0% found this document useful (0 votes)
24 views14 pages

11 DR ZahedMahmood2017

This document summarizes a study on the socio-demographic characteristics and co-morbidities of tuberculosis patients in selected areas of Punjab, Pakistan. A total of 366 tuberculosis patients were included in the study. ZN microscopy and PCR testing found that 70.5% of patients were positive for tuberculosis. The study found that 52% of patients were female, 75.6% were married, and 51.9% were uneducated. Additionally, 63.2% of patients had co-morbidities, with 24% having diabetes, 17.8% having hepatitis virus infection, and 4.2% having HIV.

Uploaded by

M Arfat Yameen
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
24 views14 pages

11 DR ZahedMahmood2017

This document summarizes a study on the socio-demographic characteristics and co-morbidities of tuberculosis patients in selected areas of Punjab, Pakistan. A total of 366 tuberculosis patients were included in the study. ZN microscopy and PCR testing found that 70.5% of patients were positive for tuberculosis. The study found that 52% of patients were female, 75.6% were married, and 51.9% were uneducated. Additionally, 63.2% of patients had co-morbidities, with 24% having diabetes, 17.8% having hepatitis virus infection, and 4.2% having HIV.

Uploaded by

M Arfat Yameen
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
You are on page 1/ 14

See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/318850417

Socio-demographic and co-morbidity study of TB patients from selected areas


of Punjab Pakistan

Article · January 2017

CITATION READS

1 200

6 authors, including:

Irum Javed Javed Tariq M.


Govt.College Women University Faisalabad Pakistan University of Agriculture Faisalabad
13 PUBLICATIONS 60 CITATIONS 150 PUBLICATIONS 1,192 CITATIONS

SEE PROFILE SEE PROFILE

Naila Rafiq
Government College Women University Faisalabad
13 PUBLICATIONS 101 CITATIONS

SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Synthesis of some Novel Pyrimidine derivatives and their Pharmacokinetics View project

wildlife studies View project

All content following this page was uploaded by Muhammad Riaz on 08 August 2017.

The user has requested enhancement of the downloaded file.


Irum Javed, et al RJLBPCS 2017 www.rjlbpcs.com Life Science Informatics Publications

Original Research Article


SOCIO-DEMOGRAPHIC AND CO-MORBIDITY STUDY OF TB PATIENTS
FROM SELECTED AREAS OF PUNJAB PAKISTAN
Irum Javed, Muhammad Tariq Javed, Zahed Mahmood, Zahed Mahmood, Muhammad
Riaz, Riffat Iqbal , Naila Rafiq, Shumaila Rafiq.
1.Department of Biochemistry, Govt. College Women University Faisalabad, Pakistan.
2.Department of Pathology, Faculty of Veterinary Sciences, University of Agriculture. Faisalabad, Pakistan.
3. Department of Applied Chemistry and Biochemistry, Government College University, Faisalabad, Pakistan.
4.Department of Allied Health Sciences, Sargodha Medical College, University of Sargodha, Sargodha.
5.Department of Biochemistry, Govt. College Women University Faisalabad, Pakistan.
6.Department of Biochemistry, Govt. College Women University Faisalabad, Pakistan.
7 Department, Clinical Medicine, Arhus University, Denmark.

ABSTRACT: The study was carried out to investigate the socio-demographic characteristics and
co-morbidity of patients suffering from tuberculosis from selected hospitals of Faisalabad and Lahore,
Pakistan. A total of 366 patients were included in the study. The ZN microscopy was carried out along
with PCR. The socio-demographic characteristics of each patient were recorded along with any
comorbidity. All the patients under study were found positive by ZN staining, while, 258 (70.5%)
were found positive by PCR. Of these 258 patients, 52% were females and 48% were males. The
36.8% patients were between 16-30 years, 40% had a body weight between 41-50 Kg, 75.6% were
married, 51.9% were uneducated, while 41.8% had education up to ten grades, and 38% were
housewives. Tuberculosis alone was present in 36.8% cases, while 63.2% patients had other disease
conditions as well. Out of 63.2%, 24% had diabetes, 17.8% had hepatitis virus infection, 11.2% had
diabetes and hepatitis (HCV) together, 4.2% had HIV infection, 12.3% had both HIV and HCV
infections together and 3.4% had myocardial infarction. Among TB patients 52% were females,
75.6% were married and 51.9% uneducated. The 63.2% patients had comorbidity of which 24% had
diabetes, 17.8% viral hepatitis, 4.2% HIV and 3.4% myocardial infarction.

KEYWORDS: Tuberculosis, comorbidity, socio-demography, ZN, PCR.

© 2017 Life Science Informatics Publication All rights reserved


Peer review under responsibility of Life Science Informatics Publications
2017 July- August RJLBPCS 3(2) Page No.109
Irum Javed, et al RJLBPCS 2017 www.rjlbpcs.com Life Science Informatics Publications

*Corresponding Author: Dr. Zahed Mahmood, Ph.D.,


Department of applied Chemistry and Biochemistry, Government College University, Faisalabad, Pakistan *
Email Address: drzahiduaf2003@gmail.com

1. INTRODUCTION
The tuberculosis is chronic disorder as old as the human history and the Mycobacterium tuberculosis
is recovered from Egyptian mummies [1]. WHO reported that Pakistan is ranked 5th among highest
tuberculosis burden countries [2] The occurrence of tuberculosis in Pakistan is 181/100,000
populations per year [3].Pakistan is under developing country. The poverty, malnutrition and illness is
directly related to each other due to economical constrain [4]. Malnutrition in early ages decreases the
immunity that render the undernourished individual and those are more susceptible to infection [5].
Tuberculosis is more linked with congested areas with low income group, low literacy rate and an
inadequate health care facilities. So suspects of tuberculosis often remain undiagnosed under such
circumstances [6]. The death rate in TB patients also depends on co-morbidity. It is established that
occurrence of other diseases in TB patients is cardiac diseases, cancer, diabetes, various infections
and toxicity of the drugs [7]. Diabetic patients are more prone to infections, because the high blood
glucose levels compromise the immune system [8, 9]. Up to 2% of TB patients can develop
cardiovascular diseases [10]. More than 8.6 million (4.8% of the population) Pakistani population are
infected with Hepatitis C [11]. Population infected with hepatitis C virus [HCV] have a high
incidence of latent to TB infection [12]. Occurrence of Tuberculosis with human immunodeficiency
virus (HIV) infections is the main cause of death. The Population of Punjab carrying 57% of the TB
burden of Pakistan as Punjab is the largest province of country [13]. Keeping in view, it was an
attempt to investigate the socio-demographic facts regarding the magnitude of TB patients and
co-morbidities of other disorders in selected pockets of central Punjab, Pakistan.
2. MATERIALS AND METHODS
The study was approved formally by the ethical /synopsis scrutiny committee and finally approved by
the Directorate of graduate studies and research board (GSRB) University of Agriculture Faisalabad.
The patients coming for diagnosis of tuberculosis in TB hospitals of Faisalabad, DHQ hospital
Faisalabad, Gulab Devi Chest Hospital Lahore, DHQ hospital Gojra and District prison Faisalabad
were included in the study. The sputum samples were collected then confirmed by ZN staining and
PCR. The information about patients was recorded on a specially designed case history performa. All
the patients were told about the study and their verbal consent was sought to be included in the study.
The Zeihl Nelsen staining was done following the method as described previously [14]. The PCR was
performed on sputum samples which were digested and decontaminated using 4% Sodium hydroxide
method. DNA extraction was done by Phenol Chloroform method. Direct PCR was performed by
© 2017 Life Science Informatics Publication All rights reserved
Peer review under responsibility of Life Science Informatics Publications
2017 July- August RJLBPCS 3(2) Page No.110
Irum Javed, et al RJLBPCS 2017 www.rjlbpcs.com Life Science Informatics Publications
using set of oligonucleotide primers [TB-1F [5’ GAACAATCCGGAGTTGACAA 3’; TB-1R [5’
AGCACGCTGTCAATCATGTA 3’] which were specific to MPB70 sequence for identification of
M. tuberculosis complex [15]. The data obtained were analyzed by applying the Chi-Square test by
using SAS software [SAS, 2007].
3. RESULTS AND DISCUSSION
Socio-demography of TB patients:
The results of sociodemograpy of patients are presented in Table 1. All the 366 samples collected
from suspected TB patients were found positive by ZN staining microscopy (Figure 1), while 258
(70.5%) were found positive by PCR (Figure 2). One hundred and thirty four were females, while 124
were male. TB was significantly higher in patients of age between 16-30 years (36.8%) and patients
having the body weight between 41-50Kg (40%). The disease was new in 68.9%, while relapse was
reported by 17.4% patients. The results suggest that 9.9 time’s higher chances of tuberculosis in
married than unmarried. Of the TB patients, 76% had family members between 5 to 10 and 31.8%
had a family history of TB. The majority of patients were uneducated (51.9%) or had only education
to high school level (41.8%) and had a monthly income between 5000 to 10000 rupees (75.6%). The
results showed that house wives (38%) and labourer (24.4%) were in majority followed by students
(9.3%). It was further noted that 27.1% patients belonged Rajput clan, 14.7% Jat and the third being
the Sheikhs (15.9%) (Table 1).
Co-morbidity: The results revealed that TB alone was present in 36.8% cases and 24% had diabetes
also, 17.8% had HCV, diabetes + HCV together was in 11.24% cases, HIV was in 4.2%, HIV+ HCV
in 2.3% cases and myocardial infarction was in 3.4% as co-morbidity [Table 2].

DISCUSSION
Ziehl Neelsen’s (ZN) staining of sputum smear is the most widely used diagnostic technique for M.
tuberculosis in developing countries, but it has limitation of the presence of minimum 1000 bacili/
mL of sputum sample [16]. The culture isolation technique is the gold standard method for
tuberculosis diagnosis is, but require longer time duration for growth of M.tuberculosis isolates [17].
It has been reported by Riaz et al. that detection of MTB complex by PCR of clinical sample is most
acceptable technique for the early tuberculosis and must be used before starting anti-tuberculus
therapy with expensive and toxic drugs [18]. Therefore, in the present study, ZN positive samples
were confirmed through PCR. In the present study, PCR analysis showed that 70.5% were found
positive by PCR. This study reveals socio-demography of the TB patients and the extent of
co-morbidities in two major cities of Pakistan. The result showed no difference in distribution of
disease in male and female. Saqib et al. reported same proportion of male and female (49.6 and
50.4%, respectively) in Rawalpindi and Islamabad [19]. However, Bates et al. and Khattak et al.
reported more number of males from India and Pakistan because females remained in houses, while
the male spend most of times outside and have more chances of contracting the disease [20, 21].
© 2017 Life Science Informatics Publication All rights reserved
Peer review under responsibility of Life Science Informatics Publications
2017 July- August RJLBPCS 3(2) Page No.111
Irum Javed, et al RJLBPCS 2017 www.rjlbpcs.com Life Science Informatics Publications
Cadmus et al. Filho et al. and Towhidi et al. found higher tuberculosis rate in people of productive
years (20-40) of age [22-24]. However, Al-Kadhimi and Dawood reported that majority of
patients were of 60 year of age [25]. The significantly higher number of patients had body weight
41-50 Kg which is lower than normal weight, may be due to TB infection as TNFα effect the appetite
in TB patients. The 32.1% patients were diagnosed within 60-90 days after the onset of symptoms,
21.3% were diagnosed within 90 to 180 days and 11.6% within 30 days. Jagodzinski et al. obsrved
that 31.3% patients were hospitalized within 30 days and 28.3% up to 60 days after the onset of
symptoms of TB [26].Frequency percentage of married patients was 75.6% (195/258) compared with
the unmarried (24.4%; 63/258). These findings are in agreement with those of Ali et al. who reported
that and 64.6% were married, respectively [27]. The number of family members also influence the
disease distribution as majority of patients had 5-10 family members Sami-ul-Haq et al. reported
higher TB prevalence in families having 7 to 14 members in Sindh, Pakistan [28]. During present
study 31.8% of patients had family history of tuberculosis and higher proportion of patients were
uneducated (51.7%). Similarly, Jethani et al. also repoted that 95% of patients had family history
of disease and found higher number of cases in un-educated (40.8%) [29]. Munsab et al. also
reported higher number of cases (57.3%) in people with upto primary school education, and less in
graduates (3.7%) [30]. The present results showed that 75.6% had medium income (Rs.
5000-10000), 12.4% lower income (Rs. <5000) and 3.1% belonged to the higher income group (Rs.
>20000). It has been reported that poverty is linked with disease because of malnourishment,
unhygienic lifestyle along with the lack of healthcare facilities, even if diagnosed they afraid to
disclose themselves as a TB patient [31].The results showed that 38% were house wives, 24.4%
laborers and 9.3% were students. Gupta et al. reported higher prevalence of TB patients among
labourers (44%), working in offices (27.0%), retired and unemployed (6.3%), household (12%) and
students (11%) [32]. In Pakistan, because of its agricultural practices and the use of biomass fuel
early marriages, consecutive pregnancies, lactation and malnutrition weaken immunity resulting in
higher susceptibility to tuberculosis [33-34]. Furthermore, Munsab et al. reported that unskilled
workers (36.6%) are more infected than skilled workers (17.06%) [30].The most significant infected
ethnic group was Rajput 27.1%, Sheikh and Ansari (15.9%) and Jat (14.7%). The majority of the
families of Rajput and Jat belong to land and cattle farming in rural areas with inbreeing may be
harbouring suscuptible genes for tuberculosis while, Sheikh and ansari belong to shopkeeping and
power looms. The role of genetics need to be explored further to find the link in the occurrence of
disease in some ethnic groups.Tuberculosis alone was present in 36.8% cases, while 63.2% cases
showed comorbidity with other diseases and 24% cases had diabetes as co-morbidity. These results
indicate that tuberculosis alone is rare, most of the time it has some comorbidity. Gldhaber-Fiebert et
al. and Veswanathan et al. also reported a positive association between tuberculosis and diabetes [35,
36]. Jabbar et al. also reported a ten time increase in tuberculosis in patients with diabetes in Pakistan
© 2017 Life Science Informatics Publication All rights reserved
Peer review under responsibility of Life Science Informatics Publications
2017 July- August RJLBPCS 3(2) Page No.112
Irum Javed, et al RJLBPCS 2017 www.rjlbpcs.com Life Science Informatics Publications
[37]. The results showed that 17.8% patients had HCV as co-morbidity. Richards et al. and
Sami-ul-Haq et al. reported equal number (22%) of TB patients infected with HCV in Georgia and
Rahim Yar Khan, Pakistan, respectively [38, 28]. The results of the present study revealed that
cases had HIV comorbidity. The present results, however, suggest that HIV is not a serious issue in
Pakistan because of the social setup of the country. It was observed that 3.4% cases had
as myocardial infarction. Myocardial infarction is on the increase all over the world and also in
Pakistan. Fowler reported that only 1-2% of TB patients showed cardiovascular involvement [39].
Rajesh et al. reported 24% occurrence of cardiovascular involvement in TB patients in India [40].
4.CONCLUSIONS
The socio demographic aspects are fundamental and standard tools in population those
provide the foundation and to manage the eradication, prevention and control various disease
outbreaks. It has been concluded that lower socioeconomic and edu-cultural status, lack of awareness
and ignorance of health care systems in urban and rural areas and also the co-morbidities (including
diabetes, hepatitis C, HIV and MI) are the basic cause of spread of tuberculosis and noncompliance of
anti-tuberculosis treatment. PCR is the most reliable technique should be used for the diagnosis
before starting anti-tuberculosis drugs.
CONFLICT OF INTEREST
The authors have no conflict of interest.
ACKNOWLEDGEMENT
The financial assistance by Higher Education Commission (HEC) Islamabad, Pakistan, under the
Indigenous 5000 PhD Fellowship Scheme (pin# BM6-080) is highly acknowledged. The financial
funding by Higher Education commission (HEC) Islamabad, through project grant No. 20-1519/R &
D/09 entitled Molecular Epidemiology of Mycobacterium bovis causing human infection” is also
highly acknowledged.
REFERENCES
1. Zink AR, Sola AC, Reischl BU, Grabner CW, Rastogi AN, Wolfc DH and Nerlicha AG..
Molecular Identification and Characterization of Mycobacterium tuberculosis Complex in
Ancient Egyptian mummy. Int J Osteoarchaeol. 2004; 14: 404–413.
2. World Health Organization. 2013. Global tuberculosis report. WHO/HTM/TB/2013.11.
3. World Health Organization. 2009. Global tuberculosis control: a short update to the 2009 report.
WHO /HTM/TB/2009426. Geneva. Access.ed on: Jan, 2012.
4. Enwonwu C. O. and Warren R. Nutrition and HIV-Infection/ AIDS in sub-Saharan Africa. In:
R. Watson editor, Nutrition and Aids III. 2001; 175-92.
5. Ambrus J. L. and Ambrus J. L. Nutrition and infection diseases in developing countries and
problems of acquired immunodeficiency syndrome. Exp Biol Med 2004; 229: 464-472.
6. Mohar A, Romo J and Salido F. The spectrum of clinical and pathological manifestations of
© 2017 Life Science Informatics Publication All rights reserved
Peer review under responsibility of Life Science Informatics Publications
2017 July- August RJLBPCS 3(2) Page No.113
Irum Javed, et al RJLBPCS 2017 www.rjlbpcs.com Life Science Informatics Publications
AIDS in a consecutive series of autopsied patients in Maxico. AIDS 1992; 6: 476-4.
7. Mathew TA, Ovsyanikova TN, Shin SS, Gelmanova I, Balbuena DA and Atwood S. Causes of
death during tuberculosis treatment in Tomsk Oblast, Russia. Int J Tuberc Lung Dis. 2006;
10(8): 857-863.
8. Peleg AY, Weerarathna T, McCarthy JS and Davis TME. Common infections indiabetes:
pathogenesis, management and relationship to glycaemic control. Diabetes Metab J. 2007; 23: 3–
13.
9. Stegenga ME, Vander CSN and Blümer RME. Hyperglycaemia enhances coagulation and
reduces neutrophil degranulation, whereas hyperinsulinemia inhibits fibrinolysis during human
endotoxemia. Blood 2008; 112: 82–89.
10. Rota S, Tuncer S, Rota S and Kanat O. Mycobacterium tuberculosis complex DNA does not
exist in atheromatous plaques. New Microbiology 2005; 28(2): 165-9.
11. WHO Statistics. 2012. Hepatitis C. available from URLhttp;//www.whoint/mediacenter/
factsheet/fc164/en/. WHO/HTM/TB/2010.3. ISBN 978 92 4 159919 1.
12. Grasso, A, De PL, Malfatti F, Toscanini F, Anselmo M and Menardo G. Late occurrence of
pleural and peritoneal effusion due to Mycobacterium tuberculosis infection (TB) in a patient
with post-transplantation recurrent HCV chronic hepatitis: safety of peg-interferon and ribavirin
treatment after recovery of TB: a case report. Transplant Proc. 2008; 40(5): 1783-1785.
13. Gilani SI and Khurram M. Perception of tuberculosis in Pakistan: findings of a nation-wide
survey. J Pak Med Assoc. 2012; 62(2): 116-120.
14. Ellis R. C. and Zabrowarny L. A. Safer staining method for acid fast bacilli. J Clin Pathol, 1975;
46: 559–560.
15. Wilton S. and Cousins D. Detection and identification of multiple Mycobacterial Pathogens by
DNA Amplification in a single tube. Cold Spring Harbor Lab Press, 1992; 1: 269-273.
16. Daley P, Michael JS, Kalaiselvan S, A pilot study of short-duration pretreatment procedures for
optimizing smear microscopy for tuberculosis. (PLoS One, 2009; 4: e5626.
17. Mustafa A.S., Abal A. T. and Chugh T. D. Detection of Mycobacterium tuberculosis complex
and non-tuberculosis mycobacteria by multiplex polymerase chain reaction. Eastern
Mediterranean Health Journal, 1995; 61–70.
18. Riaz M., Mahmood Z., Javed M. T., Javed I., Shahid M.,1 Abbas M4 and Ehtisham-ul-Haque S.
Drug resistant strains of Mycobacterium tuberculosis identified through PCR-RFLP from
patients of Central Punjab, Pakistan. International Journal of Immunopathology and
Pharmacology, 2016; 29: 443–449.
19. Saqib MAN, Awan IN, Rizvi SKA, Shahzad MI, Mirza ZS, Tahseen S, Khan IH and
Khanum A. 2011. Delay in diagnosis of tuberculosis in Rawalpindi, Pakistan. BMC Research
Notes, 2013; 4: 165.
© 2017 Life Science Informatics Publication All rights reserved
Peer review under responsibility of Life Science Informatics Publications
2017 July- August RJLBPCS 3(2) Page No.114
Irum Javed, et al RJLBPCS 2017 www.rjlbpcs.com Life Science Informatics Publications
20. Bates I., Fenton C. and Gruber J. Vulnerability to malaria, tuberculosis, and HIV/AIDS
infection and disease. Part 1: determinants operating at individual and household level. Lancet
Infect Dis. 2004; 4(5): 267-277.
21. Khattak MI, Ihsanullah M, Muhammad A, Khan N and Zaman M. Frequency of Sputum
Positive AFB cases among patients of Pulmonary Tuberculosis in Tertiary Care Hospitals of
Northern Pakistan. J Ayub Med Coll Abbottabad. 2010; 22: 56-60.
22. Cadmus C., Palmer S., Okker M., Dale J., Gover K., Smith N., Jahans K., Hewinson and
GordonS.V. Molecular Analysis of Human and Bovine Tubercle Bacilli from a Local Setting in
Nigeria. J Clin Microbiol. 2006; 44(1): 2934.
23. Filho J. P. C., Anna C. C. S., Bóia M. N. Clinical aspects of pulmonary tuberculosis in elderly
patients from a university hospital in Rio de Janeiro, J Bras Pneumol. 2007; 33(6): 700-706.
24. Towhidi M, Azarian A, Asnaashari A. Pulmonary tuberculosis in the elderly. Tanaffos. 2008;
7(1): 52-57.
25. Al-Kadhimi H. M., Dawood H. N. The Effect of Age on Clinical and Radiological Presentation
in Patients with Pulmonary Tuberculosis in baghdad. The Iqra Post Med J 2011; 10(1):125-
129.
26. Jagodziński J, Zielonka TM and Błachnio M. Socio-economic status and duration of TB
symptoms in males treated at the Mazovian Treatment Centre of Tuberculosis and Lung
Diseases in Otwock. Pneumonol Alergol Pol 2012; 80(6):533–540.
27. Ali M., Imam F, Mallik S, Mehra RK, Kumar P and Garg A. Effect of Social Factors on
Tuberculosis Patients: A Comprehensive Illness Behaviour Study. Indian Journal
Pharmacy Practice, 2013; 2(6): 61-64.
28. Sami-ul-Haq R., Hussain M, Krishin J and Abbasi S. Risk Factors of Tuberculosis in
Children, Annals of Pakistan Institute of Medical Science, 2010; 6(1): 50-54.
29. Jethani S, Semwal J, Kakkar R and Rawat. Study of epidemiological correlates of tuberculosis.
Indian Journal of Community Medicine, 2012; 24(4): 304-309.
30. Munsab A, Manju S, Najmi AK, Faisal I, Santanu M and Ravinder KM. Associated
socioeconomic status with illness behavior in tuberculosis patients undergoing DOTS therapy. .
Ind J Pharm Prac, 2012; 3(5): 45-48.
31. Thorson A and Hoa NP. Health seeking behaviour of individuals with a cough of more than 3
weeks. Lancet, 2000; 356 (9244): 1823–24.
32. Gupta S, Shenoy V, Mukhopadhyay C, Bairy I and Muralidharan S. Role of risk factor and
socioeconomic status in pulmonary tuberculosis: a search for the root cause in patient sin the
tertiary care hospital, South India. . Trop Med Int Health. 2011; 16: 74-78.
33. Mishra K.and Retherford D. Biomass Cooking Fuels and Prevalence of Tuberculosis in India.
Int J Infect Dis. 1999; 3(3): 119–129.
© 2017 Life Science Informatics Publication All rights reserved
Peer review under responsibility of Life Science Informatics Publications
2017 July- August RJLBPCS 3(2) Page No.115
Irum Javed, et al RJLBPCS 2017 www.rjlbpcs.com Life Science Informatics Publications
34. ShafiUllah Shah S. H., Rehman A., Kamal A., Begum N. and Khan G. Extra pulmonary
tuberculosis in lady reading hospital Peshawar, NWFP, Pakistan: survey of biopsy results. J
Ayub Med Coll Abbottabad. 2008; 20(2): 34-46.
35. Goldhaber-Fiebert JD, Jeon CY, Cohen T and Murray M. B. Diabetes mellitus and
tuberculosis in countries with high tuberculosis burdens: individual risks and social
determinants. Int J Epidemiol. 2011; 40(2): 417-428.
36. Viswanathan V, Kumpatla S, Aravindalochanan V, Rajan R and Chinnasamy C. Prevalence of
diabetes and pre-diabetes and associated risk factors among tuberculosis Patients in India. PLoS
ONE, 2012; 7(7): 41367.
37. Jabbar A, Hussain SF and Khan A A. Clinical characteristics of pulmonary TB in adult
Pakistani patients with co-existing diabetes mellitus. East Mediterr Health J.2006; 12(5):
522-527.
38. Richards DC, Mikiashvili T, Parris JJ, Kourbatova EV, Wilson JCE, Shubladze N. High
prevalence of hepatitis C virus but not HIV co-infection among patients with
tuberculosis in Georgia. Int J Tuberc Lung Dis., 2006; 10 (4): 396–401.
39. Fowler N. O. Tuberculous Pericarditis. J Am Med Assoc, 1991; 266: 199-203.
40. Rajesh S., Sricharan K.N., Jayaprakash K., Francis N. P. Cardiac Involvement in Patients with
Pulmonary Tuberculosis. J of Cli and Diag Res. 2011, 5(3): 440-442.

© 2017 Life Science Informatics Publication All rights reserved


Peer review under responsibility of Life Science Informatics Publications
2017 July- August RJLBPCS 3(2) Page No.116
Irum Javed, et al RJLBPCS 2017 www.rjlbpcs.com Life Science Informatics Publications
Supplementary Files

Figure 1; ZN stained smear from the sputum sample, pink colored rods of bacteria against blue
back ground.

Figure 2: PCR product of Mycobacterium tuberculosis complex.


From right to left Lane 1, DNA Ladder; lane 2;Negative control Lane 3 - 8, Positive PCR product;
Lane 9,10, Negative PCR product.

© 2017 Life Science Informatics Publication All rights reserved


Peer review under responsibility of Life Science Informatics Publications
2017 July- August RJLBPCS 3(2) Page No.117
Irum Javed, et al RJLBPCS 2017 www.rjlbpcs.com Life Science Informatics Publications

Table 1: The results on socio-demographic factors of TB patients


Parameters No of Cases Frequency 95% CI
(N) Percentage Lower Limit Upper Limit
(%)
PCR
Negative 108 29.5 25.00 34.34
Positive 258 70.5 65.66 75.00
Odds Ratio = 0.18; reciprocal = 5.71; P <0.0001
Gender
Female 134 52 45.84 58.00
Male 124 48 42.00 54.16
Odds Ratio = 1.17; reciprocal= 0.86
Age
<15 years 8 3.1 1.45 5.80
16-30 years 95 36.8 31.10 42.84
31-45 years 61 23.7 18.76 29.12
46-60 years 61 23.7 18.76 29.12
>60 years 33 12.8 9.12 17.29
P <0.0001
Weight (Kg)
< 20 Kg 6 2.3 0.95 4.77
21-30 Kg 22 8.5 5.56 12.42
31-40 Kg 53 20.5 15.94 25.80
41-50 Kg 103 40 34.07 46.00
51-60 Kg 52 20.2 15.59 25.38
>60 Kg 22 8.5 5.56 12.42
P <0.0001
Duration
< 30 days 30 11.6 8.13 15.98
30-60 days 21 8.13 5.25 11.97
60-90 days 83 32.1 26.68 38.06
90-180 days 55 21.3 16.64 26.63
180-365 days 21 6.2 3.71 9.67
365-730 days 9 3.4 1.71 6.30

© 2017 Life Science Informatics Publication All rights reserved


Peer review under responsibility of Life Science Informatics Publications
2017 July- August RJLBPCS 3(2) Page No.118
Irum Javed, et al RJLBPCS 2017 www.rjlbpcs.com Life Science Informatics Publications
>730 days 9 3.4 1.71 6.30
Unknown 35 13.6 9.79 18.16
P < 0.0001
Relapse /New
New 178 68.9 63.15 74.41
Relapse 45 17.4 13.17 22.44
Unknown 35 13.5 979 18.16
P <0.0001
Marital Status

Unmarried 63 24.4 19.47 29.94


Married 195 75.6 70.06 80.53
Odds Ratio = 0.10; reciprocal = 9.58; P <0.0001
Family members
≤5 22 8.5 5.56 12.42
5-10 196 76 70.47 80.89
10-15 27 10.5 7.15 14.66
≥15 13 5.0 2.83 8.25
P < 0.0001
Family History of TB
No Family TB 162 62.7 56.76 68.53
Family TB 82 31.8 26.32 37.66
Unknown 14 5.4 3.12 8.73
P <0.0001
Kind of Blood Relation
Close Relative 69 84.2 75.03 90.89
Life partner 6 7.32 3.02 14.60
Others 7 8.5 3.81 16.16
P <0.0001
Education
Uneducated 134 51.9 45.84 58.00
High School 108 41.8 35.95 47.96
More than High School 9 3.5 1.71 6.30
Professional education 7 2.7 1.19 5.29
P < 0.0001
Monthly Income (Rupees)

© 2017 Life Science Informatics Publication All rights reserved


Peer review under responsibility of Life Science Informatics Publications
2017 July- August RJLBPCS 3(2) Page No.119
Irum Javed, et al RJLBPCS 2017 www.rjlbpcs.com Life Science Informatics Publications
≤5000 32 12.4 8.79 16.86
5000-10000 195 75.6 70.06 80.53
11000-20000 23 8.9 5.87 12.87
≥20000 8 3.1 1.45 5.80
P <0.0001
Occupation/Profession
Labor 63 24.4 19.47 29.94
Driver 9 3.4 1.71 6.30
House Wives 99 38 32.21 44.03
Livestock holders 10 3.8 1.99 6.80
Electrician 8 3.1 1.45 5.80
Tailor 12 4.6 2.54 7.77
Student 24 9.3 6.19 13.32
Farmer 11 4.2 2.26 7.29
Beautician 3 1.2 0.30 3.13
Teacher 3 1.2 0.30 3.13
Medical rep 4 1.6 0.49 3.70
Professional 5 1.9 0.71 4.24
No work 4 1.6 0.49 3.70
Shopkeeper 3 1.2 0.30 3.13
P < 0.0001
CAST
Arain 11 4.3 2.26 7.29
Baloch 3 1.4 0.49 3.70
Bari 4 1.6 0.49 3.70
Balore 2 0.78 0.13 2.54
Chris 4 1.6 0.49 3.70
Dogar 8 3.1 1.45 5.80
Gill 15 5.5 3.12 8.73
Gujar 5 1.9 0.71 4.24
Jat 38 14.7 10.79 19.45
Lali 3 1.4 0.49 3.70
Malik 6 2.3 0.95 4.77
Mughal 18 7 4.32 10.60
Pathan 7 2.7 1.19 5.29
Rajpot 70 27.1 21.97 32.80
© 2017 Life Science Informatics Publication All rights reserved
Peer review under responsibility of Life Science Informatics Publications
2017 July- August RJLBPCS 3(2) Page No.120
Irum Javed, et al RJLBPCS 2017 www.rjlbpcs.com Life Science Informatics Publications
Rawal 2 0.78 0.13 2.54
Shah 12 4.7 2.54 7.77
Sayed 9 3.5 1.71 6.30
Sheikh 41 15.9 11.81 20.74
P < 0.0001
Table 2: The results of comorbid conditions
Parameters No of cases Frequency 95% CI
(N) Percentage Lower Limit Upper Limit
(%)
TB alone 95 36.8 31.10 42.84
TB+Diabetic 62 24.0 19.11 29.53
TB+HCV 46 17.8 13.52 22.86
TB+Diabetes+ HCV 29 11.24 7.80 15.54
TB+ HIV 11 4.2 2.26 7.29
TB+HCV+HIV 6 2.3 0.95 4.77
TB +MI 9 3.4 1.71 6.30

© 2017 Life Science Informatics Publication All rights reserved


Peer review under responsibility of Life Science Informatics Publications
2017 July- August RJLBPCS 3(2) Page No.121
View publication stats

You might also like