This library extends the native codecs
library (namely for adding new custom encodings and character mappings) and provides a myriad of new encodings (static or parametrized, like rot
or xor
), hence its named combining CODecs EXTension.
$ pip install codext
Note: Some encodings are available in Python 3 only.
$ codext -i test.txt encode dna-1
GTGAGCGGGTATGTGA
$ echo -en "test" | codext encode morse
- . ... -
Python 3 (includes Ascii85, Base85, Base100 and braille):
$ echo -en "test" | codext encode braille
⠞⠑⠎⠞
$ echo -en "test" | codext encode base100
👫👜👪👫
Using codecs chaining:
$ echo -en "Test string" | codext encode reverse
gnirts tseT
$ echo -en "Test string" | codext encode reverse morse
--. -. .. .-. - ... / - ... . -
$ echo -en "Test string" | codext encode reverse morse dna-2
AGTCAGTCAGTGAGAAAGTCAGTGAGAAAGTGAGTGAGAAAGTGAGTCAGTGAGAAAGTCAGAAAGTGAGTGAGTGAGAAAGTTAGAAAGTCAGAAAGTGAGTGAGTGAGAAAGTGAGAAAGTC
$ echo -en "Test string" | codext encode reverse morse dna-2 octal
101107124103101107124103101107124107101107101101101107124103101107124107101107101101101107124107101107124107101107101101101107124107101107124103101107124107101107101101101107124103101107101101101107124107101107124107101107124107101107101101101107124124101107101101101107124103101107101101101107124107101107124107101107124107101107101101101107124107101107101101101107124103
$ echo -en "AGTCAGTCAGTGAGAAAGTCAGTGAGAAAGTGAGTGAGAAAGTGAGTCAGTGAGAAAGTCAGAAAGTGAGTGAGTGAGAAAGTTAGAAAGTCAGAAAGTGAGTGAGTGAGAAAGTGAGAAAGTC" | codext -d dna-2 morse reverse
test string
Getting the list of available codecs:
>>> import codext
>>> codext.list()
['ascii85', 'base85', 'base100', 'base122', ..., 'tomtom', 'dna', 'html', 'markdown', 'url', 'resistor', 'sms', 'whitespace', 'whitespace-after-before']
Usage examples:
>>> codext.encode("this is a test", "base58-bitcoin")
'jo91waLQA1NNeBmZKUF'
>>> codext.encode("this is a test", "base58-ripple")
'jo9rA2LQwr44eBmZK7E'
>>> codext.encode("this is a test", "base58-url")
'JN91Wzkpa1nnDbLyjtf'
>>> codecs.encode("this is a test", "base100")
'👫👟👠👪🐗👠👪🐗👘🐗👫👜👪👫'
>>> codecs.decode("👫👟👠👪🐗👠👪🐗👘🐗👫👜👪👫", "base100")
'this is a test'
>>> for i in range(8):
print(codext.encode("this is a test", "dna-%d" % (i + 1)))
GTGAGCCAGCCGGTATACAAGCCGGTATACAAGCAGACAAGTGAGCGGGTATGTGA
CTCACGGACGGCCTATAGAACGGCCTATAGAACGACAGAACTCACGCCCTATCTCA
ACAGATTGATTAACGCGTGGATTAACGCGTGGATGAGTGGACAGATAAACGCACAG
AGACATTCATTAAGCGCTCCATTAAGCGCTCCATCACTCCAGACATAAAGCGAGAC
TCTGTAAGTAATTCGCGAGGTAATTCGCGAGGTAGTGAGGTCTGTATTTCGCTCTG
TGTCTAACTAATTGCGCACCTAATTGCGCACCTACTCACCTGTCTATTTGCGTGTC
GAGTGCCTGCCGGATATCTTGCCGGATATCTTGCTGTCTTGAGTGCGGGATAGAGT
CACTCGGTCGGCCATATGTTCGGCCATATGTTCGTCTGTTCACTCGCCCATACACT
>>> codext.decode("GTGAGCCAGCCGGTATACAAGCCGGTATACAAGCAGACAAGTGAGCGGGTATGTGA", "dna-1")
'this is a test'
>>> codecs.encode("this is a test", "morse")
'- .... .. ... / .. ... / .- / - . ... -'
>>> codecs.decode("- .... .. ... / .. ... / .- / - . ... -", "morse")
'this is a test'
>>> with open("morse.txt", 'w', encoding="morse") as f:
f.write("this is a test")
14
>>> with open("morse.txt",encoding="morse") as f:
f.read()
'this is a test'
>>> codext.decode("""
=
X
:
x
n
r
y
Y
y
p
a
`
n
|
a
o
h
`
g
o
z """, "whitespace-after+before")
'CSC{not_so_invisible}'
>>> print(codext.encode("An example test string", "baudot-tape"))
***.**
. *
***.*
* .
.*
* .*
. *
** .*
***.**
** .**
.*
* .
* *. *
.*
* *.
* *. *
* .
* *.
* *. *
***.
*.*
***.*
* .*
Codec | Conversions | Comment |
---|---|---|
a1z26 |
text <-> alphabet order numbers | keeps words whitespace-separated and uses a custom character separator |
affine |
text <-> affine ciphertext | aka Affine Cipher |
ascii85 |
text <-> ascii85 encoded text | Python 3 only |
atbash |
text <-> Atbash ciphertext | aka Atbash Cipher |
bacon |
text <-> Bacon ciphertext | aka Baconian Cipher |
barbie-N |
text <-> barbie ciphertext | aka Barbie Typewriter (N belongs to [1, 4]) |
baseXX |
text <-> baseXX | see base encodings |
baudot |
text <-> Baudot code bits | supports CCITT-1, CCITT-2, EU/FR, ITA1, ITA2, MTK-2 (Python3 only), UK, ... |
bcd |
text <-> binary coded decimal text | encodes characters from their (zero-left-padded) ordinals |
braille |
text <-> braille symbols | Python 3 only |
citrix |
text <-> Citrix CTX1 ciphertext | aka Citrix CTX1 passord encoding |
dna |
text <-> DNA-N sequence | implements the 8 rules of DNA sequences (N belongs to [1,8]) |
excess3 |
text <-> XS3 encoded text | uses Excess-3 (aka Stibitz code) binary encoding to convert characters from their ordinals |
gray |
text <-> gray encoded text | aka reflected binary code |
gzip |
text <-> Gzip-compressed text | standard Gzip compression/decompression |
html |
text <-> HTML entities | implements entities according to this reference |
ipsum |
text <-> latin words | aka lorem ipsum |
klopf |
text <-> klopf encoded text | Polybius square with trivial alphabetical distribution |
leetspeak |
text <-> leetspeak encoded text | based on minimalistic elite speaking rules |
letter-indices |
text <-> text with letter indices | encodes consonants and/or vowels with their corresponding indices |
lz77 |
text <-> LZ77-compressed text | compresses the given data with the algorithm of Lempel and Ziv of 1977 |
lz78 |
text <-> LZ78-compressed text | compresses the given data with the algorithm of Lempel and Ziv of 1978 |
manchester |
text <-> manchester encoded text | XORes each bit of the input with 01 |
markdown |
markdown --> HTML | unidirectional |
morse |
text <-> morse encoded text | uses whitespace as a separator |
navajo |
text <-> Navajo | only handles letters (not full words from the Navajo dictionary) |
octal |
text <-> octal digits | dummy octal conversion (converts to 3-digits groups) |
ordinal |
text <-> ordinal digits | dummy character ordinals conversion (converts to 3-digits groups) |
pkzip_deflate |
text <-> deflated text | standard Zip-deflate compression/decompression |
pkzip_bzip2 |
text <-> Bzipped text | standard BZip2 compression/decompression |
pkzip_lzma |
text <-> LZMA-compressed text | standard LZMA compression/decompression |
radio |
text <-> radio words | aka NATO or radio phonetic alphabet |
resistor |
text <-> resistor colors | aka resistor color codes |
rot |
text <-> rot(N) ciphertext | aka Caesar cipher (N belongs to [1,25]) |
rotate |
text <-> N-bits-rotated text | rotates characters by the specified number of bits ; Python 3 only |
scytale |
text <-> scytale ciphertext | encrypts with L, the number of letters on the rod (belongs to [1,[) |
shift |
text <-> shift(N) ciphertext | shift ordinals with N (belongs to [1,255]) |
sms |
text <-> phone keystrokes | also called T9 code ; uses "- " as a separator for encoding, "- " or "_ " or whitespace for decoding |
southpark |
text <-> Kenny's language | converts letters to Kenny's language from Southpark (whitespace is also handled) |
tomtom |
text <-> tom-tom encoded text | similar to morse , using slashes and backslashes |
url |
text <-> URL encoded text | aka URL encoding |
xor |
text <-> XOR(N) ciphertext | XOR with a single byte (N belongs to [1,255]) |
whitespace |
text <-> whitespaces and tabs | replaces bits with whitespaces and tabs |
A few variants are also implemented.
Codec | Conversions | Comment |
---|---|---|
baudot-spaced |
text <-> Baudot code groups of bits | groups of 5 bits are whitespace-separated |
baudot-tape |
text <-> Baudot code tape | outputs a string that looks like a perforated tape |
bcd-extended0 |
text <-> BCD-extended text | encodes characters from their (zero-left-padded) ordinals using prefix bits 0000 |
bcd-extended1 |
text <-> BCD-extended text | encodes characters from their (zero-left-padded) ordinals using prefix bits 1111 |
manchester-inverted |
text <-> manchester encoded text | XORes each bit of the input with 10 |
octal-spaced |
text <-> octal digits (whitespace-separated) | dummy octal conversion |
ordinal-spaced |
text <-> ordinal digits (whitespace-separated) | dummy character ordinals conversion |
southpark-icase |
text <-> Kenny's language | same as southpark but case insensitive |
whitespace_after_before |
text <-> lines of whitespaces[letter]whitespaces | encodes characters as new characters with whitespaces before and after according to an equation described in the codec name (e.g. "whitespace+2*after-3*before ") |