Revision test

Molecular basis of Inheritance

Question no 1 to 14 carries one mark each.
1. Amino acid sequence, in protein synthesis is decided by the sequence of
(a) rRNA (c) mRNA
(b) tRNA (d) cDNA
2. What is not true for genetic code?
(a) It is nearly universal.
(b) It is degenerate.
(c) It is unambiguous
(d) A codon in mRNA is read in a non-contiguous fashion
3. Removal of introns and joining the exons in a defined order in a transcription unit is
called
(a) tailing (c) capping
(b) transformation (d) splicing
4. The promoter site and the terminator site for transcription are located at
(a) 3' (downstream) end and 5' (upstream) end, respectively of the transcription
unit
(b) 5' (upstream) end and 3' (downstream) end, respectively of the transcription
unit
(c) the 5' (upstream) end
(d) the 3' (downstream) end
5. The human chromosome with the highest and least number of genes in them are
respectively
(a) Chromosome 21 and Y (c) Chromosome 1 and Y
(b) Chromosome 1 and X (d) Chromosome X and Y
6. Discontinuous synthesis of DNA occurs in one strand, because
(a) DNA molecule being synthesized is very long
(b) DNA dependent DNA polymerase catalyzes polymerization only in one
direction (5′ → 3′)
(c) it is a more efficient process
(d) DNA ligase joins the short stretches of DNA
7. If the sequence of nitrogen bases of the coding strand of DNA in a transcription unit is:
5' - A T G A A T G - 3', the sequence of bases in its RNA transcript would be
(a) 5' - A U G A A U G - 3' (c) 5' - C A U U C A U - 3'
(b) 5' - U A C U U A C - 3' (d) 5' - G U A A G U A - 3'
8. In E.coli, the lac operon gets switched on when
a) lactose is present, and it binds to the repressor
(b) repressor binds to operator
(c) RNA polymerase binds to the operator
(d) lactose is present, and it binds to RNA polymerase
 9. Which of the following steps in transcription is catalysed by RNA polymerase?
(a) Initiation (c) Termination
(b) Elongation (d) All of the above

10. The net electric charge on DNA and histones is

(a) both positive (c) negative and positive, respectively
(b) both negative (d) zero

In the following questions a statement of assertion followed by a statement of reason is

given. Choose the correct answer out of the following choices.
(a) Assertion and reason both are correct statements and reason is correct
explanation for assertion.
(b) Assertion and reason both are correct statements, but reason is not correct
explanation for assertion.
(c) Assertion is correct statement, but reason is wrong statement.
(d) Assertion is wrong statement, but reason is correct statement.

11. Assertion: Histones are basic proteins of major importance in packaging of eukaryotic
DNA, DNA and histones comprise chromatin forming the bulk of eukaryotic
chromosome.
Reason: Histones are of five major types: H1, H2A, H2B, H3 and H4.

12. Assertion: Replication and transcription occur in the nucleus, but translation occurs in
the cytoplasm.
Reason: mRNA is transferred from the nucleus into the cytoplasm where ribosomes and
amino acids are available for protein synthesis.

13. Assertion: In Griffith's experiment, the mixture of heat-killed virulent R bacteria and live
nonvirulent S bacteria, lead to the death of mice.
Reason: The transforming principle got transferred from S strain to heat-killed R strain
and made it virulent.

14. Assertion: DNA is a better genetic material than RNA for most organisms.
Reason: 2'–OH group present in DNA makes it less reactive.

15. Assertion: Eukaryotic mRNA requires post-transcriptional modifications to form

functional mRNA.
Reason: Eukaryotic transcripts possess extra non-functional gene segments called
introns
Case-based/Source-based Question
16. Study the figure given below and answer the questions. [3]

a. How does the repressor molecule get inactivated?

b. When does the transcription of lac mRNA stop?
c. Name the enzyme transcribed by the gene ‘z’.
17. Watson-Crick gave the semi-conservative mode of DNA replication [5]

a. In a nucleus, the number of RNA nucleoside triphosphates is 10 times more than

the number of DNA nucleoside triphosphates, still only DNA nucleotides are
added during the DNA replication, and not the RNA nucleotides. Why?
b. Name the enzyme and state its property that is responsible for continuous and
discontinuous replication of the two strands of a DNA molecule.
c. Name the enzyme involved in the continuous replication of DNA strand. Mention
the polarity of the template strand.
Very Short Answer Questions [1 mark]
18. Mention the carbon positions to which the nitrogenous base and the phosphate
molecule are respectively linked in the nucleotide given below:
 19. Name the negatively charged and positively charged components of a nucleosome.
20. Name the transcriptionally active region of chromatin in a nucleus.
21. What is cistron?
22. Mention two functions of the codon AUG.
23. What do ‘X’ and ‘Y’ represent in the transcription unit of the DNA molecule shown?

24. Why hnRNA is required to undergo splicing?

25. If the sequence of the coding strand in a transcription unit is written as follows:
5′—ATGCATGCATGCATGCATGCATGCATG—3′ Write down the sequence of mRNA.
Short Answer Questions [2 marks]
26. If a double stranded DNA has 20 per cent of cytosine, calculate the per cent of adenine
in the DNA.
27. What is DNA fingerprinting? Mention its application.
28. Explain the role of 35S and 32P in the experiments conducted by Hershey and Chase.
29. How do histones acquire positive charge?
30. A template strand is given below. Write down the corresponding coding strand and the
mRNA strand that can be formed, along with their polarity.
a. 3′ ATGCATGCATGCATGCATGCATGC 5′
31. Name the category of codons UGA belongs to. Mention another codon of the same
category. Explain their role in protein synthesis.
32. List the two methodologies which were involved in human genome project. Mention
how they were used.
Long Answer Questions–I [3 marks]
33. Look at the diagram given below and answer the
questions.
a. What is this diagram representing?
b. Name the parts a, b and c.
c. In the eukaryotes, the DNA molecules are
organised within the nucleus. How is the DNA
molecule organised in a bacterial cell in
absence of a nucleus?

34. Answer the following questions based on Meselson and Stahl’s experiment:
a. Write the name of the chemical substance used as a source of nitrogen in the
experiment by them.
b. How did the scientists make it possible to distinguish the heavy DNA molecule
from the light DNA molecule? Explain.
c. Write the conclusion the scientists arrived at after completing the experiment.
 35. Describe the initiation and elongation process of transcription in bacteria.
36. How is hnRNA processed to form mRNA?
37. State the conditions when ‘genetic code’ is said to be
(i) degenerate,
(ii) unambiguous and specific,
(iii) universal
.