Journal Pre-proof

Effects of different dietary vitamin D combinations during the grower

phase and the feed restriction phase on growth performance and
sternal morphology, mineralization, and related genes expression of
bone metabolism in Pekin ducks

X.Y. Zhou , X.C. Chen , G.S. Fraley , K.Y. Zhang , G. Tian ,

S.P. Bai , X.M. Ding , J.P. Wang , L. Lv , Y. Xuan , Q.F. Zeng

PII: S0032-5791(23)00810-6
DOI: https://doi.org/10.1016/j.psj.2023.103291
Reference: PSJ 103291

To appear in: Poultry Science

Received date: 14 August 2023

Accepted date: 13 November 2023

Please cite this article as: X.Y. Zhou , X.C. Chen , G.S. Fraley , K.Y. Zhang , G. Tian , S.P. Bai ,
X.M. Ding , J.P. Wang , L. Lv , Y. Xuan , Q.F. Zeng , Effects of different dietary vitamin D combi-
nations during the grower phase and the feed restriction phase on growth performance and sternal
morphology, mineralization, and related genes expression of bone metabolism in Pekin ducks, Poultry
Science (2023), doi: https://doi.org/10.1016/j.psj.2023.103291

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition
of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of
record. This version will undergo additional copyediting, typesetting and review before it is published
in its final form, but we are providing this version to give early visibility of the article. Please note that,
during the production process, errors may be discovered which could affect the content, and all legal
disclaimers that apply to the journal pertain.

© 2023 Published by Elsevier Inc. on behalf of Poultry Science Association Inc.

This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/)
 RUNNING TITLE: VD COMBINATIONS ON STERNUM

Effects of different dietary vitamin D combinations during the grower phase and
the feed restriction phase on growth performance and sternal morphology,
mineralization, and related genes expression of bone metabolism in Pekin ducks

X.Y. Zhou*2, X.C.Chen†2, G.S. Fraley&, K. Y. Zhang* , G. Tian *, S. P. Bai* ,

X. M. Ding*, J. P. Wang*, L. Lv* , Y. Xuan* , and Q. F. Zeng*1

*
Institute of Animal Nutrition, Sichuan Agricultural University; and Key Laboratory for Animal

Disease-Resistance Nutrition of Ministry of Education, of Ministry of Agriculture and Rural

Affairs, and of Sichuan Province, Chengdu, Sichuan, 611130, China.

†
Institute of Animal Science,Chengdu Agricultural College, Chengdu, Sichuan, 611130, China.

&
Animal Science Department, Purdue University, West Lafayette, IN 47907, USA.

1
Corresponding author: zqf@sicau.edu.cn
2
These authors contributed equally to this work.
ABSTRACT Our study aimed to investigate the effects of different dietary
vitamin D (VD) combinations during the grower (1 to 32d of age) and feed restriction
(33 to 52d of age) phases on growth performance. We also evaluated sternal
morphology, mineralization, and related genes expression of bone metabolism as well
as absorption of calcium and phosphorous in duodenal mucosa and kidney in Pekin
ducks. During the grower phase, we used two VD regimes ( Group A: 3,160 IU/kg
VD3; Group B: 400 IU/kg VD3+69 μg/kg 25-OH-D3). Each dietary treatment had 50
replicate pens of 10 ducks per pen. During the feed restriction phase, 30 replicate pens
selected from Group A and Group B, repetitively, were re-divided into 5 different
dietary VD regimes to form a 2×5 experimental design. Each group consisted of six
replicates, each with ten ducks. During the feed restriction phase, we evaluated 5
different dietary VD combinations were as follows: T1: 2, 000IU/kg VD3 ; T2:
5,000IU/kg VD3; T3: 3,620 IU/kg VD3+34.5 μg/kg 25-OH-D3; T4: 2,240 IU/kg
VD3+69 μg/kg 25-OH-D3 ;T5: 1,800IU/kg VD3+80 μg/kg 25-OH-D3). Results
showed that Group B combinations with T5 had a better growth performance and
breast meat deposition (P < 0.1). Regardless of 5 dietary VD regimes during the feed
restriction phase, Group B significantly increased (P < 0.05 ) 52d sternal depth and
tended to increase (P < 0.1) 52d sternal defatted weight, ash content, and phosphate
(P) content of ducks. A significant interactive effect (P < 0.05) was observed on the
mRNA abundance of DMP1 and Sost1 as well as RANKL/OPG in sternum and of
VDR in duodenal mucosa of ducks at 52d of age between dietary VD combinations
during two phases. These results indicated that dietary VD regimes during the grower
phase could affect the effectiveness of dietary VD regimes during the feed restriction
phases; Dietary VD combinations of both phases could affect the genes expression of
bone formation and the absorption as well as re-absorption of calcium and phosphorus
in duodenum and kidney.

Keywords: Absorption of calcium and phosphorus; Bone formation; Ducks;

25-hydroxycholecalciferol; Sternal calcification

 INTRODUCTION

Modern Pekin ducks are the fastest growing birds among all poultry species
(Bentley et al.,2019) and are required to reach market weight (3.2 kg) in under 5
weeks (wk) (Best et al., 2017). The differences in consumption habits among people
in different regions have led to the diversification of meat duck farming. For example,
recently in the southwest China, a feed restriction milieu in Pekin ducks between 32
to 49 or to 52d of age have been established. A focus of this feed restriction milieu
over the last several years has been to control body weight (BW) to 2.0 to 2.5 kg, to
improve sternal mineralization or calcification, to reduce fat content, and to improve
the body shape of the whole duck; among these, sternal mineralization or calcification
is the most key indicator to determine the quality of duck’s carcass (Wang et al., 2021;
Xi et al., 2023). A previous study in our lab (Zhang et al., 2017) found that the
sternum of ducks rapidly mineralized from 42 d to 49 d of age and achieved a plateau
phase after 49 days; We further established that the key indicators of sternal
calcification in ducks were defatted weight of sternum, and the sternal content of ash,
calcium (Ca) and phosphate (P) (Zhang et al., 2017).
It is known that bone development and calcification, mainly Ca and P, is
deposited inside or outside osteoblasts in the form of hydroxyapatite and is influenced
by various vitamins (Cashman, 2007). Vitamin D is essential for normal
mineralization of bone via enhancing intestinal calcium and phosphate absorption and
maintaining these ions within a range that facilitates hydroxyapatite deposition in
bone matrix (Goltzman, 2018). Studies have shown that VD3 supplementation can
treat poor fracture healing in osteoporosis patients (Fischer et al., 2018) and that
25-OH-D3, as intermediate metabolite of VD3, has a higher biological potency (Elliot
and Edwards, 1997). In a previous study (Zhang et al., 2020a), we demonstrated that
400 IU/kg VD3 combined with 69 μg/kg 25-OH-D3 improved the sternal calcification
of ducks aged from 1 to 49 d of age with free access to feed. Garcia et al. (2013)
found that supplementation of 70 μg/kg 25-OH-D3 in the 3,000 IU/kg VD3 diet can
also promote bone growth and development of ducks when fed between 1-35d. Sun et
al. (2013) also found that increasing supplemental vitamin D3 has a favorable effect
on walking ability and welfare status of high stocking density broilers. Little is known,
however, if increasing of 25-OH-D3 supplementation in different dietary VD3 dosages
can improve sternal development and calcification of ducks under a feed restriction
condition.
It is well established that, feed restriction decreases the growth performance and
muscle or fat deposition by limiting the nutrients intake (Blois et al., 2019). To
maintain sufficient VD intake during feed restriction, we designed different VD3 and
25-OH-D3 regimes according to the maximum limit of 5,000 IU of VD/kg specified in
the Chinese feed hygiene standards. With the change of production goal in modern
duck industry, the dietary vitamin regimen should be highlighted. Thus, the objective
of our current study was to investigate the effects of two dietary VD regimes during
the growth phase (d 1-32) combined with five dietary VD regimes during the feed
restriction phase (d 33-52) on growth performance, sternum morphology and
calcification, as well as gene expression related to Ca and P absorption in intestine,
re-absorption in kidney, and of bone metabolism in Pekin ducks.

MATERIALS AND METHODS

Our study included two phases and each phase had its own experimental design.
The experiment was carried out in accordance with the guidelines of the Experimental
Animal Committee of Sichuan Agricultural University (SAUPNZ-21-07Z).
Animals, Diets and Experimental Design
Phase One was the grower phase ( d 1 to 32). During this phase, a total of 1,000
one-d-old male Pekin ducks were obtained from a commercial hatchery (Mianying
duck breeding farm, Sichuan Province, P. R. China), and were randomly divided into
two experimental groups as follows: one diet supplemented with VD3 of 3,160 IU/kg
(Group A); the second diet supplemented with 69 μg/kg 25-OH-D3 (equivalent to
2,760 IU/kg VD3) combined with 400 IU/kg VD3 (Group B). Each dietary treatment
had 50 replicate pens of 10 ducks per pen. All ducks had free access to feed and water.
 Phase Two was the feed restriction phase (d 33 to 52). During this phase, we
selected 30 of the 50 pens from Group A and Group B based on the average weight,
respectively. Each 30 replicate pens in Group A and Group B were re-divided into 5
different dietary VD regimes, respectively. The 5 different dietary VD regimes were
as followed: T1: 2,000 IU/kg VD3 ; T2: 5,000 IU/kg VD3; T3: 3,620 IU/kg VD3 + 34.5
μg/kg 25-OH-D3; T4: 2,240 IU/kg VD3 + 69 μg/kg 25-OH-D3; T5: 1,800 IU/kg VD3 +
80 μg/kg 25-OH-D3). There were a total 10 dietary treatments in 2×5 factorial
completely randomized design (6 replicate pens/treatment; 10 ducks/pen, a total of
600 ducks). For feed restriction, each duck was only fed 250g of the corresponding
experimental diet per 2 days, that is, each pen (10 ducks) was only fed 2,500g of the
corresponding experimental diet per 2 days. The detailed experimental design is
illustrated in Table 1.
Ducks were reared in a temperature- and humidity-controlled room with free
access to water. During phase 1, two basal diets ( d 1 to 14; d 15 to 32) were
formulated to meet the ducks’ nutrients requirement. During phase 2, the corn-wheat
bran-corn germ meal-soya bean diet was formulated to control the BW of Pekin ducks
(Table 2). The 25-OH-D3 (ROVIMIX of DSM) used in this experiment was provided
by DSM Ltd (Shanghai, China) and its specification is 0.025% and the pure VD3 was
provided by Tieqi Lishi Industry Co. Ltd (Sichuan, China).
Sample Collection
Body weight gain (BWG), feed intake (FI), feed to gain ratio (F/G) were
calculated accordingly at the following intervals: 1 to 32d and 33 to 52d. On d 32 and
d 52, six male ducks with wight closest to the pen average (n=6) were randomly
selected and were euthanized by cervical dislocation. Parts of sternum, duodenal
mucosa, and kidney were collected and samples for mRNA analyses immediately
flash-frozen in liquid N2.
Sternum Morphology and Calcification Analysis
Sternum morphological parameters (e.g. sternal length, depth, coracoid distance,
central distance, and posterior process distance) were determined according to our
previous study (Zhang et al., 2017). After obtaining morphometric data, the sternum
was defatted by soaked in petroleum ether first. The dried-defatted sternum was then
ashed in a muffle furnace at 550 ℃ for 24 h, and the ash content was measured on the
basis of the percentage of the dry-defatted weight. The Ca and P contents were
determined on the basis of the percentage of ash weight and analyzed using a calcium
detection kit and ammonium metavanadate colorimetric assay, using a Gemini XPS
Microplate Reader (Molecular Devices, LLC., Sunnyvale, CA, USA) at 405 nm. The
kits were obtained from Nanjing Jiancheng Bioengineering Institute (Nanjing, Jiangsu,
China).
Gene Expression Assays
Samples previously stored at -80 ℃ were prepped for the RNA isolation and
real-time polymerase chain reaction (qRT-PCR) was performed as previously
described by our Laboratory based upon Qin et al. (2018). Briefly, total RNA isolation
from the sternal, duodenal mucosa, and kidney by using a TRIZOL reagent
(Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. RNA
quality (intact ribosomal RNA 28 s/18 s) was evaluated by agarose gel electrophoresis.
The cDNA was synthesized from 200 ng of total RNA by a PrimeScript RT Reagent
Kit (Takara, Kusatsu). RT-PCR was performed on ABI 7500 RT-PCR detection
system (Applied Bio-systems), using Fast SYBR Green Master Mix (Thermo Fisher
Scientific) and the melting curve analysis was performed at the end. The primers were
designed using Primer 3 and shown in Table 3. The mRNA expression of phosphate
regulating endopeptidase homolog x-linked (Phex), dentin matrix protein 1 (DMP1),
Sclerostin (Sost), vacuolar-type H1-ATPase (V-ATPase), osteo-protegerin (OPG),
receptor activator of nuclear factor-k B (RANKL), alkaline phosphatase (ALP) in
sternum, as well as type IIa sodium-dependent phosphate cotransporter (NaPi-IIa),
type IIb sodium-dependent phosphate cotransporter (NaPi-IIb), calbindin-D28k
(CaBP-28K), and vitamin D receptor (VDR) in Duodenal mucosa and kidney were
evaluated. β-actin were selected as the reference genes and relative quantities of
mRNA were calculated using the 2–ΔΔCt method reference to Livak et al. (2001).
Statistical Analyses
Data from Phase 1 (d 1 to 32) were analyzed by independent-samples T test.
Data from Phase 2 (d 33 to 52) were analyzed by two-way ANOVA using the
Glimmix procedure of SAS 9.4 (SAS Institute). Data in phase 2 are presented as
means and their standard errors of the mean (SEM). Probability values ≤ 0.05 (P ≤
0.05) were considered significant and 0.05 < P <0.1 reflects a statistical tendency.

RESULTS

Growth Performance and Pectoral Muscle Deposition

During Phase 1, diet supplemented equivalent 25-OH-D3 to replace VD3 (Group
B) only had a tendency to decrease F: G (P < 0.1; Table 4).
No significant interactive effects (P > 0.05) on the growth performance or
pectoral muscle deposition were observed between VD combinations of both phases.
However, as main effect, diet supplemented equivalent 25-OH-D3 to replace VD3
during the Phase 1 had a tendency (P < 0.1) to increase 52d BW and significantly
increased (P < 0.05) the pectoral muscle weight; Five different VD regimes during
the phase 2 had a marked effect (P < 0.05) on 52d BW; T3 (VD3 3,620 IU/kg +
25-OH-D3 34.5μg/kg) and T5 (VD31,800 IU/kg + 80 μg/kg 25-OH-D3) had a higher
52 BW compared to regimes of T1,T2, or T4. These data are represented in Table 5.
Sternal Morphological Parameters and Calcification Quality
During phase 1, diet supplemented with 25-OH-D3 to replace VD3 (Group B)
had a tendency to increase sternal depth (P < 0.1) and significantly increased (P <
0.05 ) sternal Ca content of ducks at 32d of age (Table 6) .
No significant interactive effects (P > 0.05) on sternal morphological parameters
or calcification quality were observed between VD combinations of both phases.
However, as main effect, diet supplemented equivalent 25-OH-D3 to replace VD3
during the phase 1 significantly increased (P < 0.05 ) 52d sternal depth and tended to
increase (P < 0.1) 52d sternal defatted weight, ash content, and P content of ducks.
When compared with T2 and T3 regimes, T1 (VD3 2,000IU/kg) and T5 (VD3 1,800
IU/kg + 80 μg/kg 25-OH-D3) significantly increased (P < 0.05 ) fresh weight of
sternum from ducks at 52 d of age. These data are represented in Table 7.
Gene Expression of Sternum, Duodenal Mucosa, and Kidney
 During Phase 1, diet supplemented with 25-OH-D3 to replace VD3 (Group B)
significantly up-regulated (P < 0.05 ) relative mRNA abundance of VDR and
CaBP-28K in duodenal mucosa, NaPi-IIb in kedney in ducks at 32d of age (Table 8).
There were significant interactive effects (P < 0.05) on the mRNA abundance of
DMP1 and Sost1 as well as RANKL/OPG in sternum and of VDR in duodenal mucosa
of ducks at 52d of age between VD combinations of both phases. When Phase 1 diet
only contained VD3, we observed an increase of 25-OH-D3 supplementation (T5)
significantly up-regulated (P < 0.05) the mRNA abundance of DMP1 and Sost1 in
sternum and VDR in duodenal mucosa of ducks at 52d of age (Phase 2). When diet
supplemented with 25-OH-D3 to replace VD3 during phase 1, T1 (VD3 2,000IU/kg)
significantly down-regulated (P < 0.05) the mRNA abundance of DMP1 and Sost1 in
sternum and VDR in duodenal mucosa of ducks at 52d of age (Phase 2) , but these
same genes were increased (P < 0.05) in T4 (VD3 2,240 IU/kg + 69 μg/kg 25-OH-D3)
-fed ducks. These data are represented in Table 9.
Moreover, as main effect, diet supplemented with 25-OH-D3 to replace VD3
during Phase 1 significantly increased (P < 0.05 ) the mRNA abundance of DMP1 in
sternum, NaPi-IIa in duodenal mucosa, and VDR in kidney, but decreased (P < 0.05 )
RANKL/OPG in sternum; Increasing of 25-OH-D3 supplementation during Phase 2
had a markedly up-regulated (P < 0.05) on the mRNA abundance of ALP, DMP1, and
Sost in sternum as well as NaPi-IIa, NaPi-IIb, CaBP-28K, and VDR in duodenal
mucosa and NaPi-IIa, NaPi-IIb, and VDR in kidney of ducks at 52d of age.

DISCUSSION

In the current study, we designed different dietary VD regimes during Phase 1 and
Phase 2 in accordance with our previous study of Zhang et al.(2020a) and the
maximum limit of 5,000 IU of VD/kg specified in the Chinese feed hygiene standards,
respectively. Our data showed that diet supplemented equivalent 25-OH-D3 to replace
VD3 during phase 1 could improve the growth performance and breast meat
deposition of ducks (d 1 to 52). Further, we demonstrated that ducks fed T5
(1,800IU/kg VD3+80 μg/kg 25-OH-D3, a total of 5,000 IU/kg active VD) presented
better growth performance and breast meat deposition during Phase 2. Our results
agree with many other studies that also showed that by increasing vitamin D3 levels or
by adding the metabolite 25-OH-D3 to broiler diets, growth performance can be
improved (Gómez et al., 2013). Vazquez et al. (2016) showed that broilers fed diets
supplemented with 5,000 IU of VD3/ kg + 69 μg of 25-OH-D3/kg had a significant
increase in growth performance. Zhang et al. (2020a) showed that diets supplemented
69 μg/kg 25-OH-D3 (NRC(1994) or NY/T(2012) recommended VD levels) had a
positive effect on the performance of ducks. The positive effects of supplementing
25-OH-D3 was also reflected by an increased BW gain and feed conversion ratio
(Santiago et al., 2016). Vignale et al. (2015) and Avila et al. (2022) both showed that
increased dietary 25-OH-D3 in broilers significantly increased breast meat yield
compared to the control group; the pectoralis muscle is an important carcass trait for
weight gain (Lawrence and Fowler, 2002). Therefore, the improved growth
performance and breast meat yield in our study suggests that diet supplementation of
VD3 400 IU/kg+ 69 μg/kg 25-OH-D3 (VD 3160 IU/kg) during the growth phase or
supplementation of VD3 1,800IU/kg +80 μg/kg 25-OH-D3 (VD 5,000 IU/kg ) during
the feed restriction phase could be recommended.
Sternal morphological parameters and calcification quality are important growth
indicators. We found that diet supplemented equivalent 25-OH-D3 to replace VD3
during the grower phase could be related to sternal depth and Ca content of ducks at
32d of age. We also showed that during the feed restriction phase (Phase 2), five VD
regimes had apparent effects on sternal depth and fresh sternal weight. Early studies
found that dietary supplementation of 69 μg/kg 25-OH-D3 combined with 400IU/kg
VD3 improved bone mineral content of meat ducks (Ren et al., 2016; Zhang et al.,
2020a, 2020b). Based on the genes expression related to bone turnover, our results
demonstrated that there was a significant interactive effect among VD combinations
during the two phases. These observations suggest that supplementation of different
VD forms during the grower phase could affect the effectiveness of different VD
combinations during the feed restriction phase. Meanwhile, combinations of AT5 or
BT4 presented a higher mRNA abundance of several markers of bone formation, such
as ALP, DMP1, and Sost at d 52 (Turner et al., 2014; Lind et al., 2013). Osteoblasts
are responsible for the synthesis, secretion, and mineralization of bone matrix. They
increase bone mass by inducing bone calcification (Terkeltaub, 2001). Our findings
combined with previous observations from others suggest that VD combinations
directly regulate bone remodeling by directly targeting specific bone cell types
including osteoblasts (Nakamichi et al., 2017).
Dietary VD increases bone mass in part by stimulating the intestinal absorption
of Ca and P (Christakos et al., 2016). Studies have confirmed that 25-OH-D3 is an
active metabolite of vitamin D3 that plays a significant role in calcium absorption in
the intestine, in the utilization of calcium utilization for bone growth, and in calcium
fixation (Applegate, et al., 2003; Ledwaba et al., 2003).VD binds with the VD
receptor in intestine and kidney to promote calcium and phosphorus absorption, and
re-absorption, respectively, and maintains calcium and phosphorus homeostasis (Van
Abel, et al., 2003). NaPi-IIb and NaPi-IIa are inorganic phosphorus transporters
found in small intestine and kidney of poultry. NaPi-IIa has an important function for
P re-absorption in kidney. Similarly, in the current study, diets supplemented
equivalent 25-OH-D3 to replace VD3 during the grower phase or increasing of
supplemented with 25-OH-D3 in the restricted diets both could effectively improve the
calcium and phosphorus absorption in intestine, or re-absorption in kidney of ducks.
These observations are in line with the changes we report in gene expression during
bone formation in sternum, although there was no significant impact on bone
morphology. The reason may be that development of sternal morphology and
calcification was close to completion by day 52. Therefore, more concern should be
given to investigate the effect of dietary different VD combinations on the dynamics
of the sternal development.

CONCLUSIONS

In conclusion, dietary supplementation of 400 IU/kg VD3 + 69 μg/kg 25-OH-D3 (VD

3160 IU/kg) during the grower phase combined with dietary supplementation of
1,800IU/kg VD3 +80 μg/kg 25-OH-D3 ( VD 5,000 IU/kg ) during the feed restriction
phase could improve the growth performance, breast meat deposition, and sternal
development and calcification as well as body calcium homeostasis.

ACKNOWLEDGMENTS

Our research was supported by grants from International Science and Technology
Innovation Cooperation in Sichuan Province (2022YFH0034), the 111 project of
Foreign Experts Affairs (D17015), Sichuan Agricultural University 211 Foundation of
China, and DSM Ltd, Shanghai, China.

REFERENCES

Applegate, T. J., R. Angel, H. L. and Classen. 2003. Effect of dietary calcium,

25-hydroxycholecalciferol, or bird strain on small intestinal phytase activity in
broiler chickens. Poult. Sci. 82: 1140–1148.
Avila, L. P., S. F. Leiva, G.A. Abascal-Ponciano, J. J. Flees, K. M. Sweeney, J. L.
Wilson, K. J. Meloche, B. J.Turner, G. Litta , A.M. Waguespack-Levy, A.
Pokoo-Aikins, C.W. Starkey, and J. D.Starkey. 2022. Effect of combined maternal
and post-hatch dietary 25-hydroxycholecalciferol supplementation on broiler
chicken Pectoralis major muscle growth characteristics and satellite cell mitotic
activity. J. Anim. Sci. 100:192.
Bentley, A., L. Porter, L. Van Blois, B. Van Wyk, C. N. Vuong, G. Tellez-Isaias, D.
Shafer, Z. Tucker, S. M. Fraley, B. M. Hargis, and G. S. Fraley. 2019. A feed
restriction milieu for Pekin meat ducks that may improve gait characteristics but
also affects gut leakiness. Poult. Sci. 0:1–9
Blios,V., B. A. Bentley, L. Porter, N. Prihoda, H. Potter, B. Van Wyk, D. Shafer, S.M.
Fraley, and G.S. Fraley. 2019. Feed restriction can alter gait but does not reduce
welfare in meat ducks. J. Appl. Poult. Res. 28:858–866
Best, A. A., A. L. Porter, S. M. Fraley, and G. S. Fraley. 2017. Characterization of gut
microbiome dynamics in developing pekin ducks and impact of management
system. Front. Microbiol. 7:2125.
Cashman, K. D. 2007. Diet, nutrition, and bone health. J. Nutr. 137: 2507S-2512S.
Christakos, S., P. Dhawan, A.Verstuyf, L.Verlinden, and G.Carmeliet. 2016. Vitamin
D: metabolism, molecular mechanism of action, and pleiotropic effects. Physiol.
Rev. 96:365-408.
Elliot, M. A., and H. M. Edwards. 1997. Effect of 1,25-dihydroxycholecalciferol,
cholecalciferol, and fluorescent lights on the development of tibial
dyschondroplasia and rickets in broiler chickens. Poult Sci. 76:570-580.
Fischer, V., M. Haffner-Luntzer, M. Amling, and A. Ignatius. 2018. Calcium and
vitamin D in bone fracture healing and post-traumatic bone turnover. Eur. Cell
Mater. 35:365-385.
Garcia, A.F., A.E.Murakami, C. R. Duarte, I.C. Rojas, K. P. Picoli, and M. M. Puzotti.
2013. Use of vitamin D3 and its metabolites in broiler chicken feed on performance,
bone parameters and meat quality. Asian-Australas J. Anim. Sci.26:408-15.
Goltzman, D. 2018. Functions of vitamin D in bone. Histochem. Cell Biol.
149:305-312.
Gómez, V. G., L. R. Morales, and G. E. Avila. 2013. Use of 25-
hydroxycholecalciferol in diets of broiler chickens: effects on growth performance,
immunity and bone calcification. J. Poult. Sci. 50: 60–64.
Lawrence, T. L. J., and V. R. Fowler. 2002. Growth of farm animals. 2nd ed. CAB
Int.Cromwell Press, Trowbridge, New York.
Ledwaba, M. F., and K. D. Roberson. 2003. Effectiveness of twenty-five
hydroxycholecalciferol in the prevention of tibial dyschondroplasia in Ross
cockerels depends on dietary calcium level. Poult. Sci. 82:1769–1777.
Lind, T., A. Sundqvist, L. Hu, G. Pejler, G. Andersson, A. Jacobson, and H.Melhus.
2013.Vitamin a is a negative regulator of osteoblast mineralization. PLoS One.
8:e82388.
Livak, K.J., and T. D.Schmittgen. 2001. Analysis of relative gene expression data
using real-time quantitative PCR and the 2(-Delta Delta C (T)) method. Methods.
25:402-408
Nakamichi, Y., N. Udagawa, K. Horibe, T. Mizoguchi, Y. Yamamoto, T. Nakamura, A.
Hosoya, S. Kato, T. Suda, and N.Takahashi. 2017. VDR in osteoblast-lineage cells
 primarily mediates vitamin D treatment-induced increase in bone mass by
suppressing bone resorption. J. Bone Miner. Res. 32: 1297-1308.
Pollock, S. Dridi, and C. N. Coon. 2015. 25-Hydroxycholecalciferol enhances male
broiler breast meat yield through the mTOR pathway. J Nutr.145:855-863.
Qin, S., H. Han, K. Zhang, X. Ding, S. Bai, J. Wang, and Q. Zeng. 2018.Dietary fibre
alleviates hepatic fat deposition via inhibiting lipogenic gene expression in meat
ducks. J. Anim. Physiol. Anim. Nutr. 102:e736-74.
Ren, Z. Z., J. P. Wang, Q. F. Zeng, X. M. Ding, S. P. Bai, Y. H. Luo, Z. W. Su, Y. Xuan,
and K. Y. Zhang. 2016. The effects of maternal dietary vitamin premixes,
canthaxanthin, and 25-hydroxycholecalciferol on the performance of progeny
ducklings. Poult. Sci. 95:630-635.
Santiago, M., S. David, N. Alexandra, A. Eduardo, and Q.G. Jimmy. 2016. Effect of
25- hydroxycholecalciferol (25-OH-D3) on productive performance and bone
mineralization in broiler. J. Anim. Sci. 6: 180-184.
Sun, Z. W., L. Yan, J. P. Zhao, H. Lin, and Y. M. Guo. 2019. Increasing dietary
vitamin D3 improves the walking ability and welfare status of broiler chickens
reared at high stocking densities. Poult. Sci. 92: 3071–3079
Terkeltaub,R.A. 2001. Inorganic pyrophosphate generation and disposition in
pathophysiology. Am. J. Physiol. Cell Physiol. 81:C1-C11
Turner, A.G., M.A.Hanrath, H. A.Morris, G. J. Atkins, and P. H. Anderson. 2014.The
local production of 1,25(OH)2D3 promotes osteoblast and osteocyte maturation. J.
Steroid Biochem. Mol. Biol. 144 Pt A:114-118.
Van Abel, M., J.G. Hoenderop, A.W. van der Kemp, J. P. van Leeuwen, and R.J.
Bindels. 2003. Regulation of the epithelial Ca2+ channels in small intestine as
studied by quantitative mRNA detection. Am. J. Physiol. Gastrointest. Liver
Physiol. 285: G78-85.
Vazquez, J. R., G. V. Gómez, C. C. López, A. C. Cortés, A. C. Díaz, S. R. T.
Fernández, E. M. Rosales, and A. G. Avila. 2017. Effects of
25-hydroxycholecalciferol with two D3 vitamin levels on production and immunity
parameters in broiler chickens. J. Anim. Physiol. Anim. Nutr. 1–5.
Vignale, K., E. S. Greene, J.V. Caldas, J. A.England, N. Boonsinchai, P. Sodsee, E. D.
Turner, A.G., M.A.Hanrath, H.A.Morris, G. J.Atkins, and P. H. Anderson. 2014.
The local production of 1,25(OH)2D3 promotes osteoblast and osteocyte
maturation. J. Steroid Biochem. Mol. Biol. 144 :114-118.
Wang, Y., K. Wu, X. Gan, Q. Ouyang, Q. Wu, H. Liu, S. Hu, C. Han, R. Zhang, J. Hu,
J. Wang, and L. Li. 2021. The pattern of duck sternal ossification and the changes
of histological structure and gene expression therein. Poult. Sci. 100:101112.
Xi, Y., L. Wang, J. Qi, B. Wei, X. Han, Y. Lu, S. Hu, H. He, C. Han, Y. Zhu, J. Hu, H.
Liu, J. Wang, and L. Li. 2023. Comprehensive transcriptomic and metabolomic
analysis of the effect of feed restriction on duck sternal development. Poult. Sci.
102:102961.
Zhang, H.Y., H. Liao, Q. F. Zeng, J.P.Wang, X. M.Ding, S. P. Bai, and K.Y. Zhang .
2017. A study on the sternum growth and mineralization kinetic of meat duck from
35 to 63 days of age. Poult. Sci. 96: 4103-4115.
Zhang, H.Y., Q. F. Zeng, S. P. Bai, J. P. Wang, X. M.Ding, Y. Xuan, Z.W. Su, G. S.
Fraley, B. Yao, and K.Y. Zhang. 2020a. Effect of dietary 25-hydroxycholecalciferol
on the sternal mass of meat ducks under different vitamin regimens. Poult. Sci.
299:1241-1253.
Zhang, H.Y., Q. F. Zeng, S. P. Bai, J. P. Wang, X. M.Ding, Y. Xuan, Z.W. Su, G. S.
Fraley, B. Yao, and K.Y. Zhang. 2020b. Dietary supplementation of
25-hydroxycholecalciferol increases tibial mass by suppression bone resorption in
meat ducks. Anim. Nutr. 6:467-479.
 Table 1. Detailed experimental design1
During the grower phase During the feed restriction phase
(Phase 1, 1-32d) (Phase 2, 33-52d)
Treatments 2 kinds of dietary Treatments
5 kinds of dietary VD regimes
VD regimes (n=6)
T1 VD3 2,000 IU/kg
T2 VD3 5,000 IU/kg
A (n=50) VD3 3,160 IU/kg T3 VD3 3,620 IU/kg+25-OH-D3 34.5 μg/kg（5 000 IU/kg）
T4 VD3 2,240 IU/kg+25-OH-D3 69 μg/kg（5 000 IU/kg）
T5 VD3 1,800 IU/kg+25-OH-D3 80 μg/kg（5 000 IU/kg）
T1 VD3 2,000 IU/kg
VD3 400IU/kg +
T2 VD3 5,000 IU/kg
25-OH-D3 69
B(n=50) T3 VD3 3,620 IU/kg+25-OH-D3 34.5 μg/kg（5 000 IU/kg）
μg/kg
T4 VD3 2,240 IU/kg+25-OH-D3 69 μg/kg（5 000 IU/kg）
（3,160 IU/kg）
T5 VD3 1,800 IU/kg+25-OH-D3 80 μg/kg（5 000 IU/kg）
1
different dietary VD combinations were AT1, AT2,AT3, AT4, and AT5 as well as BT1, BT2, BT3,
BT4, and BT5; 1μg of 25-OH-D3 is equivalent to 40 IU of VD3.
Table 2. Composition and nutrient levels of the experimental diet (as-fed basis).
Ingredient,% 1-14d 15-32d 33-52d
Corn 54.00 54.00 47.40
Wheat bran 6.00 14.40 14.04
Soybean oil 2.32 4.26 1.74
Corn germ meal - - 12.00
Soybean meal 32.00 22.50 11.57
L-Lysine hydrochloride 0.17 0.14 -
L-Threonine 0.05 0.08 -
DL-Methionine 0.20 0.19 0.08
Limestone 0.95 1.18 0.98
CaHPO4 1.60 1.52 1.34
Sodium chloride 0.35 0.35 0.35
Choline chloride 0.10 0.15 0.15
Vitamin premix1 0.10 0.10 0.10
Mineral premix2 0.50 0.50 0.50
Calculated nutrient levels, %
Metabolizable energy (ME), Kcal/kg 2,800 2,850 2,455
Crude protein 19.52 16.51 13.36
Digestible lysine 1.15 0.92 0.59
Digestible methionine 0.48 0.43 0.27
Calcium 0.80 0.85 0.71
Non-phytate phosphorus 0.41 0.40 0.35
1
The vitamin premix provided the following (per kg of diet): Vitamin A, 4000 IU; Vitamin E, 20 IU; Vitamin K3, 2

mg; Vitamin B1 0.2mg; Vitamin B2, 10 mg; Vitamin B6, 4 mg; Vitamin B12, 0.02 mg; Calcium pantothenate,

11mg; Folic acid, 11 mg; biotin, 50mg; Nicotinic acid, 50 mg. The experimental diets VD3 and 25-OH-D3

adjusted the formula of vitamin premix according to the experimental design and product specifications.
2
The trace mineral premix provided the following (per kg of diet): Cu (CuSO4∙5H2O),10 mg; Fe (FeSO4∙7H2O),

80 mg; Zn (ZnSO4∙7H2O),60 mg; Mn (MnSO4∙H2O), 100 mg; Se (NaSeO3), 0.3 mg; I (KI), 0.45 mg.
Table 3. The primers for quantitative real-time PCR1.
Gene Gene ID Primer Sequence (50-30) Size(bp)
Reverse ccagccatctttcttgggta 105
β-actin NM_001310408.1
Forward gtgttggcgtacaggtcctt
Reverse tgccaactatctggtgtgga 99
Phex XM_005010837.3
Forward ccgtagatcacccgagaaaa
Reverse aaccttggtcaccttcatgc 92
Dmp1 XM_005012780.3
Forward tcggcaaagtcctgctctat
Reverse ggaagggtggcaagtgttta 115
Sost XM_005026106.3
Forward tgcctggttcattgtgttgt
Reverse tccgtgtctggttcatcaaa 111
V-ATPase XM_021267166.1
Forward caggacaccagacttcagca
Reverse gcctaactggctgaacttgc 106
OPG XM_005017709.3
Forward gaaggtctgctcttgcgaac
Reverse gccttttgcccatctcatta 100
RANKL XM_021276016.1
Forward taagtttgcctggcctttgt
Reverse ggcatctctccatccgagta 115
ALP XM_005031069.3
Forward aggatgaaggcaaggcagt
Reverse aagtcatcgacaccctcctg 106
VDR NM_205098.1
Forward atcctgctgctgaatttgct
Reverse tcatccatcatcgtcagcat 81
NaPi-IIb NM_204474.2
Forward aatgtttgcccccataatga
Reverse cctcatcctcctggtcaaaa 88
NaPi-IIa XM_015293844.2
Forward tgggaggtctagtgttgatga
Reverse acctgagcaagctcaacgat 97
CaBP-28K NM_205513.1
Forward aggcaggcttggacttaaca
1
Abbreviations: Phex, phosphate regulating endopeptidase homolog x-linked; Dmp1, dentin matrix protein1; Sost,
Sclerostin; V-ATPase, Vacuolar-type H1-ATPase; OPG, osteo-protegerin; RANKL, receptor activator of nuclear

factor-kB; ALP, alkaline phosphatase; VDR, Vitamin D receptor; NaPi-IIb, type Iib Sodium-Dependent Phosphate

Cotransporter; NaPi-IIa, type Iia Sodium-Dependent Phosphate Cotransporter; CaBP-28K, calbindin-D28k.

Table4. Effect of dietary 2 kinds VD regimes on growth performance of ducks during the growth
phase ( d 1 to 32)1.
Group A2 Group B
Items P-value
(VD3) (VD3+25-OH-D3)
1 d BW3 (g) 52.75±0.18 52.59±0.19 0.855
32 d BW (g) 1910±11.73 1918±11.22 0.454
1-32 d BWG (g) 1857±11.62 1866±11.18 0.449
1-32 d FI (g) 4263±18.35 4244±20.58 0.576
1-32 d F:G 2.30±0.01 2.28±0.01 0.087
32d Pectoral muscle weight4 (g) 127.0±7.40 148.8±14.6 0.242
32d Pectoral muscle rate4 (%) 6.77±0.35 7.04±0.62 0.713
1
Values are the means of 50 pens per treatment of 10 ducks per pen (n=50).
2
Group A, 3160 IU/kgVD3 was added in the diet; Group B, 69 μg/kg 25-OH-D3 combined with 400 IU/kg VD3

was added in the diet.

3
BW, body weight; BWG, body weight gain; FI, food intake; F: G, feed to gain ratio.
4
Values are the means of 6ducks per treatment (n=6).
Table 5. Effect of dietary VD combinations on growth performance of ducks during the feed
restriction phase (d 33 to 52) 1 .
52d Pectoral 52d Pectoral
2 2 3
X Y 52 d BW(g) 33-52d BWG (g) 33-52 d F:G muscle muscle rate
weight (g) (%)
A T1 2148 223.4 11.53 258.7 12.39
A T2 2179 267.9 9.96 227.6 10.97
A T3 2216 290.0 8.75 279.1 12.57
A T4 2173 255.5 10.18 225.3 10.93
A T5 2187 263.6 9.62 282.6 12.35
B T1 2195 270.4 9.72 289.3 12.62
B T2 2175 246.3 10.58 295.5 13.63
B T3 2192 262.9 9.84 297.0 13.50
B T4 2193 263.9 9.72 266.8 11.77
B T5 2289 366.4 7.14 331.7 13.37
SEM 24.59 24.51 0.91 24.95 0.827
X
A 2181 260.1 10.01 254.7 11.84
B 2209 282.0 9.40 296.1 12.98
SEM 11.01 10.97 0.41 11.163 0.370
Y
T1 2172b 246.9 10.62 274.0 12.51
T2 2177b 257.1 10.27 261.6 12.30
T3 2204a 276.4 9.29 288.1 13.04
T4 2183b 259.7 9.95 246.0 11.35
T5 2238a 315.0 8.38 307.2 12.86
SEM 17.42 17.36 0.64 17.65 0.585
P-Value
X 0.081 0.165 0.297 0.012 0.035
Y 0.050 0.052 0.109 0.142 0.281
X×Y 0.106 0.055 0.240 0.889 0.679
1
Values are the means of 6 pens per treatment of 10 ducks per pen (n=6).
2
X: Two VD regimes in the grower phase from 1 to 32 days : Group A, 3,160 IU/kgVD3 in the diet; Group B, 69

μg/kg 25-OH-D3 combined with 400 IU/kg VD3 in the diet. Y: Five VD combinations in the feed restriction phase

from 33 to 52 d: VD3 2,000 IU/kg (T1); VD3 5,000 IU/kg (T2); VD3 3,620 IU/kg + 25-OH-D3 34.5 μg/kg (T3);

VD3 2,240 IU/kg + 25-OH-D3 69 μg/kg (T4); VD3 1,800 IU/kg+ 25-OH-D3 80 μg/kg (T5). The same as below

tables.
3
BW, body weight; BWG, body weight gain; F: G, feed to gain ratio.
Table 6. Effects of dietary 2 kinds VD regimes on the sternal morphological parameters and
calcification of 32-day-old ducks1.
Group A2 Group B2
Items P-value
(VD3) (VD3+25-OH-D3)
32d sternal morphological parameters
Length, mm 95.91±2.129 94.55±2.680 0.371
Depth, mm 20.00±3.926 25.52±5.217 0.065
Coracoid distance, mm 45.46±3.569 45.01±2.641 0.810
Central distance, mm 42.22±6.174 43.97±5.171 0.607
Posterior process distance, mm 28.30±1.644 26.89±3.356 0.378
32d sternal calcificated quality
Fresh weight, g 13.73±2.247 14.77±1.442 0.366
Defatted weight (g) 2.697±0.420 2.890±0.345 0.404
Ash content (%) 7.895±1.101 7.883±0.593 0.982
Calcium content (%) 0.548±0.244 1.551±0.918 0.043
Phosphorus content (%) 0.365±0.178 0.372±0.088 0.936
1
Values are the means of of 6ducks per treatment (n=6).
2
Group A, 3,160 IU/kgVD3 in the diet; Group B, 69 μg/kg 25-OH-D3 combined with 400 IU/kg VD3 in the diet.
Table 7. Effects of different dietary VD combinations on the sternal morphological parameters and calcification of 52-day-old ducks1.
52d Sternal morphological parameters 52d Sternal calcificated quality
X2 Y2 Length Depth Coracoid Central Posterior process Fresh Defatted Ash content Calcium Phosphorus
(mm) (mm) distance(mm) distance(mm) distance(mm) weight (g) weight (g) (%) content (%) (%)
A T1 121.8 35.97 53.58 55.29 35.74 28.46 9.223 33.38 12.59 5.259
A T2 118.5 35.30 53.16 52.91 35.52 24.18 8.363 31.20 9.645 4.369
A T3 121.2 38.35 53.63 54.01 33.37 25.88 9.115 33.32 10.91 4.816
A T4 120.0 35.65 53.22 53.12 32.71 27.01 8.700 31.77 10.92 4.591
A T5 124.4 42.76 52.97 54.26 34.22 28.53 10.85 40.23 14.73 5.973
B T1 121.0 44.49 56.66 57.03 34.58 29.07 10.84 35.91 11.64 5.318
B T2 121.7 39.49 52.40 52.40 34.11 25.51 9.752 40.85 13.27 6.407
B T3 117.7 40.44 52.28 52.86 31.62 26.38 9.738 41.67 13.38 5.953
B T4 121.8 39.61 52.56 53.36 34.34 28.63 9.912 33.05 11.03 5.147
B T5 124.1 40.67 53.14 54.71 36.23 30.18 10.32 36.74 13.08 5.384
SEM 1.921 1.753 1.411 1.593 1.286 1.081 0.773 2.913 1.191 0.559
1
X
A 121.2 37.61 53.31 53.92 34.31 26.81 9.251 33.98 11.76 5.002
B 121.3 40.94 53.41 54.07 34.17 27.95 10.11 37.64 12.48 5.642
SEM 0.859 0.784 0.631 0.712 0.575 0.484 0.346 1.304 0.533 0.250
Y
T1 121.4 40.23 55.12 56.16 35.16 28.76a 10.03 34.65 12.12 5.288
T2 120.1 37.39 52.78 52.65 34.81 24.84c 9.058 36.03 11.46 5.388
T3 119.4 39.39 52.95 53.43 32.49 26.13bc 9.427 37.50 12.14 5.384
T4 120.9 37.63 52.89 53.24 33.52 27.82ab 9.306 32.41 10.97 4.869
T5 124.3 41.72 53.06 54.48 35.22 29.35a 10.58 38.48 13.91 5.679
SEM 1.359 1.240 0.998 1.126 0.910 0.765 0.546 2.061 0.843 0.395
P-Value
X 0.960 0.004 0.917 0.879 0.867 0.101 0.085 0.053 0.344 0.076
Y 0.132 0.090 0.427 0.216 0.172 0.001 0.289 0.246 0.143 0.687
X×Y 0.465 0.062 0.549 0.918 0.425 0.971 0.647 0.161 0.143 0.173
1
Values are the means of of 6ducks per treatment (n=6).
a–c
Mean values with unlike letters were significantly different (P < 0.05).
Table 8. Effects of dietary 2 kinds VD regimes on the relative expression of genes in sternum,
duodenal mucosa, and kidney of 32-day-old ducks1.
Group A2 Group B2
Items P-Value
(VD3) （VD3+25-OH-D3）
ALP3 0.866±0.181 0.828±0.226 0.108
DMP1 1.226±0.483 0.282±0.146 0.781
Sost 0.925±0.241 1.075±0.506 0.562
Phex 1.320±0.281 0.681±0.151 0.073
Sternum
V-ATPase 1.057±0.160 0.943±0.167 0.633
OPG 0.352±0.119 0.598±0.243 0.794
RANKL 1.337±0.465 0.664±0.309 0.710
RANKL/OPG 1.324±0.450 0.597±0.129 0.152
NaPi-IIb 0.861±0.301 1.139±0.274 0.509
Duodenal NaPi-IIa 0.635±0.239 1.365±0.335 0.107
mucosa CaBP-28K 0.556±0.133 1.444±0.421 0.072
VDR 0.518±0.135 1.482±0.161 0.001
NaPi-IIb 0.691±0.118 1.309±0.085 0.002
NaPi-IIa 0.937±0.215 1.063±0.074 0.592
Kidney
CaBP-28K 0.826±0.141 1.174±0.249 0.252
VDR 0.880±0.241 1.121±0.191 0.452
1
Values are the means of of 6ducks per treatment (n=6).
2
Group A, 3,160 IU/kgVD3 in the diet; Group B, 69 μg/kg 25-OH-D3 combined with 400 IU/kg VD3 in the diet.
3
Phex, phosphate regulating endopeptidase homolog x-linked; Dmp1, dentin matrix protein1; Sost, Sclerostin;

V-ATPase, Vacuolar-type H1-ATPase; OPG, osteo-protegerin; RANKL, receptor activator of nuclear factor-kB;

ALP, alkaline phosphatase; VDR, Vitamin D receptor; NaPi-IIb, type Iib sodium-dependent phosphate

cotransporter; NaPi-IIa, type IIa sodium-dependent phosphate cotransporter; CaBP-28K, calbindin-D28k. The

same as below.
 Sternum Duodenal mucosa Kidney
RA Ca
X Y O RA D V-A NK Na Na CaB V Na Na BP V
2 2 AL So Ph
P NK MP TPa L/ Pi-I Pi-I P-28 D Pi-I Pi-I - D
P st ex
G L 1 se OP Ib Ia K R Ib Ia 28 R
G K
0.4 0. 0.7 0.3 0.5 0. 0.62 1.69 0.
T 0.4 0.5 0.60 0.3 0.8 0.5 0.4
A 22 67 04 13d 85b 57 2 3b 63
1 98 86 6 67d 43 99 95
6 8 2
0.9 0. 0.8 0.7 0.4 1. 0.70 3.89 0.4 0.
T 1.2 0.6 1.09 0.6 0.6 0.9
A 42 46 80 06c 99b 16 5 3a 97c 48
2 d 64 89 2 d 10 73 80
3 9 9
0.7 0. 0.8 0.4 0.8 0. 1.72 2.16 1.1 0.
T 0.9 0.4 1.02 0.9 1.4 0.8
A 05 56 78 26d 44b 79 5 3b 68b 65
3 45 16 8 c 63 57 96
9 5 6
1.2 1. 1.0 0.8 0.9 1. 0.94 1.93 0.7 1.
T 0.7 0.6 0.79 0.7 1.2 1.0
A 66 22 46 20b 92b 26 6 5b 78c 21
4 cd 63 24 0 d 27 07 40
7 2 8
1.6 1. 1.0 1.7 1.8 1. 1.15 0.87 1.
T 1.9 1.3 1.94 1.5 1.5 1.5 1.1
A 30 22 00 75a 42a 35 5 9b 03
5 64 74 6 84b 35 55 19
4 6 8
0.8 1. 1.1 0.8 0.8 1. 1.04 1.18 1.
T 0.4 0.5 0.51 0.4 0.6 0.8 0.7
B 22 04 21 51b 04b 03 4 3b 12
1 cd 85 21 2 11d 45 52 91
4 7 2
1.1 1. 0.8 1.4 0.8 1. 0.97 0.86 0.5 1.
T 0.8 1.3 0.81 0.8 0.7 1.0
B 65 25 43 14a 72b 54 7 0b 60c 12
2 b 10 86 2 d 45 21 02
8 1 2
0.6 0. 0.7 1.1 1.0 0. 1.28 1.09 1.
T 0.8 1.0 0.99 1.5 0.8 0.5 1.2
B 36 74 30 49a 46b 83 3 4b 04
3 bc 64 91 4 65b 46 71 45
3 6 0
0.9 1. 1.0 1.4 1.8 0. 0.99 1.96 1.
T 0.6 1.3 0.83 2.3 0.9 1.2 1.3
B 78 22 14 28a 02a 77 5 5b 81
4 b 71 35 7 28a 66 24 29
2 7 6
1.4 1. 1.7 1.1 0.7 0. 0.54 1.18 0.7 0.
T 1.7 1.9 1.38 2.0 1.1 1.1
B 34 57 85 18a 14b 64 8 3b 42c 86
5 bc 37 78 4 d 20 42 04
5 9 7
0. 0. 0.
0.2 0.2 0.2 0.2 0.29 0.56 0.6 0.2 0.15 0.2 0.2 0.2 0.1
SEM 27 24 18
50 22 33 30 6 1 22 43 0 41 59 18 99
2 3 7
X1
0.9 0. 0.9 0.8 0.9 1. 1.03 2.11 0.
1.0 0.7 1.09 0.8 0.9 1.0 0.9
A 93 83 02 08 52 03 1 3 80
87 38 2 79 36 98 06
2 2 7
1.0 1. 1.0 1.1 1.0 0. 0.96 1.25 1.
0.9 1.2 0.90 1.1 1.0 0.9 1.0
B 07 16 98 92 48 96 9 7 19
13 62 8 21 64 02 94
8 8 3
0.1 0. 0.0 0.1 0.1 0. 0.13 0.25 0.
0.1 0.1 0.06 0.1 0.1 0.0 0.0
SEM 12 12 99 04 03 10 3 1 08
07 08 7 08 16 98 89
2 9 4
Y
0.6 0. 0.9 0.5 0.6 0. 0.83 1.43 0.
0.4 0.5 0.55 0.3 0.7 0.7 0.6
T1 22b 86 13 82b 95b 80 3 8 87
91c 54b 9c 89 44b 26b 43
0 7 7b
1.0 0. 0.8 1.0 0.6 1. 0.84 2.37 0.
1.0 1.0 0.95 0.5 0.7 0.6 0.9
T2 54a 86 61 60a 85b 35 1 6 80
b b 37b 37b 2b 29 28b 97b 91
0 5 5b
 0.6 0. 0.8 0.7 0.9 0. 1.50 1.62 0.
0.9 0.7 1.01 1.3 0.9 1.0 1.0
T3 71b 65 04 88b 45a 81 4 8 84
b 04bc 53b 1b 67 05b 14ab 71
6 6 8b
1.1 1. 1.0 1.1 1.3 1. 0.97 1.95 1.
0.7 0.9 0.81 1.5 0.8 1.2 1.1
T4 22a 22 30 24a 97a 01 0 0 51
b b 17bc 80b 3bc 53 47b 15a 84
4 9 7a
1.5 1. 1.3 1.4 1.2 1. 0.85 1.03 0.
1.8 1.6 1.66 1.1 1.7 1.3 1.1
T5 32a 40 92 47a 78a 00 2 1 95
50a 76a 5a 63 77a 49a 12
0 3 3b
0.1 0. 0.1 0.1 0.1 0. 0.21 0.39 0.
0.1 0.1 0.10 0.1 0.1 0.1 0.1
SEM 77 19 57 65 62 17 0 7 13
68 72 6 70 83 54 41
2 2 2
P-Value
0.9 0. 0.1 0.0 0.5 0. 0.74 0.02 0.
0.2 0.0 0.05 0.1 0.4 0.1 0.1
X 28 05 67 12 15 67 5 0 00
56 01 7 18 36 61 41
6 8 2
0.0 0. 0.0 0.0 0.0 0. 0.12 0.17 <.0 0.
<.0 0.0 <.00 0.0 0.0 0.0
Y 04 05 78 06 06 17 9 6 00 00
001 00 01 01 13 76
6 0 1 2
0.6 0. 0.1 0.0 0.0 0. 0.35 0.03 0.
X 0.8 0.4 0.27 0.0 0.6 0.0 0.8
15 66 95 21 02 07 0 6 21
×Y 97 50 7 00 71 85 30
6 6 0
Table 9. Effects of different dietary VD combinations on the relative expression of genes in
sternum, duodenal mucosa, and kidney of 52-day-old ducks1.
1
Values are the means of of 6ducks per treatment (n=6).
a–c
Mean values with unlike letters were significantly different (P < 0.05).

Declaration of Comepeting Interest

No conflict of interest exits in the submission of this manuscript, and manuscript is
approved by all authors for publication. I would like to declare on behalf of my
co-authors that the work described was original research that has not been published
previously, and not under consideration for publication elsewhere, in whole or in part.
All the authors listed have been approved the manuscript that is enclosed.