(2024.06.08) Heptathelinae - Zmiana Statusu Do Podrodziny

Zoological Journal of the Linnean Society, 2024, 201, 339–357
https://doi.org/10.1093/zoolinnean/zlad149
Advance access publication 8 November 2023
Original Article
Original Article
Molecular phylogeny, biogeography, and species delimitation
of segmented spider genus Liphistius (Araneae: Liphistiidae)
in Thailand
Varat Sivayyapram1, Chawakorn Kunsete1, Xin Xu2, , Deborah R. Smith3, Prapun Traiyasut4,
Sureerat Deowanish1, Daiqin Li5, Natapot Warrit1,6,*,
1
Center of Excellence in Entomology and Department of Biology, Faculty of Science, Chulalongkorn University, Bangkok 10330, Thailand
2
College of Life Sciences, Hunan Normal University, Changsha, Hunan 410081, China
3
Department of Ecology & Evolutionary Biology, Haworth Hall, 1200 Sunnyside Avenue, University of Kansas, Lawrence, KS 66045, USA
4
Program in Biology, Faculty of Science, Ubon Ratchathani Rajabhat University, Ubon Ratchathani, Thailand
5
Department of Biological Sciences, National University of Singapore, 14 Science Drive 4, Singapore 117543
6
Department of Biomedical Science and Environmental Biology, Kaohsiung Medical University, Kaohsiung 80708, Taiwan
Corresponding author. Center of Excellence in Entomology and Department of Biology, Faculty of Science, Chulalongkorn University 254 Phayathai Road, Wangmai
*
Subdistrict Pathumwan District, Bangkok 10330, Thailand. E-mail: natapot.w@chula.ac.th
ABSTR ACT
Mesothelae, or primitively segmented trapdoor spiders, form the most basal clade among living spiders. In Southeast Asia, Liphistius is the only
genus recognized in the extant family Liphistiidae. Liphistius taxonomy and species identification are based largely on characters of the geni-
talia; however, the female genitalia show high intraspecific variation, males are rarely collected, and the phylogenetic relationships among the 69
described Liphistius species are unresolved. Here, we focused on the Liphistius of Thailand, including 37 described and numerous undescribed
species in four species groups. We generated sequences from five loci (COI, 16S, H3, 28S, and ITS2) for 162 specimens from 52 sites in Thailand
and Myanmar to reconstruct phylogenetic relationships, infer historical biogeography, and delimit species. The five-locus data set resolved nearly
all species and species group relationships and was mostly congruent with morphology-based classifications. Ancestral area reconstruction sug-
gested that Liphistius originated in Sibumasu (Siam–Burma–Malaysia–Sumatra) and diversified into several species groups, four (birmanicus,
bristowei, linang, and trang) of which are found in Thailand. Speciation within Liphistius occurred in the area corresponding to their current dis-
tribution. All delimitation methods tested (ASAP, GMYC, PTP, STACEY and BFD) delimited specimens from discrete locations as separate spe-
cies; variation in the number of species proposed (ranging from 53 to 72) stemmed from variation in delimitation of sympatric cryptic species.
Keywords: Mesothelae; living fossil; taxonomy; systematics; biogeography; species delimitation
INTRODUCTION The female spiders spend most of their lives in their burrows,
The primitively segmented spiders (Mesothelae: Liphistiidae) whereas the mature males abandon their burrows for mating
can be distinguished from all other living spiders by the pres- purposes (Haupt 2003). Liphistiids are long-lived; members of
ence of abdominal tergites and the position of their spinnerets some species have survived > 15 years in the laboratory (Haupt
on the median area of the ventral abdomen. They are considered 2003). Most species can be found in vertical or steeply sloped
the most basal group of all living spiders, because they retain ex- earthen banks shaded by trees. Some species have also been re-
ternal morphology similar to that of Palaeothele montceauensis ported from limestone caves. Liphistiids seem to have low dis-
(Selden, 1996), an early spider from the Carboniferous period persal ability, because most species are known from a single
(Selden 1996), in addition to many plesiomorphic traits found location (data in the World Spider Catalog 2023), and bal-
in other tetrapulmonate orders (Platnick and Gertsch 1976). looning dispersal has not been reported for these spiders.
All liphistiids are solitary burrowing spiders. They construct Liphistiidae are divided into two geographically separ-
their burrow individually, with a ‘trapdoor’ lid at the entrance. ated subfamilies: Liphistiinae, with a single genus, Liphistius,
Received 4 April 2023; revised 20 June 2023; accepted 6 September 2023

© The Author(s) 2023. Published by Oxford University Press on behalf of The Linnean Society of London. All rights reserved. For commercial re-use, please contact reprints@oup.com
for reprints and translation rights for reprints. All other permissions can be obtained through our RightsLink service via the Permissions link on the article page on our site—for further
information please contact journals.permissions@oup.com.
340 • Sivayyapram et al.
primarily restricted to Southeast Asia and southwestern China analysis using either morphological or molecular data until
(Yunnan), and Heptathelinae, with seven genera endemic 2019. Schwendinger et al. (2019) provided the first molecular
to east Asia. Among other traits, the subfamilies differ in the phylogeny for Liphistius based on cytochrome c oxidase sub-
number of spinnerets (eight in Liphistiinae and seven or eight unit I (COI) data, focusing on Malaysian taxa. However,
in Heptathelinae) and nest structure. Recently, Li (2022) pro- the results did not resolve interspecific relationships within
posed raising the two groups to family status, without providing Liphistius. In Thailand, 37 Liphistius species are known from
evidence other than reciprocal monophyly of the two groups. localities throughout the country; they are classified into the
Here, we continue the use of the two-subfamily classification ac- birmanicus group (Liphistius lahu Schwendinger, 1998 and
cording to their morphological synapomorphies and their eco- Liphistius metopiae Schwendinger, 2022), bristowei group (six
logical and behavioural homogeneity (see also Breitling 2022). species), the linang group (Liphistius indra Schwendinger,
Before the use of molecular data, most genera of the 2017), the trang group (27 species), and one incertae sedis spe-
Heptathelinae were synonymized and resurrected several times cies (Liphistius jarujini Ono, 1988) (Sivayyapram et al. 2017,
(World Spider Catalog 2023). The most recent morphology- Schwendinger et al. 2019, 2022, Zhan et al. 2022, World Spider
based classification grouped all mainland heptathelids within Catalog 2023).
Heptathela, with the genus Ryuthela represented by island In recent years, the use of molecular data in species delimita-
populations (Schwendinger and Ono 2011). More recently, tion has increased in popularity. Several methods have been de-
the Liphistiidae and the heptathelines have been the subject of veloped for delimiting species with either single- or multi-locus
several molecular phylogenetic studies. The first study (Xu et al. data. Molecular-based delimitation methods have advantages
2015c) suggested non-monophyly of Heptathela s.l., which was over classical morphology-based delimitation in cases of mor-
later divided into six monophyletic genera (Xu et al. 2015b). phologically cryptic species and in identification of males and
Recently, a phylogenomic study of Liphistiidae using ultra- females of sexually dimorphic organisms (Fourie et al. 2015,
conserved elements (Xu et al. 2021) provided further support Freitas et al. 2018). Here, we use multi-locus data sets based on
for monophyly of Liphistiidae, Liphistiinae, Heptathelinae, and mitochondrial COI and 16S ribosomal DNA (16S), and nuclear
all genera, and indicated that Neogene diversification within histone 3 (H3), 28S ribosomal DNA (28S), and internal tran-
each genus occurred in the areas corresponding to their present- scribed spacer 2 (ITS2) for phylogenetic reconstruction to test
day distribution. Liphistius species from Myanmar and Malaysia the monophyly of species groups and investigate interspecific re-
were placed at the basal node of the taxa from Thailand (Xu et lationships in the Liphistius phylogeny. In addition, we delimit
al. 2021). Other molecular studies have been used to study the the Liphistius species in Thailand and infer Liphistius biogeog-
systematics, species delimitation, and biogeography of many raphy with ancestral area reconstruction.
taxa within Heptathelinae (Xu et al. 2015a, c, 2016, 2017, 2018,
2020).
Unlike its sister taxon, the taxonomy of Liphistius (Liphisti M ATERIALS AND METHODS
inae) is still based mostly on morphology, despite being highly
conserved. Nearly all species share similar external morphology, Study area
and aspects of the genitalia are the primary characters used for Thailand includes parts of two biodiversity hotspots:
delimiting species. However, the female genitalia usually show Sundaland and Indo-Burma (Myers et al. 2000). Geologically,
high intraspecific variation, and the adult males are rarely col- it is widely accepted that Thailand consists of two prin-
lected. Therefore, assessing species diversity of Liphistius is dif- cipal continental terranes, Siam–Burma–Malaysia–Sumatra
ficult using morphology alone. Currently, Liphistius includes (Sibumasu) in the west and Indochina in the east (Kamata
69 described species (World Spider Catalog 2023) and can be et al. 2009) (Fig. 1). Recent geological studies propose sev-
distinguished from the genera in Heptathelinae by the charac- eral new tectonic divisions within these areas (Metcalfe 2013,
ters mentioned above and by the presence of a tibial apophysis 2017, Zaw et al. 2014).
in the male pedipalp; the poreplate or plate-like spermatheca in
the female; and by their nest structure, which includes ‘signal Collections and species identification
lines’, which are unique thick silk lines radiating from the Liphistius specimens were collected from 2017 to 2021 from
burrow entrance (Platnick and Sedgwick 1984, Xu et al. 2015b). 52 localities throughout Thailand and Dawei State, Myanmar,
Liphistius species are currently known from southwestern China including specimens from both Sibumasu and Indochina
(Yunnan), Indonesia (Sumatra), Laos, Malaysia, Myanmar, and terranes (Fig. 1; Table 1; Supporting Information, File S1). All
Thailand. In addition, several still-undescribed species have been specimens were collected alive by excavating them from their
reported from the currently known range of the genus and from burrows. Adult specimens were preserved in 95% ethanol and
Cambodia (undescribed Cambodian Liphistius species reported stored at −20°C for subsequent molecular studies. Juvenile spe-
by Schwendinger 2013). cimens were reared at the Department of Biology, Faculty of
Liphistius has been classified into seven species groups based Science, Chulalongkorn University, Thailand until adulthood or
on their morphology: batuensis, birmanicus, bristowei, linang, death and preserved in a similar manner.
malayanus, tioman, and trang groups (Schwendinger 1990, Specimens were assigned to species using the following cri-
2017). In addition, the large trang group was subsequently teria. Adult spiders were identified based on their morphology
divided into six subgroups, A–F (Schwendinger et al. 2019). and genitalia using available literature in the World Spider
This classification system was not tested with a phylogenetic Catalog (Schwendinger 1987, 1990, 1995, 1996, 1998, 2009,
Segmented spider genus Liphistius • 341
Figure 1. Distribution map of Liphistius. A, sample collection localities. Numbered collection locations correspond to those in Table 1.
B, geological terrain: Sibumasu in the west (purple) and Indochina in the east (blue).
Table 1. Collecting localities with GPS coordinates, species and species group identification, and geological classification.
No. Localities Latitude Longitude Altitude (m) Sample identify Geological Areas
terrains
birmanicus group:
1 Mae Sun, Fang District, Chiang Mai 19.86°N 99.05°E 1646 Liphistius lahu Sibumasu C
bristowei group:
2 Kuet Chang, Mae Taeng District, Chiang 19.32°N 98.60°E 1545 Liphistius lannaianus Sibumasu C
Mai
3 Suthep, Mueang Chiang Mai District, 18.80°N 98.90°E 1110 Liphistius bristowei s.l. Sibumasu C
Chiang Mai
4 Tha Pha, Mae Chaem District, Chiang 18.51°N 98.48°E 1428 Liphistius bristowei s.l., Sibumasu C
Mai Liphistius yamasakii
5 Mae Koeng, Wang Chin District, Phrae 17.97°N 99.59°E 389 Liphistius sp. WKS Sibumasu F
6 Mae Tho, Mueang Tak District, Tak-A 16.79°N 98.92°E 881 Liphistius jarujini Sibumasu D
7 Mae Tho, Mueang Tak District, Tak-B 16.72°N 98.97°E 967 Liphistius marginatus Sibumasu D
8 Wang Nam Yen, Wang Chao District, Tak 16.64°N 99.02°E 868 Liphistius marginatus Sibumasu D
9 Pang Ta Wai, Pang Sila Thong District, 16.09°N 99.12°E 1250 Liphistius maewongensis Sibumasu D
Kamphaeng Phet
10 Rabam, Lan Sak District, Uthai Thani 15.61°N 99.32°E 214 Liphistius sp. HKK Sibumasu D
11 Nong Lu, Sangkhlaburi District, 15.22°N 98.37°E 197 Liphistius sp. Sangkraburi Sibumasu A
Kanchanaburi-A
12 Nong Lu, Sangkhlaburi District, 15.16°N 98.34°E 183 Liphistius sp. Sangkraburi Sibumasu A
Kanchanaburi-B
13 Pilok, Thong Pha Phum District, 14.69°N 98.40°E 938 Liphistius sp. TPP Sibumasu A
Kanchanaburi
14 Pa Kar Ri, Dawei, Myanmar 14.10°N 98.30°E 39 Liphistius sp. DW Sibumasu A
trang group:
15 Noen Phoem, Nakhon Thai District, 17.00°N 101.01°E 1238 Liphistius onoi Indochina H
Phitsanulok
16 Sap Sawang, Nam Nao District, 16.74°N 101.58°E 859 Liphistius pusohm Indochina H
Phetchabun
17 Tat Ton, Mueang Chaiyaphum, 15.98°N 102.04°E 285 Liphistius sp. TT Indochina H
Chaiyaphum
18 Huai Yang, Mueang Sakon Nakhon 17.10°N 103.97°E 308 Liphistius isan Indochina H
District, Sakon Nakhon
19 Nong Pla Lai, Mueang Saraburi District, 14.44°N 100.96°E 98 Liphistius sp. SL Indochina G
Saraburi
20 Wang Phae, Kaeng Khoi District, 14.53°N 101.04°E 74 Liphistius sp. CPP Indochina H
Saraburi
21 Mittraphap, Muak Lek District, Saraburi 14.58°N 101.15°E 280 Liphistius tham Indochina H
22 Chet Khot, Kaeng Khoi District, Saraburi 14.47°N 101.17°E 201 Liphistius sp. CK Indochina H
23 Sarika, Mueang Nakhon Nayok District, 14.34°N 101.30°E 157 Liphistius sp. WTK Indochina H
Nakhon Nayok
24 Mu Si, Mueang Nakhon Nayok District, 14.44°N 101.37°E 754 Liphistius thoranie Indochina H
Nakhon Nayok
25 Na Hin Lat, Pak Phli District, Nakhon 14.37°N 101.41°E 1171 Liphistius thoranie Indochina H
Nayok
26 Udom Sap, Wang Nam Khiao District, 14.51°N 101.93°E 372 Liphistius sp. SKR Indochina H
Nakhon Ratchasima
27 Na Chaluai, Na Chaluai District, Ubon 14.44°N 105.27°E 354 Liphistius dangrek Indochina H
Ratchathani
28 Bang Phra, Si Racha District, Chon Buri 13.24°N 101.05°E 326 Liphistius sayam Indochina D
29 Pluang, Khao Khitchakut District, 12.84°N 102.12°E 79 Liphistius ornatus Indochina G
Chanthaburi
Table 1. Continued
No. Localities Latitude Longitude Altitude (m) Sample identify Geological Areas
terrains
30 Phe, Mueang Rayong District, Rayong 12.57°N 101.45°E 69 Liphistius phileion Indochina D
31 Phliu, Laem Sing District, Chanthaburi 12.53°N 102.18°E 116 Liphistius tenuis Indochina G
32 Ko Chang, Ko Chang District, Trat 12.11°N 102.27°E 84 Liphistius nesioticus Indochina G
33 Tha Kradan, Si Sawat District, 14.37°N 99.14°E 272 Liphistius erawan s.l. Sibumasu A
Kanchanaburi-A
34 Tha Kradan, Si Sawat District, 14.39°N 99.13°E 229 Liphistius erawan s.l. Sibumasu A
Kanchanaburi-B
35 Tha Sao,Sai Yok District, Kanchanaburi-A 14.38°N 98.93°E 380 Liphistius erawan s.l. Sibumasu A
36 Tha Sao, Sai Yok District, 14.24°N 99.06°E 158 Liphistius erawan s.l. Sibumasu A
Kanchanaburi-B
37 Wang Krachae, Sai Yok District, 14.20°N 99.02°E 510 Liphistius sp. TNL Sibumasu A
Kanchanaburi
38 Suan Som, Thap Sakae District, Phra 11.57°N 99.54°E 108 Liphistius albipes Sibumasu A
Chaup Khirikhan
39 Na Sak, Sawi District, Chumphon 10.23°N 98.95°E 48 Liphistius keeratikiati Sibumasu A
40 Na Kha, Suk Samran District, Ranong 9.46°N 98.50°E 52 Liphistius bicoloripes, Sibumasu B
Liphistius castaneus,
Liphistius schwendingeri s.l.
41 Krung Ching, Nopphitam District, 8.72°N 99.67°E 248 Liphistius niphanae Sibumasu B
Nakhon Si Thammarat
42 Khlong Ya, Ao Luek District, Krabi 8.35°N 98.9°E 129 Liphistius sp. KPN Sibumasu B
43 Mueang Krabi District, Krabi 8.24°N 98.92°E 307 Liphistius fuscus Sibumasu B
44 Khanaen, Thalang District, Phuket 8.03°N 98.36°E 89 Liphistius phuketensis Sibumasu B
45 Chong, Na Yong District, Trang 7.55°N 99.79°E 161 Liphistius trang Sibumasu B
46 Lam Khlaeng, Palian District, Trang 7.29°N 99.88°E 89 Liphistius sp. T Sibumasu B
47 Lang Khao, Kantang District, Trang 7.27°N 99.38°E 37 Liphistius thaleri Sibumasu B
48 Kho Hong, Hat Yai District, Songkhla 7.04°N 100.51°E 162 Liphistius hatyai Sibumasu B
49 Chalung, Hat Yai District, Songkhla 6.95°N 100.24°E 167 Liphistius yangae s.l. Sibumasu B
50 Wang Prachan, Khuan Don District, 6.71°N 100.17°E 174 Liphistius yangae s.l. Sibumasu B
Satun
Rayong, Thailand (GPS unavailable, - - - Liphistius cf. ornatus Indochina D
Not show on the map)
linang group:
51 Sai Khao, Khok Pho District, Pattani 6.66°N 101.10°E 83 Liphistius indra Sibumasu E
2017, Ono 1988a, b, Ono and Schwendinger 1990, Sivayyapram multi-locus analyses, we used sequences from one member
et al. 2017, Schwendinger et al. 2019, 2022, Zhan et al. 2022). of each of the seven heptatheline genera as outgroups
Juvenile specimens from previously known localities were as- (Xu et al. 2015c). In the single-gene analysis, we also in-
sumed to be of the same species as previously described from the cluded COI sequences from a primarily Malaysian data
location, whereas specimens first collected from a new locality set (Schwendinger et al. 2019), which included four puta-
were treated as putative new species. tive species from the malayanus group (two described and
Our collections include most of the known Liphistius species two undescribed) and four species from the trang group
from Thailand. This includes most of members of the bristowei (Liphistius murphyorum Platnick & Sedgwick, 1984, Liphistius
group species (five described species and six undescribed species), desultor s.l. Schiødte, 1849, Liphistius laruticus Schwendinger,
24 of the 33 described trang group species plus 11 undescribed 1997, and Liphistius laoticus Schwendinger, 2013)
trang group species, one of the 12 known species of the birmanicus in addition to our Thai and Myanmar specimens.
group, and one of the two members of the linang group. The
batuensis, malayanus, and tioman groups are found in Malaysia or DNA extraction and PCR amplification
Sumatra Island, Indonesia, and were not collected in this study. The spider genomic DNA was extracted from leg muscle tissue
Our analyses also included sequences downloaded from of 162 specimens using TIANamp Genomic DNA Kit (Tiangen
GenBank (see Supporting Information, File S1). In the Biotech, Beijing, China). Standard PCR was used to amplify the
five DNA loci previously used by Xu et al. (2015c): two mito- Phylogenetic reconstruction
chondrial loci (COI and 16S) and three nuclear loci (H3, 28S Single-locus phylogeny based on COI
and ITS2) (Table 2; Supporting Information, File S2).
To determine the utility of the COI barcoding sequence for re-
Sequence alignment and data partition solving phylogenetic relationships within Liphistius, we com-
bined our original COI alignment with the COI sequences used
Sequencing chromatograms were checked and edited manually
by Schwendinger et al. (2019), obtained from GenBank, to give
using MEGA11 (Tamura et al. 2021). For protein-coding genes,
more complete taxon sampling. Phylogenetic analyses were con-
alignments were translated to amino sequences to check for stop
ducted using Bayesian inference (BI) and maximum likelihood
codons and to ensure proper reading frames, then aligned using
(ML) methods.
MUSCLE in MEGA11. For non-protein-coding markers, DNA
For BI, the analyses were conducted using MrBayes v.3.2.6
sequences were aligned using the online version of MAFFT v.7
(Ronquist et al. 2012). Posterior probabilities (pp) were esti-
(Katoh and Standley 2013) with Q-INS-I methods (the sec-
mated using Markov chain Monte Carlo (MCMC) sampling,
ondary structure of RNA was considered for alignment). The re-
running two simultaneous independent chains for 10 million
trieved alignments of each gene were trimmed and concatenated
generations, sampled every 1000 generations; 10% of initial
using MEGA11 (hereafter ‘full partition’). Seven heptatheline
samples were discarded as burn-in. The best-fitting substitution
taxa used by Xu et al. (2015c) were obtained from GenBank
model was selected using Markov chain sampling over the GTR
and included in the alignment as an outgroup for rooting phylo-
model space; among-site rate variation was inferred with the
genetic trees. To determine the effect of indels in non-protein-
MrBayes command nst = mixed rates = invgamma.
coding loci on the phylogenetic tree, the retrieved alignments
Maximum likelihood analyses were conducted using IQ-
of non-protein-coding regions were pruned using an online ver-
TREE v.2 (Minh et al. 2020). Node supports were calculated
sion of Gblock (Castresana 2000) to detect and remove am-
using ultrafast bootstrapping with 1000 replications. The best-
biguous regions in the alignments and construct an alternative
fitting substitution model was selected using ModelFinder
data matrix (hereafter ‘Gblock partition’) for comparison with
(Kalyaanamoorthy et al. 2017) in IQ-TREE v.2.
the full partition.
For species delimitation, COI sequences were used for Multi-locus phylogeny using five genes
single-locus alignment from 161 individuals from Thailand and
Myanmar, representing 46 morphology-based putative species Bayesian inference and ML analyses were used to reconstruct a
(29 described and 17 undescribed). The multi-locus data set phylogeny from the ‘full gene partition’ and the ‘Gblock par-
was applied for both species delimitation and biogeographical tition’. The phylogenetic reconstruction and substitution model
analyses using concatenated alignment of all five loci, including selection for each marker followed the same procedure as for the
COI (161 sequences, 579 bp), 16S (168 sequences, 316 bp), COI phylogeny.
H3 (146 sequences, 241 bp), 28S (159 sequences, 630 bp), and
ITS2 (161 sequences, 245 bp), totalling 2011 bp. These repre- Species delimitation
sent 169 individuals, including 162 Liphistius from Thailand and The COI and multi-locus phylogenies were reconstructed using
Malaysia and seven sets of sequences taken from GenBank (Xu BEAST2 with strict clock model and Yule prior; the posterior
et al. 2015c) representing the seven heptatheline genera (for probabilities were sampled with MCMC sampling every 5000
species, locality information, and GenBank accession numbers, generations and run for 50 million generations. The best-fitting
see Supporting Information, File S1). substitution model for each locus was selected with the BEAST
Table 2. Primers used and their annealing temperatures.

Gene Primer Sequence (5ʹ–3ʹ) Annealing temperature (°C) Reference
CO1 LCO1490 GGTCAACAAATCATAAAGATATTGG 40 Folmer et al. (1994)
HCO2198 TAAACTTCAGGGTGACCAAAAAATCA 40 Folmer et al. (1994)
16S 16Sar ATAGAGCTCCCATGGCGCCTGTTTAT 54 Huber et al. (1993)
CAAAAACAT
16Sbr ATAGAGCTCCCATGGCCGGTCTGAA 54 Huber et al. (1993)
CTCAGATCACGT
ITS2 ITS-5.8S GGGACGATGAAGAACGCAGC 47 White et al. (1990)
ITS-28S TCCTCCGCTTATTGATATGC 47 White et al. (1990)
28S 28S-O GAAACTGCTCAAAGGTAAACGG 55 Hedin and
Maddison (2001)
28S-C GGTTCGATTAGTCTTTCGCC 55 Hedin and
Maddison (2001)
H3 H3aF ATGGCTCGTACCAAGCAGACVGC 50 Colgan et al. (1998)
H3aR ATATCCTTRGGCATRATRGTGAC 50 Colgan et al. (1998)
Model test. The phylogenetic trees were used in generalized setting for the remaining parameters. We ran path sampling ana-
mixed Yule coalescent (GMYC) and Poisson tree process (PTP) lyses for three replicates, then used average marginal likelihood
delimitation (COI and multi-locus tree) and the ancestral area to determine the best delimitation scenarios.
reconstruction analyses (multi-locus trees).
Biogeographical analyses
Single-locus species delimitation To infer the ancestral distribution area of Liphistius, the geo-
The COI alignment was used to delimit Liphistius species with graphical distribution of living segmented spiders was div-
Assemble Species by Automatic Partitioning (ASAP; Puillandre ided into eight discrete areas: (A) Mainland Sibumasu; (B)
et al. 2021), the GMYC model (Pons et al. 2006, Monaghan et Peninsular Sibumasu; (C) Inthanon region; (D) Central basin;
al. 2009, Fujisawa and Barraclough 2013), and the PTP model (E) Bentong–Reaub suture zone; (F) Sukhothai terrain; (G)
(Zhang et al. 2013). Chantaburi region; (H) Indochina terrain, based on the study
ASAP was conducted on the ASAP web server (https:// by Metcalfe (2017); and (I) East Asia (the distributions of all
bioinfo.mnhn.fr/abi/public/asap/asapweb.html) with three heptatheline taxa combined into a single area) (Figs. 1 and 4B
substitution models: simple-distance (p-distance), JC69 ( Jukes and Table 1). We used latitude 10°N in the Isthmus of Kra to
and Cantor 1969), and K2P (Kimura 1980). Each analysis was divide Sibumasu terrain into two discrete areas, because this
run for 10 replicates to test the consistency of the results. boundary seems to play an important role in the distributions
For GMYC delimitation, the time-constrained phylogeny was of many organisms, e.g. Apis cerana Fabricius, 1793(Smith et
analysed using ‘split’ packages (Ezard et al. 2009) in the program al. 2000, Warrit et al. 2006), reptiles (Pauwels et al. 2003), and
R with ‘single’ (sGMYC) and ‘multiple’ (mGMYC) thresholds. others (Parnell 2013).
The PTP delimitation was conducted on https://mptp.h- Ancestral state reconstruction was carried out using the
its.org/ with single (sPTP; P = .001) and multiple threshold multi-locus tree in RASP v.4.2 (Yu et al. 2020). One hundred
(mPTP) approaches. sample trees were resampled randomly, then pruned by redu-
cing terminal taxa to one individual per putative species. To
Multi-locus species delimitation infer divergence times in the Liphistius phylogeny, we dated the
The concatenated alignments were used for delimiting Liphistius root node to 100 Mya based on the age of a segmented spider
species with: GMYC, PTP, Species Tree And Classification fossil in Burmese amber (Shi et al. 2012, Selden and Ren 2017)
Estimation, Yarely (STACEY; Jones 2017), and Bayes factor de- that is believed to pre-date the split between Liphistiinae and
limitation (BFD; Grummer et al. 2014). The GMYC and PTP Heptathelinae. The divergence times of the remaining nodes
delimitations were conducted using the same procedures as the were estimated from the DNA alignments by the RASP program.
single-locus delimitation. The analyses were conducted in BioGeoBEARS v.1.1.1 with the
For STACEY delimitation, the concatenated alignments DIVALIKE+J model. The maximum number of areas for ances-
were converted to XML format using BEAUti v.2.6.6 with a tral distribution was set to three, and the remaining parameters
STACEY template. The HKY substitution model and strict clock used default settings. We conducted additional analyses using
model were assigned to all loci to reduce model complexities. three alternative methods: (i) statistical dispersal–vicariance
STACEY coalescents were set to 0.5 and 2.0 for mitochondrial analysis (S-DIVA); (ii) statistical dispersal–extinction–clado-
and nuclear loci, respectively. The MCMC sampling was run for genesis analysis (S-DEC); and (iii) BI binary MCMC analysis
200 million generations, sampling every 10 000 generations. (BBM), with the same parameter settings.
Three independent replicates were analysed in BEAST2 v.2.6.6.
Convergence and the effective sample size of each replicate were
checked in Tracer. Log and trace files from each run were RESULTS
combined in LogCombiner v.1.10.4, with 10% of initial sam-
Sequence alignments and data partitioning
ples discarded as burn-in. The combined result was processed
in SpeciesDelimitationAnalyser, with a collapse height of The concatenated alignment includes 169 sequences; the ‘full
0.0001 and similarity cut-off of 0.9 (default), to estimate the de- gene partition’ includes 2184 bp (COI, 168 sequences, 579 bp;
limited species partition with the most support. 16S, 168 sequences, 388 bp; H3, 146 sequences, 241 bp; 28S,
For comparing the species delimitations produced by other 159 sequences, 664 bp; and ITS2, 161 sequences, 312 bp),
multi-locus delimitation methods, BFD was used. The concat- whereas the ‘Gblock partition’ includes 2011 bp after removing
enated alignments were converted into XML format in BEAUti ambiguous positions from 16S, 28S, and ITS2, reducing them
v.2.6.6 with a StarBeast2 template with different assignments to 316, 630, and 245 bp, respectively. The COI alignment in-
for taxon sets (species prior) as determined by each of the de- cludes 197 sequences, 550 bp. The accession numbers for the
limitation methods. All analyses were conducted with the HKY aligned sequences are shown in the Supporting Information
substitution model, and a strict clock was assigned to all loci, (File S1). The average model from GTR space for BI and best-
with gene ploidy set to 0.5 and 2.0 for mitochondrial and nu- fitting substitution models for each locus for ML are shown in
clear loci, respectively. We used a birth–death model for the spe- the Supporting Information (File S3).
cies tree prior. The MCMC samplings were set to 200 million
Phylogenetic reconstruction
generations, with sampling every 10 000 generations; the first
10% were discarded as burn-in. Marginal likelihood estima- COI phylogeny
tions (MLEs) were obtained using path sampling analyses in the The COI phylogeny supports monophyly of genus Liphistius
Model Selection package in BEAST2, with 50 steps and default by grouping all Liphistius species together with high support
[pp = 1, ultrafast bootstrap support (bs) = 100] and as a clade and Liphistius trang Platnick & Sedgwick, 1984; these two spe-
separate from Heptathelinae with high support (pp = .98, cies are separated from the remaining species with weak support.
bs = 92). The monophyly of all putative species for which The third clade includes all taxa that were classified into the trang
multiple specimens were available is also strongly supported subgroup C: Liphistius fuscus Schwendinger, 1995, Liphistius
(pp > .90, bs > 90). The BI tree groups Liphistius erawan s.l. phuketensis Schwendinger, 1998, Liphistius schwendingeri s.l.Ono,
Schwendinger, 1996 and Liphistius albipes Schwendinger, 1995 1988, and Liphistius keeratikiati Zhan & Xu, 2022. All analyses
with seven other clades into a single polytomy, whereas ML separ- strongly support monophyly of trang subgroup C. All taxa in
ates these clades with weak support (see Supporting Information, these three trang group clades were collected from the Thai–
File S4). However, The COI phylogeny does not resolve interspe- Malaysian peninsula.
cific relationships within Liphistius, particularly the relationships The fourth clade, highly supported in all analyses, comprises
of species within and between the species groups. The COI phyl- Liphistius albipes, Liphistius bicoloripes Ono, 1988 from the Thai–
ogeny does not support monophyly of the trang group; some taxa Malaysian peninsula, plus L. erawan s.l. and an undescribed spe-
placed in the trang group by morphology are grouped with the cies, Liphistius sp. TNL, from the western part of Thailand, with
bristowei group in the COI phylogeny. However, the COI phyl- high support in all analyses. The last Sibumasu clade groups
ogeny is congruent with the geographical range of Liphistius, sep- Liphistius castaneus Schwendinger, 1995 and an undescribed
arating Indochinese members of the large trang group from the species, Liphistius sp. KPN, with high support in all analyses
remaining trang group members from Sibumasu. (pp = 1, bs > 99). These two species were collected from the
Thai–Malaysian peninsula.
Multi-locus phylogeny The sixth clade includes all species from Indochina with strong
The BI and ML analyses with two different partitions show support (shown in blue in Fig. 2). Liphistius tenuis Schwendinger,
similar tree topologies, albeit with variation within some clades 1996 from the eastern coast is the most basal species within
(Fig. 2). Tree topologies are also in agreement with morphology the Indochina clade. All analyses group Liphistius nesioticus
and the spider collection sites. The analyses using the Gblock Schwendinger, 1996 and an undescribed species, Liphistius sp.
partition provide higher likelihood scores [BI (harmonic mean), SKR, together with high support (pp = 1, bs = 100), but their
−28046.37; ML (log-likelihood of consensus tree), −27608.51] relationship with Liphistius onoi Schwendinger, 1996, Liphistius
than the analyses with the full partition (BI, −32554.92; ML, pusohm Schwendinger, 1996, Liphistius thoranie Schwendinger,
−32125.75). The results of the multi-locus phylogeny are de- 1996, and Liphistius sayam Schwendinger, 1998 is still unre-
scribed based on the analyses with the Gblock partition. solved. The BI analyses with Gblock partition group these
All analyses show monophyly of Liphistius with high support species into polytomy, whereas ML places the two latter spe-
(see Fig. 2) and resolve the polytomy produced using the COI cies in different nodes. All analyses strongly support a clade
data set. Liphistius indra and L. lahu (representing the birmanicus composed of Liphistius ornatus Ono & Schwendinger, 1990,
group and the linang group, respectively) are sister taxa to the Liphistius cf. ornatus and Liphistius phileion Schwendinger, 1998
remaining Liphistius species (pp = 1, bs = 100). The latter spe- (three taxa from the eastern coast of Thailand) with two taxa
cies are divided into two major clades (pp > .80, bs > 85), one from northeastern Thailand: Liphistius dangrek Schwendinger,
composed of all species belonging to the bristowei group plus 1996 and Liphistius isan Schwendinger, 1998 (east-northeast
several undescribed potential species from Thailand and Dawei, clade). Sister to the above group is Liphistius tham Sedgwick &
Myanmar and the other composed of all specimens belonging to Schwendinger, 1990 and four undescribed species: Liphistius sp.
trang group. CK, Liphistius sp. CPP, Liphistius sp. SL, and Liphistius sp. WTK,
The interspecific relationships within the bristowei group from the central region of Thailand (central clade). However,
are still uncertain. The phylogeny recognizes an undescribed interspecific relationships within these groups differ between
species, Liphistius sp. HKK, from the western part of Thailand BI and ML analyses (indicated in Fig. 2 by a dashed line for
as the most basal member of the group (pp > .90, bs = 100) the placement of Liphistius sp. TT; BI places Liphistius sp. TT at
and divides the remaining taxa into two clades (pp = 1, the basal node of the eastern coast taxa and northeastern clade,
bs = 68). All analyses separate the clade of Liphistius lannaianus whereas ML places this species at the basal node of the central
Schwendinger, 1990, Liphistius maewongensis Sivayyapram et clade).
al. 2017, plus three undescribed species from the western part
of Thailand and Dawei, Myanmar (Liphistius sp. Sangkraburi, Species delimitation
Liphistius sp. TPP, andLiphistius sp. DW), (bristowei-A) as dis- All molecular delimitation methods recognize more putative
tinct from the clade of L. bristowei Platnick & Sedgwick, 1984, L. species than morphology-based identification. All analyses agree
jarujini, Liphistius marginatus Schwendinger, 1990, and Liphistius in delimiting spiders from different discrete locations into dif-
sp. WKS, an undescribed species from northwestern part of ferent putative species. The difference among methods in the
Thailand (bristowei-B). In the trang group, there are five small, number of species delimited results from splitting spiders from
sequentially diverging sub-clades with distributions in Sibumasu the same area into different numbers of putative species (Fig. 3).
(shown in purple in Fig. 2), and a large sixth clade including all
the species from Indochina. Single-locus delimitation using COI
The most basal clade in the trang group includes Liphistius In the ASAP analyses, the most likely species partition was
yangae s.l.Platnick & Sedgwick, 1984, Liphistius hatyai Zhan & selected based on the lowest asap score. We found that the lowest
Xu, 2022, Liphistius thaleri Schwendinger, 2009, and Liphistius asap score was shown by a different number of delimited species
sp. T. The second clade includes Liphistius niphanae Ono, 1988 in some replicates, even using the same data set and substitution
Figure 2. Multi-locus phylogeny using Bayesian inference (BI) with ‘Gblock partition’ alignments. Dashed lines show incongruent clades
between Bayesian inference and maximum likelihood (ML). Coloured branches on the tree correspond to Liphistius species groups as follows:
red, birmanicus group; orange, linang group; yellow, bristowei group; purple, trang group from localities in Sibumasu; blue, trang group from
localities in Indochina.
Figure 3. Results of eight species delimitation methods. Each vertical bar represents a different delimitation method, and each horizontal bar
represents a putative delimited species. Taxa 1–5 are each represented by only a single specimen. The colours in the phylogenetic tree represent
Liphistius species groups, as follows: red, birmanicus group; orange, linang group; yellow, bristowei group; purple, trang group from localities in
Sibumasu; blue, trang group from localities in Indochina.
model. The results reported here are the most consistent re- The ancestor of Liphistius (sole genus in the Liphistiinae)
sult among 10 replicates for each substitution model. The most probably had a wide distribution from peninsular Sibumasu
likely species partitions using simple distance and the JC model (area B) to the Inthanon zone (area C) and diversified into sev-
resulted in the same species partition, with 67 putative species. eral species groups via vicariance (Fig. 4A, number 2).
The most likely species partition with the K80 model supported The most basal clade in this analysis of Liphistius includes L.
55 putative species. The relative barcode gap and threshold dis- lahu from the Inthanon region (area C) and L. indra from the
tances are shown in the Supporting Information (File S5). Bentong–Reaub suture zone (area E); these species belong to
The GMYC analyses with the single (sGMYC) and multiple the birmanicus group and linang group, respectively (Fig. 4A,
(mGMYC) thresholds delimited Liphistius into 58 and 68 puta- number 3). The most recent common ancestor of this clade most
tive species, respectively. The PTP analyses with single (sPTP) probably lived in the Inthanon zone (area C), then diversified via
and multiple thresholds (mPTP) delimited Liphistius into 51 dispersal to an area corresponding to the present-day Bentong–
and 66 putative species, respectively (Supporting Information, Reaub suture zone (area E) followed by vicariance. Additional
File S5). members of the birmanicus group are found in northeast
Myanmar, whereas Liphistius linang Schwendinger, 2017, the
Multi-locus delimitation other member of the linang group along with L. indra, is found in
The GMYC analyses with the single (sGMYC) and multiple northeastern Malaysia.
(mGMYC) thresholds delimited Liphistius into 53 and 72 puta- The other clade, which includes the bulk of the species exam-
tive species, respectively. The PTP analyses with single (sPTP) ined in this analysis, contains the bristowei and the trang groups.
and multiple thresholds (mPTP) delimited Liphistius into 65 The most recent common ancestor of this clade most probably
and 52 putative species, respectively. STACEY delimited 56 inhabited either peninsular Sibumasu (area B) or the central
Liphistius species (pp = .0084). Note that among these analyses, basin (area D) and diversified into two species groups via dis-
mPTP and STACEY placed the outgroups into a single taxon, persal (from peninsular Sibumasu to the central basin or vice
whereas the other methods recognized each of them as different versa), followed by speciation through vicariance (~50 Mya)
taxa (Fig. 3). (Fig. 4A, number 4).
In the BFD analyses, the highest marginal likelihood esti- The most recent common ancestor of the bristowei group
mation varied among replicates. BFD recognized STACEY as is likely to have diversified within central Thailand (area D),
producing the most likely delimited scenario based on highest followed by dispersal that brought some taxa northwards to
average marginal likelihood estimation, with decisive support Inthanon (area C) and Sukhothai regions (area F) and others
(2lnBF > 10) compared with the other scenarios shown in southwards to mainland Sibumasu (area A) (Fig. 4, number 5).
Table 3. The trang group clade originated in peninsular Sibumasu
(area B) (Fig. 4, number 6). The most recent common an-
Historical biogeography cestor and their descendants diversified within this region (Fig.
In general, all ancestral state reconstructions indicated a similar 4, numbers 6–9). At least two clades diversified and remained
pattern of Liphistius biogeographical history, with slight vari- in the peninsular region (Sibumasu I and II; Fig. 4, numbers 7
ations. Here, the results described are based on the DIVALIKE+J and 9), while the others distributed northwards via a combin-
analysis (Fig. 4; Table 4). The results of alternative analyses are ation of dispersal and vicariance events (Sibumasu III, IV, and
shown in the Supporting Information (File S6). Indochina; Fig. 4, numbers 10–12). The distribution of this
The most recent common ancestor of Liphistiidae most group separated along three routes. The first route continued
probably had a wide distribution in areas corresponding to the northwards and diversified in the mainland Sibumasu region
present-day Southeast Asia through East Asia. It diversified (Fig. 4, numbers 10 and 11). The second route moved back
into two subfamilies via vicariance ~100 Mya. The most recent to peninsular Sibumasu (Fig. 4A, number 13). The third route
common ancestor of Heptathelinae inhabited East Asia and di- turned eastwards to the Chanthaburi (area G) and Indochina
versified into seven genera within the areas corresponding to regions (area H) via multiple dispersal and vicariance events
their present-day distribution (Fig. 4A, number 1). (Fig. 4, numbers 10, 12, and 14).
Table 3. Results of Bayes factor delimitation (BFD). Marginal likelihoods of six competing species hypotheses, computed from the
concatenated alignments. The log marginal likelihoods are ranked from lowest (6) to highest (1); the Bayes factor (BF) is calculated using
2lnBF = 2 × (marginal likelihood of the highest rank species model − marginal likelihood of each lower rank species model), with 2lnBF > 10
being considered as decisive support for the highest rank species model 1.
Number of species Marginal likelihood Rank (lnBF) 2lnBF
mGMYC 72 −31519.92277 6 52.067437 104.13487
bPTP 65 −31518.39951 5 50.544171 101.08834
mPTP 52 −31497.18524 4 29.329904 58.659809
sPTP 65 −31483.86739 3 16.012054 32.024108
sGMYC 53 −31480.86681 2 13.011473 26.022947
STACEY 56 −31467.85533 1
Figure 4. The historical biogeography of Liphistius. A, chronogram and ancestral area reconstructions for Liphistius. The numbers in front
of the names of taxa correspond to those in Table 1. B, distribution routes of the trang species group (red arrows) and the bristowei species
group (blue arrows). Areas are as follows: A = Mainland Sibumasu; B = Peninsular Sibumasu; C = Inthanon region; D = Central basin;
E = Bentong–Reaub suture zone; F = Sukhothai terrain; G = Chantaburi region; H = Indochina terrain (based on Metcalfe 2017); I = East
Asia [the distributions of all heptatheline taxa combined into a single area (not shown)].
DISCUSSION various animal taxa, including some spiders (Barrett and Hebert
In this study, we provide our original multi-locus data set for 2005, Xu et al. 2015c). However, for the segmented spiders, the
Liphistius, consisting of five loci: COI, 16S, H3, 28S, and ITS2. utility of (this portion of) COI for phylogenetic study is not
We used our data set for phylogenetic reconstruction with straightforward. COI was used successfully in a phylogeny that
single-locus (based on the COI gene) and multi-locus data sets. resolved interspecific relationships in the heptatheline genera
Our five-locus data set includes all described Liphistius species Ganthela, Heptathela, and Ryuthela (Tanikawa 2013, Xu et al.
in the bristowei group, most species of the trang group (with un- 2015c, 2017, 2020). In contrast, COI alone did not resolve inter-
described species of both groups), and a representative from specific or interspecies group relationships within Liphistius.
the birmanicus and linang groups, whereas the COI data set also The results of the multi-locus phylogenetic analyses all
includes eight Malaysian species from the malayanus and trang showed a similar tree topology, with only slight variations in
groups. species relationships within some clades. The results from the
Gblock partition had higher likelihood scores than those using
Phylogenetic reconstructions the full partition in both BI and ML. The results resolved inter-
We reconstructed the Liphistius phylogeny using single-locus specific relationships of most Liphistius taxa in this study with
and multi-locus alignment. For the single-locus phylogeny, we moderate to high support. The tree topology strongly supported
combined our COI alignments with the COI alignments used by monophyly of the bristowei and the trang groups and placed the
Schwendinger et al. (2019). As in the earlier study (Schwendinger representatives of the birmanicus and the linang groups (L. lahu
et al. 2019), our larger COI data set still did not resolve interspe- and L. indra, respectively) at the basal node of the bristowei and
cific relationships within Liphistius. However, COI is widely ac- the trang groups with strong support.
cepted as a universal barcoding gene for animals because of its We cannot address the monophyly and relationships of the
utility in species delimitation (Barrett and Hebert 2005, Hebert birmanicus and linang groups owing to our limited taxon sam-
and Gregory 2005). COI has also resolved phylogenies in pling. However, our results are congruent with a phylogenomic
Table 4. Molecular dating and ancestral area reconstruction results for Liphistius using S-DIVALIKE+J. The letters A–I correspond to
geographical locations shown in Figure 4. The notation shows the biogeographic event in the phylogenetic tree (Fig. 4A) includes →: from the
parent node to descendent nodes; ^: Sympatric speciation; |: Vicariance.
Diversification events Dates DIVALIKE+J
(Mya)
Ancestral areas Process Route and
probability
The most recent common ancestor of Liphistiidae 100 BCI 13.60 Dispersal:0 BCI→I|BC
(Fig. 4, number 1) CEI 13.33 Vicariance:1 prob: .02
BEI 10.96 Extinction:0
The most recent common ancestor of Heptathelinae 58.43 I 100 Dispersal:0 I→I^I→I|I
Vicariance:0 prob: 1.00
Extinction:0
The most recent common ancestor of Liphistius 53.61 BC 14.34 Dispersal:0 BC→C|B
(Fig. 4, number 2) CE 14.05 Vicariance:1 prob: .03
C 12.37 Extinction:0
The most recent common ancestor of L. indra + L. 45.51 C 45.23 Dispersal:1 C→CE→C|E
lahu (Fig. 4, number 3) E 38.20 Vicariance:1 prob: .45
CE 16.50 Extinction:0
The most recent common ancestor of trang species 49.61 B 39.38 Dispersal:1 B→DB→D|B
group + bristowei species group (Fig. 3, number 4) D 30.43 Vicariance:1 prob: .30
BD 14.72 Extinction:0
The most recent common ancestor of bristowei spe- 32.86 D 75.76 Dispersal:0 D→D^D→D|D
cies group (Fig. 4, number 5) C 21.28 Vicariance:0 prob: .55
A 2.02 Extinction:0
The most recent common ancestor of trang species 46.54 B 99.88 Dispersal:0 B→B^B→B|B
group (Fig. 4, number 6) A 0.08 Vicariance:0 prob: 1.00
H 0.01 Extinction:0
The most recent common ancestor of Sibumasu I 41.39 B 100 Dispersal:0 B→B^B→B|B
clade (Fig. 4, number 7) Vicariance:0 prob: 1.00
Extinction:0
The most recent common ancestor of Sinbumasu II– 42.48 B 99.76 Dispersal:0 B→B^B→B|B
IV and Indochina clades (Fig. 4, number 8) A 0.18 Vicariance:0 prob: .96
G 0.03 Extinction:0
The most recent common ancestor of Shibumasu II 30.56 B 99.91 Dispersal:0 B→B^B→B|B
(Fig. 4, number 9) A 0.09 Vicariance:0 prob: .97
Extinction:0
The most recent common ancestor of Shibumasu 38.89 B 96.03 Dispersal:1 B→AB→A|B
III–IV and Indochina clade (Fig. 4, number 10) A 2.65 Vicariance:1 prob: .48
G 0.67 Extinction:0
The most recent common ancestor of Shibumasu III 31.69 A 51.95 Dispersal:0 A→A^A→A|A
(Fig. 4, number 11) B 48.05 Vicariance:0 prob: .26
Extinction:0
The most recent common ancestor of Shibumasu 34.81 B 96.15 Dispersal:1 B→BG→B|G
IV + Indochina clade (Fig. 4, number 12) G 1.94 Vicariance:1 prob: .48
H 1.90 Extinction:0
The most recent common ancestor of Shibumasu IV 17.02 B 100 Dispersal:0 B→B^B→B|B
(Fig. 4, number 13) Vicariance:0 prob: 1.00
Extinction:0
The most recent common ancestor of Indochina 31.15 G 50.43 Dispersal:1 G→GH→G|H
clade (Fig. 4, number 14) H 49.38 Vicariance:1 prob: .50
D 0.20 Extinction:0
study that placed the birmanicus group and several species parts); and less developed para-embolic plate; and female
groups in Malaysia (including the linang group) at a more basal poreplate with well-developed posterior stalk (Schwendinger
node than Thai bristowei and trang group species and separated 1990). Note that the results grouped L. jarujini and Liphistius sp.
L. bristowei from a clade of the trang group (Xu et al. 2021). Sangkraburi with other species in the bristowei group; however,
Within the trang group, our phylogeny did not support the female genitalia of these two taxa are similar to the genitalia
monophyly of subgroups A, B, and D (sensu Schwendinger et al. of the birmanicus group [posterior stalk narrow, longer than wide
2019). Only subgroup C was strongly supported in all analyses, and constricted at base; poreplate with pronounced lobes at an-
while subgroup F, with a single species (L. tenuis), was placed terior margin (Schwendinger 1990)], illustrating conflict be-
as the most basal taxon of the Indochina clade. The monophyly tween genetic and genital characters.
of subgroup E is unverified owing to the lack of taxon sampling. The trang group was divided into six subgroups by
Our phylogeny suggests that the interspecific relationships cor- Schwendinger et al. (2019). The monophyly of this species
respond more closely to the geographical distribution of species group is supported by the multi-locus phylogeny. The trang
than to their morphological traits (see ‘Biogeographical infer- group can be distinguished from the remaining species groups
ence’, below). by the following genital characters: male with deeply split em-
Comparison of the results of our single-locus COI analyses bolic parts; prominent distal margin of tegulum; and female
with our multi-locus results indicates that increasing the number poreplate with small central dorsal opening and rather small and
of loci is more effective than adding more species to the single- simple receptacular cluster; mediolateral processes on ventral
locus analysis for resolving the phylogeny of the Liphistius spe- rim of poreplate present or absent (Schwendinger 2017). The
cies. However, increasing the number of taxa sampled is also monophyly of species subgroups A, B, and D is not supported
important for testing phylogenetic and biological hypotheses by the molecular phylogeny or by geographical data. Only
that are based on these trees. monophyly of subgroup C is supported by the molecular phyl-
Ideally, phylogenetic reconstructions should use the max- ogeny, morphology, and geography. Subgroup C is characterized
imum number of taxa and genes available. The relative import- by males with a large tegulum and dentate dorsal edge of the
ance of taxon sampling vs. locus sampling has been debated contrategulum. The female poreplate lacks the lateral edge and
(Rokas and Carroll 2005). Increasing the number of loci pro- is broadly fused to the posterior stalk (Schwendinger 1998). All
vided a positive effect, whereas the number of taxa did not have taxa in subgroup C were found in the southern part of Thailand.
a significant effect on phylogenetic accuracy (Rokas and Carroll The multi-locus phylogeny suggests that the interspecific rela-
2005). However, more complete taxon sampling is important tionships within the trang group correspond better to geograph-
for dispersing homoplasy across the tree, reducing the effects of ical proximity than to morphological characters.
long-branch attraction, and improving branch length estimation
(Zwickl and Hillis 2002, Heath et al. 2008a, b). Species delimitation
All molecular species delimitation methods distinguished
Systematics spiders from different discrete localities into different putative
The monophyly of the birmanicus and linang groups is still unclear, species. The results suggest that Liphistius species are highly en-
owing to incomplete taxon sampling. The birmanicus group cur- demic to their localities and that it is possible for two or more
rently includes 12 named species: Liphistius birmanicus Thorell, sympatric species to coexist in some localities. For example, all
1897, Liphistius cupreus Schwendinger & Huber, 2022, Liphistius molecular methods and morphology delimited L. bicoloripes, L.
ferox Schwendinger & Huber, 2022, Liphistius hpruso Aung et castaneus, and L. schwendingeri s.l., which are three species that
al. 2019, L. lahu, Liphistius lordae Platnick & Sedgwick, 1984, coexist in the same location. Molecular delimitation methods
Liphistius metopiae, Liphistius nabang Yu et al. 2021, Liphistius are also very useful in discovering cryptic species in apparently
pinlaung Aung et al. 2019, Liphistius platnicki Schwendinger & widespread taxa when there is a lack of diagnostic characters for
Huber, 2022, Liphistius pyinoolwin Xu et al. 2021, and Liphistius species recognition. For example, all delimitation methods we
tung Schwendinger, 2022 (Schwendinger et al. 2022), all en- used agreed in delimiting cryptic species within the geographic-
demic to northwestern Thailand, northeastern Myanmar, and ally widespread L. bristowei s.l. and L. erawan s.l.
southwestern China. The linang group comprises two described Liphistius bristowei s.l. was reported from Doi Suthep (Mount
species: L. indra and L. linang, endemic to the Thai–Malaysian Suthep) (type locality) and Doi Inthanon (Mount Inthanon),
peninsula. The multi-locus phylogeny groups L. lahu and L. two mountain peaks in Chiang Mai, Thailand (Platnick and
indra, representatives of the birmanicus and linang groups, as the Sedgwick 1984, Ono 1988a, Schwendinger 1990). The phylo-
sister to the bristowei plus trang groups. The close relationship of genetic results grouped all specimens into a monophyletic group,
these two widely separated species, L. lahu and L. indra, is con- with a specimen from the type locality, Doi Suthep, as the sister
sistent with the close relationships between the Myanmar and to the remaining specimens from Doi Inthanon. All species de-
the Malaysian species reported by Xu et al. (2021). limitation methods recognized three species in this group: one
The monophyly of the bristowei group was supported by the species from Doi Suthep and two species from Doi Inthanon.
multi-locus phylogeny and by its geographical distribution. All The two species from Doi Inthanon appear to occupy different
taxa in this group are found along the mountain ranges between elevations.
Thailand and Myanmar (Fig. 1). The bristowei group is distin- Liphistius erawan s.l. was reported only from the type locality,
guished from the others by the following genital characters: male Erawan Waterfall, Kanchanaburi, Thailand. In this study, speci-
pedipalp with strongly elevated cumulus; hyaline and sclerot- mens matching L. erawan morphologically were collected from
ized portions of embolus are fused together (adjoining embolic the type locality and from three other locations. All delimitation
methods delimited two additional putative species from two of colonized Indochina (Fig. 4B, area H) or adjacent areas in this
the three new localities. period, during which there was a large body of water between
In single-locus delimitation, we used distance-based methods Sibumasu and Indochina terranes caused by the rise in sea level
(ASAP) and tree-based methods (GMYC and PTP). The ASAP during late Cretaceous to middle Eocene (Miller et al. 2008,
delimited putative species using pairwise genetic distances, with 2020), which probably led to incursion of seawater into the Thai
no phylogenetic reconstruction required, whereas GMYC and central basin (area D). Two clades descending from the most re-
PTP delimited species on the basis of their phylogenetic rela- cent common ancestor became ancestors of the bristowei + trang
tionships, requiring a resolved phylogenetic tree. Note that BFD species groups and the birmanicus + linang species groups. The
delimitation was not used to compare the results from single- sister-group relationship of linang and birmanicus group taxa,
locus delimitations because the COI phylogeny did not resolve now found in two widely separated areas, is congruent with the
interspecific relationships of Liphistius. results of the phylogenomic analysis by Xu et al. (2021). These
The ASAP delimitation with p-distance and JC69 substitu- two clades might represent northern and southern populations
tion models showed the same partition, with more species rec- of a most recent common ancestor with a wide distribution over
ognized than in the K80 model. The results suggested that the Sibumasu and adjacent areas.
species delimitation using COI with a stricter substitution model The ancestors of the linang group most probably lived in
(K80) seem to recognize more putative species than the ana- what is now peninsular Thailand and Malaysia. Liphistius indra,
lyses with more flexible substitution models (p-distance, JC69). included in this study, is one of two members of the linang
Note that the most likely species partition using ASAP can differ group (the other member is found in Malaysia). Members of
among replicates owing to the value of the probability of pan- the birmanicus group are found primarily in Myanmar; only L.
mixia (p-val) as occurring in our analyses with all substitution lahu, which occurs in Thailand, was included in this study. The
models. Therefore, we suggest doing several replicates of the birmanicus + linang clade is sister to a large clade that includes
analyses to test the stability of the results. The GMYC and PTP the bristowei and trang groups.
delimitations with COI data showed a similar trend, in that the The results of this study indicate that the ancestor of the
analyses with multiple thresholds recognized more putative spe- bristowei group (see Fig. 4B, blue arrows) most probably lived in
cies than the analyses with a single threshold. the Thai central basin (Fig. 4B, area D) during the mid-Oligocene
For the multi-locus delimitation, the BFD analysis suggested (~33 Mya); some of their descendants speciated within this area,
that the most likely species delimitation scenario was based whereas others dispersed to mainland Sibumasu (area A) and
on STACEY, which recognized 56 putative Liphistius species. the Inthanon zone (area C) before their descendants gave rise
Surprisingly, ASAP with the K80 model using COI data alone to the extant taxa. There were at least two independent disper-
gave results like those of STACEY; the only difference being that sals from the central basin to the Inthanon zone, and one each to
STACEY split L. cf. ornatus into two putative species, whereas the Sukhothai terrain (area F) and mainland Sibumasu (area A).
ASAP did not. The trang group (see Fig. 4B, red arrows) most probably
originated during the mid-Eocene (~46.54 Mya) in penin-
Biogeographical inference sular Sibumasu (Fig. 4B, area B), possibly in present-day pen-
In this study, divergence dating indicated a Cenozoic origin of insular Malaysia. Their descendants lived and diversified in
Liphistiinae at 53.61 Mya, earlier than previous studies, which peninsular Sibumasu. Some of these descendants dispersed
proposed 11–24 Mya (Xu et al. 2015c) and 25–31 Mya (Xu northwards along peninsular Sibumasu (Fig. 4B, number 10),
et al. 2021). The difference might be the result of the clock reaching the isthmus of Kra during late Eocene (38–35 Mya),
models and calibration methods used. In this study, we used the and continued onwards to mainland Sibumasu (area A; Fig. 4B,
strict clock model because the analyses with the relaxed clock number 11). After crossing the isthmus of Kra, some of their
never reached a stable posterior distribution (effective sample descendants colonized the areas corresponding to modern-day
size < 200). In addition, we used a Burmese amber liphistiid western Thailand (area A; Fig. 4B, number 11). Another group
fossil (~100 Mya) believed to pre-date divergence of Liphistiinae from area B dispersed eastwards and became ancestors of the
and Heptathelinae to calibrate the divergence of these two sub- large monophyletic group in the area corresponding to eastern
families on our tree. We then estimated the age of other nodes and northeastern Thailand (areas G and H; Fig. 4B, numbers 12
from branch lengths without additional calibrations. The studies and 14). A possible dispersal route might have become available
of Xu et al. (2015c) and Xu et al. (2021) included mygalomorph after late Eocene glaciation lowered sea levels, creating a land
and araneomorph fossils for calibration. bridge between Sibumasu and Indochina (Li and Li 2018).
Here, we propose our hypothesis for the phylogeographical Island colonization by L. thaleri (Fig. 1, number 45) in pen-
history of Liphistius based mainly on our own results. Our ances- insular Sibumasu (area B), L. phileion (Fig. 1, number 30) in
tral area reconstructions indicate that both vicariance and dis- the Central basin (area D), and L. nesioticus (Fig. 1, number 32)
persal processes played important roles in the diversification of in the Chantaburi region (area G) occurred before the last gla-
Liphistius. cial period in the Pleistocene (~1 Mya). These islands are near
The most recent common ancestor of Liphistiinae lived in to and were probably connected to the mainland before glacial
Southeast Asia during the mid-Eocene (~53 Mya). It was widely melting and rising sea levels isolated them as islands.
distributed over the Sibumasu terrane (Fig. 4B, areas A and B), The three Liphistius species groups (batuensis, malayanus, and
Inthanon suture zone (Fig. 4B, area C), and Bentong–Reaub su- tioman groups) found in Malaysia were not available for this
ture zone (Fig. 4B, area E). No analyses indicated an Indochinese study; therefore, how these groups are related to the ones studied
origin of Liphistiinae, and it is unlikely that Liphistius would have was not investigated here. Inclusion of more taxa from Myanmar
and Malaysia in future analyses could provide a clearer under- and supports monophyly of the bristowei and the trang groups.
standing of the very early biogeographical history of Liphistius. The monophyly and relationships of other species groups are
still unclear owing to incomplete taxon sampling or few loci.
The classification system of extant primitively segmented Our phylogenetic results indicate that a suitable strategy to re-
spiders construct the phylogeny of Liphistius is by increasing the number
Here, we rejected the arguments of Li (2022) for the eleva- of loci used, which aids in resolving the deep nodes in the phyl-
tion of ‘Heptathelidae’ to family rank, based on the following ogeny. However, increasing the number of taxa included is also
reasons. First, Li (2022) provided no supporting evidence for important for understanding the phylogeny and historical bio-
resurrecting ‘Heptathelidae’ to family rank, except for referring geography of Liphistius.
to two recent phylogenetic studies of extant mesothelids (Xu et Species delimitation analyses show that although the COI
al. 2015c, 2021). These two studies confirmed the monophyly barcoding sequence cannot resolve the phylogeny of Liphistius,
of Liphistiidae and its two subfamilies, Liphistiinae and it is still useful for delimiting Liphistius species under distance-
Heptathelinae, and both studies agreed on the single-family clas- based approaches, which show similar species partition to multi-
sification of the extant primitively segmented spiders. Although locus data under a multi-species coalescent approach (STACEY).
there is no standard criterion for what taxonomic rank to give to Molecular data are very useful in recognizing cryptic species in
a monophyletic group, we disagree on the arbitrary taxonomic Liphistius, which has few diagnostic morphological characters.
change in the classification of the extant mesothelids proposed But molecular data should not be used in the description of
by Li (2022) (see more discussion by Breitling 2022). new species as a substitute for morphological data, because, as
Second, ‘Heptathelidae’ is widely accepted as a junior we have shown, different delimitation methods or substitution
synonym of Liphistiidae. Given that Raven (1985) synonymized models can produce different assessments of species status, even
‘Heptathelidae’ owing to a lack of synapomorphy, several studies using the same multi-locus data sets. Therefore, we suggest using
have used ‘Heptathelidae’ in the family rank (Haupt 2003, more than one delimitation method to test the accuracy of de-
Wunderlich 2017). These two studies provided several new char- limited results, and we emphasize the importance of including
acters for supporting their elevation of ‘Heptathelidae’ to family other biological information, such as morphology, ecology, and
rank but have never been accepted by the World Spider Catalog. geographical distribution for delimiting Liphistius species. In
Third, elevating ‘Heptathelidae’ to family rank will change addition, for describing new Liphistius species, the taxa should
the definition of Liphistiidae. Thorell (1869) described the be named with distinct diagnostic character(s) to prevent taxo-
family rank Liphistiidae based on the presence of abdominal ter- nomic problems resulting from species identification in the fu-
gites and the absence of the spinnerets. The latter character was ture.
misunderstood owing to the damage of the type specimen (L. Biogeographical analyses suggest that both vicariance and
desultor) and changed to the position of spinnerets on the me- dispersal played important roles in the evolutionary history
dian of the abdomen in subsequent studies. This classification of Mesothelae in the Cenozoic era. Our analyses suggest that
has been accepted and used by many authors. the ancestral area of Liphistius is on the western fragments of
Here, we propose to classify all extant mesothelids in the Southeast Asia. Although the early biogeographical history of
single family Liphistiidae, which can be distinguished from other the genus is still ambiguous, the analyses indicate interesting
living spiders by the following: the presence of abdominal ter- distribution patterns for the bristowei and the trang groups. The
gites; seven or eight spinnerets on the median of the abdomen; bristowei group is most likely to have originated in an area corres-
and possessing a narrow sternum with another narrow sternite ponding to modern northwestern or western Thailand, followed
located adjacent to coxae IV (Xu et al. 2015b). The Liphistiidae by speciation within this area. The trang group is most likely to
consist of two subfamilies: Liphistiinae and Heptathelinae. have originated in the area corresponding to the present-day
Liphistiinae are characterized by the following: the burrow en- Thai–Malaysia border, followed by dispersal northwards along
trance signal lines; the male pedipalp with tibial apophysis; and peninsular Sibumasu and dispersal eastwards to colonize the
female spermathecae modified into the sclerotized plate with Indochina terrane. Our analyses indicate that colonization of
unpaired receptacular cluster (Xu et al. 2015b). Heptathelinae island species occurred before the last glacial period.
are characterized by the following: the burrow entrance without
any signal line; the male pedipalp without a tibial apophysis; SUPPLE MEN TARY DATA
and the female spermathecae are not modified into a plate with
Supplementary data is available at Zoological Journal of the
paired or unpaired receptacular clusters on the bursa copulatrix
Linnean Society online.
with or without stalks (Xu et al. 2015b).
ACKNOWLEDGE MEN TS
CONCLUSION
We used molecular information to investigate the monophyly We thank numerous people for their assistance, help, and advice
during the fieldwork: Chaowalit Songsangchote, Fengxiang Liu,
and interspecific relationships of the segmented spiders in the
Long Yu, Wasin Nawanetiwong, Pakorn Nalinrachatakan, Nontawat
genus Liphistius, with a focus on the bristowei and trang groups Chatthanabun, Phanuwutt Senawong, Chawatat Thanoosing, Teeradate
from Thailand. Our single-locus phylogeny indicates that even Srimaneeyanon, Sirat Lertjintanakit, Puttita Pasukdee, Pratchaya
when more taxa are included; the COI gene alone does not re- Pramoj Na Ayutthaya, and Thitiya Tuntrakoon. We also thank Dr
solve interspecific relationships within the genus. Our multi- Robert J. Raven from the University of Southern Queensland, Australia
locus phylogeny resolves interspecific relationships of most taxa for his graceful kindness in initiating V.S. and C.K. to appreciate the
world of spider morphology. We would like to thank the Plant Genetic Fourie A, Wingfield MJ, Wingfield BD et al. Molecular markers de-
Conservation Project under the Royal Initiative and the Department of limit cryptic species in Ceratocystis sensu stricto. Mycological Progress
National Park, Wildlife, and Plant Protection, Thailand for providing us 2015;14:1020.
with access to specimen collecting. Freitas FV, Santos Júnior JE, Santos FR et al. Species delimitation and sex
associations in the bee genus Thygater, with the aid of molecular data,
and the description of a new species. Apidologie 2018;49:484–96.
AU THOR CONTRIBU TIONS Fujisawa T, Barraclough TG. Delimiting species using single-locus data
and the Generalized Mixed Yule Coalescent approach: a revised
The authors confirm contribution to the paper as follows: study con- method and evaluation on simulated data sets. Systematic Biology
ception and design: NW, VS, DRS, DL; data collection: VS, NW, CK, 2013;62:707–24.
SD, XX, DL; analysis and interpretation of results: VS, DRS, NW; draft Grummer JA, Bryson RW Jr, Reeder TW. Species delimitation using
manuscript preparation: VS, DRS, NW. All authors reviewed the results Bayes factors: simulations and application to the Sceloporus scalaris
and approved the final version of the manuscript. species group (Squamata: Phrynosomatidae). Systematic Biology
2014;63:119–33.
Haupt J. The Mesothelae – a monograph of an exceptional group of
ETHICS STATE MENT (REG ARDING spiders (Araneae: Mesothelae). (Morphology, behaviour, ecology,
taxonomy, distribution and phylogeny). Zoologica 2003;154:1–102.
COLLECTIONS) Heath TA, Hedtke SM, Hillis DM. Taxon sampling and the accuracy
All Liphistius specimens were obtained legally under the law in the of phylogenetic analyses. Journal of Systematics and Evolution
Kingdom of Thailand. 2008a;46:239–57.
Heath TA, Zwickl DJ, Kim J et al. Taxon sampling affects inferences of
macroevolutionary processes from phylogenetic trees. Systematic
CONFLICT OF INTEREST Biology 2008b;57:160–6.
Hebert PD, Gregory TR. The promise of DNA barcoding for taxonomy.
None declared. Systematic Biology 2005;54:852–9.
Hedin MC, Maddison WP. A combined molecular approach to phyl-
ogeny of the jumping spider subfamily Dendryphantinae (Araneae:
FUNDING Salticidae). Molecular Phylogenetics and Evolution 2001;18:386–403.
Huber KC, Haider TS, Müller MW et al. DNA sequence data indicates the
This work was supported by The 100th Anniversary Chulalongkorn polyphyly of the family Ctenidae (Araneae). Journal of Arachnology
University for Doctoral Scholarship; The 90th Anniversary 1993;194–201.
of Chulalongkorn University Scholarship (grant number Jones G. Algorithmic improvements to species delimitation and phyl-
GCUGR1125641020D); Overseas Research Experience Scholarship ogeny estimation under the multispecies coalescent. Journal of
for Graduate Student Chulalongkorn University and the American Mathematical Biology 2017;74:447–67.
Arachnological Society and the Vincent Roth Fund to V.S.; the Jukes TH, Cantor CR. Evolution of protein molecules. In: Munro HN
National Natural Science Foundation of China (NSFC-32070430 and (ed.), Mammalian Protein Metabolism. New York: Academic Press,
1969, 21–132.
NSFC-31272324), the Hunan Provincial Natural Science Foundation
Kalyaanamoorthy S, Minh BQ, Wong TK et al. ModelFinder: fast
(2021JJ20035) to X.X.; the Singapore Ministry of Education AcRF Tier model selection for accurate phylogenetic estimates. Nature Methods
1 (R-154-000-A52-114) to D.L., and National Science and Technology 2017;14:587–9.
Development Agency (NSTDA), Thailand ( JRA-CO-2563-11148- Kamata Y, Ueno K, Hara H et al. Classification of the Sibumasu and Paleo-
TH) to N.W. Tethys tectonic division in Thailand using chert lithofacies. Island Arc
2009;18:21–31.
Katoh K, Standley DM. MAFFT multiple sequence alignment software
DATA AVAIL ABILIT Y version 7: improvements in performance and usability. Molecular
Biology and Evolution 2013;30:772–80.
DNA sequences and GenBank accession numbers are providing in the Kimura M. A simple method for estimating evolutionary rates of base
Supporting Information (File S1). substitutions through comparative studies of nucleotide sequences.
Journal of Molecular Evolution 1980;16:111–20.
Li F, Li S. Paleocene–Eocene and Plio–Pleistocene sea-level changes as
REFERENCES “species pumps” in Southeast Asia: evidence from Althepus spiders.
Barrett RD, Hebert PD. Identifying spiders through DNA barcodes. Molecular Phylogenetics and Evolution 2018;127:545–55.
Canadian Journal of Zoology 2005;83:481–91. Li S-Q. On the taxonomy of spiders of the suborder Mesothelae. Acta
Breitling R. On the taxonomic rank of the major subdivisions of the extant Arachnologica Sinica 2022;31:71–2.
segmented spiders (Arachnida : Araneae : Mesothelae : Liphistiidae s. Metcalfe I. Gondwana dispersion and Asian accretion: tectonic and
lat.). Miscellanea Araneologica 2022;2022:1–4. palaeogeographic evolution of eastern Tethys. Journal of Asian Earth
Castresana J. Selection of conserved blocks from multiple alignments Sciences 2013;66:1–33.
for their use in phylogenetic analysis. Molecular Biology and Evolution Metcalfe I. Tectonic evolution of Sundaland. Bulletin of the Geological
2000;17:540–52. Society of Malaysia 2017;63:27–60.
Colgan DJ, McLauchlan A, Wilson GD et al. Histone H3 and U2 snRNA Miller KG, Wright JD, Katz ME et al. A view of Antarctic ice-sheet evo-
DNA sequences and arthropod molecular evolution. Australian lution from sea-level and deep-sea isotope changes during the Late
Journal of Zoology 1998;46:419–37. Cretaceous-Cenozoic. In: Cooper A K, Barrett PJ, Stagg H, Storey
Ezard T, Fujisawa T, Barraclough TG. Splits: species’ limits by threshold B, Stump E, Wise W, and the 10th ISAES editorial team, (eds.),
statistics version 1.0-20. (2009) from R-Forge. 2009https://rdrr.io/ Antarctica: A Keystone in a Changing World—Proceedings of the 10th
rforge/splits/ (6 October 2023, date last accessed). International Symposium on Antarctic Earth Sciences. Washington, DC:
Folmer O, Black M, Hoeh W et al. DNA primers for amplification of The National Academies Press, 2008, 55–70.
mitochondrial cytochrome c oxidase subunit I from diverse meta- Miller KG, Browning JV, Schmelz WJ et al. Cenozoic sea-level and
zoan invertebrates. Molecular Marine Biology and Biotechnology cryospheric evolution from deep-sea geochemical and continental
1994;3:294–9. margin records. Science Advances 2020;6:eaaz1346.
Minh BQ, Schmidt HA, Chernomor O et al. IQ-TREE 2: new models Schwendinger PJ, Huber S, Lehmann-Graber C et al. A taxonomic re-
and efficient methods for phylogenetic inference in the genomic era. vision of the Liphistius birmanicus-group (Araneae: Liphistiidae)
Molecular Biology and Evolution 2020;37:1530–4. with the description of five new species. Revue Suisse de Zoologie
Monaghan MT, Wild R, Elliot M et al. Accelerated species inventory on 2022;129:375–424.
Madagascar using coalescent-based models of species delineation. Selden PA. First fossil mesothele spider, from the Carboniferous of
Systematic Biology 2009;58:298–311. France. Revue Suisse de Zoologie 1996;2:585–96.
Myers N, Mittermeier RA, Mittermeier CG et al. Biodiversity hotspots for Selden PA, Ren D. A review of Burmese amber arachnids. The Journal of
conservation priorities. Nature 2000;403:853–8. Arachnology 2017;45:324–43.
Ono H. Liphistiid spiders (Araneae, Mesothelae) of northwest Thailand. Shi G, Grimaldi DA, Harlow GE et al. Age constraint on Burmese amber
Bulletin of the National Science Museum of Nature and Science Tokyo (A) based on U–Pb dating of zircons. Cretaceous Research 2012;37:155–63.
1988a;14:35–41. Sivayyapram V, Smith DR, Weingdow S et al. A new Liphistius species
Ono H. Liphistiid spiders (Araneae, Mesothelae) of south Thailand. (Mesothelae: Liphistiidae: Liphistiinae) from Thailand, with notes on
Bulletin of the National Science Museum of Nature and Science Tokyo its natural history. The Journal of Arachnology 2017;45:287–95.
(A) 1988b;14:145–50. Smith DR, Villafuerte L, Otis G et al. Biogeography of Apis cerana F.
Ono H, Schwendinger PJ. Liphistiid spiders (Araneae, Mesothelae) from and A. nigrocincta Smith: insights from mtDNA studies. Apidologie
central and eastern Thailand. Bulletin of the National Science Museum of 2000;31:265–79.
Nature and Science Tokyo (A) 1990;18:165–74. Tamura K, Stecher G, Kumar S. MEGA11: molecular evolutionary
Parnell J. The biogeography of the Isthmus of Kra region: a review. Nordic genetics analysis version 11. Molecular Biology and Evolution
Journal of Botany 2013;31:001–15. 2021;38:3022–7.
Pauwels OS, David P, Chimsunchart C et al. Reptiles of Phetchaburi Tanikawa A. Phylogeny and genetic variation in the spiders of the genus
Province, Western Thailand: a list of species, with natural history Ryuthela (Araneae: Liphistiidae). Acta Arachnologica 2013;62:41–9.
notes, and a discussion on the biogeography at the Isthmus of Kra. Thorell T. On European spiders. Review of the European genera of
Tropical Natural History 2003;3:23–53. spiders, preceded by some observations on zoological nomenclature
Platnick NI, Gertsch WJ. The suborders of spiders: a cladistic analysis [first part]. Nova Acta Regiae Societatis Scientiarum Upsaliensis (3)
(Arachnida, Araneae). American Museum Novitates 1976;2607:1–15. 1869;7:1–108.
Platnick NI, Sedgwick WC. A revision of the spider genus Liphistius Warrit N, Smith DR, Lekprayoon C. Genetic subpopulations of
(Araneae, Mesothelae). American Museum Novitates 1984;2781:1–31. Varroa mites and their Apis cerana hosts in Thailand. Apidologie
Pons J, Barraclough TG, Gomez-Zurita J et al. Sequence-based species de- 2006;37:19–30.
limitation for the DNA taxonomy of undescribed insects. Systematic White TJ, Bruns T, Lee S et al. Amplification and direct sequencing of
Biology 2006;55:595–609. fungal ribosomal RNA genes for phylogenetics. PCR Protocols: A
Puillandre N, Brouillet S, Achaz G. ASAP: assemble species by automatic Guide To Methods And Applications 1990;18:315–22.
partitioning. Molecular Ecology Resources 2021;21:609–20. World Spider Catalog. World Spider Catalog. Version 24.5. Natural
Raven RJ. The spider infraorder Mygalomorphae (Araneae): cladistics History Museum Bern, 2023. http://wsc.nmbe.ch, https://doi.
and systematics. Bulletin of the American Museum of Natural History org/10.24436/2 (6 October 2023, date last accessed).
1985;182:1–180. Wunderlich J. New and rare fossil spiders (Araneae) in mid Cretaceous
Rokas A, Carroll SB. More genes or more taxa? The relative contribu- amber from Myanmar (Burma), including the description of new ex-
tion of gene number and taxon number to phylogenetic accuracy. tinct families of the suborders Mesothelae and Opisthothelae as well
Molecular Biology and Evolution 2005;22:1337–44. as notes on the taxonomy, the evolution and the biogeography of the
Ronquist F, Teslenko M, Van Der Mark P et al. MrBayes 3.2: efficient Mesothelae. Beiträge zur Araneologie 2017;10:e279.
Bayesian phylogenetic inference and model choice across a large Xu X, Liu F, Chen J et al. Integrative taxonomy of the primitively seg-
model space. Systematic Biology 2012;61:539–42. mented spider genus Ganthela (Araneae: Mesothelae: Liphistiidae):
Schwendinger PJ. On the male of Liphistius trang (Araneae: Mesothelae) DNA barcoding gap agrees with morphology. Zoological Journal of the
with notes on the natural history of the species. Natural History Linnean Society 2015a;175:288–306.
Bulletin of the Siam Society 1987;35:9–25. Xu X, Liu F, Chen J et al. A genus-level taxonomic review of primi-
Schwendinger PJ. On the spider genus Liphistius (Araneae: Mesothelae) tively segmented spiders (Mesothelae, Liphistiidae). ZooKeys
in Thailand and Burma. Zoologica Scripta 1990;19:331–51. 2015b;488:121–51.
Schwendinger PJ. New Liphistius species (Araneae, Mesothelae) Xu X, Liu F, Cheng R-C et al. Extant primitively segmented spiders have
from southern Thailand and northern Malaysia. Zoologica Scripta recently diversified from an ancient lineage. Proceedings Biological
1995;24:143–56. Sciences 2015c;282:20142486.
Schwendinger PJ. New Liphistius species (Araneae, Mesothelae) from Xu X, Liu F, Chen J et al. Pre-Pleistocene geological events shaping diver-
western and eastern Thailand. Zoologica Scripta 1996;25:123–41. sification and distribution of primitively segmented spiders on East
Schwendinger PJ. Five new Liphistius species (Araneae, Mesothelae) from Asian margins. Journal of Biogeography 2016;43:1004–19.
Thailand. Zoologica Scripta 1998;27:17–30. Xu X, Liu F, Ono H et al. Targeted sampling in Ryukyus facilitates spe-
Schwendinger PJ. Liphistius thaleri, a new mesothelid spider species from cies delimitation of the primitively segmented spider genus Ryuthela
southern Thailand (Araneae, Liphistiidae). Contributions to Natural (Araneae: Mesothelae: Liphistiidae). Zoological Journal of the Linnean
History 2009;12:1253–68. Society 2017;181:867–909.
Schwendinger PJ. On two Liphistius species (Araneae: Liphistiidae) from Xu X, Kuntner M, Liu F et al. Formation of rivers and mountains drives
Laos. Zootaxa 2013;3702:51–60. diversification of primitively segmented spiders in continental East
Schwendinger PJ. A revision of the trapdoor spider genus Liphistius Asia. Journal of Biogeography 2018;45:2080–91.
(Mesothelae: Liphistiidae) in peninsular Malaysia; part 1. Revue Xu X, Kuntner M, Bond JE et al. Molecular species delimitation in the
Suisse de Zoologie 2017;124:391–445. primitively segmented spider genus Heptathela endemic to Japanese
Schwendinger PJ, Ono H. On two Heptathela species from southern islands. Molecular Phylogenetics and Evolution 2020;151:106900.
Vietnam, with a discussion of copulatory organs and systematics of Xu X, Su Y-C, Ho SY et al. Phylogenomic analysis of ultraconserved
the Liphistiidae (Araneae: Mesothelae). Revue Suisse de Zoologie elements resolves the evolutionary and biogeographic history of seg-
2011;118:599–637. mented trapdoor spiders. Systematic Biology 2021;70:1110–22.
Schwendinger PJ, Syuhadah N, Lehmann-Graber C et al. A revision of Yu Y, Blair C, He X. RASP 4: ancestral state reconstruction tool for
the trapdoor spider genus Liphistius (Mesothelae: Liphistiidae) in multiple genes and characters. Molecular Biology and Evolution
Peninsular Malaysia; part 2. Revue Suisse de Zoologie 2019;126:321–53. 2020;37:604–6.
Zaw K, Meffre S, Lai C-K et al. Tectonics and metallogeny of mainland Southeast Zhang J, Kapli P, Pavlidis P et al. A general species delimitation method
Asia — a review and contribution. Gondwana Research 2014;26:5–30. with applications to phylogenetic placements. Bioinformatics
Zhan Y, Sivayyapram V, Liu F et al. Three new species of the spider 2013;29:2869–76.
genus Liphistius (Araneae, Mesothelae, Liphistiidae) from Thailand. Zwickl DJ, Hillis DM. Increased taxon sampling greatly reduces phylo-
ZooKeys 2022;1104:115–28. genetic error. Systematic Biology 2002;51:588–98.
Table S1: Sample data and GenBank accession number
NO. Sample code SpeciesID Localities Lat. Long. Alt COI 16S H3 28S ITS2 Reference
1 ARA-2020-028_DAK1 L. lahu Mae Sun, Fang District, Chiang Mai, Thailand 19.86 99.05 1646 This study
OP013120 OP070573 OP018695 OP070344 OP070190
2 ARA-2020-029_DAK2 L. lahu Mae Sun, Fang District, Chiang Mai, Thailand 19.86 99.05 1646 This study
OP013121 OP070574 OP018696 OP070345 OP070191
3 ARA-2020-015_HND1 L. lannaianus Kuet Chang, Mae Taeng District, Chiang Mai, Thailand 19.32 98.6 1545 This study
OP013138 OP070591 OP018710 OP070362 OP070207
4 ARA-2020-016_HND2 L. lannaianus Kuet Chang, Mae Taeng District, Chiang Mai, Thailand 19.32 98.6 1545 This study
OP013139 OP070592 OP018711 OP070363 OP070208
5 ARA-2020-026_DS1 L. bristowei Suthep, Mueang Chiang Mai District, Chiang Mai, Thailand 18.8 98.9 1110 This study
OP013123 OP070576 OP018697 OP070347 OP070192
6 ARA-2020-037_ITN1 L. bristowei Tha Pha, Mae Chaem District, Chiang Mai, Thailand 18.51 98.48 1428 This study
OP013143 OP070596 OP018715 OP070367 OP070212
Tha Pha, Mae Chaem District, Chiang Mai, Thailand
7 ARA-2019-050_ITN10 L. bristowei 18.51 98.48 1428 This study
OP013144 OP070597 OP018716 OP070368 OP070213
8 ARA-2019-039_ITN11 L. bristowei 18.51 98.48 1428 - - - - This study
OP013145
9 ARA-2019-048a_ITN7 L. bristowei 18.51 98.48 1428 This study
OP013152 OP070604 OP018723 OP070375 OP070220
10 ARA-2019-048_ITN8 L. bristowei 18.51 98.48 1428 - This study
OP013153 OP070605 OP018724 OP070376
11 ARA-2019-046_ITN9 L. bristowei 18.51 98.48 1428 This study
OP013154 OP070606 OP018725 OP070377 OP070221
12 ARA-2020-013_ITN12 L. yamasakii 18.51 98.48 1428 This study
OP013146 OP070598 OP018717 OP070369 OP070214
OP013147 OP070599 OP018718 OP070370 OP070215
OP013148 OP070600 OP018719 OP070371 OP070216
OP013149 OP070601 OP018720 OP070372 OP070217
OP013150 OP070602 OP018721 OP070373 OP070218
OP013151 OP070603 OP018722 OP070374 OP070219
18 ARA-2019-057_WKS1 Liphistius sp. WKS Mae Koeng, Wang Chin District, Phrae, Thailand 17.97 99.59 389 This study
OP013255 OP070708 OP018813 OP070471 OP070319
Mae Koeng, Wang Chin District, Phrae, Thailand
19 ARA-2019-056_WKS2 Liphistius sp. WKS 17.97 99.59 389 - - - This study
OP013256 OP070709
20 ARA-2019-061_WKS3 Liphistius sp. WKS 17.97 99.59 389 This study
OP013257 OP070710 OP018814 OP070472 OP070320
OP013258 OP070711 OP018815 OP070473 OP070321
OP013259 OP070712 OP018816 OP070474 OP070322
23 ARA-2020-017_TSM1 L. jarujini Mae Tho, Mueang Tak District, Tak-A, Thailand 16.79 98.92 881 This study
OP013249 OP070702 OP018807 OP070465 OP070313
24 ARA-2020-018_TSM2 L. jarujini Mae Tho, Mueang Tak District, Tak-A, Thailand 16.79 98.92 881 This study
OP013250 OP070703 OP018808 OP070466 OP070314
25 ARA-2017-128_DKD1 L. marginatus Mae Tho, Mueang Tak District, Tak-B, Thailand 16.72 98.97 967 - This study
OP013122 OP070575 OP070346
26 ARA-2017-124_LS1 L. marginatus Wang Nam Yen, Wang Chao District, Tak, Thailand 16.64 99.02 868 - This study
OP013194 OP070646 OP070413 OP070259
27 ARA-2017-125_LS2 L. marginatus Wang Nam Yen, Wang Chao District, Tak, Thailand 16.64 99.02 868 This study
OP013195 OP070647 OP018758 OP070414 OP070260
28 ARA-2017-126_LS3 L. marginatus Wang Nam Yen, Wang Chao District, Tak, Thailand 16.64 99.02 868 This study
OP013196 OP070648 OP018759 OP070415 OP070261
29 ARA-2017-029_MW2 L. maewongensis Pang Ta Wai, Pang Sila Thong District, Kamphaeng Phet, Thailand 16.09 99.12 1250 - This study
OP013200 OP070652 OP070419 OP070265
OP013201 OP070653 OP070420 OP070266
OP013202 OP070654 OP070421 OP070267
32 ARA-2021-067_HKK1 Liphistius sp. HKK Rabam, Lan Sak District, Uthai Thani, Thailand 15.61 99.32 214 This study
OP013135 OP070588 OP018707 OP070359 OP070204
33 ARA-2021-068_HKK2 Liphistius sp. HKK Rabam, Lan Sak District, Uthai Thani, Thailand 15.61 99.32 214 This study
OP013136 OP070589 OP018708 OP070360 OP070205
34 ARA-2020-064_WM2 Liphistius sp. Sangkraburi Nong Lu, Sangkhlaburi District, Kanchanaburi-A, Thailand 15.22 98.37 197 This study
OP013260 OP070713 OP018817 OP070475 OP070323
35 ARA-2020-062_HMP2 Liphistius sp. Sangkraburi Nong Lu, Sangkhlaburi District, Kanchanaburi-B, Thailand 15.16 98.34 183 This study
OP013137 OP070590 OP018709 OP070361 OP070206
36 ARA-2018-294_TPP1 Liphistius sp. TPP Pilok, Thong Pha Phum District, Kanchanaburi, Thailand 14.69 98.4 938 - This study
OP013245 OP070698 OP018803 OP070309
37 ARA-2018-138_DW1 Liphistius sp. DW Pa Kar Ri, Dawei, Myanmar 14.1 98.3 39 - This study
OP013124 OP070577 OP070348 OP070193
38 ARA-2018-139_DW2 Liphistius sp. DW Pa Kar Ri, Dawei, Myanmar 14.1 98.3 39 This study
OP013125 OP070578 OP018698 OP070349 OP070194
OP013126 OP070579 OP018699 OP070350 OP070195
40 ARA-2018-146_DW4 Liphistius sp. DW Pa Kar Ri, Dawei, Myanmar 14.1 98.3 39 - This study
OP013127 OP070580 OP070351 OP070196
OP013128 OP070581 OP018700 OP070352 OP070197
OP013129 OP070582 OP018701 OP070353 OP070198
43 ARA-2020-055_PRK1 L. onoi Noen Phoem, Nakhon Thai District, Phitsanulok, Thailand 17 101.01 1238 This study
OP013215 OP070667 OP018774 OP070433 OP070279
OP013216 OP070668 OP018775 OP070434 OP070280
OP013217 OP070669 OP018776 OP070435 OP070281
46 ARA-2021-041_NN1 L. pushom Sap Sawang, Nam Nao District, Phetchabun, Thailand 16.74 101.58 859 This study
OP013206 OP070658 OP018766 OP070425 OP070271
47 ARA-2021-039_TT1 Liphistius sp. TT Tat Ton, Mueang Chaiyaphum, Chaiyaphum, Thailand 15.98 102.04 285 This study
OP013251 OP070704 OP018809 OP070467 OP070315
OP013252 OP070705 OP018810 OP070468 OP070316
OP013253 OP070706 OP018811 OP070469 OP070317
OP013254 OP070707 OP018812 OP070470 OP070318
51 ARA-2018-195_PP1 L. isan Huai Yang, Mueang Sakon Nakhon District, Sakon Nakhon, Thailand 17.1 103.97 308 This study
OP013212 OP070664 OP018771 OP070430 OP070276
OP013213 OP070665 OP018772 OP070431 OP070277
OP013214 OP070666 OP018773 OP070432 OP070278
54 ARA-2017-138_SL1 Liphistius sp. SL Nong Pla Lai, Mueang Saraburi District, Saraburi, Thailand 14.44 100.96 98 This study
OP013228 OP070681 OP018787 OP070445 OP070292
OP013229 OP070682 OP018788 OP070446 OP070293
OP013230 OP070683 OP018789 OP070447 OP070294
57 ARA-2018-274_CPP1 Liphistius sp. CPP Wang Phae, Kaeng Khoi District, Saraburi, Thailand 14.53 101.04 74 This study
OP013115 OP070568 OP018691 OP070339 OP070185
58 ARA-2018-276_CPP2 Liphistius sp. CPP Wang Phae, Kaeng Khoi District, Saraburi, Thailand 14.53 101.04 74 This study
OP013116 OP070569 OP018692 OP070340 OP070186
59 ARA-2017-147_CPP4 Liphistius sp. CPP Wang Phae, Kaeng Khoi District, Saraburi, Thailand 14.53 101.04 74 - This study
OP013117 OP070570 OP070341 OP070187
60 ARA-2020-030_LPC1 L. tham Mittraphap, Muak Lek District, Saraburi, Thailand 14.58 101.15 280 This study
OP013189 OP070641 OP018753 OP070408 OP070254
OP013190 OP070642 OP018754 OP070409 OP070255
OP013191 OP070643 OP018755 OP070410 OP070256
63 L. tham Mittraphap, Muak Lek District, Saraburi, Thailand 14.58 101.15 280 This study
ARA-2021-069_LPC4 OP013192 OP070644 OP018756 OP070411 OP070257
64 L. tham Mittraphap, Muak Lek District, Saraburi, Thailand 14.58 101.15 280 This study
ARA-2021-070_LPC5 OP013193 OP070645 OP018757 OP070412 OP070258
65 ARA-2018-281_CK1 Liphistius sp. CK Chet Khot, Kaeng Khoi District, Saraburi, Thailand 14.47 101.17 201 This study
OP013104 OP070557 OP018683 OP070328 OP070174
66 ARA-2018-282_CK2 Liphistius sp. CK Chet Khot, Kaeng Khoi District, Saraburi, Thailand 14.47 101.17 201 - This study
OP013105 OP070558 OP070329 OP070175
OP013106 OP070559 OP018684 OP070330 OP070176
OP013107 OP070560 OP018685 OP070331 OP070177
OP013108 OP070561 OP070332 OP070178
OP013109 OP070562 OP018686 OP070333 OP070179
OP013110 OP070563 OP018687 OP070334 OP070180
OP013111 OP070564 OP070335 OP070181
73 ARA-2018-296_WTK1 Liphistius sp. WTK Sarika, Mueang Nakhon Nayok District, Nakhon Nayok, Thailand 14.34 101.3 157 This study
OP013261 OP070714 OP018818 OP070476 OP070324
74 ARA-2018-299_WTK2 Liphistius sp. WTK Sarika, Mueang Nakhon Nayok District, Nakhon Nayok, Thailand 14.34 101.3 157 This study
OP013262 OP070715 OP018819 OP070477 OP070325
75 ARA-2020-023_KK1 L. thoranie Mu Si, Mueang Nakhon Nayok District, Nakhon Nayok, Thailand 14.44 101.37 754 This study
OP013167 OP070619 OP018732 OP070388 OP070232
OP013168 OP070620 OP018733 OP070389 OP070233
OP013169 OP070621 OP018734 OP070390 OP070234
78 ARA-2020-054_KY1 L. thoranie Na Hin Lat, Pak Phli District, Nakhon Nayok, Thailand 14.37 101.41 1171 This study
OP013185 OP070637 OP018749 OP070404 OP070250
79 ARA-2019-064_SKR1 Liphistius sp. SKR Udom Sap, Wang Nam Khiao District, Nakhon Ratchasima, Thailand 14.51 101.93 372 This study
OP013227 OP070680 OP018786 OP070444 OP070291
80 ARA-2020-058_PCN1 L. dangrek Na Chaluai, Na Chaluai District, Ubon Ratchathani, Thailand 14.44 105.27 354 This study
OP013207 OP070659 OP018767 OP070426 OP070272
81 ARA-2020-059_PCN2 L. dangrek Na Chaluai, Na Chaluai District, Ubon Ratchathani, Thailand 14.44 105.27 354 This study
OP013208 OP070660 OP018768 OP070427 OP070273
82 ARA-2019-067_PCN3 L. dangrek Na Chaluai, Na Chaluai District, Ubon Ratchathani, Thailand 14.44 105.27 354 - - - This study
OP013209 OP070661
83 ARA-2019-067b_PCN4 L. dangrek Na Chaluai, Na Chaluai District, Ubon Ratchathani, Thailand 14.44 105.27 354 This study
OP013210 OP070662 OP018769 OP070428 OP070274
84 ARA-2019-067a_PCN5 L. dangrek Na Chaluai, Na Chaluai District, Ubon Ratchathani, Thailand 14.44 105.27 354 This study
OP013211 OP070663 OP018770 OP070429 OP070275
85 ARA-2018-204_CTT1 L. sayam Bang Phra, Si Racha District, Chon Buri, Thailand 13.24 101.05 326 This study
OP013118 OP070571 OP018693 OP070342 OP070188
86 ARA-2018-205_CTT2 L. sayam Bang Phra, Si Racha District, Chon Buri, Thailand 13.24 101.05 326 This study
OP013119 OP070572 OP018694 OP070343 OP070189
87 ARA-2018-106_KCK1 L. ornatus Pluang, Khao Khitchakut District, Chanthaburi, Thailand 12.84 102.12 79 - - - This study
OP013161 OP070613
88 ARA-2018-107_KCK2 L. ornatus Pluang, Khao Khitchakut District, Chanthaburi, Thailand 12.84 102.12 79 This study
OP013162 OP070614 OP018731 OP070384 OP070228
89 ARA-2018-108_KCK3 L. ornatus Pluang, Khao Khitchakut District, Chanthaburi, Thailand 12.84 102.12 79 - - - This study
OP013163 OP070615
90 ARA-2018-115_KCK4 L. ornatus Pluang, Khao Khitchakut District, Chanthaburi, Thailand 12.84 102.12 79 - This study
OP013164 OP070616 OP070385 OP070229
OP013165 OP070617 OP070386 OP070230
OP013166 OP070618 OP070387 OP070231
93 ARA-2020-049_AP1 L. phileion Phe, Mueang Rayong District, Rayong, Thailand 12.57 101.45 69 This study
OP013102 OP070555 OP018681 OP070326 OP070172
94 ARA-2020-050_AP2 L. phileion Phe, Mueang Rayong District, Rayong, Thailand 12.57 101.45 69 This study
OP013103 OP070556 OP018682 OP070327 OP070173
95 ARA-2017-158_Pwf1 L. tenuis Phliu, Laem Sing District, Chanthaburi, Thailand 12.53 102.18 116 This study
OP013218 OP070670 OP018777 OP070436 OP070282
OP013219 OP070671 OP018778 OP070437 OP070283
OP013220 OP070672 OP018779 OP070438 OP070284
98 ARA-2020-032_MKC1 L. nesioticus Ko Chang, Ko Chang District, Trat, Thailand 12.11 102.27 84 This study
OP013197 OP070649 OP018760 OP070416 OP070262
OP013198 OP070650 OP018761 OP070417 OP070263
OP013199 OP070651 OP018762 OP070418 OP070264
101 ARA-2020-045_ERW1 L. erawan s.l. Tha Kradan, Si Sawat District, Kanchanaburi-A, Thailand 14.37 99.14 272 This study
OP013130 OP070583 OP018702 OP070354 OP070199
102 ARA-2020-046_ERW2 L. erawan s.l. Tha Kradan, Si Sawat District, Kanchanaburi-A, Thailand 14.37 99.14 272 This study
OP013131 OP070584 OP018703 OP070355 OP070200
103 ARA-2018-260_SRD1 L. erawan s.l. Tha Kradan, Si Sawat District, Kanchanaburi-B, Thailand 14.39 99.13 229 - This study
OP013231 OP070684 OP070448 OP070295
104 ARA-2018-261_SRD2 L. erawan s.l. Tha Kradan, Si Sawat District, Kanchanaburi-B, Thailand 14.39 99.13 229 This study
OP013232 OP070685 OP018790 OP070449 OP070296
105 ARA-2018-263_SRD3 L. erawan s.l. Tha Kradan, Si Sawat District, Kanchanaburi-B, Thailand 14.39 99.13 229 This study
OP013233 OP070686 OP018791 OP070450 OP070297
106 ARA-2018-314_HFP1 L. erawan s.l. Tha Sao,Sai Yok District, Kanchanaburi-A , Thailand 14.38 98.93 380 This study
OP013132 OP070585 OP018704 OP070356 OP070201
OP013133 OP070586 OP018705 OP070357 OP070202
OP013134 OP070587 OP018706 OP070358 OP070203
109 ARA-2017-118_SY1 L. erawan s.l. Tha Sao, Sai Yok District, Kanchanaburi-B, Thailand 14.24 99.06 158 This study
OP013234 OP070687 OP018792 OP070451 OP070298
OP013235 OP070688 OP018793 OP070452 OP070299
OP013236 OP070689 OP018794 OP070453 OP070300
112 ARA-2018-364_TNL1 Liphistius sp. TNL Wang Krachae, Sai Yok District, Kanchanaburi, Thailand 14.2 99.02 510 This study
OP013243 OP070696 OP018801 OP070460 OP070307
113 ARA-2018-365_TNL2 Liphistius sp. TNL Wang Krachae, Sai Yok District, Kanchanaburi, Thailand 14.2 99.02 510 This study
OP013244 OP070697 OP018802 OP070461 OP070308
114 ARA-2020-051_CL1 L. albipes Suan Som, Thap Sakae District, Phra Chaup Khirikhan, Thailand 11.57 99.54 108 This study
OP013112 OP070565 OP018688 OP070336 OP070182
OP013113 OP070566 OP018689 OP070337 OP070183
OP013114 OP070567 OP018690 OP070338 OP070184
117 ARA-2018-027_NLC1 L. keeratikiati Na Sak, Sawi District, Chumphon, Thailand 10.23 98.95 48 This study
OP013203 OP070655 OP018763 OP070422 OP070268
OP013204 OP070656 OP018764 OP070423 OP070269
OP013205 OP070657 OP018765 OP070424 OP070270
120 ARA-2021-057_KNK4 L. bicoloripes Na Kha, Suk Samran District, Ranong, Thailand 9.46 98.5 52 This study
OP013173 OP070625 OP018738 OP070394 OP070238
121 ARA-2021-058_KNK5 L. bicoloripes Na Kha, Suk Samran District, Ranong, Thailand 9.46 98.5 52 - This study
OP013174 OP070626 OP018739 OP070239
122 ARA-2021-065_KNK8 L. castaneus Na Kha, Suk Samran District, Ranong, Thailand 9.46 98.5 52 This study
OP013177 OP070629 OP018742 OP070397 OP070242
123 ARA-2021-066_KNK9 L. castaneus Na Kha, Suk Samran District, Ranong, Thailand 9.46 98.5 52 - This study
OP013178 OP070630 OP018743 OP070243
124 ARA-2018-096_KNK1 L. schwendingeri Na Kha, Suk Samran District, Ranong, Thailand 9.46 98.5 52 This study
OP013170 OP070622 OP018735 OP070391 OP070235
OP013171 OP070623 OP018736 OP070392 OP070236
OP013172 OP070624 OP018737 OP070393 OP070237
OP013175 OP070627 OP018740 OP070395 OP070240
OP013176 OP070628 OP018741 OP070396 OP070241
129 ARA-2021-018_KS1 L. niphanae Krung Ching, Nopphitam District, Nakhon Si Thammarat, Thailand 8.72 99.67 248 This study
OP013182 OP070634 OP018746 OP070401 OP070247
OP013183 OP070635 OP018747 OP070402 OP070248
OP013184 OP070636 OP018748 OP070403 OP070249
132 ARA-2018-050_KC1 L. trang Chong, Na Yong District, Trang, Thailand 7.55 99.79 161 This study
OP013155 OP070607 OP018726 OP070378 OP070222
OP013156 OP070608 OP018727 OP070379 OP070223
134 ARA-2018-055_KC3 L. trang Chong, Na Yong District, Trang, Thailand 7.55 99.79 161 - This study
OP013157 OP070609 OP070380 OP070224
OP013158 OP070610 OP018728 OP070381 OP070225
OP013159 OP070611 OP018729 OP070382 OP070226
137 ARA-2021-052_KC6 L. trang Na Yong District, Trang, Thailand 8.37 99.74 161 This study
OP013160 OP070612 OP018730 OP070383 OP070227
138 ARA-2021-045_KPN1 Liphistius sp. KPN Ao Luek District, Krabi, Thailand 8.35 98.9 129 This study
OP013181 OP070633 OP018745 OP070400 OP070246
139 ARA-2020-047_KPB1 L. fuscus Mueang Krabi District, Krabi, Thailand 8.24 98.92 307 This study
OP013179 OP070631 OP018744 OP070398 OP070244
140 ARA-2020-048_KPB2 L. fuscus Mueang Krabi District, Krabi, Thailand 8.24 98.92 307 - This study
OP013180 OP070632 OP070399 OP070245
141 ARA-2020-020_TS1 L. phuketensis Khanaen, Thalang District, Phuket, Thailand 8.03 98.36 89 This study
OP013246 OP070699 OP018804 OP070462 OP070310
OP013247 OP070700 OP018805 OP070463 OP070311
OP013248 OP070701 OP018806 OP070464 OP070312
144 ARA-2021-075_T1 Liphistius sp. T Lam Khlaeng, Palian District, Trang, Thailand 7.29 99.88 89 This study
OP013237 OP070690 OP018795 OP070454 OP070301
145 ARA-2021-022_LB1 L. thaleri Lang Khao, Kantang District, Trang, Thailand 7.27 99.38 37 This study
OP013186 OP070638 OP018750 OP070405 OP070251
OP013187 OP070639 OP018751 OP070406 OP070252
OP013188 OP070640 OP018752 OP070407 OP070253
148 ARA-2018-370_HY1 L. hatyai Kho Hong, Hat Yai District, Songkhla, Thailand 7.04 100.51 162 This study
OP013140 OP070593 OP018712 OP070364 OP070209
149 ARA-2018-372-_HY2 L. hatyai Kho Hong, Hat Yai District, Songkhla, Thailand 7.04 100.51 162 This study
OP013141 OP070594 OP018713 OP070365 OP070210
150 ARA-2018-377_HY3 L. hatyai Kho Hong, Hat Yai District, Songkhla, Thailand 7.04 100.51 162 This study
OP013142 OP070595 OP018714 OP070366 OP070211
151 ARA-2021-017_TNC1 L. yangae s.l. Chalung, Hat Yai District, Songkhla, Thailand 6.95 100.24 167 This study
OP013242 OP070695 OP018800 OP070459 OP070306
152 ARA-2018-064_TLB1 L. yangae s.l. Wang Prachan, Khuan Don District, Satun, Thailand 6.71 100.17 174 This study
OP013238 OP070691 OP018796 OP070455 OP070302
OP013239 OP070692 OP018797 OP070456 OP070303
OP013240 OP070693 OP018798 OP070457 OP070304
OP013241 OP070694 OP018799 OP070458 OP070305
156 ARA-2021-010_SK10 L. indra Sai Khao, Khok Pho District, Pattani, Thailand 6.66 101.1 83 This study
OP013224 OP070677 OP018783 OP070441 OP070288
OP013225 OP070678 OP018784 OP070442 OP070289
OP013226 OP070679 OP018785 OP070443 OP070290
159 ARA-2020-001_RY1 L. cf. ornatus Rayong, Thailand - - - - - - This study
OP013221 OP070673
160 ARA-2020-002_RY2 L. cf. ornatus Rayong, Thailand - - - This study
OP013222 OP070674 OP018780 OP070439 OP070285
161 ARA-2020-004_RY3 L. cf. ornatus Rayong, Thailand - - - This study
OP013223 OP070675 OP018781 OP070440 OP070286
162 ARA-2020-006_RY4 L. cf. ornatus Rayong, Thailand - - - - - This study
OP070676 OP018782 OP070287
163 XUX-2013-151 Ganthela sp. Xianyou, Fujian, China KP229880 KP230038 KP229972 KP230202 KP230374 Xu et al. 2015a
164 XUX-2013-391 Heptathela higoensis Kumamoto, Kyushu, Japan KP229852 KP230132 KP230031 KP230252 KP230338 Xu et al. 2015a
165 XUX-2012-087 Qiongthela baishensis Baisha,Hainan, China KP229805 KP230144 KP229941 KP230278 KP230282 Xu et al. 2015a
166 XUX-2013-200 Ryuthela ishigakiensis Iriomotejima, Okinawa, Japan KP229848 KP230147 KP229966 KP230257 KP230356 Xu et al. 2015a
167 XUX-2011-270 Sinothela heyangensis Jingyang, Shaanxi, China KP229917 KP230062 KP230005 KP230209 KP230332 Xu et al. 2015a
168 XUX-2012-256 Songthela bristowei Wanzhou, Chongqing, China KP229808 KP230061 KP230025 KP230204 KP230324 Xu et al. 2015a
169 XUX-2013-047 Vinathela abca LaoCai, Vietnam KP229817 KP230086 KP229984 KP230221 KP230314 Xu et al. 2015a
170 XUX-2013-257 L. laoticus Etu waterfalll, Pakse, Laos KP229913 Xu et al. 2015a
171 XUX-2013-256 L. laoticus Laos, Champasak, Etu Waterfall, Laos KP229833 Xu et al. 2015a
172 XUX-2013-266 L. laoticus Laos, Champasak, Fane Waterfall, Laos KP229884 Xu et al. 2015a
173 LM-2013-02 L. malayanus Genting Highlands, Pahang, Malaysia KP229904 Xu et al. 2015a
174 LM-2013-01 L. malayanus Genting Highlands, Pahang, Malaysia KP229862 Xu et al. 2015a
175 LS014 L. malayanus Ampang Forest Reserve, Selangor, Malaysia KR017711 Schwendinger et al., 2019
176 LS013 L. malayanus Ampang Forest Reserve, Selangor, Malaysia KR017712 Schwendinger et al., 2019
177 LS020 L. malayanus Ulu Bendul Amenity Forest, Negeri Sembilan, Malaysia KR028500 Schwendinger et al., 2019
178 LS114 L. malayanus Ulu Bendul Amenity Forest, Negeri Sembilan, Malaysia KR017713 Schwendinger et al., 2019
179 LS019 L. malayanus Ulu Gombak Forest Reserve, Selangor, Malaysia KR028508 Schwendinger et al., 2019
182 LS098 L. malayanus Kemensah Waterfall, Selangor, Malaysia KR028537 Schwendinger et al., 2019
183 LS009 L. malayanus Genting Highland, Pahang, Malaysia KR028504 Schwendinger et al., 2019
185 LS012 L. malayanus Fraser’s Hill, Pahang, Malaysia KR028501 Schwendinger et al., 2019
186 LS008 L. malayanus Fraser’s Hill, Pahang, Malaysia KR028502 Schwendinger et al., 2019
188 LS094 L. endau Endau-Rompin National Park, Johor, Malaysia KR028523 Schwendinger et al., 2019
191 LS140 L. endau Kota Tinggi Waterfall, Johor, Malaysia KR028525 Schwendinger et al., 2019
192 LS141 L. endau Kota Tinggi Waterfall, Johor, Malaysia KR028526 Schwendinger et al., 2019
193 LS036 L. desultor Penang Botanic Gardens, Penang, Malaysia KR028516 Schwendinger et al., 2019
194 LS053 L. desultor Teluk Bahang Amenity Forest, Penang, Malaysia KR028517 Schwendinger et al., 2019
195 LS054 L. desultor Teluk Bahang Amenity Forest, Penang, Malaysia KR028518 Schwendinger et al., 2019
196 LS125 L. laruticus Maxwell Hill, Perak, Malaysia KR028527 Schwendinger et al., 2019
201 LS80 L. cf. desultor Ulu Kinta Amenity Forest, Perak, Malaysia KR028532 Schwendinger et al., 2019
204 LS035 L. murphyorum Teluk Bahang Amenity Forest, Penang, Malaysia KR028520 Schwendinger et al., 2019
207 LS059 Liphistiussp. Malaysia A Felda Tekam, Pahang, Malaysia KR028538 Schwendinger et al., 2019
208 LS067 Liphistiussp. Malaysia A Felda Tekam, Pahang, Malaysia KR028539 Schwendinger et al., 2019
209 LS143 Liphistiussp. Malaysia A Lake Kenyir, Terengganu, Malaysia KR028531 Schwendinger et al., 2019
210 LS142 Liphistiussp. Malaysia A Lake Kenyir, Terengganu, Malaysia KR028530 Schwendinger et al., 2019
211 LS049 Liphistiussp. Malaysia A Pasir Raja Forest Reserve, Terengganu, Malaysia KR028535 Schwendinger et al., 2019
212 LS051 Liphistiussp. Malaysia A Pasir Raja Forest Reserve, Terengganu, Malaysia KR028536 Schwendinger et al., 2019
213 LS002 Liphistiussp. Malaysia B Parit Falls Forest Eco Park, Cameron Hl., Pahang, Malaysia KR028511 Schwendinger et al., 2019
214 LS003 Liphistiussp. Malaysia B Parit Falls Forest Eco Park, Cameron Hl., Pahang, Malaysia KR028512 Schwendinger et al., 2019
215 JQ407803 L. erawan Thailand JQ407803 Unpublished

(2024.06.08) Heptathelinae - Zmiana Statusu Do Podrodziny

Uploaded by

Copyright:

Available Formats

(2024.06.08) Heptathelinae - Zmiana Statusu Do Podrodziny

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

(2024.06.08) Heptathelinae - Zmiana Statusu Do Podrodziny

Uploaded by

Copyright:

Available Formats

Zoological Journal of the Linnean Society, 2024, 201, 339–357

Subdistrict Pathumwan District, Bangkok 10330, Thailand. E-mail: natapot.w@chula.ac.th

Received 4 April 2023; revised 20 June 2023; accepted 6 September 2023

Table 2. Primers used and their annealing temperatures.

215 JQ407803 L. erawan Thailand JQ407803 Unpublished

You might also like