Cell Research (2011) :1-12.

© 2011 IBCB, SIBS, CAS All rights reserved 1001-0602/11 $ 32.00

npg
ORIGINAL ARTICLE www.nature.com/cr

The AP-3 adaptor complex is required for vacuolar

function in Arabidopsis
Marta Zwiewka1, 2, Elena Feraru1, 2, Barbara Möller3, Inhwan Hwang4, Mugurel I Feraru1, 2, Jürgen Kleine-Vehn1, 2,
Dolf Weijers3, Jiří Friml1, 2
1
Department of Plant Systems Biology, VIB, Technologiepark 927, 9052 Gent, Belgium; 2Department of Plant Biotechnology and
Genetics, Ghent University, Gent, Belgium; 3Laboratory of Biochemistry, Wageningen University, Wageningen, The Netherlands;
4
Division of Integrative Biosciences and Biotechnology, Pohang University of Science and Technology, Pohang, Korea

Subcellular trafficking is required for a multitude of functions in eukaryotic cells. It involves regulation of cargo
sorting, vesicle formation, trafficking and fusion processes at multiple levels. Adaptor protein (AP) complexes are
key regulators of cargo sorting into vesicles in yeast and mammals but their existence and function in plants have not
been demonstrated. Here we report the identification of the protein-affected trafficking 4 (pat4) mutant defective in
the putative δ subunit of the AP-3 complex. pat4 and pat2, a mutant isolated from the same GFP imaging-based for-
ward genetic screen that lacks a functional putative AP-3 β, as well as dominant negative AP-3 µ transgenic lines dis-
play undistinguishable phenotypes characterized by largely normal morphology and development, but strong intra-
cellular accumulation of membrane proteins in aberrant vacuolar structures. All mutants are defective in morphol-
ogy and function of lytic and protein storage vacuoles (PSVs) but show normal sorting of reserve proteins to PSVs.
Immunoprecipitation experiments and genetic studies revealed tight functional and physical associations of putative
AP-3 β and AP-3 δ subunits. Furthermore, both proteins are closely linked with putative AP-3 µ and σ subunits and
several components of the clathrin and dynamin machineries. Taken together, these results demonstrate that AP
complexes, similar to those in other eukaryotes, exist in plants, and that AP-3 plays a specific role in the regulation of
biogenesis and function of vacuoles in plant cells.
Keywords: AP-3 complex; PSVs; protein trafficking; vacuole biogenesis and function
Cell Research advance online publication 14 June 2011; doi:10.1038/cr.2011.99

Introduction Proteins linking cargos with the coat proteins form com-
plexes known as adaptor protein (AP) complexes [1-3].
Diverse types of cargos are sorted and transported by APs are key regulators of protein sorting into vesicles.
coated vesicles to multiple destinations in eukaryotic Four different heterotetrameric AP complexes (AP-1
cells. Vesicles that bud from a donor membrane are sub- to AP-4) have been characterized so far in eukaryotes
sequently fused with a target membrane. The process of including yeast, Drosophila and mammals. Each AP is
vesicle budding is initiated by the recruitment of specific composed of four subunits, also called adaptins: two
regulators from the cytosol onto the donor membrane. large subunits (γ/α/δ/ε and β1-β4), a medium subunit
One set of proteins form a coat that can function as a (µ1-µ4) and a small subunit (σ1-σ4). The best-known
scaffold enabling physical membrane deformation, and complexes in vesicle formation and budding are the
another can determine vesicle composition by interact- complexes made of clathrin and APs, such as AP-1 and
ing with cytosolic domains of transmembrane proteins. AP-2. AP complexes are recruited from the cytosol and
required for sorting and concentration of cargos into the
coated pits, as well as for the recruitment of clathrin to
Correspondence: Jiří Friml the membranes. The AP-2 complex mediates the forma-
Tel: +32 (0) 9-33-13-800; Fax: +32 (0) 9-33-13-809
E-mail: jiri.friml@psb.vib-ugent.be
tion of clathrin-coated vesicles for endocytosis from the
Received 21 December 2010; revised 11 February 2011; accepted 17 plasma membrane (PM) to trans-Golgi network/early
March 2011 endosomes (TGN/EEs), while AP-1 functions in clathrin-
npg AP-3 adaptor complex in Arabidopsis
2

dependent sorting at the TGN/EEs. In contrast, it appears calization in root stele cells, we observed strong intracel-
that AP-3 and AP-4 might at least partially function inde- lular accumulations (Figure 1A and 1B). Similarly, other
pendently of clathrin [3, 4]. polar (PIN2 [21]), apolar (PIP2 aquaporin [22] and BRI1
The AP-3 complex is one of the most recently iden- brassinosteroid receptor [23]) PM proteins showed ag-
tified complexes in organisms such as yeast, flies and gregation in intracellular compartments (Figure 1C-1H).
mammals and it has been found to play a role in pro- The pronounced intracellular accumulation of di-
tein sorting at the TGN and/or endosomes [5-8]. The verse proteins had surprisingly little impact on the plant
AP-3-mediated trafficking to the vacuole (in yeast) or morphology because pat4-1 did not show any abnormal
lysosomes and lysososome-related organelles (flies and phenotypes under standard growth conditions (Supple-
mammals) is supposed to bypass the classical vacuolar mentary information, Figure S1A and S1B). However,
trafficking route, which most vacuolar cargos use and about 40% of pat4-1 seedlings, when grown on medium
that involves late endosomes/prevacuolar compartments lacking sucrose, showed arrested growth at the seedling
multivesicular bodies/(LE/PVC/MVB’S) [5, 6, 8, 9]. Re- stage (Figure 1I and 1J). In addition, the germination ca-
cently, we have shown that the putative AP-3 β protein pacity of pat4 mutant seeds decreased strongly with time
plays a role in vacuolar function in Arabidopsis, includ- of storage as compared to control (not shown).
ing mediation of the transition between storage and lytic Thus, a PIN1-GFP-based forward genetic screen iden-
vacuolar identity [10]. In addition, several putative AP-3 tified the pat4 mutant showing almost normal growth
adaptins have been identified as suppressors of zigzag 1 and morphology but pronounced changes in subcellular
(zig1) [11], a mutant affecting a vesicle trafficking regu-
lator, the SNARE VTI11 [12, 13]. Nonetheless, the exis-
tence and function of AP complexes, including AP-3, has
not been demonstrated in plants.
[%]
In the present study, we present the identification and 100
characterization of pat4, a mutant defective in the AP-3 δ 80
60
adaptin, as well as the identification and genetic and bio- 40
20
chemical characterization of the AP-3 complex in Arabi- 0
dopsis. Our observations strongly suggest that an AP-3
complex exists in plants and together with clathrin and
dynamin-like proteins is required for function of lytic
and protein storage vacuoles (PSVs) in Arabidopsis.

Results

Identification of the protein-affected trafficking4 (pat4)

mutant
As an approach to identify new regulators of protein
trafficking pathways we carried out a fluorescence imag-
ing-based forward genetic screen for mutants affecting
the subcellular trafficking of the PIN1 auxin efflux carri-
er [14], which undergoes elaborate subcellular dynamics
including secretion [15], clathrin-mediated endocytosis
[16], polar recycling [17, 18] and trafficking to the vacu-
ole [19, 20]. By using an ethyl methanesulfonate (EMS)-
mutagenized PIN1pro:PIN1-GFP population we origi- Figure 1 Ectopic, intracellular accumulation of plasma mem-
nally identified three independent pat mutant loci from brane proteins in pat4-1 mutant. (A-H) Polar plasma membrane
about 1 500 M1 families; among them pat2-1 is defective proteins PIN1-GFP (A, B) and PIN2-GFP (C, D) as well as
in the putative β adaptin of the AP-3 complex [10]. In a apolar proteins PIP2a-GFP (E, F) and BRI1-GFP (G, H) showed
strong intracellular accumulations in pat4-1 mutant seedlings (B,
further genetic screen using the progeny of other 1 920
D, F, H) compared to control seedlings in wild-type background
M1 families we identified two additional non-allelic mu- (A, C, E, G). (I, J). pat4-1 seedlings showing growth arrest (I,
tants pat4 and pat5. pat4-1 is a recessive mutant showing arrowhead) on medium without sucrose. The chart (J) depicts
strong defects in subcellular trafficking of PIN1-GFP percentage of arrested seedlings in pat4-1 and pat4-2 mutant
(Figure 1A and 1B). In addition to its normal basal lo- lines. Scale bar = 10 µm.

Cell Research | www.cell-research.com

 Marta Zwiewka et al. npg
3

distribution of different PM proteins.

pat4 mutants show normal endocytosis and recycling

Next, we investigated which trafficking pathway
might be affected by the pat4 mutation, and in which
subcellular compartment(s) the ectopic accumulation of
proteins in pat4 mutants occurs. In Arabidopsis roots,
treatment with Brefeldin A (BFA) leads to internaliza-
tion of PM proteins including PIN1-GFP into so-called
BFA compartments that consist of aggregated TGN/EEs
and recycling endosomes with Golgi apparatus (GA) at
their periphery [17, 24-26]. A 1 h treatment with 50 µM
BFA, combined with PM labeling by 4 µM endocytic
tracer FM4-64 [27] led to a rapid internalization of PM-
localized PIN1-GFP and its colocalization with FM4-64-
stained BFA compartments (Figure 2A) indicating that
constitutively cycling PIN1-GFP accumulates in endo-
somal aggregations. In pat4-1 roots, the early stages of
FM4-64 uptake, as well as the effect of BFA, were com-
parable to the control. Besides the BFA compartments
defined as a colocalization of PIN1-GFP signal with
FM4-64 (Figure 2A and 2B), we also observed additional
PIN1-GFP aggregations that were not stained with FM4-
64 (Figure 2B) and corresponded to ectopic PIN1-GFP
aggregations in the untreated pat4-1 roots (Figure 1A
and 1B). Furthermore, the abundance of PIN1-GFP at
the basal PM in the pat4-1 mutant was comparable to the
control PIN1-GFP line (Figure 4G). This result is also
consistent with a notion that secretion, endocytosis and
recycling were not affected in pat4-1 mutant root cells.
From this observation we concluded that endocytosis
and recycling were not significantly affected in the pat4-
1 mutant and that the ectopic PIN1-GFP accumulation
does not occur in the early compartments of the endo-
cytic pathway since all these are associated with BFA
compartments.
Figure 2 Impaired morphology and biogenesis of lytic vacuole
pat4 mutants accumulate proteins in aberrant lytic vacu-
in pat4 mutants. (A-D) PIN1-GFP-expressing seedlings in wild
oles type (A, C) and pat4-1 mutant background (B, D) stained with
During internalization, the endocytic tracer FM4-64 FM4-64 and co-treated with 50 µM BFA for 1 h (A, B). Untreated
labels the EEs, subsequently it marks intracellular com- seedlings were stained with FM4-64 for 3 h (C, D). Note the
partments and finally it reaches the vacuole and labels PIN1-GFP aggregations in pat4-1 (B, arrowheads) were distinct
the vacuolar membrane, the tonoplast [28]. In the pat4- from BFA compartments (B, yellow compartments). Only after
1 mutant after long treatment (3 h) with 4 µM FM4-64, long incubation (3 h), FM4-64 stained PIN1-GFP-containing
the dye stained the ectopic intracellular accumulations compartments in the stele cells of pat4-1 (D, arrowheads). The
localization of GFP-RABF2b (E, F) revealed strong enlargement
of PIN1-GFP (Figure 2C and 2D). This result suggests a
of the late endosomes/PVCs in pat4-1 (F) as compared to the
late endosomal/vacuolar identity of PIN1-GFP aggrega- control (E). After 3 h, FM4-64 stained the tonoplast of root epi-
tions in the pat4-1 mutant. dermal cells in control (G, J) and revealed misshaped vacuoles
Staining of the tonoplast with FM4-64 also revealed in pat4-1 (H, K) and pat4-2 (I, L) mutants. (M-S) LysoTracker
an aberrant morphology of vacuoles in the pat4 mutant red accumulation in the vacuoles of root epidermal cells. Stron-
(Figure 2G-2L). To confirm this observation, we per- ger dye accumulation in pat4-1 (N, arrowheads) and pat4-2 (O,
formed a 1 h treatment with the fluorescent acidotro- arrowheads) indicate changed vacuolar identity. Scale bar = 5
µm (A) to (F) and 10 µm (G) to (S).

www.cell-research.com | Cell Research

npg AP-3 adaptor complex in Arabidopsis
4

pic probe Lysotracker red (2 µM), which labels acidic

compartments including PVC and vacuole [29]. The 60

staining pattern of this probe in the root cells of pat4

50
40

mutants showed pronounced differences as compared to 30

20

the control (Figure 2M-2S). The provacuole-like tubu- 10

0

lar extensions typically visible in the control [30], were >20.0 20.0-
15.0
15.0-
10.0
10.0-
5.0
5.0-2.0 <2

largely absent in the pat4 mutant, and the labeling with

the probe was generally visibly stronger (Figure 2N, 2O,
2R and 2S). These findings suggest that lytic vacuoles
in pat4 mutant cells have the aberrant morphology and
ectopically accumulate proteins, which normally undergo
vacuole-mediated degradation.
Next, we analyzed whether the pat4 mutation has an
effect on the morphology of PVCs, which are known to
function upstream of lytic vacuoles [31-33]. In the pat4
mutant background, we observed swelling and vacuoliza-
tion of PVC compartments visualized by PVC markers, Figure 3 Defects in the transition between PSVs and lytic vacu-
such as GFP-RABF2b [34] (Figure 2E and 2F). More- oles, but not in trafficking to the PSVs in pat4 mutants. (A-B)
over, the swollen PVC phenotype in the pat4 mutant PSVs in embryo root cells of control (A) and pat4-1 (B). (C-F)
Accumulation of LysoTracker red following 1 h (C, D) and 60 h
resembled the effect of wortmannin on the PVC mor-
(E, F) of imbibition in wild-type (C, E) and pat4-1 (D, F) seeds,
phology [10]. Taken together, these results indicate that indicating defects in the acidification of mutant PSVs. (G) Quan-
aberrant vacuole-like compartments in pat4 mutants can tification of the PSVs morphology. pat4-1 mutant (gray bar),
share features of both PVCs and vacuoles. This mixed pat4-2 mutant (light gray bar) and double mutant pat4 × pat2 (light
identity is presumably linked to defects in function of blue bar) show smaller PSVs compared to wild-type seeds (black
lytic vacuoles, which cause the ectopic accumulation of bar). Western blot (H) and SDS-PAGE (I) revealed no mis-
cargos in aberrant vacuoles. secretion of 2S albumin and 12S globulin precursors in pat4-2
mutant but accumulation in the vps29, a mutant known to mis-
sort reserve proteins. Scale bar = 10 µm.
pat4 mutants show defects in seed PSVs
The pat4 mutant does not show any striking morpho-
logical phenotype. However, seedlings germinated on
medium lacking sucrose regularly showed developmen- teins (Figure 3H and 3I). This result shows that, despite
tal arrest (Figure 1I and 1J). This is typical for mutants morphological defects of PSVs in the pat4 mutant, the
with defects in PSVs [10, 20, 35-37]. In seeds, PSVs sorting and delivery of storage proteins to PSVs is unaf-
accumulate high amounts of reserve proteins such as fected.
albumins and globulins that serve as a source of energy A time-course visualization of PSVs revealed that
during germination. The majority of mutants defective in pat4 mutants are defective in the morphology of storage
PSVs function display ectopic sorting of these proteins vacuoles (Supplementary information, Figure S2A-S2F).
to the extracellular space, which is reflected by defective In control seeds, 60 h following germination, almost all
maturation of these proteins and accumulation of unpro- storage proteins were degraded and PSVs showed only
cessed precursors [13, 35, 38]. PSVs in seeds of the pat4 weak remaining autofluorescence (Supplementary infor-
mutant were smaller, more fragmented and very often mation, Figure S2B). In contrast, in pat4 seeds, regions
spherically shaped in comparison with the control (Figure of strong autofluorescence were still observed after the
3A, 3B 3G and Supplementary information, Figure S4A- same time post-germination demonstrating persisting ac-
S4C). Therefore, we investigated whether the observed cumulation of storage proteins, which could be the result
defects in PSVs morphology are associated with defects of the flawed structure of PSVs (Supplementary informa-
in sorting of storage proteins. However, we could not de- tion, Figure S2D and S2F). Accordingly, the time-course
tect any defect in the processing of 2S albumin and 12S of LysoTracker red staining in germinating seeds showed
globulin storage proteins since the precursors of these abnormal acidification in pat4-1 confirming delayed
proteins did not accumulate in the dry seeds of pat4 as transition of pat4-1 PSVs into lytic vacuoles following
revealed by western blot analysis of these proteins. This germination (Figure 3C-3F). Overall, these results show
is in contrast to known mutants defective in PSVs such the aberrant morphology and the defective transition of
as vps29 [35] that accumulate precursors of storage pro- PSVs into lytic vacuoles in the pat4 mutants.

Cell Research | www.cell-research.com

 Marta Zwiewka et al. npg
5

PAT4 encodes the δ subunit of the AP-3 complex

The pat4 mutant is defective in the vacuolar function
and displays a number of unique features that are shared
by only one other characterized mutant – pat2 – that is
defective in the function of the putative β subunit of the
AP-3 complex [10]. All developmental, as well as cel-
lular phenotypes of the pat4 mutant including normal
trafficking of reserve proteins to PSVs are strongly remi-
niscent of the pat2 mutant. This suggests that pat4 and
pat2 are defective in the same process. To test whether
these mutants represent alleles of the same mutation,
we performed allelism test and analyzed F1 seedlings of
the cross between pat4-1 and pat2-2. The F1 seedlings
showed a complete rescue of the cellular phenotype pres-
ent in both parental lines (Figure 4C, 4D and 4F) con-
firming the recessive character and different identity of
both mutations.
To gain insight into the molecular nature behind the
vacuolar defect of pat4-1 we mapped the mutation by Figure 5 Vacuole morphology in pat4-2 × pat2-2 double mu-
tants. (A-D) FM4-64 uptake (3 h) in control (A), pat4-1 (B),
positional cloning using 300 chromosomes from the F2
pat4-2 (C) and pat4-2 × pat2-2 double mutant (D). Similarly to
progeny derived from crosses of pat4-1 with the Lands- the single pat4 mutants, the vacuole morphology in the double
berg erecta ecotype. Sequencing the candidate genes mutant was impaired (arrowheads). (E-H) LysoTracker red ac-
within the interval, we found a point mutation 223 nucle- cumulation in control (E), pat4-1 (F), pat4-2 (G) and pat4-2 ×
otides after the ATG resulting in a premature stop codon pat2-2 double mutant (H) showed abnormal acidification and
in the gene coding for a putative δ subunit of the AP lytic vacuole morphology in the single and double mutants (ar-
complex AP-3 (Figure 4A and 4B). The stop codon at the rowheads). (I-L) PSVs autofluorescence imaging revealing
beginning of the coding sequence leads to the truncation defective PSVs morphology in single pat4-1 (J), pat4-2 (K) and
pat4-2 × pat2-2 double mutants (L) as compared to wildtype
of more than 90% of the predicted full-length protein
embryos (I). Scale bar = 10 µm.
strongly suggesting that pat4-1 is a loss-of-function mu-
tation.

To confirm this, we analyzed an additional T-DNA

insertion allele (pat4-2) in the AP-3 δ locus that had been
previously described as a full knock-out mutant based
on the lack of AP-3 δ mRNA [11]. The pat4-2 mutant
showed comparable cellular and morphological pheno-
types as the original pat4-1 allele (Figures 1J, 2I, 2L,
2O, 2S, 3G, 5C, 5G, 5K and 6C, 6H). Furthermore, all
F1 seedlings from the cross between the original pat4-
1 allele and the pat4-2 T-DNA insertion line showed the
60

50 same intracellular PIN1-GFP aggregation as the parental

40

30
homozygous lines (Figure 4D and 4E). These findings
20 demonstrate that the pat4-1 and pat4-2 are both reces-
10

0
sive, loss-of-function alleles of the gene coding for the
putative δ subunit of the presumptive AP-3 complex. The
Figure 4 PAT4 encodes AP-3 δ adaptin. (A) Scheme of AP-3 δ positive result of the allelic test between pat4-1 and pat4-
locus on chromosome 1. (B) The positions of the pat4 allele and 2 confirmed that trafficking defect reflecting intracellular
the point mutation (red letter) are depicted. (C-F) PIN1-GFP in-
accumulation of proteins in pat4-1, is caused by muta-
tracellular distribution in PIN1::PIN1-GFP (C), pat4-1 (D) and F1
crosses between pat4-1 and the SALK line pat4-2 (E) or pat4-1
tion in the gene coding for the putative δ subunit of the
and pat2-2 (F). (G) The chart depicts intensity of PIN1-GFP sig- presumptive AP-3 complex. Thus, the similar morpho-
nal at the PM of root stele cells in pat4-1 compared to the PIN1- logical and cellular defects observed in pat2-2 and pat4-
GFP line. Error bars represent SD. Scale bar = 10 µm. 1 mutants are caused by mutations in the putative β and δ

www.cell-research.com | Cell Research

npg AP-3 adaptor complex in Arabidopsis
6

subunits of the same AP-3 complex. albeit slightly stronger, than in single mutants [10].
The similar phenotypes of the single mutants and lack
pat2 and pat4 are defective in the same process related of strong additive or synergistic interaction in the double
to vacuolar function mutant combination suggest that pat2 and pat4 are de-
The identification of PAT4 coding for the putative fective in the same process related to the biogenesis and
AP-3 δ subunit reveals that the similar morphologi- function of lytic and storage vacuoles.
cal and cellular defects observed in pat2-2 and pat4-1
mutants are caused by mutations in the putative β and δ AP-3 µ subunit is required for vacuolar morphology
subunits of the same AP-3 complex. To address the com- The similar phenotypes of mutants defective in the
mon action of the corresponding gene products, we ana- putative β and δ subunits of the AP-3 complex, pat2 and
lyzed the phenotype of the pat4 × pat2 double mutant. pat4, respectively, suggest that the AP-3 complex, previ-
The double mutant showed the same, albeit somewhat ously characterized in yeast and animals [1, 4-6], exists
stronger, aberrations in vacuole morphology than the also in plants and plays a role in regulating vacuolar
pat4 single mutant as visualized by tonoplast staining function.
with FM4-64 (Figure 5A-5D). Similarly, staining with To further test this hypothesis, we generated a domi-
LysoTracker red revealed aberrations in acidification of nant negative version of the putative AP-3 µ subunit by
vacuolar compartments in the double mutant (Figure 5E- truncating 18 amino acids from its C-terminal domain
5H). The PSVs of the double mutant seeds were affected that is required for cargo recruitment into the forming
in a similar way as those in each single mutant, but vesicle [39]. This strategy had been successfully used
showed stronger fragmentation than in the single mutant previously in animal cells to inhibit the function of the
seeds (Figures 3G, 5I-5L, Supplementary information, whole corresponding AP complex [40]. Vacuole staining
Figure S3A-S3C). The maturation of lytic vacuoles was by FM4-64 (Figure 6A-6E) or LysoTracker red (Figure
strongly abnormal in the double mutant seeds as revealed 6F-6J) revealed aberrant vacuolar morphology in seed-
by persisting autofluorescence of storage proteins in dou- lings overexpressing the dominant negative (DN) version
ble mutant PSVs contrasting to wild-type germinating of the AP-3 µ subunit (35S::AP3µDN), similar to those
seeds (Supplementary information, Figure S2B and S2F). observed in pat2 and pat4 mutants. Our findings that
Accordingly, the transition of PSVs to lytic vacuoles was interference with the function of either putative AP-3
also affected as shown by LysoTracker red staining (Sup- β, AP-3 δ or AP-3 µ has similar effects on morphology
plementary information, Figure S3D-S3G). These defects and function of vacuoles in plant cells suggest that these
in PSVs maturation of the double mutants were similar, proteins act together in the same AP-3 complex. Thus AP

Figure 6 Defects in lytic vacuole morphology and function in AP-3 µ dominant negative mutant. (A-J) FM4-64 uptake for 3 h
(A-E) and LysoTracker staining for 1 h (F-J) in wild type (A, F), pat4-1 (B, G), pat4-2 (C, H), 35S:AP3µ (D, I) and the domi-
nant negative (35S:AP3µDN) expressing root cells (E, J). Note the similar mislabeling of FM4-64 and LysoTracker red in pat4
mutants alleles and AP3µDN (arrowheads). Scale bar =10 µm.

Cell Research | www.cell-research.com

 Marta Zwiewka et al. npg
7
Table 1 Identification of AP-3 β and AP- 3 δ interacting proteins from immunopreciptations of 5-day-old seedlings
AGI Protein name AP-3 β-GFP AP-3 δ-GFP
Exp. 1 Exp. 2 Exp. 1 Exp. 2
N % Sf N % Sf N % Sf N % Sf
At3g55480 AP-3 β 73 62 63 75 62 65 36 39 31 14 17 11
At1g48760 AP-3 δ 37 51 31 38 55 34 45 53 40 41 44 31
At1g56590 AP-3 µ 14 41 11 13 45 10 4 12 2.6
At3g50860 AP-3 σ 5 39 4.4 5 39 4.1
At5g42080 ADL1A 10 20 8.4 16 32 11
At1g14830 ADL1C 6 (3) 12 4.9 4 (3) 7.2 3.1
At3g60190 ADL1E 4 (2) 5.1 2.9
At1g59610 ADL3 18 (6) 22 15 19 (7) 24 14
At1g10290 ADL6 17 (5) 21 13 15 (3) 18 10
At3g11130, Clathrin 6 3.6 4.1
At3g08530* heavy chain
For both AP-3 β and AP-3 δ, two independent pull-down experiments have been performed.
N, number of different peptides (number of unique peptides); %, percentage coverage of protein; Sf, total score factor calculated by Bioworks
v3.3.1. *Not distinguishable which of the two clathrin heavy chain proteins is identified.

tify which other proteins may interact with it, we gener-

ated constructs and transgenic Arabidopsis lines express-
ing AP-3 δ-GFP and AP-3 β-GFP proteins from their own
promoters. We immunoprecipitated AP-3 δ-GFP as well
as AP-3 β-GFP proteins from these transgenic seedlings
and performed nano-LC followed by tandem mass spec-
trometry (nLC-MS/MS). In both cases, the GFP-tagged
protein was recovered (Table 1; 73 peptides, 62% cover-
age for AP-3 β; 45 peptides, 53% coverage for AP-3 δ).
Notably, these immunoprecipitations also recovered all
three other putative subunits of the AP-3 complex from
the AP-3 β-GFP line (Table 1; Figure 7). To confirm
these findings, we performed a second independent ex-
Figure 7 Schematic representation of AP-3 δ and AP-3 β inter- periment and found essentially the same result (Table 1;
acting proteins. Immunoprecipitations using both, AP-3 δ-GFP Experiment 2). This strongly suggests that the AP-3 ex-
and AP-3 β-GFP as baits identified interaction with the remain- ists in Arabidopsis as a complex, similarly as shown in
ing µ and σ subunits of the AP-3 complex, as well between AP-3
mammalian and yeast cells [1, 7, 41, 42].
δ and/or AP-3 β and Arabidopsis dynamin-like (ADL) and clath-
rin heavy chain (CHC) proteins. Notably, we also found clathrin heavy chain (CHC) as-
sociated with AP-3 β and several Arabidopsis dynamin-
like proteins [43-45] associated with both AP-3 β and
AP-3 δ subunits (Table 1; Figure 7). Dynamin proteins
complexes likely exist and act in plant cells, consisting are typically involved in the formation of clathrin-coated
of the same subunits as the corresponding AP complexes vesicles [46-48], thus their association together with
in yeast and animals. CHC with AP-3 subunits strongly supports the view that
the AP-3 complex in plants could function as an adap-
Identification of AP-3 adaptor complex in plants tor complex for the formation of clathrin-coated vesicles
Striking similarity of phenotypes in mutants defective [49].
in AP-3 β, AP-3 δ or AP-3 µ as well as analysis of pat4 × In summary, the biochemical studies fully confirm the
pat2 double mutants suggest the existence of a functional genetic studies that the AP-3 complex exists in plants and
AP-3 protein complex encompassing these subunits. To plays a role in clathrin- and dynamin-mediated vesicle
determine if such a complex exists in plants, and to iden- trafficking for regulating vacuolar function.

www.cell-research.com | Cell Research

npg AP-3 adaptor complex in Arabidopsis
8

Discussion found abnormally sized and spherically shaped PSVs in

the pat2 embryo cells by using natural autofluorescence
A fluorescence imaging-based forward genetic screen of storage proteins, which were confirmed by transmis-
identifies putative AP-3 components sion electron microscopy [10]. The analysis of natural
The use of forward genetic approaches for the iden- autofluorescence also revealed the abnormal morphology
tification of molecular components of subcellular traf- of PSVs in pat4 mutants. Although pat4 and pat2 mu-
ficking and dynamics in plants has been limited so far, tants display similar PSVs defects they do not show typi-
possibly due to functional redundancy of the regulators cal defects in trafficking of 2S albumin and 12S globulin
and/or lethality of corresponding mutants. The utilization to the PSVs. These findings reveal that pat4-1 shows a
of screens focused not on morphological phenotypes but basically identical set of defects as pat2/ap-3 β, a previ-
on the changes in localization or dynamics in fluorescent ously identified mutant from a similar screen [10], and
subcellular markers has been performed to at least par- show that pat4-1 mutant phenotype is caused by defec-
tially circumvent these issues and identify specifically tive vacuole biogenesis and function. Furthermore, mu-
also weak alleles or components not obviously affecting tants in putative AP-3 adaptins including zig suppressor
plant growth. These approaches already identified ARF 4 (zip4)/ap-3 µ, ap-3 δ and ap-3 β all suppress the shoot
GEF components of secretion [50] and endocytosis [51] gravitropism and morphology abnormalities of the zig1/
and the putative AP-3 β component of vacuolar function vti11 mutant that is defective in protein trafficking to
[10]. The pat2 mutant deficient in AP-3 β has been iden- the lytic vacuoles [11, 13], supporting a role of the AP-3
tified as displaying strong intracellular accumulation of complex in regulating post-Golgi membrane traffick-
PIN1-GFP. From a similar screen with an extended EMS- ing toward the vacuole. Thus, this unique set of defects
mutagenized population, we identified the pat4 mutant related to vacuolar functions in mutants defective in the
displaying very similar cellular and morphological fea- putative AP-3 β, AP-3 δ or AP-3 µ subunits shows that
tures as pat2 including strong accumulation of proteins putative components of the AP-3 complex play the same
in abnormally shaped lytic vacuoles. Notably, map-based role in regulating biogenesis and function of vacuoles in
cloning revealed that pat4 is defective in another putative plants.
AP-3 component – the putative δ adaptin. Thus, the same
fluorescence-based forward genetic screen independently AP-3 complex exists in plants and mediates clathrin-
identified two components of the same putative AP-3 based trafficking for vacuolar function
complex displaying the same phenotype. Notably, these Similar phenotypes of the mutants defective in the
mutants would be very difficult to recover from the con- different putative subunits of the same AP-3 complex
ventional mutant screens as they do not display penetrant and lack of strong additive or synergistic interaction
morphological or growth phenotypes. in the double mutant combination show their identical
molecular function and suggest that these proteins act in
Putative AP-3 components play similar roles in the func- the same process, possibly in the same complex. It also
tion of vacuoles reveals that in analogy to yeast and animal model organ-
AP-3 is a heterotetrameric protein complex that is rep- isms [5, 53], the loss of either of the subunits results in
resented in the Arabidospis genome by single copy genes the loss of the entire AP-3 complex. As all these observa-
for putative β, δ, µ and σ adaptin subunits [52]. The pat2 tions strongly suggest the existence of a functional AP-3
mutant defective in AP-3 β, the pat4 mutant defective in complex in plants, we tested this hypothesis by analyz-
AP-3 δ and the dominant negative version of AP-3 µ that ing proteins associated with β and δ putative subunits
we generated all show very similar phenotypes in the of AP-3. Importantly, from these unbiased pull-down
morphology and function of the lytic vacuoles. experiments we found strongly associated proteins that
The set of defects identified in pat2 and pat4 mutants constitute the remaining subunits of the AP-3 complex.
includes subcellular phenotypes such as altered degrada- Thus the biochemical studies complemented the genetic
tion and abnormal protein accumulation in misshaped observations and confirmed that β, δ, µ and σ adaptin
lytic vacuoles, aberrant vacuolation of PVCs and im- subunits are part of the same complex.
paired transition from storage to lytic vacuoles but no Notably, also several established components of
defects in secretory or early endocytic processes. The vesicle formation such as adaptins and clathrin coat were
mutants display largely normal morphology but arrest found associated with these AP-3 subunits confirming
growth on sucrose-deficient medium. This is a feature the role of the AP-3 complex in vesicle formation in
of mutants defective in protein trafficking to the storage plant cells. The association of the plant AP-3 with clath-
and/or lytic vacuoles [20, 35, 38]. In a previous study, we rin would suggest that, unlike the yeast AP-3, the plant

Cell Research | www.cell-research.com

 Marta Zwiewka et al. npg
9

AP-3 mediates formation of clathrin-coated vesicles, a and dCAPS) markers. For the information about Col/Ler polymor-
notion that is controversial in mammalian cells [3, 7, 49, phism we used the collection of SNPs and INDELs provided by
54, 55]. Thus, the functional association of clathrin and Monsanto Arabidopsis Polymorphism and Ler Sequence Collec-
tion (Cereon Genomics) and TAIR (http://www.arabidopsis.org).
AP-3 in the formation of vesicles in the different eukary- At1G48760 candidate gene was sequenced and we found a point
otes still remains unclear. However, Lee et al. [56] re- mutation causing a stop codon at the position downstream of ATG.
ported that in Arabidopsis protoplasts EpsinR2 interacts
with AP-3 δ, clathrin, VTI12 and phosphatidylinositol- Drug treatments and microscopy
3-phosphate and plays roles in protein trafficking. This To assess different biological processes 5-day-old seedlings
finding, together with our observations that AP-3 inter- were incubated in MS medium supplemented with LysoTracker
acts with clathrin indicates that the Arabidopsis AP-3 red (Invitrogen; 2 µM in DMSO) and BFA (Invitrogen; 50 µM
complex likely functions as a clathrin adaptor complex. in DMSO). Control treatments were done in the same way with
equivalent concentration of DMSO. For FM4-64 (Invitrogen; in
In mammalian cells, clathrin interaction with AP-3 is me-
H2O) accumulation the seedlings were pulse labeled 5 min in MS
diated by the β subunit and AP-3 β has a binding region liquid medium supplemented with 4 µM FM4-64 on ice, washed
for clathrin [49]. Accordingly, our experiments revealed three times at room temperature in MS liquid medium, mounted
association of the β but not δ subunit of the Arabidopsis and observed after 3 h. For the double treatments, the seedlings
AP-3 with clathrin. This indicates that in both mammals were first pulse labeled with 50 µM BFA and 4 µM FM4-64 as de-
and higher plants, AP-3-mediated trafficking depends on scribed above, followed by 1 h incubation in MS medium supple-
the coat protein clathrin. mented with 50 µM BFA. The morphology of PSVs was examined
by imaging autofluorescence. Images of embryo root cells were
Nonetheless, the genetic and biochemical studies pre-
taken immediately after peeling off the seed coat of the dry seeds.
sented here demonstrate on the example of AP-3 that AP Accumulation of LysoTracker red (as described above) was done
complexes exist in plant cells and play a role in vesicle in 1 h and 60 h after imbibition. Samples were viewed by confocal
formation as in other eukaryotes. Although the existence laser microscopy.
of other AP complexes in plants awaits demonstration,
the AP-3 complex acquired a plant-specific function in Western blot and SDS-PAGE
regulating biogenesis and function of vacuoles. Protein extracts were prepared from 10 dry seeds per each line
in SDS-PAGE sample buffer and subjected to SDS-PAGE fol-
Materials and Methods lowed by either Coomassie blue staining or blotting to ECL mem-
brane (GE-Healthcare) as described before [35]. The membranes
Plant material and growth conditions were treated with antibodies against 2S albumin (rabbit; 1:5 000)
Seedlings of wild-type Col-0 and all mutant lines: pat4-1 (EMS and ECLTM-anti-rabbit IgG, horseradish peroxidase (GE Health-
mutant), pat4-2 (AP-3 δ SALK mutant; At1g48760; [57]), pat2-2 care; 1:5 000). The immunoreactive signals were detected by using
(AP-3 β SAIL mutant; At3G55480, [10]), vps29 (At3g47810, [58]), the ECL detection system (GE-Healthcare).
double mutant line pat4-2 × pat2-2, crossed lines: pat4-1 × PIN2-
GFP, pat4-1 × PIP2a-GFP, pat4-1 × BRI1-GFP, pat4-1 × GFP- Cloning and Arabidopsis thaliana transformation
RABF2b, GFP tagged lines: PIN1pro:PIN1-GFP (At1g73590, [59]), The full-length Atµ3 (At1g56590) and the truncated dominant
PIN2pro:PIN2-GFP (At5G57090; [21]), 35Spro:PIP2a-GFP (X75883, negative version DNA was amplified with the following primers:
[22]), BRI1pro:BRI1-GFP (AT4G39400, [23]), RABF2bpro:GFP- attB1_Atµ3_FW GGGGACAAGTTTGTACAAAAAAGCAG-
RABF2b (AT4g19640, [34]), AP-3 βpro:AP-3 β-GFP (At3G55480, GCTCGATGCTTCAATGTATCTTTCTC
[10]), AP-3 δpro:AP-3 δ-GFP (At3G55480, [56]), as well as ob- attB2_Atµ3_RW GGGGACCACTTTGTACAAGAAAGCTG-
tained by Gateway-based cloning strategy transgenic lines: full- GGTCCTACAACCTGACATCGAACTC
length Atµ3 (At1g56590) and the (18 amino acids truncated) a t t B 2 _ A t µ 3 _ RW- C t G G G G A C C A C T T T G TA C A A -
dominant negative version were grown vertically in Petri dishes GAAAGCTGGGTCCTACAAACGAGGAGGGATAGTTTG.
on 0.8% agar 0.5× Murashige and Skoog (MS) medium containing The amplified gene was cloned under the 35S promoter. Atµ3
1% sucrose (pH 5.9) at 18 °C, long-day photoperiod. clones were introduced by Gateway recombination first, into
pDONR221, and then into the destination vector pK7WG2,0 ([60];
EMS mutagenesis, mutant forward genetic screen and map- http://www.psb.ugent.be/gateway).
ping
M2 seedlings, progenies of 1920 M1 3% EMS-mutagenized Immunoprecipitation and liquid chromatography-mass
PIN1pro:PIN1-GFP plants were analyzed under an epifluorescence spectrometry
microscope for abnormal intracellular accumulation of PIN1-GFP For immunoprecipitation, 1.5-1.7 g of 5-day-old AP-3 β-GFP,
signal. AP-3 δ-GFP and Col-0 seedlings were ground in a mortar with
pat4-1 was mapped using 300 chromosomes from the F2 prog- liquid nitrogen. The powder was homogenized in extraction buf-
eny derived from crosses of pat4-1 with the Landsberg erecta fer (50 mM Tris-HCl, 150 mM NaCl, 1% Nonidet P-40 (NP40),
ecotype to a region of 85 kb on the lower arm of chromosome 1 protease inhibitors mix cocktail (Roche, 1 tablet per 50 ml)). After
(18 041-18 126; BAC F11I4), using simple sequence length poly- grinding, the protein extract was sonicated 3 × 15 sec with a probe
morphism and cleaved amplified polymorphic sequence (CAPS sonicator (MSE) at half-maximal power and incubated on ice for

www.cell-research.com | Cell Research

npg AP-3 adaptor complex in Arabidopsis
10
30 min. The NP40 in the protein extract was then diluted to 0.2%, complex, AP-3, is essential for the efficient delivery of alka-
followed by 2 × 15 min centrifugation at 20 000 rpm at 4 °C. The line phosphatase by the alternate pathway to the vacuole. J
supernatant was incubated for 2 h at 4 °C with rotation with 100 Cell Biol 1997; 139:1761-1774.
µl magnetic beads coupled to a monoclonal anti-GFP antibody 7 Dell’Angelica EC, Ohno H, Ooi CE, et al. AP-3: an adaptor-
(Miltenyi). µColumns on a MACS MultiStand (Miltenyi) were like protein complex with ubiquitous expression. EMBO J
equilibrated with 200 µl extraction buffer containing 0.1% NP40, 1997; 16:917-928.
then the supernatant was passed through the µcolumn. The col- 8 Kretzschmar D, Poeck B, Roth H, et al. Defective pigment
umn was subsequently washed with 4 × 200 µl extraction buffer granule biogenesis and aberrant behavior caused by mutations
containing 0.1% NP40 and 2 × 500 µl 50 mM ammoniumcarbon- in the Drosophila AP-3β adaptin gene ruby. Genetics 2000;
ate. The beads were eluted from the column into low bind tubes 155:213-223.
(Eppendorf AG) with 50 µl 50 mM ammoniumcarbonate that was 9 Dell’Angelica EC, Shotelersuk V, Aquilar RC, et al. Altered
heated to 95 °C. trafficking of lysosomal proteins in Hermansky-Pudlak syn-
For MS measurements, 1 µl 50 mM DTT in 50 mM NH4HCO3 drome due to mutations in the β3A subunit of the AP-3 adap-
was added to the beads and incubated at 37 °C. After 2 h, 1 µl 100 tor. Mol Cell 1999; 3:11-21.
mM iodocetamide in 50 mM NH4HCO3 was added and incubated 10 Feraru E, Paciorek T, Feraru MI, et al. The AP-3 β adaptin
2 h at room temperature in the dark. Subsequently 1 µl 200 mM mediates the biogenesis and function of the lytic vacuoles in
cysteine in 50 mM NH4HCO3 and 1 μl trypsin-sequencing grade Arabidopsis. Plant Cell 2010; 22:2812-2824.
(0.5 µg/µl in1 mM HCl) were added and the beads were incu- 11 Niihama M, Takemoto N, Hashiguchi Y, et al. ZIP genes en-
bated overnight at 20 °C while shaking. The following day 1.2 µl code proteins involved in membrane trafficking of the TGN–
trifluoroacetic acid was added to adjust to ~pH 3 and the beads PVC/vacuoles. Plant Cell Physiol 2009; 50:2057-2068.
were centrifuged 3 min at maximum speed. The supernatant was 12 Surpin M, Zheng H, Morita MT, et al. The VTI family of
subjected to nLC-MS/MS analysis using a LTQ-Orbitrap. Data SNARE proteins is necessary for plant viability and medi-
were analyzed using the Bioworks software package version 3.1.1 ates different protein transport pathways. Plant Cell 2003;
(Thermo Scientific). 15:2885-2899.
13 Sanmartín M, Ordóñez A, Sohn EJ, et al. Divergent functions
Acknowledgments of VTI12 and VTI11 in trafficking to storage and lytic vacu-
oles in Arabidopsis. Proc Natl Acad Sci USA 2007; 104:3645-
3650.
We thank Eva Benková (VIB-Ghent University, Belgium), Ben
14 Petrášek J, Mravec J, Bouchard R, et al. PIN proteins perform
Scheres (Ulrecht University, The Netherlands), Chris R Somerville
a rate-limiting function in cellular auxin efflux. Science 2006;
(University of California, Berkeley, USA), Niko Geldner (Uni-
312:914-918.
versity of Lausanne, Swilzerland) for sharing published material,
15 Dhonukshe P, Tanaka H, Goh T, et al. Generation of cell po-
ABRC and NASC for the seed stock supply, Sjef Boeren (Biqua-
larity in plants links endocytosis, auxin distribution and cell
lis, Wageningen) for help with mass spectrometry, our colleagues
fate decisions. Nature 2008; 456:962-966.
Stéphanie Robert and Tomasz Nodzyński for helpful discussions,
16 Dhonukshe P, Aniento F, Hwang I, et al. Clathrin-mediated
suggestions and technical assistance, and Martine De Cock for
constitutive endocytosis of PIN auxin efflux carriers in Arabi-
help in preparing the manuscript. This work was cofinanced by the
dopsis. Curr Biol 2007; 17:520-527.
Center for BioSystems Genomics, which is part of the Netherlands
17 Geldner N, Friml J, Stierhof Y-D, et al. Auxin transport inhib-
Genomics Initiative/Netherlands Organization for Scientific Re-
itors block PIN1 cycling and vesicle trafficking. Nature 2001;
search (NWO), and by NWO Grant VIDI-864.06.012 (BM, DW).
413:425-428.
This work was supported by the Research Foundation-Flanders
18 Kleine-Vehn J, Dhonukshe P, Sauer M, et al. ARF GEF-de-
(Odysseus) for JF.
pendent transcytosis and polar delivery of PIN auxin carriers
in Arabidopsis. Curr Biol 2008; 18:526-531.
References 19 Abas L, Benjamins R, Malenica N, et al. Intracellular traffick-
ing and proteolysis of the Arabidopsis auxin-efflux facilitator
1 Simpson F, Bright NA, West MA, et al. A novel adaptor- PIN2 are involved in root gravitropism. Nat Cell Biol 2006;
related protein complex. J Cell Biol 1996; 133:749-760. 8:249-256.
2 Rothman JE, Wieland FT. Protein sorting by transport vesi- 20 Kleine-Vehn J, Leitner J, Zwiewka M, et al. Differential deg-
cles. Science 1996; 272:227-234. radation of PIN2 auxin efflux carrier by retromer-dependent
3 Drake MT, Zhu Y, Kornfeld S. The assembly of AP-3 adaptor vacuolar targeting. Proc Natl Acad Sci USA 2008; 105:17812-
complex-containing clathrin-coated vesicles on synthetic lipo- 17817.
somes. Mol Biol Cell 2000; 11:3723-3736. 21 Xu J, Scheres B. Dissection of Arabidopsis ADP-RIBOSYLA-
4 Dell’Angelica EC, Mullins C, Bonifacino JS. AP-4, a novel TION FACTOR 1 function in epidermal cell polarity. Plant
protein complex related to clathrin adaptors. J Biol Chem Cell 2005; 17:525-536.
1999; 274:7278-7285. 22 Cutler SR, Ehrhardt DW, Griffitts JS, et al. Random
5 Cowles CR, Odorizzi G, Payne GS, et al. The AP-3 adaptor GFP::cDNA fusions enable visualization of subcellular struc-
complex is essential for cargo-selective transport to the yeast tures in cells of Arabidopsis at a high frequency. Proc Natl
vacuole. Cell 1997; 91:109-118. Acad Sci USA 2000; 97:3718-3723.
6 Stepp JD, Huang K, Lemmon SK. The yeast adaptor protein 23 Geldner N, Hyman DL, Wang X, et al. Endosomal signal-

Cell Research | www.cell-research.com

 Marta Zwiewka et al. npg
11
ing of plant steroid receptor kinase BRI1. Genes Dev 2007; subunit of the adaptor-like complex AP-3. J Biol Chem 1997;
21:1598-1602. 272:15078-15084.
24 Grebe M, Xu J, Möbius W, et al. Arabidopsis sterol endocy- 42 Panek HR, Stepp JD, Engle HM, et al. Suppressors of YCK-
tosis involves actin-mediated trafficking via ARA6-positive encoded yeast casein kinase 1 deficiency define the four
early endosomes. Curr Biol 2003; 13:1378-1387. subunits of a novel clathrin AP-like complex. EMBO J 1997;
25 Dettmer J, Hong-Hermesdorf A, Stierhof Y-D, et al. Vacuolar 16:4194-4204.
H+-ATPase activity is required for endocytic and secretory 43 Park JM, Kang SG, Pih KT, et al. A dynamin-like pro-
trafficking in Arabidopsis. Plant Cell 2006; 18:715-730. tein, ADL1, is present in membranes as a high-molecular-
26 Robinson DG, Jiang L, Schumacher K. The endosomal sys- mass complex in Arabidopsis thaliana. Plant Physiol 1997;
tem of plants: charting new and familiar territories. Plant 115:763-771.
Physiol 2008; 147:1482-1492. 44 Konopka CA, Backues SK, Bednarek SY. Dynamics of Ara-
27 Jelínková A, Malínská K, Simon S, et al. Probing plant mem- bidopsis dynamin-related protein 1C and a clathrin light chain
branes with FM dyes: tracking, dragging or blocking? Plant J at the plasma membrane. Plant Cell 2008; 20:1363-1380.
2010; 61:883-892. 45 Bednarek SY, Backues SK. Plant dynamin-related protein
28 Ueda T, Yamaguchi M, Uchimiya H, et al. Ara6, a plant- families DRP1 and DRP2 in plant development. Biochem Soc
unique novel type Rab GTPase, functions in the endocytic Trans 2010; 38:797-806.
pathway of Arabidopsis thaliana. EMBO J 2001; 20:4730- 46 Damke H, Baba T, Warnock DE, et al. Induction of mutant
4741. dynamin specifically blocks endocytic coated vesicle forma-
29 Laxmi A, Pan J, Morsy M, et al. Light plays an essential role tion. J Cell Biol 1994; 127:915-934.
in intracellular distribution of auxin efflux carrier PIN2 in 47 Sever S, Damke H, Schmid SL. Dynamin:GTP controls the
Arabidopsis thaliana. PLoS ONE 2008; 3:e1510. formation of constricted coated pits, the rate limiting step in
30 Marty F. Plant vacuoles. Plant Cell 1999; 11:587-599. clathrin-mediated endocytosis. J Cell Biol 2000; 150:1137-
31 Sanderfoot AA, Ahmed SU, Marty-Mazars D, et al. A putative 1147.
vacuolar cargo receptor partially colocalizes with AtPEP12p 48 Hill E, van der Kaay J, Downes CP, et al. The role of dynamin
on a prevacuolar compartment in Arabidopsis roots. Proc Natl and its binding partners in coated pit invagination and scis-
Acad Sci USA 1998; 95:9920-9925. sion. J Cell Biol 2001; 152:309-323.
32 Tse YC, Mo B, Hillmer S, et al. Identification of multivesicu- 49 Dell’Angelica EC, Klumperman J, Stoorvogel W, et al. As-
lar bodies as prevacuolar compartments in Nicotiana tabacum sociation of the AP-3 adaptor complex with clathrin. Science
BY-2 cells. Plant Cell 2004; 16:672-693. 1998; 280:431-434.
33 daSilva LLP, Taylor JP, Hadlington JL, et al. Receptor salvage 50 Teh OK, Moore I. An ARF-GEF acting at the Golgi and in
from the prevacuolar compartment is essential for efficient selective endocytosis in polarized plant cells. Nature 2007;
vacuolar protein targeting. Plant Cell 2005; 17:132-148. 448:493-496.
34 Jaillais Y, Fobis-Loisy I, Miège C, Rollin C, Gaude T. 51 Tanaka H, Kitakura S, De Rycke R, et al. Fluorescence im-
AtSNX1 defines an endosome for auxin-carrier trafficking in aging-based screen identifies ARF GEF component of early
Arabidopsis. Nature 2006; 443:106-109. endosomal trafficking. Curr Biol 2009; 19: 391-397.
35 Shimada T, Koumoto Y, Li L, et al. AtVPS29, a putative 52 Bassham DC, Brandizzi F, Otegui MS, Sanderfoot AA. The
component of a retromer complex, is required for the efficient secretory system of Arabidopsis. Arabidopsis Book 2008;
sorting of seed storage proteins. Plant Cell Physiol 2006; 6:e0116.
47:1187-1194. 53 Boehm M, Bonifacino JS. Genetic analyses of adaptin func-
36 Silady RA, Ehrhardt DW, Jackson K, et al. The GRV2/RME-8 tion from yeast to mammals. Gene 2002; 286:175-186.
protein of Arabidopsis functions in the late endocytic pathway 54 Simpson F, Peden AA, Christopoulou L, et al. Characteriza-
and is required for vacuolar membrane flow. Plant J 2008; tion of the adaptor-related protein complex, AP-3. J Cell Biol
53:29-41. 1997; 137:835-845.
37 Isono E, Schwechheimer C. Co-immunoprecipitation and pro- 55 Faúndez V, Horng JT, Kelly RB. A function for the AP3 coat
tein blots. In: Hennig L, Köhler C, eds. Plant Developmental complex in synaptic vesicle formation from endosomes. Cell
Biology: Methods and Protocols, Methods in Molecular Biol- 1998; 93:423-432.
ogy, Vol 655. Totowa: Humana Press, 2010:377-387. 56 Lee GJ, Kim H, Kang H, et al. EpsinR2 interacts with clath-
38 Ebine K, Okatani Y, Uemura T, et al. A SNARE complex rin, adaptor protein-3, AtVTI12, and phosphatidylinositol-3-
unique to seed plants is required for protein storage vacuole phosphate. Implications for epsinR2 function in protein traf-
biogenesis and seed development of Arabidopsis thaliana. ficking in plant cells. Plant Physiol 2007; 143:1561-1575.
Plant Cell 2008; 20:3006-3021. 57 Alonso JM, Stepanova AN, Leisse TJ, et al. Genome‑wide in-
39 Owen DJ, Evans PR. A structural explanation for the recog- sertional mutagenesis of Arabidopsis thaliana. Science 2003;
nition of tyrosine-based endocytotic signals. Science 1998; 301:653-657.
282:1327-1332. 58 Jaillais Y, Santambrogio M, Rozier F, et al. The retromer pro-
40 Nesterov A, Carter RE, Sorkina T, et al. Inhibition of the tein VPS29 links cell polarity and organ initiation in plants.
receptor-binding function of clathrin adaptor protein AP-2 by Cell 2007; 130:1057-1070.
dominant-negative mutant µ2 subunit and its effects on endo- 59 Benková E, Michniewicz M, Sauer M, et al. Local, efflux‑de-
cytosis. EMBO J 1999; 18:2489-2499. pendent auxin gradients as a common module for plant organ
41 Dell’Angelica EC, Ooi CE, Bonifacino JS. β3A-adaptin, a formation. Cell 2003; 115:591-602.

www.cell-research.com | Cell Research

npg AP-3 adaptor complex in Arabidopsis
12
60 Karimi M, Inzé D, Depicker A. GATEWAY vectors for (Supplementary information is linked to the online version of
Agrobacterium-mediated plant transformation. Trends Plant the paper on the Cell Research website.)
Sci 2002; 7:193-195.

Cell Research | www.cell-research.com