1 Campbell

Download as pdf or txt
Download as pdf or txt
You are on page 1of 31

Chapter 1

Use PCR and a Single Hair to Produce a “DNA


Fingerprint”

A. Malcolm Campbell, John H. Williamson, and Diane Padula

Biology Department
Davidson College
P.O. Box 1719
Davidson College, NC 28036-1719 USA
(704) 892–2692, macampbell@davidson.edu

Dr. Campbell (Assistant Professor) completed his Ph.D. at Johns Hopkins University in 1992. In
1992-93, Dr. Campbell was a PEW Teacher-Scholar at Washington University, St.Louis and
studied the molecular basis of sex determination in Chlamydomonas. He is continuing this research
interest at Davidson. Prior to accepting the teaching position at Davidson, Dr. Campbell was a PEW
Visiting Assistant Professor at Macalester College, MN. Since coming to Davidson in 1994, Dr.
Campbell has taught Introductory Biology (Bio 111), Molecular Biology and several research
courses.

Dr. Williamson (Professor) completed his Ph.D. in genetics at the University of Georgia in 1966.
Following his graduate work, he worked as a postdoctoral fellow at Oak Ridge National Laboratory
and then at the University of California, Riverside. He came to Davidson in 1981 as chair of the
Biology Department and served as chair until 1993. Before accepting the appointment at Davidson,
Dr. Williamson taught at the University of Calgary and was chair of the Biology Department there
from 1976-1978. Dr. Williamson teaches Genetics, “Genetics, Society and Decisions”, Introductory
Biology (Bio 111), research courses in biochemical genetics, and various seminars. His research
interests concern a group of enzymes in Drosophila and Chlamydomonas that require NADP + as a
cofactor.

Ms. Padula (Teaching Assistant) has a Master of Science Education degree from Widener
University. She is a three-quarter time staff member in biology. Ms. Padula coordinates the
introductory biology laboratories (Bio 111 and Bio112) and assists faculty in the development of
laboratory protocols for these courses. In addition, she supervises the work study program for the
department, supervises BioSociety outreach programs, and maintains the Biology Resource Center.
Ms. Padula has been with the department since 1993 and has been in her current position since
1994.
© 1997 A. Malcolm Campbell
1
2 PCR Fingerprinting
Contents
Introduction.....................................................................................................................2
Student Time Table ..........................................................................................................3
Materials..........................................................................................................................3
Student Equipment .........................................................................................................3
Student Consumable Supplies.........................................................................................3
Notes for the Instructor ....................................................................................................4
Overview.......................................................................................................................4
PCR..............................................................................................................................4
VNTR ...........................................................................................................................5
Electrophoresis ..............................................................................................................6
Safety Precautions..........................................................................................................6
Teaching Applications ....................................................................................................7
Overview of Protocols ...................................................................................................7
Detailed Protocols for Two Loci.....................................................................................10
Student Handouts.............................................................................................................13
First Lab Meeting...........................................................................................................14
Second Lab Meeting......................................................................................................16
Acknowledgements..........................................................................................................16
Literature Cited................................................................................................................16
Appendices
A.Recipes for Reagents and Proper Storage Conditions ...................................................18
B.Sources for Reagents and Equipment.............................................................................19
C.Suggested Retailers for Major Equipment......................................................................20
D.Potential Problems and Trouble Shooting ......................................................................21
E.Pouring and Running an Aragose Gel.............................................................................23
E.Photographing Gels .......................................................................................................25
F.Calculating Molecular Weights of DNA Brands .............................................................26
H.Photographs of Gels Obtained from Students Labs........................................................29
I.Molecular Weight Markers.............................................................................................30
J.Checklist for Equipment and Reagents............................................................................31

Introduction
As biology teachers, we are aware of the ever growing amount of information and new methods
that we would like to incorporate into our classes. One area of particular growth has been in the
field of DNA manipulations, or molecular biology. All of us want to share with our students these
new and exciting techniques that are driving the revolution in biotechnology and altering our
understanding of population genetics, DNA structure, replication, and mutations.
We have developed a laboratory procedure that draws upon all of these topics and is appropriate
for introductory level college biology courses (for majors and/or non-majors). For upper level
students, we have had them design potential modifications to improve the protocol. Using the
protocol described in this article, in two lab periods of two hours each, every student extracts his or
her own DNA from a single hair follicle, uses polymerase chain reaction (PCR1) to amplify a
polymorphic locus, electrophoreses the PCR products on an agarose gel, and visualizes the alleles to
generate a “DNA fingerprint”. These single-locus fingerprints can be used to generate population
genetics data or to solve a fabricated crime. Setup time for the instructor will vary due to available
equipment but for six sections of 32 students each, it takes us from 8 to 10 hours to pour all the gels,
make all the stock solutions, and aliquot/distribute all reagents.
PCR Fingerprinting 3
Student Time Table

Day #1

pluck hairs (5 - 10 minutes)


add hair to DNA extraction buffer (5 minutes)
incubate hair at 55° C (1 hour)
incubate hair at 95° C (10 minutes)
set up PCR mixtures in clean tubes (10 minutes)
allow PCR to automatically cycle 30 times (less than 3 hours)

Day #2

mix PCR sample with loading dye (5 minutes)


load gel (10 minutes)
electrophorese fragments (1-2 hours)
photograph gel (5-10 minutes)
discuss results

Materials

There are two ways to do PCR, manually and automatically. Manual PCR has been described
extensively by Garrison and dePamphilis (1994) and is cheaper since the cost of a temperature
cycler begins at about $3,000. However, we have found automated PCR to be much more
reproducible, convenient, and faster, so the equipment listed in this article will be that needed for
automated PCR. The only difference between the two methods is the temperature cycler itself, and
once the temperature cycler is purchased, the cost of a given experiment is identical between manual
and automated PCR. If you buy a thermocycler, we recommend you get one with a heated lid which
enables you to perform PCR on small volumes without having to use an oil overlay. We have found
that students have a difficult time loading their samples when oil was used in the PCR. Although we have
noticed that reactions conducted with oil overlays produced fewer extraneous bands and given
“cleaner” results, students find the samples too difficult to pipette.

Student Equipment
One temperature cycler (a programmable heating block) - one for all students in lab(s)
Micropipetters (students need to pipet 100 µl, 17.5 µl, 15 µl, 10 µl ) - one per group of 4
students
Microcentrifuge (optional, but convenient)
Power supply for electrophoresis - one per two electrophoresis chambers
Electrophoresis chamber - one per gel
Uv light box for detection of ethidium bromide stained dna - one for all students in lab(s)
Polaroid camera (not required but highly recommended) - one for all students in lab(s)
Tweezers for hair plucking - two for all students in lab(s)
Ice bucket - one per group of from four to six students
Scissors - one per group of from four to six students

Student Consumable Supplies

Marking pen - one per group of from four to six students


Microcentrifuge tubes (500 microliter size) - two per student
4 PCR Fingerprinting
Agarose gel - number required varies, depending on number of lanes in gel
Micropipette tips - about 5 per student
Gloves, disposable (reusable dishwashing gloves are ok) - one pair for anyone handling gel
Ice water bath or crushed ice - one per group of from four to six students
Distilled water (grocery store quality is acceptable)
Toothpicks - one per student
Dna extraction buffer - 100 µl per student
Pcr reagents (see details below) - less than 20 µl per student
Molecular weight marker - 5 µl per gel

Notes for the Instructor

Overview

There are a few fundamental concepts of biology that are critical for students to understand in order to
appreciate this laboratory exercise. We use “DNA fingerprinting” as a motivational tool to make relatively
abstract concepts seem more tangible, exciting, and easier to learn. In this article, we describe the basics of
PCR, variable number of tandem repeats (VNTRs), and electrophoresis which are integral to this
laboratory procedure. We conduct this experiment with our Introductory Biology students towards the end
of the semester when they have had experience with pipets and covered the necessary background
information.

PCR

Dr. Kary Mullis developed the Nobel Prize winning technique of PCR which has been described
previously (Garrison and dePamphilis, 1994; Mullis, 1990). PCR allows you to start with one molecule of
double-stranded DNA and replicate over a billion times within 3 hours a selected portion of that DNA. The
portion that is replicated is defined by two primers, short stretches of single-stranded DNA, which are used
to prime the DNA polymerase. The sequences of the two primers are complementary to opposite strands
of the double helix and have their 3’ ends facing towards each other (figure 1). The power behind PCR is
the chain reaction component; replication is expanded exponentially because after each replication, the
resulting DNA is unzipped (denatured), by raising the temperature to 95° C. After a newly polymerized
segment of DNA is denatured, it becomes the template for the next round of replication. The DNA
polymerase used in this process can withstand such extreme temperatures because the enzyme was isolated
from a thermophillic bacterium that lives in hot springs. Since the cycle is repeated thirty times, the original
copy of DNA will be replicated over one billion (230) times, which is enough DNA for visualization on an
agarose gel.
PCR Fingerprinting 5

Figure 1.1 Diagram of two PCR primers annealing to their complementary strands. A segment of
double-stranded DNA is shown with an undefined length of interviening sequence, as shown by
the dots. In a real PCR mixture, the primers would be longer.

VNTR

The evolutionary principle of variation within a population is a cornerstone in biology. This variation
results from subtle differences in the DNA sequence in individuals of a given species, and the DNA of
Homo sapiens is no exception. Variation commonly originates by the mistaken duplication of a small
sequence of nucleotides when only one copy was present before replication. This results in a tandem repeat
of the original sequence. If this mistake occurs again in another round of replication, then three copies of a
sequence will be in tandem (figure 2). These tandem repeats are part of our chromosomes and as such, they
will be inherited according to Mendelian genetics. Over the centuries, the number of tandem repeat units has
increased, therefore each of us has inherited a variable number of tandem repeats (VNTRs) at many loci
scattered throughout our genomes. A VNTR can be thought of as a locus with each particular number of
repeated units being analogous to different alleles. Therefore, each human (except for identical twins) carries
a unique combination of VNTRs and these alleles can be used in population studies or to identify a
particular individual.

F
Figure 1.2. Illustration of variable number of tandom repeats (VNTRs). Single strands of DNA from
the same locus and three different individuals are shown. Within this region, the trinucleotide repeat
CAT is present once, twice, or three times which results in alleles of three different lengths.
6 PCR Fingerprinting
Electrophoresis
PCR can be used to amplify portions of human DNA that are known to contain VNTRs. By the end of
the first lab period, each student will have generated PCR products that contain his or her own VNTR
alleles. Next, the students need to be able to see their DNA “fingerprint”, more appropriately referred to as
a DNA profile. In order to visualize a DNA profile from a given locus, the DNA fragments need to be
separated according to their variable sizes using gel electrophoresis. The gel is a matrix of agarose that
looks like white gelatin and is analogous to a microscopic thicket of bushes and trees with lots of branches
and twigs. An electric current is applied to the gel and all the negatively charged DNA molecules (negative
because of all the phosphate groups) race towards the positive pole. But this is not a fair race. Returning to
our analogy, the race is between children and adults of different sizes trying to run through the thicket of
agarose trees and branches. Of course, it is easiest for small children to run through narrow passages in the
thicket and so they move the fastest, the oldest children and the smallest adults run through at a medium
speed, and the largest adults come in last place. Like people running through a thicket, DNA molecules of
different sizes migrate through the gel at different speeds, depending on their size. By this process, students
can separate their different sized VNTR alleles with the smallest alleles migrating the fastest and the largest
alleles migrating the slowest. Once the DNA is stained in the gel, it can be visualized to reveal the DNA
profile of each student.

Safety Precautions

The major concerns with this laboratory are ethidium bromide and the electrical current. Since most
electrophoresis equipment is designed to be “idiot proof”, the risk of electrical shocks should be minimal.
However, one should always remember that the current used in agarose gel electrophoresis is powerful
enough to be fatal. Ethidium bromide (EtBr) is a known mutagen and should be handled with extreme
caution. Gloves should be worn by anyone handling EtBr. Of course the greatest risk comes when handling
the concentrated stock solution but we do not let students do this. We make the gels and all buffers which
contain EtBr. When the lab is complete, EtBr must be disposed of properly, according to your institution’s
guidelines. Schleicher and Schuell makes the Extractor, an EtBr waste reduction system which is a filtering
device that extracts EtBr from aqueous solutions. If the Extractor is used, then only the gels and the
Extractor require special disposal. Some people do not like to have EtBr in the gel buffer as, described
below. The reason we include EtBr in our gel buffer is so the progress of the electrophoresis can be
monitored at any time and to eliminate an extra staining and destaining procedure. However, either method
will give satisfactory results.
There are two alternatives to ethidium bromide for staining DNA. Molecular Probes makes a
fluorescent dye (SYBR Green I) that is reported to be more sensitive and less mutagenic, though it requires
a different filter for photography than the orange one used with ethidium bromide. Alternatively, you can use
methylene blue which is non-toxic and can be seen with visible light but is less sensitive. Kits for DNA
detection and photography can be purchased from many suppliers including Fisher, Carolina Biological, and
Fotodyne.
Dimethyl sulfoxide (DMSO) is used for the D1S80 locus protocol described in this article DMSO is not
a major concern by itself but since it can be absorbed through the skin and is a universal solvent, it can be a
means of absorbing other more toxic substances. Finally, there is a certain amount of superstition about
working with DNA that circulates in laboratories. One is that every piece of plastic that comes into contact
with DNA must be autoclaved. We do not wear gloves when working with DNA nor do we autoclave the
pipet tips or the microfuge tubes and we have no problems with DNAses degrading the DNA.
PCR Fingerprinting 7
Teaching Applications
The results from this experiment can be integrated into a biology curriculum at several points throughout
the semester, plus the experiment exposes students to several techniques used in molecular biology. Below
we have compiled a list of some areas of the curriculum that can be enhanced by this laboratory experiment.
Since PCR is based on DNA replication, you may want to discuss: the mechanism of the DNA polymerase
activity; the semiconservative nature of replication; the need for primers to initiate a DNA polymerase; and
the 5’ and 3’ orientations of DNA strands.
By their very existence, VNTRs are a good example of mutations that occur naturally in our DNA. From
this starting point, you could discuss other mutations which might have physiological or evolutionary
repercussions.
Mendelian genetics can be illustrated if students can bring in hair follicles of family members. They can
observe the genotypes of their parents and determine which alleles they have inherited. However, there is
the potential for a student to learn that his or her biological father is not the man they thought.
If all the class data are compiled, they can be used to discuss specific areas of population genetics, such as
the frequencies of different alleles, pedigree analysis, and the use of the Hardy-Weinberg equation.
Biotechnology can be introduced by using this experiment as a launching pad to discuss forensic uses of
DNA, bioengineering, Jurassic Park, etc. With the incessant example of the O. J. Simpson trial, the use of
DNA profiles in criminal cases is an obvious application. An amazing example can be found in Hochmeister
et al., (1991) where the analysis was conducted on DNA isolated from skin cells deposited on cigarette
butts. The possibilities for discussion continue to increase and are often quoted, or misquoted, in daily
newspapers.
We have our students calculate the molecular weights of all the alleles using the molecular weight marker as
standards. The D1S80 PCR product with zero repeat units is 142 base pairs long, so every repeat unit will
add 16 base pairs to the VNTR. A student can use the estimated molecular weights of each band to
determine how many repeat units are in each allele.
In conjunction with a quantitative analysis, a fun approach is to fabricate a crime where the criminal has left
behind a single hair follicle. The students are mentally prepared to find a guilty party and in our experience,
they always do, even if the hair did not come from someone in the class. This is a good opportunity to
discuss objective evaluation of data, the handling of evidence, the number of loci necessary to identify the
source of the DNA, and statistical methods to calculate the odds of this DNA profile belonging to more than
one person.
A related area ripe for discussion is the statistical basis for saying whether or not a given DNA sample is
likely to belong to only one person. There is a general agreement that, in principle, DNA could be used to
identify any given person if enough DNA is examined. However, how much is enough? Examining the
VNTRs at a single locus is not sufficient to distinguish individuals within a large population since the number
of possible allele combinations is small compared to the number of people. The number of VNTR loci
examined is a minor problem compared to the statistical analysis of a given set of data. There are several
different methods to analyze the data and these methods are eloquently discussed in the National Research
Council’s DNA Technology in Forensic Science (1992).

Overview of Protocols

Collecting the Hair Sample

The most critical step is plucking a substantial hair follicle. We do this with our fingers and have found
that most people can harvest good follicles if they pull between 3 and 20 hairs out at a time. For those with
fragile hair, we use tweezers to grip the hair shaft at its base, pull quickly, and harvest the follicle. A “good”
8 PCR Fingerprinting
follicle is comprised of many cells and is easily identified because it has a black bulbous base that is sticky
and surrounding the lowest portion of the hair shaft that is covered with a shiny layer of cells. Many follicle
cells means more template DNA, which means better student results, since the number of DNA molecules
replicated equals the initial number of template molecules raised to the thirtieth power. We cut off most of
the hair shaft and use a toothpick to transfer one follicle to a labeled microfuge tube since a good follicle will
stick to the toothpick. If a student cannot get a “good” follicle, we have used as many as 10 “bad” follicles
in one tube to extract as much DNA as possible.

APOC2 Locus

We have used two different loci; APOC2 and D1S80. We have found the APOC2 locus to be easier
to execute successfully because it is technically easier to amplify than the other locus. Therefore, you might
want to attempt PCR amplification with the APOC2 locus first, though the D1S80 locus gives much better
results. APOC2 (figure 3; Weber and May, 1989) is a locus that encodes apolipoprotein C2 (which is
involved in cholesterol transportation in the blood).

Figure 1.3. Photograph of a 3% agarose gel, stained with ethidium bromide, showing students’
results for the APOC2 locus. Lanes: 1 - 7 are from seven different students’ PCR products; MW is
the one kb molecular weight marker lane and the sizes of the major bands are indicated in base pairs
on the left side of the photograph; b indicates blank lanes, E is the evidence DNA we used for a
fabricated crime. The sample from lane 7 evaporated when the lid popped open during the PCR and
an extra tube of evidence DNA was substituted for the student’s sample (see Appendix C., Potential
Problem #6). Lane 6 produced very faint bands of the expected size and is an indication of a
pipetting error or a “bad” hair follicle. The labels on the right side of the photograph, beginning at
the bottom, note the positions of: PM, primer monomers; PD, primer dimers; APOC2, the APOC2
alleles; ?, the bands found in lanes 5 and 7 that are unidentified. The white spots scattered across
the gel are dust and powder from our gloves.

D1S80 Locus
PCR Fingerprinting 9

D1S80 (Figure 4; Budowle et al., 1991; Nakamura et al., 1988; Skowasch et al., 1992) is located on
the distal portion of the short arm of chromosome one, is not a part of any gene, and it is used in several
countries for forensic analysis of DNA samples (Kloosterman et al., 1993; Sajantila et al., 1992). D1S80
requires hotstart PCR which means that the Taq DNA polymerase is not added to the PCR mixture until the
mixture has been heated to 95° C. The hotstart is necessary because the D1S80 primers have a tendency to
anneal to each other rather than the template while the mixture is heating up for the first time, which allows
the DNA polymerase to generate “primer dimers” (figure 5). If addition of the DNA polymerase is delayed,
then inappropriately annealing primers are denatured as the kinetic energy increases, so no replication
occurs until the temperature is lowered later in the procedure, allowing the primers to anneal to the proper
portion of the template DNA. DMSO has been included in the reaction mixture to enhance the specificity of
the primers (Filikin and Gelvin, 1992).

Figure 1.4. Photograph of a 1.5% agarose gel, stained with ethidium bromide, showing the results
for the D1S80 locus using seven different sources of DNA (lanes one through seven). Examples
were chosen to illustrate the wide range of alleles found in a class of 17 students, with a bias to
highlight apparently homozygous individuals. The DNA used in lane five was extracted from five
“bad” follicles (see Potential Problems #4). Labels: MW, the one kb molecular weight markers with
the size in base pairs of relevant bands indicated to the left of the photograph; PD, primer dimers;
D1S80, the D1S80 alleles.
10 PCR Fingerprinting

Figure 1.5. Photograph of a 1.5% agarose gel, stained with ethidium bromide, showing the need for
hotstart PCR. One DNA sample was used as template for all lanes and the Taq DNA polymerase
was added to the appropriate tube at the indicated time (from zero to five minutes) after being
heated to 95° C. The labels are the same as in figure 4.

Detailed Protocols for Two Loci


Since we have developed teaching laboratory exercises for PCR1 fingerprinting two different loci,
protocols for both loci will be presented. We prefer the results obtained from the D1S80 locus and that
protocol will be presented again in the Student Handout section.

APOC2 Locus

DNA extraction (adapted from Erlich, 1992)


1. Pluck a hair so that a follicle is removed from your head.
2. Cut off most of the hair shaft but keep the follicle (~5 mm). Be careful, sometimes the follicle jumps
away when you cut the hair.
3. With the heated lid disabled, incubate the follicle in 100 µl extraction buffer (which contains 6 µg of
proteinase K) for 1 hour at 55° C, 10 minutes at 95° C, then cool the samples to room temperature.
4. When the DNA extraction cools, set up a new 500 µl microfuge tube by adding the following:
PCR Fingerprinting 11
Reagent Volume Final Concentration
extracted DNA 7.5 µl ~ 50 ng of DNA
reaction mixture 17.5 µl see below**
**The reaction mixture contains the following cocktail:

Reagent Volume Final Concentration


H2O 11.55 µl
10X PCR buffer (without Mg) 2.50 µl 0.75 mM MgCl2
20X dNTPs 1.25 µl 200 µM each
#1 primer 1.00 µl 100 ng primer
#2 primer 1.00 µ 100 ng primer
Taq DNA polymerase 0.20 µl 1 unit
Total Volume 17.50 µl

PCR
5. Start the following PCR program with the heated lid enabled.
Step 1 5 min 95° C
Step 2 1 min 95° C
Step 3 1 min 55° C
Step 4 1 min 72° C
Step 5 repeat steps two through four 29 more times
Step 6 hold at 20° C
6. When the PCR is completed, the tubes are removed and stored at 4° C until the second lab meeting.

Second Lab Meeting


1. Add 2.5 µl of 10X loading dye to your PCR products and load up to 25 µl of each sample into a
separate well.
2. Electrophorese the 25 µl of the reactions + loading dye on a 3.0% (w/v) agarose gel in 0.5X TBE +
ethidium bromide (200 ng/ ml final concentration) at 90 volts for 1.75 hours (see Appendix D., Potential
Problem #7).

APOC2 facts:
80% of American population is heterozygous
11 alleles have been published
the repeated sequence is two nucleotides long
the VNTR occurs within an intron
30 dinucleotide repeats have been observed in the largest allele
Primers:
#1 5’ CATAGCGAGACTCCATCTCC 3’
#2 5’ GGGAGAGGGCAAAGATCGAT 3’

D1S80 Locus

First Lab Meeting

DNA extraction
Follow the same procedure given above (steps one through three) for DNA extraction in the first
laboratory meeting under APOC2 Locus.
4. When the DNA extraction cools, set up a new 500 µl microfuge tube by adding the following:
12 PCR Fingerprinting

Reagent Volume Final Concentration


extracted DNA 15.0 µl ~ 100 ng of DNA
reaction mixture 10.0 µl see below **

**The reaction mixture contains the following cocktail:


Reagent Volume Final Concentration
H2O 4.00 µl
10X PCR buffer (without Mg) 2.50 µl 1.5 mM MgCl2 (from extraction buffer)
DMSO 1.25 µl 5% v/v
20X dNTP’s 1.25 µl 200 µM each
#1 primer 0.50 µl 100 ng primer
#2 primer 0.50 µl 100 ng primer
Total Volume 10.00 µl

PCR

5. To initiate hot start PCR, denature the DNA by incubating the tubes for four to five minutes at 95° C
(Step 1), maintain the tubes at 95° C while you add 0.5 µl Taq DNA polymerase to each tube. Do not
allow the tubes to cool and do not take time to mix the reaction mixture after adding the Taq polymerase.
6. .Resume the following PCR program with the heated lid enabled:
Step 2 1 min 95° C
Step 3 1 min 65° C
Step 4 1 min 72° C
Step 5 repeat steps two through four 29 more times
Step 6 hold at 20° C
7. When the PCR is completed, the tubes are removed and stored at 4° C until next lab meeting.

Second Lab Meeting


Add 2.5 µl of the 10X loading dye to each tube, load up to 25 µl of the PCR product into a well, and
electrophorese the DNA on a 1.5% agarose gel using 0.5X TBE and ethidium bromide (200 ng/ml final
concentration). We usually run these gels at 90 volts for 1 - 1.5 hours. The exact time and voltage will
depend on the gel box configuration and appropriate conditions can be refined accordingly (see Appendix
D., Potential Problem #7).

D1S80 facts:
>80% of all populations tested are heterozygous
28 alleles have been published
repeat unit is 16 nucleotides long
D1S80 PCR product with zero repeat units is 142 base pairs long, so every repeat unit will add 16
base pairs to the VNTR.
PCR products range from 430 to 814 base pairs long
41 repeated units have been observed in the largest allele
Primers:
#1 5’ GAAACTGGCCTCCAAACACTGCCCGCCG 3’
#2 5’ GTCTTGTTGGAGATGCACGTGCCCCTTGC 3’
PCR Fingerprinting 13

Student Handouts

What is your genotype? A PCR Answer

Introduction

Unless you have spent the last couple of years in a cave, you have heard about the increasing use of
“DNA fingerprinting” in court cases. The technology available is so sensitive that unbelievable sources of
DNA have been used to convict criminals. In Minnesota for example, DNA was extracted from the back of
a postage stamp since some epidermal cells from the suspect’s tongue had been deposited on the glue when
the stamp was licked. My prediction is that the pivotal point in future court cases will be the collection and
handling of the evidence. For example, what if some DNA from the crime scene is shown to be the
accused? The defense attorney could suggest that the police collected some epidermal cells from the
sidewalk (from a visit the day before) at the same time as the blood drops. What do you think of this
possibility as a defense? If you want to read more about this area, the library has several books on this
topic.
There are two standard methods for “DNA fingerprinting”: 1) Southern blots and, 2) PCR. We have
discussed Southern blots ad nauseam in class but have not covered PCR in much detail. Dr. Kary Mullis,
the inventor of PCR, was awarded a Nobel Prize in 1993 for his revolutionary innovation. As you know,
PCR allows you to amplify a single copy of DNA into millions of copies, provided the DNA has been
sequenced because you have to supply DNA polymerase with primers that will specifically hybridize to the
target gene and no other DNA. Over the next two weeks, we will use PCR to determine the genotype of
every student taking this class. We are using a hair root as our source of genomic DNA and are looking at a
locus called D1S80. D1S80 contains a Variable Number of Tandem Repeat sequence (VNTR). As the
term implies, there is a section of DNA that is repeated to varying degrees in each person. As a simplified
example, the repeat unit is the two nucleotides (CG). So if we were to sequence this portion of 4 different
D1S80 alleles, we might see the following:

1) ATGCCGTATTACGCGCGCGCGCGCGCCTATTAGGTATTAG
2) ATGCCGTATTACGCGCGCGCGCGCGCGCGCGCGCGCCTATTAGGTATTAG
3) ATGCCGTATTACGCGCGCGCCTATTAGGTATTAG
4) ATGCCGTATTACGCGCGCGCGCGCGCGCGCCTATTAGGTATTAG

In this example, there are 4 copies of the VNTR with 4 different lengths. If we electrophoresed these 4
segments of DNA on a gel, we would find 4 different bands of different sizes (2>4>1>3). In a criminal
case, we might have 4 suspects and one DNA sample from the crime scene. The resulting gel might look
like this:

Figure 1.6. Diagram of fictitious gel using the data depicted above. Lanes one
through four contain suspect DNA.
14 PCR Fingerprinting
Questions :
1) So, “who done it”?
2) What is wrong with the above gel? Why is this too easy?

First Lab Meeting

Now it is time for us to determine our genotypes. You should be forewarned, this si a delicate
procedure that does not always work for everyone. In order to process this kind of evidence for a criminal
case, a technician usually has a master’s degree in Forensic Science, and a few years of “on-the-job
training”. Nevertheless, even these experts sometimes make mistakes. So do not be discouraged if your
sample does not “work”, but try to avoid this situation by observing these guide lines:
1. Follow the protocol as carefully as possible.
2. Do not contaminate your hair or DNA with that of others (remember one cell is enough to be
amplified).
3. When the DNA extraction is just finished, visually check to verify that you have extracted DNA by
gently removing the tube from the thermocyler and flicking the tube while holding it up to a light and
looking very carefully. You should see a more dense portion of the solution as it mixes with the less
dense water.
4. The most common mistakes are pipetting errors. Be sure to visually check to see that you are
transferring about the right volumes and always use clean tips; when in doubt get a new one.
5. Be very careful loading the gel. We will have time to practice this week so that when you are loading
your real sample next week, you will be a pro.

Protocol

DNA extraction1

1. Pluck a hair so that some root is removed from your head (yikes!) The root is white/translucent in
appearance. Check to make sure you got some root and not all shaft.
2. Cut off most of the hair but keep the root (~5mm). Be careful, sometimes the root will jump away when
you cut the hair.
3. Incubate the root in 100 µl digestion buffer (which contains 6 µg of proteinase K) for 1 hour at 55° C,
then 10 minutes at 95° C (what is the purpose of this step?). Use thermocycler program HAIR 1 - lid
disabled.

PCR Reaction Mixtures

1. When the DNA extraction cools to 20° C, set up a new 500 µl microfuge tube by adding the following:

Reagent Volume Final Concentration


extracted DNA 15.0 µl ~ 100 ng of DNA
reaction mixture 10.0 µl see below **

1
(Adapted from: PCR Technology by Henry A. Erlich, W. H. Freeman and Co., NY, 1992, pp. 35-37.)
PCR Fingerprinting 15

**the reaction mixture already contains the following cocktail and has been aliquoted for you:

Reagent Volume Final Concentration


H2O 4.00 µl
10X PCR buffer (without Mg) 2.50 µl 1.5 mM MgCl2 (from extraction buffer)
DMSO 1.25 µl 5% v/v
20X dNTP’s 1.25 µl 200 µM each
#1 primer 0.50 µl 100 ng primer
#2 primer 0.50 µl 100 ng primer
Total Volume 10.00 µl

PCR

This locus requires hotstart PCR which means that the Taq DNA polymerase is not added to the PCR
mixture until it has been heated to 95° C. The hotstart is necessary because the D1S80 primers have a
tendency to anneal to each other rather than the template while the mixture is heating up for the first time,
which allows the DNA polymerase to generate “primer dimers”. If addition of the DNA polymerase is
delayed, then inappropriately annealing primers are denatured as the kinetic energy increases, so no
replication occurs until the temperature is lowered later in the procedure, allowing the primers to anneal to
the proper portion of the template DNA. DMSO has been included in the reaction mixture to enhance the
specificity of the primers.
5. To initiate hot start PCR, denature the DNA by incubating the tubes for 5 minutes at 95° C (Step 1),
maintain the tubes at 95° C while the instructor adds 0.5 µl Taq DNA polymerase to each tube. Do not
allow the tubes to cool and do not take time to mix the reaction mixture after adding the Taq polymerase.
6. Resume the following PCR program with the heated lid enabled:
Step 2 1 min 95° C
Step 3 1 min 65° C
Step 4 1 min 72° C
Step 5 repeat steps two through four 29 more times
Step 6 hold at 20° C
7. When the PCR is completed, the tubes are removed and stored at 4° C until next lab meeting.

D1S80 facts:

>80% of all populations tested are heterozygous


28 alleles have been published
repeat unit is 16 nucleotides long
if there were zero repeat units, the PCR product would be 142 bp long
PCR products range from 430 to 814 base pairs long
41 repeated units have been observed in the largest allele
Primers2:
#1 5’ GAAACTGGCCTCCAAACACTGCCCGCCG 3’
#2 5’ GTCTTGTTGGAGATGCACGTGCCCCTTGC 3’

2
Budowle, B., Chakraborty, R., Giusti, A. M., Eisenberg, A. J., and Allen, R. C. (1991) Analysis of the VNTR
locus D1S80 by the PCR followed by high-resolution PAGE. American Journal of Human Genetics 48: 137
- 144.
16 PCR Fingerprinting

Second Lab Meeting

The PCR Results

Add 2.5 µl of the 10X loading dye to each tube and electrophorese the DNA on a 1.5% agarose gel
using 0.5X TBE and 200 µg/ml ethidium bromide. We usually run these gels at 90 volts from 1 to 1.5
hours. The exact time and voltage will depend on the gel box configuration and appropriate conditions can
be refined accordingly.
While these gels are running, we will purify a lot of genomic DNA from our friend, Chlamydomonas.
The protocol can be found on the next page.

Recipe for 0.5X TBE

45 mM Tris-borate pH 8.0
1 mM EDTA

Acknowledgements

We would like to thank the Pew Charitable Trusts, the Pew Midstates Mathematics and Science
Consortium for their support, Linda McNally and Dr. Don Kimmel for critically reviewing the manuscript,
and the biology students at Davidson and Macalester Colleges who helped us. This article is based upon
work supported in part by the North Carolina Biotechnology Center. A similar article has been accepted
for publication in The American Biology Teacher but no specific information is available at the time of
submitting this manuscript.

Literature Cited

Budowle, B., Chakraborty, R., Giusti, A. M., Eisenberg, A. J., and Allen, R. C. 1991. Analysis of the
VNTR locus D1S80 by the PCR followed by high-resolution PAGE. American Journal of Human
Genetics 48: 137 - 144.
Campbell, Neil. 1993. Page 401, in Biology. Third Edition. Benjamin/Cummings Publishing Company, Inc.
Redwood City, CA, 1190 pages.
Erlich, H. A. 1992. Pages 35-37, in PCR Technology W. H. Freeman and Co., NY, 196 pages.
Filikin, S. A., and Gelvin S. B. 1992. Effect of dimethylsulfoxide concentration on specificity of primer
matching in the polymerase chain reaction. BioTechniques 12: 828-830.
Garrison, S. J., and dePamphilis, C. 1994. Polymerase chain reaction for educational settings. The
American Biology Teacher 56 (8): 476 - 481.
Hochmeister, M. N., Budowle, B., Jung, J., Borer, U. V., Comey, C. T., and Dirnhofer, R. 1991. PCR-
based typing of DNA extracted from cigarette butts. International Journal of Legal Medicine 104: 229 -
223.
Kloosterman, A. D., Budowle, B., and Daselaar, P. 1993. PCR-amplification and detection of the human
D1S80 VNTR locus: amplification conditions, population genetics,and application in forensic analysis.
International Journal of Legal Medicine 105: 257 - 264.
Mullis, K. 1990. The unusual origin of the polymerase chain reaction. Scientific American, 262: 56-61.
PCR Fingerprinting 17
Nakamura, Y., Carlson, M., Krapcho, K., and White, R. 1988. Isolation and mapping of a polymorphic
DNA sequence (pMCT118) on chromosome 1p (D1S80) Nucleic Acids Research 16 (19): 9364.
National Research Council. 1992. DNA Technology in Forensic Science. Washington, D.C. National
Academy Press.
Sajantila, A., Budowle, B., Strom, M., Johnsson, V., Lukka, M., Peltonen, L., and Ehnholm, C. 1992.
PCR amplification of alleles at the D1S80 locus: comparison of a Finnish and a North American
Caucasian population sample, and forensic casework evaluation. American Journal of Human Genetics
50: 816 - 825.
Skowasch, K., Wiegand, P., and Brinkmann, B. 1992. pMCT118 (D1S80): a new allelic ladder and an
improved electrophoretic separation lead to the demonstration of 28 alleles. International Journal of
Legal Medicine 105: 165 - 168.
Weber, J. L. and May, P. E. 1989. Abundant class of human DNA polymorphisms which can be typed by
polymerase chain reaction. American Journal of Human Genetics 44 (3): 388-396.
18 PCR Fingerprinting
APPENDIX A
Recipes for reagents

0.5X TBE store at room temp.


45 mM Tris-borate pH 8.0
1 mM EDTA

Hair DNA Extraction Buffer store at +4° C


Amount Reagent Final Concentration
1.86 g KCl 50 mM KCl
0.61 g Tris 10 mM Tris
0.25 g MgCl2.6H2O 2.5 mM MgCl2,
0.05 g gelatin 0.1 mg/ml gelatin
2.25 ml NP40 0.45% NP40
2.25 ml Tween 20 0.45% Tween 20
pH to 8.3 at room temperature.
water to 500 ml and autoclave (will look white until it cools)

20X dNTPs store at -20° C


final concentration of this stock is 4 mM of each nucleotide

Primers store at -20° C


dilute each primer to 200 ng/ µl

Taq DNA polymerase store at -20° C


do not alter concentration, use as supplied by manufacturer
very temperature sensitive, do not leave out except to pipet

Proteinase K store at -20° C


dissolve in 1 ml of sterile water (10 mg/ml final concentration)
aliquot in 20 µl volumes; do not thaw and refreeze
add 0.6 µl for every 100 µl of extraction buffer

Molecular Weight Markers store at -20° C


make a stock solution of the 1 kb ladder (0.1 ug/ µl)
that contains a 1X concentration of loading dye
use 5 µl of the marker per lane

10 X loading dye store at +4° C


35% glycerol
0.25% bromophenol blue
0.25% xylene cyanol FF

ethidium bromide KNOWN MUTAGEN store at +4° C


10 mg/ml stock solution
use 1 µl for every 50 ml of buffer or gel
200 ng/ml final concentration in gel and buffer
PCR Fingerprinting 19
APPENDIX B
Sources for Reagents and Equipment

This is a list of the reagents and equipment we use but substitutes can be purchased from wide variety of
sources such as: Amresco, Fisher, Fotodyne, New England Biolabs, Pharmacia, Promega, and Boehringer
Mannheim.
Item Company Phone Number
thermocycler MJ Research 1-800 -729-2165
Taq DNA polymerase Promega #M1862 (in storage buffer A) 1-800 -356-9526
10X reaction buffer free from Promega
deoxynucleotides (dNTPs) Promega #U1240 (40 umoles each)
1 kb ladder Gibco BRL 1#15615-016 250 µg 1-800 -828-6686
nonidet P-40 Sigma # N-6507 1-800 -325-3010
Tween 20 Sigma # P-1379
proteinase K Sigma # P2308 (10 mg amount)
ethidium bromide Sigma # E-8751 KNOWN MUTAGEN
agarose (low EEO) Fisher # BP160-100 1-800 -766-7000
gelatin Sigma # G-9382
Extractor Scleicher and Schuell #448030 1-800 -245-4024
Primers see list below

There must be over 100 sources of oligonucleotides that can be used for PCR primers. We have used:
Retrogen 1-619-586-7918
National Biosciences 1-800-369-5118
Genset 1-619-551-6551

You want to have the oligos desalted and you should get a minimum of 5 OD units worth for each
primer. Currently, we use Geneset because the primers arrive in solution, the concentration of each primer is
written on the vial, and they charge about $1.80 per nucleotide and no set-up charges. A new and
inexpensive source that we have not tried yet is Universal DNA which charges $1.00 per nucleotide for
desalted oligos, no set-up charge, and 5 ODs [(800) 768-8744].
20 PCR Fingerprinting
APPENDIX C
Suggestions for Equipment Sources

We have found some places that sell particularly good equipment that can be recommended. Of course
there are plenty of other sources for equipment that are comparable, but if you are going to buy something
new, you might want to try these vendors.
1. Electrophoresis chambers - Jordan Scientific’s Gel-o-Submarine Electrophoresis Systems. They have
a very nice casting system that eliminates the need for taping the gel molds. They come in different sizes,
depending on your needs. (800) 222-2092
2. PCR machine - MJ Research’s PTC-100 cycler with heated lid (you do not need the temperature
probe). This unit is nice because it can go from 100° C to 0° C but does not use a compressor or oils which
can create some problems. It has a very small footprint and the new generation of heated lids can be
adjusted to ensure that microfuge tube lids cannot pop open. (800) 729-2165
3. Photo-documentation - Fotodyne has a wide range of systems that range from handheld models to
photostands, to video documentation systems that store images electronically and print on thermal paper.
Fotodyne is very good at supplying kits that contain every component you need but they also sell individual
components (e.g. UV light boxes, safety equipment, Polaroid cameras, filters, and films) (800) 362-3686
We have just learned about Kodak’s new EDAS system which is a digital camera attached to a hood
that fits over the UV light box. The images are then moved to either a Mac or PC and Kodak has
software that can analyze the data. To get hard copies, you can print the pictures either on a normal
laser jet printer, or Kodak sells printers for this as well. (800) 225-5352
4. Micropipets - Rainin brand “Pipetman”. This is still the industry standard and with two micropipetrs
(the P-20 and P-200), you can deliver volumes from 0.2 to 200 µl. The Pipetman, despite its name, is very
user-friendly and durable. Rainin also sells pipetrs (P-2) that specialize in very small volumes that are good
for delivering the 0.5 µl volume required for the hotstart PCR. However, this is not a requirement, and since
only one is needed for the instructor, it is a nice option that will not add significantly to your budget. (617)
935-3050

There are a number of other manufacturers of micropipets which are represented by Fisher, VWR,
Baxter, etc.
PCR Fingerprinting 21
APPENDIX D.
Potential Problems and Trouble Shooting

In the process of designing and trouble shooting this protocol, we have learned a few tips to facilitate
good results.
Make sure students are comfortable working with the micropipets. In our introductory labs, we have the
students pipet only three solutions: 100 µl of the extraction buffer, 15 µl of extracted DNA, and 10 µl of the
reaction buffer. We add the 0.5 µl of Taq DNA polymerase to the tubes, and make the common stock
solutions of extraction buffer with proteinase K, and the reaction mixture. If pipetting is a trouble spot, the
teacher should do all the pipetting.
Make sure students use fresh tips for every volume they pipet. Students want to conserve tips, but this
results in contaminated reagents.
Make sure the students do not add the reaction mixture to their entire 100 µl of extracted DNA; usually
happens about once per lab day.
Make sure students get the best possible hair follicles; this is the most common mistake. We offer to pluck
hairs from those with brittle hair. We use the tweezers and grip a few hairs very close to the scalp, near the
crown. A “good” follicle should be obvious from several feet away. African American hair follicles are more
difficult to distinguish visually since the hair and its follicle are equally pigmented. However, all “good”
follicles are always sticky. If a student cannot get a good follicle, we have use as many as 10 “bad” follicles
in one tube to extract as much DNA as possible. When the one hour extraction is complete, make sure the
students mix the contents of their tubes since the DNA tends to collect at the bottom of the tube (you can
see it go into solution). It is critical that the tube with the extracted DNA be shaken vigorously to ensure the
DNA is mixed into solution; it tends to accumulate at the bottom of the tube during the extraction process.
Care should be taken by working close (about 5 cm) to the bench top when cutting off the hair shaft, since
follicles tend to jump when cut free. We find it helpful to cut dark hair over white paper and light colored
hair over dark surfaces.
With the APOC2 locus, make sure the lids of the microfuge tubes do not pop open during the first 3 cycles.
This is especially a problem if any liquid was dispensed on the lip of the tube before it was closed. We
periodically check the microfuge tubes during the first three cycles by quickly lifting the heated lid of the
temperature cycler. We recommend that you set up a few extra PCR tubes for two reasons. First, it ensures
that every student will have some DNA to load even if their lid pops open. Second, if you are working on a
fabricated crime, use the evidence DNA in your extra tubes and exchange one of the extra tubes with a
student’s tube. This guarantees that at least one student will have identical bands to the evidence (figure 2).
Run the gels at a higher voltage for less time, only if time is limited since the resolution and clarity of the
bands are reduced compared to gels run at lower voltage for longer times. You will get more distinct bands
if the gels are run at 90 volts rather than higher voltages (e.g. 120 volts maximum).
During the first lab, we have a practice gel into which students load water mixed with 10X loading dye. This
allows them to make mistakes when there is no harm; for the next lab, they get only one chance to load their
PCR samples.
WARNING: ethidium bromide is a mutagen and should be handled carefully while wearing gloves. Use the
same concentration of ethidium bromide in the gel and in the running buffer. Differences in ethidium bromide
concentration will result in a gel that is half light and half dark, since the ethidium will electrophorese through
the gel in the opposite direction of the DNA.
If you do use oil, we recommend freezing the samples and removing the oil before adding the 10X loading
dye to the DNA solution.

1. Answers to questions in Student Handout:


22 PCR Fingerprinting
The figure is too easy because there is only a single band in each lane. Humans are diploids and
therefore should carry two alleles and it is unlikely that everyone involved would be homozygous.
The 95° C incubation during the DNA extraction is required to inactivate the proteinase K. Without this
step, the Taq DNA polymerase would be degraded during the PCR.
PCR Fingerprinting 23
APPENDIX E
Pouring and Running an Agarose Gel

One of the basic properties of DNA is that it is negatively charged, a consequence of ionization of its
many phosphate groups and the reason that the substance is an acid. Because they are acidic, molecules of
DNA in an aqueous solution will migrate towards the positive pole when exposed to an electric field.
Agarose gels are highly porous, with pore size varying inversely with concentration of agarose. Small
molecules of DNA can migrate through the pores relatively easily, while larger molecules migrate through
pores with some difficulty and are retarded in their movement. Thus agarose gel electrophoresis allows us to
separate molecules of DNA according to molecular size, usually represented as base pairs (bp) or kilobase
pairs (kb).
Once the samples have 2.5 µl of 10X loading dye added to them, they are ready to be loaded onto the
gel. It is important that a fresh tip be used for each sample to avoid contamination. The pipet tip must be
positioned over the well in the gel, the pipet tip dipped into the buffer just over the appropriate well and the
plunger very carefully depressed. Do not stick the pipet tip deep into the well because the tip’s opening may
get clogged with agarose or a hole may be created in the well. Glycerol in the loading dye will cause the
sample to sink to the bottom of the well. If there is air in the pipet tip, in front of the sample, it can be
expelled by carefully depressing the plunger to push the sample to the end of the tip before submerging the
tip in the buffer. (Air bubbles over the well may deflect the sample so that it does not fall into the well.) The
gel may be checked to determine if the bands of DNA have separated adequately by turning off the power
supply and removing the gel to the UV light box for observation. If the bands of DNA are not well
separated, the gel may be put back into the gel box for additional separation. Good separation will usually
have occurred when the indicator dye (bromophenol blue) has moved several centimeters from the wells.
The bromophenol blue should never be allowed to run off the end of the gel.

How to Pour an Agarose Gel

1. Seal off the ends of the gel mold with lab tape or other appropriate means. Use your fingernails to make
sure it is a good seal.
2. Put the comb into place and confirm that it is set for the proper depth (1-2 mm clearance).
3. Dilute the 5X stock of TBE so that you wind up with the desired volume of 0.5X TBE. For example:
50 ml of 5X TBE
450 ml water
500 ml total of 0.5 X TBE
4. Weigh the appropriate amount of agarose. For example, if you want a 50 ml gel of 1.5%, you would
weigh out 0.75 g of agarose (0.75 ÷ 50 = 1.5%).
5. Pour the agarose into a large flask (typically 2-5 times larger than the gel volume) along with the 50 ml
of buffer, swirl gently, and cover with saran wrap or a beaker.
6. Microwave the mixture for about 1 minute and 20 seconds.
7. Using insulated gloves, remove flask and swirl. Look to see if the agarose has begun to melt but is still
solid and translucent. Continue to microwave for 20 seconds and swirl until all the agarose is melted.
8. Now add in 1 µl of EtBr (10 mg/ml stock) for every 50 ml of agarose solution. For example, add 1.0 µl
for a 50 ml gel.
9. For these high percentage gels, you do not usually need to worry about leakage. Simply pour the molten
agarose and make sure the gel comb is in place.
10. Allow this to cool completely; it will turn white as it gels.
24 PCR Fingerprinting
11. Slowly and smoothly, remove the comb from the gel with one side (e.g. the left side) coming out slightly
before the other (the right side). Remove the tape from the mold and put the gel and the mold into gel
box.
12. With the remaining 0.5X TBE buffer, pour in enough buffer to just cover the gel and the wells. Now
add in 1 µl of EtBr (10 mg/ml stock) for every 50 ml of buffer in the gel box.
13. To load DNA onto a gel, set your pipettor for the appropriate volume.
14. Slowly remove the blue DNA mixture (assuming you have already added the required DNA loading
dye). Avoid getting bubbles in the pipet tip.
15. Slowly and smoothly pipet the blue mixture into the well (see figures below). Put the pipet tip into the
well but do not jab it into the agarose. The DNA loading dye will cause the mixture to sink.
16. Close the gel box and turn on the current (typically 90 volts). Verify direction and current. (An easy
way to remember which way the DNA will migrate is “DNA Runs Red”; it migrates to the red
electrode.)

Figure 1.7. Diagrams depict the proper way to load DNA samples into agarose gels. Reprinted with
permission from Cold Springs Harbor Laboratory Press. From: DNA Science: A first course in
recombinant DNS technology. By David A. Micklos and Greg A. Freyer, 1990, Cold Springs Harbor
Laboratory Press, USA, pages 263-264/
PCR Fingerprinting 25
APPENDIX E
Photographing Gels

Given that we can separate DNA molecules in an agarose gel, we need to visualize these molecules to
determine how far they have moved through the gel. This is accomplished by “staining” the molecules of
DNA with some compound having an affinity for DNA. We routinely stain DNA with ethidium bromide, a
highly planar molecule that intercalates between base pairs in DNA. When subjected to UV irradiation,
ethidium fluoresces orange-red, allowing us to visualize DNA in the gel. We then make a copy of the gel
using a Polaroid camera and use a photocopier with enlargement capabilities to make a print for each
student. Our students collect their data directly from this photocopy.
When we have determined that our DNA samples have separated adequately, we photograph our gel.
We obtain excellent photographs using the versatile Polaroid M4 photographic system. However, very
good photographs can be obtained using a hand-held Polaroid camera. The latter system has only one focal
length, but is less expensive to purchase. Since the gels and the running buffer contain ethidium bromide,
caution must be taken to wear gloves when handling gels.
The gel is removed from the gel box and placed on the UV transilluminator. While 1.5% agarose gels
are firm enough to remove from the tray and to place back on the tray after visualization, they are sippery
and need to be handled carefully. Type 667 (ASA 3000) film is used to make a photographic copy of the
gel. Excellent photographs are obtained using the orange filter that is part of the camera package with the
aperture set at f/8 and the shutter speed set at 1/4 second. You may adjust these setting to meet your
individual preferences. Once all the photographs have been taken for a laboratory section, they can be
enlarged en masse so each student can have a copy of all the data.
26 PCR Fingerprinting
APPENDIX F
Calculating Molecular Weights of DNA bands

We have found photocopies of gels to be convenient when measuring migration distances of DNA in
agarose gels. We measure from the front of the well to the front of each band of DNA. With a little
practice, one can quickly learn to estimate fractions of millimeters. It is important to remember that each gel
must contain at least one lane of molecular weight marker DNA and that molecular weight marker DNA on
one gel may not be used with data from a second gel. In other words, each gel must contain its own
molecular weight marker.

Calculating the Molecular Weights of the PCR Products

We use three sequential steps when teaching our students to analyze gels (see the three graphs below
for examples of student data). First, we have students plot their data using normal graph paper. They plot
the size of the molecular weight marker DNA fragments in base pairs, versus migration distances of those
fragments. Next we have them use semi-log graph paper to graph the same data. After mastering semi-log
plots, we use standard graph paper again but plot sizes of fragments as log10 base pairs versus migration
distances. Of course, these second two graphs are not different from the first graph, but some students need
time to recognize the relationship between these three ways of managing the same data. It is important to
remember that the migration distance of a molecule moving through a gel is proportional to the log10 of its
molecular weight. Threfore, the last two graphs should provide the students with a straight line. Lastly, we
have students use the regression program in their calculators to do these chores (see Table I for the
regression program for a TI-35X calculator). We find that students need to draw and visualize graphs
several times before using calculators effectively. They need to “know” what their machine is really doing.
When our students first perform these experiments, they invariably ask “Why are my data wrong?” or
“Why didn’t I get the right answer?” This becomes an ideal situation for teaching students by letting them
answer their own questions. We suggest to our students that they determine just how “bad” their
estimations really are. They will determine that their estimates usually vary less than ten per cent from the
actual size of the fragments. If necessary, we point out that 90 per cent accuracy on a test or exam might be
very acceptable. This leads our analysis to a discussion of sources of experimental error and precision of
techniques.

Practice Data Used to Generate Regression Analysis and 3 Standard Curves


Base Pairs Log10 Distance Migrated (mm)
6557 3.8167 20
4361 3.6396 23.8
2322 3.3659 28.3
2027 3.3069 30.8
564 2.7513 44
PCR Fingerprinting 27

Table I: Regression analysis for model TI-35X calculator to determine sizes of DNA fragments
separated by agarose gel electrophoresis.

Procedure View
1. Press: 3rd, Stat 2 0
2. Press: 2nd, CSR 0
3. Press: 3.8167, X<-->Y, 20, + 1
4. Press 3.6396, X<-->Y, 23.8, + 2
5. Press 3.3659, X<-->Y, 28.3, + 3
6. Press 3.3069, X<-->Y, 30.8, + 4
7. Press 2.7513, X<-->Y, 44, + 5
8. Press 3rd, COR -0.996339584

To determine the molecular weights of bands (in bp) using the standard curve from above, one would
need the distances traveled by the different DNA bands. Below is a series of calculations for several
different sized bands (data not shown). The distances each band migrated is the number which follows the
word “Press”.

Procedure View
Lane 2. Press 28 (distance in mm), 2nd, X’, 2nd, 10x 2737 (bp)
Lane 3. Press 23, 2nd, X’, 2nd, 10x 4567 (bp)
Lane 4. Press 23, 2nd, X’, 2nd, 10x 4567 (bp)
Lane 5. Press 23, 2nd, X’, 2nd, 10x 4567 (bp)
Lane 6. Press 24.4, 2nd, X’, 2nd, 10x 3957 (bp)
Press 39.5, 2nd, X’, 2nd, 10x 844 (bp)
Lane 7. Press 27.5, 2nd, X’, 2nd, 10x 2882 (bp)
Press 30.3, 2nd, X’, 2nd, 10x 2164 (bp)
Lane 8. Press 25.2, 2nd, X’, 2nd, 10x 3646 (bp)
Press 34.7, 2nd, X’, 2nd, 10x 3679 (bp)
Lane 9. Press 28, 2nd, X’, 2nd, 10x 2738 (bp)
Press 35, 2nd, X’, 2nd, 10x 1338 (bp)
Press 39, 2nd, X’, 2nd, 10x 888 (bp)

Key to symbols and abbreviations:


CSR = Clearing Statistical Registers X’ = 1st deduced value for X in log MW
COR = CORrelation X⇔Y = exchange key for dependent and
independent variables
28 PCR Fingerprinting

Figure 1..8. Three graphs, generated with a graphing program, depicting the same data (see text
above) plotted three different ways. The top graph uses regular graph paper to plot the distance
each band migrated (x-axis) as a function of its molecular weight (y-axis). The middle graph uses
semi-log paper to generate a straight line with a correlation of 0.991, which is identical to the
correlation in the top graph. The bottom graph uses regular graph paper again and plots the
distance migrated as a function of the log10 of the molecular weight with a correlation of 0.998.
Students can generate similar plots by hand on the appropriate graph paper.
PCR Fingerprinting 29
APPENDIX H
Photographs of Gels Obtained from Student Labs

Figure 1.9. The top two gels are 14 different sources of DNA templates analyzed at the D1S80
locus. The bottom two gels are the same 14 different samples analyzed at the APOC2 locus.
30 PCR Fingerprinting
APPENDIX I
Molecular Weight Markers (one KB Ladder on 1.5% Gel)

Figure 1.10. Photograph of one KB molecular weight markers that were electrophoresed on a 1.5%
agarose gel. The molecular weights (in kilobases or base pairs) are listed next to the appropriate
bands.
PCR Fingerprinting 31
APPENDIX J
Checklist For Equipment and Reagents

agarose: (low EEO) Fisher #BP160-100 or equivalent


proteinase K Sigma # P2308 10 mg
5X TBE:
micropipets (P200 and P20): x4 or more for each size
yellow tips
parafin oil: grocery store quality (only needed if PCRmachine does not have heated lid)
parafilm: 4” roll
toothpicks: grocery store qualitye
tweezers: drugstore quality
microfuge tubes: (500 ul) (1.5 ml) for preparation of stock solutions
microfuge tubes: (1.5 ml) for preparation of stock solutions
photo setup and UV box: Polaroid is good
microwave: standard, should hold 250 ml flasks
250 ml flasks
saran wrap: 5 ft long or more
hot gloves
ethidium bromide solution: (10mg/ml stock) - 1 ml
balance: (0.01 - 10 gram range minimum)
weigh paper
small spatulas
distilled water
graduated cylinders: 1 liter and 100 ml
lab tape: Fisher # 11-880-20F
PCR machine that holds 500 µl microfuge tubes
VWR lab markers: (black; extra fine tips) #52877-150
microfuge tube racks
gel molds, boxes and power supplies
crushed ice and ice buckets
microfuge (nice to have but optional)
-20° C freezer (preferably frost free) and +4° C refrigerator

You might also like