TP53 Mutation in Urinary Bladder Cancer-Bn

TP53 Mutation in Urinary Bladder Cancer
Tumor protein p53 (TP53) is a tumor suppressor gene and mutations in this gene are
found frequently in several human cancer including urinary bladder cancer. Strong
invasiveness and recurrence occur in about 25% of bladder cancer patients. Muscle-invasive
bladder cancer (MIBC) have worse prognosis when detected during diagnosis or treatment.
Non muscle-invasive bladder cancer (NMIBC) primarily treated by TURB (Transurethral
resection of the bladder) whereas MIBC requires both surgery and chemotherapy for
treatment. TP53 mutations affect several target gene expression resulting transcriptional
activation or change in metabolism and cell cycle, senescence, apoptosis and complicated
cellular progression (Vousden & Prives, 2009). Mutations in TP53 and its related pathways
can act as driver mutations for bladder cancer. Mutant TP53 activate several mechanisms
relevant to cancer initiation, progression and poor outcome disease (Kim, Zhang & Lozano,
2015; Smith et al., 2002). Recently, Wu G et al., 2019 studied contribution of the TP53
mutation for progression to muscle-invasiveness by comparing MIBC (n=408) versus
NMIBC. They have observed mutations in 49.5% patients in MIBC as compare to 21% of
patients of NIMBC. Type of mutations include missense mutation (31.6%), truncation
(15.6%), deletion (2.2%), multiple(0.7%) and inframe (0.2%) mutations (Figure below). Even
though mutations are detected spanning all exons, highest frequency was observed in exon 7,
R248Q/W/G in MIBC and in exon 8, E285K/G in NMIBC. These mutations can be useful as
marker of muscle invasiveness. Other mutational analysis studies have shown point mutations
spanning exons 4-8 which includes R72P (58%), P67T (9%), A159P (0.7%), D185N (28%),
G199 V (0.7%), G199E (0.7%), D208N (0.7%), R283P (1.4%). These mutations were found
to be significantly associated with late stage (pT2-pT4) muscle-invasive bladder tumors.
DOI:10.1016/j.mgene.2017.01.002
TheTP53 mutation R72P is also known as functional single-nucleotide polymorphism
(SNP, rs1042522) at codon 72. TP53 codon 72 polymorphism has been linked to an
increased risk of breast cancer, cervical cancer, oesophageal cancer, gastric cancer, lung
cancer, and skin cancer. This polymorphism may affects the phenotypes or clinical
outcomes of bladder cancer but the underlying mechanism remains unknown. However,
three genotypes, Arg/Arg,Arg/Pro, and Pro/Pro, were found in 37% (38/103), 42%
(43/103), and 21% (22/103) of the patients, respectively in bladder cancer. Genetic
association yet to be studied. Prevalence of mutations in FGFR3 was significantly higher

inpatients with the Arg allele (41% vs 4.5%, p < 0.01). In contrast, the prevalence of
mutations in RAS was higher in patients without the Arg allele (41% vs 20%, p = 0.04)
PMID: 31369573
Methodology
TP53 Gene: The TP53 gene sequence corresponds to (hg38) on chr17:7687599...7668459,
the genomic sequence NC_000017.11 (TP53 5'UTR to 3'UTR) and consists of 11 exons.
TP53 ORF corresponds exon 2 (aa1-25), 3 (aa26-32), 4 (aa 33-125), 5 (aa126-186), 6 (aa187-
224), 7 (aa225-260), 8 (aa126-186), 9 (aa307-331), 10 (aa332-367) and 11 (aa368-393).
Isolation of genomic DNA
For genomic DNA, biopsy tissue or from whole blood will be obtained from both
MIBC or NIMBC patients. Genomic DNA will be isolated in commercial kits such as
QIAamp whole blood/tissue nucleic acid kit using automated nucleic acid extraction system
qiasymphony or by manual method from tissues.
Amplification of TP53 exon and detection of tumor associated mutations and its
frequency
Detection of tumor associated somatic mutation will be carried out by direct
sequencing or by droplet digital PCR or by pyrosequencing using IARC TP53 specific
primer. These regions flanking exon 4, 7 and 8 will be amplified using exon specific PCR
primers as mentioned below:
Gene Primers Size

TP53Exon4 P-329: tgctcttttcacccatctac 353 bp
(IARC P-330: atacggccaggcattgaagt
sequencing P-326:tgaggacctggtcctctgac 413 bp
primer P-327:agaggaatcccaaagttcca
TP53Exon7 P333F510-5’ –CTTGCCACAGGTCTCCCCAA-3 237bp
(IARC P313R-746- 5-AGGGGTCAGCGGCAAGCAGA-3’
sequencing P237-F529: 5 AGGCGCACTGGCCTCATCTT3’ 177bp
primer P238-R705:5’TGTGCAGGGTGGCAAGTGCC-3’
TP53Exon P-316: ttccttactgcctcttgctt 231bp
8 (IARC P-319: aggcataactgcacccttgg
Alternative to direct sequencing, droplet digital PCR or pyrosequencing will be will

be carried out using commercial assay. The assay ID and COSMIC ID for the mutations are
mentioned below.
Gene TP53 TP53 TP53 TP53 TP53
name
Mutation COSM250061 COSM10656 COSM10662 COSM10817 COSM10722
ID
AA p.P72R p.R248W p.R248Q p.R249S p.E285K
mutation
CDS c.215C>G c.742C>T c.743G>A c.747G>T c.853G>A
mutation
Assay ID

TP53 Mutation in Urinary Bladder Cancer-Bn

Uploaded by

Copyright:

Available Formats

TP53 Mutation in Urinary Bladder Cancer-Bn

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

TP53 Mutation in Urinary Bladder Cancer-Bn

Uploaded by

Copyright:

Available Formats

TP53 Mutation in Urinary Bladder Cancer

Non muscle-invasive bladder cancer (NMIBC) primarily treated by TURB (Transurethral

mutation for progression to muscle-invasiveness by comparing MIBC (n=408) versus

patients of NIMBC. Type of mutations include missense mutation (31.6%), truncation

to be significantly associated with late stage (pT2-pT4) muscle-invasive bladder tumors.

association yet to be studied. Prevalence of mutations in FGFR3 was significantly higher

TP53 Gene: The TP53 gene sequence corresponds to (hg38) on chr17:7687599...7668459,

224), 7 (aa225-260), 8 (aa126-186), 9 (aa307-331), 10 (aa332-367) and 11 (aa368-393).

Isolation of genomic DNA

qiasymphony or by manual method from tissues.

Gene Primers Size

Alternative to direct sequencing, droplet digital PCR or pyrosequencing will be will

You might also like