KVS(DR)/2024/TE

KENDRIYA VIDYALAYA SANGATHAN, DELHI REGION

Pre board Examination -1 - 2024-25

Class- XII Subject- Biology (044)

M.M.- 70 Time- 3 Hrs

General Instructions:
(i) All questions are compulsory.
(ii) The question paper has five sections and 33 questions.
(iii) Section–A has 16 questions of 1 mark each; Section–B has 5 questions of 2
marks each; Section– C has 7 questions of 3 marks each; Section– D has 2 case-
based questions of 4 marks each; and Section–E has 3 questions of 5 marks each.
(iv) There is no overall choice. However, internal choices have been provided in
some questions. A student has to attempt only one of the alternatives in such
questions.
(v) Wherever necessary, neat and properly labelled diagrams should be drawn.

SECTION A
1. Estrogen is secreted by :
(a) Corpus luteum
(b) Membrane granulosa of Graafian follicle
(c) Pituitary gland
(d) Germinal epithelium
2. Select the options which is/are incorrect statement(s) with respect to T-
lymphocytes in the human body.
(i) They are a type of white blood cells.
(ii) They are produced in bone marrow.
(iii) They remain active at all times in the body.
(iv) They mature in the bone marrow.
(a) (i) and (iv) only (b) (iii) only
(c) (iv) only (d)(iii) and (iv) only
3. The mosquito-borne disease in humans causing chronic inflammation of the
lymphatic vessels is :
(a) Elephantiasis
(b) Ascariasis
(c) Ringworm
 (d) Amoebiasis
4. Crystals of Bt toxin produced by some bacteria, do not kill the bacteria producing
them because :
(a) bacteria are resistant to the toxin
(b) toxin is immature
(c) toxin is inactive
(d) bacteria encloses ‘toxin’ in a special capsule.
5. Identify the option that gives the correct type of evolution exhibited by the two
animals shown, living in the same habitat in Australia.

(a) Convergent Evolution

(b) Disruptive Selection
(c) Divergent Evolution
(d) Homologous Ancestry
For visually challenged students (in lieu of Q 5)
The correct reason for survival of certain moth population in post-industrialization
period in England was due to :
(a) the moths moved to a different type of vegetation and survived.
(b) the moths flew away to a different locality.
(c) the moths that were able to camouflage their colour with the background,
survived.
(d) the reproductive rate of moths declined post-industrialisation.
6. Match the correct Structures given in Column I with the Fruit in Column II in
the chart given below :
Column I Column II
(Structure) (Fruit)
P. Perisperm i. Maize
Q. Thalamus ii. Black pepper
 R. Pericarp iii. Strawberry
S. Endosperm iv. Mango
(a) P-i, Q-ii, R-iii, S-ii (b) P-ii, Q-iii, R-iv, S-i
(c) P-iii, Q-i, R-i, S-iii (d) P-iv, Q-i, R-ii, S-iv
7. DNA profiles of the child and three individuals 1, 2 and 3 who claim to be
the parents of the child are given below. Select the option that shows the
correct actual parent/parents of the child.

(a) Individual 1 and 3

(b) Individual 1 and 2
(c) Individual 2 and 3
(d) Individual 1 is the only parent of the child amongst 1, 2 and 3
For visually challenged students (in lieu of Q.7)
In ‘lac’ operon z gene codes for beta-galactosidase, which is
primarily responsible for the hydrolysis of :
(A) lactose
(B) sucrose
(C) fructose
(D) amylose
8. A patient was advised to have a kidney transplant. To suppress the immune
 reaction, the doctor would administer him:
(a) statins produced from Monascus purpureus
(b) statins produced from Streptococcus thermophilus
(c) cyclosporin A produced from Trichoderma polysporum
(d) cyclosporin A produced from Clostridium butylicum
9. Swathi was growing a bacterial colony in a culture flask under ideal laboratory
conditions where the resources are replenished. Which of the following
equations will represent the growth in this case?
(Where population size is N, birth rate is b, death rate is d, unit time period is t,
and carrying capacity is K).
(a) dN/dt = KN
(b) dN/dt = r N
(c) dN/dt = r N(K-N/K)
(d) dN/dt = r N(K+N/K
10. Which of the following food chains is the major conduit for energy flow in terrestrial
and aquatic ecosystems respectively?
Terrestrial Ecosystem Aquatic Ecosystem
(a) Grazing Grazing
(b) Detritus Detritus
(c) Detritus Grazing
(d) Grazing Detritus
11. Which of the following is an example of ex situ conservation?
(a) Sacred Groves
(b) National Park
(c) Biosphere Reserve
(d) Seed Bank
12. Vertical distribution of different species occupying different levels in a biotic
community is known as
(a) Stratification
(b) Pyramid
(c) Divergence
(d) Zonation
Question number 13 to 16 consist of two statements, assertion (A )and reason (R)
answer these questions selecting the appropriate option given below:
a) Both A and R are true, and R is the correct explanation of A.
b) Both A and R are true, but R is not the correct explanation of A.
c) A is true, but R is false.
d) A is false but R is true.

13. Assertion : Periodic abstinence is a method in which couples avoid coitus

from day 10 to 17 of menstrual cycle.
Reason : Periodic abstinence has limited effectiveness because menstrual
cycles are not always regular.
14. Assertion : Gross primary productivity is always less than net primary
productivity.
Reason : Rate of synthesis of organic matter by consumers is known as
secondary productivity.
15. Assertion : In a monohybrid cross between tall plants and dwarf plants, the
F2 generation showed tall and dwarf plants in the ratio of 3 : 1.
Reason : There is no blending of traits/characters in the F2 generation.
16. Assertion: Functional ADA cDNA genes must be inserted in the lymphocytes
at the early embryonic stage.
Reason: Cells in the embryonic stage are mortal, differentiated and easy to
manipulate.
SECTION B
17. How do ‘implants’ act as an effective method of contraception in human
females ? Mention their one advantage over contraceptive pills.
18. (a) Comment on the interaction between a fig tree and wasp. Mention the
phenomenon that operates in their relationship. 2
OR
(b) Explain “brood parasitism” with the help of an example.
19. (a) ‘Insertional Inactivation’ is a method to detect recombinant DNA. Explain
the method.
OR
(b) Explain how recombinant DNA technology is used to detect a disease even
before any clinical symptom appears.
20. In our country NACO and other Non-Government Organisations (NGOs)
 are doing a lot to educate people about AIDS. Expand ‘NACO’. Enlist any
three ways by which transmission of HIV-AIDS infection occurs.
OR
20. Write the scientific name of the plant and its part from which opioids are
extracted. How does it affect our body functions ?
21. The diagram below shows the sequence of amino acids in part of a
haemoglobin molecule.

(a) If the base T* was substituted with A, how would it affect the haemoglobin
chain?
(b) Name the condition and the effects associated with the above substitution.
For visually challenged students (in lieu of Q.21)
(a) Name the scientists who combined the knowledge of chromosomal
segregation with Mendelian principles.
(b) How did they explain the similarity in behaviour of chromosomes and
genes ?
SECTION C
22. Given below is the diagram showing a part of the reproductive system of a
human female.
(a) Identify ‘Y’ and write its function.
(b) Identify the outermost layer of ‘Z’ , also write its importance after fertilization.
(c) Mention the stage at which the process of oogenesis temporarily gets
arrested and name the cells thus formed in the ‘X’ of a baby girl at the time
of her birth.
For visually challenged students (in lieu of Q.22)
What is implantation ? What are the immediate changes that occur after the process ?
23. Explain how did the experiment conducted by S.L. Miller substantiate that life
evolved from pre- existing non-living organic molecules.
24. (a) What is gene therapy ?
(b) Describe the procedure of such a therapy that could be a permanent cure
for a genetic disease. Name the genetic disease.
25. (a) (i) What are “biodiversity hotspot” regions ? Mention any two criteria
used for determining any region as a “hotspot”.
(ii) Name any two hotspots of India.
OR
(b) Explain giving three reasons, why tropics show greatest level of species
diversity.
26. (a) Differentiate between homologous and analogous organs.
(b) Give one example each of both homologous and analogous organs.
27. Explain the phases in embryonic development from the morula stage till the
establishment of pregnancy in a human female.
28. The aeration tank of a sewage treatment plant is not functioning properly.
Explain in detail the impact of this on the treatment of sewage and BOD of the
effluent.
 SECTION D
The following questions are case-based questions. Read the cases carefully and
answer the questions that follow.
29. The diagram shows the life cycle of a pathogenic protozoan.

(i) Name the parasitic stage that is being transferred from host ‘X’ to host ‘Y’.
(ii) Write the changes the parasite undergoes in the liver.
(iii) Write the changes the parasite undergoes when it enters the RBC.
(iv) Trace the changes the parasite undergoes when the host ‘X’ takes it blood meal
from infected host ‘Y.’
OR
(iv) At which stage during the life cycle of the pathogen does the host ‘Y’
experience the symptoms of the disease ? Name the disease and the toxic
substance responsible for these symptoms.
For visually challenged students (in lieu of Q.29)
Some helminths are known to be pathogenic to humans. A healthy person acquires this
helminth infection through contaminated water, vegetables, fruits, etc. The common
roundworm, filarial worms live as parasites in humans. Besides helminths some fungi
also cause common infectious diseases in humans. Maintenance of personal and public
hygiene is very important for prevention and control of many such infectious diseases.
Public hygiene includes proper
disposal of waste and excreta, periodic cleaning and disinfection of water reservoirs.
(i) Name the causal organisms for filariasis and ringworm.
(ii) Mention two symptoms each of filariasis and ringworm.
(iii) How do these diseases spread ?
OR
(iii) Write two preventive measures each for filariasis and ringworm.
30. This pedigree shows the inheritance of colour blindness or sex-linked trait.

(a) Is this trait dominant or recessive? Give resaons.

(b) Is the mother of the colourblind girl in the F3 generation colourblind, a carrier or a
person with normal colour vision? Explain.
OR
(c) In this type of inheritance pattern, out of male and female children which one
has less probability of receiving the trait from the parents. Give a reason.
For visually challenged students (in lieu of Q.30)
The unequivocal proof that DNA is a genetic material came from the experiments of
Alfred Hershey and Martha Chase in 1952. They worked with viruses that infect
bacteria and are called bacteriophages. The experiments were designed to ascertain
whether it was protein or DNA from the viruses that entered the bacteria. Radioactive
elements were used to label DNA and proteins in the bacteriophages. Recall the
experiment and answer the questions that follow :
(i) (a) Why were viruses grown in medium containing radioactive phosphorus ?
(b) What happened when viruses were grown in medium containing
radioactive sulfur ?
(ii) Why were bacteriophage and E. coli used in the experiment ?
(iii) (a) Write the conclusion that Hershey and Chase arrived at, at the end of
this experiment.
OR
(iii) (b) Why was a blender used during this experiment ?
SECTION E
31. (i) Describe a replication fork indicating the process of DNA
replication.
(ii) Differentiate between the two newly synthesised DNA strands
within the fork.
(iii) Name the enzymes involved in the process of DNA replication.
(iv) Name the eukaryote in which it was proved experimentally that the DNA
also replicate in chromosomes semi-conservatively.
OR
31. You are given a tall pea plant with green seeds. The genotype of this plant is
unknown. You are allowed to do only ‘selfing’ of these plants to find out the genotype of
the given plant. Work out all possible crosses and show how you would determine the
genotype of the given plant.
32. Given below is a diagrammatic representation of a human ovum.
 (i) Identify the parts ‘a’, ‘b’ and ‘c’.
(ii) This ovum is released from the ovary with incomplete meiotic division.
When, where and how is the meiotic division completed ?
(iii) How does an ovum ensure the entry of a single sperm during fertilisation ?
For visually challenged students (in lieu of Q.32)
(i) Mention any two reasons for causing infertility in humans.
(ii) ‘IVF’ in vitro fertilisation is a technique that has helped childless couple to
bear children. Describe the technique giving special mention of ‘ZIFT’ and
‘IUT’.

OR
32. (i) Double fertilisation is an event unique to all flowering plants.
Explain the process.
(ii) Give a reason for the following :
(1) A seed of an orange has many embryos.
(2) Cashew is a false fruit but Guava is a true fruit.
33. Some restriction enzymes break a phosphodiester bond on both the DNA
strands, such that only one end of each molecule is cut and these ends have
regions of single stranded DNA. BamH1is one such restriction enzyme which
binds at the recognition sequence, 5’-GGATCC- 3’and cleaves these sequences
just after the 5’- guanine on each strand.
(a) What is the objective of this action?
(b) Explain how the gene of interest is introduced into a vector.
(c) You are given the DNA shown below.
5’ ATTTTGAGGATCCGTAATGTCCT 3’
3’ TAAAACTCCTAGGCATTACAGGA 5’
If this DNA was cut with BamHI, how many DNA fragments would you
expect? Write the sequence of these double-stranded DNA fragments with
their respective polarity.
(d) A gene M was introduced into E.coli cloning vector PBR322 at BamH1 site.
What will be its impact on the recombinant plasmids? Give a possible way by
which you could differentiate non recombinant to recombinant plasmids.
 OR
33. GM crops especially Bt crops are known to have higher resistance to pest attacks. To
substantiate this an experimental study was conducted in 4 different
farmlands growing Bt and non Bt-Cotton crops. The farm lands had the same
dimensions, fertility and were under similar climatic conditions. The histogram below
shows the usage of pesticides on Bt crops and non-Bt crops in these farm lands.

(a) Which of the above 4 farm lands has successfully applied the concepts
of Biotechnology to show better management practices and use of
agrochemicals? If you had to cultivate, which crop would you prefer
(Bt or Non- Bt) and why?
(a) Cotton Bollworms were introduced in another experimental study on
the above farm lands wherein no pesticide was used. Explain what
effect would a Bt and Non Bt crop have on the pest.
For visually challenged students (in lieu of Q.33 - OR)
(i) What is the cause of ADA deficiency in children ?
(ii) Explain how gene therapy is used to cure this deficiency.
(iii) Why does a patient require periodic infusion of genetically engineered
lymphocytes ?