Facultad de veterinaria

Common fragile sites are regions of the eukaryotic chromosome with a tendency to show breaks or gaps when inductors such as 5'azacytidine are added to the lymphocyte culture media. Recently, chromosome fragile sites have been correlated with hereditary defects affecting humans and domestic animals (mental retardation syndrome, parakeratosis, baldy calf syndrome and low fertility). A spontaneous fragile site in the sexual chromosome X (FRA Xq 3.1) was observed in lymphocyte cultures of Uruguayan Holstein-Friesian cattle. In the present study, the chromosome fragility expression in lymphocyte cultures of Uruguayan Holstein-Friesian female cattle treated with 5'azacytidine was analized. A number of different fragility regions were scored considering autosomes and sexual X chromosomes.

Various genetic markers, including microsatellites, have been used to analyze the genetic polymorphism and heterozygosity in canine breeds. In this work, we used nine microsatellite markers to investigate the genetic variability in Cimarron Uruguayo dogs, the only officially recognized native canine breed in Uruguay. DNA from 30 Cimarron Uruguayo dogs from northeastern and southern Uruguay was analyzed. The allelic frequencies for each microsatellite, the genetic variability and the consanguinity were calculated, as were the polymorphic information content (PIC) and the probability of exclusion (PE). All of the microsatellites studied were polymorphic. FH 2361, FH 2305 and PEZ 03 were the most informative, with PIC values > 0.7, in agreement with results for other canine breeds. The PE values for the markers were within the ranges previously described and were generally greater for microsatellites with higher PIC values. The heterozygosity value (0.649) was considered high since only nine microsatellites were analyzed. Compared with data for other breeds, the results obtained here indicate that Cimarron Uruguayo dogs have high genetic diversity.

Uruguayan Creole cattle inhabit areas that cannot sustain conventional farming. They have adapted to fragile environments and are influenced only by natural selection. In this study, random amplified polymorphic DNA (RAPD) and microsatellite (MS) markers were used to analyse Creole cattle genome polymorphism. A comparative analysis using the RAPD technique was performed in pooled DNA of three cattle breeds (Holstein Friesian, Creole and Hereford) in order to evaluate their amplification patterns. A primary screening of RAPD primers allowed us to select and use those with higher percentage of GC base composition. A total of 215 loci ranging between 300 and 2500 bp were amplified. Bandsharing frequency (BSF) among breeds showed that less related fingerprints were observed between Creole and Hereford cattle (0.77), while the highest similarity frequency corresponded to Holstein Friesian compared to Hereford (0.81). Specific RAPD bands were identified in the three DNA pools and they wer...

Molecular approach of the fragile chromosomal region Xq31-34 in cattle (Bos taurus) by microdissection and DOP-PCR [Aproximação molecular da região cromossômica frágil Xq31-34 em bovinos (Bos taurus) utilizando microdissecação cromossômica e DOP-PCR]

Objective. The aim of this paper is to analyze the frequency of the mdr1-1D mutation of the MDR1 gene in a dog sample of the Uruguayan Cimarron breed with the objective of increasing the knowledge of this breed�s genome. Materials and methods. Thirty-six animals of this breed were analyzed. The MDR1 gene region, which includes the location where the mutation would be present, was amplified by PCR. Results. The mutation was not detected in any of the analyzed Uruguayan Cimarron. Conclusions. The lack of described ivermectin intoxication cases in veterinary clinic in this breed is explained by the lack of the mutation object of this study. The sequence studied in Cimarron dogs is kept compared to other breeds, except Collies and related breeds (Border Collie, Bearded Collie, Old English sheepdog).

Twenty Uruguayan Holstein-Friesian cows were cytogenetically examined, focusing on Xq 3.1 fragility manifestation (Fra Xq). Comparative culture media studies were carried out by simultaneously culturing blood samples in TC 199 and RPMI 1640 media. Taking into account that X chromosome aberrations may be interfering with fertility, the cattle population were also evaluated for their reproductive performance. One thousand metaphase spreads were studied in each culture media and showed normal chromosome constitution in most cells. Frequency of Xq fragility detected in TC 199 was 0.9% while in RPMI 1640 it was 1.8% (0.05 > P > 0.01). According to reproductive performance, repeat breeders manifested 92% of all Fra Xq detected. The differences in expression in both tissue culture media and the frequencies of the Xq fragility observed in cattle with reproductive problems are discussed. fragile X / cattle / cytogenetics / fertility Résumé-Étude préliminaire sur l'incidence de la fragilité du chromosome X en race bovine Holstein. Vingt vaches de race Holstein-Friesian Uruguayenne ont été examinées cytogénétiquement pour apprécier la fragilité Xq 3.1 (Fra Xq). Une étude comparative entre les milieux de culture a été menée par culture simultanée des échantillons sanguins dans le smilieux TC 199 et RPMI 1640. En raison de l'incidence possible des aberrations du chromosome X sur la fertilité, les animaux ont été aussi évalués pour leur performance reproductive. Mille métaphases ont été étudiées dans chaque milieu de culture et la majorité des cellules a montré une constitution chromosomique normale. La fragilité Xq exprimée dans le milieu TC 199 a été de 0,9 % tandis que dans le milieu RPMI 1640 elle a été de 1,8 % (0, 05 > p > 0, Ol). En ce qui concerne la reproduction, les vaches infertiles ont exprimé 9! % de tous les Fra Xq détectés. Les différences d'expression dans les deux milieux de culture, ainsi que les fréquences observées chez les vaches présentant des problèmes de reproduction sont discutées. X fragile / bovin / cytogénétique / fertilité

In this study, we genetically characterized the Uruguayan pig breed Pampa Rocha. Genetic variability was assessed by analyzing a panel of 25 microsatellite markers from a sample of 39 individuals. Pampa Rocha pigs showed high genetic variability with observed and expected heterozygosities of 0.583 and 0.603, respectively. The mean number of alleles was 5.72. Twenty-four markers were polymorphic, with 95.8% of them in Hardy Weinberg equilibrium. The level of endogamy was low (F IS = 0.0475). A factorial analysis of correspondence was used to assess the genetic differences between Pampa Rocha and other pig breeds; genetic distances were calculated, and a tree was designed to reflect the distance matrix. Individuals were also allocated into clusters. This analysis showed that the Pampa Rocha breed was separated from the other breeds along the first and second axes. The neighbour-joining tree generated by the genetic distances D A showed clustering of Pampa Rocha with the Meishan breed. The allocation of individuals to clusters showed a clear separation of Pampa Rocha pigs. These results provide insights into the genetic variability of Pampa Rocha pigs and indicate that this breed is a well-defined genetic entity.

Analizar la estructura poblacional en una muestra de perros “Cimarrón Uruguayo” usando marcadores moleculares tipo microsatélites. Materiales y métodos. Se analizaron treinta caninos de diferentes zonas de Uruguay con un set de nueve marcadores moleculares microsatélites empleando PCR. La estructura poblacional se analizó con el software de distribución libre “Structure”. Resultados. Según nuestros datos, los resultados preliminares muestran que no es posible establecer una subdivisión entre los animales de la muestra. Conclusiones. El estudio realizado apoya la hipótesis de que los perros que existen en la actualidad derivan del núcleo fundador que se refugió en la región noreste del país. La distribución de la raza entre las distintas áreas de Uruguay continúa hoy en día, no existe aislamiento entre los diferentes grupos de animales y el intercambio es constante.

This study assessed the effect of bran rice inclusion in the diet on the productive behavior and carcass characteristics of Pampa Rocha piglets. Sixteen animals were used from weaning up to 42 days and 77 days of age, which were housed in boxes in a deep bed system of wheat straw. A randomized complete block design with two treatments and four replications was used. Treatments consisted of diets with different lipid content (T0 = 0 % rice bran; T15 = 15 % rice bran). Productive behavior was evaluated through analysis of variance and comparison of means for daily food consumption (DC), daily weight gain (DG) and conversion efficiency (CE). Weight and backfat thickness were the evaluated carcass traits, and they were analyzed through a comparison of means per treatment. The DG and CE showed differences during week 5, although they showed no differences in the experimental period average. For DC, no differences were recorded during the weeks or the average of the experimental period. Carcass traits did not differ statistically between treatments. Based on the results, rice bran could be considered as an alternative in the preparation of ration for piglets.

©FUNPEC-RP www.funpecrp.com.br Genetics and Molecular Research 18 (4): gmr18307 M.C. Montenegro et al. 2 T15, respectively. Three male piglets of the Uruguayan creole breed Pampa Rocha were used per treatment, which lasted from weaning at 42 days until 77 days of age. The animals were reared in confinement on deep bedding and were slaughtered at the end of the experiment, when muscle samples were collected. Intramuscular fat content (IMF) and fatty acid composition were analyzed to determine if diets had a phenotypic effect. Gene expression analysis was performed with RNA-seq methodology to carrying out a functional analysis of genes with differential expression between treatments. The added fat to the diet did not affect IMF or fatty acid composition. However, we identified 359 genes with differential expression between treatments. These genes participate in various metabolic pathways, some of them affecting meat quality. The most relevant genes identified in this regard were PDK4 (up-regulated with T15), which is associated with energy metabolism, FOS, ATF3, MYOD1 and MAFF (all downregulated with T15), which are associated with skeletal muscle growth, and TNC (up-regulated with T15), which is associated with extracellular matrix-receptor interactions. This study of the skeletal muscle transcriptome in pigs can help understand the genetic basis of how diet affects important production traits.

Los bovinos Criollos del Uruguay constituyen una reserva genetica de alrededor de 1000 animales, ubicada al sureste del pais en un ecosistema de montes serranos. Su caracterizacion genetica se ha abordado principalmente con marcadores cromosomicos, inmunologicos, moleculares, permitiendo analizar su grado de variacion y relacion con razas Criollas de la region e iberoamericanas. Los resultados preliminares han permitido considerarla un recurso cuya diversidad genetica se ha mantenido por la presion de la seleccion natural. Se ha demostrado: a) ausencia de marcadores caracteristicos de raza cebu (Bos indicus); b) presencia de translocacion heterocigota rob 1/29; c) presencia de fenogrupos del sistema B descritos en razas iberoamericanas. Los analisis de variabilidad genetica y su comparacion con reservas de la region e iberoamericanas se realizaron con los siguientes fragmentos genomicos: a) secuencias codificantes para proteinas de la leche y suero (kCN, bLG, a LA); b) secuencias co...

Palabras clave: Recursos zoogenéticos Morfometría Abstract We performed morphometric characterization of pigs Pampa Rocha of Uruguay experimental station belonging to the Southern Regional Center College of Agriculture (56 o 36 o 13'W34'S). For measurements using zoométrico stick, compass Broca inextensible tape and electronic scale to record weight. 18 morphometric variables were measured and calculated morphometric indices 8 in a population of 20 females and 3 males breeding pigs Pampa Rocha Southern Regional Center of players belonging to Faculty of Agronomy, University of the Republic (UdelaR). Morphometric characterization in Pampa Rocha pigs with evidence of sexual dimorphism, with females mesolíneas. Body and pelvic indices were superior to American creole pigs (Venezuelan, Cuban) indicating that pigs have a higher skeletal proportion . As for the CV for live weight was higher in females (25.36%) and low in males (8.88%) these results could be due to a variable degree...

Bovine presents a complex genome due to high number of repetitive sequences involved in macro and micro-rearrangements that are essential in the bovids evolution. However, it has a morphologically simple karyotype, with acrocentric autosomes (2n=60,XX and 60,XY). The Robertsonian translocation rob(1;29), which produces embryo mortality, has been widely described in different breeds of Bos taurus but the complexity of its mechanism and its consequences in chromatin changes, are still not clear. Clastogenic agents are used as an approach to study this rearrangement in chromatin structure. Particularly, the aphidicolin (APC) inhibits the eukaryotic DNA polymerase α during replication. This fact permit to identify regions rich in dCTP due to a competition and spreading of the enzyme. Lymphocyte macro culture of 2 female Uruguayan Creole cattle carriers of rob(1;29) were APC-inducted (0,3uM) in one cell cycle. A new break point, rob(1;29)p13/21 (relative distance: p2c/p1=0.45), is locate...

La deficiencia en la adhesión leucocitaria bovina (BLAD) y en la enzima arginosuccinato sintetasa (Citrulinemia) son enfermedades de herencia autosómica recesiva que han sido descritas a nivel mundial en la raza Holando. El objetivo de este estudio fue optimizar e implementar una metodología de genotipado para la identificación de animales portadores de los alelos causantes de estas enfermedades en una población cohorte de terneras de recría de la raza Holando de la cuenca lechera de Cerro Largo. Las muestras de ADN de 190 terneras Holando fueron extraídas a partir de sangre fresca, siguiendo normas y protocolos del Banco de ADN de la Unidad de Biotecnología INIA Las Brujas. El genotipado fue realizado mediante análisis PCR-RFLP con las enzimas de restricción TaqI para BLAD y Eco47I (AvaII) para Citrulinemia. La confirmación del genotipado fue evaluada mediante secuenciación de los productos amplificados de ambas enfermedades. Se detectó la presencia del alelo mutante para BLAD en u...

The Uruguayan Cimarron dog is the only canine breed native from Uruguay; it was finally recognized as a breed in early 2011 by the "Federation Cynologique Internationale". This has meant an increased interest in the breed by breeders, exhibitors and pet owners in general. This interest has led to a significant increase in the number of animals registered in the genealogical records of the race, from nine hundred and thirty animals in October 1997, to more than 6,000 today. Moreover, these factors have led to different analysis are performed in order to continue with the knowledge of the genetics of this breed. Among the studies currently underway are those related to pharmacogenetics. CYP2D15 is one of the genes that are more involved in the metabolism of many widely used drugs in veterinary medicine, being described different polymorphisms for it. With primers: forward: TCTCTCCCTCTGCCCCAGAG; reverse: CCCAGGCTGTCCATCCTCTC, different polymorphisms were detected for exon 7 o...