[CANCER RESEARCH 64, 7610 –7617, October 15, 2004]

Selective Loss of AKR1C1 and AKR1C2 in Breast Cancer and Their Potential
Effect on Progesterone Signaling
Qing Ji,1 Chisa Aoyama,5 Yih-Dar Nien,2 Paul I. Liu,5 Peter K. Chen,5 Lilly Chang,3 Frank Z. Stanczyk,3,4 and
Andrew Stolz1
Departments of 1Medicine, 2Surgery, 3Obstetrics and Gynecology, and 4Preventive Medicine, Keck School of Medicine, University of Southern California, Los Angeles,
California; and 5Department of Pathology, Olive View-UCLA Medical Center, University of California Los Angeles, Sylmar, California

ABSTRACT Initiative trial receiving estrogen and a progestin had increased incidence
of breast cancer compared with those receiving estrogen alone. These
Progesterone plays an essential role in breast development and cancer
findings strongly suggest that exogenous progestin may be a causative
formation. The local metabolism of progesterone may limit its interactions
factor for breast tumor development (1, 2, 7, 8).
with the progesterone receptor (PR) and thereby act as a prereceptor
regulator. Selective loss of AKR1C1, which encodes a 20␣-hydroxysteroid The local regulation of hormone synthesis and catabolism are key
dehydrogenase [20␣-HSD (EC 1.1.1.149)], and AKR1C2, which encodes a modifiers for the development and growth of hormone-dependent
3␣-hydroxysteroid dehydrogenase [3␣-HSD (EC 1.1.1.52)], was found in tumors, including breast cancer (9 –11). For example, induction of
24 paired breast cancer samples as compared with paired normal tissues aromatase in breast cancer results in the in situ synthesis of estrogen,
from the same individuals. In contrast, AKR1C3, which shares 84% promoting tumor growth, and aromatase inhibitors effectively prevent
sequence identity, and 5␣-reductase type I (SRD5A1) were minimally breast cancer recurrence (10, 12). Thus, estrogen is an effective target
affected. Breast cancer cell lines T-47D and MCF-7 also expressed re- for chemoprevention. Similarly, progesterone and/or its metabolites
duced AKR1C1, whereas the breast epithelial cell line MCF-10A ex-
may provide novel targets for chemoprevention of breast cancer or
pressed AKR1C1 at levels comparable with those of normal breast tissues.
Immunohistochemical staining confirmed loss of AKR1C1 expression in
treatment strategies for breast cancer because they act as either growth
breast tumors. AKR1C3 and AKR1C1 were localized on the same myo- promoters or cell cycle inhibitors in breast cancer cells (4, 6). Little is
epithelial and luminal epithelial cell layers. Suppression of ARK1C1 and known about the pathways responsible for catabolism of progesterone
AKR1C2 by selective small interfering RNAs inhibited production of in the human breast, but in rat placenta, robust induction of 20␣-
20␣-dihydroprogesterone and was associated with increased progesterone hydroxysteroid dehydrogenase [20␣-HSD (EC 1.1.1.149)] expression
in MCF-10A cells. Suppression of AKR1C1 alone or with AKR1C2 in immediately precedes reduction in local progesterone levels at partu-
T-47D cells led to decreased growth in the presence of progesterone. rition (13, 14). In humans, a similar increase in placental 20␣-HSD
Overexpression of AKR1C1 and, to a lesser extent, AKR1C2 (but not activity occurs, but not in other pathways, implying a common mech-
AKR1C3) decreased progesterone-dependent PR activation of a mouse
anism for the local elimination of progesterone (15, 16).
mammary tumor virus promoter in both prostate (PC-3) and breast
(T-47D) cancer cell lines. We speculate that loss of AKR1C1 and AKR1C2
The 20␣-HSDs are members of a newly emerging family of NADPH-
in breast cancer results in decreased progesterone catabolism, which, in dependent cytosolic oxidoreductases, known as the aldo-keto reductase
combination with increased PR expression, may augment progesterone super gene family (17, 18). AKR1C1 is one of four highly related human
signaling by its nuclear receptors. hydroxysteroid dehydrogenases that share ⬎84% sequence identity but
have distinctive substrate specificities and tissue distributions. Three of
INTRODUCTION these AKR1C family members are expressed in the human breast and
catalyze the following reactions: (a) AKR1C1 reduces the carbonyl group
In women, breast cancer is the most common noncutaneous malig- at the 20 position, and their products are weaker activators of the tran-
nancy, and lifetime exposure to ovarian hormones is a well-recognized scriptional activity of PR (19); (b) AKR1C2 encodes for a 3␣-hydroxy-
risk factor for breast cancer development (1, 2). The actions of both steroid dehydrogenase [3␣-HSD (EC 1.1.1.52)] that reduces the carbonyl
estrogen and progesterone are required for normal growth and maturation group at the 3 position of progesterone metabolites that are also weak PR
of breast tissues, and progesterone is required for terminal duct formation activators (20); and (c) AKR1C3, also referred to as 17␤-HSD type V,
required for lactation (3). Estrogen can also regulate expression of the has minimal 20␣-HSD or 3␣-HSD activity for progesterone (21). Re-
progesterone receptor (PR), linking the action of both these two hor- markably, AKR1C2 differs by only 7 of 323 amino acids from AKR1C1
mones and suggesting a complex interplay between estrogen and regu- (20, 22), and all three genes are in close proximity on chromosome
lation of progesterone-dependent genes. Inconsistent results in breast 10p14, suggesting evolution by gene duplication (18, 23).
cancer cell lines and animal studies have made it difficult to assess a role To assess whether AKR1C may act as a prereceptor regulator of
of progesterone in either development or promotion of breast cancer hormone activity by adjusting the availability of hormones to act with
(4 – 6). However, women receiving progestin are at greater risk for their cognate receptors, we recently demonstrated significant reduction of
development of increased mammographic breast density, suggesting AKR1C2, which catalyzes reduction of dihydrotestosterone to the weak
greater cellular proliferation (1, 7), and women in the Women’s Health
androgen 3␣-androstanediol, in prostate cancer as compared with unaf-
fected tissue (24). We hypothesized that selective reduction of this key
Received 5/11/04; revised 7/12/04; accepted 8/11/04.
Grant support: University of Southern California/Norris Comprehensive Cancer
androgen-catabolizing gene would result in maintenance of intracellular
Center grant 5P30 CA14089 –29 from the National Cancer Institute; Robert E. and Mary levels of dihydrotestosterone in prostate tumors and thereby provide a
R. Wright Foundation; Margaret E. Early Medical Research Foundation; and University selective growth advantage for these malignant cells. Because progester-
of Southern California Research Center for Liver Disease DK98-016. This work was
presented in part at the 85th ENDO Annual Meeting in Philadelphia, Pennsylvania on June one is likely to modify growth of breast cancer cells (4, 5), we now report
21, 2003. the relative expression of three AKR1C family members in paired breast
The costs of publication of this article were defrayed in part by the payment of page cancer and normal tissue samples using our recently developed real-time
charges. This article must therefore be hereby marked advertisement in accordance with
18 U.S.C. Section 1734 solely to indicate this fact. polymerase chain reaction (PCR) methodology (24). Effects of small
Requests for reprints: Andrew Stolz, Hoffman Medical Research, Room 101A, 2011 interfering RNA (siRNA) suppression of AKR1C1 alone or with AKR1C2
Zonal Avenue, Los Angeles, CA 90033. Phone: 323-442-2699; Fax: 323-442-5425;
E-mail: astolz@hsc.usc.edu. on progesterone metabolism and cellular proliferation were also deter-
©2004 American Association for Cancer Research. mined in MCF-10A and T-47D cell lines, indicating that AKR1C1 and
7610

Downloaded from cancerres.aacrjournals.org on February 10, 2022. © 2004 American Association for Cancer
Research.
 DECREASED AKR1C1 AND AKR1C2 IN BREAST CANCER

AKR1C2 may act as prereceptor regulators of PR activity. The signifi- body, and color was developed using AEC Substrate Pack (NeoMarkers,
cance of these findings has been extended to assess whether changes in Fremont, CA), according to the manufacturer’s protocols. Sections were coun-
expression of AKR1C family members could modify progesterone- terstained with Meyer’s hematoxylin (NeoMarkers) and mounted in Glycergel
dependent transcriptional activity of the mouse mammary tumor virus (Dako). Both preimmune sera and peptide-preabsorbed antisera were used as
(MMTV) promoter by PR-B. controls for IHC staining specificity.
Suppression of AKR1C1 and/or AKR1C2 Expression by Small Interfer-
ing RNAs. Four siRNAs were designed by Qiagen, and the resultant sequence
MATERIALS AND METHODS was compared with the human genome to assess their cross-reactivity with
other AKR1C family members. Ultimately, the following ARK1C1 sequences
Chemicals and Supplies. All chemicals were of molecular biology grade from M86609 were used and are listed with their percentage similarity to the
or higher and were purchased from Sigma (St. Louis, MO), unless otherwise other AKR1C family members expressed in human breast tissue: Seq-A,
stated. Molecular biology reagents were purchased from Promega (Madison, AAGCTTTAGAGGCCACCAAAT (85% sequence identity to both AKR1C2
WI), Roche Molecular Biochemicals (Indianapolis, IN), and Life Technolo- and AKR1C3); Seq-B, AACTGCTGGATTTCTGCAAGT (100% sequence
gies, Inc. (Gaithersburg, MD). Cell culture supplies were purchased from identity to AKR1C2 and 90% sequence identity to AKR1C3); Seq-C, AAAGC-
Invitrogen (Carlsbad, CA). CAGGTGAGGAAGTGAT (100% sequence identity to AKR1C2 and 81%
Breast Tissues and RNA Extraction. Human breast samples were pro- sequence identity to AKR1C3); and Seq-D, AAGGTCACTGAAAAATCT-
cessed according to our previously described method (24). Twenty-four paired TCA (100% sequence identity with AKR1C2 and 71% sequence identity with
breast tumors and their paired surrounding unaffected tissues were selected AKR1C3). Transfection of siRNA (Qiagen) was performed according to the
from the University of Southern California/Norris Comprehensive Cancer manufacturer’s protocol, and quantitative real-time PCR was used to monitor
Center (Los Angeles, CA) or Olive View-University of California Los Angeles suppression of AKR1C family members.
Medical Center (Sylmar, CA) after institutional review board approval. Sam- MCF-10A cells (8 ⫻ 104) were seeded onto 6-well plates and grown for 24
ples were fresh frozen in liquid nitrogen, and sections (5 ␮m) were subse- hours to approximately 50% confluence. Small interfering RNAs (4.5 ␮g) were
quently reviewed by pathologists for pathological diagnosis along with immu- diluted in 100 ␮L of suspension buffer, vortexed, and mixed with 15 ␮L of
nohistochemistry staining for estrogen receptor (ER), PR, Ki-67, and Her2/neu RNAiFect. Cells were incubated with the samples for 5 to 10 minutes at room
status. Only paired samples in which breast tumors contained ⬎90% tumor temperature, the medium was exchanged with 300 ␮L of growth medium, and
cells and normal tissue lacking any tumor cells were used. Clinical information then cells were allowed to recover for 24 hours. Nonsilencing fluorescein-labeled
and surgical pathology reports were available without any patient identifiers. siRNA (Qiagen) was used as the control for siRNA transfections.
The frozen tissues were homogenized with tissue pulverizers (Spectrum Lab- Progesterone Metabolism. MCF-10A cells (8 ⫻ 104) were seeded in 6-well
oratories, Rancho Dominguez, CA), and total RNA was prepared using the tissue culture plates and cultured 24 hours before siRNA transfections. Twenty-
RNeasy Mini Kit (Qiagen, Valencia, CA) as described previously (24). four hours after siRNA treatments, 0.2 mCi of [3H]progesterone (Perkin-Elmer
Quantitative Real-Time Polymerase Chain Reaction Assay. Real-time Life Science, Boston, MA) was added to the media, and cells were then grown for
PCR for AKR1C1, AKR1C2, AKR1C3, and SRD5A1 was performed as an additional 16 hours. Medium and cells were harvested separately, and metab-
described previously (24). SRD5A1 (forward primer, 5⬘-ATCCTCCTG- olites were separated by thin-layer chromatography. Aliquots (0.5 mL) of lysed
GCCATGTTCC-3⬘; reverse primer, 5⬘-TCGCATCAGAAACGGGTAA- cells and supernatants were extracted twice with ethyl acetate:hexane (3:2) and
AT-3⬘; probe, fluorescein amidite-5⬘CGTCCACTACGGGCATCGGTGC- evaporated under nitrogen at 40°C to remove the solvent, and 10 ␮g of proges-
3⬘-black hole quencher) was designed using Primer Express version 2.0 terone and 20␣-dihydroprogesterone were added as carriers. Extracts were applied
software (Applied Biosystems, Foster City, CA). Random primed cDNA to a thin-layer chromatography chromatography plate (Silica gel 60F254 on
libraries were prepared for TaqMan quantitative PCR by using the Omni- 20 ⫻ 20-cm aluminum sheet; EM Science, Gibbstown, NJ) and run for 1.5 hours
script Kit (Qiagen) with random hexamers (Applied Biosystems), and using chloroform:diethyl ether (10:3) as solvent mixture. Locations of progester-
relative expression was calculated as described previously (24). one and 20␣-dihydroprogesterone were identified by ultraviolet light, the regions
Cell Culture. MCF-7, MCF-10A, T-47D, and PC-3 cell lines were all were scraped, and radioactivity was determined by liquid scintigraphy.
purchased from American Type Culture Collection (Rockville, MD). Cell lines T-47D Proliferation Studies. T-47D cells were grown in RPMI 1640 with-
were cultured in RPMI 1640 with 10% fetal bovine serum (FBS), except for out phenol red with 4% charcoal dextran-treated FBS (HyClone, Logan, UT) and
MCF-10A, which was grown in Clonetics Mammary Epithelial Growth Me- treated with different concentrations of progesterone [0.1% in ethanol (v/v)] or
dium (MEGM Bullet Kit, CC-3051, serum-free) supplemented with 100 with 0.1% (v/v) ethanol as controls. Cell proliferation assays were performed as
ng/mL cholera toxin. Total RNA was isolated as described above for quanti- described previously (27, 28) with the following modifications: Twenty-four hours
tative real-time PCR assays. Stable PC-3 prostate cancer cell lines expressing before initiation of growth studies, cells were treated with siRNA as described
either AKR1C1, AKR1C2, or AKR1C3 were developed as described previ- above. A total of 1.5 ⫻ 104 cells were then seeded into 12-well tissue culture
ously (24) and used to assess activation of MMTV luciferase reporter assays. dishes from a common cell culture and grown for an additional 24 hours. Proges-
Development and Characterization of AKR1C Polyclonal Antibodies. terone was then added, and half of the media was replaced on a daily basis. The
Polyclonal antibodies from rabbits for individual AKR1C family members were number of cells in quadruplet wells was then determined daily with the 3-(4,5-
developed using peptides and recombinant protein as immunogens. An AKR1C3- dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay using Bio-Rad Mi-
specific antiserum was developed as described previously (25) using peptide croplate Reader Model 3550 (Bio-Rad, Hercules, CA) after a standard curve
sequence N-GLDRNLHYFNSDSFASHPNYPYS to generate antiserum ␣7548. confirmed a linear relationship between cell number and absorbance.
Rabbits injected with the peptide N-FNHRLLEMIL(C) were used to generate PR-B–Dependent Transactivation Assay. Permanently transfected PC-3
antiserum ␣6621, which recognizes both AKR1C1 and AKR1C3, but not cell lines with varying stable expression levels of AKR1C1, AKR1C2, or
AKR1C2. Bacterial-expressed protein was used to immunize rabbits, and the AKR1C3 were used for progesterone-dependent transactivation experiments
resultant antisera, ␣1850, recognizes all family members (24). Specificity of with cotransfection of human PR-B. These PC-3 cell lines were individually
antisera was assessed by Western blots with lysates of PC-3 cell lines that stably transiently transfected with 2 ␮g of pMMTV-Luc (kindly provided by Dr.
express individual AKR1C family members. Western blots were performed as Gerhard A. Coetzee, Keck School of Medicine at University of Southern
described previously (24) using a 1:2,000 dilution for all antisera. California, Los Angeles, CA), 0.2 ␮g of pCMV-hPR-B expression plasmid
Immunohistochemical Staining of Breast Tissues. Immunohistochemical (kindly provided by Dr. Michael R. Stallcup, Keck School of Medicine at
(IHC) staining was performed according to the previously described method University of Southern California), and 5 ng of Renilla luciferase plasmid
(26) with the following modifications. Five-micrometer sections of paraffin- pRL-SV40 (Promega) to control for transfection efficiency. Cells were trans-
embedded breast tissues were cut and pretreated for 5 minutes with serum-free fected with 15 ␮L of SuperFect (Qiagen) in 600 ␮L of RPMI 1640 and allowed
protein blocking solution (Dako, Carpinteria, CA) and then incubated with the to recover for 36 hours in RPMI 1640 with 4% charcoal dextran-treated FBS.
primary antihuman AKR1C polyclonal antisera (␣6621, ␣7548, or ␣1850) at Cells were then washed with PBS and treated for 16 hours with 100 pmol/L
1:1,000 to 1:2,000 dilution overnight in a humidified chamber at 4°C. Slides progesterone in 4% charcoal dextran-treated fetal calf serum. Luciferase ac-
were then incubated with antirabbit horseradish peroxidase secondary anti- tivity was measured using the Luminoskan Ascent instrument (Labsystems,
7611

Downloaded from cancerres.aacrjournals.org on February 10, 2022. © 2004 American Association for Cancer
Research.
 DECREASED AKR1C1 AND AKR1C2 IN BREAST CANCER

Franklin, MA) and the Dual Luciferase Activity Kit (Promega). The ratio of blocked by preincubation with excess peptide, thereby confirming the
firefly to Renilla luciferase activity was normalized to total protein, and specificity of IHC staining.
luciferase activity of control PC-3 cells was arbitrarily defined as 100 ⫾ SD. As illustrated in Fig. 1B, IHC staining with both ␣6621 and ␣7548
revealed predominant staining on the myoepithelial and luminal epi-
RESULTS thelial cells. Because ␣6621 cross-reacts with both AKR1C1 and
ARK1C3, selective localization for AKR1C1 was determined in
Relative Expression Profile of AKR1C Family Members and paired BT6 and BN6 tissue samples that lacked AKR1C3 expression.
SRD5A1 in Paired Breast Tissue Samples. The relative expression In Fig. 1C, no IHC staining with ␣7548 was observed, confirming the
profiles of AKR1C1, AKR1C2, AKR1C3, and SRD5A1 were determined
lack of expression of AKR1C3. IHC staining with ␣6621, which
in 24 paired breast cancer and normal tissue samples using RNase P as
could only correspond to AKR1C1, was localized on the myoepithe-
the internal control. RNase P expression was equivalent in tumor and
lial and luminal epithelial cells. Endothelial cells were also stained
normal tissue (data not shown). Table 1 lists the relative changes in gene
with this antiserum (data not shown). Decreased IHC staining was
expression for AKR1C family members and SRD5A1 in individual pairs
observed on the corresponding tumor sample, in close agreement with
of tissue samples, along with clinical features and PR, ER, Her2/neu, and
the 48-fold decrease in relative expression of AKR1C1. Thus,
Ki-67 status. A substantial (defined as ⬎5-fold) decrease in AKR1C1
AKR1C1 is normally expressed in the same location as AKR1C3,
expression was found in 13 of 24 cases. AKR1C2 expression was absent
with staining observed on a majority of myoepithelial and luminal
in tumors or reduced in 6 of these 13 cases. AKR1C3 expression was only
epithelial cells, the latter being the same site of PR expression (3, 29).
significantly reduced in one case without a significant decrease in
AKR1C1. SRD5A1 expression was significantly decreased in only four IHC staining with ␣6621 and ␣7548 was then performed on all
cases and increased (⬎5-fold) in three cases, and no apparent relationship available samples to determine the relationship between relative gene
existed between reduced expression of SRD5A1 and that of AKR1C1. No expression profile and protein levels. Fig. 1D illustrates two examples of
consistent pattern was found in the expression profile for AKR1Cs or paired tissue samples in which AKR1C1 mRNA expression was reduced
SRD5A1 and PR, ER, Her2/neu, or Ki-67 status. Thus, reduced gene or absent in tumor samples associated with minimal changes in AKR1C3.
expression of ARK1C1 appears to be unrelated to PR or ER status. Decreased staining of ␣6621 in both cases corresponds with AKR1C1
Development of AKR1C-Specific Antisera and Immunohisto- expression levels, whereas ␣7548 staining for AKR1C3 was unchanged
chemical Staining in Breast Tissue Samples. Rabbits received injec- in accordance with the real-time PCR data. These cases suggest that
tion with synthesized peptides to develop antisera that recognize specific decreased ␣6621 staining closely parallels AKR1C1 mRNA expression
family members, despite the high sequence homology of family mem- patterns and confirm the selectivity of ␣7548 IHC staining for AKR1C3.
bers. Lysates harvested from permanently transfected PC-3 cells express- Fig. 1E demonstrates additional cases in which ␣6621 IHC staining
ing AKR1C1, AKR1C3, or AKR1C2 (24) were used to assess specificity matches AKR1C1 expression but not ARK1C3 expression. Finally, Fig.
of rabbit antisera by Western blot. As illustrated in Fig. 1A, ␣1850 1F confirms that ␣7548 staining corresponds with relative changes in
recognized all transfected AKR1C family members expressed in PC-3 AKR1C3 expression. Pathologists, who were unaware of relative expres-
cells. We confirmed that ␣7548, designed according to Pelleiter et al. sion patterns, then independently compared the IHC staining intensity of
(25), selectively recognized only ARK1C3, whereas ␣6621 recognized ␣6621 and ␣7548 for all available cases. Table 2 demonstrates that
both AKR1C1 and AKR1C3, but not AKR1C2. As shown in Fig. 1B, approximately two thirds of the ␣7548 and ␣6621 IHC staining corre-
both ␣6621 and ␣7548, but not their preimmune sera, stained normal sponded with relative expression of AKR1C1 and AKR1C3. Taken to-
myoepithelial and luminal epithelial cells in the alveoli, which was gether, these findings confirm that decreased expression of AKR1C1

Table 1 Clinical features and changes in relative expression of AKR1C family members and SRD5A1 mRNAs in paired samples of breast tumors versus unaffected tissues
Sample Age AKR1C1 AKR1C2 AKR1C3 SRD5A1
code Diagnosis (y) ER PR Ki-67 Her2 (mean ⫾ SD) (mean ⫾ SD) (mean ⫾ SD) (mean ⫾ SD)
BTN1 Inv duct 64 ⫹ ⫹ 15% ⫹ 12.8 ⫾ 1.1 ND 6.5 ⫾ 0.3 84.5 ⫾ 6.5
BTN4 Inv duct 52 ⫺ ⫹ NA ⫹ ⫺3.7 ⫾ 0.4 1.9 ⫾ 0.1 1.1 ⫾ 0.1 30.3 ⫾ 2.2
BTN5 Inv lob 68 ⫺ ⫹ 5% ⫺ 5.0 ⫾ 0.5 ND ND ⫺24.5 ⫾ 2.1
BTN6 Inv lob 53 ⫹ ⫺ 40% ⫺ ⫺48.3 ⫾ 3.7 ND ND 1.9 ⫾ 0.2
BTN7 Inv duct 35 ⫹ ⫹ 10% ⫹/⫺ ⫺14.7 ⫾ 1.3 ND ND 1.7 ⫾ 0.1
BTN8 Inv duct 46 ⫺ ⫺ 90% ⫺ ⫺342 ⫾ 25.8 ⫺3.6 ⫾ 0.3 ⫺4.9 ⫾ 0.3 ⫺4.6 ⫾ 0.3
BTN9 Inv duct 33 ⫺ ⫺ 20% ⫹ ⫺285 ⫾ 16.9 ⫺3.5 ⫾ 0.5 ⫺1.5 ⫾ 0.1 ⫺4.6 ⫾ 0.2
BTN10 Inv duct 50 ⫹ ⫹ 5% ⫹/⫺ 1.4 ⫾ 0.1 ND ⫺1.3 ⫾ 0.1 1.5 ⫾ 0.1
BTN13 Inv duct 56 ⫹ ⫹ 20% NA ⫺67.1 ⫾ 5.8 ⫺2.4 ⫾ 0.2 ⫺3.7 ⫾ 0.2 ⫺6.6 ⫾ 0.4
BTN15 Muc CA 49 ⫹ ⫹ 10% ⫺ ⫺2.1 ⫾ 0.1 ND ND 1.7 ⫾ 0.1
BTN17 ADH 58 NA NA NA NA ⫺3.6 ⫾ 0.2 1.7 ⫾ 0.1 1.4 ⫾ 0.1 ⫺237 ⫾ 29.6
BTN19 Inv lob 58 ⫹ ⫹ 10% ⫺ ⫺330 ⫾ 25.4 ⫺81.4 ⫾ 7.8 ⫺3.6 ⫾ 0.2 ⫺2.1 ⫾ 0.1
CHTN1 Inv duct 28 NA NA NA NA 6.4 ⫾ 0.2 2.4 ⫾ 0.2 ⫺3.6 ⫾ 0.3 4.8 ⫾ 0.2
CHTN2 Inv duct 37 NA NA NA NA ⫺42.6 ⫾ 3.7 3.6 ⫾ 0.3 2.9 ⫾ 0.3 6.6 ⫾ 0.4
BTN20 DCIS 50 ⫺ ⫺ 15% ⫹ 7.7 ⫾ 0.5 12.7 ⫾ 0.9 ⫺1.5 ⫾ 0.1 1.1 ⫾ 0.1
BTN21 Inv duct 65 ⫹/⫺ ⫹/⫺ 20% ⫹ ⫺63.3 ⫾ 4.4 ⫺15.3 ⫾ 1.1 1.2 ⫾ 0.1 ⫺1.2 ⫾ 0.1
BTN22 Inv duct 40 ⫹ ⫹ 20% ⫺ ⫺1198 ⫾ 83.8 ND ⫺34.5 ⫾ 2.4 2.4 ⫾ 0.2
BTN23 Inv lob 47 ⫹ ⫹ 15% ⫺ ⫺10.9 ⫾ 0.8 ⫺11.5 ⫾ 0.8 ⫺1.2 ⫾ 0.1 ⫺1.5 ⫾ 0.1
BTN24 Inv lob 72 ⫹ ⫺ 15% ⫺ ⫺199.2 ⫾ 14.1 ⫺288 ⫾ 20.2 ⫺6.5 ⫾ 0.5 ⫺1.7 ⫾ 0.1
BTN26 Inv duct 37 ⫹ ⫹ 10% ⫹ ⫺2506 ⫾ 175.4 ⫺24.6 ⫾ 1.7 ⫺1.6 ⫾ 0.1 ⫺2.9 ⫾ 0.2
BTN28 Inv duct 42 ⫺ ⫺ 10% ⫹ ND in cancer ND in cancer ⫺3.6- ⫾ 0.3 ⫺4.6 ⫾ 0.2
BTN30 Inv duct 62 ⫹ ⫹ 25% ⫹ ⫺1.6 ⫾ 0.1 2.8 ⫾ 0.2 ⫺5.7 ⫾ 0.4 ⫺9.2 ⫾ 0.6
BTN31 Inv duct 58 ⫹ ⫹ 10% ⫹ 24.2 ⫾ 1.7 8.1 ⫾ 0.6 15.5 ⫾ 1.1 ⫺2.3 ⫾ 0.2
BTN32 Inv duct 51 ⫹ ⫹ 20% ⫺ 5.5 ⫾ 0.4 2.9 ⫾ 0.2 1.2 ⫾ 0.1 1.6 ⫾ 0.1
NOTE. Numbers listed in the table represent fold changes in mRNA expression in tumor samples compared with paired normal samples relative to RNase P expression. A positive
number refers to increased mRNA expression in tumors, whereas a negative number represents decreased expression in tumor as compared with unaffected tissue.
Abbreviations: Inv duct, invasive ductal carcinoma; ND, not detectable in both normal and cancer tissues; NA, not available; Inv lob, invasive lobular carcinoma; Muc CA, mucinous
carcinoma; ADH, atypical ductal hyperplasia; DCIS, ductal carcinoma in situ; ND in cancer, not detectable in cancer tissues.
7612

Downloaded from cancerres.aacrjournals.org on February 10, 2022. © 2004 American Association for Cancer
Research.
 DECREASED AKR1C1 AND AKR1C2 IN BREAST CANCER

Fig. 1. IHC staining of ␣6621 and ␣7548 in

paired breast cancer and normal tissue samples. A
and B, specificity of ␣6621 and ␣7548 used for
IHC localization of AKR1C family members in
breast tissues. A. Specificity of antipeptide antibod-
ies ␣6621 and ␣7548 compared with ␣1850, gen-
erated against the entire AKR1C1, was determined
by Western blot using lysates (30 ␮g) from PC-3
cells stably expressing AKR1C1, AKR1C2, or
AKR1C3 compared with nontransfected PC-3
cells. B. Specificity and localization of IHC stain-
ing with ␣6621 and ␣7548 was determined by
respectively staining normal breast tissue from
samples BN13 and BN9 with preimmune, immune,
and immune sera preabsorbed with corresponding
peptides. Absence of staining with preimmune sera
and by preabsorption of sera with peptide confirms
the specificity of IHC staining for each antiserum.
C⫺F, comparison between IHC staining of ␣6621
and ␣7548 in paired breast tissues and mRNA
levels. C. Tissue localization of AKR1C1 was de-
termined in paired samples BN6 and BT6 because
neither tumor nor normal tissue expressed
AKR1C3. ␣7548 lacked IHC staining, confirming
the absence of AKR1C3. In normal tissue, ␣6621
staining is seen on myoepithelial and luminal epi-
thelial cells, which is lost in the corresponding
tumor sample. Real-time PCR data for each of the
IHC samples are listed to compare IHC staining
with relative changes in mRNA expression. Rela-
tive changes in AKR1C1 or AKR1C3 expression in
tumor as compared with unaffected tissue are in-
cluded (⫺, reduced tumor expression; ND, not de-
tectable). D, decreased ␣6621 staining in two pairs
of samples in which AKR1C3 staining and gene
expression are minimally affected. Staining with
␣6621 paralleled changes in gene expression for
AKR1C1, whereas ␣7548 staining remained rela-
tively unchanged. E, IHC staining with ␣6621 in
two paired tissue samples that express varying
amounts of AKR1C1 and AKR1C3. F, IHC staining
of ␣7548 in paired tissue samples that express
varying amounts of AKR1C3.

mRNA identified in the tumor samples closely corresponds with loss of Reduced Relative Expression of AKR1C1 in Human Breast
protein expression. Due to the lack of AKR1C2-specific antisera, we Cancer Cell Lines. Gene and protein levels of AKR1Cs were deter-
suspect (but cannot confirm) that decreased AKR1C2 mRNA will be mined in the established human breast cancer cell lines MCF-7 and
associated with loss of protein expression. T-47D as well as in human breast epithelial cell line MCF-10A (30).

Table 2 Immunohistochemical staining of ␣6621 and ␣7548 in paired breast samples compared with AKR1C1 and AKR1C3 gene expression profile.
Sample Changes in AKR1C1 in Changes in AKR1C3 in
code tumor vs. normal tissue (fold) ␣6621 in normal tissue ␣6621 in cancer tissue tumor vs. normal tissue ␣7548 in normal tissue ␣7548 in cancer tissue
BTN1 13 1ⴙ 2⫹ 7 2⫹, myoepithelial cell 2⫹, focally (10%)
BTN5 5 2⫹ ⫹/⫺ to 1⫹ ND NA NA
BTN6 ⫺48 3⫹, myoepi ⬎ luminal 1⫹ ND Negative Negative
BTN13 ⫺67 2⫹, myoepi ⬎ luminal 1⫹ ⫺4 2⫹, myoepi⬎luminal Negative
BTN17 ⫺4 2⫹, myoepi ⬎ luminal 1⫹ 1 2⫹, myoepi⬎luminal 1⫹. myoepi
BTN20 8 2⫹ 2⫹ ⫺1 NA NA
BTN21 ⫺63 2⫹ ⫺ to ⫹ 1 1⫹ 1⫹
BTN22 ⫺1198 2⫹, myoepi ⬎ luminal 2⫹, diffuse cytoplasm ⫺35 Negative Negative
BTN23 ⫺11 2⫹ 2⫹ ⫺1 2⫹ Negative
BTN24 ⫺199 2⫹, myoepi, luminal squamous 1⫹ ⫺7 1⫹, myoepi⬎luminal, Negative
epithelial cell and smooth muscle smooth muscle
BTN28 ND in cancer 3⫹, myoepi ⬎ luminal ⫹/⫺ ⫺4 1⫹, rare myoepithelium ⫹/⫺ to 1⫹, diffusely
NOTE. The intensity of the staining was graded as follows on a scale of 1 to 3: negative, lack of staining; 1⫹, weak staining; 2⫹, moderate staining; and 3⫹, strong staining.
Distribution of the staining was reported as diffuse (staining present in a majority of the glands) or focal (staining on only some of the glands).
Abbreviations: ND, not detectable; NA, not available; myoepi, myoepithelial cell; luminal, luminal epithelial cell.
7613

Downloaded from cancerres.aacrjournals.org on February 10, 2022. © 2004 American Association for Cancer
Research.
 DECREASED AKR1C1 AND AKR1C2 IN BREAST CANCER

As shown in Fig. 2A, significantly less AKR1C1 was found in MCF-7 Progesterone Metabolism Catalyzed by AKR1C1 and AKR1C2.
and T-47D cell lines as compared with MCF-10A, whereas AKR1C3 To assess the role of AKR1C1 and AKR1C2 on progesterone metab-
was equivalently expressed in all cell lines. ␣7548 Western blot data olism, siRNAs were developed. Pilot results showed that Seq-A
in Fig. 2B confirmed that AKR1C3 was equally expressed in all cell selectively suppressed AKR1C1, whereas Seq-D suppressed both
lines, whereas use of ␣6621 showed significantly less AKR1C1 AKR1C1 and AKR1C2 without affecting expression of AKR1C3, as
expression in MCF-7 and T-47D cell lines as compared with MCF- illustrated in Fig. 2C. The ability of these two siRNAs to alter
10A, which paralleled the AKR1C1 gene expression profile. progesterone metabolism was then monitored in MCF-10A cells,

Fig. 2. Suppression of AKR1C1 and AKR1C1/AKR1C2 in T-47D cells enhanced progesterone-mediated inhibition of cellular growth. A and B, reduced expression of AKR1C1 in established
breast cancer cell lines. Expression levels of AKR1C1 and AKR1C3 in the breast cancer cell lines MCF-7 and T-47D and breast epithelial cell line MCF-10A were determined at both the mRNA
and protein levels by real-time PCR and Western blot. A. Relative expression of AKR1C1 and AKR1C3 was determined using real-time PCR in triplicate compared with relative levels of MCF-7
cells (arbitrarily defined as 1 ⫾ SD). Relative expression is compared with a normal breast tissue. Substantially lower AKR1C1 levels were found in MCF-7 and T-47D breast cancer cell lines
as compared with breast epithelial cell line MCF-10A and a normal breast tissue. No substantial changes in AKR1C3 expression were noted in all three cell lines. B. Protein levels in breast
cell lines were determined by Western blot with ␣7548 and ␣6621. Relative equivalent amounts of AKR1C3 were found in all three cell lines, whereas decreased expression of AKR1C1 was
found in MCF-7 and T-47D compared with MCF-10A. C⫺E. Suppression of AKR1C1 alone or with AKR1C2 reduces formation of 20␣-dihydroprogesterone from progesterone in MCF-10A.
C. AKR1C1-specific siRNA (Seq-A) substantially suppressed AKR1C1 expression but not AKR1C2 and AKR1C3 in MCF-10A cells compared with nonspecific siRNA (Ns)-treated MCF- 10A
cells as a control. The other siRNA (Seq-D) was able to significantly suppress both AKR1C1 and AKR1C2 as compared with nonspecific siRNA-treated MCF-10A cells. AKR1C3 expression
was relatively unaltered by either siRNA. D. Production of 20␣-dihydroprogesterone from progesterone in MCF-10A cells treated with AKR1C1-specific siRNA (Seq-A) or AKR1C1/AKR1C2-
specific siRNA (Seq-D) was able to substantially reduce 20␣-dihydroprogesterone in both media and cell lysates. Note that the majority of the metabolite was distributed in the media. E.
Decrease in 20␣-dihydroprogesterone is associated with increased progesterone in siRNA-treated cells. Suppression of both AKR1C1 and AKR1C2 leads to more unmetabolized progesterone
in both cell lysates and media. F⫺I. Suppression of AKR1C1 and AKR1C1/AKR1C2 in T-47D cells enhanced the suppression of cellular proliferation by progesterone. F. AKR1C1-specific
siRNA (Seq-A) selectively suppressed AKR1C1 with minimal reduction of AKR1C2, whereas siRNA (Seq-D) suppressed both AKR1C1 and AKR1C2 in T-47D cells. AKR1C3 expression was
not affected with either treatment. G. Cellular proliferation of T-47D treated with siRNA (Ns, nonspecific siRNA) demonstrated no significant changes in cellular growth with suppressed
AKR1C1 alone or with suppressed AKR1C2 expression when progesterone was not presented. H and I. Growth of T-47D cells with siRNA treatments in the presence of 10⫺10 (H) or 10⫺9
mol/L (I) progesterone demonstrated a substantial decrease in cell numbers, with loss of AKR1C1 alone or in combination with AKR1C2. Concentrations of 10⫺10 and 10⫺9 mol/L progesterone
were selected based on our pilot study of the effects of progesterone on T-47D growth inhibition. It confirmed that 10⫺11 and 10⫺8 mol/L progesterone had effects on T-47D growth inhibition
similar to published studies (refs. 41, 42; data not shown).
7614

Downloaded from cancerres.aacrjournals.org on February 10, 2022. © 2004 American Association for Cancer
Research.
 DECREASED AKR1C1 AND AKR1C2 IN BREAST CANCER

which express levels of AKR1C1 comparable with those found in

normal tissue. In Fig. 2D and E, suppression of AKR1C1 in MCF-10A
cells significantly reduced the conversion of progesterone to 20␣-
dihydroprogesterone in media and cell lysates.
Suppression of AKR1C1 and AKR1C2 leads to additional and
significant inhibition of 20␣-dihydroprogesterone formation. This re-
duction in 20␣-dihydroprogesterone correlated with a significant in-
crease in progesterone in both media and cell lysates.
Suppression of AKR1C1 Alone or with ARK1C2 Affects Proges-
terone-Mediated Inhibition of Cellular Growth of T-47D. To as-
sess potential loss of AKR1C1 and AKR1C2 on progesterone-depen-
dent growth, siRNA suppression of AKR1C1 and AKR1C1/AKR1C2
in T-47D cells was determined because they endogenously express
PRs. In Fig. 2F, suppression of AKR1C1 alone or with AKR1C2 is
illustrated. The same cells were then used for proliferation assays with
progesterone treatments. As shown in Fig. 2G, no significant changes
were found in those cell lines treated with siRNAs in the absence of
progesterone In Fig. 2H and I, progressive inhibition of cellular
proliferation was observed with suppression of both AKR1C1 and
AKR1C1/AKR1C2 in the presence of 10⫺9 or 10⫺10 mol/L progester-
one, suggesting that reduced metabolism of progesterone in T-47D is
responsible for progesterone-mediated inhibition of cellular growth.
Inhibition of Progesterone-Dependent Transactivation by
AKR1C1 and AKR1C2. To determine whether progesterone catabo-
lism can alter PR-B ligand-dependent activity, the activity of a MMTV
luciferase reporter gene was evaluated in the prostate cancer cell line
PC-3 stably expressing AKR1C1, AKR1C2, or AKR1C3. These cells,
along with PC-3 cells stably transfected with vector alone, were tran-
siently transfected with pCMV-hPR-B, a luciferase reporter driven by the
MMTV promoter, as well as a Renilla luciferase to control for transfec-
tion efficiency. In the absence of progesterone or PR-B, no activity was
detectable (data not shown). In Fig. 3A, two different expression levels of
AKR1C1 and AKR1C2, but not AKR1C3, in PC-3 cells were able to
inhibit progesterone-dependent activation of the MMTV promoter, indi-
cating that AKR1C1 and AKR1C2 metabolize progesterone to weaker
activators of PR-B (17). Despite low levels of AKR1C1 expression,
AKR1C1 completely inhibited luciferase activity, confirming that 20␣- Fig. 3. Effect of AKR1C1, AKR1C2, and AKR1C3 on PR-B– dependent transactiva-
HSD can effectively block PR-B activation. Despite adequate levels of tion of MMTV promoter. A. Prostate cancer PC-3 cell lines stably expressing different
amounts of AKR1C1, AKR1C2, and AKR1C3 as determined by Western blot with ␣1850,
AKR1C3, AKR1C3 failed to inhibit progesterone-dependent activation, along with vector-transfected PC-3 cell line as a negative control, were transiently
confirming that progesterone is a poor substrate for AKR1C3. These transfected with pMMTV-Luc (2 ␮g), pCMV-hPR-B expression plasmid (0.2 ␮g), and
findings were extended to T-47D, which endogenously expresses PRs. Renilla luciferase plasmid pRL-SV40 (5 ng) to control for transfection efficiency. Pro-
gesterone (100 pmol/L) was used to treat transfected cells for 16 hours before luciferase
As shown in Fig. 3B, different amounts of AKR1C1 plasmid transfected assays. Ratio of firefly to Renilla luciferase activities was normalized to total protein to
into T-47D cells together with MMTV luciferase reporter plasmid sig- compare relative promoter activity from different cell lines. Luciferase activity of control
PC-3 cells was arbitrarily defined as 100 ⫾ SD in three independent experiments
nificantly inhibited luciferase activity. performed in triplicate. Relative luciferase activities of modified PC-3 cell lines express-
ing different levels of AKR1C family members are compared with those of control PC-3
cells. Statistical significance was determined by comparing changes in luciferase activity
DISCUSSION of the PC-3 cells expressing AKR1C family members versus PC-3 control cells using
Student’s t test. B. T-47D was used to confirm the findings presented in A by transient
Catabolism of steroid hormones can modulate availability of critical transfection with pMMTV-Luc (1 ␮g) and two concentrations of pSVL-AKR1C1 using
ligands for their cognate transcription factors and thereby function as 100 pmol/L progesterone for 16 hours before luciferase assays. Luciferase activity of
control T-47D cells was arbitrarily defined as 100 ⫾ SD in two independent experiments
effective prereceptor regulators of gene expression. This type of regula- performed in triplicate. Relative luciferase activity of the T-47D cell line transfected with
tion is best characterized for the mineralocorticoid receptor, in which different amounts AKR1C1 plasmid was compared with control cells. Student’s t test
compared changes in luciferase activities between each T-47D cell line transfected with
selective expression of 11␤-hydroxysteroid dehydrogenase type II in AKR1C1 and the T-47D control.
aldosterone target tissue prevents inappropriate activation of the miner-
alocorticoid receptor by cortisol (31). A similar paradigm is also devel-
oping for the prereceptor regulation of progesterone activity by AKR1C1 may reach up to 300 to 700 nmol/L by the end of the third trimester (34).
(17, 31). For example, as the human placenta comes to term, increased The function of AKR1C1 in the kidney may thus imitate that of 11␤-
20␣-HSD (but not 3␣-HSD or 17␤-hydroxysteroid dehydrogenase) ac- hydroxysteroid dehydrogenase type II to prevent inappropriate occupa-
tivity is observed, implicating it as the major catabolic pathway for tion of ligand-dependent transcription factor.
progesterone elimination (15, 16). Besides the placenta, studies in the We initially assessed the relative expression of ARK1C1 and two
human kidney further support this concept because expression of highly related family members using a gene-specific real-time PCR.
AKR1C1 protects the mineralocorticoid receptor from binding with pro- Although mRNA levels of the AKR1C family members had been quan-
gesterone, an effective aldosterone antagonist (32, 33). This may be tified by semiquantitative reverse transcription-PCR and RNase protec-
especially important during pregnancy, when serum progesterone levels tion methods (35, 36), real-time PCR provides a reliable and highly
7615

Downloaded from cancerres.aacrjournals.org on February 10, 2022. © 2004 American Association for Cancer
Research.
 DECREASED AKR1C1 AND AKR1C2 IN BREAST CANCER

reproducible method to monitor large changes in relative gene expres- 47, 48). In the recent Women Health Initiative Study, increased
sion. On average, we noticed that approximately half of the 24 cases incidence of total and invasive breast cancer was observed in the
demonstrated a substantial loss of AKR1C1 expression, defined as a estrogen ⫹ progestin group as compared with the placebo group (7).
⬎5-fold reduction in tumor as compared with paired unaffected tissue. A The risks of invasive lobular carcinoma and invasive ductal carcinoma
similar reduction in AKR1C2 expression was also found in half of these were also significantly increased among women who used combined
cases, whereas AKR1C3 expression was relatively unchanged. Reduction estrogen ⫹ progestin therapy (with continuous or sequential progestin
in AKR1C1 expression was observed in a previous microarray study of use), but not among those who solely used estrogen therapy (49),
human breast cancer, and loss of 20␣-HSD activity occurs in 7,12- strongly implicating progesterone in combination with estrogen as
dimethylbenz(a)anthracene-induced breast tumors in rats (37, 38). Others stimulating cellular proliferation.
reported a similar reduction in AKR1C1 and AKR1C2 gene expression by To explain how loss of AKR1C1 and AKR1C2 expression could
reverse transcription-PCR in nine breast cancer tumors as compared with modify progesterone-dependent PR-B activation, a progesterone-depen-
unaffected surrounding tissue from the same individuals (39). They also dent MMTV reporter activity was monitored in two different cell lines.
noted a significant increase in SRD5A1 expression in tumors as compared Prostate cancer PC-3 cells stably expressing either AKR1C1 or AKR1C2,
with normal breast tissues in contrast to our findings, which may be due but not AKR1C3, were able to reduce progesterone-dependent transac-
to differences in the tissue sample pool sizes, stage of tumor samples, and tivation of the MMTV reporter construct with cotransfected PR-B.
accuracy of the RNA quantitative techniques. We confirmed that de- AKR1C1 was able to completely inhibit progesterone-dependent activity,
creased protein expression of AKR1C1 was associated with the previ- despite its low level of expression. Increasing concentrations of proges-
ously reported reduction in AKR1C1 gene expression in the MCF-7 and terone were able to overcome this kind of inhibition (data not shown),
T-47D breast cancer cell lines in contrast to the breast epithelial cell line indicating that metabolism, not some nonspecific process, is responsible
MCF-10A (35). This pattern differed from that of AKR1C3, which was for reduced PR-B activation. Studies in the T-47D cell line confirmed that
equally expressed in all cell lines. Furthermore, reduced AKR1C1 and AKR1C1 was able to inhibit progesterone-dependent PR-B activation in
AKR1C2 expression in MCF-10A cells by siRNA suppression leads to a breast-derived cell line. In addition to 20␣-HSD, the 3␣-HSD of
decreased production of 20␣-hydroxyl or 3␣-hydroxyl progesterone me- AKR1C2 can also inhibit progesterone-dependent activation of PR-B,
tabolites. Thus, decreased expression of AKR1C1 and AKR1C2 observed although not as effectively as AKR1C1.
in human samples is mimicked in certain breast cancer cell lines, which In normal breast tissues, AKR1C1 is localized predominately in the
will prove useful for future studies on the AKR1C gene family. myoepithelial cells and in the luminal epithelial cells, which also express
Cellular localization of specific AKR1C members is difficult to PR (3, 50). We speculate that expression of AKR1C1 and possibly
determine due to their high sequence similarity. Immunohistochem- AKR1C2 in normal tissue may regulate progesterone-dependent gene
istry with AKR1C3-specific antiserum ␣7548 prominently stained expression by limiting progesterone’s interactions with nuclear PRs. This
myoepithelial and luminal epithelial cells as observed previously (25), observation resembles our recent finding of selective reduction in
and AKR1C1 was localized to the same epithelial layers in samples AKR1C2 expression, but not ARK1C3, in prostate cancer samples (24),
that lacked ARK1C3 expression (25). Although ␣6621 was able to suggesting that specific yet highly related AKR1C family members can
recognize both AKR1C1 and AKR1C3 using the Western blot tech- act as prereceptor regulators for ligand-dependent transcription factors.
nique, ␣6621 IHC staining closely matched AKR1C1 gene expression, Thus, AKR1C1 may limit progesterone-dependent signaling of nuclear
and ␣6621 IHC staining could be used to evaluate relative AKR1C1 PRs and thereby indirectly regulate gene expression. This is compatible
expression in pathological samples. with the role of AKR1C1 to limit the inhibitory interactions of proges-
The MCF-10A cell line was used to assess the physiologic function terone with mineralocorticoid receptor.
of AKR1C1 because it expresses AKR1C1 at levels comparable with We hypothesize that loss of key catabolic enzymes in breast cancer
those found in normal breast tissues. Selective reduction of AKR1C1 tissues in combination with increased expression of PR may enhance
by siRNA suppression in MCF-10A leads to a decrease in conversion progesterone-dependent gene expression. In addition to increased proges-
of progesterone to 20␣-dihydroprogesterone, present in both cell terone levels and differences in progesterone metabolites as a result of
lysate and media, which was further reduced with loss of AKR1C2. loss of AKR1C1 or AKR1C2, changes in relative expression of PR-A
Substantial decrease in 20␣-dihydroprogesterone production was as-
sociated with a corresponding increase in progesterone levels in
MCF-10A cells. Progesterone-mediated inhibition of growth in T-47D
cells was also observed with suppression of AKR1C1, which was
further enhanced in the absence of AKR1C2 expression. The loss of
these catabolic enzymes in breast cancer presumably leads to in-
creased progesterone levels, which, in combination with increased PR,
could enhance progesterone-responsive gene expression.
Confounding findings have been reported in the literature on the
proliferative effects of progesterone in established human breast cell
lines, with a majority of studies reporting growth-inhibitory effects (6,
28, 40 – 43). However, progesterone was found to cause cells to enter
one mitotic cycle with induction of genes associated with cell growth
(44, 45). Although progestins are proliferative when administered in a
transient or sequential manner, sustained treatment results in growth
arrest (46). Our data demonstrated that suppression of AKR1C1 or
AKR1C1 and AKR1C2 can significantly inhibit cellular proliferation
by progesterone as compared with control cell lines.
The role of progesterone as an antiproliferative agent in cell lines Fig. 4. Potential role of AKR1C1 as prereceptor regulator of progesterone-dependent gene
expression. Potential role of AKR1C1 in regulating availability of progesterone (F) to interact
does not mimic its function in vivo. A majority of studies in animals with nuclear PRs by shunting a certain percentage of progesterone to metabolites (‚) that are
and humans find that progestin treatment promotes growth in vivo (40, weaker transcriptional activators and thereby reduce PR signaling by progesterone.
7616

Downloaded from cancerres.aacrjournals.org on February 10, 2022. © 2004 American Association for Cancer
Research.
 DECREASED AKR1C1 AND AKR1C2 IN BREAST CANCER

and PR-B in breast cancer could also alter the spectrum of progesterone- 23. Lou H, Hammond L, Sharma V, et al. Genomic organization and chromosomal
localization of a novel human hepatic dihydrodiol dehydrogenase with high affinity
regulated genes (51). Wiebe et al. (28, 35) have also reported a differ- bile acid binding. J Biol Chem 1994;269:8416 –22.
ential effect of specific progesterone metabolites as either growth pro- 24. Ji Q, Chang L, VanDenBerg D, et al. Selective reduction of AKR1C2 in prostate
moters or inhibitors of the cell cycle in the MCF-7 cell line, suggesting a cancer and its role in DHT metabolism. Prostate 2003;54:275– 89.
25. Pelletier G, Luu-The V, Tetu B, et al. Immunocytochemical localization of type 5
specific role for progesterone metabolites. The appearance of specific 17beta-hydroxysteroid dehydrogenase in human reproductive tissues. J Histochem
progesterone metabolite binding sites on MCF-7 membranes further Cytochem 1999;47:731– 8.
supports a role for progesterone metabolites as signaling molecules (52). 26. Han YP, Nien YD, Garner WL. Recombinant human platelet-derived growth factor
and transforming growth factor-beta mediated contraction of human dermal fibroblast
Thus, metabolites of progesterone may also have unsuspected effects on populated lattices is inhibited by Rho/GTPase inhibitor but does not require phos-
cell growth. Fig. 4 illustrates the potential role of AKR1C1 and AKR1C2 phatidylinositol-3⬘ kinase. Wound Repair Regen 2002;10:169 –76.
27. Syed V, Ulinski G, Mok SC, et al. M. Expression of gonadotropin receptor and
functioning as a prereceptor regulator of progesterone interactions with growth responses to key reproductive hormones in normal and malignant human
PRs. Loss of AKR1C1 in combination with increased PR in selective ovarian surface epithelial cells. Cancer Res 2001;61:6768 –76.
breast cancers could therefore provide therapeutic opportunities to block 28. Wiebe JP, Muzia D, Hu J, et al. The 4-pregnene and 5alpha-pregnane progesterone
metabolites formed in nontumorous and tumorous breast tissue have opposite effects
ligand-dependent activation of PRs by using antiprogestational agents. on breast cell proliferation and adhesion. Cancer Res 2000;60:936 – 43.
29. Anderson E. The role of oestrogen and progesterone receptors in human mammary
development and tumorigenesis. Breast Cancer Res 2002;4:197–201.
ACKNOWLEDGMENTS 30. Soule HD, Maloney TM, Wolman SR, et al. Isolation and characterization of a
spontaneously immortalized human breast epithelial cell line, MCF-10. Cancer Res
We thank Dr. Mike Stallcup and Dr. Michael Press (Keck School of 1990;50:6075– 86.
31. Tomlinson JW, Stewart PM. Cortisol metabolism and the role of 11beta-hydroxy-
Medicine at University of Southern California) for their thoughtful discussions steroid dehydrogenase. Best Pract Res Clin Endocrinol Metab 2001;15:61–78.
and review of the manuscript. 32. Bumke-Vogt C, Bahr V, Diederich S, et al. Expression of the progesterone receptor
and progesterone-metabolising enzymes in the female and male human kidney.
J Endocrinol 2002;175:349 – 64.
REFERENCES 33. Quinkler M, Johanssen S, Bumke-Vogt C, et al. Enzyme-mediated protection of the
mineralocorticoid receptor against progesterone in the human kidney. Mol Cell
1. Ross RK, Paganini-Hill A, Wan PC, et al. Effect of hormone replacement therapy on Endocrinol 2001;171:21– 4.
breast cancer risk: estrogen versus estrogen plus progestin. J Natl Cancer Inst 34. Johansson ED, Jonasson LE. Progesterone levels in amniotic fluid and plasma from
(Bethesda) 2000;92:328 –32. women. I. Levels during normal pregnancy. Acta Obstet Gynecol Scand 1971;50:
2. Pike MC, Spicer DV, Dahmoush L, et al. Estrogens, progestogens, normal breast cell 339 – 43.
proliferation, and breast cancer risk. Epidemiol Rev 1993;15:17–35. 35. Wiebe JP, Lewis MJ. Activity and expression of progesterone metabolizing 5alpha-
3. Soyal S, Ismail PM, Li J, et al. Progesterone’s role in mammary gland development reductase, 20alpha-hydroxysteroid oxidoreductase and 3alpha(beta)-hydroxysteroid
and tumorigenesis as disclosed by experimental mouse genetics. Breast Cancer Res oxidoreductases in tumorigenic (MCF-7, MDA-MB-231, T-47D) and nontumorigenic
2002;4:191– 6. (MCF-10A) human breast cancer cells. BMC Cancer 2003;3:9.
4. Lange CA, Richer JK, Horwitz KB. Hypothesis: progesterone primes breast cancer 36. Burczynski ME, Lin HK, Penning TM. Isoform-specific induction of a human
cells for cross-talk with proliferative or antiproliferative signals. Mol Endocrinol aldo-keto reductase by polycyclic aromatic hydrocarbons (PAHs), electrophiles, and
1999;13:829 –36. oxidative stress: implications for the alternative pathway of PAH activation catalyzed
5. Pasqualini JR, Paris J, Sitruk-Ware R, et al. Progestins and breast cancer. J Steroid by human dihydrodiol dehydrogenase. Cancer Res 1999;59:607–14.
Biochem Mol Biol 1998;65:225–35. 37. Perou CM, Jeffrey SS, Van de Rijn M, et al. Distinctive gene expression patterns in
6. Clarke CL, Sutherland RL. Progestin regulation of cellular proliferation. Endocr Rev human mammary epithelial cells and breast cancers. Proc Natl Acad Sci USA
1990;11:266 –301. 1999;96:9212–7.
7. Chlebowski RT, Hendrix SL, Langer RD, et al. Influence of estrogen plus progestin 38. Mori M, Tominaga T, Tamaoki BI. Steroid metabolism in normal mammary gland
on breast cancer and mammography in healthy postmenopausal women: the Women’s and in the dimethylbenzanthracene-induced mammary tumor of rats. Endocrinology
Health Initiative Randomized Trial. JAMA 2003;289:3243–53. 1978;102:1387–97.
8. Rossouw JE, Anderson GL, Prentice RL, et al. Risks and benefits of estrogen plus 39. Lewis MJ, Wiebe JP, Heathcote JG. Expression of progesterone metabolizing enzyme
progestin in healthy postmenopausal women: principal results from the Women’s genes (AKR1C1, AKR1C2, AKR1C3, SRD5A1, SRD5A2) is altered in human breast
Health Initiative Randomized Controlled Trial. JAMA 2002;288:321–33. carcinoma. BMC Cancer 2004;4:27.
9. Zhu BT, Conney AH. Functional role of estrogen metabolism in target cells: review 40. Horwitz KB. The molecular biology of RU486. Is there a role for antiprogestins in the
and perspectives. Carcinogenesis (Lond) 1998;19:1–27. treatment of breast cancer? Endocr Rev 1992;13:146 – 63.
10. Harada N. Aromatase and intracrinology of estrogen in hormone-dependent tumors. 41. Schoonen WG, Joosten JW, Kloosterboer HJ. Effects of two classes of progestagens,
Oncology (Basel) 1999;57(Suppl 2):7–16. pregnane and 19-nortestosterone derivatives, on cell growth of human breast tumor
11. Sasano H, Suzuki T, Harada N. From endocrinology to intracrinology. Endocr Pathol cells. II. T47D cell lines. Steroid Biochem Mol Biol 1995;55:439 – 44.
1998;9:9 –20. 42. Schoonen WG, Joosten JW, Kloosterboer HJ. Effects of two classes of progestagens,
12. Chen S, Zhou D, Okubo T, et al. Prevention and treatment of breast cancer by pregnane and 19-nortestosterone derivatives, on cell growth of human breast tumor
suppressing aromatase activity and expression. Ann N Y Acad Sci 2002;963:229 –38. cells. I. MCF-7 cell lines. Steroid Biochem Mol Biol 1995;55:423–37.
13. Stocco CO, Zhong L, Sugimoto Y, et al. Prostaglandin F2 alpha-induced expression 43. Lin VC, Ng EH, Aw SE, Tan MG, et al. Progestins inhibit the growth of MDA-MB-
of 20alpha-hydroxysteroid dehydrogenase involves the transcription factor NUR77. 231 cells transfected with progesterone receptor complementary DNA. Clin Cancer
J Biol Chem 2000;275:37202–11. Res 1999;5:395– 403.
14. Wiest WG, Kidwell WR, Balogh K. Progesterone catabolism in the rat ovary: a 44. Musgrove EA, Lee CS, Sutherland RL. Progestins both stimulate and inhibit breast
regulatory mechanism for progestational potency during pregnancy. Endocrinology cancer cell cycle progression while increasing expression of transforming growth
1968;82:844 –59. factor alpha, epidermal growth factor receptor, c-fos, and c-myc genes. Mol Cell Biol
15. Milewich L, Gant NF, Schwarz BE, et al. Initiation of human parturition. IX. 1991;11:5032– 43.
Progesterone metabolism by placentas of early and late human gestation. Obstet 45. Hissom JR, Moore MR. Progestin effects on growth in the human breast cancer cell
Gynecol 1978;51:278 – 80. line T-47D: possible therapeutic implications. Biochem Biophys Res Commun 1987;
16. Diaz-Zagoya JC, Wiest WG, Arias F. Metabolism of progesterone by placentas from 145:706 –11.
several mammalian species in vitro. Am J Obstet Gynecol 1979;135:809 –13. 46. Eden J. Progestins and breast cancer. Am J Obstet Gynecol 2003;188:1123–31.
17. Penning TM. Molecular endocrinology of hydroxysteroid dehydrogenases. Endocr 47. Longacre TA, Bartow SA. A correlative morphologic study of human breast and
Rev 1997;18:281–305. endometrium in the menstrual cycle. Am J Surg Pathol 1986;10:382–93.
18. Vergnes L, Phan J, Stolz A, et al. A cluster of eight hydroxysteroid dehydrogenase 48. Graham JD, Clarke CL. Physiological action of progesterone in target tissues. Endocr
genes belonging to the aldo-keto reductase supergene family on mouse chromosome Rev 1997;18:502–19.
13. J Lipid Res 2003;44:503–11. 49. Li CI, Malone KE, Porter PL, et al. Relationship between long durations and different
19. Wilks JW, Spilman CH, Campbell JA. Steroid binding specificity of the hamster regimens of hormone therapy and risk of breast cancer. JAMA 2003;289:3254 – 63.
uterine progesterone receptor. Steroids 1980;35:697–706. 50. Conneely OM, Mulac-Jericevic B, DeMayo F, et al. Reproductive functions of
20. Hara A, Matsuura K, Tamada Y, et al. Relationship of human liver dihydrodiol progesterone receptors. Recent Prog Horm Res 2002;57:339 –55.
dehydrogenases to hepatic bile-acid-binding protein and an oxidoreductase of human 51. Richer JK, Jacobsen BM, Manning NG, et al. Differential gene regulation by the two
colon cells. Biochem J 1996;313:373– 6. progesterone receptor isoforms in human breast cancer cells. J Biol Chem 2002;277:
21. Higaki Y, Usami N, Shintani S, et al. Selective and potent inhibitors of human 5209 –18.
20alpha-hydroxysteroid dehydrogenase (AKR1C1) that metabolizes neurosteroids 52. Weiler PJ, Wiebe JP. Plasma membrane receptors for the cancer-regulating
derived from progesterone. Chem Biol Interact 2003;143–144:503–13. progesterone metabolites, 5alpha-pregnane-3,20-dione and 3alpha-hydroxy-4-
22. Zhang Y, Dufort I, Rheault P, et al. Characterization of a human 20alpha-hydroxy- pregnen-20-one in MCF- 7 breast cancer cells. Biochem Biophys Res Commun
steroid dehydrogenase. J Mol Endocrinol 2001;25:221– 8. 2000;272:731–7.

7617

Downloaded from cancerres.aacrjournals.org on February 10, 2022. © 2004 American Association for Cancer
Research.
Selective Loss of AKR1C1 and AKR1C2 in Breast Cancer and
Their Potential Effect on Progesterone Signaling
Qing Ji, Chisa Aoyama, Yih-Dar Nien, et al.

Cancer Res 2004;64:7610-7617.

Updated version Access the most recent version of this article at:
http://cancerres.aacrjournals.org/content/64/20/7610

Cited articles This article cites 48 articles, 12 of which you can access for free at:
http://cancerres.aacrjournals.org/content/64/20/7610.full#ref-list-1

Citing articles This article has been cited by 11 HighWire-hosted articles. Access the articles at:
http://cancerres.aacrjournals.org/content/64/20/7610.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Subscriptions Department at pubs@aacr.org.

Permissions To request permission to re-use all or part of this article, use this link
http://cancerres.aacrjournals.org/content/64/20/7610.
Click on "Request Permissions" which will take you to the Copyright Clearance Center's
(CCC)
Rightslink site.

Downloaded from cancerres.aacrjournals.org on February 10, 2022. © 2004 American Association for Cancer
Research.