of the provinces who provided one or more patient samples and infor-
mation for this study. We acknowledge Dr. Huanying Li and Dr Xiaoman Weng for their
work conducting leprosy research investigations in BTMRI, China.
Author Contributions
Data curation: Jun He, Jian Liu, Yuangang You, Lianchao Yuan, Yan Wen.
Formal analysis: Xiaohua Chen, Lianchao Yuan.
Funding acquisition: Yan Wen.
Investigation: Xiaohua Chen, Yan Wen.
Methodology: Xiaohua Chen, Yuangang You, Yan Wen.
Project administration: Yan Wen.
Resources: Jun He, Jian Liu, Yan Wen.
Validation: Xiaohua Chen.
Visualization: Xiaohua Chen.
Writing – original draft: Xiaohua Chen.
Writing – review & editing: Xiaohua Chen.
References
1. Benjak A, Avanzi C, Singh P, Loiseau C, Girma S, Busso P, et al. Phylogenomics and antimicrobial
resistance of the leprosy bacillus Mycobacterium leprae. Nat Commun. 2018; 9: 352. https://doi.org/10.
1038/s41467-017-02576-z PMID: 29367657
2. Avanzi C, Busso P, Benjak A, Loiseau C, Fomba A, Doumbia G, et al. Transmission of drug-resistant
leprosy in guinea-conakry detected using molecular epidemiological approaches. Clin Infect Dis. 2016;
63: 1482–1484. https://doi.org/10.1093/cid/ciw572 PMID: 27558568
3. World Health Organization. Global leprosy situation, 2012. Wkly Epidemiol Rec. 2012; 87: 317–328.
PMID: 22919737
4. Saunderson PR. Drug-resistant Mycobacterium leprae. Clin Dermatol. 2015; 34: 79–81. https://doi.org/
10.1016/j.clindermatol.2015.10.019 PMID: 26773627
5. Matsuoka M. Global surveillance system to monitor the development of drug resistance in Mycobacte-
rium leprae. Res Rep Trop Med. 2015; 6: 75.
6. Cambau E, Perani E, Guillemin I, Jamet P, Ji B. Multidrug-resistance to dapsone, rifampicin, and ofloxa-
cin in Mycobacterium leprae. Lancet. 1997; 349: 103–104.
7. Maeda S, Matsuoka M, Nakata N, Kai M, Maeda Y, Hashimoto K, et al. Multidrug resistant Mycobacte-
rium leprae from patients with leprosy. Antimicrob Agents Chemother. 2001; 45: 3635–3639. https://doi.
org/10.1128/AAC.45.12.3635-3639.2001 PMID: 11709358

8. Matsuoka M, Kashiwabara Y, Namisato M. A Mycobacterium leprae isolate resistant to dapsone, rifam-

pin, ofloxacin and sparfloxacin. Int J Lepr Other Mycobact Dis. 2000; 68: 452–455. PMID: 11332288
9. Matsuoka M, Kashiwabara Y, Liangfen Z, Goto M, Kitajima S. A second case of multidrug-resistant
Mycobacterium leprae isolated from a Japanese patient with relapsed lepromatous leprosy. Int J Lepr
Other Mycobact Dis. 2003; 71: 240–243. https://doi.org/10.1489/1544-581x(2003)71<240:ascomm>2.
0.co;2 PMID: 14608820
10. Matsuoka M, Budiawan T, Aye KS, Kyaw K, Tan EV, Cruz ED, et al. The frequency of drug resistance
mutations in Mycobacterium leprae isolates in untreated and relapsed leprosy patients from Myanmar,
Indonesia and the Philippines. Lepr Rev. 2007; 78: 343–352. PMID: 18309708
11. Rocha ADS, Cunha M, Diniz LM, Salgado C, Aires MA, Nery JA, et al. Drug and multidrug resistance
among Mycobacterium leprae isolates from Brazilian relapsed leprosy patients. J Clin Microbiol. 2012;
50: 1912–1917. https://doi.org/10.1128/JCM.06561-11 PMID: 22495562
12. You EY, Kang TJ, Kim SK, Lee SB, Chae GT. Mutations in genes related to drug resistance in Mycobac-
terium leprae isolates from leprosy patients in Korea. J Infect. 2005; 50: 6–11. https://doi.org/10.1016/j.
jinf.2004.03.012 PMID: 15603834
13. WHO Regional Office for South-East Asia. Guidelines for global surveillance of drug resistance in lep-
rosy. New Delhi, India: WHO Regional Office for South-East Asia; 2009.
14. Cambau E, Chauffour-Nevejans A, Tejmar-Kolar L, Matsuoka M, Jarlier V. Detection of antibiotic resis-
tance in leprosy using GenoType LepraeDR, a novel ready-to-use molecular test. PLoS Negl Trop Dis.
2012; 6: e1739. https://doi.org/10.1371/journal.pntd.0001739 PMID: 22860144
15. Araujo S, Goulart LR, Truman RW, Goulart IMB, Vissa V, Li W, et al. qPCR-high resolution melt analysis
for drug susceptibility testing of Mycobacterium leprae directly from clinical specimens of leprosy
patients. PLoS Negl Trop Dis. 2017; 11: e0005506. https://doi.org/10.1371/journal.pntd.0005506
PMID: 28570560
16. Yu G, Fadrosh D, Goedert JJ, Ravel J, Goldstein AM. Nested PCR biases in interpreting microbial com-
munity structure in 16S rRNA gene sequence datasets. PLoS One. 2015; 10: e0132253. https://doi.org/
10.1371/journal.pone.0132253 PMID: 26196512
17. Kai M, Phuc NHN, Nguyen HA, Pham TH, Nguyen KH, Miyamoto Y, et al. Analysis of drug-resistant
strains of Mycobacterium leprae in an endemic area of Vietnam. Clin Infect Dis. 2011; 52: e127–e132.
https://doi.org/10.1093/cid/ciq217 PMID: 21292655
18. Nakata N, Kai M, Makino M. Mutation analysis of the Mycobacterium leprae folP1 gene and dapsone
resistance. Antimicrob Agents Chemother. 2011; 55: 762–766. https://doi.org/10.1128/AAC.01212-10
PMID: 21115799
19. Mori S, Yotsu RR, Suzuki K, Makino M, Ishii N. Present situation of leprosy in Japan, 2006–2010: Analy-
sis of drug resistance in new registered and relapsed cases by molecular biological methods. J Derma-
tol Sci. 2012; 67: 192–194. https://doi.org/10.1016/j.jdermsci.2012.05.002 PMID: 22739027
20. Liu D, Zhang Q, Sun Y, Wang C, Zhang Y, Fu X, et al. Drug resistance in Mycobacterium leprae from
patients with leprosy in China. Clin Exp Dermatol. 2015; 40: 908–911. https://doi.org/10.1111/ced.
12665 PMID: 25991507
21. Cambau E, Saunderson P, Matsuoka M, Cole ST, Kai M, Suffys P, et al. Antimicrobial resistance in lep-
rosy: Results of the first prospective open survey conducted by a WHO surveillance network for the
period 2009–15. Clin Microbiol Infect. 2018; 24: 1305–1310. https://doi.org/10.1016/j.cmi.2018.02.022
PMID: 29496597
22. Beltrán-Alzate C, López Dı́az F, Romero-Montoya M, Sakamuri R, Li W, Kimura M, et al. Leprosy drug
resistance surveillance in Colombia: The experience of a sentinel country. PLoS Negl Trop Dis. 2016;
10: e0005041. https://doi.org/10.1371/journal.pntd.0005041 PMID: 27706165

Artigo 3

Uploaded by

Copyright:

Available Formats

Artigo 3

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Artigo 3

Uploaded by

Copyright:

Available Formats

RESEARCH ARTICLE

Nested PCR and the TaqMan SNP Genotyping

Received: May 22, 2019 Methodology/Principal findings

PLOS Neglected Tropical Diseases | https://doi.org/10.1371/journal.pntd.0007946 December 27, 2019 1 / 17

PLOS Neglected Tropical Diseases | https://doi.org/10.1371/journal.pntd.0007946 December 27, 2019 2 / 17

PLOS Neglected Tropical Diseases | https://doi.org/10.1371/journal.pntd.0007946 December 27, 2019 3 / 17

DNA extraction and quality control

Simple PCR, nested PCR, and sequencing

PLOS Neglected Tropical Diseases | https://doi.org/10.1371/journal.pntd.0007946 December 27, 2019 4 / 17

TaqMan SNP genotyping

PLOS Neglected Tropical Diseases | https://doi.org/10.1371/journal.pntd.0007946 December 27, 2019 5 / 17

Comparison of DNA yield between skin biopsy and FFPE samples

Analytical specificity of simple PCR, nested PCR and TaqMan methods

Performance of drug resistance testing of clinical samples

PLOS Neglected Tropical Diseases | https://doi.org/10.1371/journal.pntd.0007946 December 27, 2019 6 / 17

Table 3. Clinical characteristics of the leprosy patients enrolled in this study.

PLOS Neglected Tropical Diseases | https://doi.org/10.1371/journal.pntd.0007946 December 27, 2019 7 / 17

Fig 1. DNA concentrations (ng/μl) resulting from M. leprae clinic specimens.

PLOS Neglected Tropical Diseases | https://doi.org/10.1371/journal.pntd.0007946 December 27, 2019 8 / 17

Comparison of the three molecular assays for drug resistance based on

Characteristics of patients with mutated strains

PLOS Neglected Tropical Diseases | https://doi.org/10.1371/journal.pntd.0007946 December 27, 2019 9 / 17

PLOS Neglected Tropical Diseases | https://doi.org/10.1371/journal.pntd.0007946 December 27, 2019 10 / 17

PLOS Neglected Tropical Diseases | https://doi.org/10.1371/journal.pntd.0007946 December 27, 2019 11 / 17

PLOS Neglected Tropical Diseases | https://doi.org/10.1371/journal.pntd.0007946 December 27, 2019 12 / 17

These different drug resistance characteristics may be due to differences in demographics

PLOS Neglected Tropical Diseases | https://doi.org/10.1371/journal.pntd.0007946 December 27, 2019 13 / 17

PLOS Neglected Tropical Diseases | https://doi.org/10.1371/journal.pntd.0007946 December 27, 2019 14 / 17

Table 8. The mutation rates of new and relapsed leprosy patients.

PLOS Neglected Tropical Diseases | https://doi.org/10.1371/journal.pntd.0007946 December 27, 2019 15 / 17

PLOS Neglected Tropical Diseases | https://doi.org/10.1371/journal.pntd.0007946 December 27, 2019 16 / 17

8. Matsuoka M, Kashiwabara Y, Namisato M. A Mycobacterium leprae isolate resistant to dapsone, rifam-

PLOS Neglected Tropical Diseases | https://doi.org/10.1371/journal.pntd.0007946 December 27, 2019 17 / 17

You might also like