snad (snail dad)

all i want is to get hellsitegeneticsed. i want to know what kind of creature my post is. god i want it to be something cool sooooooooo bad do you think they have the genetic code for werewolves

String identified: aattgttgtcattatcattgattttgcattatgtcc

Closest match: fucking badass werewolf Common name: hell yeahhhh

so this is what it's like to be god's favorite

i need to sit by the ocean about this

"it's all in your head" correct! unfortunately I am also in there

sorry boss can't come in today i was on my way to work and then a gentle spring breeze kissed my cheek and reminded me it is a serious thing just to be alive on this fresh morning in this broken world

tumblr is not social media. idk how to explain but its so calm here. like this is the field and the valleys. over there is the town and people. but here we are little sheep in our pastures eating our grass and laying in the sun <3

i love old science fiction because it’s all like “IT’S THE DISTANT YEAR TWO THOUSAND AND THREE AND MAN IS EXPLORING THE DEEP CORNERS OF THE UNIVERSE” like god bless you old sci-fi you had such high hopes for us

you should come within biting range. no reason

Right click -> save as -> ancient curse

String identified: at' tac t tt? c t at t …. t gt t t

Closest match: Felimida luteorosea genome assembly, chromosome: 9 Common name: Yellow Dotted Doris

(image source)

IM SO SORRY ENTITY IM SO SORRY

for april fools i will turn into a beast and attack the town at nightfall

god forbid a snail has hobbies

for april fools we’re deleting this entire site sayonara you weeaboo shits

for april fools i will turn into a beast and attack the town at nightfall

It’s fools day every day on tumblr dot com