ARTICLE cro

An extracellular acidic cleft confers profound Hⴙ-sensitivity

to epithelial sodium channels containing the ␦-subunit in
Xenopus laevis
Received for publication, March 2, 2019, and in revised form, June 27, 2019 Published, Papers in Press, June 27, 2019, DOI 10.1074/jbc.RA119.008255
X Lukas Wichmann‡§, Jasdip Singh Dulai‡, X Jon Marles-Wright‡, X Stephan Maxeiner¶, Pawel Piotr Szczesniak储,
Ivan Manzini§, and X Mike Althaus‡1
From the ‡School of Natural and Environmental Sciences, Newcastle University, Newcastle upon Tyne NE1 7RU, United Kingdom,
the ¶Institute of Anatomy and Cell Biology, Saarland University, 66421 Homburg, Germany, the 储Department of Medicine, Haematology/
Oncology, Johann-Wolfgang-Goethe University Frankfurt, 60323 Frankfurt, Germany, and the §Institute of Animal Physiology,
Department of Animal Physiology and Molecular Biomedicine, Justus-Liebig University Giessen, 35390 Giessen, Germany
Edited by Mike Shipston

The limited sodium availability of freshwater and terrestrial tetrapod ancestors faced major physiological challenges, such
environments was a major physiological challenge during verte- as the need for breathing air, as well as a limited availability of
brate evolution. The epithelial sodium channel (ENaC) is pres- water and sodium. Mechanisms that permitted sodium absorp-
ent in the apical membrane of sodium-absorbing vertebrate epi- tion from a sodium-scarce environment are likely to have
thelia and evolved as part of a machinery for efficient sodium evolved while vertebrate ancestors invaded freshwater habitats.
conservation. ENaC belongs to the degenerin/ENaC protein This suggests that tetrapod ancestors were likely equipped with
family and is the only member that opens without an external a molecular machinery allowing them to evolve efficient mech-
stimulus. We hypothesized that ENaC evolved from a proton- anisms for bulk sodium and, consequently, water conservation.
activated sodium channel present in ionocytes of freshwater Although comparative physiological studies reveal evolu-
vertebrates and therefore investigated whether such ancestral tionary adaptations at an organ level (1), not much is known
traits are present in ENaC isoforms of the aquatic pipid frog about functional adaptations of proteins required for sodium
Xenopus laevis. Using whole-cell and single-channel electro- and water conservation. In tetrapod vertebrates, a key protein
physiology of Xenopus oocytes expressing ENaC isoforms for conserving sodium is the epithelial sodium channel
assembled from ␣␤␥- or ␦␤␥-subunit combinations, we dem- (ENaC).2 The presence of ENaC genes in modern jawless ver-
onstrate that Xenopus ␦␤␥-ENaC is profoundly activated by tebrates (2) suggests that ENaC evolved early within the verte-
extracellular acidification within biologically relevant ranges brate lineage. In sodium-absorbing epithelia of tetrapod verte-
(pH 8.0 – 6.0). This effect was not observed in Xenopus ␣␤␥- brates, ENaC is located in the apical epithelial membrane and is
ENaC or human ENaC orthologs. We show that protons inter- rate-limiting for the uptake of sodium ions into epithelial cells.
fere with allosteric ENaC inhibition by extracellular sodium In conjunction with basolateral Na⫹/K⫹-ATPases, ENaC facil-
ions, thereby increasing the probability of channel opening. itates the vectorial absorption of sodium ions, which also gen-
Using homology modeling of ENaC structure and site-directed erates osmotic forces that drive water absorption (3). In
mutagenesis, we identified a cleft region within the extracellular humans, an increased volume of airway surface liquid as well as
loop of the ␦-subunit that contains several acidic amino acid urinary salt-loss in patients suffering from type 1 pseudohy-
residues that confer proton-sensitivity and enable allosteric poaldosteronism are clinical manifestations of ENaC loss– of–
inhibition by extracellular sodium ions. We propose that Xeno- function mutations mirroring insufficient adaptation to terres-
pus ␦␤␥-ENaC can serve as a model for investigating ENaC trial life (4). In severe cases, patients require a daily uptake of
transformation from a proton-activated toward a constitutively- 18 g of sodium (2) as compared with a recommended daily value
active ion channel. Such transformation might have occurred of a maximum of 1.5 g (5).
during the evolution of tetrapod vertebrates to enable bulk Canonical ENaCs assemble as heterotrimers consisting of
sodium absorption during the water–to–land transition. three homologous subunits (␣, ␤, and ␥). A fourth ␦-subunit
can replace the ␣-subunit and form heteromeric ENaCs with
different biophysical and functional properties (6). A recent
Water–to–land transition was a key event in the evolution of study resolving the structure of human ␣␤␥-ENaC revealed
tetrapod vertebrates. By transitioning into terrestrial habitats, that each subunit contains short intracellular N and C termini
that are connected by two transmembrane helices and a large
extracellular domain (7). The topology of this ectodomain
The authors declare that they have no conflicts of interest with the contents resembles a clenched hand comprising the “palm,” “knuckle,”
of this article.
This article contains Table S1.
1 2
To whom correspondence should be addressed: School of Natural and The abbreviations used are: ENaC, epithelial sodium channel; ANOVA, anal-
Environmental Sciences, Newcastle University, Ridley Bldg. 2, New- ysis of variance; ASIC, acid-sensing ion channel; SSI, sodium self-inhibition;
castle upon Tyne NE1 7RU, United Kingdom. Tel.: 44-191-208-4700; PDB, Protein Data Bank; TEVC, two-electrode voltage-clamp; NMDG,
E-mail: mike.althaus@newcastle.ac.uk. N-methyl-D-glucamine.
This is an open access article under the CC BY license.
J. Biol. Chem. (2019) 294(33) 12507–12520 12507
© 2019 Wichmann et al. Published under exclusive license by The American Society for Biochemistry and Molecular Biology, Inc.
pH-sensitivity of Xenopus ␦-ENaC

Figure 1. Extracellular pH modifies Xenopus ␦␤␥-ENaC currents. a, representative recordings of transmembrane currents (IM) in oocytes expressing
Xenopus ␦␤␥-ENaC. The extracellular pH alters transient current kinetics of Xenopus ␦␤␥-ENaC. Arrows indicate application of amiloride (a, 100 ␮M). b, current
decays normalized to the initial peak values (IM, initial) from recordings as depicted in a follow a two-phase decay consisting of a fast, initial decay as well as a
slow, continuous current rundown. c, fractions of the fast, initial current decay (IM decayinitial) are reduced with decreasing extracellular pH (one-way ANOVA,
F ⫽ 20.31, p ⬍ 0.0001; Tukey’s multiple comparisons test). d, amiloride-sensitive current fractions (⌬Iami) derived from recordings as shown in a are markedly
increased at pH 6.0 (Kruskal-Wallis test, p ⬍ 0.0001; Dunn’s multiple comparisons test).

“finger,” and “thumb” domains, surrounding a central “␤-ball.” We and others (17) have recently shown that ␦␤␥-ENaC in
Aside from the ENaC-specific GRIP (gating relief of inhibition the South African clawed frog Xenopus laevis generates sodium
by proteolysis) domain, which confers channel sensitivity to currents, which have a more transient form compared with
proteolytic activation, this structural organization is similar to those generated by ␣␤␥-ENaC. This is the only ENaC ortholog
that of acid-sensing ion channels (ASICs) (7). However, despite characterized to date that displays such characteristics. The
a shared channel architecture, representatives of the degen- transient nature is due to a slow but profound inhibition of
erin/ENaC family are functionally distinct, as they open in ENaC activity by extracellular sodium ions, a mechanism called
response to various external stimuli (8). This includes mecha- sodium self-inhibition (SSI) (17, 18). Various cues such as acidic
nosensitive degenerin channel complexes in Caenorhabditis pH (14) or proteases (19) have been shown to increase ENaC
elegans (9), peptide-gated channels in molluscs (10), and pro- activity by uncoupling channels from SSI. Because Xenopus
ton-sensitive ASICs (11). ENaC emerged in vertebrates and is ENaCs containing the ␦-ENaC subunit are insensitive to pro-
the only member of this protein family that opens without an teolytic activation (18), we hypothesized that the enhanced SSI
external stimulus, representing an evolutionary adaptation for of Xenopus ␦␤␥-ENaC enables channel activation through
bulk sodium absorption. The molecular changes that enabled extracellular acidification. This ENaC isoform might therefore
an evolutionary transition from a stimulus-activated ancestor exhibit functional characteristics of a proton-stimulated ENaC
to a constitutively-active ENaC are unknown. Many freshwater ancestor.
vertebrates absorb sodium ions from the environment by spe- We demonstrate that, in contrast to canonical Xenopus
cialized gill epithelial cells (ionocytes) that secrete protons via ␣␤␥-ENaC, ␦-ENaC-containing channels are profoundly
apical vacuolar-type H⫹-ATPases (12). Protons are either used activated by extracellular acidification. Modulation of ␦␤␥-
to co-transport sodium ions into ionocytes via proton-coupled ENaC activity within physiological pH ranges (pH 8.0 – 6.0)
sodium transporters or sodium-permeable ion channels that involves changes in single-channel open probability and SSI.
open in response to apical extracellular acidification (12). Substitutions of single aspartates in an acidic cleft located at
We hypothesize that ENaC evolved from an ancestral ion the interface between the ␦-ENaC knuckle and finger
channel that was originally opened in response to protons and domains significantly alter ␦␤␥-ENaC sensitivity to pH and
then progressed to constitutive activity during water–to–land SSI, suggesting convergence of channel regulation by extra-
transition. At a molecular level, this hypothesis is supported cellular protons and sodium within this region. These find-
by the close evolutionary relationship and the structural simi- ings suggest that Xenopus ␦␤␥-ENaC might be a functional
larities between ENaC and proton-gated ASICs, which are evo- model that represents the junction between constitutively active
lutionarily older. ASICs recently have been suggested as possi- ENaCs and cognate proton-gated ion channels within the degen-
erin/ENaC family. Consequently, this amphibian ENaC isoform
ble candidates for proton-coupled sodium uptake in ionocytes
may provide insight into the evolutionary transition between gat-
of freshwater zebrafish (12) and rainbow trout (13). Further-
ing modes that may have occurred during water–to–land transi-
more, mammalian ENaCs are sensitive to extracellular pH in a
tion of tetrapod vertebrates.
species-specific manner, as exemplified by a 40% increase in
human ␣␤␥-ENaC activity due to extracellular acidification
Results
(pH 6.0) (14). Precedents for evolutionary gain or loss of pro-
ton-sensitivity within vertebrate degenerin/ENaC proteins Activity of Xenopus ␦␤␥-ENaC is sensitive to changes in the
have recently been demonstrated for ASIC1, which gained pro- extracellular pH
ton-sensitivity during the emergence of bony fishes (15), and The effect of extracellular acidification on Xenopus ␦␤␥-
ASIC4, which lost proton-sensitivity in the mammalian lineage ENaC activity was functionally characterized by microelec-
(16). trode recordings, employing the Xenopus oocyte expression

12508 J. Biol. Chem. (2019) 294(33) 12507–12520

 pH-sensitivity of Xenopus ␦-ENaC

Figure 2. Extracellular pH affects gating of Xenopus-␦␤␥ ENaC. a, representative current traces from cell-attached patch-clamp recordings of oocytes
expressing Xenopus ␦␤␥-ENaC at a holding potential of ⫺100 mV. Recordings were performed using pipette solutions at pH 8.0, 7.4, or 6.0 (pHpip).
Dashed lines indicate the number of individual open channel levels or the current baseline (c). b, open probability of individual channels increases with
decreasing pHpip (one-way ANOVA, F ⫽ 24.93, p ⬍ 0.0001; Tukey’s multiple comparisons test). c, number of visible channels in cell-attached recordings
as depicted in a (one-way ANOVA, F ⫽ 5.83, p ⫽ 0.0056; Tukey’s multiple comparisons test). d, current (I)/voltage (Vhold) plots derived from cell-attached
patch-clamp recordings of Xenopus ␦␤␥-ENaC at different pHpip. The pHpip does not affect the channel’s slope conductance (Gslope) (one-way ANOVA,
F ⫽ 1.854, p ⫽ 0.1725), which was calculated from the linear regression of unitary channel conductance (mean of at least three single channel
amplitudes per n) at ⫺40 to ⫺100 mV. e, estimation of the number of channels in the patch. Pn is the probability of n channels out of the total number
of channels within the patch being opened. The observed probability for each n (i.e. observed current levels) was compared with a theoretical
distribution of Pn as predicted by a binomial distribution, assuming n channels present in the patch. There is no significant difference between observed
and predicted Pn values under the employed pHpip conditions (Kruskal-Wallis test with Dunn’s multiple comparisons test in each panel. p ⬎ 0.9999
between each pair of Pn observed and Pn predicted.). Statistical evaluation is based on individual recordings lasting for 120 –180 s with a maximum of
eight channels per patch. Please note that single-channel characteristics at pHpip 7.4 include data, which have been reported earlier (18). Patch-clamp
data for both studies were collected simultaneously using the same oocyte batches for all pH conditions and ␣␤␥- as well as ␦␤␥-ENaC.

system at a holding potential (VM) of ⫺60 mV. We and others current fractions (⌬Iami) mediated by Xenopus ␦␤␥-ENaC
have previously demonstrated a transient nature of transmem- under acidic conditions (Fig. 1d). Changes in the extracellular
brane currents (IM) mediated by Xenopus ENaC containing the pH did not affect the magnitude of the initial peak in IM (IM, peak:
␦-subunit after washout of the ENaC blocker amiloride or a ⫺11.0 ⫾ 1.6 ␮A at pH 8.0, ⫺10.3 ⫾ 1.1 ␮A at pH 7.4, and
rapid increase in the extracellular sodium concentration (17, ⫺12.5 ⫾ 1.1 ␮A at pH 6.0; one-way ANOVA, F ⫽ 0.7822, p ⫽
18). As illustrated in Fig. 1, this characteristic decay of IM in 0.4632). These results indicate that the extracellular pH influ-
oocytes expressing Xenopus ␦␤␥-ENaC was altered depending ences the activity of Xenopus ␦␤␥-ENaC and alters current
on the extracellular pH. Changing the extracellular sodium kinetics at the whole-cell level.
concentration ([Na⫹]) from 1 to 90 mM at pH 7.4, elicited a We next examined the effect of extracellular acidification on
rapid increase of IM that was followed by an initial, fast decline ␦␤␥-ENaC at the single channel level. Cell-attached patch-
and a subsequent slow but continuous rundown (Fig. 1a). Cur- clamp recordings lasting for 120 –180 s at Vhold ⫽ ⫺100 mV
rent levels normalized to the initial peak in IM followed a two- were performed using pipette solutions with pH values (pHpip)
phase decay function (Fig. 1b), where 39.6 ⫾ 3.1% (n ⫽ 14) of of 8.0, 7.4, and 6.0 (Fig. 2). Individual channels displayed a low
the total current decline was attributable to the initial fraction open probability (Po) at pHpip 8.0 (0.12 ⫾ 0.02, n ⫽ 15), whereas
of IM decay (Fig. 1c). Although this two-phase current decline Po increased to a moderate level at pHpip 7.4 (0.24 ⫾ 0.04; p ⫽
was also observed at an alkaline pH of 8.0, the fraction of the 0.011; n ⫽ 18) and was further enhanced at pHpip 6.0 (0.52 ⫾
initial IM decay under these conditions was significantly 0.04; p ⫽ 0.0003; n ⫽ 15; Fig. 2b). The number of visible chan-
enhanced (58.5 ⫾ 3.1%; p ⫽ 0.0058; n ⫽ 17). In contrast, acid- nels was increased in recordings performed at pHpip 6.0 when
ification of the extracellular solution to pH 6.0 markedly compared with alkaline conditions at pHpip 8.0 (Fig. 2c); how-
reduced the fraction of this initial IM decay (15.9 ⫾ 6.9%; p ⫽ ever, a low Po at pHpip 8.0 might lead to underestimation of
0.0048; n ⫽ 8) culminating in increased amiloride-sensitive channel abundance. The slope conductance (Gslope) of ␦␤␥-

J. Biol. Chem. (2019) 294(33) 12507–12520 12509

pH-sensitivity of Xenopus ␦-ENaC
when H2SO4 was employed for pH titration instead of HCl
(data not shown). In Xenopus ENaC containing the ␣-subunit,
maximal acid-induced channel activation was significantly
reduced to a factor of 1.2 ⫾ 0.06 (n ⫽ 12), while there was no
channel inhibition at alkaline pH. Moreover, pH-mediated
channel regulation between pH 8.0 and 6.0 was also reduced in
human ENaC isoforms (Fig. 3, c and d). Human ␦␤␥-ENaC
displayed a maximal acid-induced fold-activation of 1.05 ⫾
0.01 and an alkaline inhibition to a factor of 0.93 ⫾ 0.04 (n ⫽
12), whereas in ␣␤␥-ENaC these values were 1.03 ⫾ 0.01 and
0.9 ⫾ 0.1 (n ⫽ 11), respectively. These results demonstrate that
the presence of the ␦-subunit facilitates a markedly pronounced
pH-sensitivity in Xenopus ENaC that is not found in either iso-
form of orthologous human channels. As IM recorded in water-
injected oocytes was not reduced at alkaline pH or enhanced
under acidic conditions, the involvement of endogenous chan-
nels or transporters in the observed pH-mediated changes of IM
can be excluded.

Changes in the extracellular pH modulate ENaC sodium

self-inhibition
Figure 3. Xenopus ␦␤␥-ENaC is activated by extracellular acidifica-
tion. a, recordings of IM in oocytes expressing Xenopus ␣␤␥- or ␦␤␥-ENaC. Transmembrane currents mediated by ENaC are generally
Amiloride-sensitive (a, amiloride, 100 ␮M) currents mediated by ␦␤␥- but subject to a time-dependent decay that is attributable to two
not ␣␤␥ ENaC are dose-dependently increased by a stepwise acidification
of the extracellular solution (pH 8.0 – 6.0; pH 0.2 increments). b, dose-re- distinct mechanisms. SSI describes an immediate, allosteric
sponse curves of acid-mediated activation of Xenopus ENaC isoforms. Nor- reduction of ENaC Po in the presence of high extracellular
malized (IM, pHx/IM, pH 7.4) current levels were fit to a sigmoidal dose-re-
sponse function with variable slope (Hill-slope of Xenopus ␦␤␥-ENaC: sodium concentrations (20). The more slowly-progressing
1.6 ⫾ 0.4). Compared with pH 7.4, alkaline conditions decrease channel feedback inhibition involves a reduction of channel Po and
activity to a minimal factor (min.) of 0.5 ⫾ 0.2, whereas acidification internalization of membrane resident ENaCs due to accumula-
enhances activity of ␦␤␥-ENaC by a maximal factor (max.) of 3.9 ⫾ 0.2. c
and d, maximal acid-induced activation of currents mediated by human tion of intracellular Na⫹ (21). Because previous reports have
␣␤␥-ENaC (max.: 1.03 ⫾ 0.01) or ␦␤␥-ENaC (max.: 1.05 ⫾ 0.01) is consid- suggested that ENaC activation by acidic pH is predominantly
erably reduced with respect to Xenopus ␦␤␥-ENaC. associated with a reduced SSI (14), we hypothesized a similar
correlation in Xenopus ␦␤␥-ENaC, which is characterized by a
ENaC was derived from linear regression of unitary channel markedly pronounced SSI (17, 18). Fig. 4 illustrates a similar
conductance at Vhold from ⫺40 to ⫺100 mV. The pHpip did not reversibility and magnitude of acid-induced activation and SSI
significantly affect the Gslope of the channel (Fig. 2d; one-way of ␦␤␥-ENaC as well as an apparent independence of both
ANOVA, F ⫽ 1.854, p ⫽ 0.1725). Taken together, these results mechanisms from the slowly progressing decline of IM over
indicate that pH-mediated modulation of Xenopus ␦␤␥-ENaC time. Increasing extracellular [Na⫹] from 1 to 90 mM at pH 7.4
activity is based on changes in channel Po. induced a peaked increase in IM that was followed by a rapid,
initial current decay and a subsequent slow current rundown
The ␦-subunit confers a pronounced pH-sensitivity to Xenopus (Fig. 4a, also see Fig. 1). During this current rundown, extracel-
ENaC lular acidification (pH 6.0 for 30 s) reversibly activated a con-
The magnitude of stimulation of Xenopus ␦␤␥-ENaC by sistent fraction of IM that did not decrease but slightly increased
extracellular acidification was compared with channels con- over time (Fig. 4b). The observed increase of pH 6.0 sensitive IM
taining the ␣-ENaC subunit (␣␤␥) from X. laevis as well as both fractions can be mainly attributed to a reduced magnitude of
human channel orthologs (␦␤␥- and ␣␤␥-ENaC). As depicted the first acid-induced current increase, which may originate
in Fig. 3a, stepwise acidification of the extracellular solution from an overlap with the strong, initial current decay. Notably,
from pH 8.0 to 6.0 in increments of pH 0.2 resulted in a succes- the magnitudes of SSI (measured as current fractions lost after
sive increase of IM in oocytes expressing Xenopus ␦␤␥-ENaC 3 min of SSI) were constant over time when SSI was repetitively
that reached a maximum between pH 6.4 and 6.0 and was sen- induced (Fig. 4, c and d) supporting a functional correlation
sitive to amiloride. The dose-response relationship of individ- between ENaC activation by acidic pH and inhibition through
ual current levels normalized to IM at pH 7.4 indicated a maxi- SSI. To examine a functional interdependence between Na⫹-
mal activation of the channel by a factor of 3.9 ⫾ 0.2 under mediated inhibition and acid-induced activation of ENaC, we
acidic conditions, whereas alkaline pH reduced ENaC activity assessed the Na⫹ dependence of channel activation due to
to a factor of 0.5 ⫾ 0.2 (n ⫽ 15). The sigmoidal dose-response extracellular acidification. As presented in Fig. 4, e and f, the
curve exhibited a Hill-slope of 1.6 ⫾ 0.4 and a half-maximal half-maximal proton-induced activation (pH EC50) of Xenopus
channel activation (EC50) at pH 6.9 (Fig. 3b). Alkaline inhibi- ␦␤␥-ENaC depended on the extracellular Na⫹ concentration.
tion, maximal acidic activation, as well as the EC50 and Hill- Reduction of the extracellular [Na⫹] dose-dependently shifted
slope of Xenopus ␦␤␥-ENaC were not significantly different the channel’s pH EC50 to more alkaline values, suggesting that

12510 J. Biol. Chem. (2019) 294(33) 12507–12520

 pH-sensitivity of Xenopus ␦-ENaC
lower concentrations of protons are necessary to maximally
activate ENaC at reduced extracellular [Na⫹]. These results
indicate that pH-mediated activation of Xenopus ␦␤␥-ENaC is
affected by the extracellular Na⫹ concentration, thus suggest-
ing that protons alter channel activity by modulating SSI.
Because SSI of ENaC is only visible during experimental condi-
tions as employed in this study, we additionally examined
whether proton-sensitivity is maintained in prolonged record-
ings, when currents have reached a quasi-steady–state level.
Indeed, extracellular acidification (pH 6.0) led to a strong
increase of IM (Fig. 4g), indicating that pH-sensitivity might also
represent a physiologically relevant stimulus activating Xeno-
pus ␦␤␥-ENaC.
To further examine how protons and SSI interact, we deter-
mined the effect of extracellular pH on the magnitude and
apparent Na⫹ affinity of SSI in Xenopus ␦␤␥-ENaC (Fig. 5). SSI
was assessed by successively increasing extracellular [Na⫹]
from 1 mM to either 3, 10, 30, 60, 90, or 120 mM for 3 min.
Fractional inhibition of IM from the initial peak current
(IM, peak) to current levels after 3 min (IM, 3 min) was defined as
SSI ((IM, peak/IM, 3 min)/(IM, peak)). Plotting the magnitude of SSI
against the respective [Na⫹] allowed for estimation of maximal
inhibition (Vmax) and apparent Na⫹ affinity (Km) of SSI as val-
ues followed a Michaelis-Menten relation. Under alkaline con-
ditions (pH 8.0), Xenopus ␦␤␥-ENaC exhibited a maximal SSI
of 0.57 ⫾ 0.03, which was half-maximally reached at 2.1 ⫾ 0.4
mM Na⫹ (n ⫽ 10; Fig. 5a). Although the magnitude of maximal
SSI reached a similar value in the presence of pH 7.4 (0.55 ⫾
0.03, p ⫽ 0.9502), the Na⫹ affinity of SSI was significantly
reduced under these conditions (Km ⫽ 8.1 ⫾ 2.2 mM Na⫹,
p ⫽ 0.0347, n ⫽ 16; Fig. 5b). Compared with pH 7.4, further
extracellular acidification (pH 7.0, Fig. 5c) led to a reduction
of maximal SSI (0.4 ⫾ 0.05, p ⫽ 0.017), whereas the apparent
Na⫹ affinity (Km ⫽ 16.8 ⫾ 6.8 mM Na⫹, p ⫽ 0.9999, n ⫽ 13)
was not significantly changed. In line with results presented
in Fig. 1, SSI of Xenopus ␦␤␥-ENaC was altered at pH 6.0
(Fig. 5d). Although the magnitude of channel inhibition was
moderate in the presence of 3 mM Na⫹ (0.29 ⫾ 0.04), it did
not increase with rising sodium concentrations (SSI at 120
Figure 4. Acidic pH elicits a reversible, consistent, and Naⴙ-dependent
activation of Xenopus ␦␤␥-ENaC. a, representative current trace of an mM Na⫹ ⫽ 0.14 ⫾ 0.02, n ⫽ 10). Because these data did not
oocyte expressing Xenopus ␦␤␥-ENaC. Repetitive acidification of the extracel- converge with a Michaelis-Menten fit, estimation of maxi-
lular milieu (from pH 7.4 to pH 6.0 for 30 s) reversibly increases IM (a ⫽ mal SSI and apparent Na⫹ affinity was not feasible. Never-
amiloride, 100 ␮M). b, normalized IM fractions sensitive to pH 6.0 ((IM, pH 6.0 ⫺
IM, pH 7.4)/IM, pH 6.0) from recordings as depicted in a. Acid-sensitive current theless, these data clearly demonstrate that changes in the
fractions do not decline but rather increase over time (repeated-measures extracellular pH affect the magnitude and Na⫹ affinity of SSI
one-way ANOVA, F ⫽ 57.8, p ⬍ 0.0001; Tukey’s multiple comparisons test). c,
assessment of repetitive SSI in an oocyte expressing Xenopus ␦␤␥-ENaC. SSI in Xenopus ␦␤␥-ENaC, thus indicating that extracellular
was defined as the decline in IM at 3 min after increasing extracellular [Na⫹] protons activate ENaC by antagonizing Na⫹-mediated chan-
from 1 to 90 mM. d, Na⫹ self-inhibition values from recordings as depicted in
c. Current fractions lost to SSI ((IM, peak ⫺ IM, 3 min)/IM, peak) are constant over nel inhibition. This is additionally supported by the synergy/
time (repeated-measures one-way ANOVA, F ⫽ 0.8537, p ⫽ 0.4313; Tukey’s antagonism estimation using an interaction matrix com-
multiple comparisons test). e, Na⫹ dependence of acid-induced ENaC activa- posed of Na⫹- and proton-dependent SSI values of Xenopus
tion was examined through determination of the pH EC50 (pH 8.5– 6.0; pH 0.5
increments) under different Na⫹ concentrations (3–90 mM). Fractional chan- ␦␤␥-ENaC (Fig. 5e). The landscape visualizes deviations of
nel activation was calculated as the difference between IM at a given pH (IM, x) the observed values for SSI from a reference model (Bliss
and the minimal IM (IM, min) in relation to the maximally observed difference in
IM (⌬max IM) in the respective recording ((IM, x ⫺ IM, min)/⌬max IM)). f, alkaline- model (22)) that assumes a functional independence be-
shift of the pH EC50 in the presence of reduced [Na⫹] indicates that less pro- tween the two factors. Negative Bliss values with an average
tons are needed for acid-induced channel activation under low [Na⫹] (one-
way ANOVA, F ⫽ 38.51, p ⬍ 0.0001; Tukey’s multiple comparisons test). g, of ⫺23.4 indicate an antagonistic combinational effect,
extracellular acidification (from pH 7.4 to pH 6.0) still activates Xenopus ␦␤␥- which protons exert on the Na⫹-dependent magnitude of
ENaC after maximal rundown of currents.
SSI in Xenopus ␦␤␥-ENaC.

J. Biol. Chem. (2019) 294(33) 12507–12520 12511

pH-sensitivity of Xenopus ␦-ENaC
Mutations in the “acidic cleft” of the ␦-ENaC subunit affect
pH-sensitivity and sodium self-inhibition
To identify molecular determinants that facilitate ENaC
inhibition by extracellular Na⫹ ions, Kashlan et al. (23) previ-
ously reported the presence of a putative binding site for Na⫹ in
the extracellular loop of the ␣-subunit in mouse ENaC, which
was termed the acidic cleft. Site-directed mutagenesis of several
acidic residues within this region altered SSI of mouse ␣␤␥-
ENaC and in one instance additionally affected sensitivity to
extracellular acidification. Hypothesizing the presence of an
analogous site of interaction in Xenopus ␦-ENaC, we aimed to
determine the effect of mutating key acidic residues within the
␦-subunit of Xenopus ENaC on channel modulation by pH and
Na⫹. Fig. 6a shows a 3D model of a Xenopus ␦␤␥-ENaC trimer
based on the cryo-EM– derived structure of human ␣␤␥-ENaC
(PDB code 6BQN (7)). The region corresponding to the acidic
cleft in mouse ␣-ENaC is located at the interface between the
␤2-␣1 and ␤6-␤7 loops at the top of the ␦-ENaC extracellular
domain (Fig. 6a, red area). This region contains three nega-
tively charged aspartates (␦Asp-105, ␦Asp-293, and ␦Asp-296)
that provide potential sites for protonation and potentially con-
tribute to the coordination of Na⫹ ions (Fig. 6, b and c) (24, 25).
Within the corresponding structure of Xenopus ␣-ENaC, two
of these aspartates are replaced by a lysine (␣Lys-105) and a
glutamate (␣Glu-296), respectively (Fig. 6c). In line with previ-
ous observations (23), these structural discrepancies may suffi-
ciently alter the Na⫹- and proton-sensitivity of the ␣-ENaC
acidic cleft. To examine a putative role of the acidic cleft in
proton-mediated activation and SSI of Xenopus ␦␤␥-ENaC, we
generated mutant channels containing either single (␦D105K,
␦D293N, and ␦D296N), double (␦D105K,D296N and ␦D293N,D296N),
or triple (␦D3: ␦D105K,D293N,D296N) substitutions of aspartates
within this region. The charge-reversing ␦D105K mutation
was chosen, as the presence of a negatively charged ␦Asp-
105 in place of a lysine in ␣-ENaC (␣Lys-105) represents the
primary difference between both subunits’ acidic clefts.
Because negatively charged side chains in positions ␦Asp-
293 and ␦Asp-296 are conserved in the acidic cleft of
␣-ENaC, we decided to investigate their impact on pH- and
Na⫹-mediated channel regulation through introduction of
charge-neutralizing mutations.
The magnitude of acid-induced activation of WT or
Figure 5. Extracellular acidification antagonizes sodium self-inhibition
of Xenopus ␦␤␥-ENaC. a, representative recording of IM in oocytes express- mutant channels was assayed by successively decreasing
ing Xenopus ␦␤␥-ENaC. SSI was determined by rapidly changing extracellular extracellular pH from 8.0 to 6.0 in pH 0.2 increments (see
[Na⫹] from 1 to 3–120 mM at pH 8.0. The magnitude of Na⫹ self-inhibition Fig. 3). Introduction of single aspartate substitutions within
((IM, peak ⫺ IM, 3 min)/IM, peak) was plotted against the respective [Na⫹] and fitted
to the Michaelis-Menten equation, allowing estimation of maximal inhibition the ␦-ENaC acidic cleft significantly reduced maximal acid-
(Vmax) and apparent affinity for Na⫹ (Km). b– d, current recordings and Michae- induced channel activation when compared with WT ␦␤␥-
lis-Menten plots of SSI in Xenopus ␦␤␥-ENaC at pH 7.4, 7.0, and 6.0. At pH 8.0,
Vmax of SSI is similar to values at pH 7.4 (b), but SSI displays an enhanced Na⫹ ENaC (Fig. 7, a and b, and Table 1). This effect was not
affinity (Kruskal-Wallis test, p ⫽ 0.035; Dunn’s multiple comparisons test). cumulative in double-mutant channels, as maximal acid-in-
Compared with values at pH 7.4, further acidification (pH 7.0, c) decreases duced activation of ␦D105K,D296N␤␥ and ␦D293N,D296N␤␥ was
Vmax (one-way ANOVA, F ⫽ 5.508, Tukey’s multiple comparisons test, p ⫽
0.017), whereas the apparent Na⫹ affinity of SSI is not significantly changed not significantly different from that of ENaC containing only
(Kruskal-Wallis test, Dunn’s multiple comparisons test, p ⬎ 0.999). Irrespective single aspartate substitutions. However, mutation of all aspar-
of the extracellular [Na⫹], SSI of Xenopus ␦␤␥-ENaC is markedly reduced at pH
6.0 (d) and does not converge to a Michaelis-Menten fit. e, interaction land- tates in the ␦-ENaC acidic cleft (␦D3) further decreased the
scape for Na⫹-dependent SSI at different extracellular H⫹. The Bliss score maximal acid-induced channel activation when compared with
indicates deviations of the measured combinational responses from a refer- double-mutant channels (Table 1). Reduction of ENaC activity
ence model that assumes independence between Na⫹- and H⫹-mediated
responses. Negative Bliss values across the interaction landscape indicate at alkaline pH was curtailed in all mutant channels except those
antagonism of Na⫹ dependent SSI by increasing H⫹. containing the ␦D293N mutation (Table 1). The SSI of WT and

12512 J. Biol. Chem. (2019) 294(33) 12507–12520

 pH-sensitivity of Xenopus ␦-ENaC

Figure 6. Comparison of acidic cleft residues in Xenopus ␦- and ␣-ENaC subunits. a, structural arrangement of a Xenopus ␦␤␥-ENaC trimer with the position
of the ␦-ENaC acidic cleft highlighted in red. b, sequence alignments of human and Xenopus ENaC subunits depicting the ␤2–␣1 and ␤6 –␤7 loops that
constitute parts of the ␦-ENaC acidic cleft. Bold letters indicate acidic cleft residues that have been mutated in this study. c, models of the acidic cleft within
Xenopus ␦- and ␣-ENaC. Residues in the acidic cleft are shown as stick representations with the rest of the protein chain depicted as ribbon representations.
Contacts between residues in the acidic cleft are highlighted with distances shown.

mutant Xenopus ␦␤␥-ENaC was assessed at extracellular [Na⫹] ␦-ENaC acidic cleft in the ␣-ENaC subunit conveyed an
from 3 to 120 mM as described above. Interestingly, ENaCs enhanced pH-sensitivity to the channel (Fig. 7g), thus deeming
containing the ␦D296N mutation (␦D296N␤␥, ␦D293N,D296N␤␥, the acidic cleft necessary but not sufficient for proton-mediated
and ␦D3␤␥) exhibited a strongly reduced SSI with moderate activation of Xenopus ENaC. Previous work on vertebrate
inhibition of channel activity in the presence of 3 mM Na⫹ ASICs revealed that a segment connecting the first two
(␦D296N␤␥, 0.23 ⫾ 0.04) that did not increase with [Na⫹] ␤-sheets within the proximal part of the channel’s ectodomain
(␦D296N␤␥ SSI at 120 mM Na⫹ ⫽ 0.18 ⫾ 0.02, n ⫽ 16; Fig. 7, c modifies ASIC-gating kinetics and pH-sensitivity indepen-
and d). Although introduction of ␦D105K or ␦D293N also dently of the proton sensor within the acidic pocket (26, 27).
decreased maximal SSI compared with WT channels, the con- Comparison of the corresponding peptide sequence in verte-
siderably reduced effect of these mutations indicates an essen- brate ENaCs revealed that a leucine residue is conserved in the
tial role for the ␦Asp-296 residue in SSI of Xenopus ␦␤␥-ENaC. ␤1–␤2 linker of ␣-ENaC orthologs, whereas ␦-ENaC contains a
Functional convergence of ENaC regulation by protons and lysine at this position (Fig. 9). Our homology model of Xenopus
Na⫹ within the acidic cleft was further investigated through ␦-ENaC indicates ␦Lys-89 to be located in the subunit’s extra-
assessment of the half-maximal proton-induced activation (pH cellular loop, where it is oriented toward the ␤9-sheet of the
EC50) in the presence of high (90 mM) and low (3 mM) [Na⫹] ␦-ENaC palm domain (Fig. 8a). Substitution of this lysine by a
(Fig. 7, e and f). Consistent with the results shown in Fig. 4, e and leucine (␦K89L) significantly shifted the pH dependence of the
f, the pH EC50 of WT ␦␤␥-ENaC significantly shifted from channel to more acidic values (Fig. 8b). Interestingly, baseline
6.93 ⫾ 0.02 (n ⫽ 11) in the presence of 90 mM [Na⫹] to 7.49 ⫾ currents generated by ␦K89L␤␥-ENaC were strongly reduced
0.05 (n ⫽ 12; p ⬍ 0.001) under 3 mM [Na⫹]. This shift was lost under alkaline to neutral pH conditions, but still susceptible to
in ␦␤␥-ENaC containing the single ␦D296N or triple ␦D3 muta- strong acid-induced activation, leading to an enhanced stimu-
tions. Instead, the pH EC50 of channels containing acidic cleft lus-activated character of this mutant channel.
mutations was shifted toward more alkaline values in the pres- In summary, we have demonstrated that incorporation of the
ence of 90 mM [Na⫹] when compared with WT ␦␤␥-ENaC. ␦-subunit confers a pronounced pH-sensitivity to Xenopus
Taken together, these results suggest a contribution of neg- ENaC, generating acid-activated ion channels. Protons antago-
atively charged residues within the acidic cleft of Xenopus nize SSI and induce ENaC activation by increasing channel
␦-ENaC to the regulation of channel activity by pH and SSI. open probability. Mutational analysis of single aspartates
Notably, the charge-neutralizing ␦D296N mutation seems suffi- within the ␦-ENaC acidic cleft suggests a functional conver-
cient for almost complete ablation of SSI, while also profoundly gence of channel regulation by pH and SSI within this region.
decreasing acid-induced ENaC activation. Because substitu- Although necessary, the presence of an acidic cleft is not suffi-
tions at the ␦Asp-105 and ␦Asp-293 positions mimicked the cient to enhance proton-sensitivity of ENaC. Analogous to ver-
␦D296N effect on pH-mediated regulation of Xenopus ␦␤␥- tebrate ASIC1, the ␤1–␤2 linker in ENaC further modifies the
ENaC but induced a less profound reduction of SSI, distinct apparent pH-sensitivity of Xenopus ␦␤␥-ENaC.
contributions of these positions to channel regulation by pro-
tons and Na⫹ may be hypothesized. Discussion
This study aimed to determine whether functional traits of
The acidic cleft is necessary but not sufficient for enhanced ancestral proton-activated ion channels are retained in the
pH-sensitivity of Xenopus ␦␤␥-ENaC ␦␤␥-ENaC isoform of the anuran X. laevis. Indeed, our results
To test whether the acidic cleft of ␦-ENaC is sufficient for demonstrate that Xenopus ␦␤␥-ENaC, unlike ␣␤␥-ENaC, is
enhanced acid-induced ENaC activation, we mutated corre- profoundly sensitive to changes in the extracellular pH. Extra-
sponding residues within Xenopus ␣␤␥-ENaC. Neither partial cellular acidification from pH 8.0 to 6.0 resulted in a 7– 8-fold
(␣K105D) nor full (␣K105D,E296D,Q297L) reconstitution of the increase of amiloride-sensitive transmembrane currents in

J. Biol. Chem. (2019) 294(33) 12507–12520 12513

pH-sensitivity of Xenopus ␦-ENaC

Figure 7. Three aspartates in the ␦-ENaC acidic cleft distinctly affect ENaC sensitivity to pH and Naⴙ. a, representative IM recordings of Xenopus
oocytes expressing WT ␦␤␥-ENaC or channels containing a single aspartate to asparagine (␦D296N␤␥) mutation. Channel sensitivity to pH was assessed
by a stepwise reduction of extracellular pH from 8.0 to 6.0 (pH 0.2 increments). b, pH-dependent activation of ␦␤␥-ENaC containing none (wt), one
(␦D105K␤␥, ␦D293N␤␥, and ␦D296N␤␥), two (␦D293N,D296N␤␥ and ␦D105K,D296N␤␥) or three (␦D3␤␥: ␦D105K,D293N,D296N␤␥) mutations leading to substitution of
single aspartates. Maximum acid-induced channel activation is reduced in ENaC-containing single mutations (␦D105K␤␥, ␦D293N␤␥, and ␦D296N␤␥) when
compared with WT ␦␤␥-ENaC. There is no cumulative effect in channels containing two mutated aspartates, but substitution of three aspartates (␦D3␤␥)
further decreases maximum acid-induced activation as well as alkaline channel inhibition (Kruskal-Wallis test, p ⬍ 0.0001; Dunn’s multiple comparisons
test). c, assessment of SSI at [Na⫹] from 3 to 120 mM in oocytes expressing WT (␦␤␥) or mutant (␦D296N␤␥) ENaC. d, Na⫹ self-inhibition ((IM, peak ⫺
IM, 3 min)/IM, peak) of WT, single, double, and triple mutant channels. Introduction of ␦D293N or ␦D105K moderately decreases maximal SSI when compared
with WT ␦␤␥-ENaC, whereas ENaC containing ␦D296N has a profoundly reduced SSI irrespective of the extracellular [Na⫹]. Substitution of additional
aspartates in double or triple mutant channels does not further decrease ENaC SSI (one-way ANOVA, F ⫽ 10.26, p ⫽ 0.0003; Tukey’s multiple compar-
isons test). e, proton-sensitivity of ␦␤␥ ENaC mutants was assessed by determining fractional channel activation ((IM, x ⫺ IM, min)/⌬max IM) resulting from
a stepwise reduction of the extracellular pH (pH 8.5– 6.0; pH 0.5 increments) in the presence of 90 or 3 mM extracellular Na⫹. f, reduction of extracellular
[Na⫹] evokes an alkaline-shift of the pH EC50 in WT ␦␤␥-ENaC but not in channels containing the ␦D296N␤␥ or ␦D3␤␥ mutations. However, in the presence
of 90 mM Na⫹, introduction of these mutations shifts the pH EC50 to more alkaline values, when compared with WT ENaC (one-way ANOVA, F ⫽ 48.02,
p ⬍ 0.0001; Tukey’s multiple comparisons test). g, pH-sensitivity of Xenopus ␣␤␥-ENaC (n ⫽ 11) is not enhanced by partial (␣K105D␤␥; n ⫽ 13) or full
(␣K105D,E296D,Q297L␤␥; n ⫽ 12) reconstitution of the ␦-ENaC acidic cleft in this subunit. Individual values for pH-mediated regulation and SSI of WT and
mutant ENaC (a– d), including statistical analyses, are listed in Table 1.

oocytes expressing Xenopus ␦␤␥-ENaC (Fig. 3). This stimula- but changes in the extracellular pH within a range that was
tory effect of extracellular protons is much stronger compared employed in our study have a slow and marginal effect on the
with Xenopus ␣␤␥-ENaC (Fig. 3), human ENaC orthologs (Fig. cytoplasmic pH of Xenopus oocytes (33, 34). Although we can-
3) (14), or rodent ENaCs (23, 28). The reversibility and rela- not completely exclude a contribution of changes in the intra-
tively fast time course of acid-induced ENaC activation suggest cellular pH to modulation of Xenopus ␦␤␥-ENaC activity, our
that protons interfere with ENaC gating, rather than altering results suggest that channel gating is predominantly affected by
membrane abundance of the channel. This is in line with pre- extracellular protons.
vious studies that either demonstrated a decreased pH-sensi- Previous studies have suggested that acid-induced ENaC
tivity of ENaCs containing gating-mutations (14, 29) or activation involves a relief from SSI, which describes an allos-
reported a direct influence of protons on ENaC Po (30, 31). teric reduction of ENaC Po due to the binding of Na⫹ to the
Consistently, cell-attached patch-clamp recordings presented extracellular domain of the channel (20, 23). Collier et al. (2009)
in this study indicate an inverse correlation between pH and demonstrated that extracellular acidification (pH 8.5– 6.5)
ENaC Po (Fig. 2b). Previous studies reported a significant inhi- reduces the magnitude but not the Na⫹ affinity of SSI in human
bition of rat ␣␤␥-ENaC by cytoplasmic acidification (31, 32), ␣␤␥-ENaC, thereby suggesting that protons trigger conforma-

12514 J. Biol. Chem. (2019) 294(33) 12507–12520

 pH-sensitivity of Xenopus ␦-ENaC
Table 1
pH-mediated regulation and Naⴙ self-inhibition of ␦-ENaC acidic cleft mutants
Individual values for pH-mediated regulation and Na⫹ self-inhibition of Xenopus ␦␤␥-ENaC containing aspartate substitutions in the ␦-ENaC acidic cleft derived from
recordings as presented in Fig. 7, a– d. Values for maximal activation and minimal activity in the “pH-mediated channel activation” columns are based on individual
sigmoidal dose-response functions. Statistical evaluation of these data was performed as follows: maximal activation (Kruskal-Wallis test, p ⬍ 0.0001; Dunn’s multiple
comparisons test); minimal activity (one-way ANOVA, F ⫽ 12.11, p ⬍ 0.0001; Tukey’s multiple comparisons test). Values for Vmax and Km in the “Na⫹ self-inhibition”
columns are derived from individual Michaelis-Menten plots where applicable. Statistical evaluation of the corresponding data was performed as follows: Vmax (Kruskal-
Wallis test, p ⬍ 0.0001; Dunn’s multiple comparisons test); Km (Kruskal-Wallis test, p ⫽ 0.061; Dunn’s multiple comparisons test). All values represent mean ⫾ S.E.
pH-mediated channel activation Naⴙ self-inhibition
Maximal activation Minimal activity n Vmax Km (mM Naⴙ) n
␦␤␥-ENaC 3.48 ⫾ 0.31a
0.5 ⫾ 0.03a
22 0.72 ⫾ 0.01 3.8 ⫾ 0.7 16
␦D105K␤␥ 2.04 ⫾ 0.11a,b 0.62 ⫾ 0.02b 14 0.57 ⫾ 0.03b 2.7 ⫾ 1.2 9
␦D293N␤␥ 1.94 ⫾ 0.07a,b 0.49 ⫾ 0.03a 14 0.62 ⫾ 0.03b 8.9 ⫾ 3.6 16
␦D296N␤␥ 1.81 ⫾ 0.10b 0.60 ⫾ 0.02a,b 16 12
␦D293N,D296N␤␥ 1.92 ⫾ 0.09a,b 0.54 ⫾ 0.02a 19 15
␦D105K,D296N␤␥ 1.7 ⫾ 0.04a,b 0.65 ⫾ 0.02b 17 11
␦D105K,D293N,D296N␤␥ 1.38 ⫾ 0.04b 0.74 ⫾ 0.03b 12 10
a
p ⬍ 0.05 when compared with ␦D105K,D293N,D296N␤␥-ENaC in the respective column.
b
p ⬍ 0.05 when compared with wildtype ␦␤␥-ENaC in the respective column.

tional changes that affect ENaC gating downstream of Na⫹ bind- charge present in Xenopus ␦Asp-296 is strongly conserved
ing. The results we presented in this study indicate a similar throughout the ␣-ENaC lineage as well as in other members of
functional interdependence between pH and SSI in Xenopus ␦␤␥- the degenerin/ENaC family (7, 35), whereas it is lost in most
ENaC, because extracellular acidification (pH 8.0 – 6.0) also mammalian ␦-ENaC orthologs. Although conservation of this
reduced the Vmax of SSI in Xenopus ␦␤␥-ENaC in a dose-depen- residue would imply a central role in channel functionality, its
dent manner (Fig. 5). However, we observed an increased potency presence does not seem to correlate with an increased pH-sen-
of acidic pH in curtailing SSI of this amphibian ENaC isoform, sitivity or SSI of ENaC. However, we found that introduction
which is potentially caused by a proton-mediated antagonism of of the neighboring ␦D105K or ␦D293N mutations in Xenopus
Na⫹ binding at a conserved Na⫹ coordination site within an acidic ␦-ENaC led to a small but significant reduction in the magni-
cleft of the ␦-ENaC ectodomain. tude of ENaC SSI while also significantly reducing proton-in-
Additional evidence for functional convergence of ENaC duced channel activation. Thus, it may be speculated that the
regulation by pH and SSI comes from mutations within the proximate molecular environment of ␦Asp-296 additionally
␦-ENaC acidic cleft, which decreased both acid-induced chan- modifies Na⫹ coordination within the acidic cleft, allowing for
nel activation as well as ENaC inhibition through SSI (Fig. 7). modification of Na⫹- and pH-sensitivity without altering basic
This is consistent with previous findings that demonstrated a channel functionality. Consistently, the structural similarities
contribution of conserved negatively charged residues in the between the acidic cleft of Xenopus ␦-ENaC and ␣-ENaC sub-
acidic cleft of mouse ␣-ENaC to both SSI and pH (23). The units (Fig. 6; also see Fig. 9) suggest that subtle amino acid
authors suggested the acidic cleft as a potential Na⫹-binding alterations within this extracellular region may have profound
site that initiates SSI and proposed that protonation of a central effects on the channel’s pH-sensitivity. This is interesting from
aspartate (Asp-296 in Xenopus ␦-ENaC) at acidic pH would an evolutionary perspective, because mutations within the
obstruct Na⫹ coordination. Consistent with this hypothesis, acidic cleft might have the potential to transform a proton-
the ␦D296N mutation led to a full disruption of SSI in Xenopus stimulated ENaC ancestor into a less proton-sensitive and
␦␤␥-ENaC, while also partially impeding acid-induced channel rather constitutively active channel. Indeed, it was recently
activation (Fig. 7). A model involving a proton-mediated antag- highlighted that functional diversification within the degen-
onism of Na⫹ binding, which would contribute to subsequent erin/ENaC protein family is associated with a high variability in
channel activation by disruption of SSI, is consistent with the the extracellular regions contributing to the formation of the
observed shift in half-maximal proton-induced activation of acidic cleft, including the knuckle and finger domains as well as
␦␤␥-ENaC due to a reduction of the extracellular [Na⫹] (Fig. 4, the ␤6 –␤7 loop (2). Three acidic residues within that region are
e and f) as well as ␦-ENaC acidic cleft mutations that mimic this conserved in ␣-like ENaC in lamprey as well as ␦-ENaC in
effect (Fig. 7, e and f). Furthermore, we observed a decrease in amphibians and reptiles, whereas the number of acidic residues
the apparent Na⫹ affinity of SSI as a result from extracellular decreases within the mammalian ␦-ENaC lineage (Fig. 9).
acidification (Fig. 5). It thus seems reasonable to propose that Human ␦␤␥-ENaCs have a largely reduced SSI (36) and lack
protonation of acidic residues within the ␦-ENaC acidic cleft strong pH-sensitivity (Fig. 3), suggesting a potential correlation
shifts the Na⫹-binding equilibrium of this coordination site between altered acidic cleft structure and constitutive-ENaC
and thereby impedes initiation of SSI. Substitutions of nearby activity within the ␦-ENaC lineage. It is, however, unclear
located aspartates in the ␦-ENaC acidic cleft (␦D105K and whether the altered structure of the acidic cleft in mammals
␦D293N), however, did not lead to a full ablation of SSI, whereas caused a reduction in SSI or the cleft mutated as a result of
acid-induced channel activation was reduced to a similar extent functional uncoupling from gating mechanisms. We also note
as observed with the ␦D296N mutation (Fig. 7). This accentuates that proton-sensitivity of Xenopus ␦␤␥-ENaC does not neces-
a central role for the negative charge of the ␦Asp-296 moiety in sarily represent a functional trait that was retained during chan-
ENaC SSI, potentially involving coordination of Na⫹ at this nel evolution but may have developed secondarily in the sec-
position. Interestingly, as indicated in Fig. 9, the negative ondarily aquatic, pipid frog (37). Future studies might focus on

J. Biol. Chem. (2019) 294(33) 12507–12520 12515

pH-sensitivity of Xenopus ␦-ENaC

Figure 8. Proton sensitivity of Xenopus ␦␤␥ ENaC is further modulated by a lysine in the ␦-ENaC ␤1–␤2 linker. a, homology model of the Xenopus ␦-ENaC
subunit indicating the location of ␦Lys-89 in the linker region between the ␤1 and ␤2 sheets in the palm domain. b, fractional channel activation ((IM, x ⫺
IM, min)/⌬max IM) resulting from a stepwise reduction of the extracellular pH (pH 8.0 –5.5; pH 0.5 increments) in WT and ␦K89L␤␥ ENaC. Introduction of the ␦K89L
mutation leads to a significant acidic-shift of the channel’s pH EC50 (Student’s unpaired t test). c, representative IM recording of an oocyte expressing ␦K89L␤␥-
ENaC. Macroscopic currents mediated by mutant channels display “stimulus-activated” characteristics as they are low at neutral pH 7.4 and reversibly increased
by extracellular acidification (pH 6.0, 30 s; a ⫽ amiloride, 100 ␮M).

comparing pH-mediated regulation of ENaC orthologs from titratable residues within the ␤- and ␥-ENaC subunits in facil-
species representing early tetrapod ancestors to attain a better itating acid-induced activation of human ␣␤␥-ENaC. Further
understanding of this conundrum. In contrast to ␦-ENaC, pro- investigations by the same group (39) convincingly demon-
teolytic processing has exclusively been established in the strated that key pH-sensitive residues located at the interfaces
␣-ENaC lineage, as represented by the presence of two furin between adjacent channel subunits affect ENaC gating by alter-
cleavage sites in subunit orthologs from terrestrial tetrapods ing intersubunit distances through electrostatic interactions.
(Fig. 9) (38). Furin cleavage activates ENaC by uncoupling the The subunit composition of Xenopus ENaC thus may alter pH-
channel from SSI (19). This might provide a potential explana- sensitivity, not only by introduction of the ␦-ENaC acidic cleft
tion for the strong conservation of the acidic cleft structure and but also through the formation of intersubunit interactions in
residual pH-sensitivity in the ␣-ENaC lineage (Fig. 9). lower parts of the channel’s extracellular loop. pH-sensitive res-
The recently resolved structure of human ␣␤␥-ENaC identi- idues in human ␣␤␥ ENaC have been proposed to facilitate
fied extensive contacts between the knuckle and finger domains acid-induced channel activation through interactions with the
of neighboring subunits, forming a collar of inter-subunit inter- ␤1–␤2 linker in the lower palm domain of adjacent subunits
actions at the top of the extracellular loop (7). The ␣-helices (39). This is in good agreement with our results suggesting that
from the knuckle (␣6) and the finger domains (␣1 and ␣2) of modulatory sites distal to the acidic cleft, such as the ␦-ENaC
human ENaC were shown to enclose the ␤6 –␤7 loop that has ␤1–␤2 linker, affect proton-induced activation of Xenopus
been proposed to form part of the acidic cleft in mouse ␣-ENaC ␦␤␥-ENaC (Fig. 8). These observations also suggest interesting
(23) as well as Xenopus ␦-ENaC (Fig. 6). The homology model of similarities to the molecular mechanisms determining pH-sen-
Xenopus ␦␤␥-ENaC presented in this study indicates the sitivity of ASICs. For example, mutations in the ␤1–␤2 linker
␤6 –␤7 loops of individual subunits to be located between the conveyed pH-sensitivity to lamprey ASIC1 (26), largely
␤2–␣1 loop preceding the finger domain and the ␣6 –␤11 loop increased macroscopic and acid-induced current amplitudes of
of the knuckle domain within the same subunit, generating elephant shark ASIC1 (27), and decreased the velocity of Xeno-
individual intra-subunit conjunctions. Conformational changes pus ASIC1.1 activation. Analogous to the proposed evolution-
due to the coordination of Na⫹ in the ␦-ENaC acidic cleft may ary adaptation of pH-sensitivity in ASICs from early diverging
therefore be transmitted by means of the knuckle–finger collar to vertebrates (27), structural modifications in the ␤1–␤2 linker
drive structural reorganizations that eventually lead to the adop- could have enabled diversification of proton-sensitivity in
tion of a low Po ENaC-gating mode. Conversely, protonation of the ENaC isoforms due to changes within the palm domain and
acidic cleft could oppose Na⫹ coordination at this site and thereby independently of the structure of the acidic cleft. Furthermore,
shift the channel’s gating equilibrium toward a high Po state. pH-sensitivity of mouse ASIC1a was reported to be affected by
Although a precise mechanistic interpretation of how the acidic mutations of Lys-211, which links the palm and thumb domains
cleft contributes to regulation of Xenopus ␦␤␥-ENaC gating by pH of neighboring subunits (16). Conservation of the positive
and SSI may not be feasible based on the present results, they charge at the corresponding position in Xenopus ␦-ENaC
clearly demonstrate that both modulatory factors converge within (␦Arg-279) could additionally account for pH-sensitivity of this
the acidic cleft where they likely interact in a competitive manner. channel isoform, whereas its absence in the ␣-ENaC subunit
Additionally, protons likely modulate conformational changes, (␣Met-282) might prevent acid-induced channel activation.
which would induce a transition into a low Po-gating mode, Taken together, we propose that extracellular acidification acti-
downstream from the binding of extracellular Na⫹. The pres- vates Xenopus ␦␤␥-ENaC through modulation of SSI by means
ence of a component in acid-induced activation of ␦␤␥-ENaC of at least two distinct mechanisms. Protonation of acidic resi-
that is independent of Na⫹ coordination at the acidic cleft is dues within the ␦-ENaC acidic cleft likely shifts the Na⫹-bind-
indicated by the residual pH-sensitivity of ␦D296N␤␥ mutant ing equilibrium of a Na⫹ coordination site and thus impedes
channels, which do not exhibit SSI (Fig. 7). Previous studies by initiation of SSI. Additionally, protons potentially interfere
Snyder and co-workers (14, 28) have identified a crucial role of with conformational changes, which would induce the transi-

12516 J. Biol. Chem. (2019) 294(33) 12507–12520

 pH-sensitivity of Xenopus ␦-ENaC
by Balinsky and Baldwin (44) reported that the urinary pH in
X. laevis is alkaline (pH 8.0), which might result from ammono-
telic nitrogen excretion in this species. Based on our study, this
would suggest ␦␤␥-ENaC activity to be generally low. We have
previously shown that currents generated by ␦␤␥-ENaC are
consistently larger than those generated by ␣␤␥-ENaC (18),
suggesting that ENaCs containing the ␦-subunit might play a
role under conditions where maximum Na⫹ absorption is nec-
essary. X. laevis can survive droughts by aestivation, a physio-
logical state where the animals absorb water via the urinary
bladder. Nitrogen excretion switches from ammonotelia to
ureotelia under aestivation, which might trigger changes in uri-
nary pH. Indeed, McBean and Goldstein (45) reported a reduc-
tion in urine flow as well as an increase of plasma Na⫹ levels
preventing dehydration of X. laevis in an hyperosmotic envi-
ronment. Similar physiological responses due to salt stress have
been observed the aestivating toad Scaphiopus couchi (46) and
the semiaquatic B. marinus (47). However, because the cellular
localization of ␦␤␥-ENaC in the urogenital tract is still
unknown, further exploration is warranted to dissect the pre-
cise physiological role of this ENaC isoform under such
conditions.
In summary, we have demonstrated that X. laevis ␦␤␥-ENaC
Figure 9. Conservation of motifs involved in pH-sensitivity and proteo- is a profoundly pH-sensitive ion channel. Proton-sensitivity is
lytic maturation of ␣- and ␦-ENaC orthologs. Multiple sequence alignment partially provided by an extracellular acidic cleft, where proto-
inferred from amino acid sequences of ␣- and ␦-ENaC orthologs (Table S1)
showing sites involved in proton-mediated activation of X. laevis ␦␤␥-ENaC nation of acidic residues is coupled to SSI. These characteris-
that have been identified in this study (␤1–␤2, ␤2–␣1, and ␤1–␤2 linker). tics, together with the evolutionary variability of this extracel-
Note that only one ␣-like subunit ortholog has been identified in hagfish lular region, suggest that ␦-ENaC might have evolved from a
Eptatretus burgeri and lamprey Petromyzon marinus, which therefore are dis-
played in a separate group. Rats do not have a functional gene for ␦-ENaC. stimulated–activated ancestor that was uncoupled from pro-
Colored backgrounds illustrate the presence of residues with hydrophobic ton-sensitivity during the evolution of tetrapod vertebrates.
(blue) or polar (red) side chains in the ␤1–␤2 linker or negatively-charged
residues (yellow) in the acidic cleft. The Asp-296 position, which is essential for Experimental procedures
Na⫹ coordination in Xenopus ␦␤␥-ENaC, is highlighted in red. Conservation of
the minimal consensus sequence for proteolytic maturation of ENaC subunits Synthesis of cRNA
by furin (sequence RXXR) is indicated by green check marks, and red crosses
represent the absence of this consensus sequence. Gray checkmarks indicate Constructs encoding full-length human or X. laevis ␦-␣-␤-
the presence of an RXXR motif dislocated from the conserved location of the and ␥-ENaC were present in the pTNT expression vector (Pro-
respective furin cleavage site.
mega, Mannheim, Germany). Site-directed mutagenesis (prim-
ers listed in Table 2) was performed using the QuikChange
tion into a low Po gating mode resulting from the binding of Lightning kit (Agilent Technologies, Waldbronn, Germany)
extracellular Na⫹. according to the manufacturer’s instructions. Successful
Finally, the results presented in this study suggest a putative mutagenesis was verified by sequencing (SeqLab, Goettingen,
physiological role of ENaCs containing the ␦-subunit. In adult Germany). Constructs were linearized with BamHI (␦- and
X. laevis, we found ␦-ENaC mRNA exclusively in tissue samples ␣-ENaC) or NaeI (␥-ENaC, both enzymes purchased from Pro-
from the urogenital tract, including the kidneys, urinary blad- mega). Plasmids containing ␤-ENaC were not linearized due to
der, and cloaca but not in the skin (18). The presence of func- the presence of BamHI and NaeI restriction sites in the coding
tional ␦␤␥-ENaC channels in the apical membrane of epithelial sequence. Synthesis of m7G-capped cRNA was performed
cells within those organs could indicate a coupling of transepi- using the T7 RNA polymerase system (RiboMAX large scale
thelial Na⫹ absorption to urinary pH. Interestingly, luminal RNA production system, Promega) according to the manufa-
acidification has been shown to stimulate Na⫹ absorption cturer’s protocol. cRNAs were diluted in diethylpyrocarbonate-
across the toad urinary bladder (40), whereas Na⫹ absorption treated H2O to a final concentration of 10 ng/␮l per subunit for
across the skin was unaffected (41). Indeed, urinary acidifica- two-electrode voltage-clamp (TEVC) recordings and 20 ng/␮l
tion has been observed along the distal mesonephric tubules for patch-clamp recordings.
and the urinary bladder of multiple amphibian and reptile spe-
cies (42). In the urinary bladder of Bufo marinus, mucosal pro- Expression in Xenopus oocytes
ton secretion was found to be partially associated with an Stage V/VI oocytes were isolated from adult frogs as
amiloride-sensitive Na⫹ absorption across the bladder epithe- described previously (18). Animals were anesthetized in 0.2%
lium, suggesting a reciprocal coupling between these ion trans- MS-222/H2O (Pharmaq, New Hampshire, UK) at pH 6.0 for 15
port mechanisms (43) that might resemble proton-coupled min prior to euthanasia by decapitation and sounding of the
Na⫹ absorption in ionocytes of freshwater fish. Previous work spinal cord. The methods used to humanely euthanize the ani-

J. Biol. Chem. (2019) 294(33) 12507–12520 12517

pH-sensitivity of Xenopus ␦-ENaC
Table 2
Site-directed mutagenesis primer sequences
Single nucleotide exchanges for site-directed mutagenesis are highlighted in underlined, bold letters. Generation of constructs containing single amino acid substitutions
(␦D293N, ␦D296N, ␦D105K, ␦K89L, and ␣K105D) as well as the ␦D293N,D296N double mutant was achieved using wildtype ␦- or ␣-ENaC constructs. The ␦D105K primers were
employed in combination with constructs encoding ␦D296N- or ␦D293N,D296N-ENaC for generation of ␦D105K,D296N- and ␦D105K,D293N,D296N-ENaC respectively. Primers
introducing the ␣K105D mutation were used in combination with constructs containing the ␣E296D,Q297L double mutation to create ␣K105D,E296D,Q297L triple mutants.
Primer Primer sequence (5ⴕ–3ⴕ)
␦D293N Forward GGCATGTTGTCATGAAGATTAGCCTTCACAACCATAGAC
Reverse GTCTATGGTTGTGAAGGCTAATCTTCATGACAACATGCC
␦D296N Forward GGAGAGGCATGTTGTTATGAAGATCAGCCTTCACA
Reverse TGTGAAGGCTGATCTTCATAACAACATGCCTCTCC
␦D105K Forward GAGCTGATTAATATACATATTAACTTGCTTAAATCTGTAGGGGTTCAGATTGCAAAT
Reverse ATTTGCAATCTGAACCCCTACAGATTTAAGCAAGTTAATATGTATATTAATCAGCTC
␦D293N,D296N Forward GGCATGTTGTTATGAAGATTAGCCTTCACAACCATAGAC
Reverse GTCTATGGTTGTGAAGGCTAATCTTCATAACAACATGCC
␦K89L Forward GGTCACAGCTGGAAATATTAAGCCCTTTGACTGCAAGCCT
Reverse AGGCTTGCAGTCAAAGGGCTTAATATTTCCAGCTGTGACC
␣K105D Forward GCAGATCATTCTGAATCGCATCGTACCTGTACGGGTTTAAG
Reverse CTTAAACCCGTACAGGTACGATGCGATTCAGAATGATCTGC
␣E296D,Q297L Forward GGAATGTAATCATGCAGATCAGTCCGAAGGACAAGGGTTAG
Reverse CTAACCCTTGTCCTTCGGACTGATCTGCATGATTACATTCC

mals were consistent with the recommendations of the AVMA For patch-clamp experiments, mechanically devitellinized
Guidelines for the Euthanasia of Animals. All procedures and oocytes were placed in a recording chamber containing bath
experimental protocols were approved by the Animal Welfare solution (in mM: 145 KCl, 1.8 CaCl2, 10 HEPES, 2 MgCl2, and
Officer of the University of Giessen (Registration No.: M_478/ 5.5 glucose at pH 7.4). Patch pipettes (6 –9 megohm resistance)
M_549/M_649) as well as the Animal Welfare and Ethical were pulled from borosilicate glass capillaries, heat-polished,
Review Body at Newcastle University (Project ID No: ID 630). and filled with pipette solution (in mM: 145 NaCl, 1.8 CaCl2, 10
The animal housing facility (Giessen, Germany) was licensed by HEPES, 2 MgCl2 and 5.5 glucose). The pH of the pipette solu-
local authorities (Az: FD 62-§11 JLU Tierphysiologie). For some tion was adjusted using HCl and NaOH. Current signals were
experiments, oocytes were purchased from the European Xeno- amplified using an LM-PC patch-clamp amplifier (List-Medi-
pus Resource Centre (Portsmouth, UK) or Ecocyte Bioscience cal, Darmstadt, Germany), low-pass filtered at 100 Hz (Fre-
(Castrop-Rauxel, Germany). Oocytes were kept in a culture of quency Devices, Haverhill, IL), and recorded at 2 kHz with
oocyte Ringer’s solution (CulORS, in mM: 90 NaCl, 1 KCl, 2 Axon Clampex software (Axon Instruments, Foster City, CA)
CaCl2, 5 HEPES, 2.5 sodium pyruvate, 0.06 penicillin G, and using an Axon 1200 interface. Single-channel analysis was per-
0.02 streptomycin sulfate at pH 7.4) prior to injection with 32 nl formed with Clampfit version 10.7 (Axon Instruments). The
of cRNA. Cells were incubated at 16 °C in a low-sodium amount of channels in each recording was stochastically esti-
CulORS (in mM: 10 NaCl, 80 N-methyl-D-glucamine (NMDG), mated by comparing the number of visible channels with a
1 KCl, 2 CaCl2, 5 HEPES, 2.5 sodium pyruvate, 0.06 penicillin G, theoretical amount derived from binomial distribution as
and 0.02 streptomycin sulfate at pH 7.4) for 1–2 days for two- described previously (21). All electrophysiological recordings
electrode voltage-clamp measurements or 2–7 days for patch- were performed at room temperature.
clamp recordings.
Homology modeling
Electrophysiological recordings Homology modeling of Xenopus ENaC isoforms was per-
TEVC and cell-attached patch-clamp recordings were essen- formed using the I-Tasser web server (48) and PyMol (The
tially performed as described previously (18). In brief, TEVC PyMOL Molecular Graphics System, Version 2.0, Schrödinger,
recordings of oocyte whole-cell transmembrane currents (IM) LLC) to generate the heterotrimeric complexes based on the
were conducted using a Turbo Tec-03X amplifier (NPI, Tamm, cryo-EM– derived structure of human ␣␤␥-ENaC (PDB code
Germany) at a holding potential of ⫺60 mV. Current signals 6BQN (7)). Sequence alignments were generated employing the
were low-pass filtered at 1 kHz and recorded with a strip-chart Clustal Omega online tool (49).
recorder. If not stated otherwise, oocytes were perfused with
ORS (in mM: 90 NaCl, 1 KCl, 2 CaCl2, 5 HEPES) through a Vertebrate ENaC sequence analysis
gravity-driven system at a speed of 10 ml/min. Sodium was Protein sequences of different vertebrate ␣- and ␦-ENaC
substituted with equimolar amounts of NMDG in ORS con- orthologs were collected from the UniProt and NCBI Protein
taining differing sodium concentrations. Adjustment of pH was databases. Because many protein sequences are in silico trans-
achieved with HCl and NaOH. NMDG was used for alkaline lation products from genomic DNA of sequencing efforts from
titration of ORS containing defined Na⫹ concentrations. The different animals that have yet not been validated by cDNA
ENaC inhibitor amiloride (100 ␮M; Sigma-Aldrich, Taufkirchen, cloning, verification of available sequence information was
Germany) was employed to identify ENaC-mediated current frac- required. To verify, or complete, a coding DNA sequence, the
tions (⌬Iami). genomic sequence information was compared with known cod-

12518 J. Biol. Chem. (2019) 294(33) 12507–12520

 pH-sensitivity of Xenopus ␦-ENaC
ing sequences from other species such as human or Xenopus. If synergy. All figures were assembled and finalized using Ink-
available, genomic sequence information was retrieved from scape (version 0.92.3; https://inkscape.org).3
the linked sources of the respective protein sequences (Table
S1). In other cases, sequence information from closely related Author contributions—L. W. and M. A. conceptualization; L. W. and
species was submitted to BLASTN (NCBI) with default param- S. M. data curation; L. W., J. M.-W., S. M., P. P. S., and M. A. formal
eters for megablast/blast algorithms choosing the database for analysis; L. W. and S. M. validation; L. W., J. S. D., J. M.-W., and
whole-genome shotgun contigs and specifying the respective S. M. investigation; L. W. and J. M.-W. visualization; L. W., P. P. S.,
organism or family. Depending on the size of the output and M. A. methodology; L. W. and M. A. writing-original draft;
sequence, all sequences were immediately or iteratively com- L. W., J. S. D., J. M.-W., S. M., P. P. S., I. M., and M. A. writing-review
pared with confirmed exon sequences using MultAlin (http:// and editing; I. M. and M. A. resources; M. A. supervision; M. A.
multalin.toulouse.inra.fr/multalin/)3 (51) with parameters set funding acquisition; M. A. project administration.
for DNA alignment. The comparison included determination
of the exon boundaries and the quality of the splice donor Acknowledgments—We thank Sean Gettings for generating ENaC
and acceptor sites, exon length (as a consistent feature across cRNA and Dr. Tim Boswell as well as Dr. Peter Simmons for critical
various species and isoforms), as well as potential Kozak con- comments on the manuscript.
sensus sequences for the translational start. The verified or
completed cDNA sequence information was finally trans-
References
lated into the respective amino acid sequence (https://web.
1. Bayley, M., Damsgaard, C., Thomsen, M., Malte, H., and Wang, T. (2019)
expasy.org/translate/;3 Table S1). Generation of sequence Learning to air-breathe: the first steps. Physiology 34, 14 –29 CrossRef
alignments using the ClustalW algorithm was achieved Medline
employing the Mega X suite. 2. Hanukoglu, I., and Hanukoglu, A. (2016) Epithelial sodium channel
(ENaC) family: phylogeny, structure–function, tissue distribution, and as-
Data analysis sociated inherited diseases. Gene 579, 95–132 CrossRef Medline
Data are presented in column scatter plots or x–y graphs with 3. Studer, R. A., Person, E., Robinson-Rechavi, M., and Rossier, B. C. (2011)
Evolution of the epithelial sodium channel and the sodium pump as lim-
lines/symbols and error bars representing mean ⫾ S.E. Oocytes for
iting factors of aldosterone action on sodium transport. Physiol. Genomics
each experiment were derived from at least three different donors, 43, 844 – 854 CrossRef Medline
and the number of individual experiments (n) is noted in paren- 4. Kerem, E., Bistritzer, T., Hanukoglu, A., Hofmann, T., Zhou, Z., Bennett,
theses. Statistical analyses were performed using GraphPad Prism W., MacLaughlin, E., Barker, P., Nash, M., Quittell, L., Boucher, R., and
version 7 (GraphPad Software Inc., La Jolla, CA). Gaussian distri- Knowles, M. R. (1999) Pulmonary epithelial sodium-channel dysfunction
bution of individual data were assessed with the D’Agostino and and excess airway liquid in pseudohypoaldosteronism. N. Engl. J. Med.
341, 156 –162 CrossRef Medline
Pearson omnibus normality test. Multiple groups were compared
5. Cogswell, M. E., Zhang, Z., Carriquiry, A. L., Gunn, J. P., Kuklina, E. V.,
by one-way ANOVA followed by a post hoc Tukey’s multiple- Saydah, S. H., Yang, Q., and Moshfegh, A. J. (2012) Sodium and potassium
comparison test (two-tailed) for normally distributed data or a intakes among US adults: NHANES 2003–2008. Am. J. Clin. Nutr. 96,
Kruskal-Wallis test followed by Dunn’s multiple-comparison test 647– 657 CrossRef Medline
(two-tailed) for data not following Gaussian distribution. A p 6. Giraldez, T., Rojas, P., Jou, J., Flores, C., and Alvarez de la Rosa, D. (2012)
value ⱕ 0.05 was considered significant. Whole-cell current The epithelial sodium channel ␦-subunit: new notes for an old song. Am. J.
Physiol. Renal Physiol. 303, F328 –F338 CrossRef Medline
decays as depicted in Fig. 1a were fit to the built-in equation for a
7. Noreng, S., Bharadwaj, A., Posert, R., Yoshioka, C., and Baconguis, I.
two-phase exponential decay provided by GraphPad Prism, using (2018) Structure of the human epithelial sodium channel by cryo-electron
the constraints Y0 (IM/IM, initial after 0 min) ⫽ 1 and Yplateau (IM/ microscopy. Elife 7, e39340 CrossRef Medline
IM, initial after infinite minutes) ⬎0. 8. Kellenberger, S., and Schild, L. (2002) Epithelial sodium channel/degen-
Evaluation of synergy or antagonism between extracellular erin family of ion channels: a variety of functions for a shared structure.
H⫹ and Na⫹ on ENaC sodium self-inhibition (SSI) was per- Physiol. Rev. 82, 735–767 CrossRef Medline
9. Tavernarakis, N., and Driscoll, M. (1997) Molecular modeling of mecha-
formed with the R-based syngeryfinder package (https://synergy-
notransduction in the nematode Caenorhabditis elegans. Annu. Rev.
finder.fimm.fi)3 (50). Oocytes were exposed to six concentra- Physiol. 59, 659 – 689 CrossRef Medline
tions of Na⫹ (3, 10, 30, 60, 90, and 120 mM) at four different 10. Cottrell, G. (1997) The first peptide-gated ion channel. J. Exp. Biol. 200,
extracellular pH values (pH 8.0, 7.4, 7.0, and 6.0), and the 2377–2386 Medline
degree of SSI was determined as relative fractions of ENaC 11. Boscardin, E., Alijevic, O., Hummler, E., Frateschi, S., and Kellenberger, S.
inhibition. pH values were expressed as proton concentra- (2016) The function and regulation of acid-sensing ion channels (ASICs)
and the epithelial Na⫹ channel (ENaC): IUPHAR Review 19. Br. J. Phar-
tion in millimolar. To quantify the degree of H⫹/Na⫹ inter-
macol. 173, 2671–2701 CrossRef Medline
action, SSI “inhibitory values” ranging from 0 (no inhibition) 12. Dymowska, A. K., Boyle, D., Schultz, A. G., and Goss, G. G. (2015) The role
to 100 (full inhibition) were used as input for the synergy of acid-sensing ion channels in epithelial Na⫹ uptake in adult zebrafish
finder tool employing the Bliss synergy reference model (22). (Danio rerio). J. Exp. Biol. 218, 1244 –1251 CrossRef Medline
Interaction scores were visualized as three-dimensional 13. Dymowska, A. K., Schultz, A. G., Blair, S. D., Chamot, D., and Goss, G. G.
interaction surfaces according to Ref. 50 with negative Bliss (2014) Acid-sensing ion channels are involved in epithelial Na⫹ uptake in
the rainbow trout Oncorhynchus mykiss. Am. J. Physiol. Cell Physiol. 307,
values indicating antagonism and positive values indicating
C255–C265 CrossRef Medline
14. Collier, D. M., and Snyder, P. M. (2009) Extracellular protons regulate
3
Please note that the JBC is not responsible for the long-term archiving and human ENaC by modulating Na⫹ self-inhibition. J. Biol. Chem. 284,
maintenance of this site or any other third party hosted site. 792–798 CrossRef Medline

J. Biol. Chem. (2019) 294(33) 12507–12520 12519

pH-sensitivity of Xenopus ␦-ENaC
15. Coric, T., Zheng, D., Gerstein, M., and Canessa, C. M. (2005) Proton the epithelial Na⫹ channel. Am. J. Physiol. 276, C477–C486 CrossRef
sensitivity of ASIC1 appeared with the rise of fishes by changes of residues Medline
in the region that follows TM1 in the ectodomain of the channel. J. Physiol. 33. Awayda, M. S., Boudreaux, M. J., Reger, R. L., and Hamm, L. L. (2000)
568, 725–735 CrossRef Medline Regulation of the epithelial Na⫹ channel by extracellular acidification.
16. Lynagh, T., Mikhaleva, Y., Colding, J. M., Glover, J. C., and Pless, S. A. Am. J. Physiol. Cell Physiol. 279, C1896 –C1905 CrossRef Medline
(2018) Acid-sensing ion channels emerged over 600 Mya and are con- 34. Humphreys, B. D., Jiang, L., Chernova, M. N., and Alper, S. L. (1994)
served throughout the deuterostomes. Proc. Natl. Acad. Sci. U.S.A. 115, Functional characterization and regulation by pH of murine AE2 anion
8430 – 8435 CrossRef Medline exchanger expressed in Xenopus oocytes. Am. J. Physiol. 267,
17. Babini, E., Geisler, H. S., Siba, M., and Gründer, S. (2003) A new subunit of C1295–C1307 CrossRef Medline
the epithelial Na⫹ channel identifies regions involved in Na⫹ self-inhibi- 35. Assmann, M., Kuhn, A., Dürrnagel, S., Holstein, T. W., and Gründer, S.
tion. J. Biol. Chem. 278, 28418 –28426 CrossRef Medline (2014) The comprehensive analysis of DEG/ENaC subunits in Hydra re-
18. Wichmann, L., Vowinkel, K. S., Perniss, A., Manzini, I., and Althaus, M. veals a large variety of peptide-gated channels, potentially involved in
(2018) Incorporation of the ␦-subunit into the epithelial sodium channel neuromuscular transmission. BMC Med. 12, 84 CrossRef Medline
(ENaC) generates protease-resistant ENaCs in Xenopus laevis. J. Biol. 36. Ji, H. L., Su, X. F., Kedar, S., Li, J., Barbry, P., Smith, P. R., Matalon, S., and
Chem. 293, 6647– 6658 CrossRef Medline Benos, D. J. (2006) ␦-Subunit confers novel biophysical features to ␣␤␥-
19. Sheng, S., Carattino, M. D., Bruns, J. B., Hughey, R. P., and Kleyman, T. R. human epithelial sodium channel (ENaC) via a physical interaction. J. Biol.
(2006) Furin cleavage activates the epithelial Na⫹ channel by relieving Chem. 281, 8233– 8241 CrossRef Medline
Na⫹ self-inhibition. Am. J. Physiol. Physiol. 290, F1488 –F1496 CrossRef 37. Evans, B. J., Carter, T. F., Greenbaum, E., Gvoždík, V., Kelley, D. B.,
Medline McLaughlin, P. J., Pauwels, O. S., Portik, D. M., Stanley, E. L., Tinsley, R. C.,
20. Bize, V., and Horisberger, J. D. (2007) Sodium self-inhibition of human Tobias, M. L., and Blackburn, D. C. (2015) Genetics, morphology, adver-
epithelial sodium channel: selectivity and affinity of the extracellular so- tisement calls, and historical records distinguish six new polyploid species
dium sensing site. Am. J. Physiol. Renal Physiol. 293, F1137–F1146 of African clawed frog (Xenopus, Pipidae) from West and Central Africa.
CrossRef Medline PLoS ONE 10, e0142823 CrossRef Medline
21. Anantharam, A., Tian, Y., and Palmer, L. G. (2006) Open probability of the 38. Kashlan, O. B., Balchak, D. M., Gentilcore, C., and Clark, N. L. (2018)
epithelial sodium channel is regulated by intracellular sodium. J. Physiol. Cleavage of ENaC ␣ and ␥ subunits evolved with the terrestrial migration.
FASEB J. 32 (Abstr 624.16)
574, 333–347 CrossRef Medline
39. Collier, D. M., Tomkovicz, V. R., Peterson, Z. J., Benson, C. J., and Snyder,
22. Yadav, B., Wennerberg, K., Aittokallio, T., and Tang, J. (2015) Searching
P. M. (2014) Intersubunit conformational changes mediate epithelial so-
for drug synergy in complex dose-response landscapes using an interac-
dium channel gating. J. Gen. Physiol. 144, 337–348 CrossRef Medline
tion potency model. Comput. Struct. Biotechnol. J. 13, 504 –513 CrossRef
40. Leaf, A., Keller, A., and Dempsey, E. F. (1964) Stimulation of sodium trans-
Medline
port in toad bladder by acidification of mucosal medium. Am. J. Physiol.
23. Kashlan, O. B., Blobner, B. M., Zuzek, Z., Tolino, M., and Kleyman, T. R.
207, 547–552 CrossRef Medline
(2015) Na⫹ inhibits the epithelial Na⫹ channel by binding to a site in an
41. Ussing, H. H. (1949) The active ion transport through the isolated frog
extracellular acidic cleft. J. Biol. Chem. 290, 568 –576 CrossRef Medline
skin in the light of tracer studies. Acta Physiol. Scand. 17, 1–37 CrossRef
24. Liu, W., Chun, E., Thompson, A. A., Chubukov, P., Xu, F., Katritch, V.,
Medline
Han, G. W., Roth, C. B., Heitman, L. H., IJzerman, A. P., Cherezov, V., and
42. Steinmetz, P. R. (1974) Cellular mechanisms of urinary acidification.
Stevens, R. C. (2012) Structural basis for allosteric regulation of GPCRs by
Physiol. Rev. 54, 890 –956 CrossRef Medline
sodium ions. Science 337, 232–236 CrossRef Medline
43. Frazier, L. W., and Vanatta, J. C. (1971) Excretion of H⫹ and NH4⫹ by the
25. Harding, M. M. (2002) Metal-ligand geometry relevant to proteins and in urinary bladder of the acidotic toad and the effect of short-circuit current
proteins: sodium and potassium. Acta Crystallogr. D Biol. Crystallogr. 58, on the excretion. Biochim. Biophys. Acta 241, 20 –29 CrossRef Medline
872– 874 CrossRef Medline 44. Balinsky, J. B., and Baldwin, E. (1961) The mode of excretion of ammonia
26. Li, T., Yang, Y., and Canessa, C. M. (2010) Two residues in the extracel- and urea in Xenopus laevis. J. Exp. Biol. 38, 695–705
lular domain convert a nonfunctional ASIC1 into a proton-activated 45. McBean, R. L., and Goldstein, L. (1970) Renal function during osmotic
channel. Am. J. Physiol. Cell Physiol. 299, C66 –C73 CrossRef Medline stress in the aquatic toad Xenopus laevis. Am. J. Physiol. 219, 1115–1123
27. Li, T., Yang, Y., and Canessa, C. M. (2010) Leu85 in the ␤1–␤2 linker of CrossRef Medline
ASIC1 slows activation and decreases the apparent proton affinity by sta- 46. McClanahan, L., Jr. (1967) Adaptations of the spadefoot toad Scaphiopus
bilizing a closed conformation. J. Biol. Chem. 285, 22706 –22712 CrossRef couchi, to desert environments. Comp. Biochem. Physiol. 20, 73–99
Medline CrossRef
28. Collier, D. M., Peterson, Z. J., Blokhin, I. O., Benson, C. J., and Snyder, P. M. 47. Shoemaker, V. H. (1964) The effects of dehydration on electrolyte con-
(2012) Identification of extracellular domain residues required for epithe- centrations in a toad, Bufo marinus. Comp. Biochem. Physiol. 13, 261–271
lial Na⫹ channel activation by acidic pH. J. Biol. Chem. 287, 40907– 40914 CrossRef Medline
CrossRef Medline 48. Yang, J., Yan, R., Roy, A., Xu, D., Poisson, J., and Zhang, Y. (2015) The
29. Ji, H.-L., and Benos, D. J. (2004) Degenerin sites mediate proton activation I-TASSER Suite: protein structure and function prediction. Nat. Methods
of ␦␤␥-epithelial sodium channel. J. Biol. Chem. 279, 26939 –26947 12, 7– 8 CrossRef Medline
CrossRef Medline 49. Sievers, F., Wilm, A., Dineen, D., Gibson, T. J., Karplus, K., Li, W., Lopez,
30. Zhang, P., Fyfe, G. K., Grichtchenko, I. I., and Canessa, C. M. (1999) Inhi- R., McWilliam, H., Remmert, M., Söding, J., Thompson, J. D., and Higgins,
bition of ␣␤ epithelial sodium channels by external protons indicates that D. G. (2011) Fast, scalable generation of high-quality protein multiple
the second hydrophobic domain contains structural elements for closing sequence alignments using Clustal Omega. Mol. Syst. Biol. 7, 539 CrossRef
the pore. Biophys. J. 77, 3043–3051 CrossRef Medline Medline
31. Palmer, L. G., and Frindt, G. (1987) Effects of cell Ca2⫹ and pH on Na⫹ 50. Ianevski, A., He, L., Aittokallio, T., and Tang, J. (2017) SynergyFinder: a
channels from rat cortical collecting tubule. Am. J. Physiol. 253, web application for analyzing drug combination dose-response matrix
F333–F339 CrossRef Medline data. Bioinformatics 33, 2413–2415 CrossRef Medline
32. Chalfant, M. L., Denton, J. S., Berdiev, B. K., Ismailov, I. I., Benos, D. J., and 51. Corpet, F. (1988) Multiple sequence alignment with hierarchical cluster-
Stanton, B. A. (1999) Intracellular H⫹ regulates the ␣-subunit of ENaC, ing. Nucleic Acids Res. 16, 10881–10890 CrossRef Medline

12520 J. Biol. Chem. (2019) 294(33) 12507–12520