TYPE Original Research

PUBLISHED 21 February 2023

DOI 10.3389/fbioe.2023.1114946

Exploring Class I
OPEN ACCESS polyhydroxyalkanoate synthases
EDITED BY
Kumar Sudesh,
University of Science Malaysia (USM),
with broad substrate specificity for
Malaysia

REVIEWED BY
polymerization of structurally
Maciej Guzik,
Jerzy Haber Institute of Catalysis and
Surface Chemistry, Polish Academy of
diverse monomer units
Sciences, Poland
Christopher John Brigham, Ramamoorthi M Sivashankari 1, Maierwufu Mierzati 1,
Wentworth Institute of Technology,
United States Yuki Miyahara 1, Shoji Mizuno 1, Christopher T. Nomura 2,
*CORRESPONDENCE Seiichi Taguchi 3, Hideki Abe 4 and Takeharu Tsuge 1*
Takeharu Tsuge,
1
tsuge.t.aa@m.titech.ac.jp Department of Materials Science and Engineering, Tokyo Institute of Technology, Yokohama, Japan,
2
Department of Biological Sciences, College of Science, University of Idaho, Moscow, ID, United States,
SPECIALTY SECTION 3
Graduate School of Science, Technology and Innovation, Kobe University, Kobe, Japan, 4Bioplastic
This article was submitted to Research Team, RIKEN Center for Sustainable Resource Science, Wako, Japan
Industrial Biotechnology,
a section of the journal
Frontiers in Bioengineering
and Biotechnology

RECEIVED 03 December 2022 Polyhydroxyalkanoate (PHA) synthases (PhaCs) are key enzymes in PHA
ACCEPTED 06 February 2023 polymerization. PhaCs with broad substrate specificity are attractive for
PUBLISHED 21 February 2023
synthesizing structurally diverse PHAs. In the PHA family, 3-hydroxybutyrate
CITATION (3HB)-based copolymers are industrially produced using Class I PhaCs and can
Sivashankari RM, Mierzati M, Miyahara Y,
Mizuno S, Nomura CT, Taguchi S, Abe H
be used as practical biodegradable thermoplastics. However, Class I PhaCs with
and Tsuge T (2023), Exploring Class I broad substrate specificities are scarce, prompting our search for novel PhaCs. In
polyhydroxyalkanoate synthases with this study, four new PhaCs from the bacteria Ferrimonas marina, Plesiomonas
broad substrate specificity for
polymerization of structurally diverse
shigelloides, Shewanella pealeana, and Vibrio metschnikovii were selected via a
monomer units. homology search against the GenBank database, using the amino acid sequence
Front. Bioeng. Biotechnol. 11:1114946. of Aeromonas caviae PHA synthase (PhaCAc), a Class I enzyme with a wide range of
doi: 10.3389/fbioe.2023.1114946
substrate specificities, as a template. The four PhaCs were characterized in terms
COPYRIGHT of their polymerization ability and substrate specificity, using Escherichia coli as a
© 2023 Sivashankari, Mierzati, Miyahara,
Mizuno, Nomura, Taguchi, Abe and host for PHA production. All the new PhaCs were able to synthesize P(3HB) in
Tsuge. This is an open-access article E. coli with a high molecular weight, surpassing PhaCAc. The substrate specificity
distributed under the terms of the of PhaCs was evaluated by synthesizing 3HB-based copolymers with 3-
Creative Commons Attribution License
(CC BY). The use, distribution or hydroxyhexanoate, 3-hydroxy-4-methylvalerate, 3-hydroxy-2-methylbutyrate,
reproduction in other forums is and 3-hydroxypivalate monomers. Interestingly, PhaC from P. shigelloides
permitted, provided the original author(s) (PhaCPs) exhibited relatively broad substrate specificity. PhaCPs was further
and the copyright owner(s) are credited
and that the original publication in this engineered through site-directed mutagenesis, and the variant resulted in an
journal is cited, in accordance with enzyme with improved polymerization ability and substrate specificity.
accepted academic practice. No use,
distribution or reproduction is permitted
which does not comply with these terms. KEYWORDS

PHA synthases, broad substrate specificities, molecular weight, blast, copolymer

Introduction
The bacterial polyesters polyhydroxyalkanoates (PHAs) are considered excellent bio-
based plastics and have been demonstrated to be biodegradable in various environments
such as compost, soil, freshwater, and marine water (Suzuki et al., 2021). A myriad of
microorganisms can synthesize PHA as an intracellular carbon and energy reserve under
stressful conditions (Anderson and Dawes, 1990). Poly[(R)-3-hydroxybutyrate], P(3HB), is a

Frontiers in Bioengineering and Biotechnology 01 frontiersin.org

Sivashankari et al. 10.3389/fbioe.2023.1114946

major member of the PHA family and has been extensively studied enzymes can be possibly due to their different structures (Chek et al.,
since its discovery in 1926 (Lenz and Marchessault, 2005). Despite 2019). Although the crystal structure of PhaCAc has not yet been
these merits, it is still challenging for PHA to compete with solved, a basic understanding of the enzymatic capability of PhaCAc
petroleum-based plastics because of the inherent flaws in P(3HB). could be elucidated using in silico homology modeling (Harada et al.,
The poor material properties of P(3HB) (Lehrle and Williams, 1994) 2021). Additionally, the use of structural information, namely the
such as its high crystallinity and narrow processing temperature comparison of the amino acid residues that constitute the substrate-
window have greatly hampered the entry of this polymer into the binding pocket of PhaCs, led to the generation of further engineered
commercial world. Fortunately, 3HB-based copolymers (Tsuge PhaCAcs (Harada et al., 2021).
et al., 2005; Mizuno et al., 2010; Mierzati et al., 2020; Furutate PhaCAc and its PhaCAcNSDG variant are biocatalysts that
et al., 2021) have been proven to overcome the material property produce PHA polymers with desirable material properties;
limitations of P(3HB) to a certain extent, and have been used as a however, the number of other naturally occurring PhaCs with
remedy for problems related to plastics (Sivashankari and Tsuge, broad substrate specificities are limited, hindering the
2021). development and commercial mass production of desirable
PHA synthases are key enzymes involved in PHA PHAs. Thus, it is necessary to identify other novel PhaCs with
polymerization (Sudesh et al., 2000). Based on the substrate broad substrate specificities to enable industrial-scale production of
specificities and subunit compositions of PHA synthases, they are PHA copolymers to completely replace petroleum-based plastics.
categorized into four classes (Rehm, 2003). Class I and II PHA PhaCs, which can synthesize high-molecular-weight PHA, is
synthases are homodimers of the PhaC subunits. Class I PHA essential to produce PHA as practical materials. The currently
synthases, represented by the Ralstonia eutropha enzyme, mainly available PhaCAc is highly sensitive to ethanol (Hiroe et al.,
polymerize short chain length (scl)-monomers (C3-C5), whereas 2015), which is a metabolite of some bacteria, including
Class II PHA synthases, represented by the Pseudomonas aeruginosa Escherichia coli, and functions as a chain transfer agent to
and Pseudomonas putida enzymes, polymerize medium chain length terminate polymerization reactions (Tsuge, 2016), resulting in the
(mcl)-monomers (C6-C14). Class III PHA synthases such as synthesis of relatively low-molecular-weight PHA when using E. coli
Allochromatium vinosum and Synechocystis sp. PCC as a production host. These low-molecular-weight PHA polymers
6803 consists of two heterosubunits (PhaC and PhaE). Class IV have less desirable physical properties than their high-molecular-
PHA synthases, represented by Bacillus megaterium and Bacillus weight counterparts. Despite the unique ability of PhaCAc to
cereus, are similar to Class III PHA synthases and possess two polymerize various monomers, the relatively low molecular
subunits (PhaC and PhaR). Similar to Class I synthases, Class III and weight of PHA produced in recombinant E. coli using this
IV PHA synthases preferentially polymerize scl-monomers (C3-C5). enzyme has room for improvement.
PhaCs with broad substrate specificities are attractive In this study, to explore novel PhaCs with high polymerization
biocatalysts for PHA synthesis because they can naturally ability and broad substrate specificity, four new PhaCs were
copolymerize different monomers to produce polymers with identified by a bioinformatics approach using the PhaCAc amino
desirable physical properties. PhaC from Aeromonas caviae acid sequence as a template for a basic local alignment search tool
(PhaCAc) can naturally synthesize poly(3HB-co-3- (BLAST) and included PhaCs from the bacteria Ferrimonas marina,
hydroxyhexanoate) [P(3HB-co-3HHx)] from vegetable oils and Plesiomonas shigelloides, Shewanella pealeana, and Vibrio
fatty acids (Kobayashi et al., 1994; Shimamura et al., 1994; Doi metschnikovii. PhaC proteins were individually expressed in
et al., 1995; Tsuge et al., 2007a; Tsuge, 2016), distinguishing it from E. coli LSBJ to synthesize P(3HB) and 3HB-based copolymers
other Class I PhaCs because it exhibits polymerization activities containing 3HHx, 3H4MV, 3H2MB, and 3-hydroxypivalate
toward 3HB monomers and mcl 3HHx monomers (Kobayashi et al., (3HPi) units. Furthermore, the effects of mutagenesis on
1994). Therefore, PhaCAc is a marketable biocatalyst to produce polymerization activity and substrate specificity in the highest-
P(3HB-co-3HHx) copolymers. The potential of PhaCAc has been performing PhaC enzyme were investigated.
fortified through evolutionary engineering with the development of
the PhaCAcNSDG variant (Tsuge et al., 2007b). The PhaCAcNSDG
variant has amino acid substitutions of asparagine 149 by serine Materials and methods
(N149S) and aspartate 171 by glycine (D171G) and was shown to
have the ability to synthesize the P(3HB-co-3HHx) copolymer with Bioinformatic analysis
an enhanced 3HHx fraction compared to the wild-type enzyme, as
well as recognize and incorporate other monomer units, such as 3- A BLAST-protein (BLASTP) search was performed against the
hydroxy-4-methylvalerate (3H4MV) (Tanadchangsaeng et al., 2009) protein sub-sections of the National Center for Biotechnology
and 3-hydroxy-2-methylbutyrate (3H2MB) (Watanabe et al., 2015). Information (NCBI) and DNA Data Bank of Japan (DDBJ)
In addition, the molecular weight of P(3HB) synthesized by databases using the PhaCAc amino sequence as a template
PhaCAcNSDG was higher than that of the wild-type enzyme (Accession No. BAA21815) (Altschul et al., 1990). PhaCs with
(Tsuge et al., 2007b). These properties of PhaCAcNSDG variant more than 85% similarity index and an identity index of 50%–
are desirable for the development of PHA as an industrial 60% in the BLASTP search were targeted as potential PhaCs with
biomaterial, making it a promising biocatalyst. broad substrate specificities. Among the various PhaCs from
The partial crystal structures for several PhaCs have been solved different organisms that satisfied the criteria in the BLASTP
(Wittenborn et al., 2016; Chek et al., 2017; Kim et al., 2017; Chek search, four PhaCs were selected based on the diversity of the
et al., 2020). The differences in the catalytic properties of these N-terminal region for further evaluation. Phylogenetic analyses

Frontiers in Bioengineering and Biotechnology 02 frontiersin.org

Sivashankari et al. 10.3389/fbioe.2023.1114946

were performed using the maximum likelihood method in MEGA11 added at the beginning of the culture at 30°C for 72 h. For the
(Tamura et al., 2021) and the protein sequences were aligned using synthesis of 3HB-based copolymers, the total incubation time was
ClustalW. This analysis involved six amino acid sequences: PhaCAc, set to 76 h, in which an initial step for 4 h at 30°C with reciprocal
four newly selected PhaCs from BLASTP, and PhaC from Ralstonia shaking (130 rpm) was performed before the addition of IPTG,
eutropha (WP_011615085) as an outgroup. precursors, and glucose, and further cultured for 72 h. Hexanoic
acid, 4-methylvaleric acid, trans-2-methylbut-2-enoic acid (tiglic
acid), and 2,2-dimethyl-3-hydroxypropionic acid (3-hydroxypivalic
Bacterial strain and plasmid acid), which had previously been converted to their respective
sodium salts, were used as precursors for the 3HHx, 3H4MV,
Four PhaC amino acid sequences were chosen based on the 3H2MB, and 3HPi units, respectively (Füchtenbusch et al., 1998;
BLASTP search results. These phaC genes were chemically Tanadchangsaeng et al., 2009; Watanabe et al., 2015). These
synthesized with optimized codon usage in E. coli by Eurofins precursors are known to inhibit cell growth, and a high
Genomics Co. Ltd. (Tokyo, Japan) for plasmid construction and concentration of glucose can repress phaJ and pct genes,
evaluation. E. coli LSBJ, a fadB fadJ double-deletion strain of E. coli otherwise induced by IPTG. Thus, lower concentrations of
LS5218 [fadR601, atoC (Con)] (Tappel et al., 2012a), was used as the glucose and the precursors were added intermittently to the
host strain for PHA biosynthesis. This strain is an ideal host for non- culture medium (at 4, 28, and 52 h). A total of 7.5 g/L glucose
native PHA production because of its ability to take up a wide variety (2.5 g/L each time) and 0.6 g/L precursors (0.2 g/L each time) were
of substrates to be incorporated into PHA homo- and copolymers, added throughout the main incubation period. Finally, cells were
and bench-level scale-up methodologies available for overall harvested by centrifugation and lyophilized for further analysis. The
production (Tappel et al., 2012b; Levine et al., 2016; Pinto et al., relationship between the precursors used and biosynthesized
2016; Fadzil et al., 2018; Furutate et al., 2021; Scheel et al., 2021). A polymers is shown in Figure 1.
broad-host-range plasmid pBBR1MCS-2 (Kovach et al., 1995)
harboring the genes encoding the PhaCs to be evaluated, the lac
promoter region, the (R)-specific enoyl-CoA hydratase gene from A. Site-directed mutagenesis
caviae (phaJAc), the 3-ketothiolase gene (phaA) from Ralstonia
eutropha H16, and the acetoacetyl-CoA reductase gene (phaB) To construct mutated phaCPs, a substitution (N175G) was
from R. eutropha H16, termed pBBR1-phaCsABReJAc, was used introduced into the gene by overlap extension PCR (Supplementary
for the expression of PhaCs (Supplementary Figure S1). For Figure S2) (Warrens et al., 1997). The primers for amino acid
phaAB expression, the R. eutropha pha promoter and terminator substitution were designed and chemically synthesized as follows:5′-
regions were located upstream and downstream of their genes, GGCGGCCGCTCTAGAACTAGTGGATCCCGGGGCAA-3′ and
respectively. To enhance the supply of 3HHx, 3H4MV, and 5′- CACTAAGTTTTGACCGCCGTTCTCCAAGGT-3′ for an
3H2MB monomers, the plasmid pTTQ-PCT (Furutate et al., amplification of the 1.4-kb fragment, 5′-GCGCTTGGAGGCCGG
2017) containing the propionyl-CoA transferase (PCT) gene from CACCG-3′ and 5′- GTGACCTTGGAGAACGGCGGTCAAAAC
Megasphaera elsdenii (pct) (Taguchi et al., 2008) was introduced into TTA-3′ for an amplification of the 2.3-kb fragment. The underlined
the E. coli LSBJ strain (Supplementary Figure S1). sequence in the primer indicates the codon used to replace Asn175
(AAT) with Gly (GGC). The resulting plasmid carrying the mutated
gene was introduced into E. coli LSBJ along with pTTQ-PCT for PHA
Cell culture conditions biosynthesis analysis.

Initially, recombinant E. coli LSBJ was incubated overnight at

37°C with reciprocal shaking (160 rpm) in a 50 mL baffle flask Analysis of PHA
containing 20 mL of lysogeny broth (LB) medium as a seed
culture. The LB medium contained 10 g/L Bacto-tryptone (Difco The dry cell weight was gravimetrically measured after
Laboratories, Detroit, MI, United States), 5 g/L Bacto-yeast extract centrifuging the culture medium at 6,000 × g for 10 min at room
(Difco Laboratories), and 10 g/L NaCl. For plasmid maintenance temperature three times (once for collecting the cells, discarding the
throughout the initial incubation period, 50 mg/L of kanamycin and medium, and twice to wash away the remaining salts with water) and
50 mg/L of carbenicillin were added. lyophilized for approximately 3 days.
Inoculations for PHA production were started with 5 mL of seed PHA content, PHA yield, and 3HA monomer composition were
culture added to 500 mL shake flasks containing 95 mL of modified determined by gas chromatography (GC) using a Shimadzu GC-
M9 medium (Furutate et al., 2021) (final volume:100 mL and 5% 2014s instrument (Shimadzu, Kyoto, Japan) with a flame ionization
inoculum). The modified M9 medium comprised of 17.1 g/L detector. Lyophilized cells were methanolyzed to convert PHA into
Na2HPO4·12H2O, 3 g/L KH2PO4, 0.5 g/L NaCl, 2 mL of 1 M 3HA-methyl ester constituents in the presence of 15% sulfuric acid
MgSO4·7H2O, 0.1 mL of 1 M CaCl2, and 2.5 g/L Bacto-yeast for GC analysis. The methanolysis reaction was carried out at 100°C
extract. For plasmid maintenance during PHA production, for 140 min, except for 3H2MB- and 3HPi-containing polymers, for
50 mg/L of kanamycin and 50 mg/L of carbenicillin were added. which the reaction time was set to 8 h to increase the reaction yield.
Additionally, 1 mM isopropyl-β-D-thiogalactopyranoside (IPTG) The methanolyzed samples were allowed to cool to room
was used to induce phaJ and pct gene expression. The P(3HB) temperature, and 1 mL of deionized water was added to separate
homopolymer was synthesized from 20 g/L glucose, which was the polar components from the non-polar components. The non-

Frontiers in Bioengineering and Biotechnology 03 frontiersin.org

Sivashankari et al. 10.3389/fbioe.2023.1114946

FIGURE 1
Chemical structure of PHA copolymers and precursors.

polar fraction containing 3HA-methyl ester was filtered, and an Henderson 1947; Janda et al., 2016), Shewanella pealeana
equal volume of chloroform solution containing 0.1% (w/v) methyl- (Leonardo et al., 1999), and Vibrio metschnikovii (Lee et al.,
n-octanoate as an internal standard was added to prepare the final 1978) were selected for further evaluation, because of the
sample for GC analysis. The samples were injected through the GC diversity of the N-terminal region such as positions 149 and
capillary column InertCap 1 (30 m × 0.25 mm, GL Science, Tokyo, 171 in PhaCAc. These PhaCs were identified as Class I PHA
Japan). The column temperature was initially set at 90°C for 2 min, synthases, which have a high potential for synthesizing scl-mcl
increased to 110°C at a rate of 5°C/min, and then increased to 280°C PHA copolymers in a manner similar to PhaCAc, based on their
at a rate of 20°C/min. The signal peak areas obtained were calculated homology. Although these bacteria were discovered long ago, their
for the total PHA content and 3HA monomer composition. ability to produce PHA has not yet been studied.
The molecular weight of P(3HB) synthesized using various A comparison with the amino acid sequence of PhaCAc
PhaC enzymes was determined by gel permeation revealed that the four PhaC enzymes identified in this study
chromatography (GPC) using a Shimadzu Nexera GPC system shared 85%–91% similarity and approximately 55% identity
with an RI-504 refractive index detector (Shodex, Tokyo, Japan) with PhaCAc (Table 1). Multiple sequence alignment of PhaCs
equipped with two KF-406 LHQ joint-columns (at 40°C, Shodex, is shown in Figure 2. All new PhaCs have a PhaC box sequence at
Tokyo, Japan). Chloroform was used as the mobile phase at a flow the active site, which is typically described as G-X-C-X-G-G
rate of 0.3 mL/min. The sample concentration and injection volume (where X is an arbitrary amino acid), and cysteine (Cys319 in
were set at 1 mg/mL and 10 μL, respectively. Polystyrene standards PhaCAc) is the active center (Nambu et al., 2020). In PhaCAc,
with low polydispersity were also analyzed as reference standards to the active sites Cys319, Asp475, and His503 have been proposed to
construct a calibration curve. form a catalytic triad (Tsuge et al., 2007a), which are all conserved
in the newly identified PhaC enzymes. In contrast, PhaC from P.
shigelloides has a primary sequence of approximately 30 amino
Results and discussion acid residues greater than that of others and exhibits relatively low
sequence homology in the C-terminal region. The phylogenetic
Identification of new PhaC enzymes using tree shown in Figure 3 indicates that PhaC from F. marina is
BLAST closely related to PhaCAc, whereas PhaC enzymes from S. pealeana
and V. metchniskovii are evolutionarily distinct. PhaC from P.
A BLASTP search was performed against the protein sub- shigelloides is neither closely related nor evolutionarily distant
sections of the NCBI and DDBJ databases using the amino acid from PhaCAc. To the best of our knowledge, no study has explored
sequence of PhaCAc, the first enzyme characterized by the natural PhaC enzymes isolated from these bacteria for PHA production.
copolymerization of 3HB and 3HHx monomers to PHA Thus, genes encoding the four PhaC enzymes were chemically
copolymers. Four PhaCs from the bacteria Ferrimonas marina synthesized with optimized codon usage in E. coli. The DNA
(Katsuta et al., 2005), Plesiomonas shigelloides (Ferguson and sequences are included in Supplementary Information.

Frontiers in Bioengineering and Biotechnology 04 frontiersin.org

Sivashankari et al. 10.3389/fbioe.2023.1114946

TABLE 1 Four PhaCs characterized in this study.

PhaC from Abbreviation Accession Protein size (amino acids) Homology to PhaCAc

Identity Similarity
Ferrimonas marina PhaCFm WP_067661665 592 58% (341/585) 91% (534/585)

Plesiomonas shigelloides PhaCPs WP_116546999 623 54% (324/595) 86% (512/595)

Shewanella pealeana PhaCSp WP_012154995 584 53% (303/564) 88% (499/564)

Vibrio metschnikovii PhaCVm WP_154168902 590 52% (306/580) 85% (494/580)

PhaCAc: PhaC from Aeromonas caviae (Accession BAA21815) with a protein size of 594 aa.

FIGURE 2
Multiple sequence alignment of PHA synthases (PhaCs) from Aeromonas caviae, Ferrimonas marina, Plesiomonas shigelloides, Shewanella
pealeana, and Vibrio metschnikovii. The active site residues of PhaCAc, cysteine (C319), aspartic acid (D475), and histidine (H503) are highlighted in blue. For
the PhaCAcNSDG variant, the positions of two amino acid substitutions (N149 replaced with S and D171 replaced with G) are highlighted in orange.

FIGURE 3
A phylogenetic tree of PhaCs rooted by outgroup (PhaC from Ralstonia eutrophus, WP_011615085). Sequences were aligned using ClustalW, and
the phylogenetic tree was generated using MEGA11 software. PhaCs from Aeromonas caviae (BAA21815), Ferrimonas marina (WP_067661665),
Plesiomonas shigelloides (WP_116546999), Shewanella pealeana (WP_012154995), and Vibrio metschnikovii (WP_154168902) were used. Bootstrap
values (expressed as percentages of 1,000 replications) are shown at the branch points. Scale bar = 0.2 substitution per amino acid position.

Frontiers in Bioengineering and Biotechnology 05 frontiersin.org

Sivashankari et al. 10.3389/fbioe.2023.1114946

TABLE 2 Biosynthesis of P(3HB) from glucose by E. coli LSBJ expressing various PhaCs.

PhaC Dry cell wt. (g/L) P(3HB) content (wt%) P(3HB) yield (g/L) Molecular weight

Mw (×105) PDI
A. caviae 2.66 ± 0.02 39.8 ± 1.4 1.06 ± 0.04 8.5 ± 0.4 2.58 ± 0.36

A. caviae 3.83 ± 0.04 60.1 ± 4.3 2.30 ± 0.15 13.2 ± 0.5 2.45 ± 0.17
NSDG variant

F. marina 2.77 ± 0.04 42.3 ± 1.1 1.17 ± 0.04 24.0 ± 3.0 1.39 ± 0.12

P. shigelloides 3.31 ± 0.02 54.2 ± 1.0 1.80 ± 0.03 34.4 ± 2.7 1.46 ± 0.13

P. shigelloides 3.59 ± 0.07 63.5 ± 1.4 2.28 ± 0.07 31.8 ± 5.9 1.37 ± 0.04
NG variant

S. pealeana 2.39 ± 0.02 38.4 ± 5.0 0.92 ± 0.13 22.6 ± 1.6 1.54 ± 0.25

V. metschnikovii 3.08 ± 0.10 49.0 ± 2.2 1.51 ± 0.12 19.7 ± 1.5 2.62 ± 0.10

E. coli LSBJ harboring pBBR1-phaCsABReJAc was incubated in the modified M9 medium containing 20 g/L glucose as a carbon source. The values of dry cell weight, PHA content, and molecular
weight were the averages of three independent experiments. P(3HB): poly(3-hydroxybutyrate). The NSDG variant of A. caviae PhaC had a double mutation of N149S and D171G. The NG
variant of P. shigelloides PhaC had a single mutation of N175G. PDI is polydispersity index (Mw/Mn).

P(3HB) synthesis in recombinant E. coli values compared with PhaCAc and its NSDG variant, which could
expressing PhaC enzymes benefit PHA processing and material properties.

The biosynthesis of P(3HB) from 20 g/L glucose using one of

the four PhaC enzymes is summarized in Table 2. P(3HB) PHA copolymer synthesis by recombinant
accumulation ranging from 38.4 wt% to 54.2 wt% was achieved E. coli expressing PhaC enzymes
using the new PhaC enzymes, which was comparable to PhaCAc
and its variant PhaCAcNSDG. Thus, all newly identified PhaC The new PhaC enzymes were evaluated for their substrate
enzymes showed great potential as biocatalysts for P(3HB) specificities alongside PhaCAc and its NSDG variant for
production. However, PhaCs from P. shigelloides (PhaCPs) incorporating 3HHx, 3H4MV, 3H2MB, and 3HPi monomers.
showed the highest P(3HB) accumulation among the wild-type Biosynthesis was performed using four precursors (hexanoic acid, 4-
PhaCs tested. methylvaleric acid, tiglic acid, and 3-hydroxypivalic acid) in the
The molecular weight is a crucial aspect in determining the presence of glucose (Figure 1). These precursors are toxic to cells,
suitability of a material for various commercial uses (Sudesh et al., thus inhibiting cell growth and subsequently lowering PHA
2000). The weight-average molecular weight (Mw) is more closely accumulation in bacteria. As PHA production is associated with cell
related to material properties than the number-average molecular growth (Sudesh et al., 2000), it is imperative to eliminate or reduce the
weight (Mn). For PHA, ultrahigh molecular weight polymers can risk of toxicity induced by such precursors. Therefore, the precursors
form strong fibers (Tsuge, 2016), thus meeting the requirements were introduced into the culture medium after 4 h, once substantial cell
for practical use. In addition, a low polydispersity index (PDI) growth was achieved, mainly for better tolerance (Furutate et al., 2021).
(Tsuge, 2016) also plays a significant role in determining the Meanwhile, a high glucose concentration can cause catabolic repression
suitability of PHA for specific applications. However, not all PhaC of phaJ and pct genes induced by IPTG (Furutate et al., 2021); thus, the
enzymes can synthesize PHAs with high Mw and low PDI. In this glucose concentration was maintained at a minimum to promote cell
study, PhaCPs synthesized P(3HB) with an ultrahigh Mw, which growth only. Glucose and its precursors were intermittently added to
exceeded 3 × 106, with a relatively low PDI below 1.5 (Table 2). allow for better uptake of the second monomer, with no or fewer
Moreover, the other two identified PhaC enzymes from F. marina unanticipated effects on the cells. The details of the biosynthesis results
and S. pealeana could also synthesize P(3HB) with Mw of are summarized in Tables 3–6.
approximately 2 × 106 with PDIs ranging from 1.3 to 1.5. All PhaCs, except PhaC from S. pealeana (PhaCSp), were able to
PhaCVm from V. metschnikovii proved to be an exception, with incorporate all targeted monomers (3HHx, 3H4MV, 3H2MB, and
PDI >2.5. The currently available PhaCAc is highly sensitive to 3HPi). PhaCSp copolymerized 3HB with 3HHx or 3HPi, but not
ethanol (Hiroe et al., 2015), which is a metabolite of some bacteria, 3H4MV or 3H2MB. The number of PhaC enzymes with broad
including E. coli, and functions as a chain transfer agent to substrate specificity is scarce; thus, the new PhaC enzymes reported
terminate polymerization reactions (Tsuge, 2016), resulting in in this study are highly intriguing for future studies. Furthermore, PHAs
the synthesis of relatively low-molecular-weight PHA. The new containing α-carbon methylated units are potentially attractive bio-
PhaCs reported in this study may be less sensitive toward ethanol, based materials (Füchtenbusch et al., 1998; Furutate et al., 2021); thus,
thereby producing PHA with high Mw and low PDI. These new PhaCs with the ability to polymerize 3H2MB and 3HPi are of great
PhaC enzymes, especially PhaCPs, exhibited superior Mw and PDI interest. PhaCPs demonstrated superior performance in the

Frontiers in Bioengineering and Biotechnology 06 frontiersin.org

Sivashankari et al. 10.3389/fbioe.2023.1114946

TABLE 3 Biosynthesis of P (3HB-co-3HHx) by E. coli LSBJ expressing various PhaCs from glucose and hexanoic acid.

PhaC Dry cell wt. (g/L) PHA content (wt%) PHA yield (g/L) PHA composition (mol%)

3HB 3HHx
A. caviae 1.93 ± 0.04 16.9 ± 0.8 0.30 ± 0.01 86.7 ± 0.8 13.3 ± 0.8

A. caviae 2.12 ± 0.02 25.2 ± 1.3 0.51 ± 0.03 78.2 ± 1.4 21.8 ± 1.4
NSDG variant

F. marina 1.92 ± 0.03 23.6 ± 1.2 0.45 ± 0.02 90.5 ± 1.0 9.5 ± 1.0

P. shigelloides 1.78 ± 0.04 19.1 ± 0.3 0.34 ± 0.01 89.1 ± 1.2 10.9 ± 1.2

P. shigelloides 1.80 ± 0.05 11.9 ± 0.7 0.21 ± 0.12 90.0 ± 0.2 10.0 ± 0.2
NG variant

S. pealeana 1.68 ± 0.06 12.2 ± 0.5 0.20 ± 0.01 89.5 ± 0.5 10.5 ± 0.5

V. metschnikovii 1.82 ± 0.01 18.7 ± 0.9 0.34 ± 0.02 96.0 ± 0.2 4.0 ± 0.2

E. coli LSBJ harboring pBBR1-phaCsABReJAc and pTTQ-PCT was incubated in the modified M9 containing 7.5 g/L glucose (2.5 g/L × 3 times) and 0.6 g/L hexanoic acid (0.2 g/L × 3 times),
which were added at 4, 28, and 52 h. The values of dry cell weight, PHA content, and PHA composition were the averages of three independent experiments. The NSDG variant of A. caviae
PhaC had a double mutation of N149S and D171G. The NG variant of P. shigelloides PhaC had a single mutation of N175G. 3HB: 3-hydroxybutyrate; 3HHx: 3-hydroxyhexanoate.

TABLE 4 Biosynthesis of P (3HB-co-3H4MV) by E. coli LSBJ expressing various PhaCs from glucose and 4-methylvaleric acid.

PhaC Dry cell wt. (g/L) PHA content (wt%) PHA yield (g/L) PHA composition (mol%)

3HB 3H4MV
A. caviae 1.66 ± 0.04 17.8 ± 1.2 0.30 ± 0.03 95.4 ± 0.3 4.6 ± 0.3

A. caviae 1.68 ± 0.01 18.0 ± 1.4 0.30 ± 0.02 93.7 ± 0.5 6.3 ± 0.5
NSDG variant

F. marina 1.92 ± 0.02 27.0 ± 2.9 0.52 ± 0.06 98.5 ± 0.1 1.5 ± 0.1

P. shigelloides 1.78 ± 0.03 20.9 ± 0.8 0.37 ± 0.01 97.5 ± 0.2 2.5 ± 0.2

P. shigelloides 1.86 ± 0.01 16.6 ± 4.9 0.31 ± 0.10 96.3 ± 0.1 3.7 ± 0.1
NG variant

S. pealeana 1.69 ± 0.01 18.4 ± 1.2 0.31 ± 0.02 100 ND

V. metschnikovii 1.85 ± 0.02 20.7 ± 2.1 0.38 ± 0.04 98.1 ± 0.4 1.9 ± 0.4

E. coli LSBJ harboring pBBR1-phaCsABReJAc and pTTQ-PCT was incubated in the modified M9 containing 7.5 g/L glucose (2.5 g/L × 3 times) and 0.6 g/L 4-methylvaleric acid (0.2 g/L ×
3 times), which were added at 4, 28, and 52 h. The values of dry cell weight, PHA content, and PHA composition were the averages of three independent experiments. The NSDG variant of A.
caviae PhaC had a double mutation of N149S and D171G. The NG variant of P. shigelloides PhaC had a single mutation of N175G. 3HB: 3-hydroxybutyrate; 3H4MV: 3-hydroxy-4-
methylvalerate.

polymerization of 3HPi to PhaCAc. Additionally, all PhaCPs-expressing production yield and substrate specificity) compared to that of
strains showed higher PHA content than PhaCAc-expressing strains. the wild-type enzyme (Tsuge et al., 2007b). In addition, various
Therefore, the potential of PhaCPs was further explored using site- studies have proven the efficacy of PhaC engineering in PHA
directed mutagenesis. production towards the formation of super biocatalysts for tailor-
made PHAs (Taguchi and Doi, 2004; Nomura and Taguchi,
2007). Therefore, PhaCPs, which exhibited the best
Generation and evaluation of PhaCPsNG performance among the new PhaCs, were selected for site-
variant directed mutagenesis to study their potential positive effects
on PHA production. Considering that the double mutation of
In vitro evolution of PhaC is a powerful approach for PhaCAcNSDG, amino acid substitutions of N149S and D171G
enhancing the productivity and quality of PHA (Kichise et al., drastically enhanced the performance of the enzyme (Tsuge et al.,
2002; Taguchi and Doi, 2004). For instance, PhaCAcNSDG, a 2007b; Harada et al., 2021), similar efforts were adopted to
variant of PhaCAc, exhibits enhanced performance (such as generate a PhaCPs variant. According to the alignment

Frontiers in Bioengineering and Biotechnology 07 frontiersin.org

Sivashankari et al. 10.3389/fbioe.2023.1114946

TABLE 5 Biosynthesis of P (3HB-co-3H2MB) by E. coli LSBJ expressing various PhaCs from glucose and tiglic acid.

PhaC Dry cell wt. (g/L) PHA cont. (wt%) PHA yield (g/L) PHA composition (mol%)

3HB 3H2MB
A. caviae 2.02 ± 0.04 23.1 ± 0.6 0.47 ± 0.02 95.7 ± 0.1 4.3 ± 0.1

A. caviae 2.33 ± 0.03 29.5 ± 2.6 0.69 ± 0.06 95.1 ± 0.2 4.9 ± 0.2
NSDG variant

F. marina 2.30 ± 0.08 31.9 ± 1.2 0.74 ± 0.05 99.3 ± 0.0 0.7 ± 0.0

P. shigelloides 2.21 ± 0.08 29.5 ± 2.6 0.76 ± 0.05 97.9 ± 0.2 2.1 ± 0.2

P. shigelloides 2.24 ± 0.03 30.0 ± 1.2 0.67 ± 0.03 94.6 ± 0.1 5.4 ± 0.1
NG variant

S. pealeana 1.88 ± 0.06 20.3 ± 0.3 0.38 ± 0.01 100 ND

V. metschnikovii 2.31 ± 0.03 30.4 ± 2.7 0.72 ± 0.01 99.5 ± 0.0 0.5 ± 0.0

E. coli LSBJ harboring pBBR1-phaCsABReJAc and pTTQ-PCT was cultured in the modified M9 medium containing 7.5 g/L glucose (2.5 g/L × 3 times) and 0.6 g/L tiglic acid (0.2 g/L × 3 times),
which were added at 4, 28, and 52 h. The values of dry cell weight, PHA content, and PHA composition were the averages of three independent experiments. The NSDG variant of A. caviae
PhaC had a double mutation of N149S and D171G. The NG variant of P. shigelloides PhaC had a single mutation of N175G. 3HB: 3-hydroxybutyrate; 3H2MB: 3-hydroxy-2-methylbutyrate.

TABLE 6 Biosynthesis of P (3HB-co-3HPi) by E. coli LSBJ expressing various PhaCs from glucose and 3-hydoxypivalic acid.

PhaC Dry cell wt. (g/L) PHA cont. (wt%) PHA yield (g/L) PHA composition (mol%)

3HB 3HPi
A. caviae 2.01 ± 0.03 16.3 ± 1.4 0.33 ± 0.03 94.2 ± 0.6 5.8 ± 0.6

A. caviae 2.07 ± 005 19.4 ± 1.2 0.40 ± 0.03 79.9 ± 1.1 20.1 ± 1.1
NSDG variant

F. marina 2.22 ± 0.04 23.1 ± 0.3 0.51 ± 0.01 97.5 ± 0.6 2.5 ± 0.6

P. shigelloides 1.98 ± 0.05 16.7 ± 1.3 0.33 ± 0.03 89.8 ± 0.4 10.1 ± 0.4

P. shigelloides 1.91 ± 0.22 15.0 ± 2.7 0.29 ± 0.06 88.4 ± 0.5 11.6 ± 0.5
NG variant

S. pealeana 1.80 ± 0.08 9.7 ± 0.1 0.17 ± 0.01 97.9 ± 0.4 2.1 ± 0.4

V. metschnikovii 2.15 ± 0.03 24.2 ± 0.9 0.52 ± 0.02 97.2 ± 0.2 2.8 ± 0.2

E. coli LSBJ harboring pBBR1-phaCsABReJAc and pTTQ-PCT was incubated in the modified M9 medium containing 7.5 g/L glucose (2.5 g/L × 3 times) + 0.6 g/L 3-hydroxypivalic acid (0.2 g/
L × 3 times), which were added at 4, 28, and 52 h. The values of dry cell weight, PHA content, and PHA composition were the averages of three independent experiments. The NSDG variant of
A. caviae PhaC had a double mutation of N149S and D171G. The NG variant of P. shigelloides PhaC had a single mutation of N175G. 3HB: 3-hydroxybutyrate; 3HPi: 3-hydroxypivalate.

(Figure 2), PhaCPs naturally contain a serine residue at the incorporation of the 3H2MB monomer. Moreover, PhaCPsNG
corresponding position of 149 in PhaCAcNSDG. Thus, a single was shown to have a better ability to incorporate 3H4MV and
amino acid substitution was performed in PhaCPs in which 3HPi than the parent enzyme but less so than PhaCAcNSDG
asparagine 175 was changed to glycine (N175G). The resultant (Table 4 and Table 6). Finally, PhaCPsNG exhibited an almost
variant was termed PhaCPsNG, and its PHA production ability similar level of 3HHx incorporation as the parent enzyme, which
was examined. was inferior to PhaCAcNSDG (Table 3).
Interestingly, PhaCPsNG showed enhanced P(3HB)
synthesis, while maintaining a high molecular weight
(Table 2). PhaCPsNG exhibited enhanced activity for the Conclusion
incorporation of the α-methylated monomer 3H2MB
compared with the parent enzyme and PhaC AcNSDG In conclusion, four Class I PhaC enzymes from different
(Table 5). This indicates the potential of PhaCPsNG to surpass bacteria were identified using BLASTP and were characterized
the currently best-performing enzyme (PhaC AcNSDG) for the for PHA production. To the best of our knowledge, this is the

Frontiers in Bioengineering and Biotechnology 08 frontiersin.org

Sivashankari et al. 10.3389/fbioe.2023.1114946

first report to characterize PhaC enzymes from F. marina, P. Funding

shigelloides, S. pealeana, and V. metschnikovii. These PhaCs
exhibited a relatively high potential for polymerizing P(3HB) in JSPS KAKENHI Grant Number 21H03640.
recombinant E. coli. PhaC enzymes identified in this study, with
the exception of PhaCSp from S. pealeana, were able to
incorporate all the targeted monomers, namely 3HHx, Acknowledgments
3H4MV, α-carbon methylated 3H2MB, and α-carbon
dimethylated 3HPi. Among the four new PhaCs, PhaC Ps The authors thank S. Ozawa (Teijin Co., Tokyo, Japan) and T.
from P. shigelloides displayed the best performance; thus, we Yamamoto (Teijin Co., Tokyo, Japan) for helpful discussions. The
attempted to further improve their attributes through protein authors also thank the Biomaterials Analysis Division of the Tokyo
engineering. The resultant variant PhaC Ps NG exhibited Institute of Technology for the DNA sequencing analysis.
superior capability in polymerizing the 3H2MB monomer
compared to PhaC Ac and its NSDG variant. Furthermore,
PhaC Ps NG showed the enhanced synthesis of P(3HB) with Conflict of interest
ultrahigh molecular weight and low PDI. Finally, these newly
identified PhaC enzymes show great versatility, suggesting their The authors declare that the research was conducted in the
potential as workhorse enzymes for the industrial-scale absence of any commercial or financial relationships that could be
production of 3HB-based copolymers. construed as a potential conflict of interest.

Data availability statement Publisher’s note

The datasets presented in this study can be found in online All claims expressed in this article are solely those of the authors and
repositories. The names of the repository/repositories and do not necessarily represent those of their affiliated organizations, or
accession number(s) can be found in the article/Supplementary those of the publisher, the editors and the reviewers. Any product that
Material. may be evaluated in this article, or claim that may be made by its
manufacturer, is not guaranteed or endorsed by the publisher.

Author contributions
Supplementary material
RS, MM, YM, SM, CN, ST, HA, and TT jointly conceived the
study. RS, MM, YM, and SM performed the experiments. RS wrote The Supplementary Material for this article can be found online
the manuscript in consultation with CN, ST, HA, and TT. All at: https://www.frontiersin.org/articles/10.3389/fbioe.2023.1114946/
authors read and approved the final manuscript. full#supplementary-material

References
Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990). Basic local Füchtenbusch, B., Fabritius, D., Wältermann, M., and Steinbüchel, A. (1998).
alignment search tool. J. Mol. Biol. 215, 403–410. doi:10.1016/S0022-2836(05)80360-2 Biosynthesis of novel copolyesters containing 3-hydroxypivalic acid by Rhodococcus
ruber NCIMB 40126 and related bacteria. FEMS Microbiol. Lett. 159, 85–92. doi:10.
Anderson, A. J., and Dawes, E. (1990). Occurrence, metabolism, metabolic role, and
1111/j.1574-6968.1998.tb12845.x
industrial uses of bacterial polyhydroxyalkanoates. Microbiol. Rev. 54, 450–472. doi:10.
1128/mr.54.4.450-472.1990 Furutate, S., Kamoi, J., Nomura, C. T., Taguchi, S., Abe, H., and Tsuge, T. (2021).
Superior thermal stability and fast crystallization behavior of a novel, biodegradable α-
Chek, M. F., Hiroe, A., Hakoshima, T., Sudesh, K., and Taguchi, S. (2019). PHA
methylated bacterial polyester. NPG Asia Mater 13, 31. doi:10.1038/s41427-021-
synthase (PhaC): Interpreting the functions of bioplastic-producing enzyme from a
00296-x
structural perspective. Appl. Microbiol. Biotechnol. 103, 1131–1141. doi:10.1007/
s00253-018-9538-8 Furutate, S., Nakazaki, H., Maejima, K., Hiroe, A., Abe, H., and Tsuge, T. (2017).
Biosynthesis and characterization of novel polyhydroxyalkanoate copolymers
Chek, M. F., Kim, S. Y., Mori, T., Arsad, H., Samian, M. R., Sudesh, K., et al. (2017).
consisting of 3-hydroxy-2-methylbutyrate and 3-hydroxyhexanoate. J. Polym. Res.
Structure of polyhydroxyalkanoate (PHA) synthase PhaC from Chromobacterium
24, 221. doi:10.1007/s10965-017-1392-3
sp. USM2, producing biodegradable plastics. Sci. Rep. 7, 5312. doi:10.1038/s41598-
017-05509-4 Harada, K., Kobayashi, S., Oshima, K., Yoshida, S., Tsuge, T., and Sato, S.
(2021). Engineering of Aeromonas caviae polyhydroxyalkanoate synthase
Chek, M. F., Kim, S. Y., Mori, T., Tan, H. T., Sudesh, K., and Hakoshima, T. (2020).
through site-directed mutagenesis for enhanced polymerization of the 3-
Asymmetric open-closed dimer mechanism of polyhydroxyalkanoate synthase PhaC.
hydroxyhexanoate unit. Front. Bioeng. Biotechnol. 9, 627082. doi:10.3389/
iScience 23, 101084. doi:10.1016/j.isci.2020.101084
fbioe.2021.627082
Doi, Y., Kitamura, S., and Abe, H. (1995). Microbial synthesis and characterization of
Hiroe, A., Shiraishi, M., Mizuno, K., and Tsuge, T. (2015). Behavior of different
poly(3-hydroxybutyrate-co-3-hydroxyhexanoate). Macromolecules 28, 4822–4828.
polyhydroxyalkanoate synthases in response to the ethanol level in Escherichia coli
doi:10.1021/ma00118a007
cultures. Polym. J. 47, 767–770. doi:10.1038/pj.2015.53
Fadzil, F. I. M., Mizuno, S., Hiroe, A., Nomura, C. T., and Tsuge, T. (2018). Low
Janda, J. M., Abbott, S. L., and McIver, C. J. (2016). Plesiomonas shigelloides revisited.
carbon concentration feeding improves medium-chain-length polyhydroxyalkanoate
Clin. Microbiol. Rev. 29, 349–374. doi:10.1128/CMR.00103-15
production in Escherichia coli strains with defective β-oxidation. Front. Bioeng.
Biotechnol. 6, 178. doi:10.3389/fbioe.2018.00178 Katsuta, A., Adachi, K., Matsuda, S., Shizuri, Y., and Kasai, H. (2005). Ferrimonas
marina sp. nov. Int. J. Syst. Evol. Microbiol. 55, 1851–1855. doi:10.1099/ijs.0.63689-0
Ferguson, W. W., and Henderson, N. D. (1947). Description of strain C27: A motile
organism with the major antigen of Shigella sonnei phase I. J. Bacteriol. Res. 54, 179–181. Kichise, T., Taguchi, S., and Doi, Y. (2002). Enhanced accumulation and changed
doi:10.1128/jb.54.2.179-181.1947 monomer composition in polyhydroxyalkanoate (PHA) copolyester by in vitro

Frontiers in Bioengineering and Biotechnology 09 frontiersin.org

Sivashankari et al. 10.3389/fbioe.2023.1114946

evolution of Aeromonas caviae PHA synthase. Appl. Environ. Microbiol. 68, 2411–2419. Sivashankari, R., and Tsuge, T. (2021). “Development of polyhydroxyalkanoate (PHA) and its
doi:10.1128/AEM.68.5.2411-2419.2002 copolymers as a possible “cure” for the plastic pollution,” in Environmental and Microbial
Biotechnology book series. Editor R. Prasad (Singapore: Springer), 59–79. doi:10.1007/978-981-
Kim, J., Kim, Y. J., Choi, S. Y., Lee, S. Y., and Kim, K. J. (2017). Crystal structure of
15-5499-5_3
Ralstonia eutropha polyhydroxyalkanoate synthase C-terminal domain and reaction
mechanisms. Biotechnol. J. 12, 1600648. doi:10.1002/biot.201600648 Sudesh, K., Abe, H., and Doi, Y. (2000). Synthesis, structure and properties of
polyhydroxyalkanoates: Biological polyesters. Prog. Polym. Sci. 25, 1503–1555. doi:10.
Kobayashi, G., Shiotani, T., Shima, Y., and Doi, Y. (1994). “Biosynthesis and
1016/S0079-6700(00)00035-6
characterization of poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) from oils and
fats by Aeromonas sp. OL-338 and Aeromonas sp. FA-440,” in Biodegradable Suzuki, M., Tachibana, Y., and Kasuya, K. I. (2021). Biodegradability of poly(3-
plastics and polymers. Editors Y. Doi and K. Fukuda (Amsterdam: Elsevier), hydroxyalkanoate) and poly(ε-caprolactone) via biological carbon cycles in marine
410–416. doi:10.1016/b978-0-444-81708-2.50044-0 environments. Polym. J. 53, 47–66. doi:10.1038/s41428-020-00396-5
Kovach, M. E., Elzer, P. H., Hill, D. S., Robertson, G. T., Farris, M. A., Roop, R. M., Taguchi, S., and Doi, Y. (2004). Evolution of polyhydroxyalkanoate (PHA)
et al. (1995). Four new derivatives of the broad-host-range cloning vector pBBR1MCS, production system by "enzyme evolution": Successful case studies of directed
carrying different antibiotic-resistance cassettes. Gene 166, 175–176. doi:10.1016/0378- evolution. Macromol. Biosci. 4, 145–156. doi:10.1002/mabi.200300111
1119(95)00584-1
Taguchi, S., Yamada, M., Matsumoto, K. I., Tajima, K., Satoh, Y., Munekataet, M.,
Lee, J. V., Donovan, T. J., and Furniss, A. L. (1978). Characterization, taxonomy, and et al. (2008). A microbial factory for lactate-based polyesters using a lactate-
emended description of Vibrio metschnikovii. Vibrio metschnikovii Int. J. Syst. Evol. polymerizing enzyme. Proc. Natl. Acad. Sci. U.S.A. 105, 17323–17327. doi:10.1073/
Microbiol. 28, 99–111. doi:10.1099/00207713-28-1-99 pnas.0805653105
Lehrle, R., and Williams, R. J. (1994). Thermal degradation of bacterial Tamura, K., Stecher, G., and Kumar, S. (2021). Mega 11: Molecular evolutionary genetics
poly(hydroxybutyric acid): Mechanisms from the dependence of pyrolysis yields on analysis version 11. Mol. Biol. Evol. 38, 3022–3027. doi:10.1093/molbev/msab120
sample thickness. Macromolecules 27, 3782–3789. doi:10.1021/ma00092a017
Tanadchangsaeng, N., Kitagawa, A., Yamamoto, T., Abe, H., and Tsuge, T. (2009).
Lenz, R. W., and Marchessault, R. H. (2005). Bacterial polyesters: Biosynthesis, Identification, biosynthesis, and characterization of polyhydroxyalkanoate copolymer
biodegradable plastics and biotechnology. Biomacromolecules 6, 1–8. doi:10.1021/bm049700c consisting of 3-hydroxybutyrate and 3-hydroxy-4-methylvalerate.
Biomacromolecules10 2866-10, 2866–2874. doi:10.1021/bm900696c
Leonardo, M. R., Moser, D. P., Barbieri, E., Brantner, C. A., MacGregor, B. J., Paster, B.
J., et al. (1999). Shewanella pealeana sp. nov., a member of the microbial community Tappel, R. C., Kucharski, J. M., Mastroianni, J. M., Stipanovic, A. J., and Nomura, C. T.
associated with the accessory nidamental gland of the squid Loligo pealei. Int. J. Syst. (2012b). Biosynthesis of poly[(R)-3-hydroxyalkanoate] copolymers with controlled
Evol. Microbiol. 49, 1341–1351. doi:10.1099/00207713-49-4-1341 repeating unit compositions and physical properties. Biomacromolecules 13,
2964–2972. doi:10.1021/bm301043t
Levine, A. C., Heberlig, G. W., and Nomura, C. T. (2016). Use of thiol-ene click
chemistry to modify mechanical and thermal properties of Tappel, R. C., Wang, Q., and Nomura, C. T. (2012a). Precise control of repeating unit
polyhydroxyalkanoates (PHAs). Int. J. Biol. Macromol. 83, 358–365. doi:10. composition in biodegradable poly(3-hydroxyalkanoate) polymers synthesized by
1016/j.ijbiomac.2015.11.048 Escherichia coli. Escherichia coli J. Biosci. Bioeng. 113, 480–486. doi:10.1016/j.jbiosc.
2011.12.004
Mierzati, M., Mizuno, S., and Tsuge, T. (2020). Biosynthesis and characterization of
poly(3-hydroxybutyrate-co-2-hydroxyalkanoate) with different comonomer Tsuge, T. (2016). Fundamental factors determining the molecular weight of
fractions. Polym. Degrad. Stabil. 178, 109193. doi:10.1016/j.polymdegradstab.2020. polyhydroxyalkanoate during biosynthesis. Polym. J. 48, 1051–1057. doi:10.1038/pj.
109193 2016.78
Mizuno, K., Ohta, A., Hyakutake, M., Ichinomiya, Y., and Tsuge, T. (2010). Isolation Tsuge, T., Watanabe, S., Sato, S., Hiraishi, T., Abe, H., Doi, Y., et al. (2007a). Variation
of polyhydroxyalkanoate-producing bacteria from a polluted soil and characterization in copolymer composition and molecular weight of polyhydroxyalkanoate generated by
of the isolated strain Bacillus cereus YB-4. Polym. Degrad. Stabil. 95, 1335–1339. doi:10. saturation mutagenesis of Aeromonas caviae PHA synthase. Macromol. Biosci. 7,
1016/j.polymdegradstab.2010.01.033 846–854. doi:10.1002/mabi.200700023
Nambu, Y., Ishii-Hyakutake, M., Harada, K., Mizuno, S., and Tsuge, T. (2020). Expanded Tsuge, T., Watanabe, S., Shimada, D., Abe, H., Doi, Y., and Taguchi, S. (2007b).
amino acid sequence of the PhaC box in the active center of polyhydroxyalkanoate synthases. Combination of N149S and D171G mutations in Aeromonas caviae
FEBS Lett. 594, 710–716. doi:10.1002/1873-3468.13651 polyhydroxyalkanoate synthase and impact on polyhydroxyalkanoate biosynthesis.
FEMS Microbiol. Lett. 277, 217–222. doi:10.1111/j.1574-6968.2007.00958.x
Nomura, C. T., and Taguchi, S. (2007). PHA synthase engineering toward
superbiocatalysts for custom-made biopolymers. Appl. Microbiol. Biotechnol. 73, Tsuge, T., Yano, K., Imazu, S. I., Numata, K., Kikkawa, Y., Abe, H., et al. (2005).
969–979. doi:10.1007/s00253-006-0566-4 Biosynthesis of polyhydroxyalkanoate (PHA) copolymer from fructose using wild-type
and laboratory evolved PHA synthases. Macromol. Biosci. 5, 112–117. doi:10.1002/
Pinto, A., Ciesla, J., Palucci, A., Sutliff, B., and Nomura, C. T. (2016). Chemically
mabi.200400152
intractable no more: In vivo incorporation of “click”-ready fatty acids into poly-[(R)-3-
hydroxyalkanoates in Escherichia coli. ACS Macro. Lett. 5, 215–219. doi:10.1021/ Warrens, A. N., Jones, M., and Lechler, R. I. (1997). Splicing by overlap extension by
acsmacrolett.5b00823 PCR using asymmetric amplification: An improved technique for the generation of
hybrid proteins of immunological interest. Gene 186, 29–35. doi:10.1016/S0378-
Rehm, B. H. (2003). Polyester synthases: Natural catalysts for plastics. Biochem. J. 376,
1119(96)00674-9
15–33. doi:10.1042/bj20031254
Watanabe, Y., Ishizuka, K., Furutate, S., Abe, H., and Tsuge, T. (2015). Biosynthesis
Scheel, R. A., Ho, T., Kageyama, Y., Masisak, J., McKenney, S., Lundgren, B. R., et al.
and characterization of novel poly(3-hydroxybutyrate-co-3-hydroxy-2-
(2021). Optimizing a fed-batch high-density fermentation process for medium-chain-
methylbutyrate): Thermal behavior associated with α-carbon methylation. RSC Adv.
length poly(3-hydroxyalkanoates) in Escherichia coli. 9, 134. Front. Bioeng. Biotechnol.
5, 58679–58685. doi:10.1039/C5RA08003G
9, 618259. doi:10.3389/fbioe.2021.618259
Wittenborn, E. C., Jost, M., Wei, Y., Stubbe, J., and Drennan, C. L. (2016).
Shimamura, E., Kasuya, K., Kobayashi, G., Shiotani, T., Shima, Y., and Doi, Y.
Structure of the catalytic domain of the class I polyhydroxybutyrate synthase
(1994). Physical properties and biodegradability of microbial poly(3-
from Cupriavidus necator. J. Biol. Chem. 291, 25264–25277. doi:10.1074/jbc.
hydroxybutyrate-co-3-hydroxyhexanoate). Macromolecules 27, 878–880. doi:10.
M116.756833
1021/ma00081a041

Frontiers in Bioengineering and Biotechnology 10 frontiersin.org