Detection of Human Papillomavirus DNA by PCR in Esophageal

Squamous Cell Carcinoma from Turkmen Sahra, North-East of

Iran
Abdolvahab Moradi
*1
, Ethel-Michele de Villiers
2
, Talat Mokhtari-Azad
3
, Mahmoud
Mahmoudi
3
, Bahman Hazrati
4
, Ezzat-Elah Ghaemi
5
and Rakhshandeh Nategh
3
1
Zahedan University oI Medical Sciences, Zahedan, Iran;
2
German Cancer Research Center, Heidelberg, Germany;
3
Tehran University oI Medical Sciences, Tehran, Iran;
4
Gorgan Laboratory oI Pathology, Gorgan, Iran;
5
Gorgan
University oI Medical Sciences, Gorgan, Iran
ABSTRACT
Human papillomavirus (HPV) DNA has been identified in esophageal carcinomas. However, the
incidence of HPV varies significantly in different geographical locations. In this study, neoplasms from
Turkmen Sahra, a region in Golestan province in northeast part of Iran, with a high incidence of
squamous cell carcinoma were analyzed for the presence of HPV DNA. Turkmen Sahra is located in the
cancer belt in Asia. Eighty-five squamous cell carcinomas were examined for the presence of HPV
DNA. PCR was utilized to amplify a 124-bp segment of the HPV L1 gene using the consensus primers.
The amplified region was subsequently sequenced to identify the HPV. The results indicated that the
rates of HPV detection in squamous cell carcinoma specimen for men and women were 52.8 and
43.7 respectively. The positive cases included HPV-16( 54.7), HPV-18( 4.8), HPV-6 (14.3),
HPV-66( 7.1), HPV-52( 4.8) and 14.3 of cases were positive for more than one type of HPV.
Human papillomavirus type 16 that can be potentially oncogenic was prevalent in 54.8 of the cases of
esophageal squamous cell carcinoma. Our results confirm the previously reported HPV involvement in
the esophageal squamous cell carcinoma, and support the possible role of HPV as an etiological agent in
esophageal carcinogenesis. Iran. Biomed. J. 6 (1): 19-23, 2002
Keywords: Esophageal carcinoma, HPV, Turkmen Sahra, Iran
INTRODUCTION
sophageal carcinoma has a striking geographical distribution. The incidence is remarkably high in
certain regions oI Iran, China and South AIrica. The highest incidence oI this highly malignant tumor
was encountered in the northeast oI Iran, particularly in the Turkmen Sahra. (Fig. 1) The annual
incidence oI esophageal cancer in the Turkmen Sahra is estimated to be 8.8 in 100,000 persons Ior all
ages, and 37in 100,000 persons in people aged over 35 years old. Based on the data collected in 1999, the
highest incidence oI squamous cell carcinoma is observed in women aged 75-80 years old with an annual
incidence oI 192 in 100,000 persons, and in men aged 70-74years old with an annual incidence oI 145 in
100,000 persons (unpublished data).
Fig. 1. Iran and its location in the esophageal cancer belt in Asia. (ReI. 3)
Although a great deal oI inIormation has been obtained on esophageal cancer, the causative Iactor oI this
disease remains to be established |1-5|. Cigarette smoking and excessive alcohol intake may be the risk
Iactors in some areas (e.g. Western countries and South AIrica), especially when the two Iactors are
combined. Nevertheless, these Iactors do not appear to be a problem in Iran |6-8|. According to the previous
E
Page 1 oI 5 Detection oI Human Papillomavirus DNA by PCR in Esophageal Squamous Cell Car
2005/08/13 Iile://E:\Iranian20Biomedical20Journal\vol.20620no.20120January202
Archive of SID
www.SID.ir
studies in Iran, speciIic nutritional deIiciencies such as vitamin A, B, C and certain minerals, nitrosamines
Iormed in moldy IoodstuIIs may be important |9-11|. Furthermore, opium tar has been blamed as possible risk
Iactor |1, 7|. However, as stated earlier, it seems extremely unlikely that these Iactors alone could oIIer
satisIactory explanation Ior the high mortality and morbidity oI this malignancy in the Turkmen Sahra. It is
more likely that these Iactors may render the esophageal mucous membrane, more susceptible to injury by
carcinogens such as mycotoxins, nitrosyl compound, and possibly viruses.
HPV plays an important role in the development oI squamous cell carcinomas in various body sites,
including the anogenital, |12| upper respiratory, and digestive tracts |13-20|. Eighty-Iive types oI HPV have
been described in Iull and 120 types have been partially characterized |21|. HPV types 6, 11, 16, 18, and 31
represent the most common types Iound in the epithelium oI squamous cell hyperplasia, dysplasia, and
carcinomas |14|. Based on their association with neoplasm`s in the anogenital tract, HPV types can be
categorized as either high-risk types (HPV-16, 18 and 31) or low-risk types (HPV-6, 11).
Members oI the high-risk group promote carcino-genesis and their DNA usually integrates into the host
genome, whereas, the low-risk HPV types which are primarily Iound in benign tumors and their DNA remain
extrachromosomal |19|. HPV 6, 11, 16, 18, and 31 have been described in association with esophageal
squamous cell lesions |22|. However, the incidence oI HPV positively varies signiIicantly depending on the
histology oI the lesion and the geographical location oI the patient. Studies that suggest a role Ior HPV in the
genesis oI esophageal carcinoma almost invariably involve a population which is at a high risk Ior
development oI esophageal carcinoma |13, 15|.
This study was designed to determine the incidence oI various HPV types in the specimen obtained Irom
esophageal squamous cell carcinoma cases based on the DNA sequence oI L1 gene, which is the most widely
gene used in PCR assay and can be detected a segment oI the gene encoding the L1 major capsid protein, that
is common to all HPV types.
MATERIALS AND METHODS
A total oI 85 human squamous cell carcinomas 53 men and 32 women, aged between 42to 85 years were
removed by biopsy between 1997 to 1998 Irom Turkmen Sahra and were studied in the Institute oI Public
Health and Research at the Tehran University oI Medical Sciences. The patients were classiIied histologically
and clinically based on the guideline Ior clinical and pathological studies on carcinoma oI the esophageal
diseases. All specimens were Iixed in 10 buIIered Iormalin, processed routinely, and embedded in paraIIin.
For each case, all available hematoxylin and eosin stained sections were reviewed, and a representative block
was selected Ior Iurther studies.
Sample preparation. Genomic DNA was extracted by the standard proteinase K/ phenol method |23|.
AIter ethanol precipitation, the DNA was resuspended in TE buIIer (10mM Tris -HCl 1 mM EDTA) and
quantiIied by measuring absorbance at 260 nm. DNA concentration oI more than 10ng /l was judged as
suitable Ior Iurther studies. DNA samples were then checked by agarose gel electrophoresis to veriIy that
degradation had not occurred during the extraction. Samples containing 100 ng oI puriIied DNA were used Ior
PCR ampliIication according to the Iollowing procedure |24|.
Polymerase chain reaction (PCR). A slight modiIication oI the PCR method described by Saiki et al. |24|
were used. PCR was perIormed in a total volume oI 50 l containing 100 ng oI DNA extracted Irom paraIIin-
embedded tissue, 50mM -KCl, 10 mM Tris-HCl pH 8.3, 200 M oI each dNTP, 2 to 4 mM MgCl2, 1 U Taq
polymerase and 50pmol oI each primer . The primers used in this study were GP5/GP6 pairs with the
Iollowing sequences de Roba Husman et al: 1995 modiIied in German Cancer Research Center|:
GP5 5TTGGATCCTTTGTTACTGTGGTA GATACTAC
GP6 5TTGGATCCGAA AAA TAA ACT GTA AATCATATTC
The mixture was denatured at 94
o
C Ior 5 min, Iollowed by 40 cycles oI ampliIication using a PCR processor
Bio-Med (Perkin Elmer Cetus USA). Each cycle consisted oI 94
o
C Ior 1.5 min, 40
o
C Ior 2 min, and 72
o
C Ior
1.5 min. The Iinal elongation step was prolonged Ior 4 minutes to ensure complete extension oI the ampliIied
product. Samples processing prior to and aIter the ampliIication reactions were perIormed in strictly separated
rooms to avoid contamination by PCR products. Samples containing distilled water were used as negative
controls. Ten l oI each PCR mixture was Iinally analyzed by 1.5 agarose gel electrophoresis |24| (Fig. 2).
Fig. 2. PCR product oI HPV DNA Irom esophageal carcinoma. Lane 1, positive control; Lane 2, negative control;
Page 2 oI 5 Detection oI Human Papillomavirus DNA by PCR in Esophageal Squamous Cell Car
2005/08/13 Iile://E:\Iranian20Biomedical20Journal\vol.20620no.20120January202
Archive of SID
www.SID.ir
Lanes 3, 5, 7, 8, 9, 10, 12, positive patient samples; Lane 4, 6, 11, negative patient samples.
Sequence analysis of PCR products. PCR ampliIied products (124 bp) were puriIied with commercial
PCR product puriIication Kit (Boehringer Mannheim, Germany) according to the procedure described by the
manuIacturer. Approximately 25 ng oI each puriIied ampliIied DNA product was subjected to nucleotide
sequence analysis using 20 pmoles oI M13 Iorward (-20) and reverse primers with the Iollowing sequences.
M13 Forward (-20) priming site 5GTAAAACGA CGGCCAG, M13 Reverse Priming site 5CAG
GAAACAGCTATGAC
The sequencing was perIormed using commercial sequencing kite (Perkin Elmer, USA). Subsequently, X-
ray Iilm autoradiography was then perIormed to reveal the nucleotide oI diIIerent HPV DNA.
RESULTS
A total oI 85 specimens Irom 85 patients with squamous cell carcinoma oI the esophagus were available Ior
examination. The neoplasm was histo-logically graded as, well diIIerentiated (56.3), moderately
diIIerentiated (28.6) and poorly diIIerentiated (25.1). DNA was ampliIiable in every specimen as
determined by ampliIication oI the beta-globin gene. Forty-two specimens were PCR positive (49.4) using
primers oI the HPV L1 gene. The distribution oI the HPV positive cases with esophageal cancer based on sex
oI the patients were 52.8 Ior male and 43.7 Ior Iemale (Table 1).
Table. 1. Frequency oI HPV types in esophageal squamous cell carcinoma Irom north-east oI Iran (Turkmen Sahara).
DISCUSSION
Esophageal carcinoma has a distinct geographical distribution with a high prevalence in certain regions oI
Iran, China, AIrica and France |19|. The basis Ior the variation in geographical distribution oI the disease
stems in part Irom environmental Iactors such as the mineral content oI the soil, dietary practices,
occupational Iactors, and personal habits |25|. Viral inIections may also play a role in the genesis oI
esophageal carcinoma in some popu-lations |26|. In 1982, Syrjanen published his observation on the presence
oI histological changes, consistent with those oI condyloma in esophageal squamous cell cancer |14|. This
observation showed etiological role oI HPV inIection in the development oI esophageal carcinoma. An
association between HPV and esophageal carcinoma has been previously reported in China |13-15| , France
|18|, Italy |20|, Japan |27|, South AIrica |28, 29|, Hong Kong |19|, Slovenia |30|, Portugal |31| , and the
United State |20|. However, the incidence oI inIection diIIers based on the geographical location oI the
patient population under study. HPV detection rate varies Irom none up to 70, depending on the regions,
under study |32|. The highest incidence oI HPV isolation has been reported Irom high-risk regions oI China
and South AIrica |22|. Turkmen Sahra located in the cancer belt in Asia is also a high-risk region Ior
esophageal carcinoma.
In our study, HPV-16, which has a potential Ior oncogenesis, was the most prevalent among the esophageal
cancer cases examined together with HPV types 52 and 66. These types have not been previously recovered
Irom esophageal tumors.
The data indicate that the inIection with oncogenic DNA viruses such as HPV, may be a Iactor in
development oI cancer by itselI or in synergism with other Iactors including environmental carcinogens,
Ioods, health habits, and hereditary Iactors. We don`t have any evidence to determine whether inIection with
HPV preceded or Iollowed the development oI squamous cell carcinoma. Further studies are required to
pinpoint the cases oI esophageal cancer in this area.
HPV Types Frequency Percent
HPV-6 6 14.3
HPV-16 ` 54.7
HPV-18 ` ^
HPV-66 ``
HPV-52 ` ^
HPV-6,16 `
HPV-16,18 ` ^
Total ` 100.0
Page 3 oI 5 Detection oI Human Papillomavirus DNA by PCR in Esophageal Squamous Cell Car
2005/08/13 Iile://E:\Iranian20Biomedical20Journal\vol.20620no.20120January202
Archive of SID
www.SID.ir
ACKNOWLEDGMENTS
This work would not have been possible without the sustained support, interest and encouragement oI ProI.
H. Zur Hausen, Irom the German Cancer Research Center, Heidelberg, Germany.
REFERENCES
1. Kemt, J., McLaren, D.S. and Siassi, F. (1980) Epidemiology oI esophageal cancer with special reIerence to
nutritional studies among the Turkmen oI Iran. In: Advances in modern human nutrition. Pathotox, New York, pp.
343-365.
2. Oneill, C.H., Hodges, G.M. and Riddle, P.N. (1980) A Iine Iibrous silica contaminant oI Ilour in the high
oesophageal cancer area oI north-east Iran. Int. J. Cancer 26: 617-628.
3. Kmet, J. and Mahboubi, E. (1972) Esophageal cancer in the Caspian littoral oI Iran: Initial Studies. Science 17:
846-853.
4. Munoz, N., Grassi, A., Qiong, S., Crespi, M., Wang G.Q. and Li, Z.C. (1982) Precursor lesions oI esophageal
cancer in high- risk populations in Iran and China. Lancet Apr. 17: 876-879.
5. Mahboubi, E., Kemet, J., Cook, P.J., Day, N.E., Ghadirian, P. and Salmasizadeh, S. (1973) Oesophageal cancer
studies in the Caspion littoral oI Iran: the Caspian cancer registry. Br. J. cancer 28: 197-214.
6. Editorial (1978) Oesophageal Cancer in the Caspian littoral. Lancet (I) 641-642.
7. Joint Iran/IARC Study Group (1977) Esophageal cancer studies in the Caspian littoral oI Iran: results oI population
studies-a prodome. J. Nat. Cancer Inst. 59: 1127-1138.
8. Crespi, M., Munoz, N., Grassi, A., Aramesh, B., Amiri, G., Mojtabai, A. and Casale, V. (1979) Esophageal lesions
in Northern Iran: A pre-malignant condition? Lancet Aug. 4: 217-220.
9. Hormozdiari, H., Day, N.E., Aramesh, B. and Mahboubi, E. (1975) Dietary Iactors and esophageal cancer in the
Caspian littoral oI Iran. Cancer Research 35: 3493-3498.
10. Cook-MozaIIari, P.J., Azordegan, F., Day, N.E., Ressicaud, A., Sabai, C. and Aramesh, B. (1979) Esophageal
cancer studies in the Caspian littoral oI Iran: Results oI a case-control study. B. J. Cancer 39: 293-309.
11. Ghadirian, P. (1987) Thermal irritation and esophageal cancer in North oI Iran. Cancer 60: 1909-1914.
12. Zur Hausen, H. and de Villiers, E.M. (1994) Human papillomaviruses. Ann. Rev. Microbiol. 48: 427-447.
13. Chen, B., Yin, H. and Dhurandhar, N. (1994) Detection oI human papillomavirus DNA in esophageal squamous
cell carcinomas by the polymerase chain reaction using general consensus primers. Hum. Pathol. 25: 920-923.
14. Chang, F., Syrjanen, S., Shen, Q., Hongxiu, J.I. and Syrjanen, K. (1990) Human papillomavirus (HPV) DNA in
esophageal precancer lesions and squamous cell carcinomas Irom China. Int. J. Cancer 45:21-25.
15. Chang, F., Syrjanen, S., Shen, Q., Wang, L. and Syrjanen, K. (1993) Screening Ior human papillomavirus
inIections in esophageal squamous cell carcinoma by in situ hybridization. Cancer 72: 2525-2530.
16. Kulski, J., Demeter, T., Sterret, G.F. and Shilkin, K.B. (1986) Human papillomavirus DNA in esophageal
carcinoma. Lancet 2: 683-684.
17. Loke, S.L., Ma, L., Wong, M., Srivastava, G., Lo, I. and Bird, C.C. (1990) Human papillomavirus in esophageal
squamous cell carcinoma. J. Clin. Pathol. 43: 909-1012.
18. Benamouzig, R., Pigot, F., Quiroga, G., Validire, P., Chaussade, S., Catalan, F. and Couturier, D. (1992) Human
papillomavirus inIection in esophageal squamous cell carcinoma in western countries. Int. J. Cancer 50: 549-552.
19. Toh, Y., Kuwano, H., Tanaka, S., Baba, K., Matsuda, H., Sugimachi, K. and Mori, R. (1992) Detection oI human
papillomavirus DNA in esophageal carcinoma in Japan by polymerase chain reaction. Cancer 70( 3): 2234-2238.
20. Togawa, K., Jaskiewicz, K., Takahashi, H., Meltzer, S.J. and Sugimachi, K. (1994) Human papillomavirus DNA
sequences in esophageal squamous cell carcinoma. Gastroenterology 107: 128-136.
21. Zur Hausen, H. (1999) Papillomaviruses in human cancer. Pro. Assoc. Am. Physicians (United States). Nov. Dec.
111 (6): 581-587.
22. Maniatis, T., Fritsch, E.F. and Sambrook, J. (1989) Molecular cloning: A laboratory manual. Cold Harbor
Laboratory Press, New York.
23. Saiki, R.K., ScharI, S. and Faloona, F. (1985) Enzymatic ampliIication oI the beta-globin genomic sequences and
restriction site analysis Ior diagnosis oI sickle cell anemia. Science 230: 1350-1354.
24. Saiki, R.K., GelIand, D.H. and StoIIel, S. (1988) Primer directed enzymatic ampliIication oI DNA with a Taq DNA
polymerase. Science 239: 487-491.
25. Whelan, S.L., Parkin, D.M. and Masuyer, E. (1990) Pattern oI cancer in Iive continents. IARC ScientiIic
Publications. No.102, Lyon: International Agency Ior Research on Cancer, pp.14- 104.
26. Chang, F., Syrjanen, S., Shen, Q., Wang, L. and Syrjanen, K. (1992) InIections agents in the etiology oI esophageal
cancer. Gastroenterology 103: 1336-1348.
27. Mori, M., Shimono, R., Inoue, T., Kuwano, H., Sugimachi, K. and Imachi, K. (1989) Papillomavirus and
esophageal cancer in the Japanese and Chinese. Am. J. Gastroenterol. 84: 1126-1127.
28. Williamson, A.L., Jaskiesicz, K. and Gunning, A. (1991) The detection oI human papillomavirus in esophageal
lesions. Anticancer Res. 11(1 ): 236265.
29. Cooper, K., Taylor, L. and Govind, S. (1995) Human papillomavirus DNA in esophageal carcinomas in AIrica. J.
Pathol. 175 (3): 273-277.
Page 4 oI 5 Detection oI Human Papillomavirus DNA by PCR in Esophageal Squamous Cell Car
2005/08/13 Iile://E:\Iranian20Biomedical20Journal\vol.20620no.20120January202
Archive of SID
www.SID.ir
30. Polijak, M., Cerar, A. and Seme, K. (1998) Human papillomavirus inIection in esophageal carcinoma a study oI 121
lesions using multiple broad-spectrum PCR and literature review. Human Pathology 29( 3): 266-271.
31. Fidalgo, P., Cravo, M. and Chaves, P. (1995) High prevalence oI human papillomavirus in squamous cell
carcinoma and matched normal esophageal mucosa. Cancer 76: 1522-1528.
32. Benamouzing, R., Jullian, E., Chang, F., Robaskiewicz, M., Flejou, J.F., Raoul, U.L., Coste, T., Couturier, D.,
Pompidou, A. and Rautkureau, J. (1995) Absence oI human papillomavirus DNA detected by polymerase chain
reaction in French patients with esophageal carcinoma. Gastroenterology 109 (6): 18761881.
Page 5 oI 5 Detection oI Human Papillomavirus DNA by PCR in Esophageal Squamous Cell Car
2005/08/13 Iile://E:\Iranian20Biomedical20Journal\vol.20620no.20120January202
Archive of SID
www.SID.ir