0% found this document useful (0 votes)
10 views74 pages

Chapter 02 Data and Data Preprocessing

Uploaded by

Ariq Alwin
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
10 views74 pages

Chapter 02 Data and Data Preprocessing

Uploaded by

Ariq Alwin
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
You are on page 1/ 74

DEPARTEMEN SISTEM INFORMASI

Fak. Teknologi Elektro & Informatika Cerdas

ES234422
PEMODELAN & ANALITIKA PREDIKTIF
(PREDICITVE MODELING & ANALYTICS)

Chapter 2
Data & Data Preprocessing
Prof. Ir. Arif Djunaidy, M.Sc., Ph.D.
arif.djunaidy@its.ac.id
adjunaidy@gmail.com
Learning Objectives & Book Reading

Learning Objectives: To understand different types of


data, data quality, data preprocessing, and measurement
of similarity and dissimilarity between data objects

Book reading: Daniel T. Larose & Chantal D. Larose, “Data


Mining and Predictive Analytics”, 2nd edition, Wiley, 2015.
[Chapter 2]
What is Data?
• Collection of data objects and Attributes
their attributes

• An attribute is a property or Tid Refund Marital Taxable


Status Income Cheat
characteristic of an object
1 Yes Single 125K No
– Examples: eye color of a
person, temperature, etc. 2 No Married 100K No
3 No Single 70K No
– Attribute is also known as
variable, field, characteristic, or 4 Yes Married 120K No

feature 5 No Divorced 95K Yes


Objects
• A collection of attributes 6 No Married 60K No

describe an object 7 Yes Divorced 220K No

– Object is also known as 8 No Single 85K Yes

record, point, case, sample, 9 No Married 75K No


entity, or instance 10
10 No Single 90K Yes

Data & Data Preprocessing Chapter 02 / 3


Attribute Values (1)
• Attribute values are numbers or symbols assigned to
an attribute
• Distinction between attributes and attribute values
– Same attribute can be mapped to different attribute
values
• Example: height can be measured in feet or meters

– Different attributes can be mapped to the same set of


values
• Example: Attribute values for ID and age are integers
• But properties of attribute values can be different
– ID has no limit but age has a maximum and minimum value

Data & Data Preprocessing Chapter 02 / 4


Attribute Values (2)
• The way you measure an attribute is somewhat may not match the
attributes properties. Example: measurement of length
5 A 1

B
7 2

8 3

10 4

15 5

Data & Data Preprocessing Chapter 02 / 5


Types of Attributes
• There are different types of attributes
– Nominal
• Examples: ID numbers, eye color, zip codes
– Ordinal
• Examples: rankings (e.g., taste of potato chips on a scale
from 1-10), grades, height in {tall, medium, short}
– Interval
• Examples: calendar dates, temperatures in Celsius or
Fahrenheit.
– Ratio
• Examples: temperature in Kelvin, length, time, counts

Data & Data Preprocessing Chapter 02 / 6


Properties of Attribute Values
• The type of an attribute depends on which of the
following properties it possesses:
– Distinctness: = ≠
– Order: < >
– Addition: + -
– Multiplication: */

– Nominal attribute: distinctness


– Ordinal attribute: distinctness & order
– Interval attribute: distinctness, order & addition
– Ratio attribute: all 4 properties

Data & Data Preprocessing Chapter 02 / 7


Properties of Attribute Values …
Attribute
Description Examples Operations
Type
Nominal The values of a nominal attribute zip codes, employee ID mode, entropy,
are just different names, i.e., numbers, eye color, sex: contingency
nominal attributes provide only {male, female} correlation, χ2 test
enough information to distinguish
one object from another (=, ≠)
Ordinal The values of an ordinal attribute hardness of minerals, median, percentiles,
provide enough information to {good, better, best}, rank correlation, run
order objects (<, >) grades, street numbers tests, sign tests
Interval For interval attributes, the calendar dates, mean, standard
differences between values are temperature in Celsius deviation, Pearson's
meaningful, i.e., a unit of or Fahrenheit correlation, t and F
measurement exists (+, - ) tests
Ratio For ratio variables, both temperature in Kelvin, geometric mean,
differences and ratios are monetary quantities, harmonic mean,
meaningful (*, /) counts, age, mass, percent variation
length, electrical
current

Data & Data Preprocessing Chapter 02 / 8


Properties of Attribute Values …
Attribute
Transformation Comments
Level
Nominal Any permutation of values If all employee ID numbers were
reassigned, would it make any
difference?

Ordinal An order preserving change of An attribute encompassing the


values, i.e., notion of good, better best can be
new_value = f(old_value) represented equally well by the
where f is a monotonic function. values {1, 2, 3} or by { 0.5, 1, 10}.

Interval new_value =a * old_value + b where Thus, the Fahrenheit and Celsius


a and b are constants temperature scales differ in terms of
where their zero value is and the
size of a unit (degree).

Ratio new_value = a * old_value Length can be measured in meters


or feet.

Data & Data Preprocessing Chapter 02 / 9


Discrete and Continuous Attributes
• Discrete Attribute
– Has only a finite or countably infinite set of values
– Examples: zip codes, counts, or the set of words in a collection
of documents
– Often represented as integer variables.
– Note: binary attributes are a special case of discrete attributes

• Continuous Attribute
– Has real numbers as attribute values
– Examples: temperature, height, or weight.
– Practically, real values can only be measured and represented
using a finite number of digits.
– Continuous attributes are typically represented as floating-point
variables.

Data & Data Preprocessing Chapter 02 / 10


Types of data sets
• Record
– Data Matrix
– Document Data
– Transaction Data
• Graph
– World Wide Web
– Molecular Structures
• Ordered
– Spatial Data
– Temporal Data
– Sequential Data
– Genetic Sequence Data

Data & Data Preprocessing Chapter 02 / 11


Record Data
Tid Refund Marital Taxable
Status Income Cheat

1 Yes Single 125K No • Data that consists of a


2 No Married 100K No collection of records,
3 No Single 70K No each of which consists
4 Yes Married 120K No
of a fixed set of
5 No Divorced 95K Yes
attributes
6 No Married 60K No
7 Yes Divorced 220K No
8 No Single 85K Yes
9 No Married 75K No
10 No Single 90K Yes
10

Data & Data Preprocessing Chapter 02 / 12


Data Matrix
• If data objects have the same fixed set of numeric
attributes, then the data objects can be thought of as
points in a multi-dimensional space, where each
dimension represents a distinct attribute
• Such data set can be represented by an m by n matrix,
where there are m rows, one for each object, and n
columns, one for each attribute
Projection Projection Distance Load Thickness
of x Load of y load

10.23 5.27 15.22 2.7 1.2


12.65 6.25 16.22 2.2 1.1

Data & Data Preprocessing Chapter 02 / 13


Document Data
• Each document becomes a “term' vector”
– each term is a component (attribute) of the vector,
– the value of each component is the number of times the
corresponding term occurs in the document.

timeout

season
coach

game
score
team

ball

lost
pla

wi
n
y

Document 1 3 0 5 0 2 6 0 2 0 2

Document 2 0 7 0 2 1 0 0 3 0 0

Document 3 0 1 0 0 1 2 2 0 3 0

Data & Data Preprocessing Chapter 02 / 14


Transaction Data
• A special type of record data, where
– each record (transaction) involves a set of items.
– For example, consider a grocery store. The set of
products purchased by a customer during one shopping
trip constitute a transaction, while the individual products
that were purchased are the items.
TID Items
1 Bread, Coke, Milk
2 Beer, Bread
3 Beer, Coke, Diaper, Milk
4 Beer, Bread, Diaper, Milk
5 Coke, Diaper, Milk

Data & Data Preprocessing Chapter 02 / 15


Graph Data
• Examples: Generic graph and HTML Links
<a href="papers/papers.html#bbbb">
Data Mining </a>
<li>
2 <a href="papers/papers.html#aaaa">
Graph Partitioning </a>
5 1 <li>
<a href="papers/papers.html#aaaa">
2 Parallel Solution of Sparse Linear System of Equations </a>
<li>
<a href="papers/papers.html#ffff">
5 N-Body Computation and Dense Linear System Solvers

Data & Data Preprocessing Chapter 02 / 16


Chemical Data
• Benzene Molecule: C6H6

Data & Data Preprocessing Chapter 02 / 17


Ordered Data (1)
• Sequences of transactions
Items/Events

An element of
the sequence
Data & Data Preprocessing Chapter 02 / 18
Ordered Data (2)
• Genomic (DNA) sequence data
DNA sequencing is the process of determining the nucleic acid
sequence – the order of nucleotides in DNA. It includes any method
or technology that is used to determine the order of the four bases:
adenine, guanine, cytosine, and thymine
GGTTCCGCCTTCAGCCCCGCGCC
CGCAGGGCCCGCCCCGCGCCGTC
GAGAAGGGCCCGCCTGGCGGGCG
GGGGGAGGCGGGGCCGCCCGAGC
CCAACCGAGTCCGACCAGGTGCC
CCCTCTGCTCGGCCTAGACCTGA
GCTCATTAGGCGGCAGCGGACAG
GCCAAGTAGAACACGCGAAGCGC
TGGGCTGCCTGCTGCGACCAGGG
Data & Data Preprocessing Chapter 02 / 19
Ordered Data (3)
• Spatio-Temporal Data

Average Monthly
Temperature of
land and ocean

Data & Data Preprocessing Chapter 02 / 20


Data Quality
• What kinds of data quality problems?
• How can we detect problems with the data?
• What can we do about these problems?
• Examples of data quality problems:
– noise and outliers
– missing values
– duplicate data

Data & Data Preprocessing Chapter 02 / 21


Noise
• Noise refers to modification of original values
– Examples: distortion of a person’s voice when talking on
a poor phone and “snow” on television screen

Two Sine Waves Two Sine Waves + Noise

Data & Data Preprocessing Chapter 02 / 22


Outliers
• Outliers are data objects with characteristics that are
considerably different than most of the other data
objects in the data set

Data & Data Preprocessing Chapter 02 / 23


Missing Values
• Reasons for missing values
– Information is not collected
(e.g., people decline to give their age and weight)
– Attributes may not be applicable to all cases
(e.g., annual income is not applicable to children)

• Handling missing values


– Eliminate data objects
– Estimate missing values
– Ignore the missing value during analysis
– Replace with all possible values (weighted by their
probabilities)

Data & Data Preprocessing Chapter 02 / 24


Duplicate Data
• Data set may include data objects that are
duplicates, or almost duplicates of one another
– Major issue when merging data from heterogeous
sources
• Examples:
– Same person with multiple email addresses
• Data cleaning
– Process of dealing with duplicate data issues

Data & Data Preprocessing Chapter 02 / 25


Data Preprocessing
• Aggregation
• Sampling
• Dimensionality Reduction
• Feature subset selection
• Feature creation
• Discretization and Binarization
• Attribute Transformation

Data & Data Preprocessing Chapter 02 / 26


Aggregation (1)
• Combining two or more attributes (or objects)
into a single attribute (or object)
• Purpose
– Data reduction
• Reduce the number of attributes or objects
– Change of scale
• Cities aggregated into regions, states, countries, etc
– More “stable” data
• Aggregated data tends to have less variability

Data & Data Preprocessing Chapter 02 / 27


Aggregation (2)
Example: Variation of Precipitation in Australia

Standard Deviation of Average Standard Deviation of Average


Monthly Precipitation Yearly Precipitation

Data & Data Preprocessing Chapter 02 / 28


Data Preprocessing
• Aggregation
• Sampling
• Dimensionality Reduction
• Feature subset selection
• Feature creation
• Discretization and Binarization
• Attribute Transformation

Data & Data Preprocessing Chapter 02 / 29


Sampling
• Sampling is the main technique employed for data
selection.
– It is often used for both the preliminary investigation of the data
and the final data analysis.

• Statisticians sample because obtaining the entire


set of data of interest is too expensive or time
consuming.
• Sampling is used in data mining because
processing the entire set of data of interest is too
expensive or time consuming.

Data & Data Preprocessing Chapter 02 / 30


Sampling …
• The key principle for effective sampling is the
following:
– using a sample will work almost as well as using the entire
data sets, if the sample is representative
– A sample is representative if it has approximately the same
property (of interest) as the original set of data

Data & Data Preprocessing Chapter 02 / 31


Types of Sampling
• Simple Random Sampling
– There is an equal probability of selecting any particular item
• Sampling without replacement
– As each item is selected, it is removed from the population
• Sampling with replacement
– Objects are not removed from the population as they are
selected for the sample.
• In sampling with replacement, the same object can be picked up
more than once

• Stratified sampling
– Split the data into several partitions; then draw random samples
from each partition

Data & Data Preprocessing Chapter 02 / 32


Sample Size (1)

8000 points 2000 Points 500 Points

Data & Data Preprocessing Chapter 02 / 33


Sample Size (2)
• What sample size is necessary to get at least one object
from each of 10 groups.

Data & Data Preprocessing Chapter 02 / 34


Data Preprocessing
• Aggregation
• Sampling
• Dimensionality Reduction
• Feature subset selection
• Feature creation
• Discretization and Binarization
• Attribute Transformation

Data & Data Preprocessing Chapter 02 / 35


Dimensionality Reduction
• Purpose:
– Avoid curse of dimensionality
– Reduce amount of time and memory required by data
mining algorithms
– Allow data to be more easily visualized
– May help to eliminate irrelevant features or reduce noise

• Techniques
– Principle Component Analysis
– Singular Value Decomposition
– Others: supervised and non-linear techniques

Data & Data Preprocessing Chapter 02 / 36


Curse of Dimensionality
• When dimensionality
increases, data becomes
increasingly sparse in the
space that it occupies

• As the number of dimensions


(features) increases, the data
points spread out and become
sparse in the feature space.
• This sparsity makes it difficult
for machine learning
algorithms to generalize well
• Randomly generate 500 points because the model doesn't
• Compute difference between max and min have enough data points that
distance between any pair of points
are "close" to each other in
the high-dimensional space.

Data & Data Preprocessing Chapter 02 / 37


Dimensionality Reduction: PCA
• Goal is to find a projection that captures
the largest amount of variation in data
x2

x1

Data & Data Preprocessing Chapter 02 / 38


Dimensionality Reduction: PCA
• Find the eigenvectors of the covariance
matrix
• The eigenvectors define the new space
x2

x1

Data & Data Preprocessing Chapter 02 / 39


Dimensionality Reduction: ISOMAP

By: Tenenbaum, de Silva,


Langford (2000)

• Construct a neighbourhood graph


• For each pair of points in the graph, compute the shortest
path distances (geodesic distances)

Data & Data Preprocessing Chapter 02 / 40


Data Preprocessing
• Aggregation
• Sampling
• Dimensionality Reduction
• Feature subset selection
• Feature creation
• Discretization and Binarization
• Attribute Transformation

Data & Data Preprocessing Chapter 02 / 41


Feature Subset Selection (1)
• Another way to reduce dimensionality of
data
• Redundant features
– duplicate much or all of the information contained in one or
more other attributes
– Example: purchase price of a product and the amount of
sales tax paid
• Irrelevant features
– contain no information that is useful for the data mining
task at hand
– Example: students' ID is often irrelevant to the task of
predicting students' GPA

Data & Data Preprocessing Chapter 02 / 42


Feature Subset Selection (2)
• Techniques:
– Brute-force approch:
• Try all possible feature subsets as input to data mining
algorithm
– Embedded approaches:
• Feature selection occurs naturally as part of the data mining
algorithm
– Filter approaches:
• Features are selected before data mining algorithm is run
– Wrapper approaches:
• Use the data mining algorithm as a black box to find best
subset of attributes

Data & Data Preprocessing Chapter 02 / 43


Data Preprocessing
• Aggregation
• Sampling
• Dimensionality Reduction
• Feature subset selection
• Feature creation
• Discretization and Binarization
• Attribute Transformation

Data & Data Preprocessing Chapter 02 / 44


Feature Creation
• Create new attributes that can capture the
important information in a data set much
more efficiently than the original attributes
• Three general methodologies:
– Feature Extraction
• domain-specific
– Mapping Data to New Space
– Feature Construction
• combining features

Data & Data Preprocessing Chapter 02 / 45


Mapping Data to a New Space
• Fourier transform
• Wavelet transform

Two Sine Waves Two Sine Waves + Noise Frequency

Data & Data Preprocessing Chapter 02 / 46


Data Preprocessing
• Aggregation
• Sampling
• Dimensionality Reduction
• Feature subset selection
• Feature creation
• Discretization and Binarization
• Attribute Transformation

Data & Data Preprocessing Chapter 02 / 47


Discretization Using Class Labels
• Entropy based approach

3 categories for both x and y 5 categories for both x and y

Data & Data Preprocessing Chapter 02 / 48


Discretization Without Using Class Labels

Data Equal interval width

Equal frequency K-means

Data & Data Preprocessing Chapter 02 / 49


Data Preprocessing
• Aggregation
• Sampling
• Dimensionality Reduction
• Feature subset selection
• Feature creation
• Discretization and Binarization
• Attribute Transformation

Data & Data Preprocessing Chapter 02 / 50


Attribute Transformation
• A function that maps the entire set of values of a
given attribute to a new set of replacement values
such that each old value can be identified with one
of the new values
– Simple functions: xk, log(x), ex, |x|
– Standardization and Normalization

Data & Data Preprocessing Chapter 02 / 51


Similarity and Dissimilarity
• Similarity
– Numerical measure of how alike two data objects are.
– Is higher when objects are more alike.
– Often falls in the range [0,1]
• Dissimilarity
– Numerical measure of how different are two data objects
– Lower when objects are more alike
– Minimum dissimilarity is often 0
– Upper limit varies
• Proximity refers to a similarity or dissimilarity

Data & Data Preprocessing Chapter 02 / 52


Similarity/Dissimilarity for Simple Attributes
p and q are the attribute values for two data objects.

Data & Data Preprocessing Chapter 02 / 53


Euclidean Distance (1)
• Euclidean Distance

n 2
dist = ∑ ( pk − qk )
k =1
Where n is the number of dimensions (attributes) and pk and qk
are, respectively, the kth attributes (components) or data objects
p and q.

• Standardization is necessary, if scales differ.

Data & Data Preprocessing Chapter 02 / 54


Euclidean Distance (2)
3
point x y
2 p1
p1 0 2
p3 p4
p2 2 0
1
p2 p3 3 1
0 p4 5 1
0 1 2 3 4 5 6

p1 p2 p3 p4
p1 0 2.828 3.162 5.099
p2 2.828 0 1.414 3.162
p3 3.162 1.414 0 2
p4 5.099 3.162 2 0

Distance Matrix

Data & Data Preprocessing Chapter 02 / 55


Minkowski Distance (1)
• Minkowski Distance is a generalization of Euclidean
Distance
1
n r r
dist = ( ∑ | pk − qk |)
k =1
Where r is a parameter, n is the number of dimensions
(attributes) and pk and qk are, respectively, the kth
attributes (components) or data objects p and q.

Data & Data Preprocessing Chapter 02 / 56


Minkowski Distance: Examples
• r = 1. City block (Manhattan, taxicab, L1 norm) distance.
– A common example of this is the Hamming distance, which is just the
number of bits that are different between two binary vectors

• r = 2. Euclidean distance

• r → ∞. “supremum” (Lmax norm, L∞ norm) distance.


– This is the maximum difference between any component of the vectors

Do not confuse r with n, i.e., all these distances are defined


for all numbers of dimensions.

Data & Data Preprocessing Chapter 02 / 57


Minkowski Distance (2)
L1 p1 p2 p3 p4
p1 0 4 4 6
p2 4 0 2 4
p3 4 2 0 2
p4 6 4 2 0
point x y
p1 0 2 L2 p1 p2 p3 p4
p2 2 0 p1 0 2.828 3.162 5.099
p3 3 1 p2 2.828 0 1.414 3.162
p4 5 1 p3 3.162 1.414 0 2
p4 5.099 3.162 2 0

L∞ p1 p2 p3 p4
p1 0 2 3 5
p2 2 0 1 3
p3 3 1 0 2
p4 5 3 2 0

Distance Matrix
Data & Data Preprocessing Chapter 02 / 58
Mahalanobis Distance (1)
mahalanobis( p, q) = ( p − q) ∑ −1 ( p − q)T

• Σ is the covariance matrix


of the input data X

1 n
Σ j ,k = ∑ ( X ij − X j )( X ik − X k )
n − 1 i =1

• For red points, the


Euclidean distance is 14.7,
Mahalanobis distance is 6.

Data & Data Preprocessing Chapter 02 / 59


Mahalanobis Distance (1)
Covariance Matrix:

 0.3 0.2
Σ= 
 0 . 2 0 .3
C

B A: (0.5, 0.5)
B: (0, 1)
A C: (1.5, 1.5)

Mahal(A,B) = 5
Mahal(A,C) = 4

Data & Data Preprocessing Chapter 02 / 60


Common Properties of a Distance (1)
• Distances, such as the Euclidean distance,
have some well known properties.
1. d(p, q) ≥ 0 for all p and q and d(p, q) = 0 only if p = q.
(Positive definiteness)
2. d(p, q) = d(q, p) for all p and q. (Symmetry)
3. d(p, r) ≤ d(p, q) + d(q, r) for all points p, q, and r.
(Triangle Inequality)
where d(p, q) is the distance (dissimilarity) between
points (data objects), p and q.

• A distance that satisfies these properties is


a metric

Data & Data Preprocessing Chapter 02 / 61


Common Properties of a Similarity (2)

• Similarities, also have some well known


properties.
1. s(p, q) = 1 (or maximum similarity) only if p = q.

2. s(p, q) = s(q, p) for all p and q. (Symmetry)

where s(p, q) is the similarity between points (data


objects), p and q.

Data & Data Preprocessing Chapter 02 / 62


Similarity Between Binary Vectors
• Common situation is that objects, p and q, have only
binary attributes
• Compute similarities using the following quantities
M01 = the number of attributes where p was 0 and q was 1
M10 = the number of attributes where p was 1 and q was 0
M00 = the number of attributes where p was 0 and q was 0
M11 = the number of attributes where p was 1 and q was 1

• Simple Matching and Jaccard Coefficients


SMC = number of matches / number of attributes
= (M11 + M00) / (M01 + M10 + M11 + M00)

J = number of 11 matches / number of not-both-zero attributes values


= (M11) / (M01 + M10 + M11)

Data & Data Preprocessing Chapter 02 / 63


SMC versus Jaccard: Example
p= 1000000000
q= 0000001001

M01 = 2 (the number of attributes where p was 0 and q was 1)


M10 = 1 (the number of attributes where p was 1 and q was 0)
M00 = 7 (the number of attributes where p was 0 and q was 0)
M11 = 0 (the number of attributes where p was 1 and q was 1)

SMC = (M11 + M00)/(M01 + M10 + M11 + M00) = (0+7) / (2+1+0+7) =


0.7

J = (M11) / (M01 + M10 + M11) = 0 / (2 + 1 + 0) = 0

Data & Data Preprocessing Chapter 02 / 64


Cosine Similarity
• If d1 and d2 are two document vectors, then
cos( d1, d2 ) = (d1 • d2) / ||d1|| ||d2|| ,
where • indicates vector dot product and || d || is the length of vector d.

• Example:
d1 = 3 2 0 5 0 0 0 2 0 0
d2 = 1 0 0 0 0 0 0 1 0 2

d1 • d2= 3*1 + 2*0 + 0*0 + 5*0 + 0*0 + 0*0 + 0*0 + 2*1 + 0*0 + 0*2 = 5
||d1|| = (3*3+2*2+0*0+5*5+0*0+0*0+0*0+2*2+0*0+0*0)0.5 = (42) 0.5 = 6.481
||d2|| = (1*1+0*0+0*0+0*0+0*0+0*0+0*0+1*1+0*0+2*2) 0.5 = (6) 0.5 = 2.245

cos( d1, d2 ) = .3150

Data & Data Preprocessing Chapter 02 / 65


Extended Jaccard Coefficient
(Tanimoto)

• Variation of Jaccard for continuous or count


attributes
– Reduces to Jaccard for binary attributes

Data & Data Preprocessing Chapter 02 / 66


Correlation
• Correlation measures the linear relationship
between objects
• To compute correlation, we standardize data
objects, p and q, and then take their dot product

Data & Data Preprocessing Chapter 02 / 67


Visually Evaluating Correlation

Scatter plots
showing the
similarity from
–1 to 1.

Data & Data Preprocessing Chapter 02 / 68


General Approach for Combining Similarities
• Sometimes attributes are of many different
types, but an overall similarity is needed.

Data & Data Preprocessing Chapter 02 / 69


Using Weights to Combine Similarities
• May not want to treat all attributes the same.
– Use weights wk which are between 0 and 1 and
sum to 1.

Data & Data Preprocessing Chapter 02 / 70


Density
• Density-based clustering require a notion
of density
• Examples:
– Euclidean density
• Euclidean density = number of points per unit
volume
– Probability density
– Graph-based density

Data & Data Preprocessing Chapter 02 / 71


Euclidean Density – Cell-based (1)
• Simplest approach is to divide region into a number of
rectangular cells of equal volume and define density as
the number of points the cell contains

Data & Data Preprocessing Chapter 02 / 72


Euclidean Density – Center-Based (2)
• Euclidean density is the number of points within
a specified radius of the point

Data & Data Preprocessing Chapter 02 / 73


End of Chapter 2

You might also like