Flu Case Study

Name: ______________________Michael Fanizzi____________________ID: _____________________
Decoding the Flu: A Case Study in Viral Gene Expression

adapted from the National Center for Case Study Teaching in Science
Introduction
Jason was worried. He had landed a summer internship at the National Center for Preparedness,
Detection, and Control of Infectious Diseases (NCPDCID). His boss also let him tag along on a CDC
research trip to rural Mexico. However, what had appeared to be a wonderful opportunity didn’t
seem so great when the team contracted one of the lu viruses they had been studying. So far, he
was the only one other than the team leader, Dr. Phillips, who was not sick.
Earlier that morning, Dr. Phillips told Jason she had a job for him. “Normally, I would give this to a
senior staffer, but they’re all sick. We think there may be a problem with the lu virus the team has
caught. Here’s some background. I’ll be right back with your assignment.”
Dr. Phillips came back a few minutes later. “Here is the situation. The team appears to have
contracted an atypical lu virus. For starters, the symptoms are worse than usual and even healthy
adults are getting severely ill. Also, none of the team’s vaccinations protected them from this virus.
We’re worried that we are dealing with a new strain of in luenza we haven’t seen before. We need
to igure out how this virus is different.”
“The hemagglutinin (HA) protein helps the lu virus infect cells and the structure of this protein
can vary in different virus strains. I want you to compare the HA gene for the viruses the team was
examining with a typical lu virus. Because we don’t have power right now, you will have to do this
the old-fashioned way with pencil and paper. I will get you the nucleotide sequence for a typical
HA gene. You can start by inding the coding region for the gene.”
Check for Understanding:

1. What is the most convincing evidence that Dr. Phillips has to indicate that her staff has been
infected by an “atypical [unusual] lu virus?”
None of the teams vaccinations protected them from the virus.
2. What does the HA protein do?
The HA protein helps the lu virus infect cells.
3. How will looking at the nucleotide sequence for the HA gene help Jason determine whether
the team has been affected by a new lu strain?
This can help ind the difference between the regular lu, and this potential new strain of
lu, and could also lead to a solution. If they are two different strains, the sequence would be
different.
f
f
f
f
f
f
f
f
f
f
f
f
f
f
Finding Genes
Recall that a gene is a stretch of DNA sequence that codes for a protein. Genes actually have 2
general regions: a coding region and a regulatory region:
Fig. 1: Regulatory and coding regions of double-stranded DNA
The coding region contains nucleotide sequence that actually determines the amino acid sequence
of the inal protein. The regulatory region contains nucleotide sequence that signals to the cell
where the gene is and when the gene should be expressed. RNA polymerase recognizes speci ic
sequences in the regulatory region and binds at those sites to begin transcription.
Fig. 2: Binding of RNA polymerase and transcription of coding region
Transcription is similar to DNA replication in that one strand of DNA is used as a template strand,
and complementary base pairing rules determine the sequence of the newly synthesized nucleic
acid. However, transcription results in the production of single-stranded messenger RNA
(abbreviated mRNA).
1. What is the mRNAs that could be produced from the DNA below. Indicate which strand was
used as the template strand for your mRNA sequence.
5’ - UAGCCGUCCUGGAAUUUA-3’
f
f
The 3’-5’ is used as the template strand.
2. What does the “m” stand for in mRNA? It stands for Messenger
Translation
Once the mRNA is formed, it exits the nucleus through a
nuclear pore. A ribosome then assembles around the
mRNA. (Remember that ribosomes are small, non-
membrane-bound organelles used for protein synthesis.)
Ribosomes are made of protein and of special structural
RNA called ribosomal RNA (rRNA). Once the ribosome is
assembled, protein synthesis can begin.
The ribosome holds the mRNA in place while molecules

called transfer RNAs (tRNA) carry amino acids to the
mRNA/ribosome complex. Each tRNA has an anticodon—
a sequence of three consecutive bases that recognize and
base pair with the mRNA codons. At the other end of the
tRNA is an amino acid. Complementary base pairing allows
the tRNA molecules to “translate” the mRNA codons into a
polypeptide. Translation occurs in the 5’!3’ direction.
Fig. 3 : Interaction of mRNA codon and

tRNA anticodon
Fig. 4: Translation occurring in the ribosome
1. If the mRNA codon is AUG, what is the corresponding anticodon?
UAC is the corresponding anticodon.
2. What do the circles with three letters in them (“Trp,” “Lys,” “Asp,” etc) represent in Fig. 4?
They represent peptides.

The code has “punctuation” too—codons signaling “start” and “stop.”
3. Use the codon chart to translate the following mRNA. Find the “start” codon irst.
5’CACGGUCGAUGAGGUUACAUACA… 3’
Met, Arg, Leu, His, Thr.
Analyzing Flu Virus Sequence

Dr. Phillips provides Jason with some DNA sequence from the in luenza virus and the known
amino acid sequence of the protein. Below is an mRNA sequence from typical in luenza
hemagglutinin (HA), along with mRNA from the suspected new strain (labeled strain #1). What is
the difference between these two mRNAs? (You may need to translate them to fully answer this
question.)
Typical: AGA: Lys

Strain: GGA: Arg
f
f
f

Flu Case Study

Uploaded by

Copyright:

Available Formats

Flu Case Study

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Flu Case Study

Uploaded by

Copyright:

Available Formats

Name: __Michael FanizziID: _

Decoding the Flu: A Case Study in Viral Gene Expression

Check for Understanding:

None of the teams vaccinations protected them from the virus.

2. What does the HA protein do?

The HA protein helps the lu virus infect cells.

Fig. 1: Regulatory and coding regions of double-stranded DNA

Fig. 2: Binding of RNA polymerase and transcription of coding region

The ribosome holds the mRNA in place while molecules

Fig. 3 : Interaction of mRNA codon and

Fig. 4: Translation occurring in the ribosome

1. If the mRNA codon is AUG, what is the corresponding anticodon?

UAC is the corresponding anticodon.

They represent peptides.

Met, Arg, Leu, His, Thr.

Analyzing Flu Virus Sequence

Typical: AGA: Lys

You might also like