Biotechnology and Biochemical Engineering: Prasanna B.D. Sathyanarayana N. Gummadi Praveen V. Vadlani Editors

Prasanna B.D.
Sathyanarayana N. Gummadi
Praveen V. Vadlani Editors
Biotechnology
and
Biochemical
Engineering
Select Proceedings of ICACE 2015
Biotechnology and Biochemical Engineering
Prasanna B.D. Sathyanarayana N. Gummadi
•
Praveen V. Vadlani
Editors
Biotechnology and
Biochemical Engineering
Select Proceedings of ICACE 2015
123
Editors
Prasanna B.D. Praveen V. Vadlani
Department of Chemical Engineering Department of Chemical Engineering
National Institute of Technology Karnataka Kansas State University
Mangalore, Karnataka Manhattan, KS
India USA
Sathyanarayana N. Gummadi
Bhupat and Jyoti Mehta School
of Biosciences
Indian Institute of Technology Madras
Chennai, Tamil Nadu
India
ISBN 978-981-10-1919-7 ISBN 978-981-10-1920-3 (eBook)

DOI 10.1007/978-981-10-1920-3
Library of Congress Control Number: 2016947027
© Springer Science+Business Media Singapore 2016

This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part
of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations,
recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission
or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar
methodology now known or hereafter developed.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this
publication does not imply, even in the absence of a specific statement, that such names are exempt from
the relevant protective laws and regulations and therefore free for general use.
The publisher, the authors and the editors are safe to assume that the advice and information in this
book are believed to be true and accurate at the date of publication. Neither the publisher nor the
authors or the editors give a warranty, express or implied, with respect to the material contained herein or
for any errors or omissions that may have been made.
Printed on acid-free paper
This Springer imprint is published by Springer Nature

The registered company is Springer Science+Business Media Singapore Pte Ltd.
Preface
The Department of Chemical Engineering, National Institute of Technology

Karnataka, Surathkal, India was started in the year 1965 with the assistance of
UNESCO, MHRD-Government of India, and the Government of Karnataka and is
consistently ranked as one of the top chemical engineering departments in India by
the National Board of Accreditation. The department has completed 50 years of its
glorious service to the cause of Chemical Engineering Education, Research and
Industrial collaboration, and celebrated Golden Jubilee Year in 2015. In order to
commemorate this important milestone, International Conference on Advances in
Chemical Engineering (ICACE)—2015 was organized during December 20–22,
2015.
Chemical engineering is a branch of science that combines physical sciences
(physics and chemistry) and life sciences (molecular and synthetic biology) with
applied mathematics and economics to synthesize and transform chemicals, mate-
rials, and energy from various feedstocks. Essentially, chemical engineers con-
ceptualize novel and innovative processes and implement large-scale industrial
operations to produce chemicals and materials suited to every need of the society,
including food, chemicals, energy, environment, and information. ICACE-2015
conference provided a platform for deliberating advances in chemical engineering
as well as allied fields, through invited lectures delivered by researchers of national
and international repute, and paper and poster presentation by participants from
academia, research organizations, and industries.
ICACE-2015 had solicited technical and research submissions related to
Industrial Biotechnology and Biochemical Engineering. Bioprocessing of renew-
able resources to useful products is a sustainable approach and has the wherewithal
to solve some of the challenging issues facing humanity. We had an overwhelming
response to our call for paper submission, and all the submitted papers were
screened and selected by the technical committee on the basis of originality, sig-
nificance, coherence of data and clarity. Altogether 53 papers were received; out of
which 37 papers were selected for oral presentation in the conference. The papers
v
vi Preface
presented during the conference were again subjected to peer-review and plagiarism
check. Based on the outcome, 26 papers have been selected for publication in this
book.
We would like to thank Dr. Keyur Raval for helping us in the peer-review
process. Our heartfelt thanks to Dr. Kalaivani, Mrs. Jaya Mary, and Mr. Basavaraj
Nainegli for their editorial assistance. We are highly grateful to NITK adminis-
tration, TEQIP, and technical committee members for their cooperation. The efforts
by faculty, staff, students, and alumni of NITK Surathkal in organizing
ICACE-2015 are greatly appreciated. We are grateful to all those who have con-
tributed directly and indirectly for the success of this event. We hope that all the
readers will find this book volume useful and productive.
Karnataka, India Prasanna B.D.

Chennai, India Sathyanarayana N. Gummadi
Manhattan, USA Praveen V. Vadlani
Contents
Selection of Medium and Optimization of Process Parameters

for Melanin Biosynthesis from Pseudomonas stutzeri HMGM-7 . . . . . . . 1
Harsha Thaira, Shraddha S. Bhosle, Rajmohan Balakrishnan
and Keyur Raval
Unstructured Kinetic Modeling of Glutathione Production
by Saccharomyces cerevisiae NCIM 3345 . . . . . . . . . . . . . . . . . . . . . . . . . 11
Abhinandan Dhavale, Atul Vhanmarathi, Shrinivas Deshmukh
and Seema Dabeer
Statistical Optimization of Lactic Acid Extraction
from Fermentation Broth Using Emulsion Liquid Membrane . . . . . . . . . 21
Avinash Thakur, Parmjit Singh Panesar and Manohar Singh Saini
Optimization of Microwave Assisted Extraction
of Pectin from Helianthus annuus Head Using Response
Surface Methodology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35
B.K. Aarthi, V. Aswini, M. Lakshmi Priya, M. Nirosha
and M. Shanmugaprakash
Production and Characterization of Hydrophobins
from Fungal Source . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 47
Basavaraj Hungund, Chaitanya Habib, Vaibhav Hiregoudar,
Sona Umloti, Saiprasad Wandkar and Gururaj Tennalli
Sustainable Utilization of Food Industry Waste
and by-Products for the Production of Prebiotic
Isomaltooligosaccharides (IMO) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 55
Anindya Basu and S.G. Prapulla
Enhancing the Bioproduction of Cellulase by
Aspergillus nidulan via Medium Optimization . . . . . . . . . . . . . . . . . . . . . 65
P. Saravanan and R. Muthuvelayudham
vii
viii Contents
Modeling and Theoretical Analysis of

Isomaltooligosaccharide (IMO) Production
Using Fed-Batch Process . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 73
Sarma Mutturi and Anindya Basu
Optimization of Na2CO3 Pre-treatment by RSM Approach
for Releasing Reducing Sugars from Cocoa Pod Shells . . . . . . . . . . . . . . 85
Vinayaka B. Shet, Nisha, Manasa Bhat, Manasa,
Leah Natasha S. Mascarenhas, Louella C. Goveas,
C. Vaman Rao and P. Ujwal
Partitioning of Nitralase Enzyme from Pseudomonas putida
in Polymer/Salt Aqueous Two Phase System . . . . . . . . . . . . . . . . . . . . . . 93
V. Lokesh Ramana, Iyyaswami Regupathi, B.S. Rashmi
and S. Nainegali Basavaraj
Aqueous Two-Phase (Acetonitrile–Potassium Citrate)
Partitioning of Bovine Serum Albumin: Equilibrium
and Application Studies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 101
Badekar Sagar Dilip, Regupathi Iyyaswami, Basavaraj S. Nainegali
and B.S. Rashmi
Mixed Surfactant Based Reverse Micelle Extraction
of Lactose Peroxidase from Whey . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 111
Sivananth Murugesan, Prudhvi Ambakam, Akshay Naveen,
Aarathi Makkada, Nithin Solanki and Regupathi Iyyaswami
Evaluation of Bio-surfactant on Microbial EOR
Using Sand Packed Column . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 121
A. Rajesh Kanna, Sathyanarayana N. Gummadi and G. Suresh Kumar
Extraction of Polyphenols from Orange Peel by Solvent
Extraction and Microbial Assisted Extraction and Comparison
of Extraction Efficiency . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 129
Prabha Hegde, Pushpa Agrawal and Praveen Kumar Gupta
Enzymatic Concentration of n−3 Polyunsaturated
Fatty Acids from Indian Sardine Oil . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 137
Charanyaa Sampath, N. Anita, B.D. Prasanna
and Iyyaswami Regupathi
High-Throughput Screening of Cell Repellent Substrate
Chemistry for Application in Expanded Bed Adsorption
Chromatography . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 145
Vikas Yelemane, Martin Kangwa and Marcelo Fernández-Lahore
Concentration of C-Phycocyanin from Spirulina platensis
Using Forward Osmosis Membrane Process . . . . . . . . . . . . . . . . . . . . . . . 153
Shoaib A. Sharief and Chetan A. Nayak
Contents ix
Design and Fabrication of Miniature Bubble Column

Bioreactor for Plant Cell Culture . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 163
K. Sandesh, P. Ujwal, Blecita D. Mascarenhas, Gayatri Dhamannavar,
Narmada Kumar and Dakshayini
Industrial Applications of Caffeine Degradation
by Pseudomonas sp. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 171
Swati Sucharita Dash, Sree Ahila Retnadhas, Nameeta Rao
and Sathyanarayana N. Gummadi
Highly Sensitive Determination of Ascorbic Acid,
Dopamine and Uric Acid Using Mesoporous
Nitrogen Containing Carbon . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 179
Anju Joshi and C.N. Tharamani
Nano-aptamer Based Quantitative Detection
of Chloramphenicol . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 187
Richa Sharma, K.V. Ragavan, K.S.M.S. Raghavarao and M.S. Thakur
Influence of Substrate Concentration, Nutrients
and Temperature on the Biodegradation of Toluene
in a Differential Biofilter Reactor . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 197
Suganya Baskaran, Shri Vaishnavi Perumal Selvakumar, Roshni Mohan,
Rhea Mariam John, Swaminathan Detchanamurthy,
Meyyappan Narayanan and Peter Alan Gostomski
Importance of Biomass-Specific Pretreatment Methods
for Effective and Sustainable Utilization of Renewable Resources . . . . . . 207
Yadhu N. Guragain and Praveen V. Vadlani
Medium Optimisation for Maximum Growth/Biomass
Production of Arthrobacter sulfureus for Biodesulphurisation . . . . . . . . . 217
E. Asha Rani, M.B. Saidutta and B.D. Prasanna
Effect of Electrodeposited Copper Thin Film on the Morphology
and Cell Death of E. Coli; an Electron Microscopic Study . . . . . . . . . . . 227
Arun Augustin, Harsha Thaira, K. Udaya Bhat and K. Rajendra Udupa
Optimization of a Glucocorticoid Encapsulated PLGA
Nanoparticles for Inflammatory Diseases . . . . . . . . . . . . . . . . . . . . . . . . . 233
Sriprasad Acharya and Bharath Raja Guru
About the Editors
Dr. Prasanna B.D. is Assistant Professor in the Department of Chemical

Engineering, National Institute of Technology Karnataka. He has produced more
than 25 research publications in the field of biotechnology and two patent appli-
cations. His research areas include fermentation process development: enzymes,
probiotics and nematodes; downstream process technologies; and oenology.
Prof. Sathyanarayana N. Gummadi is Professor in the Department of
Biotechnology, Bhupat and Jyoti Mehta School of Biosciences, Indian Institute of
Technology Madras. His research primarily focuses on understanding the molecular
and physiological basis of survival of microbes under extreme conditions and
exploiting their industrial importance, and on understanding the molecular and
biochemical basis of phospholipid translocation in cellular membranes.
Dr. Praveen V. Vadlani is the Gary and Betty Lortscher Renewable Energy
Associate Professor at the Department of Grain Science and Industry, Kansas State
University, USA. He has more than 30 research publications to his credit and is
currently working in the advanced chemical engineering field.
xi
Selection of Medium and Optimization
of Process Parameters for Melanin
Biosynthesis from Pseudomonas stutzeri
HMGM-7
Harsha Thaira, Shraddha S. Bhosle, Rajmohan Balakrishnan

and Keyur Raval
1 Introduction
Pigments are colorful chemical compounds which absorbs light in the visible
spectrum. The produced color is due to the absorption of energy by a group of
molecules known as chromophore which leads to the excitation of an electron. The
non-absorbed energy which is reflected or refracted is captured by the eye to
generate neural impulses which are then carried to the brain where they could be
decoded as a color (Hari 1994). Pigments are of two types, synthetic pigments and
natural pigments. They are widely used in clothes, cosmetics, furniture, foods,
medicines, and in other products. Based on their structural characteristics, the
natural pigments are classified as Tetrapyrrole derivatives, Isoprenoid derivatives,
Benzopyran derivatives, Quinones and Melanins (Hari 1994). Melanins are
nitrogenous polymeric compounds with indole ring as their monomeric unit but
they are not homopolymers. Generally, they are present as a mixture of macro-
molecules and are responsible for most of the black, brown and gray colorations of
plants, animals, and microorganisms. Melanins are classified into three groups, they
are; Eumelanins which are black or brown pigments and are widely distributed in
vertebrates and invertebrates. It is the most common type of melanin. Pheomelanins
which are yellow to red pigments and are found in mammals and birds. And finally
allomelanins that are present in fungi, seeds and spores.
H. Thaira (&) S.S. Bhosle R. Balakrishnan K. Raval

Department of Chemical Engineering, National Institute of Technology Karnataka,
Mangaluru, Karnataka, India
e-mail: harshathaira@gmail.com
© Springer Science+Business Media Singapore 2016 1

Prasanna B.D. et al. (eds.), Biotechnology and Biochemical Engineering,
DOI 10.1007/978-981-10-1920-3_1
2 H. Thaira et al.
The very first report of melanin production was reported in Pseudomonas

aeruginosa producing pyomelanin (Osawa et al. 1963) followed by Shewanella
colwelliana, Vibrio cholera, and Hyphomonas strain (Kotob et al. 1995; Ruzafa
et al. 1995). The melanin synthesis using homogentisic acid as a precursor was first
reported in Vibrio cholerae, Hyphomonas species and Shewanella colwelliana
(Kotob et al. 1995). The synthesis of melanin and its characterization such as
solubility, free radical nature was initially studied in Proteus mirabilis (Agodi et al.
1996). A novel marine bacterium Alteromonas strain MMB-1, was isolated from
the Mediterranean Sea and its melanin synthesis ability was studied using L-tyrosine
as a precursor (Solano et al. 1997). Melanin production was studied by UV-resistant
mutant of Bacillus thuringiensis subsp. Kurstaki and its UV-protection ability for
insecticidal crystals was tested (Saxena et al. 2002). The thermo tolerant strains of
Bacillus thuringiensis were also reported for melanin production (Ruan et al. 2004).
Another important melanin producing bacterium reported was Marinomonas
mediterranea, which produces black eumelanin from L-tyrosine (Lucas-Elio et al.
2012). A marine bacterium, Pseudomonas stutzeri HMGM-7 producing consider-
able amount of melanin in sea water medium without the addition of L-tyrosine was
also reported (Ganesh Kumar et al. 2013).
The different properties and functions of melanins are being explored for various
applications. The high reactivity of melanin due to the presence of =O, –OH, –NH,
and –COOH groups is the reason behind growing interest in melanin research.
Melanins have a broad spectrum of biological applications. This includes inhibition
of Human Immunodeficiency Virus (HIV) replication, antivenin activity, antimi-
crobial activity and antioxidant activity. Melanins also have physical and chemical
applications. This includes their use in nano particle synthesis, cosmetics and in
lenses.
Inspite of so many potential applications, melanins are not used due to
non-availability of a sustainable and cost effective method of melanin production.
The major sources of melanin are cephalopods, plants and microorganisms.
Melanin obtained from microbes has great advantages over melanin from animals
and plants. Microorganisms do not cause the problems of seasonal variations and
are fast in growth. They also modify themselves according to the medium and
conditions provided. The bacterial sources have been used as a main source of
melanin with immense applications in the field of agriculture, cosmetics and
pharmaceutical industries (Riley 1997), hence its optimization is important for large
scale production. The high production cost and high commercial value of melanin
has given rise to the need of a demanding research for cheaper production methods.
The present study aims to increase the productivity of melanin from an epiphytic
bacterium known as Pseudomonas stutzeri HMGM-7 (MTCC 11712). This bac-
terium was isolated from the branches of sea weed Hypnea musciformis, which
released a black extracellular pigment into the medium. The physical parameters
and nutritional requirements which plays an important role in the production of
melanin were optimized in the present study.
Selection of Medium and Optimization of Process Parameters … 3
2 Materials and Methods
2.1 Microorganisms and Culture Conditions
Nutrient agar slants and plates were prepared for maintenance of the organism
(Pseudomonas stutzeri HMGM-7) obtained from MTCC Chandigarh. Periodical
subcultures were done for maintenance of the viability of the strain. Media volume
used throughout the experiments was 50 ml in 250 ml Erlenmeyer flasks which was
maintained at 37 °C at 150 rpm. Nutrient broth prepared in distilled water was used
for shake flask studies.
2.2 Growth Studies
2 % inoculum volume was added to each flask and incubated at 37 °C and observed
at two different rpm: 150 and 250. During the incubation period of 72 h, the OD of the
samples was measured at 660 nm after every 4 h using appropriate blank. Biomass
dry weight for a volume of 28 ml of the culture was accounted for by centrifuging
(8000 rpm, 8 min, and 40 °C) and drying the pellet for 8 h at 60 °C in a hot air oven.
The supernatant obtained after centrifugation is filter sterilized with 0.45 µm syringe
filters and their absorbance is measured at 400 nm to quantify the melanin.
2.3 Optimization of Nutritional Parameters

for Melanin Production
All the experiments conducted used a constant media volume of 50 ml in 250 ml

Erlenmeyer flasks. NB was used as the basal medium which was incubated at 37 °C
and 150 rpm unless otherwise stated. The effect of different parameters on the
production of melanin such as pH, temperature, carbon sources, nitrogen sources,
trace elements were evaluated by keeping Nutrient broth as the basal medium. The
factorial design of experiments known as ‘one factor at a time’ method was applied
to improve the reproducibility of the experimental results and to optimize the entire
biosynthesis process. The experiments were conducted by varying one factor at a
time and keeping the remaining factors constant.
2.4 Effect of Inoculum Age
The effect of age of the inoculum on the melanin production was studied using
Nutrient Broth medium by using 6, 12, 18 and 32 h old cultures maintained at 37 °C
and 150 rpm.
4 H. Thaira et al.
2.5 Effect of Inoculum Size
0.5, 5, 10, 15 and 20 % inoculum volume were evaluated for melanin production
using Nutrient Broth medium at 37 °C and 150 rpm.
2.6 Effect of Shaking Frequency
The shaking frequency was optimized by incubating the Erlenmeyer flasks in

incubator shaker at 100, 150, 200 and 250 rpm at 37 °C with a shaking diameter of
25 mm.
2.7 Effect of pH
The optimum pH for the production of melanin was determined by setting initial pH
of medium to 4, 5, 6, 7, 8 and 9 by using 0.1 N HCl and 0.1 N NaOH.
2.8 Effect of Temperature
The optimization of temperature for melanin production was carried out by incu-
bating flasks at 30, 35, 37, 40 and 45 °C in incubator shaker.
2.9 Effect of Different Growth Media
Four different growth media, Nutrient Broth (NB), Luria Bertini (LB) Broth,
Bushnell-Haas Broth (BHB) and Trypticase Soy Broth (TSB) were studied for
melanin production by culturing the microorganism in each of the medium at 37 °C
and 150 rpm.
2.10 Effect of Carbon Sources
The effect of various carbon sources was studied by adding each carbon source in
the medium at the concentration (2.5 g/L). The carbon sources evaluated were
glucose, sucrose, lactose, fructose, starch, xylose, maltose, glycerol and dextrose.
2.11 Effect of Organic Nitrogen Sources
To evaluate the various nitrogen sources for maximum melanin, the production
medium was supplemented with each organic nitrogen source at the concentration
(1.5 g/L). The organic nitrogen sources tested were peptone, beef extract, yeast
extract, and tryptone.
2.12 Effect of L-Tyrosine
To study the effect of L-tyrosine on melanin yield, 1.6 g/L of L-tyrosine was added
to TSB and NB and were incubated in an orbital shaker at 150 rpm maintained at
37 °C.
2.13 Extraction and Purification of Melanin
The extraction of melanin was done in accordance with the procedure described for
the purification of melanin from the culture of Aspergillus bridgeri (Kumar et al.
2011) with some minor modifications. In short, the medium was centrifuged at
5000 g for 10 min to remove the biomass. The supernatant collected was then
treated with 1 M NaOH and then autoclaved at 120 °C for 15–20 min. After
autoclaving, the solution was cooled and centrifuged at 5000 g for 10 min to collect
the alkylated supernatant which was then acidified to pH 2 by using 1 N HCl, in
order to precipitate the melanin. The precipitated melanin was collected by cen-
trifuging at 12,000 g for 20 min and washed with distilled water and evaporated to
dryness at room temperature and was stored for further use.
2.14 Characterization Studies
Purified melanin was dissolved in 0.1 N NaOH for UV-visible spectrophotometric

analysis. The solution was scanned from 200 to 900 nm. The absorbance was
measured by using a double beam UV-visible spectrophotometer (Hitachi,
Labomed Inc). The absorption spectrum of the melanin pigment from the
Pseudomonas stutzeri HMGM-7 strain was compared with that of standard mela-
nin. For FT-IR analysis, the pigment and standard melanin were scanned between
the wavenumber range of 4000–400 cm−1 by using KBr discs with an FT-IR
spectrophotometer (IR Prestige, Shimadzu).
6 H. Thaira et al.
3 Results and Discussions
3.1 Effect of Inoculum Age
After evaluating different inoculum age (6, 12, 18, and 32 h) for their melanin
production, the 12 h old inoculum gave the highest melanin concentration
(197 mg/L) at the 48th h. When 6 h old culture was used, the highest melanin
concentration (195.2 mg/L) was attained in the 40th h itself. The maximum bio-
mass yield was obtained for the 32 h old culture (1.434 g/L 12th h) whereas the 6 h
old culture managed to attain its maximum biomass in the 22nd h (1.69 g/L). 1.344
and 1.410 g/L were the highest biomass concentrations for cultures that were 12
and 18 h old respectively. The highest melanin obtained in the control medium was
177 mg/L and biomass attained was 1.107 g/L. Increase in inoculum age thus
results in increase in biomass whereas reduction inoculum age resulted in increase
in melanin production.
3.2 Effect of Inoculum Size
Different inoculum volumes (0.5, 5, 10, 15 and 20 %) were investigated to observe

their effect on melanin production. The highest melanin production of 270.9 mg/L
(32nd h) was achieved when 10 % inoculum was added to 50 ml of Nutrient Broth
medium. Change in inoculum size did not alter the biomass yields, 1.425, 1.4, 1.46,
1.418 and 1.385 g/L being the maximum biomass concentrations obtained at 0.5, 5,
10, 15 and 20 % inoculum sizes respectively. As a result of which, 10 % inoculum
volume was selected to be the optimum inoculum volume to be used for further
investigations. The melanin production was observed after 10th h. The highest
yield of melanin was achieved (270.9 mg/L) at the 32nd h. Thus there was a 53 %
increase in melanin productivity.
3.3 Effect of Shaking Frequency on Biomass Production
Nutrient broth medium was used as the growth medium which was maintained at
37 °C and the shaking frequency was varied to study its effect on the melanin
production. The maximum biomass production obtained for Pseudomonas stutzeri
HMGM-7 was 1.107 g/L at the 8th and 12th h when the organism was allowed to
grow for a period of 72 h at 150 rpm. In the medium prepared in sea water without
adding L-tyrosine, Ganesh Kumar et al. (2013) obtained maximum biomass pro-
duction of 2.5 g/L. There was a substantial increase in the biomass at the increased
shaking frequency of 250 rpm as compared to 150 rpm.
3.4 Effect of Shaking Frequency on Melanin Production
There was a steady increase in the melanin production till the 48th h when the
culture flasks were maintained at 37 °C and 150 rpm, where maximum production
of 0.177 g/L was obtained followed by a decline in its productivity by the end of
the incubation period. The onset of melanin production was significant only after
the 8th h. Ganesh Kumar et al. (2013) obtained the maximum melanin production
of 6.7 g/L at the 60th h in the sea-water medium without L-tyrosine supplemen-
tation. The melanin yield obtained in this study is comparatively lesser since
Nutrient broth medium prepared in distilled water was used instead of sea-water
medium which is known to be conducive for marine species like Pseudomonas.
Melanin production at 37 °C and 250 rpm increased till the 32nd h, where maxi-
mum production of 0.164 g/L was obtained followed by a decline in its produc-
tivity by the end of the incubation period. When L-tyrosine was used as a sole
carbon and nitrogen source into the melanin production media containing KH2PO4,
NaCl and MgSO47H2O made in Distilled water by Kurian et al. (2014),
Pseudomonas stutzeri Strain BTCZ10 produced 47.47 ± 0.2 μg/mL of melanin.
Thus, in present study it was found that increase in shaking frequency from 150 to
250 rpm caused a decrease in melanin productivity.
3.5 Effect of Growth Media
Nutrient Broth (NB), Luria Bertini (LB) broth, Bushnell-Haas broth (BHB) and
Trypticase Soy broth (TSB) were the four different growth media that were utilized
in this study to screen for the medium that produced more amount of melanin. The
highest melanin yield, 167.38 mg/L was obtained at the 32nd h in NB, followed by
TSB and LB, whereas BHB had very low melanin production (Fig. 1). None of the
additional nutrients could affect a significant rise in melanin production when
compared to NB alone.
Fig. 1 Melanin productions 180

for different growth media 160
140
Melanin (mg/l)
120
100
80
60
40
20
0
NB LB BHB TSB
Growth media
8 H. Thaira et al.
3.6 Melanin Yield Before and After Optimization
The highest yield of melanin concentration, 0.27 g/L, was obtained in nutrient broth
at 32 h. The yield was 1.53 times higher than the melanin obtained before opti-
mization, 0.177 g/L at 48 h (Fig. 2). The increase in the productivity of melanin
after selection of suitable medium and optimization of process parameters was
128.73 %. The melanin yield obtained can be further enhanced by statistical
optimization and evaluating the effect of different combinations of nutrients like
carbon and nitrogen sources and trace elements and further scale up of the process
can be done.
3.7 UV-Visible Absorption Spectra and FTIR Analysis
The spectral property of the pigment was analyzed to confirm the nature of the
pigment. Its UV spectrum was found to be similar to that of synthetic melanin
which exhibited absorption peak of maxima between 200 and 300 nm (Fig. 3).
0.3
Melanin g/L
0.2
0.1
0
Before optimization After optimization
Fig. 2 Melanin yield before and after optimization
0.8
Absorbance
0.6
0.4
0.2
0
200 300 400 500 600 700 800 900
Wavelength (nm)
Fig. 3 The UV absorption spectrum of melanin produced by Pseudomonas stutzeri HMGM-7

(a)
92
%T
90
88
3847.99 979.84
86
84 1950.03
82
2765.92
3518.16 2330.01
80
1292.31
3188.33
78 1712.79
1614.42
76
4000 3600 3200 2800 2400 2000 1800 1600 1400 1200 1000 800 600 400
(b) MS-1R) 1/cm
92
%T
90
88
86
84 1014.56
1936.53
82
1435.04
80
3512.37 1622.13
78
2328.08
76 3188.33 2916.37
4000 3600 3200 2800 2400 2000 1800 1600 1400 1200 1000 800 600 400
MS-2(R) 1/cm
Fig. 4 a FTIR spectra of synthetic melanin, b FTIR spectra of melanin obtained from
Pseudomonas stutzeri HMGM-7
It showed a high degree of similarity, when the main absorption peaks in the
FT-IR spectra of the synthetic melanin (Sigma Aldrich) and melanin obtained from
Pseudomonas stutzeri HMGM-7 were compared (Fig. 4).
4 Conclusion
Many bacterial sources have been used widely as a major source of melanin in
recent years and hence its optimization is important for large scale production.
Pseudomonas stutzeri HMGM-7 used in this investigation has a competence to
produce melanin under various process conditions and in different growth medium
and can prove to be of commercial use for the large scale industrial production.
Physical parameters and nutritional requirements often determine the melanin
productivity that can be obtained from bacterial sources, and hence these param-
eters were evaluated in the current study. Pseudomonas stutzeri HMGM-7 was able
10 H. Thaira et al.
to produce its highest melanin yield within shorter incubation period (32 h) for
most of the studies that were conducted by varying different nutritional and process
parameters. The optimum inoculum age and size that produced higher melanin
yield was found to be 6 h and 10 % respectively. Nutrient broth along with three
different media (TSB, BHB, LB) were evaluated for its melanin production, from
which Nutrient broth proved to be the best, 0.27 g/L being the highest melanin
yield produced across all the experiments conducted. There was no significant
increase in the melanin production when the media was supplemented with addi-
tional nutrients.
References
Agodi, A., Stefani, S., Corsaro, C., Campanile, F., Gribaldo, S., Sichel, G.: Study references: of a
melanic pigment of Proteus mirabilis. Res. Microbiol. 147(3), 167–174 (1996)
Ganesh Kumar, C., Mongolla, P., Pombala, S., Kamle, A., Joseph, J.: Physicochemical
characterization and antioxidant activity of melanin from a novel strain of Aspergillus
bridgeri ICTF-201. Lett. Appl. Microbiol. 53(3), 350–358 (2011)
Ganesh Kumar, C., Sahu, N., Narender Reddy, G., Prasad, R.B., Nagesh, N., Kamal, A.:
Production of melanin pigment from Pseudomonas stutzeri isolated from red seaweed Hypnea
musciformis. Lett. Appl. Microbiol. 57(4), 295–302 (2013)
Hari, R.K., Patel, T.R., Martin, A.M.: An overview of pigment production in biological systems:
functions, biosynthesis, and applications in food industry. Food Rev. Int. 10(1), 49–70 (1994)
Kotob, S.I., Coon, S.L., Quintero, E.J., Weiner, R.M.: Homogentisic acid is the primary precursor
of melanin synthesis in Vibrio cholerae, a Hyphomonas strain, and Shewanella colwelliana.
Appl. Environ. Microbiol. 61(4), 1620–1622 (1995)
Kurian, N.K., Nair, H.P., Bhat, S.G.: Melanin producing Pseudomonas stutzeri BTCZ10 from
marine sediment at 96 m depth (Sagar Sampada cruise #305). Int. J. Curr. Biotechnol. 2(5), 6–
11 (2014)
Lucas-Elio, P., Goodwin, L., Woyke, T., Pitluck, S., Nolan, M., Kyrpides, N.C., Sanchez-Amat,
A.: Complete genome sequence of the melanogenic marine bacterium Marinomonas
mediterranea type strain (MMB-1(T)). Stand Genomic Sci. 6(1), 63–73 (2012)
Osawa, S., Yabuuchi, E., Narano, Y., Nakata, M., Kosono, Y., Takashina, K., Tanabe, T.: Pigment
production by Pseudomonas aeruginosa on glutamic acid medium and gel filtration of the
culture fluid filtrate. Jpn. J. Microbiol. 7, 87–95 (1963)
Riley, P.: Melanin. Int. J. Biochem. Cell Biol. 29 (1997)
Ruan, L., Yu, Z., Fang, B., He, W., Wang, Y., Shen, P.: Melanin pigment formation and increased
UV resistance in Bacillus thuringiensis following high temperature induction. Syst. Appl.
Microbiol. 27(3), 286–289 (2004)
Ruzafa, C., Sanchez-Amat, A., Solano, F.: Characterization of the melanogenic system in Vibrio
cholerae, ATCC 14035. Pigment Cell Res. 8(3), 147–152 (1995)
Saxena, D., Ben-Dov, E., Manasherob, R., Barak, Z., Boussiba, S., Zaritsky, A.: A UV tolerant
mutant of Bacillus thuringiensis subsp. kurstaki producing melanin. Curr. Microbiol. 44(1),
25–30 (2002)
Solano, F., Garcia, E., Perez, D., Sanchez-Amat, A.: Isolation and characterization of strain
MMB-1 (CECT 4803), a novel melanogenic marine bacterium. Appl. Environ. Microbiol. 63
(9), 3499–3506 (1997)
Unstructured Kinetic Modeling
of Glutathione Production
by Saccharomyces cerevisiae NCIM 3345
Abhinandan Dhavale, Atul Vhanmarathi, Shrinivas Deshmukh

and Seema Dabeer
1 Introduction
Glutathione (GSH) is a biologically active tri-peptide consisting of L-glutamate,

L-cysteine, and glycine. It is an abundant and ubiquitous low-molecular-mass thiol
in living tissues. GSH is an important component in the cellular mechanisms that
protect against UV (Sollod et al. 1992), heavy metals (Perego et al. 1997), and
many exogenous organic substances (Goto et al. 1995). GSH also plays a very
critical role in sacrificial defensive mechanism against oxidative damage in
organisms (Berhane et al. 1994). It is now widely used as a medicine, in health
foods to prevent hepatotoxicity induced by acetaminophen, vinyl ethers or bro-
mobenzene in animals and in the cosmetic industry. Glutathione majorly functions
as an antioxidant, an immunity booster, and as a detoxifier (Pastore et al. 2003).
Recently several studies have described GSH producing yeast strains, which are
commonly used for commercial production such as Saccharomyces cerevisiae and
Candida utilis (Sakato and Tanaka 1992; Wei et al. 2003a, b). Many studies have
tried to improve the GSH production by supplementing certain materials, such as
glucose, minerals, ATP, and phosphorus to the culture medium (Li et al. 1998). The
studies have also been reported for investigating the different concentration of
amino acids and related compounds such as cysteine on glutathione production
(Alfafara et al. 1992). Finally, optimization of fermentation process parameters and
conditions were achieved so as to enhance the GSH production using S. cerevisiae
(Cha et al. 2004).
A. Dhavale (&) A. Vhanmarathi S. Deshmukh S. Dabeer

K.I.T.’s College of Engineering, Kolhapur 416006, Maharashtra, India
e-mail: abhibiocpd@gmail.com

DOI 10.1007/978-981-10-1920-3_2
12 A. Dhavale et al.
As mentioned above, many kinds of literature provide information about the

optimization of the fermentation process for GSH production using S. cerevisiae,
but very few references in the literature provide information about kinetic modeling
of the production processes. It is essential to have an in-depth understanding of the
fermentation process so as to establish better controls at commercial scale pro-
duction to achieve a consistent and quality product. The already known and well-
established kinetics models help develop these strategies (Ghaly et al. 2005). In the
present study GSH, production was carried out under the optimal condition and
various renowned unstructured kinetic models were used to understand the kinetics
of GSH production.
2.1 Microorganism
Saccharomyces cerevisiae NCIM 3345 was procured from NCL Pune, India. While
all the media components (LR grade) were bought from Hi-media Ltd, Mumbai,
India.
2.2 Culture Maintenance
Saccharomyces cerevisiae NCIM 3345 stock culture was maintained using nutrient
media containing; Peptone 10 (g/L), Beef extract 3 (g/L), NaCl 5 (g/L). This culture
was used to inoculate seed medium with working volume 100 mL containing
Glucose 1 g, Peptone 0.5 g, Yeast extract 0.3 g and Malt extract 0.3 g. Seed flask
i.e. inoculum was incubated at 30 °C for 24 h.
2.3 Fermentation
The GSH formation using Saccharomyces cerevisiae NCIM 3345 was achieved in
the same 100 mL production medium in 250 mL Erlenmeyer flask containing these
components in (g/L): Glucose 30, Yeast extract 30, KH2PO4 0.6 and L-cysteine 0.6.
The pH of media was set to 5.5 and further subjected to sterilization using autoclave
at 121 °C for 30 min. Post sterilization, the flasks were inoculated with 8 % (v/v) of
matured seed obtained from seed flask. To achieve desired growth and product
formation, production flasks were incubated in an orbital incubator at 30 °C with a
speed of 150 rpm for 16 h. Sampling was performed as per the protocol for esti-
mation of biomass growth, glutathione production, and glucose utilization. All the
analysis was carried out in triplicate.
Unstructured Kinetic Modeling of Glutathione Production … 13
2.4 Biomass Determination
The concentration of cell biomass was obtained by calculating dry cell weight
(DCW) of the cells. Eight mL broth was taken in pre-weighted centrifuge tubes and
was subjected to centrifugation at 5000 rpm for 10 min at room temperature.
Supernatant was discarded and the pellet was washed using distilled water (twice).
The tubes containing pellets were further kept in hot air oven at 100 °C for drying.
The weight of each tube was checked after 24 h of drying, ensuring all moisture had
evaporated.
2.5 Glucose Determination
To calculate the residual substrate concentration i.e. glucose in the production flask,
the 3,5-Dinitrosalicylic acid method was used (Miller 1959).
2.6 Glutathione (GSH) Determination
After 16 h of fermentation, broth was subjected to centrifugation to achieve bio-

mass pellets, which were further suspended in 0.2 M phosphate buffer (pH 7.2) and
disrupted by sonication. The glutathione concentration in the supernatant achieved
after centrifugation was measured using published methods (Cohn and Lyle 1966),
such as measuring the absorbance maxima (λmax) at 412 nm using a UV spec-
trophotometer (Thermo-Scientific CHEMITO 215D). A standard curve was gen-
erated by preparing samples of different known concentrations of GSH, which was
used to determine specimen concentrations.
2.7 Fermentation Description Using Unstructured

Kinetics Models
2.7.1 Biomass Growth
Various unstructured models had characterized the cell culture growth patterns in
fermentation kinetics. In an unstructured model, the total biomass concentration
(whole quantity) is considered as a single component in representations
(Chandrasekhar et al. 1999). Many mathematical equations and theories are avail-
able in literature which can explain the sigmoidal relationship between the specific
growth rate of cells and key limiting substrate used for biomass growth. In current
study, the most suitable kinetic model tested for describing cell growth was logistic
equation.

dX X
¼ l0 1 X ð1Þ
dt Xmax
where l0 are initial specific growth rate (h−1) and Xmax maximum attainable bio-
mass concentration (g/L), which on integration, with the initial condition that at
t = 0, X = X0, yields
X X0
ln ¼ lmax t þ ln ð2Þ
ðX Xmax Þ ðXmax XÞ
On rearrangement, and explicit function for biomass is obtained as:
X0 eðl0 tÞ
Xt ¼ ð3Þ
1 XXmax
0
ð1 eðl0 tÞ Þ
2.7.2 Glutathione Production Kinetics
The GSH production kinetics was analyzed according to the Luedeking-Piret

equation. This model illustrates that the rate of product formation is mainly
dependent on; (1) the desired cell mass for product formation (X) and (2) the rate at
which biomass is increasing with respect to time (dX/dt) in a linear fashion.
dP dX
¼a þ bX ð4Þ
dt dt
In Eq. (4), α and β are the constants determined experimentally, which provides
the basis for classification of microbial metabolites into growth associated (β = 0),
non-growth associated (α = 0), and mixed (α ≠ 0 and β ≠ 0). Integration of Eq. (4)
using Eq. (3) and initial conditions, (X0, P0) yields,
Pt ¼ P0 þ aAðtÞ þ bBðtÞ ð5Þ
In Eq. (5) A (t) and B (t) as follows,

2 3
l0 t

X e Xmax X0
AðtÞ ¼ 4 15 l0 t
0
and BðtÞ ¼ ln 1 ð1 e Þ
1 XXmax
0
ð 1 e l0 t Þ l0 Xmax
Here, Eq. (5) can be used to calculate approx. GSH concentration produced at
any given time (t) in fermentation.
2.7.3 Glucose Consumption Kinetics
The modified Luedeking-Piret equation is used to describe the glucose consumption

kinetics in yeast culture. This model consider that, the substrate utilized by cells
mainly functions for biomass and product formation and maintenance activities in
cell (Weiss and Ollis 1980).
dS 1 dX 1 dP
¼ Ke X ð6Þ
dt YX=S dt YP=S dt
Substituting rfp = −Yp/s rfs values in Eq. (6) and rearranging,
dS dX
¼ c gX ð7Þ
dt dt
where rfp is the rate of product formation, rfs is the rate substrate utilization
1 a b
And cðgS=gXÞ ¼ þ gðgS=gX:hÞ ¼ þ Ke
YX=S YP=S YP=S
Equation (7) is the modified Luedeking-Piret equation for substrate utilization

kinetics. Rearranging Eq. (7)
dS g
¼ cþ ð8Þ
dt l
Integrating Eq. (8) with initial conditions X = X0 (t = 0) and S = S0 (t = o) give
St ¼ S0 cmðtÞ gnðtÞ ð9Þ
where
2 3
l0 t
X e
mðtÞ ¼ 4 0 15
X0 l
1 Xmax ð1 e Þ0 t
and

Xmax X0
nðtÞ ¼ ln 1 ð 1 e l0 t Þ
l0 Xmax
This Eq. (9) can be used to obtain the residual substrate concentration in the
production media.
3 Results and Discussion
3.1 Glutathione Production (Product Formation Kinetics)
The GSH production kinetics using S. cerevisiae NCIM 3345 was studied with the
optimized medium and process parameters; temp at 30 °C, media pH 5.5 and
mixing at 150 rpm. Figure 1, illustrates the kinetic study profiles of biomass for-
mation, GSH production, and substrate consumption with respect to time using the
optimized media and process parameters.
The rate of GSH production was found to be significantly increasing along with
the exponential growth phase of micro-organisms proving that the GSH is being the
growth associated product. The highest GSH concentration obtained was
157.5 mg/L in 16 h of the fermentation period. After 16th h, production reduces
slowly. This might be due to the production of ethanol. GSH production and
accumulation in yeast cells are favorable in lower ethanol concentration, while
higher ethanol concentration inhibits the glutathione production. The maximum
biomass concentration achieved was 3.48 g/L in 16 h duration as stationary phase
hadn’t contributed towards the increase in biomass concentration. First 4 h duration
was an adaptation phase of cells to operating conditions and optimized production
media. Next 6 h duration in fermentation was characterized as an exponential
growth phase of the microorganism. The rate of product formation and substrate
consumption were observed to be highest in this period. Yeast cells had consumed
almost 92 % of the glucose till the fermentation ends and maximum GSH pro-
duction was obtained at this stage correspondingly. The mathematical expression of
obtained data from experimentation concluded that, unstructured kinetic models
have the ability to explain and deliver process understating of the fermentation
process for Glutathione production.
3.5
30
Cell mass concentration(g/lit)
3.0 150
Glucose concentration(g/lit)
GSH(mg/lit)
2.5
2.0 20
1.5
100
1.0
10
0.5
0.0
0 2 4 6 8 10 12 14 16
Fermentation Time(h)
Fig. 1 Fermentation profile of cell mass concentration (filled diamond), glucose concentration
(filled triangle) and GSH production (filled square)
3.2 Unstructured Kinetic Models
The models used in this study had provided a good estimation of predictive
capability despite having very limited cellular mechanism information. Following
Table 1, gives the calculated values for the estimated kinetic parameters used in
unstructured models.
The relationship between actual versus predicted values is explained briefly
using statistical tools such as regression coefficient (R2) values for biomass growth,
GSH production and glucose utilization profiles observed in fermentation. The
regression coefficient measures the strength of linear relationship between
the experimental (Actual) and predicted values obtained using the kinetic models.
The linear relationship modeled by the straight line illustrates the steady increase or
decrease. In Fig. 2a unbroken line shows estimated the response of Logistic model
and broken line experimental response. Figure 2b gives a comparison of actual
Table 1 Estimated kinetic Parameter Value

model parameters for GSH
production µ0 (1/h) 0.37
Xmax (g/L) 5.60
X0 (g/L) 0.88
α (gP/gX) 8.95
β (gP/gX.h) 2.04
γ (gS/gX) 4.10
η (gS/gX.h) 0.52
Yx/s (g/g) 0.15
Yp/s (mg/g) 4.09
Yp/x (mg/g) 27.76
Ke (g/g.h) 0.018
(a) (b)
3.5
Logistic
Experimental
3
2.5 3.5
R2=0.9972
concentarion (g/lit)
3.0
cell mas concentration(g/lit)
2
Cell mass
Logistic model predicted
2.5
1.5 2.0
1.5
1
1.0
0.5
0.5
0.0
0
0 2 4 6 8 10 12 14 16 0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5
Fermentation Time (h) Experimental Cell mass concentration(g/lit)
Fig. 2 a Experimental (dashed line) and model prediction (dotted line) biomass concentration.
b Comparison of actual versus predicted biomass concentration by Logistic mode
versus predicted values obtained for biomass concentration with (R2 = 0.9972).
Figure 3a show response of Luedeking-Piret model for GSH production and
Fig. 3b show comparison between experimental and model predicted GSH pro-
duction with (R2 = 0.9814). In Fig. 4a response of Modified Luedeking-Piret for
glucose consumption and comparison of experimental and model predicted con-
sumption shown in Fig. 4b. (R2 = 0.9535). As observed in figures, product for-
mation rate was maximum in the exponential growth phase of the cells i.e. (‘α’ ≫
than ‘β’) thus, the product glutathione was considered as primary metabolite due to
its growth associated production during the fermentation process.
(a) (b)
180 180 Ludeking-Piret model
Luedeking-Piret Model
Experimentall
160
R2=0.9814
160
Predicted GSH (mg/L)
140
140
GSH (mg/L)
120
120
100
100
80
80 60
100 150
60
0 2 4 6 8 10 12 14 16 Experimental GSH (mg/L)
Fermentation Time (h)
Fig. 3 a Experimental (dashed line) and model prediction (dotted line) of GSH. b Comparison of
experimental and predicted GSH by Luedeking-Piret model
(a) (b)
35
Modified Luedeking-Piret Model
Experimental 35
30
R2=0.9535
model predicted glucose concentration(g/lit)
30
25
concentration (g/lit)
25
Modified Luedeking-Piret
Glucose
20 20
15
15
10
10
5
5
0
0 10 20 30
0 2 4 6 8 10 12 14 16
Experimental glucose concentration(g/lit)
Fermentation Time (h)
Fig. 4 a Experimental (dashed line) and model prediction (dotted line) Glucose consumption.
b Comparison of experimental and predicted glucose consumption by modified Luedeking-Piret
model
4 Conclusion
The mathematical modeling and expression of unstructured kinetics models were

found to be relatively simple and easy. The greater prediction capability of the
models had made them highly flexible for applying in any fermentation processes.
In the present study, the models like Logistic equations for biomass growth,
Luedeking-Piret model for GSH production and modified Luedeking-Piret model
for glucose consumption i.e. substrate utilization were found best suitable to
describe the glutathione production process using Saccharomyces cerevisiae NCIM
3345. All the models tested were able to predict profiles with higher R2 values. The
parameter of Luedeking-Piret model clearly indicated that GSH production is
strictly growth associated.
Acknowledgments We are very much grateful that, department of biotechnology at KIT’s

College Of Engineering provided us an opportunity to utilize their facilities to conduct this
research work as expected.
References
Alfafara, C.G., Kanda, A., Shioi, T., Shimizu, H., Shioya, S., Suga, K.: Effect of amino acids on
glutathione production by Saccharomyces cerevisiae. Appl. Microbiol. Biotechnol. 36,
538–540 (1992)
Berhane, K., Widersten, M., Engstrom, A., Kozarich, J.W., Mannervik, B.: Detoxication of base
propenals and other, unsaturated aldehyde products of radical reactions and lipid peroxidation
by human glutathione transferase. Proc. Natl. Acad. Sci. U S A. 91, 1480–1484 (1994)
Cha, J.Y., Park, J.C., Jeon, B.S., Lee, Y.C., Cho, Y.S.: Optimal fermentation conditions for
enhanced glutathione production by Saccharomyces cerevisiae FF-8. J. Microbiol. 42, 51–55
(2004)
Chandrasekhar, K., Felse, P.A., Panda, T.: Optimization of temperature and initial pH and kinetic
analysis of tartaric acid production by Gluconobacter suboxydans. Bioprocess. Eng. 20,
203–207 (1999)
Cohn, V.H., Lyle, J.: A fluorometric assay for glutathione. Anal. Biochem. 14, 434–440 (1966)
Ghaly, A.E., Kamal, M., Correia, L.R.: Kinetic modeling of continuously submerged fermentation
of cheese whey for single cell protein production. Bioresour. Technol. 96, 1143–1152 (2005)
Goto, S., Yoshida, K., Morikawa, T., Urata, Y., Suzuki, K., Kondo, T.: Augmentation of transport
for cisplatin-glutathione adduct in cisplatin-resistant cancer cells. Cancer Res. 55, 4297–4301
(1995)
Li, Y., Chen, J., Zhou, N., Fu, W., Ruan, W., Lun, S.: Effects of amino acids and yeast extract on
glutathione production. Chin. J. Pharm. 29, 537–542 (1998)
Miller, G.L.: Use of Dinitrosalicylic acid reagent for determination of reducing sugar. Anal. Chem.
31, 426–428 (1959)
Pastore, A., Federici, G., Bertini, E., Piemonte, F.: Analysis of glutathione: implication in redox
and detoxification. Clin. Cham. Acta. 33, 19–39 (2003)
Perego, P., Weghe, J.V., Ow, D.W., Howell, D.W.: The role of determinants of cadmium
sensitivity in the tolerance of Schizosaccharomyces pombe to cisplatin. Mol. Pharmacol. 51,
12–18 (1997)
Sakato, K., Tanaka, H.: Advanced control of glutathione fermentation process. Biotechnol.
Bioeng. 40, 904–912 (1992)
Sollod, C.C., Jenns, A.E., Daub, M.E.: Cell surface redox potential as a mechanism of defense
against photosensitizers in fungi. Appl. Environ. Microbiol. 58, 444–449 (1992)
Wei, G., Li, Y., Chen, J.: Effect of surfactants on the extracellular accumulation of glutathione by
Saccharomyces cerevisiae. Process Biochem. 38, 1133–1138 (2003a)
Wei, G., Li, Y., Chen, J.: Application of a two-stage temperature control strategy for enhanced
glutathione production in the batch fermentation by Candida utilis. Biotechnol. Lett. 25,
887–890 (2003b)
Weiss, R.M., Ollis, D.F.: Extracellular microbial polysaccharides I. Substrate, biomass and product
kinetic equations for batch Xanthan gum fermentation. Biotechnol. Bioeng. 22, 859–873
(1980)
Statistical Optimization of Lactic Acid
Extraction from Fermentation Broth
Using Emulsion Liquid Membrane
Avinash Thakur, Parmjit Singh Panesar and Manohar Singh Saini
1 Introduction
Lactic acid (CH3CHOHCOOH) first refined in 1780 by the Swedish chemist

Scheele from sour milk is utilized in the manufacturing of a wide range of industrial
compounds as acidulant, flavor and preservative for food, textile, pharmaceuticals,
cosmetics and chemical industries etc. and a variety of industrially important
chemicals such as propylene oxide, propylene glycol, 2, 3-pentanedione and lactate
esters can be easily produced (Se-Kwon et al. 2012). It is also polymerized to
produce highly demanded biodegradable poly-lactic acid (PLA) (Mohamed et al.
2011; Pattana et al. 2010).
Lactic acid can be obtained either by chemical synthesis or by fermentation. The
chemical synthesis route gives only a racemic mixture of L- and D-lactic acid from
petrochemical resources (a major cost-contributor). While stereoisomer of lactic
acid can be produced by a fermentation process from renewable resources by
A. Thakur (&)
Department of Chemical Engineering, Sant Longowal Institute of Engineering
and Technology, Longowal, Sangrur 148106, Punjab, India
e-mail: avin_thakur2@yahoo.com
P.S. Panesar
Biotechnology Research Laboratory, Department of Food Engineering
and Technology, Sant Longowal Institute of Engineering and Technology,
Longowal, Sangrur 148106, Punjab, India
e-mail: pspanesarrr@yahoo.com
M.S. Saini
Guru Nanak Dev Engineering College, Ludhiana, Punjab, India
e-mail: mssaini58@hotmail.com

DOI 10.1007/978-981-10-1920-3_3
22 A. Thakur et al.
choosing the appropriate microorganism and offers several other advantages over
chemical synthesis such as, low cost of substrates, a low production temperature
and low energy consumption (Niju et al. 2004). Worldwide about 90 % of lactic
acid is obtained by fermentation route (Joglekar 2006). Both bacterial and fungal
strains can be utilized for lactic acid production. But normally fungal strains grow
very slowly and exhibits relatively lower productivity (Se-Kwon et al. 2012).
For the manufacturing of lactic acid by fermentation, inexpensive renewable raw
materials, such as molasses, starch (corn starch, wheat starch, potato starch) and
lignocellulose (corn cobs and woody materials) have been utilized, tested or pro-
posed by various investigators. Cane molasses (approximately 45–60 % (w/w) total
sugars), is an excellent source of carbohydrates along with other essential nutrients
and stimulates cell growth (Ke and Ping 2014; Umar et al. 2012; Dan et al. 2010).
Cell immobilization is an ideal approach for getting improved fermentation
performance since immobilized cells have numerous advantages over free cell
(Mrinal et al. 2014). Due to the simplicity and non-toxic character, entrapment in
calcium/sodium alginate gel has been frequently used immobilization method
(Min-Tian et al. 2009; Farshid et al. 2011).
The recovery or separation of lactic acid from the fermentation broth is very
complex and cumbersome process since other impurities such as residual sugar,
impurity protein, pigment, mycelium and carbohydrates also coexists along with the
produced acid (Tayyba et al. 2014; Xiaolin et al. 2012). The possibility to reduce
cost also causes interest in lactic acid removal (Lucas 2013). Conventional purifi-
cation technique consists of a numerous downstream treatment steps which are not
environmental benign and economically favorable (Dey and Pal 2012; Xiaolin et al.
2012). An economic separation method for the lactic acid recovery from fermen-
tation broth is required to compete with a synthetic process (Sushil et al. 2011).
Emulsion liquid membrane (ELM) technology, initially proposed by Li in 1968
(Jia et al. 2013) is a simplified extraction process with high extraction efficiency
which combines both extraction and stripping stage to undertake simultaneously
purification and concentration. ELM processes are simple, consume relatively low
energy compared to other separation processes, provides high selectivity and
enables very high and rapid mass transfer rate with a high degree of effectiveness as
it offers large surface area per unit volume (Jia et al. 2013; Goyal et al. 2011). The
enhanced selectivity can be obtained by addition of a carrier/extractant to the
membrane phase (Julio et al. 2010). ELM could be cheaper (≤40 %) in comparison
to other solvent extraction methods (Mokhtari and Pourabdollah 2012). ELM has
been successfully employed by the various researchers for the separation of sugars,
organic acids, proteins, amino acids and antibiotics (Julio et al. 2010).
Keeping in view the various advantages offered by ELM, its performance for
lactic acid extraction from diluted and centrifuged fermentation broth has been
studied and response surface methodology, a collection of statistical and mathe-
matical techniques is useful for developing, improving and optimizing processes
and was employed for process optimization of the process variables for maximizing
the lactic acid extraction from diluted and centrifuged fermentation broth.
Statistical Optimization of Lactic Acid Extraction … 23
2.1 Lactic Acid Production by Fermentation
2.1.1 Procurement of Microbial Cultures

and Cell Culture Preparation
The microbial strain Lb. casei MTCC 1423 utilized in present study was procured
from Microbial Type Culture Collection (MTCC), Institute of Microbial
Technology (IMTECH), Chandigarh, India. Freeze-dried microbes were cultured
for 20 h at 37 °C (1 %, w/v) in sterile MRS (de Mann Rogosa Sharpe) broth. The
obtained culture was then sub-cultured (37 °C, 20 h) twice in sterile MRS broth
using l % (w/v) of inoculums for activation and adaptation.
2.1.2 Molasses, Corn Steep Liquor and Chemicals
Sugarcane molasses, the byproduct of cane sugar plants, was procured from
Bhagwanpura Sugar Mill Limited Dhuri, Punjab, India. Corn steep liquor (CSL),
waste water was procured from Sukhjeet Industries, Phagwara, Punjab, India.
Sugarcane molasses and corn steep liquor were stored at 4 °C and were used
without pretreatment. All the chemicals used during present study for experimental
investigations were of analytical grade (HPLC grade for HPLC analysis).
2.1.3 Fermentation Media and Immobilization of Cells
Fermentation medium (50 mL) having molasses sugar (186.5 gm/L), MnSO4
(20 mg/L), CaCO3 (25 %, w/w) with respect to sugar content and CSL (2.5 %, v/v)
in Erlenmeyer flasks was sterilized (121 °C, 15 psi for 20 min) before the fer-
mentation. The procedure adopted by Ani et al. (2006) and Imdad et al. (2014) was
used for the entrapment of Lb. casei MTCC 1423 cells. The bead coating was
employed as described by Klinkenberg et al. (2010).
2.2 Emulsion Liquid Membrane
2.2.1 Membrane Preparation
For preliminary stability analysis and lactic acid extraction efficiency of ELM (w/o/w)
in the presence of molasses in the external phase, the emulsion was obtained by
mixing the internal stripping phase with membrane (organic) phase. The membrane
phase contained 4.5 % (v/v) Span 80 as stabilizer, 0–10 % (v/v) tri-n- octyl amine
(TOA), as carrier in n-hexane and 2 % (v/v) cyclohexanone (Prasad et al. 2010) (to
24 A. Thakur et al.
reduce water co-transportation) was stirred at 200 rpm for 2 min using a magnetic
stirrer. To this homogeneous membrane phase, 0.1 M stripping phase (Na2CO3
solution) with 1:1 (v/v) internal to organic phase ratio was added drop wise and was
stirred at 2000 rpm using a four blade impeller stirrer (Model: IKA RW 20, Digital
Dual Range Mixer from Cole-Parmer, India) for 20 min at room temperature
(25 ± 2 °C) to form a stable liquid emulsion membrane.
2.2.2 Emulsion Stability and Lactic Acid Extraction

with Molasses in External Phase
For stability analysis, the formed emulsions were poured into 100 mL of diluted
centrifuged molasses solution in a 250 mL beaker (treat ratio = 2) at a low stirring
speed. The molasses was diluted and centrifuged at a 7000 rpm for 10 min to make
the conditions similar to that of after the fermentation of molasses by immobilized
cells. The external phase pH was measured after different interval of experimental
contact time. Synthetic lactic acid (0.05 M) was added in the diluted centrifuged
molasses solution to check ηext. with 0.2 M Na2CO3 in internal phase of ELM.
2.3 Lactic Acid Extraction from Fermentation Broth
Keeping in view the stability of the emulsion in molasses solutions, an optimized

formulation of water in oil emulsion obtained previous experimentation for maxi-
mizing the lactic acid extraction efficiency from aqueous lactic acid solution with
slight modification was used for batch extraction of lactic acid after fermentation by
double coated (first with chitosan and then by sodium alginate) immobilized
Lactobacillus (Lb.) casei MTCC 1423 cells. The membrane phase was consisted of
span-80 concentration (4.5 %, v/v), TOA (4.75 %, v/v) and 2 % (v/v) cyclohex-
anone dissolved in n-hexane. The water in oil emulsion was prepared by mixing of
membrane phase (20 mL) with 0.2 M Na2CO3 (20 mL) at 2000 rpm for 20 min. For
the extraction experiments, the fermentation broth containing lactic acid produced by
Lb. casei MTCC 1423 cells was centrifuged at 6700 rpm for 10 min and analyzed for
lactic acid concentration after adding the concentrated sulphuric acid to release the
lactic acid and then diluted to obtain the desired concentration of lactic acid (0.06 M).
The extraction was carried out at 200 rpm for 13.5 min with a treat ratio of 2 (v/v).
2.4 Estimation of Total Sugar, Lactic Acid

Concentration and pH
The total sugar concentration was determined according to the phenol sulfuric acid
method (Dubois et al.1996). The lactic acid concentration measurement was carried
out by the HPLC method (Ginjupalli et al. 2013) using Shimadzu LC 2010 CHT
(Shimadzu Corporation, Kyoto, Japan) equipped with low pressure quaternary
gradient pump, dual wavelength UV-Visible detector and column oven. pH was
measured using Eutech pH 5+.
2.5 Calculation of Emulsion Breakage (%)
The emulsion breakage (%) λ (percentage of stripping phase reagent leaked into the
external phase) was calculated using pH method as (Hongpu et al. 2013)
Ms VE ð10pH14 10pH0 14 Þ

Emulsion breakageð%Þ; k ¼ 100 ð1Þ
cs0 Vs
where Ms is the molar mass of stripping reagent, pH0 and pH is initial pH of

external phase and after certain contact time respectively. cs0 is initial stripping
reagent concentration in stripping phase.
2.6 Calculation of Lactic Acid Extraction
The extraction efficiency had been calculated using the equation:
Cl0: Cls
Extraction efficiency; gext ¼ 100 ð2Þ
Cl0
where Cl0 and Cls is the lactic acid concentration in external phase initially at time
t = 0, and after contacting the aqueous phase with emulsion liquid membrane for
desired time respectively.
2.7 Optimization of Lactic Acid Extraction

from Fermentation Broth
2.7.1 Experimental Design
For the optimization of extraction efficiency, the experiments were conducted

according to experimental design obtained from central composite rotatable design
(CCRD) with three variables viz. span 80 concentration, cs (v/v), stirring speed, ω
(rpm) and batch extraction time (τ, min) on the extraction efficiency (ηext) at five
levels each using Design-Expert 7.16 software (Statease Inc., Minneapolis, USA) at
the ranges as shown in Table 1. The experimental plan in un-coded form of process
variables along with experimental results is as shown in Table 2.
26 A. Thakur et al.
Table 1 Range of different variables for lactic acid extraction from fermentation broth using ELM
Factors Process parameters Level
Coded values −α −1.000 0.000 +1.000 +α
Un-coded X1 Span 80 concentration, 4 4.5 5.25 6 6.5
values cs (%, v/v)
X2 Carrier concentration, 3.25 5 7.5 10 11.75
ψ (%, v/v)
X3 Batch extraction time, 10 15 22.5 30 35
τ (min)
Table 2 Experimental design using central composite rotatable design for lactic acid extraction
from fermentation broth by emulsion liquid membrane
Span 80 concentration Carrier concentration Batch extraction Extraction
cs (%, v/v) ψ (%, v/v) time τ (min) efficiency ηext (%)
6 10 15 58.56
5.25 7.5 22.5 76.54
4.5 10 15 62.68
5.25 7.5 10 59.42
6.5 7.5 22.5 61.26
6 10 30 82.74
4.5 5 30 67.2
4.5 5 15 65.14
5.25 7.5 35 81.25
5.25 3.25 22.5 57.21
5.25 7.5 22.5 76.84
4 7.5 22.5 68.24
6 5 15 51.5
5.25 7.5 22.5 76.14
5.25 7.5 22.5 76.65
6 5 30 63.11
4.5 10 30 77.23
5.25 11.75 22.5 72.43
5.25 7.5 22.5 75.12
2.7.2 Experimental Procedure
The external phase utilized during the optimization experiments and the ELM
employed was obtained as per procedure described above (2.3) in combination
process variables values of Table 2.
2.7.3 Statistical Analysis and Optimization
Response surface methodology was applied to the experimental data using

Design-Expert 7.16 software for the generation of response surface and contour
plots showing the interactions of any two independent variables while keeping the
values of the other variables as constant. The same software was used for the
optimization of process variables.
3.1 Effect of Loading External Phase with Molasses

on Emulsion Stability and Extraction Efficiency
The increase in the molasses content in the external phase had caused a decrease in
the emulsion stability (Fig. 1). Certain components in the molasses might be
destabilizing the emulsion either by interacting with surfactant Span 80 or by
altering its properties (Julio et al. 2010). Moreover with the decrease in the dilution
rate, the viscosity of the external phase also increases. It may have promoted the
shear force phenomenon acting on the emulsion at 200 rpm stirring speed.
Emulsion had been dispersed in the external phase containing synthetic lactic acid
and centrifuged diluted molasses by varying the dilution factor, D(4–10). The
extraction efficiency had been observed to be increased with the increase in dilution
of the molasses (Fig. 2).
Fig. 1 Effect of loading 3 Purified water D= 4 (v/v) molasses

external phase with molasses D= 6 (v/v) molasses D= 8 (v/v) molasses
on emulsion stability
D= 10 (v/v) molasses
Breakage (%)
0
0 10 20 30
Contact time (min)
28 A. Thakur et al.
Fig. 2 Effect of loading 100

external phase with molasses
Extraction efficiency (%)

on lactic acid extraction by 80
ELM
60 Purified water
D= 4 (v/v) molasses
40
D= 6 (v/v) molasses
20 D= 8 (v/v) molasses
D= 10 (v/v) molasses
0
0 5 10 15 20 25
Contact time (min)
3.2 Lactic Acid Extraction Efficiency from Fermentation

Broth Using Emulsion Liquid Membrane
The lactic acid extraction using ELM from the diluted and centrifuged fermentation
broth by immobilized Lb. casei MTCC 1423 cells after the 60 h of incubation time
at incubation temperature of 37.5 °C with optimized conditions was carried out.
The extraction efficiency (82 %) after 13.5 min of the batch extraction time was
obtained. During the extended batch extraction time, the stability of the emulsion
tends to slightly decreased with 4.5 % (v/v) span 80 concentration. This could be
due to interaction of certain ingredients of the fermentation broth with the surfactant
(Julio et al. 2010).

from Fermentation Broth Using Emulsion Liquid
Membrane
3.3.1 Regression Model
For extraction efficiency (%), the fit summary concluded that the quadratic model is
significant for analysis. The ANOVA for the quadratic model before elimination of
non-significant terms had nine terms which contain three linear terms, three
quadratic terms and three two-factorial interactions. Probability p > f values were
employed as a tool to verify the significance of each of the coefficients.
The ANOVA table for a quadratic model after backward elimination with alpha
out = 0.0500 has been shown in Table 3.
The model results indicated that model is significant (R2 and adjusted R2 are
98.79 and 98.48 % respectively), lack of fit has been found to be non-significant.
Table 3 Regression model and ANOVA for lactic acid extraction using emulsion liquid
membrane from fermenation broth
Source Sum of Degree of Mean f- value p>f
squares freedom square
Model 1480.65 9 164.51 706.75 <0.0001
Span 80 concentration (X1) 57.73 1 57.73 248.01 <0.0001
Trioctyl amine 262.34 1 262.34 1127.03 <0.0001
(TOA) concentration (X2)
Batch extraction time (X3) 581.48 1 581.482 2498.03 <0.0001
(X1) × (X2) 45.69 1 45.6968 196.31 <0.0001
(X1) × (X3) 45.985 1 45.98 197.54 <0.0001
(X2) × (X3) 78.50 1 78.500 337.23 <0.0001
(X1) × (X1) 226.71 1 226.71 973.94 <0.0001
(X2) × (X2) 223.96 1 223.96 962.14 <0.0001
(X3) × (X3) 60.24 1 60.24 258.79 <0.0001
Residual 2.09 9 0.232
Lack of fit 0.21 5 0.042 0.091 0.9892*
Pure error 1.88 4 0.47
Corrected total 1482.74 18
Standard Deviation = 0.69 R2 = 0.9879 Adjusted R2 = 0.9848
Mean = 69.09 Predicted R2 = 0.9812 Adequate precision = 64.122
PRESS = 6.81 C.V. = 0.99
*non-significant at 5 % level
The final response equation for extraction efficiency (%) is given as follows (in
terms of coded factors)
Extraction efficiency; gext ð%Þ ¼ 76:26 2:05X1 þ 4:38X2 þ 6:26X3

þ 2:39X1 X2 þ 2:42X1 X3 þ 3:13X2 X3
4:17X1 X1 4:05X2 X2 2:10X3 X3 ð3Þ
Response surface curves for lactic acid from centrifuged and diluted (D = 10)
fermentation broth by ELM using TOA are shown in Figs. 3, 4, 5. The interactive
effect of carrier (TOA) and surfactant (span 80) concentration had been depicted in
the Fig. 3. It is evident that with the increase in span 80 concentration the extraction
efficiency had decreased. The decrease in ηext is significant at the higher carrier
concentration. This might be due to the reason that both the variables had con-
tributed towards the growth of membrane phase-internal phase interfacial viscosity
resulting an increase in resistance to the diffusion of lactic acid across it (Hongpu
et al. 2013). The extraction efficiency had increased with the increase in carrier
concentration, but tends to slightly decrease at the higher concentration.
The extraction efficiency had increased with the increase in batch extraction time
(Fig. 4). The extraction efficiency had achieved an approximately early steady state
30 A. Thakur et al.
Fig. 3 Effect of carrier concentration and span 80 concentration on extraction efficiency of ELM
from fermentation broth
Fig. 4 Effect of batch extraction time and span 80 concentration on extraction efficiency of ELM
at lower surfactant concentration while at higher concentration it was taking a

longer time to achieve it. This might be owing to the fact that at higher surfactant
concentration globule in the external phase (fermentation broth) did not disperse
very well and the surface area for mass transfer has been significantly decreased. At
the same time the surfactant hydration also significantly increases the co-transport
of water molecules thus diluting the internal phase (Raja et al. 2014).
The extraction efficiency had increased with the increase in TOA concentration
and batch extraction time (Fig. 5). The extraction time required to attain the
maximum extraction at higher carrier concentration is more in comparison to that of
Fig. 5 Effect of batch extraction time and carrier concentration on extraction efficiency of ELM
from the aqueous phase. There might be due to chemical complexity arisen due to
certain other components present in the fermentation broth and caused a decrease in
the lactic acid transport rate through the membrane phase (Julio et al. 2010).

from Fermentation Broth
A numerical optimization technique was employed to obtain the workable optimum

conditions for the extraction of lactic acid from the centrifuged and diluted fer-
mentation broth. The optimum conditions obtained for maximum lactic acid
extraction (82.67 %) were: span 80 concentration, cs: 5 % (v/v); TOA concentra-
tion, ψ: 9.5 % (v/v); batch extraction time τ: 28 min. A set of experiments were
carried to validate the results which were predicted by the model for the maximum
extraction efficiency using predicted optimum values of variables. The maximum
value of extraction efficiency achieved from fermentation broths was around
79.87 %.
4 Conclusion
L(+)-lacticacid extraction using ELM from the diluted and centrifuged fermentation
broth by immobilized Lb. casei MTCC 1423 cells after the 60 h of incubation time
with optimized conditions was carried out. The extraction efficiency (82 %)
32 A. Thakur et al.
after 13.5 min of the batch extraction time was obtained. Keeping in view the
stability aspect using ELM for lactic acid extraction from fermentation broth, fur-
ther investigations had been carried out with different combination of surfactant
concentration along with by varying the extractant concentration and batch
extraction time using response surface methodology. The optimum conditions
obtained for maximum L(+)-lactic acid extraction (82.67 %) were: span 80 con-
centration 5 % (v/v); TOA concentration 9.5 % (v/v); batch extraction time 28 min.
References
Ani, I., Wahidin, S.: Effect of sodium alginate concentration, bead diameter, initial pH and
temperature on lactic acid production from pineapple waste using immobilized Lactobacillus
delbrueckii. Process Biochem. 41, 1117–1123 (2006)
Dan, C.V., Adriana, P., Fancisc, V.D., Carmen, S.: HPLC characterization of lactic acid formation
and ftir fingerprint of probiotic bacteria during fermentation processes. Not. Bot. Horti.
Agrobo. 38(1), 109–113 (2010)
Dey, P., Pal, P.: Direct production of L(+) lactic acid in a continuous and fully
membrane-integrated hybrid reactor system under non-neutralizing conditions. J. Membr.
Sci. 389, 355–362 (2012)
Dubois, M., Gilles, K.A., Hamilton, J.K., Robers, P.A., Smith, F.: Colorimetric method for
determination of sugar and related substances. Anal. Chem. 28, 350–356 (1996)
Farshid, G., Habibollah, Y., Abbas, E.S., Ghasem, N.: Cane molasses fermentation for continuous
ethanol production in an immobilized cells reactor by Saccharomyces cerevisiae. Renew. Ener.
36, 503–509 (2011)
Ginjupalli, K., Armugam, K., Shavi, V.G., Averineni, R.K., Mahalingam, B., Udupa, N.:
Development of RP-HPLC method for simultaneous estimation of lactic acid and glycolic acid.
Der Pharma Chemica. 5(4), 335–340 (2013)
Goyal, R.K., Jayakumar, N.S., Hashim, M.A.: Chromium removal by emulsion liquid membrane
using [BMIM]+[NTf2]—as stabilizer and TOMAC as extractant. Desalination 278, 50–56
(2011)
Hongpu, J., Wei, P., Juntong, Z., Chunjian, X.: Extraction performance of bisphenol A from
aqueous solutions by emulsion liquid membrane using response surface methodology.
Desalination 313, 36–43 (2013)
Imdad, K., Huang, S., Bo, L., Bin, W., Ra, Aamir, Chun, L.: Efficient biosynthesis of glycyrrhetic
acid 3-O-mono-β-D-glucuronide(GAMG) in water-miscible ionic liquid by immobilized whole
cells of Penicillium purpurogenum Li-3 in alginate gel. Chem. Eng. Sci. 106, 136–143 (2014)
Jia, O., Rui, M., Zhaojuan, Z.C.C., Min, Z., Ting, J.: Open fermentative production of L-lactic acid
by Bacillus sp. strain NL01 using lignocellulosic hydrolyzates as low-cost raw material.
Bioresour. Technol. 135, 475–480 (2013)
Joglekar, H.G., Imran, R., Suresh, B., Kulkarni, B.D., Ajit, J.: Review-comparative assessment of
downstream processing options for lactic acid. Sep. Purif. Technol. 52, 1–17 (2006)
Julio, B., Leo, D.P., Geran, A.: Gibberellic acid extraction from aqueous solutions and
fermentation broths by using emulsion liquid membranes. J. Membr. Sci. 348, 91–98 (2010)
Ke, X., Ping, X.: Efficient production of L-lactic acid using co-feeding strategy based on cane
molasses/glucose carbon sources. Bioresour. Technol. 153, 23–29 (2014)
Klinkenberg, G., Lystad, K.Q., Levine, D.W., Dyrset, N.: Cell release from alginate immobilized
Lactococcus lactis ssp. lactis in chitosan and alginate coated beads. J. Dairy Sci. 84, 1118–
1127 (2010)
Lucas, D., Phylipe, A. C., Julio, L. d. S. J., Leonardo, H. d. O., Martin, A.: Liquid equilibrium data
for ternary systems of water + lactic acid + C4-C7 alcohols at 298.2 K and atmospheric
pressure, Fliuid Phase Equilibr. 354, 12–18 (2013)
Min-Tian, G., Takashi, S., Nobuhiro, I., Haruo, T.: Fermentative lactic acid production with a
metabolically engineered Yeast immobilized in photo-crosslinkable resins. Biochem. Eng.
J. 47, 66–70 (2009)
Mohamed, A.Abdel-R, Yukihiro, T., Kenji, S.: Lactic acid production from lignocellulose-derived
sugars using lactic acid bacteria, overview and limits. J. Biotechnol. 156, 286–301 (2011)
Mokhtari, B., Pourabdollah, K.: Inclusion desalination of alkali metal cations by emulsion liquid
membranes and nano-baskets of p-tert-calix105arene bearing di-[N-(X)sulfonylcarboxamide]
and di-(1-propoxy) in para-cone conformation. Desalination, 292, 1–8 (2012)
Mrinal, N.K., Angelika-Ioanna, G., Jean Bernard, M., Panagiotis, K., Argyro, B., Athanasios, A.
K., Maria, K.: Lactic acid fermentation by cells immobilised on various porous cellulosic
materials and their alginate/poly-lactic acid composites. Bioresour. Technol. 165, 332–335
(2014)
Niju, N., Pradip, K.R., Aradhana, S.: L(+) lactic acid fermentation and its product polymerization.
Electron. J. Biotechn. 7(2), 167–179 (2004)
Pattana, L., Arthit, T., Vichean, L., Lakkana.: L. Acid hydrolysis of sugarcane bagasse for lactic
acid production. Bioresour. Technol. 101, 1036–1043 (2010)
Prasad, S.K., Shrikant, J.W., Vijaykumar, V.M.: Process intensification in extraction by liquid
emulsion membrane (LEM) process, a case study; enrichment of ruthenium from lean aqueous
solution. Chem. Eng. Process. 49, 441–448 (2010)
Raja, N.R.S., Norasikin, O., Nor, A.S.A.: Emulsion liquid membrane stability in the extraction of
ionized nanosilver from wash water. J. Ind. Eng. Chem. 20, 3243–3250 (2014)
Se-Kwon, M., Young-Jung, W., Gi-Wook, C.: A novel lactic acid bacterium for the production of
high purity L-lactic acid, Lactobacillus paracasei subsp. paracasei CHB2121. J. Biosci.
Bioeng. 114, 155–159 (2012)
Sushil, K., Dipaloy, D., Babu, B.V.: Estimation of equilibrium parameters using differential
evolution in reactive extraction of propionic acid by tri-n-butyl phosphate. Chem. Eng. Process.
50, 614–622 (2011)
Tayyba, G., Muhammad, I., Zahid, A., Tahir, A., Zubia, Z., Asma, T., Muhammad, K., Nudrat, E.,
Sajid, M.: Recent trends in lactic acid biotechnology, a brief review on production to
purification. J. Rad. Res. Ap. Ac. 7, 222–229 (2014)
Umar, F., Faqir, M.A., Tahir, Z., Sajjad-U-R., Muhammd, A.R., Anwaar, A., Kashif, A.:
Optimization of lactic acid production from cheap raw material, sugarcane molasses. Pak.
J. Bot. 44(1), 333–338 (2012)
Xiaolin, W., Yaoming, W., Xu, Z., Tongwen, X.: In situ combination of fermentation and
electrodialysis with bipolar membranes for the production of lactic acid, operational
compatibility and uniformity. Bioresour. Technol. 125, 165–171 (2012)
Optimization of Microwave Assisted
Extraction of Pectin from Helianthus
annuus Head Using Response Surface
Methodology
B.K. Aarthi, V. Aswini, M. Lakshmi Priya, M. Nirosha

and M. Shanmugaprakash
1 Introduction
Pectin is a heteropolysaccharide consisting mainly of 65 % galacturonic acid units

linked to neutral sugars by rhamnose unit to form branched chain contained in a
middle lamella and primary cell wall of terrestrial plants. Its application is wide in
food industry as gelling agent and pharmaceutical industry as drug carriers (Liu
et al. 2003). Source of pectin includes citrus peel, gooseberries, apple pomace ,
oranges, citrus fruits which contains higher pectin. Citrus peel contains relatively
higher percent of pectin that is 25 % compared to apple pomace (15–18 %).
Alternate sources for pectin is sugar beet waste (Morris et al. 2010) and mango
waste.
Waste resources like sunflower heads that are thrown waste can be utilized for
the extraction of pectin efficiently. Sunflower heads are rich in Lignin (12.3 %), D-
Glucose (23.5 %), low methoxy (LM) pectin and several other biomolecues and the
entire plant contributes to about 15–24 % of pectin. Commercial extraction of
pectin is done under high temperature using acids i.e., hot acid extraction
(Srivastava et al. 2011). Considering the process economics and time consumption
of hot acid method, there are many alternate methods of extraction of pectin like
Microwave assisted extraction, Ultrasound assisted extraction (Li et al. 2014), using
acid solvents have been done by researchers all around the world. Microwave
assisted extraction is an efficient method that reduces the time and energy for
extraction and gives higher yield (Fishman et al. 2006; Kratchanova et al. 2004).
B.K. Aarthi V. Aswini M. Lakshmi Priya M. Nirosha M. Shanmugaprakash (&)

Downstream Processing Laboratory, Department of Biotechnology, Kumaraguru College
of Technology, Coimbatore 641049, Tamil Nadu, India
e-mail: sunbioin@gmail.com

DOI 10.1007/978-981-10-1920-3_4
36 B.K. Aarthi et al.
Several authors reported that various factors such as time, microwave power,
solid-liquid ratio and pH affecting the efficiency of extraction (Koh et al. 2014;
Rahmati 2015; Kute et al. 2015). If the multiple factors and their interaction affects
a desired output, response surface methodology (RSM) is an effective tool to
optimize the process (Nwabueze 2010). Over a decade, RSM has been effectively
adopted by several researchers for their various work (Prakash Maran et al. 2013;
Shanmugaprakash et al. 2014, 2015).
Among that, BBD is one of the response surface methodologies was used for
optimization of parameters since BBD limits the number of experiments for
extraction. The objective of the current work is to optimize the process parameters
for the extraction of pectin from sunflower heads by Box-Behnken design and to
characterize the extracted pectin using Fourier transform infrared spectroscopy.
2.1 Raw Materials and Reagents
Raw materials (sunflower heads) were collected from sunflower garden,

Coimbatore, Tamil Nadu. Sunflowers heads were shade dried powdered. The
powdered sample was used for further analysis. Citric acid (SDFCL, Mumbai) was
used to dissolve the sample powder. Iso-propanol (SDFCL, Mumbai) was used to
precipitate pectin (Yoo et al. 2012).
2.2 Extraction of Pectin Using Microwave Assisted

Radiation
According to the method described by Wang et al. (2007), extraction process was
performed with a household microwave oven (LG, 3850 W) with adjustable irra-
diation time and microwave power under different conditions (Table 1). About 1 g
of sample powder was weighed and dissolved in citric acid in a glass beaker and the
beaker was placed in the rotating disk exposed to microwave radiation at different
time for selected microwave power, temperatures and solid-liquid ratios. After that,
the mixture was then cool down to room temperature, centrifuged (10,000 rpm at
4 °C for 10 min). The mixture was filtered using Whatman no-1 filter paper and
precipitation of supernatant was carried out with an equal volume of Isopropanol.
The coagulated pectin was centrifuged (10,000 rpm at 4 °C for 10 min), and pellet
was dried and dry weight was taken. The equation proposed by Maran et al. (2014)
was used to calculate pectin yield.
Optimization of Microwave Assisted Extraction of Pectin … 37
PY ¼ ðm0 =mÞ 100 ð1Þ
where, m0 (g) is the dry weight of pectin and m (g) is the dry weight of sunflower
husk.
2.3 Experimental Design
In this work, RSM based BBD was chosen to find relationship of process variables
on the pectin extraction. Four factors of variables such as pH (X1), microwave
power (X2), time (X3) and solid-liquid ratio (X4) is shown (Table 1). The extracted
pectin yield (Y) was selected as experimental response. Second order polynomial
equation was derived, as shown in the following equation
X
K X
K XX
K
Y ¼ b0 þ bi Xj þ bjj X2j þ bij Xi Xj þ ei ð2Þ
j¼1 j¼1 i \j¼2
where, Y is the response; Xi and Xj represents variables (i and j range from 1 to k);
β0 is the model intercept coefficient; βj, βjj and βij represents interactive coefficients
of linear, quadratic equation with second-order terms, respectively; k is the number
of independent parameters (k = 4); and ei is the error.
3.1 Modeling and Optimization of Extraction Process
Based on BBD design, experiments were performed in order to study the combined
effects of the independent variables such as pH (X1), microwave power (X2), time
(X3) and solid-liquid ratio (X4) on pectin extraction and the measured responses are
listed in Table 2. The second order polynomial equation was generated which
denotes the pectin extraction process, having higher F-value with low p-value.
Pectin extraction = −47.8233 + 71.09877 * pH + 0.200452 * S/L + 0.210228 *
time + 0.010747 * micro oven − 0.20963 * pH * S/L − 0.00908 * pH * time +
0.001326 * pH * micro oven + 0.001104 * S/L * time − 0.00011 * S/L * micro
oven + 2.31E−07 * time * micro oven − 22.2874 * pH^2 + 0.003182 *
S/L^2 − 0.0025 * Time^2 − 1.3E−05 * micro oven^2.
The predicted F-values (3916) and p-values (p < 0.0001) show that, the model
which was developed was found to be highly significant. The determination
co-efficient (R2), adjusted determination co-efficient (R2), predicted determination
co-efficient (R2) and co-efficient of variance (CV) and signal to noise ratio (S/N)
Table 1 Box-Behnken experimental design matrix

Factor 1 Factor 2 Factor 3 Factor 4 Response
Run A-pH B-S/L (ml) C-time (s) D-microwave power (W) Pectin yield in (g)
1 2 20 30 540 8.67
2 2 40 60 180 8.01
3 1.5 30 60 360 14.68
4 1.5 30 45 360 15.38
5 2 40 30 540 7.64
6 1.5 30 45 360 15.2
7 1.5 20 45 360 14.67
8 1 40 30 540 11.35
9 1 40 60 540 11.95
10 1 20 60 180 7.81
11 2 20 60 540 8.37
12 1 20 30 180 7.96
13 1.5 40 45 360 16.25
14 1 20 60 540 8.14
15 2 40 30 180 7.65
16 1 30 45 360 10.57
17 1.5 30 45 360 15.19
18 1.5 30 45 540 14.78
19 1 40 30 180 11.78
20 1.5 30 45 360 15.18
21 2 20 30 180 7.88
22 1 20 30 540 8.13
23 1.5 30 45 360 15.17
24 1 40 60 180 12.45
25 2 40 60 540 7.92
26 2 30 45 360 8.57
27 1.5 30 45 360 15.17
28 2 20 60 180 7.58
29 1.5 30 30 360 14.48
30 1.5 30 45 180 14.68
was evaluated using goodness of fit model. Higher R2 values (0.99) shows that, this
model are statistically significant and this model does not explain about smaller
variations (0.01). As the value of R2 (0.99) relates with the value of adjusted R2
(0.99) which shows that this model was chosen to explain the relationship between
the factors and the response which was well-correlated. Lower the CV % values
(0.66) states that, the deviations between experimental and predicted values are low
which shows high degree of precision and reliability of the conducted experiments.
Table 2 ANOVA for response surface quadratic model of pectin yield

Source Sum of squares df Mean square F-value p-value Prob > F
Model 315.5735 14 22.54097 3916.096 <0.0001
A-pH 17.70125 1 17.70125 3075.28 <0.0001
B-S/L 13.85134 1 13.85134 2406.426 <0.0001
C-time 0.104272 1 0.104272 18.11546 0.0007
D-micro oven 0.073472 1 0.073472 12.7645 0.0028
AB 17.57706 1 17.57706 3053.704 <0.0001
AC 0.074256 1 0.074256 12.90071 0.0027
AD 0.228006 1 0.228006 39.61207 <0.0001
BC 0.438906 1 0.438906 76.25223 <0.0001
BD 0.604506 1 0.604506 105.0223 <0.0001
CD 6.25E−06 1 6.25E−06 0.001086 0.9741
A^2 80.43587 1 80.43587 13974.32 <0.0001
B^2 0.262263 1 0.262263 45.56363 <0.0001
C^2 0.817863 1 0.817863 142.0893 <0.0001
D^2 0.439454 1 0.439454 76.34743 <0.0001
Residual 15.65351 15 1.043567
Lack of fit 15.65351 10 1.565351
Pure error 0 5 0
Cor total 93.36667 29
The precision (signal to noise ratio) was found to be >163.65, which denotes the
best fitness of the developed models (Shanmugaprakash and Sivakumar 2013).
3.2 Effect of pH on Pectin Yield
In order to determine the optimized pH value for extraction, experiments were done
at different pH range 1–2. From the figures (Fig. 1), it was found that the pectin
yield (PY) was increasing for decreasing pH values. At lower acidic environment,
solvent can easily contact with the insoluble pectin and favor the hydrolysis of
insoluble pectin which results in soluble pectin, thus increasing the pectin recovery
(El-Nawawi and Shehata 1988) and the maximum yield of pectin was obtained at
pH 1. Also the molecular weight of pectin was reduced at low pH so that the pectin
was extracted from tissues of plant (Faravash and Ashtiani 2007). However,
increasing pH value beyond particular value results in reduced pectin yield (PY).
The poor pectin release was due to the aggregation of pectin in the solvent. The
optimum pH was 1.01, predicted by response surface methodology (Fig. 2)
Fig. 1 Graph showing the

effect of time and microwave
power on the pectin yield

effect of pH and time on the
pectin yield
3.3 Effect of Solid-Liquid Ratio on Pectin Yield
Quantity of solvent is one of the main factors for pectin extraction. To determine the
optimum extraction, sample to solvent ratio of 1:20–1:40 g/ml were used. From the
results (Figs. 3, 4), the yield was increasing up to in the ratio of 1:30 g/ml. This is
because of solvent can efficiently absorbs the microwave energy and plant tissues
swells, which increase the contact area between plant matrix and solvent (Guo et al.
2001). So, cells were ruptured and the pectin was released. However increasing of
solid-liquid ratio beyond 1:30 g/ml could decrease the extraction because of
solution get saturated with higher solvent content. This could decrease the
absorption of microwave energy, which affects the mass transfer rate thus by
decreases the penetration and pectin yield. The optimum solid-liquid ratio was
31.06 g/ml predicted by using RSM (Fig. 3).
3.4 Effect of Time on Pectin Yield
In the extraction of pectin, time is the most important factor and used to estimate the
proper emission time for the maximum pectin yield. In this work, the time range of
30–60 s investigated. From the (Fig. 4), it was found that the yield was increased at

effect of pH and microwave
Fig. 4 Graph showing for

the effect of solid-liquid ratio
and time on the pectin yield
60 s. It could be observed that the dissolution of pectin into the solution occur due
to the thermal accumulation of microwave energy until 60 s. The time beyond the
particular limit would degrade the pectin chain. 59.7 s was the optimum time for
pectin extraction predicted by RSM.
3.5 Effect of Microwave Power on Pectin Yield
The pectin was extracted using microwave oven. In this work different microwave
powers were used in the range of 180–540 W. Here, the extraction process was
carried out by heating mechanism. Microwave extraction was carried out based on
two principles. One is dipole rotation and ionic conduction. Ionic conduction refers
to the electrophoretic migration of the charge carriers under the influence of electric
field. Dipolar rotation occurs when dipolar molecules attempts to follow the electric
field. The microwave energy disrupts the cell wall of the plant material by elec-
tromagnetic radiation. So, pectin could leach out from plant material. Heat will be
generated during this process. In this work higher pectin yield was obtained at
360 W and beyond the 360 W pectin could degrade due to heat generated by
microwave energy. The optimum microwave power 372.49 W was predicted by
RSM (Figs. 5 and 6).

effect of solid-liquid ratio and
microwave power on the
pectin yield

effect of time and microwave
3.6 Determination and Validation of Optimized Conditions
To optimize pectin extraction process conditions. Derringer’s desired function

methodology was used. The microwave power of 482.58 W, pH of 1.37, time of
35.34 s, solid-liquid ratio of 36.15 g/100 ml gave the maximum yield of pectin was
15 % with a desirability value of 1.0. Selected optimal conditions were tested
experimentally to predict the optimum response values. The experiments were
performed in triplicate under the optimized conditions. The mean values
(14.98 ± 0.18 %) which was obtained from the real experiments, shows the vali-
dation of the optimized conditions (15 %).
3.7 Characterization of Extracted Pectin by FT-IR
The major peak of pectin is in the range of 1000–2000 cm−1 (Fig. 7). The peak
from 1335–1250 cm−1 corresponds to aromatic amines, 1650–1580 cm−1 corre-
sponds to primary amines and peaks at 1650–1750 cm−1 corresponds to ketone
stretch of the compound (Silva et al. 2012). Carboxylic acids and esters are indi-
cated by the peak around 1350 cm−1 (Thetsrimuang et al. 2011). C–o and o–H
99.8
99.6
Transmittance [%]
99.4
99.2
3500 3000 2500 2000 1500 1000

Wavenumber cm-1
Fig. 7 FT-IR spectrum for pectin extracted from sunflower heads

99.9
99.8
Transmittance [%]
99.7
99.6
99.5
3500 3000 2500 2000 1500 1000

Wavenumber cm-1
Fig. 8 FT-IR spectrum for commercial pectin
bond stretches are shown by the peaks beyond 3500 cm−1 (Silva et al. 2012).
Moreover, the peak region between the area 1250–1728 cm−1 denotes the presence
of α, β unsaturated esters and aliphatic amine functional group that ressembled the
peak of commercial pectin (Fig. 8).
4 Conclusion
In this work, effect of microwave power, pH, time and solid-liquid ratio on the
pectin yield from sunflower heads were studied. The influence of process variables
increased to certain level and then decreased. The BBD model, successfully
describes the inter relationship of process variables on the pectin yield. Using
response surface methodology, the model was validated and the optimized condi-
tions was found to be such as microwave power of 482.58 W, pH of 1.37, time of
35.34 s and solid-liquid ratio of 36.15 g/100 ml and the maximum yield of pectin
of 15 % were obtained.
Acknowledgments The authors are thankful to the management of Kumaraguru College of

Technology, Coimbatore, India, for the encouragement and providing the research facilities.
References
Agarwal, A.K., Goyal, P., Lakashminarasimhaiah, P.G., Desai, P., Singh, G.K.: Isolation of pectin
from emblica officinalis & Linum unitatissimum using microwave assisted extraction technique
and compare with conventional extraction method. Int. J. Pharma Res. Rev. 4(2), 16–20 (2015)
El-Nawawi, S.A., Shehata, F.R.: Effect of the extraction temperature on the characteristics of
pectin extracted from Egyptian orange peel. Biol. Wastes 24, 307–311 (1988)
Faravash, R.S., Ashtiani, F.Z.: The effect of pH, ethanol volume and acid washing time on the
yield of pectin extraction from peach pomace. Int. J. Food Sci. Technol. 42, 1177–1187 (2007)
Fishman, M.L., Chau, H.K., Hoagland, P.D., Hotchkiss, A.T.: Microwave-assisted extraction of
lime pectin. Food Hydrocolloids 20(8), 1170–1177 (2006)
Guo, Z.K., Jin, Q.H., Fan, G.Q., Duan, Y.P., Qin, C., Wen, M.J.: Microwaveassisted extraction of
effective constituents from a Chinese herbal medicine Radix puerariae. Anal. Chim. Acta 436,
41–47 (2001)
Koh, P.C., Leong, C.M., Mohd Adzahan, N.: Microwave-assisted extraction of pectin from
jackfruit rinds using different power levels. Int. Food Res. J. 21(5), 2091–2097 (2014)
Kratchanova, M., Pavlova, E., Panchev, I.: The effect of microwave heating of fresh orange peels
on the fruit tissue and quality of extracted pectin. Carbohydr. Polym. 56(2), 181–185 (2004)
Kute, A., Mohapatra, D., Babu, B., Sawant, B.P.: Optimization of microwave assisted extraction of
pectin from orange peel using response surface methodology. J. Food Res. Technol. 3(2), 62–
70 (2015)
Liu, L., Fishman, M.L., Kost, J., Hicks, K.B.: Pectin-based systems for colon-specific drug
delivery via oral route. Biomaterials 24(19), 3333–3343 (2003)
Li, J., Zu, Y.-G., Fu, Y.-J., Yang, Y.-C., Li, S.-M., Li, Z.-N., et al.: Optimization of
microwave-assisted extraction of triterpene saponins from defatted residue of yellow horn
(Xanthoceras sorbifolia Bunge.) kernel and evaluation of its antioxidant activity. Innovative
Food Sci. Emerg. Technol. 11(4), 637–643 (2010)
Maran, J.P., Manikandan, S., Thirugnanasambandham, K., VignaNivetha, C., Dinesh, R.:
Box-Behnken design based statistical modeling for ultrasound-assisted extraction of corn silk
polysaccharide. Carbohydr. Polym. 92, 604–611 (2014)
Morris, G.A., Ralet, M.-C., Bonnin, E., Thibault, J.-F., Harding, S.E.: Physical characterisation of
the rhamnogalacturonan and homogalacturonan fractions of sugar beet (Beta vulgaris) pectin.
Carbohydr. Polym. 82(4), 1161–1167 (2010)
Nwabueze, T.U.: Review article: basic steps in adapting response surface methodology as
mathematical modelling for bioprocess optimisation in the food systems. Int. J. Food Sci.
Technol. 45(9), 1768–1776 (2010)
Prakash Maran, J., Mekala, V., Manikandan, S.: Modeling and optimization of ultrasound-assisted
extraction of polysaccharide from Cucurbita moschata. Carbohydr. Polym. 92(2), 2018–2026
(2013)
Rahmati, S., Abdullah, A., Momeny, E., Kang, O.L.: Optimization studies on microwave assisted
extraction of dragon fruit (Hylocereus polyrhizus) peel pectin using response surface
methodology. Int. Food Res. J. 22, 233–239 (2015)
Shanmugaprakash, M., Sivakumar, V.: Development of experimental design approach and
ANN-based models for determination of Cr (VI) ions uptake rate from aqueous solution onto
the solid biodiesel waste residue. Bioresour. Technol. 148, 550–559 (2013)
Shanmugaprakash, M., Kirthika, J., Ragupathy, J., Nilanee, K., Manickam, A.: Statistical based
media optimization and production of naringinase using Aspergillus brasiliensis 1344. Int.
J. Biol. Macromol. 64, 443–452 (2014)
Silva, S., Martins, S., Karmali, A., Rosa, E.: Production, purification and characterisation of
polysaccharides from Pleurotus ostreatus with antitumour activity. J. Sci. Food Agric. 92(9),
1826–1832 (2012)
Srivastava, P., Malviya, R.: Sources of pectin, extraction and its applications in pharmaceutical
industry-an overview. Indian J. Nat. Prod. Resour. 2(1), 10–18 (2011)
Thetsrimuang, C., Khammuang, S., Chiablaem, K., Srisomsap, C., Sarnthima, R.: Antioxidant
properties and cytotoxicity of crude polysaccharides from Lentinus polychrous Lév. Food
Chem. 128(3), 634–639 (2011)
Venkatesh Prabhu, M., Karthikeyan, R., Shanmugaprakash, M.: Modeling and optimization by
response surface methodology and neural network–genetic algorithm for decolorization of real
textile dye effluent using Pleurotus ostreatus: a comparison study. Desalin. Water Treat. 57, 1–
15 (2015)
Wang, S.J., Chen, F., Wu, J.H., Wang, Z.F., Liao, X.J., Hu, X.S.: Optimization of pectin extraction
assisted by microwave from apple pomace using response surface methodology. J. Food Eng.
78(2), 693–700 (2007)
Yoo, S.H., Lee, B.H., Lee, H., Lee, S., Bae, I.Y., Lee, H.G., Jr Hotchkiss, A.T., et al.: Structural
characteristics of pumpkin pectin extracted by microwave heating. J. Food Sci. 77(11), C1169–
C1173 (2012)
Production and Characterization
of Hydrophobins from Fungal Source
Basavaraj Hungund, Chaitanya Habib, Vaibhav Hiregoudar,

Sona Umloti, Saiprasad Wandkar and Gururaj Tennalli
1 Introduction
Hydrophobins are cysteine rich proteins (about 100 amino acids) that are produced
by filamentous fungi having molecular mass of around 20 kDa. These hydro-
phobins are reported to be produced by filamentous fungi belonging to the
Ascomycetes, the Basidiomycetes and may also be produced by Zygomycetes
(Scholtmeijer et al. 2001). The name hydrophobin has been used initially due to
their high content of hydrophobic amino acids. Recent investigations show that,
hydrophobins play crucial role in fungal growth and development. The hydro-
phobins are reported to reduce the surface tension of medium in which fungi grow
and maintain good permeability for gaseous exchange (De Vocht et al. 1998).
Hydrophobins cover the aerial spores of these filamentous fungi making their
surface hydrophobic and water repellent. Based on their inter Cys spacing,
hydrophobins are classified into two classes as Class I and Class II. The class I
hydrophobins assemble into highly insoluble polymeric layers which are composed
of fibrillar structures. These fibrillar structures are known as rodlets and possess
considerable variation in the inter Cys spacing. The rodlets are extremely stable and
can only be solubilized with harsh acid treatments. The soluble forms can poly-
merize back into rodlets under appropriate conditions. The amino acid sequence
and the inter-Cys spacing are more conserved in class II hydrophobins. The
monolayers formed by class II hydrophobins lack the fibrillary rodlet morphology
and can be solubilized with organic solvents and detergents.
They possess a unique self-assembly mechanism and can assemble at a hydro-
philic–hydrophobic interface developing a monolayer amphipathic film
(Scholtmeijer et al. 2001). This property makes hydrophobins useful in many
B. Hungund (&) C. Habib V. Hiregoudar S. Umloti S. Wandkar G. Tennalli

Department of Biotechnology, B.V.B. College of Engineering and Technology,
Hubballi 580031, India
e-mail: hungundb@gmail.com

DOI 10.1007/978-981-10-1920-3_5
48 B. Hungund et al.
industries such as food industry, brewing industry, enzymes immobilization, etc.

Khalesi et al. (2012). The term molecular self-assembly refers to the autonomous
formation of structures or patterns from pre-existing components. This is a rever-
sible process driven only by the properties of the components (Whitesides and
Grzybowski 2002). Protein self-assembly is very common in biological systems.
Examples are the formation of virus capsids, the DNA replication machinery, and
disease-related amyloid fibres. Hydrophobins form self-assembled structures at the
air–water interface. Class I hydrophobins form a mosaic of rod-like structures,
called rodlets, which are 5–10 nm in width and several hundred nanometers in
length (Linder et al. 2005). Class II hydrophobins does not possess rodlet mor-
phology. The class II hydrophobins HFBI, HFBII and HFBIII from Trichoderma
reesei have been shown to form films with a self-assembled hexagonally ordered
structure (Paananen et al. 2003). Studies on the possible interfacial self-assembly of
other class II hydrophobins have not been reported. In the present investigation, an
attempt was made to achieve lab scale production of hydrophobins using various
fungal strains.
2.1 Microorganisms
For the laboratory scale production of hydrophobins, fungal strains Trichoderma

reesei NCIM 1171, Trichoderma viride NCIM 1060, Trichoderma harzianum
NCIM 1185 and an isolate-white rot fungus were used. The pure cultures of these
fungal strains were maintained on Sabouraud’s dextrose agar slants at 6–8 °C in the
refrigerator and sub-culturing was done every three months.
2.2 Production Media
Standard medium as defined by Askolin et al. (2001) was used for the growth of
fungal strains and for the production of hydrophobins. The production medium
contains glucose (20 g/l), peptone (4 g/l), yeast extract (1 g/l), KH2PO4 (4 g/l),
(NH4)2SO4 (2.8 g/l), MgSO4 (0.6 g/l), CaCl22H2O (0.8 g/l), CoCl26H2O
(0.004 g/l), MnSO4H2O (0.0032 g/l), ZnSO47H2O (0.0069 g/l). Initial studies
were carried out using both glucose and lactose as carbon sources separately.
Inoculum development was done using the standard medium and 100 ml of pro-
duction medium was inoculated with each organism separately and incubated at
150 rpm at 25 °C for four days. After the completion of incubation period, the cells
were harvested by centrifugation at 10,000 rpm for 15 min. The cell lysis was
achieved by subjecting the cells to sonication using both bath sonicator and probe
sonicator separately. Sonication process was done for 40 min to release intracellular
Production and Characterization of Hydrophobins … 49
contents along with hydrophobins. The whole contents were taken into a separating
funnel and shaken vigorously to produce visible foam. The foam was verified for
stability and was removed and dissolved in water. These contents were further
stored at 4 °C till further testing.
2.3 Quantitative Analysis
The qualitative study for the hydrophobins was performed using lead sulfide test
(Katoch 2011). Further quantitative analysis for hydrophobins was done by
Bradford’s method (1976). The amount of hydrophobins present in each sample
was calculated referring to the standard graph.
2.4 Molecular Weight Determination: SDS-PAGE
Standard gel preparation protocol: The Resolving gel was prepared using the fol-
lowing, 30 % acrylamide, 10 % SDS, 10 % APS (freshly prepared), TEMED,
1.5 M Tris pH 8.8, 5× SDS Running Buffer (1 L): Tris 15 g, Glycine 72 g, SDS
5 g. Coomassie Blue Stain: 10 % (v/v) acetic acid, 0.006 %(w/v) Coomassie Blue
dye, 90 % double distilled water. Stacking gel was prepared using all the same
ingredients above but with 1.0 M Tris with a pH of 6.8. Then isopropanol fixing
solution was prepared with 10 % (v/v) acetic acid 25 % (v/v) isopropanol 65 %
double distilled water. Then 40 ml of SDS sample loading buffer was prepared
using the following: double distilled water 16 ml, 0.5 M Tris pH 6.8 (5 ml), 50 %
Glycerol (8 ml), 10 % SDS (8 ml), 2-mercaptoethanol (2 ml) was added immedi-
ately before using, bromophenol blue. 10 % (v/v) acetic acid.
Gel running protocol: Polyacrylamide gel was prepared according to standard
protocol. The samples were loaded and gel was run at 25 mA in 1× SDS Running
Buffer. Later the gel was stained with Coomassie brilliant blue and placed in a
plastic container covered with isopropanol fixing solution and was kept on gel
rocker at room temperature for 10 min. The fixing solution was poured off, and the
gel was covered with Coomassie blue staining solution and was kept on gel rocker
at room temperature for 2 h, then the staining solution was poured off and the gel
was washed with 10 % acetic acid to de-stain by keeping on gel rocker at room
temperature.
2.5 Ultrafiltration
Membrane ultrafiltration (UF) is a pressure-modified, convective process that uses

semi permeable membranes to separate species in aqueous solutions by molecular
size, shape, and/or charge (Schratter 2004). The different pore sizes are notated by
their respective molecular weight cut offs (MWCO). In the present study MWCO of
20 KDa was used. The molecules smaller than 20 KDa pass through the membrane
(permeate) whereas those larger than it remain within the membrane (retentate). The
chamber was applied with positive pressure (1 bar) so that the molecules were
forced through the membrane. The retentate and permeate were further analyzed for
protein content by Bradford method.
3.1 Production of Hydrophobins
Fungal strains Trichoderma reesei NCIM 1171, Trichoderma viride NCIM 1060,
Trichoderma harzianum NCIM 1185 and an isolate-white rot fungus were used for
hydrophobin production. The cells were subjected to lysis and the contents were
vigorously shaken in separating funnel. The foam produced in each case was varied
for stability by exposing to air. Also the degree of foam formed and its stability was
compared among all the strains. Strain Trichoderma reesei was found to produce
the highest amount of foam with better stability (Fig. 1). The foam from this
organism was dissolved into water and subjected for further qualitative and
quantitative analyses.
Fig. 1 Picture showing foam

produced by Trichoderma
reesei NCIM 1171
0.3
0.25
Concentration (mg/ml)
0.23 0.2
0.15
0.07
0.08
0.
0.
T. reesei T. viridae white rot fungus T. harzanium
Fungal Strains
Fig. 2 Graph showing comparison of hydrophobin content from various fungal strains
The stability of the foam was measured by the time period to which the air
bubbles were stable and Trichoderma reesei showed highest and most stable foam.
More the concentration of the protein, more stable the air bubbles to process of
disproportionation. The foam produced by it was taken for further analysis,
Bradford estimation was performed for Quantitative analysis for all the strains and
the following results were obtained. Figure 2 represents the concentrations of
protein for all the fungal strains in mg/ml. The results of SDS PAGE revealed that
the produced hydrophobins falls under low molecular weight proteins.
3.2 Lead Sulphide Test
The qualitative study for the hydrophobins was performed using lead sulfide test.
This test is basically used to detect the presence of cysteine residue in the prepa-
ration. As hydrophobin is a cysteine rich protein the test should confirm the
presence of cysteine in the given protein sample. Basically the reaction goes as
follows, Cysteine rich protein upon boiling with sodium hydroxide (hot alkali),
yield sodium sulphide. This reaction is due to partial conversion of the organic
sulphur to inorganic sulphide, which can be detected by precipitating it to lead
sulphide, using lead acetate solution.
SðProteinÞ þ 2NaOH ! Na2 S

Na2 S þ ðCH3 COOÞ2Pb ! PbS þ 2CH3 COONa
Further quantitative analysis for hydrophobins was done by Bradford’s method

(1976). The amount of hydrophobins present in each sample was calculated
referring to the standard graph. The foam produced was subjected to Lead sulphide
test for confirmation of presence of cysteine. The formation of gray precipitate
indicates positive test for presence of cysteine in the sample.
Concentration 0.3
(mg/ml) 0.242
0.225
0.15
0.075 0.026
0.0051 0.001
0.
Glucose Lactose
Concentration in mg/ml
Retentate Permeate
Fig. 3 Graph showing comparison of protein content in retentate and permeate for Trichoderma
reesei
3.3 Partial Purification by Ultrafiltration
As the hydrophobins are smaller molecules, ultrafiltration was carried out for partial
purification using 20 KDa membranes. After filtration, both permeate and retentate
were taken from glucose and lactose media separately and subjected to protein
estimation using Bradford method. The results show that, the protein content is
more in case of permeate indicating partial purification of the protein sample.
Figure 3 represent the comparison of protein content in retentate and permeate. The
presence of higher amount of protein in the permeate indicates that protein may
possess molecular mass less than 20 KDa. This study also demonstrates that,
glucose is the preferred carbon source for the production of hydrophobins by
Trichoderma reesei NCIM 1171.
4 Conclusion
Present investigation reports the lab scale production of fungal hydrophobins.

Screening activity for hydrophobin production showed that Trichoderma reesei was
the highest producer with stable foam. Confirmation of hydrophobins was done
using cysteine residue test. Partial purification of hydrophobins from Trichoderma
reesei was done using ultrafiltration method. Retentate and permeate obtained by
ultrafiltration were subjected to Bradford assay. More concentration was observed
in permeate solution which contains proteins whose molecular mass is less than
20 KDa. The results of SDS PAGE revealed that the produced hydrophobins falls
under low molecular weight proteins. Thus, we have achieved lab scale production,
characterization and partial purification of hydrophobins from Trichoderma reesei.
Acknowledgments The authors acknowledge Dr. Ashok Shettar, Vice Chancellor, KLE
Technological University, Hubballi (Formerly BVBCET Hubballi) for constant support and
encouragement. The authors also acknowledge Technical Education Quality Improvement
Program (TEQIP) of World Bank for providing needful support to carry-out the present study.
References
Askolin, S., Nakari-Setala, T., Tenkanen, M.: Overproduction, purification, and characterization of
the Trichoderma reesei hydrophobin HFBI. Appl. Microbiol. Biotechnol. 57, 124–130 (2001)
Bradford, M.M.: A rapid and sensitive method for the quantitation of microgram quantities of
protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254 (1976)
De Vocht, K., Van Der Scholtmeijer, E.W., De Vegte, O.M., Vries, N.Sonveaux, Wosten, A.,
Ruysschaert, J.M., Hadziloannou, G., Wessels, J.G., Robillard, D.G.T.: Structural character-
ization of the hydrophobin SC3, as a monomer and after self-assembly at hydrophobic/
hydrophilic interfaces. Biophys. J. 74, 2059–2068 (1998)
Katoch, R.: Quantitative and qualitative estimation of amino acids and proteins. Analytical
Techniques in Biochemistry and Molecular Biology, pp. 93–147. Springer, Berlin (2011)
Khalesi, M., Deckers, S.M., Gebruers, K., Vissers, L., Verachtert, H., Derdelinckx, G.:
Hydrophobins: exceptional proteins for many applications in brewery environment and other
bio-industries. Cerevisia 37(1), 3–9 (2012)
Linder, M.B., Szilvay, G.R., Nakari-Setala, Tiina, Penttila, Merja E.: Hydrophobins: the
protein-amphiphiles of filamentous fungi. FEMS Microbiol. Rev. 29, 877–896 (2005)
Paananen, A., Ananen, A., Vuorimaa, E., Torkkeli, M., Penttila, M., Kauranen, M., et al.:
Structural hierarchy in molecular films of two class II hydrophobins. Biochemistry 42(18),
5253–5258 (2003)
Scholtmeijer, K., Wessels, J.G.H., Wosten, H.A.B.: Fungal hydrophobins in medical and technical
applications. Appl. Microbiol. Biotechnol. 56, 1–8 (2001)
Schratter, P.: Purification and concentration by ultrafiltration. Protein Purification Protocols, vol.
244, pp. 101–116. Humana Press, New York (2004)
Whitesides, G.M., Grzybowski, B.: Self-assembly at all scales. Science 295(5564), 2418–2421
(2002)
Sustainable Utilization of Food Industry
Waste and by-Products for the Production
of Prebiotic Isomaltooligosaccharides
(IMO)
Anindya Basu and S.G. Prapulla
1 Introduction
Prebiotic are functional food elements that are selectively fermented by the bene-
ficial micro-organisms in the gut and contributes to the well being of the host
(Roberfroid 2007). To date, the major reported studies and the most reliable evi-
dence accumulated for prebiotic effects have been for several non-digestible
oligosaccharides (NDOs). Among these NDOs Isomaltooligosaccharides (IMO) has
always received exceptional attention because of its (1) numerous physicochemical
properties favourable for industrial application (Glor et al. 1988; Yoo et al. 1995;
Sheu et al. 1997) and (2) several reported health benefits (Goffin et al. 2011). IMO
are oligosaccharides, having mixtures of α-(1, 4) and α-(1, 6)-glycosidic linkages.
Most common IMOs include panose, maltotriose, isomaltose, isomaltotriose, iso-
maltotetraose, kojibiose, isopanose, and other higher oligosaccharides. IMO pro-
duction occurs via a complex three-step enzymatic process, whereby starch is
transformed into maltose by subsequent liquefaction and saccharification. IMOs are
then synthesized by using either transglucosidase or glucosyltransferase. IMOs can
be used as a low calorie sweetener in foods and beverages (Goffin et al. 2011).
Food processing industries generate an enormous amount of waste causing
disposal and potentially severe pollution problem. The potato processing industry
produces large volume of wastes (nearly 35 % of the total potato processed). Potato
processing waste (PPW) causes serious pollution problem owing to its high
A. Basu S.G. Prapulla (&)

Microbiology & Fermentation Technology Department, CSIR-Central
Food Technological Research Institute, Mysore, India
e-mail: prapullasg@yahoo.co.in
A. Basu
e-mail: anindya.rintu@gmail.com
A. Basu S.G. Prapulla
AcSIR—Academy of Scientific & Innovative Research, New Delhi, India

DOI 10.1007/978-981-10-1920-3_6
56 A. Basu and S.G. Prapulla
chemical oxygen demand (COD) and total dissolved solid (TDS) content. In
addition to protein, PPW also contains a high concentration of starch, nearly 60 %
(Mironescu 2011), which can be enzymatically converted to greater value IMO
reducing disposal problem. Additionally, the process can also help the farmers to
tackle the hefty financial losses due to the glut of potatoes.
Food processing also leads to the generation of different by-products which are
generally considered as a low-value material. One such by-product of rice milling is
broken rice (BR) having 3/4 length of the whole grain. In the past, broken rice was
used by beer industries. However, nowadays decent quality brewers favour whole
rice in place of broken rice for brewing. Currently, broken rice is used for feeding
livestock and making infant food. Alternatively broken rice can be used for IMO
production as it also contains a high amount of starch (60–70 % (Gohel and Duan
2012) adding value to the otherwise considered low-value by-product of rice mil-
ling industry with better economic return.
Therefore, the current investigation aims to develop a sustainable method for the
production of IMO utilizing starch-rich broken rice (BR) and potato processing
waste (PPW).
2.1 Chemicals and Microorganism
IMO standards (D-maltose, maltotriose, isomaltotriose, isomaltotetraose, panose and

isomaltose) were obtained from Sigma-Aldrich (USA). Acetonitrile (HPLC grade)
was procured from Ranbaxy Fine Chemicals Ltd (New Delhi, India). Termamyl SC
and Fungamyl 800L were a gifted by Novozyme, India. Aspergillus niger PFS08, a
paddy field isolate was grown on potato dextrose agar slants and maintained at
4 ± 1 °C.
2.2 Production of α-Glucosidase
α-glucosidase was produced by submerged fermentation of Aspergillus niger

PFS08, as described in our earlier research paper (Basu et al. 2015). The enzyme
was concentrated using 50 KD Amicon filters (Sigma-Aldrich, USA). The con-
centrated broth, without any further purification, was used as the source of
α-glucosidase in the study. The α-glucosidase assay was also performed as
described by Basu et al. (2015).
Sustainable Utilization of Food Industry Waste … 57
2.3 Milling of BR
The rice grains were cleaned by removing foreign materials manually. The rice
grains were milled using a laboratory grinder to pass through 90 mesh sieve (US
standard). The rice powder was stored in an airtight plastic container at room
temperature (28 ± 2 °C) until needed.
2.4 Isolation of Starch from PPW
The potato processing waste (PPW) was collected from Maxvita Foods (India) Pvt
Ltd., Mysore, pH of the waste was noted, and it was stored at 4 °C until further use.
The foreign materials were cleaned manually, and the solid in the waste was
allowed to settle at 4 °C. The sediments were collected and washed with double
distilled water several times. The sediments were then dried overnight in an oven
(50 °C). The dried powder was passed through U.S standard 40 mesh sieve. The
starch powder was stored in an airtight plastic container at room temperature
(28 ± 2 °C) until needed.
2.5 Liquefaction
Starch (25 %) slurry was prepared, and 30 ppm Ca2+ (as CaCl2) ions were added.
The pH of the slurry was made 6.0 using 0.5 N NaOH. Termamyl SC (500 µL) was
added to 500 g of starch slurry, and the mixture was maintained at 90–95 °C (in a
Lab Companion water Bath) with continuous agitation (150 rpm). Samples were
withdrawn at regular interval and analyzed for residual starch using KI/I2 solution.
The liquefaction process was stopped by adjusting the slurry pH to 3.0 with lactic
acid.
2.6 Saccharification
The pH of the liquefied slurry was made 5.0 with the help of 0.5 N NaOH.
Following the addition of 12.5 µL Fungamyl 800 L to 5 mL slurry, the reaction
mixture was maintained 55 °C in a water bath (Lab Companion) with constant
agitation (150 rpm) for 24 h. Sampling was done every 6 h and reaction was
stopped by holding the reaction mixture in a boiling water bath for 10 min. The
carbohydrate composition of the samples was found by HPLC.
2.7 Transglucosylation
The saccharified slurry (5 mL) was then adjusted to pH 4.0 with lactic acid and
mixed with α-glucosidase (125 µL, 8 U/mL). The reaction mixture was held at
65 °C for 24 h in a water bath (Lab Companion) with constant agitation (150 rpm).
Every 6 h, samples were collected. After arresting, the reaction mixture was ana-
lyzed by HPLC for quantification of carbohydrates.
2.8 Production of High Content IMO (HC-IMO)
The glucose and unreacted maltose in the produced IMO was removed by baker’s
yeast fermentation. It involved mixing of 5 % (w/v) baker’s yeast with undiluted
low purity oligosaccharides liquid and adjusting the pH to 5. Samples were with-
drawn at a regular interval for 24 h and analysed for residual glucose and maltose
by HPLC. After the yeast fermentation, resultant ethanol was removed from the
liquid by evaporation.
2.9 HPLC Analysis
HPLC LC-20A (Shimadzu, Japan) installed with a refractive index detector RID
20A (Shimadzu, Kyoto, Japan) was used for the quantification of carbohydrate An
aminopropyl analytical column [250 mm × 4.6 mm SS Excil amino 5 μm (Santa
Clara, California)] was used with 65 % Acetonitrile as the mobile phase.
3.1 Liquefaction of BR and PPW
Liquefaction of both BR and PPW was complete within 4 h of reaction as indicated

by the development of light red to a brown (no blue) color when reacted with KI/I2
solution. As the liquefaction proceeded, the iodine-staining power of the slurry
slowly decreased and finally almost disappeared. In liquefaction, thermostable
Termamyl, SC (bacterial endo α-amylase) hydrolyses 1,4-α-glucosidic linkages in
amylose and amylopectin fraction of starch producing soluble dextrins of varying
chain length. Since the enzyme cannot hydrolyse the 1,6-α-glucosidic linkages in
starch, the products of the action of Termamyl SC are glucose, maltose, maltotriose
of panose and other higher maltooligosaccharides. The liquefied slurry from BR
consisted of 22.15 ± 1.49 g/L glucose, 47.22 ± 3.18 g/L maltose, 46.17 ± 3.10 g/L
maltotriose (DP3), 30.79 ± 2.07 g/L tetra-saccharides (DP4) and 43.30 ±

2.91 g/L of pentasaccharides (DP5). The HPLC analysis of the liquefied slurry
produced from PPW indicated the presence of glucose (17.02 ± 1.23 g/L), maltose
(41.78 ± 1.81 g/L), maltotriose (39.38 ± 2.66 g/L), DP4 (17.59 ± 0.53 g/L),
DP5 (48.39 ± 3.48 g/L), and other higher oligosaccharides (36.6 ± 3.38 g/L). The
results are in accordance with the other studies that showed that liquefaction of
starch formed a syrup with quite a similar composition (Takasaki et al. 1991; Zanin
and De Moraes 1996). It can also be noted that a high amount (40–50 %) of DP4
and other higher oligosaccharides were accumulated in the slurry which usually
improve the yield of maltose during saccharification (Mironescu et al. 2009).
3.2 Saccharification of BR and PPW
Fungamyl 800L is an endo-amylase that catalyses the liberation of maltose from

higher oligosaccharides. Figure 1a depicts the change in carbohydrate composition
during 24 h of saccharification when the liquefied slurry from broken rice (BR) was
used as the starting material. It was observed that the concentration of maltose is
raised to 165.65 ± 10.09 g/L during the first 6 h of saccharification. The concen-
tration of other sugars (DP4 and DP5) decreased gradually during this initial period
of saccharification because Fungamyl 800L sequentially hydrolyzes the higher
oligosaccharides to produce maltotriose (Eqs. 1–3), which is then hydrolyzed to
maltose (Eq. 4). The maltotriose concentration remained constant during this time
and was only found to decrease after 6 h of saccharification. The glucose con-
centration increased steadily throughout the saccharification and reached to
61.04 ± 2.21 g/L after 24 h of reaction. The results of saccharification also
Fig. 1 Change in carbohydrate composition during 24 h saccharification (pH 5.5, Temp 55 °C).
a Broken rice slurry was used substrate. b Potato processing waste slurry was used as substrate
indicated that the concentration of maltose reduced after 6 h due to its hydrolysis to
glucose (Eq. 5) and hence the 6 h was selected to be optimal for saccharification of
broken rice slurry.
Similar results were obtained when the liquefied slurry from potato processing
waste (PPW) was used substrate for Fungamyl 800L, as shown in Fig. 1b. During
initial 6 h of saccharification, the maltose concentration increased steadily to
130.92 ± 7.68 g/L whereas the concentration of other higher oligosaccharides
including maltotriose declined slowly (Eqs. 1–4). The trisaccharide panose was also
detected in the slurry during the saccharification that was not produced during the
saccharification of broken rice slurry. The maltose concentration was maximum
after 6 h of reaction and the 6 h saccharified syrup was further used for the pro-
duction of IMO by transglucosylation.
The results thus obtained are compatible with the findings of
Chockchaisawasdee and Poosaran (2013) who saccharified banana flour for the
production of IMO.
Gn þ H2 O ! Gn1 þ Gðn 5Þ ð1Þ
G5 þ H2 O ! G4 þ G ð2Þ
G4 þ H2 O ! Ga3 þ G ð3Þ
Ga3 þ H2 O ! Ga2 þ G ð4Þ
Ga2 þ H2 O ! 2G ð5Þ
where G = Glucose, Ga2 = Maltose, Ga3 = Maltotriose, G4 = Tetrasaccharides,

G4 = Pentasaccharides and G4 = other higher oligosaccharides.
3.3 Transglucosylation of BR and PPW
Alpha-glucosidase was used to achieve transglucosylation of malto-saccharified

syrup. The function of α-glucosidase is to hydrolyse α-glycosidic bonds in
oligosaccharides and polysaccharides with the liberation of α-D-glucose. However,
α-glucosidase also perform transglucosylation reaction at higher substrate concen-
tration resulting in IMO (Basu et al. 2015). The IMO synthesis was observed to
vary with the time of reaction and governed by Eqs. 6–9. When malto-saccharified
slurry from broken rice was used as a substrate, the maximum IMO production
(81.17 ± 3.15 g/L) was observed after 12 h of transglucosylation which corre-
sponds to nearly 45 % of the total sugar (Fig. 2a and b). During this time, the
concentration of glucose and panose (DP3) increased steadily while the later
reached a maximum of 38.35 ± 1.64 g/L and the maltose concentration reduced
considerably. During this period, glucose was released from maltose and the
Fig. 2 a and b Time course of IMO production from malto-saccharified syrup of broken rice
(pH 4, Temp 65 °C)
transfer of glucosyl residue takes place mostly to the 6-OH of the maltose and
yields panose as major transglucosylation product (Eq. 6). After 6 h of reaction, the
level of the tetrasaccharides (DP4) was also observed to rise due to the transfer of
glucosyl residue to the 6-OH of Panose (Eq. 8). Transfer of glucosyl residue also
occurred to the 6-OH of another glucose moiety leading to the formation of iso-
maltose (DP2) (Eq. 9) and reached 25.60 ± 0.75 g/L after 24 h of reaction.
Production of isomaltotriose (DP3) was found to be initiated from 12 h of reaction
as glucosyl residues are transferred to the 6-OH of the isomaltose which acts as an
acceptor and increased thereafter with further incubation, reaching a maximum of
4.08 ± 0.20 g/L after 24 h of reaction (Eq. 7). The concentration of maltotriose
was also found to decline whereas the concentration of DP5 increased in the course
of transglucosylation.
A comparable sugar profile was obtained when the malto-saccharified slurry
from PPW was used as a starting material for transglucosylation. As depicted in
Fig. 3a and b, maximum IMO (89.61 ± 0.03 g/L) was produced after 18 h of
transglucosylation. During this period, the main product formed was panose
(31.82 ± 0.06 g/L) and isomaltose (31.36 ± 0.25 g/L). Panose was formed by
transglucosylation of maltose and isomaltose was formed by transglucosylation of
glucose. The production of DP4 was initiated from 12 h of reaction and reached a
maximum of 13.15 ± 0.43 g/L. Isomaltotriose production did not start till 12 h and
increased after that.
The results showed that transglucosylation product, in both the cases, was
enriched in 1,6-α linked compounds. This could be due to their superior resistance
to hydrolysis by α-glucosidase as the enzyme is more specific for the cleavage of
α-(1, 4) glycosidic linkages. These observations are quite similar to that reported for
the synthesis of IMO by α-glucosidase produced from Aspergillus carbonarious
(Duan et al. 1994) and Xantophyllomyces dendrorhous (Fernández-Arrojo et al.
2007) which produced panose as the key transglucosylation product and A. niger
(Duan 1995), A. nidulans (Kato et al. 2002) which give isomaltose as the chief
Fig. 3 a and b Time course of IMO production from the malto-saccharified syrup of potato
processing waste (pH 4, Temp 65 °C)
reaction product. However, this profile contrasts the reports for α-glucosidase from
Acremonium sp. (Konishi and Shindo 1997) that produces oligosaccharides having
α-(1,2) bonds and Paecilomyces lilacinus (Kobayashi et al. 2003) which synthe-
sizes both α-(1,2) and α-(1,3) bonds.
2Ga2 ! Gb3 þ G ð6Þ
2Gb2 ! Gc3 þ G ð7Þ
2G3 ! G4 þ G ð8Þ
2G ! Gb2 ð9Þ
where G = Glucose, Ga2 = Maltose, Gb2 = Isomaltose, Gb2 = Panose, Gc3 =

Isomaltotriose, G4 = Tetrasaccharides.
3.4 Production of High Content IMO
The IMO was fermented by Baker’s yeast to eliminate liberated glucose and
unreacted maltose from the product Fig. 4 showed that almost all glucose and a
considerable amount of maltose was removed from the oligosaccharides mixture by
12–18 h of fermentation without affecting the total IMO content. The yeast possibly
failed to utilize isomaltose and other oligosaccharides due to the presence of
1,6-α-glucosidic linkages. This outcome is consistent with earlier reports that
described IMO to be undigested by yeast (Pan and Lee 2005; Chockchaisawasdee
and Poosaran 2013). After yeast fermentation, 92 % IMO was produced from BR
and PPW composition of which is depicted in Table 1.
Fig. 4 Time course of Baker’s yeast fermentation for the production of high content IMO, a from
broken rice, b from potato processing waste
Table 1 Composition of IMO produced from BR and PPW

Component Broken rice (BR) Potato processing waste (PPW)
Isomaltose (g/L) 14.15 ± 0.87 26.43 ± 0.24
Maltotriose (g/L) 4.24 ± 0.18 1.89 ± 0.19
Panose (g/L) 38.13 ± 0.58 32.05 ± 2.46
Isomaltotriose (g/L) 1.98 ± 0.11 2.94 ± 0.06
DP4 (g/L) 14.57 ± 0.59 9.81 ± 0.22
DP5/Higher oligo (g/L) 11.51 ± 0.03 8.78 ± 0.19
Total IMO (g/L) 84.60 ± 2.31 81.94 ± 2.55
% IMO 92 % 92 %
Yield 0.34 kg of IMO/kg of BR 0.1 kg of IMO/l of PPW
4 Conclusion
From the present investigation, it is possible to conclude that broken rice and potato
processing waste could be potential raw materials for the enzymatic synthesis of
IMO. This process has the potential to solve the disposal problem of PPW to some
extent. The process will also enable utilization of industrial by-products like broken
rice, which are presently considered as low-value material, for the production of
high-value prebiotic IMO. On the basis of the promising findings presented in this
paper, investigations on the remaining issues are ongoing. We intend to concentrate
on improving the yield and productivity of the process by simultaneous sacchari-
fication and transglucosylation in future. Additionally evaluating the prebiotic and
physico-chemical properties of IMO mixtures is worth exploring.
Acknowledgments Anindya Basu would like to express his sincere thanks to Council of
Scientific and Industrial Research (CSIR), India for the award of Fellowship. The Director,
CSIR-Central Food Technological Research Institute, Mysore, India is also thanked for his
support.
References
Basu, A., Mutturi, S., Prapulla, S.G.: Modeling of enzymatic production of isomaltooligosaccha-
rides: a mechanistic approach. Catal. Sci. Technol. 5, 2945–2958 (2015)
Chockchaisawasdee, S., Poosaran, N.: Production of isomaltooligosaccharides from banana flour.
J. Sci. Food Agric. 93, 180–186 (2013)
Duan, K.: Transglucosylation of a fungal α-glucosidase. Ann. N. Y. Acad. Sci. 750, 325–328 (1995)
Duan, K.J., Sheu, D.C., Lin, M.T., Hsueh, H.C.: Reaction-mechanism of isomaltooligosaccharides
synthesis by alpha-glucosidase from Aspergillus carbonarious. Biotechnol. Lett. 16, 1151–
1156 (1994)
Fernández-Arrojo, L., Marín, D., Gómez De Segura, A., et al.: Transformation of maltose into
prebiotic isomaltooligosaccharides by a novel α-glucosidase from Xantophyllomyces dendror-
hous. Process Biochem. 42, 1530–1536 (2007)
Glor, E.B., Miller, C.H., Spandau, D.F.: Degradation of starch and its hydrolytic products by oral
bacteria. J. Dent. Res. 67, 75–81 (1988)
Goffin, D., Delzenne, N., Blecker, C., et al.: Will isomalto-oligosaccharides, a well-established
functional food in Asia, break through the European and American market? The status of
knowledge on these prebiotics. Crit. Rev. Food Sci. Nutr. 51, 394–409 (2011)
Gohel, V., Duan, G.: No-cook process for ethanol production using Indian broken rice and pearl
millet. Int. J. Microbiol. 1–9 (2012)
Kato, N., Suyama, S., Shirokane, M., et al.: Novel alpha-glucosidase from Aspergillus nidulans
with strong transglycosylation activity. Appl. Environ. Microbiol. 68, 1250–1256 (2002)
Kobayashi, I.K., Okuda, M.T., Ashimoto, H.H., et al.: Purification and characterization of a new type
of α-glucosidase from Paecilomyces lilacinus that has transglucosylation activity to produce α-1,
3- and α- 1, 2-linked oligosaccharides. Biosci. Biotechnol. Biochem. 67, 29–35 (2003)
Konishi, Y., Shindo, K.: Production of nigerose, nigerosyl glucose, and nigerosyl maltose by
Acremonium sp. S4G13. Biosci. Biotechnol. Biochem. 61, 439–442 (1997)
Mironescu, M.: Investigations on wastewaters at potato processing and starch recovery and
characterisation. J. Agroalim. Process Technol Investig. 17, 134–138 (2011)
Mironescu, M., Mironescu, I.D., Trifan, A.: Influence of the liquefied starch composition and pH on
the saccharification at the obtaining of maltose syrup. Bull. UASVM Agric. 66, 364–369 (2009)
Pan, Y.C., Lee, W.C.: Production of high-purity isomalto-oligosaccharides syrup by the enzymatic
conversion of transglucosidase and fermentation of yeast cells. Biotechnol. Bioeng. 89, 797–
804 (2005)
Roberfroid, M.: Prebiotics: the concept revisited. J. Nutr. 137, 830S–837S (2007)
Sheu, D.C., Huang, C.I., Duan, K.J.: Production of isomaltooligosaccharides by alpha-glucosidase
immobilized in chitosan beads and by polyethyleneimine-glutaraldehyde treated mycelia of
Aspergillus carbonarious. Biotechnol. Tech. 11, 287–291 (1997)
Takasaki, Y., Shinohara, H., Tsuruhisa, M., Imada, K.: Maltotetraose-producing amylase from
Bacillus. Agric. Biol. Chem. 55, 1715–1720 (1991)
Yoo, S.H., Kweon, M.R., Kim, M.J., et al.: Branched oligosaccharides concentrated by yeast
fermentation and effectiveness as a low sweetness humectant. J. Food Sci. 60, 516–519 (1995)
Zanin, G.M., De Moraes, F.F.: Modeling cassava starch saccharification with amyloglucosidase.
Appl. Biochem. Biotechnol. 57(58), 617–625 (1996)
Enhancing the Bioproduction of Cellulase
by Aspergillus nidulan via Medium
Optimization
P. Saravanan and R. Muthuvelayudham
1 Introduction
Enzymatic hydrolysis of cellulose to glucose was carried out by the enzyme cel-
lulase, a multi enzyme complex made up of several proteins. The cellulase enzyme
is synthesized by microorganisms for their growth on cellulosic materials. The
microorganisms are aerobic, anaerobic, mesophilic (or) thermophilic. Among them,
the genera of Clostridium, Cellulomonas, Thermomonospora, Trichoderma,
Aspergillus are extensively studied cellulase producer (Riswanali et al. 2012). The
fungus Aspergillus nidulan is an efficient producer of cellulase enzymes.
The lignocelluloses are agro industrial products by solid materials and utilized as
physical support and source of nutrients in Solid state fermentation (SmF). The
lignocellulosic substrates are such as barley bran, oat straw, sugarcane bagasse,
grape, rice straw, corn, wheat straw, and others (Singhania et al. 2009; Dashtban
et al. 2009). These biodegradable wastes are recognized as potential sustainable
source for production of various value added products like, biofuel, animal feed,
chemicals and enzymes (Ping et al. 2011). Fruit wastes fabricated in large amounts
in India are both used as an animal feed and disposed of to the soil. Since fruit
wastes include large amounts of carbohydrates and some nutrients, they can
function as substrates for production of ligninolytic enzymes and other value-added
products due to their renewable nature and low-cost availability through SmF
(Akpinar and Ozturk Urek 2012).
P. Saravanan (&) R. Muthuvelayudham

Department of Chemical Engineering, Annamalai University, Annamalai Nagar,
Chidambaram 608002, Tamil Nadu, India
e-mail: pancha_saravanan@yahoo.com
R. Muthuvelayudham
e-mail: muthupriya_03@yahoo.com

DOI 10.1007/978-981-10-1920-3_7
66 P. Saravanan and R. Muthuvelayudham
The present study was aimed at screening of nutrients and optimization of the
selected nutrients in SmF using Plackett–Burman method and central composite
design (CCD) to enhance the cellulase production.
2.1 Microorganisms and Maintenance
A. nidulan were obtained from the Institute of Microbial Technology, Chandigarh,

India. The cultures were maintained on potato dextrose agar slants at 4 °C and the
slants were sub-cultured by every month.
2.2 Inoculum Preparation
The inoculum preparation, 2.0 ml of a spore suspension (containing

108 conidia/ml) of A. nidulan was inoculated into 50 ml of seed medium in 250 ml
Erlenmeyer flask and cultured at 30 °C, pH of 5.5 and 180 rpm for three days.
2.3 Fermentation Conditions
Fermentation was carried out in 250 ml cotton plugged Erlenmeyer flasks with 10 g
of pre-treated pomegranate peel (Saravanan et al. 2012) at pH 7. The supplemented
with different nutrient concentration for tests according to the selected factorial
design and sterilized at 120 °C for 20 min. After cooling the flasks at room tem-
perature, the flasks were inoculated with 1 ml of grown culture broth. The flasks
were maintained at 30 °C under agitation at 200 rpm for 48 h. During the pre-
liminary screening process, the experiments were carried out for 9 days and it was
found that the maximum production was obtained at 6th day. Hence further
experiments were carried out for 6 days.
2.4 Enzyme Assay
Cellulase activity (measured as filter paper hydrolysing activity, using a 1 × 6 cm

strip of Whatman no. 1 filter paper) and cellobiase activity were assayed by Ghose
(Ghose 1987) and expressed as international units (IU). One international unit of
cellulase activity is the amount of enzyme that forms 1 µmol glucose (reducing
Enhancing the Bioproduction of Cellulase by Aspergillus nidulan … 67
sugars as glucose) per minute during the hydrolysis reaction. Reducing sugar was
determined by the dinitro salicylic acid (DNS) method (Ghose 1987).
2.5 Optimization of Cellulase Production
Design of experiment (DOE)

The RSM combined with a 33 full factorial experimental design was used to point out
the relationship existing between the response functions and effect of nutrients as well
as to determine the conditions of these variables able to optimize the fermentation.
3 Results and Discussions
Initially the carbon and nitrogen sources were screened and among them the best
carbon and nitrogen sources were selected for further optimization using PB design.
PB design was adopted to optimize various medium components for the production
of cellulase fermentation by A. nidulan. Various media components were investi-
gated for their effect in the process of cellulase production. The Pareto plots offer a
convenient view of the results obtained by PB design. The main effects plot is very
useful in determining the cellulase production at intermediate levels of different
combination of the independent variable. From the Pareto chart (Fig. 1) the
Pareto Chart of the Standardized Effects

(response is C14, Alpha = 0.05)
2.228
C
A
E
Term
H
D
0.0 0.5 1.0 1.5 2.0 2.5 3.0

Standardized Effect
Fig. 1 Pareto chart (A—avicel, B—corn steep flour, C—MnSO4H2O, D—FeSO47H2O, E—beef
extract, F—soybean cake flour, G—KH2PO4, H—CoCl26H2O, I—yeast extract)
Table 1 Ranges of variables Variables (g/l) Code −2 −1 0 +1 +2

used in RSM
Yeast extract I 5 7.5 10 12.5 15
MnSO4H2O C 0.6 0.8 1.0 1.2 1.4
Avicel A 15 20 25 30 35
Beef extract E 0.4 0.6 0.8 1.0 1.2
variables viz., yeast extract, MnSO4H2O, Avicel and beef extract, were selected for
further optimization to attain a maximum response (Table 1).
The level of factors yeast extract, MnSO4H2O, Avicel and beef extract and the
effect of interactions on cellulase production were determined by central composite
design of RSM. Thirty experiments were preferred at different proportions of the
factors shown in (Table 2) and the central point was repeated five times (8, 17, 20,
21 and 26). The results were analysed by ANOVA. The second order regression
equation provided the levels of cellulase activity.
Y ¼ 11:63 þ 0:43I þ 0:94C þ 0:53A + 1:05E 0:67IC

þ 0:20IA þ 0:13IE þ 0:86CA þ 0:087BE 0:24CE ð1Þ
0:60I 0:95C 1:27A 0:91E
2 2 2 2
where Y is the cellulase yield (IU/mL), I, C, A and Y is yeast extract, MnSO4H2O,

Avicel and beef extract respectively.
The analysis of variance of the quadratic regression method demonstrated for the
highly significant model. The Model F-value of 11.69 implies that the model is
significant. There is only a 0.01 % chance that a “Model F-Value” this large could
occur due to noise. Values of “Prob > F” less than 0.05 indicate model terms are
significant. Values greater than 0.1 indicate the model terms are not significant. In
the present work, all the linear and square effects of A, B, C, and D are significant
for cellulase production. The coefficient of (R2) for cellulase activity is calculated as
0.9160, which is very close to 1 and can explain up to 91.60 % variability of the
response. The predicted R2 value of 0.5882 is reasonable agreement with the
adjusted R2 value of 0.8376. An adequate precision value greater than 4 is desir-
able. The adequate precision value of 10.079 indicates an adequate signal and
suggests that the model can be used to navigate the design space.
The interactive effects for cellulase production are studied by plotting 3D surface
curves against any two independent variables, while the other variables at its central
(0) level. The 3D curves of the calculated response (cellulase production) and
contour plots from the interactions between the variables are shown in Fig. 2.
Figure 2 shows the dependency of cellulase on yeast extract and MnSO4H2O. The
cellulase activity increases with increase in yeast extract upto 10.35 g/l and
thereafter cellulase activity decreases with further increase in yeast extract. Increase
in avicel resulted increase in cellulase activity up to 26.91 g/l. This is evident from
Fig. 2 show the dependency of cellulase activity on beef extract. The effect of beef
extract on cellulase observed is similar to other variables. The maximum cellulase
Table 2 Central composite design (CCD) of factors in coded levels with enzyme activity
Run no. I C A E Experimental cellulase activity Predicted cellulase activity
1 −1 1 −1 1 7.9 5.23
2 0 0 0 2 11.6 6.50
3 −1 −1 −1 1 7.1 4.28
4 1 −1 −1 −1 6.3 5.23
5 0 0 0 −2 5.1 4.17
6 0 −2 0 0 6.8 4.48
7 1 1 −1 1 8.5 5.49
8 0 0 0 0 12.3 7.80
9 1 −1 1 −1 7.8 4.89
10 0 0 0 0 11.3 7.80
11 0 2 0 0 9.6 6.38
12 1 1 1 1 10.7 7.71
13 1 −1 −1 1 8.9 5.64
14 0 0 2 0 7.5 6.70
15 −1 1 1 1 11.5 7.69
16 −1 1 1 −1 9.6 5.78
17 0 0 0 0 12.3 7.80
18 −1 −1 1 −1 4.6 3.73
19 −2 0 0 0 9.4 4.47
20 0 0 0 0 12.2 7.80
21 0 0 0 0 11.2 7.80
22 1 −1 1 1 8.8 6.46
23 −1 −1 −1 −1 5.3 3.81
24 2 0 0 0 9.8 5.90
25 1 1 −1 −1 6.3 4.78
26 0 0 0 0 10.5 7.80
27 0 0 −2 0 6.3 4.57
28 1 1 1 −1 9.4 5.84
29 −1 −1 1 1 4.6 5.34
30 −1 1 −1 −1 6.5 4.46
activity is observed at 0.90 g/l of beef extract. Figure 2 shows the dependency of
cellulase activity on MnSO4H2O.
The maximum cellulase activity was observed at 1.12 g/l afterwards, the
organism exhibited a decreasing trend. The optimum conditions for the maximum
production of cellulase are estimated by regression equation. The optimum con-
ditions are: yeast extract—10.35 g/l, MnSO4H2O—1.12 g/l, Avicel—26.91 g/l
and beef extract—0.90 g/l.
The interactive effects for cellulase production are studied by plotting 3D surface
curves against any two independent variables, while the other variables at its central
(0) level. The 3D curves of the calculated response (cellulase production) and
(a) (b)
13 12.3
Cellulase activity IU/mL

9.75 9.975
6.5 7.65
5.325
3.25
3
0
2.00 1.00
2.00 1.00
1.00 0.25
1.00 0.25 0.00 -0.50
0.00 -0.50 -1.00 -1.25
C: Avicel A: Yeast extract
B: MnSO4.H2O -1.00 -1.25 A: Yeast extract -2.00 -2.00
-2.00 -2.00
(c) (d)
12.3 13

10 9.25
7.7 5.5
5.4 1.75
3.1 -2
2.00 1.00 2.00 2.00

1.00 0.25 1.00 1.00
0.00 -0.50 0.00 0.00
D: Beef extract -1.00 -1.25 A: Yeast extract C: Avicel -1.00 -1.00 B: MnSO4.H2O
-2.00 -2.00 -2.00 -2.00
(e) (f)
13
13
9.25
9.75
5.5
6.5
1.75
3.25
-2
0
2.00 2.00
2.00 2.00 1.00 1.00
1.00 1.00 0.00 0.00
0.00 0.00 D: Beef extract -1.00 -1.00 C: Avicel
-1.00 -1.00 -2.00 -2.00
D: Beef extract B: MnSO4.H2O
-2.00 -2.00
Fig. 2 3D plot showing the effect of nutrients on the cellulase production
contour plots from the interactions between the variables are shown in Fig. 2a–f.
Figure 2a shows the dependency of cellulase on yeast extract and MnSO4H2O. The
cellulase activity increases with increase in yeast extract upto 10.35 g/l and
thereafter cellulase activity decreases with further increase in yeast extract. The
similar observation in Fig. 2b. Increase in avicel resulted increase in cellulase
activity up to 26.91 g/l. This is evident from Fig. 2c, e and f show the dependency
of cellulase activity on beef extract. The effect of beef extract on cellulase observed
is similar to other variables. The maximum cellulase activity is observed at 0.90 g/l
of beef extract. Figure 2d shows the dependency of cellulase activity on
MnSO4H2O. The maximum cellulase activity was observed at 1.12 g/l afterwards,
the organism exhibited a decreasing trend. The optimum conditions for the maxi-
mum production of cellulase are estimated by regression equation. The optimum
conditions are: yeast extract—10.35 g/l, MnSO4H2O—1.12 g/l, Avicel—26.91 g/l
and beef extract—0.90 g/l.
4 Conclusions
The production of an enzyme by a bioprocess using a fruit waste is a value addition

to the fruit residues. In this work, optimization of cellulase production by
Aspergillus nidulan using the cheap substrate pomegranate waste was tried. The
nutrients were screened using PBD and the selected nutrients were optimized using
CCD to enhance the cellulase production. The best conditions for enzyme pro-
duction are identified as yeast extract—10.35 g/l, MnSO4H2O—1.12 g/l, Avicel—
26.91 g/l, and beef extract—0.90 g/l with respect to media components. Using the
optimized conditions, the cellulase production reaches 11.6 IU/mL. Additionally,
these findings are potential for developing an eco-friendly process for industries,
involving in the processing of lignocellulosic substrates containing wastes to confer
value added products.
References
Akpinar, M., OzturkUrek, R.: Production of ligninolytic enzymes by solid state fermentation using
Pleurotus eryngii. Prep. Biochem. Biotechnol. 42, 582–597 (2012)
Dashtban, M., Schraft, H., Qin, W.: Fungal bioconversion of lignocellulosic residues; opportu-
nities and perspectives. Int. J. Biol. Sci. 5(6), 578–595 (2009)
Ghose, T.K.: Measurement of cellulase activities. Pure Appl. Chem. 59(2), 257–268 (1987)
Ping, L., Brosse, N., Sannigrahi, P., Ragauskas, A.: Evaluation of grape stalks as a bioresource.
Ind. Crops Prod. 33, 200–204 (2011)
Riswanali, S.B., Saravanan, P., Muthuvelayudham, R., Viruthagiri, T.: Optimization of nutrient
medium for cellulase and hemicellulase productions from rice straw: a statistical approach. Int.
J. Chem. Anal. Sci. 3(4), 1364–1370 (2012)
Saravanan, P., Muthuvelayudham, R., Viruthagiri, T.: Application of statistical design for the
production of cellulase by Trichoderma reesei using mango peel. Enzyme Res. Article ID
157643, 7 pages (2012)
Singhania, R.R., Patel, A.K., Zoclo, C.R., Pandey, A.: Recent advances in solid-state fermentation.
Biochem. Eng. J. 44, 13–18 (2009)
Modeling and Theoretical Analysis
of Isomaltooligosaccharide
(IMO) Production Using Fed-Batch
Process
Sarma Mutturi and Anindya Basu
1 Introduction
A prebiotic is defined as a ‘non-digestible food ingredient that beneficially affects

the host by selectively stimulating the growth and/or activity of one or a limited
number of bacteria in the colon and thus improves host health’ (Gibson and
Roberfroid 1995). Non-digestible oligosaccharides (NDOs) are drawing an
increasing amount of attention as prebiotics since health promoting effects of some
of this prebiotics are well documented. Oligosaccharides with a degree of poly-
merization (DP) between 2 and 8 have shown to selectively increase the growth of
lactobacillus sp. and bifidobacteria sp. Oligosaccharides are also helpful as they are
not used by pathogenic microbes such as Salmonella and Escherichia coli in the
colon (Licht et al. 2012). Prebiotics are mainly associated with breakfast cereals,
baked goods, cereal bars and baby foods, as well as some dairy products. The
probiotics market has come into existence primarily on the launch of special yogurt
and fermented milk drinks and is growing at a fast rate.
Isomaltooligosaccharides (IMO) is a promising prebiotic widely used for food or
feed additives because of their mild sweetness superior heat and acid stability,
lower viscosity and water activity (Glor et al. 1988; Yoo et al. 1995; Sheu et al.
1997). Structurally IMO is oligosaccharides (DP 2-5) containing glucose monomer
linked together by α-(1,4) and α-(1,6) glyosidic linkages. The most abundant IMOs
are isomaltose, panose, isomaltotriose, isomaltotetraose, isopanose and higher
branched oligosaccharides. Although traditionally glucosyl-transferase (EC 2.4.1) is
used for the conversion of maltose to isomaltooligosaccharides, the widely avail-
S. Mutturi (&) A. Basu

Microbiology and Fermentation Technology Department,
CSIR-CFTRI, Mysore 570020, India
e-mail: sarma.mutturi@gmail.com
S. Mutturi A. Basu
AcSIR—Academy of Scientific and Innovative Research, New Delhi, India

DOI 10.1007/978-981-10-1920-3_8
74 S. Mutturi and A. Basu
able α-glucosidase (EC 3.2.1.20) can also be used. It hydrolyses α-glycosidic

linkages from the non-reducing end of oligosaccharides and polysaccharides with
the release of α-glucose. Besides this hydrolytic activity, the enzyme also displays a
transferase activity at higher maltose concentration (transglucosylation reaction),
which results in the formation of IMO (Pan and Lee 2005).
In our previous study, we described a batch process for the production of IMO
by enzymatic transglucosylation of maltose using α-glucosidase obtained from
Aspergillus niger PFS (Basu et al. 2015). The reaction mechanism was formulated
and modeled mechanistically using a set of experimental data and later validated
against a different experimental setup in the same study. The results showed several
inhibition parameters were significant and lowered the yield of the process con-
siderably during transglucosylation. Interestingly in a fed-batch system such inhi-
bitions can be avoided by adding the substrate (maltose) gradually to the reactor.
Therefore in the present study our earlier comprehensive model for the batch system
has been extended to a fed-batch system and theoretical analysis have been carried
out. The model simulations were carried for two different feeding strategies, i.e.,
constant feeding and linear feeding and some simulations have indeed resulted in
higher yields in comparison to the batch experiments. To the best of our knowledge,
this is the first study to deal with IMO production in a fed batch system.
2 Methods
2.1 Model Development
IMO produced from maltose involves a complex combination of simultaneous

hydrolysis and transglucosylation reactions in an enzymatic setup. The model was
developed using inventory equation wherein the dynamic accumulation rates are
accounted as follows:
Rate of accumulation of the state component = Input of the component (via
feeding) + generation of the component (via hydrolysis/transglucosylation)—con-
sumption of the component (via hydrolysis/transglucosylation)
The rate of accumulations of individual components is as follows:
Glucose:

dG 2 180 180 180
¼ ðr1 þ r4 Þ þ ðr2 þ r3 þ r5 þ r14 Þ þ ðr6 þ r7 Þ
dt 342 504 666

180 FðtÞ
þ ðr8 þ r9 þ r10 Þ r13 G
2 342 VðtÞ
Modeling and Theoretical Analysis of Isomaltooligosaccharide … 75
Maltose:

dG2 342 342 FðtÞ
¼ r1 þ ðr3 þ r5 Þ ðr8 þ r9 Þ þ ðr11 þ r12 Þ þ ðSF G2 Þ
dt 504 2 504 VðtÞ
Isomaltose:
0
dG2 342 342 FðtÞ 0
¼ ðr2 þ r14 Þ r4 r10 þ r13 ðG2 Þ
dt 504 2 180 VðtÞ
Panose:

dG3 504 504 FðtÞ
¼ ðr2 þ r3 Þ þ r7 þ r9 r12 ðG3 Þ
dt 666 2 342 VðtÞ
Maltotriose:
0
dG3 504 504 FðtÞ 0
¼ r5 þ r6 þ r8 r11 ðG3 Þ
dt 666 2 342 VðtÞ
Isomaltotriose:
00
dG3 504 FðtÞ 00
¼ r14 þ r10 ðG3 Þ
dt 2 342 VðtÞ
Tetraose:

dG4 666 FðtÞ
¼ r6 þ r11 ðG4 Þ
dt 2 504 VðtÞ
Glucosylpanose:
0
dG4 666 FðtÞ 0
¼ r7 þ r12 ðG4 Þ
dt 2 504 VðtÞ
Flowrate:
dV
F¼
dt
In case of constant flowrate F(t) = constant, where as in case of linear flowrate

F(t) = slope × time (t)
The reaction terms are defined in Table 1.
Table 1 Kinetics assumed for reaction rates during modeling of fed-batch process
r1 ¼
v1r G2 2r G3
r2 ¼ Kv2M r3 ¼ v
3r
G3
G2 þ G3 G2
K1M þ 1þK G2 K3M 1 þ K G 1þK þ G3
1iG2 3iG 3iG2

0
v4r G2
r6 ¼ v6r G4
0
v5r G3

r4 ¼ r5 ¼
0 K6M 1 þ K G þ G4 G2 0
K4M 1 þ K G þ G2 6iG K5M 1 þ K G 1þK þ G3
4iG 5iG 5iG2
0 v8r
G2 v9r
G2
r7 ¼ v7r G4 r8 ¼ r9 ¼
G2 G2
0 K8M þ G2 1 þ K K9M þ G2 1 þ K
K7M 1 þ KG þ G4 8iG 9iG
7iG
v10r G2
0
v11r G3
0
r12 ¼ v12r G3
r10 ¼ r11 ¼ G2
0 G2 0 K12M 1 þ K þ G3
K10M 1þK G þ G2 K11M 1 þ K þ G3 12iG2
10iG 11iG2
13r G r15 ¼ FðtÞ

r13 ¼ Kv13M þG
The parameters are defined in the appendix section. The parameter values were
obtained from Basu et al. (2015) which were computed using genetic algorithm
while calibrating against the experimental data.
2.2 Simulations
All the simulations were carried using MATLAB® 2013b on Windows 8.1pro
platform with Intel(R) Core(TM) i7-4770 processor. The solution to a set of ODEs
was obtained using the MATLAB ODE solver, ode15s. This solver uses variable
order and variable step-length with implicit numerical differentiation formula
(NDF) to compute the solution over each time interval (Ashino et al. 2000).
3.1 Constant Feeding
The fed-batch simulations for IMO production using constant flow rate were carried
using different values as shown in Table 2. The comparison in final yield of IMO
with reference to the batch reaction and also in terms of other variables is shown in
Table 2. It can be observed that above the feed rate values of 0.005 L/h the yields in
IMO is higher than of batch reaction. Moreover from the values it can be observed
Table 2 Comparison of batch and constant feeding fed-batch production of IMO

Time Mode Flow Initial Final Total Final Residual Yield
(h) rate volume volume IMO glucose maltose predicted
(L/h) (L) (L) (g/L) (g/L) (g/L) (g IMO/g
maltose)
24 h Batch 0 – – 319.57 265.58 23.23 0.55
Constant 0.0005 0.01 0.022 166.33 107.62 55.85 0.31
feeding 0.005 0.01 0.13 289.64 166.87 100.70 0.58
0.05 0.01 1.21 312.07 175.39 111.24 0.64
0.5 0.01 12.01 314.47 176.17 112.53 0.65
60 h Batch 0 – – 227.32 380.28 8.69 0.38
Constant 0.0005 0.01 0.04 207.68 214.41 35.28 0.37
feeding 0.005 0.01 0.31 280.22 263.51 45.74 0.51
0.05 0.01 3.01 290.48 269.46 47.17 0.53
0.5 0.01 30.01 291.56 270.06 47.32 0.53
Fig. 1 Yield at different

constant flow rates for
enzymatic reaction time of 24
and 60 h
that the yields levelled beyond the constant flow rate of 0.05 L/h (Fig. 1). Thus, it
can be concluded that with operating flow rates between 0.005 and 0.5 L/h would
alleviate substrate inhibition during IMO production. The time profiles of all the
components at 0.005 L/h constant feed rate is shown in Fig. 2. Here the volume
follows a linear profile for a constant feed rate profile.
Fig. 2 Time profiles of state variables during constant feed (0.005 L/h) fed-batch of IMO
production
3.2 Linear Feeding
Here in linear feeding, the feed profile follows a linear curve with a constant slope
along the time axis. The slopes were predetermined and the time course profiles for
the state variables have been observed at each selected slope. The yield of total
IMO during different linear feeding profiles has been computed and shown in
Table 3. It can be observed from this table that the yields of IMO could reach a
value of 0.68, higher than that of batch and constant feed rate fed-batch. Also it can
be observed from Table 3 that as the slope increased beyond 2E−03 L/h2, the yields
were consolidated to 0.66–0.68 and 0.58–0.59 in case of 24 and 60 h, respectively.
It can be observed that the substrate inhibition can be effectively alleviated using
linear feed fed-batch production IMO. Figure 3 describes the effect of slope of
Table 3 IMO response values for linear feeding fed-batch production of IMO
Time (h) Start Final Slope Initial Final Total Final Residual Yield
flow flow volume volume IMO glucose maltose predicted
rate rate (L) (L) (g/L) (g/L) (g/L) (g IMO/g
(L/h) (L/h) Maltose)
Linear 0.005 0.0055 2E−05 0.01 0.016 103.80 59.33 57.46 0.19
Feeding 0.005 0.0098 2E−04 0.01 0.068 241.40 122.15 149.37 0.54
(24 h)
0.005 0.053 2E−03 0.01 0.59 274.08 133.38 184.24 0.66
0.005 0.485 2E−02 0.01 5.78 277.38 134.03 189.63 0.68
0.005 4.805 2E−01 0.01 57.70 277.70 134.06 190.24 0.68
Linear 0.005 0.0062 2E−05 0.01 0.046 230.00 182.92 61.66 0.43
feeding 0.005 0.017 2E−04 0.01 0.37 294.89 216.79 78.02 0.56
(60 h)
0.005 0.1205 2E−03 0.01 3.62 303.69 220.62 80.23 0.58
0.005 1.205 2E−02 0.01 36.08 304.63 221.00 80.47 0.59
0.005 12.005 2E−01 0.01 360.75 304.72 221.04 80.49 0.59
Fig. 3 Yield at different

constant flow rates for
enzymatic reaction time of 24
and 60 h
linear feed on IMO yield. It can be observed with increasing slope in the range of
2E−5 to 0.002 L/h2 the yield of IMO has increased for both reaction times of 24 and
60 h. However beyond 0.002 L/h2 the yield of IMO has not increased significantly
and reached a plateau with maximum yields of 0.68 and 0.59 for 24 and 60 h of
reaction times, respectively (Fig. 3).
The time course analysis of one of the slopes (2E−03 L/h2) is provided in Fig. 4.
From this figure it can be observed that the volume follows a parabolic profile for a
linear feed profile.
Fig. 4 Time profiles of state variables during linear feed (2E−03 L/h2) fed-batch of IMO
production
4 Conclusion
Using 0.005 and 0.05 L/h constant feeding for 60 and 24 h fed-batch reactions,
respectively, would be feasible in a lab scale reactor to achieve optimal IMO yield
with final working volume reaching 0.31 and 1.21 L, respectively. Similarly for
linear feeding the 2 × 10−4 and 2 × 10−3 L/h2 slopes would be appropriate for
bench scale reactors, where the final volumes would reach 0.37 and 0.59 L,
respectively. Both linear and constant feed-based fed-batch production of IMO has
alleviated substrate and product inhibitions significantly and thus contributed
increased yield and productivity of IMO when compared to batch studies.
Acknowledgments The authors would like to thank Director, CSIR-CFTRI and Head,
Microbiology and Fermentation Technology, CSIR-CFTRI for their kind support and
encouragement.
Appendix
G Glucose V4r Maximum velocity of hydrolysis

of isomaltose to glucose (g/L h)
G2 Maltose K4M Michaelis-Menton constant of
hydrolysis of isomaltose to
glucose (g/L)
0
G2 Isomaltose K4iG Competitive inhibition constant
by glucose on isomaltose as
substrate (g/L)
G3 Panose v5r Maximum velocity of hydrolysis
of maltotriose to maltose (g/L h)
0
G3 Maltotriose K5M Michaelis-Menton constant of
hydrolysis of maltotriose to
maltose (g/L)
00
G3 Isomaltotriose K5iG Competitive inhibition constant
by glucose on maltotriose as
substrate (g/L)
G4 Maltotetraose K5iG2 Competitive inhibition constant
bymaltose on maltotriose as
substrate (g/L)
0
G4 Glucosyl-panose v6r Maximum velocity of hydrolysis
of maltotetraose to maltotriose
(g/L h)
v Maximum velocity (g/L h) K6M Michaelis-Menton constant of
hydrolysis of maltotetraose to
maltotriose (g/L)
KM Michaelis-Menton constant (g/L) K6iG Competitive inhibition constant
by glucose on maltotetraose as
substrate (g/L)
Ki Inhibition constant (g/L) v7r Maximum velocity of hydrolysis
of glucosyl-panose to panose
(g/L h)
R Rate of reaction (1, 2, 3, … K7M Michaelis-Menton constant of
subscripts denotes Eqs. 1, 2, 3, …) hydrolysis of glucosyl-panose to
panose (g/L)
v1r Maximum velocity of hydrolysis K7iG Competitive inhibition constant
of maltose to glucose (g/L h) by glucose on glucosyl-panose as
substrate (g/L)
K1M Michaelis-Menton constant of v8r Maximum velocity of hydrolysis
hydrolysis of maltose to glucose of isomaltotriose to isomaltose
(g/L) (g/L h)
(continued)
(continued)
K1iG2 Substrate inhibition constant of K8M Michaelis-Menton constant of
hydrolysis of maltose to glucose hydrolysis of isomaltotriose to
(g/L) isomaltose (g/L)
v2r Maximum velocity of hydrolysis v9r Maximum velocity of
of panose to isomaltose (g/L h) transglucosylation of maltose to
maltotriose (g/L h)
K2M Michaelis-Menton constant of K9M Michaelis-Menton constant of
hydrolysis of panose to isomaltose transglucosylation of maltose to
(g/L) maltotriose (g/L)
v3r Maximum velocity of hydrolysis K9iG2 Substrate inhibition constant of
of panose to maltose (g/L h) transglucosylation of maltose to
maltotriose (g/L)
K3M Michaelis-Menton constant of v10r Maximum velocity of
hydrolysis of panose to maltose transglucosylation of maltose to
(g/L) panose (g/L h)
K3iG Competitive inhibition constant by K10M Michaelis-Menton constant of
glucose on panose as substrate transglucosylation of maltose to
(g/L) panose (g/L)
K3iG2 Competitive inhibition constant by K10iG2 Substrate inhibition constant of
maltose on panose as substrate transglucosylation of maltose to
(g/L) panose (g/L)
v11r Maximum velocity of K13M Michaelis-Menton constant of
transglucosylation of isomaltose to transglucosylation of panose to
isomaltotriose (g/L h) glucosyl-panose (g/L)
K11M Michaelis-Menton constant of K13iG2 Competitive inhibition constant
transglucosylation of isomaltose to by maltose on panose as substrate
isomaltotriose (g/L) (g/L)
K11iG Substrate inhibition constant of v14r maximum velocity of
transglucosylation of isomaltose to transglucosylation of glucose to
isomaltotriose (g/L) isomaltose (g/L h)
v12r Maximum velocity of K14M Michaelis-Menton constant of
transglucosylation of maltotriose to transglucosylation of glucose to
maltotetraose (g/L h) isomaltose (g/L)
K12M Michaelis-Menton constant of
transglucosylation of maltotriose to
maltotetraose (g/L)
K12iG2 Substrate inhibition constant of
transglucosylation of maltotriose to
maltotetraose (g/L)
v13r Maximum velocity of
transglucosylation of panose to
glucosyl-panose (g/L h)
References
Ashino, R., Nagase, M., Vaillancourt, R.: Behind and beyond the MATLAB ODE Suite. Comput.
Math. Appl. 40(4–5), 491–512 (2000)
Basu, A., Mutturi, S., Prapulla, S.G.: Modeling of enzymatic production of isomaltooligosaccha-
rides: a mechanistic approach. Catal. Sci. Technol. 5, 2945–2958 (2015)
Gibson, G.R., Roberfroid, M.B.: Dietary modulation of the human colonic microbiota: introducing
the concept of prebiotics. J. Nutr. 125, 1401–1412 (1995)
Glor, E.B., Miller, C.H., Spandau, D.F.: Degradation of starch and its hydrolytic products by oral
bacteria. J. Dent. Res. 67, 75–81 (1988)
Licht, T.R., Ebersbach, T., Frøkiær, H.: Prebiotics for prevention of gut infections. Trends Food
Sci. Technol. 23, 70–82 (2012)
Pan, Y.C., Lee, W.C.: Production of high-purity isomalto-oligosaccharides syrup by the enzymatic
conversion of transglucosidase and fermentation of yeast cells. Biotechnol. Bioeng. 89, 797–
804 (2005)
Sheu, D.C., Huang, C.I., Duan, K.J.: Production of isomaltooligosaccharides by alpha-glucosidase
immobilized in chitosan beads and by polyethyleneimine-glutaraldehyde treated mycelia of
Aspergillus carbonarious. Biotechnol. Tech. 11, 287–291 (1997)
Yoo, S.H., Kweon, M.R., Kim, M.J., Auh, J.H., Jung, D.S., Kim, J.R., Yook, C., Kim, J.W., Park,
K.H.: Branched oligosaccharides concentrated by yeast fermentation and effectiveness as a low
sweetness humectant. J. Food Sci. 60, 516–519 (1995)
Optimization of Na2CO3 Pre-treatment
by RSM Approach for Releasing Reducing
Sugars from Cocoa Pod Shells
Vinayaka B. Shet, Nisha, Manasa Bhat, Manasa,

Leah Natasha S. Mascarenhas, Louella C. Goveas,
C. Vaman Rao and P. Ujwal
1 Introduction
Lignocelullose is the most abundant energy source on earth (Wang et al. 2007).
Biological conversion of lignocellulose into biochemicals involves hydrolysis of
polysaccharides such as cellulose and hemicelluloses into monosaccharides via
enzyme or chemicals prior to fermentation (Badger 2002). Lignin prevents cellulase
to catalyse cellulose and also adsorbs enzymes, making them inactive for hydrolysis
(Converse et al. 1990). Alkali pre-treatments are among the most effective methods
due to their ability to remove lignin (Zhang et al. 2012). Pre-treatment at mild
conditions using inexpensive chemicals is suggested to decrease the cost of
pre-treatment (Karimi et al. 2013). Sodium carbonate is one of the inexpensive and
environmentally friendly alkali chemicals used for pre-treatment, under harsh
conditions and also oxidative pre-treatment of lignocellulosic materials (Bjerre et al.
1996; Salehi et al. 2012). Cocoa pod was reported to contain about 43.9–45.2 %
carbohydrate (Davendra 1980). Cocoa pod shell are abundantly available in
Dakshina Kannada (D.K) India. In the current study one factor at a time (OFAT)
analysis was carried out. Further parameter levels identified by OFAT were used to
generate centre points for response surface methodology (RSM) experiments to
achieve maximum production of reducing sugar as response.
V.B. Shet (&) Nisha M. Bhat Manasa L.N.S. Mascarenhas

L.C. Goveas C.V. Rao P. Ujwal
Department of Biotechnology Engineering, NMAMIT (V.T.U, Belagavi),
Nitte 574110, Karnataka, India
e-mail: vinayakabshet@nitte.edu.in

DOI 10.1007/978-981-10-1920-3_9
86 V.B. Shet et al.
2 Methodology
2.1 Processing of Raw Material
The raw material used in the study was Cocoa pod shells (CPS) which were
sundried and then further moisture content was removed by drying in hot air oven at
around 100 °C. Size reduction unit operation was carried out to achieve powder of
CPS by using grinder. All chemicals, solvents and reagents used in the study were
of analytical grade, unless mentioned.
2.2 Optimization of CPS Pre-treatment
2.2.1 Selection of Significant Parameters and Their Levels by OFAT
Pre-treatment of CPS was carried out by sodium carbonate hydrolysis. The OFAT
approach was used to select the significant physical parameters and the levels for
pre-treatment process are given in Table 1.
Estimation of reducing sugars released was carried out by dinitrosalicylic acid
(DNSA) method (Miller 1972) after neutralising the samples. The parameter at
which maximum reducing sugars released were chosen as the centre point values to
enhance the pre-treatment process by RSM.
2.2.2 Central Composite Design
The factors (X1 and X2) exhibiting significant effect during OFAT studies were
chosen and their levels were optimized for maximum extraction of reducing sugars
as response (Y1) using central composite design (CCD) for Na2CO3 hydrolysis.
CCD was designed for RSM optimization by STATISTICA software (Statsoft
1999) with two factors and five levels (Table 2) and it consisted of 12 experimental
runs (Table 3).
The data of pre-treatment studies obtained was subjected to analysis by using
analysis of variance (ANOVA) using the same software.
The optimization experiments were carried out as per Tables 3. The levels of
other non significant factors, agitation speed and weight of CPS was maintained at
Table 1 Parameters and their Parameter Notation Test range

levels for OFAT studies
Weight of CPS (%w/v) X1 1–7
Na2CO3 concentration (N) X2 1–6
Time (h) X3 1–6
Agitation speed (rpm) X4 50–150
Optimization of Na2CO3 Pre-treatment by RSM Approach … 87
Table 2 Coded parameters Factors Notations Levels

and their actual levels for
−α −1 0 1 +α
optimisation by CCD
Weight (%w/v) X1 2.171 3 5 7 7.828
Concentration (N) X2 0.585 1 2 3 3.414
Table 3 CCD for Run X1 X2 Y1

optimization of CPS
pre-treatment 1 3 1 0.985
2 3 3 0.631
3 7 1 0.884
4 7 3 0.530
5 2.17 2 0.783
6 7.82 2 0.934
7 5 0.58 1.237
8 5 3.41 0.631
9(C) 5 2 0.682
10(C) 5 2 0.682
11(C) 5 2 0.732
12(C) 5 2 0.682
100 rpm and 0.5 g/L (from OFAT studies). The expected products of hydrolysis are
glucose, galactose, cellobiose and minor saccharides as xylose and arabinose. All of
these saccharides are reducing sugars (Ranjan et al. 2014).
2.3 Validation of the Second Order Polynomial Model
The second order polynomial model obtained from RSM was validated. The
experimental output was then compared to the values predicted by the second order
model obtained from CCD, to find out the goodness of fit of the model.
3 Results
3.1 Optimisation of Pre-treatment of CPS
3.1.1 Selection of Significant Parameters and Their Levels by OFAT
The significant physical parameters and the initial test range of four factors
(Table 1) for the pre-treatment processes were obtained by OFAT. When X1 was
88 V.B. Shet et al.
Fig. 1 Effect of change in a CPS weight; b Na2CO3 concentration (N); c time (h) and d agitation
speed (rpm) on the release of reducing sugars by Na2CO3 hydrolysis of CPS
varied by keeping other factors constant (X2 = 2 N, X3 = 1 h, X4 = 100 rpm),

maximum released reducing sugar (RRS) concentration of X1 was 5 (%w/v) rep-
resented in Fig. 1a. Similarly X2 was 2 N (Fig. 1b). In the present study, on
variation of time and agitation speed, it was observed that, there was no significant
difference in RRS (Fig. 1c, d). On the basis of these results, levels of factors (X1
and X2) were determined and subjected to optimization by CCD.
3.1.2 Optimisation of Parameters for Release of Reducing

Sugars by Alkali Hydrolysis by CCD
The influence of X1 and X2 on release of reducing sugars was determined by CCD

as indicated in Table 3.
Table 4 shows that only the linear effect of the Na2CO3 showed highly signif-
icant effect on the reducing sugar concentration released by alkali hydrolysis of
CPS (Y1) whereas all the other effects were found to be insignificant.
It was observed that RRS decreased with increase in X2 and increased with
increase in X1 (Fig. 2). On the basis of desirability plots the optimized conditions
for obtaining maximum RRS (Y1) were 7.82 g of CPS treated with 0.58 N of
Na2CO3 (Fig. 3). Concentration of RRS was found to be 0.94 g/L at optimized
condition.
Table 4 ANOVA table showing the effect of independent and interaction effects of variables on
the RRS by Na2CO3 hydrolysis of CPS
SS df MS F P
X1(L) 1.71E−05 1 1.71E−05 0.00154 0.96993
X1(Q) 0.01433 1 0.01433 1.32776 0.29304
X2(L) 0.30616 1 0.30616 28.3749 0.00178
X2(Q) 0.04631 1 0.04631 4.29185 0.08369
X1 * X2 0 1 0 0 1
Error 0.06474 6 0.01079
Total SS 0.42334 11
Values less than 0.05 indicate significance at 95% confidence interval and are emphasized in bold
Fig. 2 3D plot showing the variation of RRS with respect to changes in X1 and X2
The regression equation for RRS by alkali hydrolysis, as a function of the two
independent variables (X1 and X2) and their linear and quadratic interactions, are
represented by the following model
Y1 ¼ 1:718 0:1179X1 1:536X2 þ 0:0118X21 þ 0:0851X22 þ 2:49E 17X1 X2
Coefficient of determination (R2) was found to be 0.84, is a measure of the

strength of the linear relationship between the experimental and predicted value.
The observed values of RRS were compared with the RRS values as predicted
by the second order models. These results of Table 5 indicates that there is excellent
correlation between experimental and predicted values and in turn proves the
validity of the models.
90 V.B. Shet et al.
Fig. 3 Profiles for desirability levels of factors X1 and X2 for maximum RRS by Na2CO3
hydrolysis
Table 5 Validation RUN # X1 X2 Yex Ypr

experiments indicating the
fitness of the model generated 1 2.5 1.5 0.71 0.885
by CCD to predict the RRS 2 6 2.5 0.56 0.63
from pre-treated CPS 3 4 3 0.51 0.595
4 5 3 0.51 0.583
5 7 2 0.71 0.743
6 3 1 0.81 1.021
4 Conclusion
Optimization studies in the field of pre-treatment of lignocellulosic biomass are

scarce. In this context, an attempt was made to optimize the release of reducing
sugars by Na2CO3 hydrolysis of cocoa pod shells by using CCD. RSM was found
to be efficient in describing the effect of significant factors and modeling the
pre-treatment process. The significance of this study is that the optimized conditions
obtained from this study can be used for the release of reducing sugars from the
lignocellulosic raw material which could be used as an input for production of
biochemical’s by fermentation.
Acknowledgments Authors thank Mr. Anantharamakrishna from the Peruvai village of Vittla
(D.K.) India for providing cocoa pod shells as per the requirement and VGST, Government of
Karnataka, India for funding the project.
References
Badger, P.C.: Ethanol from cellulose: a general review. In: Janick, J., Whipkey, A. (eds.) Trends in
New Crops and New Uses. ASHS Press, Alexander (2002)
Bjerre, A.B., Olesen, A.B., Fernqvist, T., Ploger, A., Schmidt, A.S.: Pre-treatment of wheat straw
using combined wet oxidation and alkaline hydrolysis resulting in convertible cellulose and
hemicelluloses. Biotechnol. Bioeng. 49, 568–577 (1996)
Converse, A.O., Ooshima, H., Burns, D.S.: Kinetics of enzymatic hydrolysis of lignocellulosic
materialsbased on surface area of cellulose accessible to enzyme and enzyme adsorption on
lignin and cellulose. Appl. Biochem. Biotechnol. 24–25(1), 67–73 (1990)
Davendra, C.: The feeding value of by-product from cocoa and coconuts in diets for farm
livestock. In: Proceeding of the International Conference on Cocoa and Coconuts, Kuala
Lumpur, 457–471 (1980)
Karimi, K., Shafiei, M., Kumar, R.: Progress on physical and chemical pre-treatment of
lignocellulosic biomass. In: Kumar Gupta, V. (ed.), Biofuels and biorefineries: recent
developments. Springer Science Publisher, Germany, pp. 53–96 (2013)
Miller, G.L.: Use of dinitrosalicylic acid reagent for determination of reducing sugar. Anal. Chem.
31(3), 426–428 (1972)
Rajan, K., Carrier, D.J.: Effect of dilute acid pre-treatment conditions and washing on the
production of inhibitors and on recovery of sugars during wheat straw enzymatic hydrolysis.
Biomass Bioenergy 62, 222–227 (2014)
Salehi, S.M.A., Karimi, K., Behzad, T., Poornejad, N.: Efficient conversion of rice straw to
bioethanol using sodium carbonate pre-treatment. Energy Fuels 26, 7354–7361 (2012)
Statsoft: Statistics for Windows, Statsoft Inc., Tulsa, USA (1999)
Wang, M., Wu M, Huo H.: Life cycle energy and greenhouse gas emission impacts of different
corn ethanol plant types. Environ. Res. Lett. 2,1–13 (2007)
Zhang, Sh, Keshwani, D.R., Xu, Y., Hanna, M.A.: Alkali combined extrusion pre-treatment of
corn stover to enhance enzyme saccharification. Ind. Crop. Prod. 37, 352–357 (2012)
Partitioning of Nitralase Enzyme
from Pseudomonas putida in Polymer/Salt
Aqueous Two Phase System
V. Lokesh Ramana, Iyyaswami Regupathi, B.S. Rashmi

and S. Nainegali Basavaraj
1 Introduction
Nitriles are organic compounds with –CN as their functional group. Nitriles are
important intermediates in the synthesis of amides, amines, esters, carboxylic acid,
ketones and heterocyclic compounds (Gong et al. 2012). These are extensively used
in chemical industry for the production of solvents, drug intermediates, pharma-
ceuticals and herbicides. Nitrilase (EC 3.5.5.1) is an enzyme, which can be used as
a green catalyst for the hydrolysis of the nitriles to their respective carboxylic acids
and ammonia, it is of great importance because of their ability to convert toxic
nitriles to high value acids and amides under mild conditions without affecting other
reactive groups (Kaul et al. 2004).
Various kinds of purification techniques like salt precipitation, chromatography,
gel filtration have been used to purify nitrilase (Banerjee et al. 2006). All these
methods were expensive and difficult to scale up at industrial level. Overall design
of a process must be consider in order to scale up a technique which will reduce the
downstream costs and operational steps. Aqueous two phase extraction is one of the
selective extraction method. ATPS has several advantages over other techniques
such as system consists of 80–90 % of water which reduces the degradability of
target biomolecules, high biocompatibility, good resolution, simple process
scale-up and low interfacial tension. In the present study, the partition behavior of
Nitralase produced from Pseudomonas putida in polymer/salt systems with dif-
ferent salts was studied in detail. Binodal curves were constructed and tie lines were
V. Lokesh Ramana I. Regupathi (&) B.S. Rashmi S.N. Basavaraj

Surathkal, Mangalore 575025, India
e-mail: regupathi@nitk.ac.in

DOI 10.1007/978-981-10-1920-3_10
94 V. Lokesh Ramana et al.
generated for PEG/Salt systems and equilibrium phase compositions of the

two-phase systems were analysed using Othmer-Tobias and Bancroft equations.
The partitioning behavior of Nitralase was investigated by varying system
parameters.
Pseudomonas putida culture was grown on media described by (Banerjee et al.

2006) and incubated for 12 h at 30 °C in an orbital shaker (150 rpm) which was
subjected to homogenization followed by centrifugation (12,000 rpm at 4 °C) and
for the partitioning studies supernatant was used. To study the partition behavior of
enzyme, crude extract of 30 % (w/w) was added to different composition of ATPS.
Total protein and Nitralase activity in Top and bottom phase samples were analysed
by Bradford assay (Bradford 1976) and nessler method (Banerjee et al. 2006)
respectively.
Cloud point method was employed to obtain the binodal curves (Bolar et al.
2013). Tie lines were determined (Eq. 2) by preparing a suitable biphasic system of
salt and polyethylene glycol of total weight of 10 g. Systems were allowed to
equilibrate at 25 °C for 24 h and the separated individual phases were analyzed for
the concentration of salt and polymer by using flame photometer and digital
refractometer respectively. The concentration of polymer as well as salt influences
the Refractive index of the solution. For dilute aqueous solution containing a
polymer and salt, the relation between refractive index (ηD) and the mass fraction
of polymer (Wp) and salt (Ws) is given by
g D ¼ a0 þ a1 W p þ a2 W s ð1Þ
where Wp is the weight fraction of polymer and Ws are the and salt respectively. a0,
a1, a2 are the fitting parameters and were presented in Table 1.
Tie line length (TLL),
qffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi
TLLðwt%Þ ¼ ðWst Wsb Þ2 þ ðWpt Wpb Þ2 ð2Þ
where Wst and Wsb are the salt concentration at top and bottom phase (%W/W),
Wpt and Wpb corresponds to polymer concentration in top and bottom phase (%
w/w).
Table 1 Fit parameters for ATPS a0 a1 a2

Eq. (1)
PEG1000/Na2SO4 1.331 0.127 0.155
PEG1000/NaH2PO4 1.331 0.144 0.105
PEG1000/Na3C6H5O7 1.331 0.148 0.168
PEG1000/K3C6H5O7 1.331 0.144 0.130
Partitioning of Nitralase Enzyme from … 95
Pseudomonas putida Putrid culture was grown on media described by Banerjee

et al. (2006) and incubated for 12 h at 30 °C in an orbital shaker (150 rpm) which
was subjected to homogenization followed by centrifugation (12,000 rpm at 4 °C)
and supernatant was used for further partitioning studies. To study the partition
behavior of enzyme, 30 %(w/w) of crude extract was added to different composi-
tion of ATPS. Top and bottom phase samples were analysed for total protein
content by Bradford assay (Bradford 1976) and Nitralase activity by measuring the
amount of ammonia produced using nessler method using mandelonitrile as a
substrate (Banerjee et al. 2006). The important parameters in ATPS which char-
acterize the partitioning behavior of the enzyme like, Activity partitioning coeffi-
cient (Ke), Partitioning coefficient of total protein (Kp), Enzyme purification folds
and %yield were analyzed at different conditions. All these parameters were find
out by using the equations described in Bolar et al. (2013).
3.1 Effect of Type of Salt
The enzyme partition behavior depends on the concentration and type of phase
forming components, polymer Molecular weight, pH, volume ratio and equilibrium
characteristics. Four different salts (sodium sulphate, sodium dihydrogen phos-
phate, Trisodium citrate and Tripottasium citrate) effect were investigated on par-
titioning of Nitralase with PEG1000 concentration and constant 10 %w/w salt
concentration. The phase forming ability of all the four salts were evaluated with
PEG-1000. Binodal data was generated through cloud point method for PEG
1000-salt combinations except PEG1000/tripottasium citrate which was obtained
from Kalaivani et al. (2013). The binodal curves shape and position depends on the
type of salt and polymer used. From the binodal curve (Fig. 1) it was known that
the concentration of salts required to form two phase are in the sequence of
Na2SO4 < Na3C6H5O7 < NaH2PO4 < K3C6H5O7. Decreased cationic radius of
sodium increased the salting out ability. Two phase region formed was high in case
of sodium salts (0.098 nm) due to decreased cationic radius than potassium salt
(0.133 nm). It was observed that cations with more negative Gibbs free energies of
hydration (DGhydation) require less salt concentration to form biphasic system
consequently less amount of sodium salts (Na+: −375 kJ/mol) were required to salt
out PEG when compared to potassium salt (K+: −304 kJ/mol).
From Fig. 1b it was seen that anionic species (So4 2 , HPo4 2 , acetate) which has
high charge density are more effective and consequently affected the Nitralase
partition. Thus sodium sulfate with high sulfate charge density and high salting out
ability expelled nitralase to a top phase which increases the hydrophobic interaction
Fig. 1 a Binodal curves for PEG1000/salt system; b Partitioning coefficient of nitrilase with
different salts [Sodium sulphate (filled diamond), Sodium dihydrogen phosphate (filled square),
Trisodium citrate (–) and Tri potassium citrate (x)]
between PEG and enzyme giving highest partition Ke when compared to other salts.
The best Ke of 2.066 and yield of 67.38 % was obtained for the salt sodium sulfate.
3.2 Effect of PEG and Salt Concentration
The selection of the polymer and its concentration is one of the critical factor to
achieve maximum partitioning in an ATPS. Different PEG MW (1000, 2000, 4000,
6000 and 8000) were investigated on partition coefficient of enzyme.
Partitioning was carried out with five different MWs of PEG and with different
PEG (12–17 %) concentration with constant 10 % sodium sulfate. It was observed
from Fig. 2a that increases in molecular weight and concentration of the PEG
decreases the partition coefficient of an enzyme. This trend was observed due to
volume exclusion effect and increased viscosity and interfacial tension. At
Molecular weight of PEG-1000 and concentration of 15 % with constant 10 %
sodium sulfate maximum ke of 2.066 and yield of 67.39 % was achieved.
Mehrnoush et al. (2011) observed similar findings in pectinase partition from
mango waste.
Effect of concentration of salt on partitioning of nitrilase was studied by keeping
the PEG1000 (15 %w/w) concentration constant and varying the salt concentration
from 10–14 %w/w. From Fig. 2b, it was noticed that on increasing the salt con-
centration above 10 % the partitioning of total protein increased from 1.426 to 2.56
whereas the partitioning coefficient of the nitrilase enzyme decreased. This could be
due to the salting out effect of the salt which resulted in expelling the contaminating
protein to the top phase. Yucekan et al. (2011) reported similar results when par-
titioning invertase in PEG-3000 and sodium sulphate system. Bolar et al. (2013)
also observed identical findings for the enzyme L-glutaminase from Zacharomycex
rouxii.
Fig. 2 a Effect of PEG on nitrilase partitioning coefficient at different PEG [MW—1000 (filled
diamond), 2000 (filled square), 4000 (filled circle), 6000 (x) and 8000 (+)]. b Effect of
concentration of salt on Ke (filled diamond), Kp (filled square) and yield % (filled circle)
3.3 Effect of Tie Line Length (TLL)
Tie line length describes the phase forming components concentration present in the
top and bottom phase. The partition coefficient of nitrilase tends to increase up to a
TLL% of 35.09 and above this TLL there was precipitation observed at the inter-
phase for PEG1000/sodium sulfate system (Fig. 3a).Increase in TLL increases the
phase forming components concentration in the respective phases. Hydrophobic
interactions between PEG and protein increases with increase in PEG thus reduces
the free volume of salt phase which results in effective salting out which moves the
protein towards top phase thus increase in partition coefficient of an enzyme. At
very high TLL the physical properties like density and viscosity of the system
increases and also available free volume for target biomolecule to accommodate in
given phases decreases thus enzyme partitioned to interphase above 35.09 %. Very
low TLL fails to give a sharp resolution between the phases. Mehrnoush et al.
(2013) reported findings in serine protease recovery from mango waste where the
maximum k was observed at TLL of 28.5 and decreases above that, this result was
in agreement with glutaminase partition reported by Bolar et al. (2013).
3.4 Effect of PH
Change in pH alters the composition of ions in the phases and changes the prop-
erties of a biomolecule. Different range of pH from 5.5 to 10 was analyzed in
system of 15 %w/w PEG1000 and 10 % w/w sodium sulphate on Nitralase parti-
tion. It was noticed from Fig. 4a that the Ke and Yield % of nitrilase increased up to
pH 7.5 and decreased above that. This could be due to negative charge acquired by
enzyme above its isoelectric point which increases its affinity towards PEG and
Fig. 3 a Effect of TLL on Ke with PEG -1000/salt (Sodium sulphate (filled diamond), Sodium
digydrogenphosphate (filled square), Trisodiumcitrate (filled circle) Tripotassium citrate (x).
b Effect of TLL on Ke with PEG-1000 (filled diamond), 2000 (filled square), 4000 (filled circle),
6000 (x) and 8000 (+) with Sodium sulphate
Fig. 4 a Effect of pH on Ke (filled square) and yield % (filled circle); b Effect of broth loading
(BL)
leads to high partition. Similar results were reported by yang et al. (2008) in
partitioning of plant esterase in PEG1000/NaH2PO4 and (Kavakcioglu et al. 2013)
in partitioning of catalase from Phanerochaete chrysosporium. Maximum Ke of
5.412 and yield % 84.40 % was obtained at pH 7.5
3.5 Effect of Broth Loading and Phase Volume Ratio (Vr)
Effect of broth loading was studied by adding the fermentation broth from 10 to
70 %w/w to the PEG1000 (15 %w/w) and sodium sulfate (10 %) ATPS. From
Fig. 4b it was observed that up to 50 % of broth loading Ke increases and decreases
with further increase. When broth loading % increases above certain value enzyme
as well as the contaminant protein concentration increases. These impurities com-
pete with nitrilase in the top phase for the free volume and exclude it from the top
phase and results in poor Ke. Similar results were obtained by in purification of
lipase from recombinant E. coli BL21 and (Khayati et al. (2013). At Broth loading
of 50 % a purification factor of 2.525 and yield of 75.75 % and ke of 3.125 was

obtained for nitrilase from Pseudomonas putida.
The effect of volume ratio on nitralase partition was studied at TLL 35.09 % by
employing different range of Vr from 0.5 to 2 at pH 7.5 and 50 % Broth loading.
The equilibrium composition of phase forming salts remains constant irrespective
of the volume ratio. It was observed that purification factor increases up to a volume
ratio of 1.5 and decreases with further increase this was observed because, at high
volume ratio saturation limit was attained by Particular phases which tends the
proteins to precipitate at interface. The optimum volume ratio is 1.5 with Ke 5.482,
yield 89.15 % purification fold 2.46.
4 Conclusions
The partition study of Nitralase from Pseudomonas putida was successfully. The
phase diagrams for four salts (sodium sulphate, sodium dihydrogen phosphate,
Trisodium citrate and tripottasium citrate) with PEG 1000 was developed. The
system comprising of PEG1000/sodium sulfate gave maximum two phase region
and yield higher partition coefficient in top phase. The effect of phase forming
components, TLL, broth loading, concentration of phase component, polymer
molecular weight and pH was effectively studied. It was found that increase in
molecular weight of the PEG decreases the partition coefficient of the enzyme. TLL
of 35.02 %, Broth loading of 50 %, pH 7.5 and volume ratio of 1.5 exhibit max-
imum partition coefficient for Nitralase enzyme. It was investigated by present
study that PEG/sodium sulfate system can be effectively employed for the selective
extraction of Nitralase enzyme from fermentation broth.
References
Banerjee, A., Kaul, P., Banerjee, U.C.: Purification and characterization of an enantioselective
arylacetonitrilase from Pseudomonas putida. Arch Microbial, 184:407–418 (2006)
Bolar, S., Belur, P.D., Iyyaswami, R.: Partitioning studies of glutaminase in polyethylene glycol
and salt based Aqueous two-phase system. Chem. Eng. Technol. 8, 1378–1386 (2013)
Bradford, M.M.: A rapid and sensitive method for the quantitation of microgram quantities of
protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254 (1976)
Gong, J.S., Lu, Z.M., Li, H., Shi, J.S., Zhou, Z.M., Xu, Z.H.: Nitrilases in nitrile biocatalysis:
recent progress and forthcoming research. Microb. Cell Fact. 11, 142 (2012)
Kalaivani, S., Regupathi, I.: Partitioning studies of a-lactalbumin in environmental friendly poly
(ethylene glycol)—citrate salt aqueous two phase systems. Bioprocess Biosyst. Eng. 90, 342–
350 (2013)
Kaul, P., Banerjee, A., Mayilraj, S., Banerjee, U.C.: Screening for enantio selective nitrilase:
kinetic resolution of racemic mandelonitrile to (R)-(−)—mandelic acid by new bacterial
isolates. Tetrahedron: Asymmetry, 15:207–211 (2004)
Kavakçıoğlu, B., Tarhan, L.: Initial purification of catalase from Phanerochaete chrysosporium by
partitioning in poly(ethylene glycol)/salt aqueous two phase systems. Sep. Purif. Technol. 105,
8–14 (2013)
Khayati, G., Alizadeh, S.: Extraction of lipase from Rhodotorula glutinis fermentation culture by
aqueous two-phase partitioning. Fluid Phase Equilib. 13(353), 132–134 (2013)
Mehrnoush, A., Sarker, M.Z.I., Mustafa, S., Yazid, A.M.M.: Direct purification of pectinase from
mango (Mangifera Indican Cv. Chokanan) peel using a PEG/salt-based aqueous two phase
system. Molecules 16: 8419–8427 (2011)
Mehrnoush, A., Yazid, A.M.M.: Purification and recovery of serine protease from mango
(Mangifera indica cv.Chokanan) waste using aqueous two-phase system: potential low cost of
enzyme and purification method. J. Food, Agri. Environ. 11(3 & 4): 4 0–4 6 (2013)
Yang, S., Huang, Z., Jiang, Z., Li, L.: Partition and purification of a thermostable xylanase
produced by Paecilomyces thermophila in solid-state fermentation using aqueous two-phase
systems. Process Biochem. 43(1), 56–61 (2008)
Yücekan, I., Önal, S.: Partitioning of invertase from tomato in poly(ethylene glycol)/sodium
sulfate aqueous two-phase systems. Process Biochem, 46, 226–232 (2011)
Aqueous Two-Phase (Acetonitrile–Potassium
Citrate) Partitioning of Bovine Serum
Albumin: Equilibrium and Application
Studies
Badekar Sagar Dilip, Regupathi Iyyaswami,

Basavaraj S. Nainegali and B.S. Rashmi
1 Introduction
Aqueous two-phase extraction systems (ATPE) are formed by mixing distinctive

hydrophilic solvents, immiscible polymers and salts in some ranges of concentra-
tion and are highly used in the separation and purification of biomolecules (Liu
et al. 2012) such as proteins (Asenjo and Andrews 2011), nucleic acids (Luechau
et al. 2009), enzymes (Mehrnoush et al. 2012), flavor compounds (Cardoso et al.
2013), antioxidants and antibiotics (Azevedo et al. 2009) and low molecular weight
products. Partitioning of biomolecules in ATPE systems is affected by many fac-
tors, including molecular weight/size of polymer, concentration of solvent, salt type
and its ionic strength (Brooks et al. 1985), addition of salts, such as NaCl, the
degree of pH, temperature and affinity of the macromolecule towards polymer or
solvent (Alberttson 1986; Ratanapongleka 2010). The primary point of interest of
ATPE strategy is that it generously decreases the number of primary steps of
downstream processing mainly partial purification is coordinated in one unit. It can
be used in combination of other separation methods such as liquid chromatography
(Alberttson 1986), packed column (Rosa et al. 2012), magnetic particle adsorption
(Gai et al. 2011). However some difficulties during the scale-up of the ATPS in the
industry was reported, especially polyethylene glycol (PEG)/salt system causing
corrosion of equipment and precipitation of target product.
In the past decades, ATPS have shown capable to be created by two polymers
[dextran/polyethylene glycol (Grolbmann et al. 1995)] or by a polymer-salt com-
bination [polypropylene glycol/(NH4)2SO4, MgSO4, KCl or KCH3CO2] (Zhao
et al. 2011) can be labeled as ‘‘traditional systems’’. In recent times, other com-
pounds have been successfully used in the replacement of the traditional con-
B.S. Dilip R. Iyyaswami (&) B.S. Nainegali B.S. Rashmi

Surathkal, Mangalore 575025, Karnataka, India

DOI 10.1007/978-981-10-1920-3_11
102 B.S. Dilip et al.
stituents, such as the pairs alcohol–salt (Reis et al. 2012), ionic liquid–salt (Neves
et al. 2009), ionic liquid–polymer (Pereira et al. 2013), and ionic liquid–carbohy-
drate (Freire et al. 2011). Recently, pioneering ATPS based on acetonitrile
(ACN) and sugars have also been reported (Wang et al. 2008).
Acetonitrile (CH3CN) is an aprotic organic solvent miscible with water in the
whole composition range and its molecules do not strongly interact with themselves
leaving a hydrogen bond network formed by water (Takamuku et al. 1998).
Acetonitrile is a by-product from the manufacture of acrylonitrile (Pollak et al.
2000) widely used in pesticide, rubber, perfume, pharmaceutical industries and also
used as mobile phase in reverse phase high performance liquid chromatography in
separation and purification processes (Taha et al. 2012). Aiming to find novel
phase-forming components to create ATPS, this work found innovative ATPS
formed by acetonitrile and potassium citrate (C6H5K3O7) as a salt and water. The
corresponding phase diagrams, tie-lines and tie-line lengths were determined at
303.15 K. Moreover, to investigate the extractive performance of this novel system
and used in the partitioning of BSA protein.
2.1 Materials
All compounds were purchased from Sigma-Aldrich: acetonitrile (HPLC grade with
a purity of 99.99 %), Potassium citrate (>99.5 % pure), BSA (>99 % pure).
2.2 Phase Diagrams and Tie-Lines
The binodal curve was determined for acetonitrile and potassium citrate by cloud
point titration method at temperature 303.15 K and atmospheric pressure.
Liquid-liquid equilibrium experiments were carried out by gravimetric method to
determine the tie-lines. The mass of the bottom phase was determined from the
volume of bottom phase and density of bottom phase and mass of the top phase was
obtained by the subtraction method. Then the mass fractions of salts in the top and
bottom phases were determined by flame photometer. Refractive index method was
used for determination of mass fraction of acetonitrile in both phases using the
following relation between refractive index of solution, (nD), and the mass fractions
of acetonitrile (w1) and C6H5K3O7 (w2) (Zafarani-Moattar et al. 2013)
nD ¼ a0 þ a1 w1 þ a2 w2 ð1Þ
Here, a0 is the refractive index of pure water for which obtained value of
1.33192 at T = 303.15 K. Two constants a1 and a2 corresponding to acetonitrile
Aqueous Two-Phase (Acetonitrile–Potassium Citrate) … 103
and potassium citrate respectively are obtained by using solver in excel and linear
calibration plot of refractive index of the solution are obtained (a1 and a2 are 0.0299
and 0.1652, respectively).
Also the slope of the tie-line and tie-line length at different compositions were
calculated using the Eqs. 2 and 3.
S ¼ ðW t1 W b1 Þ=ðW t2 W b2 Þ ð2Þ
2 2
TLL ¼ ½ W t1 W b1 þ W t2 W b2 0:5 ð3Þ
where, wt1 and wt2 represent the equilibrium compositions of acetonitrile and
potassium citrate mass fractions in the top phase, similarly wb1 and wb2 in bottom
phase respectively.
2.3 Partitioning of Bovine Serum Albumin
The partitioning of BSA in acetonitrile and potassium citrate was performed by

adding 1 mg/mL in the initial aqueous solution along with the phase forming
components. After complete mixing for 5 min, each tube was placed in a ther-
mostatic bath at 303.15 K for about 18 h for phase separation. The volume of each
phase was initially measured and both phases were further separated for the
quantification of BSA and for determination of their density, viscosity and pH
values. The concentration of BSA at each aqueous phase was quantified through
Bradford Assay. The partition coefficient and recovery of BSA was determined
according to Eqs. 4 and 5.
CT
K BSA ¼ ð4Þ
CB
CT
RT ¼ 100 ð5Þ
CT þ CB
3.1 Phase Diagram Data and Correlation
The experimental binodal data of the Acetonitrile + potassium citrate + water

system at (303.15 K) was correlated using Eq. 6 (Wang et al. 2009).
Table 1 Values of parameters of Eq. 6 for the Acetonitrile + C6H5K3O7 + H2O system at
temperature T = 303.15 K
ATPS (303.15) a b c SD R2
Acetonitrile + C6H5K3O7 0.9766 −2.9335 2.0319 0.0214 0.9984
w1 ¼ ða þ b w0:5
2 þ c w2 Þ ð6Þ
where, w1 and w2 are the mass fractions of acetonitrile and potassium citrate, and the
coefficients a, b and c, corresponding correlation coefficient (R2) and corresponding
standard deviations (SD) of Eq. 6 for the investigated system are given in Table 1.
n
X 2
sd ¼ ½ W1cal W1exp =n0:5
i¼1
1
Where, n represent the number of binodal data, Wexp is the experimental mass
1
fraction of acetonitrile and Wcal is the corresponding data calculated. The binodal
curve which is closer to the coordinate axis indicates the easier formation of the
phases (Guoa et al. 2012). Here, Potassium citrate shows higher tendency of phase
separation besides that, the conclusion was also explained by the effective excluded
volume (EEV) theory of salts (Han et al. 2013) where V* of 360.416 was obtained
for our system with Eq. 7.

w2 w1
ln v þ v ¼0 ð7Þ
m2 m1
3.2 Liquid-Liquid Equilibrium Data and Correlation
The experimental tie-line data of the acetonitrile + potassium citrate + H2O systems
at 303.15 K are shown in Table 2 and Fig. 1. The Othmer–Tobias equation (Eq. 8)
Table 2 Tie-line data for the acetonitrile + C6H5K3O7 + H2O systems at temperature
T = 303.15 K
ATPE at 303.15 K Total Top system Bottom system TLL Slope
system (wt
100 100 100 100 100 100 %)
W1 W2 W1t W2t W1b W2b
Acetonitrile + C6H5K3O7 39 7 48.118 3.300 19.189 13.964 30.83 −2.712
41 7.4 52.222 2.756 17.960 15.415 36.52 −2.706
43 7.8 56.193 2.357 17.031 16.721 41.71 −2.726
45 8.2 60.063 1.958 16.236 17.990 46.66 −2.733
47 8.6 63.199 1.523 15.840 19.187 50.54 −2.681
120
100
Acetonitrile (W1) wt %
80
60
40
20
0
0 5 10 15 20 25
C6H5K3O7 (W2) wt %
Fig. 1 Tie-lines at T = 303.15 K acetonitrile/potassium citrate (C6H5K3O7) ATPS
Table 3 Values of parameters of Eq. 8 for acetonitrile + C6H5K3O7 + H2O systems at temper-
ature 303.15 K
ATPS at 303.15 K K1 n R2 SD
Acetonitrile + C6H5K3O7 0.16980 0.89981 0.99977 0.11325
was used for correlating the LLE data of acetonitrile—C6H5K3O7 ATPS (Zhao et al.
2011).
!n
ð1 W t1 Þ ð1 W b2 Þ
¼ K 1 ð8Þ
W t1 W b2
Here, K1 and n are fitting parameters. As per the values of R2 and SD in Table 3,
it can be concluded that Othmer–Tobias equation can be satisfactorily applied for
correlating the tie-line data of the studied system.
3.3 Partitioning of Bovine Serum Albumin
Acetonitrile-potassium citrate system showed partition coefficient of BSA more

than 1 and showed the preferential interaction of BSA towards the acetonitrile-rich
phase. The partition coefficient increased with increase in tie line length of system
(Fig. 2a) and the hydration capacity of the salts prompts to an exclusion impact of
the BSA towards the acetonitrile-rich phase. Effect of acetonitrile concentration on
partitioning of BSA was investigated at salt concentration of 7 wt% with varying
Fig. 2 Effect of variables on top phase recovery % and the total BSA partition coefficient in
acetonitrile—C6H5K3O7 system. a Effect of TLL. b Effect of Acetonitrile concentration. c Effect of
Potassium citrate concentration. d Effect of pH. e Effect of phase volume ratio
acetonitrile concentration in the range of 39–51 wt%. The maximum partition

coefficient was obtained at acetonitrile concentration of 48 wt% with a maximum k
of 3.83(Fig. 2b). As concentration of acetonitrile increases, the free volume
available for the protein to partition into the top phase decreases causing the protein
to move into bottom phase as observed for acetonitrile concentration higher than 48
wt%. Partition coefficient increased up to salt concentration 9.4 wt% with constant
acetonitrile concentration. Maximum k value obtained for BSA in this system is
6.38 (Fig. 2c). Finally the system composition 48 wt% acetonitrile and 9.4 wt%
potassium citrate having TLL 53 wt% showed highest top phase BSA recovery of
86.45 %. In aqueous two phase system stronger phase separating compounds
improve the migration of the biomolecule for the opposite phase. Potassium citrate
showed good salting out capacity which is best for biomolecule migration in
opposite phase which is confirmed with BSA protein in our studies. After particular
concentration of salt the partition coefficient decreases, this may be because of
denaturation of biomolecule in presence of higher salt concentration and accumu-
lation of protein in the interphase (Kalaivani et al. 2012).
The ratio of charged species present in the system and also the net charge of the
biomolecule are known to vary with the system pH. Above isoelectric point, net
charge of the protein is negative and further increase in negativity depends on the
presence of charged amino acids on the protein surface. The variation of partition
coefficient with pH was analyzed for TL of 48 wt% acetonitrile—9.4 wt% potas-
sium citrate system and is reported in (Fig. 2d). Partition coefficient of protein was
observed to increase from system pH 4 to 6 and again it was decreasing at system
pH 7 and 8. The pI of BSA is 4.7 above which it is negatively charge. Acetonitrile
is also negatively charged which means that BSA must show maximum partitioning
below pH 4.7, but as per the results obtained we can find maximum partitioning of
BSA at pH 6 showing that partitioning of BSA is majorly affected by the salting out
effect and not the charge of the molecule.
Choice of a proper volume proportion is also important to achieve maximal
recovery of protein. The equilibrium compositions of the phase forming compo-
nents (Acetonitrile and salt) are constant regardless of the volume ratio along a TLL
at constant system pH 6. Considering both the recovery and partition coefficient
(Fig. 2e), it was concluded that the volume proportion of 1.5 at a TLL of 53 wt%
and system pH 6 is suitable to obtain a higher partition coefficient and recovery of
BSA was 7.78 and 88.61 % respectively.
4 Conclusions
ATPS can be formed by acetonitrile and potassium citrate at specific concentrations

in aqueous media. The phase diagrams, tie-lines and tieline lengths were deter-
mined at 303.15 K and atmospheric pressure. Potassium citrate showed higher
tendency of phase separation, the conclusion was also explained by the effective
excluded volume (EEV) theory of salts. The liquid–liquid equilibrium data were
predicted through the Othmer–Tobias correlations. Bovine Serum Albumin
(BSA) was considered to access the partition ability of the Acetonitrile—potassium
citrate system. BSA preferentially partitions for the acetonitrile-rich phase with
maximum partition coefficient higher than 7. Moreover, the BSA recovery obtained
at optimal conditions was higher than 88 %, supporting the huge potential of this
system to be explored in the extraction of the most diverse value added compounds
for industrial applications.
References
Alberttson, P.A.: Partition of Cell Particles and Macromolecules. Separation and Purification of
Biomolecules, Cell Organelles, Membranes and Cells in Aqueous Polymer Two-phase Systems
and Their Use in Biochemical Analysis and Biotechnology. Wiley-Interscience, New York
(1986)
Asenjo, J.A., Andrews, B.A.: Aqueous two-phase systems for protein separation: a perspective.
J. Chromatogr. A 1218, 8826–8835 (2011)
Azevedo, A.M., Sommerfeld, S., Mutter, A., Aires-Barros, M.R., et al.: Application of aqueous
two-phase systems to antibody purification: a multi stage approach. J. Biotechnol. 139, 306–
313 (2009)
Brooks, E., Sharp, K.A., Fischer, D.: Partitioning in Aqueous Two-Phase Systems: Theory,
Methods, Uses and Applications to Biotechnology. Academic Press, New York (1985)
Cardoso, G., Mourao, T., Pereira, F., Freire, M., Fricks, A., Soares, C., Lima, A.: Aqueous
two-phase systems based on acetonitrile and carbohydrates and their application to the
extraction of vanillin. Sep. Purif. Technol. 104, 106–113 (2013)
Freire, M.G., Louros, C.L.S., Rebelo, L.P.N., Coutinho, J.A.P.: Aqueous biphasic systems
composed of a water-stable ionic liquid + carbohydrates and their applications. Green Chem.
13, 1536–1545 (2011)
Gai, Q., Qu, F., Zhang, T., Zhang, Y.: Integration of carboxyl modified magnetic particles and
aqueous two-phase extraction for selective separation of proteins. Talanta 85, 304–309 (2011)
Grolbmann, C., Tintinger, R., Zhu, J., Maurer, G.: Aqueous two-phase systems of poly(ethylene
glycol) and dextran—experimental results and modeling of thermodynamic properties. Fluid
Phase Equilib. 106, 111–138 (1995)
Guoa, W., Ma, J., Wang, Y., Han, J., Li, Y., Song, S.: Liquid–liquid equilibrium of aqueous
two-phase systems composed of hydrophilic alcohols (ethanol/2-propanol/1-propanol) and
MgSO4/ZnSO4 at (303.15 and 313.15) K and correlation. Thermochim. Acta. 546, 8–15 (2012)
Han, J., Wu, Y., Xiang, Y., Wang, Y., Ma, J., Hu, Y.: Liquid–liquid equilibria of hydrophilic
alcohol + sodium hydroxide + water systems: Experimental and correlation. Thermochim.
Acta 566, 261–267 (2013)
Kalaivani, S., Srikanth, C.K., Regupathi, I.: Densities and viscosities of binary and ternary
mixtures and aqueous two-phase system of poly ethylene glycol 2000 + diammonium
hydrogen citrate + water at different temperatures. J. Chem. Eng. Data 57, 2528–2534 (2012)
Liu, Y., Wu, Z., Zhang, Y., Yuan, H.: Partitioning of biomolecules in aqueous two-phase systems
of polyethylene glycol and nonionic surfactant. Biochem. Eng. J. 69, 93–99 (2012)
Luechau, F., Ling, T.C., Lyddiatt, A.: Primary capture of high molecular weight nucleic acids
using aqueous two-phase systems. Sep. Purif. Technol. 66, 202–207 (2009)
Mehrnoush, A., Mustafa, S., Sarker, M.I., Yazi, A.M.M.: Optimization of serine protease
purification from mango (Mangifera Indica cv. Chokanan) peel in polyethylene glycol/dextran
aqueous two phase system. Int. J. Mol. Sci. 13, 3636–3649 (2012) (Rosa PAJ)
Neves, C.M.S.S., Ventura, S.P.M., Freire, M.G., MarruchoI, M., Coutinho, J.A.P.: Evaluation of
cation influence on the formation and extraction capability of ionic liquid-based aqueous
biphasic systems. J. Phys. Chem. B 113, 5194–5199 (2009)
Pereira, J.F.B., Ventura, S.P.M., Silva, F.A., Shahriari, S., Freire, M.G., Coutinho, J.A.P.:
Aqueous biphasic systems composed of ionic liquids and polymers: a platform for the
purification of biomolecules. Sep. Purif. Technol. 113, 83–89 (2013)
Pollak, P., Romeder, G., Hagedorn, F., Gelbke, H.P.: Ullmann’s Encyclopedia of Industrial
Chemistry. Wiley Online Library, New York (2000)
Ratanapongleka, K.: Recovery of biological products in aqueous two phase systems. Int. J. Chem.
Eng. Appl. 1, 191–198 (2010)
Reis, I.A.O., Santos, S.B., Santos, L.A., Oliveira, N., Freire, M.G., Pereira, J.F.B., Ventura,
S.P.M., Coutinho, J.A.P., Soares, C.M.F., Lima, A.S.: Increased significance of food wastes:
selective recovery of added-value compounds. Food Chem. 135, 2453–2461 (2012)
Rosa, P.A.J., Azevedo, A.M., Sommerfeld, S., Mutter, M., Bäcker, W., et al.: Continuous aqueous
two-phase extraction of human antibodies using a packed column. J. Chromatogr. B 880, 148–
156 (2012)
Takamuku, T., Tabata, M., Yamaguchi, A., Nishimoto, J., Kumamoto, M., Wakita, H.,
Yamaguchi, T.: Liquid structure of acetonitrile-water by X-ray diffraction and infrared
spectroscopy. J. Phys. Chem. B 102, 8880–8888 (1998)
Taha, M., Teng, H.L., Lee, M.J.: Phase diagrams of acetonitrile or (acetone + water + EPPS)
buffer phase separation systems at 298.15 K and quantum chemical modeling. J. Chem.
Thermodyn. 54, 134–141 (2012)
Wang, B., Ezejias, T., Feng, H., Blaschek, H.: Sugaring-out: a novel phase separation on
extraction system. Chem. Eng. Sci. 63, 25958–26000 (2008)
Wang, Y., Hu, S., Yan, Y., Guan, W.: Liquid-liquid equilibrium of potassium/sodium
carbonate + 2-propanol/ethanol + water aqueous two-phase systems and correlation at
298.15 K. CALPHAD: Comput. Coupling Phase Diagrams Thermochem. 33, 726–731 (2009)
Zafarani-Moattar, M., Hosseinpour-Hashemi, V., Banisaeid, S., Beirami, M.: The study of phase
behavior of aqueous 1-propanol/2-propanol/2-butanol/2-methyl-2-propanol systems in the
presence of disodium tartrate or disodium succinate at T = 298.15 K. Fluid Phase Equilib. 338,
37–45 (2013)
Zhao, X., Xie, X., Yan, Y.: Liquid–liquid equilibrium of aqueous two-phase systems containing
poly (propylene glycol) and salt ((NH4)2SO4, MgSO4, KCl, and KAc): experiment and
correlation. Thermochim. Acta 516, 46–51 (2011)
Mixed Surfactant Based Reverse Micelle
Extraction of Lactose Peroxidase
from Whey
Sivananth Murugesan, Prudhvi Ambakam, Akshay Naveen,

Aarathi Makkada, Nithin Solanki and Regupathi Iyyaswami
1 Introduction
Global production of liquid whey from cheese and casein amounted be over billion
to trillion tonnes with respect to increasing demand in the dairy industry (Smithers
2008). β-lactoglobulin, α-lactalbumin, bovine serum albumin and immunoglobu-
lins (IgG) are the major proteins found in whey while LPO and Lactoferrin remain as
minor constituents of whey (Bottomley et al. 1990; De Wit 1998). Most of the
proteins found in the whey possess health benefits and are directly or indirectly
related to the functioning of the immune system. Lactoperoxidase (E.C. 1.11.1.7),
LPO as they are commonly referred to, constitute about 30 mg/L or about 1 % of
cheese whey that are generated from the Dairy industries. LPO are oxidoreductase
enzymes that are found to function in the mammary glands and acts as potent
antimicrobial agent in the intestinal tract of the new born infants (Pruitt et al. 1985;
Sharma et al. 2013). They have also been employed extensively as food preservants,
in cosmetics, and dental applications. Recent studies have been reported on suc-
cessful usage of LPO towards tumor cells and LPO have been reported to activate
immune response—macrophage that act upon the tumor cells (Lefkowitz et al. 1990;
Takeshi et al. 1996). Separation of these minor protein fractions from whey has been
a difficult task owing to the high concentration of β-lactoglobulin, α-lactalbumin that
interferes the separation process. Previous reports on purification of LPO elaborate
the usage of different types of chromatography—affinity (Ozdemir et al. 2001), Ion
exchange (Atasever et al. 2013) and Hydrophobic interaction chromatography
(Langbakk et al. 1984) and reverse micelle extraction (Nandini et al. 2010).
S. Murugesan P. Ambakam A. Naveen A. Makkada N. Solanki R. Iyyaswami (&)

Surathkal, Mangalore 575025, India

DOI 10.1007/978-981-10-1920-3_12
112 S. Murugesan et al.
Liquid–liquid extraction (LLE) has been employed in the selective extraction of

such solutes from the feed in general. However, Reverse Micelles based extraction
is one such LLE Technique, a versatile, easily scalable and sustainable process that
involves the usage of surfactants to form reverse micelle in the presence of an
immiscible liquid usually water phase. The solute molecules are solubilized within
the reverse micelle, which facilitate the forward extraction and the solutes from
reverse micelle are further back extracted into fresh stripping aqueous phase. Water
content and solubilization of protein can be altered by changing the aqueous phase
pH, with the addition of solvents, co-surfactants and electrolytes (Yazdi 2011; Saha
et al. 2015; Mohd-Steapar et al. 2012, 2014). In the present work, the extraction of
LPO from whey was studied by employing mixed surfactant based reverse micelles
at different conditions.
Dioctyl sulfosuccinate sodium salt (AOT), cetyltrimethylammonium bromide

(CTAB) were purchased from CDH, India. Triton X 100 (TX100) and Isooctane
were purchased from Sigma Aldrich, Alcohols—propanol, butanol, pentanol,
hexanol, heptanol and octanol were purchased from CDH, India. Dilute HCL,
Disodium hydrogen phosphate and sodium dihydrogen phosphate were purchased
from Merck, India. Deionized water was used and the experiments were conducted
at room temperature unless otherwise specified. Skimmed milk was used for the
preparation of whey.
Whey was prepared by altering the pH of skimmed milk to 4.6 with the addition
of dilute HCL acid and once the pH was attained, the milk turned into slurry which
was centrifuged at 4500 rpm for 10 min and the pellet obtained was discarded
while the supernatant was stored at 4 °C for further usage. Sodium phosphate buffer
was used as a stripping phase, which was prepared according to standard protocol.
The organic phase with surfactant was prepared by dissolving AOT and TX100 in
Isooctane, in the presence of Hexanol—23 % (V/V) and Octanol—30 % (V/V)
which were added for complete dissolution of the surfactants (different concen-
trations) in the solvent. The Critical Micelle Concentration (CMC) of the mixed
surfactants was obtained from a graph drawn which depicting densities of the
solutions and their respective concentrations. Similar experiments were repeated
with CTAB/TX100 containing the prescribed amount of Hexanol and Octanol in
the stock solution.
LPO assay solution was prepared by diluting 150 µl of 0.09 M hydrogen per-
oxide to 30 ml of 0.005 M potassium iodide dissolved in 0.033 M sodium phos-
phate buffer (pH-7.0), 3.0 ml reaction mixture was pipetted into cuvette and
incubated at 25 °C for 3–4 min to achieve temperature equilibrium. 100 µl of the
enzyme was added and absorbance was recorded at 350 nm for one minute
(Morrison and Bayse 1970). Forward Extraction was performed in centrifuge tubes
where in equal volumes of the organic phase and the aqueous phase—whey were
Mixed Surfactant Based Reverse Micelle Extraction … 113
mixed and the tubes were centrifuged at 3500 rpm for 5 min. From the tube 100 µl
of top phase and bottom phase were added to the LPO assay solution and the
activity was recorded for a minute at an absorbance of 350 nm. The same was used
to calculate the active enzyme units present in 1 ml of whey. The following for-
mulas were used in the calculation of activity of LPO in top and bottom phases.
DA 350=min
Activity ðUnits=mlÞ ¼ ð1Þ
ð26Þ
Partition coefficient:
Activity top phase ð2Þ
ðForward ExtractionÞ ¼
Activity bottom phase
Activity bottom phase

ðBackward ExtractionÞ ¼ ð3Þ
Activity top phase
Whey pH was adjusted and the above protocol was performed to find out the
extraction efficiency of the reverse micelles at altered pH; similar experiments were
performed for increasing chain length of alcohols from propanol to octanol with
varying concentrations respectively. Different Electrolytes were added with the
aqueous phase to study the effect of salts on the extraction of LPO from whey to the
reverse micelles. Conditions of pH, Alcohol and electrolyte which resulted in
maximum partitioning of LPO into the reverse micelle were considered and the
forward extraction was performed in bulk. Top phase from the bulk forwards
extraction was used for the backward extraction studies, in which one ml of the top
phase was used with an equal volume of fresh stripping buffer solution. Different
operating conditions were maintained such as pH, alcohols of varying chain length
and salts with increasing concentrations, respectively. During the backward
extraction process, the top and bottom phases were analyzed for the enzyme activity
in the top and bottom phase.
The CMC value of AOT/TX100/Isooctane and CTAB/TX100/Isooctane solutions

were obtained from the density and viscosity measurements and were obtained as
0.1 and 0.01 M, respectively. Both the solutions at their CMC values were used as
the organic phase for the extraction of LPO. Effect of pH was studied by varying the
pH (7.9–8.7) around the Isoelectric point (pI) of the protein—LPO, since the pI of
Bovine LPO has been reported to be 7.9.
From Fig. 1 for AOT/TX100 mixture, it can be inferred that the forward
extraction is maximum at a pH of 8.1 while the backward extraction is maximum at
a pH of 8.3. As the pH of the solution is maintained above the pI of the protein, the
Fig. 1 Effect of pH—

AOT/TX100. Forward
extraction filled circle,
backward extraction filled
diamond
Fig. 2 Effect of pH—

CTAB/TX100. Forward
extraction filled circle,
backward extraction filled
diamond
protein attains a net negative charge and with respect to negatively charge surfactant
head group, there should be rejection of protein into the aqueous phase while the
vice versa effect noted down might be as a result of enhanced hydrophobic inter-
action of TX100 present in the mixed surfactant reverse micelle system. With
further increase in the pH during backward extraction, the protein attains a strong
negative charge which might lead to the expulsion of the same into the fresh
stripping aqueous phase. For CTAB/TX100, maximum protein partitioning
occurred at 8.5 during forward extraction and backward extraction maximum
partitioning from reverse micelle to fresh stripping phase was obtained at a pH of
8.7 as shown in Fig. 2.
Effect of Alcohol on the extraction efficiency of LPO by AOT/TX100 was
studied by considering varying chain length of alcohols and different concentra-
tions. It was found from the Fig. 3 that, as the alcohol chain length increases from
propanol to butanol the protein partitioning into the top reverse micellar phase
increases and with further increase in the chain length butanol to pentanol and
heptanol, the extraction efficiency was found to decrease during forward extraction.
The said effect is as a result of interaction of alcohol with the surfactant head
groups, as the chain length is less the alcohol molecules solubilize in the water core
to a smaller extent and also place themselves within the head groups (Chuo et al.
2014; Saran Chaurasiya et al. 2015). As the organic phase contains Hexanol and
Fig. 3 Effect of alcohol—

AOT/TX100. Forward
extraction, filled diamond
Propanol, filled triangle down
Butanol, filled triangle up
Pentanol, filled square
Heptanol

AOT/TX100. Backward
Propanol, filled triangle down
Butanol, filled triangle up
Pentanol, filled square
Heptanol
Octanol for proper dissolution of the surfactants in the solvent, the combined effect
of higher chain lengths of alcohols leads to breakage of reverse micelles and
thereby causing decrease in the mass transfer of LPO from whey to the reverse
micelle. During backextraction process, the similar effects were noted as shown in
Fig. 4, pentanol leads to breakage of reverse micelle and release of LPO from the
reverse micelle water core to the fresh stripping aqueous phase.
When CTAB/TX100, was employed pentanol at a concentration of 0.25 M
partitioned LPO from whey to the reverse micelle while heptanol at a concentration
of 0.5 M gave maximum LPO back extraction from reverse micelle to the fresh
stripping phase as shown in Figs. 5 and 6. Similar effects as seen in AOT/TX100
reverse micellar extraction of LPO were observed and the explanation suits for
CTAB/TX100 as well.
Effect of salts on the partitioning of LPO during forward and backward
extractions were studied by considering four different salts from Hofmeister series
with varying concentrations as shown in the Figs. 7, 8, 9 and 10. It was observed
that when AOT/TX100 system was used, ammonium sulphate at a concentration of
0.25 M gave maximum protein partitioning during forward extraction while 0.5 M
sodium chloride gave maximum back extraction of the protein. Ammonium ions
during forward extraction screen the electrostatic effect between the surfactant head
groups and the protein while the sulphate ions hold the protein molecules within the

CTAB/TX100. Forward
extraction, filled square
Propanol, filled diamond
Butanol, filled triangle down
Pentanol, filled triangle up
Heptanol

CTAB/TX100. Backward
Propanol, filled square
Butanol, filled triangle down
pentanol, filled triangle up
heptanol
Fig. 7 Effect of salt—

AOT/TX100. Forward
Ammonium Chloride, filled
triangle down Sodium
Chloride, filled triangle up
Ammonium Sulphate, filled
square Sodium Sulphate
water core. This effect results in the expulsion of larger proteins like lactalbumin
and lactoglobulin while the minor protein concentrations increase in the water core.
Sodium chloride resulted in maximum back extraction, sodium ions are smaller in
ionic radius compared to ammonium ions that results in enhanced electrostatic
attraction between the surfactant head groups and on the protein molecules and as a

AOT/TX100. Backward
Ammonium Chloride, filled
Chloride, filled triangle up
square Sodium Sulphate

CTAB/TX100. Forward
Sulphate, filled triangle up
Sodium Chloride, filled
square Ammonium Chloride

CTAB/TX100. Backward
Sulphate, filled triangle up
Sodium Chloride, filled
square Ammonium Chloride
result the number of sodium ions in a reverse micelle increases leading to expulsion
of water core with the proteins solubilized in it (Yu et al. 2014; Wan et al. 2013).
As CTAB/TX100 reverse micelles were used for the extraction process, Sodium
chloride at a concentration of 0.1 M was found to cause maximum partitioning of
protein during the forward extraction process; this effect is as a result of electrostatic
repulsion of ammonium ions compared to those of sodium ions which are smaller in
ionic radius. With increasing concentration of sodium chloride, the protein parti-
tioning was found to decrease; which might be as a result of increase in the chloride
ion concentration that leads to protein instability. Ammonium sulphate at a con-
centration of 1.5 M lead to the disruption of reverse micelles, thereby back
extraction of LPO from the reverse micelles to the fresh stripping phase was suc-
cessfully achieved.
4 Conclusion
AOT/TX100 and CTAB/TX100 mixed surfactant based reverse micelles were

formed and their CMC values were determined using density and viscosity mea-
surements and were found to be 0.1 and 0.01 M respectively. Different conditions
were tested to observe their effect on extraction efficiency of LPO from whey during
the forward and backward extraction steps. It was inferred that maximum protein
partitioning occurred when AOT/TX100 reverse micelles were used during the
forward extraction process compared to that of CTAB/TX100 reverse micelles.
Though the forward extraction of both the systems gave different partitioning
values at the end of bulk extraction process, AOT/TX100-10.5, CTAB/
TX100-1.37; backward extraction of both the systems resulted in an almost simi-
lar back extraction value of AOT/TX100-24.4, CTAB/TX100-23.75. This proves
that AOT/TX100 is a better Ionic/Nonionic mixed surfactant system for the
extraction of LPO from whey, although back extraction also accounts for the total
efficiency of the reverse micelle extraction process.
References
Atasever, A., Ozdemir, H., Gulcin, I., Kufrevioglu, O.I.: One-step purification of LPO from bovine
milk by affinity chromatography. Food Chem. 136(2), 864–870 (2013)
Bottomley, R.C., Evans, M.T.A., Parkinson, C.J.: Whey proteins. In: Food Gels, pp. 435–466.
Springer Netherlands (1990)
Chuo, S.C., Mohd-Setapar, S.H., Mohamad-Aziz, S.N., Starov, V.M.: A new method of extraction
of amoxicillin using mixed reverse micelles. Colloids Surf. A 460, 137–144 (2014)
De Wit, J.N.: Nutritional and functional characteristics of whey proteins in food products. J. Dairy
Sci. 81(3), 597–608 (1998)
Langbakk, B., Flatmark, T.: Demonstration and partial purification of LPO from human colostrum.
FEBS Lett. 174(2), 300–303 (1984)
Lefkowitz, D.L., Hsieh, T.C., Mills, K., Castro, A.: Induction of tumor necrosis factor and
cytotoxicity by macrophages exposed to LPO and microperoxidase. Life Sci. 47(8), 703–709
(1990)
Mohd-Setapar, S.H., Mohamad-Aziz, S.N., Harun, N.H., Mohd-Azizi, C.Y.: Review on the
extraction of biomolecules by biosurfactant reverse micelles. APCBEE Procedia 3, 78–83
(2012)
Mohd-Setapar, S.H., Mohamad-Aziz, S.N., Chuong, C.S., Che Yunus, M.A., Ahmad Zaini, M.A.,
Kamaruddin, M.J.: A review of mixed reverse micelle system for antibiotic recovery. Chem.
Eng. Commun. 201(12), 1664–1685 (2014)
Morrison, M., Bayse, G.S.: Catalysis of iodination by lactoperoxidase. Biochemistry 9(15), 2995–
3000 (1970)
Nandini, K.E., Rastogi, N.K.: Single step purification of LPO from whey involving reverse
micelles-assisted extraction and its comparison with reverse micellar extraction. Biotechnol.
Prog. 26(3), 763–771 (2010)
Ozdemir, H., Aygul, I., Küfrevioglu, O.I.: Purification of LPO from bovine milk and investigation
of the kinetic properties. Prep. Biochem. Biotechnol. 31(2), 125–134 (2001)
Pruitt, K.M., Tenovuo, J.O.: The Lactoperoxidase System. Chemistry and Biological Significance,
vol. 27. of Immunology Series, Marcel Dekker, New York (1985)
Saha, A., Yadav, R.: Reverse micellar extraction: technological aspects, applications and recent
developments. J. Pharm. Res. 9(2), 145–156 (2015)
Saran Chaurasiya, R., Umesh Hebbar, H., Raghavarao, K.S.M.S.: Recent developments in
nanoparticulate based reverse micellar extraction for downstream processing of biomolecules.
Curr. Biochem. Eng. 2(2), 118–134 (2015)
Sharma, S., Singh, A.K., Kaushik, S., Sinha, M., Singh, R.P., Sharma, P., Singh, T.P.: LPO:
structural insights into the function, ligand binding and inhibition. Int. J. Biochem. Mol. Biol. 4
(3), 108 (2013)
Smithers, G.W.: Whey and whey proteins—from ‘gutter-to-gold’. Int. Dairy J. 18(7), 695–704
(2008)
Takeshi, O., Mihoko, O., Emiko, H., Naomi, M., Yuko, M., Akiyo, S.: Cytolysis of B-16
melanoma tumor cells mediated by the myeloperoxidase and LPO systems. Biol. Chem. 377
(11), 689–694 (1996)
Wan, J., Li, Q., Zhou, F., Liu, J., Cao, X.: Influence of chaotropes on recovery of trypsin and
micellar sizes during reverse micelle extraction. Sep. Purif. Technol. 116, 307–312 (2013)
Yazdi, A.S.: Surfactant-based extraction methods. TrAC Trends Anal. Chem. 30(6), 918–929
(2011)
Yu, T., Cao, X.: Effect of chaotropes on lipase back extraction recovery in the process of reverse
micellar extraction. Appl. Biochem. Biotechnol. 172(6), 3287–3296 (2014)
Evaluation of Bio-surfactant on Microbial
EOR Using Sand Packed Column
A. Rajesh Kanna, Sathyanarayana N. Gummadi and G. Suresh Kumar
1 Introduction
Crude oil plays a vital role in our day to day life. The contribution of energy is
about 70 % comparatively with other sources of energy. Oil recovery refers to the
process by which crude oil is extracted from the cap rock of petroleum reservoir.
Crude oil recovery is categorized into three phase namely primary recovery, sec-
ondary and tertiary recovery methods. In primary recovery method crude oil is
extracted to the surface with help of pressure present in the reservoir. The recovery
obtained using the method is about 10–15 %. Once the pressure gets declined no
more oil can be recovered to the surface. At this stage secondary recovery method
helps to recover oil. In this method, artificially water is pumped at high pressure to
build up pressure. Due to pressure difference oil is moved from high pressure to low
pressure zone. In water drive method around 20 % of oil is recovered after primary
recovery technique (Lazar et al. 2007). Still a considerable amount of oil remains
trapped in the cap rocks, which are held due to high interfacial tension and capillary
force. Around 50 % of OOIP can be recovered using tertiary recovery method.
Injection of different agents like Heat, Polymers, Chemical surfactants and
Microbial surfactants to recover crude oil from trapped zone is known as enhanced
oil recovery methods. Additionally 20–30 % of oil is recovered after secondary
recovery. There are many approaches to improve oil recovery rate. Utilization of
microbes and its metabolites is considered to be the most promising methods in oil
recovery. Currently numerous studies were carried out using bacteria as EOR
A.R. Kanna G.S. Kumar

Department of Ocean Engineering, IIT Madras, Chennai, India
S.N. Gummadi (&)
Department of Biotechnology, Bhupat and Jyoti Mehta School of Biosciences,
IIT Madras, Chennai, India
e-mail: gummadi@iitm.ac.in

DOI 10.1007/978-981-10-1920-3_13
122 A.R. Kanna et al.
technique. They are well known as microbial enhanced oil recovery (MEOR) where
bacteria were used in place of chemical surfactants to retrieve oil. MEOR technique
is found to be cost effective among all other EOR methods. In MEOR, microbes
and its metabolites help to recover oil by producing bio-surfactant (Li et al. 2002).
Bio-surfactants are microbial compounds which are amphiphilic in nature (Fiechter
1992). Bio-surfactants are surface active compounds produced by variety of bac-
teria (Mukherje et al. 2008). Due to their potential applications in various fields like
agriculture, food processing and petroleum industries. Properties of bio-surfactant
include surface tension reduction, promoting foaming agents, stable and environ-
ment friendly and are effective at high temperature and pH conditions (Makkar and
Cameotra 1997; Singh 2012).
In recent years, interests in bio-surfactants have gained steady increase in pop-
ularity and have emerged as a promising alternative for chemical surfactants.
Bio-surfactants have potential roles in oil industries such as cleaning oil sludge,
mobilizing heavy crude oil and managing oil spillage (Desai and Banat 1997).
Pseudomonas aeruginosa, Bacillus subtilis and Bacillus licheniformis are some of
the well-known bacteria which produce bio-surfactant (Fracchia et al. 2012).
Increasing demand for petroleum over recent years and to meet the gap, application
of bio-surfactant in oil recovery plays a major role in petroleum industries.
However, stability of bio-surfactant at extreme pH and temperature conditions is
crucial for its usage in enhanced oil recovery process. Bio-surfactant produced from
P. putida has the potential to reduce surface and interfacial tension between
oil-water mixtures, which is a key factor in oil recovery (Kanna et al. 2014). In our
current study, an attempt is made to produce bio-surfactant using Bacillus subtilis
MTCC 2422. The produced bio-surfactant is further used to recover oil, saturated in
sand packed column.
2.1 Microorganism
Bacillus subtilis MTCC 2422 was procured from Microbial Type Culture
Collection and Gene Bank (MTCC), Institute of Microbial Technology, India for
this current study. The culture was maintained in nutrient agar plates with the
following composition (g/L): peptone, 5.0; yeast extract, 2.0; beef extract, 1.0;
NaCl, 5.0; agar, 15.0; pH 7.0 ± 0.2, storage temperature −2 to −8 °C.
2.2 Media and Cultivation Conditions
Nutrient broth with the following composition (g/L) was used for inoculum prepa-
ration. Beef extract, 1.0; yeast extract, 2.0; peptone, 5.0; NaCl, 5.0. Bacillus subtilis
Evaluation of Bio-surfactant on Microbial EOR … 123
(MTCC 2422) grown in Nutrient broth for 8–10 h at 30 °C (A600nm 0.7–0.9) and
2 % (v/v) of the inoculum was used for production of bio-surfactant using mineral
salt medium with the following composition (g/L) KNO3, 0.3; Na2HPO4, 0.2;
KH2PO4, 0.014; NaCl, 0.001; MgSO4, 0.06; CaCl2, 0.004; FeSO4, 0.002; 0.1 mL of
trace element solution containing (g/L) ZnSO47H2O, 2.32; H3BO3, 0.56;
CuSO45H2O, 1.0; MnSO44H2O, 1.78; Na2MoO42H2O, 0.39; CoCl26H2O, 0.42;
EDTA, 0.5; NiCl26H2O, 0.004; KI, 0.66; K2SO4, 3.0. Cultivation was performed in
1 L Erlenmeyer flask at 30 °C and 180 rpm in incubator cum shaker. Cell free
supernatant was collected after centrifugation at 12,000 × g for 20 min and it was
further analyzed for bio-surfactant.
3 Analytical Methods
3.1 Analysis of Sucrose Concentration
1 mL of was centrifuged at 12,000 × g for 20 min and the supernatant was col-
lected to determine sucrose concentration using dinitrosalicylic (DNS) method.
1 mL sample was mixed with 25 µl of 3 M HCl and heated at 100 °C for 20 min.
1 mL of DNS reagent was added to the hydrolyzed samples and heated for 100 °C
for 10 min. Sucrose concentration was determined by measuring absorbance at
540 nm (Miller 1959).
3.2 Cell Biomass Determination
2 mL of sample was subjected to centrifugation for 25 min at 12,325 × g and the

supernatant was decanted. The precipitate was washed twice with 0.8 % NaCl and
the pellet was dried in hot air oven at 50 °C overnight. The pellet was cooled in
desiccator and the dry weight of pellet was measured. The procedure was repeated
till concurrent values were obtained.
3.3 Biosurfactant Determination
The culture was centrifuged at 12,325 × g to remove bacterial cells. Supernatant

was subjected to acid precipitation at pH 2.0 by adding 6 N HCl at 4 °C. The
precipitate was pelleted out by centrifugation at 12,325 × g for 25 min,
re-suspended in double distilled water and pH was adjusted to 7.0, freeze dried and
weighed. The dried surfactant was extracted with dichloromethane and the extract
was dried using rotary evaporator under vacuum. The concentrated liquid obtained
was the pure form of bio-surfactant.
3.4 Interfacial Tension Analysis
In order to measure interfacial tension, equal volume of crude oil and cell free broth
(bio-surfactant) was mixed. IFT was determined by K6 Tensiometer (Kruss GmbH,
Hamburg, Germany), using Wilhelmy plate method. 10 mL (5 mL crude oil and
5 mL broth) of sample was placed in the glass container. Measurements were
carried out by automatic controller which smoothly pulls down the plate such that it
is contacted with the liquid placed. The force acting on the rectangular plate with
known length are measured and IFT values were digitally recorded.
3.5 Sand Packed Column Experiment
A sand packed column (a plastic column of 10 cm in length and 2.5 cm diameter)

was fabricated to study the oil recovery using biosurfactant produced by the strain.
35 g of fine sand soil was packed in the column and saturated with brine and
followed by oil. This mimicks the petroleum reservoir condition. The sand packed
column was flooded again with brine until no more oil received at the effluent. 0.5
PV (Pore Volume) of Bacillus subtilis MTCC 2422 (OD = 0.23) in mineral salt
medium was injected into the column. The column was flooded with water
(Secondary flooding) followed by Triton X 100 (Chemical flooding). Produced
bio-surfactant was flooded finally to check the recovery rate using various flooding
methods. The effluent collected from the outlet of the column gives the amount of
oil recovered and determined using standard methods.
3.6 Satistical Analysis
All the experiments were performed at least three times and the values reported are
mean of three individual experiments with p < 0.005.
Bacillus subtilis was grown in minimal media with 2 % (w/v) sucrose as the carbon
source. Dry cell weight, bio-surfactant production, substrate consumption by the
organism were determined every 12 h for a period of 132 h. A time course increase
Fig. 1 Cell dry weight 1.5
Cell dry weight (g/l)

1.0
0.5
0.0
0 20 40 60 80 100 120 140
Time (h)
Fig. 2 Bio-surfactant 1.0

concentration
Biosurfactant (g/l)
0.8
0.6
0.4
0.2
0.0
0 20 40 60 80 100 120 140
Time (h)
in biosurfact was observed with increase in growth and susbstrate consumption.

Maximum biomass obtained was 1.2 g/L at 96 h and maximum bio-surfactant
produced at 132 h was 0.84 g/L (Figs. 1 and 2). These results were in agreement
with earlier reports such that biomass and bio-surfactant were 0.9 and 1.3 g/L
respectively with Bacillus subtilis (Priya and Usharani 2009) (Fig. 3).
Maximum production of bio-surfactant was observed in the late log phase. The
produced bio-surfactant was further purified by acid precipitation and analyzed for
interfacial tension reduction. Interfacial tension (IFT) reduction was directly pro-
portional to the amount of bio-surfactant produced. IFT was initially, 49 mN/m but
with increase in fermentation time, the amount of bio-surfactant produced increased
gradually resulting in IFT reduction to a final value of 17 mN/m at 132 h (Fig. 4).
Fig. 3 Reducing sugar 20
Sugar concentration (g/l)

concentration
15
10
5
0 20 40 60 80 100 120 140
Time (h)
Fig. 4 Interfacial tension 50

Interfacial tension (mN/m)
profile
40
30
20
10
0 20 40 60 80 100 120 140
Time (h)
Bio-surfactant produced by Bacillus subtilis was tested for its possible appli-
cation microbial enhanced oil recovery by using sand pack column on laboratory
scale. Water injection which is secondary recovery method, can only achieve a
certain amount of oil recovery. Beyond this, no more oil could be recovered due to
high capillary force, which restricts the mobility of oil. As bio-surfactant can reduce
the capillary force by reduction of IFT between crude oil and water, we employed
this technique to study its influence on oil recovery.
Experimental results showed that water injection initially recovered 27 % of oil
and further enhancement of 9 % was observed when bio-surfactant was injected to
the column, yielding to a total recovery of 36 % (Fig. 5). Similar results were
observed where 38 % of oil was recovered using bio-surfactant production by
Fusarium sp. (Qazi et al. 2013). Same experiment when repeated with chemical
surfactant Triton X 100 gave a total recovery of 34 % (Fig. 6). Since bio-
Fig. 5 Oil recovery using p < 0.004

bio-surfactant 40 72 h + 120 h
72 h
Oil recovery (%)

30
20
10
ter
nt
cta
Wa
rfa
su
io-
+B
ter
Fig. 6 Oil recovery using Wa p < 0.003
Triton 40 72 h + 120 h
72 h
Oil recovery (%)
30
20
10
0
n
te r
rito
Wa
+T
te r
Wa
surfactants are less expensive, bio-degradable and able to enhance oil recovery, it
can be consider as best alternative for chemical surfactants.
5 Conclusions
Strain Bacillus subtilis MTCC 2422 has potential to produce bio-surfactant and IFT
of the medium during biosurfact production was reduced from 78 to 32 mN/m.
Studies in sand packed column were used to screen and evaluate the possible
bio-surfactant application in oil recovery. Around 36 % of oil recovery was
achieved with water and bio-surfactant injection similarly 34 % recovery with
Triton X 100. Hence, bio-surfactants can be used as promising alternative to
chemical surfactants for EOR applications.
Acknowledgments The authors acknowledge Dr. Indumathi M. Nambi, Department of Civil

Engineering for interfacial tension analysis. ARK acknowledges MHRD for scholarship.
References
Desai, J.D., Banat, I.M.: Microbial production of surfactants and their commercial Potential.
Microbiol. Mol. Biol. Rev. 61, 47–64 (1997)
Fiechter, A.: Biosurfactants: moving towards industrial application. Trends Biotechnol. 10, 208–
217 (1992)
Fracchia, L., Cavallo, M., Martinooti, M.G., Banat, I.M.: Bio-surfactants and Bio-emulsifiers
Biomedical and Related Applications—Present Status and Future Potentials, pp. 325–370. In
Tech, Rijeka (2012)
Kanna, R., Gummadi, S.N., Kumar, G.S.: Production and characterization of bio-surfactant by
Pseudomonas putida MTCC 2467. J. Biol. Sci. 14(6), 436–445 (2014)
Lazar, I., Petrisor, I.G., Yen, T.F.: Microbial enhanced oil recovery (MEOR). Pet. Sci. Technol.
25, 1353–1366 (2007)
Li, Q., Kang, C., Wang, H., Liu, C., Zhang, C.: Application of microbial enhanced oil recovery
technique to Daqing Oilfield. Biochem. Eng. J. 11, 197–199 (2002)
Makkar, R.S., Cameotra, S.S.: Bio-surfactant production by a thermophilic Bacillus subtilis strain.
J. Ind. Microbiol. Biotechnol. 18, 37–42 (1997)
Miller, G.L.: Use of dinitrosalicylic acid reagent for determination of reducing sugar. Anal. Chem.
31, 426–428 (1959)
Mukherje, S., Das, P., Sivapathasekaran, C., Sen, R.: Enhanced production of bio-surfactant by
marine bacterium on statistical screening of nutritional parameters. J. Biochem. Eng. 42, 254–
260 (2008)
Priya, T., Usharani, G.: Comparative study for biosurfactant production by using Bacillus subtilis
and Pseudomonas aeruginosa. Bot. Res. 2, 284–287 (2009)
Qazi, M.A., Malik, Z.A., Qureshi, G.D., Hameed, A., Ahmed, S.: Yeast extract as the most
preferable substrate for optimized biosurfactant production by rh1B gene positive
Pseudomonas putida SOL-10 isolate. J. Bioremed. Biodeg. 4, 1–10 (2013)
Singh, V.: Biosurfactant—isolation, production, purification & significance. J. Sci. Ind. Res. 2,
1–4 (2012)
Extraction of Polyphenols from Orange
Peel by Solvent Extraction and Microbial
Assisted Extraction and Comparison
of Extraction Efficiency
Prabha Hegde, Pushpa Agrawal and Praveen Kumar Gupta
1 Introduction
One of major secondary metabolites of the plants are Polyphenols, which contains
more than one phenol unit as building block of molecule. Fruits, vegetables,
leguminous plants and some cereals are rich sources of polyphenols. Polyphenols
are often present in higher concentration in the outer non edible part of the fruits
like peel compared to inner edible part (Gianmaria 2011; Vinson and Hontz 1995;
Wolfe 2003; Vinson 1998, 2001). Orange peels contains high concentration of
polyphenols which makes orange as high antioxidant source, (Hegazy and Ibrahium
2012). Orange peels are rich in polyphenols. Polyphenols are abundantly present in
our diet (Scalbert and Williamson 2000). The benefits of dietary polyphenols have
been studied extensively over the last decade. Polyphenols have been established to
play a significant role in preventing diseases like cardiovascular diseases, cancer
and other diseases (Duda-Chodak and Tarko 2007).
In this research work polyphenols are extracted by using solvent and microbial
assisted extraction. Total polyphenols was estimated by using Folin Ciocalteu
spectrophotometer method. The major polyphenols were estimated individually by
using High Pressure Liquid Chromatography (HPLC) technique.
P. Hegde (&) P. Agrawal P.K. Gupta

Department of Biotechnology, R V College of Engineering, Mysore Road,
RV Vidyaniketan Post, Bangalore 560059, India
e-mail: prabha_hegde@yahoo.com

DOI 10.1007/978-981-10-1920-3_14
130 P. Hegde et al.
2.1 Materials
Gallic acid monohydrate, Caffeic acid, p-Coumaric acid (+)-Catechin hydrate,

Epicatechin were purchased from Sigma–Aldrich, Methanol (HPLC) Sodium car-
bonate and Phosphoric acid were obtained from Merck. Folin Ciocalteu reagent,
Soybean Casein Digest Broth, Potato Dextrose Broth were obtained from HiMedia.
Staphylococcus aureus (ATCC 6538), E. coli (ATCC 8739) and Aspergillus niger
(ATCC9642) was procured from National Chemical Laboratory, Pune, India.
2.2 Samples
Three types of oranges namely Coorg, Nagpur and Kinnow were used for the study.
Outer Peels of fresh oranges were cut into small pieces of *2 mm × 2 mm
dimension. 50 g of the fresh peel was dried by each of the following different
techniques, viz., freeze dried in lyophilizer at −50 °C for 36 h (Li et al. 2006a, b),
oven dried at 50 °C for 36 h and sundried for 2 days in bright sunlight.
Abbreviation of the sample used are tabulated in Table 1.
2.3 Extraction Method
Dried samples were chemically extracted using a mixture of water and methanol
(1:1) (Li et al. 2006a, b), at 95 °C for 3 h (Hegde et al. 2015). After extraction
samples were filtered using Whatman filter paper number 1, and filtrate are stored in
the refrigerator.
Microbiological extraction was performed by using sterilised Soybean Casein
Digest Broth (for bacteria) and Potato Dextrose Broth (for fungi). Different
organism like Staphylococcus aureus, E. coli and Aspergillus niger were used
(Arora and Kaur 2013; Armando et al. 2008). Optimum results were obtained using
Table 1 Name of the samples

Variety Nagpur Nagpur Nagpur Coorg Coorg Coorg Kinnow Kinnow Kinnow
Drying Oven Sun Freeze Oven Sun Freeze Oven Sun Freeze
technique
Abbreviation NO NS NF CO CS CF KO KS KF
Chemical NOC NSC NFC COC CSC CFC KOC KSC KFC
extraction
Micro NOM NSM NFM COM CSM CFM KOM KSM KFM
extraction
Extraction of Polyphenols from Orange Peel … 131
Potato Dextrose Broth, Aspergillus niger organism, incubation temperature of

20 °C for 48 h using 2 g of sample in 100 mL of the media. After 48 h samples
were filtered using 0.2 micron nylon 47 mm disc membranes under vacuum and
stored in the refrigerator.
2.4 Estimation of Total Polyphenols by Spectrophotometer

Method
Total Polyphenol content was estimated by modified Folin Ciocalteu method. In

this test, two strong inorganic oxidants namely phosphotungstic and phospho-
molybdic acids (Stevanato 2004) reduce the molecules by chemical oxidation and
then Folin Ciocalteu develops the color which is read at 765 nm in spectropho-
tometer. Gallic acid is used as standard and a standard curve was obtained using
10–100 ppm concentration solutions with a coefficient of correlation of 0.99
(Fig. 1). 1 mL of known dilution of the sample that were previously made up with
methanol were taken in 10 mL volumetric flasks. 0.5 mL of Folin Ciocalteu reagent
was added and allowed to stand for 3 min. 1.5 mL of 10 % Sodium carbonate was
added and volume made up to 10 mL with water. The solutions were heated at
50 °C for 16 min. Samples were cooled and absorption was measured at 765 nm
using a UV visible spectrophotometer (Perkin Elmer, Lamda35) with water as
blank. Each sample was analyzed in triplicate. Sample absorbance was compared
with standard graph obtained for Gallic acid from which concentration of total
polyphenols was estimated.
1.2
Gallic acid Standard
1 10, 1.007266667
9, 0.890646667
Absorbance
0.8 8, 0.8018
7, 0.660466667
0.6
6, 0.547266667
0.4 5, 0.4511
4, 0.3662
3, 0.259926667
0.2 2, 0.159963333
1, 0.067333333
0
0 2 4 6 8 10 12
Gallic acid concentration ( ppm)
Fig. 1 Gallic acid standard graph (n = 3). Gallic acid standard solution were prepared from 1 to
10 ppm
132 P. Hegde et al.
2.5 Estimation of Individual Polyphenols

Using HPLC Method
Polyphenol standards like Gallic acid, Catechin, Epicatechin, Caffeic acid and
p-Coumaric acid were used for characterization of the phenolics in the extraction.
A linear curve was produced for each of these standards and the linear calibration
curve within the concentration studied had a coefficient of correlation ranging from
0.998 to 0.999.
Analysis was performed using phosphoric acid (0.1 %) as mobile phase A and
100 % methanol (HPLC) as solvent B. The elution conditions were: 0–30 min from
5 % B to 80 % B; 30–33 min 80 % B; 33–35 min from 80 % B to 5 % B; flow
rate = 0.8 mL/min. The operating conditions were: column temperature, 40 °C;
injection volume of 10 µL and a C18 waters Symmetry column was used. The
detection wavelength was 280 nm for Gallic acid. Catechin and Epicatechin, 320 nm
for Caffeic acid and p-Coumaric acid (Šeruga et al. 2011; Antoanela et al. 2011)
Extracted samples were removed from refrigeration and allow to come to room
temperature, 1 mL of the sample was diluted to 10 mL using the aqueous methanol
(1:1) as diluent, this diluted samples were filtered through Puradisc 25 mm syringe
filters from Whatman before injecting into HPLC. Each samples were injected three
times.
As Gerhard (EuroFood Chem, “Food for Future” in 2009) states, citrus peels shows
higher concentration of polyphenols compared to seeds. So only peels were con-
sidered for this study. Solvent extraction was performed by using aqueous methanol
as solvent (Li et al. 2006a, b) with optimized conditions (Hegde et al. 2015).
Armando et al. used Aspergillus niger to extract Ellagic acid, a polyphenol from
pomegranate residues, in this study Aspergillus niger was used to extract
polyphenols from orange peel.
Solvent extraction and the Microbial assisted extraction produced different
results. Different varieties of oranges and their drying technique also had an effect
on content of total polyphenols content and the individual identified polyphenols in
the orange peels. Total Polyphenols content in orange peel samples extracted by
both solvent and microbial assisted extraction method were estimated by modified
Folin Ciocalteu test method and calculated equivalent to Gallic acid. Results are
tabulated in Fig. 2.
Several thousand molecules having a polyphenols structure have been identified
in higher plants, and several hundred are found in edible plants (Manach et al.
2004). It is difficult identify and quantify each individual polyphenols so HPLC test
method is used to identify and quantify few important polyphenols like Gallic acid,
Catechin, Epicatechin, Caffeic acid and p-Coumaric. Five standards from Sigma
Total polyphenols ( g/100g) of orange Total polypheols estimation by

spectrophotmeter metod
3.94 3.94 4.02
peel
2.84
2.61 2.58
1.78 1.82 1.67 1.83

1.10 1.22 1.29 1.13 1.57 1.69
1.31 1.28
KOC KSC KFC NOC NSC NFC COC CSC CFC KOM KSM KFM NOM NSM NFM COM CSM CFM
Fig. 2 Total polyphenol content of orange peel (n = 9). Orange peel dried under different
conditions were extracted by chemical and micro extraction method
AREA UNDER THE CURVE
10000000
R² = 0.9999
8000000
R² = 0.9997
6000000
4000000 R² = 1
2000000 R² = 0.9964
R² = 0.9997
0
0 2 4 6 8 10 12
CONCENTRATION IN PPM
Gallic acid Catechin P-Couramic Acid Epicatechin Caffic acid
Fig. 3 Gallic acid, Catechin, Epicatechin P Couramic acid and Caffic acid standard graph (n = 5).
These standard solution were prepared from 0.1 to 10 ppm and analysed by HPLC. All the
standard has a R2 of minimum 0.9996
Aldrich were used to create a standard curve for each of these standards and Fig. 3
shows the linearity of these standards
Results very clearly demonstrates that total polyphenols content are more in the
microbial assisted extraction compared to chemical extraction. Results from the
chemical extraction shows that total polyphenols in Nagpur freeze dried shows
maximum followed by Nagpur sundried. Coorg orange peel showed higher con-
centration of total polyphenols and individuals polyphenols compared to Nagpur
and Kinnow. Different drying had a very less effect on the total polyphenols con-
tent, though sundried and freeze dried showed a slightly higher value. In the
microbiological extraction also Coorg orange had a highest concentration. Out of
the five individual polyphenols quantified Catechin showed highest concentration
in all the samples (Fig. 2).
134 P. Hegde et al.
Fig. 4 Gallic acid, Catechin, Epicatechin, P Couramic acid and Caffic acid contents of the orange
peels by chemical extraction and microbiological extraction (n = 5)
4 Conclusion
Maria et al. (2013) showed that citrus peels exhibit quite high antioxidant activity,
which together with polyphenols contained makes them a valuable source for natural
antioxidants and citrus flavonoids in the cosmetic and food industries. As per study by
the Gerhard (EuroFood Chem, “Food for Future” in 2009) polyphenols have
remarkable antioxidant and radical scavenging properties, so it is worth considering
polyphenols as additive for food products and dietary supplement. As per Market
research (study Transparency Market Research. April 01, 2015) polyphenol con-
sumption can increase up to 21,033 tons by the end of 2018 with CGAR of 8 %. But
there are challenges as there is increased pressure on land for agriculture, and research
is focused on finding out the exact class of plant for production. Our work is showing a
way forward for this problem as the source for polyphenol extraction is orange waste,
and if microbiological extraction considered, it is ecofriendly also as there is no use of
solvent and heat involved in this extraction.
Though total polyphenols content of the Coorg oranges ranged from 2.84 to
4.02, Kinnow ranged from 1.28 to 2.68 and Nagpur had 1.67 to 3.94. There could
be geographical and seasonal effect are natural variations which may affect the
polyphenols concentration in the orange peels (Figs. 3 and 4).
References
Antoanela, P., Negreanu-Pirjol, T., Rosca, C., Arcus, M., Bucur, L., Istudor, V.: HPLC analysis of
polyphenols and antioxidant capacity determination of Scirpus holoschoenus L. rhizome.
Ovidius Univdersity Ann. Chem. 22(1), 62–66 (2011)
Armando, R., Aguilera-Carbo, A., Rodriguez, R., Martinez, J.L., Garza, Y., Aguilar, C.N.: Ellagic
acid production by Aspergillus niger in solid state fermentation of pomegranate residues.
J. Ind. Microbiol. Biotechnol. 35, 507–513 (2008)
Arora, M., Kaur, P.: Antimicrobial and antioxidant activity of orange pulp and peel. Int. J. Sci.
Res. (IJSR). 2(11), 2319–7064 (2013). ISSN (online)
Duda-Chodak, A., Tarko, T.: Antioxidant properties of different fruits seeds and peels. Acta Sci.
Pol. Technol. Aliment. 6(3), 29–36 (2007)
Gerhard, K.: Antioxidant activity and total polyphenols in citrus fruit peels and seeds. In:
Proceeding of Food for future- the Contribution of Chemistry to Improvement of Food Quality
(EuroFoodChemXV). Copenhagen, Denmark, 5–8 July 2009
Gianmaria, F.F., Amato, I., Ingenito, A., Zarrelli, A., Pinto, G., Pollio, A.: Plant polyphenols and
their anti carcinogenic properties: a review. Molecules 16, 1486–1507 (2011)
Hegazy, A.E., Ibrahium, M.I.: Antioxidant activities of orange peel extracts. World Appl. Sci.
J. 18(5), 684–688 (2012)
Hegde, P., Agrawal, P., Gupta, P.K.: Isolation and optimization of polyphenols from the peels of
orange fruit. J. Chem. Pharm. Sci. 8(3) (2015)
Li, B.B., Smith, B., Hossain, M.M.: Extraction of phenolics from citrus fruits peels II enzyme
assisted extraction method. Sep. Purif. Technol. 48, 189–196 (2006a)
Li, B.B., Smith, B., Hossain, M.M.: Extraction of phenolics from citrus peels, I solvent extraction
method. Sep. Purif. Technol. 48, 182–188 (2006b)
Manach, C., Scalbert, A., Morand, C., Rémésy, C., Jiménez, L.: Polyphenols: food sources and
bioavailability. Am. Soc. Clin. Nutr. 7(9), 727–747 (2004)
Maria, K., Kirova, E., Alexandrova, S.: Natural antioxidants from Citrus Mandarin peels,
extraction of polyphenols; effect of operational conditions on total polyphenols contents and
antioxidant activity. J. Chem. Technol. Metall. 48(1), 35–41 (2013)
Scalbert, A., Williamson, G.: Dietary intake & bioavailability of polyphenols. J. Nutr. 130, 2073S–
2085S (2000)
Šeruga, M., Novak, I., Jakobek, L.: Determination of polyphenols content and antioxidant activity
of some red wines by differential pulse voltammetry. HPLC Spectrophotometric Method Food
Chem. 124, 1208–1216 (2011)
Stevanato, R., Fabris, S., Momo, F.: New enzymatic method for the determination of total phenolic
content in tea and wine. J. Agric. Food Chem. 52, 6287–6293 (2004)
Transparency Market Research: Polyphenols Market is anticipated to reach a total consumption of
21,032.7 tons by the end of 2018, will demonstrate a CAGR of 6.1 % during the forecast period of
2012 to 2018: Transparency Market Research. April 01, 2015 09:36 EThttps://globenewswire.
com/news-release/2015/04/01/721169/10127269/en/Polyphenols-Market-is-anticipated-to-reach-
a-total-consumption-of-21-032-7-tons-by-the-end-of-2018-will-demonstrate-a-CAGR-of-6-1-
during-the-forecast-period-of-2012-to-2018-Transpa.html. Cited on 21 Feb 2016
Vinson, J.A., Hontz, B.A.: Phenol antioxidant index: comparative antioxidant effectiveness of red
and white wines. J. Agric. Food Chem. 43, 401–403 (1995)
Vinson, J.A., Hao, Y., Su, X., Zubik, L.: Phenol antioxidant quantity and quality in food:
vegetables. J. Agric. Food Chem. 46, 3630–3634 (1998)
Vinson, J.A., Su, X., Zubik, L., Bose, P.: Phenol antioxidant quantity and quality in food: fruits.
J. Agric. Food Chem. 49, 5315–5321 (2001)
Wolfe, K., Wu, X., Liu, R.H.: Antioxidant activity of apple peels. J. Agric. Food Chem. 51, 609–
614 (2003)
Enzymatic Concentration of n−3
Polyunsaturated Fatty Acids
from Indian Sardine Oil
Charanyaa Sampath, N. Anita, B.D. Prasanna

and Iyyaswami Regupathi
1 Introduction
The demand for healthy food and nutrition are becoming a need for everyone to
build up the immunity for different types of diseases. Therefore, there is a search for
the production of compounds which prevent these diseases. Many reports have
studied the beneficial properties of n−3 PUFA namely Eicosapentaenoic acid
(EPA) and Docosahexaenoic acid (DHA). Researches over the last decades have
shown positive effects of fish oils on the cognitive development and vision
enhancement in the newborns (Colombo et al. 2004). The long chain fatty acids like
EPA and DHA have been shown to reduce certain types of cancers, diabetes,
mental health disorders and asthma (Alasalvar et al. 2002; Nettleton and Katz
2005). The presence of large quantities of these two long chain polyunsaturated
fatty acids (PUFA) in Sardine oil (Pike and Jackson 2010) has induced immense
interest in researchers to look for methods to concentrate n−3 PUFA from sardine
oil. In response to this demand, pharmaceutical industries used various techniques,
namely, chromatographic separation, fractional distillation, low temperature crys-
tallization, supercritical fluid extraction, and urea complexation. However, most of
these methods produce PUFA in the form of free fatty acids (FFA) or alkyl esters
which are nutritionally unfavorable and are known to occur at high temperatures.
Since n−3 PUFA are sensitive to heat and oxidation, a hunt for mild conditions
which leads to the concentration of EPA and DHA have become essential. Several
papers describing the use of lipase for hydrolyzing the glycerides in fish oil are
available. Wanasundara and Shahidi (1998) have reported the use of Candida
cylindracea lipase for the enrichment of n−3 PUFA in seal blubber oil. The n−3
C. Sampath (&) N. Anita B.D. Prasanna I. Regupathi

Department of Chemical Engineering, NITK, Mangaluru, Karnataka, India
e-mail: charansampath.2853@gmail.com

DOI 10.1007/978-981-10-1920-3_15
138 C. Sampath et al.
PUFA content increased from 28.0 % (w/v) to 43.5 % after 70 h enzymatic

treatment. Hoshino et al. (1990) have claimed twofold increase in n−3 PUFA after
Candida cylindracea lipase treatment in the case of refined Sardine oil. Shimada
et al. (1994) have reported that Geotrichum candidum lipase increased the n−3
PUFA content to 48.7 % in tuna oil. However, no literature has studied the
hydrolysis of Indian Sardine oil. In this study, maximum activity of Candida
rugosa lipase (CRL) was found by optimizing the various operation parameters.
The Indian Sardine fish oil was subjected to hydrolysis by this CRL to concentrate
the n−3 PUFA content.
2.1 Materials
Crude Indian sardine oil was obtained from Mukka fish oil industries, Mukka,
which was obtained by a conventional pressing method. The refined oil was
achieved through degumming, neutralization, bleaching and deodorization
according to Cmolik and Pokorny (2000). Refined oil was stored under nitrogen at
−20 °C in dark container until use. CRL was obtained from Sigma Aldrich, India.
All other chemicals and solvents were of reagent grade and were used without
further purification.
2.2 Methods
The optimal activity of the CRL was obtained by studying the parameters like pH,
temperature, water- oil ratio, solvent- oil ratio and time. The reaction mixture
containing 1 g of oil and 0.325 mg/mL of CRL was subjected to pH ranging from
(5.5, 6, 6.5, 7, 7.5, 8), temperature (25, 30, 35, 40, 45 °C), oil to water ratio (1:1,
1:4, 1:8, 1:10, 1:12), oil to solvent ratio (1:0.5, 1:1, 1:1.5, 1:2) and time (10, 20, 30,
40, 50, 60 min) by shaking at 500 rpm at room temperature. Enzymatic activity was
obtained by the determination of the liberated FFA through titration with 0.1 N
KOH using phenolphthalein as the end point indicator. The activity of CRL was
calculated according to the official method of American Oil Chemists’ Society
(AOCS) (2009) methodologies, (Cd 3d-63). The hydrolysis was performed under
the optimized reaction conditions of CRL for 30 min and the reaction was stopped
by addition of 10 mL ethanol. The hydrolyzed oil was subjected to solvent
extraction using methanol in the ratio 1:1 oil to methanol (w/w) in order to remove
the FFA released during the hydrolysis reaction. The solvent extracted oil was
studied for its iodine value (AOCS (Cd 1c-85) 2009) which was compared with the
iodine value of the refined oil measured before hydrolysis.
Enzymatic Concentration of n−3 Polyunsaturated Fatty Acids … 139
Stability of the lipase was checked at different pH, temperatures, time, water con-
centration and solvent amount. This study is important since the information it reveals
about the optimum processing conditions is for the efficient hydrolysis of sardine oil.
3.1 Effect of pH on Activity of CRL
The activity of CRL was studied at room temperature by dissolving it in the

phosphate buffer ranging in pH from 5.5 to 8 as given in Fig. 1.
As seen in the Fig. 1, lipase showed the maximum activity of 90.9 mg KOH/g of
oil at pH 7. This is because they generally contain residues of amino acids at the active
site which bind efficiently to the substrate at neutral pH. CRL was unstable in alkaline
and extremely acidic pH because of the structural changes in the proteins due to the pH
variation. In alkaline solutions (pH > 8.0), the partial damage of cysteine residues
caused by β-elimination could result in the reduced activity of CRL and in acidic
solutions (pH < 4.0) the labile peptide bonds sometimes found next to aspartic acid
residues may be hydrolyzed (Akova and Ustun 2000). Besides, at acidic pH, the
enzyme may form high molecular weight aggregates due to the unspecific associations
with other proteins because of its hydrophobic nature (Montero et al. 1993). The result
of this study was similar with that of Montero et al. (1993), where the soluble CRL was
active between pH 6.2 and 7.7. Another study by Fadologlu and Soylemez (1997)
stated the optimum pH for the soluble CRL as 7.0.
3.2 Effect of Temperature on the Activity of CRL
Tests to decide the effect of temperature on lipase activity were done at a tem-
perature range of 25–45 °C, and it was taken in that CRL showed a maximum
Fig. 1 Effect of pH of buffer

on activity of CRL at room
temperature
Fig. 2 Effect of temperature

on the activity of CRL at pH 7
activity of 88.7 mg KOH/g of oil at a temperature of 35 °C in pH 7.0 phosphate

buffer. However, 9.4 and 26.35 % of the activity was lost at 40 °C and 45 °C,
respectively (Fig. 2). This is due to the denaturation of the enzyme structure at these
temperatures. Several researchers have reported the optimum temperature of soluble
CRL at 37 °C (Montero et al. 1993; Xu et al. 1995). Also, Montero et al. (1993)
found that treatment at higher temperatures led to the inactivation of the enzyme.
According to Fadologlu (1996), CRL exhibits its maximal activity at 40 °C. In this
study, enzyme showed considerable activity in a temperature of 35 °C.
3.3 Effect of Oil to Water Ratio
CRL catalyse the splitting of the ester bonds of triglycerides with the consumption
of water molecules. Hence it gets significant to consider the quantity of water
required for hydrolysis as it increases the functionality of the enzyme at the
interphase in the biphasic solvent system. From Fig. 3, it is clearly seen that the
hydrolytic activity was highest (88.5 mg KOH/g of oil) at the oil to water ratio of
1:10 (w/v). The ratios less than 1:10 (w/v) and above 1:10 (w/v) showed lesser
activities which could be because the lesser quantity of water leads to the reduced
Fig. 3 Effect of oil to water

ratio (w/v) on the activity of
CRL at pH 7, temperature
35 °C
Fig. 4 Effect of oil to solvent

ratio (w/v) on the activity of
CRL at pH 7, temperature
35 °C
rate of conversion, whereas higher quantity of water leads to a thicker water layer
around the CRL which increases the flexibility of CRL to interact with the sol-
vents,causing denaturation. (Aditi et al. 2014). Han and Rhee (1986) stated similar
reaction conditions for the hydrolysis of olive oil catalyzed by CRL enzyme in the
range of pH 6.5–7.1, temperature 30–35 °C and 0.72–9.78 (v/v) oil to water ratio.
3.4 Effect of Oil to Solvent Ratio
The enzyme displayed a maximum activity of 86.7 mg KOH/g of oil at 1:1 (w/v)
oil to solvent ratio, as is shown in the Fig. 4. The isooctane due to its non polarity,
acts as an organic phase and completely dissolves the non polar triglycerides
formed during hydrolysis and separates them with great ease (Yadav and Devi
2004). The enzyme activity is found to decrease beyond 1:1 (w/v) oil to solvent
ratio due to the excess amount of iso octane which reduces the availability of the
active site of enzyme to the oil. (Aditi et al. 2014). The presence of iso octane
results in an increased interfacial area of the oil water system due to the reduced
effect of viscosity of the oil.(Aditi et al. 2014). The non polarity of iso octane
reduce the enzyme inhibition without stripping off the essential water from CRL
during hydrolysis and helps in maintaining a monolayer of water around the CRL
(Klibanov 1989).
3.5 Effect of Time
Figure 5 shows the time course of hydrolysis where the CRL was shown to give
maximum product formation at 30 min equivalent to 85.4 mg of KOH/g of oil. It is
clear from the trend observed in Fig. 5, that with the initial increase in time the
product formation was increased up to 30 min and a further increase in time up to
1.5 h did not lead to any improvement in the product formation. The progress of
biocatalytic reactions is almost never linear and is given to slow down with time
Fig. 5 Effect of variation in

time (minutes) on the activity
of CRL at pH 7, temperature
35 °C
due to the decrease in oil concentration, the increase in product concentration or the
inactivation of the biocatalyst (Gardossi et al. 2010).
Thus, the most suitable reaction conditions for hydrolysis of sardine fish oil with
CRL in solvent system were obtained at pH 7.0, temperature 35 °C, and oil to water
ratio of 1:10 (w/v), oil to solvent ratio of 1:1 (w/v), and time 30 min. The activity of
lipase for optimized parameters was found to be 85.4 for CRL in µmoles of FFAs/ml.
3.6 Enhancement of n−3 PUFA in Oil
The iodine value of oil before hydrolysis was found to be 145.45 and after
hydrolysis it was 162.29. This significant increase in iodine value number indicates
the enhancement of unsaturated fatty acids in the oil. The increase in the unsatu-
ration is probably due to the enhancement of nutritionally important n−3 PUFA like
EPA and DHA. This is because CRL has fatty acid chain length specificity showing
an increased discrimination against the long chain PUFA like C18–C22. CRL
hydrolyses the short chain fatty acids, saturated fatty acids and mono unsaturated
fatty acids because of the reduced steric hinderances when linked to the glycerol
backbone acids leading to the protection and concentration of EPA and DHA
(Okada and Morrissey 2006).
4 Conclusions
In this study, the optimal activity of CRL was found after which the hydrolysis of
oil with CRL in the optimized conditions was carried out followed by FFA removal
which resulted in an enhancement of n−3 PUFA in Indian sardine oil. It should be
noted that the hydrolysis of oil for 30 min resulted in a significant increase in n−3
PUFA after which there was not much increase observed. For commercial purposes,
30 min might be an optimum reaction time for producing n−3 PUFA concentrates.
Hence lipase catalysed hydrolysis was considered to be a beneficial and feasible

method for the enhancement of n−3 PUFAs from Indian sardine oil for the use in
nutraceuticals and other products.
References
Aditi, S., Chaurasia, S.P., Dalai, A.K.: Non-selective hydrolysis of tuna fish oil for producing free
fatty acids containing docosahexaenoic acid. Can. J. Chem. Eng. 92, 344–354 (2014)
Akova, A., Ustun, G.: Activity and adsorption of lipase from Nigella sativa seeds on celite at
different pH values. Biotechnol. Lett. 22, 355–359 (2000)
Alasalvar, C., Shahidi, F., Quantick, P.: Food and health applications of marine nutraceuticals: a
review. Seafoods Qual. Technol. Nutraceutical Appl. 175–195 (2002)
AOCS: Official methods and recommended practices of the American oil chemists. Soc. Sampling
Anal. Fats Oils (2009)
Cmolik, J., Pokorny, J.: Physical refining of edible oils. Eur. J. Lipid Sci. Technol. 102, 472–486
(2000)
Colombo, J., Shaddy, D.J., Anderson, C.J., Blaga, O.M., Kannass, K.N., Kundurthi, S.:
Maternal DHA and the development of attention in infancy and toddlerhood. Child Dev. 75(4),
1254–1267 (2004)
Fadologlu, S.: Kinetics of olive oil hydrolysis by free and immobilised Candida rugosa lipase. Ph.
D thesis, University of Gaziantep (1996)
Fadologlu, S., Soylemez, Z.: Kinetics of lipase catalyzed hydrolysis of olive oil. Food Res. Int. 30,
171–175 (1997)
Gardossi, L., Poulsen, P.B., Ballesteros, A., Hult, K., Svedas, V.K., Vasic-Racki, D., Carrea, G.,
Magnusson, A., Schmid, A., Wohlgemuth, R., Halling, P.J.: Guidelines for reporting of
biocatalytic reactions. Trends Biotechnol. 28, 171–180 (2010)
Han, D., Rhee, J.S.: Lipase-catalyzed hydrolysis of milk fat in lecithin reverse micelles.
Biotechnol. Bioeng. 28, 1250–1255 (1986)
Hoshino, T., Yamane, T., Shimazu, S.: Selective hydrolysis of fish oil by lipase to concentrate n−3
polyunsaturated fatty acids. Agric. Biol. Chem. 54, 1459–1467 (1990)
Klibanov, M.A: Enzymatic catalysis in anhydrous organic solvents. Trends Biochem Sci. 14(4),
141–144 (1989)
Montero, S., Blanco, A., Virto, M., Ladenta, L.C., Agud, I., Solozabal, R., Lascaray, J.M.,
Renobales, M., Llama, M.J., Serra, J.L.: Immobilization of Candida rugosa lipase and some
properties of the immobilized enzyme. Enzyme Microb. Technol. 15, 239–247 (1993)
Nettleton, J.A., Katz, R.: n−3 long-chain polyunsaturated fatty acids in type 2 diabetes: a review.
J. Am. Diet. Assoc. 105(3), 428–440 (2005)
Okada, T., Morrissey, M.T.: Production of n−3 polyunsaturated fatty acid concentrate from
sardine oil by lipase-catalyzed hydrolysis. Food Chem. 103, 1411–1419 (2006)
Pike, I.H., Jackson, A.: Fish oil: production and use now and in the future. Lipid Technol. 22(3),
59–61 (2010)
Shimada, Y., et al.: Enrichment of polyunsaturated fatty acids with Geotrichum candidum lipase.
J. Am. Oil Chemist’s Soc. 71(9), 951–954 (1994)
Wanasundara, U.N., Shahidi, F.: Lipase-assisted concentration of n−3 polyunsaturated fatty acids
in acylglycerols from marine oils. J. Am. Oil Chemist’s Soc. 75(8), 945–951 (1998)
Xu, H., Li, M., He, B.: Immobilization of Candida cylindracea lipase on methyl acrylate-divinyl
benzene copolymer and its derivatives. Enzyme Microb. Technol. 17, 194–199 (1995)
Yadav, G.D., Devi, K.M.: Kinetics of hydrolysis of tetrahydrofurfuryl butyrate in a three phase
system containing immobilized lipase from Candida antarctica. J. Biochem. Eng. 17, 57–63
(2004)
High-Throughput Screening of Cell
Repellent Substrate Chemistry
for Application in Expanded Bed
Adsorption Chromatography
Vikas Yelemane, Martin Kangwa and Marcelo Fernández-Lahore
1 Introduction
Downstream processing costs in biomolecule purification can constitute up to 80 %

of the total manufacturing costs (Anspach et al. 1999). Increasing competition in the
biotech markets and pressure from the regulatory agencies to keep the costs low
triggered the development of novel and efficient (bio) separation technologies
(DSouza et al. 2013). Process integration is one of the standard routines in the field
of biochemical engineering. Process integration refers to the reduction of processing
steps by combining multiple unit operations, which will in turn help reduce product
and time losses incurred in individual steps. One of such integrated process
approaches in downstream processing is Expanded Bed Adsorption (EBA), which
has been already successfully applied in the purification of a variety of biomole-
cules (Anspach et al. 1999; de Sousa Junior et al. 2015). An illustration of the
integrative approach is presented in Fig. 1.
In 1992 Chase and Draeger demonstrated a novel approach in which feedstock
can be fed to the EBA system without earlier removal of particulate material by
centrifugation or filtration, thus showing considerable potential for this approach in
simplifying downstream processing steps (Draeger and Chase 1991). Performance
of EBA mainly depends on the column hydrodynamics, which in turn depends on
the stability of a perfectly fluidised bed in the presence of complex feedstock to
obtain the best results. Cell adhesion on the adsorbent poses a threat to the success
of EBA technology. It will result in formation of internal channels in the EBA bed,
V. Yelemane (&) M. Kangwa M. Fernández-Lahore

Downstream Bioprocessing Laboratory, School of Engineering and Science Jacobs
University, Campus Ring 1, 28759 Bremen, Germany
e-mail: v.yelemane@jacobs-university.de

DOI 10.1007/978-981-10-1920-3_16
146 V. Yelemane et al.
Fig. 1 Process flow for classical and integrative downstream processing
which leads to irregular colloidal distribution in the column resulting in bed col-
lapse (Fernandez-Lahore et al. 2000). To alleviate such interaction, polymer
shielding of the chromatographic adsorbents has been proven to be among the more
successful approaches (Vennapusa and Fernandez-Lahore 2010). The main objec-
tive of this work is to develop simple microwell plate assay for high throughput
screening polymer with cell repellent properties—mainly towards Saccharomyces
cerevisiae (baker’s yeast) cells. Validation experiments will be performed using
microscopy techniques by coating the screened polymer onto EBA adsorbent to test
its cell repellent property in process conditions.
High-Throughput Screening of Cell Repellent Substrate Chemistry … 147
2.1 Chemicals and Reagents
Polystyrene flat-bottom 96 microwell plate were purchased from Greiner Bio-One

GmbH, Germany. Polymers polyvinyl alcohol (PVA), poly ethylene glycol (PEG
26), Triton X100, Brij 58, Tween 20, Polyvinylpyrrolidone (PVP360),
DEAE-dextran, Glycidylmethacrylate (GMA), dimethylsulfoxide (DMSO) and
2,2′-Azobis(2-methylpropionitrile (AIBN) from Sigma–Aldrich, Germany. Poly
acrylic acid from Polysciences, Germany. All other chemicals and salts were pur-
chased from AppliChem, Germany. Milli-Q purified water was used.
2.2 Cell Culture
Saccharomyces cerevisiae cells were cultivated in yeast peptone dextrose medium

in Erlenmeyer flasks on an orbital shaker set at 220 rpm and 30 °C. Cells were
harvested at late log phase by centrifugation and washed with PBS, Milli-Q and
20 mM phosphate buffer at pH 7.5 (Eq. Buffer), in that order, respectively. For all
experiments fresh cells, with more than 95 % viability, were used.
2.3 Epoxy Coating of Microwell Plate
Initially, Poly(glycidylmethacrylate) was synthesised by homo-polymerisation of

glycidylmethacrylate in methanol with 2,2′-Azobis(2-methylpropionitrile) as ini-
tiator. Reaction mixture consists of 20 % v/v GMA and 1 % w/w AIBN in
methanol. Reaction was initiated by heating the mixture to 70 °C for 30 min. The
polymerisation reaction was stopped at gelling point by diluting with DMSO.
PolyGMA was then dip coated on to 96 well plates. The residual solvent was
evaporated at 40 °C for 16 h. Finally, the plates were washed thoroughly with
Milli-Q water and dried at room temperature before use (Eckert et al. 2000).
2.4 Coupling of DEAE-Dextran to Epoxy Groups

in Microwell Plate
10 mg/mL of DEAE-dextran was dissolved in reagent solution (1 mL of 1 M

sodium hydroxide, 3.6 mg of sodium borohydride, and 0.4 mL of water). 100 µL
of the solution was added per well for the coupling reaction. Plates were incubated
for 18 h on plate mixer at room temperature. Then plates were washed with eq.
buffer till plate pH reaches neutral and also to remove unreacted residues. The
plates are stored in same buffer at 4 °C.
2.5 Polymer Coating and Cell Adhesion Studies
300 µL per well of polymer solution with 1 % v/v in Eq. buffer was loaded on
plate and incubated for 30 min at room temperature. The plate was then washed
repeatedly with eq. buffer to remove the unbound polymer. Cell suspension of
concentration one OD600 was taken in quantities of 300 µL per well and incubated
for 3 h. After the incubation cell suspension was removed and 150 µL of 0.2 %
w/v Crystal Violet dye in water was added and plates were incubated for 15 min.
Plate was gently washed 2–3 times with 300 µL of Eq. buffer to remove excess dye
and unbound cells. Subsequently, the plate was dried overnight. The dye was eluted
with 150 µL of 30 % acetic acid by incubating plate on a plate mixer for 15 min.
The eluted mixture was transferred to a fresh microwell plate and absorbance was
measured at 570 nm.
In a previous study, we have developed agarose gel based discs, which can be
functionalised with standard ligands in easy steps and placed in microwell plates for
similar studies. However, the main limitation of this method was the difficulty in the
estimation of cell adhesion. It was found that the gel adsorbed crystal violet dye
which resulted in a false positive result when testing. To overcome this challenge
current method has been developed.
3.1 PolyGMA Coating and Dextran Coupling
In the first stage, PolyGMA was synthesised as mentioned previously. During the
polymerisation reaction the acrylic part of GMA plays the main role and poly-
merises—resulting in freely accessible epoxide groups in the polymer. Coating with
epoxy groups is an effective and easy way to modify inert surfaces. The layer of
polyGMA will provide free epoxy functional groups which can then be easily
utilised for further coupling of proteins or polymers using well proven techniques.
Last well of the every row was left without coating and later used as negative
control. In second stage, polyGMA coated plates were coupled with commercially
available functionalised dextran. In this study we used DEAE-dextran, a func-
tionalised polysaccharide similar to DEAE-agarose used in expanded bed adsorp-
tion. Protocol mentioned in methods was used for coupling. Wide variety of
functionalised dextran with varying ionic and hydrophobic properties, which mimic
chromatographic conditions, are commercially available. Using such a product
saves a significant amount of time. At end of the coupling reaction plates were
washed 2–3 times to remove any uncoupled material and stored in eq. buffer.
Figure 2 represent modification process graphically (Fig. 3).
Fig. 2 Schematic representation of step by step modification of microwell plate
Fig. 3 List of polymer tested and their cell repellant index for yeast cells
3.2 Effect of Polymer Coating on Cell Adhesion
In this study, we have chosen a set of ionic and non-ionic polymers with high
molecular weight viz., polyvinyl alcohol, poly ethylene glycol, Triton X100, Brij
58, Tween 20, Polyvinylpyrrolidone and polyacrylic acid for coating. Polymer
coating was performed as described in the previous section. Native or non-coated
and empty wells were used as positive and negative control respectively. Polymer
coating modified the surface properties of DEAE-dextran and this change influence
cell-surface interaction. To measure such change in interaction, crystal violet
(CV) assay was used and performed as described in the previous section. CV binds
to cells and is a well proven method to study biofilms because the dye binds
proportionally to cell number. Post staining, plates were washed 2–3 times to
remove any unbound cells or excess stain and dried overnight. The colour intensity
at bottom of the plate will give qualitative estimation of cell adhesion. We
employed dye elution techniques where, CV was eluted with acetic acid to estimate
the cell adhesion quantitatively. Results of the cell adhesion assay were expressed
as dimensionless cell repellent index, which is defined as
0Dcoated
Cell repellent index ¼ 1 ð1Þ
0DNeat
Results showed highest interaction with native Dextran-DEAE surface. PEG and
triton X100 coating did not have any influence on the cell adhesion. Pluronic F68
and PVP 360 increased the cell repulsion property by 15 % but highest cell
repulsion property was demonstrated by PAA 320 with more than 50 %. To vali-
date these results, PAA 320 was coated on Streamline DEAE, a commercial EBA
adsorbent and tested with partition experiments followed by microscopic obser-
vation for cell adhesion. Figure 4 shows the microscopy images of the adsorbent
Fig. 4 Deposition of yeast cells S. cerevisiae onto Streamline DEAE. a Interaction of cells
(arrow) on to the naked adsorbent. b Reduced yeast cell interaction onto PAA coated adsorbent
after the adhesion experiments figure (A) shows the naked bead with a clear
interaction with cell and forming a thin layer on the bead surface.
Figure (B) Shows PAA coated bead showing cell repulsion property showing very
negligible interaction exists at the adsorbent surface. The interaction between the
substrate and yeast needs to be studied further. Microscopic visualisation clearly
demonstrate the cell repulsion property of PAA 320 and it corroborates the results
of microwell plate method. It demonstrating that polymer coating can reduce cell
adhesion in integrated bioprocessing and enhance process efficiency.
4 Conclusion
In conclusion, this paper demonstrates a robust and simple method for microwell
plate assay for cell adhesion studies. It can be used for high-throughput screening
cell repulsion polymers. Plate surface can be modified with protein or polymers by
coating of grafting techniques to fit our requirement. In this study we tested eight
polymers for cell repulsion property. PAA, a pharmaceutical grade polymer inter-
acted with plate surface and adsorbent. We assume that it formed a layer on sub-
strate and altered the surface properties. It was directly indicated by change is cell
adhesion behaviour after coating. The optimal combination found from the
experiments performed was used to coat the commercial adsorbent for further tests.
Coated adsorbents showed similar cell repulsion property in process like conditions
and were validated using microscopic visualisation.
Acknowledgments The authors gratefully acknowledge financial support from the European
Union Seventh Framework Programme (EU-FP7 KBBE 2012 Project 312004-INTENSO).
References
Anspach, F.B., Curbelo, D., Hartmann, R., Garke, G., Deckwer, W.-D.: Expanded-bed
chromatography in primary protein purification. J. Chromatogr. A 865, 129–144 (1999)
de Sousa Junior, F.C., Vaz, M.R.F., de Araújo Padilha, C.E., Chibério, A.S., Martins, D.R.A., de
Macedo, G.R., dos Santos, E.S.: Recovery and purification of recombinant 503 antigen of
Leishmania infantum chagasi using expanded bed adsorption chromatography. J Chromatogr.
B 986–987, 1–7 (2015)
Draeger, N.M., Chase, H.A.: Liquid fluidized bed adsorption of protein in the presence of cells.
Bioseparation 2, 67–80 (1991)
DSouza, R.N., Azevedo, A.M., Aires-Barros, M.R., Krajnc, N.L., Kramberger, P., Carbajal, M.L.,
Grasselli, M., Meyer, R., Fernández-Lahore, M.: Emerging technologies for the integration and
intensification of downstream bioprocesses. Pharm. Bioprocess. 1, 423–440 (2013)
Eckert, A.W., Grobe, D., Rothe, U.: Surface-modification of polystyrene-microtitre plates via
grafting of glycidylmethacrylate and coating of poly-glycidylmethacrylate. Biomaterials 21,
441–447 (2000)
Fernandez-Lahore, H.M., Geilenkirchen, S., Boldt, K., Nagel, A., Kula, M.R., Thommes, J.: The
influence of cell adsorbent interactions on protein adsorption in expanded beds. J. Chromatogr.
A 873, 195–208 (2000)
Vennapusa, R.R., Fernandez-Lahore, M.: Effect of chemical additives on biomass deposition onto
beaded adsorbents. J. Biosci. Bioeng. 110, 564–571 (2010)
Concentration of C-Phycocyanin
from Spirulina platensis Using Forward
Osmosis Membrane Process
Shoaib A. Sharief and Chetan A. Nayak
1 Introduction
Phycobiliproteins are a gathering of water soluble colored proteins that are ordi-
narily found in red algae and Cyanobacteria. They have a wide range of uses and
are known for their fluorescent application in the field of immunological and
clinical analysis. Their additional uses incorporate as a food colorant and also as a
therapeutic agent (Sekar and Chandramohan 2008). Phycobilisome are comprised
of allophycocyanin centers that are fenced by phycocyanin at the fringe. The pivotal
part is phycocyanin though the connecting pigment between photosynthetic lamella
and phycobilisomes is the allophycocyanin (Eisele et al. 2000). The cyanobacteria
to be specific, Spirulina platensis have been promoted in couple of countries in
view of its critical constituents, for example, vitamins and proteins. Spirulina
platensis is a cheap and rich wellspring of color like phycocyanin (Kato 1994;
McCarty 2007). It is likewise utilized as a part of food colorant in products, for
example, yogurt, chewing gum, mixed beverages soda pops, milk shakes beauty
care, furthermore in pharmaceutical (Babu et al. 2006). Water is the significant
constituent in a large portion of natural color extract that helps in development of
microorganism. Shelf life and usage of these extracts can be increased by elimi-
nation of water by concentrating and freeze drying. Phycocyanin is a heat sensitive
protein (Sarada et al. 1999; Chethana et al. 2015). The industrial processing of the
food substances has a tremendous and serious impact on the final product as it
affects the nutritional as well as sensorial properties of the product. In order to
reduce this impact, membrane technology can be used as an optional procedure to
concentrate the phycocyanin. For the concentrating of natural colorant, non-heat
sensitive procedures like Forward Osmosis (FO) is been reported (Nayak et al.
S.A. Sharief C.A. Nayak (&)

Department of Chemical Engineering, BMS College of Engineering,
P B NO. 1908 Bull Temple Road, Bengaluru 560019, Karnataka, India
e-mail: canayak.che@bmsce.ac.in

DOI 10.1007/978-981-10-1920-3_17
154 S.A. Sharief and C.A. Nayak
2010a, b; Rastogi and Nayak 2010). The grade or the quality of food is maintained
by FO, without bringing about any changes to the physical properties, (for example,
smell, shading, nourishment and taste) (Nayak et al. 2011; Sant’ Anna et al. 2012).
It uses a hydrophilic semi-permeable membrane, which separates the osmotic and
feed solution having particular osmotic pressure. The main driving force is osmotic
pressure difference across the membrane. The objective of this present work is to
extensively study the Forward osmosis process for concentrate the purified phy-
cocyanin biomolecule.
2.1 Organism and Chemicals
The blue green algae (Spirulina platensis) in the dried powder form was kindly
provided by M/s. Parry Nutraceuticals, a Division of E.I.D Parry (India) Ltd.,
Chennai. Sodium Chloride (NaCl) and Sodium phosphate was procured from S.D
Fine chemicals, India. Sodium Dodecyl Sulfate (SDS) was procured from Sisco
research lab, India. All the chemicals used were of analytical grade.
2.2 Extraction and Purification of C-PC

from Spirulina platensis
The Phycobiliprotein extraction involves the rupture of cell biomass for the
extraction of protein from the cell of Spirulina platensis. The pigment C-PC was
extracted from Spirulina platensis by using techniques like: (a) Water extraction:
Dry Spirulina platensis biomass was suspended in distilled water and maintained at
room temperature for 2 h and the C-PC leached out was centrifuged at 10,000 rpm
at 4 °C for 10 min. (b) Homogenization of cells using Homogenizer: Wet Biomass
was homogenized by Growell Homogenizer from (Bio-Lab, Growell instruments
Pvt. Ltd. India) at 5000 rpm for 10 min and the extract was centrifuged at
10,000 rpm at 4 °C, supernatant was collected. (c) Freezing and thawing: C-PC was
also extracted by repeated freezing and thawing of wet biomass cells in 50 mM
phosphate buffer pH 6.8 for comparison. Deep freezing at temperature of −69 °C
was carried out for 2 h, immediate thawing was performed. The extract was cen-
trifuged at 10,000 rpm. At 4 °C for 10 min and the supernatant contained C-PC.
To separate and eliminate small cell fragments in the crude C-PC extract,
Whatman filter paper of Grade 1:11 μm (medium flow filter paper) was used in the
coarse filtration step. The filter paper was placed on a funnel and the crude C-PC
sample taken after extracting using homogenization method was used. For the fine
filtration step, Tangential Flow Filtration (TFF) unit (Millipore, Pellicon XL with
Concentration of C-Phycocyanin from Spirulina platensis … 155
PS pump, USA) was modified for Microfiltration. Module I was connected to the
TFF unit. Polypropylene membranes (Sterlitech corporation, USA) disc of 0.047 m
diameter with a pore size 0.45 μm, was placed between the module I plates and
concealed by connecting it to the peristaltic pump (Master flex L/S Cole Parmer,
USA.) The feed was loaded into the feed tank to check the transmembrane flux. The
feed transmembrane pressure was maintained at 1.4 kg/cm2 and the retentate
pressure was maintained at 1.3 kg/cm2 this experiment conducted for a period of
one hour. Periodically, the membrane was changed in order to increase the trans-
membrane flux and to avoid fouling. The final pure filtrate was obtained by using
syringe filtration in batch process. The complete feed is forced through the
Polypropylene membrane (Sterlitech Corporation, USA) disc of 0.025 m diameter
and pore size 0.2 μm to get the final product.
2.3 Feed and Osmotic Agent
Crude C-PC and purified C-PC was used as feed by using different modules each
time. Double distilled water was used as feed as into compare the transmembrane
flux with that of the C-PC. OA solution were prepared by dissolving sodium
chloride in distilled water in various degrees of (1.0–6.0 M) concentrations. These
solutions were kept overnight at room temperature before utilization to ensure
complete dissolution of sodium chloride.
2.4 Experimental Setup and Membrane Modules

for Concentration of C-PC
Two acrylic membrane Module I (Fig. 1a. Circular module) and Module II
(Fig. 1b. Flat membrane module) were fabricated and used for study which is
represented in Fig. 1. For the concentration of feed by FO process, the experimental
setup consisted of a hydrophilic, semi permeable Cellulose Tri Acetate
(CTA) membrane (HTI Technologies, USA), placed between the modules. Feed
solution (water, C-PC extract) and osmotic agent (1.0–6.0 M NaCl) was passed on
either sides of the membrane in co-current direction by using peristaltic pumps. The
effect of change in feed and OA flow rate (25–125 mL min−1) on transmembrane
flux was studied. Transmembrane flux was calculated by measuring the increase in
volume of OA for every 1 h. Small scale experiment was performed for 3 h by
using module I and the average values of the flux was reported. Large scale
experiment was carried out for a period of 11 h by using module II. Reverse solute
diffusion was estimated by using flame photometer (Systronic flame photometer
Model No. 128). All the experiments were performed at room temperature of
25 ± 2 °C.
Fig. 1 Illustrative diagram of (1a) 1 Circular membrane module I for FO process: 1 circular
membrane module of membrane area of 0.00519 m2, 2 feed reservoir, 3 OA reservoir and 4
peristaltic pump. 1b Flat membrane module II-Front acrylic module. 2 Back acrylic module. 3
Membrane area of 0.012954 m2. 4 Silicon rubber gasket
Fig. 2 Flow chart of forward osmosis membrane process
The process of concentration using FO membrane process is depicted in Flow

chart Fig. 2.
2.5 Determination of C-Phycocyanin Concentration
The concentration of C-Phycocyanin was determined by using a UV-Visible

spectrophotometer (Model: Cary 8454, Agilent Technologies, Inc.) by measuring
the absorbance at 620 nm. Digital refractometer (HI 9680, HANNA) was used in
estimation of Total soluble solid (TSS) in Brix. The C-Phycocyanin concentration
was calculated using the following Eq. 1 as given by (Siegelman et al. 1978;
Chethana et al. 2015).
½A620 0:474ðA652 Þ
C PC ðmg mL1 Þ ¼ : ð1Þ
5:34
where A620 is the Absorbance of C-PC and A652 is the absorbance of

Allophycocyanin.
3.1 Effect of Change in Osmotic Agent Concentration

on Transmembrane Flux
Experiments were conducted using module I. On account of water and C-PC as a

feed, the transmembrane flux was found to increase from 1.978 to 2.939 lm−2 h−1
and 0.614 to 1.095 lm−2 h−1 with an increase concentration of OA from 1.0 to
6.0 M NaCl as shown in Fig. 3.
Fig. 3 Variation of osmotic agent concentration versus feed transmembrane flux

Fig. 4 a Effect of change in feed flow rate on transmembrane flux and on concentration of C-PC.
b Effect of change in osmotic agent flow rate on transmembrane flux and on concentration of C-PC
3.2 Effect of Change in Feed and Osmotic Agent Flow Rate
With an increase in feed flow rate from 25 to 125 mL min−1, the transmembrane
flux for water and C PC was found to increase from 2.498 to 2.786 lm−2 h−1 and
0.941 to 1.614 lm−2 h−1 respectively Phycocyanin concentration was found to
increase from 0.228 to 0.320 mg mL−1 Fig. 4a. The TSS in the C-Phycocyanin
sample increased from 3.1 °Bx to 4.9 °Bx respectively. The transmembrane flux
was found to increase from 0.826 to 1.191 lm−2 h−1 the C-Phycocyanin concen-
tration was calculated by using the Eq. 1 and it was found to increase from 0.1031
to 0.247 mg mL−1 Fig. 4b. The TSS in the C-Phycocyanin sample increased from
3 °Bx to 5.1 °Bx, respectively.
3.3 Large Scale Experiments Using Module II
Based upon the optimized conditions, the crude C-PC content was concentrated
from 0.288 mg mL−1 initial concentration to 0.313 mg mL−1 final concentration
8.68-fold increase in concentration. Due to increase in feed concentration, the
transmembrane flux was found to decrease from 0.602 to 0.502 lm−2 h−1 with time.
Babu et al. (2006) have reported a maximum concentration of 3-fold for
Phycocyanin for osmotic membrane distillation process, wherein 2.9 °Bx crude
extract was concentrated up to 5.3 °Bx C-PC concentrate.
3.4 Purification of C-PC and Concentration for 11 h
The purification of CPC was carried out; the total volume and the concentration of
C-PC found in the crude extract were considered to be 100 %, during coarse
filtration when the sample was filtered through a membrane of pore size 1 μm, the
reduction in volume from 100 to 85.1 %. Later, after the process of fine filtration
i.e., by using microfiltration and syringe filtration wherein membranes of pore size
Fig. 5 Variation of concentration of purified C-PC during large scale experiment using module I
0.45 and 0.2 μm respectively were used. The volume of the C-PC extract was
further reduced to 76 %. There was a change in the color of the extract changed
from dark blue to blue after fine filtration processes However, the purity ratio of the
supernatant liquid was slightly increased. When C-PC extract was filtered through
membrane with 0.45 μm pore size, an average level of permeate flux of
1.304 lm−2 h−1 was determined. After nearly 70 min of the microfiltration process
there was reduction seen in the permeate flux, this may be attribute to membrane
fouling. Later, the membrane was replaced in order to improve the permeate flux
and to complete the filtration process. After the microfiltration process the purified
C-PC permeate was subjected to dead end filtration by the help of syringe filters.
Sterile Cellulose Acetate membranes of pore size 0.2 μm wherein the ultimate fine
filtration was carried out. The result of syringe filtration was a purified C-PC and
the purity ratio (A620/A280) was also determined. There was an increase from
0.2977 of crude C-PC to 0.597 purified C-PC. During FO, Initial volume of
99.3 mL of C-PC was reduced to 70.6 mL. Simultaneously, C-Phycocyanin content
was concentrated from 0.133 mg mL−1 initial concentration to 0.175 mg mL−1
final concentration (Fig. 5) it was also found that around 2.9 °Bx initial C-PC
extract was concentrated to 5.3 °Bx C-Phycocyanin concentrate. To the purity ratio
increasing from initial crude C-PC of 0.2977 to final pure C-PC of 0.597 (Fig. 6).
3.5 Confirmation of C-PC Using SDS-PAGE
The purity of C-PC sample obtained after syringe filtration and FO were confirmed
by using SDS-PAGE. SDS-PAGE indicates the majority of C-PC (α and β) subunits
Fig. 6 Variation of C-PC conc. in large scale experiment using module II
Fig. 7 SDS-PAGE of
C-Phycocyanin. Lane-1
molecular marker; lane-2
crude C-PC + FO; lane-3 pure
C-PC + FO
concentration at around 19.4 kDa in Lane-3 which is obtained after Syringe fil-
tration and FO process as shown in Fig. 7.
4 Conclusion
Forward osmosis membrane process for concentrate the purified phycocyanin was
studied. The effect of change in feed and OA flow rate was found prominent at
higher concentration of the phycocyanin. The crude C-PC content was concentrated
from an initial concentration of 0.288 to 0.313 mg mL−1 using module II. The pure
C-PC obtained by microfiltration using syringe showed a change in concentration
from an initial concentration of 0.133 to 0.175 mg mL−1 by using module I for FO.
The purity ratio was also found to increase from initial crude C-PC of 0.2977 to
final purified C-PC of 0.598 which is nearly equal to a food grade C-PC. The
forward osmosis membrane process is a promising method for concentration of
value added biomolecules.
Acknowledgments The work reported in this paper is supported by the college through the
TECHNICAL EDUCATION QUALITY IMPROVEMENT PROGRAMME [TEQIP-II] of the
MHRD, Government of India. Authors express their sincere thanks to Vision Group of Science
and Technology (VGST). This project is continuation of the project granted by (VGST), Karnataka
State to Dr. Chetan A Nayak, Project grant No. GRD 204 for 2013–14.
References
Babu, B.R., Rastogi, N.K., Raghavarao, K.S.M.S.: Mass transfer in osmotic membrane distillation
of phycocyanin colorant and sweet-lime juice. J. Membr. Sci. 272, 58–69 (2006)
Chethana, S., Nayak, C.A., Madhusudhan, M.C., Raghavarao, K.S.M.S.: Single step aqueous
two-phase extraction for downstream processing of C-phycocyanin from Spirulina platensis.
J. Food Sci. Technol. 52(4), 2415–2421 (2015)
Eisele, L.E., Bakhru, S.H., Liu, X., MacColl, R., Edwards, M.R.: Studies on C-phycocyanin from
Cyanidium caldarium, a eukaryote at the extremes of habitat. Biochim. Biophys. Acta 1456(2–
3), 99–107 (2000)
Kato, T.: Blue pigment from Spirulina. New Food Ind. 29, 17–21 (1994)
McCarty, M.F.: Clinical potential of Spirulina as a source of phycocyanobilin. J. Med. Food 10(4),
566–570 (2007)
Nayak, C.A., Rastogi, N.K.: Forward osmosis for the concentration of anthocyanin from Garcinia
indica Choisy. Sep. Purif. Technol. 71, 144–151 (2010a)
Nayak, C.A., Rastogi, N.K.: Comparison of osmotic membrane distillation and forward osmosis
membrane processes for concentration of anthocyanin. Desalin. Water Treat. 16, 134–145
(2010b)
Nayak, C.A., Valluri, S.S., Rastogi, N.K.: Effect of high or low molecular weight of components
of feed on transmembrane flux during forward osmosis. J. Food Eng. 106, 48–52 (2011)
Rastogi, N.K., Nayak, C.A.: Membranes for Membranes for forward osmosis in industrial
applications. In: Basile A., Nunes S.P. (eds.) Advanced Membrane Science and Technology for
Sustainable Energy and Environmental Applications, pp. 680–717. Woodhead Publishers,
Cambridge (2010)
Sarada, R., Pillai, M.G., Ravishankar, G.A.: Phycocyanin from Spirulina sp: influence of
processing of biomass on phycocyanin yield, analysis of efficacy of extraction methods and
stability studies on phycocyanin. Process Biochem. 34, 795–801 (1999)
Sekar, S., Chandramohan, M.: Phycobiliproteins as a commodity: trends in applied research,
patents and commercialization. J. Appl. Phycol. 20(2), 113–136 (2008)
Siegelman, H.W., Kycia, J.H.: Algal biliproteins. In: Hellebust J.A., Craigie J.S. (eds.) Handbook
of Phycological Methods, pp. 72–80. Cambridge University Press, Cambridge (1978)
Sant’ Anna, V., Marczak, L.D.F., Tessaro, I.C.: Membrane concentration of liquid foods by
forward osmosis: process and quality view, J. Food Eng. 111, 483–489 (2012)
Design and Fabrication of Miniature
Bubble Column Bioreactor for Plant
Cell Culture
K. Sandesh, P. Ujwal, Blecita D. Mascarenhas,

Gayatri Dhamannavar, Narmada Kumar and Dakshayini
1 Introduction
The bubble column bioreactor is an apparatus having its shape in the form of a
column. The aeration is introduced from the base of the column which keeps the
reaction medium in its mixed form (Deckwer and Schumpe 1993). The various
features like low capital costs, simple mechanical configurations, low energy
consumption and a minimum operational cost makes it an efficient system to be
implemented for any product operation (Betts et al. 2006).
Takayama and Misawa (1981) reported for the first time about the use of
bioreactor for micropropagation in Begonia. As in our traditional method, the task
of plant cell culture techniques (Bányai et al. 2003) requires many sensitive pro-
tocols and the maintenance of the entire propagation needs routine monitoring.
Considering the same, its specific that micropropagation by this technique is labour
intensive. Bioreactors based propagation can increase the multiplication rate, cul-
ture growth and space reduction (Karppinen et al. 2006). It minimizes the expen-
diture of energy and manual operational protocols in other commercial purposes.
These bioreactors can be a key step to produce secondary metabolites (Choi et al.
1990) in large scale through plant cell cultures, organ cultures and hairy root
cultures (Saurabh et al. 2002). Controlled production conditions, product yield
variations and high quality product can be maximized in these bioreactors thus
simplifying the various processes (Paek et al. 2005 and Ozlem et al. 2010).
In the present study, the bioreactor constructed provided optimum condition,
with respect to temperature, pH and basic function. The functional bioreactor after
K. Sandesh (&) P. Ujwal B.D. Mascarenhas G. Dhamannavar N. Kumar Dakshayini

Department of Biotechnology Engineering, NMAM Institute of Technology
(Affiliated to VTU Belgaum), Nitte, Karkala Taluk, Udupi, Karnataka, India
e-mail: sandeshk@nitte.edu.in

DOI 10.1007/978-981-10-1920-3_18
164 K. Sandesh et al.
construction was studied with the biomass of plant cell callus of Cichorium intybus
(Chicory). A batch wise operational mechanism was observed for a required period
of time and the yield of the cell mass was calculated.
2.1 Preparation of Callus
The explants from the C. intybus species was collected, surface sterilised and
cultivated in Murashige and Skoog (MS) semisolid medium supplemented with
1 g/L benzylaminopurine (BAP) and 1 g/L Naphthalene acetic acid
(NAA) (Nandagopal et al. 2007). The callus was grown in a span of 15–20 days.
The callus from the semi solid media was removed and finely chopped using
sterile knife in the laminar air flow. The Petri plate containing the callus was sealed
with paraffin tape and weighed. 2 g of this callus was inoculated into the shake flask
and bubble column bioreactor.
2.2 Shake Flask Study
The growth of C. intybus callus was carried out in 2 L conical flask kept in rotary
shaker under the source of light. Since the growth of callus differs from one flask to
another, scaling up becomes difficult. Thus to overcome this problem, inoculation
of the callus weighing 2 g was added to a 2 L of conical flask and kept in rotary
shaker. Contamination was observed after 2 days of inoculation.
2.3 Designing of Bubble Column Reactor
The reactor wall of the bubble column bioreactor was made of glass material with
the aspect ratio 2, the column length 22 cm and diameter 11 cm (Pirdashti and
Kompany 2009). The callus was held under suspension by continuously sparing the
sterile air through sparger consisting of evenly spaced 6 number of hole with
0.3 cm diameter at the bottom of the reactor (
Klass et al. 1991). The sterility of air was maintained by passing air through
0.45 μm filter (Fig. 1).
The content inside the bioreactor was autoclaved using electric heater. The
sample port was provided with plunger to draw the sample at different time
intervals. An outlet of 2 cm diameter was provided at the bottom of the reactor to
drain out the contents at the end of the batch. Necessary monitoring devices and
ports such as temperature, pH, light source, feed inlet and vent were provided on the
head plate. Light source required to maintain photoperiod of 16 h for the growth of
Design and Fabrication of Miniature Bubble Column Bioreactor … 165
Fig. 1 Bubble column

bioreactor setup
callus was provided by LED lights equipped with time controller mounted inside
the reactor head plate. It was set in such a way that the light was in ON mode for
16 h and in OFF mode for the next 8 h.
2.4 Parameter Estimation for Bubble Column Reactor
The calculation of Superficial gas velocity, circulation time and velocity of liquid at
the center of the column and hold up was done by using the Eqs. (1)–(4) (Klass
et al. 1991 and Bouaifi et al. 2001). The values obtained for the designed reactor
setup is listed in Table 1.
The tower diameter, Tv = 11 cm and Height Hv = 22 cm
Superficial Gas Velocity,
Q
c
Vgc ¼ ð1Þ
A
Liquid Velocity at the Centre of the Column,
c 0:33
Vlc ¼ 0:9ðg Tv Vgc Þ ð2Þ
Table 1 Parameter estimation for bubble column reactor

Volumetric Superficial gas Liquid Gas Circulation
flow rate velocity velocity hold time
c
Q, L/min Vgs m/s Vlc m/s up (s)
ε
Batch 1 3 1.18 0.97 0.67 2.28
Batch 2 2 0.79 0.85 0.51 2.61
Batch 3 1 0.39 0.68 0.31 3.28
Circulation Time, when Hv > Tv,
HV c 2 0:33
tc ¼ 11 ðg Vgc TV Þ ð3Þ
TV
Gas Hold Up for heterogeneous, When db = 3 mm

Hold up,
c 0:7
e ¼ 0:6ðVgc Þ ð4Þ
2.5 Bubble Column Study
The 2L volume of media was fed into the bubble column bioreactor. The media was
autoclaved at 120 °C (Nandagopal et al. 2007). Once the media was cooled to room
temperature 2 g of callus was inoculated into bioreactor by opening the butterfly
valve at the top of the head plate. The sterile oxygen required for the growth of
callus was supplied through the sparger and air flow rates were regulated by control
valve. The experiment was carried out in 3 batches by varying the volumetric flow
rate (Q) of air.
3.1 Shake Flask Study
In shake flask study the callus was inoculated to grow for 15 days. At the end of
15 days, C. intybus callus grown conical flask showed the maximum increase in
biomass of 2 g in MS suspension media, with partial contamination 30–40 % of the
flasks in every batch. The yield obtained in shake flask is shown in Fig. 2. Thus the
mass of culture enhancement was drastically slow and no further growths of cells
were observed in these flasks.
Fig. 2 Mass of callus grown

in shake flask study
3.2 Reactor Study
A Preliminary study was carried out using callus cells in the bioreactor for deter-
mining the total biomass. As there are no much existing reports available with the
study of bubble column bioreactors with the use of cell culture biomass. In the
present investigation the experiment was carried out in 3 batches. In each batch the
growth was efficient in bubble column bioreactor, since it provided all necessary
conditions for the growth of plant cell and maintenance of sterility. As shown in
Fig. 3 at the end of 15 days, the callus grown in 2 L bioreactor showed a maximum
increase of 6.26 g in MS suspension media.
The yield obtained in batch 1, was comparatively less when compared to batch 2
and batch 3 in the reactor. The reason behind this could be the high air flow rate
which resulted in foaming. Initially the air flow rate was maintained at 3 L/min
which resulted in vigorous agitation and thus rupturing of callus. The initial flow
Fig. 3 Mass of callus in

bubble column bioreactor
rate of 3 L/min resulted in foaming. This was observed after 8 days of inoculation.
Due to agitation or fermentation an accumulation of fine frothy bubbles were
formed surrounding the surface of the liquid. In the work done by Ozturk et al.
(1987) on Atropa belladonna, the development of foam and maintenance of sta-
bility was investigated as a main function of culture conditions (Hyndman et al.
1997). In determining the total volume of foam, the rate of air flow was found to be
of major importance and thus the highest foam levels were measured 11 days after
inoculation (Behkish et al. 2002).
4 Conclusion
In the present study the construction of bubble column bioreactor for the production
of commercially valuable secondary metabolite in vitro was discussed. Also, the
observation of sterile environment without any contamination till 15 days with
growth yield inside the reactor was a remarkable observation. The growth of callus
was found to be 6.26 g/L, when compared to shake flask 2.58 g/L. This could prove
that these bioreactors have a tremendous potential for the commercial scale syn-
thesis of plant cell culture and their necessary metabolites. The metabolite pro-
duction by plants cell, various characteristic features and configuration of the
designed reactor contributes to the economic feasibility of the process. Though a
single plant cell is used for the production of a single product, the flexible design,
different flow materials with necessary aeration requirements is a need of concern.
The successful exploitation of any plant cell used in suspension cell cultures will
depend on multidisciplinary approaches of the plant morphogenesis.
The physical as well as chemical environment with the growth of cell biomass
and controlled conditions need to be further investigated. The different chemical
composition in the growth media, growth promoting regulators also need to be
further studied in detail which plays a crucial role in accompanying the physical
conditions. Though the efficiency of plant cell cultures is studied by few
researchers, there exists few problems with the scale up processes and its rela-
tionships with different plant cells. However, the broad advantage with the use of
these types of bioreactors is its high efficiency and its ease of operation. This could
be of significant challenge to the process engineers for designing the bioreactors
with all relevant invitro environment conditions in the bioreactors for the purpose of
plant cell cultures.
Acknowledgments The authors would like to express their sincere thanks to Dr. C. Vaman Rao,
HOD, Department of Biotechnology, for the necessary guidance. Due thanks are to the Principal,
NMAMIT, Nitte for supporting with the department facilities.
References
Bányai, P., Bálványos, I., Kursinszki, L., Szöke, E.: Cultivation of Lobelia inflata L. Hairy Root
culture in bioreactor. Acta Hortic. 597, 253–256 (2003)
Behkish, A., Men, Z., Inga, R.J., Morsi, B.I.: Mass transfer characteristics in a large-scale slurry
bubble column reactor with organic liquid mixtures. Chem. Eng. Sci. 57(16), 3307–3324
(2002)
Betts, J., Baganz, F.: Miniature bioreactors: current practices and future opportunities. Microb.
Cell Fact. 5(21), 1–14 (2006)
Bouaifi, M., Hebrard, G., Bastoul, D., Roustan, M.: A comparative study of gas holdup, bubble
size, interfacial area and mass transfer coefficients in stirred gas–liquid reactors and bubble
columns. Chem. Eng. Process 40(2), 97–111 (2001)
Choi, K.T., Park, J.C., Ahn, I.O.: Saponin production in tissue culture of ginseng (Panax ginseng
C. A. Meyer). J. Ginseng Res. 14(2), 107–111 (1990)
Deckwer, W.D., Schumpe, A.: Improved tools for bubble column reactor design and scale-up.
Chem. Eng. Sci. 48(5), 889–911 (1993)
Hyndman, C.L., Larachi, F., Guy, C.: Understanding gas-phase hydrodynamics in bubble
columns: a convective model based on kinetic. Chem. Eng. Sci. 52(1), 63–77 (1997)
Karppinen, K., Hohtola, A., Gyorgy, Z., Neubauer, P., Tolonen, A., Jalonen, J.: Comparison of
growth and secondary metabolite accumulation in cultures of compact callus aggregates and
shoots of Hypericum perforatum L. in shake flask and bubble column bioreactor. Acta Hortic.
725, 605–612 (2006)
Klaas, V.R., Johannes, T.: Basics of Bioreactor Design, pp. 197–199. Marcel Dekker Inc., New
York (1991)
Nandagopal, S., Ranjitha, K.B.D.: Phytochemical and antibacterial studies of Chicory (C. Intybus.
L.) a multipurpose medicinal plant. Adv. Biol. Res. 1(1–2), 17–21 (2007)
Ozlem, Y.C., Aynur, G., Fazilet, V.S.: Large Scale Cultivation of Plant Cell and Tissue Culture in
Bioreactors, pp. 1–54. Transworld Research Network Kerala (2010)
Ozturk, S.S., Schumpe, A., Deckwer, W.D.: Organic liquids in a bubble column: holdups and
mass transfer coefficients. Am. Inst. Chem. Eng. 33(9), 1473–1480 (1987)
Paek, K., Chakrabarty, D., Hahn, E.: Application of bioreactor systems for large scale production
of horticultural and medicinal plants. In: Liquid Culture Systems for in vitro Plant Propagation,
pp. 95–116. Springer link (2005)
Pirdashti, M., Kompany, R.: Effects of height to diameter ratio and aeration rate on liquid mixing
and hydrodynamic properties in a bubble column. Iran. J. Chem. Eng. 6(3), 46–52 (2009)
Saurabh, C., Sunita, F., Ashok, K.S., Virendra, S.B.: Bioprocess considerations for production of
secondary metabolites by plant cell suspension cultures. Biotechnol. Bioprocess Eng. 7,
138–149 (2002)
Takayama, S., Misawa, M.: Mass propagation of Begonia hiemalis plantlets by shake culture.
Plant Cell Physiol. 22, 461–467 (1981)
Industrial Applications of Caffeine
Degradation by Pseudomonas sp.
Swati Sucharita Dash, Sree Ahila Retnadhas, Nameeta Rao

and Sathyanarayana N. Gummadi
1 Introduction
Coffee and tea are the major drinks which people consume throughout the world and
they are also the rich source of caffeine, a purine alkaloid naturally present in tea
leaves, coffee beans, cocoa beans, cola nuts and many other plants. Caffeine acts as a
vasoconstrictor, diurant and central nervous system stimulant (Kalmar and Cafarelli
1999). Acute intake of caffeine is known to cause osteoporosis (Rapuri et al. 2001),
pregnancy complications (Kuczkowski 2009) and many types of cancers (Slattery
et al. 1990). Also, industries like coffee and tea processing industries which use
caffeine rich starting materials release a large amount of solid and liquid wastes
which are rich in caffeine. Solid wastes like coffee husks and coffee affect soil
fertility and microbial growth (Friedman and Waller 1983). Caffeine in liquid
effluents when released into surrounding waterbodies alters water eco-system and
contaminates surface water and ground water (Glassmeyer and Shoemaker 2005).
Caffeine in the effluents make the environment for biological degradation of other
organic components very difficult as caffeine is toxic to majority of the microbial
species. Removing caffeine from food products and industrial wastes thus becomes
very vital for environmental and health safety (Dash and Gummadi 2006).
Conventional methods of caffeine removal include solvent extraction procedures
where toxic solvents like ethylacetate, dichloromethane and trichloroethylene are
used (Gokulakrishnan et al. 2005). In many developed countries, solvent extraction
was replaced by non-toxic and safer supercritical CO2 extractions but the process is
Swati Sucharita Dash and Sree Ahila Retnadhas have contributed equally to the work presented
here.
S.S. Dash S.A. Retnadhas N. Rao S.N. Gummadi (&)

Department of Biotechnology, Bhupat and Jyoti Mehta School of Biosciences,
IIT Madras, Chennai, India
e-mail: gummadi@iitm.ac.in

DOI 10.1007/978-981-10-1920-3_19
172 S.S. Dash et al.
expensive. These methods are also non-specific as they remove the flavour of food
products thereby necessitating the need to add chemically synthesized flavouring
compounds. Biological methods offer a cheaper and safer alternative for conven-
tional decaffeination (Dash and Gummadi 2006). A Pseudomonas sp. isolated from
coffee plantation soil was shown to grow on caffeine as its only source of energy,
utilizing as high as 20 g/l caffeine completely within 120 h (Gummadi and
Santhosh 2010). It has been reported that caffeine and its metabolites degrading
enzymes are inducible (Dash and Gummadi 2008). In this study, we have used
induced cells of Pseudomonas sp. and devised decaffeination techniques for caf-
feine removal from industrial effluents and black tea.
2.1 Materials and Microorganism
Effluent was obtained from Tata Coffee’s Instant Coffee Division, Theni Unit,
India. Liquid effluent after removing solid contents was used for effluent decaf-
feination experiments. AVT black tea powder was used for the black tea decaf-
feination experiments. Pseudomonas sp. used in this study was isolated in our lab
and was maintained on CAS agar medium (Dash and Gummadi 2008). Induced
cells were prepared by inoculating three loops full of actively growing cells in
25 ml nutrient broth (NB) and incubated at 30 °C and 180 rpm. Once A600 reaches
1.2–1.4, production media (CAS media) (Gummadi et al. 2009) was inoculated
with 6 % seed culture (NB) and incubated at 30 °C and 180 rpm till 90–95 % of
initial caffeine gets degraded. Cells were then harvested by spinning at 10,000 rpm,
4 °C for 5 min under sterile conditions.
2.2 Degradation of Caffeine in Liquid Effluent

from Instant Coffee Manufacturing Unit
Induced cells were washed with 10 mM potassium phosphate buffer pH 7.0 and
they were inoculated in the effluent so as to get different cell concentrations (0.5–
8 g/l) and incubated at 30 °C and 180 rpm. Samples were collected at regular
intervals for biomass growth and caffeine degradation. The same experiments were
repeated in another batch with pH of the effluent adjusted to 7.8. Induced cells of
Pseudomonas sp. were immobilized as described earlier (Gummadi et al. 2009) in
various immobilization matrices like sodium alginate, agar-agar and agarose to a
final concentration of 8 g/l of induced cells in the respective matrix solution. 6 and
18 % of beads (v/v) were inoculated in pH adjusted (7.8) effluent and incubated at
30 °C 180 rpm. Samples were taken at regular intervals and caffeine concentration
was estimated. Re-usability of the beads was tested for 3 times.
Industrial Applications of Caffeine Degradation … 173
2.3 Degradation of Caffeine in Black Tea Powder

by Induced Cells of Pseudomonas sp.
Commercially available AVT black tea powder was used for all the decaffeination
experiments. Induced cells of Pseudomonas sp. were suspended in 10 mM potas-
sium phosphate buffer, pH 8.0 to get final concentrations of 50–600 g/l. These
induced cells at various concentrations were added to black tea in the ratio 1:1 (v/w)
to get concentrations of 0.05–0.6 g cells/g tea and was incubated at 30 °C for 2.5 h
after proper mixing. After incubation, tea-bacteria mixture was subjected to 70 °C
for 10 min to heat inactivate the bacterial cells. Caffeine and polyphenol contents
were then estimated after it was dried at room temperature for 16 h. After selecting
an optimum cell concentration, incubation time of tea-bacteria was optimized.
2.4 Sequential Treatment of Black Tea Powder

with Induced Cells of Pseudomonas sp.
After incubation of tea-bacteria mixture at 30 °C for 2.5 h, the cells were heat
inactivated at 70 °C for 10 min and then they were cooled before adding the next
batch of fresh induced cells in the same 1:1 ratio. After 2.5 h incubation at 30 °C,
again the process of heat inactivation and addition of fresh batch of cells were
continued for 3 cycles totally. After 3 cycles, the mixture was dried at room
temperature for 16 h before estimating polyphenols and caffeine content.
2.5 Analytical Procedures
Caffeine was estimated at 254 nm by HPLC using C-18 column as stationary phase
and 30 % methanol as mobile phase. Polyphenols in black tea were estimated by
following the protocol discussed by Someswararao et al. (2013). Extraction of
caffeine from black tea was done following an ISO 20481 (2008) method.
3.1 Degradation of Caffeine in Liquid Effluent from Instant

Coffee Manufacturing Unit by Induced Cells
Effluent was found to be acidic with pH 4.8 and initial caffeine concentration before
inoculation with Pseudomonas sp. was 110 mg/l. At native pH, only 8 g/l of
induced cells were able to degrade caffeine completely in 1 h and at concentrations
less than 8 g/l (Fig. 1a). This shows the toxicity of acidic pH for the survival of
Pseudomonas sp. However, when the pH of effluent was adjusted to 7.8 which is
the optimum pH for Pseudomonas sp. to degrade caffeine (Dash and Gummadi
2007), even 0.5 g/l of induced cells were enough to completely degrade caffeine
within half an hour. As the concentration of induced cells increases, caffeine
degradation rates were also increased. At 8 g/l of induced cells, complete caffeine
degradation was obtained within 30 min (Fig. 1b).
3.2 Degradation of Caffeine in Liquid Effluent from Instant

Coffee Manufacturing Unit by Immobilized Cells
Different matrices were used to immobilize induced cells of Pseudomonas

sp. Induced cells were immobilized at 8 g/l concentration in all the three matrices.
Initially 6 % (v/v) of the immobilized beads were added to the effluent. It was
observed that 14, 33.5 and 38 % degradation of caffeine was achieved at the end of
4 h in agar-agar, agarose and calcium alginate respectively (Fig. 1c). After 3 h
when 18 % inoculum was used, 70 and 82 % degradation of caffeine was observed
in agar-agar and agarose respectively, while the maximum degradation of 93 % was
detected in calcium alginate (Fig. 1d). Out of three matrices used, calcium alginate
was found to be more effective in retaining caffeine degrading ability of induced
Pseudomonas sp. When 18 % inoculums was used, it was able to degrade almost
95 % of caffeine in 3 h. These calcium alginate beads were also re-usable as the
efficiency in degrading caffeine was not reduced even after three runs (Fig. 1e) and
no cell leaching was observed.
3.3 Degradation of Caffeine in Black Tea Powder

by Induced Cells of Pseudomonas sp.
HPLC analysis of the black tea extract showed concentration of caffeine to be

122.45 mg/L. This constitutes 3.67 % dry weight of tea which correlates with the
standard value of caffeine which is 3–4 % of the tea dry weight (Goto et al. 1996).
Tea samples were treated with bacterial cells at concentrations ranging from 0.05 to
0.6 g cells/g tea for 2.5 h. At cell concentration of 0.05 g/g tea, the amount of
caffeine removed was as low as 6 % but increased to 17 % with increase in cell
concentration to 0.15 g/g tea (Fig. 2a). However, further increase in the cell loading
(up to 0.6 g cells/g tea) did not enhance the amount of caffeine degraded. Hence,
cell loading of 0.15 g cell/g tea was found to be optimum for caffeine removal in
tea. Theaflavin level was found to be reduced at all cell concentrations when
compared to untreated tea. A proportionate increase in total liquor colour was seen
with increase in cell loading. At 0.15 g cell/g tea, there was no significant reduction
Fig. 1 Degradation of caffeine in coffee industry effluent by induced cells of Pseudomonas

sp. Caffeine degradation profile by various concentrations of induced Pseudomonas sp. in effluent
at a degradation at its native pH, b degradation at pH adjusted to 7.8. Degradation of caffeine in
coffee industry effluent by induced Pseudomonas sp. immobilized in various immobilization
matrices at a concentration of c 6 % (v/v) immobilized beads, d 18 % (v/v) immobilized beads,
e re-usability of induced cells immobilized in calcium alginate beads
Fig. 2 Degradation of caffeine in commercially available tea samples using induced

Pseudomonas sp. Effect of various cell concentrations on a caffeine content, b polyphenolic
content of black tea samples. Effect of incubation period of induced cells with black tea on
c caffeine content, and d polyphenolic content of black tea. Effect of sequential addition of induced
cells to black tea samples on e caffeine content, and f polyphenolic content
in polyphenolic contents other than theaflavin (Fig. 2b). Initial cell loading was
then fixed at 0.15 g cells/g tea.
Upon incubating tea-bacteria mixture for different time intervals, it was observed
that the percent age of degradation increased with increase in incubation time and
22 % degradation of caffeine was achieved in 2.5 h. Maximum degradation of 33.7 %

was obtained at an incubation time of 5 h (Fig. 2c). Polyphenol content analysis
shows that there was no significant change in polyphenol content compared to
untreated tea (Fig. 2d). It was also noted that the total liquor colour increases with time
probably because of oxidation of polyphenols (Smith 2002). Since the percentage of
increase in caffeine degradation from 2.5 to 5 h was not high and also to avoid more
polyphenol oxidation, 2.5 h was chosen for further experiments.
3.4 Sequential Treatment of Black Tea with Induced Cells

of Pseudomonas sp.
In an attempt to increase caffeine removal from tea, sequential bacterial treatment of

tea sample was adopted. Addition of fresh cells at 0.15 g cells/g tea after 2.5 h was
found to enhance caffeine degradation process. After three additions of fresh cells,
83 % of caffeine degradation was obtained (Fig. 2e). In order to detect differences
between sequential bacterial treatment and one time treatment, tea samples were
treated with cell concentration of 0.45 g/g tea, which added up to the amount of
cells used for 3 sequential additions, and incubated at a stretch for 7.5 h. However,
only 5.5 % caffeine removal was obtained on single treatment. Polyphenol analysis
shows that total liquor colour and highly polymerized substances increased whereas
theaflavin decreased significantly in the sequentially treated tea (Fig. 2f).
4 Conclusions
Biological decaffeination techniques can effectively overcome the disadvantages

caused by conventional decaffeination techniques (Gokulakrishnan et al. 2005).
This study has shown that Pseudomonas sp. is an efficient candidate for develop-
ment of biological decaffeination techniques. Immobilization of induced cells
protects them from other toxic compounds in the effluents and they are reusable
thereby offer a better alternative than free cells (Aksu and Bülbül 1999). Even
though induced cells were able to degrade caffeine from black tea with very less
change in polyphenolic content, using whole bacterial cells to degrade caffeine in
food products like tea powder is unsafe. Application of purified caffeine metabo-
lizing enzyme from Pseudomonas sp. for decaffeinating food products is a better
alternative which can be studied in future. Thus, this study encourages the use of
safer and effective biological decaffeination techniques to be used in industries.
Acknowledgments The authors acknowledge the Department of Biotechnology (DBT), India

and the Department of Science and Technology (DST), India for funding the research work
described in this paper. SR also acknowledges University Grant Commission (UGC) for
fellowship.
References
Aksu, Z., Bülbül, G.: Determination of the effective diffusion coefficient of phenol in
Ca-alginate-immobilized P. putida beads. Enzyme Microb. Technol. 25, 344–348 (1999)
Dash, S.S., Gummadi, S.N.: Catabolic pathways and biotechnological applications of microbial
caffeine degradation. Biotechnol. Lett. 28, 1993–2002 (2006)
Dash, S.S., Gummadi, S.N.: Optimization of physical parameters for biodegradation of caffeine by
Pseudomonas sp.: a statistical approach. Am. J. Food Technol. 2, 21–29 (2007)
Dash, S.S., Gummadi, S.N.: Inducible nature of the enzymes involved in catabolism of caffeine
and related methylxanthines. J. Basic Microbiol. 48, 227–233 (2008)
Friedman, J., Waller, G.R.: Caffeine hazards and their prevention in germinating seeds of coffee
(Coffea arabica L.). J. Chem. Ecol. 9, 1099–1106 (1983)
Glassmeyer, S.T., Shoemaker, J.A.: Effects of chlorination on the persistence of pharmaceuticals in
the environment. Bull. Environ. Contam. Toxicol. 74, 24–31 (2005)
Gokulakrishnan, S., Chandraraj, K., Gummadi, S.N.: Microbial and enzymatic methods for the
removal of caffeine. Enzyme Microb. Technol. 37, 225–232 (2005)
Goto, T., Yoshida, Y., Kiso, M., Nagashima, H.: Simultaneous analysis of individual catechins
and caffeine in green tea. J. Chromatogr. A 749, 295–299 (1996)
Gummadi, S.N., Santhosh, D.: Kinetics of growth and caffeine demethylase production of
Pseudomonas sp. in bioreactor. J. Ind. Microbiol. Biotechnol. 37, 901–908 (2010)
Gummadi, S.N., Ganesh, K.B., Santhosh, D.: Enhanced degradation of caffeine by immobilized
cells of Pseudomonas sp. in agar-agar matrix using statistical approach. Biochem. Eng. J. 44,
136–141 (2009)
Kalmar, J.M., Cafarelli, E.: Effects of caffeine on neuromuscular function. J. Appl. Physiol. 87,
801–808 (1999)
Kuczkowski, K.M.: Caffeine in pregnancy. Arch. Gynecol. Obstet. 280, 695–698 (2009)
Rapuri, P.B., Gallagher, J.C., Kinyamu, H.K., Ryschon, K.L.: Caffeine intake increases the rate of
bone loss in elderly women and interacts with vitamin D receptor genotypes. Am. J. Clin. Nutr.
74, 694–700 (2001)
Slattery, M.L., West, D.W., Robison, L.M., French, T.K., Ford, M.H., Schuman, K.L., Sorenson,
A.W.: Tobacco, alcohol, coffee, and caffeine as risk factors for colon cancer in a low-risk
population. Epidemiology 1(2), 141–145 (1990)
Smith, A.: Effects of caffeine on human behavior. Food Chem. Toxicol. 40, 1243–1255 (2002)
Someswararao, C., Srivastav, P.P., Das, H.: Quality of black teas in Indian market. Afr. J. Agric.
Res. 8, 491–494 (2013)
Highly Sensitive Determination
of Ascorbic Acid, Dopamine
and Uric Acid Using Mesoporous
Nitrogen Containing Carbon
Anju Joshi and C.N. Tharamani
1 Introduction
Ascorbic Acid (AA), dopamine (DA), and uric Acid (UA) are physiologically
essential biomolecules involved in maintenance of metabolism, central nervous
system and circulation system of human body. However slight change of their
concentration in extracellular fluid represent an alarming situation for a wide variety
of neurodegenerative diseases, scurvy, gout, and hyperuricemia. Hence simulta-
neous determination of these biomolecules is of utmost importance in the field of
neurochemistry, clinical diagnostics and medical applications (Mo and Ogorevc
2001).
All of these biomolecules are electroactive in nature making electrochemical
determination a most convenient choice for their determination. But simultaneous
determination of these biomolecules is generally hampered by the drawbacks like
fouling of electrode, closely spaced oxidation potentials and homogeneous elec-
trocatalytic oxidation of AA by the oxidation products of dopamine. Therefore
suitable electrocatalyst materials are generally in great demand to modify the sur-
face of GCE and enable highly sensitive and selective determination of these
biomolecules. As compared with metal nanoparticles (Wang et al. 2012), polymers
(Ensafi et al. 2010), polymers composite (Liu et al. 2007), carbonaceous material
have drawn considerable attention because of their wide electrochemical window,
low cost, and consistent mass scale production. As a result, more and more efforts
are targeted towards development of novel carbonaceous material with tunable
properties to impart novel characteristics features.
A. Joshi (&) C.N. Tharamani

Department of Chemistry, Indian Institute of Technology Ropar,
Rupnagar 140001, Punjab, India
e-mail: anju.joshi@iitrpr.ac.in

DOI 10.1007/978-981-10-1920-3_20
180 A. Joshi and C.N. Tharamani
Fig. 1 Schematic representation of the electrooxidation process of AA, DA and UA using MNC
modified sensor
Motivated by this fact, we here propose to synthesize novel mesoporous nitrogen

containing carbon as an active catalyst material possessing graphitic structure and
porous nature with multiple nitrogen containing groups enabling (Fig. 1).
2 Experimental Section
2.1 Chemicals
Ascorbic acid, dopamine hydrochloride, uric acid, Nafion and KCl. Phosphate
buffer solutions (PBS 0.1 M) were prepared from stock solution of 0.1 M KH2PO4
and 0.1 M K2HPO4. All aqueous solutions were prepared with deionized water
from a Millipore system (>10 MΩ cm−1).
2.2 Synthesis of MNC
For synthesis of mesoporous carbon (MNC), SBA-15 was utilized as a hard tem-
plate as previously reported (Vinu et al. 2007; Vinu 2008). Pyrolyzing the
Highly Sensitive Determination of Ascorbic Acid, Dopamine and Uric Acid … 181
polymerized ethylenediamine nanocasted into a SBA-15 hard template at 600 °C

results into MNC-600. The synthesized material was characterized using scanning
electron microscopy (SEM, JEOL, JSM-6610l V) and XRD (PANalytical,
X’Pert-Pro MPD).
2.3 Sample Preparation and Electrochemical Investigation
In order to undergo electrochemical investigation glassy carbon electrode was cleaned

sequentially with alumina slurry of 3, 1, 0.3, 0.05 µm, respectively using Nylon
polishing cloth (SM 407052, AKPOLISH). Since the oxidation of these biomolecules
is a proton dependent process. Hence pH of the buffer solution plays an important role
in driving the electrocatalytic oxidation process of AA, DA and UA. pH 6.0 was
chosen on the basis of linear sweep voltammetry studies conducted at different pH
buffers for further experiments. The amount of catalyst was optimized to achieve
maximum sensitivity for the oxidation of AA, DA and UA by carrying out linear
sweep voltammetry as shown in Fig. 2 in a solution containing 500 µM ascorbic acid
with varying concentration of catalyst dropcasted on to the surface of GCE.
3.1 Electrochemical Determination of AA, DA and UA
Preliminary investigations were carried out to identify the potential of MNC-600

towards electrocatalytic oxidation of AA, DA and UA. For this purpose, cyclic
Fig. 2 Optimization of
amount of MNC-600 catalyst
dropcasted on to the surface
of GCE using linear sweep
voltammetry (LSV)
Fig. 3 Cyclic voltammetric

studies at a bare GCE,
b MNC-600/GCE in 0.1 M
PBS (pH 6.0) solution
containing 1 mM AA, 25 µM
DA, 100 µM UA at a scan
rate of 5 mV s−1, CE: Pt wire,
RE: Ag/AgCl/3M KCl
voltammetry (CV) was conducted in a mixture containing 1 mM AA, 25 μM DA

and 100 μM UA at different modified surfaces (Fig. 3). CV studies shows three
well separated peaks at a potentials of 49, 279 and 389 mV corresponding to
electrooxidation of AA, DA and UA respectively for MNC-600/GCE which sug-
gests that MNC-600 possess high sensitivity towards determination of AA, DA and
UA with enhanced peak current and wide peak separation between oxidation
potentials of analyte molecules (AA-DA and DA-UA).
Peak corresponding to AA results due to the conversion of hydroxyl group to a
carbonyl group in the furan ring of AA whereas well defined redox peaks corre-
sponds to the conversion of dopamine to dopaminoquinone (Kalimuthu et al. 2009).
Similar to DA, UA also shows a well-defined oxidation peak due to the conversion
of UA into quinonoid, followed by a fast electrochemical (EC) reaction (Safavi
et al. 2006).
Compared to MNC-600/GCE, bare GCE shows a broadened response at a
potential of 306 mV with a shoulder at about 420 mV which suggests a sluggish
electron transfer kinetics (Stergiou et al. 2010) with concomitant fouling of the
electrode surface due to formation of polymerized oxidation products onto the
surface of GCE (Ping et al. 2012). The above mentioned remarkably high elec-
trocatalytic activity of MNC-600 material can be ascribed to the presence of
numerous nitrogen containing groups (Sheng et al. 2012) and highly porous nature
of MNC material.
To gain insights into the mechanism towards electro-oxidation process, cyclic
voltammetric studies were conducted at varying scan rates (5–100 mV/s) for
individual biomolecule. A continuos increase in peak current with increase in scan
rate is observable for all biomolecule as shown in Fig. 4 which suggests the
electrooxidation process to be diffusion controlled (Yuan et al. 2012).
Fig. 4 Cyclic voltammograms of a MNC-600 modified GCE in 0.1 M PBS (pH 6.0) solution
containing a 500 µM, b 25 µM, c 40 µM UA at various scan rates ranging from 5 to 100 mV s−1
To explore the potential of MNC-600 towards sensitive and selective determi-

nation of AA, DA and UA linear sweep voltammetry was employed at variable
concentration of concerned biomolecule while keeping the concentration of other
two biomolecules at constant. It is quite clear from Fig. 5 that there is a sequential
increase in peak current with subsequent increase in concentration of the concerned
biomolecule while peak current of other two biomolecule remains constant.
The linear range for simultaneous determination was evaluated out to be 0.01–
500 μM, 0.001–50 μM, 0.01–200 μM. Both MNC material possess excellent
sensitivity towards simultaneous determination of ascorbic acid, dopamine and uric
Fig. 5 Linear sweep voltammograms over MNC-600 in 0.1 M PBS (pH 6.0) solution containing
(a) 1 µM DA and 1 µM UA and different concentrations of AA ranging from 0.01 to 500 µM,
(b) 100 µM AA and 1 µM UA and different concentrations of DA ranging from 0.001 to 50 µM,
(c) 1 µM DA and 100 µM AA and different concentrations of UA ranging from 0.01 to 200 µM at
a frequency of 15 Hz, step potential 0.3 mV, pulse amplitude 25 mV, scan rate 5 mV s−1, CE: Pt
wire, RE: Ag/AgCl/3M KCl
acid. Moreover, peak separation remains sufficient to study the analyte of interest in
presence of coexisting biomolecules. Furthermore, lowest detection limit and
detection range obtained for the simultaneous determination of AA, DA and UA
using MNC-600/GCE has been compared with existing literature which is men-
tioned in Table 1. It is quite clear from Table 1 that MNC-600 possess high sen-
sitivity towards simultaneous determination of AA, DA and UA.
Table 1 Comparison of the electrocatalytic activity for the simultaneous detection of

biomolecules over different electrodes
Electrode material Linear range (µM) Detection limit (µM) Reference
AA DA UA AA DA UA
Palladium 50– 0.5– 2– 15 0.2 0.7 Huang
nanoparticle-loaded 4000 160 200 et al.
carbon nanofibers (2008)
modified carbon
paste electrode
N-doped graphene 5– 0.5– 0.1– 2.2 0.25 0.045 Sheng
1300 170 20 et al.
(2012)
Multiwall carbon 15– 0.5– 0.55– 7.71 0.31 0.42 Habibi
nanotubes 800 100 90 et al.
(MWCNT) (2010)
modified
carbon-ceramic
electrode
Mesoporous carbon 100– 0.05– 0.5– 50 0.02 0.2 Yue et al.
nanofiber-modified 10,000 30 120 (2012)
pyrolytic graphite
electrode
Mesoporous 1– 0.001– 0.01– 1 0.001 0.01 This
nitrogen rich 2000 400 1500 work
carbon/GCE
4 Conclusion
MNC-600 material possess excellent sensitivity towards determination of ascorbic

acid, dopamine and uric acid due to their high surface area and N-content in the
carbon material. MNC-600 modified electrodes show well separated potentials for
the oxidation of AA, DA and UA, suggesting the applicability of these materials for
simultaneous determination of these analytes with enhanced selectivity and sensi-
tivity. These favourable features depict promising ability of MNC catalyst modified
electrodes for the simultaneous determination of AA, DA and UA.
References
Ensafi, A.A., Taei, M., Khayamian, T.: Simultaneous determination of ascorbic acid, dopamine,
and uric acid by differential pulse voltammetry using tiron modified glassy carbon electrode.
Int. J. Electrochem. Sci. 5, 116–130 (2010)
Habibi, B., Pournaghi-Azar, M.H.: Simultaneous determination of ascorbic acid, dopamine and
uric acid by use of a MWCNT modified carbon-ceramic electrode and differential pulse
voltammetry. Electrochim. Acta 55, 5492–5498 (2010)
Huang, J., Liu, Y., Hou, H., You, T.: Simultaneous electrochemical determination of dopamine,
uric acid and ascorbic acid using palladium nanoparticle-loaded carbon nanofibers modified
electrode. Biosens. Bioelectron. 24, 632–637 (2008)
Kalimuthu, P., John, S.A.: Modification of electrodes with nanostructured functionalized
thiadiazole polymer film and its application to the determination of ascorbic acid.
Electrochim. Acta 55, 183–189 (2009)
Liu, A., Honma, I., Zhou, H.: Simultaneous voltammetric detection of dopamine and uric acid at
their physiological level in the presence of ascorbic acid using poly (acrylic acid)-multiwalled
carbon-nanotube composite-covered glassy-carbon electrode. Biosens. Bioelectron. 23(1),
74–80 (2007)
Mo, J.-W., Ogorevc, B.: Simultaneous measurement of dopamine and ascorbate at their
physiological levels using voltammetric microprobe based on overoxidized poly
(1,2-phenylenediamine)-coated carbon fiber. Anal. Chem. 73, 1196–1202 (2001)
Ping, J., Wu, J., Wang, Y., Ying, Y.: Simultaneous determination of ascorbic acid, dopamine and
uric acid using high-performance screen-printed graphene electrode. Biosens. Bioelectron. 34,
70–76 (2012)
Safavi, A., Maleki, N., Moradlou, O., Tajabadi, F.: Simultaneous determination of dopamine,
ascorbic acid, and uric acid using carbon ionic liquid electrode. Anal. Biochem. 359, 224–229
(2006)
Sheng, Z.H., Zheng, X.Q., Xu, J.Y., Bao, W.J., Wang, F.B., Xia, X.H.: Electrochemical sensor
based on nitrogen doped graphene: simultaneous determination of ascorbic acid, dopamine and
uric acid. Biosens. Bioelectron. 34(1), 125–131 (2012)
Stergiou, D.V., Diamanti, E.K., Gournis, D., Prodromidis, M.I.: Comparative study of different
types of graphenes as electrocatalysts for ascorbic acid. Electrochem. Commun. 12, 1307–1309
(2010)
Vinu, A.: Two-dimensional hexagonally-ordered mesoporous carbon nitrides with tunable pore
diameter, surface area and nitrogen content. Adv. Funct. Mater. 18(5), 816–827 (2008)
Vinu, A., Srinivasu, P., Sawant, D.P., Mori, T., Ariga, K., Chang, J.S., Hwang, Y.K.:
Three-dimensional cage type mesoporous CN-based hybrid material with very high surface
area and pore volume. Chem. Mater. 19(17), 4367–4372 (2007)
Wang, C., Yuan, R., Chai, Y., Chen, S., Hu, F., Zhang, M.: Simultaneous determination of
ascorbic acid, dopamine, uric acid and tryptophan on gold
nanoparticles/overoxidized-polyimidazole composite modified glassy carbon electrode. Anal.
Chim. Acta 741, 15–20 (2012)
Yuan, D., Yuan, X., Zhou, S., Zou, W., Zhou, T.: N-Doped carbon nanorods as ultrasensitive
electrochemical sensors for the determination of dopamine. RSC Adv. 2, 8157–8163 (2012)
Yue, Y., Hu, G., Zheng, M., Guo, Y., Cao, J., Shao, S.: A mesoporous carbon nanofiber-modified
pyrolytic graphite electrode used for the simultaneous determination of dopamine, uric acid,
and ascorbic acid. Carbon 50, 107–114 (2012)
Nano-aptamer Based Quantitative
Detection of Chloramphenicol
Richa Sharma, K.V. Ragavan, K.S.M.S. Raghavarao and M.S. Thakur
1 Introduction
Chloramphenicol is a highly-effective antibiotic used widely in the treatment of

animals. However, prolonged intake of CAP is associated with aplastic anaemia
(AA) and bone marrow suppression in humans with percent mortality of 40–50 %
(Shukla et al. 2011). Most countries, including India, have prohibited usage of CAP
in production of animal food (Food Safety and Standards Regulations 2011) while
maximal permissible levels is 0.3 parts per billion (ppb) in milk (Vora and Raikwar
2013). However, in recent years traces of it have been detected in milk, honey,
shrimp and other aquaculture products raising serious concerns about health of
consumers and the export of antibiotic-containing honey from India (Shukla et al.
2011; Islam et al. 2014).
Most available assays are based on antibodies employing conjugated enzymes.
These assays, though sensitive, suffer from issues such as adjuvant addition, high
cost, cumbersome and time-consuming primary and secondary antibody generation
(Samsonova et al. 2012). Thus, need exists for quick, simple and cost-effective yet
sensitive detection of CAP.
The proposed assay is based on salt-induced aggregation of gold nanocolloids
that leads to red-to-blue colour change. Gold nanocolloids (5–100 nm) show
R. Sharma K.V. Ragavan K.S.M.S.Raghavarao (&)

Academy of Scientific and Innovative Research (AcSIR), CSIR-Central Food Technological
Research Institute (CSIR-CFTRI), Mysore, India
e-mail: raghavarao@cftri.res.in
R. Sharma K.V. Ragavan K.S.M.S.Raghavarao
Department of Food Engineering, CSIR-Central Food Technological Research Institute
(CSIR-CFTRI), Mysore, India
M.S. Thakur (&)
Materials Science Centre, University of Mysore, Mysore, India
e-mail: msthakur@yahoo.com

DOI 10.1007/978-981-10-1920-3_21
188 R. Sharma et al.
Fig. 1 a Principle of gold nanocolloid and aptamer-based colorimetric determination of

CAP. b Dispersed and aggregated nanocolloids
remarkable size-dependent optical properties. They are being widely used in

detection systems, a major portion of which constitutes of colorimetric aggregation
based bioassays (Katiyar et al. 2013; Sharma et al. 2015b). In this technique dis-
persed gold nanocolloids (usually red in colour) are protected by a biorecognition
element from salt-induced aggregation, the absence of which leads to the formation
of larger particles changing the colour to bluish purple. When added, analyte binds
and engages the biorecognition element that can no more protect the nanocolloids.
The salt ions interfere with the electrostatic repulsive forces between nanoparticles,
leading to formation of bigger clumps. The resulting colour change is observed
visually and measured spectrophotometrically.
Aptamers are highly specific biorecognition elements that change conformation
on analyte binding (Sharma et al. 2015b). The present method involves protection
of nanocolloids by a DNA aptamer that has a strong affinity for CAP, to produce a
fast and quantitative response in its detection in buffer (principle explained in
Fig. 1). Gold nanocolloid based colorimetric aptasensing has been used to detect
antibiotics in previous studies (Kim et al. 2010; Derbyshire et al. 2012).
2.1 Materials
Tetrachloroauric acid trihydrate, trisodium citrate, Tris-HCl and aptamer for CAP
(5′AGCAGCACAGAGGTCAGATGACTTCAGTGAGTTGTCCCACGGTCGGC
GAGTCGGTGGTAGCCTATGCGTGCTACCGTGAA-3′) were obtained from
Sigma-Aldrich, USA. All other chemicals were procured from Ranbaxy Fine
Nano-aptamer Based Quantitative Detection of Chloramphenicol 189
Chemicals Limited, India. All reagents used were extra pure and of analytical grade.
Three-stage MilliQ-Millipore plus purification system was used for purification of
water used in the experiments. Buffer used was as reported (Mehta et al. 2011).
Aptamer stock was prepared in water and stored at −20 °C.
2.2 Methods
2.2.1 Synthesis and Characterization of Gold Nanocolloids
Citrate-capped gold nanocolloids were synthesized according to our previously

reported protocol (Sharma et al. 2015a). Size and concentration of the nanocolloids
were calculated using the absorbance data (Haiss et al. 2007) and confirmed by
Transmission Electron Microscopy (TEM) (Jeol 2100, USA).
2.2.2 Optimization of Parameters
The following parameters and reaction conditions were optimized: binding buffer
for optimal binding of aptamer with CAP (5–100 % concentration of the reported
buffer composition), NaCl concentration for the least salt amount required for
nanoparticle aggregation (0.05–0.6 M at intervals of 0.05 M), incubation time for
the appropriate interaction of ions and aptamers with nanocolloids and analyte (5,
10, 15, 20 and 25 min) and aptamer concentration for the minimum quantity
required to protect the nanocolloids from aggregation (0.2–4 μM). The added
volumes are mentioned in Table 1.
2.2.3 Detection of CAP
With optimized conditions, the assay was developed for CAP detection. Different
concentrations of CAP was dissolved in buffer and 25 μL of the solution was added
Table 1 Optimization of parameters and corresponding reaction composition
Parameter Composition of reaction mixture (Volumes in µL)
optimized Gold Binding NaCl Aptamer H2O Total
nanocolloids buffer volume
Binding buffer 300 75a – – 75 450
concentration
NaCl concentration 75b 50a – 25
Incubation time 75b 50b – 25
Aptamer 75b 50b 25a –
concentration
a
Different concentrations
b
Optimized concentration
to the reaction mixture comprising of 300 μL gold nanocolloids and optimized

concentrations of 50 μL buffer, 25 μL aptamer and 50 μL NaCl. The extinction
spectra were recorded (Spectrophotometer UV-1601, Shimadzu, Japan) and the
least concentration that could be spectrophotometrically determined was noted.
3.1 Synthesis and Characterization of Gold Nanocolloids
The UV-Vis spectra of the nanocolloids show that the surface plasmon resonance
(SPR) peak occurs at 520 nm, where the absorbance for as-prepared nanocolloids
was 0.518 (Fig. 2a). According to Haiss et al. (2007), the calculated size was 7 nm
and concentration was found to be 1.83 × 10−8 M. The TEM images conform to
the calculated size (Fig. 2b).
3.2 Optimization of Parameters
Nanocolloid aggregation led to the formation of larger particles that corresponded

to a second extinction peak. For quantitative estimation of the aggregation the ratio
of the absorbance at 610 nm (A610, where secondary peak begins to form) to that at
the SPR wavelength (in our case 520 nm, A520) was calculated and plotted against
the parameter to be measured (Derbyshire et al. 2012). The same has been com-
Fig. 2 a UV-Visible extinction spectrum of as-prepared gold nanocolloids. b Transmission

electron micrograph image of the as-prepared nanocolloids revealing particle size of around 7 nm
pared with control values for clarification of the obtained results.

Fig. 3 a Extinction spectra showing effect of different concentrations of buffer on nanocolloids.

Spectral lines overlap. b A610/A520 values plotted against different buffer concentration
3.2.1 Buffer
Variation in concentration of buffer was not found to affect aggregation with respect
to control, as seen from Fig. 3a, b. The spectral lines overlap, and the A610/A520
values are almost in the same range as the control (Fig. 3b). As such the buffer
without any dilution (100 %) was used in the assay.
3.2.2 NaCl Concentration
Gradual increase in NaCl concentration was found to aggregate more nanocolloids

(Fig. 4a). It was seen that after 0.4 M of NaCl there was no significant increase in
aggregation (Fig. 4b), and thus this concentration was chosen for further
experiments.
Fig. 4 a Aggregation pattern of gold nanocolloids using different concentrations of NaCl. b A610/
A520 values plotted against different NaCl concentrations. Control is 0 M NaCl
Fig. 5 a Effect of incubation time on aggregation of gold nanocolloids. b Linear increase in

aggregation with increasing incubation time
3.2.3 Incubation Time
It was found that after 25 min of incubation of nanoparticles with 0.4 M NaCl
complete aggregation could be achieved (Fig. 5a, b). For all later assays, this time
period was used.
3.2.4 Aptamer Concentration
As aptamer concentration was increased, fewer nanocolloids were aggregated.

Control I consisted of gold nanocolloids, buffer and salt i.e. complete aggregation.
Control II consisted of only gold nanocolloids and buffer i.e. absence of aggrega-
tion. From Fig. 6a, b, it can be seen that 0.8 μM was able to protect nanocolloids
i.e. it is closer to A610/A520 value of Control II. It can be noted that even higher
amount of aptamers can protect nanoparticles, but more number of aptamer
molecules may prevent aggregation of nanoparticles even after binding to analyte.
As such minimum quantity should be used. Thus, 0.8 μM aptamer concentration
was chosen for further experiments.
Fig. 6 a Increased protection of nanocolloids from aggregation by increasing aptamer concen-

tration. b A610/A520 values plotted against aptamer concentration, compared with control values
3.3 Estimation of CAP
Following the hypothesis and using optimized values of the reaction components,
the assay to estimate CAP was performed. Concentrations of CAP differing by 100
units could be resolved by the detection system from 0.55 pg/mL to 55 μg/mL
within which linear increase was observed (Fig. 7a, b). The lowest limit that could
be reached using this technique was 0.55 pg/mL of CAP (final concentration in
solution).
As is evident from the above data, the values of A610/A520 are quite close, which
can be attributed to the relatively large size of the aptamer (80 bases) and the small
size of the analyte (molecular weight 323 g/mol). Some part of the aptamer may be
protecting the colloid nanoparticles even after binding to CAP. In such cases, even
the presence of CAP may show very less aggregation (Fig. 8). It has been reported
that development and application of small molecule aptamers is challenging
Fig. 7 a Absorption curves of nanocolloids in presence of different concentrations of

CAP. b Linear quantification of CAP using the proposed system (compared to controls without
aggregation and with complete aggregation)
Fig. 8 Probable explanation for less A610/A520 values in CAP detection. Even after aptamer binds
CAP, it protects nanocolloids and fails to produce significant colour change on salt addition
(McKeague and DeRosa 2012). Often there is no sufficient change in conformation

of the aptamers and in such cases aptamers need to be hybridized with a nucleotide
or split into parts. Even for such modifications, the structure of the aptamer should
be clearly elucidated, however, such information is scanty. As observed in the
present detection system, colorimetric aptasensing in unmodified form faces chal-
lenges concerning sensitivity in real samples (Kim and Gu 2014). The technique
has been used successfully for certain small molecules, but in those cases the
aptamer length was much shorter as compared to the present system (Katiyar et al.
2013).
4 Conclusion
In the present work, we report a simple, convenient and cost-effective nanocolloid

and aptamer-based bioanalytical system for chloramphenicol in buffer. The assay
time is 30–35 min. The cost of around 10 assays is less than Rs. 20. Only
instrumentation involved is a spectrophotometer. The detection limit is 0.55 pg/mL
that is equivalent to 0.55 parts per trillion, a value much lower than the acceptable
limit of CAP in food (0.3 ppb). This biosensing technique can be used for CAP
detection in food and medical samples, aiding regulatory bodies and health
professionals.
Acknowledgments The authors are grateful to the Director, CFTRI for providing necessary
laboratory facilities. R.S. and K.V.R thank CSIR for providing research fellowship.
References
Derbyshire, N., White, S.J., Bunka, D.H., Song, L., Stead, S., Tarbin, J., Sharman, M., Zhou, D.,
Stockley, P.G.: Toggled RNA aptamers against aminoglycosides allowing facile detection of
antibiotics using gold nanoparticle assays. Anal. Chem. 84, 6595–6602 (2012)
Food Safety and Standards (Contaminants, Toxins and Residues) Regulations: Food Safety and
Standards Authority of India, FNo 2-15015/30/2010. Accessed 21 Feb 2015 (2011)
Haiss, W., Thanh, N.T.K., Aveyard, J., Fernig, D.G.: Determination of size and concentration of
gold nanocolloids from UV-Vis spectra. Anal. Chem. 79, 4215–4221 (2007)
Islam, M.J., Liza, A.A., Reza, A.H.M.M., Reza, M.S., Khan, M.N.A., Kamal, M.: Source
identification and entry pathways of banned antibiotics nitrofuran and chloramphenicol in
shrimp value chain of Bangladesh. Eurasia J. Biosci. 8, 71–83 (2014)
Katiyar, N., Selvakumar, L.S., Patra, S., Thakur, M.S.: Gold nanoparticles based colorimetric
aptasensor for theophylline. Anal. Methods 5, 653–659 (2013)
Kim, Y.S., Gu, M.B.: Advances in aptamer screening and small molecule aptasensors. Adv.
Biochem. Eng. Biotechnol. 140, 29–67 (2014)
Kim, Y.S., Kim, J.H., Kim, I.A., Lee, S.J., Jurng, J., Gu, M.B.: A novel colorimetric aptasensor
using gold nanoparticle for a highly sensitive and specific detection of oxytetracycline.
Biosens. Bioelectron. 26, 1644–1649 (2010)
McKeague, M., DeRosa, M.C.: Challenges and opportunities for small molecule aptamer
development. J. Nucleic Acids. Article ID 748913, 20 pages (2012)
Mehta, J., Dorst, B.V., Rouah-Martina, E., Herrebout, W., Scippo, M.-L., Blust, R., Robbens, J.:
In vitro selection and characterization of DNA aptamers recognizing chloramphenicol.
J. Biotech. 155, 361–369 (2011)
Samsonova, J.V., Cannavan, A., Elliot, C.T.: A critical review of screening methods for the
detection of chloramphenicol, thiamphenicol and florfenicol residues in food-stuffs. Crit. Rev.
Anal. Chem. 42, 50–78 (2012)
Sharma, R., Ragavan, K.V., Abhijith, K.S., Akanksha, Thakur M.S.: Synergistic catalysis by gold
nanoparticles and metal ions for enhanced chemiluminescence. RSC Adv. 5, 31434–31438
(2015a)
Sharma, R., Ragavan, K.V., Thakur, M.S., Raghavarao, K.S.M.S.: Recent advances in
nanoparticle based aptasensors for food contaminants. Biosens. Bioelectron. 74, 612–627
(2015b)
Shukla, P., Bansode, F.W., Singh, R.K.: Chloramphenicol toxicity: a review. J. Med. Med. Sci. 2,
1313–1316 (2011)
Vora, V.R., Raikwar, M.K.: Determination of chloramphenicol and thiamphenicol residues in fish,
shrimp and milk by ESI-LCMSMS. Int. J. Agr. Food Sci. Tech. 4, 823–828 (2013)
Influence of Substrate Concentration,
Nutrients and Temperature
on the Biodegradation of Toluene
in a Differential Biofilter Reactor
Suganya Baskaran, Shri Vaishnavi Perumal Selvakumar,

Roshni Mohan, Rhea Mariam John, Swaminathan Detchanamurthy,
Meyyappan Narayanan and Peter Alan Gostomski
1 Introduction
Biofiltration is a combination of different physical and biological processes:

absorption, adsorption and degradation of the gaseous contaminant and desorption
of the degradation products (Vergara-Fernández et al. 2007). Biofilter performance
can be directly influenced by various operational parameters such as the filter bed
type, water content, nutrient supplies, contaminant concentrations, temperature and
gas flow rates (Abdel-El-Haleem 2004; Jorio et al. 2000). Understanding the impact
of these environmental parameters in a biofilter is very important both at industrial
scale and in lab scale biofilters. The differential biofiltration reactor system is an
effective tool for investigating these operational parameters on the pollutant
degradation rate. This article will discuss the outcome of the studies with a lab scale
differential biofiltration reactor to understand the impact of substrate/pollutant
concentration, nutrients and temperature on the toluene elimination capacity (EC) in
soil.
S. Baskaran S.V.P. Selvakumar R. Mohan R.M. John S. Detchanamurthy (&)

M. Narayanan
Department of Chemical Engineering, Sri Venkateswara College of Engineering, Pennalur,
Sriperumbudur 602117, Tamil Nadu, India
e-mail: dswami@svce.ac.in
P.A. Gostomski
Department of Chemical and Process Engineering, University of Canterbury, Christchurch
8041, New Zealand

DOI 10.1007/978-981-10-1920-3_22
198 S. Baskaran et al.
Pollutant/Substrate Concentration
Knowledge about the effect of pollutant concentration on degradation is essential.
In a biofilter, elimination capacity (EC) is used to describe the degradation rate
normalised by bed volume (g m−3 h−1). The microbial degradation kinetics in a
biofilter, as a function of pollutant concentration, are usually described using a
modified form of Monod’s growth equation (Eq. 1) (Doran 1995). Degradation in a
biofilm is actually a combination of microbial kinetics and mass transfer through
the biofilm, but without explicit knowledge of the biofilm area and thickness, this
lumped approach is commonly used. When substrate inhibition affects the degra-
dation rate, Andrew’s substrate inhibition equation (Andrews 1968) is one option
that can be used (Eq. 2).
ECmax S
EC ¼ ð1Þ
KS þ S
ECmax S
EC ¼ ð2Þ
KS þ S þ S2 =Ki
where, EC is elimination capacity in g m−3 h−1, ECmax is maximum elimination

capacity, S is substrate concentration in g m−3, Ki is substrate inhibition constant in
g m−3 and Ks is substrate half saturation constant in g m−3. Equation 2 does not
have mass transfer as an explicit term. However as Ks and Ki are lumped param-
eters, substrate concentration can influence EC directly through microbial kinetics
or indirectly through a higher mass transfer rate causing more biofilm to be engaged
in the degradation process.
Nutrients
Microorganisms present in the biofilter bed use the carbon present in the pollutant
[e.g. volatile organic compound (VOC)] typically as an energy source and poten-
tially as a carbon source for cell material, if the nutrient balance in the bed material
allows for growth, as carbon is the most important building block in any cell
(Kennes and Veiga 2001). After carbon, nitrogen is the next most essential nutrient
for microbial growth. It makes up about 15 % of the dry cell mass and is a major
constituent of nucleic acids and proteins. Next to nitrogen, phosphorus, sulphur and
potassium are considered essential for many intracellular processes in a microor-
ganism (ATP production, disulphate bond formation, maintenance of cellular pH,
etc.) (Alahari and Apte 2004; du Plessis et al. 1998; Nikiema et al. 2010; Sorial
et al. 1998). Therefore, the concentration, frequency and type of nutrients needed
for treating different gaseous pollutants with various biofilter bed media remains
highly empirical.
Temperature
Environmental conditions can raise or lower the bed temperature through solar
input, winter cooling or upstream process changes. The optimum temperature range
for toluene degraders is usually reported as 30–40 °C (Kiared et al. 1997; Leson
and Winer 1991; Ottengraf and Vandenoever 1983). However, based on the type of
Influence of Substrate Concentration, Nutrients … 199
microorganisms involved in degrading the particular pollutant, the optimum tem-

perature range will change for attaining the maximum degradation rate. Hence, the
major objective of this article is to understand the effects of toluene concentration,
different nutrients and temperature on the toluene elimination capacity using soil
with a differential biofilter with excellent control of the water environment. These
studies will help further to identify a suitable toluene concentration range and
working temperature to attain high EC.
2.1 Differential Biofilter Reactor
The design of the differential biofiltration reactor used in the current study exposes
the whole biofilter bed medium to the same environmental conditions and residual
pollutant concentration (Fig. 1). This is in contradictory to a typical column
biofilter where most of the parameters change along the length of the reactor.
A matric potential of −10 cm H2O is maintained throughout this study as previous
work demonstrated this was in the optimum water content range. The desired inlet
toluene concentration is generated by a diffusion flask-water bath set up
(Detchanamurthy and Gostomski 2012) and the air flow rate is controlled by a mass
flow controller (M100B, MKS Instruments, Andover, MA, USA). Before the
toluene-laden air enters the reactor, it is humidified by a shell and tube humidifier
(Perma Pure LLC, Toms River, NJ, USA). Soil (Park house Garden Supplies, C/N
Fig. 1 a A cut-away of the differential biofiltration reactor with water content control,
b experimental set-up
ratio of 11.2) is used as a bed medium for the current research. The reactor inlet and
outlet toluene concentrations are monitored continuously by a gas chromatograph
(GC) (SRI-8610C, SRI Instruments, CA, USA). In order to prevent condensation,
the outlet line is heat traced at 40 °C and insulated until the GC sample entry port.
In addition, a carbon dioxide analyser (GMP343, Vaisala Inc, CO, USA) is con-
nected online to the GC sample purge port in order to measure the carbon dioxide
production during the biodegradation of toluene (data not shown).
2.2 Nutrient Addition
New nutrient solutions (Table 1) are added by first draining the previous solution
from both the upper and lower water chambers. Then the chambers are filled with
phosphate buffered saline (PBS) at pH 7 to extract previous nutrient additions from
the soil. This is repeated 3 times. Then the new nutrient solution is added to both
chambers. All the nutrient solutions and the reactor at start-up are autoclaved at
121 °C for 45 min before being used in the experiment to minimise residual bio-
logical growth in the water reservoirs. Except for tap water and calcium chloride, all
other nutrient solutions are prepared in the PBS solution at pH 7.0 in order to
eliminate the pH effect on microbial degradation.
2.3 Temperature Studies
The temperature of the insulated box containing the differential reactor is controlled
between 20 and 50 °C using a temperature controller (LTR-5, LAE Electronics,
Italy) by a 60 W light bulb as a heat source; in addition, a cooling coil is added for
obtaining temperatures below ambient.
Table 1 Different nutrients added to the differential biofilter to determine the impact on toluene
elimination capacity
Nutrient Concentration (g L−1) Duration (days)
N source 4.00 ± 0.005 5
(a) NaNO3
P source (PB buffer) 0.24 ± 0.001 43
(a) KH2PO4 1.44 ± 0.007 43
(b) NaH2PO42H2O
S, Mg, Fe sources 0.2 ± 0.01 7
(a) MgSO47H2O 0.0008 ± 0.00001 7
(b) FeSO47H2O
Ca source 1.42 ± 0.005 56
(a) CaCl22H2O
Tap water NA 15
2.4 Substrate Concentration Studies
The study of the toluene concentration effect on the elimination capacity (EC) ran
for 4 months. Inlet concentrations were varied in a step-wise fashion. The inlet
concentration was held constant until a steady outlet toluene concentration/EC was
observed. Toluene inlet concentrations varied between 46.6 ± 0.5 ppm and
649.6 ± 4.2 ppm by varying the water bath temperature between 5 and 55 °C for
this study. The experiment was repeated in three cycles with first two cycles at
increasing order of concentrations and the last cycle at mixed order of
concentrations.
3.1 Nutrient Effect
The differential biofilter reactor was operated initially for 7 days as an acclimation
period for toluene degraders present in the biofilter medium (soil) with tap water in
the water reservoirs. A steady EC was observed after the 7th day (Fig. 2), which
was followed by the addition of the nutrient solutions in Table 1.
Following the steady state EC (31.9 ± 0.8 g m−3 h−1) with tap water, at day 16,
0.01 M calcium chloride (Houba et al. 2000) replaced the tap water which slightly
increased the EC to 35.9 ± 1.0 g m−3 h−1. Since this marginal increase in EC was
not considered significant, the toluene degraders present in the soil were not
Fig. 2 Elimination capacity for nutrient addition studies at different time intervals
calcium-limited. After achieving steady state EC at day 29, phosphate buffered

saline (PBS) was added by removing the calcium chloride from the reactor. Similar
to calcium chloride, it slightly increased the EC after 10 days (day 39) to
41.5 ± 2.7 g m−3 h−1. All subsequent experiments were performed with PBS
buffer adjusted to 7.0. Moreover, PBS washes were performed whenever a new test
solution was loaded and removed from the reactor. The pH of solution removed
from the reactor over the rest of the subsequent experiments ranged from pH 6.5–
6.8. After the day 66, PBS was replaced by 0.05 M sodium nitrate which increased
the EC after 12 days to 145 ± 0.9 g m−3 h−1, a 3.5-fold increase. This response
indicated that nitrogen was the substrate limiting the growth of toluene degraders
present in the biofilter bed. Nitrogen limitation has been commonly observed in
other related biofiltration research work treating different volatile organic com-
pounds (VOCs) (Acuña et al. 2002; Beuger and Gostomski 2009; Jorio et al. 2000;
Morgenroth et al. 1996; Weckhuysen et al. 1993). After achieving a new steady
state EC, the sodium nitrate solution was replaced with a PBS solution on day 69.
No significant change in the EC was observed following this change. This response
clearly indicated that the EC increase during the addition of sodium nitrate was due
to biomass growth. On the 74th day, PBS was replaced with a magnesium
sulphate/ferrous sulphate solution and no further change in EC was observed. This
indicated that the toluene degraders were not Mg, Fe or sulphate limited.
3.2 Temperature Effect
The operating temperature of reactor was increased stepwise from 20 to 50 °C

during the experiment and the EC increased gradually from 34 ± 2.0 g m−3 h−1 to
a maximum of 49.8 ± 2.6 g m−3 h−1 at 45 °C (Fig. 3). However, the EC started to
Fig. 3 Effect of temperature on elimination capacity

drop steeply above 45 °C. Similar studies reported that maximum specific toluene
degradation rate was observed at 30 °C in a biofilter (Lee et al. 2002;
Vergara-Fernández et al. 2007; Yoon and Park 2002). Hence from the current study
it can be concluded that a highest intensity of the metabolic microbial activity in
soil was seen at 45 °C which was 18 % lower than the optimal temperature reported
earlier by Beuger and Gostomski (2009) in compost.
3.3 Substrate Concentration Effect
The effect of residual (outlet) toluene concentration on EC was studied by

manipulating the inlet toluene concentrations to change the load. Before these
experiments were started, the reactor was operated for 120 days, and any excess
nutrients to stimulate growth were assumed to be exhausted. Therefore it was
assumed that maintenance energy was driving the toluene degradation with no net
change in active biomass. Three cycles of repeat experiments were conducted and
in each experiment the EC increased with residual substrate concentration before
dropping at higher toluene concentrations (Fig. 4).
Fig. 4 The relationship between the outlet (residual) toluene concentration and the EC for cycle
1–3
The initial increase in EC with increasing toluene concentrations seen in all three
cycles is a typical response of a biofilm combining diffusion-limited degradation at
lower concentrations followed by full biofilm penetration at higher concentrations
as described by Ottengraf and van den Oever (1983). The subsequent drop in EC at
higher toluene concentrations seen in all three cycles indicates substrate inhibition
(Zilli et al. 2000). The other outstanding anomaly is that the biofilter displayed a
steady EC of approximately 38 g m−3 h−1 for over 100 days at 160 ppm prior to
the start of cycle 1. However, after a relatively brief time at lower residual con-
centrations (#1, #2), an increase back to the range of 160 ppm gave a much higher
EC (*145 g m−3 h−1, #4). At present there is no acceptable explanation for this
and is probably related to inhibition and how different strains in the microbial
community responded overtime to different toluene concentrations and is the
subject of further.
4 Conclusion
The differential biofilter reactor used in these studies showed a high degree of
flexibility in manipulating environmental parameters, such as substrate concentra-
tion, dissolved nutrients and operating temperature while controlling water content.
From the substrate concentration studies, it was demonstrated that below critical
substrate concentration, mass transfer limitation influenced the EC and above that,
substrate inhibition was the dominant influence. Furthermore, by replicate substrate
concentration studies on the same biofilter media (soil) demonstrated a loss of
active toluene degraders but less substrate inhibition. This drop in EC was attributed
to exposure to higher toluene concentrations during earlier cycles. Studies carried
out using different nutrients clearly proved that the toluene degraders present in the
soil were nitrogen limited. This was evident from the 3.5-fold increase in the EC
with the addition of nitrogen (NaNO3) but the other nutrients did not show a
significant increase in EC. Temperature studies showed that the EC of the soil in the
differential biofilter reactor increased with increasing temperature, from
34 ± 1.4 g m−3 h−1 to 49.8 ± 2.6 g m−3 h−1 for temperatures of 20–45 °C,
respectively and dropping above 45 °C.
References
Abdel-El-Haleem, D.: Acinetobacter: environmental and biotechnological applications. Afr.

J. Biotechnol. 2(4), 71–74 (2004)
Acuña, M.E., Villanueva, C., Cardenas, B., Christen, P., Revah, S.: The effect of nutrient
concentration on biofilm formation on peat and gas phase toluene biodegradation under
biofiltration conditions. Process Biochem. 38(1), 7–13 (2002)
Alahari, A., Apte, S.K.: A novel potassium deficiency-induced stimulon in Anabaena torulosa.
J. Biosci. 29(2), 153–161 (2004)
Andrews, J.F.: A mathematical model for the continuous culture of microorganisms utilizing
inhibitory substrates. Biotechnol. Bioeng. 10(6), 707–723 (1968)
Beuger, A.L., Gostomski, P.A.: The Impact of Environmental Parameters on Toluene Degradation
Using a Laboratroy-Scale Reactor with Internal Recycle. Engineering Our Future: Are We up
to the Challenge, pp. 303–307, (2009)
Detchanamurthy, S., Gostomski, P.A.: Development of a modified differential biofiltration reactor
with online sample and carbon dioxide monitoring system. Asia-Pac. J. Chem. Eng. 8(3), 414–
424 (2012)
Doran, P.M.: Bioprocess Engineering Principles (vol. 1). Academic Press, Cambridge (1995)
Du Plessis, C.A., Kinney, K.A., Schroeder, E.D., Chang, D.P.Y., Scow, K.M.: Denitrification and
nitric oxide reduction in an aerobic toluene-treating biofilter. Biotechnol. Bioeng. 58(4), 408–
415 (1998)
Houba, V., Temminghoff, E., Gaikhorst, G., Van Vark, W.: Soil analysis procedures using 0.01 M
calcium chloride as extraction reagent. Commun. Soil Sci. Plant Anal. 31(9–10), 1299–1396
(2000)
Jorio, H., Bibeau, L., Heitz, M.: Biofiltration of air contaminated by styrene: effect of nitrogen
supply, gas flow rate, and inlet concentration. Environ. Sci. Technol. 34(9), 1764–1771 (2000)
Kennes, C., Veiga, M.C.: Bioreactors for Waste Gas Treatment (vol. 4). Kluwer Academic
Publishers, Berlin (2001)
Kiared, K., Fundenberger, B., Brzezinski, R., Viel, G., Heitz, M.: Biofiltration of air polluted with
toluene under steady-state conditions: experimental observations. Ind. Eng. Chem. Res. 36(11),
4719–4725 (1997)
Lee, E.Y., Jun, Y.S., Cho, K.S., Ryu, H.W.: Degradation characteristics of toluene, benzene,
ethylbenzene, and xylene by Stenotrophomonas maltophilia T3-c. J. Air Waste Manag. Assoc.
52(4), 400–406 (2002)
Leson, G., Winer, A.M.: Biofiltration—an innovative air-pollution control technology for VOC
emissions. J. Air Waste Manag. Assoc. 41(8), 1045–1054 (1991)
Morgenroth, E., Schroeder, E.D., Chang, D.P.Y., Scow, K.M.: Nutrient limitation in a compost
biofilter degrading hexane. J. Air Waste Manag. Assoc. 46(4), 300–308 (1996)
Nikiema, J., Brzezinski, R., Heitz, M.: Influence of phosphorus, potassium, and copper on methane
biofiltration performance (A paper submitted to the journal of environmental engineering and
science). Can. J. Civ. Eng. 37(2), 335–345 (2010)
Ottengraf, S.P.P., Vandenoever, A.H.C.: Kinetics of organic-compound removal from waste gases
with a biological filter. Biotechnol. Bioeng. 25(12), 3089–3102 (1983)
Sorial, G.A., Smith, F.L., Suidan, M.T., Pandit, A., Biswas, P., Brenner, R.C.: Evaluation of
trickle-bed air biofilter performance for styrene removal. Water Res. 32(5), 1593–1603 (1998)
Vergara-Fernández, A., Lara Molina, L., Pulido, N.A., Aroca, G.: Effects of gas flow rate, inlet
concentration and temperature on the biofiltration of toluene vapors. J. Environ. Manag. 84(2),
115–122 (2007)
Weckhuysen, B., Vriens, L., Verachtert, H.: The effect of nutrient supplementation on the
biofiltration removal of butanal in contaminated air. Appl. Microbiol. Biotechnol. 39(3), 395–
399 (1993)
Yoon, I.K., Park, C.H.: Effects of gas flow rate, inlet concentration and temperature on biofiltration
of volatile organic compounds in a peat-packed biofilter. J. Biosci. Bioeng. 93(2), 165–169
(2002)
Zilli, M., Del Borghi, A., Converti, A.: Toluene vapour removal in a laboratory-scale biofilter.
Appl. Microbiol. Biotechnol. 54(2), 248–254 (2000)
Importance of Biomass-Specific
Pretreatment Methods for Effective
and Sustainable Utilization
of Renewable Resources
Yadhu N. Guragain and Praveen V. Vadlani
1 Introduction
Transportation fuels and climate change are topics of keen discussion in political
and scientific communities throughout the world. A gradual decrease in economi-
cally and sustainably recoverable petroleum reserves requires a search for alter-
native to fossil fuels. In addition, increasing instability in most of the oil-producing
countries has further worsened the fuels crisis for the non-oil-producing countries
(Mousdale 2008). Bio-based fuel and chemical production has rapidly increased in
last one and half decades; however, current biorefineries predominantly use
food-based materials as feedstocks (Guragain et al. 2016b), which is not sustainable
due to a global food security issue. The abundantly available lignocellulosic resi-
dues are sustainable feedstocks for bio-based fuels and chemicals production
without affecting global food supply (Guragain 2015a).
Bioprocessing of lignocellulosic biomass can be broadly divided into three unit
operations: pretreatment, hydrolysis and fermentation, as shown in Fig. 1. Each
step of this bioconversion process is associated with a number of challenges
(Mousdale 2008); among them pretreatment is the central unit operation that sig-
nificantly affects the efficiency of all subsequent steps of bioprocessing, and is the
most expensive single unit operation in the context of existing biomass conversion
technologies (Guragain 2015a). In addition, valorization of lignin stream is critical
for the commercial viability of biorefinery industries (Ragauskas et al. 2014);
Y.N. Guragain (&) P.V. Vadlani

Bioprocessing and Renewable Energy Laboratory Grain Science and Industry Department,
Kansas State University, Manhattan, KS, USA
e-mail: guragain@ksu.edu
P.V. Vadlani
Department of Chemical Engineering, Kansas State University, Manhattan, KS, USA

DOI 10.1007/978-981-10-1920-3_23
208 Y.N. Guragain and P.V. Vadlani
Fig. 1 Bioprocessing for lignocellulosic biomass to produce fuels and chemical
biomass pretreatment significantly effects the quality of extracted lignin for high
value application.
Pretreatment methods are broadly divided into physical, chemical,
physico-chemical, and biological pretreatment methods. Each pretreatment method
is associated with some advantages as well as disadvantages (Guragain 2015a). In
addition, variations in biomass composition among different biomass feedstocks
significantly affect the effectiveness of each pretreatment method. Moreover,
structure of biopolymers, especially lignin, differs from biomass to biomass
(Guragain et al. 2015b), which further affect the pretreatment efficiency. Biomass
lignin is made up of three types of monomer units such as syringyl (S), guaiacyl
(G) and p-hydroxyphenyl (H). In addition, grass lignin also contains a significant
proportion of p-coumarate and ferulate monomers (Guragain et al. 2015b) (Fig. 2).
The proportion of different lignin monomers, and type of linkages between these
monomers in biomass lignin affect delignification efficiency during pretreatment
process. The pretreatment efficiency is better for biomass containing higher S/G
ratio, higher proportion of p-coumarate and ferulate monomers, and higher amount
of ester and ether inter-unit linkages, whereas the efficiency decreases with increase
in carbon-carbon linkages (Studer et al. 2011).
In this study, a wide range of biomass feedstocks, including grass, softwood and
hardwood, were evaluated and compared for the most common biomass pretreat-
ment methods, such as dilute acid and alkali pretreatment. These biomass feed-
stocks were also evaluated for the effectiveness of organic solvent pretreatment
using alkali catalyst. Alkaline organosolv pretreatment is considered as the
promising pretreatment method to extract good quality biomass lignin to produce
high-value products from the extracted lignin (Guragain et al. 2016a). Effectiveness
of these pretreatment methods were evaluated based on the sugar released during
enzymatic hydrolysis of pretreated biomass. In addition, three sorghum cultivars
(Early Hegari, Atlas and Kansas Collier) and brown midrib (bmr)-12 mutant of each
cultivar were evaluated for sugar release during enzymatic hydrolysis of alkali
pretreated biomass. The objective of bmr mutation is to perturb lignin biosynthesis
pathways leading to change in total lignin content and/or proportion of different
type of lignin monomers so that a new crop line with better feedstock quality for
biofuels and biochemical production is developed (Guragain 2015a).
Importance of Biomass-Specific Pretreatment Methods … 209
Fig. 2 Lignin monomers and inter-lignin linkages in biomass lignin structure (Guragain et al.
2015b)
A schematic representation of the methodology used in this study is given in Fig. 3.

Biomass composition was first determined using standard protocols (Guragain
2015a). Dilute acid and alkali pretreatment methods were evaluated and compared
for a wide variety of biomass feedstocks such as grass (corn stover, switchgrass,
and sorghum stalks), softwood (Douglas fir) and hardwood (poplar). In addition,
alkaline organic solvent pretreatment method was evaluated using two types of
organic solvents (high- and low-boiling point solvents) for corn stover, Douglas fir
and poplar. Glycerol and 2,3-butanediol were used as high-boiling point solvents,
and isopropanol, ethanol, butanol and water were used as low-boiling point sol-
vents. Pretreatment conditions were optimized for processing temperature and
catalyst (sodium hydroxide) concentration; temperature range was less than the
boiling point of solvent for atmospheric pressure processing. The pretreated slurry
was filtered, washed and residual solid was enzymatically hydrolysed using the
methods used by Guragain et al. (2013). Monomers sugars were measured using
high performance liquid chromatography (Shimadzu Corporation, Japan), and data
from triplicate experiments were statistically analysed for Least Significant
Difference (LSD) at 95 % confidence level (P < 0.05) using JMP software (SAS
Institute Inc., Cary, North Carolina, United States).
Fig. 3 Schematic representation of biomass processing. Sulfuric acid and sodium hydroxide
(NaOH) were used in acid and alkali pretreatment process, respectively. Organosolv pretreatment
using alkali (NaOH) catalyst was optimized separately for high- and low-boiling point solvents
using corn stover as feedstock, and the optimized conditions were used for all biomass samples
In a separate experiment, three sorghum cultivars (Early Hegari, Atlas and

Kansas Collier) and bmr12 mutant of each cultivar were evaluated and compared
for non-structural content and sugar released from structural carbohydrates (cellu-
lose and hemicellulose). The non-structural sugar content was determined by
extracting ground biomass in water using Soxhlet extraction, and the sugar released
from structural carbohydrates was determined by alkali pretreatment of ground
biomass followed by enzymatic hydrolysis. Total fermentable sugar was then cal-
culated by adding these two types of sugars: non-structural sugars and released
sugars from structural carbohydrates.
Figure 4 shows that biomass composition significantly varied among different

biomass samples; the composition variation was not only among softwood
(Douglas fir), hardwood (poplar) and grass (corn stover, switchgrass and sor-
ghums), but also among different grass samples. The acid pretreatment was sig-
nificantly less effective than alkali pretreatment at the same processing conditions,
including processing time, temperature and acid/alkali concentration, to release
sugar during enzymatic hydrolysis for all biomass feedstocks. Alkali pretreatment
delignifies biomass, making the carbohydrate polymers accessible for enzyme
hydrolysis; whereas, acid pretreatment expose cellulose for cellulase enzyme
accessibility by hydrolysing hemicellulose (Leu and Zhu 2013). The results
Fig. 4 Composition of different biomass feedstocks, and sugar released during enzymatic
hydrolysis after alkali (NaOH) and acid (H2SO4) pretreatment at same processing conditions:
121 °C for 30 min using 1 and 2 % acid (v/v)/alkali (w/v) for grass and woody biomass,
respectively. bmr = brown midrib sorghum mutant. Hydrolysis of pretreated biomass was carried
out in citrate buffer using Cellic CTec2 and Cellic HTec2 enzymes. Composition data are average
values of triplicate experiments, and the sugar yield data are average values of triplicate
experiments ± sample standard deviation
indicated that harsher conditions are required for hemicellulose hydrolysis by acid
process compared to lignin degradation by alkali. The results also showed that acid
pretreatment effectiveness increase with increase in hemicellulose content in
extractives-free basis, indicating that structural variation in hemicellulose is not
significant among different biomass samples. On the other hand, decrease in total
lignin in biomass was not necessarily beneficial to increase alkali pretreatment
effectiveness with the same proportion. For example, sugars released from alkali
pretreated corn stover was 27 % more than switchgrass while both biomass had
statistically equal lignin content; similar results were observed between sorghum
stalks and poplar. Moreover, a decrease in lignin content by 50 % in bmr sorghum
compared to wild type sorghum resulted in an increase in sugar yield only by 3 %.
These results are consistent with the facts that S/G ratio in corn stover lignin is more
than that of switchgrass lignin (Guragain et al. 2015b), thereby making corn stover
more susceptible for alkali pretreatment. Poplar lignin contains higher S/G ratio
compared to grass lignin; however, absence of p-coumarate and ferulate lignin
monomers in poplar lignin polymer (Guragain et al. 2015b) indicate that the poplar
lignin contains significantly lower proportion of alkali labile ether linkages, and
higher proportion of strong carbon-carbon linkages compared to grass lignin. These
differences in lignin structure could be the reason for a less alkali pretreatment
effectiveness in poplar than a grass (sorghum stalks) with same amount of total
lignin content. High total lignin (29 %) and low extractives (4 %) coupled with
Table 1 Sugar released during enzymatic hydrolysis of alkaline organic solvent pretreated
biomass
Pretreatment solvent system Sugar yield (%, g/g raw biomass)
Corn stover Poplar Douglas fir
Glycerol 37.9 ± 0.6c 39.5 ± 0.2a 2.3 ± 0.1a
2,3-butanediol 43.9 ± 6.0bc 38.9 ± 0.2b 2.4 ± 0.2a
Ethanol 44.8 ± 3.8 b
32.3 ± 2.0 d
1.9 ± 0.5a
Ethanol: Isopropanol = 1:1 (by volume) 49.8 ± 2.0 a
31.2 ± 1.2 d
2.0 ± 0.3a
Ethanol: Butanol: Water = 1:1:1 (by volume) 46.9 ± 1.8 b
35.0 ± 0.6 c
2.1 ± 0.3a
Pretreatment was carried out by refluxing the biomass slurry in alkaline (0.4 %, w/v NaOH) organic
solvent at 170 °C for glycerol and 2,3-butanediol (high-boiling point solvents), and at 75 °C for rest
of the solvents (low-boiling points solvents). Hydrolysis of pretreated biomass was carried out in
citrate buffer using Cellic CTec2 and Cellic HTec2 enzymes. Data are average values of triplicate
experiments ± sample standard deviation. Values with the same letters in superscripts within the
same column are not significantly different from each other at the P < 0.05 level
high proportion of C–C linkages in softwood (Douglas fir) lignin was the reason for
ineffective pretreatment in both acid and alkali processes for this biomass sample.
Table 1 shows that mixture of low-boiling point alcohols were better solvent
system for corn stover pretreatment than high-boiling point solvents, whereas
opposite was true for poplar; glycerol was the promising solvent for poplar pre-
treatment. None of these solvents worked well for Douglas fir pretreatment. These
data indicated that an appropriate alkaline organic solvent for pretreatment (delig-
nification) of any biomass feedstock depends on biomass types due to a distinct
variation in composition (Fig. 4) and structure of biomass lignin (Guragain et al.
2015b). Therefore, each biomass feedstock must be separately optimized for each
organic solvent to develop an effective organosolv pretreatment process.
We also evaluated and compared three sorghum cultivars (Early Hegari, Atlas
and Kansas Collier) and bmr 12 mutant of each cultivar. Table 2 shows that bmr 12
mutants of Atlas and Kansas Collier had 36.2 and 30.1 % more total fermentable
sugars, respectively, than their parent cultivars, whereas bmr 12 of Early Hegari had
12.1 % less total fermentable sugar than its parent line. Total sugar released during
enzymatic hydrolysis was significantly higher in all bmr mutants than their parent
cultivars, indicating that bmr mutation led to improved hydrolysis efficiency of
sorghum biomass. Sugar yield per unit weight of sorghum biomass was further
increased in bmr mutants compared to their parents because of higher amount of
non-structural sugars (glucose, fructose and sucrose) in Atlas and Kansas Collier
cultivars. However, the benefits from improved hydrolysis efficiency in bmr 12
mutant of Early Hegari was surpassed by decreased non-structural sugar content in
this mutant compared to its parent line. These results showed that bmr 12 mutation
leads to better feedstocks for biofuels and biochemical production in some sorghum
cultivars, while the same mutation has adverse effects in other cultivar. Therefore,
bmr mutation of each sorghum cultivar must be separately evaluated to develop a
promising bioenergy crops.
Table 2 Sugar released during enzymatic hydrolysis of alkaline organic solvent pretreated
biomass
Sorghum Non-structural sugar Sugar released in Total fermentable sugar
genotype (g/100 g biomass) hydrolysis (g/100 g (g/100 g biomass)
biomass)
Early 15.40 ± 0.12d 34.34 ± 0.80b 49.74 ± 0.78c
Hegari
(EH)
EH bmr 12 2.70 ± 0.00f 40.84 ± 1.18a 43.54 ± 1.18e
mutant
Atlas (AT) 11.10 ± 0.10e 30.51 ± 0.95c 41.61 ± 0.93f
AT bmr 12 21.40 ± 0.14 b
35.27 ± 1.19 b
56.67 ± 1.26b
mutant
Kansas 16.69 ± 0.03c 29.32 ± 1.46c 46.01 ± 1.43d
Collier
(KC)
KC bmr 12 26.34 ± 0.46a 33.52 ± 0.42b 59.86 ± 0.68a
mutant
bmr = brown midrib sorghum mutant. Non-structural sugars was total sugars extracted from
ground biomass in water using Soxhlet extraction. Sugar released in hydrolysis was total sugars
generated during enzymatic hydrolysis of pretreated biomass. Pretreatment was carried out at
121 °C for 30 min using 1.25 % (w/v) sodium hydroxide solution followed by filtration and
enzymatic hydrolysis of residual solid was carried out in citrate buffer using Cellic CTec2 and
Cellic HTec2 enzymes. Data are average values of triplicate experiments ± sample standard
deviation. Values with the same letters in superscripts within the same column are not significantly
different from each other at the P < 0.05 level
As a consequence, above results show that effectiveness of different pretreatment

methods differ from biomass to biomass. A number of factor other than gross
biomass composition significantly affect the saccharification efficiency of pretreated
biomass, including lignin structure and crystallinity of cellulose (Guragain et al.
2014). Therefore, a fundamental understanding of gross biomass composition,
structure of each biopolymer, and the interactions among different biopolymers
within a biomass is critical to develop an appropriate pretreatment method specific
to each biomass feedstock. In addition, plant breeding, such as bmr mutation, to
develop better feedstocks for biofuels and biochemical production should be sep-
arately evaluated for each plant cultivar because of a distinct variation on the effect
of same mutation on different cultivars of a plant crop.
4 Summary and Conclusions
This study showed that a single pretreatment method cannot be an all-encompassing

process for different types of biomass feedstocks due to distinct variations in the
effectiveness among various pretreatment methods. Structure of biopolymers and
their interactions within biomass are critical, in addition to gross biomass compo-
sition, in the development of an appropriate pretreatment method specific to each
biomass feedstock. In addition, biomass pretreatment process must be tailored with
the optimum use of each component of biomass, including lignin. For example,
alkali pretreatment process solubilizes biomass lignin, opening up an opportunity to
produce high-value phenolic compounds. Whereas acid pretreatment process sol-
ubilizes hemicellulose so that biomass lignin can be obtained after hydrolysis of
cellulose from pretreated biomass, which can be used for composite materials
production. Moreover, separate cellulose and hemicellulose hydrolyzates can be
obtained in acid pretreatment process because hemicellulose and cellulose are
hydrolyzed during pretreatment and enzymatic hydrolysis steps, respectively, in this
process. A separate biomass-derived glucose and xylose sugar is beneficial for
efficient fermentation to fuel and chemicals. Nevertheless, harsher pretreatment
conditions are required in acid pretreatment compared to alkali pretreatment,
leading to a need for additional detoxification process to generate clean sugars. Less
pretreatment-induced inhibitory compounds are produced in alkali pretreatment
compared to acid pretreatment due to the milder processing conditions; however,
both cellulose and hemicellulose are hydrolyzed during enzymatic hydrolysis step
leading to a mixture of glucose and xylose sugars in hydrolyzate, which is less
efficient medium for fermentation compared to single sugar medium (Guragain
2015a). Furthermore, some biomass feedstocks, such as sorghum stalks, contain as
high as 20 % (w/w) of non-structural sugars, including sucrose, glucose, and
fructose, which must be extracted prior to biomass pretreatment to avoid their
degradation during pretreatment process. Similarly, separate innovative strategies
are required for the valorization of various phytochemicals such as terpenes, fats,
waxes, phenolics, and alkaloids. However, all biomass feedstocks do not contain
these non-structural sugars and phytochemicals in economically feasible level;
therefore, a targeted biorefining strategy is required for each type of biomass
feedstock.
Acknowledgments This work was funded by the Development Initiative Competitive Grants
Program (BRDI; grant number: 2012-10008-20263), and the Small Business Innovation Research
(SBIR), Department of Navy; Grant Number: N68335-13-C-0174. Author PVV thanks the
Lortscher Endowment for their support. The authors are also grateful to Novozymes Inc. for
enzyme samples.
References
Guragain, Y.N.: Sustainable bioprocessing of various biomass feedstocks: 2,3-butanediol

production using novel pretreatment and fermentation. Doctoral Dissertation, Kansas State
University, USA (2015a)
Guragain, Y.N., Wilson, J., Staggenborg, S., McKinney, L., Wang, D., Vadlani, P.V.: Evaluation
of pelleting as a pre-processing step for effective biomass deconstruction and fermentation.
Biochem. Eng. J. 77, 198–207 (2013)
Guragain, Y.N., Ganesh, K., Bansal, S., Sathish, R.S., Rao, N., Vadlani, P.V.: Low-lignin mutant
biomass resources: effect of compositional changes on ethanol yield. Ind. Crop Prod. 61, 1–8
(2014)
Guragain, Y.N., Bastola, K.P., Madl, R.L., Vadlani, P.V.: Novel biomass pretreatment using
alkaline organic solvents: a green approach for biomass fractionation and 2,3-butanediol
production. BioEnerg. Res. 9, 643–655 (2016a). doi:10.1007/s12155-015-9706-y
Guragain, Y.N., Herrera, A.I., Vadlani, P.V., Prakash, O.: Lignins of bioenergy crops: a review.
Nat. Prod. Commun. 10, 201–208 (2015b)
Guragain, Y.N., Probst, K.V., Vadlani, P.V.: Fuel alcohol production. In: Corke, H., Faubion, J.,
Seethraman, K., Wrigley, C. (eds.) Encyclopedia of Food Grain, pp. 235–244. Elsevier, Oxford
(2016b)
Leu, S., Zhu, J.: Substrate-related factors affecting enzymatic saccharification of lignocelluloses:
our recent understanding. Bioenerg. Res. 6, 405–415 (2013)
Mousdale, D.M.: Biofuels: Biotechnology, Chemistry, and Sustainable Development. CRC Press,
Boca Rato (2008)
Ragauskas, A.J., Beckham, G.T., Biddy, M.J., Chandra, R., Chen, F., Davis, M.F., et al.: Lignin
valorization: improving lignin processing in the biorefinery. Science 344(6185), 1246843
(2014)
Studer, M.H., DeMartini, J.D., Davis, M.F., Sykes, R.W., Davison, B., Keller, M., et al.: Lignin
content in natural populus variants affects sugar release. Proc. Natl. Acad. Sci. U.S.A. 108,
6300–6305 (2011)
Medium Optimisation for Maximum
Growth/Biomass Production
of Arthrobacter sulfureus
for Biodesulphurisation
E. Asha Rani, M.B. Saidutta and B.D. Prasanna
1 Introduction
Diesel oil contains large amount of organosulphur compounds, combustion of

which leads to Sulphur oxide emissions causing harmful effects on environment.
Hydrodesulphurisation (HDS), a conventional technique employed by refineries
operates at high temperature and pressure, but this process is being ineffective in
removal of organic sulphur compounds like dibenzothiophenes (DBT), therefore it
is not applicable for deep-desulphurisation. In this case, Biodesulpharisation
(BDS) as a complement to deep HDS could be an interesting option for removal of
remaining sulphur compounds. BDS is a promising technology which works at
mild operating conditions and is considered “green” (Luo et al. 2003).
Arhtrobacter sulfureus is capable of removing sulphur from DBT in a selective
way without carbon skeleton rupture. Since the bacteria transform the DBT molecule
into 2-hydroxybiphenyl (HBP) and sulphate by means of a non-destructive pathway,
usually called 4S pathway by which fuel value is preserved (Labana et al. 2005).
Other microorganisms such as, Rhodococcus sp. Strain T09 (Matsui et al. 2001),
Corynebacterium sp. Strain SY1 (Omori et al. 1992), Pseudomonas delafieldii R-8
(Shan et al. 2005) have been reported which helps in removal of sulphur from this
kind of compounds. For BDS process, initially the organism is grown by employing
nutrient source and after a desulphurising biomass is obtained; these cells in the form
E. Asha Rani (&) M.B. Saidutta B.D. Prasanna

Surathkal, Srinivasnagar 575025, Karnataka, India
e-mail: asha.devnekar@gmail.com
M.B. Saidutta
e-mail: saidutta.mb@gmail.com
B.D. Prasanna
e-mail: prsnbhat@gmail.com

DOI 10.1007/978-981-10-1920-3_24
218 E. Asha Rani et al.
of resting cellsare employed to remove sulphur from diesel and model oil in a
biphasic system.
For efficient production of desulphurising cells, it is highly essential to optimise
the media composition which further helps in economic design of large scale fer-
mentation operation system, making it cost effective which is one of the drawbacks
of BDS process. Central Composite Design (CCD) and Box-Behnken Design
(BBD) of RSM are well known fractional factorial designs used for optimization of
variables with a limited number of experiments (Hasan et al. 2010; Wu et al. 2010).
The aim of this work is to optimise medium components for production of
Arthrobacter sulfureus with high biomass yield using CCD and to understand the
influence of operational conditions (concentration of cells, water-oil ratio and
substrate concentration) for treatment of diesel and model oil in a biphasic system
using resting cell suspension.
High-speed Diesel oil was obtained from Mangalore Refinery and Petrochemicals
Limited, India.NB (Nutrient Broth), a complex medium is used for preparing an
inoculum of A. Sulfureus and a standard medium (BSM) is used for the opti-
mization of growth media which has following composition:
NaH2PO4H2O 4 g/L, K2HPO43H2O 4 g/L, CaCl22H2O 0.001 g/L MgCl26H2O
0.0245 g/L, FeCl36H2O 0.001 g/L in addition with 2 % carbon source (glucose
and sodium succinate), nitrogen source (ammonium chloride and ammonium
nitrate), sulphur source (DBT, DMSO and MgSO4) were added.
Resting cell suspension is prepared for biphasic reaction by harvesting cells during
mid-log phase and suspending the harvested cells in phosphate buffer with 2 %
glucose which acts as an aqueous phase. The procedure for harvesting cell is by
centrifuging at 10,000 rpm for 10 min at 4 °C and washed twice with 0.1 M
phosphate buffer of pH 7.
After 5 days of incubation of biphasic system, the culture was centrifuged at
10,000 g for 10 min to separate the oil and aqueous phases. The total sulphur
content in the oil phase was measured by X-ray fluorescence method and in
accordance with ASTM standard D-4294.
3.1 Optimisation of Biomass Growth
One-factor-at-a-time method was adopted to analyse the effect of medium com-

ponents (carbon, nitrogen and sulphur components) on biomass growth in our
Medium Optimisation for Maximum Growth/Biomass Production … 219
earlier experiments. Different nutrient sources likecarbon source (Glucose and

sodium succinate), nitrogen source (ammonium chloride and ammonium nitrate)
and sulphur source (DBT, DMSO and magnesium sulphate) have been checked
among which glucose, ammonium chloride and DMSO were selected as the best
carbon, nitrogen and sulphur source giving higher growth rate. Glucose is the most
commonly employed carbon source in the growth of various BDS strains like in
Gordona strain CYKS1 (Rhee et al. 1998) and Rhodococcus erythropolis KA2-5-1
(Yan et al. 2000). Similarly, most commonly employed nitrogen source is found to
be ammonium chloride (Shan et al. 2005; Yu et al. 2006). The growth rate of
Arthrobacter sulfureus on DMSO was higher compared to DBT being used as the
sole sulfur source and in further experiments it was observed that the resting cells of
Arthrobacter sulfureus grown on DMSO as the sulphur source were more effective
in desulfurizing DBT. A similar observation was reported by Mohebali et al.
(2008).
RSM was used for better understanding of interaction between medium com-
ponents and further optimisation for higher biomass production of Arthrobacter
sulfureus. In order to define the optimal response region of biomass production,
experimental values of biomass yield were subjected to multiple linear regression
analysis using MINITAB 16.
Preliminary trials were carried out to set the concentration range for these
components and significance of regression the lowest and highest level of variables
considered for RSM studies is given in Table 1. The effect of each compound on
biomass production was taken as a response implemented in 20 experiments
wherein 23 factorial design was augmented by 6 axial points (α = 1.682) and three
replicates at the center point.
The effect of glucose, ammonium chloride and DMSO on biomass production
(g/L) was described in the form Eq. (1) and a second order polynomial model in
coded unit of the variables.
Biomass yield ¼ð6:82507Þ þ ð0:132329ÞA þ ð1:55278ÞB þ ð0:00536844ÞC ð0:00141858ÞA2

ð0:159358ÞB2 ð2:91708E 06ÞC2 ð0:0105556ÞAB
þ ð1:08333E 05ÞAC ð3:141667E 04ÞBC
ð1Þ
where variable A is Glucose concentration (g/L), variable B is ammonium chloride

concentration (g/L) and variable C is DMSO concentration (μM).
Table 2 shows the analysis of variance (ANOVA), coefficient determination
(R2), adjusted determination for the experiment. The coefficient determination (R2)
Table 1 Experimental range and design matrix

Component −α −1 0 +1 +α
Glucose (g/l) 0.505 10 25 40 49.495
Ammonium chloride (g/l) 0.0505 1 2.5 4 4.9495
DMSO (µM) 73.4 200 400 600 726.6
Table 2 ANOVA for response surface quadratic model

Source DF Seq SS Adj SS Adj MS F P
Regression 9 15.0930 15.0930 1.67700 48.17 0.000
Linear 3 11.6392 11.6392 3.87973 111.43 0.000
Square 3 2.9100 2.9100 0.97001 27.86 0.000
Interaction 3 0.5437 0.5437 0.18125 5.21 0.023
Lack-of-fit 5 0.2294 0.2294 0.04588 2.19 0.234
Pure error 4 0.0839 0.0839 0.02098 0 0
Total 19 15.4090 0 0 0 0
was shown as 0.9797, indicating 97.97 % of the variability in the response, while
adjusted determination coefficient value was Adj. R2 = 0.95 for which the model
effectively explains and advocates for significance R2 = 97.97 %,
R2(pred) = 84.95 %, R2(adj) = 95.71 %.
3.2 Analysis of Response Surface
The correlation between variables is expressed as surface plots and counter plots.
Figure 1 describes the response surface plots which show the interaction effect of
glucose, ammonium chloride and DMSO concentration on the biomass growth. In
these plots, one factor remains constant at the optimum level whereas the other two
factors vary within their experimental range.
The model was then subjected to optimization using “Response optimizer” of
MINITAB 16 and the optimized biomass yield (y) was found to be 13.31 g/L. The
Fig. 1 Surface plots showing interactive effects of glucose, ammonium chloride and DMSO on
biomass yield of Arthrobacter sulfureus
Fig. 2 Contour plots showing interactive effects of glucose, ammonium chloride and DMSO on
biomass yield of Arthrobacter sulfureus
experiment performed with the concentration of variables after optimization gave a

biomass yield of 13.49 g/L and hence the effectiveness of the design at optimized
conditions was verified (Fig. 2).
3.3 Biodesulphurisation of Model Oil
3.3.1 Effect of Cell Density on BDS of Model Oil
To study the impact of cell concentration of Arhtrobacter sulfureus on desul-

phurisation of model oil, resting cells were prepared which acts as an aqueous
phase. Cell suspension of 0.2, 1, 2, 3 and 4 g (DCW) L−1 in aqueous phase is mixed
with model oil (having 20 ppm sulphur content) at a ratio of 3:1 (water-oil ratio) in
100 ml Erlenmeyer flasks with total working volume of 20 ml for biphasic system.
Rotary shaker was used to agitate the flask at 150 rpm, 30 °C and stopped after
5 days. Sulphur reduction was analysed using X-ray fluorescence spectrometer
(XRF). As shown in Fig. 3, the sulphur reduction increased with increasing
Fig. 3 Final sulphur 40
% of Sulphur
concentration in two-phase
Reduction
reaction of model oil for
20
different cell concentration
0
0.2 0.5 1 2 3 4
Biomass (g/L) DCW
biomass concentration until 1 g/L and later started decreasing at higher biomass
concentration, possibility being due to the mass transfer limitation, especially
oxygen transfer needed for the oxidation reaction of DBT as said by Maghsoudi
et al. (2000) by examining Rhodococcus sp. P32C1. This implies that the higher
biocatalyst concentration did not mean more DBT molecules converted, and
probably the process would achieve better conversion level by increasing interface
surface.
3.3.2 Effect of Sulphur Concentration on BDS of Model Oil
Two-phase reaction was carried out for different DBT concentrations of 10–40 ppm
having dissolved in the organic solvent (hexadecane), setting the optimised aqueous
phase cell concentration (1 g DCW/L) keeping the ratio of water-oil as 3:1.
Desulphurisation percentages of model oil were analysed after 5 days of reaction
time i.e., incubation on a rotary shaker at 30 °C and 150 rpm using XRF. As shown
in Fig. 4. In biphasic media, Arthrobacter sulfureus showed lower desulphurisation
percentages with increasing concentration of DBT. The reason for lower desul-
phurisation percentage is due to lower diffusivity rate of DBT into aqueous phase
(Caro et al. 2007). In addition, end-product inhibition effects could also be
responsible since the potent 4S pathway inhibitor is HBP (Monticello 2000).
3.3.3 Effect of Phase Ratio on BDS of Model Oil
W/O ratio of 0.75, 1.0, 1.5, 3 and 5 are considered at optimum DBT and cell
concentration. Sulphur reduction of model oil after 5 days of reaction time is
analysed using XRF (volume of the oil is changed while keeping the volume and
Fig. 4 Final sulphur 60

% of Sulphur
Reduction
reaction of model oil for 40
different DBT concentration
20
0
10 20 30 40
Sulphur Content (ppm)
Fig. 5 Final sulphur
% of Sulphur
100
reduction
reaction of model oil for
50
different biphasic W/O ratio
0
05:01 03:01 1.5:01 01:01 0.75:01
W/O ratio
the cell concentration of aqueous phase invariable). From Fig. 5, it is observed from
the graph that the ratio of 1.5:0.1 showed higher desulphurisation reaction with
reduction of up to 82.9 % compared to other ratios. This may be due to mass
transfer limitations. Mixing is a necessity for a good mass transfer for creating a
satisfactory oil-cell-water contact (Montecello 2000).
3.3.4 Biodesulphurisation of Diesel Oil
Once the optimum values for cell concentration, DBT concentration and phase ratio
was obtained for sulphur removal in model oil, sulphur removal from diesel oil was
analysed using same optimal conditions as for the model oil. Shake flask studies are
carried out by replacing hydrocarbon phase of model oil with high-speed diesel
sample (7 ppm). The phosphate buffer (with 2 % glucose) desulphurisation rates as
shown in the results were 78.57 % after 5 days of BDS reaction. The decrease in
sulphur content of high-speed diesel of 7 ppm (control) to 1.5 ppm shows that the
strain has high capability for desulphurisation of diesel oil treated by HDS.
4 Conclusion
DBT has been used as the sulphur compound for growth by most researchers.
However, mass production of organism using DBT has been considered commer-
cially impractical because of its high price, low water solubility and growth inhi-
bition by 2-HBP. Therefore, some researchers had previously made an effort to find
a alternative sulphur source to DBT such as DMSO. Experimental observations
have shown that resting cells of Arthrobacter sulfureus grown on DMSO as the
sulphur source has higher growth rate than compared to DBT and were able to
desulfurize DBT from oil.
BDS process can be efficiently developed by mass production of organism with
high desulphurisation activity to be economically feasible. Therefore one can
implement an experimental or statistical design like RSM with the objective of
identifying the combination of nutrient concentrations that will lead to the highest
cell mass concentration, since even small changes in medium formulation is said to
have a significant impact on the outcome. The biomass yield of Arthrobacter
sulfureus obtained after RSM is found to be 13.49 g/L which was previously
7.6 g/L before RSM studies.
Biphasic BDS system is studied for conditions like cell density effects, DBT
(substrate) concentration effects and W/O ratio effects, the optimised conditions for
the same has been studied and implemented in order to obtain high BDS reaction
for both the model oil and diesel oil. Maximum percentage of sulphur reduction for
model oil and diesel sample was found to be 85.7 and 78.57 % respectively.
Therefore this shows that Arthrobacter sulfureus can be efficiently used for BDS
reaction.
References
Arulkumar, M., Sathishkumar, P., Palvannan, T.: Optimization of orange G dye adsorption by
activated carbon of Thespesia populnea pods using response methodolog. J. Hazard. Mater.
186, 827–834 (2001)
Caro, A., Boltes, K. Leton, P., Garcıa-Calvo, E.: Dienzothiophene biodesulfurization in resting cell
conditions by aerobic bacteria. Biochem. Eng. J. 35, 191–197 (2007)
Gallagher, J.R., Olson, E.S., Stanley, D.C.: Microbial desulfurization of dibenzothiophene: a
sulfur-specific pathway. FEMS Microbiol. Lett. 107, 31–36 (1993)
Hasan, S.H., Ranjan, D., Talat, M.: Water hyacinth biomass (WHB) for the biosorption of
hexavalent chromium: optimization of process parameters. Bioresource 5(2), 563–575 (2010)
Labana, S., Pandey, G., Jain, R.K.: Desulphurization of dibenzothiophene and diesel oils by
bacteria. Lett. Appl. Microbiol. 40, 159–163 (2005)
Luo, M.F., Xing, J.M., Gou, Z.X., Li, S., Liu, H., Chen, J.Y.: Desulfurization of dibenzothiophene
by lyophilized cells of Pseudomonas delafieldii R-8 in the presence of dodecane. Biochem.
Eng. J. 13, 1–6 (2003)
Maghsoudi, S., Kheirolomoom, A., Vossoughi M., Tanaka E., Katoh S.: Selective desulfurization
of dibenzothiophene by newly isolated Corynebacterium sp. strain P32C1. Biochem. Eng. J. 5,
11–6 (2000)
Matsui, T., Hirasawa, K., Konishi, J., Tanaka, Y., Maruhashi, K., Kurane, K.: Microbial
desulfurisation of alklated di enzothiophene and alkylated benzothiophene by recombinant
Rhodococcus sp. Strain T09. Appl. Microbiol. Biotechnol. 56,196–200 (2001)
Mohbeali, G., Ball, A.S., Katash, A., Rasekh, B.: Dimethyl sulfoxide (DMSO) as the sulfur source
for the production of desulfurizing resting cells of Gordonia alkanivorans RIPI90A.
Microbiology 154, 878–885 (2008)
Moheali, G., Ball, A., Katash, A., Rasekh, B.: Stailization of water/gas oil emulsions by
desulfurizing cells of Gordonia alkanivorans RIPI90A. Microbiology (UK) 153, 1573–1581
(2007)
Monticello, D.J.: Biodesulfurization and the upgrading of petroleum distillates. Curr. Opin.
Biotechnol. 11, 540–546 (2000)
Olson, E.S., Stanle, D.C., Gallaguer, J.R.: Characterization of intermediates in the microbial
desulfurization of di enzothiophene. Energy Fuels 7, 159–64 (1993)
Omori, T., Monna, L., Saiki, Y., Kodama, T.: Desulfurization of dibenzothiophene by
Corynebacterium sp. strain SY1. Appl. Environ. Microbiol. 58, 911–915 (1992)
Rhee, S.K., Chang, J.H., Chang, H.N.: Desulfurization of dibenzothiophene and diesel oils by a
newly isolated Gordonia strain CYKS1. Appl. Environ. Microbiol. 64, 2327–2331 (1998)
Shan, G., Xing, J., Zhang, H., Liu, H.: Deep desulfurization of hydrodesulfurized diesel oil by
Pseudomonas delafieldii R-8. J. Chem. Technol. Biotechnol. 80, 420–424 (2005)
Tanyildizi M.Ş.: Modeling of adsorption isotherms and kinetics of reactive dye from aqueous
solution by peanut hull. Chem. Eng. J. 168, 1234–1240 (2011)
Wu, J., Wang, J.L., Li, M.H., Lin, J.P., Wei, D.Z.: Optimization of immoilization for selective
oxidation of benzyl alcohol by Gluconobacter oxydans using response surface methodolog.
Biores. Technol. 101, 8936–8941 (2010)
Yan, H., Kishimoto, M., Omasa, T., Katakura, Y., Suga, K., Okumura, K.: Increase in
desulfurization activity of Rhodococcus erythropolis KA2-5-1 using ethanol feeding. J. Biosci.
Bioeng. 89(4), 361–366 (2000)
Yu, B., Xu, P., Shi, Q., Ma, C.: Deep desulphurization of diesel oil and crude oils by a newly
isolated Rhodococcus erthropolis strain. Appl. Environ. Microbiol. 72, 54–58 (2006)
Effect of Electrodeposited Copper Thin
Film on the Morphology and Cell Death
of E. Coli; an Electron Microscopic Study
Arun Augustin, Harsha Thaira, K. Udaya Bhat

and K. Rajendra Udupa
1 Introduction
According to study results from the Centres for Disease Control and Prevention
(CDC), hospital acquired infection affects two million people per year, one lacks are
dying among them (Reed and Kemmerly 2009; Hassan et al. 2014). Hence, the role
of antimicrobial touch surface in hospital has more significance. Even though
copper was used against infectious diseases since BC 400, the recent evolution of
new microbes renaissance the research of antimicrobial activity and mechanisms of
killing microbes by copper (Borkow and Gabbay 2005). The rapid biocidal action
of copper was proved against E. coli and salmonella (Warnes et al. 2012). Many
mechanisms has reported for the mode of attacking of copper to microbes which
includes plasma membrane attacking by Cu2+ ions, copper initiate protein damage
and DNA distortion by copper ions (Borkow and Gabbay 2005). But Santo et al.
(2011) stated that copper is not targeted the DNA in E. coli. Recent studies revealed
that copper attacks on the Fe–S clusters in hydratases and thereby inactivate the
proteins (Santo et al. 2011; Ben-Sasson et al. 2013; Macomber and Imlay 2009).
The understanding of the mechanisms of killing the microbes by the copper is not
complete till now. In most of the proposed mechanisms, cell wall is the primary
target of attack. In the present study to understand the effect of copper on structure
and morphology of gram negative bacteria, E. coli has treated with 99.99 % pure
A. Augustin (&) K. Udaya Bhat K.R. Udupa

Department of Metallurgical and Materials Engineering, National Institute
of Technology Karnataka, Surathkal, Mangalore, India
e-mail: arunmalabar@yahoo.com
K. Udaya Bhat
e-mail: udayabhatk@gmail.com
H. Thaira
Chemical Engineering Department, National Institute of Technology Karnataka,
Surathkal, Mangalore, India

DOI 10.1007/978-981-10-1920-3_25
228 A. Augustin et al.
copper thin film which is prepared by electrodeposition. The structural and mor-
phological changes of E. coli has been analysed by scanning electron microscope
and transmission electron microscope.
5 μm thick copper thin film coating (99.99 % pure) has been done on the com-
mercial pure aluminium of 1 cm2 surface area by electrodeposition. The freshly
coated coupons were kept in the 20 mL E. coli ATCC 25922 culture with
approximate concentration of 107 CFU/mL for 6 h. Equal amount of the same
culture was kept without copper as control. The culture was washed in distilled
water, centrifuge at 1000 rpm and dried at 35 °C using hot air oven before electron
microscopic analysis. The same culture sample has been serially diluted and plated
on MHA plate to estimate the number of viable cells from the CFU count. The
morphological study of the copper treated and non-treated E. coli cell was done by
Scanning Electron Microscopy (SEM, JSM-6380, JEOL make). The presence of
copper on treated sample was confirmed from Energy Dispersive Spectroscope
(EDS) attached with SEM. The structural changes of E. coli due to the copper
treatment has analysed by Transmission Electron Microscope (TEM, JEM-2100,
JEOL make) and the elemental composition of copper treated cell and non-treated
cell has been estimated using EDS attached with TEM.
3 Results
Figure 1a shows the SEM micrographs of copper treated E. coli bacteria and
Fig. 1c represent the EDS corresponding to the same. Compared to the SEM
micrograph of non-treated E. coli (as shown in Fig. 1b), the treated cells were
damaged and wrinkled. Initially the cells were rod shaped as shown in Fig. 1b.
The EDS corresponding to Fig. 1b was shown in Fig. 1d. Compared to normal
E. coli, EDS results showed that copper treated cells contain 0.1 at.% of copper in
the cell. It indicates that noticeable amount of copper ions were present either inside
the E. coli cell or at the surface of the cell.
Figure 2a shows the bright field TEM micrograph of the copper treated E. coli
cell. The noticeable change in the cell structure can be observed as compared to the
TEM image of non-treated one, as shown in Fig. 2b. The presence of copper in the
treatable cell was confirmed from EDS shown in Fig. 2c and that for non-treated
cell was shown in Fig. 2d. The TEM micrograph showed that the treated cell has
been shrinked to 25 % in size after the copper treatment. The observed distorted
and shrunk, rod shape of the E. coli is attributed to the leaking out of cell fluid by
copper treatment. The number of viable cells calculated from the CFU count shows
Effect of Electrodeposited Copper Thin Film … 229
Fig. 1 a and b SEM micrograph of copper treated and non-treated E. coli cell, c and d EDS
corresponding to copper treated and non-treated E. coli cell respectively
that 96 % of the cells (viable cell count in control = 22.4 × 106 cells/mL and that
of copper coated sample = 8.9 × 105 cells/mL) were dead.
4 Discussion
The electron microscopic images elucidated that the cell membrane as the target of
copper attack on E. coli. The copper ion treated samples were observed as wrinkled
and damaged as compared to the non-treated E. coli cells. The wrinkling has
happened due to the leakage of body fluids to the extra cellular space. The outer
Fig. 2 a and b TEM micrograph of copper treated and non-treated E. coli cell, c and d EDS
corresponding to copper treated and non-treated E. coli cell respectively
membrane of E. coli is made up of lipopolysaccharides, phospholipids and proteins

(Bai et al. 2007). Lipopolysaccharide contains negatively charged groups, which
can attract Cu+ and Cu2+ ions from copper surfaces. These copper ions steal the
electrons from the cell wall and affect its integrity. Damage to cell membrane by
copper is reported (Santo et al. 2011; Ben-Sasson et al. 2013). When a bacterium
comes in contact with a copper surface, a short circuiting of the current in the cell
membrane can occurs between positively charged copper ions and negatively
charged cell wall. This weakens the membrane and creates holes (Rai and Duran
2011). This disturbs the selective permeability of the plasma membrane. The efflux
and influx of the cell imbalanced and loss of K+ ions from the cytoplasm reduces its
conductivity (Bai et al. 2007). As a result the copper controlling enzymes like
CopA, CueO and CuS were inactivated. Moreover the proteins were inactivated due
to the breakage of Fe–S bonds in cytoplasmic hydratases like dihydroxy-acid
dehydratase in the common branched chain pathway and isopropylmalate isomerase
(IPMI) in the leucine-specific branch as reported by Macomber and Imlay (2009).
The inherent affinity of copper ions to sulphur makes the rapid cell death and
prolonged exposure of cells made the permanent damage of cell wall. Another
possibility reported is formation of reactive oxygen species (ROS) at the
Effect of Electrodeposited Copper Thin Film … 231
intracellular region due to the presence of copper in aqueous medium. This gen-
erates oxidative stresses in the bacteria followed by DNA damage and finally failure
(Shi et al. 2012). It is essential to note that the exact mechanism for microbial
damage by copper is not fully understood. Our TEM micrographs indicate a
reduction in cell volume to 25 % of initial volume (Fig. 2a, b) and this is possible
only if membrane is damaged and cell fluid flows out from the cell. EDS data
(Fig. 2c) also indicates the presence of copper ions in the damaged cell. So we
conclude that copper is altering morphology and cell death of E. coli.
5 Conclusions
Copper induced cell damage of E. coli has been observed in the SEM and TEM
analysis. The E. coli cell which is treated with copper was found to be wrinkled and
damaged as compared to the non-treated cell because cell wall was broken, intra-
cellular fluids were leaked out to the extracellular space. The inclusion of copper
into the cell was confirmed by EDS attached with SEM and TEM. The Cu2+ ions
was damaged the cell integrity. Copper ions have broken Fe–S bonds in the
hydratases and which leads to the inactivation of cells.
Acknowledgments Authors would like to thank Department of Chemical Engineering NITK

Surathkal for providing lab facilities to do E. coli culture preparation. Arun Augustin would like to
thank MHRD, India for research fellowship.
References
Bai, W., Zhao, K., Asami, K.: Effects of copper on dielectric properties of E. coli cells. Colloids
Surf. B 58(2), 105–115 (2007)
Ben-Sasson, M., Zodrow, K.R., Genggeng, Q., Kang, Y., Giannelis, E.P., Elimelech, M.: Surface
functionalization of thin-film composite membranes with copper nanoparticles for antimicro-
bial surface properties. Environ. Sci. Technol. 48(1), 384–393 (2013)
Borkow, G., Gabbay, J.: Copper as a biocidal tool. Curr. Med. Chem. 12(18), 2163–2175 (2005)
Hassan, I.A., Parkin, I.P., Nair, S.P., Carmalt, C.J.: Antimicrobial activity of copper and copper
(I) oxide thin films deposited via aerosol-assisted CVD. J. Mater. Chem. B 2(19), 2855–2860
(2014)
Macomber, L., Imlay, J.A.: The iron-sulfur clusters of dehydratases are primary intracellular
targets of copper toxicity. Proc. Natl. Acad. Sci. 106(20), 8344–8349 (2009)
Rai, M., Duran, N.: Metal Nanoparticles in Microbiology. Springer, Berlin (2011)
Reed, D., Kemmerly, S.A.: Infection Control and Prevention: A Review of Hospital-Acquired
Infections and the Economic Implications, vol. 9, pp. 27–31 (2009)
Santo, C.E., Lam, E.W., Elowsky, C.G., Quaranta, D., Domaille, D.W., Chang, C.J., Grass, G.:
Bacterial killing by dry metallic copper surfaces. Appl. Environ. Microbiol. 77(3), 794–802
(2011)
Shi, M., Kwon, H.S., Peng, Z., Elder, A., Yang, H.: Effects of surface chemistry on the generation
of reactive oxygen species by copper nanoparticles. ACS Nano 6(3), 2157–2164 (2012)
Warnes, S., Caves, V., Keevil, C.: Mechanism of copper surface toxicity in Escherichia coli O157:
H7 and Salmonella involves immediate membrane depolarization followed by slower rate of
DNA destruction which differs from that observed for Gram-positive bacteria. Environ.
Microbiol. 14(7), 1730–1743 (2012)
Optimization of a Glucocorticoid
Encapsulated PLGA Nanoparticles
for Inflammatory Diseases
Sriprasad Acharya and Bharath Raja Guru
1 Introduction
Age related macular degeneration and retinitis pigmentosa are one of the major
causes for blindness all around the world. It is a slow and progressive condition
assisted by activated microglia by aggravating internal inflammation. These acti-
vated microglia release chemically active molecules that cause cell damage within
the outer retina (Lezzi et al. 2012). A viable treatment for this condition is nearly
non-existent. Steroids, like prednisolone, have been used as anti-inflammatory
agents. Unfortunately these drugs in present dosage lead to severe side effects. Use
of biodegradable polymers for encapsulating the drug will not only help in a
sustained release but also help in reducing the severe side effects.
PLGA was selected as the carrier since it is one of the most widely used polymer
for drug delivery applications (Danhier et al. 2012). The degradation time can be
well controlled by varying the copolymer ratio and molecular weight (Vert et al.
1994; Prokop and Davidson 2008).
The drug prednisolone used in the study, is classified as a synthetic glucocor-
ticoid, used in the treatment of several inflammatory and auto-immune conditions.
Prolong use is known to cause depression, insomnia, mood swings and memory
loss. Thus optimized nanoparticles of PLGA encapsulating the drug prednisolone
(Pred-PLGA-NPs) could significantly help in reducing the side effects. Quality by
Design is recognized and implemented by regulatory agencies worldwide. The
objective of the study was to develop Pred-PLGA-NPs and analyze the effect of the
S. Acharya
Department of Chemical Engineering, Manipal Institute of Technology, Manipal, India
e-mail: sriprasad.acharya@manipal.edu
B.R. Guru (&)
Department of Biotechnology, Manipal Institute of Technology, Manipal, India
e-mail: Bharath.guru@manipal.edu

DOI 10.1007/978-981-10-1920-3_26
234 S. Acharya and B.R. Guru
important factors on the responses like size and drug loading. A 23 factorial design
was adopted to formulate the Pred-PLGA-NPs.
2.1 Materials
PLGA 50:50 (100,000–120,000) was purchased from Durect Corporation AL,

USA. Prednisolone, Polyvinyl alcohol and chloroform were purchased from
Sigma-Aldrich.
2.2 Experiment Design
A 23 factorial design method was employed for the formulations. The variables
considered for the study, along with the levels are shown in Table 1. Design expert
software (version 9) was employed to design the formulations.
2.3 Preparation of Pred-PLGA-NPs Using Solvent

Evaporation Technique
Predetermined quantities of prednisolone and PLGA were dissolved in 1.5 ml of

chloroform. An oil-in-water emulsion was formed by emulsifying the polymer
solution in 15 ml of 1–3 % w/v aqueous PVA solution using a probe sonicator for
2–4 min over an ice bath. The resultant emulsion was then stirred for 18 h at
ambient conditions to remove chloroform. Nanoparticles were recovered by cen-
trifugation (15,000 rpm) and washed three times with deionized water to remove
excess PVA, followed by lyophilization prior to storage. The formulation compo-
sition is summarized in Table 2.
Table 1 The independent and dependent variables with levels

Independent variables Levels Dependent variables (responses)
Low High
Drug/polymer ratio (Factor A) 0.2 0.5 Particle size
PVA concentration (%) (Factor B) 1 3 Zeta potential
Sonication time (Factor C) 2 4 Drug loading
Optimization of a Glucocorticoid Encapsulated PLGA Nanoparticles … 235
Table 2 Formulations and their quantities

Formulation Factor A: D/P ratio Factor B: PVA (%) Factor C: Son. time (min)
P1 0.20 1.00 2.00
P2 0.50 1.00 2.00
P3 0.20 3.00 2.00
P4 0.50 3.00 2.00
P5 0.20 1.00 4.00
P6 0.50 1.00 4.00
P7 0.20 3.00 4.00
P8 0.50 3.00 4.00
2.4 Measurement of Size and Zeta Potential
Average particle size (z-average), zeta potential of the developed NPs was deter-
mined by laser dynamic light scattering using Malvern Zetasizer (Malvern,
Worcestershire, UK).
2.5 HPLC Conditions
HPLC was performed using (SHIMADZU Model SPD 20A) equipped with a
binary solvent delivery pump. The chromatographic separation was performed on a
reverse phase Eclipse plus C18 column, (150 × 4.6 mm, 3.5 μ) and the absorbance
was monitored at 254 nm. The system was run with a mobile phase consisting of
water +0.1 % TFA: acetonitrile +0.1 % TFA in the ratio of 60:40 (v/v) and was
delivered at a flow rate of 0.5 mL/min.
A set of 8 runs were conducted with 3 independent and 3 dependent variables. All
formulations underwent characterization for average particle size, drug loading and
zeta potential. The effect of factors on the responses was studied (Table 3) and their
respective contour plots were developed.
3.1 Effect on Zeta Potential
The zeta potential for nanoparticles helps in assessing the stability of the colloidal
systems. The analysis found no significant factors but some unaccounted lurking
Table 3 Response data for the complete set of runs

Std Factor Factor Factor C: Response 1 Response Response 3 Drug
A: D/P B: PVA Son. time D 2 Zeta pot loading (µg drug/mg
ratio (%) (min) (z-average) of NPs)
1 0.20 1.00 2.00 1696 −3.51 13.042
2 0.50 1.00 2.00 537 −4.64 22.184
3 0.20 3.00 2.00 2354 −13.1 7.184
4 0.50 3.00 2.00 691 −10.4 21.217
5 0.20 1.00 4.00 347 −10.9 5.8
6 0.50 1.00 4.00 503 −14 18.203
7 0.20 3.00 4.00 796 −2.2 9.011
8 0.50 3.00 4.00 539 −11.5 26.892
Fig. 1 Zeta potential distribution and size distribution graph of drug loaded PLGA NPs (P5)
variable may have influenced the response during the experiment. The values
ranged from −2.2 to −14 mV. Figure 1 shows the zeta potential and size distri-
bution graphs for the drug loaded PLGA NPs (P5).
3.2 Effect on z-Average
The factor Drug/polymer ratio (30.35 %) and Sonication time (33.98 %) were
found to have significant effect on the size of the NPs. There were no interaction
effects. z-Average of developed NPs were in the range of 347 d nm (P5)–2354 d
nm (P3) for different variable combinations (Fig. 2).
The model with an F-value of 97.34 was found to be significant (p < 0.0001)
along with the R-square values, which were in reasonable agreement (Predicted:
0.9345, Adjusted: 0.9857). The observed adequate precision ratio was 27.311,
which is well above the minimum prescribed ratio of 4, resulting in a satisfactory
signal-to-noise ratio. Thus, this model could be used to navigate the design space.
Design-Expert® Software
Factor Coding: Actual D arg
3.00
D arg
Design Points
2354
347
2.50 2000
X1 = A: D/P Ratio
X2 = B: PVA
B: PVA (%)
Actual Factor
C: Son. time = 2.00
2.00 1500 1000
1.50
1.00
0.20 0.27 0.35 0.43 0.50
A: D/P Ratio
Fig. 2 Contour plot showing effect of D/P ratio and PVA on size of the particle
z-average ¼ 4467 7710 A þ 429:58333 B 1180:25 C

764:16667 A B þ 2267:5 A C ð1Þ
The analysis revealed that the Drug/polymer ratio and Sonication time had a
significant but negative effect on the z-average of the polymeric NPs. During
emulsification, an increase in drug/polymer ratio may lead to an optimum amount
of PLGA being utilized for the encapsulation of the drug (Feczkó et al. 2011; Seju
et al. 2011), thus helping in reducing the size of the NPs. The particle size also
reduced with the increase in sonication time as finer droplets were being formed by
the prolonged and concentrated supply of energy. The factor PVA, showed a slight
positive effect as compared to the other factors.
3.3 Effect on Drug Loading
The concentration of the drug loaded (µg drug/mg of NP) was found in the range of
5.8 (P5)–26.892 (P8). The model with an F-value of 26.38 was found to be
Design-Expert® Software
Factor Coding: Actual Drug loading (ug drug /mg of NP)
3.00
Drug loading (ug drug /mg of NP) 25
Design Points
26.892
5.8
2.50
X1 = A: D/P Ratio
X2 = B: PVA
20
B: PVA (%)
Actual Factor
C: Son. time = 4.00
2.00 10 15
1.50
1.00
0.20 0.27 0.35 0.43 0.50
A: D/P Ratio
Fig. 3 Contour plot showing effect of D/P ratio and PVA on drug loading
significant (p < 0.0001) along with the R-square values, which were in reasonable
agreement (Predicted: 0.7610, Adjusted: 0.9477). The observed adequate precision
ratio was 12.761, which is well above the minimum prescribed ratio of 4, resulting
in a satisfactory signal-to-noise ratio. Thus, this model could be used to navigate the
design space.
Drug loading ¼ 20:06838 þ 27:26750 A 9:41179 B

5:14638 C þ 8:64083 A B þ 2:34063 B C ð2Þ
The factor Drug/polymer ratio was found to have the most significant effect
(83.89 %) on drug loading. The other factors showed no significant effect on the
response (Fig. 3).
The drug loading increased with the increase in the drug to polymer ratio. The
drug-polymer interaction and drug miscibility in the organic solution affects the
percentage drug entrapment in the NPs (Panyam et al. 2004). An increase in
concentration of the drug and polymer in the organic phase causes the viscosity of
the organic phase to increase, leading to lesser drug movement into aqueous phase.
This may have brought about an increase in the amount of drug inside the NPs
(Song et al. 2008).
By applying the constraints (minimize size and maximize the drug loading) on
the dependent factors, an optimum Pred-PLGA-NPs formulation was selected.
Keeping desirability factor as a basis, Design Expert software was employed to
predict the process parameters for the optimized NPs. These Pred-PLGA-NPs
obtained by employing the optimized process parameters (0.5:1, 3 % and 4 min)
were characterized for z-average (549.8 nm), zeta potential (−15.6 mV) and drug
loading (21.169 µg/mg). The response values were in good agreement with the
software-predicted values (568.5 nm, −9.950 mV and 25.930 µg/mg), thereby
reaffirming the validity of the model.
4 Conclusion
To determine the effects of process variables, a 3-factorial 2-level design and

analysis was been carried out. Drug/polymer ratio and sonication time had the most
significant effect on the size of the NPs. Maximum levels of Drug/polymer ratio and
sonication time showed to produce the smallest particle size. Drug/polymer ratio
alone was found to have the most significant and also the largest positive effect on
drug loading. The study also found that none of the selected process variables had
any significant effect on the zeta potential of the particles.
References
Danhier, F., Ansorena, E., Silva, J.M., Coco, R., Le Breton, A., Préat, V.: PLGA-based
nanoparticles: an overview of biomedical applications. J. Controlled Release 161, 505–522
(2012)
Feczkó, T., Tóth, J., Dósa, G., Gyenis, J.: Influence of process conditions on the mean size of
PLGA nanoparticles. Chem. Eng. Process. 50(8), 846–853 (2011)
Lezzi, R., Guru, B.R., Glybina, I.V., Mishra, M.K., Kennedy, A., Kannan, R.M.: Dendrimer-based
targeted intravitreal therapy for sustained attenuation of neuroinflammation in retinal
degeneration. Biomaterials 33(3), 979–988 (2012)
Panyam, J., William, D., Dash, A., Leslie-Pelecky, D., Labhasetwar, V.: Solid-state solubility
influences encapsulation and release of hydrophobic drugs from PLGA/PLA nanoparticles.
J. Pharm. Sci. 93(7), 1804–1814 (2004)
Prokop, A., Davidson, J.M.: Nanovehicular intracellular delivery systems. J. Pharm. Sci. 97,
3518–3590 (2008)
Seju, U., Kumar, A., Sawant, K.K.: Development and evaluation of olanzapine-loaded PLGA
nanoparticles for nose-to-brain delivery: in vitro and in vivo studies. Acta Biomater. 7(12),
4169–4176 (2011)
Song, X., Zhao, Y., Hou, S., Xu, F., Zhao, R., He, J., Cai, Z., Li, Y., Chen, Q.: Dual agents loaded
PLGA nanoparticles: systematic study of particle size and drug entrapment efficiency. Eur.
J. Pharm. Biopharm. 69(2), 445–453 (2008)
Vert, M., Mauduit, J., Li, S.: Biodegradation of PLA/GA polymers: increasing complexity.
Biomaterials 15, 1209–1213 (1994)

Biotechnology and Biochemical Engineering: Prasanna B.D. Sathyanarayana N. Gummadi Praveen V. Vadlani Editors

Uploaded by

Copyright:

Available Formats

Biotechnology and Biochemical Engineering: Prasanna B.D. Sathyanarayana N. Gummadi Praveen V. Vadlani Editors

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Biotechnology and Biochemical Engineering: Prasanna B.D. Sathyanarayana N. Gummadi Praveen V. Vadlani Editors

Uploaded by

Copyright:

Available Formats

Prasanna B.D.

ISBN 978-981-10-1919-7 ISBN 978-981-10-1920-3 (eBook)

Library of Congress Control Number: 2016947027

© Springer Science+Business Media Singapore 2016

Printed on acid-free paper

This Springer imprint is published by Springer Nature

The Department of Chemical Engineering, National Institute of Technology

Karnataka, India Prasanna B.D.

Selection of Medium and Optimization of Process Parameters

Modeling and Theoretical Analysis of

Design and Fabrication of Miniature Bubble Column

Dr. Prasanna B.D. is Assistant Professor in the Department of Chemical

Harsha Thaira, Shraddha S. Bhosle, Rajmohan Balakrishnan

H. Thaira (&) S.S. Bhosle R. Balakrishnan K. Raval

© Springer Science+Business Media Singapore 2016 1

The very ﬁrst report of melanin production was reported in Pseudomonas

2 Materials and Methods

2.1 Microorganisms and Culture Conditions

2.2 Growth Studies

2.3 Optimization of Nutritional Parameters

All the experiments conducted used a constant media volume of 50 ml in 250 ml

2.4 Effect of Inoculum Age

2.5 Effect of Inoculum Size

2.6 Effect of Shaking Frequency

The shaking frequency was optimized by incubating the Erlenmeyer flasks in

2.8 Effect of Temperature

2.9 Effect of Different Growth Media

2.10 Effect of Carbon Sources

2.11 Effect of Organic Nitrogen Sources

2.12 Effect of L-Tyrosine

2.13 Extraction and Puriﬁcation of Melanin

2.14 Characterization Studies

Puriﬁed melanin was dissolved in 0.1 N NaOH for UV-visible spectrophotometric

3 Results and Discussions

3.1 Effect of Inoculum Age

3.2 Effect of Inoculum Size

Different inoculum volumes (0.5, 5, 10, 15 and 20 %) were investigated to observe

3.3 Effect of Shaking Frequency on Biomass Production

3.4 Effect of Shaking Frequency on Melanin Production

3.5 Effect of Growth Media

Fig. 1 Melanin productions 180

3.6 Melanin Yield Before and After Optimization

3.7 UV-Visible Absorption Spectra and FTIR Analysis

Fig. 2 Melanin yield before and after optimization

Fig. 3 The UV absorption spectrum of melanin produced by Pseudomonas stutzeri HMGM-7

(b) MS-1R) 1/cm

Abhinandan Dhavale, Atul Vhanmarathi, Shrinivas Deshmukh

Glutathione (GSH) is a biologically active tri-peptide consisting of L-glutamate,

A. Dhavale (&) A. Vhanmarathi S. Deshmukh S. Dabeer

© Springer Science+Business Media Singapore 2016 11

As mentioned above, many kinds of literature provide information about the

2 Materials and Methods

2.2 Culture Maintenance

2.4 Biomass Determination

2.5 Glucose Determination

2.6 Glutathione (GSH) Determination

After 16 h of fermentation, broth was subjected to centrifugation to achieve bio-

2.7 Fermentation Description Using Unstructured

2.7.1 Biomass Growth