Hypertension Research (2011) 34, 655–661

& 2011 The Japanese Society of Hypertension All rights reserved 0916-9636/11 $32.00
www.nature.com/hr

ORIGINAL ARTICLE

Detection of global DNA methylation and paternally

imprinted H19 gene methylation in preeclamptic
placentas
Wen-long Gao1,4, Dong Li1,4, Zhong-xin Xiao2, Qin-ping Liao3, Hui-xia Yang3, Yu-xia Li1, Lei Ji1
and Yan-ling Wang1

Preeclampsia (PE) is a severe hypertensive disorder associated with pregnancy; despite substantial research effort in the past
several years, the etiology of PE is still unclear. The role of epigenetic factors in the etiology of PE, including DNA methylation,
has been poorly characterized. In the present study, we investigated global DNA methylation as well as DNA methylation of the
paternally imprinted H19 gene in preeclamptic placentas. Using 5-methylcytosine immunohistochemistry and Alu and LINE-1
repeat pyrosequencing, we found that the global DNA methylation level and the DNA (cytosine-5) methyltransferase 1 mRNA
level were significantly higher in the early-onset preeclamptic placentas when compared with the normal controls. Data from
methylation-sensitive high resolution melting demonstrated hypermethylation of the promoter region of the H19 gene, and
results of real-time PCR showed decreased mRNA expression of H19 gene in the early-onset preeclamptic placentas as
compared with the normal controls. Our results suggest that abnormal DNA methylation during placentation might be involved
in the pathophysiology of PE, especially early-onset preeclampsia.
Hypertension Research (2011) 34, 655–661; doi:10.1038/hr.2011.9; published online 17 February 2011

Keywords: DNA methylation; H19; placenta; preeclampsia

INTRODUCTION logical and biochemical changes of trophoblast cells and endometrial

Preeclampsia (PE) is a pregnancy-specific syndrome, generally defined cells, thus negatively impinging upon the delicate feto-maternal
as the development of hypertension and proteinuria after 20 weeks interaction during the early pregnancy. In addition, results from
of gestation in a previously normotensive woman. The disease affects cloned animals also revealed that disruptions in DNA methylation
5–7% of pregnancies worldwide, and is one of the major causes of the profiles in placentas may be involved in the severe symptoms of
maternal and neonatal mortality and morbidity.1,2 PE has been termed placentomegaly.8,9
the ‘disease of theories’, reflecting the confusion that surrounds the Recent mounting evidence strongly suggests the contribution of
etiology of PE.3 The pathogenesis of PE is complex, likely resulting epigenetic factors to the etiology of PE. Results from two independent
from the interaction of numerous genetic, immunologic and environ- laboratories demonstrated that significant hypomethylation occurs
mental factors.4 Although the prime cause remains unclear, it is in the promoter regions of the serpinb5 and serpina3 genes in
generally accepted that the syndrome may be initiated by abnormal preeclamptic placenta as compared with normal controls placen-
placental development during the first trimester, resulting in placental tas.10,11 Novakovic et al. reported decreased DNA methylation levels
insufficiency and the release of impaired placental factors into the of the cyp24a1 gene in preeclamptic placenta tissues.12 However, most
maternal circulation.5–7 of these evidences are limited to the analysis of individual genes, and
It has been well documented that a successful pregnancy involves a variations of global DNA methylation is still poorly understood in PE.
complex and precisely coordinated modulation of gene expression in On the other hand, parent-of-origin specific imprinting of many
gestational tissues mainly including placenta and uterine decidua. genes in placenta is likely to have key roles in many aspects of placental
Recent evidence suggests that epigenetic regulation of gene expression function, including trophoblast cell proliferation, differentiation,
is likely to have a key role in this process. Serman et al. indicated that angiogenesis and transportation of nutrients.13,14 The variations of
variations in the extent of DNA methylation could induce morpho- some imprinted genes were also reported to be associated with PE.

1State Key Laboratory of Reproductive Biology, Institute of Zoology, Chinese Academy of Sciences, Beijing, China; 2School of Public Health and Family Medicine, Capital Medical

University, Beijing, China; 3Department of Obstetrics and Gynecology, Peking University First Hospital, Beijing, China and 4Graduate School of Chinese Academy of Sciences,
Beijing, China
Correspondence: Dr L Ji or Dr Y-l Wang, State Key Laboratory of Reproductive Biology, Institute of Zoology, Chinese Academy of Sciences, 1 Beichen West Road, Beijing 100101,
China.
E-mails: jilei@ioz.ac.cn or wangyl@ioz.ac.cn
Received 5 August 2010; revised 13 December 2010; accepted 16 December 2010; published online 17 February 2011
 Detection of DNA methylation in preeclampsia
W-l Gao et al
656

These mainly included the single nucleotide polymorphorism of the peroxide for 15 min, incubated with 1% bovine serum albumin for 1 h at room
STOX1 gene (van Dijk et al.)15 and the gene mutation of the parentally temperature, and subsequently incubated with a mouse monoclonal antibody
imprinted p57 gene (Kanayama et al.)16 The paternally imprinted H19 against 5-MC (0.5 mg ml1) at 4 1C overnight. The negative control was
gene is transcribed as an untranslated RNA that may serve as a prepared by replacing primary antibodies with non-immune mouse IgG at
riboregulator. The gene is located in close proximity to the maternally the same concentration. The slides were further incubated with horseradish
peroxidase streptavidin -conjugated anti-mouse IgG (Zhongshan Goldenbrige
imprinted IGF-2 gene on chromosome 11p15.5.17 Notably, the H19
Biotechnology, Beijing, China) for 30 min. Final visualization was performed by
null mice display hyperplasia of all layers of the placenta,18 and recent incubating the sections with a DAB Detection Kit (Zhongshan Goldenbrige
studies demonstrated the regulatory role of H19 in the invasive Biotechnology), and the staining time was tightly fixed at 5 min for every slide.
property of placental trophoblasts.19,20 The evidences strongly indicate The slides were evaluated under a light microscope (Olympus BX51, Tokyo,
that the H19 gene is critical to the early development of placenta. Japan), and the staining intensity of the antibody was analyzed by a semi-
However, it remains unclear as to the DNA methylation status in the quantitative analysis HSCORE.22 The HSCORE was calculated using the
promoter region of H19 gene in preeclamptic placenta. following equation: HSCORE¼SPi (i+1), where i was the staining intensity
In the present study, we investigated the extent of global DNA (1¼weak, 2¼moderate and 3¼strong), and Pi was the percentage of the
methylation in preeclamptic placentas obtained from a cohort of positively stained cells for each intensity varying from 0 to 100%. The
Chinese patients, and further compared the mRNA expression as assessment of staining intensity and HSCORE were evaluated in a double-
blind condition by three independent observers who did not know the disease
well as the methylation change in the promoter region of the paternally
status of the samples.
imprinted H19 gene between preeclamptic and normal placentas.

RNA isolation and real-time PCR

METHODS
Total RNAs from cells and placenta tissue were isolated with TRIzol reagent
Subjects (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instruction.
Placentas from normal and severe preeclamptic pregnant women were obtained A total of 2 mm of total RNA was used for reverse transcription with oligo-
from the Department of Obstetrics and Gynecology, Peking University First (dT)15 primer using moloney murine leukemia virus reverse transcriptase
Hospital, China, from November 2005 to March 2007. The study was approved (Promega, Madison, WI, USA). Real-time quantitative PCR was performed
by the Research Ethic Committees of the Institute of Zoology, Chinese using the SYBR green detection system (TaKaRa Biotechnology, Dalian, China)
Academy of Sciences and Peking University First Hospital. A total of 24 in the ABI Prism 7500 Sequence Detection System (Applied Biosystems, Foster
preeclamptic cases and 24 controls were recruited for a nested case-control City, CA, USA). Reaction for each sample was performed in duplicate in a 20 ml
study. According to the onset time of the clinical symptoms, the 24 pre- reaction volume containing 1 ml cDNA, 10 ml SYBR Premix Ex Taq, 0.4 ml ROX
eclamptic cases were categorized into 10 early-onset (E-PE, p34 weeks) and Reference Dye II (50) and 0.2 mM of each primer. The PCR conditions and
14 late-onset PE (L-PE, 434 weeks). Severe PE was diagnosed according to primers sequence are shown in Table 2. To control for uniform amount of
the criterion of the International Society for the Study of Hypertension
in Pregnancy. In brief, these study patients had no history of preexisting
or chronic hypertension, but showed systolic blood pressure of 4160 mm Hg Table 2 Primers and PCR conditions for real-time PCR
or diastolic blood pressure of 4110 mm Hg on at least two occasions,
PCR
accompanied by significant proteinuria (42 g per 24 h or 3+ by dipstick in
two random samples collected at 44 h interval) after 20 weeks of gestation. Gene PCR primers (5 ¢–3 ¢) PCR conditions production
Those who developed renal disease, transient hypertension in pregnancy,
DNMT1 F: TACCTGGACGACCCTGACCTC Real-time PCR: 103 bp
gestational diabetes, spontaneous abortion, intrauterine fetal death, fetal
R: CGTTGGCATCAAAGATGGACA 95 1C for 5 s,
chromosomal or congenital abnormalities or pregnancies conceived by fertility
DNMT3a F: GACAAGAATGCCACCAAAGC 60 1C for 30 s. 190 bp
treatment were excluded from this study. The clinical characteristics of
R: CGTCTCCGAACCACATGAC (40 cycles)
the patients included in this study were summarized in Table 1. Placental
Specimens were quickly dissected, snap frozen in liquid nitrogen and stored at DNMT3b F: GACTCGAAGACGCACAGCTG 98 bp
80 1C until prepared for further analyses. R: CTCGGTCTTTGCCGTTGTTATAG
H19 F: CCGGACACAAAACCCTCTAGCT 142 bp
R:TGTTCCGATGGTGTCTTTGATG
Immunohistochemistry for 5-methylcytosine (5-MC) GAPDH F: CCACATCGCTCAGACACCAT 114 bp
Immunohistochemistry was performed as previously described.21 Briefly, 4 mm
R: GGCAACAATATCCACTTTACCAGAGT
thick tissue frozen sections were mounted onto microscope glass slides and
b-actin F: CCTGGCACCCAGCACAAT 70 bp
fixed with the pre-cooled acetone for 10 min at room temperature. After the
R: GCCGATCCACACGGAGTACT
fixation, the slides were immersed in 3N HCL for 30 min at room temperature
to expose the CpG sits. The slides were then treated with 1.0% hydrogen Abbreviations: F, forward; R, reverse.

Table 1 Clinical characteristics of the women enrolled in this study

Characteristics Normal pregnancy (n¼24) Early-onset preeclampsia (n¼10) Late-onset preeclampsia (n¼14)

Maternal age (years) 30.5652±4.0768 31.2000±5.1381 30.3571±3.6712

BMI (kg m–2) 24.5114±2.4750 24.1371±3.2172 23.5179±3.0814
SBP (mm Hg) 110.2174±8.3228 161.8000±29.0624* 158.2143±24.8540*
DBP (mm Hg) 71.3043±5.6844 104.2000±15.9081* 106.0714±22.9698*
24 h proteinuria (g per 24 h) ND 3.9350±3.6700* 3.1658±3.1795*
50 g GCT (mmol l1) 7.4633±1.8116 7.2333±1.3614 8.1900±2.2650
Gestational age at delivery (day) 268.1739±12.8511 226.3000±8.7439* 257.9286±14.5996*

Abbreviations: BMI, body mass index; DBP, diastolic blood pressure; ND, not determined; SBP, systolic blood pressure; 50 g GCT, 50 g glucose challenge test.
Data are expressed as means±s.d. and compared by the one-way analysis of variance or independent sample t-test.
*Po0.05 vs. normal pregnancy.

Hypertension Research
 Detection of DNA methylation in preeclampsia
W-l Gao et al
657

Table 3 Primers and PCR conditions for pyrosequencing analyses

Pyrosequencing Sequence
Gene/Repeat PCR primers (5 ¢–3 ¢) primers (5 ¢–3 ¢) analyzed (5 ¢–3 ¢) PCR conditions PCR products

Alu F: biotin-TTTTTATTAAAAATATAAAAATT AATAACTAAAATTA G/AC/TG/AC/TG/ 95 1C for 90 s, 43 1C for 60 s, 144 bp

R: CCCAAACTAAAATACAATAA CAAAC ACCACCA 72 1C for 120 s. (40 cycles)

LINE-1 F: TTTTTTGAGTTAGGTGTGGG GGGTGGGAGTGAT C/TGATTTTTTAGGTGC/ 95 1C for 30 s, 50 1C for 30 s, 249 bp

R: biotin-TCTCACTAAAAAATACCAAACAA TGTTC/TG 72 1C for 30 s. (35 cycles)

Abbreviations: F, forward; R, reverse.

input RNA template, all results were normalized by using a geometric mean cycles of 95 1C for 5 s, 60 1C for 35 s. HRM was carried out at 95 1C for 15 s,
of the expression level of two internal control genes, GAPDH and b-actin.23 50 1C for 1 min and with a ramping from 60 to 95 1C rising by 0.1 1C every
To compare the expression levels among different samples, the relative second as recommended by the manufacturer. HRM data were analyzed using
mRNA level was calculated using the 2DCT method recommended by the HRM software v2.0 (Applied Biosystems). The melting curves were
Schmittgen et al.24 In our experiments, 2DCT means 2(CTDNMTCTcontrol) normalized by the calculation of two normalization regions before and after
or 2(CTH19CTcontrol). In addition, product purity was confirmed by dissocia- the major fluorescence decrease representing the melting of the PCR product.
tion curve analysis and agarose gel electrophoresis. This algorithm allows the direct comparison of the samples that have different
starting fluorescence levels. Normalization regions were in the range 74–76 and
Genomic DNA extraction and bisulfite treatment 85–88 1C. A differential profile was then evaluated for each sample by
Genomic DNA was extracted from cells or frozen tissues using a genomic DNA comparing fluorescence at the melting point against the value of fluorescence
extraction kit (ZR Genomic DNA II Kit; Zymo Research, Orange, CA, USA) of the negative control (unmethylated DNA). Values of relative fluorescent
according to the manufacturer’s instructions. Bisulfite modification of genomic density for reference DNA standards were plotted against the corresponding
DNA was carried out by using the EZ DNA Methylation-Gold Kit (Zymo methylation level to generate a typical standard curve, against which the
Research) following the manufacturer’s instructions. methylation level of each unknown sample was evaluated.

Bisulfite PCR and pyrosequencing Statistical analysis

DNA methylation level was quantified using the methods of bisulfite PCR and All data are presented as mean values±s. d. calculated from three independent
pyrosequencing.25,26 In brief, the bisulfite-modified DNA was PCR amplified experiments. Statistical comparison between groups was estimated using
using the primers shown in Table 3. The PCR products were purified and two-sided Student’s t-test or one-way analysis of variance, and Po0.05 was
quantified using the PSQ HS 96 Pyrosequencing System (Pyrosequencing, considered statistically significant. All statistical analyses were performed using
Westborough, MA, USA). A biotin-labeled primer was used to purify the final the SPSS software for windows 13.0 (SPSS, Chicago, IL, USA) or GraphPad
PCR product using sepharose beads. The PCR product was bound to Prism version 5.01 for Windows (GraphPad Software, San Diego, CA, USA).
Streptavidin Sepharose High Performance (GE Healthcare, Milwaukee, WI,
USA), and the Sepharose beads containing the immobilized PCR product were RESULTS
purified, washed, denatured using a 0.2 mol l1 NaOH solution, and washed Clinical characteristics of the subjects
again using the Pyrosequencing Vacuum Prep Tool (Pyrosequencing) according Of the 48 pregnant women enrolled in this study, 10 suffered from
to the manufacturer’s recommendations. Subsequently, 0.3 mM pyrosequencing early-onset PE, 14 suffered from late-onset PE and 24 were normal
primer was annealed to the purified single-stranded PCR product and pregnant subjects. The clinical characteristics of these study partici-
pyrosequencing was done using the PSQ HS96 Pyrosequencing System. pants are described in Table 1. The systolic and diastolic blood
Quantification of cytosine methylation was performed using the PSQ HS96A pressures as well as the 24 h urine protein content were significantly
1.2 software (Pyrosequencing). The ratio of C to T nucleotides was evaluated
higher in the preeclamptic groups than in the control group. There
for LINE-1 methylation, and ratio of G to A nucleotides was evaluated for Alu
were no significant differences in age, body mass index and glucose
methylation. The unmethylated human control DNA (EpiTect Control DNA;
Qiagen, Hilden, Germany) was used to verify bisulfite conversion. tolerance (indicated by 50 g glucose challenge test) between the
preeclamptic and the normal pregnant women.
Methylation-sensitive high resolution melting analysis (MS-HRM)
MS-HRM was performed as previously described.27,28 Universal methylated
Global DNA methylation status in preeclamptic and normal
and unmethylated genomic DNAs were purchased from Qiagen (EpiTect control placentas
Control DNA; Qiagen), and mixed to create a serial of reference DNA standards 5-MC immunohistochemistry. Global DNA methylation was first
containing methylation levels of 100, 75, 50, 25 and 0%. visually examined in frozen sections of placenta using an antibody
PCR amplification and MS-HRM were performed on the Applied Biosys- directed against 5-MC. Figure 1 showed a representative pattern of
tems 7500 real-time PCR system (Applied Biosystems). Primers for amplifying immunohystochemical staining for 5-MC in placenta villus from
5¢ promoter region of the H19 gene were described previously.29 The target preeclamptic and normal control women. HSCORE was used to
region comprised the region from 9394 to 9529 within the sequence AF125183, semi-quantitatively evaluate the staining intensity. The HSCORE
spanning the upstream of the H19 transcription start site and the downstream value of normal control, early-onset and late-onset preeclamptic
of the CTCF7 zinc-finger binding site. PCR was performed using Fast EvaGreen
placenta villus were 2.653±0.03697, 2.953±0.09952 and 2.763±
Master Mix for quantitative PCR and HRM (Biotium, Hayward, CA, USA) in a
20 ml reaction volume containing 10 ml 2 Fast EvaGreen Master Mix, 0.25 mM
0.05038, respectively. Statistical analysis revealed that the intensity
primers and 5 ng bisulfite-modified DNA. The primer sequences to bisulfite- was significantly higher in the early-onset preeclamptic placenta villus
modified DNA were as follows: H19F, 5¢-GGGAGAGTTTGTGAGGT-3¢ and (P¼0.0036) as compared with the normal controls. The late-onset
H19R, 5¢-AAATCCCCACAACCGCTAAAC-3¢. The 137-bp fragment was preeclamptic specimens exhibited relatively higher, but not statistically
amplified from bisulfite-modified DNA. Cycling was at 95 1C for 5 min, 40 significant, HSCORE values than the normal controls (P¼0.0826).

Hypertension Research
 Detection of DNA methylation in preeclampsia
W-l Gao et al
658

Figure 1 Immunohistochemical staining for 5-methylcytosine in preeclamptic and control placentas. Figures show a relatively higher staining intensity in the
early-onset preeclamptic placenta villus than in the normal controls. Bar¼100 mm.

Alu and LINE-1 pyrosequencing. To reliably compare the global

methylation level in preeclamptic and normal placenta samples, we
applied the pyrosequencing method to determine the methylation
density in the Alu and LINE-1 repeats, which are surrogate markers of
global methylation. In normal control, early-onset and late-onset
preeclamptic placentas, Alu methylation levels were 0.2553±0.0091,
0.2952±0.0065 and 0.2786±0.0081, respectively, and LINE-1 methy-
lation levels were 0.3067±0.0063, 0.3484±0.0084 and 0.3217
±0.010, respectively. Statistical analysis showed that methylation of
both Alu and LINE-1 repeats were significantly higher in the early-
onset preeclamptic placentas compared with the normal controls
(P¼0.0054 for Alu; P¼0.0016 for LINE-1). Alu and LINE-1 methyla-
tion in the late-onset preeclamptic placentas were also relatively
higher than the normal controls, but the changes did not
reach statistical significance (P¼0.1006 for Alu; P¼0.2136 for
LINE-1) (Figure 2).

DNMTs mRNA expression. It is well established that DNA methyla-

tion at the CpG dinucleotides is catalyzed by various DNMTs, among
Figure 2 Quantitation of DNA methylation using Alu (a) and LINE-1 (b)
which DNA methyltransferase 1 (DNMT1), 3a and 3b are all highly pyrosequencing. Statistical analysis showed that methylation of both Alu and
expressed in human placenta.30 We then examined expression of LINE-1 repeats was significantly higher in the early-onset preeclamptic
DNMTs mRNA in preeclamptic and control placentas using real- placentas as compared with normal controls (P¼0.0054 for Alu; P¼0.0016
time PCR (Figures 3a–c). After normalization by the control genes, for LINE-1). Alu and LINE-1 methylation in the late-onset preeclamptic
GAPDH and b-actin, the expression of DNMT1 was significantly placentas were relatively higher than the normal controls, but the changes
higher in the early onset (0.7523±0.2135), but not in the late-onset were not statistically significant (P¼0.1006 for Alu; P¼0.2136 for LINE-1).
Box plots were used to show the methylation level. The line within each
preeclamptic placentas (0.3344±0.1210) when compared with the
box denotes the median. The crisscross denotes the mean. Limits of the
normal controls (0.3020±0.0711). Placental DNMT3a and DNMT3b box denote the 25th and 75th percentiles. Whiskers denote the 5th and
expressions did not show any statistically significant difference among 95th percentiles. *Po0.05 vs. Control.
the three groups, though the level of DNMT3a in the early-onset
preeclamptic placentas (0.0394±0.0093) was relatively higher than in H19 mRNA expression in the placentas. We further measured the
normal controls (0.0201±0.0053). expression of H19 mRNA in preeclamptic and control placentas by
Methylation status of the paternally imprinted H19 gene in using real-time PCR (Figure 4b). After normalization by the control
preeclamptic and normal control placentas genes, GAPDH and b-actin, the H19 mRNA expression in control,
The paternally imprinted H19 gene has been indicated to be critical to early-onset and late-onset preeclamptic placentas were 14.22±2.644,
the early development of placenta. We further examined H19 mRNA 2.720±1.811 and 6.916±4.266, respectively. As expected, H19 mRNA
expression and the methylation status in the promoter region of H19 level was appreciably lower in the early-onset preeclamptic placentas
gene in preeclamptic placentas. than in controls (P¼0.0034). Though the level in the late-onset
preeclamptic placentas was also lower than that in the normal
MS-HRM for H19. We applied a rapid and sensitive tool, MS-HRM, controls, the change was not statistically significant (P¼0.1408).
to selectively and reliably measure the degree of H19 methylation in
placentas. The melt curve and standard curve of the method was DISCUSSION
shown as Supplementary Figure 1. As shown in Figure 4a, methylation Epigenetic regulation in preeclamptic placenta has been scarcely
levels in the promoter region of the H19 gene in normal control, early- investigated, and little evidence has been so far reported on the degree
onset and late-onset preeclamptic placentas were 47.87±1.678, of global DNA methylation in this complex disease. In the present
57.19±2.068 and 51.51±2.182, respectively. Statistical analysis study, we measured the global DNA methylation level in preeclamptic
revealed a statistically significant difference of H19 gene methylation placenta using immunohistochemistry for 5-MC and pyrosequencing
in the early-onset preeclamptic placentas as compared with the normal of Alu and LINE-1 repeats, which are two surrogate markers of global
controls (P¼0.0023). methylation. The data consistently revealed a marked hypermethyla-

Hypertension Research
 Detection of DNA methylation in preeclampsia
W-l Gao et al
659

Figure 3 DNMT1 (a), DNMT3a (b) and DNMT3b (c) mRNA levels in placentas were determined by real-time PCR. The expression of DNMTs was normalized
by the control genes GAPDH and b-actin. The expression of DNMT1 was significantly higher in the early onset, but not in the late-onset preeclamptic
placentas when compared with the normal controls. Placental DNMT3a and DNMT3b expressions did not show any statistically significant difference among
the three groups, though the level of DNMT3a in the early-onset preeclamptic placentas was relatively higher than in normal control. *Po0.05 vs. Control.

methylation patterns during cell division in mammalian cells. On the

other hand, DNMT3a and 3b are specific methyltransfersase involved
in establishing DNA methylation patterns during embryonic
development.31 Our results thus indicated that the significantly
higher expression of DNMT1 may substantially contribute to the
global hypermethylation in the early-onset preeclamptic placenta.
Recent studies may suggest cues as to the factors that may cause
high DNMT1 expression and global hypermethylation in PE patients.
Folate, in the form of 5-methyltetrahydrofolate, is involved in
remethylation of homocysteine to methionine, which is a precursor
of SAM, the primary methyl group donor for DNA methylation. Adult
rats subject to a short-term folate-deficient diet exhibited upregulation
of DNMT as well as genomic DNA hypermethylation in the liver.32
Choline, via betaine, provides methyl groups for the production of
S-adenosylmethionine.33 Feeding pregnant rats with a choline-defi-
cient diet led to increased global DNA methylation in fetal liver and
brain.34 Deficiency of methyl group donors like folate or choline could
result in hypomethylation of the regulatory CpGs within the DNMT1
gene, leading to its overexpression and subsequent increased global
Figure 4 H19 methylation and mRNA expression levels in control and DNA methylation.35 Furthermore, Ray et al. reported that pregnant
preeclamptic placentas. (a) H19 methylation levels were evaluated by women with low levels of circulating folate had an increased risk of
methylation-sensitive high resolution melting (MS-HRM). The degree of developing PE.36 Lastly, results from two independent laboratories
methylation of clinical samples was evaluated by comparison with the
demonstrated that women with homozygous mutation of the T677
standard curve. Statistical analysis revealed increased methylation of the
H19 gene in the early-onset preeclamptic placentas when compared with allele in the 5, 10-methylenetetrahydrofolate reductase (MTHFR) gene,
the normal controls (P¼0.0023). The late-onset preeclamptic placentas also an important enzyme in folate metabolism, had a significantly
showed hypermethylation of the H19 gene when compared with the normal increased risk of PE.37,38 Therefore, it may be worth investigating
controls, but the change was not statistically significant (P¼0.1944). (b) whether abnormality of folate or choline metabolisms is involved in
The expression of H19 was measured by real time PCR, and normalized by the onset of PE via interfering with the status of DNA methylation
the control genes GAPDH and b-actin. H19 mRNA level was appreciably
during placentation.
lower in the early-onset preeclamptic placentas than in controls
(P¼0.0034). Though the level in the late-onset preeclamptic placentas was
Appropriate DNA methylation is indispensable for normal placenta
also lower than that in the normal controls, the change was not statistically development and function.39 A number of studies have suggested
significant (P¼0.1408). *Po0.05 vs. Control. critical links between alterations of appropriate epigenetic regulation
in the placenta and diseases of gestation and early life. General
disruption of DNA methylation consequent to certain clinical drug
tion in the genome of the early-onset preeclamptic placentas as treatments has been shown to inhibit invasiveness of trophoblast cells
compared with control placentas. It is well established that DNA and therefore to disrupt placental development.40,41 Specific genetic
methylation at the CpG dinucleotides is catalyzed by various DNMTs, approaches have shown that lack of DNMT1 or DNMT3L genes
among which DNMT1, 3a and 3b are all highly expressed in human results in impaired trophoblast differentiation and aberrant placenta
placenta.30 DNMT1 is usually regarded as a maintenance methyl- development.42,43 A recent report has revealed that LINE-1 sequences
transferase being responsible for accurately replicating genomic DNA are significantly hypermethylated in partial hydatidiform moles tissues

Hypertension Research
 Detection of DNA methylation in preeclampsia
W-l Gao et al
660

relative to normal placentas.44 Partial hydatidiform moles is charac- experiments, we examined the expression of DNMTs and H19 as well
terized by placenta overgrowth, trophoblastic hyperplasia and as global methylation and H19 methylation in placentas derived from
abnormal or absent fetus.45 These placenta phenotypes are to some six pre-term birth patients who delivered at gestational weeks 32–35.
extent similar to the observations in preeclamptic placenta where No evident differences in either DNMTs and H19 expression or global
immature intermediate trophoblasts are over proliferating.46 Cases of methylation and H19 methylation were found between these samples
PE in combination with partial hydatidiform mole have also been and term placentas (Supplementary Figure 2). Therefore, we used
reported in literatures.47,48 Taken together, these data demonstrate an normal term placentas as universal controls in our study. Meanwhile,
epigenetic disorder in placentas of women who suffered from gesta- the extensive microarray data of Winn et al. did not show the
tional diseases such as PE and partial hydatidiform mole. It remains to expression change of DNMTs and H19 genes during various develop-
be investigated whether global DNA hypermethylation in placenta is a mental stages in human placentas.54 What’s more, Fuke et al. demon-
causal factor for gestational diseases. strated that the global methylation (as measured by 5-MC content) in
The paternally imprinted H19 gene is transcribed as an untranslated human placenta increased on average by 10% at the first half of
RNA that may serve as a riboregulator. H19 is located in close pregnancy, but exhibited slight gestation-dependent difference at
proximity to the maternally imprinted IGF-2 gene on chromosome weeks 32 to term.55 The early-onset, late-onset preeclamptic placentas
11p15.517 and the H19 null mice display hyperplasia of all layers of the and normal control ones used in this study were at average gestational
placenta.18 These data strongly indicate that the H19 gene is critical to weeks 32.2, 36.8 and 38.3, respectively. Taken these evidences together,
the early development of placenta. The actual functions of the H19 we propose that the difference in the duration of the pregnancy
gene are still unclear. During pregnancy, the H19 gene in the devel- according to the disease status may have little influence on both global
oping placenta can be expressed either biallelically or monoallelically. methylation and H19 methylation and expression.
Its biallelic expression is confined to the placenta until 10 weeks of In general, the present study is the first report on the change of
gestation, after which it is predominantly, but not exclusively, global DNA methylation and H19 gene methylation in human
expressed from the maternal allele, and its paternal allele is proved preeclamptic placenta. The influence of such epigenetic change on
to be methylated.49 Some studies suggested that H19 might act as an placenta development as well as the occurrence of gestational diseases
oncogene in human gestational trophoblastic tumors, based on the needs further investigations.
evidences that high level and biallelic expression of H19 gene was
observed in human choriocarcinoma cells, as well as that H19 gene
CONFLICT OF INTEREST
expression was much higher in the tumors formed by choriocarci-
The authors declare no conflict of interest.
noma cells injected in nude mice.50 In human placenta, H19 expres-
sion was most pronounced in the invasive intermediate trophoblasts
and villous cytotrophoblasts, whereas its expression was negligible in ACKNOWLEDGEMENTS
syncytiotrophoblasts. Such a differential expression pattern of H19 The work was supported by the grants from the Chinese National Special Fund
may be consistent with its proposed role in regulating the invasive for Basic Research Project (No: 2011CB944400), National Natural Sciences
property of trophoblasts.19,20 This possibility is supported by the data Foundation (No: 30530760) and the Knowledge Innovation Program in
from Walsh et al., who showed an invasion-promoting effect of H19 Chinese Academy of Sciences (No: KSCX2-EW-R-06).
gene in trophoblastic cells.51 The trophoblasts in preeclamptic placenta
showed trophoblastic hyperplasia, over-proliferated immature inter-
mediate trophoblasts and impaired trophoblast invasion.46 The hyper-
methylation and reduced expression of the H19 gene in early-onset 1 Roberts JM, Cooper DW. Pathogenesis and genetics of pre-eclampsia. Lancet 2001;
357: 53–56.
preeclamptic placentas as reported in the present study, may indicate a 2 Sibai BM, Ewell M, Levine RJ, Klebanoff MA, Esterlitz J, Catalano PM, Goldenberg RL,
role of H19 in the abnormal proliferation and invasion phenotypes of Joffe G. Risk factors associated with preeclampsia in healthy nulliparous women. The
Calcium for Preeclampsia Prevention (CPEP) Study Group. Am J Obstet Gynecol 1997;
the preeclamptic trophoblasts. Indeed, recent data suggest that H19 177: 1003–1010.
might regulate expressions of specific target genes by acting as the 3 Roberts JM. Endothelial dysfunction in preeclampsia. Semin Reprod Endocrinol 1998;
precursor of microRNA-675.52 To better address this issue, we are 16: 5–15.
4 Hladunewich M, Karumanchi SA, Lafayette R. Pathophysiology of the clinical
currently performing further studies on the molecular mechanisms manifestations of preeclampsia. Clin J Am Soc Nephrol 2007; 2: 543–549.
underlying H19 gene functions in human placental trophoblasts. 5 Redman CW, Sargent IL. Latest advances in understanding preeclampsia. Science
It has been suggested that early-onset and late-onset PE may have 2005; 308: 1592–1594.
6 Maynard SE, Min JY, Merchan J, Lim KH, Li J, Mondal S, Libermann TA, Morgan JP,
different etiologies and clinical expression, and should be regarded as Sellke FW, Stillman IE, Epstein FH, Sukhatme VP, Karumanchi SA. Excess placental
different forms of the disease.53 The different methylation status in soluble fms-like tyrosine kinase 1 (sFlt1) may contribute to endothelial dysfunction,
hypertension, and proteinuria in preeclampsia. J Clin Invest 2003; 111: 649–658.
placental genome as well as in the H19 gene as observed in this study is 7 Venkatesha S, Toporsian M, Lam C, Hanai J, Mammoto T, Kim YM, Bdolah Y, Lim KH,
likely supporting this idea. However, for the late-onset preeclamptic Yuan HT, Libermann TA, Stillman IE, Roberts D, D¢Amore PA, Epstein FH, Sellke FW,
placentas, both the global methylation and H19 gene methylation Romero R, Sukhatme VP, Letarte M, Karumanchi SA. Soluble endoglin contributes to
the pathogenesis of preeclampsia. Nat Med 2006; 12: 642–649.
levels are in between the levels observed in the normal gestations and 8 Serman L, Vlahovic M, Sijan M, Bulic-Jakus F, Serman A, Sincic N, Matijevic R, Juric-
early-onset PE. Therefore, it is quite possible that early-onset and late- Lekic G, Katusic A. The impact of 5-azacytidine on placental weight, glycoprotein
onset PE represent two degrees of severity of the disease, and maybe a pattern and proliferating cell nuclear antigen expression in rat placenta. Placenta
2007; 28: 803–811.
pathological continuum. Patients with early-onset PE may have severe 9 Ohgane J, Wakayama T, Senda S, Yamazaki Y, Inoue K, Ogura A, Marh J, Tanaka S,
genetic or epigenetic disorders such as aberrant methylation in both Yanagimachi R, Shiota K. The Sall3 locus is an epigenetic hotspot of aberrant DNA
methylation associated with placentomegaly of cloned mice. Genes Cells 2004; 9:
genome and imprinted H19 gene, which can disturb the proper early 253–260.
development of placenta during pregnancy. 10 Chim SS, Tong YK, Chiu RW, Lau TK, Leung TN, Chan LY, Oudejans CB, Ding C, Lo YM.
One problem in our study is the difference in the duration of the Detection of the placental epigenetic signature of the maspin gene in maternal plasma.
Proc Natl Acad Sci USA 2005; 102: 14753–14758.
pregnancy according to the disease status, which may cause gestation- 11 Chelbi ST, Mondon F, Jammes H, Buffat C, Mignot TM, Tost J, Busato F, Gut I,
dependent variation in DNA methylation levels. In our preliminary Rebourcet R, Laissue P, Tsatsaris V, Goffinet F, Rigourd V, Carbonne B, Ferre F, Vaiman D.

Hypertension Research
 Detection of DNA methylation in preeclampsia
W-l Gao et al
661

Expressional and epigenetic alterations of placental serine protease inhibitors: 34 Kovacheva VP, Mellott TJ, Davison JM, Wagner N, Lopez-Coviella I, Schnitzler AC,
SERPINA3 is a potential marker of preeclampsia. Hypertension 2007; 49: 76–83. Blusztajn JK. Gestational choline deficiency causes global and Igf2 gene DNA
12 Novakovic B, Sibson M, Ng HK, Manuelpillai U, Rakyan V, Down T, Beck S, Fournier T, hypermethylation by up-regulation of Dnmt1 expression. J Biol Chem 2007; 282:
Evain-Brion D, Dimitriadis E, Craig JM, Morley R, Saffery R. Placenta-specific 31777–31788.
methylation of the vitamin D 24-hydroxylase gene: implications for feedback auto- 35 Ghoshal K, Li X, Datta J, Bai S, Pogribny I, Pogribny M, Huang Y, Young D, Jacob ST. A
regulation of active vitamin D levels at the fetomaternal interface. J Biol Chem 2009; folate- and methyl-deficient diet alters the expression of DNA methyltransferases and
284: 14838–14848. methyl CpG binding proteins involved in epigenetic gene silencing in livers of F344
13 Coan PM, Burton GJ, Ferguson-Smith AC. Imprinted genes in the placenta–a review. rats. J Nutr 2006; 136: 1522–1527.
Placenta 2005; 26(Suppl A): S10–S20. 36 Ray JG, Laskin CA. Folic acid and homocyst(e)ine metabolic defects and the risk of
14 Fowden AL, Sibley C, Reik W, Constancia M. Imprinted genes, placental development placental abruption, pre-eclampsia and spontaneous pregnancy loss: a systematic
and fetal growth. Horm Res 2006; 65(Suppl 3): 50–58. review. Placenta 1999; 20: 519–529.
15 van Dijk M, Mulders J, Poutsma A, Konst AA, Lachmeijer AM, Dekker GA, Blankenstein 37 Sohda S, Arinami T, Hamada H, Yamada N, Hamaguchi H, Kubo T. Methylenetetrahy-
MA, Oudejans CB. Maternal segregation of the Dutch preeclampsia locus at 10q22 drofolate reductase polymorphism and pre-eclampsia. J Med Genet 1997; 34:
with a new member of the winged helix gene family. Nat Genet 2005; 37: 514–519. 525–526.
16 Kanayama N, Takahashi K, Matsuura T, Sugimura M, Kobayashi T, Moniwa N, 38 Grandone E, Margaglione M, Colaizzo D, Cappucci G, Paladini D, Martinelli P,
Tomita M, Nakayama K. Deficiency in p57Kip2 expression induces preeclampsia-like Montanaro S, Pavone G, Di Minno G. Factor V Leiden, C 4T MTHFR
symptoms in mice. Mol Hum Reprod 2002; 8: 1129–1135. polymorphism and genetic susceptibility to preeclampsia. Thromb Haemost 1997;
17 Moulton T, Crenshaw T, Hao Y, Moosikasuwan J, Lin N, Dembitzer F, Hensle T, Weiss L, 77: 1052–1054.
McMorrow L, Loew T, Kraus W, Gerald W, Tycko B. Epigenetic lesions at the H19 locus 39 Hemberger M. Epigenetic landscape required for placental development. Cell Mol Life
in Wilms’ tumour patients. Nat Genet 1994; 7: 440–447. Sci 2007; 64: 2422–2436.
18 Eggenschwiler J, Ludwig T, Fisher P, Leighton PA, Tilghman SM, Efstratiadis A. 40 Serman L, Vlahovic M, Sijan M, Bulic-Jakus F, Serman A, Sincic N, Matijevic R, Juric-
Mouse mutant embryos overexpressing IGF-II exhibit phenotypic features of the Lekic G, Katusic A. The impact of 5-azacytidine on placental weight, glycoprotein
Beckwith-Wiedemann and Simpson-Golabi-Behmel syndromes. Genes Dev 1997; 11: pattern and proliferating cell nuclear antigen expression in rat placenta. Placenta
3128–3142. 2007; 28: 803–811.
19 Rachmilewitz J, Gileadi O, Eldar-Geva T, Schneider T, de-Groot N, Hochberg A. 41 Rahnama F, Shafiei F, Gluckman PD, Mitchell MD, Lobie PE. Epigenetic regulation
Transcription of the H19 gene in differentiating cytotrophoblasts from human placenta. of human trophoblastic cell migration and invasion. Endocrinology 2006; 147:
Mol Reprod Dev 1992; 32: 196–202. 5275–5283.
20 Adam GI, Cui H, Miller SJ, Flam F, Ohlsson R. Allele-specific in situ hybridization 42 Lewis A, Mitsuya K, Umlauf D, Smith P, Dean W, Walter J, Higgins M, Feil R,
(ASISH) analysis: a novel technique which resolves differential allelic usage of H19 Reik W. Imprinting on distal chromosome 7 in the placenta involves repressive
within the same cell lineage during human placental development. Development 1996; histone methylation independent of DNA methylation. Nat Genet 2004; 36:
122: 839–847. 1291–1295.
21 Piyathilake CJ, Frost AR, Bell WC, Oelschlager D, Weiss H, Johanning GL, Niveleau A, 43 Arima T, Hata K, Tanaka S, Kusumi M, Li E, Kato K, Shiota K, Sasaki H, Wake N. Loss
Heimburger DC, Grizzle WE. Altered global methylation of DNA: an epigenetic of the maternal imprint in Dnmt3Lmat-/- mice leads to a differentiation defect in the
difference in susceptibility for lung cancer is associated with its progression. extraembryonic tissue. Dev Biol 2006; 297: 361–373.
Hum Pathol 2001; 32: 856–862. 44 Perrin D, Ballestar E, Fraga MF, Frappart L, Esteller M, Guerin JF, Dante R. Specific
22 Meyer WR, Castelbaum AJ, Somkuti S, Sagoskin AW, Doyle M, Harris JE, Lessey BA. hypermethylation of LINE-1 elements during abnormal overgrowth and differentiation
Hydrosalpinges adversely affect markers of endometrial receptivity. Hum Reprod 1997; of human placenta. Oncogene 2007; 26: 2518–2524.
12: 1393–1398. 45 Fisher RA, Hodges MD. Genomic imprinting in gestational trophoblastic disease–a
23 Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F. review. Placenta 2003; 24(Suppl A): S111–S118.
Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of 46 Redline RW, Patterson P. Pre-eclampsia is associated with an excess of proliferative
multiple internal control genes. Genome Biol 2002; 3: RESEARCH0034. immature intermediate trophoblast. Hum Pathol 1995; 26: 594–600.
24 Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C(T) 47 Szulman AE, Surti U. The clinicopathologic profile of the partial hydatidiform mole.
method. Nat Protoc 2008; 3: 1101–1108. Obstet Gynecol 1982; 59: 597–602.
25 Yang AS, Estecio MR, Doshi K, Kondo Y, Tajara EH, Issa JP. A simple method for 48 Brittain PC, Bayliss P. Partial hydatidiform molar pregnancy presenting with severe
estimating global DNA methylation using bisulfite PCR of repetitive DNA elements. preeclampsia prior to twenty weeks gestation: a case report and review of the literature.
Nucleic Acids Res 2004; 32: e38. Mil Med 1995; 160: 42–44.
26 Bollati V, Baccarelli A, Hou L, Bonzini M, Fustinoni S, Cavallo D, Byun HM, Jiang J, 49 Jinno Y, Ikeda Y, Yun K, Maw M, Masuzaki H, Fukuda H, Inuzuka K, Fujishita A,
Marinelli B, Pesatori AC, Bertazzi PA, Yang AS. Changes in DNA methylation patterns in Ohtani Y, Okimoto T. Establishment of functional imprinting of the H19 gene in human
subjects exposed to low-dose benzene. Cancer Res 2007; 67: 876–880. developing placentae. Nat Genet 1995; 10: 318–324.
27 Wojdacz TK, Dobrovic A. Methylation-sensitive high resolution melting (MS-HRM): a 50 Lustig-Yariv O, Schulze E, Komitowski D, Erdmann V, Schneider T, de Groot N,
new approach for sensitive and high-throughput assessment of methylation. Nucleic Hochberg A. The expression of the imprinted genes H19 and IGF-2 in choriocarcinoma
Acids Res 2007; 35: e41. cell lines. Is H19 a tumor suppressor gene? Oncogene 1997; 15: 169–177.
28 Wojdacz TK, Dobrovic A, Hansen LL. Methylation-sensitive high-resolution melting. 51 Walsh C, Miller SJ, Flam F, Fisher RA, Ohlsson R. Paternally derived H19 is
Nat Protoc 2008; 3: 1903–1908. differentially expressed in malignant and nonmalignant trophoblast. Cancer Res
29 Wojdacz TK, Dobrovic A, Algar EM. Rapid detection of methylation change at H19 in 1995; 55: 1111–1116.
human imprinting disorders using methylation-sensitive high-resolution melting. 52 Cai X, Cullen BR. The imprinted H19 noncoding RNA is a primary microRNA precursor.
Hum Mutat 2008; 29: 1255–1260. RNA 2007; 13: 313–316.
30 Robertson KD, Uzvolgyi E, Liang G, Talmadge C, Sumegi J, Gonzales FA, Jones PA. 53 Huppertz B. Placental origins of preeclampsia: challenging the current hypothesis.
The human DNA methyltransferases (DNMTs) 1, 3a and 3b: coordinate mRNA Hypertension 2008; 51: 970–975.
expression in normal tissues and overexpression in tumors. Nucleic Acids Res 1999; 54 Winn VD, Haimov-Kochman R, Paquet AC, Yang YJ, Madhusudhan MS, Gormley M,
27: 2291–2298. Feng KT, Bernlohr DA, McDonagh S, Pereira L, Sali A, Fisher SJ. Gene expression
31 Goll MG, Bestor TH. Eukaryotic cytosine methyltransferases. Annu Rev Biochem 2005; profiling of the human maternal-fetal interface reveals dramatic changes between
74: 481–514. midgestation and term. Endocrinology 2007; 148: 1059–1079.
32 Kim YI. Nutritional epigenetics: impact of folate deficiency on DNA methylation and 55 Fuke C, Shimabukuro M, Petronis A, Sugimoto J, Oda T, Miura K, Miyazaki T, Ogura C,
colon cancer susceptibility. J Nutr 2005; 135: 2703–2709. Okazaki Y, Jinno Y. Age related changes in 5-methylcytosine content in human
33 Kim YI. Folate and DNA methylation: a mechanistic link between folate deficiency and peripheral leukocytes and placentas: an HPLC-based study. Ann Hum Genet 2004;
colorectal cancer? Cancer Epidemiol Biomarkers Prev 2004; 13: 511–519. 68(Pt 3): 196–204.

Supplementary Information accompanies the paper on Hypertension Research website (http://www.nature.com/hr)

Hypertension Research