Supplementary Tables

Table S1. Bacterial strains and plasmids used in this study.

Strains and plasmids Relevant characteristics

Strains

E. coli DH10B Cloning host; F- , mcrA, D(mrr-hsdRMS-mcrBC), f80dlacZDM15, DlacX74,

recA1, deoR, endA1, araD139, D(ara, leu)7697, galU, galK, l- , rpsL, nupG
E. coli Rosetta 2 (DE3) Strain for recombinant protein expression; F–, ompT, hsdSB(rB– mB–), dcm (DE3),
pRARE2 (CamR)

Microbacterium sp. 5-2b Wild-type carminic acid-catabolizing strain

Plasmids

pET24a(+) T7 RNA polymerase-dependent recombinant protein expression vector, KanR.

pET24a(+)-His-carA The His-tag added carA fragment (1056 bp) was inserted into the NdeI and EcoRI
sites of pET24a(+)

Table S2. Primers used in this study.

Primers used for cloning of carA and construction of the mutant
carA Fw (NdeI) TAAGAAGGAGAGATATACATATGAGCGAGGCCGTCGACGTCCTCGTC

carA Rv (EcoRI) TTGTCGACGGAGCTCGAATTCTCACCGTCCTCTCCTCTCTCCGCCGGCGAG

AgcarA Fw (NdeI) TAAGAAGGAGATATACATATGAGCGGCAGCAGATATCCCGCCG

AgcarA Rv (EcoRI) CTCGAGTGCGGCCGCAAGCTTTTTCACCATTCTATTGTCAGATTCTGACAT

MtcarA Fw (NdeI) TAAGAAGGAGATATACATATGAGCACCCGCGTATACCCCG

MtcarA Rv (EcoRI) CTCGAGTGCGGCCGCAAGCTTGACAGAAGCAAGATCTGCGGTGATCTC

CarA H429A-F CAGCTCGCTGgcCTACCAGGGATCGGTCCGG

CarA H429A-R CCGGCCGGGAGCAGCTGC

The restriction site is underlined. Small characters in CarA H429A-F indicate the mutated base.
Table S3. Effects of metals on the activity of CarA.
Relative activity (%)
Metals
CarA
Control 100±0
LiCl 100±1
NaCl 103±3
MgCl2 102±2
CaCl2 36.2±16.0
BaCl2 109±2
MnCl2 83.8±5.7
ZnCl2 25.5±1.3
CdCl2 109±16
CoCl2 27.9±1.9
AlCl3 12.4±1.6
PbCl2 57.8±22.7
HgCl2 N.D.
NiCl2 83.1±4.1
CuCl2 13.7±1.0
FeSO4 N.D.
FeCl3 46.1±6.6
RbCl2 89.1±3.1
SrCl2 10.8±1.9
CsCl 94.7±2.2
NaMoO4 N.D.

N.D.: Not detected.

All data points represent mean values ± S.D. for three experiments.
Table S4. Effects of small-molecular compounds on the activity of CarA.
Relative activity (%)
Compounds
CarA
Control 100±0
Thiol reagents
5,5’-Dithio-bis-2-nitrobenzoate (DTNB) 94.3±7.7
Iodoacetate 92.1±0.9
N-Ethylmaleimide (NEM) 94.7±3.2
p-Chloromercuribenzoate (PCMB) 41.6±7.6
Carbonyl reagents
Hydroxylamine 83.7±3.3
Phenylhydrazine 88.6±6.1
Semicarbazide 92.0±2.7
Aminoguanidine 90.5±0.6
Chelators
α,α'-Dipyridyl 95.3±5.6
o-Phenanthroline 88.8±3.5
8-Hydroxyquinoline 98.1±6.8
Ethylenediaminetetraacetic acid (EDTA) 95.3±5.6
Diethyldithiocarbamate 88.8±3.5
NaN3 88.3±2.9
KCN 77.0±4.2
Reductants
Dithiothreitol (DTT) 105±0
2-Mercaptoethanol 101±3
Na2S2O4 101±5
Oxidants
H2O2 98.7±3.6
Ammonium persulfate 49.7±1.9
Serine modifiers
Phenazine methosulfate (PMS) 91.0±2.9
Diisopropyl fluorophosphate 96.6±3.0

All data points represent mean values ± S.D. for three experiments.
Table S5. Homologs of CarA from bacteria.
Length Identity Similarity
Organism Gene Accession No.
(aa) (%) (%)
Microbacterium sp. 5-2b carA 501 LC387598 - -
Arthrobacter globiformis
AgcarA 519 WP_003803563.1 47 57
NBRC12137
Microbacterium
trichothecenolyticum MtcarA 515 WP_045298611.1 45 57
NBRC15077

Table S6. X-ray crystallographic data collection and refinement statistics.

Data collection
Space group H32
Cell dimensions
a, b, c (Å) 267.1
267.1
87.2
Resolution (Å) 48.19–2.40 (2.53–2.40)
Rmerge (%) 8.0 (57.1)

<I/σ(I)> 12.4 (3.3)

Completeness (%) 100.0 (100.0)
Multiplicity 6.5 (6.2)

Refinement
Resolution (Å) 48.19–2.40
No. reflections 46281
Rwork/ Rfree 0.224/0.257
No. atoms
Protein/FAD/other/Water 5686/53/5/69
B-factors
Protein/FAD/other/Water 79.3/52.5/85.6/56.3
R.m.s deviations
Bond lengths (Å) 0.008
Bond angles (º) 0.980
Ramachandran plot
Favored/Allowed/Outliers 96.14/3.73/0.13
PDB ID 7DVE
Table S7. Specific activities of CarA and its mutant.
Enzymes Specific activity Relative activity
(µmol/min/mg) (%)
CarA (WT) 19.9 ± 4.4 100
H429A 0 0
All data points represent mean values ± S.D. for three experiments.
 Supplementary figures

Figure S1. Time courses of cell growth, carminic acid degradation activity during culture.
Growth curve of 1/10 2×YT medium (A); the amount of carminic acid in the 1/10 2×YT medium
supplemented with carminic acid (B); specific activities of cell-free extracts prepared from cells
cultured in the 1/10 2×YT medium supplemented with carminic acid (C); and without carminic acid
(D). 1 U (μmol/min) is defined as the amount of the enzyme that catalyzes the conversion of one micro
mole of substrate per minute.
 OH O
4 5
HO 3 4a 9 6 OH
4b
8a
2 8b 10 7
OH
1 8

OH O O

Position 1H (MeOD, 600 MHz) 13C (MeOD, 150 MHz)

1 159.7
2 6.64 (1H, s) 118.8
3 154.8
4 147.4
4a 112.6
4b 135.9
5 7.69 (1H, s) 111.5
6 159.1
7 135.9
8 142.0
8a 123.8
8b 106.4
8-CH3 2.89 (3H, s, CH3) 19.4
9 186.8
10 187.5
C=O 171.8

Figure S2. The structure and NMR data of kermesic acid.

Figure S3. HPLC chromatogram of X1 in methanol and an aqueous solution.
Purified compound X1 was dissolved in methanol or 20 mM potassium buffer (pH 4-8) and
then incubated for 3 h. Each sample was subjected to HPLC.
Figure S4. HPLC chromatogram of X2 in methanol and an aqueous solution.
Purified compound X2 was dissolved in methanol or 20 mM potassium buffer (pH 4-8) and
then incubated for 3 h. Each sample was subjected to HPLC.
 OH O
5
4
HO 3 4a 9
OH
4b 6
6’ 2 8a 7
O 8b 10
OH
HO 1’ 1 8
5’
4’ 2’ OH O O
HO 3’ OH
O HMBC
Position 1H (MeOD, 600 MHz) 13C (MeOD, 150 MHz)

1 159.3
2 118.5
3 154.0
4 146.7
4a 112.2
4b 135.7
5 7.56 (1H, s) 111.5
6 159.2
7 133.4
8 142.2
8a 123.7
8b 105.8
8-CH3 2.70 (3H, s, CH3) 19.5
9 187.2
10 187.0
C=O 171.7

1’ 5.05 (1H, d, J=10.1 Hz) 76.1

2’ 5.30 (1H, d, J= 9.96 Hz) 73.0
3’ 207.6
4’ 4.41 (1H, dd, J=10.0, 1.6 Hz) 72.1
5’ 3.56 (1H, ddd, J=9.8, 5.4, 2.0 Hz) 83.7
6’ 3.90 (1H, dd, J=12.3, 5.3 Hz) 61.7
4.01 (1H, dd, J=12.3, 1.9 Hz)

Figure S5. The structure and NMR data of 3’-keto carminic acid (X1).
 OH O
4 5
HO 3 4a 9 4b 6 OH

6’ 2
O 8b 10 8a 7
OH
HO 5’ 1’ 1 8
4’ 2’ OH O O
HO 3’ O
OH
Position 1H (MeOD, 600 MHz) 13C (MeOD, 150 MHz)

1 158.6
2 118.8
3 154.0
4 146.8
4a 112.4
4b 136.3
5 7.66 (1H, s) 111.4
6 158.1
7 131.3
8 141.3
8a 123.6
8b 105.8
8-CH3 2.75 (3H, s, CH3) 19.0
9 186.4
10 186.8
C=O 169.6

1’ 5.54 (1H, s) 74.3

2’ 211.3
3’ 5.21 (1H, br) 74.9
4’ 4.38 (1H, br) 71.5
5’ 3.84 (1H, br) 83.9
6’ 3.84 (1H, br) 62.8
4.02 (1H, br)

Figure S6. The structure and NMR data of 2’-keto carminic acid (X2).
Figure S7. SDS-PAGE of the carminic acid-metabolizing enzyme (CarA).
Lane 1, protein markers; lane 2, purified CarA. The arrow indicates CarA.
Figure S8. Amino acid sequence alignment of CarA, pyranose oxidases and FAD-GO.
AgCarA, CarA homolog from Arthrobacter globiformis NBRC12137 (WP_003803563.1);
MtCarA, CarA homolog from Microbacterium trichothecenolyticum NBRC15077
(WP_045298611.1); KaPOx, pyranose oxidase from Kitasatospora aureofaciens
19
(ARF78047.1) ; PsP2Ox, pyranose oxidase from Arthrobacter siccitolerans
(WP_050056845.1)20; PeP2O, pyranose oxidase from Peniophora sp. (PDB: 1TZL)18; and FAD-
GO, O-glycoside oxidoreductase from Rhizobium sp. GIN6111521. Alignment was performed
using Clustal W45 and ESPript46. Identical residues are shown in white in red boxes and similar
residues in red. The arrow indicates the conserved catalytic residue in pyranose oxidases (H429
in CarA).

Figure S9. Stoichiometry of the carminic acid-conversion reaction catalyzed by CarA.

Carminic acid (open circles), oxygen (filled triangles), H2O2 (open squares), and keto
carminic acid (X1, X2) (closed circles). All data points represent mean values ± S.D. for three
experiments.
Figure S10. Michaelis-Menten plot of the carminic acid conversion reaction catalyzed by
CarA.
The inset figure shows a magnified plot of the specific activity of CarA in the range of 0.01 -
0.1 mM. All data points represent mean values ± S.D. for three experiments.
Figure S11. Dependency of the CarA activity on temperature (A) and pH (B).
All data points represent mean values ± S.D. for three experiments.
Figure S12. Stability of CarA against temperature (A) and pH (B).
All data points represent mean values ± S.D. for three experiments.
Figure S13. HPLC chromatogram of the CarA reaction at pH 8.0 (A) and pH 4.0 (B).
The reaction was stopped with methanol and 1 M HCl to maintain acidic conditions before
HPLC analysis. The peaks of compounds X1 (2) and X2 (3) are indicated by arrows.

Figure S14. UV-Vis spectrum of CarA.

Figure S15. HPLC chromatogram of flavin cofactors.
Each chromatogram represents analysis of one of the following samples: blue line, cofactor
extracted from CarA; orange line, authentic FMN; red line, authentic FAD; green line, mixture of
cofactor extracted from CarA with authentic FMN.
Figure S16. Simulated annealing Fo-Fc omit map (green) for FAD and His127 in MtCarA.
The omit map is contoured at the level of 3.0 sigma.
Figure S17. SDS-PAGE of CarA mutants.
Lane 1, protein markers; lane 2, wild type of CarA; lane 3, CarA (H429A). The red arrow
indicates CarA.

Figure S18. CD spectra of CarA and its mutant.

Each line represents the CD spectrum of the following samples: blue line, mutant CarA
(H429A); black line, CarA. The protein concentration of each sample was as follows: CarA,
0.68 mg/ml; and CarA(H429A), 0.72 mg/ml.
 Supplementary references

45. D.-G. Higgins, J.-D. Thompson, T.-J. Gibson, Using CLUSTAL for multiple sequence

alignments. Methods Enzymol., 266, 383-402 (1996)

46. P. Gouet, X. Robert, E. Courcelle, ESPript/ENDscript: Extracting and rendering sequence and

3D information from atomic structures of proteins. Nucleic Acids Res., 31, 3320-3323 (2003)
 Full wwPDB X-ray Structure Validation Report ○
i

Jan 15, 2021 – 12:58 PM JST

PDB ID : 7DVE
Title : Crystal structure of FAD-dependent C-glycoside oxidase
Deposited on : 2021-01-13
Resolution : 2.40 Å(reported)

This is a Full wwPDB X-ray Structure Validation Report.

This report is produced by the wwPDB biocuration pipeline after annotation of the structure.

We welcome your comments at validation@mail.wwpdb.org

A user guide is available at
https://www.wwpdb.org/validation/2017/XrayValidationReportHelp
with specific help available everywhere you see the ○
i symbol.

i were used in the production of this report:

The following versions of software and data (see references ○)

MolProbity : 4.02b-467
Mogul : 1.8.5 (274361), CSD as541be (2020)
Xtriage (Phenix) : 1.13
EDS : 2.16
buster-report : 1.1.7 (2018)
Percentile statistics : 20191225.v01 (using entries in the PDB archive December 25th 2019)
Refmac : 5.8.0158
CCP4 : 7.0.044 (Gargrove)
Ideal geometry (proteins) : Engh & Huber (2001)
Ideal geometry (DNA, RNA) : Parkinson et al. (1996)
Validation Pipeline (wwPDB-VP) : 2.16
Page 2 Full wwPDB X-ray Structure Validation Report 7DVE

1 Overall quality at a glance ○

i

The following experimental techniques were used to determine the structure:

X-RAY DIFFRACTION
The reported resolution of this entry is 2.40 Å.
Percentile scores (ranging between 0-100) for global validation metrics of the entry are shown in
the following graphic. The table shows the number of entries on which the scores are based.

Whole archive Similar resolution

Metric
(#Entries) (#Entries, resolution range(Å))
Rf ree 130704 3907 (2.40-2.40)
Clashscore 141614 4398 (2.40-2.40)
Ramachandran outliers 138981 4318 (2.40-2.40)
Sidechain outliers 138945 4319 (2.40-2.40)
RSRZ outliers 127900 3811 (2.40-2.40)

The table below summarises the geometric issues observed across the polymeric chains and their
fit to the electron density. The red, orange, yellow and green segments of the lower bar indicate
the fraction of residues that contain outliers for >=3, 2, 1 and 0 types of geometric quality
criteria respectively. A grey segment represents the fraction of residues that are not modelled.
The numeric value for each fraction is indicated below the corresponding segment, with a dot
representing fractions <=5% The upper red bar (where present) indicates the fraction of residues
that have poor fit to the electron density. The numeric value is given above the bar.

Mol Chain Length Quality of chain

1 A 528

1 B 528
Page 3 Full wwPDB X-ray Structure Validation Report 7DVE

2 Entry composition ○
i

There are 4 unique types of molecules in this entry. The entry contains 5813 atoms, of which 0
are hydrogens and 0 are deuteriums.
In the tables below, the ZeroOcc column contains the number of atoms modelled with zero occu-
pancy, the AltConf column contains the number of residues with at least one atom in alternate
conformation and the Trace column contains the number of residues modelled with at most 2
atoms.
• Molecule 1 is a protein called 6’’’-hydroxyparomomycin C oxidase.

Mol Chain Residues Atoms ZeroOcc AltConf Trace

Total C N O S
1 A 498 0 0 0
3676 2281 658 723 14
Total C N O S
1 B 299 0 0 0
2010 1246 352 403 9

There are 26 discrepancies between the modelled and reference sequences:

Chain Residue Modelled Actual Comment Reference

A 516 LYS - expression tag UNP A0A0M2HFA3
A 517 LEU - expression tag UNP A0A0M2HFA3
A 518 ALA - expression tag UNP A0A0M2HFA3
A 519 ALA - expression tag UNP A0A0M2HFA3
A 520 ALA - expression tag UNP A0A0M2HFA3
A 521 LEU - expression tag UNP A0A0M2HFA3
A 522 GLU - expression tag UNP A0A0M2HFA3
A 523 HIS - expression tag UNP A0A0M2HFA3
A 524 HIS - expression tag UNP A0A0M2HFA3
A 525 HIS - expression tag UNP A0A0M2HFA3
A 526 HIS - expression tag UNP A0A0M2HFA3
A 527 HIS - expression tag UNP A0A0M2HFA3
A 528 HIS - expression tag UNP A0A0M2HFA3
B 516 LYS - expression tag UNP A0A0M2HFA3
B 517 LEU - expression tag UNP A0A0M2HFA3
B 518 ALA - expression tag UNP A0A0M2HFA3
B 519 ALA - expression tag UNP A0A0M2HFA3
B 520 ALA - expression tag UNP A0A0M2HFA3
B 521 LEU - expression tag UNP A0A0M2HFA3
B 522 GLU - expression tag UNP A0A0M2HFA3
B 523 HIS - expression tag UNP A0A0M2HFA3
B 524 HIS - expression tag UNP A0A0M2HFA3
B 525 HIS - expression tag UNP A0A0M2HFA3
B 526 HIS - expression tag UNP A0A0M2HFA3
B 527 HIS - expression tag UNP A0A0M2HFA3
Continued on next page...
Page 4 Full wwPDB X-ray Structure Validation Report 7DVE

Continued from previous page...

Chain Residue Modelled Actual Comment Reference
B 528 HIS - expression tag UNP A0A0M2HFA3

• Molecule 2 is FLAVIN-ADENINE DINUCLEOTIDE (three-letter code: FAD) (formula:

C27 H33 N9 O15 P2 ) (labeled as "Ligand of Interest" by depositor).

Mol Chain Residues Atoms ZeroOcc AltConf

Total C N O P
2 A 1 0 0
53 27 9 15 2

• Molecule 3 is SULFATE ION (three-letter code: SO4) (formula: O4 S).

Page 5 Full wwPDB X-ray Structure Validation Report 7DVE

Mol Chain Residues Atoms ZeroOcc AltConf

Total O S
3 B 1 0 0
5 4 1

• Molecule 4 is water.
Mol Chain Residues Atoms ZeroOcc AltConf
Total O
4 A 65 0 0
65 65
Total O
4 B 4 0 0
4 4
ALA VAL G214 R134 HIS MET D455 H188 MET
PRO PHE ALA SER SER 3
•
GLY ALA V218 L144 ARG THR A458 L200 THR
SER VAL L219 GLU R4 ARG
• •
Page 6

ILE ARG G220 L153 ASP V467 D216 V5

VAL MET L154 ASP V10 W468
•

Chain B:
Chain A:
GLY ARG N228 ASP D11 G469 E234 A8
•
LEU ASP F229 E158 ARG V12 A470
• •
GLY PHE T230 R159 VAL R239 V15
•
LEU THR L231 L160 GLY V15 L473
•
F372 PRO F232 L161 GLY G16 E243 P19
C373 VAL G162 ILE S17 A476
• • • •
A374 VAL L236 V163 VAL G18 G477 R246 T23
•
K375 ASP V237 T164 LYS P19 N478 A247
• • • •
ALA T238 THR SER G479 A248 R26
D381 ASP R239 ASP ALA A22
•
R382 GLY V240 ALA GLN T23 P482 D254 V42
•
V383 VAL L241 PHE ARG
A384 PRO V242 ASP ARG E30 T485 T257 H53
F385 GLN E243 ALA ALA ARG A486 G258 V54
S386 THR SER ARG ALA C487 E259 K55
D387 GLY A248 PRO PRO SER N488 R260
•
S388 LEU G249 TYR GLY S34 R76
D389 SER V250 ALA THR V494 R264 GLU
•
V390 GLU GLY TYR I37 A265 ASP
TYR T253 ILE LEU A38 V498 ASP
• •
Y393 THR D254 VAL LEU M39 V270 ASP
G394 GLY ARG GLU E507 A271 ARG
•
M395 VAL T257 GLU SER V42 I508 A272 VAL
•
THR G258 ARG GLY G43 T509 D273 GLY
•
M398 TRP E259 LEU TYR PRO GLY
• •
V333 ALA GLN THR A513 T277 ILE
H401 P334 V270 ALA ALA VAL SER P278 VAL
•
i

Y402 F335 A271 VAL ASP SER VAL LYS

•
Residue-property plots ○

T403 T336 A272 GLU GLY ASP LYS I286 S88

•
L404 D337 D273 ASP GLU PRO LEU
•

• Molecule 1: 6’’’-hydroxyparomomycin C oxidase

• Molecule 1: 6’’’-hydroxyparomomycin C oxidase

S405 D338 A274 ALA ASP PRO ALA Q298 A93

M339 L275 HIS GLY GLY ALA R94
•
D408 P340 R276 ARG LEU ALA ALA F303
•
H409 F341 T277 ASP PRO HIS LEU L99
•
in the sample, but not in the model, are shown in grey.

A410 H342 P278 ALA VAL VAL GLU F310 L100

•
T411 GLY Q279 ASP ALA LYS HIS E101
• •
I412 GLN L280 GLU ALA ASN HIS D315
•
D413 VAL ARG PHE ILE HIS A316 M124
•
R414 MET S284 VAL SER ALA HIS
•
A415 GLN G285 Q196 SER ASP HIS F341 W128
•
K416 LEU I286 ASN ALA HIS
•
A417 ASP R287 A201 VAL ASP P352 A131
•
E418 ALA P288 VAL GLY GLU C132
•
I419 SER D289 HIS GLY ARG L355 P133
•
V420 PRO A290 ARG MET ALA
•
R421 VAL L291 ARG ALA HIS G368 E139
•
L422 LYS G292 ASP ALA ALA
•
Full wwPDB X-ray Structure Validation Report

G423 LEU R293 ASP HIS GLN P429 L160

K424 ALA Y294 GLY TRP ARG
•
A425 ASP L295 PRO THR ARG S442 A183
•
ILE ASP LEU G130 SER V184
• •
GLY ASP A299 VAL A131 GLU V449 E185
• •
ASP PRO Q300 TRP C132 GLY R450 D186
• • •
PRO ALA I301 SER P133 PRO A187
•
• •
A red dot above a residue indicates a poor fit to the electron density (RSRZ > 2). Stretches of 2
first graphic for a chain summarises the proportions of the various outlier classes displayed in the

for which they contain at least one outlier: green = 0, yellow = 1, orange = 2 and red = 3 or more.

or more consecutive residues without any outlier are shown as a green connector. Residues present
second graphic. The second graphic shows the sequence view annotated by issues in geometry and
These plots are drawn for all protein, RNA, DNA and oligosaccharide chains in the entry. The
7DVE

electron density. Residues are color-coded according to the number of geometric quality criteria
HIS LEU
HIS ASP
HIS ASP
HIS ARG
Page 7

HIS PRO
PHE
VAL
MET
PRO
LEU
GLY
ALA
SER
L443
H444
Y445
Q446
•

V449
R450
M451

V460

P463
D464

V467

A470

L473
F474
V475
A476
G477
N478

P482

A486
C487
•

A495

R499

D511
LEU
ALA
SER
VAL
LYS
Full wwPDB X-ray Structure Validation Report

LEU
ALA
ALA
ALA
LEU
GLU
HIS
7DVE
Page 8 Full wwPDB X-ray Structure Validation Report 7DVE

4 Data and refinement statistics ○

i

Property Value Source

Space group H32 Depositor
Cell constants 267.08Å 267.08Å 87.21Å
Depositor
a, b, c, ↵, , 90.00 90.00 120.00
48.19 – 2.40 Depositor
Resolution (Å)
48.19 – 2.40 EDS
% Data completeness 100.0 (48.19-2.40) Depositor
(in resolution range) 100.0 (48.19-2.40) EDS
Rmerge 0.08 Depositor
Rsym (Not available) Depositor
< I/ (I) > 1 3.25 (at 2.39Å) Xtriage
Refinement program PHENIX 1.9-4092 Depositor
0.224 , 0.257 Depositor
R, Rf ree
0.222 , 0.256 DCC
Rf ree test set 2315 reflections (5.00%) wwPDB-VP
Wilson B-factor (Å2 ) 56.8 Xtriage
Anisotropy 0.245 Xtriage
Bulk solvent ksol (e/Å3 ), Bsol (Å2 ) 0.29 , 49.5 EDS
L-test for twinning2 < |L| > = 0.47, < L2 > = 0.30 Xtriage
Estimated twinning fraction No twinning to report. Xtriage
Fo ,Fc correlation 0.94 EDS
Total number of atoms 5813 wwPDB-VP
Average B, all atoms (Å2 ) 78.0 wwPDB-VP

Xtriage’s analysis on translational NCS is as follows: The largest off-origin peak in the Patterson
function is 2.89% of the height of the origin peak. No significant pseudotranslation is detected.

1
Intensities estimated from amplitudes.
2
Theoretical values of < |L| >, < L2 > for acentric reflections are 0.5, 0.333 respectively for untwinned datasets,
and 0.375, 0.2 for perfectly twinned datasets.
Page 9 Full wwPDB X-ray Structure Validation Report 7DVE

5 Model quality ○
i

5.1 Standard geometry ○

i

Bond lengths and bond angles in the following residue types are not validated in this section: SO4,
FAD
The Z score for a bond length (or angle) is the number of standard deviations the observed value
is removed from the expected value. A bond length (or angle) with |Z| > 5 is considered an
outlier worth inspection. RMSZ is the root-mean-square of all Z scores of the bond lengths (or
angles).

Bond lengths Bond angles

Mol Chain
RMSZ #|Z| >5 RMSZ #|Z| >5
1 A 0.43 0/3750 0.67 1/5116 (0.0%)
1 B 0.36 0/2038 0.61 0/2786
All All 0.41 0/5788 0.65 1/7902 (0.0%)

There are no bond length outliers.

All (1) bond angle outliers are listed below:

Mol Chain Res Type Atoms Z Observed(o ) Ideal(o )

1 A 273 ASP CB-CG-OD1 5.51 123.26 118.30

There are no chirality outliers.

There are no planarity outliers.

5.2 Too-close contacts ○

i

In the following table, the Non-H and H(model) columns list the number of non-hydrogen atoms
and hydrogen atoms in the chain respectively. The H(added) column lists the number of hydrogen
atoms added and optimized by MolProbity. The Clashes column lists the number of clashes within
the asymmetric unit, whereas Symm-Clashes lists symmetry-related clashes.

Mol Chain Non-H H(model) H(added) Clashes Symm-Clashes

1 A 3676 0 3524 34 0
1 B 2010 0 1731 53 0
2 A 53 0 31 5 0
3 B 5 0 0 0 0
4 A 65 0 0 0 0
4 B 4 0 0 0 0
All All 5813 0 5286 87 0
Page 10 Full wwPDB X-ray Structure Validation Report 7DVE

The all-atom clashscore is defined as the number of clashes found per 1000 atoms (including
hydrogen atoms). The all-atom clashscore for this structure is 8.
All (87) close contacts within the same asymmetric unit are listed below, sorted by their clash
magnitude.

Interatomic Clash
Atom-1 Atom-2
distance (Å) overlap (Å)
1:B:467:VAL:HG23 1:B:470:ALA:HB3 1.71 0.71
1:B:17:SER:HA 1:B:39:MET:CE 2.23 0.69
1:B:270:VAL:HG12 1:B:277:THR:HG23 1.74 0.69
1:B:449:VAL:HG11 1:B:475:VAL:HG11 1.74 0.68
1:B:446:GLN:HE21 1:B:478:ASN:HB3 1.59 0.68
1:B:4:ARG:NH1 1:B:254:ASP:OD2 2.27 0.67
1:B:375:LYS:NZ 1:B:381:ASP:OD2 2.31 0.63
1:B:30:GLU:OE2 1:B:159:ARG:NH2 2.31 0.62
1:A:93:ALA:HB2 1:A:99:LEU:HG 1.82 0.61
1:B:133:PRO:HG2 1:B:487:CYS:HB2 1.82 0.61
1:B:17:SER:HA 1:B:39:MET:HE2 1.82 0.60
1:B:134:ARG:NH1 1:B:158:GLU:OE1 2.36 0.58
1:B:237:VAL:HG23 1:B:250:VAL:HG13 1.85 0.57
1:B:240:VAL:HG11 1:B:473:LEU:HD23 1.87 0.56
1:B:254:ASP:HB3 1:B:257:THR:HG22 1.88 0.55
1:A:15:VAL:HG13 1:A:270:VAL:HA 1.89 0.54
1:B:154:LEU:O 1:B:158:GLU:HG3 2.08 0.53
1:B:15:VAL:HG12 1:B:272:ALA:HB2 1.90 0.53
1:A:124:MET:CE 2:A:801:FAD:H1’1 2.39 0.53
1:B:254:ASP:HB3 1:B:257:THR:CG2 2.40 0.52
1:B:280:LEU:O 1:B:284:SER:OG 2.27 0.52
1:B:271:ALA:HB2 1:B:476:ALA:HB3 1.91 0.52
1:B:385:PHE:CE1 1:B:398:MET:HG2 2.44 0.52
1:A:26:ARG:HD2 1:A:160:LEU:HD22 1.92 0.51
1:B:288:PRO:HD2 1:B:291:LEU:HB2 1.92 0.51
1:B:449:VAL:HG13 1:B:460:VAL:HG11 1.93 0.51
1:A:450:ARG:HB2 1:A:482:PRO:HB3 1.92 0.50
1:B:12:VAL:HB 1:B:37:ILE:HD12 1.93 0.50
1:B:19:PRO:O 1:B:23:THR:N 2.40 0.50
1:B:242:VAL:HG21 1:B:286:ILE:HD11 1.92 0.49
1:B:42:VAL:HG23 1:B:236:LEU:HB2 1.93 0.49
1:B:277:THR:HB 1:B:278:PRO:HD3 1.95 0.49
1:A:494:VAL:O 1:A:498:VAL:HG23 2.13 0.48
1:A:124:MET:HE3 2:A:801:FAD:H9 1.94 0.48
1:B:383:VAL:HG21 1:B:398:MET:HE3 1.96 0.47
1:B:381:ASP:HA 1:B:401:HIS:O 2.14 0.47
1:B:272:ALA:O 1:B:273:ASP:HB3 2.14 0.47
Continued on next page...
Page 11 Full wwPDB X-ray Structure Validation Report 7DVE

Continued from previous page...

Interatomic Clash
Atom-1 Atom-2
distance (Å) overlap (Å)
1:B:270:VAL:CG1 1:B:277:THR:HG23 2.42 0.47
1:A:15:VAL:CG1 1:A:270:VAL:HA 2.45 0.47
1:A:450:ARG:HD2 1:A:458:ALA:O 2.14 0.47
1:B:412:ILE:HD12 1:B:413:ASP:N 2.30 0.47
1:B:15:VAL:HB 1:B:270:VAL:HA 1.97 0.46
1:B:275:LEU:HB3 1:B:398:MET:HE1 1.98 0.46
1:A:467:VAL:HG21 1:A:473:LEU:HD23 1.97 0.46
1:A:271:ALA:HB2 1:A:476:ALA:HB3 1.98 0.46
1:A:257:THR:OG1 1:A:259:GLU:HG2 2.15 0.46
1:B:253:THR:HA 1:B:259:GLU:O 2.14 0.46
1:A:467:VAL:CG2 1:A:470:ALA:HB3 2.46 0.46
1:B:10:VAL:HG11 1:B:38:ALA:HB2 1.99 0.45
1:A:303:PHE:CZ 1:A:429:PRO:HB3 2.51 0.45
1:B:467:VAL:HG21 1:B:473:LEU:HD12 1.98 0.45
1:A:277:THR:HB 1:A:278:PRO:HD3 1.98 0.45
1:B:404:LEU:HD23 1:B:409:HIS:CD2 2.51 0.45
1:B:275:LEU:HD13 1:B:398:MET:HE1 1.98 0.45
1:B:243:GLU:HB3 1:B:248:ALA:HB2 1.99 0.45
1:A:133:PRO:HG2 1:A:487:CYS:HB2 1.99 0.44
1:A:128:TRP:HA 2:A:801:FAD:C7 2.48 0.44
1:A:298:GLN:O 1:A:442:SER:HB3 2.17 0.44
1:A:124:MET:CE 2:A:801:FAD:H9 2.47 0.44
1:B:467:VAL:CG2 1:B:470:ALA:HB3 2.45 0.44
1:A:355:LEU:HD12 1:A:368:GLY:HA3 1.99 0.44
1:A:42:VAL:O 1:A:234:GLU:HA 2.17 0.44
1:B:153:LEU:HB3 1:B:495:ALA:HB1 1.99 0.43
1:B:290:ALA:HA 1:B:293:ARG:HD2 2.01 0.43
1:A:455:ASP:HB2 1:A:468:TRP:CE3 2.53 0.43
1:B:279:GLN:OE1 1:B:395:MET:HB3 2.18 0.43
1:A:53:HIS:CE1 1:A:55:LYS:HG3 2.53 0.42
1:A:243:GLU:HB3 1:A:248:ALA:HB2 2.00 0.42
1:A:216:ASP:N 1:A:216:ASP:OD1 2.52 0.42
1:B:449:VAL:HG12 1:B:475:VAL:HG21 2.02 0.42
1:B:464:ASP:OD1 1:B:499:ARG:NH1 2.43 0.42
1:B:408:ASP:O 1:B:412:ILE:HG13 2.19 0.42
1:A:286:ILE:HD13 1:A:473:LEU:HD22 2.02 0.41
1:A:254:ASP:OD2 1:A:257:THR:HG23 2.19 0.41
1:A:131:ALA:HA 1:A:200:LEU:HD23 2.03 0.41
1:B:340:PRO:HD2 1:B:341:PHE:CE2 2.55 0.41
1:B:237:VAL:HG13 1:B:237:VAL:O 2.21 0.41
1:A:23:THR:HG23 1:A:160:LEU:CD1 2.51 0.41
Continued on next page...
Page 12 Full wwPDB X-ray Structure Validation Report 7DVE

Continued from previous page...

Interatomic Clash
Atom-1 Atom-2
distance (Å) overlap (Å)
1:A:128:TRP:HA 2:A:801:FAD:C6 2.51 0.41
1:A:507:GLU:HA 1:A:507:GLU:OE1 2.21 0.41
1:B:273:ASP:OD1 1:B:274:ALA:N 2.54 0.40
1:B:450:ARG:HG2 1:B:482:PRO:HA 2.04 0.40
1:B:451:MET:HE2 1:B:463:PRO:HA 2.03 0.40
1:B:295:LEU:HD23 1:B:402:TYR:CD1 2.57 0.40
1:A:239:ARG:HH21 1:A:260:ARG:HH12 1.69 0.40
1:A:94:ARG:HD3 1:A:352:PRO:O 2.21 0.40
1:A:139:GLU:HB3 1:A:485:THR:HG22 2.04 0.40

There are no symmetry-related clashes.

5.3 Torsion angles ○

i

5.3.1 Protein backbone ○

i

In the following table, the Percentiles column shows the percent Ramachandran outliers of the
chain as a percentile score with respect to all X-ray entries followed by that with respect to entries
of similar resolution.
The Analysed column shows the number of residues for which the backbone conformation was
analysed, and the total number of residues.

Mol Chain Analysed Favoured Allowed Outliers Percentiles

1 A 494/528 (94%) 480 (97%) 14 (3%) 0 100 100
1 B 283/528 (54%) 267 (94%) 15 (5%) 1 (0%) 34 48
All All 777/1056 (74%) 747 (96%) 29 (4%) 1 (0%) 51 68

All (1) Ramachandran outliers are listed below:

Mol Chain Res Type

1 B 450 ARG

5.3.2 Protein sidechains ○

i

In the following table, the Percentiles column shows the percent sidechain outliers of the chain as a
percentile score with respect to all X-ray entries followed by that with respect to entries of similar
resolution.
The Analysed column shows the number of residues for which the sidechain conformation was
Page 13 Full wwPDB X-ray Structure Validation Report 7DVE

analysed, and the total number of residues.

Mol Chain Analysed Rotameric Outliers Percentiles

1 A 373/409 (91%) 365 (98%) 8 (2%) 53 72
1 B 168/409 (41%) 161 (96%) 7 (4%) 30 47
All All 541/818 (66%) 526 (97%) 15 (3%) 43 63

All (15) residues with a non-rotameric sidechain are listed below:

Mol Chain Res Type

1 A 26 ARG
1 A 101 GLU
1 A 128 TRP
1 A 185 GLU
1 A 264 ARG
1 A 341 PHE
1 A 450 ARG
1 A 488 ASN
1 B 4 ARG
1 B 159 ARG
1 B 239 ARG
1 B 284 SER
1 B 295 LEU
1 B 382 ARG
1 B 405 SER

Sometimes sidechains can be flipped to improve hydrogen bonding and reduce clashes. All (3) such
sidechains are listed below:
Mol Chain Res Type
1 B 279 GLN
1 B 298 GLN
1 B 446 GLN

5.3.3 RNA ○
i

There are no RNA molecules in this entry.

5.4 Non-standard residues in protein, DNA, RNA chains ○

i

There are no non-standard protein/DNA/RNA residues in this entry.

Page 14 Full wwPDB X-ray Structure Validation Report 7DVE

5.5 Carbohydrates ○
i

There are no monosaccharides in this entry.

5.6 Ligand geometry ○

i

2 ligands are modelled in this entry.

In the following table, the Counts columns list the number of bonds (or angles) for which Mogul
statistics could be retrieved, the number of bonds (or angles) that are observed in the model and
the number of bonds (or angles) that are defined in the Chemical Component Dictionary. The
Link column lists molecule types, if any, to which the group is linked. The Z score for a bond
length (or angle) is the number of standard deviations the observed value is removed from the
expected value. A bond length (or angle) with |Z| > 2 is considered an outlier worth inspection.
RMSZ is the root-mean-square of all Z scores of the bond lengths (or angles).

Bond lengths Bond angles

Mol Type Chain Res Link
Counts RMSZ #|Z| > 2 Counts RMSZ #|Z| > 2
2 FAD A 801 - 51,58,58 1.65 9 (17%) 60,89,89 1.97 11 (18%)
3 SO4 B 601 - 4,4,4 0.29 0 6,6,6 0.24 0

In the following table, the Chirals column lists the number of chiral outliers, the number of chiral
centers analysed, the number of these observed in the model and the number defined in the
Chemical Component Dictionary. Similar counts are reported in the Torsion and Rings columns.
’-’ means no outliers of that kind were identified.
Mol Type Chain Res Link Chirals Torsions Rings
2 FAD A 801 - - 2/30/50/50 0/6/6/6

All (9) bond length outliers are listed below:

Mol Chain Res Type Atoms Z Observed(Å) Ideal(Å)

2 A 801 FAD C2A-N3A 5.67 1.41 1.32
2 A 801 FAD C4-N3 5.00 1.41 1.33
2 A 801 FAD C2A-N1A 3.30 1.40 1.33
2 A 801 FAD C10-N1 2.95 1.37 1.33
2 A 801 FAD C5’-C4’ 2.82 1.55 1.51
2 A 801 FAD C6A-C5A -2.38 1.34 1.43
2 A 801 FAD C7M-C7 2.21 1.55 1.51
2 A 801 FAD C5A-C4A -2.18 1.35 1.40
2 A 801 FAD C9A-N10 -2.05 1.35 1.38

All (11) bond angle outliers are listed below:

Page 15 Full wwPDB X-ray Structure Validation Report 7DVE

Mol Chain Res Type Atoms Z Observed(o ) Ideal(o )

2 A 801 FAD N3A-C2A-N1A -6.31 118.81 128.68
2 A 801 FAD C1’-N10-C9A 5.79 122.85 118.29
2 A 801 FAD C4-N3-C2 5.66 119.92 115.14
2 A 801 FAD O4B-C1B-C2B -5.05 99.54 106.93
2 A 801 FAD C10-C4X-N5 -3.89 118.57 121.26
2 A 801 FAD C4X-C4-N3 -3.29 118.94 123.43
2 A 801 FAD C4-C4X-N5 3.01 122.03 118.60
2 A 801 FAD C4X-N5-C5X 2.92 119.69 116.77
2 A 801 FAD C5A-C6A-N6A -2.71 116.24 120.35
2 A 801 FAD C1B-N9A-C4A 2.49 131.01 126.64
2 A 801 FAD P-O3P-PA -2.04 125.84 132.83

There are no chirality outliers.

All (2) torsion outliers are listed below:

Mol Chain Res Type Atoms

2 A 801 FAD PA-O3P-P-O5’
2 A 801 FAD O4B-C4B-C5B-O5B

There are no ring outliers.

1 monomer is involved in 5 short contacts:
Mol Chain Res Type Clashes Symm-Clashes
2 A 801 FAD 5 0

The following is a two-dimensional graphical depiction of Mogul quality analysis of bond lengths,
bond angles, torsion angles, and ring geometry for all instances of the Ligand of Interest. In
addition, ligands with molecular weight > 250 and outliers as shown on the validation Tables will
also be included. For torsion angles, if less then 5% of the Mogul distribution of torsion angles is
within 10 degrees of the torsion angle in question, then that torsion angle is considered an outlier.
Any bond that is central to one or more torsion angles identified as an outlier by Mogul will be
highlighted in the graph. For rings, the root-mean-square deviation (RMSD) between the ring
in question and similar rings identified by Mogul is calculated over all ring torsion angles. If the
average RMSD is greater than 60 degrees and the minimal RMSD between the ring in question and
any Mogul-identified rings is also greater than 60 degrees, then that ring is considered an outlier.
The outliers are highlighted in purple. The color gray indicates Mogul did not find sufficient
equivalents in the CSD to analyse the geometry.
Page 16 Full wwPDB X-ray Structure Validation Report 7DVE

Ligand FAD A 801

Bond lengths Bond angles

Torsions Rings

5.7 Other polymers ○

i

There are no such residues in this entry.

5.8 Polymer linkage issues ○

i

There are no chain breaks in this entry.

Page 17 Full wwPDB X-ray Structure Validation Report 7DVE

6 Fit of model and data ○

i

6.1 Protein, DNA and RNA chains ○

i

In the following table, the column labelled ‘#RSRZ> 2’ contains the number (and percentage)
of RSRZ outliers, followed by percent RSRZ outliers for the chain as percentile scores relative to
all X-ray entries and entries of similar resolution. The OWAB column contains the minimum,
median, 95th percentile and maximum values of the occupancy-weighted average B-factor per
residue. The column labelled ‘Q< 0.9’ lists the number of (and percentage) of residues with an
average occupancy less than 0.9.

Mol Chain Analysed <RSRZ> #RSRZ>2 OWAB(Å2 ) Q<0.9

1 A 498/528 (94%) 0.18 17 (3%) 45 44 47, 61, 101, 163 0
1 B 299/528 (56%) 0.77 47 (15%) 2 1 73, 105, 137, 162 0
All All 797/1056 (75%) 0.40 64 (8%) 12 11 47, 75, 125, 163 0

All (64) RSRZ outliers are listed below:

Mol Chain Res Type RSRZ

1 A 188 HIS 4.9
1 A 310 PHE 4.8
1 B 230 THR 4.8
1 B 22 ALA 4.5
1 B 417 ALA 4.3
1 B 388 SER 4.1
1 B 372 PHE 3.9
1 B 340 PRO 3.8
1 B 341 PHE 3.7
1 B 416 LYS 3.4
1 B 415 ALA 3.4
1 B 386 SER 3.4
1 B 218 VAL 3.4
1 B 334 PRO 3.3
1 B 163 VAL 3.3
1 B 420 VAL 3.2
1 B 339 MET 3.2
1 B 419 ILE 3.2
1 B 301 ILE 3.1
1 B 445 TYR 3.1
1 A 186 ASP 3.1
1 A 183 ALA 3.1
1 B 338 ASP 3.1
1 B 390 VAL 3.1
Continued on next page...
Page 18 Full wwPDB X-ray Structure Validation Report 7DVE

Continued from previous page...

Mol Chain Res Type RSRZ
1 A 246 ARG 3.0
1 B 131 ALA 3.0
1 B 486 ALA 3.0
1 B 423 GLY 3.0
1 B 232 PHE 3.0
1 B 229 PHE 2.8
1 B 228 ASN 2.8
1 B 43 GLY 2.8
1 B 130 GLY 2.8
1 B 425 ALA 2.8
1 A 316 ALA 2.7
1 B 393 TYR 2.7
1 B 154 LEU 2.6
1 B 161 LEU 2.5
1 B 418 GLU 2.5
1 B 373 CYS 2.5
1 B 421 ARG 2.4
1 B 299 ALA 2.4
1 B 424 LYS 2.4
1 B 394 GLY 2.4
1 A 509 THR 2.4
1 B 414 ARG 2.3
1 B 395 MET 2.2
1 B 271 ALA 2.2
1 B 144 LEU 2.2
1 A 449 VAL 2.2
1 A 513 ALA 2.2
1 B 410 ALA 2.2
1 A 315 ASP 2.2
1 A 184 VAL 2.2
1 A 187 ALA 2.2
1 B 220 GLY 2.1
1 A 479 GLY 2.1
1 A 8 ALA 2.1
1 A 477 GLY 2.1
1 B 336 THR 2.0
1 A 19 PRO 2.0
1 A 265 ALA 2.0
1 B 279 GLN 2.0
1 B 236 LEU 2.0
Page 19 Full wwPDB X-ray Structure Validation Report 7DVE

6.2 Non-standard residues in protein, DNA, RNA chains ○

i

There are no non-standard protein/DNA/RNA residues in this entry.

6.3 Carbohydrates ○
i

There are no monosaccharides in this entry.

6.4 Ligands ○
i

In the following table, the Atoms column lists the number of modelled atoms in the group and the
number defined in the chemical component dictionary. The B-factors column lists the minimum,
median, 95th percentile and maximum values of B factors of atoms in the group. The column
labelled ‘Q< 0.9’ lists the number of atoms with occupancy less than 0.9.

Mol Type Chain Res Atoms RSCC RSR B-factors(Å2 ) Q<0.9

3 SO4 B 601 5/5 0.94 0.11 77,82,91,91 0
2 FAD A 801 53/53 0.96 0.17 44,51,63,63 0

The following is a graphical depiction of the model fit to experimental electron density of all
instances of the Ligand of Interest. In addition, ligands with molecular weight > 250 and outliers
as shown on the geometry validation Tables will also be included. Each fit is shown from different
orientation to approximate a three-dimensional view.
Page 20 Full wwPDB X-ray Structure Validation Report 7DVE

Electron density around FAD A 801:

2mFo -DFc (at 0.7 rmsd) in gray

mFo -DFc (at 3 rmsd) in purple (negative)
and green (positive)

6.5 Other polymers ○

i

There are no such residues in this entry.