International Journal of Oral Science www.nature.

com/ijos

ARTICLE OPEN

Host-microbe computational proteomic landscape in oral

cancer revealed key functional and metabolic pathways
between Fusobacterium nucleatum and cancer progression
Camila Paz Muñoz-Grez1,2, Mabel Angélica Vidal 1,3, Tamara Beatriz Rojas4, Luciano Esteban Ferrada5, Felipe Andrés Zuñiga6,
Agustin Andrés Vera1, Sergio Andrés Sanhueza1, Romina Andrea Quiroga1, Camilo Daniel Cabrera1, Barbara Evelyn Antilef1,
Ricardo Andrés Cartes1, Milovan Paolo Acevedo 6, Marco Andrés Fraga1, Pedro Felipe Alarcón-Zapata7,8,
Mauricio Alejandro Hernández 9, Alexis Marcelo Salas-Burgos10, Francisco Tapia-Belmonte10, Milly Loreto Yáñez11,
Erick Marcelo Riquelme12, Wilfredo Alejandro González13,14, Cesar Andrés Rivera 15, Angel Alejandro Oñate16,
Liliana Ivonne Lamperti1 and Estefanía Nova-Lamperti 1 ✉

Oral squamous cell carcinoma (OSCC) is the most common manifestation of oral cancer. It has been proposed that periodontal
pathogens contribute to OSCC progression, mainly by their virulence factors. However, the main periodontal pathogen and its
mechanism to modulate OSCC cells remains not fully understood. In this study we investigate the main host-pathogen pathways in
OSCC by computational proteomics and the mechanism behind cancer progression by the oral microbiome. The main host-
1234567890();,:

pathogen pathways were analyzed in the secretome of biopsies from patients with OSCC and healthy controls by mass
spectrometry. Then, functional assays were performed to evaluate the host-pathogen pathways highlighted in oral cancer. Host
proteins associated with LPS response, cell migration/adhesion, and metabolism of amino acids were significantly upregulated in
the human cancer proteome, whereas the complement cascade was downregulated in malignant samples. Then, the microbiome
analysis revealed large number and variety of peptides from Fusobacterium nucleatum (F. nucleatum) in OSCC samples, from which
several enzymes from the L-glutamate degradation pathway were found, indicating that L-glutamate from cancer cells is used as an
energy source, and catabolized into butyrate by the bacteria. In fact, we observed that F. nucleatum modulates the cystine/
glutamate antiporter in an OSCC cell line by increasing SLC7A11 expression, promoting L-glutamate efflux and favoring bacterial
infection. Finally, our results showed that F. nucleatum and its metabolic derivates promote tumor spheroids growth, spheroids-
derived cell detachment, epithelial-mesenchymal transition and Galectin-9 upregulation. Altogether, F. nucleatum promotes pro-
tumoral mechanism in oral cancer.

International Journal of Oral Science (2025)17:1 ; https://doi.org/10.1038/s41368-024-00326-8

INTRODUCTION the quality of life of patients with OSCC5. Its etiology is

Head and neck squamous cell carcinoma (HNSCC) ranks among multifactorial, among its main etiological agents are long-term
the top 10 most common cancers worldwide. Its incidence is use of tobacco, alcohol abuse, sun exposure, premalignant oral
around 4%-5% and its mortality describes 1.5% of all cancers1. lesions, viruses (HPV) and sexually transmitted diseases6. However,
Oral squamous cell carcinoma (OSCC), a subtype of HNSCC, is the lately, it has been reported high incidence and aggressive
most common oral manifestation of this cancer2. OSCC represents behaviors of OSCC, not fully explained by these risk factors, thus
90% of all oral malignancies cases, and it has a poor 5-year survival oral dysbiosis related to poor oral hygiene or periodontitis has
rate3. Despite advances in surgical management, chemotherapy been proposed as an important agent participating in OSCC tumor
and radiotherapy, these percentages have not improved4. Early development, progression and metastasis7–9. Periodontitis is a
diagnosis and management are crucial on the survival rate and chronic inflammatory disease with multiple contributing factors,

1
Molecular and Translational Immunology Laboratory, Department of Clinical Biochemistry and Immunology, Pharmacy Faculty, Universidad de Concepción, Concepción, Chile;
2
Facultad de Odontología y Ciencias de la Rehabilitación, Universidad San Sebastián, Concepción, Chile; 3Department of Computer Science, Universidad de Concepción,
Concepción, Chile; 4Facultad de Ingeniería, Universidad de Talca, Talca, Chile; 5CMA BIO BIO, Faculty of Biological Sciences, Universidad de Concepción, Concepción, Chile;
6
BIOTER Laboratory, Clinical Biochemistry and Immunology Department, Pharmacy Faculty, Universidad de Concepción, Concepción, Chile; 7Department of Pharmacology,
Faculty of Biological Sciences, Universidad de Concepcion, Concepción, Chile; 8Facultad de Medicina y Ciencia, Universidad San Sebastián, Concepción, Chile; 9MELISA Institute,
San Pedro de la Paz, Chile; 10Cancer Molecular Dynamics Laboratory, Pharmacology Department, Faculty of Biological Sciences, Universidad de Concepción, Concepción, Chile;
11
Anatomy Pathology Unit and Dental Service, Oral Pathology Department, Hospital Las Higueras, Talcahuano, Chile; 12Respiratory diseases Department, Faculty of Medicine,
Pontifical University Catholic of Chile, Santiago, Chile; 13Dentistry Faculty, Universidad de los Andes, Santiago, Chile; 14Center for Research and Innovation in Biomedicine,
Universidad de Los Andes, Santiago, Chile; 15Oral Medicine and Pathology Research Group, Faculty of Health Sciences, Universidad de Talca, Talca, Chile and 16Laboratory of
Molecular Immunology, Department of Microbiology, Faculty of Biological Sciences, Universidad de Concepción, Concepción, Chile
Correspondence: Estefanía Nova-Lamperti (enovalamperti@gmail.com)

Received: 18 April 2024 Revised: 16 September 2024 Accepted: 18 September 2024

 Host-microbe computational proteomic landscape in oral cancer revealed. . .
Muñoz-Grez et al.
2
linked to the formation of dysbiotic plaque biofilms. It is marked RESULTS
by the gradual deterioration of the structures supporting the Host and microbe computational proteomic landscape in
teeth10. In this condition, specific bacteria have been involved, oral cancer
such as the red-complex (Porphyromonas gingivalis, Tannerella The contribution of pathogens in the progression of oral cancer
forsythia, Treponema denticola) and the orange-complex (Fuso- has been suggested by several-research groups15,26,43. We have
bacterium nucleatum, Prevotella intermedia, Prevotella nigrescens, previously identified pathways associated with Vitamin
Peptostreptococcus micros, Streptococcus constellatus, Eubacterium D-mediated Th2 responses in OSCC44, however we did not
nodatum, Campylobacter showae, Campylobacter gracilis, and explore the potential pro-tumoral role of the microbiota. In this
Campylobacter rectus) bacteria11,12. Microorganisms from the study, we analyzed the host and microbe proteomic landscape in
mouth are among the most abundant in the human body, and the secretome of biopsies from patients with oral cancer
they are essential for sustaining a healthy oral environment13. compared to biopsies from healthy controls (Supplementary Table
Consequently, imbalance in the microbiome of susceptible 1). Significantly upregulated pathways were revealed in human
individuals can result in both oral and systemic diseases, including malignant samples such as response to organic substance/
periodontitis or cancer13,14. chemical, cell migration, intermediate filament cytoskeleton
The association of oral cancer and periodontitis has been organization, cell adhesion, metabolism of amino acids and
explained by the large number of periodontal bacteria detected derivatives and infectious diseases (Fig. 1a). Interestingly, several
on the OSCC tissues15. Through the advent of high-throughput, downregulated pathways in oral cancer were associated with the
next-generation sequencing (NGS), several studies have regulation of the complement cascade (Fig. 1a). We then analyze
assessed to bacterial profiles associated with OSCC, detecting activated upstream regulators by Ingenuity Pathways Analysis
a group of periodontitis-related species enriched on tumoral (IPA) and the data revealed the top 3 upstream regulators: MYC,
tissues compared to controls samples16–18. It has been reported lipopolysaccharide (LPS) and 1,2-dithiol-3-thione (D3T), suggesting
that some species could survive from both superficial and deep that gram-negative bacteria could be an important modulator of
portions of OSCC19 and their products such as enzymes cancer progression in OSCC (Fig. 1b). To evaluate the tumoral
(phospholipase, proteases, fibrinolysin, collagenases), metabolic microbiome, bacterial peptides analyzed by mass spectrometry
byproducts (fatty acids, ammonia, hydrogen sulfide) and were identified with PEAKS X+ software and label free quantifica-
endotoxins (lipopolysaccharides) could be toxic to oral epithelial tion was processed by PEAKSQ. We started with the analysis of the
cells, inducing mutations or altering signaling pathways that bacterial proteins in triplicate, obtaining 441 peptides in the
participate on proliferation and/or survival of cancer cells20, healthy control samples (Fig. 1c) and 1 131 peptides in cancer
however specific tumorigenic bacteria and the precise mechan- samples (Fig. 1d). Between conditions, a total of 337 peptides were
isms by which they influence oral cancer progression are still shared between oral cancer and healthy tissue secretomes,
unclear. whereas 794 peptides were unique for oral cancer and 104
According to previous metatranscriptomic analysis of the oral peptides were present only in the control condition (Supplemen-
microbiota associated with OSCC sites in humans, only Fusobac- tary Fig. 1A), with a different profile of differentially expressed
terium nucleatum (F. nucleatum) was highly active in OSCC peptides between healthy and malignant samples (Supplementary
tissues18. Fig. 1B). For the healthy tissue explant secretome (Control), we
F. nucleatum is a gram-negative, anaerobic, opportunistic identified bacterial peptides corresponding to Malate dehydro-
bacteria21 associated with diverse systemic diseases22,23, includ- genase from Aggregatibacter actinomycetemcomitans, Triosepho-
ing cancer. Its role as an oncogenic bacterium has been mostly sphate isomerase from Corynebacterium coyleae and Glutathione
studied on colorectal cancer24 and the mechanisms are related reductase from Listeria monocytogenes (Fig. 1c, Supplementary
to its main virulence factors25. However, researchers are Table 2). The bacterial peptides present in oral cancer explant
presently investigating the precise mechanisms by which secretomes belong mainly to F. nucleatum (Figs. 1d & 2,
periodontal bacteria, such as F. nucleatum influence oral cancer Supplementary Table 2). Thus, our results strongly suggest that
development. under pathophysiological conditions of oral cancer, the primary
In vitro and in vivo studies have proposed that periodontal bacterial colonization is likely attributed to F. nucleatum, implying
bacteria could alter tumor mass and promote tumoral growth by that this bacterium may play a pro-tumoral role.
increasing the proliferation of OSCC cells26,27 either by altering cell
cycling7,28 or causing DNA damage27. Also, they have been related Bacterial peptides from F. nucleatum are associated to the
to epithelial mesenchymal transition (EMT) by promoting the L-Glutamate degradation pathway
expression of EMT-classical markers29–33. It has been shown that After identifying F. nucleatum as the primary bacterium in OSCC,
periodontal bacteria modulate EMT phenotype in oral cancer cells we search for metabolic pathways associated with the specific
by upregulating the expression of metalloproteinases (MMP-9, bacterial peptides identified in OSCC samples. Interestingly,
MMP-1, MMP-2, MMP-10)29,34, transcription factors (STAT-3, ZEB-1, several enzymes from the L-Glutamate degradation pathway,
MYC, Snail)32 and downregulating the expression of epithelial highlighted in red, were present in malignant samples (Fig. 3a),
markers (E-cadherine, Cytokeratine 13)33. Even, the presence of suggesting that F. nucleatum catabolize L-Glutamate into butyrate
these bacteria on OSCC could modulate local immunity, upregu- (Fig. 3b). Since it has been shown that F. nucleatum metabolize
lating cytokines such as IL-8, IL-6, TNF-α, IL-1a, polymorphonuclear L-Glutamate as a major source of energy45,46, we analyze the
leukocytes (PMNs) and myeloid-derived suppressor cells (MDSCs) presence of glutamate transporters in the host proteomic dataset.
promoting an oral proinflammatory environment35 with a In this context, our proteomic results revealed that one of the
suppressed immune response which is permissive for tumor main overexpressed targets was the chaperone protein SLC3A2
progression36. In OSCC the presence of immunosuppressive (Fig. 4a). Interestingly, the cystine/glutamate antiporter (SLC7A11)
molecules or immune-checkpoint inhibitors is associated with forms a complex with the chaperone SLC3A2, known as System
early metastasis, degree of differentiation, lymph node invasion xc-47. Thus, we measured and confirmed the expression and
and poor diagnosis37–42. colocalization of SLC7A11 and SLC3A2 in the OSCC cell line HSC3
In this study, we analyzed the main host-pathogen pathways in (Fig. 4b). Therefore, we assessed whether the System xc- is
the secretome of biopsies from patients with OSCC and healthy functional for glutamate efflux in the HSC3 cell line. Our findings
controls by performing a computational proteomics landscape. revealed that HSC3 cells release glutamate into the extracellular
Then, we evaluated the protumoral mechanisms and metabolic medium in a xc- dependent manner, as the use of imidazole
pathways of the main OSCC-associated bacteria. ketone erastin (IKE), a potent and selective inhibitor of System

International Journal of Oral Science (2025)17:1

 Host-microbe computational proteomic landscape in oral cancer revealed. . .
Muñoz-Grez et al.
3
Functional enrichment analysis in GO:BP b Ingenuity pathways analysis (IPA)
Negative regulation of peptidase activity Response to organic substance Dexamethasone MYC
Negative regulation of hydrolase activity Response to chemical HNF4A Lipopolysaccharide
Negative regulation of proteolysis Tissue development Sirolimus 1,2-dithiol-3-thione
Regulation of peptidase activity Cell migration Tretinoin Nitrofurantion
Negative regulation of catalytic activity Intermediate filament cytoskeleton org... RICTOR MYCN
Negative regulation of endopeptidase... Intermediate filament-based process LARP1 IFNG
Complement activation Cell adhesion Methotrexate IL3
Negative regulation of molecular function Locomotion ST1926 YAP1
Negative regulation of protein metaboli... Anatomical structure development Estrogen receptor Methapyrilene
Regulation of proteolysis Biological process involved in symbioti... MTOR MLXIPL
Complement activation, classical path... Developmental process CLPP FN1
Humoral immune response mediated... Organonitrogen compound metabolic... SRF IL4
Complement activation, alternative pat... Protein maturation Hmgn3 VCAN
Regulation of hydrolase activity Epidermis development Valproic acid Gentamicin
Regulation of endopeptidase activity Cellular localization Tcf 1/3/4 IgG
Response to stress Regulation of cell migration MYOD1 TCR
Wound healing Protein folding Inosine 2-amino-1-methyl-6-phenylimidazo-4-...
Proteolysis Cell motility Epigallocatechin-gallate INSR
Humoral immune response Cellular response to chemical stimulus Cardiotoxin LRP1
Response to stimulus Cell killing Semaxinib Tunicamycin
Response to wounding Multicellular organismal process Resveratrol TgF beta
Regulation of protein metabolic process Regulation of cell adhesion Brd4 PLAUR
Organonitrogen compound metabolic... Response to inorganic substance 3,5-diiodothyronine PRKCA
Protein metabolic process External encapsulating structure orga... UDP-D-glucose ETV5
Regulation of molecular function Regulation of cell motility RB1 CIP2A
Regulation of catalytic activity Positive regulation of cellular process ABCA1 CD3
Muscle system process Positive regulation of biological process ESRRG Lh
Circulatory system development Anatomical structure morphogenesis KDM6A PML
Supramolecular fiber organization Organic substance catabolic process Gefitinib GAST
Muscle filament sliding Biological process involved in interacti... LEPR CCND1
0 10 20 30 0 2 4 6 8 Regulation type 0 5 10 15 20 25 0 10 20 30 40 Regulation type
-Log10 adj P-value -Log10 adj P-value Activated -Log10 adj P-value -Log10 adj P-value
Inhibited Activated
Inhibited

c
Control 2 497 Control 2 498

68
22 35

441
Aggregatibacter
67 1 actinomycetemcomitans

20
Ralstonia
Control 2 499 pickettii

Campylobacter
sputorum
Peptide
Liseria Cupriavidus
monocytogenes gilardii
Protein
Desulfomicrobium
Bacteria Corynebacterium
coyleae
orale

Total

d
Cancer 2 501 Cancer 2 502 Fusobacterium
Fusobacterium hwasookii
gonidiaformans
Fusobacterium
124 periodonticum
Fusobacterium
345 184 Agrobacterium necrophorum Moraxella
osloensis
Tumefaciens

Peptostreptococcaceae
1131 Streptococcus
mitis XIG-1

254 130 Fusobacterium

Sp.

Mesorhizobium Treponema
198 loti medium

Peptoniphilus
Cancer 2 503 lacrimalis

Treponema
Fusobacterium nucleatum Mycoplasma
orale
vincentii
Peptide Bosea
vestrisii

Protein
Bacteria
Total
Fig. 1 Computational proteomic analysis of host-microbe interactions in oral cancer. a Gene ontology functional enrichment analysis in
biological process (GO:BP) and b Upstream regulator analysis in Ingenuity Pathways Analysis (IPA) of activated (red) and inhibited (blue)
pathways identified in human malignant samples in comparison with healthy samples. c Venn diagram of peptides from healthy samples
triplicates and the identification of unique healthy-samples proteins (pink circle) with the corresponding peptides (white circle) from specific
bacteria. d Venn diagram of peptides from malignant samples triplicates and the identification of unique malignant-samples proteins (pink
circle) with the corresponding peptides (white circle) from specific bacteria

xc-48, significantly reduced L-glutamate efflux (Fig. 4c). We System xc-. At the same time, our data showed that the presence
confirmed that IKE inhibited the expression of SLC7A11 without of F. nucleatum promotes the overexpression of SLC7A11 in HSC3
affecting cell survival in HSC3 cells (Supplementary Fig. 2). Then, cells (Fig. 4e). Finally, F. nucleatum infection was evaluated in the
we analyzed the effect of F. nucleatum in the xc- System and we presence of IKE and we observed that the inhibition of the System
observed that the presence of the bacterium was promoting the xc- reduced the infection capacity of F. nucleatum by using
L-Glutamate efflux, an effect selectively inhibited by IKE (Fig. 4d), IncuCyte® Live-Cell Analysis System (Fig. 4f) and flow cytometry
suggesting that F. nucleatum induces L-Glutamate efflux via the (Fig. 4g) in live HSC3 cells. In summary, our data suggest that the

International Journal of Oral Science (2025)17:1

 Host-microbe computational proteomic landscape in oral cancer revealed. . .
Muñoz-Grez et al.
4
Agrobacterium tumefaciens Thymidine phosphorylase
Mesorhizobium loti Thymidine phosphorylase
Bosea vestrisii ATP synthase subunit alpha
Campylobacter concisus
Campylobacter curvus Arginine deiminase
Campylobacter gracilis Isocitrate dehydrogenase [NADP]
Campylobacter showae Pyrimidine-nucleoside phosphorylase
Campylobacter sputorum
Campylobacter ureolyticus Acyl-CoA dehydrogenase
Desulfomicrobium orale
Desulfovibrio fairfieldensis
Haematobacter missouriensis
Helicobacter pylori
Mycoplasma orale Hypothetical protein
Neisseria perflava
Streptococcus mitis
Putative FAD-linked oxidoreductase
Flavodoxin
Acetate CoA-transferase subunit alpha
Alkyl hydroperoxide reductase subunit C

Chaperone protein DnaK

Elongation factor Tu
Fusobacterium nucleatum
NAD-specific glutamate dehydrogenase

Acyl-CoA dehydrogenase short-chain specific

Solute-binding protein
(R)-2-hydroxyglutary1-CoA dehydratase subunit beta

D-galactose-binding periplasmic protein

Moraxella osloensis
Peptoniphilus lacrimalis Elongation factor G
Treponema medium
Fusobacterium gonidiaformans Enolase
Treponema vincentii
Fusobacterium periodonticum Glutaconate CoA-transferase subunit A

Trigger factor
Fusobacterium sp.
Elogation factor Ts
Outer membrane porin F
Fusobacterium hwasookii Acetyl-CoA acetyltransferase
Pyruvate synthase
Peptostreptococcaceae XIG-1 Glyceraldehyde-3-phosphate dehydrogenase
Fusobacterium necrophorum Alkyl hydroperoxide reductase C

Fig. 2 Distribution of proteins among bacterial species identified in OSCC secretome. Sankey diagram representing the protein distribution
between bacterial species identified in oral cancer explants

System xc- (SLC7A11 and SLC3A2) (Fig. 4h.1) is exacerbated by the cell migration. To confirm the effect of F. nucleatum on cell
presence of F. nucleatum, promoting more L-Glutamate efflux and migration, cell counting was evaluated in the supernatant of
bacterial infection (Fig. 4h.2). tumourspheres and by transwell assay (Fig. 6d, e). In both cases,
this periodontal bacterium significantly increased the number of
Tumoral growth and OSCC cells migration is promoted by F. cells in the supernatants surrounding the tumorspheres (Fig. 6d)
nucleatum infection and through transwell in vitro migration (Fig. 6e). These results
According to the host pathways observed in Fig. 1 and the suggest that F. nucleatum infection in OSCC promotes a more
infection revealed in Fig. 3, 4, we evaluated whether F. nucleatum aggressive phenotype of this type of cancer, enhancing tumor
affect cell migration after HSC3 infection. The internalization of F. growth and increasing migration.
nucleatum into the HSC3 cell was confirmed by live-cell confocal
images, after 6 h of culture. F. nucleatum was observed inside live F. nucleatum induces EMT markers expression on OSCC cells
cancer cells at 6 h postinfection, where propidium iodide (magenta As we observed a potential EMT behavior in OSCC cells after F.
label) was used to detect dead bacteria or dead HSC3 cells, thus nucleatum infection and based on the increased tumor size and
bacterial infection did not induce cancer cell death (Fig. 5). To cell migration, we evaluated the expression of E-cadherin (EMT
discard the possibility that F. nucleatum was attached to the cell markers) and MPMP-9 in HSC3 cells after 6 h of F. nucleatum
surface and not inside of HSC3, cells were cultured in the presence infection. The mRNA MMP-9 expression was significantly higher
of antibiotic with broad-spectrum anaerobic activity, metronida- on OSCC cells after F. nucleatum infection and mRNA E-cadherin
zole and gentamicin, to kill bacteria outside the cells after infection. expression significantly decreased after the co-culture with the
In addition, we confirmed F. nucleatum entrance to HSC3 cells by bacteria (Fig. 7a). To further investigate EMT the acquisition of the
3D confocal images and video (Supplementary Fig. 3). Interestingly, mesenchymal phenotype, we performed a Proteome array for
at longer infection time points (48 h), OSCC cells started to detach cancer proteins. Human XL Oncology Array Kit exhibited 26
(data not shown). The effect of F. nucleatum on tumoral growth differentially expressed proteins in the cellular lysate and 13
was evaluated by 2D (monolayer) and 3D (tumorsphere) model of differentially expressed proteins in the supernatant of HSC3 cells
oral cancer. First, we performed a monolayer infection assay for after 24 h of F. nucleatum infection (Supplementary Fig. 5A).
24 h, where the cell counting revealed a significant increase of F. FOXO1/FKHR, MMP-3, MMP-9 and SerpinE1 were significantly
nucleatum-infected HSC3 cells in comparison with non-infected higher expressed on HSC3 cellular lysate, after F. nucleatum
cells (Fig. 6a). In accordance with the increased cell counts in infection, whereas survivin, ERB2, ICAM-1, DLL-1 and E-cadherin
infected cells, we evaluate the effect of the bacteria regarding significantly decreased after F. nucleatum infection (Fig. 7b &
tumorsphere formation and cell detachment from the 3D tumor- Supplementary Fig. 5B). Proteins from supernatants from infected
sphere (Supplementary Fig. 4). Our results revealed that the area of and non-infected OSCC cell cultures were also evaluated with the
tumorspheres from infected cells shown in Supplementary Fig. 4 Human XL Oncology Array Kit (Fig. 7c). Progranulin, GM-CSF,
was significantly larger than the tumorsphere from non-infected Cathepsin S, Serpin B5/Maspin and EGFR significantly increased
cells (Fig. 6b). Moreover, the area of isolated cells detached from their expression on supernatants from HSC3 infected cells (Fig. 7c).
spheroids in infected tumourspheres was higher in comparison Finally, we evaluated the presence of EMT proteins in the human
with non-infected tumourspheres (Fig. 6c), thus F. nucleatum not secretome dataset obtained from OSCC and control tissues and
only increased spheroids size over time, but also promoted cancer we observed significant downregulation of epithelial marker

International Journal of Oral Science (2025)17:1

 Host-microbe computational proteomic landscape in oral cancer revealed. . .
Muñoz-Grez et al.
5
a Gene proteomic-derivated found in glutamate pathways
Genes fetched
3-thia-L-glutamate biosynthesis
All
4-hydroxy-4-methyl-L-glutamate biosy... Found
5-oxo-L-proline metabolism
D-glutamate degradation
L-arginine degradation I (arginase pat...
L-glutamate and L-glutamine biosynth...
L-glutamate biosynthesis I
L-glutamate biosynthesis II
L-glutamate biosynthesis III
L-glutamate biosynthesis IV
L-glutamate biosynthesis V
L-glutamate degradation I
Pathways

L-glutamate degradation II
L-glutamate degradation IX (via 4-ami...
L-glutamate degradation V (via hydrox...
L-glutamate degradation VI (to pyruvate)
L-glutamate degradation VII (to butan...
L-glutamate degradation X
L-glutamate degradation XI (reductive...
L-glutamate biosynthesis I
L-proline biosynthesis I (from L-gluta...
Glutamate removal from folates
Poly-γ-D-glutamate biosynthe...
Superpathway of heme <i>b</i> biosy...
Tetrapyrrole biosynthesis I (from gluta...
0 5 10 15 20 25 30 35 40
Count of records

Gene proteomic-derivated found in glutamate pathways

L-proline biosynthesis I (from L-gluta... Genes fetched
All
L-glutamate degradation V (via hydrox... Found
L-glutamate degradation Vl (to pyruvate)
Pathways

L-glutamate degradation Vll (to butan...

L-glutamate degradation Xl (reductive...
Superpathway of heme <i>b</i> biosy...
Tetrapyrrole biosynthesis I (from gluta...
0 2 4 6 8 10 12 14 16 18 20 22
Count of records

b L-glutamate
NAD+
Glutamate dehydrogenase H2O
(NAD dependent) H+
Pa-gdhA NADH
Ammonium

2-oxoglutarate

H+
2-Oxoglutarate reductase NADH
(Pa)
NAD+

(R)-2-hydroxyglutarate

(R )-2-hydroxyglutarate Acetyl-CoA
CoA-transferase
Acetate
Af-gctA Af-gctB

(R)-2-hydroxyglutaryl-
CoA

(R )-2-hydroxyglutaryl-
CoA-dehydratase
H O
Af-hgdA Af-hgdB 2

(E )-glutaconyl-CoA

Na+
Glutaconyl-CoA decarboxylase
H+
Af-gcdA Af-gcdB Na+
Af-gcdC Af-gcdD CO2

Crotonyl-CoA

H 2O Acyl-CoA dehydrogenase
short-chain specific
(S )-3-hydroxybutanoyl- ACADS
CoA

NAD+
H+
NADH Butanyl-CoA

Acetoacetyl-CoA
Acetate CoA-transferase
Acetyl-CoA Acetate
Coenzyme A subunit alpha
acetyltransferase
ctfA
ACAT
2 acetyl-CoA Aceyl-CoA
Butanoate

Acetate and ATP formation from acetyl-CoA Acetate and ATP formation from acetyl-CoA

Fig. 3 Metabolic pathways of L-Glutamate degradation are associated to F. nucleatum pepetides. a Bar chart of unsupervised and reproducible
analysis of 25 metabolic pathways from MetaCyc containing 135 unique protein-encoding genes (in gray), from which the presence of
protein-encoding genes derived from the oral malignant microbiome from F. nucleatum (in red) were present in metabolic pathways
associated with L-Glutamate degradation, but not in L-Glutamate biosynthesis pathways. b Schematic representation of F. nucleatum enzymes
found in the proteome of malignant samples (red) within the L-glutamate degradation pathway

International Journal of Oral Science (2025)17:1

 Host-microbe computational proteomic landscape in oral cancer revealed. . .
Muñoz-Grez et al.
6
SLC3A2 b c 5.0
d 8 e
50 * ** ***
***

L-Glutamate/(Pmol/L)
L-Glutamate/(Pmol/L)
Quantitative value 40 6
4.5 F.n – +
30 4 SLC7A11
35 kD
20 4.0 42 kD
2 Actin
10
3.5 0
0
SLC3A2-Cy2 IKE- IKE+

n-

n+

E+
F.

F.

IK
l-S

-S

SLC7A11-Cy3

n+
C
tro

SC

F.
on

O
C

f h 1 Glutamate Cystine

10
**
% MTG-F.n+ HSC-3 cells

IKE-
8
3A2
SLCA

6 SLC7A11

4
Glutamate Cystine

2
IKE+
0 O O
2 HO OH
IKE- IKE+ NH2

Glutamate Cystine Glutamate Cystine

g
25 IKE- IKE+
**
% MTG-F.n+ HSC-3 cells

20
104 104 2
SLCA3A
CFSE CFSE SLCA3A
2
CFSE-FN

15
14.8 3.83 SLC7A11 SLC7A11
103 103
10

5 102 102
Glutamate Glutamate
0 0
Cystine
0 –102 –102 Cystine

–103 0 10
3
IKE- IKE+ 104 105 –103 0 103 104 105
Live dead Live dead

Fig. 4 The L-Glutamate degradation pathway shows an association with bacterial peptides derived from F. nucleatum. a Scatter plots of
quantitative value of SLC3A2 from the human proteomic dataset in Fig. 1. b Confocal image of the cystine/glutamate antiporter (System xc-)
showing the expression and colocalization of SLC3A2 (green) and SLC7A11 (red) in HSC3 cells. c Scatter plots of extracellular L-glutamate from
HSC3 cell cultures in the presence or absence of the Imidazole Ketone Erastin (IKE) and d in HSC3 cells uninfected or infected with F. nucleatum
for 24 h. e Western blot of SLC7A11 in the HSC3 cells uninfected or infected with F. nucleatum for 24 h. f Scatter plots and representative
images or dot plots of bacterial infection in the absence or presence of IKE by Incucyte and g Flow cytometry. h Schematic overview of F.
nucleatum influencing the System xc- and L-Glutamate efflux. For all statistical analysis T test was used, ****P < 0.000 1, ***P < 0.001, **P < 0.01
and *P < 0.05 were considered significant

Death marker 5 Pm
Nucleus Membrane F.nucleatum Merge
5 Pm 5 Pm 5 Pm 5 Pm

Fig. 5 Confocal images of Oral cancer cells after 6-hour infection with F. nucleatum. Confocal images of HSC3 cells infected with F. nucleatum
(6 h). Bacteria was stained with CSFE (red) previous the infection. HSC3 were stained with Hoechst (blue), plasma membrane cell mask deep
red (green) and propidium iodide (magenta) to confirm bacteria viability

E-cadherin and an upregulation of mesenchymal markers MMP-9 Butyrate stimulates tumor growth in a dose-dependent manner in
(Fig. 7d). In addition, Cathepsin S and EGFR were also upregulated OSCC tumorspheres
in cancer secretomes in comparison to control samples (Fig. 7e). Butyrate was the main metabolite derived from the
Collectively, these findings provide further support the hypothesis L-Glutamate degradation pathway (Fig. 3b) and it has been
that F. nucleatum infection in OSCC contributes to a more associated with cancer progression49. In this scenario, the
aggressive phenotype by inducing EMT. effect of butyrate on OSCC tumorspheres growth was

International Journal of Oral Science (2025)17:1

 Host-microbe computational proteomic landscape in oral cancer revealed. . .
Muñoz-Grez et al.
7
a Cell count HSC3 24th
20

Cell count of live cells/

**

1000 counting beads

15
Monolayer cell
counting 10

0
Control F.n

Tumorsphere
b c Tumorsphere-derived cells

Tumorsphere-derived
6 **** 4
Tumorsphere area/

**** Area ***

cells area/Pm2
3
4 isolated cells **
** Control Control
Pm2

Area F.n 2 F.n

tumorsphere 2
1

0 0
3 6 10 3 6 10
Time/d Time/d

d Supernatant HSC3 e Migrated HSC3 cells

cells
250 40

Cell count of live cells/

Cell count of live cells/

1 000 counting beads

1 000 counting beads

** **
200 30
Supernatant 150 20
HSC3 cells
100 10
50 0
Migrated HSC3 cells
0 -10
Control F.n Control F.n

Fig. 6 F. nucleatum infection drives tumoral growth and enhances the migratory behavior of OSCC cells. a Representative schema and scatter
plot of cell counting of uninfected or F. nucleatum-infected HSC3 cells in monolayer (24 h). b Representative schema and point-&-connection
line plot of tumourspheres area of uninfected or F. nucleatum-infected HSC3 cells at day 3, 6 and 10. c Representative schema and point-
&-connection line plot of isolated cells from tumorsphere of uninfected or F. nucleatum-infected HSC3 cells at day 3, 6 and 10. d Representative
schema and scatter plot of isolated HSC3 cells in supernatants from tumourspheres of uninfected or F. nucleatum-infected HSC3 cells after 6
days of infection. e Representative schema and scatter plot of isolated HSC3 cells in supernatants from de lower chamber of transwell from
tumourspheres of uninfected or F. nucleatum-infected HSC3 cells after 6 days of infection. Data are presented as individual symbols with
paired lines (Paired t test). For statistical analysis, Two way ANOVA and T test were used,****P < 0.000 1, ***P < 0.001, **P < 0.01 and *P < 0.05
were considered significant

evaluated by challenging them with increasing concentrations complement proteins from the human secretome dataset and
of butyrate (Fig. 8a). Kinetic graphic showed that butyrate we observed that most complement proteins in OSCC samples
stimulates tumorsphere growth at day 7 using 100 and 1 were reduced in comparison with the control samples (Fig. 10a).
000 nmol/L of butyrate (Fig. 8b, c), however, the highest Complement proteins were then measured in the secretome to
concentration tested (10 μmol/L) tested did not change validate the differences observed in the proteomic data. Our data
tumorsphere size (Fig. 8b, c). Thus, it is tempting to speculate showed that complement proteins C3a and C4a were reduced in
that F. nucleatum may incorporate the glutamate released from OSCC secretome compared to the control secretome (Fig. 10b).
OSCC tumor cells, metabolize it into butyrate, which could Overall, our data showed a potential dysregulation of the
subsequently be utilized by tumor cells to promote their complement cascade in cancer samples. Further studies are
growth. required to understand the dual role of these soluble factors
between tumor progression and the antitumor immune response.
Increased GAL-9 on OSCC-infected cells
OSSC behavior is impacted by the presence of immunosuppres-
sive molecules, especially on the response of tumors to DISCUSSION
immunotherapy, chemotherapy, and radiotherapy50. CD39, Oral microbiome imbalance of susceptible individuals can lead to
CD73, Galactine 9, CD155 and PDL-1 has been described as the development of both oral and systemic diseases. In this study
immunosuppressive molecules in OSCC cells37,39,40,42,51. In this we identified the host-pathogen pathways from the secretome of
context, we evaluated the expression of these molecules after 24 h OSCC biopsies compared with healthy biopsies. Markedly
of F. nucleatum infection. We noticed that CD39 is not expressed increased activity in pathways related to responses to LPS, cell
by HSC3 cells whereas CD73, CD155 and PDL-1 are fully expressed migration, organization of intermediate filament cytoskeleton, cell
by these cancer cells, and their expression did not change with F. adhesion and amino acid and derivative metabolism were
nucleatum infection (Fig. 9). Interestingly, Gal-9 showed differential detected in human malignant samples, and interestingly, path-
expression after F. nucleatum infection. In fact, the periodontal ways associated with the regulation of the complement cascade
bacteria significantly increased Gal-9 in OSCC cells (Fig. 9). were found downregulated in oral cancer. Microbiome proteomics
results reveled that F. nucleatum has the higher presence of
Complement proteins in oral cancer peptides on OSCC secretome compared with control and notably,
Since the complement system was downregulated in the host various enzymes associated with the L-Glutamate degradation
proteomics and this cascade has been associated with innate pathway were detected in the OSCC samples, indicating the
responses against pathogens52,53, we evaluated the main involvement of F. nucleatum in the catabolize of L-Glutamate into

International Journal of Oral Science (2025)17:1

 Host-microbe computational proteomic landscape in oral cancer revealed. . .
Muñoz-Grez et al.
8
a E-cadherin MMP9 b HSC3 lysate

Normalized gene expression

Normalized gene expression 3
**
1.5 ***
E-cadherine/RPLPO

MMP9/RPLPO
1.0 2 Samples
Cancer
CXCL 8 (IL-8) 0
Control
0.5 1 Amphiregulin
Galactin 3 -0.5

0.0 0 Uplasminigen activator

Control F.n Control F.n -1
Cathepsina S
Enolase -1.5
Axl
c HSC3 supernatant -2
Progranulina
Dkk-1

Samples EGFR
0 Cancer Cap G
Uplasminogen activator Control
-0.5
Epcam/TROP
DKK Serpin B5
-1
Amphiregulin FGF basic
-1.5 Survivin
Progranulina
-2
Cathepsina B
GM-CSF
Cathepsina D
CXCL 8 (IL-8)
GM-CSF
Serpin E1/PAl-1 Serpin E1
ERB2
MMP-3
DLL-1
AXL
ICAM-1
Cathepsin p E-cardherin
Serpin B5/maspin MMP-3

EGFR MMP9
FOXO1/FKHR
Cathepsin S
HSC3_1 HSC3_2 HSC3.F.n_1 HSC3.F.n_2
HSC3_1 HSC3_2 HSC3.F.n_1 HSC3.F.n_2

d HSC3 lysate markers in secretomes e HSC3 supernatant markers in secretomes

MMP-9 EGFR Cathepsin S
E-cadherin
80 *** 20 **** 50 **** 10
*
Quantitative value

Quantitative value
Quantitative value

Quantitative value

15 40 8
60
10 30 6
40
5 20 4
20 10 2
0
0 -5 0 0
l-S

-S
l-S

-S
l-S

-S

l-S

-S

C
C
C

tro
C

tro
tro

tro

SC
SC
SC

SC

on
on
on

on

O
O
O

C
C
C

Fig. 7 F. nucleatum promotes ETM markers expression in OSCC. a Symbols and line plots of E-cadherin and MMP9 mRNA expression
uninfected or F. nucleatum-infected HSC3 cells in monolayer (6 h). Data are presented as individual symbols with paired lines (Paired t test).
b Differential protein expression heatmap of EMT markers from lysate of uninfected or F. nucleatum-infected HSC3 cells in monolayer (24 h).
c Differential protein expression heatmap of EMT markers from supernatants of uninfected or F. nucleatum-infected HSC3 cells (24 h). d, e
Scatter plots of quantitative value of E-cadherin, MMP9, EGFR and Cathepsin S from the human proteomic dataset in Fig. 1. For statistical
analysis, Sidaks multiple comparisons and T test were used, ****P < 0.000 1, ***P < 0.001, **P < 0.01 and *P < 0.05 were considered significant

butyrate. Also, we observed that bacterium promote the inflammatory and oncogenic reactions25. In addition, FadA
L-Glutamate efflux from HSC3 by the System xc-. As proteins activate cadherin/β-catenin pathway of cancer cells, leading to
associated with cancer growth and EMT markers were identified upregulation of chk2, a checkpoint enzyme, responsible of DNA
on OSCC secretome, we demonstrated in vitro, the protumoral damage27,56. Based on our results and previous studies, F.
mechanisms of F. nucleatum in an OSCC cell line. nucleatum participates on OSCC progression through several
From the last past decade, numerous scientific findings have mechanism. Recently, Kamarajan et al., reported that F. nucleatum
illustrated the changed bacterial colonization in cancerous tissue. enhanced tumorsphere formation and cell migration/invasion via
Hooper et al., detected for the first time viable bacteria within the integrin/TLR pathway and Nisin, an antibacterial peptide produced
tissue of oral squamous cell carcinoma19,54 and with emergence of by commensal bacteria26. Our resulted showed cancer cell
NGS, several studies have assessed to bacterial profiles associated migration and tumorphere formation promoted by the bacteria,
with OSCC15–18. However, recent research has focused on but we also observed higher cell detachment from the tumor-
identifying the specific bacteria and their mechanism participating sphere associated to F. nucleatum infection. Likewise, butyrate, a
on OSCC development and progression. According to our analysis, derivates metabolic product of the bacteria, also modulated
F. nucleatum was the main bacteria detected in malignant tissues. tumorphere formation. Butyrate is produced by periodontal
This bacterium has been recognized as an oncogenic bacteria, pathogens fermentation in the oral cavity and it has been
especially on colorectal cancer, according to its virulence factors24. demonstrated to contribute to the occurrence and development
For example, the fusobacterial adhesin (FadA) is one of the main of periodontitis57. Its role in cancer is controversial, some studies
virulence factor from F. nucleatum55 and its binding to E-cadherin postulated antitumoral effects58, based on its great efficiency in
in cancer cells activates b-catenin signaling and regulates the maintaining intestinal epithelial barrier function and regulating

International Journal of Oral Science (2025)17:1

 Host-microbe computational proteomic landscape in oral cancer revealed. . .
Muñoz-Grez et al.
9
a Day 1 Day 3 Day 7

Ctrl

b Control
HCS3 time plot
Butyrate 1 nmol/L

Brightfield area/Pm2
Butyrate 10 nmol/L
Butyrate 1 nmol/L

1.0×105
Butyrate 100 nmol/L
Butyrate 1 000 nmol/L
7.5×104
Butyrate 10 Pmol/L

5.0×104
Butyrate 10 nmol/L

0 2 4 6
Time/d
Butyrate 10 Pmol/L Butyrate 1 000 nmol/L Butyrate 100 nmol/L

c ***
**
1.2×105
Control
Brightfield area/Pm2

1.0×105 Butyrate 1 nmol/L

Butyrate 10 nmol/L
8.0×104
Butyrate 100 nmol/L
6.0×104 Butyrate 1 000 nmol/L

4.0×104 Butyrate 10 Pmol/L

7 DIV

Fig. 8 Butyrate intermediate concentrations encourage HSC3 tumorsphere growth. a Representative images by live cell microscopy using the
IncuCyte system to determine HSC3 tumorsphere growth, after being challenged with different concentrations of butyrate. b Time plot of
HSC3 tumorsphere size after butyrate treatment for 7 days. c HSC3 tumorsphere size after butyrate treatment at day 7. Data represent the
mean ± SEM of at least 3 independent biological replicates. Data represent the mean ± SEM of at least 3 independent biological replicates. t
test student, **P < 0.01; ***P < 0.001

host mucosal immune responses59, however, other researchers and MMP-1 after poli infections, nevertheless showed that F.
have elucidated protumoral effects on OSCC. According to Zang nucleatum alone had comparable or greater effects than the four
et al., butyrate could promoted cell migration, invasion and the bacteria together29. Our data revealed increased levels of MMP-9
expression of EMT markers such as SNAI1 and Vimentin in oral on infected cancer cells, but also decreased levels of E-cadherin
cancer cells49. We observed both effects associated to butyrate after the infection, which is described as a key event of EMT,
concentrations, intermediate concentrations stimulate tumor- permitting the separation of individual cells from the primary
sphere growth, but higher concentrations did not affect the tumor mass, and therefore promoting cancer invasion62.
tumorsphere size. On another hand, it is well characterized that F. nucleatum can
Indeed, the most associated protumoral mechanism of F. induce significant changes in the expression of genes related to
nucleatum is EMT. EMT, or epithelial-mesenchymal transition, is a immune defense responses during periodontal diseases63. More-
dynamic and reversible process in which epithelial cells undergo a over, according to prior reports, F. nucleatum modulates the local
transformation into a mesenchymal cell phenotype. This transfor- immunity of cancers by creating a permissive tumor microenvir-
mation is marked by a notable increase in the production of onment, insensitive to pro inflammatory signals, with low
extracellular matrix (ECM) components, enhanced migratory TLR4 signaling and recruitment of type 2 Macrophages64. Our
capability, increased invasiveness, and a resistance to apoptosis60. in vitro results illustrated differential expression of immunosup-
Our findings suggested the acquisition of this phenotype by the pressive markers on oral cancer cells after F. nucleatum infection.
oral cancer cells, after F. nucleatum infection. This phenomenon Gal-9 was highly expressed on infected cells; it has been previous
has been studied by several researchers in both oral and colorectal identified on OSCC lesions and it has been proposed as an
cancer30,61 principally by the expression of classical markers on important marker on differential diagnosis between oral squa-
cancer cells, after the infection. Harrandah et al., reported mous cell carcinoma and other oral lesions65. It has immunor-
increased expression of mesenchymal markers such as MMP-9 egulatory properties, inducing Treg expression via TGF-β and Th1

International Journal of Oral Science (2025)17:1

 Host-microbe computational proteomic landscape in oral cancer revealed. . .
Muñoz-Grez et al.
10

Unstained

HSC3 control

HSC3 F.n

-103 0 103 104 105 -103 0 103 104 105 -103 0 103 104 105 -103 0 103 104 105 -103 0 103 104 10
5

CD39 CD73 CD155 PD-L1 GAL-9

CD39 CD73 CD155 PDL-1 GAL-9

100 100 100 100 15
**
80 80 80 80
Percentage/%

Percentage/%

Percentage/%

Percentage/%

Percentage/%
10
60 60 60 60

40 40 40 40
5
20 20 20 20

0 0 0 0 0
Control F.n Control F.n Control F.n Control F.n Control F.n

Fig. 9 GAL-9 is induced on OSCC cells after F. nucleatum infection. Histograms and total percentage of cells expressing CD39, CD73, CD155,
PDL-1 and GAL-9 from uninfected or F. nucleatum-infected HSC3 cells (24 h). For all statistical analysis, T test was used, ****P < 0.000 1,
***P < 0.001, **P < 0.01 and *P < 0.05 were considered significant

apoptosis by Tim-3/Gal-9 pathway38,66. Furthermore, we identified of other strains present in the tumor environment were not
significantly decreased expression of DLL-1, which is part of explored in depth. Third, F. nucleatum was not measured in the
Notch/DLL-1 pathway associated to enhance T cell infiltration into periodontal plaque of the patients.
tumors and elevated numbers of CD44+CD62L+CD8+ memory Taken together this evidence, oral dysbiosis and the
T cells67. The differential expression of these molecules after F. presence of specific bacteria in the tumor environment seems
nucleatum infection could alter antitumoral immune responses to play an important role in the prognosis of prevalent
and indeed enhance tumoral growth and progression. malignant diseases, so it is crucial to establish preventive
Since F. nucleatum was the main specie detected in the measures associated with periodontal health care, both in
secretome of OSCC, the tumor-colonization skills of this bacteria healthy and OSCC patients, and thus contribute to a better
were another important aspect to evaluate. The mechanisms that prognosis, response to treatment and therefore a better quality
allow its colonization are still unclear, however, according to our of life for them.
findings, we proposed that is through its metabolic pathways. F.
nucleatum appears to be one of the few anaerobic bacteria that Methodology
can obtain energy also from amino acids. Indeed, it can survive by Patient data. Patients with and without OSCC were selected and
obtaining energy only from the degradation of L-glutamate46,68. consented in accordance with the Talcahuano Health Service
Surprisingly, several enzymes from the L-Glutamate degradation Research Ethics Committee, reference number 19-06-11 and
pathway were identified in the OSCC samples and thus we Concepcion Health Service Research Ethics Committee, reference
confirmed that HSC3 was able to efflux L-Glutamate to the number 19-03-07 and in accordance with the Declaration of
extracellular by the System xc-. Previous studies have reported the Helsinki. Patient data is summarized in Supplementary Table 1.
expression of this antiporter and glutamate receptors on oral OSCC and healthy biopsies were obtained from patients, after
cancer cells69,70, however, we evaluated for the first time the link informed consent was approved.
of the periodontal bacteria and the System xc-. It seems that the
System xc- plays and important role during F. nucleatum infection Sample collection and processing. The biopsies obtained were
in cancer cells, because the bacterium significantly promoted transported to the laboratory in 10 mL of serum-free X-VIVO15
L-Glutamate efflux from HSC3 and the expression of SLC7A11 in medium (LONZA) at 4 °C and processed in a time course of 2-3 h.
HSC3 cells, but when an inhibitor of this antiporter was applied, For secretome collection, a piece of tissue (weight approximately
the effects were reverted. Based in our data, we believe that F. 0.1 g) was cut from the oral cancer and control biopsies and
nucleatum take advantage of glutamate to colonize and infect incubated in serum-free X-VIVO15 (LONZA) medium for 48 h at
OSCC cells, promoting the expression of the System xc- to enhance 37 °C. After incubation, the medium was collected, debris was
the glutamate efflux, allowing more colonization in a positive removed by centrifugation and filtration (0.22 μm), and the
feedback manner. medium with all proteins and factors secreted from the tissue
Additionally, the secretome analysis revealed a potential (Secretome) was stored at −80 °C until use. Data were obtained
dysregulation in the complement cascade in OSCC, illustrated by from a triplicate analysis of 2 conditions: 500 μL of Secretome
reduce levels of proteins C3a and C4a. The complement cascade “OSCC” and 500 μl of Secretome “Healthy Control”. Each of these
plays an important role in the innate response against bacterial two conditions consists of a pool of secretome samples (100 μL
infection and in the recruitment and regulation of inflammatory each) from 5 OSCC patients and 5 control individuals. In addition,
cells, participating in the pathogenesis of periodontitis52. The an X-VIVO15 medium condition was analyzed only in order to rule
reduced levels of complement proteins could also favor bacteria out potential contaminants from the medium, since this medium
colonization into OSCC cells. was used for secretome collection. Once the samples were
This study has the following limitations. First, in vivo studies are selected and both pools were generated, protease inhibitor and
required to confirm F. nucleatum protumoral mechanisms 1X phosphatase were added. The samples were cold homo-
identified in our in vitro data. Second, it is well known that the genized using ultrasound and centrifuged to remove debris.
oral microbiome is a complex ecosystem. The interactions of F. Subsequently, the proteins contained in the samples were
nucleatum with other bacteria/microorganisms and the existence precipitated using cold acetone overnight at −20 °C. The proteins

International Journal of Oral Science (2025)17:1

 Host-microbe computational proteomic landscape in oral cancer revealed. . .
Muñoz-Grez et al.
11
a Complement cascade
Control OSCC
C3
CFH
C4A/C4B
C4B
C4A/C4B C4A
C8A C1q
CFB
C5
C1R CFl
C3 C9

Complement cascade
C5 C4 C2 C8B
CFHR1
C8B C1R
C2 C4a C4b2a C2b C8A
C6 C6
C3 C7
C8G C8G
C1RL C3a C2
C1S C3b CFD
C1S
C7 C4b2a3b C3bBb3b CFHR2
C9 C1RL
C1QC C6 CD55
C5 C5b C7 C1QBP
C4BPA C8 CD93
C1QB C5a C9

0
200
400
600
0 1 2 3 4 5
Control OSCC
Log(1/P value) C1QC
C1QB
2 4 6 8 10

b C4a C3a C5a

3 000 ** 1 500 ** 1 500
hu C4a/(pg/mL)

hu C3a/(pg/mL)

hu C5a/(pg/mL)
2 000 1 000 1 000

1 000 500 500

0 0 0
l

C
tro

tro

tro
SC

SC

SC
on

on

on
O

O
C

Fig. 10 Complement cascade proteins identified on OSCC secretome. a Plots, schematic representation, and differential protein expression
heatmap of proteins from the complement cascade protein from the proteomic dataset in Fig. 1. b Scatter plots of soluble C4a, C3a and C5a in
control and OSCC secretome. For all statistical analysis, T test was used, ****P < 0.000 1, ***P < 0.001,**P < 0.01 and *P < 0.05 were considered
significant

obtained were dried in a rotary concentrator at 4 °C. The samples Bacterial automatics glutamate pathway search in Metacyc. The
were resuspended in urea and bicarbonate, reduced with identification of genes derived from the proteomics analyzes in
dithiothreitol (DTT), alkylated with iodine acetamide and subse- the metabolic pathways involved in L-glutamate was automated.
quently diluted with ammonium bicarbonate. The samples were A code was developed in python that consists of three steps: i)
digested with Trypsin/Lys-C overnight at 37 °C and the peptides identification of the genes derived from the proteins identified in
obtained were dried in a rotary concentrator at 4 °C and the proteomic profiles using the database of HOMD73, ii)
resuspended in formic acid. Finally, 200 ng of the peptides identification of the metabolic pathways in Metacyc74 associated
obtained from condition 1) Secretome “OSCC” 2) Secretome with a metabolite, and iii) counting of the genes found in each
“Healthy Control” and 3) X-VIVO15 medium were injected in metabolic pathway. The source code is available at https://
triplicate into a timsTOF Pro mass spectrometer (Bruker Daltonics). github.com/Nanocell-Lab/metabcrosstalk.
The collection of results was performed under the use of oTOF
software (Bruker Daltonics). Protein identification. Data analysis was performed by PEAKS
The mass spectrometry human proteomics data have been Studio version X+ software (Bioinformatics Solutions Inc., Water-
deposited to the ProteomeXchange Consortium via the PRIDE loo, Canada). All annotated protein sequences of genomes from
partner repository with the dataset identifier PXD023049. the expanded Human Oral Microbiome Database (eHOMD,
www.homd.org/) were used as a database (5.041.813 sequences,
Human functional enrichment analysis. Two statistical analyzes accessed 19/08/2021). The parameters used were 50 ppm as mass
were performed associated with the genes derived from the tolerance using monoisotopic masses and ionic fragments of
proteomics analyses: i) Ingenuity Pathways Analysis (IPA), per- 0.05 Da. Trypsin was used as digestion enzyme, specific digestion
formed with the tool QIAGEN IPA, ii) Gene Ontology Enrichment mode, and a maximum of 2 missed cleavages per peptide.
Analysis (GOEA) performed with the g-profiler platform, https:// Carbamidomethylation (fixed PTM) of cysteine, Oxidation of
biit.cs.ut.ee/gprofiler/gost71. The raw data from both analyzes Methionine, Acetylation of Lysine, Deamination of Asparagine
were processed in Python and graphs were developed for and Glutamine and Carbamylation of Lysine and Nterminal were
interpretation72. The code is available at https://github.com/ used as PTM. In the same way, the culture medium used in the
Nanocell-Lab/metabcrosstalk. experiment was analyzed, which allowed discarding the proteins

International Journal of Oral Science (2025)17:1

 Host-microbe computational proteomic landscape in oral cancer revealed. . .
Muñoz-Grez et al.
12
detected in the secretome runs. Additionally, FDR estimation was 2 h. Finally, samples were washed with 1X PBS and mounted on
included by means of a decoy database. The filters used were an slides using a fluorescent mounting medium (DAKO). Images
FDR ≥ 1% and at least 1 unique peptide per protein. were acquired using the Leica SP8 super-resolution confocal
microscope. The HC PL APO 63x/1.40 OIL CS2 oil immersion
Protein quantification LFQ “Free Label Quantification”. Quantifica- objective was utilized. Images were acquired in x,y,z at a size of
tion was performed using the LFQ (“Label free Quantification”) 1 024 × 1 024 and represented as maximum intensity projec-
strategy, using PEAKS Studio X+ software (Bioinformatics Solu- tions generated in the LASX software.
tions) with the PEAKSQ quantification module. As parameters at
least one peptide was set to make pairwise comparisons between Cell counting. HSC3 cells were counted after 24 h of infection,
two random samples of the assay, retention time of 20 min, ion using CountBright Absolute Counting Beads, stained with Live/
mobility (1/K0) with tolerance 0.05, normalization using TIC (“Total Dead dye (L34974, Invitrogen, Thermo Fisher Scientific) and
Ion Current”), FDR of 1% and a fold change of 1. analyzed by flow cytometry.

Cell culture of oral squamous cell carcinoma cancer HSC3. Oral Tumorsphere formation. A tumorsphere is defined as an
squamous cell carcinoma cancer HSC3 (Merck, Cat. # SCC193) cells aggregate of cells that is at least 50 μm in diameter. HSC3
were kindly donated by Dr. Wilfredo Gonzalez from Universidad cells were challenged with F. nucleatum for 90 min, then
de Los Andes (Santiago, Chile). These cancer cells were maintained tumorspheres were developed by maintaining cells under
in DMEM/GIBCO supplemented with 10% fetal bovine serum suspension on ultra-low cluster polystyrene plates (ULA #7007)
(SV30160.03, HyClone cytiva, collected in Paraguay, processed in and centrifugating a 400 g for 10 min. After 3 days the
France), penicillin/streptomycin (1:100) (15140-122 Gibco®, Carls- tumorsphere formation was confirmed microscopically. The
bad, CA, USA), and glutamina/glutamax (1:100) (10378-016 Gibco®, total area occupied by tumorspheres and isolated cells in each
Carlsbad, CA, USA) incubated at 37 °C, 5% CO2. well was measured by Motic AE31 microscopy, ProgRes®MFcool
and Image J software.
Bacterial culture. F. nucleatum strain ATCC 25586 were grown in
anaerobe basal broth (CM0972, OXOID) at 37 °C in an anaerobic Transwell assays. These assays were carried out using Transwell
chamber according to manufacture instructions. For infection assay chambers (5 μm pore size; Corning). Tumor spheres from infected/
bacteria were grown until their exponential growth phase (0,35 OD), noninfected cancer cells were suspended in 100 μL DMEM
with growth rate measured by optical density at 600 nm. medium, after 4 days of infection. 100 μL of DMEM medium was
added in the lower chamber. After 2 days, cells from the
Infection assay. HSC3 cells (1 × 106) were seeding in tubes, supernatant of the tumoursphere and cells migrated to the lower
incubating at 37 °C in 5% CO2. Bacteria were grown, suspended chamber were collected, counted using CountBright Absolute
in DMEM media, and added to a multiplicity of infection (MOI) of Counting Beads, stained with Live/Dead dye (Life Technologies)
100 approximately. The tubes were centrifuged a 300 × g for and analyzed by flow cytometry.
20 min to ensure the contact between the cell layer and the
bacteria; after centrifugation, tubes were incubated for 90 min at RT-qPCR. Total RNA from harvested cells was isolated using Trizol
37 °C in 5% CO2 to allow for internalization of bacteria75. Cells Reagent (Invitrogen®) and Direct-zolTM RNA Microprep, (ZYMO
were then washed and incubated with fresh medium (DMEM) RESEARCH) kit. The mRNA expression of the two markers (MMP9
supplemented with gentamicin (G1914 Sigma-Aldrich®, Gilling- and E-cadherine) was measured using quantitative real-time
ham, UK) and metronidazole (M3761 Sigma-Aldrich®, Gilling- polymerase chain reaction (qPCR). The primers were previously
ham, UK), (300 µg/mL and 200 µg/mL respectively) for the designed in the Primer-BLAST (NCBH-NIH) platform and Ensembl
postinfection times defined. Genome, using the sequences; MMP9 (F’ GCCACTACTGTGCCTTT-
GAGTC; R’ CCCTCAGAGAATCGCCAGTACT) and E-cadherine (F’
Super resolution live cell microscopy. F. nucleatum infection on GTCTGTCATGGAAGGTGCT; R’ TACGACGTTAGCCTCGTTC). RPLPO
HSC3 cells was observed by confocal images. Before the infection, expression levels were used as a normalizing endogenous control.
the bacteria was stained with CFSE CellTrace™ (green dye Thermo The results were graphed using 2-ΔΔCt method.
Fisher). After every time of infection 1 × 104 HSC3 cells were
seeded in cell view cell culture slide, glass bottom, advanced TC Proteome profile array. Cellular lysate and supernatant of HSC3
(Greiner Bio-One #543979) and stained with Hoechst 33342 infected/noninfected cells was analyzed to determinate the
(Invitrogen) (0.1 μg/mL) for nucleus and cellmask Deep red (0.3X, expression of 84 proteins related to cancer. “Proteome profile
Invitrogen) for plasma membrane. Cancer cells were stained with ArrayTMHuman XL Oncology Array Kit” (R&D Systems) was
propidium iodide (1X. Invitrogen) to confirm bacteria/cells viability performed according to manufacturer’s instructions.
only at 6 h of infection. Live cell images were taken 6-, 24- and 48-
hour after infection assay by confocal microscope Leica Sp8 with Flow cytometry. HSC3 cells after 24 h of infection were stained
super-resolution module per lighting, at 37 °C and 5% CO2. The HC with anti-CD155(0.25 μg/mL), anti-Galg 9(100 μg/mL), anti-PDL-
PL APO 63x/1,40 OIL CS2 oil immersion objective was used. The 1(100 μg/mL), anti-CD73(200 μg/mL) and anti-CD39(100 μg/mL)
images were acquired in x,y,z at a size of 1 024 × 1 024 and are (all BioLegend) for 30 min at 4 °C in the dark. Samples were
represented as projection of maximum intensity generated in the acquired on LSR Fortessa (BD), and files analyzed using FlowJo
LASX software. (Tree Star). Gates were set based on biological controls and
fluorescence minus one control (FMO).
Immunocytochemistry. 6 × 104 HSC3 cells were seeded onto
glass coverslips for 24 h. Subsequently, the cells were fixed Western blot for cystine/glutamate antiporter (SLC7A11). The HSC3
with 4% PFA for 30 min. Next, three washes were performed cells were infected with F. nucleatum for 24 h. Subsequently, they
with 1X PBS, followed by overnight incubation with primary were lysed with RIPA buffer supplemented with a cocktail of
antibodies against SLC3A2 (Santa Cruz #SC-59145) and protease/phosphatase inhibitors (Cell Signaling #5872). Proteins
SLC7A11 (Cell Signaling #12691). The following day, cells were were then extracted by centrifugation at 15 000 r/min for 15 min
washed three times with 1X PBS and incubated with Hoechst at 4 °C. From the supernatant, the total protein concentration was
33342 as a nuclear marker and secondary antibodies Anti- determined using the Bradford method. 30 μg of protein were
mouse Cy2 and anti-rabbit Cy3 (The Jackson Laboratory) for loaded and separated on TGX FastCast Acrylamide 10% gels

International Journal of Oral Science (2025)17:1

 Host-microbe computational proteomic landscape in oral cancer revealed. . .
Muñoz-Grez et al.
13
(BioRad #1610173). The proteins were then transferred to a PVDF the OSCC diagnosis and collected the clinical data. E.R. cosupervised the study.
membrane and incubated with anti-SLC7A11 antibody 1:1 000 C.M.G., E.N.L. wrote the manuscript, which the other authors edited and approved.
(Cell Signaling #D2M7A) overnight. The next day, the membrane
was incubated with an HRP secondary antibody (1:5 000) and the
reaction was developed using the Western Lighting® Plus-ECL ADDITIONAL INFORMATION
enhanced chemiluminescence substrate (PerkinElmer Supplementary information The online version contains supplementary material
#NEL103001EA). Anti-actin (Santa Cruz #sc-47778) conjugated to available at https://doi.org/10.1038/s41368-024-00326-8.
HRP was used at 1:20 000 and incubated for 2 h at room
temperature. Competing interests: The authors declare no competing interests.

Inhibition assay of SLC7A11 mediated by imidazole ketone

erastin (IKE). 1 × 104 HSC3 cells per well were incubated on REFERENCES
DMEM media supplemented with 10% fetal bovine serum, 1. Ferlay, J. et al. Estimating the global cancer incidence and mortality in 2018:
streptomycin (1:100), and penicillin (1:100) at 37 °C, 5% CO2. GLOBOCAN sources and methods. Int. J. Cancer 144, 1941–1953 (2019).
Before the infection, F. nucleatum, was stained with CFSE 2. Vigneswaran, N. & Williams, M. D. Epidemiologic trends in head and neck cancer
CellTrace™ (green dye) and cancer cells media was changed to and aids in diagnosis. Oral. Maxillofac. Surg. Clin. North Am. 26, 123–141 (2014).
3. Chow, L. Q. M. Head and Neck Cancer. N. Engl. J. Med 382, 60–72 (2020).
DMEM without antibiotics supplementation, then the bacteria was
4. Cancer Genome Atlas, N. Comprehensive genomic characterization of head and
added to cancer cells at a multiplicity of infection (MOI). After 12 h neck squamous cell carcinomas. Nature 517, 576–582 (2015).
of infection, IKE (MedChem #HY-114481) 5 µmol/L was added to 5. Bremmer, J. F. et al. Prognostic value of DNA ploidy status in patients with oral
infected and non-infected cells to blockade glutamate efflux. leukoplakia. Oral. Oncol. 47, 956–960 (2011).
Bacteria colonization on HSC3 cells was measured by IncuCyte S3 6. Maymone, M. B. C. et al. Premalignant and malignant oral mucosal lesions:
and Flow cytometer after 24 h of glutamate blocking. Clinical and pathological findings. J. Am. Acad. Dermatol 81, 59–71 (2019).
7. Binder Gallimidi, A. et al. Periodontal pathogens Porphyromonas gingivalis and
Butyrate assay. Tumorsphere from HSC3 cells were incubated in Fusobacterium nucleatum promote tumor progression in an oral-specific che-
IncuCyte S3 for 3 days. Subsequently, a dose-response curve of mical carcinogenesis model. Oncotarget 6, 22613–22623 (2015).
8. Michaud, D. S., Fu, Z., Shi, J. & Chung, M. Periodontal Disease, Tooth Loss, and
butyrate was performed (1 nmol/L, 10 nmol/L, 100 nmol/L, 1
Cancer Risk. Epidemiol. Rev. 39, 49–58 (2017).
000 nmol/L, and 10 μmol/L). Kinetic images by live cell microscopy 9. Ganly, I. et al. Periodontal pathogens are a risk factor of oral cavity squamous cell
were obtained by IncuCyte S3 system every 4 h for 7 days to carcinoma, independent of tobacco and alcohol and human papillomavirus. Int J.
determine the growth of the tumorsphere. Cancer 145, 775–784 (2019).
10. Papapanou, P. N. et al. Periodontitis: Consensus report of workgroup 2 of the
Anaphylatoxin detection. Levels of complement proteins in 2017 World Workshop on the Classification of Periodontal and Peri-Implant
cancer and control secretomes were determined by BD Cytometric Diseases and Conditions. J. Clin. Periodontol. 45(Suppl 20), S162–S170 (2018).
Bead Array Human Anaphylatoxin Kit (BD) according to manu- 11. Radaic, A. & Kapila, Y. L. The oralome and its dysbiosis: New insights into oral
facturer’s instructions. microbiome-host interactions. Comput Struct. Biotechnol. J. 19, 1335–1360 (2021).
12. Kolenbrander, P. E., Palmer, R. J. Jr, Periasamy, S. & Jakubovics, N. S. Oral multi-
species biofilm development and the key role of cell-cell distance. Nat. Rev.
Statistical analysis. Statistical tests were performed using Prism Microbiol 8, 471–480 (2010).
9 software (GraphPad). The analysis of graphical comparisons 13. Socransky, S. S., Haffajee, A. D., Cugini, M. A., Smith, C. & Kent, R. L. Jr Microbial
between 2 variables was carried out by T-test with paired and complexes in subgingival plaque. J. Clin. Periodontol. 25, 134–144 (1998).
unpaired data, or in the case of more than 2 variables by ANOVA 14. Chang, C. et al. The prevalence rate of periodontal pathogens and its association
and Sidak´s multiple comparisons test. p values are reported as with oral squamous cell carcinoma. Appl Microbiol Biotechnol. 103, 1393–1404
follows: *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.000 1. (2019).
In addition, after preprocessing proteomic data, we transformed 15. Zhao, H. et al. Variations in oral microbiota associated with oral cancer. Sci. Rep. 7,
it to a structure data by using R. To observe hierarchical data 11773 (2017).
16. Hayes, R. B. et al. Association of Oral Microbiome With Risk for Incident Head and
structure suitable for heatmap visualization using heatmaply.
Neck Squamous Cell Cancer. JAMA Oncol. 4, 358–365 (2018).
Besides, we used the circlepackeR function to generate circular 17. Pushalkar, S. et al. Microbial diversity in saliva of oral squamous cell carcinoma.
layouts, facilitating the visualization of hierarchical relationships FEMS Immunol. Med Microbiol 61, 269–277 (2011).
among proteins. 18. Yost, S. et al. Increased virulence of the oral microbiome in oral squamous cell
carcinoma revealed by metatranscriptome analyses. Int J. Oral. Sci. 10, 32 (2018).
19. Hooper, S. J. et al. Viable bacteria present within oral squamous cell carcinoma
tissue. J. Clin. Microbiol 44, 1719–1725 (2006).
ACKNOWLEDGEMENTS 20. Lax, A. J. & Thomas, W. How bacteria could cause cancer: one step at a time.
This work was supported by Agencia Nacional de Investigación y Desarrollo (ANID), Trends Microbiol 10, 293–299 (2002).
Chilean Government Fondecyt Regular 1211480. C.M. was supported by a Master 21. Bolstad, A. I., Jensen, H. B. & Bakken, V. Taxonomy, biology, and periodontal
ANID Scholarship. EN-L, AV, SS, CC, RQ, and BA were funded by ANID/Fondecyt aspects of Fusobacterium nucleatum. Clin. Microbiol Rev. 9, 55–71 (1996).
Regular 1211480. Flow Cytometer was funded by EQM150061 (FONDEQUIP-ANID). 22. Didilescu, A. C. et al. Investigation of six selected bacterial species in endo-
We thank to all our participants for their contribution with their samples and clinical periodontal lesions. Int Endod. J. 45, 282–293 (2012).
data, ¨Las Higueras¨ Hospital, Guillermo Grant Benavente´s Hospital, Family Heath 23. Han, X. Y. et al. Fusobacterial brain abscess: a review of five cases and an analysis
Center ¨CESFAM Penco-Lirquén¨ and the Pathological Anatomy Unit at University of of possible pathogenesis. J. Neurosurg. 99, 693–700 (2003).
Concepcion to support recruitment and sample collection. We thank to Melisa 24. Marongiu, L. et al. Metagenomic analysis of primary colorectal carcinomas and
Institute, Biotechnology Center (CB-FONDEQUIP EQM120148) and the Advance their metastases identifies potential microbial risk factors. Mol. Oncol. 15,
Microscopy Centre (CMA BIOBIOANID PIA ECM-12) at University of Concepcion for 3363–3384 (2021).
providing the infrastructure and human resources to perform crucial experiments. 25. Rubinstein, M. R. et al. Fusobacterium nucleatum promotes colorectal carcinogen-
esis by modulating E-cadherin/beta-catenin signaling via its FadA adhesin. Cell Host
Microbe 14, 195–206 (2013).
26. Kamarajan, P. et al. Periodontal pathogens promote cancer aggressivity via TLR/
AUTHOR CONTRIBUTIONS MyD88 triggered activation of Integrin/FAK signaling that is therapeutically
C.M.G. and E.N.-L. conceived and designed the study. C.M.G., E.N.L., L.F., F.Z., A.V., S.S., reversible by a probiotic bacteriocin. PLoS Pathog. 16, e1008881 (2020).
M.A. performed most experiments. M.V., T.R., M.H., A.S., F.T. conducted most data 27. Geng, F., Zhang, Y., Lu, Z., Zhang, S. & Pan, Y. Fusobacterium nucleatum Caused
analysis. R.Q., C.C., B.B., R.C., M.A., M.F., W.G., P.A., C.R., L.L. and A.O. contributed to the DNA Damage and Promoted Cell Proliferation by the Ku70/p53 Pathway in Oral
experiments, data acquisition, and/or analysis. MY. recruited patients, participated in Cancer Cells. DNA Cell Biol. 39, 144–151 (2020).

International Journal of Oral Science (2025)17:1

 Host-microbe computational proteomic landscape in oral cancer revealed. . .
Muñoz-Grez et al.
14
28. Yao, Y., Shen, X., Zhou, M. & Tang, B. Periodontal Pathogens Promote Oral 56. Guo, P. et al. FadA promotes DNA damage and progression of Fusobacterium
Squamous Cell Carcinoma by Regulating ATR and NLRP3 Inflammasome. Front nucleatum-induced colorectal cancer through up-regulation of chk2. J. Exp. Clin.
Oncol. 11, 722797 (2021). Cancer Res 39, 202 (2020).
29. Harrandah, A. M., Chukkapalli, S. S., Bhattacharyya, I., Progulske-Fox, A. & Chan, E. 57. Cueno, M. E. & Ochiai, K. Re-discovering periodontal butyric acid: New insights on
K. L. Fusobacteria modulate oral carcinogenesis and promote cancer progression. an old metabolite. Micro Pathog. 94, 48–53 (2016).
J. Oral. Microbiol 13, 1849493 (2020). 58. Chen, L. et al. Delivery of short chain fatty acid butyrate to overcome Fusobacterium
30. Shao, W. et al. Conversion from epithelial to partial-EMT phenotype by Fuso- nucleatum-induced chemoresistance. J. Control Release 363, 43–56 (2023).
bacterium nucleatum infection promotes invasion of oral cancer cells. Sci. Rep. 59. Wang, R. X., Lee, J. S., Campbell, E. L. & Colgan, S. P. Microbiota-derived butyrate
11, 14943 (2021). dynamically regulates intestinal homeostasis through regulation of actin-
31. Zhang, S. et al. Fusobacterium nucleatum promotes epithelial-mesenchymal associated protein synaptopodin. Proc. Natl Acad. Sci. USA 117, 11648–11657
transiton through regulation of the lncRNA MIR4435-2HG/miR-296-5p/Akt2/ (2020).
SNAI1 signaling pathway. FEBS J. 287, 4032–4047 (2020). 60. Zhang, Y. & Weinberg, R. A. Epithelial-to-mesenchymal transition in cancer:
32. Sztukowska, M. N. et al. Porphyromonas gingivalis initiates a mesenchymal-like complexity and opportunities. Front Med 12, 361–373 (2018).
transition through ZEB1 in gingival epithelial cells. Cell Microbiol 18, 844–858 61. Yu, M. R., Kim, H. J. & Park, H. R. Fusobacterium nucleatum Accelerates the
(2016). Progression of Colitis-Associated Colorectal Cancer by Promoting EMT. Cancers
33. Ha, N. H. et al. Prolonged and repetitive exposure to Porphyromonas gingivalis (Basel) 12, 2728 (2020).
increases aggressiveness of oral cancer cells by promoting acquisition of cancer 62. Sommariva, M. & Gagliano, N. E-Cadherin in Pancreatic Ductal Adenocarcinoma:
stem cell properties. Tumour Biol. 36, 9947–9960 (2015). A Multifaceted Actor during EMT. Cells 9, 1040 (2020).
34. Ha, N. H. et al. Porphyromonas gingivalis increases the invasiveness of oral cancer 63. Signat, B., Roques, C., Poulet, P. & Duffaut, D. Fusobacterium nucleatum in peri-
cells by upregulating IL-8 and MMPs. Cytokine 86, 64–72 (2016). odontal health and disease. Curr. Issues Mol. Biol. 13, 25–36 (2011).
35. Hajishengallis, G. Immunomicrobial pathogenesis of periodontitis: keystones, 64. Neuzillet, C. et al. Prognostic value of intratumoral Fusobacterium nucleatum and
pathobionts, and host response. Trends Immunol. 35, 3–11 (2014). association with immune-related gene expression in oral squamous cell carci-
36. Elebyary, O., Barbour, A., Fine, N., Tenenbaum, H. C. & Glogauer, M. The Cross- noma patients. Sci. Rep. 11, 7870 (2021).
roads of Periodontitis and Oral Squamous Cell Carcinoma: Immune Implications 65. Muniz, J. M. et al. Galectin-9 as an important marker in the differential diagnosis
and Tumor Promoting Capacities. Front Oral. Health 1, 584705 (2020). between oral squamous cell carcinoma, oral leukoplakia and oral lichen planus.
37. Ahmed, S & Shaikh, F Increased Tim-3 and Gal-9 expression are related to poor Immunobiology 220, 1006–1011 (2015).
prognosis in Oral Squamous Cell Carcinoma. Research Square PREPRINT (Version 66. Lv, K., Zhang, Y., Zhang, M., Zhong, M. & Suo, Q. Galectin-9 promotes TGF-beta1-
1) https://doi.org/10.21203/rs.3.rs-1418045/v1 (2022). dependent induction of regulatory T cells via the TGF-beta/Smad signaling
38. Dong, J. et al. Tim-3-expressing macrophages are functionally suppressed and pathway. Mol. Med Rep. 7, 205–210 (2013).
expanded in oral squamous cell carcinoma due to virus-induced Gal-9 expres- 67. Biktasova, A. K. et al. Multivalent Forms of the Notch Ligand DLL-1 Enhance
sion. Tumour Biol. 39, 1010428317701651 (2017). Antitumor T-cell Immunity in Lung Cancer and Improve Efficacy of EGFR-
39. Zheng, Y. et al. IL-6-induced CD39 expression on tumor-infiltrating NK cells Targeted Therapy. Cancer Res 75, 4728–4741 (2015).
predicts poor prognosis in esophageal squamous cell carcinoma. Cancer Immu- 68. Shah, H. N., Gharbia, S. E. & Zhang, M. I. Measurement of electrical bioimpe-
nol. Immunother. 69, 2371–2380 (2020). dance for studying utilization of amino acids and peptides by Porphyromonas
40. Liu, X. et al. Dysfunctional role of elevated TIGIT expression on T cells in oral gingivalis, Fusobacterium nucleatum, and Treponema denticola. Clin. Infect.
squamous cell carcinoma patients. Oral. Dis. 27, 1667–1677 (2021). Dis. 16, S404–407 (1993).
41. Ren, Z. H., Yuan, Y. X., Ji, T. & Zhang, C. P. CD73 as a novel marker for 69. Cetindis, M. et al. Glutaminolysis and carcinogenesis of oral squamous cell car-
poor prognosis of oral squamous cell carcinoma. Oncol. Lett. 12, 556–562 cinoma. Eur. Arch. Otorhinolaryngol. 273, 495–503 (2016).
(2016). 70. Wang, M. et al. System Xc(-) exacerbates metabolic stress under glucose depletion
42. Wu, T. et al. PD-L1-Mediated Immunosuppression in Oral Squamous Cell Carci- in oral squamous cell carcinoma. Oral Dis 2023 https://doi.org/10.1111/odi.14774.
noma: Relationship With Macrophage Infiltration and Epithelial to Mesenchymal 71. Kolberg, L. et al. g:Profiler-interoperable web service for functional enrichment
Transition Markers. Front Immunol. 12, 693881 (2021). analysis and gene identifier mapping (2023 update). Nucleic Acids Res 51,
43. Yang, C. Y. et al. Oral Microbiota Community Dynamics Associated With Oral W207–W212 (2023).
Squamous Cell Carcinoma Staging. Front Microbiol 9, 862 (2018). 72. Van Rossum, G. Y Fred L. Drake Python 3 Reference Manual. (Scotts Valley, CA:
44. Fraga, M. et al. Immunomodulation of T Helper Cells by Tumor Microenvironment CreateSpace, 2009).
in Oral Cancer Is Associated With CCR8 Expression and Rapid Membrane Vitamin 73. Escapa, I. F. et al. New Insights into Human Nostril Microbiome from the
D Signaling Pathway. Front Immunol. 12, 643298 (2021). Expanded Human Oral Microbiome Database (eHOMD): a Resource for the
45. Bakken, V., Hogh, B. T. & Jensen, H. B. Utilization of amino acids and peptides by Microbiome of the Human Aerodigestive Tract. mSystems 3, e00187–18 (2018).
Fusobacterium nucleatum. Scand. J. Dent. Res 97, 43–53 (1989). 74. Caspi, R. et al. The MetaCyc database of metabolic pathways and enzymes - a
46. Gharbia, S. E. & Shah, H. N. Pathways of glutamate catabolism among Fuso- 2019 update. Nucleic Acids Res 48, D445–D453 (2020).
bacterium species. J. Gen. Microbiol 137, 1201–1206 (1991). 75. Betancur, D., Munoz Grez, C. & Onate, A. Comparative Analysis of Cytokine
47. Ferrada, L. et al. Pharmacological targets for the induction of ferroptosis: Focus on Expression in Oral Keratinocytes and THP-1 Macrophages in Response to the
Neuroblastoma and Glioblastoma. Front Oncol. 12, 858480 (2022). Most Prevalent Serotypes of Aggregatibacter actinomycetemcomitans. Micro-
48. Liu, Y. et al. Ferroptosis in hematological malignant tumors. Front Oncol. 13, organisms 9, 622 (2021).
1127526 (2023).
49. Zang, W. et al. Butyrate promotes oral squamous cell carcinoma cells migration,
invasion and epithelial-mesenchymal transition. PeerJ 10, 12991 (2022). Open Access This article is licensed under a Creative Commons
50. Qin, L. & Wu, J. Targeting anticancer immunity in oral cancer: Drugs, products, Attribution 4.0 International License, which permits use, sharing,
and nanoparticles. Environ. Res 239, 116751 (2023). adaptation, distribution and reproduction in any medium or format, as long as you give
51. Jeske, S. S. et al. Age-related changes in T lymphocytes of patients with head and appropriate credit to the original author(s) and the source, provide a link to the Creative
neck squamous cell carcinoma. Immun. Ageing 17, 3 (2020). Commons licence, and indicate if changes were made. The images or other third party
52. Damgaard, C., Holmstrup, P., Van Dyke, T. E. & Nielsen, C. H. The complement material in this article are included in the article’s Creative Commons licence, unless
system and its role in the pathogenesis of periodontitis: current concepts. J. indicated otherwise in a credit line to the material. If material is not included in the
Periodontal Res 50, 283–293 (2015). article’s Creative Commons licence and your intended use is not permitted by statutory
53. Damgaard, C. et al. Complement component 3 and its activation split-products in regulation or exceeds the permitted use, you will need to obtain permission directly
saliva associate with periodontitis. J. Periodontol. 93, 1294–1301 (2022). from the copyright holder. To view a copy of this licence, visit http://
54. Hooper, S. J. et al. A molecular analysis of the bacteria present within oral creativecommons.org/licenses/by/4.0/.
squamous cell carcinoma. J. Med Microbiol 56, 1651–1659 (2007).
55. Kolenbrander, P. E. Oral microbial communities: genomic inquiry and interspecies
communication. American Society for Microbiology Press (2011). © The Author(s) 2025

International Journal of Oral Science (2025)17:1