Molecular Biology Labnote
Molecular Biology Labnote
Molecular Biology
-Practical-
(BCH 361)- Handout
0
Table of Contents
Introduction to Molecular Biology ____________________________________________ 1
• What is Molecular Biology ____________________________________________________ 1
• Why Understanding of Molecular Biology is Important _____________________________ 1
• Things you must to know as Molecular Biologist __________________________________ 1
➢ Basic Molecular Biology background __________________________________________ 1
➢ Molecular Biology techniques _______________________________________________ 2
➢ Lab safety _______________________________________________________________ 2
➢ Types of hazards in molecular biology lab ______________________________________ 2
➢ Website Sources of information ______________________________________________ 3
➢ Writing a lab report ________________________________________________________ 3
Experiment (1): Extraction of DNA from Blood _________________________________ 4
• Aim ______________________________________________________________________ 4
• Introduction ________________________________________________________________ 4
• Principle __________________________________________________________________ 5
• Materials __________________________________________________________________ 5
• Protocol ___________________________________________________________________ 6
• Results ____________________________________________________________________ 6
Experiment (2): DNA Extraction from Plant Tissue ______________________________ 8
• Aim ______________________________________________________________________ 8
• Introduction ________________________________________________________________ 8
• Principle __________________________________________________________________ 8
• Materials __________________________________________________________________ 9
• Protocol ___________________________________________________________________ 9
• Results ____________________________________________________________________ 9
Experiment (3): Characterization of DNA by Spectrophotometric Assay and Melting
Temperature (Tm) ________________________________________________________ 12
• Aim _____________________________________________________________________ 12
• Introduction _______________________________________________________________ 12
• Principle _________________________________________________________________ 13
• Materials _________________________________________________________________ 13
• Protocol __________________________________________________________________ 13
• Results ___________________________________________________________________ 14
Experiment (4): Agarose Gel Electrophoresis __________________________________ 17
• Aim _____________________________________________________________________ 17
• Introduction _______________________________________________________________ 17
• Principle _________________________________________________________________ 18
• Materials _________________________________________________________________ 18
• Protocol __________________________________________________________________ 18
• Results ___________________________________________________________________ 19
Experiment (5): Polymerase Chain Reaction (PCR) _____________________________ 22
• Introduction _______________________________________________________________ 22
• What is PCR (DNA photocopier) ____________________________________________ 22
1
• PCR components _________________________________________________________ 23
• PCR cycle ______________________________________________________________ 24
• Performing PCR steps _____________________________________________________ 26
• Primer design ___________________________________________________________ 26
• PCR Optimization ________________________________________________________ 27
• Post-PCR analysis ________________________________________________________ 27
• Advantages of PCR _______________________________________________________ 27
• PCR application _________________________________________________________ 28
• Supporting materials ______________________________________________________ 28
Experiment (6): Optimization of Annealing Temperature ________________________ 31
• PCR Optimization : _______________________________________________________ 31
• Optimization of annealing temperature (Ta): ___________________________________ 33
• Materials: ______________________________________________________________ 33
• Protocol: _______________________________________________________________ 33
• Results: ________________________________________________________________ 34
Experiment (7): PCR Troubleshooting ________________________________________ 37
• Common Issues in PCR ___________________________________________________ 37
1. Low or no amplification (no band or faint band) ________________________________ 37
2. Non-specific band or primer dimer ___________________________________________ 38
3. Incorrect product size _____________________________________________________ 38
4. Smeared Bands __________________________________________________________ 38
• Common PCR additive reagents _____________________________________________ 39
Experiment (8): Digestion of DNA with Restriction Enzymes _____________________ 42
• How Restriction Enzyme cut the DNA ________________________________________ 42
• Mechanism of Action _____________________________________________________ 43
• Uses in Biotechnology ______________________________________________________ 43
• Principle _________________________________________________________________ 44
• Materials _________________________________________________________________ 44
• Protocol __________________________________________________________________ 44
• Results ___________________________________________________________________ 44
Experiment (9): Sanger Sequencing __________________________________________ 47
• Aim _____________________________________________________________________ 47
• Introduction _______________________________________________________________ 47
• Principle of automated Sanger method __________________________________________ 48
• Sanger sequencing steps _____________________________________________________ 49
• Sanger sequencing application ________________________________________________ 49
2
BCH361 [Practical] Biochemistry department
1
BCH361 [Practical] Biochemistry department
➢ Lab safety:
1. Before Start Working:
• Wearing of laboratory coats.
• Wear gloves and goggles when working with toxic chemicals or UV light.
• Disinfect your lab bench at the beginning using 70% ethanol.
2. During Working:
• Clean up as you proceed through experiments and keep your work area organized.
• Do not work with UV light on.
• Read the labels on the chemical that you are using carefully, some chemical are
mutagens like ethidium bromide.
3. After Working:
• Wash your hands.
• Disinfect your lab bench at the beginning using 70% ethanol.
• Wash your glassware and organize your working area.
2. Chemical hazards:
All chemicals are, to varying extents, capable of causing damage to the body.
*Ethidium bromide (EtBr): is a mutagen and a potential carcinogen and must be
treated with respect. EtBr solutions can be handled safely as long as gloves are worn.
2
BCH361 [Practical] Biochemistry department
2. Review article:
Review articles are also peer-reviewed, and don’t present new information, but
summarize multiple primary research articles, to give a sense of the consensus,
debates, and unanswered questions within a field. It is better to start with it
for reading new topic.
References:
3
BCH361 [Practical] Biochemistry department
Aim:
• To isolate pure genomic DNA from rat blood sample.
Introduction:
Genomic DNA constitutes the total genetic information of an organism. The genomes
of almost all organisms are DNA, the only exceptions being some viruses that have RNA
genomes. Genomic DNA molecules are generally large, and in most organisms are organized
into DNA–protein complexes called chromosomes. The size, number of chromosomes, and
nature of genomic DNA varies between different organisms. Genomic DNA contains genes,
discrete regions that encode a protein or RNA. A gene comprises the coding DNA sequence,
as well as the associated regulatory elements that control gene expression. Nuclear eukaryotic
genes also contain noncoding regions called introns. The number of genes varies widely
between different organisms.
DNA isolation is an essential technique in molecular biology; it is the first step in the
study of specific DNA sequences, genomic structure, DNA fingerprinting, restriction fragment
length polymorphism (RFLP), and PCR analysis. The quantity, quality and integrity of the
isolated DNA will directly affect these results.
Sources for DNA extraction are very diverse, practically DNA can be isolated from any
part of human body such as semen, saliva, hair roots, mouth swabs and even from several skin
cells left on the surface after it has been touched. However, the most common sources are soft
tissue or blood samples. There are many different methods which can be used to perform DNA
extraction on such samples such as organic extraction, salting out, magnetic separation and
silica based technology. The choice of a method depends on many factors: the tissue type, the
concentration of DNA, sample number, safety of the experiment and coast. Regardless of the
used methods, they happen to follow some common procedures aimed to achieve effective cell
lysis, proteins and RNA removal, and lastly DNA precipitation. Resulting in a
homogeneous DNA preparation that represent the entire genetic information contained within
the cell.
PAUSE AND THINK ➔ Can we obtain DNA from mature RBC? Why?
4
BCH361 [Practical] Biochemistry department
Principle:
Successful nucleic acid isolation protocols have been published for nearly all biological
materials. They involve the physical and chemical processes of tissue homogenisation (to
increase the number of cells or the surface area available for lysis), cell permeabilization, cell
lysis (using hypotonic buffers), removal of nucleases, protein degradation, protein
precipitation, solubilisation of nucleic acids and finally various washing steps. Cell
permeabilization may be achieved with the help of non-ionic (non DNA-binding) detergents
such as Triton.
Materials:
Chemical
Ethylene diamine tetra acetate (EDTA), NaOH, Tris-HCl, sucrose, MgCl2, Triton X100,
Sodium dodecyl sulphate (SDS), NaCl, Sodium perchlorate, TE buffer or double distilled
water, cold chloroform, cold ethanol.
Preparation of solutions
1) 0.5 M EDTA, pH 8.0
Add 146.1 g of anhydrous EDTA to 800 ml of distilled water. Adjust pH to 8.0 with NaOH
(about 20 g). Make up the volume to 1 L with distilled water.
2) 1 M Tris-HCl, pH 7.6
Dissolve 121.1 g of Tris base in 800 ml of distilled water. Adjust pH with concentrated HCl
(about 60 ml). Make up the volume to 1 L with distilled water.
5
BCH361 [Practical] Biochemistry department
Protocol:
1. Place 3 mL of whole blood in a 15-mL falcon tube (centrifuge tube).
2. Add 12 mL of reagent A.
3. Mix on a rolling or rotating blood mixer for 4 min at room temperature (to prevent
leakage, close the lid tightly).
4. Centrifuge at 3000g for 5 min at room temperature.
5. Discard supernatant without disturbing cell pellet. Remove remaining moisture by
inverting the tube and blotting onto tissue paper.
6. Add 1 mL of reagent B and vortex briefly to re-suspend the cell pellet.
7. Add 250 μL of 5 M NaCl and mix by inverting tube several times.
8. Place tube in water bath for 15 to 20 min at 65 °C.
9. Add 2 mL of ice-cold chloroform.
10. Mix on shaker for 20 min.
11. Centrifuge at 2400g for 2 min.
12. Transfer upper phase into a clean falcon tube using a sterile pipette.
13. Add 2 to 3 ml of ice-cold ethanol and invert gently to allow DNA to precipitate (if a
cloudy did not form, add more ethanol).
14. Using a clean Pasteur pipette spool the DNA onto the hooked end.
15. Immediately transfer to a 1.5-mL microcentrifuge tube.
16. Spin the microcentrifuge tube at 6000 rpm for about 5 minutes.
17. Gently remove the supernatant (ethanol layer) without disrupting the DNA pellets, and
leave it to dry.
18. Re-suspend in 200 μL of TE buffer or doubled distal water water and label the tube.
19. As a final step in nucleic acid isolation, the yield and purity of the extracted nucleic acid
may need to be determined (Lab No. 3).
Results:
Cloudy precipitation can be seen by the naked eye, and it represents the isolated genomic DNA.
References:
6
BCH361 [Practical] Biochemistry department
Analysis Sheet #1
Name: ______________________
ID: _________________________
Problem.1:
What is the purpose of the following? How it performs its role?
EDTA: ______________________________________________________________
The cell lysis solution:___________________________________________________
_____________________________________________________________________
70% Ethanol: __________________________________________________________
Problem.2:
Isolated DNA should be free from contaminating proteins, heme and other cellular
macromolecule, what precautions did you take to solve this situation?
___________________________________________________________________________
___________________________________________________________________________
Problem.3:
In this procedure, what other salts can be used instead of 5M sodium chloride?
___________________________________________________________________________
___________________________________________________________________________
7
BCH361 [Practical] Biochemistry department
Aim:
• To isolate pure genomic DNA from plant tissue.
Introduction
Studying plant genome allows us to characterize and modify plant genes and metabolic
pathways, as well as understanding the genetic variation in species. Transgenic (GM) plants
are those that have been genetically modified using recombinant DNA technology. This may
be to express a gene that is not native to the plant or to modify endogenous genes. The protein
encoded by the gene will confer a particular trait or characteristic (eg: growth or survival) to
that plant. The technology can also be used to improve the nutritional content of the plant, as
well as production of some industrial products, such as monoclonal antibodies, vaccines,
plastics and biofuels.
Method used for extracting DNA from plants is different from extracting DNA from
animal sources as the plant contains hard cellulose cell wall and large DNA molecule.
Essentially, breaking the cell wall and cellular membranes (lysis) using mechanical or non-
mechanical methods to allow access to nuclear material, without its degradation. For this,
usually an initial grinding step is employed to break down cell wall material and allow access
to DNA while cellular enzymes are inactivated.
The main goal of developing number of protocol for isolating DNA from plant, is to
extract DNA with pure and high quality. DNA must be purified from cellular material in a
manner that prevents degradation.
PAUSE AND THINK ➔ How extraction of plant DNA differ from animal DNA?
Principle:
Breaking the cell wall and cellular membranes (lysis) by using mechanical or non-
mechanical methods. Mechanical methods is to force the cell wall to open and spilling the
contents. On the other hand, non-mechanical method is the addition of enzymes or chemicals
that specifically break down cell wall components in combination with mechanical force. The
advantage of mechanical disruption over the non-mechanical is that no chemicals are
introduced that might interfere with the extracted substance, and these chemicals need to be
removed from the sample afterwards.
After lysis, small cracks were formed in the cell membrane for accessibility of
detergents. Detergents will break down the cell membranes due to the amphipathic (having
both hydrophilic and hydrophobic regions) nature of both cellular membranes and detergent
molecules.
The DNA is then precipitated from the protein in a subsequent step with isopropanol or
ethanol. The clean DNA is now suspended in a 1XTE buffer or dd.H2O.
8
BCH361 [Practical] Biochemistry department
Materials:
Chemical
Strawberry, Extraction solution, 96% Cold ethanol or isopropanol, and TE buffer or double
distilled water.
Protocol:
1. After removing the green leaf of the strawberry, weight the plant using sensitive
balance.
2. Place the plant onto a mortal. Chop it into small pieces using a clean razor blade.
3. Add the DNA extraction buffer on a 1:1 ratio (e.g. if the plant weight 20 g, we will add
20 ml of the solution).
4. Then mix the chopped strawberry pieces using a pestle for 5 minutes.
5. Pour the mixture through cheesecloth into clean beaker.
6. Pipette 2 ml of the mixture into a clean test tube.
7. On the same tube, slowly add 2 ml of cold ethanol (DON’T MIX).
8. DNA will appear as a clear white thread.
9. Using a clean Pasteur pipette, spool the DNA onto the hooked end.
10. Immediately transfer to centrifuge tube.
11. Spin the centrifuge tube at 6000 rpm for about 5 minutes.
12. Gently remove the supernatant (ethanol layer) without disrupting the DNA pellets, and
leave it to dry.
13. Suspend the pellet in 0.5 - 1.5 ml TE buffer or double distilled water.
Results:
Cloudy precipitation can be seen by the naked eye, and it represent the isolated DNA.
References:
9
BCH361 [Practical] Biochemistry department
Analysis Sheet #2
Name: ______________________
ID: _________________________
Problem.1:
DNA from other sources like mitochondrion and chloroplast can precipitate out with your
nuclear DNA; discuss how you can overcome this problem?
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
Problem.2:
What are possible sources that can contaminate your plant DNA sample?
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
10
BCH361 [Practical] Biochemistry department
Problem.3:
In general, what precautions you should keep in mind while isolating DNA?
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
Problem.4:
In general, why it is important to remove the ethanol completely before re-suspending DNA?
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
11
BCH361 [Practical] Biochemistry department
Aim:
• Determination of the concentration and purity of extracted DNA using UV
spectrophotometer.
• Determination of DNA melting temperature and GC content percentage.
Introduction:
DNA extracts must meet downstream applications requirements. For that after each
extraction approach, DNA undergo characterization process, where quantity and quality (purity
and intactness) must be measured. The characterization of DNA could be performed with a
number of different techniques. In this experiment, spectrophotometric and melting
temperature will be used to determine DNA concentration, purity, and GC content.
Characterization of extracted DNA by spectrophotometric assay: DNA concentration
and purity can be determined by measuring the absorption of ultraviolet light. The DNA has a
maximum and minimum absorbance at 260 nm and 234nm, respectively and the purines and
pyrimidine in nucleic acid are responsible for these absorptions. At 260 nm double-stranded
DNA has specific absorption coefficient of 0.02 (μg/ml)-1cm-1. Moreover, the A260/A280 ratio
allow to detect nucleic acid purity from proteins contamination since proteins have maximum
absorption at 280 nm. Highly purified DNA samples have a 260/280 nm ratio of (1.8-1.9), thus
below (1.8) a significant amount of protein impurity may present within the sample. The
A260/A230 ratio determined to confirm that the sample is pure from carbohydrates, peptides,
ethanol or any organic compounds, and it is usually between 2 and 2.2.
DNA melting temperature and GC content: The two strands of the DNA double helix
separate when hydrogen bonds between the paired bases are disrupted and this can occur in
vitro if the pH of the DNA solution is altered, or if the solution is heated. When DNA is heated,
the double-stranded DNA (dsDNA) unwinds and separates into single-stranded (ssDNA) by
breaking the hydrogen bonds between the bases (A=T and G≡C). This process called DNA
denaturation and it can be monitored by measuring its absorbance at 260 nm. The absorbance
of DNA at 260 nm increases as the DNA becomes denatured, a phenomenon known as the
hyperchromic effect. The opposite, a decrease of absorbance is called hypochromic effect. The
Tm is the temperature at which 50% of the DNA is unpaired (denatured), and it is depending
on both length and GC content of the DNA. The GC content of the DNA that is critical for its
stability, and it can be provided by melting temperature (Tm) profile. This profile can be
achieved by gradual denaturation of dsDNA into ssDNA.
PAUSE AND THINK ➔ What is the principle behind hyper/hypochromic effect?
12
BCH361 [Practical] Biochemistry department
Principle:
When a dilute aqueous DNA solution is heated slowly, the two strands of the double
helix gradually separate, leading to the formation of a single stranded DNA (denaturation). It
results in an increase in absorbance at 260 nm. Temperature for midpoint of denaturation gives
Tm by increasing the temperature slowly and measuring absorbance at 260 nm as melting
profile can be generated. The DNA of each species has a specific denaturation curve which is
dependent on the % GC content and length. In double stranded DNA, G and C base pairing is
more stable and requires more heat energy to break the three hydrogen bonds to separate the
strands.
Materials:
The extracted blood and plant DNA from previous experiments, 0.1 X SSC buffer.
Preparation of 20X SSC buffer
Dissolve 175.3 g of NaCl, 88.2g of sodium citrate dehydrate in 8000 ml distilled water. Adjusts
pH to 7.0 with diluted HCl. Make up the final volume to 1 L by distilled water.
Protocol:
A. Characterization of DNA by Spectrophotometric Assay (concentration and purity):
1. Prepare 1 ml of the sample by diluting your extracted DNA (your stock) in 0.1 X SSC
buffer with 1:10 ratio.
2. Place the DNA sample in a quartz cuvette (why?) along with a second cuvette contains
distal water as a blank, then set the spectrophotometer as follows:
Nucleic acid → DNA → 10 mm→ µg/ml → yes→ Enter the dilution factor.
OR
2. Traditionally, measure the absorbance at 230, 260 and 280 nm.
1. In a test tube, prepare 1 ml of the sample by diluting your extracted DNA (your stock)
to 10 µg/ml with 0.1 X SSC buffer.
2. In another test tube, pipette 1 ml of distilled water.
3. Cover the tubes by aluminium foil. Then place them into a water bath at 25°C and allow
temperature to equilibrate (4 min).
4. Immediately, transfer the sample and the blank into quartz cuvette, re-place them in the
water bath, and allow temperature to equilibrate for 1 min.
5. Immediately read the absorbance at 260 nm.
6. Raise the temperature of the water bath to 50 °C, 60 °C, 70 °C, and boiling, then repeat
steps 3-5.
13
BCH361 [Practical] Biochemistry department
Results:
A. Characterization of DNA by Spectrophotometric Assay (concentration and purity):
➢ Determine the purity of the DNA samples by calculating A260/A280 and A260/A230 ratios.
B. Melting Temperature:
➢ Plot the value of absorbance vs. temperature and calculate the Tm for sample DNA.
➢ Find out the GC content of your sample using the following formula:
(G + C)% = (Tm - 69.3) x 2.44
References:
14
BCH361 [Practical] Biochemistry department
Analysis Sheet #3
Name: ______________________
ID: _________________________
Problem.1:
How pure is your DNA samples? Reflect on the possible sources of contaminations of your
samples? What your sample should have?
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
15
BCH361 [Practical] Biochemistry department
Problem.2:
Discuss the curve of your melting temperature, is it the same pattern that it supposes to be or
not and why?
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
Problem.3:
Compare between the melting temperatures of DNA obtained from the two different
sources.
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
Problem.4:
Answer the following:
What does the ratio of AT/CG tells you?
____________________________________________________________________
____________________________________________________________________
____________________________________________________________________
What is the relationship between the DNA melting temperature and GC content?
Explain the reason behind this relationship?
____________________________________________________________________
____________________________________________________________________
____________________________________________________________________
____________________________________________________________________
16
BCH361 [Practical] Biochemistry department
Aim:
• Evaluating the intactness of the extracted DNA by agarose gel electrophoresis.
• To separate and calculate the molecular size of DNA fragment by comparing the
separated bands with known standard molecular weight marker.
• To quantify DNA fragment by comparing the separated band with known quantity of
DNA.
Introduction:
Agarose gel electrophoresis is method for separation (by size), quantifying, purification
of nucleic acids fragments mixture, and analysis of DNA restriction fragments. It is one of the
most widely-used techniques in biochemistry and molecular biology. Agarose is a liner
polymer composed of alternative residues of D-galactose and 3,6-anhydro-L-galactopyranose
joined by α (1→3) and β (1→4) glycosidic linkages. Agarose and acrylamide matrices are used
to separate DNA by gel electrophoresis. The choice of gel matrices and gel concentration
depends on the size of nuclear acid molecules, as the concentration of the agarose or acrylamide
determine the pores size:
Size of DNA fragments
w/v % Gel type
(Kb = 1000 bp)
0.5 % 1 kb to 30 kb
0.7 % 800 bp to 12 kb
1.0 % 500 bp to 10 kb
1.2 % 400 bp to 7 kb
1.5 % 200 bp to 3 kb
2.0 % 50 bp to 2 kb
PAUSE AND THINK ➔ What is the relation between the concentration of the gel and
the pores size?
17
BCH361 [Practical] Biochemistry department
Several buffers are used for agarose gel electrophoresis, but the most common are: Tris-acetate
EDTA buffer (TAE) and Tris-borate EDTA buffer (TBE). The DNA mobility in TBE buffer is
approximately two times slower than in TAE buffer. This is due to the lower porosity of agarose
gel when agarose polymerizes in the presence of borate.
Since DNA is colourless, the loaded sample need to be tracked. This is achieved by
using a loading dye solution. Finally, to visualize DNA (results), agarose gels are usually
stained with ethidium bromide and illuminated with UV light.
Identifying the size of a DNA sample is one of the common AGE uses and this
accomplished through what called: DNA marker (Ladder). A DNA and RNA size markers
contain a mixture of DNA (or RNA) fragments of known length, making them suitable for
estimating the fragment length of concurrently run samples.
Principle:
Nucleic acids are separated by applying an electric field, so these negatively charged
molecules will move through an agarose matrix towards the anode, and the biomolecules are
separated by size in the agarose gel matrix, where the distance travelled by a DNA molecule is
inversely correlated with its size.
Materials:
Agarose powder, 1X TBE buffer (89 mM Tris-base, 89 mM boric acid and 2 mM EDTA)
prepared from 10X TBE, Ethidium Bromide (5 mg/ml), Gel loading dye (Glycerol and orange
dye),1 kb and 100 bp DNA ladder, horizontal electrophoresis apparatus and power supply.
Protocol:
1. Measure the desired grams of agarose to make 1% agarose gel.
2. Heat the solution to boiling in the microwave to dissolve the agarose to produce a
homogeneous mixture.
3. Add 4 μl of ethidium bromide CARFULLY to the dissolved agarose and mix .
4. Get a gel plate and a comb. Put the two dams into the slots on each side of the gel plate.
Make sure that they fit tight. Pour the melted agarose onto the gel plate in the
electrophoresis tray.
5. Place the comb in its place. Let the gel cool to room temperature.
6. Place the gel in the electrophoresis chamber.
7. Pour enough electrophoresis buffer (1X TBE) to cover the gel to prevent overheating of
the gel.
18
BCH361 [Practical] Biochemistry department
Results:
Picture of the gel.
References:
19
BCH361 [Practical] Biochemistry department
Analysis Sheet #4
Name: ______________________
ID: _________________________
Problem.1:
What is the role of the following chemicals in the loading dye:
Bromophenol blue / orange dye:
_____________________________________________________
_____________________________________________________________________
Glycerol/Sucrose:______________________________________________________
_____________________________________________________________________
20
BCH361 [Practical] Biochemistry department
Problem.2:
1. Discuss the mobility of different sizes and shape of the DNA on the agarose gel, and which
band is closest to the positive electrode and which is the closest to the negative electrode?
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
2. Why do you think selection of the right percentage of agarose gel is crucial in separation of
the DNA sample?
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
3. Why should we use low agarose concentration gels to separate large DNA fragments?
___________________________________________________________________________
___________________________________________________________________________
Problem.3:
Below is an agarose gel electrophoresis result of genomic DNA. Comment on each sample.
S1:___________________________________________
______________________________________________
S2: ___________________________________________
______________________________________________
S3: ___________________________________________
______________________________________________
21
BCH361 [Practical] Biochemistry department
Aim:
• Amplification of a specific region on DNA.
• Primer design.
• Determine the parameters that may affect the specificity, fidelity and efficiency of PCR.
Introduction:
Nucleic acid amplification is an important process in biotechnology and molecular
biology and has been widely used in research, medicine, agriculture and forensics. (1) In order to
study individual genes or specific DNA regions of interest, it is often necessary to obtain a large
quantity of nucleic acid for study, rather than isolate a single copy of the target DNA from a
large number of cells. It is often more useful to generate multiple copies of a target from a
single molecule of DNA or mRNA, via an in vitro amplification method. (2)
Figure.1. Two primers are prepared, complementary to sequences on opposite strands of the target
DNA.
So, PCR does not copy all of the DNA in the sample. It copies only a very specific
sequence, targeted by the PCR primers.
22
BCH361 [Practical] Biochemistry department
PCR components:
Basic PCR reaction requires four components:
(1) DNA template.
(2) Primers.
(3) Deoxynucleotide triphosphates (dNTPs).
(4) Thermostable DNA polymerase.
The below table illustrate the function of each components and other needed PCR
components.
Template DNA The template carries the DNA segment or (target) you wish to amplify.
A primer is a short, single-stranded piece of DNA that anneals
(attaches) to its complementary sequence on the template. A pair of
Forward and primers will bind to either side of the target DNA segment providing
Reverse
initiation sites for DNA synthesis.
Primers
➔ e.i. Providing initiation site + specify the amplification to the target
DNA segment.
This is the enzyme used to synthesize new strands of DNA. The DNA
polymerase adds nucleotides onto the end of an annealed primer.
Thermostable
➔ PCR uses a heat-stable DNA polymerase, such as the Taq
DNA
polymerase, which remains active after every heating step and does
polymerase
not have to be replenished. It is named after the thermophilic
bacterium Thermus aquaticus from which it was originally isolated.(7)
These are the four nucleotides used by DNA polymerase to extend an
dNTPs
annealed primer (building blocks).
DNA polymerase requires magnesium for activity (co-factor).
Magnesium Magnesium is usually supplied to a PCR amplification in the form of
magnesium chloride.
PCR buffer is necessary to create optimal conditions for activity of
PCR buffer
Taq DNA polymerase.
* Additional reagents may include like, DMSO, BSA, potassium salt K+ or glycerol.
In addition PCR require a special PCR tubes and a device called thermal cycler to perform
the heating and cooling cycles (see below).
23
BCH361 [Practical] Biochemistry department
PCR cycle:
PCR proceeds in THREE distinct steps Governed by Temperature:
One
cycle
1. Denaturation:
This is the first step in cycling event and consists of heating the reaction to 94–
97 °C for 20–30 seconds. This causes DNA melting, or denaturation, of the double-
stranded DNA template by breaking the hydrogen bonds between complementary
bases, yielding two single-stranded DNA molecules.
2. Annealing:
3. Extension/elongation:
24
BCH361 [Practical] Biochemistry department
At the end of the PCR reaction, the specific sequence will be accumulated in billions of
copies called amplicons. In only 20 cycles, PCR can product about a million (220) copies
of the target. [Number of copies -amplicons- = 2 number of cycles]
25
BCH361 [Practical] Biochemistry department
Primer design:
To design a primer, many parameters should be considered including: primer
sequence, length, GC content, melting temperature, annealing temperature and GC
clamp.(8)
1. Primer sequence:
Primers must be complementary to flanking sequences of target region. Avoid
repeat (ex: ATATATAT) and run (ex: AGCGGGGGAT) sequence which leads to
misprime, maximum number is 4 di/nucleotides respectively. It is important to be sure
that primer is match to the target sequence at the 3’ end. In addition, complementary
sequences between primers should be avoided to prevent primer dimer (self and cross
dimers). Avoid cross homology sequences that lead to nonspecific amplification.
2. Primer length:
It is generally accepted that the optimal length of primers is 18-25 bp. Length
should be long enough for adequate specificity and short enough for primers to bind
easily to the template at the annealing temperature. It prefers that the two primers have
a similar length.
3. GC content:
GC%= the number of G's and C's in the primer as a percentage of the total bases.
Optimal GC content should be ranged 40-60%. GC percentage can be calculated by
using the below formula:
GC% = [(G + C) / (G + C + A + T)] x 100
As shown, the GC content of the sequence gives a fair indication of the primer Tm. In
addition there are some online tools that calculate the Tm.
26
BCH361 [Practical] Biochemistry department
6. GC clamp:
Presence of G or C bases within the last five bases from the 3' end of primers. It
promote a specific binding at the 3' end. GC clamp should be not more than 2 G's or
C's .
There are different tools for primer design, the following are two of the most used tools:
1. NCBI Primer design tool: https://www.ncbi.nlm.nih.gov/tools/primer-blast/
2. Primer3 or primer3Plus: http://bioinfo.ut.ee/primer3-0.4.0/primer3/
After designing the primer, the specificity of the primer should be checked to avoid
amplification of related pseudogenes or homologs. It could be useful to run a BLAST on
NCBI to check for the target specificity of the primers.
PCR Optimization :
There is no single set of conditions that is optimal for all PCR reactions. PCR
optimization means to find the most effective condition. This part will be discussed in
the next lab.
Post-PCR analysis:
Once the PCR has finished, you need to analyze the products (amplicons). The usual
way of doing this is to size fractionate the DNA through an agarose gel. Examining the
gel provides evidence for success or failure. The concentration of agarose depends on the
product size. (9)
PAUSE AND THINK ➔ How you will make sure that you target sequence is
amplified?
By knowing the target sequence size (product size).
Advantages of PCR:
27
BCH361 [Practical] Biochemistry department
PCR application:
The polymerase chain reaction has been elaborated in many ways since its
introduction and is now commonly used for a wide variety of applications including:
genotyping, cloning, mutation detection, sequencing, microarrays, RT-PCR, forensics, and
paternity testing. (6)
Supporting materials:
1. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization
Strategies: http://www.bio-rad.com/en-sa/applications-technologies/pcr-
troubleshooting
2. PCR animation: https://www.youtube.com/watch?v=DkT6XHWne6E
3. PCR troubleshooting: http://www.bio-rad.com/en-sa/applications-technologies/pcr-
troubleshooting
4. History of PCR: http://siarchives.si.edu/research/videohistory_catalog9577.html
References:
1. Fakruddin M, Mannan KS, Chowdhury A, Mazumdar RM, Hossain MN, Islam S, et al.
Nucleic acid amplification: Alternative methods of polymerase chain reaction. J PHarm
Bioallied Sci. 2013;5:245-52.
2. https://www.neb.com/applications/dna-amplification-pcr-and-qpcr
3. Mullis KB. The unusual origin of the polymerase chain reaction. Sci Am.1990;4: 56-61.
4. http://himedialabs.com/TD/HTBM016.pdf
5. Cox M, Doudna J, O’Donnell M. Molecular Biology genes to proteins. p.226. (2012).
6. http://www.bio-rad.com/en-gu/applications-technologies/pcr-polymerase-chain-reaction
7. Chien A, Edgar DB, Trela JM. Deoxyribonucleic acid polymerase from the extreme
thermopHile Thermus aquaticus. J Bacteriol. 1976;3: 1550-7.
8. https://www.neb.com/tools-and-resources/usage-guidelines/guidelines-for-pcr-optimization-
with-onetaq-and-onetaq-hot-start-dna-polymerases
9. Mcpherson M, Møller S. PCR. Garland Science. (2007).
28
BCH361 [Practical] Biochemistry department
Analysis Sheet #5
Name: ______________________
ID: _________________________
Problem.1:
What is the purpose of the polymerase chain reaction?
___________________________________________________________________________
Problem.2:
What is the role of each of the following in the PCR reaction:
Heating around 95°C: ___________________________________________________
Primers: _____________________________________________________________
Thermostable DNA Polymerase: __________________________________________
Heating around 72°C: ___________________________________________________
Problem.3:
Regarding the following primers:
Forward: 5’-CTG AAC CCC ATG TGG AAC GA-3’ Tm:_____ GC%:_____
Reverse: 5’- GGC ATC CAT CAC CTA GCT ACA-3’ Tm:_____ GC%:_____
1. Calculate the Tm and GC% for each one. Is the Tm of the two primers are similar? Why it
is important to be similar?
__________________________________________________________________________
__________________________________________________________________________
29
BCH361 [Practical] Biochemistry department
Problem.4:
How you will choose the concentration of the agarose to see your PCR product?
__________________________________________________________________________
Problem.5:
Identify the error/s and the outcome/s of it in each primer pair of the following:
Primer pair.1:
Forward: 5’- GATACGTCATCTGGCGGA – 3’ Tm: 57.9 °C
➔ Error/s: ________________________________________________________________
➔ Outcome/s: _____________________________________________________________
Primer pair.2:
Forward: 5’- GATTAAGGATCGCTGGCGGA – 3’ Tm: 61.6 °C
➔ Error/s: ________________________________________________________________
➔ Outcome/s: ______________________________________________________________
Primer pair.3:
Forward: 5’- GATTAAGGATCGCTTTAATC – 3’ Tm: 50.6 °C
➔ Error/s: ________________________________________________________________
➔ Outcome/s: ______________________________________________________________
30
BCH361 [Practical] Biochemistry department
Aim:
• To optimize different parameters that effects PCR results/performance.
• Optimization of PCR annealing temperature.
• Be familiar with PCR technique and thermal cycler device.
Introduction:
PCR optimization means to find the most effective and optimum conditions. Failure to
amplify under optimum conditions can lead to the generation of multiple undefined and
unwanted products, even to the exclusion of the desired product.(1) When developing a protocol
for PCR amplification of a new target, it may be important to optimize all parameters including
reagent concentrations, cycling temperatures, and cycle number.
PAUSE AND THINK ➔ There is no single set of conditions that is optimal for all PCR
reactions. Why?
PCR Optimization :
In PCR optimization, you need to optimize:
In this lab, we will briefly review the conditions that should optimized and the focus
will be on the annealing temperature optimization.
PAUSE AND THINK ➔ How you will know that you reached to the optimum
conditions?
31
BCH361 [Practical] Biochemistry department
From all, optimizing the annealing temperature of your PCR assay is one of the most
critical parameters for reaction specificity.
32
BCH361 [Practical] Biochemistry department
The purity yield of the reaction products depend on several parameters, one of
which is the annealing temperature (Ta). Reaching the optimum Ta is critical for
reaction specificity, as non-specific products may be formed as a result of non-optimal
Ta. (2) Optimization done by applying temperature gradient PCR, where PCR carried
with different Ta starting at 5 °C below the lowest calculated melting temperature (Tm)
of the primer pair. For example if your primer Tm is 58 °C, you will start from 53 °C
and you will increase the temperature for 8 degree, so the Ta is often fall in the range
of 53 - 60 °C.
PAUSE AND THINK ➔ When optimizing Ta what you should do with other PCR
component?
Materials:
PCR buffer, DNA Taq polymerase, dNTPs, MgCl2, primers, DNA template, Nuclease free
water.
Protocol:
1. Start by applying the standard concentration of PCR component that work with
majority of PCR reaction. Use the below table to calculate the needed volume of
each PCR component.
Stock Final Volume per
Components
concentration concentration reaction (µl)
PCR buffer 10X 1X
Taq polymerase 5 U/µl 0.05 U/µl
dNTPs 10 mM 200 µM
MgCl2 25 mM 1.5 mM
Forward primer 10 µM 0.4 µM
Reverse primer 10 µM 0.4 µM
DNA Template 45 ng/ µl 90 ng
Water
Total volume 50 µl
2. Prepare a master mix that contains everything except the DNA template by
multiplying the volume per reaction of each component by (number of desired
reaction +1 for pipetting error).
33
BCH361 [Practical] Biochemistry department
Master mix
Volume per reaction (µl)
(Volume per reaction x ….)
50 µl ….. µl
3. Using special PCR tubes, distribute the master mix by pipetting …. µl to each tube.
4. Add the DNA template for each template.
5. Centrifuge the tubes briefly.
6. Set the thermal cycling condition as following:
Elongation 72 °C
30 sec
Results:
Analyse the results using 2% agarose gel, and determine the optimum Ta.
References:
1. Roux KH. Optimization and troubleshooting in PCR. PCR Methods Appl, 1995;5:185-94.
2. Rychlik W, Spencer WJ, Rhoads R. Optimization of the annealing temperature for DNA
amplification in vitro. Nucleic Acids Res, 1990;21: 6409–12.
34
BCH361 [Practical] Biochemistry department
Analysis Sheet #6
Name: ______________________
ID: _________________________
Problem.1:
What does a PCR optimization means?
__________________________________________________________________________________
Problem.2:
You are working on a gradient PCR to determine the optimum annealing temperature for
your primer, and you get the following result.
Problem.3:
What is the objective of gradient PCR?
__________________________________________________________________________________
35
BCH361 [Practical] Biochemistry department
Problem.4:
What does a PCR master mix contain?
__________________________________________________________________________________
Problem.5:
Your target is to amplify a promoter region of TRF2 gene. You design the following primer
pair:
4. What is the next step after you know the optimum temperature and concentrations of
the PCR component?
___________________________________________________________________
36
BCH361 [Practical] Biochemistry department
Aim:
• Be familiar with common PCR difficulties.
• PCR troubleshooting.
Introduction:
37
BCH361 [Practical] Biochemistry department
Annealing temperature was too low. Too much primer was added.
Too many cycles were used. Too much Mg2+ was added.
Extension time was too long. Primers were designed or synthesized
incorrectly.
Impure primers, dNTPs, or water.
To identify Primer dimers, it always has a very low molecular weight (less than 100 bp
usually).
To have a single band, however it is not the same size of your target.
4. Smeared Bands:
Too many cycles were used. Too much template was added.
Impure primers, dNTPs, or water.
Template contained an exonuclease or
was degraded.
38
BCH361 [Practical] Biochemistry department
Additive reagents may yield results when all else fails. Understanding the reagents
and what they are used for is critical in determining which reagents may be most effective
in the acquisition of the desired PCR product. The following is a list of some of the
common additives and the purpose of them. (2)
1. Additives that benefit GC Rich templates:
2. Q solution:
Q-Solution will often enable or improve PCR systems that have a high degree
of secondary structure or that are GC-rich. In addition, Q-Solution increases PCR
specificity in certain primer–template systems. (3)
3. PCRx Enhancer:
For problematic and/or GC-rich templates, the PCRx Enhancer System offers
higher primer specificity, broader magnesium concentration optima, broader
annealing temperature optima and improved thermostabilization of Taq DNA
polymerase. (4)
References:
1. http://www.bio-rad.com/en-sa/applications-technologies/pcr-troubleshooting
2. Lorenz TC. Polymerase chain reaction: basic protocol plus troubleshooting and
optimization strategies. J Vis Exp,2012;63:e3998.
3. Taq PCR Handbook from qiagen.
4. PCRx Enhancer System handbook from invitrogen.
39
BCH361 [Practical] Biochemistry department
Analysis Sheet #7
Name: ______________________
ID: _________________________
Problem.1:
Identify the problem in the following PCR results. Think in some causes. How to solve it?
__________________________________________________________________
__________________________________________________________________
_ __________________________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
_ __________________________________________________________________
__________________________________________________________________
Problem.2:
A student was working on PCR but she was not careful and cautious enough and she get the
following result. What do you think happened?
_____________________________________________________
_____________________________________________________
_____________________________________________________
40
BCH361 [Practical] Biochemistry department
Problem.3:
A student was working on PCR and she performs the additives shown in (A) and get the
result in (B):
A. B.
Component Volume per reaction (µl)
10X PCR buffer 2.5
MgSO4 1
dNTPs (10mM) 0.5
Enzyme 0.2
Forward Primer (10 pmole) 1
Reverse Primer (10 pmole) 1
RNase/DNase – free water 14.8
DNA 4 µl
Total volume 25
What do you think she should change in her protocol to avoid the problem?
_________________________________________________________________________
Problem.4:
If you have a GC reach template, what PCR additives you may use? What is their function? Can
manipulating the thermal cycling condition help? How?
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
41
BCH361 [Practical] Biochemistry department
Aim:
• Restriction of genomic DNA.
Introduction:
Restriction enzymes (RE) are enzymes that have the ability to recognizes a specific,
short nucleotide sequence and cleave the sugar phosphate backbones in double stranded DNA
at that specific site, which is known as RESTRICTION SITE or target sequence. RE naturally
found in a wide variety of prokaryotes. In live bacteria, restriction enzymes function to defend
the cell against invading viral bacteriophages by cleaving its DNA at specific sites and so
prevent replication. Over 300 restriction enzyme have been isolated and the nomenclature
depends on the organism from which they are derived e.g. EcoRI: is isolated from E. coli strain
RY13, I (Roman numeral) indicates it was the first enzyme of that type isolated from E. coli
RY13. Table.1 present few examples of restriction enzymes, their origin and restriction site.
PAUSE AND THINK ➔ Bacterium is immune to its own restriction enzymes, even if it has the
target sequences ordinarily targeted by them. Why?
42
BCH361 [Practical] Biochemistry department
Mechanism of Action:
Restriction Endonuclease scan the length of the DNA, binds to the DNA molecule
when it recognizes a specific sequence and makes one cut in each of the sugar phosphate
backbones of the double helix by hydrolyzing the phosphodiester bond. Specifically, the
bond between the 3’ O atom and the P atom is broken.
Uses in Biotechnology:
The ability of restriction enzymes to cut DNA at specific sequences has led to the
widespread use of these tools in many molecular genetics techniques. Restriction enzymes
can be used to map DNA fragments or genomes. Mapping means determining the order of
the restriction enzyme sites in the genome. Perhaps the most important use of restriction
enzymes has been in the generation of recombinant DNA molecules, which are DNAs that
consist of genes or DNA fragments from two different organisms (gene cloning). In
addition, Restriction enzymes also have applications in several methods for identifying
individuals or strains of a particular species. Restriction Fragment Length Polymorphism
(RFLP) is a tool to study variations among individuals (humans and other species). This
technique able to differentiate minor nucleotide sequence variations in homologous
fragments of DNA. It relies on the specificity of restriction endonucleases, which are highly
sequence-specific and cut the double-stranded DNA only at their recognition sites.
43
BCH361 [Practical] Biochemistry department
Principle:
Cleavage by RE is accomplished by the incubating of genomic DNA or DNA fragments
obtained following amplification using PCR with the RE under appropriate experimental
conditions of temperature, pH and ionic strength. The RE restricts the DNA at sites where the
specific sequence recognized by the RE are presents, resulting in the production of different
size fragments. These fragments can be separated on agarose gel electrophoresis.
In this experiment restriction of genomic DNA will be done using MstII, which cut the DNA
at ‘5-CCTNAGG-3’
Materials:
DNA solution (0.5 µg/µl), MstII (3U/ μl), 10X restriction buffer, NaCl solution, nuclease free
water, 0.5 M EDTA.
Protocol:
2. Add MstII (3 U for each one μg DNA) and incubate the reaction mixture for 20 min at
37 °C in an incubator.
3. Stop the reaction by adding 0.5 μl of 0.5 M EDTA.
4. Prepare it for agarose gel electrophoresis by adding 5 μl of gel loading buffer.
Results:
Analyse the results using agarose gel electrophoresis.
References:
1. https://www.thebalance.com/what-are-restriction-enzymes-375674
2. http://medicine.jrank.org/pages/2779/Restriction-Enzymes-Use-Restriction-Enzymes-in-
Biotechnology.html
3. https://www.thermofisher.com/sa/en/home/life-science/cloning/cloning-learning-
center/invitrogen-school-of-molecular-biology/molecular-cloning/restriction-
enzymes/restriction-enzymes-genome-mapping.html
44
BCH361 [Practical] Biochemistry department
Analysis Sheet #8
Name: ______________________
ID: _________________________
Problem.1:
If you that MstII cuts the DNA around the β-globin gene in three sites as shown:
1. Determine wither the results below belong to normal or sickle cell anaemia patient?
Why?
__________________________________________________________________
__________________________________________________________________
45
BCH361 [Practical] Biochemistry department
Problem.2:
By drawing, show how EcoRI will digest the following sequence, and the resulted fragments.
‘5-CCATTACGAGCTCAGTCGGAATTCAACGGATTACCGCATGGCCAATACCA-3’
3’-GGTAATGCTCGAGTCAGCCTTAAGTTGCCTAATGGCGTACCGGTTATGGT-5’
Problem.3:
Use the linear restriction map below to predict where you would expect to see bands on a gel
if a digest is performed using the specified restriction enzymes.
46
BCH361 [Practical] Biochemistry department
Aim:
• To determine the order of the nucleotides in a given DNA sample.
Introduction:
The term DNA sequencing refers to methods for of determining the precise order of
nucleotide bases (As, Ts, Cs, and Gs) in a molecule of DNA. Knowledge of DNA sequences
has become necessary numerous applied fields such as medical diagnosis, biotechnology and
forensic biology. A sequencing can be done by different methods including: Maxam – Gilbert
sequencing (chemical degradation method), Sanger sequencing (dideoxy chain-termination
method) and high- throughput sequencing technologies. The most commonly used method is
the dideoxy chain termination method developed by Sanger and co-workers in 1975 owing to
its relative easy and reliability (Figure.1).
PAUSE AND THINK ➔ Why the reaction terminated by the ddNTPs (dideoxynucleosides) and cannot be
continued?
47
BCH361 [Practical] Biochemistry department
48
BCH361 [Practical] Biochemistry department
1. PCR amplification.
2. Purification of PCR product: removal of unwanted primers and dNTPs from PCR
product mixture.
3. Sequencing reaction.
4. Post reaction clean-up: The post sequencing reaction product needs to be purified for
removal of excess dye terminators and unused primer by using ethanol precipitation
protocol.
5. Capillary electrophoresis.
6. Data analysis
References:
49
BCH361 [Practical] Biochemistry department
Analysis Sheet #9
Name: ______________________
ID: _________________________
Problem.1:
Below is electropherogram for exon 7 of the PLCE1 gene (phospholipase C, epsilon1) in a
patient and his parents.
2. What is the difference in the sequence between the patient and his parents in the position
indicated by arrows?
___________________________________________________________________________
3. Does the patient has an identical alleles for the gene? Why?
___________________________________________________________________________
4. What is the zygosity of the parents genotype?
___________________________________________________________________________
50
BCH361 [Practical] Biochemistry department
Problem.2:
Compare between manual and automated Sanger sequencing.
Problem.3:
The following is a gel resulted from manual Sanger sequencing. Determine the order of the
nucleotide in that DNA molecule.
51