Sci Forschen
Open HUB for Scientific Researc h
Nutrition and Food Technology: Open Access
ISSN 2470-6086 | Open Access
Volume 5 - Issue 1 |
RESEARCH ARTCLE
Molecular Diagnosis of Salmonellae in Frozen Meat and Some Meat Products
Shaltout FA1*, El-Toukhy EI2 and Abd El-Hai MM3
1
Department of Food Control, Faculty of Veterinary Medicine, Benha University, Egypt
Department of Biotechnology, Animal Health Research Institute, Dokki, Egypt
3
General organization of veterinary services, Egypt
2
*Corresponding author: Shaltout FA, Department of Food Control, Faculty of Veterinary Medicine, Benha University, Egypt, Tel: 002
01006576059; E-mail: fahimshaltout@hotmail.com
Received: 07 Mar, 2019 | Accepted: 22 Apr, 2019 | Published: 29 Apr, 2019
Citation: Shaltout FA, El-Toukhy EI, Abd El-Hai MM (2019) Molecular Diagnosis of Salmonellae in Frozen Meat and Some Meat Products. Nutr
Food Technol Open Access 5(1): dx.doi.org/10.16966/2470-6086.155
Copyright: © 2019 Shaltout FA, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License,
which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Abstract
A total of one hundred and twenty random samples of luncheon, fresh raw sausage, frozen packed minced meat and frozen meat (30 samples of
each) were collected from different supermarkets at Kalyobia Governorate. The collected samples were transferred directly to the laboratory in
an ice box under complete aseptic conditions. The samples were immediately examined bacteriologically for the detection of Salmonellae. The
Salmonellae isolates were confirmed by PCR.
Salmonellae failed to be detected in luncheon beef samples but the percentage of Salmonellae in fresh sausage was 10% and the isolated serovars
were S. typhi (3.3%), S. typhimurium (3.3%) and S. enteritidis (3.3%). In frozen packed minced meat, the percentage of Salmonellae was 6.7% and
the isolated serovars were S. typhi (3.3%) and S. typhimurium (3.3%) and in frozen meat, the percentage of Salmonellae was 13.3% and the isolated
serovars were S. papuana (6.7%), S. paratyphi A (3.3%) and S. vircho (3.3%). The virulence of the isolated strains was confirmed through molecular
technique by polymerase chain reaction (PCR) of the isolated Salmonellae strains for detection of the virulence factor (invA gene).
Keywords: Luncheon; Sausage; Minced meat; Frozen meat; Salmonellae; Serovars; PCR
Introduction
Food borne illnesses are considered by the World Health
Organization (WHO) as diseases either infectious or toxic made
by causative agents in ingested food. The reports in 2005 recorded
1.8 million people died from diseases causing diarrhea and high
proportion of which was attributed to contamination of food and
drinking water [1]. Salmonellae food poisoning is one of the most
common and widely distributed diseases in the world [2], estimated
to cause 1.3 billion cases of gastroenteritis and 3 million deaths
worldwide [3].
Recently, some food borne diseases are considered as emerging
diseases. Various food borne pathogens have been identified for
food borne illness. Campylobacter, Escherichia coli O157:H7, Listeria
monocytogenes and Salmonellae are found to be responsible for most
of food origin outbreaks [4].
Meat products such as sausage, luncheon and minced meat are
more popular because they are considered as quick easily prepared
meat meals and solve the problem of fresh meat shortage which is not
within the reach of many peoples.
Microorganisms may contaminate meat products during a
long chain of processing from the time of preparation, handling,
Nutr Food Technol Open Access | NFTOA
processing, distribution and storage as well as marketing. Such
contamination may render the products of inferior quality or even
unfit for human consumption and at times may constitute a public
health hazard. The possibility of contamination of meat products with
food poisoning bacteria especially Salmonellae organisms has been
extensively reported [5].
Traditional and conventional methods for identification of
microbial pathogens depend on specific bacteriological and
biochemical identification [6], which are time consuming, laborious
and less accurate [7] and slow because Salmonellae needs 5-7 days to
confirm its presence in meat products [8]. Several Polymerase Chain
Reaction (PCR) assays have been developed by targeting various
Salmonellae genes, such as invA [9,10]. The invA gene, is widely used
as a target in PCR assays for Salmonella detection [11-13].
Materials and Methods
Isolation and identification of Salmonellae
The techniques adopted were carried out according to ICMSF
(1978) [14]. Samples were cultivated for the isolation of Salmonellae
species on MacConkey agar. After 24 h of incubation at 37°C,
suspected colonies with typical characteristics of Salmonellae were
sub-cultured on XLD (Xylose Lysine Deoxycholate) agar for 24 h at
1
Sci Forschen
Nutrition and Food Technology: Open Access
Open Access Journal
Open HUB for Scientific Researc h
37°C and Salmonella shigella (S.S) agar plates then incubated at 37°C
for 24 h.
Molecular identification of Salmonellae isolates by PCR
Extraction of genomic DNA according to QIAamp DNA mini
kit instructions: Genomic DNA was extracted from cell suspensions
of bacteria grown overnight on XLD broth at 37°C using QIAamp®
DNA Mini kit from Qiagen according to Lee SH, et al. [15]. A single
colony from Salmonellae was resuspended in 3 ml XLD liquid media
and grown overnight at 37°C. The bacterial culture was precipitated by
centrifugation in a microcentrifuge at 5000 xg for 10 min. The bacterial
pellets were resuspended in 180 µl AL buffer (supplied in the QIAamp
DNA Mini Kit) for complete lysis. The samples were immediately
cooled on ice for 5 min, and the cell lysates were digested with 20 µl
of proteinase K (final concentration 800 μg/ml) at 56°C for 3 h. 200
μl ethanol (96 to 100%) was added to each tube and vortexed for 15
s. The mixtures were loaded onto the QIAamp Mini spin column and
centrifuged at 6000 xg for 1 min. The filtrate was discarded and the spin
column was placed in a clean collection tube (2 ml). A 500 μl of AW1
wash buffer was added to the QIAamp spin column and centrifuged at
6000 xg for 1 min. The washing step was repeated twice using 500 μl
of washing buffer AW2. To elute bacterial DNA, 100 μl elution buffer
(AE) was added to the center of the column, and the column was
incubated at 37°C for 5 min then centrifuged at 20,000 xg for 1 min.
DNA purity and quantity was determined using spectrophotometer
(GeneSys 10UV, Thermo Scientific, USA).
Salmonellae were detected in 7.5 % of the examined meat product
samples. The percentage of Salmonellae in luncheon meat, fresh
sausage, frozen minced meat and frozen meat was 0%, 10% and 6.7%
and 13.3% respectively (Table 2).
The results present in table 2 revealed that Salmonellae failed to be
detected in the examined luncheon samples.
These results agree with that reported by Gouda HI, Saleh AA, Edris
A, Nashed-Heba F, Moussa MM, et al, Fathi S, et al, Aiedia HA, AbdEl-Aziz A, S, et al., Ouf-Jehan M, Eleiwa-Nesreen ZH, Edris AM, et al,
Abd El-Kader-Hanaa A, et al. and Shaltout FA, et al. [18-30]. The result
disagrees with that reported by Mohamed (1988) [31] who recorded
that Salmonellae could be detected out of 100 examined luncheon
samples and Mohamed K [32] who recorded that Salmonellae could be
detected out of 10 examined luncheon samples (10%).
The results presented in table 2 revealed that Salmonellae were
present in 10% of the examined samples of fresh sausage. Similar
results were recorded by Edris AM, et al. [28]. Nearly similar results
were obtained by Ouf-Jehan M, Eleiwa-Nesreen ZH and Mohamed FA
[26,27,33] with an incidence of (8%) for each of them, Cabedo L, et al.
(11.1) and El-Kader HA, et al. (13.3) [34,29]. While higher results were
reported by Banks JG, et al. [35] (55 %) and Shaltout FA, et al. (16%)
[30]. Lower results obtained by Zaki EMS (5%) and Ahmed AAH, et
al. (5 %) [36,37]. Some investigators failed to detect Salmonellae in
meat products as Vazgecer B, et al. and Ismail AH [38,39].
Oligonucleotide primers for Salmonellae spp. (invA gene):
Primer sets for the pathotypes and virulence genes for the isolated
Salmonellae spp. according to Oliveira, et al. [16] (Table 1).
It’s clear from the results reported in table 2 that 6.7% of the
examined samples of frozen packed minced meat were positive for
Salmonellae. This result agrees with that of Edris AM, et al. and ElKader HA, et al. [28,29].
DNA amplification: The samples were done in BioRad Thermal
cycler (T100-England) with the following thermal profile: initial
denaturation at 95°C for 5 min then denaturation at 95°C for 30 sec,
annealing at 60°C for 30 sec, extension for 30 sec at 72°C for 35 cycles
and after the last cycle, the mixture was incubated for final extension
at 72°C for10 min.
Nearly similar results were obtained by Abd El-Aziz AS, et al. (5%),
and Shaltout FA (6%) [25,40]. While lower results were recorded by
Roberts TA, et al. and Abd El-Atty NS, et al. [41,42] as (2%) for each of
them. On the other hands, higher results were reported by Molla B, et
al. (32.7%), Ejeta G, et al. (14.4%), Mohamed K (40%), AL-Jobori KM,
et al. (36%), and Shaltout FA, et al. (40%) [43,44,32,7,30].
Detection of PCR products according to Sambrook J, et al. [17]:
Amplified products were detected in 1.5% agarose gel electrophoresis
pre-stained with ethidium bromide, at 80 V for 1 hour. Specific
amplicons were observed under ultraviolet transillumination,
compared with the marker, the gel was transferred to UV cabinet, and
the gel was photographed by a gel documentation system and the data
was analyzed through computer software.
Salmonellae were present in 13.3 % of the examined samples of
frozen meat (Table 2). Nearly similar results were recorded by El-Kader
HA, et al. [29] (10%), but higher results reported by AL-Jobori KM, et
al. [7] (40%) and Mahmood NR, et al. [45] who isolated Salmonellae
spp. at a rate of 24.76% and Elsayed MS, et al. (18%) [46].
Results and Discussion
In this work, a total of one hundred and twenty random samples
of meat products, (30 samples of luncheon beef, 30 samples of fresh
sausage, 30 samples of frozen minced meat and 30 samples of frozen
meat) were examined for Salmonellae. The virulence of the isolated
serotypes was confirmed by detection of the invA gene which is
responsible for the pathogenicity of Salmonella serotypes.
From the results recorded in table 2 it’s clear that frozen meat had
the higher incidence of Salmonellae contamination followed by fresh
sausage and frozen packed minced meat while Salmonellae could not
be detected in luncheon.
The absence of Salmonellae in luncheon meat may be due to the
addition of food additives such as spices and preservatives, which have
Table 2: Incidence of Salmonellae in the examined meat products and
frozen meat samples.
No. of samples
Positive
Luncheon (beef)
30
0
0
Fresh sausage
30
3
10
Frozen packed minced meat
30
2
6.7
Frozen meat
30
4
13.3
Total
120
9
7.5
Incidence of Salmonellae
Samples
Table 1: Primers used for the detection of Salmonellae sp.
Primer
invA
Sequence
GTGAAATTATCGCCACGTTCGGGCAA
TCATCGCACCGTCAAAGGAACC
Amplified product
284 bp
Citation: Shaltout FA, El-Toukhy EI, Abd El-Hai MM (2019) Molecular Diagnosis of Salmonellae in Frozen Meat and Some Meat
Products. Nutr Food Technol Open Access 5(1): dx.doi.org/10.16966/2470-6086.155
%
2
Sci Forschen
Open HUB for Scientific Researc h
Nutrition and Food Technology: Open Access
Open Access Journal
Figure 1: Agarose gel electrophoresis 2% showing PCR products of invA gene (284 bp) Specific for characterization of all Salmonella species. Lanes
(1) to (6): Positive Salmonella species for invA gene.
Lane L: Molecular marker DNA ladder (100 bp) (cat. No. 239035) supplied from QIAGEN (USA)
Lane Pos: Control positive Salmonella strain for invA gene
Lane Neg: Control negative
Lane 1: Salmonella typhi
Lane 2: Salmonella typhimurium
Lane 3: Salmonella enteritidis
Lane 4: Salmonella paratyphi A
Lane 5: Salmonella papuana
Lane 6: Salmonella vircho
an antimicrobial activity and inhibit survival and multiplication of
micro-organisms [47]. This also may be attributed to the exposure to
high temperature during processing and cooking procedures.
High incidence of Salmonellae in fresh sausage may be due to faults
in certain practices of slaughtering and handling processes such as the
use of contaminated knives, tools, rags, saws, boards, etc., as well as
unhygienic slaughtering, dressing, washing, transporting, handling
and cutting in abattoirs and butcher shops that affect the incidence of
Salmonellae. High incidence of Salmonellae in fresh sausage may be
due to the fact that this product is made from raw meat in addition to
natural casing which is often used in their manufacture and may be act
as an important source for Salmonella [48].
The high incidence of Salmonellae in frozen packed minced
meat may be due to cutting and contamination of meat besides the
increase in its water and oxygen contents as well as contamination
from grinders, air, packaging materials and hands of the workers.
Temperature rise (2-4°C) during grinding could also increase the
incidence of Salmonella organisms [49].
The incidence of Salmonellae in frozen meat may be originated
through a different infected touch of food handlers and butchers,
improper clothing, fecal hand contamination, may be through
rodent and other insects or unhygienic practice in slaughter house
area. There is a risk of chances for developing Salmonellosis is
major due to survival of Salmonella at very low temperature too.
They may come in different serotypes S. enteridis, S. typhi, S.
typhimurium, etc. [50].
Serotyping of the isolated Salmonellae
From the result recorded in table 3, it is clear that 3 Salmonella
serovars were identified from fresh sausage samples, 1 (3.3 %) strains
as S. typhi, 1 (3.3 %) strains as S. typhimurium and 1 (3.3%) strain as
S. enteritidis.
Similar results were obtained by Abd EL-Kader-Hanaa, et al. [29]
where they could isolate S. typhi and S. typhimurium with a percentage
of 3.3 % for each strain but higher results were recorded for S. enteritidis
with a percentage of 6.7%.
Nearly similar results were obtained by Rao NM, et al. [51] where
they could isolate S. typhimurium and S. enteritidis with a percentage
of 2.5 % for each strain, Edris AM, et al. [28] where they could isolate
S. typhi, S. typhimurium and S. enteritidis with a percentage of 4%,
4% and 2% respectively and Shaltout FA, et al. [30] where they could
detect S. enteritidis (4%).
From the result recorded in table 4 it is clear that 2 Salmonellae
serovars were identified in the examined frozen packed minced meat
samples and identified as 1 (3.3%) strain as S. typhimurium and 1
(3.3%) strain as S. typhi.
This result agrees with that obtained by El-Kader HA, et al. [29]
where they recorded that the incidence of S. typhimurium in the
examined frozen packed minced meat samples was 3.3 %.
Nearly similar results were obtained by Edris AM, et al. [28] where
they could isolate S. typhi (2%) and S. typhimurium (4%) and Shaltout
FA, et al. [30] where they could detect S. typhi (4%), but higher results
were recorded for S. typhimurium (8%).
Citation: Shaltout FA, El-Toukhy EI, Abd El-Hai MM (2019) Molecular Diagnosis of Salmonellae in Frozen Meat and Some Meat
Products. Nutr Food Technol Open Access 5(1): dx.doi.org/10.16966/2470-6086.155
3
Sci Forschen
Nutrition and Food Technology: Open Access
Open Access Journal
Open HUB for Scientific Researc h
From the result recorded in table 5 it’s clear that 3 Salmonella serovars
were identified in the examined frozen meat samples and identified as
2 (6.7%) strains as S. papuana, 1 (3.3%) strain as S. paratyphi A and 1
(3.3%) strain as S. vircho. Higher results were reported by Elsayed MS,
et al. [46] where they stated that S. paratyphi A was detected in 8/18
(44.44%) positive samples.
Identification of Salmonella by PCR
The specificity of the oligonucleotide primers were carried out
by testing of all Salmonella strains with PCR using the primer pairs
targeting the invA gene (specific for all members of Salmonella species).
All the 6 Salmonella isolates detected by bacteriological examination
were tested by PCR using the same primer pair after selective
enrichment media on XLD agar and all Salmonella serovars were
positive for amplification of 284 bp fragments of invA gene as shown
in figure 1.
The present study supports the ability of this specific primer set to
confirm the isolates as Salmonella. Isolates were subjected to Salmonella
specific gene (invA) and were confirmed as Salmonella positive by the
predicted product of 284 bp DNA fragments. The results obtained in
the present study were in accordance with Nagappa K, et al., Abd ElKader-Hanaa A, et al., and Moustafa NY, et al. [52,29,53] where they
could amplify 284 bp of invA gene which is specific for demonstration
and characterization of the isolated Salmonella species by using PCR.
The ability of Salmonella specific primers to detect Salmonella
species rapidly and accurately in the present study is primarily due
to the primer sequences that are selected from the gene invA of S.
Table 3: Serotyping of Salmonellae isolated from the examined fresh
sausage samples (n=30).
Salmonella serovars
No.
%*
%**
S. typhi
1
33.3
3.3
S. typhimurium
1
33.3
3.3
S. enteritidis
1
33.3
3.3
typhimurium as reported by Darwin KH, et al., Nucera DM, et al., and
Craciunas C, et al. [54-56].
Culture techniques are universally recognized as the standard
methods for the detection of bacterial pathogens, such as Salmonella
in food stuffs [57]. These techniques generally take longer time [58]
and are less sensitive compared to PCR based methods [55,56].
The use of invA gene specific PCR method in most diagnostic and
research laboratories is possible and through the molecular basis of
Salmonella identification techniques, this method is the simplest and
less expensive.
Conclusion
In conclusion, PCR is a rapid and specific method for the
detection of the virulent strains of Salmonellae in meat products
and frozen meat samples. It gives the ability to detect Salmonella
cells and identify the virulence of the isolated strains within a little
time and PCR was demonstrated to be accurate methods for S.
enterica identification.
References
1.
World Health Organization (WHO) (2007) Food Safety and FoodBorne Illness-Fact Sheet N°237. Geneva, Switzerland.
2.
World Health Organization (WHO) (2018) Salmonella (nontyphoidal). Geneva, Switzerland.
3.
Bhunia AK (2008) Foodborne Microbial Pathogens: Mechanisms and
Pathogenesis. Springer Science & Business Media, USA.
4.
Chemburu S, Wilkins E, Abdel-Hamid I (2005) Detection of
Pathogenic Bacteria in Food Samples Using Highly-Dispersed Carbon
Particles. Biosens Bioelectron 21: 491-499.
5.
Abd El-Aziz-Reham A (2004) Microbial evaluation of some meat
products. MVSc Thesis (Meat hygiene) Fac Vet Med Moshtohor
Zagazig University (Benha Branch), Egypt.
6.
Aycicek H, Aydogan H, Kucukkaraaslan A, Baysallar M, Basustaoglu
AC (2004) Assessment of the Bacterial Contamination on Hands of
Hospital Food Handlers. Food Control 15: 253-259.
7.
AL-Jobori KM, AL-Bakri AK, AL-Baity BH (2015) Detection of
Salmonella spp. in Different Food Sources in Baghdad City: A
Comparison between Conventional and Chromogenic Methods. Int
J Adv Res Biol Sci 2: 171-184.
8.
Helmy-Noha A (2003) Application of biotechniques for detection
and discrimination of some pathogenic microorganisms in chicken
meats. PhD Thesis (Meat Hygiene), Fac Vet Med, Cairo University,
Egypt.
9.
Rahn K, De Grandis SA, Clarke RC, McEwen SA, Galán JE, et al. (1992)
Amplification of an invA Gene Sequence of Salmonella typhimurium
by Polymerase Chain Reaction as a Specific Method of Detection of
Salmonella. Mol Cell Probes 6: 271-279.
%*=percentage collected from only positive Salmonella samples
%**=percentage collected from total examined samples
Table 4: Serotyping of Salmonellae isolated from the examined frozen
packed minced meat samples (no=30).
Salmonella serovars
No.
%*
%**
S. typhi
1
50
3.3
S. typhimurium
1
50
3.3
%*=percentage collected from only positive Salmonella samples
%**=percentage collected from total examined samples
Table 5: Serotyping of Salmonellae isolated from the examined frozen
meat samples (n=30).
Salmonella serovars
S. papuana
S. paratyphi A
S. vircho
No.
%*
%**
2
1
1
50
25
25
6.7
3.3
3.3
%*=percentage collected from only positive Salmonella samples
%**=percentage collected from total examined samples
10. Moussa IM, Gassem MA, Al-Doss AA, Mahmoud WAS, Mawgood
AAL (2010) Using Molecular Techniques for Rapid Detection of
Salmonella Serovars in Frozen Chicken and Chicken Products
Collected from Riyadh, Saudi Arabia. Afr J Biotechnol 9: 612-619.
11. Hara-Kudo Y, Yoshino M, Kojima T, Ikedo M (2005) Loop-Mediated
Isothermal Amplification for the Rapid Detection of Salmonella.
FEMS Microbiol Lett 253: 155-161.
12. Singer RS, Cooke CL, Maddox CW, Isaacson RE, Wallace RL (2006)
Use of Pooled Samples for Detection of Salmonella in Feces by
Polymerase Chain Reaction. J Vet Diagn Invest 18: 319-325.
Citation: Shaltout FA, El-Toukhy EI, Abd El-Hai MM (2019) Molecular Diagnosis of Salmonellae in Frozen Meat and Some Meat
Products. Nutr Food Technol Open Access 5(1): dx.doi.org/10.16966/2470-6086.155
4
Sci Forschen
Open HUB for Scientific Researc h
Nutrition and Food Technology: Open Access
Open Access Journal
13. Shanmugasamy M, Velayutham T, Rajeswar J (2011) InvA gene
specific PCR for detection of Salmonella from broilers. Vet World 4:
562-564.
31. Mohamed AS (1988) Salmonella in Locally Produced Meat Products.
MVSc thesis (Meat Hygiene) Faculty of Veterinary Medicine, Cairo
University, Egypt.
14. International Commission on Microbiological Specification for Foods
(1978) Microorganisms in Foods 1: Their Significance and Methods
of Enumeration: A Publication of the International Commission on
Microbiological Specifications for Foods (ICMSF) of the International
Association of Microbiological Societies. 2nd Edition, University of
Toronto press 434.
32. Mohamed K (2013) Prevalence of Salmonella in Meat Products.
Global Veterinaria 11: 685-688.
15. Lee SH, Jung BY, Rayamahji N, Lee HS, Jeon WJ, et al. (2009) A
Multiplex Real-Time PCR for Differential Detection and Quantification
of Salmonella spp., Salmonella enterica Serovar Typhimurium and
Enteritidis in Meats. J Vet Sci 10: 43-51.
16. Olivera SD, Rodenbusch CR, Ce MC, Rocha SLS, Canal CW (2003)
Evaluation of Selective and Non Selective Enrichment PCR
Procedures for Salmonella Detection. Lett Appl Microbiol 36: 217221.
17. Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: A
Laboratory Manual, 2nd Edition. Cold spring Harbor Laboratotry
press, New York, USA.
18. Gouda HI (1991) Indicator Organisms in Some Meat Products. MVSc
Thesis (Meat Hygiene), Fac Vet Med, Alexandria University, Egypt.
19. Saleh AA (1991) Hygienic and Economic Aspects of Some
Microorganisms Affecting Production and Quality of Some Meat
Products. MVSc Thesis (Meat hygiene), Fac Vet Med, Alexandria
University, Egypt.
20. Edris A (1993) Isolation and Identification of E. coli and Salmonella
from Ready to Eat Meat Products. Zag Vet Med J 21: 187-193.
33. Mohammed FA (2011) The Incidence of Enterobacteriaceae Causing
Food Poisoning in Some Meat Products. Adv J Food Sci Technol 3:
116-121.
34. Cabedo L, Picart i Barrot L, Teixidó i Canelles A (2008) Prevalence
of Listeria monocytogenes and Salmonella in Ready-To-Eat Food in
Catalonia, Spain. J Food Prot 71: 855-859.
35. Banks JG, Board RG (1983) The Incidence and Level of Contamination
of British Fresh Sausages and Ingredients with Salmonellas. J Hyg
(Lond) 90: 213-223.
36. Zaki EMS (2003) Risk Assessment of Ready Prepared Meat Products.
PhD Thesis (Meat Hygiene), Fac Vet Med, Cairo university, Egypt.
37. Ahmed AAH, Abd-El-Rahman HA, Moustafa MK (1988) Incidence of
Enterobacteriaceae in Some Selected Food Stuffs. Assuit Vet Med J
20: 104-109.
38. Vazgecer B, Ulu H, Oztan A (2004) Microbiological and Chemical
Qualities of Chicken Doner Kebab Retailed on the Turkish
Restaurants. Food Control 15: 261-264.
39. Ismail AH (2008) Effential microbiological quality control points
associated with some locally processed meat products. MVSc
Thesis, Faculty of Vet Med, Cairo University, Egypt.
40. Shaltout FA (1998) Incidence of Proteolytic and Psychrotrophic
Organisms in Some Meat Products. Alex J Vet Science 14: 97-107.
21. Nashed-Heba F (1993) Salmonella and Enteropathogenic E. coli
serotypes in meat products. MVSc Thesis (Meat Hygiene), Fac Vet
Med, Moshtohor Zagazig University (Benha Branch), Egypt.
41. Roberts TA, Britton CR, Hudson WR (1980) The Bacteriological
Quality of Minced Beef in the UK. J Hyg Lond 85: 211-217.
22. Moussa MM, Awad HA, Yassien MM, Gouda H (1993) Microbial
Quality of Some Meat Products. Alex Vet Med J 41: 59-62.
42. Abd El-Atty NS, Meshref AMS (2007) Prevalence of Salmonella and
E. coli O157 in Some Foods. 5th Scientific Conference, Beni-Suef Vet
Med J 73-78.
23. Fathi S, El-khateib T, Moustaf S, Hassanein K (1994) Salmonellae
and Enteropathogenic E.coli in Some Locally Manufactured Meat
Products.
24. Aiedia HA (1995) Quality Investigation into Room Kept Traditional
Meat Products in Egypt. PhD Thesis (Meat Hygiene), Fac Vet Med,
Cairo University, Egypt.
25. Abd El-Aziz AS, El-Neklawy EIS, Hussien A, Niazi Z (1996) Food
Poisoning Microorganisms in Some Locally Meat Products. Vet Med
J Giza 44: 691-698.
26. Ouf-Jehan M (2001) Microorganisms of Sanitary Importance in Some
Meat Products and their Additives. PhD Thesis (Meat Hygiene), Fac
Vet Med, Cairo University, Egypt.
27. Eleiwa-Nesreen ZH (2003) Effect of Chemical Preservatives on Food
Poisoning Bacteria in Some Locally Manufactured Meat Products.
PhD Thesis (Meat hygiene), Fac Vet Med, Zagazig University, Egypt.
28. Edris AM, Shaltout FA, Salem GH, El-Toukhy EI (2011) Plasmid Profile
Analysis of Salmonellae Isolated from Some Meat Products. Benha
Vet Med J 172-178.
29. El-Kader HA, EL-Toukhy EI, Hanan AF, Masoud EA, EL-Berbawy SM
(2015) Molecular Study on Virulence Gene of Some Isolates of
Salmonellae Isolated from Chicken Meat and Some Meat Products.
Anim Health Res J 3: 310-317.
30. Shaltout FA, Salem-Amani M, Khater-Dalia F, Lela-Radwa A (2016)
Studies on Bacteriological Profile of Some Meat Products. Benha Vet
Med J 31: 43-49.
43. Molla B, Kleer J, Sinell H (1994) Detection of Salmonella in Food by
Immuno-magnetic Separation. Archiv Fur Lebensmittelhgiene 45:
112-113.
44. Ejeta G, Molla B, Alemayehu D, Muckle A (2004) Salmonella
Serotypes Isolated from Minced Meat Beef, Mutton and Pork in
Addis Ababa, Ethiopia. Revue Med Vet 155: 547-551.
45. Mahmood NR, Awni DH, Dhaher FH, Jameel MM, HS Rasheed (2011)
Isolation and Diagnosis of Salmonella in Animal Origin Food, Import
Feed in Baghdad Local Markets and Local Poultry Farms. Iraq Acad
Sci J 3: 1-19.
46. Elsayed MS, Abdeen E, Akiela MA, Farouk T, Zahran RN (2014) Real
Time and Conventional PCR for Characterization of Salmonella sp.
from Imported Meat to Egypt. Adv Anim Vet Sci 2: 199-203.
47. Libby JA, Brandly JP (1975) Meat Hygiene. 4th Edition LEA and
Febiger, Cornell University, Philadelphia, USA.
48. Escartin EF, Castillo A, Hinojosa-Puga A, Saldaña-Lozano J (1999)
Prevalence of Salmonella in Chorizo and its Survival Under Different
Storage Temperatures. Food microbiol 16: 479-486.
49. Field RA, Smith FC, Denane DD, Thomas GM, Kotula AW (1977)
Sources of Variation at the Retail Level in Bacteriological Condition
of Ground Beef. J Food prot 40: 385-388.
50. Sen U, Garode AM (2016) Identification and Detection of Salmonella
Risk Assessment from Frozen Buffalo Meat Exported from India. J
Bacteriol Mycol Open Access 2: 1-4.
Citation: Shaltout FA, El-Toukhy EI, Abd El-Hai MM (2019) Molecular Diagnosis of Salmonellae in Frozen Meat and Some Meat
Products. Nutr Food Technol Open Access 5(1): dx.doi.org/10.16966/2470-6086.155
5
Sci Forschen
Open HUB for Scientific Researc h
51. Rao NM, Nandy SC (1977) Organisms of Enterobacteriaceae
Family Associated with Animal By-products. Indian J Anim Sci 47:
344-348.
52. Nagappa K, Tamuly S, Brajmadhuri, Saxena MK, Singh SP (2007)
Isolation of Salmonella typhimurium from Poultry Eggs and Meat of
Tarai Region of Uttaranchal. Indian J Biotechnol 6: 407-409.
53. Moustafa NY, Abd El-Hafiz RM, ElBahy EF (2016) Incidence of
Staphylococcus aureus and Salmonella in Poultry Meat. Global
Veterinaria 16: 570-578.
54. Darwin KH, Miller VL (1999) Molecular basis of the interaction of
Salmonella with the intestinal mucosa. Clin Microbiol Rev 12: 405428.
Nutrition and Food Technology: Open Access
Open Access Journal
55. Nucera DM, Maddox CW, Hoien-Dalen P, Weigel RM (2006)
Comparison of API 20E and invA PCR for Identification of Salmonella
enterica isolates from Swine Production Units. J Clin Microbiol 44:
3388-3390.
56. Craciunas C, Keul AL, Flonta M, Cristea M (2012) DNA-based
diagnostic tests for Salmonella strains targeting hilA, agfA, spvC and
sef genes. J Environ Manage 95: S15-S18.
57. Whyte P, Mc Gill K, Collins JD, Gormley E (2002) The Prevalence and
PCR Detection of Salmonella Contamination in Raw Poultry. Vet
Microbiol 89: 53-60.
58. Malorny B, Hoorfar J, Hugas M, Heuvelink A, Fach P, et al. (2003)
Interlaboratory Diagnostic Accuracy of a Salmonella Specific PCRbased Method. Int J Food Microbiol 89: 241-249.
Citation: Shaltout FA, El-Toukhy EI, Abd El-Hai MM (2019) Molecular Diagnosis of Salmonellae in Frozen Meat and Some Meat
Products. Nutr Food Technol Open Access 5(1): dx.doi.org/10.16966/2470-6086.155
6