17373.selected Works in Bioinformatics by Xuhua Xia PDF

SELECTED WORKS IN
BIOINFORMATICS
Edited by Xuhua Xia
Selected Works in Bioinformatics
Edited by Xuhua Xia
Published by InTech
Janeza Trdine 9, 51000 Rijeka, Croatia
Copyright 2011 InTech

All chapters are Open Access distributed under the Creative Commons Attribution 3.0
license, which permits to copy, distribute, transmit, and adapt the work in any medium,
so long as the original work is properly cited. After this work has been published by
InTech, authors have the right to republish it, in whole or part, in any publication of
which they are the author, and to make other personal use of the work. Any republication,
referencing or personal use of the work must explicitly identify the original source.
As for readers, this license allows users to download, copy and build upon published
chapters even for commercial purposes, as long as the author and publisher are properly
credited, which ensures maximum dissemination and a wider impact of our publications.
Notice
Statements and opinions expressed in the chapters are these of the individual contributors
and not necessarily those of the editors or publisher. No responsibility is accepted for the
accuracy of information contained in the published chapters. The publisher assumes no
responsibility for any damage or injury to persons or property arising out of the use of any
materials, instructions, methods or ideas contained in the book.
Publishing Process Manager Silvia Vlase

Technical Editor Teodora Smiljanic
Cover Designer Jan Hyrat
Image Copyright marema, 2011. Used under license from Shutterstock.com
First published October, 2011

Printed in Croatia
A free online edition of this book is available at www.intechopen.com

Additional hard copies can be obtained from orders@intechweb.org
Selected Works in Bioinformatics, Edited by Xuhua Xia

p. cm.
ISBN 978-953-307-281-4
free online editions of InTech
Books and Journals can be found at
www.intechopen.com
Contents
Preface IX
Chapter 1 Allergen Bioinformatics:

Recent Trends and Developments 1
Debajyoti Ghosh and Swati Gupta-Bhattacharya
Chapter 2 Family Based Studies in Complex Disorders:

The Use of Bioinformatics Software for Data
Analysis in Studies on Osteoporosis 17
Christopher Vidal and Angela Xuereb Anastasi
Chapter 3 Guide to Genome-Wide Bacterial

Transcription Factor Binding Site
Prediction Using OmpR as Model 41
Phu Vuong and Rajeev Misra
Chapter 4 Understanding LiP Promoters from

Phanerochaete chrysosporium: A Bioinformatic Analysis 57
Sergio Lobos, Rubn Polanco, Mario Tello, Dan Cullen,
Daniela Seelenfreund and Rafael Vicua
Chapter 5 Prediction and Experimental Detection of Structural

and Functional Motifs in Intrinsically Unfolded Proteins 81
Cesira de Chiara and Annalisa Pastore
Chapter 6 Relaxed Linear Separability (RLS)

Approach to Feature (Gene) Subset Selection 103
Leon Bobrowski and Tomasz ukaszuk
Chapter 7 Disease Gene Prioritization 119

Carlos Roberto Arias, Hsiang-Yuan Yeh
and Von-Wun Soo
Chapter 8 Exploiting Protein Interaction Networks

to Unravel Complex Biological Questions 139
Bernd Sokolowski and Sandra Orchard
VI Contents
Chapter 9 Flexible Protein-Protein Docking 161

Sebastian Schneider and Martin Zacharias
Preface
Bioinformatics has come a long way from its humble beginning of heuristic search
engines such as FASTA and BLAST. The power of these heuristic search engines has
resulted in rapid proliferation of specialized databases such as Pfam, InterPro,
Prosite, UniProt, COG, CDD, from which a search will produce not only one or more
matched sequences, but also a variety of functional annotations related to the query
sequence. The database proliferation is an ongoing process, with some protein
families (e.g., the G protein-coupled receptors) having their own database and
website. These databases constitute essential tools for many biologists in their daily
research activities.
The first chapter in this book, by Debajyoti Ghosh and Swati Gupta-Bhattacharya,
brings us to two specialized databases of protein allergens as well as bioinformatic
tools for the characterization, identification, and prediction of such protein allergens.
Perhaps not many people still remember the transgenic soy that has been genetically
engineered to express ground-nut 2S albumin which turned out to be a strong allergen
for ground-nut allergic people. Such problems could have been avoided if searchable
allergen databases were available. While only a very small number of proteins are
known to be potent allergens - the allergome database currently lists less than 2000
protein allergens - it is quite possible that a protein that does not cause allergic
response by itself, but it may well increase the allergic potency of other proteins. An
allergic response may be caused by two or more proteins that are individually not
allergenic. Allergen databases serve as essential infrastructure not only for future
allergen research, but also for transgenic experiments in general.
Publicly available databases also facilitate the identification of disease genes,

especially those involving multi-gene disorders. For example, conventional genetic
linkage analysis based on human pedigrees or from breeding experiments using
animal disease models allow scientists to map the disease trait to one or a few genomic
regions. Sequencing these regions and searching them against databases will yield
information on the differences between these regions and those in the database,
whether these differences are in conserved or variable regions, in coding sequences or
in regulatory sequences, whether the matched sequences/genes are already annotated
to be related to the complex disease trait, what biological functions are performed by
the gene products encoded in these regions, etc. The chapter by Christopher Vidal and
X Preface
Angela Xuereb Anastasi provides a real example of such an application involving

osteoporosis.
While database creation, maintenance and development continue to consume the time
and effort of many bioinformaticians, most bioinformatic research projects are now
focused on the identification of genetic switches, and how these switches are
recognized by cellular machinery enabling the genetic program encoded in the
genome to unfold during ontogeny. What switches are responsible for turning on the
cellular machinery for genome replication and for its quality control? What switches
are flipped on to initiate new protein synthesis in response to environmental
challenges? What recognition system is packaged in the egg to turn on the first set of
genetic switches in a newly formed zygote? Will we eventually be able to incorporate
these genetic switches and the associated recognition system in a digital cell as a
platform for drug testing, such as exploring the side effects of new
biopharmaceuticals? What genetic switches often differ among people? How can the
understanding of these differences in genetic switches among people guide us towards
personalized medicine? It is not an exaggeration to state that modern molecular
biology, which is the driving force for bioinformatics, is little more than the
elucidation of genetic switches and their interactions with their dynamic recognition
system in specifying the developmental process. Most chapters in this book deal with
the recent development in characterizing and predicting the genetic switches and how
they interact with other cellular components.
The most fundamental genetic switches are the regulatory sequence motifs in both
nucleotide and amino acid sequences. The most well known types of nucleotide motifs
include the origin of genome replication, the transcription factor binding site, the 5
and 3 splice sites and branchpoint site in eukaryotic introns, the Shine-Dalgarno
sequence for prokaryotic translation initiation, the Kozak consensus for eukaryotic
translation initiation, internal ribosomal entry site, the poly-A site, the numerous
hormone response elements and many more. Well known peptide motifs include those
that facilitate posttranslational modifications such as phosphorylation,
acetylation/deacetylation, proteolytic cleavage, N-terminal processing, leader
sequences for targeting various cellular and extracellular locations and so on.
Given a set of aligned sequence segments that are experimentally verified to be

recognized by cellular machinery to accomplish a particular function, e.g., a set of
transcription factor binding sites, how can we characterize these segments and use the
characterization to scan the genome for new transcription factor binding sites? Phu
Vuong and Rajeev Misra reviewed computational methods for identifying
transcription factor binding sites in prokaryotic genomes. While their illustration of
the method is somewhat primitive and does not really touch upon the modern
computational approaches (in particular those incorporating site-dependence) and the
associated statistical tests, the compilation of the relevant tools from a user perspective
should be quite useful to readers who need a simple introduction to bridge them to
more advanced bioinformatic tools and algorithms.
Preface XI
The chapter by Sergio Lobos and colleagues represents a more systematic application
of motif-discovery methods to identify functional motifs in promoters of genes that
participate in lignin degradation in Phanerochaete chrysosporium. The evolutionary
perspective and the phylogenetic relationship among lip (lignin peroxidase) genes
offer the reader a glimpse of how genetic switches may change during evolution
leading to functional divergence.
While many bioinformatic studies focus on identifying shared sequence features in

motifs and how these shared features are recognized by protein or RNA domains to
accomplish a function, some sequences may share the same function but exhibit no
similarity in either sequence or structure. There are two known types of functional
sequences that belong to this category. The first is the eukaryotic ribosomal entry site
(IRES). Among experimentally validated eukaryotic IRESs, no shared sequence or
structural similarity has been found. Recent studies suggest that the shared feature is
the lack of secondary structure, which explains their shared lack of sequence or
structural similarities. The second type is exemplified by the intrinsically unfolded
protein or region (IUP/IUR) which, according to the dog-on-a-leash model, may
function by allowing a biochemically active domain (the dog) to stretch out to reach its
target/substrate. The chapter by Cesira de Chiara and Annalisa Pastore provides an
excellent introduction to IUP/IUR.
A biological concept closely related to regulatory motifs is the regulon, which is a set
of genes sharing the same regulatory motif and co-regulated by the same cellular or
environmental signal. For example, when oestrogen molecules diffuse into the cell and
into the nucleus, they will bind to the oestrogen receptors which in turn will control
the expression of genes sharing the oestrogen response element. The genes that share
the oestrogen response element and co-regulated by the oestrogen through the
oestrogen receptors constitute a regulon (the oestrogen regulon). The classical regulon
is the lac operon in Escherichia coli that responds to the environmental availability of
glucose and lactose.
How can we identify a regulon in response to an environmental change? In the case

of the oestrogen regulon, we may only need to characterize the oestrogen response
elements, and then scan the genome for other genes harbouring such elements to
obtain a putative oestrogen regulon, followed by experimental validation. But what
can we do if we do not know anything about the oestrogen response element? The
common approach is to subject the experimental animals to oestrogen treatment,
check which genes are up-regulated or down-regulated relative to the control by
microarray, SAGE or deep sequencing method, and verify whether some co-
expressed genes are in fact co-regulated, e.g., whether they share the same
regulatory motif. Such a seemingly straightforward task is made difficult because of
the immense noise inherent in the experimental result from large-scale
transcriptomic studies. In addition to the genes in the oestrogen regulon that may
increase or decrease their expression in response to the oestrogen treatment, many
other genes may also increase or decrease their expression, either stochastically or
XII Preface
through indirect/downstream regulation. How can we peel off the shell of noise and
reach the central core of truth?
The chapter by Leon Bobrowski and Tomasz ukaszuk, advocating the relaxed linear
separability (RLS) approach to feature (gene) subset selection, represents one of the
exciting new mathematical and computational tools that can help us to progressively
narrow down to a minimal set of genes that lead to the best separation between the
experiment and the control. Such a set of genes should greatly improve the efficiency
of identifying shared regulatory motifs and co-regulated genes.
A conceptually closely related but computationally different method is presented by

Carlos Roberto Arias, Hsiang-Yuan Yeh and Von-Wun Soo, in the context of disease
gene prioritization. Given a set of genes, how would we know which one is the most
related to the disease? Suppose we have two set of people, one with a particular
disease and the other not. Also suppose that biologists have done a variety of
phenotypic (e.g. gene expression) and genetic analysis (e.g., linkage analysis from
pedigrees) related to the disease. Now given all these information (the training
information) and a set of candidate genes (which could be large) that might be
causative agents of the disease, how can we prioritize the genes to facilitate our
identification of the genes responsible for the disease? The chapter by Arias et al.
covers several approaches for such a complex task by using network methods.
What research should bioinformaticians be busy with in the future? The discovery of
DNA and base complementarity paved the way for understanding and predicting
interactions between nucleotide sequences they interact mainly through
complementary base pairing. The characterization of nucleotide regulatory motifs has
led to fantastic progresses in predicting interactions between nucleotide sequences and
proteins, such as that between splice sites and spliceosomes, or between restriction
sites and restriction enzymes. However, understanding the interaction among
proteins, the ultimate workhorses in the cell, still lags behind.
To be fair, biomedical scientists in general, and biochemists in particular, have

characterized a large number of protein interactions, e.g., the interaction between
antibody and antigen, between surface proteins of viruses (such as HIV-1) and the
receptor proteins on the host cell membrane, between certain proteases and their
cleavage sites, between various kinases and their target proteins, between
acetylases/deacetylases and histones, etc. However, these interactions are not sufficient
to understand how living cells work. We need large-scale methods to systematically
characterize and predict all protein interactions in a cell and to understand how
proteins come together to form partners through their surface features.
The last two chapters of the book are exclusively on proteins. A variety of technologies
for large-scale characterization of protein interactions have been developed in recent
years. The chapter by Bernd Sokolowski and Sandra Orchard reviews the technology
and illustrate how the results can be used in conjunction with relevant databases to
understand protein interactions and to construct protein interaction networks. Some
Preface XIII
readers might feel concerned about an overemphasis on physical interactions in recent

years because many proteins cooperate to accomplish a task not by physical
interactions. For example, the -galactosidase (LacZ) and -galactoside permease
(LacY) encoded in the E. coli lac operon cooperate to accomplish the task of
metabolizing lactose, but they do not physically interact. Similarly, not all Krebs cycle
enzymes are found physically interacting. We need parallel development of
biotechnological and bioinformatic methods for both functionally interacting networks
and physically interaction networks. Some of the databases reviewed in the chapter
are relevant for constructing functionally interacting networks.
With a large number of protein physical interactions and interaction networks

documented in recent years, biologists have found themselves in an awkward position
of knowing little about how proteins interact physically and specifically with their
partners through their surface features. How much of the cellular protein interaction is
due to surface geometry, electrostatic interaction or simply due to local crowding that
forces together otherwise non-interacting proteins? It would be really nice to know
how interacting protein partners find each other, adapt their surface features to each
other and achieve the structural docking necessary for their function. The time is ripe
for such research endeavour. Recent increase in the number of protein structures has
provided an excellent platform for validating computational algorithms for structural
modelling. In particular, structures of protein-protein complexes and protein-RNA
complexes have shed light on the induced structural changes of proteins and RNA in
response to the surface features of their interacting partners. The chapter by Sebastian
Schneider and Martin Zacharias offers an advanced review of the current
computational algorithms used in flexible protein-protein docking.
Dr. Xuhua Xia

Biology Department
University of Ottawa
Canada
1
Allergen Bioinformatics: Recent

Trends and Developments
Debajyoti Ghosh1 and Swati Gupta-Bhattacharya2
1Division of Allergy, Immunology and Rheumatology, Department of Internal Medicine
University of Cincinnati College of Medicine, Ohio
2Division of Plant Biology Bose Institute Kolkata
1United States of America
2India
1. Introduction
Allergy is a major cause of morbidity worldwide. Allergic reactions result from maladaptive
immune responses in predisposed subjects, to otherwise harmless molecules. These
allergenic molecules, usually proteins/glycoproteins, can not only elicit specific
immunoglobulin E (IgE) in susceptible subjects, but also crosslink effector cell-bound IgE
molecules Leading to the release of mediators (e.g. Histamine) and causation of symptoms.
From clinical and molecular biological data available in several publicly accessible
databases, it is now evident that among hundreds and thousands of proteins that exist in
nature, only a few can cause allergy. For example, in more than 500,000 entries (71345
documented at the protein level; Nov, 2010) in swissprot/uniprot database
(http://www.uniprot.org), only 686 proteins have been listed in the IUIS allergen
nomenclature database (www.allergen.org) as documented allergens. Although about 1500
allergens (including iso-allergens) have been listed in the Allergome database
(www.allergome.org), it has been shown that they are distributed into a very limited
number of protein families. However, critical feature(s) that makes proteins allergenic is not
fully understood. In the present article, well discuss recent applications of bioinformatic
tools that shaped our current understanding about allergenicity of proteins.
2. Allergen bioinformatics - a need of the hour

Experiments on genetic engineering during the last few decades have led to the production
of numerous genetically modified (GM) organisms. So, proteins introduced into GM
organisms through genetic engineering must be evaluated for their potential to cause
allergic diseases. As a classical example, transgenic soy, that has been genetically engineered
to express ground-nut 2S albumin, was found to elicit hypersensitivity reactions in ground-
nut allergic people (Nordlee et al., 1996). In 2001, the FAO/WHO suggested a procedure for
performing FASTA or BLAST (Basic Local Alignment Search Tool) searches, and a threshold
of greater than 35% identity in 80 or greater amino acids to identify potential allergenic
cross-reactivity of transgene encoded proteins in genetically enhanced crops (Silvanovich et
2 Selected Works in Bioinformatics
al., 2009). Given that this will not exclude all probabilities of a protein to be allergenic (and
cross-reactive to known allergens), the codex guidance recognized that the assessment will
evolve based on new scientific knowledge (Goodman, 2008).
Bioinformatic tools are key components of the 2009 Codex Alimentarius for an overall
assessment of the allergenic potential of novel proteins. Bioinformatic search comparisons
between novel protein sequences, as well as potential novel fusion sequences derived from
the genome and transgene or from any known allergen(s) are required by all regulatory
agencies that assess the safety of genetically modified (GM) products(Ladics et al., 2011).
Allergens were usually seen as an array of proteins with no apparent similarity in structure
and function. They come from diverse sources: Plants, animals or fungi and may take different
modes of exposure: inhalation, ingestion, sting or contact. They are, like their non-allergenic
counterparts, structurally heterogeneous. For example, the major cat allergen Fel d 1, is an
alpha-helical tropomyosin, while a major dust mite allergen Der p 2 consists predominantly of
beta sheets and the major birch pollen allergen Bet v 1 contains both of these structural
elements. Allergen sequences are extensively studied to find out any possible structural
element or function associated with allergenicity. However, no such allergen-specific
structural / functional element could be identified. High sequence identity between
homologous protein allergens may result in common surface patches that may confer cross-
reactivity among them. Aalberse pointed out that proteins sharing less than 50% sequence
identity are rarely cross-reactive(Aalberse, 2000). In contrast, proteins that share at least 70%
identity often show cross-reactivity. Many IgE-binding epitopes have been identified as
sequential epitopes, although for many this does not represent the full epitope. Linear epitopes
are usually part(s) of conformational epitope(s) responsible for a significant portion of IgE
binding. While IgE-binding peptides can consist only of five amino acids (Banerjee et al., 1999),
the majority of characterized IgE-linear epitopes are eight amino acids or longer (Chatchatee et
al., 2001; Shin et al., 1998). Astwood et al. recommended sequence comparisons to a database
of known IgE-binding epitopes. Finally, Ivanciuc and colleagues have recently utilized mixed
sequence and structure-based methods to predict IgE-binding sites. This is based on
comparison of local sequence and structure to identify common features associated to
allergens (Ivanciuc et al., 2009b).
3. Allergen databases
Exponential growth of molecular and clinical data on allergens has created a huge demand
for efficient storage, retrieval and analyses of available information. There are numerous
allergen databases available on Internet. They are targeted to different aims ranging from
easy accessibility of data to novel allergen prediction. A few examples have been provided
in table-1.
The IUIS (International Union of Immunological Societies) allergen nomenclature
subcommittee has created a unique, unambiguous nomenclature system for allergenic
proteins. It maintains an allergen database (www.allergen.org) containing an expandable list
of WHO/IUIS recognized allergen molecules arranged according to Linnean system of
classification (Kingdoms: Plantae, Fungi and Animalia and subdivided into lower
orders)(Chapman et al., 2007) of the source organism. This database is a precise and
convenient source for researchers, since it contains the biochemical name and molecular
weight of the allergens and isoallergens (multiple molecular forms of the same allergen
showing 67% sequence identity). It is searchable by allergen name, source and taxonomic
Allergen Bioinformatics: Recent Trends and Developments 3
group. For example, a search using the key word Bet v 1 shows about 36 variants
(isoallergens) of this allergen, each with genbank, uniprot accession numbers and, if
available, with PDB IDs. Each uniprot ID is linked to the original entry in uniprot database.
Moreover, once the uniprot IDs are obtained, their sequences can be retrieved in batches
using uniprots retrieve tab.
Allergome (Mari et al., 2006) is a vast repository of data related to all allergen molecules. It
contains data about a larger number of allergens than actually recognized by IUIS/WHO. It
also contains links to other databases (eg Uniprot, PDB) and computational resources with
additional extensive links to literature. The Allfam database is a useful resource for
grouping of allergens into protein families. It utilizes the allergen information from
Allergome database and protein family information from pfam database. It can be sorted
by source (plants/animals/bacteria/fungi) and route of exposure
(inhalation/ingestion/contact/sting etc) or can be searched for specific protein families.
Allergen entries are linked to corresponding records in the Allergome database. In addition,
each allergen family is linked to a family fact sheet containing descriptions of the
biochemical properties and the allergological significance of the family members.
Name (URL) Purpose

Database targated towards
IUIS
systematic nomenclature of
(http://www.allergen.org/)
allergenic proteins
Vast source of information and
Allergome
references about allergen
(http://www.allergome.org/)
molecules
Allfam
Database for allergen classification
(http://www.meduniwien.ac.at/allergens/allfam/)
Allergen Database for Food Safety (ADFS) Database with computational
(http://allergen.nihs.go.jp/ADFS/) allergenicity prediction tool
The Allergen Database A basic database for allergen
(http://allergen.csl.gov.uk//index.htm) structures
Allermatch Allergenicity prediction from
(http://www.allermatch.org/) sequence
Webserver for predicting
AllerTool
allergenicity and allergenic cross-
http://research.i2r.a-star.edu.sg/AllerTool/
reactivity
AlgPred
In silico prediction of allergenicity
(http://www.imtech.res.in/raghava/algpred/)
WebAllergen To predict potential allergenicity
(http://weballergen.bii.a-star.edu.sg/) of a protein from its sequence
Database of allergen structure
SDAP
with various resources, links and
(http://fermi.utmb.edu/SDAP/)
computational tools
Table 1. A few databases of allergenic proteins and web-servers to predict protential
allergenicity from amino-acid sequence.
Although the above-mentioned databases are very useful resources, they do not contain any
computational tool to predict allergenicity from amino acid sequences of proteins. However,
there are several other databases that can efficiently deal with this aspect. ADFS (Allergen
Database for Food Safety) is developed and maintained by Japans National Institute of
Health Sciences. It is a good resource of available information about known allergens
(uniprot protein ID, PDB accession number, epitope sequence, presence of carbohydrate,
pfam - and interpro domain IDs etc.). Moreover, this website has computational tools to
predict allergenicity. Other websites dedicated to allergenicity prediction are Allermatch,
AllerTool and Algpred etc. Detailed discussion on these servers is beyond the scope of the
present article.
The database which is dedicated to the structural biology of the allergic proteins is SDAP
(Structural Database of Allergenic Proteins) hosted by the University of Texas Medical
Branch. It integrates a database of allergenic proteins with various computational tools for
prediction of allergenicity and epitope sequences on protein allergens.
Analyses of data available in different publicly accessible database have shaped our current
understanding about allergens, as discussed in the subsequent sections of this article.
3.1 Allergens seen as proteins without bacterial homolog

Among numerous proteins sequenced till date, only about a thousand has been classified as
allergens, although no common structural or biochemical function could be assigned to all
allergens. To address this problem, Emanuelson and Spangfort (2007) used 30 randomly
selected allergen sequences to search the non-redundant Expasy/SIB and UniProt/TrEMBL
databases (subsection Bacteria+Archea) using BLAST (Basic Local Alignment Search Tool)
program. For each allergen, an appropriate species-specific non-allergenic control homolog
was included. It has been found that 25 out of 30 allergens do not have any bacterial
homologues; two other allergens have only a few, while all the non-allergenic controls
retrieved numerous bacterial homologues. Moreover, major allergens like Bet v 1, also lack
human homolog. The authors, thus, interpreted that the allergens are usually foreign
proteins that lack bacterial homologues (Emanuelsson and Spangfort, 2007).
3.2 Allergenic proteins can be organized into families

The first definite interpretation that allergens can be grouped came from arranging
allergens into pfam protein families. Pfam classifies proteins into families on the presence
of specific domains (pfam domains) identified through multiple sequence alignments and
Hidden Markov Models. Pfam 25.0 (latest version; March 2011) contains over 100, 000
protein sequences classified into 12,275 families (Finn et al., 2010). The allergen database
that contains pfam domain information is AllFam (http://www.meduniwien.ac.at
/allergens/allfam), where allergen sequences are classified into protein families using the
Pfam database, and its associated database, SwissPfam. AllFam includes all allergens that
can be assigned to at least one Pfam family. But many allergens are multi-domain
proteins. The domains of these proteins are merged into a single AllFam family, if the
Pfam domains of this allergen occur only in combination with a single other Pfam
domain. Figure-1 shows the distribution of allergenic proteins in different Allfam families.
The major allergen families (containing 10 or more allergens) with corresponding Pfam
domains are shown in Table-2.
Fig. 1. Pi chart showing the distribution of allergic proteins in different AllFam families.
Numbers of constituent allergens have been indicated within brackets.
Allfam ID Name Pfam ID Allergens Examples

Prolamin Amb a 6 (Ragweed)
AF050 PF00234 82
superfamily Ana o 3 (cashewnut)
PF00036 Aln g 4 (Alder)
AF007 EF hand domain 63
PF01023 Bet v 3 (birch)
Bet v 2 (birch)
AF051 Profilin PF00235 48
Ana c 1 (pinapple)
Der p 10 I(mite)
AF054 Tropomyosin PF01357 47
Hom a 1 (lobster)
Cupin PF00190 Ara h 1 (peanut)
AF045 42
superfamily PF04702 Gly m 5 (soyabean)
CRISP/PR-
Pol d 5 (wasp venom),
AF044 1/venom group 5 PF00188 26
Art v 2 (mungwort)
allergen family
Bet v 1-related Bet v 1 (birch)
AF069 PF00407 24
protein Api g 1 (celery)
PF00061 Can f 1 (dog)
AF015 Lipocalin 23
PF08212 Bos d 2 (domestic cattle)
Expansin, C- Phl p 1 (timothy grass)
AF093 PF01357 22
terminal domain Tri a 1 (wheat)
PF00082
Subtilisin-like Asp f 13 (fungal)
AF021 PF02225 21
serine protease Pen c 1 (fungal)
PF05922
PF00089
Trypsin-like Der f 3 (mite)
AF024 PF02983 17
serine protease Blo t 3 (mite)
PF09396
Thaumatin-like Mal d 2 (apple)
AF060 PF00314 14
protein Pru av 2 (Cherry)
Can f 3 (dog)
AF056 Serum albumin PF00273 13
Fel d 2 (cat)
Expansin, N- Phl p 1 (timothy grass)

AF094 PF03330 12
terminal domain Ory s 1 (rice)
PF00113 Alt a 6 (fungal)
AF031 Enolase 11
PF3952 Cha h 6 (fungal)
Chi t 1 (midge)
AF009 Globin PF00042 11
Chi t 2 (midge)
Hevein-like Hev b 6 (rubber latex)
AF043 PF00187 11
domain Mus a 2 (banana)
Amb a 1 (ragweed)
AF073 Pectate lyase PF00544 11
Cry j 1 (Japanese cedar)
Cry j 2 (Japanese Cedar)
AF057 Polygalacturonase PF00295 11
Jun a 2 (mountain Cedar)
PF00151 Pol a 1 (wasp)
AF037 Lipase 11
PF01477 Sol i 1 (ant)
60S acidic Alt a 5 (fungal)
AF070 PF00428 10
ribosomal protein Cla h 6 (fungal)
PF00128
PF02806
Blo t 4 (mite)
AF033 Alpha amylase PF07821 10
Der p 4 (mite)
PF09154
PF09260
Bos d 8 alphaS1
(domestic cattle)
AF065 Alpha/beta casein PF00363 10
Ovi a casein alphaS1
(sheep)
Eukaryotic PF00026 Asp f 10 (fungal)
AF004 10
aspartyl protease PF07966 Bla g 2 (cockroach)
Papain-like serin PF00112 Der p 1 (mite)
AF030 10
protease PF08246 Blo t 1 (mite)
Alt a 4 (fungal)
AF023 Thioredoxin PF00085 10
Fus c 2 (fungal)
Amb a 1 (short ragweed)
AF073 Pectate lyase PF00544 10
Jun a 1 (mountain ceder)
Table 2. Major allergen families (AllFam familes) that contain 10 or more allergens are
shown with correspondent pfam domains and examples. Number of allergenic members /
allergen family has also been shown.
AllFam takes the allergen information from Allergome, the comprehensive allergen
database. In the latest version of Allfam (May, 2011), 950 allergens have been arranged into 150
allergen families (AllFam families). It has been found that the allergens are distributed in a
really skewed manner with about 30% members belonging to only 5 families (Prolamin,
Profilins, EF hands, tropomyosin and cupins) and showing few restricted biological functions
such as hydrolysis, storage or binding to cytoskeleton [6]. Moreover, allergens contain about
245 pfam domains in total, which is only about 2.0% of all domains identified to date.
AllFam gave us an opportunity to retrieve and sort allergen data according to source
(plant/animal/fungi/bacteria), route of exposure (inhalation/ingestion/contact etc) and
Pfam/AllFam family identities. This analysis combined with the study of evolutionary
relationship among the proteins has led to the following valuable insights:
i. Pollen allergens (Inhalant plant allergens) are restricted into few protein
families(Radauer and Breiteneder, 2006). They populate only 29 out of more than 7000
protein families, with (a) Expansins (b) Profilins and (c) calcium-binding proteins (with
EF-hand domains) consisting most of the pollen allergens followed by Bet v 1 related
/pathogenesis-related proteins (PR10 family). Figure-2 shows the evolutionary
relationship between several allergenic and non-allergenic members of (a) expansins
and (b) profiling families. The evolutionary history was inferred using the Neighbor-
Joining method(Saitou and Nei, 1987). The evolutionary distances were computed using
the Poisson correction method(Zuckerkandl and Pauling, 1965) and the phylogenetic
analyses were conducted in MEGA4(Tamura et al., 2007). Similar method has been
followed in the subsequent sections of the present article. Allergens of the expansin
family are clustered as highly identical proteins as shown in the figure. Allergenic plant
profilins also constitute a conserved homologous group with high sequence identities
(70-85%) among themselves, while showing low identities (30-40%) with non-allergenic
profilins from other eukaryotes including human(Radauer and Breiteneder, 2006).
About 10 of the 29 pollen allergen families are also present in plant-derived foods.
Fig. 2. Phylogenetic trees showing the relationships of two major pollen allergen families: (a)
Expansins, (b) Profilins and their respective non-allergenic homologues. Pollen-related plant
food allergens such as Ara h 5, Dau c 1 etc are also included. Uniprot accession numbers are
shown. Positions of allergens are indicated by dotted lines.
ii. In case of major animal food protein families evolutionary distance from human
homologue reflects their allergenicity (Jenkins et al., 2007). This has been demonstrated
in major food allergen families like (a) parvalbumins, (b) casins and (c) tropomyosins.
Fig. 3. Dendrogram showing evolutionary relationship among 12 different parvalbumins (a)

and 13 different tropomyosins (b) from animals and human. Allergenic proteins and their
non-allergenic homologues as well as the closest human homologues are chosen. The
Uniprot accession numbers and positions of allergen clusters are indicated.
iii. Plant food allergens are clustered into only four major protein families
T ree
co tt
H az el
C ot to
H or
o n
Hornb eam alle
RN
b
A lle rg
n PR 10 e p rot.
e am
C5
A
1
se li
6 93
5US
Q 8 L 6K
a lle
en C or a r b 1 .2
B irc
.1
P8
H az
Q0
k
2-
rg e n
YN
Birc h Be
P .B -Q
Alder Aln g 1-P38948
h Be
Q 6Q 4B
17-
K8
el a
C4
6
R G 2-
-Q
a 1.01 -P 3 8
rge
M
BR
C
US
tv1
D W 8kD W A
lle r
9S
Ch
sp
-Q 9
l lo e a A l o v e r p e a A
n
-Q
Q5
er
t v 1.Sc 39 4 2 8
r e ld r e
4 5E7
G a rlfa lfa P P
g en
8
.G C
Car
ry
ot
-Q
77
4
.C -
52
al
.p
7
co
08
le
C or
-P
3 4 -Q
p C den
AP
1M
b 1-Q 963 82
sp
rg
s1
.1a
40 79 5 0
Ap
sw
1- Q 3941
en W
Q8
10
r us M o ru
Ap
A
ri c
a 1 .0
eet
Pr
BA
-
PR
pl
ot
ea u 10
1 8k
av
che
Ap PR
n
al l
7
4 03
pi
ll e U9
1
Lith pl e 1. .R
71
er
lu
S tr rg
s tn
02
7
o sp ar 2V
ge
41
a ll en
-Q 9
ic k
aw
w
e rm 03 er g -Q
Q
n
Be
b er M m
ut
-Q ta 10
Mo
Ch
um
.2-
en
Pr
ry al
ec
FPK
Re PR
Ye
P R2 d 1 6Q
PR
alle Ma
R4
5
u
8
hP
Litho -Q9 rg e n 9
l H ea P2 5
ar
aP
sperm n F d 1.0 .03- U
10 9Z R
u m P ZTP 6 gb R1-
3
Ch e
R1
1-
pe
rry ra a 5-A Q4V 1 un n P
Q9 U
R1-Q
O5
XX8
-Q
alle M y b ea
rgen 1c-Q 0A PH
w
40154
-Q9S
00
Co
3Y 8
Pru 25 U 9 ne P R3
01
av 1 6S4 C8 Kid ow pea
H9
987
Sweet
orange
-O2
4248 C m 4-P26
Gly
PR10-A rgen 43453
0FIJ6
ya be an alle ess-induced prot.-Q
So Str
Soyabean
94IM3
Durango PR
10-Q7Y083 Alfalfa PR10.2-Q
Pisum f. Ypr10.Pi.ful.2
Oxalis major STP octin-Q8W2B4 -O24256
Peanut Ara
Pean h 8-Q6VT83
Barrel medic MtN13-P93330 ut PR
10-Q Wh
ite lu 0PKR
Protein T1-P93105 C pin 4
Rosy Periwinkle PR G a h i ck PR1
0-O
Vitis q. PR10.3-Q20BD2 2 r d p ea 240
-Q9FS4 en PR 10
PR10.1 Pe 1
a A 0 a -Q
Grape 43 39 4
9FS BR 50
1 0.2-Q 18
-Q
R
pe P 06
Gra 93
0
SJ W
o rt
Bo PO
nn CP
Bell H 1-
et Q 8H
9065 p
Po e p p
Ca p e pp e 1L1
-O4 ps r PR
rgen LWB1 i cu 10-Q
To
X9 ta e r-
alle to Q5 m 2 VT 5
n root P - Q9
Q8
LN m o la n PR GM ba Bo 5
dell
io S
10- a to cc a n n
D an ry V ST N2 tum et p
S
h ico a PR ST H e
PR pper
C i 40 H2 -2
n 81 6 1 0- P
3
Zi n 2
1 -O 31 937 A 3 R1 0 - Q
90
P1
um
-Q
08 89
. PR 75T -P4
8S
76 QN 5D
79 8
53
lla b 41
40 9 41
-Q
Q N0 UH
v.
e 0 - 1 U3
1. 0 6
0 .1
1-P 8
pin R1
5
1 -Q -P 1
PR
N a se 0
5
Pim P g
R1
se 2 9 18
r ot
n g R P 8089
i
1 .3
1 0-
Tom
Ap
tP
Ca
Ch
PR
2
ro
y
Q4
-P 9
l er
ine
Ca
le y
a to
-
PR
Ce
K
.0 2
rs
YL
s
ey
Pa
T SI-
g1
e sa
Na
1
rs l
in se
pi
gR
Pa
ge
O 49
yA
S TH
se n
an G
881
ler
G in
2-A
Ce
K o re
6N
ea n
8C
K or
As
4
pa
ra g
44 53
us
10.4-O2N X 6
T ru m
ea r
9S
M aiz e PR
A
Hya
ly
So rg hu
s pa
0 .2 -Q
f lo
p et lil
cin th
we
r
Sorghum bicolor PR10-Q4 1298
ag u
PR1
t lily PR
r in
m bico
y P R 10
sP
10-Q 29
g -Q
P R1
ru ce
R1
9
0-Q 5
0.5
623
lo r PR
Tr um pe
ite p
.1 -Q 9Z
-Q
SB 6
3
Y JR
9Z
Wh
RR
10 c-Q 4V
3
P P9
9
2
a-Q 9L KJ
Berley PR10-Q84Q C7
Q B4
14
1
Rice PR 10
3
2X X
1
WZ
1A
U
9FY
2A
3A
d -A
bin d W P 8
-A
-A
in g -Q
ic te
0a
ed
Z
R1
-Q 9
ict
red
j. P
r ed
1
TJ
in g
ep
is
4Q
ep
pt
2
in d
R ic
in in
-Q
TJ
Co
R ic
2
4Q
th
in b
yn
y to k
1-Q
es
k in
in
th
ur
in C
yn
y to
la
oc
es
nc
rc
Lup
in
no
ur
b ea
py
c la
p
Po
ng
co
or
Mu
yn
pp
Po
0.2
Fig. 4. Un-rooted neighbor-joining tree showing evolutionary relationship among the

members of Bet v 1-related plant protein family (containing pfam domain PF00407). Uniprot
accession numbers and position of the allergen cluster has been indicated.(Radauer and
Breiteneder, 2007). They are (a) the Prolamin superfamily with PF00234 domain (b) the
cupin superfamily with PF00190 and PF04702 domains (c) the Profilins with PR00235
domain and (d) the Bet v 1 like proteins containing PF00407 domain. Prolamins are seed
storage proteins containing about 82 characterized allergens, with 65 enlisted as ingestants.
Figure-4 shows the evolutionary relationship among the Bet v 1-homologous protein family.
Twenty-four proteins of this group are known as allergens present in pollen and plant-
derived foods responsible for causing allergic sensitization in a large number of people.
3.3 Allergen-associated protein domains

The other allergen database that utilizes the Pfam protein family information is Motifmate
(http://born.utmb.edu/motifmate/index.php) (Ivanciuc et al., 2009a). Motifmate assigns
pfam domains to the allergens listed in the SDAP (Structural Database of Allergenic
Proteins) database developed and maintained by the University of Texas
(http://fermi.utmb.edu/SDAP)(Ivanciuc et al., 2003). The recent version of this database
contains 679 Proteins (May, 2011). The authors pointed out that all the allergenic protein
entries in SDAP could be associated with only 130 pfams (of total 9318 pfams) with only
about 31 pfam protein families containing 4 or more number of allergens. [Figure-5]. This
outcome supports the previous finding that the allergenic proteins are clustered in few pfam
families.
40
35
30
25
20
15
10
0
PF00234
PF00235
PF00036
PF01357
PF00188
PF00407
PF00261
PF00190
PF00061
PF03330
PF00042
PF00544
PF00112
PF00428
PF00082
PF00314
PF01190
PF01620
PF00012
PF00578
PF02221
PF05922
PF00089
PF00113
PF00187
PF00273
PF03952
PF00151
PF00197
PF00295
PF01630
Fig. 5. Distribution of Pfam domains in allergenic proteins according to Motifmate database.

lipid transfer proteins (PF0234) highest number of allergns.
4. Insights from structural bioinformatics

After the elucidation of X-ray crystal structure of the birch pollen allergen Bet v 1(Gajhede et
al., 1996), structures of several allergens have been solved. Searching the protein databank
with the keyword allergens returns 321 entries, with occasional presence of multiple
entries for one single allergen. Although protein structure gives us valuable insight into
their function, structures of several allergens are still not known. More importantly, some
allergen families have members with known structures, while others may have very few /
no member whose structure(s) have been deduced. Allergen structures are particularly
useful to elucidate molecular features related to allergenicity, cross-reactivity and for
designing hypoallergenic derivatives. For example, there are about five structures in protein
data bank that correspond to Bet v 1, the major birch pollen allergen : the x-ray structure
(1BV1.pdb), the NMR structure (1BTV.pdb), mutants (1B6F.pdb and 1QMR.pdb), complexed
with IgG Fab (1FSK.pdb) and the hypoallergenic isoform Bet v 1d (3K78.pdb). On the
contrary, several groups, such as the cupin family of seed storage protein allergens are
under-represented.
Knowledge about allergen structures is important because it is the over-all structure, not the
sequence, which determines the biochemical/immunological properties. Molecular
modeling can help us in case the experimentally determined structure of the allergen is not
available. Homology modeling, also known as comparative molecular modeling, can predict
the 3D model of a given protein from its amino acid sequence using experimentally derived
structure(s) (X-ray/NMR) of one or more related homologous protein(s) (called template).
This technique is becoming increasingly popular because, if required template selection and
alignment criteria are met, it is believed to be the most reliable modeling technique to date
(Marti-Renom et al., 2000). It is becoming increasingly useful because although there are
millions of proteins in nature, the number of structural folds they can assume is limited
(Zhang, 1997) and the number of X-ray/NMR structure of proteins is exponentially
increasing providing an increased chance of getting a suitable template. Several authors
have successfully utilized this technique of molecular modeling to predict allergen
structures and to elucidate the structural basis of cross-reactivity between allergens.
Ara h 1 (vicilin) and Ara h 2 (2S albumin) are seed storage proteins of peanut (Arachis
hypogea). They are recognized by serum IgE of >90% of peanut-allergic people, thus showing
their importance as major peanut allergens (Shin et al., 1998; Stanley et al., 1997). Ara h 1
shows IgE-mediated cross-reactivity with other vicilin allergens such as Len c 1 (from lentil)
and Pis s 1 (from sweet pea). Following sequence alignment using ClustalX, structural
models of Ara h 1, Len c 1 and Pis s 1 were generated from experimentally derived structure
of beta-conglycinin (RCSB protein data bank code: 1IPJ) using programs InsightII,
Homology and Discover3 (Accelrys, USA). Electrostatic surfaces of these proteins were also
generated using program GRASP (Nicholls et al., 1991). Mapping of linear epitope
sequences revealed that nine out of 23 linear B-cell epitopes are located in the N-terminal
region. They are unique to Ara h 1. But the remaining B-cell epitopes, situated in the C-
terminal part, are well-exposed to the surface, share a high degree of homology and 3D
conformation to Len c 1 and Pis s 1. They might be responsible for cross-reactivity among
Ara h 1, Len c 1 and Pis s 1 food proteins. Similarly, Ara h 2 and other dietary allergenic 2S
albumins Jug r 1 (walnut), Car i 1 (pecan nut), Ber e 1 (Brazil nut) were modeled using the
atomic coordinates of homologous Ric c 1(castor bean 2S albumin). Mapping of known
epitope sequences on the template and modeled structures revealed no structural homology
between allergenic 2S albumins of peanut, walnut, pecan and brazil nut. This indicates that
cross-reactivity between Ara h 1 and other 2S albumins, which is less likely, might not be
mediated by protein epitopes, but CCDs (cross-reactive carbohydrate determinants).
However, the c-terminal epitope region of Jug r 1 showed a clear structural homology with
Car i 1 indicating the possibility of their cross-reactivity.
Another important insight was obtained from the homology modeling of allergenic
cyclophilins(Roy et al., 2003). Groups of highly homologous cross-reactive allergens such as
cyclophilins, profilins, MnSOD are known as pan-allergens. They often cross-react with their
respective human homologues(Crameri et al., 1996) and such cross-reactivity might be

responsible for severity and perpetuation of symptoms in the absence of exogenous allergen
exposure(Fluckiger et al., 2002). Allergenic cyclophilins (peptidyl-prolyl cis-trans isomerase;
PF00160) have been identified from several organisms such as: Periwinkle (pollen allergen
Cat r 1), birch (pollen allergen Bet v 7), Aspergillus fumigatus (Asp f 11, Asp f 27), Psilocybe
cubensis, Malassazia furfur (Mala s 6, formerly known as Mal f 6) and carrot. IgE-mediated
cross-reactivity between Mala s 6, Asp f 11, yeast cyclophilin and human cyclophins has
been demonstrated (Fluckiger et al., 2002). The structure of human cyclophilin, which shows
high sequence identities to Asp f 11, Mala s 6 and yeast cyclophilin, was known from
crystallography (PDB code: 2RMB). Thus, taking this as the template, the molecular models
of three other cyclophilins were generated and compared with the human homologue to
understand the structural basis of their cross-reactivity.
Fig. 6. Structure diagram of the allergenic cyclophilin Mala s 6 as predicted in 2003 from
homology modeling (left figure) and as determined by x-ray crystallography (right figure)
in 2006 (2CFE.pdb). Alpha helices have been shown in red, while beta sheets are in yellow
and loops (smoothed) are in green.
Molecular modeling was done using program Modeller (Sali and Blundell, 1993). The
structures were energy-minimized using program Discover with Consistent Valence Force
Fields(Hagler et al., 1979) and their steriochemical qualities were checked using
Procheck(Laskowski, 1993). Several empirical/semi-empirical programs were used to
predict the antibody binding sites (B-cell epitopes) on these proteins and residue-wise
solvent accessibility values of these predicted epitopes were calculated using program
NACCESS(Hubber, 1992). The cyclosporine-binding site of these proteins were also
identified by aligning the sequences (using ClustalW) and structures. This study revealed
large conserved solvent-exposed patches on the surfaces of these proteins strongly
suggesting their cross-reactivity. The x-ray crystal structure of Mala s 6 (PDB code: 2CFE),
published three years later (Glaser et al., 2006), very much resembles its predicted model
[Figure-6]. The domain-swapped structure of Asp f 11 dimer (PDB code: 2C3B), also
published at the same time, showed similar structural fold. Asp f 11 dimer (resulting from
increased protein concentration) seems to be enzymatically inactive, since the active sites of
both its subunits are blocked due to dimerization. However the constituent monomers
retained the basic cyclophilin structure. More recently, a comprehensive 3D structural

modeling of allergens, with no known structure, has been conducted followed by surface
accessibility calculation and mapping of known IgE-binding epitope sequences. It has been
found that Ala, Asn, Gly and Lysine have a high propensity to occur in the IgE-binding sites
on the surface of allergenic proteins (Oezguen et al., 2008).
Finally, techniques of structural bioinformatics have also been applied to assess features
critically required for allergenicity and cross-reactivity. This has been done by analyzing the
predicted structure of protein T1, the naturally occurring non-allergenic member of the Bet v
1 allergen family (Ghosh and Gupta-Bhattacharya, 2008). Protein T1 shows considerable
sequence similarity with the proteins of Bet v 1 allergen family, but it is neither allergenic,
nor cross-reactive to the Bet v 1 group (Laffer et al., 2003). Comparative molecular modeling,
solvent accessibility calculations and mapping of surface electrostatic potential showed
substantial difference in antigenic surface that can be responsible for the loss of cross-
reactivity. Solvent-accessible surface area and electrostatics calculations were done using
program DSSP (dictionary of secondary structure of proteins) and program APBS (Adoptive
Poissopn-Blotzman solver) respectively (Baker et al., 2001; Kabsch and Sander, 1983).
Although, as suggested by ligand docking, it should be able to perform its biological
function as a brassinosteroid carrier.
5. Conclusion
Allergy is a world-wide problem. Allergic symptoms are elicited following exposure to a
structurally diverse group of proteins known as allergens. Understanding allergenicity at
the molecular level has wide application in food safety and in treating allergic diseases.
What makes a protein allergic is not yet understood. However, advanced tools of
bioinformatics have been applied to address this problem. It has been found that allergens
are usually foreign proteins with few/no bacterial homologue. They are clustered into few
protein families (associated with a limited number of protein domains) opposing the idea
that any protein can be allergenic. Methods have been developed to predict probable
allergenicity from protein sequence, although more works need to be done for better and
more precise prediction. The structural difference between IgG-binding and IgE-binding
epitopes is still not very clear, but homology modelling in combination with residue-wise
solvent-accessibility of monomers and biological assemblies of allergens certainly gives
valuable information about antigenic determinants on protein allergens.
6. References
Aalberse R. C. (2000) Structural biology of allergens. J Allergy Clin Immunol 106, 228-38.
Baker N. A., Sept D., Joseph S., Holst M. J. and McCammon J. A. (2001) Electrostatics of
nanosystems: application to microtubules and the ribosome. Proc Natl Acad Sci U S
A 98, 10037-41.
Banerjee B., Greenberger P. A., Fink J. N. and Kurup V. P. (1999) Conformational and linear
B-cell epitopes of Asp f 2, a major allergen of Aspergillus fumigatus, bind
differently to immunoglobulin E antibody in the sera of allergic bronchopulmonary
aspergillosis patients. Infect Immun 67, 2284-91.
Chapman M. D., Pomes A., Breiteneder H. and Ferreira F. (2007) Nomenclature and
structural biology of allergens. J Allergy Clin Immunol 119, 414-20.
Chatchatee P., Jarvinen K. M., Bardina L., Beyer K. and Sampson H. A. (2001) Identification
of IgE- and IgG-binding epitopes on alpha(s1)-casein: differences in patients with
persistent and transient cow's milk allergy. J Allergy Clin Immunol 107, 379-83.
Crameri R., Faith A., Hemmann S., Jaussi R., Ismail C., Menz G. and Blaser K. (1996)
Humoral and cell-mediated autoimmunity in allergy to Aspergillus fumigatus. J
Exp Med 184, 265-70.
Emanuelsson C. and Spangfort M. D. (2007) Allergens as eukaryotic proteins lacking
bacterial homologues. Mol Immunol 44, 3256-60.
Finn R. D., Mistry J., Tate J., Coggill P., Heger A., Pollington J. E., Gavin O. L., Gunasekaran
P., Ceric G., Forslund K., Holm L., Sonnhammer E. L., Eddy S. R. and Bateman A.
(2010) The Pfam protein families database. Nucleic Acids Res 38, D211-22.
Fluckiger S., Fijten H., Whitley P., Blaser K. and Crameri R. (2002) Cyclophilins, a new
family of cross-reactive allergens. Eur J Immunol 32, 10-7.
Gajhede M., Osmark P., Poulsen F. M., Ipsen H., Larsen J. N., Joost van Neerven R. J., Schou
C., Lowenstein H. and Spangfort M. D. (1996) X-ray and NMR structure of Bet v 1,
the origin of birch pollen allergy. Nat Struct Biol 3, 1040-5.
Ghosh D. and Gupta-Bhattacharya S. (2008) Structural insight into protein T1, the non-
allergenic member of the Bet v 1 allergen family-An in silico analysis. Mol Immunol
45, 456-62.
Glaser A. G., Limacher A., Fluckiger S., Scheynius A., Scapozza L. and Crameri R. (2006)
Analysis of the cross-reactivity and of the 1.5 A crystal structure of the Malassezia
sympodialis Mala s 6 allergen, a member of the cyclophilin pan-allergen family.
Biochem J 396, 41-9.
Goodman R. E. (2008) Performing IgE serum testing due to bioinformatics matches in the
allergenicity assessment of GM crops. Food Chem Toxicol 46 Suppl 10, S24-34.
Hagler A. T., Lifson S. and Dauber P. (1979) Consistant force field studies of intermolecular
forces in hydrogen-bonded crystals.2. A benchmark for the objective comparison of
alternative force fields. J. Amer. Chem. Soc. 101, 5122-5130.
Hubber S. (1992) ACCESS: A program for calculating Accessibilities. Dept. of Biochemistry
and Molecular Biology, Univ Col of London.
Ivanciuc O., Garcia T., Torres M., Schein C. H. and Braun W. (2009a) Characteristic motifs
for families of allergenic proteins. Mol Immunol 46, 559-68.
Ivanciuc O., Schein C. H. and Braun W. (2003) SDAP: database and computational tools for
allergenic proteins. Nucleic Acids Res 31, 359-62.
Ivanciuc O., Schein C. H., Garcia T., Oezguen N., Negi S. S. and Braun W. (2009b) Structural
analysis of linear and conformational epitopes of allergens. Regul Toxicol Pharmacol
54, S11-9.
Jenkins J. A., Breiteneder H. and Mills E. N. (2007) Evolutionary distance from human
homologs reflects allergenicity of animal food proteins. J Allergy Clin Immunol 120,
1399-405.
Kabsch W. and Sander C. (1983) Dictionary of protein secondary structure: pattern
recognition of hydrogen-bonded and geometrical features. Biopolymers 22, 2577-637.
Ladics G. S., Cressman R. F., Herouet-Guicheney C., Herman R. A., Privalle L., Song P.,
Ward J. M. and McClain S. (2011) Bioinformatics and the allergy assessment of
agricultural biotechnology products: Industry practices and recommendations.
Regul Toxicol Pharmacol. 60, 46-53.
Laffer S., Hamdi S., Lupinek C., Sperr W. R., Valent P., Verdino P., Keller W., Grote M.,
Hoffmann-Sommergruber K., Scheiner O., Kraft D., Rideau M. and Valenta R.
(2003) Molecular characterization of recombinant T1, a non-allergenic periwinkle

(Catharanthus roseus) protein, with sequence similarity to the Bet v 1 plant allergen
family. Biochem J 373, 261-9.
Laskowski R. A. (1993) PROCHECK: A program to check the stereochemistry of protein
structure. J. Appl. Cryst. 26, 283-291.
Mari A., Scala E., Palazzo P., Ridolfi S., Zennaro D. and Carabella G. (2006) Bioinformatics
applied to allergy: allergen databases, from collecting sequence information to data
integration. The Allergome platform as a model. Cell Immunol 244, 97-100.
Marti-Renom M. A., Stuart A. C., Fiser A., Sanchez R., Melo F. and Sali A. (2000)
Comparative protein structure modeling of genes and genomes. Annu Rev Biophys
Biomol Struct 29, 291-325.
Nicholls A., Sharp K. A. and Honig B. (1991) Protein folding and association: insights from
the interfacial and thermodynamic properties of hydrocarbons. Proteins 11, 281-96.
Nordlee J. A., Taylor S. L., Townsend J. A., Thomas L. A. and Bush R. K. (1996) Identification
of a Brazil-nut allergen in transgenic soybeans. N Engl J Med 334, 688-92.
Oezguen N., Zhou B., Negi S. S., Ivanciuc O., Schein C. H., Labesse G. and Braun W. (2008)
Comprehensive 3D-modeling of allergenic proteins and amino acid composition of
potential conformational IgE epitopes. Mol Immunol 45, 3740-7.
Radauer C. and Breiteneder H. (2006) Pollen allergens are restricted to few protein families
and show distinct patterns of species distribution. J Allergy Clin Immunol 117, 141-7.
Radauer C. and Breiteneder H. (2007) Evolutionary biology of plant food allergens. J Allergy
Clin Immunol 120, 518-25.
Roy D., Ghosh D. and Gupta-Bhattacharya S. (2003) Homology modeling of allergenic
cyclophilins: IgE-binding site and structural basis of cross-reactivity. Biochem
Biophys Res Commun 307, 422-9.
Saitou N. and Nei M. (1987) The neighbor-joining method: a new method for reconstructing
phylogenetic trees. Mol Biol Evol 4, 406-25.
Sali A. and Blundell T. L. (1993) Comparative protein modelling by satisfaction of spatial
restraints. J Mol Biol 234, 779-815.
Shin D. S., Compadre C. M., Maleki S. J., Kopper R. A., Sampson H., Huang S. K., Burks A.
W. and Bannon G. A. (1998) Biochemical and structural analysis of the IgE binding
sites on ara h1, an abundant and highly allergenic peanut protein. J Biol Chem 273,
13753-9.
Silvanovich A., Bannon G. and McClain S. (2009) The use of E-scores to determine the
quality of protein alignments. Regul Toxicol Pharmacol 54, S26-31.
Stanley J. S., King N., Burks A. W., Huang S. K., Sampson H., Cockrell G., Helm R. M., West
C. M. and Bannon G. A. (1997) Identification and mutational analysis of the
immunodominant IgE binding epitopes of the major peanut allergen Ara h 2. Arch
Biochem Biophys 342, 244-53.
Tamura K., Dudley J., Nei M. and Kumar S. (2007) MEGA4: Molecular Evolutionary
Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 24, 1596-9.
Zhang C. T. (1997) Relations of the numbers of protein sequences, families and folds. Protein
Eng 10, 757-61.
Zuckerkandl E. and Pauling L. (1965) Evolutionary divergence and convergence in proteins.
in Evolving Genes and Proteins, edited by V. Bryson and H.J. Vogel. Academic Press, New
York., 97-166
2
Family Based Studies in Complex Disorders:

The Use of Bioinformatics Software for Data
Analysis in Studies on Osteoporosis
Christopher Vidal and Angela Xuereb Anastasi
University of Malta,
Malta
1. Introduction
Complex diseases are common within human populations and communities and pose a
great burden not only to affected individuals, but also to society and the health system.
Disorders such as chronic heart disease, diabetes, Alzheimers, epilepsy and many others,
are caused by complex interactions of a number of genetic and environmental factors. This
makes the identification of the responsible genes difficult if using the same methodologies
used for monogenic diseases. For more than fifteen years there has been a collective effort by
researchers from around the world to identify genes and genetic variations that increase the
risk for osteoporosis and fractures in ageing populations to identify novel therapeutic and
prognostic targets, but predominantly most studies have been inconclusive. Genetic
heterogeneity between different populations is the main factor responsible for this lack of
concordance between different studies. Using different approaches such as association,
family linkage, genome-wide association and meta-analysis, researchers reported numerous
genes that might play a role in bone physiology, most of the time searching for correlation
with phenotypes such as low bone mineral density (BMD) and fractures. Unfortunately,
most of these genetic variations were not further investigated for their functional role and
how these could lead to the disease. Some monogenic bone diseases led to the identification
of genes that were never considered to be involved in bone physiology such as the low
density lipoprotein receptor-related protein (LRP)-5 (Gong et al., 2001) and sclerostin (SOST)
genes (Brunkow et al., 2001).
A genome-wide linkage scan was performed in two Maltese families with a very high
incidence of osteoporosis, where suggestive linkage to chromosome 11p12 was observed.
After investigating the genes known to be found at this region by DNA sequencing, we
identified a variant in the CD44 gene that was co-segregating with the inherited haplotype
in all affected members within one of the families. Further studies on this variant suggested
that it could affect pre-messenger RNA splicing, or organisation, leading to different levels
of slightly modified variants of the same protein (isoforms). Other loci were identified in
both families.
Without doubt, the analysis of data would not have been possible without the number of
bioinformatic tools and software that are available. The advances in computer technology
including the internet, led to the development of various software and online tools. In this
chapter, we will take a look at software and other online tools used in this study. We will
discuss the basic concepts of the study, how the analysis was performed using different
software and the interpretation of results.
1.1 Gene mapping using families

One of the greatest challenges for geneticists is the identification of genes responsible for
complex disease. Unlike classical Mendelian disorders, these diseases do not show obvious
Mendelian patterns of inheritance and involve complex interactions between various
environmental and genetic factors. Confounding factors such as heterogeneity, phenocopies,
genetic imprinting and penetrance further complicate the identification of susceptibility genes.
When performing a genetic study, correlation between phenotype and genotype is sought.
In complex traits, this correlation might be very low due to incomplete penetrance where
not all individuals having the same susceptibility allele are affected or where affected
individuals do not have a susceptibility allele (phenocopies). These factors lead a wide
ranging severity of disease even within a single family. Further more, late onset diseases
such as cardiovascular disease and osteoporosis show up later in life and thus unaffected
individuals tested today might become affected in the near future. Late onset diseases are
more sensitive to environmental (mostly lifestyle related) factors and are observed to have a
higher level of genetic variation due to weak selective pressures on these variants that are
usually neutral early in life (Wright et al., 2003). Besides testing for a qualitative trait where
individuals are grouped as either having or not having the disease, one can use quantitative
or a continuous measurement such as BMD. When using a quantitative variable one must be
very cautious as it might not completely correlate with the disease and it could also be
dependent on a number of other non-genetic factors including limitations of methodology.
Complex disorders are most often polygenic where multiple genes contribute to the
phenotype. Complex patterns of inheritance might be due to allelic or locus heterogeneity
where different variants within the same gene are responsible for the disease or where a
number of different genes are involved in the same biological process. When studying
complex disorders, therefore, one is looking for susceptibility alleles at multiple loci that
together increase the individuals risk for the disease. In polygenic traits, penetrance is
determined by the genotypes of other loci and therefore it is likely to be low and will vary
between individuals. To increase the chance of successful gene mapping, it is important to
identify families from probands with extreme phenotypes, earlier age at onset or else to
study families from an isolated population with a very high incidence of disease. Wright
and colleagues (2003) suggested that it is important to identify genes with the largest
contribution to the extremes of the trait and avoid quantitative trait loci (QTL) that have
minimal effects on the individual or disease mechanism. Using single extended families
from populations that are homogeneous and consanguineous has proven to be a successful
approach in localising the genes and novel mutations in type 2 diabetes (Kambouris, 2005).
Using one extended family, Kambouris reported similar results to those obtained from
previous genome-wide scans using hundreds of individuals (Hanson et al., 1998). This
shows that costs and time to identify novel genes responsible for complex disorders can be
significantly reduced, when using extended and consanguineous families coming from
homogeneous populations.
1.1.1 Linkage analysis

In linkage analysis, the non-independent co-segregation of marker and disease locus is
tested in families with multiple affected individuals. Linked alleles (marker with disease-
The Use of Bioinformatics Software for Data Analysis in Studies on Osteoporosis 19
causing allele) on the same chromosome segregate together more often than expected by
chance; i.e. against Mendels law of independent assortment. Gene mapping of a trait
identifies chromosomal loci that are shared among affected individuals and that differ
between affected and non-affected family members. Positive linkage can only be obtained
for marker alleles inherited together with disease allele on the same chromosome. This is a
major limitation for linkage analysis when different disease alleles present at the same locus
are on different chromosomes, hence in trans, as in a case of coeliac disease (Vidal et al.,
2009a). In this study, no evidence of linkage was observed to the human major
histocompatibility complex (MHC) locus on chromosome 6, in a family with high incidence
of celiac disease. Further investigations showed that this was because inherited risk alleles
coding for HLA group DQ2.2 occur in trans and so cannot be detected by linkage.
For a linkage study family members from pedigrees with normal and osteoporotic
individuals are genotyped for a set of polymorphic markers either across the whole genome
or at specific chromosomal loci, where known candidate genes are located. Genetic linkage
is measured by the recombination fraction that is the probability that a parent will produce a
recombinant offspring and is dependent upon the distance between loci. The more distant
two markers are from each other the higher is the chance that a recombination event occurs
between them during meiosis. The recombination fraction theta () ranges from 0 for
completely linked markers to 0.5 for unlinked loci. Genetic linkage is measured in
centiMorgans (cM), where 1cM represents 1% recombination or = 0.01 that is equivalent to
1 million base pairs. So using the recombination fraction one can calculate the physical
distance on the chromosome, although recombination rates might vary depending on
location on chromosome. Recombination rate is usually lower closer to the centromere. Also
these measurements might not be so accurate for longer chromosomal distances where
multiple crossovers might occur during a single meiotic event, a phenomenon known as
interference. Two mapping functions to convert recombination fraction into map distance
are Haldanes, that does not assume interference, and Kosambis, which assumes
interference as 1 - 2.
1.1.2 Parametric linkage analysis

Parametric linkage analysis is a statistical approach using the logarithm of the odds ratio
(LOD score) to assess the strength of linkage. This is also known as a model based linkage
where the mode of inheritance, frequencies of disease and marker loci together with
penetrance must be known. The statistic assumes the likelihood (or probability) that a
disease and marker loci in a family are not inherited together ( = 0.5) compared with the
likelihood that they are linked over a selected range of recombination fractions ( range of 0
to 0.5). The LOD score is the base ten logarithm of the likelihood ratio that is calculated for
each value of . A two point LOD (z) score (between disease locus and marker) is calculated
using the following equation:
z(x) = log10 [L(=x) L(=0.5)] (1)

where x is a value of recombination fraction and L is the likelihood.
Significant evidence of linkage is taken at a LOD score of 3.0 or higher and linkage is
completely excluded with a LOD score of -2.5. A LOD score of 3.0 corresponds to odds of
1000:1 that means that it is 1000 times more likely that the alternate hypothesis in favour of
linkage holds while a LOD score of 3.5 is equivalent to odds of 3162:1. The LOD score can be
converted to a chi-square statistic by simply multiplying by 4.6 and calculating a p-value at
1 degree of freedom (df) for ordinary LOD and at 2 df for heterogeneity LOD scores
(HLOD), under the null hypothesis (Ott, 1991). The p-values obtained are always divided by
2 for one-sided tests except when calculating p-values for multi-point LOD (MLOD). Using
these calculations a LOD score of 3.0 is equivalent to a p-value of 0.0001 while that of 3.6 is
equivalent to 0.00002. However, a chi-square derived p-value applies more for large sample
sizes and can be underestimated when sample size is too small. Lander and Kruglyak (1995)
suggested that linkage must be reconfirmed by other independent investigators where a
nominal p value of 0.01 would be required, while they advised caution when reporting LOD
scores that are less than 3.0 and so are only suggestive of linkage. In case of suggestive
linkage, additional family data would be required before conclusions can be drawn (Lander
& Kruglyak, 1995).
LOD scores can be influenced by a number of factors including the phase or whether
parental genotypes are known, misspecification of disease and marker allele frequencies,
penetrance, heterogeneity and mostly by phenotypic misclassification. Also for more
accurate linkage information and to better localize the disease gene, multi-point linkage
analysis is preferred over two-point analysis. Statistical analyses in complex pedigrees are
carried out using software such as MLINK and GENEHUNTER where the LOD score can
also be adjusted for locus heterogeneity (HLOD) (Kruglyak et al., 1996).
Another kind of analysis which is thought to be useful when analysing linkage data for
complex traits is the MOD-score. In complex traits both the genetic model and disease allele
frequency are very difficult to specify correctly. An incorrect assumption of the genetic
model can significantly affect the analysis and can lead to a false negative result. The MOD
score is calculated by maximising the LOD score over a number of replicates using different
penetrances and disease allele frequencies, to obtain a maximum LOD score using the best
genetic model (Strauch et al., 2003). To control type I errors, it was found that a MOD-score
of 3.0 should be adjusted by a value ranging from 0.3 1.0 where it was proposed that a
MOD-score of 2.5 is indicative of suggestive linkage (Berger et al., 2005). MOD-score
analysis can be used to determine the best genetic model for those regions indicated by an
initial genome scan using ordinary LODs and it can also be calculated assuming paternal or
maternal imprinting. When assuming imprinting a heterozygote paternal penetrance is also
used with the other three penetrances with a total of four penetrance values. If a low
heterozygote frequency is calculated for paternal imprinting, it indicates that maternal genes
are preferentially expressed at that locus (Strauch et al., 2005; Berger et al., 2005).
1.1.3 Non-parametric linkage analysis

Since the mode of inheritance for complex disorders is uncertain, evidence of linkage might
be missed by using the LOD score method described above. A more appropriate approach is
that described by Kruglyak et al (1996) known as a non-parametric linkage (NPL) or a model
free analysis. The NPL statistic measures allele sharing among affected relative pairs (ARP)
and/or affected sib-pairs (ASP) within a pedigree. By chance it is expected that siblings
share zero, one or two marker alleles identical by descent (IBD) with a probability of 0.25,
0.50 and 0.25, respectively. If disease and marker alleles are linked then affected siblings will
share these alleles more frequently than expected by chance regardless of the mode of
inheritance. Comparison between expected and observed allele sharing between ASPs is
then analysed using the chi-square statistic. Highly heterozygous markers, multipoint
linkage and genotyping of non-affected siblings when parents are not available help to
increase the sharing information. One great advantage of the NPL statistic is that data from
markers on a chromosome can also be evaluated in a multipoint approach using software
such as GENEHUNTER which uses the Lander-Green algorithm to calculate IBD
distribution (Kruglyak, 1996).
1.2 Phenotype definition, selection of family and population

1.2.1 Phenotype
Phenotype definition is one of the most important factors and should be determined by
proper diagnosis or exclusion of other medical conditions that could lead to the same
disease. To exclude disease and other factors leading to secondary osteoporosis, individuals
were asked to answer a questionnaire and a series of other medical tests were performed.
Measurement of bone mineral density (BMD) together with t-scores (number of standard
deviations from the mean BMD of a control group of young women at peak bone mass) is
the gold standard to diagnose osteoporosis, as recommended by World Health Organisation
(WHO). However, this methodology does not show the whole picture partly because bone
strength, thus fracture risk, is not completely assessed by measuring bone density. Also,
individuals with normal BMD, who might become osteoporotic in ten or twenty years time,
could still carry the responsible allele. As discussed above, miss-classification of affected
status might seriously affect the results obtained by statistical analysis. To overcome this
issue, and unlike other linkage studies for osteoporosis, we used different thresholds of t-
scores and z-scores at the lumbar and femoral sites obtained after measuring BMD, to define
discreet phenotypes as simply affected or not-affected. Statistical analyses were performed
in five different scenarios defining discreet phenotypes using the guidelines suggested by
the International Society of Clinical Densitometry (Khan et al., 2004).
1.2.2 Families
Extended families with a number of affected individuals are ideal for identifying variants
with higher penetrance but are less frequently found in populations. Development of novel
treatments can be targeted to these pathways. Factors such as mode of inheritance,
penetrance and disease or allele frequencies together with technical factors such as accuracy
of genotyping, all affect power to detect a significant linkage.
1.2.3 Population
The genetic component within a population is strongly affected by its history and
demography. The genetic pool of a population is determined by mutations, population
admixture as well as by random genetic drift that occurs most often due to catastrophic
events that result in a major decrease in population (Wright et al., 1999). Genetically isolated
populations (by geography and/or culture), that recently expanded from a very small
number of founders with occasional interbreeding with other ethnic groups, are more likely
to share haplotypes identical by descent (IBD) over longer genetic distances (Wright et al.,
1999).
The present Maltese population, although geographically (but not genetically) isolated, is
thought to have expanded exponentially from a much smaller population during the last
four hundred years with a possibility of a number of founder effects introduced by
admixture with other populations coming from Sicily, the eastern Mediterranean and
northern Africa. Founder effects were reported in the Maltese population, including a
mutation (R1160X) found in the NPHS1 gene coding for nephrin that causes nephrotic
syndrome (Koziell et al., 2002) and the 68G>A mutation within the quinoid
dihydropteridine reductase gene that causes a rare form of hyperphenylalaninaemia and
phenylketonuria (Farrugia et al., 2007). The introduction of founder effects and major
bottlenecks may increase the chance of creating sub-populations with particularly high
allele frequencies when compared to the rest of the population (Heiman, 2005). Significant
fluctuations in the population were brought about by emigration of the Maltese in fear of
further attacks by the Turks, death by famine or plague. On the other hand, the existence of
a relatively frequent disease in an island population does not necessarily always indicate a
possible founder effect since this might result from multiple mutations in a single gene or in
different genes that could lead to the same phenotype (Zlotogora, 2007).
Genetically isolated populations proved to be very useful for the identification of genes not
only in the case of the BMP-2 gene in Iceland but also for a number of other diseases
(Styrkarsdottir et al., 2003). More than 15 mutated genes were successfully identified by
positional cloning in families from the isolated population of Finland. The Finnish
population demographic history was characterised by rapid expansion from a much smaller
population with a number of founder effects (Peltonen, 2000). Another island population
that proved successful for the identification of a mutation responsible for uric acid
nephrolithiasis by linkage was the Sardinian population (Gianfrancesco et al., 2003). Linkage
studies in Maltese families resulted in successful identification of rare genetic variants
responsible for other human disorders such as coeliac disease (Vidal et al., 2009a), epilepsy
(Cassar, 2008) and recently in the identification and confirmation of the role played by the
erythroid transcriptional factor KLF1 in hereditary persistence of foetal haemoglobin (Borg
et al., 2010).
2. Materials and methods

2.1 Patient recruitment
Two extended families consisting of a total of 27 family members with several individuals
having low BMD were recruited for this study. Families were selected through index
patients (or probands) referred to the Bone Density Unit, Department of Obstetrics and
Gynaecology, St. Lukes Hospital, Malta for an osteoporosis risk evaluation. The proband in
Family 1 was a 61-year-old female diagnosed with osteoporosis six years earlier and was
known to have a family history of osteoporosis. Five out of seven of her siblings were
recruited while the other two were not willing to participate in the study. Osteoporosis was
confirmed in all six recruited siblings. All female siblings were osteoporotic at the lumbar
spine and one male was osteoporotic at the femoral neck. One sibling had an asymptomatic
compressed vertebral fracture. Three daughters of the proband were recruited (age range 33
38 years) and all of them were found to have very low BMD for their relatively young age.
Their 37-year-old cousin was also found to have very low BMD at both the lumbar (t-score -
2.25) and femoral neck (t-score -1.07), and had very low body mass index (BMI) (16.2
kg/m2). It was not possible to collect blood for DNA analysis from this participant.
The proband in Family 2 was a 55-year-old woman with osteoporosis at the lumbar spine,
diagnosed five years earlier. A closer investigation of this family revealed four osteoporotic
siblings out of five. Their children were healthy young adults, some of whom had very low
BMD relative to their age. The presence of males with low BMD and history of fractures in a
severely osteoporotic sibling were good indicators that a genetic factor might be involved.
As already discussed, five different scenarios were tested using thresholds for t-scores and
z-scores as previously described (Khan et al., 2004). Osteoporosis for post-menopausal
women and men over fifty years of age was defined using a lumbar and/or femoral t-score
of less than -2.50 (WHO criteria). Definition of affected status for younger individuals was
determined using z-scores of less than -1.0 and less than -2.0 for a more severe phenotype,
for scenarios III and IV, respectively. For scenario V, analysis was performed using only
affected individuals having femoral z-scores of less than -1.0. In all five scenarios, family
members having normal BMD measurements were assumed to have an unknown
phenotype. This assumption takes into consideration the possibility that any apparently
clinically unaffected individual might actually be affected, thus reducing the chance of
obtaining false negative results.
2.2 Genotyping
To perform a successful gene mapping study, a number of polymorphic markers have to be
typed in affected and non-affected individuals to identify genes that increase the risk of
disease. Different types of genotyping markers were used in recent years and new
techniques for typing are constantly being developed to increase efficiency, accuracy and
throughput while reducing costs.
2.2.1 Microsatellite genotyping

Short tandem repeats (STRs) or microsatellites are widely distributed in the genome and so
are useful tools for genome-wide scans. These tandem repeats can be dinucleotide,
trinucleotide or tetranucleotide repeats where polymorphisms are generated by gain or loss
of repeats usually as a result of both replication slippage and point mutation. Microsatellites
have several advantages for typing, the most important of which is that they are highly
polymorphic with a very high heterozygosity (>70%), so making them ideal for use in
linkage studies. Another advantage is that they can be very easily typed using PCR
techniques where fluorescently labelled primers flanking the polymorphic region are
designed. The variable number of repeats creates amplicons of different sizes which can be
typed using automated sequencers such as those by Applied Biosystems (ABI) (PE Applied
Biosystems Division, Foster City, CA). Different sets of markers across the whole genome
are electronically available from databases such as those of Marshfield Institute of Genetics
(http://research.marshfieldclinic.org/genetics/), deCode (http://www.decode.com/
services/microsatellite-genotyping-genome-wide-scans.php) and the Cooperative Human
Linkage Centre (http://gai.nci.nih.gov/CHLC/). Markers can be selected from these
databases either across the whole genome or at candidate loci usually with an average
spacing of 10cM and for a higher resolution at < 5cM. To increase throughput and reduce
costs, the amplified fragments are carefully pooled in sets in such a way that the allele size
range does not overlap within a set and by using different dyes for different sets.
An initial genome-wide scan, 400 microsatellite markers spread across the 22 autosomes and
x-chromosome with an average spacing of 8.63cM and heterozygosity of 0.77, was
performed. The average performance of markers for all samples was of 96.96%. Fine-
mapping was performed by increasing the markers at indicated loci from the initial scan.
Genotyping was performed by polymerase chain reaction (PCR) followed by fragment
analysis using a 3730xl ABI genetic analyser (Applied Biosystems, Foster City, CA, USA).
The average performance of the markers was of 96.02%. Genotyping was performed
commercially at the McGill University and Genome Quebec Innovation Centre, Quebec,
Canada.
2.3 Analysis of linkage data

PedCheck (OConnell and Weeks, 1998) was used to determine if the inheritance of marker loci
was according to Mendels laws. Multipoint parametric and non-parametric linkage analyses
were performed using GENEHUNTER-PLUS (Markianos et al., 2001) which is an improved
version of GENEHUNTER (Kruglyak et al., 1996). GENEHUNTER v1.2 was used to calculate
Zlr scores according to Kong and Cox (1997). Linkage analysis of markers on the X-
chromosome was performed using a specific application for this chromosome included with
the GENEHUNTER package. All analyses were performed using EasyLinkage v5.05
(http://www.uni-wuerzburg.de/nephrologie/molecular_genetics/molecular_genetics.htm)
(Lindner and Hoffmann, 2005). Parametric analysis was carried out using variable
penetrances for both a dominant and recessive mode of inheritance. Penetrances used for
the dominant model were 0.01 for the wild-type homozygote, 0.90 for mutant heterozygote
and 0.90 for mutant homozygote, respectively. The recessive model was defined by
penetrances 0.01, 0.01, and 0.80 for the wild-type homozygote, mutant heterozygote and
mutant homozygote, respectively. A more complex model was also analysed using
penetrances 0.01, 0.05, 0.30 for wild-type homozygotes, mutant heterozygotes and mutant
homozygotes, respectively. A parametric analysis assuming heterogeneity was computed
using data from both families (HLOD).
A co-dominant allele frequency algorithm was used for the analysis, as suggested in the
EasyLinkage manual, for extended families. For all models, the disease allele frequency
assumed was 0.001, and phenocopy rate of 1%. This disease allele frequency is equivalent to
a population prevalence of 0.2% assuming Hardy-Weinberg equilibrium calculated using
the following equation (Xu & Meyers, 1998):
2(1 q) q + q2 (2)
q = disease allele frequency.
Analysis was performed using other penetrance values for loci showing evidence of linkage
in the initial genome-wide scan. The exact genetic model was determined using
GENEHUNTER-MODSCORE v1.1 (Strauch et al, 2005), where MOD scores were calculated
from simulations of different models and disease allele frequencies with and without
imprinting. This analysis was suggested by Strauch et al (2003) for complex trait analysis
and was done only for those regions showing suggestive linkage. The deCode genetic map
was used throughout the study.
2.3.1 Using EasyLinkage v5.05 graphical user interface (GUI)

EasyLinkage is a Microsoft Windows based GUI, developed in recent years. This was a
step forward for researchers wanting to perform linkage analysis. Using EasyLinkage and a
common input file format, one can analyse data using all major software such as PedCheck,
GENEHUNTER, Merlin and Allegro. EasyLinkage can be used to analyse data generated
from projects using both single nucleotide polymorphisms (SNPs) as well as STRs. Analysis
can be performed on chromosome by chromosome or else genome-wide basis, making use
of the appropriate genetic maps (such as deCode and Marshfield), using male, female or
sex-averaged maps, from which more accurate genetic positions can be drawn. Both
graphical and text output files are automatically generated for each individual family
together with a collective report averaging all families, in text or pdf formats and stored into
an appropriately labelled folder showing date and type of analysis. These files show
statistical analyses results such as LOD scores, NPL, p-values and input parameters given
by the user for that model including penetrances, disease allele frequencies and genetic
positions of markers ranked according to the most significant results.
There are four allele frequency algorithms to choose from depending on the type of analysis
needed. Several versions of this software have been developed, improving its capabilities to
handle large amounts of data generated from SNP arrays such as the Affymetrix 500k and
Illumina 650k chips. For SNP analysis, allele frequencies of all the major ethnic groups form
part of the EasyLinkage software package.
2.3.2 Data entry

There are two main types of files needed to perform linkage analysis using microsatellites or
STRs. In this study, a qualitative type of analysis was performed using discrete phenotypes
(affected vs unaffected). One type of input file should contain family or families information
in a standard linkage format. The marker file should include the genotype results for each
family member. All family or families information including pedigree structure has to be
entered into a pedigree file. Shown below is part of the pedigree file as created in our study
(only obligatory columns were used). From left to right columns represents (i) unique family
identifier; (ii) individual unique identifier (iii) father and (iv) mother identifiers; (v) sex
identification code (1=male, 2=female, 0=unknown); (vi) affected status (1=unaffected,
2=affected, 0=unknown). In case parents are unknown then enter 0`. As explained previously
is an unknown phase and so it reduces the power of the study, even though the software is
able to assume the genotypes of these individuals using the known genotypes from their
offspring (inferred genotypes). An example for using the unknown option in column (v) is
when you do not know the sex of a child due to death in utero.
A_1 A_1_01 A_1_11 A_1_12 2 2

A_1 A_1_02 A_1_11 A_1_12 1 2
A_1 A_1_03 A_1_11 A_1_12 2 2
A_1 A_1_10 0 0 1 0
A_1 A_1_11 0 0 1 0
A_2 A_2_11 A_2_28 A_2_29 1 1
A_2 A_2_12 A_2_28 A_2_29 2 2
Phenotype definition has to be done using appropriate criteria and diagnostic tests, for
example in our study, measurements of BMD together with blood tests were used to exclude
other medical conditions that could also affect BMD. In complex disorders, it might be
difficult to define the phenotype correctly and this could seriously affect the outcome of
results. Select 1 and 2 wherever diagnostic tests were performed and phenotype is known.
Any individuals not tested should be defined as having an unknown status. This is a better
option because individuals wrongly defined as normal could give a false negative result
(type II error) as these might be carrying the causative alleles and might become affected at a
later stage in their life. As described in the phenotype definition section, we analysed our
data using five different scenarios defined by t-scores and z-scores. For each scenario a
different pedigree file was created and saved in a folder together with the marker files
described in the next section.
Creating marker files
Marker files should include genotyping results for all family members tested. Entering data
is the most laborious part of the study because different files have to be created for each
marker, i.e. if 400 markers were tested then 400 different marker files have to be created and
saved in the same folder together with pedigree files. These files should be named with the
marker identification corresponding with that in the marker map file (.map) used by the
software e.g. D1S200_FINAL.abi`. If the marker is not found within the marker map file
then an error is given when running the analysis. This error can be corrected manually by
adding the marker into the marker map file found in the EasyLinkage folder in Program
Files.
This is an example of the method used to input data into marker files:
MARKER LANE ID A_1 A_2

D1S200 A1 A_1_01 165 176
D1S200 A2 A_1_02 161 176
D1S200 A3 A_1_03 165 176
D1S200 A4 A_1_04 161 176
D1S200 A5 A_1_05 161 176
D1S200 A6 A_1_06 161 176
D1S200 B1 A_2_10 161 176
D1S200 B2 A_2_11 161 176
D1S200 B3 A_2_12 161 161
Column (i) name of marker e.g. D1S200; (ii) PCR reaction position in a 96-well PCR plate
(information not used by software); (iii) individual identification number corresponding
with pedigree file; (iv) allele 1 in base pairs (bp) and (v) allele 2 in bp. Any missing
genotypes should be entered as 0`. When analysing data, the software will re-code these
alleles numbering them consecutively as 1, 2 etc depending on the number of alleles
observed for that marker in all genotyped individuals. The higher the number of alleles
observed the higher the heterozygosity and thus the more informative that marker is.
2.3.3 Running EasyLinkage analysis

On the main screen of the GUI, we selected a Single Locus` analysis, the linkage software
(GENEHUNTER) and microsatellites project type. Next step was to select whether to
perform a genome-wide analysis, one chromosome at a time or even to analyse small
segments from a chromosome. Analysing small segments from a chromosome is useful to
analyse large scale SNP data possibly analysing 500 markers in one segment. A lower LOD
score was observed when analyzing a large number of markers, which would mean that for
SNP analysis, it is better to avoid SNPs that are very close to each other. LOD scores were
observed to be lower in such instances most likely due to allele frequencies used. It would
be advisable to first analyse the whole chromosome for SNP analysis, and if significant
results are observed, then re-analyse blocks of 100 markers at a time and as overlapping
blocks. Another suggestion would be to use different and appropriate allele frequency
algorithms, as will be described below.
After choosing the chromosomes, the sex-averaged deCode genetic map was selected to
position the markers. There is a difference of approximately 10 cM between the male and
female genetic maps, being longer in females due to a higher recombination rate. Other
general options selected included recode alleles` for continuous recoding of alleles within
the marker files, Mendelian testing using PedCheck and the autoscale Y-axis for LOD /
NPL plots.
Finally we chose the folder where the pedigree files were saved and the option to give
individual pedigree results as well as totals. As decribed earlier, five different phenotype
scenarios were used and each one had to be analysed using a different pedigree file.
GENEHUNTER (GH)
This computer package was developed to perform multipoint linkage analysis (parametric
and non-parametric) in pedigrees of moderate size (Kruglyak et al., 1996). The program can
compute LOD scores for pedigrees using a mode of inheritance and penetrance specified by
user. It also allows the user to test for linkage under genetic heterogeneity. The multipoint
NPL analysis tests for IBD allele sharing among affected individuals within pedigrees that is
not affected by the mode of inheritance. It is thus ideal to be used for complex traits. GH
also constructs the most likely haplotypes indicating crossovers even if there is missing data.
A major advantage of GH over other statistical software, such as VITESSE and MLINK, is
that it uses the Lander-Green algorithm and therefore it can perform multipoint analysis
using several markers on a chromosome. Major drawbacks of GENEHUNTER include
restrictions on pedigree size and its relatively slow speed when compared to similar
software such as Allegro. Another limitation of GENEHUNTER is that it cannot analyse
large number of markers which means that if one was analysing more than 100 markers on
same chromosome, one would have to analyse these in groups of 100, repeating the analysis
with different set sizes so as not to miss the signal. A recent version of GH can also perform
transmission disequilibrium testing (TDT) analysis and analysis of quantitative traits
making GH the ideal software to use for genetic analysis (Nyholt, 2001). In this study
GENEHUNTER v1.2 was used to calculate Zlr scores using the Kong and Cox (1997) model.
This algorithm addresses the problem encountered by previous versions of GENEHUNTER
where NPL scores were found to be too conservative when inheritance data was incomplete.
Another application used in this study was GENEHUNTER-MODSCORE v1.1 that
maximises LOD scores with a series of penetrances and disease allele frequencies (Strauch et
al., 2005).
Using GENEHUNTER (GH) with EasyLinkage GUI
Performing linkage analysis using GH through the Easylinkage GUI is easy and
straightforward and saves time. After choosing the GENEHUNTER package software as
described above, one has to go to Program Options from the main dashboard to be able to
define a model for analysis. We analysed our data using both dominant and recessive
models of disease. GENEHUNTEr v1.2 and GENEHUNTER-MODSCORE v1.1 were used
for the analysis. A Codominant` allele frequency algorithm was used for our analysis.
EasyLinkage gives you four different algorithms to choose from. The Codominant algorithm
was the best choice to use for extended families. This algorithm uses only alleles from
genotyped individuals within the pedigree file. Frequencies of the alleles are calculated to
sum up to 1, which means that if 5 different alleles were observed, then the allele frequency
for each allele will be set to 0.200 or if 10 then to 0.100. If less than 5 alleles are found then
still the frequency is set to 0.200. Other allele frequency algorithms include either all
individuals within the marker file or all individuals from pedigree file, both suitable for the
affected sib pair (ASP) design. There are also specialised algorithms such as founders only`,
suitable only for pedigrees with large number of founders. SNP projects will use reference
allele frequencies from different ethnic groups.
As described before, we analysed our data using variable penetrances of disease starting
with a highly pentetrant form (90%) down to 50%, for each scenario. Disease allele
frequency was taken as 0.001 and the analysis steps between markers for multi-point
analysis were set to 5, with recombination counting set to On`. Penetrances were entered
into the appropriate fields as described before, turning the haplotyping options to on` and
choosing the Display all family plots`. The haplotyping option significantly increases the
run time of the analysis but it creates plots for each family with haplotypes and marker
positions together with other files that can be used by other software such as HaploPainter
(Thiele & Nurnberg, 2004).
3. Results
3.1 Reading analysis files
All analysis files were saved into an appropriately labelled folder with details of software
used, allele frequency algorithm, pedigree file name, date and time of analysis. Data was
saved as text and post-script format. The .OUT` file within the LOG` folder can be opened
using Notepad where one can find all commands given to GENEHUNTER by EasyLinkage.
If any errors were encountered and analysis was not completed, then one would find all
information logged in, within this file. This file also includes detailed results such as LOD /
NPL scores, marker information etc for each individual family and totals for all the families.
EasyLinkage automatically commands GENEHUNTER to set up the maximum number of
bits to be analysed within the family and to trim` large families when needed. These two
functions are needed to keep computations within the computer running ability due to
memory limitations. Max Bits function is dependent on the number of meiosis being
examined and represents 2N F, where N is the number of non-founders and F is the
number of founders. If, in the family there are 10 children (non-founders) from 2 sets of
parents (4 founders), then max bits will be set to 16. If the family is larger, then the less
informative individuals will be excluded from the analysis using the trim` command.
Automatically EasyLinkage also commands GENEHUNTER to use the Haldane map and
there is no option to use the Kosambi map. The Haldane map does not assume interference,
as described in a previous section.
Figure 1A, shows the upper left hand quandrant of a parametric LOD score plot, including
information such as allele frequency algorithm used, inheritance model, allele frequencies and
penetrancies expressed as percentages. Markers are ranked in order of their most significant
LOD / NPL scores with information about chromosome number, their position on the genetic
map and calculated probability (Figure 1B). Figure 1C shows NPL results for a genome-wide
analysis with NPL scores on the y-axis and chromosomal marker positions on the x-axis. Other
plots are given for LOD scores, HLODs, p-values, Zlr scores and marker information.
If the haplotyping option was chosen then a folder named Haplotyping` is created and
haplotype files for each pedigree are saved there. This haplotype data can then be imported
to other software such as HaploPainter (Thiele & Nurnberg, 2004) to construct a graphical
representation of the inherited haplotypes.
Fig. 1. Information given by parametric LOD score analysis plots (A & B) and genome wide
NPL plot (C)
3.2 Linkage results

From the initial genome-wide scan using both families, evidence of linkage was observed to
marker D11S1392, where the highest NPL score was of 5.77 (p=0.0006) and LOD/HLOD of
2.55, for the dominant model with 90% penetrance and phenocopy rate of 1%. Fine mapping
was performed by analysing four additional markers at this region (D11S4101, D11S935,
D11S4102, and D11S1911) with average spacing of 1 to 1.5cM. Fine mapping confirmed
linkage to marker D11S935 that is 52.94cM from 11p-telomere. Table 1 shows the highest
scores obtained for this marker using the dominant mode of inheritance with 90%
penetrance and phenocopy 1%. HLODs are calculated when more than one family are
analysed together and thus the score can be different from the LOD if there is heterogeneity
between families.
Table 2 shows results obtained when analysing the same families assuming clinically
unaffected individuals, whose BMD was measured by DEXA, as normal phenotype
(according to WHO criteria) rather than having unknown phenotype (as in Table 1). NPL
and Zlr scores were the same as observed in Table 1, but LOD and HLOD scores were
different.
LOD scores shown are for the autosomal dominant model with 90% penetrance and 1%
phenocopy rate.
Phenotype LOD (cM) HLOD () NPL (p-val) Zlr

Scenario I 2.90 (52.94) 2.90 (1.00) 7.00 (0.0014) 3.01
Scenario II 2.46 (52.94) 2.46 (1.00) 4.02 (0.0038) 2.90
Scenario III 2.89 (52.94) 2.89 (1.00) 7.23 (0.0013) 3.04
Scenario IV 3.35 (52.94) 3.35 (1.00) 6.90 (0.0002) 3.74
Scenario V 2.59 (52.94) 2.59 (1.00) 5.37 (0.0020) 3.28
deCode map position in brackets in cM
Table 1. Highest scores for marker D11S935 in both Pedigrees using an Autosomal
Dominant Model after Fine Mapping
This is because in the second analysis, shown in Table 2, based on current BMD
measurements were defined as normal, individuals that might be osteoporotic in the future.
These individuals might also be carrying the inherited causative allele and so will result in a
false negative result if taken as normal. This is a common situation with complex and late
onset disorders such as osteoporosis.
Phenotype LOD (cM) HLOD () NPL (p-val) Zlr

Scenario I 3.07 (52.94) 3.07 (1.00) 7.00 (0.0014) 3.01
Scenario II -0.19 (52.94) -0.00 (0.00) 4.02 (0.0038) 2.90
Scenario III 2.97 (52.94) 2.97 (1.00) 7.23 (0.0013) 3.04
Scenario IV 2.80 (52.94) 2.80 (1.00) 6.90 (0.0002) 3.74
Scenario V 1.26 (50.64) 1.26 (1.00) 5.24 (0.0020) 3.28
Table 2. Analysis of Chromosome 11 in Both Families Assuming Unaffected Individuals as
Normal
When calculating MOD scores for chromosome 11, the highest MOD was of 3.28 at the
same region 52.94cM using the best calculated genetic model with penetrances 0.06 wild-
type homozygotes (6% phenocopy rate), 0.97 for both heterozygotes and mutant
homozygotes. The disease allele frequency calculated at this model was of 0.000006 with a
calculated population prevalence of 0.001%, assuming Hardy-Weinberg equilibrium. A
MOD score of 4.33 (info = 0.87) was obtained when assuming imprinting with a disease
allele frequency of 1 X 10-6. Estimated penetrances of wild-type homozygote (f +/+) 0.00;
paternal heterozygote (f m/+) 0.00; and 1.00 for both maternal heterozygote (f +/m) and
mutant homozygotes (f m/m) show evidence of paternal imprinting at this locus. Paternal
imprinting indicates that the expression of the gene responsible for the disease at this
locus may be entirely maternal.
This locus was further analysed by varying the penetrance and phenocopy rates for the
dominant mode of inheritance. Analyses were performed using phenocopies from 1% to
20% and penetrance 0.7 0.5. The phenocopy rate is the percentage of individuals within the
family that are clinically affected but do not carry the disease allele and hence their
phenotype is due to other mainly environmental factors. As shown in Table 3, the highest
LOD/HLOD score (3.32) was observed at penetrance of 0.8 and 0.7 with a 5% phenocopy.
Changing the penetrances and hence the model, does not affect NPL scores (since these are
model free) and therefore NPL scores are not shown in Table 3.
Family 1 Family 2
LOD (cM)* NPL (p-val) Zlr LOD (cM)* NPL (p-val) Zlr
Scenario I 1.92 (54.35) 6.26 (0.0078) 2.84 1.04 (52.48) 4.42 2.41
(0.0098)
Scenario II 1.35 (55.77) 3.10 (0.0313) 2.12 1.18 (52.94) 3.06 2.11
(0.0625)
Scenario III 1.92 (54.35) 6.26 (0.0078) 2.84 1.04 (51.56) 4.74 2.27
(0.0117)
Scenario IV 1.64 (54.35) 4.41 (0.0156) 2.58 1.77 (52.94) 5.85 2.75
(0.0156)
Scenario V 0.86 (48.21) 1.94 (0.1250) 1.63 1.75 (50.64) 5.83 2.88
(0.0156)
Table 3. Multipoint LOD/HLOD Scores on Chromosome 11 under an Autosomal Dominant
Model with Variable Penetrance and Phenocopy
Although both families shared the same linkage interval, the highest LOD scores were
obtained by two different markers with a spacing of approximately 4cM between them,
showing also different inherited alleles, suggesting that different genes at the same locus,
and within the same linkage interval, might be responsible for the same disease in different
families (allelic heterogeneity). Highest LOD and NPL scores (1.77 and 5.9, respectively)
were obtained for marker D11S1392 (50.64cM) for Family 2, while for Family 1 highest
scores were obtained to marker D11S4102 (54cM) (Table 4). Inherited haplotypes identical
by descent were observed in both individual families between markers D11S1392 and
D11S935, with a number of recombination events defining boundaries for the linkage
interval where the causative genes can be found in between.
Penetrance LOD/HLOD LOD/HLOD LOD/HLOD LOD/HLOD LOD/HLOD

Phenocopy Phenocopy Phenocopy Phenocopy Phenocopy
= 1% = 5% = 10% = 15% = 20%
0.9 3.07 3.25 3.05 2.78 2.47
0.8 3.10 3.32 3.11 2.82 2.44
0.7 3.12 3.32 3.08 2.73 2.23
0.6 3.14 3.30 2.99 2.54 1.80
0.5 3.17 3.25 2.84 2.17 1.07
Table 4. Analysis of chromosome 11 for Families 1 & 2 after fine mapping * deCode map
position in brackets in cM
3.3 Choosing and sequencing candidate genes

The locus indicated by both parametric and non-parametric linkage analyses on
chromosomes 11p12 was scanned for known candidate genes. Candidate genes within the
linkage interval were selected with prior knowledge of physiology using the NCBI map
viewer (http://www.ncbi.nlm.nih.gov/mapview/) Homo sapiens build 36. The online
application GeneSeeker v2.0 (http://www.cmbi.kun.nl/GeneSeeker) was also used. A new
online tool GeneDistiller (http://www.genedistiller.org/) was recently developed to filter
genes within a specified linkage interval is (Seelow et al., 2008). When using NCBI
MapViewer to select the genes manually, one has to align the genes with the corresponding
genetic map (e.g. deCode), setting the resolution of the map to 1 cM for accurate alignment.
Applications such as GeneDistiller can facilitate this process since they automatically extract
all genes within a given interval. It is also advisable to search for genes further away from
both ends of the linkage interval even up to 5 10 cM. This will compensate for differences
in positioning of markers on the genetic map and the actual physical map.
The whole area from 49 to 55cM on chromosome 11 (deCode genetic map) was searched for
genes that might plausibly be involved in the disease. More than twenty genes and
hypothetical proteins are found in this region, with the best candidates being the tumour
necrosis factor receptor-associated factor 6 (TRAF6) gene [MIM 602355] and the CD44 gene
[MIM 107269] (sequenced in Family 2) found 1cM away from D11S1392 (~51cM). TRAF6
was sequenced in both families but it was closer to D11S4102 showing highest scores in
Family 1.
Oligonucleotide primers were designed using the online application Primer 3
(http://frodo.wi.mit.edu/primer3/) (Rozen and Skaletsky, 2000) to amplify all coding
regions including intron-exon boundaries and promoter region of the CD44 gene using
transcript ENST00000278385) from the ENSEMBL database (http://www.ensembl.org).
Transcript ENST00000313105 was used for TRAF6 gene. Due to limitations of the
sequencing technique, only fragments from 200 to 600bp were amplified by PCR. Large
exons and up to 1500bp of the 5` untranslated region were covered by overlapping PCR
fragments. Bidirectional DNA sequencing was performed using standard techniques and
fluorescent capillary electrophoresis.
3.4 Reading and Interpretation of sequencing results

DNA sequencing results were compared to reference sequences in public databases by using
the software ChromasPro v1.33 (http://www.technelysium.com.au) that directly searches
the BLAST application on NCBI. Variations that did not agree with the reference sequence
were confirmed by the reverse sequence. Electropherograms were also printed and checked
manually.
Detailed information about specific genes including information about known
mutations/polymorphisms and gene expression was obtained from GENECARDS
(http://www.genecards.org) and The Human Gene Mutation Database
(http://www.hgmd.cf.ac.uk/). When identifying a variation, the first step is to check using
databases whether it is already known. Information about individual SNPs can be searched
in gene and SNP databases such as the NCBI SNP database
(http://www.ncbi.nlm.nih.gov/projects/SNP/). A list of SNP databases can be found at
http://www.humgen.nl/SNP_databases.html. If the variation is a known SNP, then one
has to refer to it using the database reference number such as rs3830511`. In the database
one can find information about individual SNPs including any population frequencies. The
next step is to identify the frequency of these variations in the local population and
determine whether it is a rare or common variation. To perform population screening, one
can use techniques such as restriction fragment length polymorphism (RFLP), real-time PCR
or direct DNA sequencing in a random sample from the general population. For our studies,
random samples of DNA were obtained from newborns and used for this purpose, followed
by a small scale case-control study using osteoporotic and normal post-menopausal women.
Virtual restriction fragment length polymorphism (RFLP) gel electrophoresis was carried
out using the online web applications NEBcutter V2.0 (http:// tools.neb.com
/NEBcutter2/index.php) to test the identified polymorphisms.
3.4.1 TRAF6 Sequencing and functional assays

Following direct sequencing, three different variants were identified when compared to
reference sequences on the NCBI and Ensembl databases. An A to T transversion was
identified at position -721 (5` upstream of exon 1), when compared to TRAF6 reference
sequence (AY228337). This variant had not been previously described. Following
sequencing of all family members, three affected individuals from Family 1 were observed
to be heterozygous for this variant. Individuals from Family 2 were all wild-type
homozygotes. RFLP was carried out in 82 unrelated postmenopausal women. This variant
was observed to be very rare within an unrelated group of postmenopausal women, as only
three heterozygotes were observed. After screening 350 chromosomes in a random sample
from the general population, only 2 alleles were observed (0.57%) with this variant having a
population frequency of 1.1%.
A previously described insertion/deletion of a T in the intron between exons 4 and 5, in the
polyT region, sixteen base pairs ahead of the exon-intron boundary (rs3830511), was also
identified. When analysing all family members and controls, only three individuals were
observed to be heterozygotes for this insertion/deletion, one of whom was severely affected
and the other two were normal individuals.
A transition from G to A was found in the intron between exons 6 and 7, 110bp upstream of
the exon-intron boundary. When sequencing all members from both families, four
heterozygotes for this variant were identified, and the rest were homozygous for the wild
type allele G. Three of the four heterozygous individuals for this variant had a low BMD,
two of whom were also heterozygous for the T insertion/deletion described above.
Genotyping by RFLP (PvuII) was performed in 82 unrelated postmenopausal women.
Genotype frequencies observed were 72.3% GG, 26.5% GA and 1.2% AA.
Although the -721 A/T polymorphism was not linked to the inherited haplotype within
Family 1, this polymorphism was rare within the population and it was thus hypothesised
that it could affect gene expression. The TRAF6 gene plays a major role in osteoclast
differentiation and activation and plays an important role in osteoimmunology (ref).To
test this hypothesis the TRAF6 gene promoter region, harbouring the -721 variant, was
analysed for possible transcriptional factor binding sites in the presence and absence of
the variant identified in this study, using the online application MatInspector by
Genomatix Software GmbH(http://www.genomatix.de/online_help/help_matinspector/
matinspector_help.html) (Cartharius et al., 2005). The whole sequence, up to 1500bp
upstream from the transcriptional start, site was thus copied and tested using the
MatInspector online application. Free registration was needed to use this application for
academic use allowing twenty analyses per month. Both normal and mutated sequences
were used and analysis was performed using a vertebrate matrix. When comparing
normal and mutated alleles it was observed that position -721 might be a potential
binding site for nuclear factor Y (NF-Y), a CCAAT binding factor, that binds to the wild-
type allele but not to the mutated one. Non-binding of this factor would result in a
decreased expression of the gene.
Three different sized fragments from the promoter region of TRAF6 (up to 1500bp) were
cloned into a luciferase reporter vector and transfected into two types of mammalian cells.
After measuring luciferase activity in both cell lines, it was evident that gene expression was
affected by the -721 variant found in the TRAF6 gene promoter. Expression of the mutated
allele was observed to be as low as 5% that of the normal allele expressed in murine
macrophages. The two longer constructs showed higher expression for the mutated allele
suggesting that other transcriptional factors most likely interact either directly or with other
factors at the mutated site. Although these observations suggest that this variant affects a
transcriptional factor binding site and thus could increase the risk for osteoporosis, further
research is needed to identify the molecular mechanisms.
3.4.2 CD44 gene sequencing in family 2

DNA sequencing of the CD44 gene found on chromosome 11p12 was performed in Family 2
since this gene is found closer to D11S1392, which shows the highest LOD scores within this
family, as described above. Osteoclast formation was inhibited by CD44 antibody
suggesting its important role in bone physiology and as a potential therapeutic target for
metabolic bone disease (Kania et al., 1997). As well, CD44 was also associated with
inflammatory bone loss (Hayer et al., 2005).
Sequencing CD44 revealed a number of intronic sequence variants, including two A/G
changes (rs4756196 and rs3736812) and an A/C transversion in intron 16, none of which
were observed to be inherited with the linked marker. A number of other variants were
found in coding regions, including an A/G (rs9666607) and C/T (rs11607491) changes in
exon 10, both resulting in an amino acid change, which were not linked with the inherited
haplotype. Another C/T synonymous variant (rs35356320) was detected in three affected
and one unaffected individual. A non-synonymous variant found in exon 12 (rs1467558)
was only found in two affected members of this family.
An interesting variant was detected in exon 9, a synonymous G/A transition (rs11033026),
found 32 nucleotides upstream from the exon/intron junction. Sequencing the gene in all
members of this family, revealed that all individuals carrying the linked STR allele 3 (Figure
1B) for marker D11S1392 were also heterozygous for this variant, suggesting that the two
were linked.
As shown in Figure 1B, all affected members, with the exception of one phenocopy
(III:4), were heterozygous for both the STR allele and the A allele. This variant was not
found in any of the non-affected family members, with the exception of two who also
carried the linked STR allele (III:2 and III:7) (incomplete penetrance). The minor allele
frequency within the Maltese population was determined to be 0.012 (1.19%) with a
population frequency 2.38%. According to the NCBI dbSNP database
(http://www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi?rs=11033026), and HapMap, this
frequency compares with that found in Sub-Saharan Africans, African-Americans and
Han Chinese from Beijing (minor allele frequencies 0.336, 0.115, 0.012, respectively), and
was absent in European Caucasians. This suggests a founder effect in the Maltese
population, complementing other previously reported studies on other human diseases
(Farrugia et al., 2007; Koziell et al., 2002).
Since this variant was found in an exon but does not result in an amino acid change, we
hypothesised that it could affect pre-mRNA splicing resulting in a different protein isoform.
To test this hypothesis at the transcriptional level an online Bioinformatics predictive tool
was used to identify any possible exon splicing enhancers (ESEs) at this region as described
by Cartegne et al (2002) (http://rulai.cshl.edu/tools/ESE2/index.html) . The G/A variant
was found to abolish an ESE motif (TGAGGA > TGAAGA) for the SR protein (SRp55) with
a score of 2.817 (threshold 2.676), in the presence of the A allele. Another online application
RESCUE-ESE (http://genes.mit.edu/fas-ess/) did not predict any possible ESEs at this
locus (Wang et al., 2004).
The experimental approach to test this hypothesis involved the use of an in vitro exon-
trapping vector where the whole exon 9 and adjacent introns were inserted into a vector
yielding a hybrid construct made up of two vector -globin exons flanking CD44 exon 9 and
adjacent introns. Following transfection into mammalian cells, the construct was transcribed
under the control of a SV40 promoter and spliced. The mRNA derived from this construct
was extracted and reverse transcribed followed by specific amplification using cDNA as
template and specific primers to -globin exons (SD6 and SA2). The spliced transcripts were
analysed by agarose gel (Vidal et al., 2009). Our results showed that in the presence of the A
allele only one transcript (261bp) was weakly amplified in both COS-7 and HeLa cells and
was completely absent in RAW264.7 macrophages. DNA sequencing confirmed that this
transcript did not contain any part of CD44 exon 9, and was entirely made up of vector exon
sequences, suggesting skipping of exon 9. Two transcripts were amplified in the presence of
the G allele (378bp and 261bp).
4. Conclusion
In this study, two polymorphisms with a population frequency of less than 5.0%were
identified by linkage analysis in two extended Maltese families with a highly penetrant form
of osteoporosis. In vitro functional studies confirmed that these polymorphisms might
increase the individuals susceptibility to osteoporosis. This study adds to the existent
knowledge of the complex pathophysiology involved in disorders such as osteoporosis. This
knowledge is useful for the development of more targeted and individualised treatments.
Our results added to the increasing evidence that rare but functional polymorphisms are
also responsible for disorders such as osteoporosis, and also that using extended families
with extreme phenotypes increases the chance to identify the responsible genes. Computer
technology and the internet contribute significantly to the outcome of these studies. Both
technologies were important tools for researchers throughout the whole study starting from
planning and design of experiments, analysis of data and interpretation of results.
5. Acknowledgements
We would like to thank the families that participated in this study for their collaboration
and Dr Raymond Galea for his support in patient recruitment. We also thank Dr Andrew
Verner and the staff at the Genotyping Facility McGill University and Genome Quebec
Innovation Centre, Montreal Canada for the STR genotyping and Dr Marisa Cassar at MLS
BioDNA Ltd, Malta, for DNA sequencing of genes. We would like to thank Dr. Pierre
Schembri Wismayer M.D., Ph.D. and Dr. Anthony Fenech Ph.D., B.Pharm. (Hons.), for the
use of facilities at the Department of Anatomy and Cell Biology, and Department of
Pharmacology and Clinical Therapeutics, University of Malta, and Prof Junko Oshima,
Department of Pathology, University of Washington, Washington, USA, who generously
donated the pSPL3 plasmid. This project was approved by the Research Ethics Committee,
and supported by the Research Fund Committee of the University of Malta.
Glossary Allele Alternative states of genes only identical

if their base sequences are identical
Body Mass Index A statistic of the relationship between
(BMI) weight and height = body weight
divided by height squared
Bone mineral A measure of bone density usually
density (BMD) measured by x-ray techniques
Haplotype A set of variants (SNPs or STRs) that are
inherited together as a single block on a
linear chromosome
Imprinting Expression of genes depending upon
the parent of origin
Linkage Groups of markers or genes on the same
disequilibrium linear chromosome that are inherited
(LD) together more often than expected by
chance as long as genetic recombination
does not take place between them. LD
can be used to locate genes associated
with phenotype
Locus Variability of chromosomal regions
Heterogeneity involved between different subjects
Penetrance The percentage of individuals that
express a trait determined by gene/s
Phenocopy A phenotyping change that mimics the
expression of a mutation usually
resulting from effects of the
environment
Segregate Separation of homologous
chromosomes at random during meiosis
SNP A difference in a single nucleotide at a
particular DNA site
STR Short tandem repeat variations differing
between different individuals in the
number of repeated sequences eg:
(CACACA) or (CACACACACA). Used
as markers in forensics for
identification.
6. References
Berger, M., Mattheisen, M., Kulle, B., Schmidt, H., Oldenberg, J., Bickeboller, H., Walter, U.,
Lindner, T.H., Strauch, K., & Schambeck, C.M. (2005). High factor VIII levels in
venous thromboembolism show linkage to imprinted loci on chromosomes 5 and

11, Blood, Vol.105, No.2, (January 2005), pp. 638 644, ISSN 0006-4971
Borg, J., Papadopoulos, P., Georgitsi, M., Gutirrez, L., Grech, G., Fanis, P., Phylactides, M.,
Verkerk, A.J., van der Spek, P.J., Scerri, C.A., Cassar, W., Galdies, R., van Ijcken, W.,
Ozgr, Z., Gillemans, N., Hou, J., Bugeja, M., Grosveld, F.G., von Lindern, M.,
Felice, A.E., Patrinos, G.P.. & Philipsen, S. (2010) Haploinsufficiency for the
erythroid transcription factor KLF1 causes hereditary persistence of fetal
hemoglobin. Nat Genet, Vol.42, No.9, (September 2010), pp. 801-805, ISSN 1061-
4036
Brunkow, M.E., Gardner, J.C., Van Ness, J., Paeper, B.W., Kovacevich, B.R., Proll, S.,
Skonier, J.E., Zhao, L., Sabo, P.J., Fu, Y-H., Alisch, R.S., Gillett, L., Colbert, T.,
Tacconi, P., Galas, D., Hamersma, H., Beighton, P., & Mulligan, J.T. (2001) Bone
dysplasia sclerosteosis results from loss of the SOST gene product, a novel cystine
knot-containing protein. Am J Hum Genet, Vol.68, No.3, (March 2001), pp. 577-589,
ISSN 0002-9297
Cartharius, K., Frech, K., Grote, K., Klocke, B., Haltmeier, M., Klingenhoff, A., Frisch, M.,
Bayerlein, M., & Werner, T. (2005) MatInspector and beyond: promoter analysis
based on transcriptional factor binding sites. Bioinformatics, Vol.21, No.13, (July
2005), pp. 2933 2942, ISSN 1367-4803
Cartegni, L., Chew, S.L., & Krainer A.R. (2002) Listening to silence and understanding
nonsense: exonic mutations that affect splicing. Nat Rev Genet, Vol.3, No.4, (April
2002), pp. 285-298, ISSN 1471-0056
Cassar, M. (2008) Linkage analysis in a familial case of idiopathic epilepsy and its
implications in drug development. PhD Dissertation, University of Malta
Farrugia, R., Scerri, C.A., Attard Montalto, S., Parascandalo, R., Neville, B.G.R., & Felice,
A.E. (2007) Molecular genetics of the tetrahydrobiopterin (BH4) deficiency in the
Maltese population. Mol Genet Metab, Vol.90, No.3, (March 2007), pp. 277 283,
ISSN 1096-7192
Gianfrancesco, F., Esposito, T., Ombra, M.N., Forabosco, P., Maninchedda, G., Fattorini, M.,
Casula, S., Vaccargiu, S., Casu, G., Cardia, F., Deiana, I., Melis, P., Falchi, M., &
Pirastu, M. (2003) Identification of a novel gene and a common variant associated
with uric acid nephrolithiasis in a Sardinian genetic isolate. Am J Hum Genet,
Vol.72, No.6, (June 2003), pp. 1479 1491, ISSN 0002-9297
Gong Y, Slee, R.B, Fukai, N., Rawadi, G., Roman-Roman, S., Reginato, A.M., Wang, H.,
Cundy, T., Glorieux, F.H., Lev, D., Zacharin, M., Oexle, K., Marcelino, J., Suwairi,
W., Heeger, S., Sabatakos, G., Apte, S., Adkins, W.N., Allgrove, J., Arslan-Kirchner,
M., Batch, J.A., Beighton, P., Black, G.C., Boles, R.G., Boon, L.M., Borrone, C.,
Brunner, H.G., Carle, G.F., Dallapiccola, B., De Paepe, A., Floege, B., Halfhide, M.L.,
Hall, B., Hennekam, R.C., Hirose, T., Jans, A., Jppner, H., Kim, C.A., Keppler-
Noreuil, K., Kohlschuetter, A., LaCombe, D., Lambert, M., Lemyre, E., Letteboer, T.,
Peltonen, L., Ramesar, R.S., Romanengo, M., Somer, H., Steichen-Gersdorf, E.,
Steinmann, B., Sullivan, B., Superti-Furga, A., Swoboda, W., van den Boogaard,
M.J., Van Hul, W., Vikkula, M., Votruba, M., Zabel, B., Garcia, T., Baron, R., Olsen,
B.R., & Warman, M.L; Osteoporosis-Pseudoglioma Syndrome Collaborative Group.
(2001) LDL receptor-related protein 5 (LRP5) affects bone accrual and eye
development. Cell, Vol.107, No.7, (July 2001), pp. 513 523, ISSN 0092-8674
Hanson, R.L., Ehm, M.G., Pettitt, D.J., Prochazka, M., Thompson, D.B., Timberlake, B.,
Foroud, T., Kobes, S., Baier, L., Burns, D.K., Almasy, L., Blangero, J., Garvey, W.T.,
Bennett, P.H., & Knowler, W.C. (1998) An autosomal genomic scan for loci linked
with type II diabetes mellitus and bone-mass index in Pima Indians. Am J Hum
Genet, Vol.63, No.4, (October 1998), pp. 1130 1138, ISSN 0002-9297
Hayer, S., Steiner, G., Grtz, B., Reiter, E., Tohidast-Akrad, M., Amling, M., Hoffmann, O.,
Redlich, K., Zwerina, J., Skriner, K., Hilberg, F., Wagner, E.F., Smolen, J.S., & Schett,
G. (2005) CD44 is a determinant of inflammatory bone loss. J Exp Med, Vol.201,
No.6, (March 2005), pp. 903 914, ISSN 0040-8724
Heiman, G.A. (2005) Robustness of case-control studies to population stratification. Cancer
Epidemiol Biomarkers Prev, Vol.14, No.6, (June 2005), pp. 1579 1582, ISSN 1055-
9465
Kambouris, M. (2005) Target gene discovery in extended families with type 2 diabetes
mellitus. Atheroscler Suppl, Vol.6, No.2, (May 2005), pp. 31 36, ISSN 1567-5688
Kania, J.R., Kehat-Stadler, T., & Kupfer, S.R. (1997) CD44 antibodies inhibit osteoclast
formation. J Bone Miner Res. Vol.12, No.8, (August 1997), pp. 1155 1164, ISSN
0884-0431
Khan, A.A., Bachrach, L., Brown, J.P., Hanley, D.A., Josse, R.G., Kendler, D.L., Leib, E.S.,
Lentle, B.C., Leslie, W.D., Lewiecki, E.M., Miller, P.D., Nicholson, R.L., O'Brien, C.,
Olszynski, W.P., Theriault, M.Y., & Watts, N.B. (2004) Standards and guidelines for
performing central dual-energy X-ray absorptiometry in premenopausal women,
men, and children. J Clin Densitom, Vol.7, No.1, (Spring 2004), pp. 51 64, ISSN
1094-6950
Kong, A., & Cox, N.J. (1997) Allele sharing models: LOD scores and accurate linkage tests.
Am J Hum Genet, Vol.61, No.5, (November 1997), pp. 1179 1188, ISSN 0002-9297
Koziell, A., Grech, V., Hussain, S., Lee, G., Lenkkeri, U., Tryggvason, K., & Scambler, P.
(2002) Genotype/phenotype correlations of NPHS1 and NPHS2 mutations in
nephrotic syndrome advocate a functional inter-relationship in glomerular
filtration. Hum Mol Genet, Vol.11, No.4, (February 2002), pp. 379 388, ISSN 0964-
6906
Kruglyak, L., Daly, M.J., Reeve-Daly, M.P., & Lander, E. (1996) Parametric and non-
parametric linkage analysis, a unified multipoint approach. Am J Hum Genet,
Vol.58, No.6, (June 1996), pp. 1347 1363, ISSN 0002-9297
Lander, E., & Kruglyak, L. (1995) Genetic dissection of complex traits, guidelines for
interpreting and reporting linkage results. Nat Genet, Vol.11, No.3, (November
1995), pp. 241 247, ISSN 1061-4036
Lindner, T.H., & Hoffmann, K. (2005) EasyLINKAGE: a PERL script for easy and automated
two-/multipoint linkage analyses. Bioinformatics, Vol.21, No.3, (February 2005),
pp. 405 407, ISSN 1367-4803
Markianos, K., Daly, M.J., & Kruglyak, L. (2001) Efficient multipoint linkage analysis
through reduction of inheritance space. Am J Hum Genet, Vol.68, No.4, (April
2001), pp. 963 977, ISSN 0002-9297
Nyholt, D.R. (2002) GENEHUNTER, Your one-stop shop for statistical genetic analysis?
Hum Hered, Vol.53, No.1, (March 2002), pp. 2 7, ISSN 0001-5652
OConnell, J.R., & Weeks, D.E. (1998) PedCheck: a program for identification of genotype
incompatibilities in linkage analysis. Am J Hum Genet, Vol.63, No.1, (July 1998),
pp. 259 266, ISSN 0002-9297
Ott, J. (1991) Analysis of human genetic linkage. John Hopkins University Press, ISBN 0-801-
842573, USA
Peltonen, L. (2000) Positional cloning of disease genes: Advantages of genetic isolates. Hum
Hered, Vol.50, No.1, (January 2000), pp. 65 75, ISSN 0001-5652
Rozen, S., & Skaletsky, H.J. (2000) Primer3 on the WWW for general users and for biologist
programmers. In: Bioinformatics Methods and Protocols: Methods in Molecular
Biology, S. Krawetz, & S. Misener, (Ed.), 365-386, Humana Press, ISBN
0896037320,Totowa, NJ, USA
Seelow, D., Schwarz, J.M., & Schuelke, M. (2008) GeneDistiller--distilling candidate genes
from linkage intervals. PLoS One. Vol.3, No.12, (December 2008), e3874, ESSN 1932-
6203
Strauch, K., Fimmers, R., Baur, M.P., & Wienker, T.F. (2003) How to model a complex trait.
Hum Hered, Vol.55, No.4, (October 2003), pp. 202 210, ISSN 0001-5652
Strauch, K., Furst, R., Ruschendorf, F., Windemuth, C., Dietter, J., Flaquer, A., Baur, M.P., &
Wienker, T.F. (2005) Linkage analysis of alcohol dependence using MOD scores.
BMC Genet, Vol.6, Suppl.1, (December 2005), S162, ESSN 1471-2156
Styrkarsdottir, U., Cazier, J.B., Kong, A., Rolfsson, O., Larsen, H., Bjarnadottir, E.,
Johannsdottir, V.D., Sigurdadottir, M.S., Bagger, Y., Christiansen, C., Reynisdottir,
I., Grant, S.F.A., Jonasson, K., Frigge, M.L., Gulcher, J.R., Sigurdsson, G., &
Stefansson, K. (2003) Linkage of osteoporosis to chromosome 20p12 and association
to BMP2. PLoS Biol, Vol.1, No.3, (November 2003), pp. 351 360, ISSN 1544 - 9173
Thiele, H., & Nrnberg, P. (2004) HaploPainter: a tool for drawing pedigrees with complex
haplotypes. Bioinformatics. Vol.21, No.8, (April 2004), pp. 1730-1732, ISSN 1367-
4803
Vidal, C., Borg, J., Xuereb-Anastasi, A., & Scerri, C.A. (2009a) Variants within protectin
(CD59) and CD44 genes linked to an inherited haplotype in a family with coeliac
disease. Tissue Antigens, Vol.73, No.3, (March 2009), pp. 225 235, ISSN 0001-2815
Vidal, C., Cachia, A., & Xuereb-Anastasi, A. (2009) Effects of a synonymous variant in exon 9
of the CD44 gene on pre-mRNA splicing in a family with osteoporosis. Bone Vol.45,
No.4, (October 2009), pp. 736 742, ISSN 8756-3282
Vidal, C., Galea, R., Brincat, M., & Xuereb-Anastasi, A. (2007) Linkage to chromosome 11p12
in two Maltese families with a highly penetrant form of osteoporosis. Eur J Hum
Genet, Vol.15, No.3, (March 2007), pp. 800 809, ISSN 1018-4813
Wang, Z., Rolish, M. E., Yeo, G., Tung, V., Mawson, M. & Burge, C. B. (2004). Systematic
identification and analysis of exonic splicing silencers. Cell Vol.119, No.6,
(December 2004), pp. 831-845, ISSN 0092-8674
Wright, A., Charlesworth, B., Rudan, I., Carothers, A., & Campbell, H. (2003). A polygenic
basis for late-onset disease. Trends Genet, Vol.19, No.2, (February 2003), pp. 97
106, ISSN 0168-9525
Wright, A.F., Carothers, A.D., & Pirastu, M. (1999) Population choice in mapping genes for
complex diseases. Nat Genet, Vol.23, No.4, (December 1999), pp. 397 404, ISSN
1061-4036
Xu, J., & Meyers, D.A. (1998) Lod Score Analysis, In : Approaches to Gene Mapping in
Complex Human Diseases, Haines, J.L., & Pericak-Vance, M.A., pp. 253 272,
Wiley-Liss Inc., ISBN 0-471-17195-6, USA
Zlotogora, J. (2007) Multiple mutations responsible for frequent genetic diseases in isolated
populations. Eur J Hum Genet, Vol.15, No.1, (January 2007), pp. 272 278, ISSN
1018-4813
3
Guide to Genome-Wide Bacterial

Transcription Factor Binding Site
Prediction Using OmpR as Model
Phu Vuong and Rajeev Misra
Arizona State University
USA
1. Introduction
Gene expression regulation in a cell plays a crucial role in the cellular response to
environmental cues and other important biological processes (Bauer et al., 2010). A major
mechanism of gene expression regulation is the binding of transcription factor (TF) protein
to a specific DNA sequence in the regulatory region of a gene, thereby activating or
inhibiting its transcription (Zhou & Liu, 2004). A TF often regulates multiple genes whose
binding sites have similar but not identical sequences (Zhang et al., 2009). There is, however,
a short, recurring pattern among the promoter sequences called a motif, and it is this motif
that a TF recognizes and interacts with (Dhaeseleer, 2006b). It is important to identify the
set of genes a TF modulates, called its regulon, as this will advance our understanding of the
regulatory network of an organism (Dhaeseleer, 2006b; Tan et al., 2005). One way to
identify the regulon is to determine a TFs motif and subsequently use the motif to search
for other candidate genes regulated by the TF.
Traditionally, TF binding sites (TFBSs) are determined by various experimental approaches.
Mutagenesis, DNase footprinting, gel-shift, and reporter construct assays are common
methods for identifying the binding sites upstream of individual genes, but the throughput
of these techniques is low (Dhaeseleer, 2006b; Ladunga, 2010). In recent years, chromatin
immunoprecipitation (ChIP) and systematic evolution of ligands by exponential enrichment
(SELEX) are available to study protein-DNA interactions in a high throughput manner.
Chromatin-immunoprecipitation of DNA cross-linked to a TF can be hybridized to a
microarray (ChIP-chip) or sequenced (ChIP-seq) to obtain the TFs cognate binding sites on
the whole genomic scale (Homann and Johnson, 2010; Ladunga, 2010; Stormo, 2010). SELEX
is an in vitro technique that measures the binding affinities of TFs for synthetic, randomly
generated oligonucleotides, usually 10-30 bp long (Dhaeseleer, 2006b; Ladunga, 2010;
Stormo, 2010). Sequences that strongly bind to a TF in question will be selectively amplified
for later identification (Schug, 2008).
The major drawback of experimental approaches to determine TF recognition motifs is the
time required and the relative high cost (Zhou & Liu, 2004). Moreover, some methods have
specific requirements. For example, ChIP requires antibodies and certain growth conditions
under which the transcription regulator is active (Tan et al., 2005). Even if a biologist can
satisfy the requirements, the resolution of the regions containing the binding sites can span
from 30-50 bp (for SELEX) to a few hundreds bp (for ChIP-chip), making the extraction of
the consensus motif from the collected sequences not an easy task (Stormo, 2010).
Thankfully, in recent times, a new, in silico approach to identify TF binding sites became
available. Many bioinformatics programsthe number ranges from 120 (Wei & Yu, 2007) to
over 200 (Ladunga, 2010)have been created to help biologists predict DNA binding motifs
from the enormous amounts of sequence and gene expression data generated from advances
in high-throughput genomic sequencing and gene expression analysis techniques.
1.1 Pattern matching and pattern discovery

There are two types of motif searches and the type dictates which programs one uses. In the
first type, known as unsupervised motif finding or de novo, ab initio, or pattern discovery, a
researcher wants to know the consensus pattern in a set of orthologous genes, genes in a
common pathway, or transcriptionally co-regulated genes or operons from an experiment
(Mrazek, 2009). The genes presumably share some binding sequence for a common TF and
the task is to discover the conserved, statistically over-represented motif in the regulatory
regions (Mrazek, 2009). In the second type, known as supervised motif finding or pattern
matching, the DNA binding motif for a TF has been determinedeither predicted de novo or
experimentally identifiedand the goal is to find which other genes in the genome have a
similar motif in their promoter (Mrazek, 2009).
Because pattern discovery and pattern matching are fundamentally different tasks, there are
two classes of motif prediction programs, each implementing different algorithms to solve
their respective problem. For de novo motif discovery programs, the goal is to iteratively find
a set of 12-20-bp sequence motifs that are most significantly similar to each other (Mrazek,
2009), usually with an enumeration, expectation maximization, or Gibbs sampling
algorithm. Representative programs of this class include AlignACE, MEME, BioProspector,
MDScan and MotifSampler (Hu et al., 2005). This is the extent of our coverage on pattern
discovery in this chapter. For more information, see Ladunga, 2010; MacIsaac & Fraenkel,
2006; Mrazek, 2009; Stormo, 2000; and Wei & Yu, 2007. For more details on the algorithms,
see Das & Dai, 2007; Dhaeseleer, 2006a; Pavesi et al., 2004; and Stormo, 2010.
1.2 Whats covered

The rest of this chapter discusses pattern matching with a focus on prokaryotes. Eukaryotes
are not covered because transcription regulation is substantially different between these two
groups (Quest et al., 2008). Promoters of prokaryotes are typically less than 500 bp and are
more likely to be palindromic, whereas those in eukaryotes can extend tens of thousands of
nucleotides (Thompson et al., 2007). Another difference is that prokaryotic TFBSs are a few
hundred bp upstream of translational start site and can overlap or appear in tandem,
whereas in eukaryotes, they can be kilobases away (Bulyk, 2003; Yanover et al., 2009).
Lastly, in prokaryotes, gene regulation occurs mainly at the transcriptional level (Yanover et
al., 2009). In eukaryotes, multiple TFs coordinately bind to relatively short binding sites in
the promoter of a single gene to regulate its expression (Thompson et al., 2007; Yoshida et
al., 2006; Zaslavsky & Singh, 2006). Also in eukaryotes, the genome is bigger with more non-
coding sequences and the regulatory elements can be located upstream of the gene, within
it, or even downstream of it (Bulyk, 2003). With eukaryote gene regulation being more
complex, motif finding programs work significantly better on lower organisms than on
higher organisms (Das & Dai, 2007).
Guide to Genome-Wide Bacterial Transcription
Factor Binding Site Prediction Using OmpR as Model 43
The chapter is intended to be a pragmatic guide for microbiologists. As such, it does not
cover algorithms in details and technical mathematical formulas. Instead, it presents a high-
level conceptual overview of the key concepts researchers need to know in order to
effectively use the available bioinformatics tools to locate TF binding sites in sequenced
prokaryote genomes. Online databases of prokaryote gene expression regulation
information are introduced next, followed by pattern matching programs designed for or
tested on prokaryotes. Finally, the chapter concludes by offering practical strategies and tips
to improve the specificity and sensitivity of the results.
Along the way, the global transcriptional regulator OmpR in Escherichia coli will be used in
examples throughout the chapter. OmpR is a cytosolic response regulator, and together with
the membrane-bound histidine sensor kinase EnvZ, constitute a prototypical two-
component signal transduction system in bacteria. Our lab is currently using bioinformatics
to identify novel target genes of OmpR in the E. coli genome.
2. Motif representation
As mentioned before, a TF binds to different DNA sequence variations to modulate the
expression of their target genes. This degeneracy of the binding sequences allows different
levels of gene regulation to be achieved (Dhaeseleer, 2006b). For instance, OmpRs DNA
binding properties fluctuate with the extent of covalent modifications, leading to changes in
the DNA binding affinity and/or its DNA binding signature, and thus broadening its
motif definition. In E. coli one of the genes regulated by OmpR, ompF, illustrates the
transcriptional regulators broad recognition signature. In vivo and in vitro experiments have
shown that two OmpR molecules bind to each of the four sites in the promoter of the ompF
gene in a tandem manner (Harlocker et al., 1995; Yoshida et al., 2006):
F1: TTTACTTTTGGTTACATATT
F2: TTTTCTTTTTGAAACCAAAT
F3: TTATCTTTGTAGCACTTTCA
F4: GTTACGGAATATTACATTGC
Many pattern matching programs take a set of TFBS sequences, such as the OmpR binding
sequences above, as input and internally convert it to a matrix representation for genome
scanning. A few programs, such as MAST, require the matrix directly, which can be
constructed using one of the matrix utility programs discussed later.
Conceptually, a motif matrix is a table of 4 rows by n columns, where n is the length of the
TFBS sequences, that tabulates the frequency information of the nucleotides at each position.
The four rows correspond to the four nucleotides A, T, G, C. Each column in the table holds
the occurrence frequency of each base at that motif position. Bases that occur more
frequently at a position/column have a higher number. See Fig. 1(a) for the matrix
representation of the four F1-F4 OmpR binding sequences shown above.
The matrix in Fig. 1(a) is called a position frequency matrix. In actual practice,
bioinformatics programs add values like pseudocounts (to avoid zero, which is undefined
for some mathematical functions used in the algorithm) and background model
probabilities (to account for genome differences like GC content) to each frequency number
(Mrazek, 2009). It is this more sophisticated matrix, called a position-specific score matrix
(PSSM) or position weight matrix (PWM), that is actually used by pattern matching
programs during genome scanning. See Fig. 1(b).
Matrices are generally used to represent more degenerate (that is, less conserved) TFBS
sequences (Mrazek, 2009). When the consensus pattern is more conserved, one may model
the motif using the International Union of Pure and Applied Chemistry (IUPAC) codes
(Dhaeseleer, 2006a). The IUPAC system defines 11 new single-letter codes that represent
more than one nucleotide (see Table 1). For example, the ompF binding sites could be neatly
represented using the IUPAC alphabet as KTWWCKKWDKRDHACHWWNH [see Fig.
1(c)]. The K is a wild card code for guanine or thymine; W, adenine or thymine; and so on.
IUPAC code Matches Nucleotide(s)

A A
C C
G G
T T
R A or G
Y C or T
W A or T
S G or C
M A or C
K G or T
H A, C or T
B C, G or T
V A, C or G
D A, G or T
N A, C, G or T
. or - (gap)
Table 1. IUPAC codes for describing more conserved transcription factor binding consensus
sequences (Pavesi et al., 2004).
Another way to represent more conserved motifs is via regular expression, or regex, a
complex but highly flexible language for describing text patterns in the computer field
(Mrazek, 2009). One simple regular expression that describes the four OmpR-binding sites
upstream of ompF is: [TG]T[AT][AT]C[TG][TG][AT][ATG][TG][GA][ATG][ATC]AC
[ATC][AT][AT][ATGC][ATC]
Each pair of brackets specifies one nucleotide and the bases in the brackets specify the
allowable nucleotides. There are slightly different flavors of the regex language that
implement slightly different features, so be sure to check the documentation accompanying
a pattern matching program to find out the features supported.
Note that both IUPAC codes and regular expression allow multiple bases to be specified at a
nucleotide position, but all the valid bases are assumed to occur with the same frequency.
Because the set of DNA sequences recognized by a TF is often degenerate and nucleotide
frequency information is helpful in pattern matching, matrices are more often used and are
supported by many programs.
Fig. 1. The first four rows, labeled F1-F4, contain the four sites upstream of the ompF gene
where OmpR binds in Escherichia coli. (a) The position frequency matrix representation of
the same ompF sequences. Each column contains the frequencies of occurrence of the
nucleotides in each corresponding F1-F4 sequence position. (b) The position weight matrix
representation of the ompF F1-F4 sequences. The weight matrix is derived from the
frequency matrix in (a). The values are calculated by taking the log of the frequency values
divided by background model values. It is this position weight matrix that is actually used
by pattern matching programs during execution. (c) The consensus motif of the four F1-F4
sequences in IUPAC codes.
3. How pattern matching programs work

Whether a motif is given as a regular expression, an IUPAC consensus sequence, or a
matrix, a pattern matching program looks for the motif by scanning a genome on both the
sense and antisense strands from the 5 to 3 end (MacIsaac & Fraenkel, 2006). See Fig. 2.
Typically, the default is to check only the intergenic regions; coding regions are skipped
over. A window with a width equal to the length of the motif slides over the genome one
base at a time. At each iteration, the sequence in the window is checked against the given
motif for a match.
For regular expression or IUPAC motif, each nucleotide in the window is checked to see if
that nucleotide is allowed at that position. If the number of mismatches is at or below a
certain limit, the sequence is considered a match and returned. If the motif is given as a
matrix, the sequence is scored against the matrix. The score for that sequence is calculated
by summing the weight score at each position. If the score is at or above a certain threshold,
that sequence is considered similar to the motif and a match is found. The score measures
how closely the candidate sequence matches the motif modeled by the position weight
matrix and how likely the candidate happens to be a random genomic background
sequence.
4. Motif databases and utilities

To use motif matching programs to discover candidate genes modulated by a TF, the TFs
motif is required. One can look in the literature to compile a list of the reported binding site
sequences, or better yet, one can search online databases of sequenced genomes and gene
regulation information, usually curated from primary journals. There are general databases
covering the prokaryotes and specialized ones for particular bacterial strains (see Table 2).
For instance, PRODORIC contains close to 3,000 TFBSs and over 2,000 genes for multiple
bacteria species (Grote et al., 2009). Another resource containing information on
transcription factors and their target genes, but for Escherichia coli K-12 only, is RegulonDB
(Gama-Castro et al., 2011).
Fig. 2. Overview of how pattern matching programs work given a motif represented using
(a) IUPAC codes or (b) a position weight matrix. These programs slide an n-bp window
(shaded and underlined), where n is the length of the motif (n = 20 in this example), over
every single base in the genome. For each iteration, the sequence inside the window is (a)
compared against the allowable nucleotides specified by the IUPAC motif, and if the
number of mismatches is at or below a certain limit, the sequence is considered a match. For
the matrix in (b), the score of an individual base in each column is looked up and summed,
and if the total is at or over a certain threshold, the sequence is considered a match. The
IUPAC consensus motif and the matrix are the same as those in Fig. 1(c) and (b). In (a), Y = a
match, N = mismatch.
Database Organism Web Address Reference

DBTBS Bacillus subtilis http://dbtbs.hgc.jp Sierro et al., 2008
http://arep.med.harvard.edu/dpint
DPInteract Escherichia coli Robison et al., 1998
eract
Gama-Castro et al.,
RegulonDB Escherichia coli http://regulondb.ccg.unam.mx
2011
CoryneRegNet Corynebacterium http://www.CoryneRegNet.de Baumbach, 2007
PRODORIC Prokaryotes http://www.prodoric.de Grote et al., 2009
http://regprecise.lbl.gov/RegPrecis Novichkov et al.,
RegPrecise Prokaryotes
e 2010a
RegTransBase Prokaryotes http://regtransbase.lbl.gov Kazakov et al., 2007
KEGG Prokaryotes http://www.genome.ad.jp/kegg Kanehisa et al., 2004
Table 2. Select databases of curated and annotated transcription factor binding sites and
other gene expression regulation information in prokaryotes. Note that the KEGG database
also covers eukaryotes.
Once a set of binding site sequences has been gathered, online tools are available to analyze
and display the motif in those sequences (Table 3). D-MATRIX (Sen et al., 2009) is a web
application that constructs alignment, frequency, and weight matrices and displays them.
The generated matrices can be exported for use as input into pattern matching programs.
The site can also generate the regular expression and IUPAC representations of the
consensus motif. WebLogo displays a motif graphically so that sequence similarity can
easily be visualized (Crooks et al., 2004).
It is important that the gathered TF binding sites are high quality since inaccuracies will
produce a subpar matrix and consequently, poor motif matching performance (Medina-
Rivera et al., 2010; Wittkop et al., 2010). Inaccuracies in TFBS information could stem from
the imprecise nature of experimental approaches since gel shift, DNase footprinting, ChIP-
chip, and ChIP-seq do not precisely identify binding sequences (Wittkop et al., 2010).
Two programs aim to analyze and optimize binding sequences. The utility matrix-quality
quantifies the ability of a matrix to distinguish background sequences and find functional
binding sites in a genome (Medina-Rivera et al., 2010). It works by combining theoretical
and empirical score distributions (Medina-Rivera et al., 2010). Another utility, MoRAine,
goes one step further by shifting nucleotides around and takes the reverse complement of
each TFBS sequence to try to improve the matrix (Wittkop et al., 2010) .
Program Platform Web Address Reference

D-MATRIX Web http://203.190.147.116/dmatrix Sen et al., 2009
Web; Medina-Rivera
matrix-quality http://rsat.ulb.ac.be/rsat
Unix et al., 2010
Web; Wittkop et al.,
MoRAine http://moraine.cebitec.uni-bielefeld.de
Java 2010
Web; Crooks et al.,
WebLogo http://weblogo.berkeley.edu
Unix 2004
Table 3. Utility programs to manipulate transcription factor binding site sequences:
construct and display frequency and weight matrices, generate regular expressions and
IUPAC consensus patterns, and check and improve alignment quality. All the programs run
inside a web browser (Platform = Web). Some of them can also be downloaded and
executed locally on the users computer running Unix or Unix-like operating system
(Platform = Unix) or locally inside a Java virtual machine (Platform = Java). The Web
Address column shows where the programs can be located or downloaded.
5. Pattern matching programs

Once a list of high quality TF binding sites is in hand, it can be fed into the pattern matching
programs listed in Table 4 to find novel binding sites. All the listed programs are designed
for prokaryotes or they have been tested with bacteria. This section briefly describes each
motif matching program.
STAMP (Mahony & Benos, 2007) is not a true pattern matching program in that it does not
scan genomes. Instead, it finds regulatory sequences deposited in motif databases that are
most similar to a user-supplied set of binding sequences. It also performs multiple
alignments on the supplied binding motifs and builds trees of the evolution of TF binding
motifs.
MAST (Motif Alignment & Search Tool) (Bailey & Gribskov, 1998), a component of the
MEME Suite, is one of the early programs that perform pattern matching on nucleotide (and
protein) sequences. The user can select one of the available genomes or upload a file
containing up to one million nucleotides to search. The program requires an input file
describing the matrix of the motif to search for.
Program Platform Web Address Reference

http://ibiza.biw.kuleuven.be/crossed/we
CRoSSeD Web Meysman et al., 2011
btool.html
EMBOSS >
Web; Unix http://emboss.sourceforge.net Rice et al., 2000
dreg
http://bayesweb.wadsworth.org/cgi-
dscan Web Thompson et al., 2005
bin/dscan.pl
FITBAR Web http://archaea.u-psud.fr/fitbar Oberto, 2010
iMotifs Mac http://wiki.github.com/mz2/imotifs Piipari et al., 2010
http://meme.sdsc.edu/meme/mast- Bailey & Gribskov,
MAST Web; Unix
intro.html 1998
Motif
Web http://www.cmbl.uga.edu/software.html Mrazek et al., 2008
Locator
MyPattern
Web http://www.nii.ac.in/~deepak/RegAnalyst Sharma et al., 2009
Finder
http://ftp.mcs.anl.gov/pub/Genomics/Pa
PatScan Unix Dsouza et al., 1997
tScan
Pattern
Web; Unix http://www.cmbl.uga.edu/software.html Mrazek & Xie, 2006
Locator
Palumbo & Newberg,
PhyloScan Web http://bayesweb.wadsworth.org/phyloscan
2010
PredictReg
Web http://www.cdfd.org.in/predictregulon Yellaboina et al., 2004
ulon
Novichkov et al.,
RegPredict Web http://regpredict.lbl.gov
2010b
Thomas-Chollier et
RSAT Web http://rsat.ulb.ac.be/rsat
al., 2008
http://wwwmgs.bionet.nsc.ru/mgs/progr Oshchepkov et al.,
SITECON Web
ams/sitecon 2004
Mahony & Benos,
STAMP Web http://www.benoslab.pitt.edu/stamp
2007
Virtual
Web http://www.prodoric.de/vfp Munch et al., 2005
Footprint
Table 4. Programs that can scan prokaryote genomes for transcription factor binding sites.
All these programs can run over the web inside a browser (Platform = Web) except iMotifs,
a MacOS X only application, and PatScan, a program that must be downloaded and run
locally on Unix or Unix-like systems. Three of the web applicationsdreg, MAST, and
Pattern Locatorcan also be downloaded and execute on Unix or Unix-like systems. The
Web Address column shows where a program can be run or downloaded.
PatScan (Dsouza et al., 1997) is another early motif matching program. Even though it is
designed to search protein sequences for motifs and nucleotide sequences for hairpins,
pseudoknots, repeats, and other secondary structures, it could be used to search genomic
DNA for TFBSs. Mismatches, insertions, and deletions are allowed. It runs on Unix systems
only. A web version seems to be no longer available.
The program dreg searches one or more sequences for a given motif described by a regular
expression (Rice et al., 2000). It is one of the hundreds of tools comprising EMBOSS
(European Molecular Biology Open Software Suite). EMBOSS mission is to provide a place
to bring together the rapid increase in the number of complete genomes and new sequence
analysis software and make them publicly available as a suite. The tools perform sequence
alignment, database searching with sequence patterns, nucleotide sequence patterns (CpG
islands, repeats, etc.), and more.
To address the usability issue associated with PatScan and dreg, Pattern Locator was created
(Mrazek & Xie, 2006). Its purpose is to find short sequence patterns in complete genomes.
The input string uses a special syntax or it can be specified using the IUPAC alphabet. The
flexible syntax allows the following to be specified: direct and inverted repeats, maximum
number of mismatches allowed, direct or complementary DNA strand to search, and gaps.
Many other programs do not require motifs to be supplied in a special syntax. Motif Locator
(Mrazek et al., 2008) takes a set of binding sequences, turns it into a matrix, and uses the
matrix to search a genome for instances of the motif. MyPatternFinder (Sharma et al., 2009)
finds exact or approximate occurrences of a motif from a selection of over 600 complete
genomes using an exact search method and an alignment technique. Insertions and
deletions are allowed. The program dscan (Thompson et al., 2005) scans genome databases
for statistically significant sites similar to the given motif. Two databases of E. coli and
Rhodopseudomonas palustris intergenic regions are provided.
PredictRegulon (Yellaboina et al., 2004) is a web application that scans a prokaryote genome
for potential target genes of a TF. The user picks a bacterial genome from a list of over 110
and supplies a set of aligned binding site sequences for the transcription factor. The
program then scans the upstream sequences of all the genes in the selected genome,
calculates a score for a potential binding site in each promoter, and outputs the site if the
score is above the threshold cutoff value, which is taken to be the lowest score in the input
sequence set. The output includes the binding site sequence, the name and description of the
gene, and operon context and detailed information on the gene.
FITBAR (Fast Investigation Tool for Bacterial and Archaeal Regulons) (Oberto, 2010) is a
matrix search program that scans whole Bacteria and Archaea genomes retrieved from the
National Center for Biotechnology Information repository to discover sets of genes
regulated by TFs. Unlike most other genome matching programs such as PredictRegulon,
FITBAR does not find matches by arbitrary score cutoff values. It uses the log-odds and
entropy-weighted search algorithms and Compound Importance Sampling (CIS) and Local
Markov Method (LMM) to calculate the statistical significance of the predicted motifs (p-
values). Aligned TFBS sequences can be supplied, or one of the 200 known prokaryotic
matrices can be selected. Results are listed, along with a graphical depiction of the motif
sequence location and the surrounding genes.
Like EMBOSS, RSAT (Regulatory Sequence Analysis Tools) (Thomas-Chollier et al., 2008)
contains a collection of tools to analyze cis-acting regulatory elements in the noncoding
sequences from over 600 genomes. The tools perform both pattern matching (and pattern
discovery) and return information on individual genes, such as orthologs and DNA
sequences. Namely, the five pattern matching programsdna-pattern, genome-scale-dna-
pattern, matrix-scan, patser, and genome-scale-patserallow one to search entire genomes or a

set of sequences for occurrences of a motif represented as a regular expression, an IUPAC
string, or a position weight matrix. Various statistical background models are available to
allow the significance of the matches to be evaluated.
Virtual Footprint (Munch et al., 2005) is an online interactive environment to search and
analyze TFBS, gapped or ungapped, in bacterial genomes. The TFBS pattern to search can be
picked from a list of pre-defined matrix motifs, or a set of sequences, a regular expression, or
IUPAC codes can be supplied. A match is assigned to a gene if possible and the genomic
context is provided. The program can check if a match also occurs in the regulatory region
of orthologous genes.
Like Virtual Footprint, iMotifs (Piipari et al., 2010) provides an integrated environment to
visualize, analyze, and annotate sequence motifs. However, it does not run over the web. It
is a Java-based application that runs on MacOS X only.
More advanced pattern matching programs incorporate the use of cross-species
conservations during their genome search to enrich the predicted sites. Comparative
genomics approach is predicated on the idea that TFs from related organisms regulate genes
that tend to be conserved (Novichkov et al., 2010b). Presence of similar TFBSs upstream of
orthologous genes increases the probability that the sites are functional binding sites
(Novichkov et al., 2010b).
PhyloScan (Carmack et al., 2007; Palumbo & Newberg, 2010) is a web program that screens
candidate sequences by using (1) aligned or unaligned sequence data from multiple species,
even evolutionarily distant ones, (2) multiple sites within an intergenic region, and (3) q-
values to predict more functional TFBSs, even weak ones, in a genome. The use of q-values
is in contrast to conventional motif matching programs, which either score a candidate
binding site against a training set of TFBS or evaluate the statistical significance of the
candidate binding site using p-value.
Another program that takes the comparative genomics approach is RegPredict (Novichkov
et al., 2010b), a web site that provides a visual environment for the discovery of genes
regulated by a TF in prokaryotes. The site contains a large collection of known TFBS motifs
gathered from the RegPrecise, RegTransBase, and RegulonDB databases and genomic
sequences of major taxonomic groups of Bacteria. Any of the motifs can be selected, or the
user can upload a set of aligned binding site sequences, and RegPredict will scan for the
motif in up to 15 genomes simultaneously. (If the regulatory motif is not known, RegPredict
can predict one de novo from user-supplied coregulated genes.) Candidate genes are
grouped into different clusters based on the degree of conservation of regulatory
interactions and then presented in a multi-pane user interface, along with the genomic
context and gene function information, for the user to analyze.
Other advanced motif matching programs use DNA structure information to increase their
performance. A factor that contributes to the specificity of the interaction between a TF and
its binding site is the local conformation of the DNA site (Oshchepkov et al., 2004). Even
though a TF often regulates multiple genes and the binding sites in the promoters of these
genes show variations, certain conformational and physicochemical properties are
conserved among these sites so that the TF can recognize the sites (Oshchepkov et al., 2004).
Thus, these context-dependent TFBS properties can be used to improve the predictions of
genes controlled by a TF (Oshchepkov et al., 2004).
SITECON (Oshchepkov et al., 2004) is a web application that can analyze and report 38
propertiesmajor groove depth, bend, entropy change, to name a fewin a given set of
DNA binding site sequences, and optionally, find binding sites in one or more DNA
sequences using those properties.
CRoSSeD (Conditional Random fields of Smoothed Structural Data) (Meysman et al., 2011)
is another program that leverages structure information. Specifically, it uses 12 structural
scales, such as protein-induced deformability and stabilization energy, that are presumably
relevant to binding site recognition in prokaryotes. (Scales are experimentally determined
models for approximating regional DNA structure based on di- or trinucleotides.) Some of
the novel binding sites found by CRoSSeD had low sequence similarity. A check with the
literature and database indicated that they may be true binding sites. This shows that
searching for binding sites based on structure information is a viable approach since these
binding sites, with their weak motif, may be missed by traditional pattern matching
programs.
6. EnvZ/OmpR regulon prediction

Our lab is currently using genetic, biochemical, and bioinformatics approaches to determine
the set of genes regulated by OmpR in E. coli. A microarray experiment showed that the
expression levels of 125 genes were significantly affected in an EnvZ-null background
(Oshima et al., 2002). To help identify the genes that are directly modulated by OmpR, we
searched the RegulonDB databank and found 23 OmpR binding sites for 11 genes, as listed
in Table 5.
Using all of the OmpR binding sequences except ecnBs (since it is not 20-bp long) as input,
the pattern matching program Motif Locator detected 12,314 matches in the intergenic
regions of the E. coli K12 genome. Since E. coli has over 4,200 genes (Blattner et al., 1997), the
results clearly contained many false positives.
Gene OmpR Binding Site Gene OmpR Binding Site

bolA AACCTAAATATTTGTTGTTA micF CGAATATGATACTAAAACTT
nmpC AACTTACATCTTGAAATAAT micF TTAAGATGTTTCATTTATCG
ompF TTTACTTTTGGTTACATATT micF TATAGATGTTTCAAAATGTA
ompF TTTTCTTTTTGAAACCAAAT ompC TTTACATTTTGAAACATCTA
ompF CTTTATCTTTGTAGCACTTT ompC AGCGATAAATGAAACATCTT
ompF GTTACGGAATATTACATTGC ompC AAAAGTTTTAGTATCATATT
csgD TACATTTAGTTACATGTTTA fadL GAGCCAGAAAACCCTGTTTA
tppB GTAACAGATTATTACAAAGG fadL TTAGATCATATTTGAAAAAA
flhD AAAAATCTTAGATAAGTGTA fadL ACGTAACATAGTTTGTATAA
flhD GGGCATTATCTGAACATAAA fadL AAATCACACTTAAAAATGAT
omrA CACACCTCGTTGCATTTCCC ecnB AACATAAATAACAT
omrB AACCTTTGGTTACACTTTGC
Table 5. List of known OmpR binding sites and the corresponding genes. The list was
compiled using RegulonDB.
To increase the specificity and reduce the number of matches returned, we picked 10
binding sites from five genes: ompF, ompC, tppB, csgD, and fadL. See Table 6. These sequences
were chosen because each contains two direct repeats of the consensus motif
GTTACANNNN, which is derived from extensive studies on interactions between OmpR
and ompF and ompC promoters (Harlocker et al., 1995; Yoshida et al., 2006). Note that we
adjusted the alignment of the csgD and fadL binding sequences to better fit the consensus
model. The csgD and fadL sequences from RegulonDB shown in Table 5 span from 57 to 38
and from +58 to +77 relative to the transcriptional start site, whereas the adjusted ones span
from -59 to -40 and from 50 to 69, respectively.
Pattern matching analysis of the 10 sequences listed in Table 6 using Motif Locator found
110 matches, five of which were among the 125 genes affected in the microarray experiment:
ompF, flgL, ompC, rpoE, and cysC. The same set of 10 sequences was fed into another pattern
matching program, Virtual Footprint, which predicted 32 genes modulated by OmpR. Four
genes were the same as those identified in the microarray data: ompF, ydgR, ompC, and ygjU.
Only two genes were found by both Motif Locator and Virtual Footprint, ompF and ompC,
showing that different programs return different results.
Gene OmpR Binding Site

ompF TTTACTTTTGGTTACATATT
ompF TTTTCTTTTTGAAACCAAAT
ompF CTTTATCTTTGTAGCACTTT
ompF GTTACGGAATATTACATTGC
ompC TTTACATTTTGAAACATCTA
ompC AGCGATAAATGAAACATCTT
ompC AAAAGTTTTAGTATCATATT
tppB GTAACAGATTATTACAAAGG
csgD GTTACATTTAGTTACATGTT
fadL GTTACAGCACGTAACATAGT
Table 6. OmpR binding sequences that contain direct repeats of the GTTACANNNN
consensus motif, where N denotes any nucleotide.
The degenerate OmpR binding motif makes identification of new regulon member difficult.
When the set of 10 sequences in Table 6 was used as input, Motif Locator predicted only half
of the 12 known OmpR regulated genes: bolA, ompF, csgD, micF, ompC, and fadL, whereas
Virtual Footprint returned four: ompF, micF, ompC, and fadL. This observation suggests that
the run was too specific and more novel genes remain to be discovered. To find them, one
can try different sets of input sequences, run other pattern matching programs, or make use
of comparative genomics or published OmpR crystal structures (Kondo et al., 1997;
Martnez-Hackert & Stock, 1997).
7. Conclusion
Like our own experience of using bioinformatics tools to study the OmpR regulon
illustrates, comparative studies on the performance of motif discovery and matching
programs found no single program works well on all data sets (MacIsaac & Fraenkel, 2006).
In particular, a benchmark of four motif matching programsRSA Tools, PRODORIC
Virtual Footprint, RegPredict, and FITBARfor their ability to discover potential binding
sites for the transcriptional regulator NagC involved in N-acetylglucosamine metabolism in
the Escherichia coli K12 MG1655 genome found that some tools uncover sites that others have
missed (Oberto, 2010). Therefore, it is recommended that multiple tools be used instead of
just one and the output from multiple programs be combined and compared in order to
improve accuracy and gain confidence in the results (Das & Dai, 2007; Mrazek, 2009).
The easiest way to run the pattern matching programsand other bioinformatics toolsis
over the web inside a browser. However, in order to help keep the load on the web servers
hosting these programs to a low level, some sites put a limit on the complexity of the jobs
submitted. If a web site places such restriction, a desktop version of the program is usually
provided for users to download and install or compile on their local computer. Many of the
desktop programs run in a Java environment or on Unix or Unix-like system, such as Linux.
Some Unix programs can run on Windows if the Linux-like environment Cygwin is set up
first. However, it should be noted that setting up the required runtime environment and
installing or compiling these programs take considerable effort and computer expertise.
Also be aware that some desktop programs, especially those that run on Unix, are run from
the command line; there is no graphical user interface.
The identification of a TFs binding motif and the identification of new target genes are
difficult to do experimentally and computationally (Pavesi et al., 2004) because we do not
completely understand the biology of gene regulation (Das & Dai, 2007). But it is hoped that
the information in this chapter will make the task of pattern matching easier for
microbiologists and other researchers.
8. Acknowledgment
This work was supported by grant GM048167 from the National Institutes of Health.
9. References
Bailey, T. L. & Gribskov, M. (1998). Combining evidence using p-values: application to
sequence homology searches. Bioinformatics, Vol. 14, No. 1, pp. 48-54.
Bauer, A. L., Hlavacek, W. S., Unkefer, P. J., & Mu, F. (2010). Using sequence-specific
chemical and structural properties of DNA to predict transcription factor binding
sites. PLoS Comput Biol, Vol. 6, No. 11, pp. e1001007.
Blattner, F. R., Plunkett, G., 3rd, Bloch, C. A., Perna, N. T., Burland, V., Riley, M., Collado-
Vides, J., Glasner, J. D., Rode, C. K., Mayhew, G. F., Gregor, J., Davis, N. W.,
Kirkpatrick, H. A., Goeden, M. A., Rose, D. J., Mau, B., & Shao, Y. (1997). The
complete genome sequence of Escherichia coli K-12. Science, Vol. 277, No. 5331, pp.
1453-62.
Bulyk, M. L. (2003). Computational prediction of transcription-factor binding site locations.
Genome Biol, Vol. 5, No. 1, pp. 201.
Carmack, C. S., McCue, L. A., Newberg, L. A., & Lawrence, C. E. (2007). PhyloScan:
identification of transcription factor binding sites using cross-species evidence.
Algorithms Mol Biol, Vol. 2, pp. 1.
Crooks, G. E., Hon, G., Chandonia, J. M., & Brenner, S. E. (2004). WebLogo: a sequence logo
generator. Genome Research, Vol. 14, No. 6, pp. 1188-90.
Das, M. K. & Dai, H. K. (2007). A survey of DNA motif finding algorithms. BMC
Bioinformatics, Vol. 8 Suppl 7, pp. S21.
D'Haeseleer, P. (2006). How does DNA sequence motif discovery work? Nat Biotechnol, Vol.
24, No. 8, pp. 959-61.
D'Haeseleer, P. (2006b). What are DNA sequence motifs? Nat Biotechnol, Vol. 24, No. 4, pp.
423-5.
Dsouza, M., Larsen, N., & Overbeek, R. (1997). Searching for patterns in genomic data.
Trends in Genetics : TIG, Vol. 13, No. 12, pp. 497-8.
Gama-Castro, S., Salgado, H., Peralta-Gil, M., Santos-Zavaleta, A., Muniz-Rascado, L.,
Solano-Lira, H., Jimenez-Jacinto, V., Weiss, V., Garcia-Sotelo, J. S., Lopez-Fuentes,
A., Porron-Sotelo, L., Alquicira-Hernandez, S., Medina-Rivera, A., Martinez-Flores,
I., Alquicira-Hernandez, K., Martinez-Adame, R., Bonavides-Martinez, C.,
Miranda-Rios, J., Huerta, A. M., Mendoza-Vargas, A., Collado-Torres, L., Taboada,
B., Vega-Alvarado, L., Olvera, M., Olvera, L., Grande, R., Morett, E., & Collado-
Vides, J. (2011). RegulonDB version 7.0: transcriptional regulation of Escherichia
coli K-12 integrated within genetic sensory response units (Gensor Units). Nucleic
Acids Research, Vol. 39, No. Database issue, pp. D98-105.
Grote, A., Klein, J., Retter, I., Haddad, I., Behling, S., Bunk, B., Biegler, I., Yarmolinetz, S.,
Jahn, D., & Munch, R. (2009). PRODORIC (release 2009): a database and tool
platform for the analysis of gene regulation in prokaryotes. Nucleic Acids Research,
Vol. 37, No. Database issue, pp. D61-5.
Harlocker, S. L., Bergstrom, L., & Inouye, M. (1995). Tandem binding of six OmpR proteins
to the ompF upstream regulatory sequence of Escherichia coli. The Journal of
Biological Chemistry, Vol. 270, No. 45, pp. 26849-56.
Homann, O. R. & Johnson, A. D. (2010). MochiView: versatile software for genome browsing
and DNA motif analysis. BMC Biol, Vol. 8, pp. 49.
Hu, J., Li, B., & Kihara, D. (2005). Limitations and potentials of current motif discovery
algorithms. Nucleic Acids Res, Vol. 33, No. 15, pp. 4899-913.
Kondo, H., Nakagawa, A., Nishihira, J., Nishimura, Y., Mizuno, T., & Tanaka, I. (1997).
Escherichia coli positive regulator OmpR has a large loop structure at the putative
RNA polymerase interaction site. Nature Structural Biology, Vol. 4, No. 1, pp. 28-31.
Ladunga, I. (2010). An overview of the computational analyses and discovery of
transcription factor binding sites. Methods Mol Biol, Vol. 674, pp. 1-22.
MacIsaac, K. D. & Fraenkel, E. (2006). Practical strategies for discovering regulatory DNA
sequence motifs. PLoS Comput Biol, Vol. 2, No. 4, pp. e36.
Mahony, S. & Benos, P. V. (2007). STAMP: a web tool for exploring DNA-binding motif
similarities. Nucleic Acids Res, Vol. 35, No. Web Server issue, pp. W253-8.
Martinez-Hackert, E. & Stock, A. M. (1997). The DNA-binding domain of OmpR: crystal
structures of a winged helix transcription factor. Structure, Vol. 5, No. 1, pp. 109-24.
Medina-Rivera, A., Abreu-Goodger, C., Thomas-Chollier, M., Salgado, H., Collado-Vides, J.,
& van Helden, J. (2010). Theoretical and empirical quality assessment of
transcription factor-binding motifs. Nucleic Acids Res, Vol. 39, No. 3, pp. 808-24.
Meysman, P., Dang, T. H., Laukens, K., De Smet, R., Wu, Y., Marchal, K., & Engelen, K.
(2011). Use of structural DNA properties for the prediction of transcription-factor
binding sites in Escherichia coli. Nucleic Acids Res, Vol. 39, No. 2, pp. e6.
Mrazek, J. (2009). Finding sequence motifs in prokaryotic genomes--a brief practical guide
for a microbiologist. Brief Bioinform, Vol. 10, No. 5, pp. 525-36.
Mrazek, J. & Xie, S. (2006). Pattern locator: a new tool for finding local sequence patterns in
genomic DNA sequences. Bioinformatics, Vol. 22, No. 24, pp. 3099-100.
Mrazek, J., Xie, S., Guo, X., & Srivastava, A. (2008). AIMIE: a web-based environment for
detection and interpretation of significant sequence motifs in prokaryotic genomes.
Bioinformatics, Vol. 24, No. 8, pp. 1041-8.
Munch, R., Hiller, K., Grote, A., Scheer, M., Klein, J., Schobert, M., & Jahn, D. (2005). Virtual
Footprint and PRODORIC: an integrative framework for regulon prediction in
prokaryotes. Bioinformatics, Vol. 21, No. 22, pp. 4187-9.
Novichkov, P. S., Laikova, O. N., Novichkova, E. S., Gelfand, M. S., Arkin, A. P., Dubchak, I.,
& Rodionov, D. A. (2010a). RegPrecise: a database of curated genomic inferences of
transcriptional regulatory interactions in prokaryotes. Nucleic Acids Research, Vol.
38, No. Database issue, pp. D111-8.
Novichkov, P. S., Rodionov, D. A., Stavrovskaya, E. D., Novichkova, E. S., Kazakov, A. E.,
Gelfand, M. S., Arkin, A. P., Mironov, A. A., & Dubchak, I. (2010b). RegPredict: an
integrated system for regulon inference in prokaryotes by comparative genomics
approach. Nucleic acids research, Vol. 38, No. Web Server issue, pp. W299-307.
Oberto, J. (2010). FITBAR: a web tool for the robust prediction of prokaryotic regulons. BMC
Bioinformatics, Vol. 11, pp. 554.
Oshchepkov, D. Y., Vityaev, E. E., Grigorovich, D. A., Ignatieva, E. V., & Khlebodarova, T.
M. (2004). SITECON: a tool for detecting conservative conformational and
physicochemical properties in transcription factor binding site alignments and for
site recognition. Nucleic Acids Res, Vol. 32, No. Web Server issue, pp. W208-12.
Oshima, T., Aiba, H., Masuda, Y., Kanaya, S., Sugiura, M., Wanner, B. L., Mori, H., &
Mizuno, T. (2002). Transcriptome analysis of all two-component regulatory system
mutants of Escherichia coli K-12. Molecular Microbiology, Vol. 46, No. 1, pp. 281-91.
Palumbo, M. J. & Newberg, L. A. (2010). Phyloscan: locating transcription-regulating
binding sites in mixed aligned and unaligned sequence data. Nucleic Acids Research,
Vol. 38, No. Web Server issue, pp. W268-74.
Pavesi, G., Mauri, G., & Pesole, G. (2004). In silico representation and discovery of
transcription factor binding sites. Brief Bioinform, Vol. 5, No. 3, pp. 217-36.
Piipari, M., Down, T. A., Saini, H., Enright, A., & Hubbard, T. J. (2010). iMotifs: an integrated
sequence motif visualization and analysis environment. Bioinformatics, Vol. 26, No.
6, pp. 843-4.
Quest, D., Dempsey, K., Shafiullah, M., Bastola, D., & Ali, H. (2008). MTAP: the motif tool
assessment platform. BMC Bioinformatics, Vol. 9 Suppl 9, pp. S6.
Rice, P., Longden, I., & Bleasby, A. (2000). EMBOSS: the European Molecular Biology Open
Software Suite. Trends in Genetics : TIG, Vol. 16, No. 6, pp. 276-7.
Schug, J. (2008). Using TESS to predict transcription factor binding sites in DNA sequence.
Curr Protoc Bioinformatics, Vol. Chapter 2, pp. Unit 2 6.
Sen, N., Mishra, M., Khan, F., Meena, A., & Sharma, A. (2009). D-MATRIX: a web tool for
constructing weight matrix of conserved DNA motifs. Bioinformation, Vol. 3, No. 10,
pp. 415-8.
Sharma, D., Mohanty, D., & Surolia, A. (2009). RegAnalyst: a web interface for the analysis
of regulatory motifs, networks and pathways. Nucleic Acids Res, Vol. 37, No. Web
Server issue, pp. W193-201.
Stormo, G. D. (2010). Motif discovery using expectation maximization and Gibbs' sampling.
Methods Mol Biol, Vol. 674, pp. 85-95.
Tan, K., McCue, L. A., & Stormo, G. D. (2005). Making connections between novel
transcription factors and their DNA motifs. Genome Res, Vol. 15, No. 2, pp. 312-20.
Thomas-Chollier, M., Sand, O., Turatsinze, J. V., Janky, R., Defrance, M., Vervisch, E.,
Brohee, S., & van Helden, J. (2008). RSAT: regulatory sequence analysis tools.
Nucleic acids research, Vol. 36, No. Web Server issue, pp. W119-27.
Thompson, W., Conlan, S., McCue, L. A., & Lawrence, C. E. (2007). Using the Gibbs Motif
Sampler for phylogenetic footprinting. Methods Mol Biol, Vol. 395, pp. 403-24.
Thompson, W., McCue, L. A., & Lawrence, C. E. (2005). Using the Gibbs motif sampler to
find conserved domains in DNA and protein sequences. Curr Protoc Bioinformatics,
Vol. Chapter 2, pp. Unit 2 8.
Wei, W. & Yu, X. D. (2007). Comparative analysis of regulatory motif discovery tools for
transcription factor binding sites. Genomics Proteomics Bioinformatics, Vol. 5, No. 2,
pp. 131-42.
Wittkop, T., Rahmann, S., & Baumbach, J. (2010). Efficient online transcription factor
binding site adjustment by integrating transitive graph projection with MoRAine
2.0. J Integr Bioinform, Vol. 7, No. 3, pp. 1-11.
Yanover, C., Singh, M., & Zaslavsky, E. (2009). M are better than one: an ensemble-based
motif finder and its application to regulatory element prediction. Bioinformatics,
Vol. 25, No. 7, pp. 868-74.
Yellaboina, S., Seshadri, J., Kumar, M. S., & Ranjan, A. (2004). PredictRegulon: a web server
for the prediction of the regulatory protein binding sites and operons in prokaryote
genomes. Nucleic acids research, Vol. 32, No. Web Server issue, pp. W318-20.
Yoshida, T., Qin, L., Egger, L. A., & Inouye, M. (2006). Transcription regulation of ompF and
ompC by a single transcription factor, OmpR. The Journal of Biological Chemistry,
Vol. 281, No. 25, pp. 17114-23.
Zaslavsky, E. & Singh, M. (2006). A combinatorial optimization approach for diverse motif
finding applications. Algorithms Mol Biol, Vol. 1, pp. 13.
Zhang, S., Xu, M., Li, S., & Su, Z. (2009). Genome-wide de novo prediction of cis-regulatory
binding sites in prokaryotes. Nucleic Acids Res, Vol. 37, No. 10, pp. e72.
Zhou, Q. & Liu, J. S. (2004). Modeling within-motif dependence for transcription factor
binding site predictions. Bioinformatics, Vol. 20, No. 6, pp. 909-16.
4
Understanding LiP Promoters from

Phanerochaete chrysosporium:
A Bioinformatic Analysis
Sergio Lobos1, Rubn Polanco2, Mario Tello3, Dan Cullen4,
Daniela Seelenfreund1 and Rafael Vicua5
1Laboratorio de Bioqumica, Departamento de Bioqumica y Biologa Molecular, Facultad
de Ciencias Qumicas y Farmacuticas, Universidad de Chile
2Escuela de Bioqumica, Facultad de Ciencias Biolgicas, Universidad Andrs Bello
3 Centro de Biotecnologa Acucola, Universidad de Santiago de Chile.
4USDA Forest Service, Forest Products Laboratory, Madison, WI 53726,
5 Departamento de Gentica Molecular y Microbiologa, Facultad de
Ciencias Biolgicas, Pontificia Universidad Catlica de Chile and

Millennium Institute for Fundamental and Applied Biology
1,2,3,5Chile
4USA
1. Introduction
DNA contains the coding information for the entire set of proteins produced by an
organism. The specific combination of proteins synthesized varies with developmental,
metabolic and environmental circumstances. This variation is generated by regulatory
mechanisms that direct the production of messenger ribonucleic acid (mRNA) and
subsequent translation of the nucleotide sequence into amino acid sequences, among other
fundamental processes including post-translational modifications. A major step of gene
expression regulation is the control of transcription initiation by RNA polymerase II.
Control systems that modulate mRNA synthesis are based on the specific recognition and
interaction of proteins with cognate sites on the DNA. The complex network of DNA-
protein and protein-protein interactions determines the degree of transcription of a specific
sequence and defines particular expression patterns. Ultimately, the outcome of this net of
interactions provides the finely-tuned response to internal clues and environmental signals
(Matthews, 1992).
Understanding gene expression in complex organisms such as eukaryotes is one of the most
important challenges of molecular biology. One of the most fundamental and unanswered
questions is whether adaptative evolution proceeds through changes in protein-coding
DNA sequences or through non-coding regulatory sequences. It has been argued that
morphological change occurs mainly via non-coding changes (Haygood et al., 2010). Diptera
studies showed that cis-regulatory sequences that control transcription are a common source
of divergent protein expression patterns and thus of phenotypic change (Wittkopp, 2006).
Also, recent analyses of the human genome suggest a distinctive role for adaptative changes
both in coding and non-coding sequences. Changes in non-coding sequences appear
primarily related to changes in neural development (Haygood et al., 2010).
The last decade has witnessed an explosion of studies showing that the complex regulation
of gene expression is mainly modulated by the manifold interactions between transcription
factors (TFs) with their corresponding transcription factors binding sites (TFBSs) on DNA
(Wei & Yu, 2007). These regulatory elements are either located proximally, in sequences
upstream of the transcription start site, which are generically known as promoters, or more
distantly, in sequences known as enhancers or silencers. Cis-regulatory elements are
information processing units that are embedded in genomic DNA and which regulate gene
expression. Most commonly, these cis-regulatory elements or modules are a few dozens to
several hundred base pairs long and are comprised of multiple binding sites for
transcription factors. On average, a module will have binding sites for different
transcription factors and for some factors, more than one site may be present (Howard &
Davidson, 2004). To date, cis-regulatory modules of some Drosophila genes have been
characterized at the target site level, providing an explanation of how these sequences and
gene network architectures control development in early dipteran embryos (Howard &
Davidson, 2004). Modules have also been denominated motifs by many authors, and this
is the nomenclature we will use throughout this work. Knowledge of the cis-regulatory
elements or motifs of many genes from different species may offer insight into how these
sequences control the building of the diverse structures and functional adaptations found in
living organisms.
As is well known, transcription involves the binding of proteins to several sites on a
promoter sequence, and in eukaryotes the action of transcription factors over long distances
seems to be the rule. Transcriptional outcome can be influenced by cooperative interactions
of proteins between adjacent or distant sites, mainly through the formation of DNA loops,
as has been described profusely in both prokaryotic and eukaryotic organisms (Han et al.,
2009; Matthews, 1992; Schleif, 1992). The property of DNA to form loops enhances the
regulatory properties of proteins and expands the flexibility of systems in responding to
signals that evoke cellular change.
In order to understand the functional organization of a eukaryotic promoter, in this study
we used the well-studied ligninolytic fungal species Phanerochaete chrysosporium, and
examined the promoters from a selected gene family. P. chrysosporium has been used as a
model system in numerous studies for its production of lignin-degrading enzymes (Singh &
Chen, 2008). Cellulose and lignin constitute the most abundant forms of organic carbon and
their degradation and mineralization is a fundamental step in the carbon cycle of the
biosphere. The use of lignocellulosic biomass depends on either the removal or disruption of
lignin by a process that can include the activity of lignin- and manganese-dependent
peroxidases in order to expose the cellulose polymer to the attack of cellulolytic enzymes.
Therefore, an understanding of the regulatory mechanisms that underlie the production of
these enzymes is of pivotal importance both for a deeper comprehension of the crucial
process of maintenance of the carbon cycle in nature and for the production of bioenergy.
Additionally, lignocellulosic wastes are produced in large amounts and efforts have been
made to convert these residues into valuable products such as biofuels, chemicals and
animal feed (Dashtban et al., 2009). This bioconversion usually requires a multistep process
involving a pretreatment (mechanical, chemical or biological) and hydrolysis to produce
readily metabolyzable molecules such as hexoses and pentoses (Snchez, 2009).
Understanding LiP Promoters from Phanerochaete chrysosporium: A Bioinformatic Analysis 59
Pretreatment of lignocellulosic residues is necessary because hydrolysis of non-pretreated

material is slow and results in low yield (Dashtban et al., 2009). It has been reported that the
use of P. chrysosporium is advantageous for pretreatment of cotton stalks in an energy-
saving, low cost and environmentally friendly approach that can reduce chemical
pretreatments (Shi et al., 2009). Reported recovery depended on culture conditions, either
agitated or shallow stationary submerged. Although agitated cultivation resulted in better
delignification, pretreatment under submerged shallow stationary conditions provides a
better balance between lignin degradation and carbohydrate availability (Shi et al., 2009).
Interestingly, under solid-state cultivation, higher cellulolytic but not ligninase activity was
associated with Mn2+ addition, although the initial purpose of supplementing Mn2+ was to
improve ligninase activities and lignin degradation (Shi et al., 2008). This fungus has also
shown promising results in wood biopulping (Singh et al., 2010) and soil bioremediation
(Jiang et al., 2006). Hence, optimization of these biotechnological processes can also profit
from a deeper understanding of the fundamental process of gene transcription.
Woodrotting fungi include white-rot basidiomycetes, brown-rot basidiomycetes, and soft-
rot ascomycetes/deuteromycetes; however, only a small group of these are able to
completely degrade lignin to carbon dioxide and thereby gain access to the carbohydrate
polymers of plant cell walls, which they use as carbon and energy sources. Selective
degradation of lignin by these fungi leaves behind crystalline cellulose with a bleached
appearance that is often referred to as "white rot" (Martnez et al., 2004). Some or all of these
enzymes and their isozymes of the lignin depolymerization system include multiple
isozymes of lignin peroxidase (LiP) and manganese-dependent peroxidase (MnP) (Kirk &
Farrell, 1987; Farrell et al., 1989; Singh & Chen, 2008). Among the ligninolytic fungi, P.
chrysosporium is considered as a model organism for the development and understanding of
the ligninolytic-enzyme-production system, as it can produce a more complete ligninolytic
enzyme complex than most other species (Kirk & Farrell, 1987) and until recently, it was the
only ligninolytic fungus whose genome has been sequenced (Martnez et al., 2004). In P.
chrysosporium, LiPs together with MnPs and H2O2-producing enzymes constitute the major
components of the lignin-degrading system that are secreted to the extracellular medium
(Kirk & Farrell, 1987; Farrell et al., 1989; Kirk et al., 1990).
The characterization of ligninolytic enzyme systems of several basidiomycetes has revealed
that in some species LiP activity is not observed. For example, in the white rot fungus
Phanerochaete sordida only MnP activity, but no lignin peroxidase or laccase activity was
detected, although several culture conditions were assayed. In this species, three highly
similar MnP isoenzymes were identified (Rttimann-Johnson et al., 1994). The white-rot
basidiomycete Ceriporiopsis subvermispora produces two families of ligninolytic enzymes,
MnPs and laccases (Lobos et al., 1994), but lignin peroxidase activity is not detected
(Rajakumar et al., 1996). In Ganoderma lucidum low levels of MnP activity are detected in
some culture media, but not in others and no LiP activity was seen in any of the media
tested (DSouza et al., 1999).
The genome of P. chrysosporium contains a large group of genes coding for lowredox
peroxidases (LRP), including 10 lip genes, 5 genes coding for MnPs, 4 genes encoding
multicopper copper oxidases (related to laccases) and an interesting peroxidase gene
unlinked to all peroxidases, that shares residues common to both MnPs and LiPs (Martnez
et al., 2004). Other white rot fungi, such as C. subvermispora (Rajakumar et al., 1996) and G.
lucidum (DSouza et al., 1999) also contain lip-like genes, but as described above, do not
exhibit detectable LiP activity.
The recent genome sequencing of a second basidiomycete, the brown-rot fungus Postia
placenta, yielded exciting novelties: genes encoding the class II secretory peroxidases LiP,
MnP and versatile peroxidase were not detected in the P. placenta genome (Martnez et al.,
2009). This fungus contains only one LRP gene that is not closely related to LiP and MnP,
but is part of an assemblage of basal peroxidases that includes the novel peroxidase (NoP)
of P. chrysosporium (Martnez et al., 2009). Comparison of the P. placenta and P. chrysosporium
genomes indicates that the derivation of brown-rot is characterized largely by the
contraction or loss of multiple gene families that are thought to be important in typical
white-rot, such as cellulases, LiPs, MnPs, copper radical oxidases, among other enzymes.
Phylogenetic analysis suggests that LiP and MnP gene lineages of P. chrysosporium were
independently derived from the basal peroxidases before the divergence of Postia and
Phanerochaete. If so, then the absence of LiP and MnP in P. placenta may reflect instances of
gene loss (Martnez et al., 2009). This general pattern of simplification is consistent with the
view that brown-rot fungi, having evolved novel mechanisms for initiating cellulose
depolymerization, have cast off much of the energetically costly lignocellulose-degrading
apparatus that is retained in white-rot fungi, such as P. chrysosporium (Martnez et al., 2009).
LiPs from P. chrysosporium are encoded by ten structurally related genes (Stewart & Cullen,
1999). The genomic organization of the lip genes that encode these isoenzymes is known:
four genes (lipA, lipB, lipC and lipE) reside within a 35 Kb region and the remaining genes
(lipG, lipH, lipI and lipJ) lie within a 15 Kb region, forming clusters where six genes occur in
pairs that are transcriptionally convergent (Stewart & Cullen, 1999). The transcriptional
orientation and intergenic distances indicate that regulatory promoter sequences are not
shared among any of the lip genes. Lip genes have been classified by their deduced amino
acid sequences and also by their intron/exon structure (Stewart & Cullen, 1999). The
phylogenetic clustering defines a major subfamily I of six genes (lipA, lipB, lipE, lipG, lipH
and lipI) and four minor subfamilies of only one member each (lipC, lipD, lipF and lipJ)
(Stewart & Cullen, 1999).
Although the lip genes are structurally related and the proteins participate in a common
physiological process, lip promoter sequences display no obvious similarities, suggesting
differential gene expression of this family of isozymes. Indeed, the relative transcriptional
activity of these genes has been assessed systematically, showing differential regulation in
response to carbon (C)-limited or nitrogen (N)-limited culture media (Stewart & Cullen,
1999). Recently, it was shown that over a hundred proteins that are secreted by P.
chrysosporium exhibited increased transcription in either C- or N-limited relative to nutrient
replete medium, including LiP and MnP expression (Wymelenberg et al., 2009). In another
study, similar expression patterns of secreted proteins between cellulose-grown and wood-
grown cultures were found (Sato et al., 2007), but this study showed the complication of
considering wood as a nutrient, since it is both N-limited and C-replete. In addition to
enzymes which act on lignocelluloses, proteases were found, suggesting the ability to
generate nitrogen (Sato et al., 2007); depletion of nitrogen triggers the onset of secondary
metabolism. Metabolic switching occurs in culture after 48 hours when linear growth ceases.
After 72 hours, P. chrysosporium has shifted to secondary metabolism, its beginning being
closely related to the appearance of LiP activity (Wu & Zhang, 2010). The complex
expression pattern of lip genes suggests that each isozyme might play a specific biological
role in the process of ligninolysis, though why there is a multiplicity of lignin peroxidases
remains unclear (Farrell et al., 1989; Stewart & Cullen, 1999; Sato et al., 2007). This long
standing question is especially intriguing and paradoxical, since LiPs are lowredox
enzymes that catalyze a unique nonspecific enzymatic combustion, i.e. susceptible

aromatic substrate molecules are oxidized by one electron and this produces unstable cation
radicals which then undergo a variety of nonenzymatic reactions (Kirk & Farrell, 1987). The
answer to this fundamental issue is still a matter of debate and it is speculated that an array
of different genes may provide the necessary plasticity to the fungus to attack diverse types
of lignin, its recalcitrant carbon and energy source, under various biotic and abiotic
conditions.
The isoenzyme family of LiP proteins from P. chrysosporium provides an interesting model
for analyzing the evolution of promoters and their coding sequences. The identification of
characteristic features regulating the main genes involved in lignin biodegradation, as well
as others that are co-regulated, can both provide a more complete understanding of
promoter organization and be used to identify novel genes involved in ligninolysis through
bioinformaticsbased searches. In this study, both bioinformatic tools and experimental data
were used to explore if the structure of promoter organization is related to the phylogenetic
grouping of the LiP proteins. A motif is a pattern common to a set of nucleic acid
subsequences which share some biological property of interest, such as being a DNA binding
site for a regulatory protein. It was expected that these motifs would provide information
about the regulatory factors that control gene expression and identify transcription factors
that bind to the motifs. The main goal was to analyze the structural organization of the
promoters of the lip gene family and determine if there exists an organization of TFBSs
and/or some kind of structured assembly of cis-regulatory elements or motifs within their
promoter sequences. The promoter structures were compared with reported data on the
differential regulation, transcription and phylogenetic analysis of the LiP proteins. To our
knowledge, no reports exist where bioinformatic data has been correlated with the
expression of a family of isoenzymes in filamentous fungi. The working hypothesis of this
study was to establish if genes involved in the same biological process have promoters that
share structural characteristics, although these common structural elements may not be
evident. In this case, it should be possible detect a common architecture using appropriate
bioinformatics tools in order to identify motif patterns that contain functional TFBSs.
2. Method and results

2.1 Analysis of promoters from lignin peroxidase genes
2.1.1 Alignment of promoter sequences reveals a similar pattern to lip gene clustering
We first analyzed 1 Kb of the available promoter sequences of the ten lip genes using the
ClustalW (Thompson et al., 1994) and the Jotun Hein algorithms (Hein, 1990) from the
DNAStar software (Figure 1). Due to lack of information about the transcriptional start sites
of the lip genes from P. chrysosporium, we first analyzed 1 Kb of the available region located
upstream of the translational start site, since it was highly probable that promoter sequences
were included. We tested two alignment algorithms: one was the Needleman-Wunsch
algorithm present in ClustalW, which does not presume an evolutionary relationship
between the analyzed sequences. The second was the Jotun Hein algorithm, a Markov chain
algorithm that presumes an evolutionary relationship between the sequences to be
analyzed. ClustalW was performed using BLOSUM62 matrix. The algorithms were used
through the PC interphase provided by the DNASTART software. When using the Jotun
Hein algorithm, a clustering of the promoters belonging to the subfamily I lip genes
appeared (i.e. lipA, lipB, lipE, lipG, lipH and lipI), that is similar to the relationship between
the protein sequences (Stewart & Cullen, 1999). Cladistic analysis based on promoter
sequences showed two main branches within the family. The main branch included all but
one of the promoter sequences of the lip family I, conformed by lipA, lipB, lipE, lipG, lipH and
lipI. The sole exception was lipH, which appeared more closely linked to the lipF promoter
sequence. The sequences corresponding to the promoters of lipD, lipC and lipJ, which
comprise the subfamilies II, III and V, respectively, were more divergent. This grouping was
also apparent when the ClustalW analysis was repeated using 2 Kb of all promoter
sequences. Both algorithms were able to detect an evolutionary relationship between
upstream regions of the lip genes, but the Jotun Hein algorithm was more sensitive to detect
this relation. The fact that very similar results were obtained using two different algorithms,
suggests that this association is not spurious and supports the finding of a common
organization of the analyzed sequences. Jotun-Hein was also used because it had been
employed for analysis of the LiP proteins (Stewart & Cullen, 1999).
Fig. 1. Cladistic analysis of 1 Kb promoter sequences of 10 lip (lignin peroxidase) genes from
Phanerochaete chrysosporium. Each sequence in the analysis corresponds to 1 Kb upstream of
the ATG codon. Analysis was performed with the Jotun-Hein (Hein, 1990) algorithm on
LASERGENE package software.
When the Clustal analysis included only the six promoter sequences of the genes belonging
to the subfamily I of lip genes, a similar order appeared where lipH again corresponded to
the most distant member of the group (Figure 2).
Fig. 2. Cladistic analysis of 1 Kb of six lip promoters corresponding to the Subfamily I

classification from Phanerochaete chrysosporium. Each sequence in the analysis corresponds to
1 Kb upstream of the ATG codon. Analysis was done with the ClustalW (Thompson et al.,
1994) algorithm on DNAStar software.
2.1.2 Defining an ATG upstream region for analysis

We then analyzed the available ATG upstream region of the ten lip genes using the
Genomatix bioinformatics tool that searches conserved cis-regulatory elements within
TRANSFAC and JASPAR databases. It is not possible to precisely define promoter

sequences, as the transcription start site is unknown in this case and it is not easy in general
to define how far upstream distal sequences control gene expression. Therefore, sequences
upstream of the ATG of 500, 1000 and 2000 bp were analyzed for the presence of conserved
cis-regulatory elements or TFBSs. With this tool, a multiplicity of elements was evident;
however, no clear pattern of structural organization emerged. Thus, a more sophisticated
method to find sequence patterns was needed. Among programs that perform this kind of
analysis, MEME (Multiple Expectation maximization for Motif Elicitation) and Gibbs are
two well-documented programs for this purpose. We chose MEME because the algorithm
for maximation of Multiple Expectation allows defining more clearly a motif pattern
independent of its position in the sequence. On the other hand, TRANSFAC and JASPAR
allow the identification of putative binding sites only for known transcription factors, but do
not find new regulatory elements, especially in organisms that have not been extensively
studied. When upstream sequences (500, 1000 and 2000 bp) were analyzed using MEME
software, a pattern of elements emerged that split the lip promoters into two groups, where
the genes of one group again corresponded to the members of subfamily I of lip genes. This
separation was subtle when analyzing 500 bp or 2000 bp of the promoter sequence but was
more evident when analyzing 1000 bp of the regulatory sequences. An additional reason for
choosing 1 Kb ATG upstream sequences for analysis is that, as explained above,
transcriptional outcome can be influenced by cooperative interactions of proteins, mainly
through the formation of DNA loops. This looping depends on the probability of two sites
coming together, which is optimal for cyclization at 500 bp and decreases at distances
greater than 1000 bp (Matthews, 1992). For these reasons, a promoter size of 1000 bp was
chosen for further studies.
2.2 Analytical strategy to identify regulatory elements

The next step consisted of applying a set of analytical tools to identify putative regulatory
elements within the lip gene family. In a step-wise strategy, first putative motifs were
identified with MEME; then, for each motif, integrated databases were searched for genes
that contained these motifs in their promoters with the MAST software. Briefly, MAST takes
any motif and transforms it into a position-dependent scoring matrix that is used to scan a
curated database of promoter sequences. Finally, to identify if this sequence corresponds to
a transcriptional binding site, the best match obtained in the yeast database is used by
MAST to screen a transcription factors database in order to identify the TF that recognizes
the yeast sequence with the motif identified by MEME. The database used for this purpose
was YEASTEXTRACT. To summarize, a general streamlined approach was defined to
identify a putatively functional structure in eukaryotic promoters, as outlined in Figure 3.
The flowchart shows the pathway for the identification of putative motifs, TFBSs and
transcription factors involved in the expression of genes containing such motifs. With this
analysis, five conserved motifs were identified and characterized in the promoters of lip
genes from P. chrysosporium.
2.2.1 Discovery of motifs within promoters

The search for signals within the DNA sequence was carried out using MEME (Multiple EM
for Motif Elicitation), a tool that was designed to discover signals (called motifs) within a set
of sequences believed to share some common (but unknown) property, such as binding sites
FASTA FLAT FILES

PROMOTER SEQUENCES
1 Kb upstream ATG
MEME
ZOOPS Analysis
w50-300
Motif Discovery
LOGO & Regular Expression Sequence
MAST
S. cerevisiae upstream
sequences Database
Best possible match Group of Genes

sequence strand +/- S. cerevisiae
YEASTRACT
DATABASE
Yeastract - Discoverer
GENES GROUPs TFBS search inside TF search on Motifs

by GO on Motifs Documented (one subst)
Biological Process
Molecular Function SGD Site Map
Cellular Component TF classification
Fig. 3. Flowchart for identifying and testing putative motifs and transcription factors
involved in gene expression of lip genes. Algorithms used at each stage are discussed in the
text.
for shared transcription factors or TFBSs in a set of promoters (Bailey et al., 2006).
Expectation-maximization (EM) algorithm is a method for finding maximum likelihood or
maximum a posteriori estimates of parameters in statistical models, where the model
depends on unobserved latent variables. EM is an iterative method which alternates
between performing an expectation (E) step, which computes the expectation of the log-
likelihood evaluated using the current estimate for the latent variables, and a maximization
(M) step, which computes parameters maximizing the expected log-likelihood found on the
E step. These parameter-estimates are then used to determine the distribution of the latent
variables in the next E step (Dempster et al., 1977). By default, MEME assumes that every
position in every sequence is equally likely a priori to be a motif site and can search for DNA
motifs on either strand (Bailey et al., 2010). MEME finds motifs by identifying highly
correlated stretches of letters in the input sequences and applies statistical models to
validate the most significant motifs contained in these input sequences. Finally, it reports an
E-value for each motif, giving a measure of the motifs validity or likelihood of not being a
random sequence artifact (Bailey & Elkan, 1994). MEME can be accessed at the web server
hosted at the http://meme.ncbr.net site and is preferentially set for searching motifs within
sequences of 1 Kb (Bailey et al., 2006).
A TFBS is defined as a conserved, relatively short sequence element of 10-15 bp (Stepanova
et al., 2005). Since TFBSs tend to be short and degenerate, the discovery of these sequences is
a difficult task. The motif discovery algorithm searches for a minimum of two elements of
similar short sequences of at least 6 bp; these motifs are searched within sliding window
frames of 6 to 300 bp of width (Bailey et al., 2006). We therefore searched for motifs
performing a serial analysis using 15-300, 20-300, 50-300, 100-300, 150-300, 200-300, 250-300
and 300-300 bp frames. The analysis was performed for all 10 lip promoters and showed a
conserved pattern of motifs (Figure 4). This analysis produced a readily apparent structural
organization of the lip genes. The motifs were most clearly noticeable with frames 15-300,
20-300 and 50-300 bp and declined with wider frames. For this reason, all further analyses
were performed using the 50-300 bp window frame.
Fig. 4. The 5 most conserved motifs of the lip genes promoters. Maximum number of motifs:
5; windows for each motif from 50 to 300 bp. All other parameters of the MEME software
corresponded to the default setting.
MEME analysis was performed using FASTA flat-files. Files containing 1 Kb of the promoter
sequence from each of the 10 genes were aligned and searched for motifs with ZOOPS (Zero
Or One Per Sequence) analysis. A pattern of five motifs emerged, which also corresponds to
the maximum number of motifs allowed when using a 50-300 bp window frame (Figure 4).
As a control, the same analysis was conducted with the promoter sequences from the
subfamily I genes; when only the six promoters of the subfamily I genes were aligned, a
most striking pattern of motifs emerged. Using 6-300, 20-300, 50-300 and 100-300 bp frames
maintained the conspicuous pattern of five motifs that clearly indicated again a conserved
organization of all six members of the subfamily I lip genes (Figure 5).
Fig. 5. Summary of the 5 most conserved motifs of the subfamily I of lip genes promoters.
Maximum number of motifs: 5; windows per each motif from 50 to 300 bp. All other
parameters of the MEME software were the default setting.
Analysis was also done using the 50-300 bp window frame or motif width window (number
of characters in the sequence pattern), since the five motifs obtained presented significant E-
values ranging from e-018 to e-003, which also corresponded to the best E-values of all
analyzed sliding windows. Cut off E-values were set at e-003. The obtained motifs
corresponded to ambiguous regular expression (LOGO) sequences of 50 to 92 bp for the five
motifs identified in the subfamily I lip promoters and between 50 and 94 bp for the
promoters of the ten lip genes using the MEME algorithm. To determine if the motifs found
were statistically significant, the sequences were shuffled and compared to the former
(training) set. Analysis of the shuffled sequences revealed that the observed motifs and the
statistical significance were lost. Therefore, the structuring found in the promoter sequences
was not trivial and possibly corresponds to a functional organization.
2.2.2 Analysis of motifs using MAST

In order to illustrate the effectiveness of the proposed strategy, as outlined in the flow sheet
shown in Figure 3, analysis of the promoters of the subfamily I lip genes is described. The
next step consisted in analyzing MEME results (LOGO) and regular expression sequences
for the five motifs using MAST (Motif Alignment and Search Tool), which searches
promoter motifs (best possible matches) in wide upstream sequences available in different
databases. As mentioned before, MAST uses a position-dependent scoring matrix to search
in a sequence for a segment with the best match. To perform this, MAST transforms any
sequence pattern (motif) into a position-dependent scoring matrix. This means that a
position-dependent scoring matrix is not applied to the end of a sequence or if any gap is
present. The sequences are ranked according to their E-values. MAST searches databases for
sequences that match the motifs and outputs detailed annotation showing genes that
contain these motifs (Bailey & Gribskov, 1998) (Figure 6).
The findings of MAST in a particular upstream sequence database allowed obtaining a
group of genes containing particular motifs in their promoters. The most comprehensive
eukaryotic promoter databases are human, Drosophila and mouse; however, considering the
relative phylogenetic closeness to the model fungal species P. chrysosporium, a yeast
database was used for the analysis. The Saccharomyces cerevisiae genome database (SGD) is a
repository of organized collection of yeast proteins and genes and their corresponding
regulatory sequences and is probably the most appropriate database available today for
fungal species. Using the SGD, the best possible match was found for motifs on either strand
of each promoter. The obtained matches corresponded to defined and unambiguous
sequences for the five motifs identified using the MEME algorithm. Sequences were
subjected to MAST analysis for each separate motif and were also analyzed when combined.
The best combined matches were found for these five motifs with varying E-values: motifs
1, 2 and 3 exhibited E-values of e-005, motifs 4 and 5 presented values of e-003 and e-002,
respectively. The number of genes that contained the identified motifs that contained the
identified motifs varied from five for motif 1, to 14 or 16 genes for motifs 2, 3 and 4 and
enlarged to 23 genes for motif 5 (Table 1).
2.2.3 Analysis of conserved TFBSs inside each motif

Once the yeast genes that share the motif found in ATG upstream sequences of lip genes
were obtained, transcriptional factors that bind to these sequences were analyzed with
Motif 1. E-value: 1.8e-019; Width:92
Motif 2. E-value: 1.2e-008; Width: 90
Fig. 6. LOGO representation of Motifs 1 to 5 from promoter sequences of the subfamily I lip
genes.
YEASTRACT-DISCOVERER (YEAst Search for Transcriptional Regulators And Consensus
Tracking; http://www.yeastract.com), a tool developed to support the analysis of transcription
regulatory associations in yeast which can be used to identify complex motifs over-represented
in promoter regions of co-regulated genes (Monteiro et al., 2008). This database contains over
48.000 documented regulatory associations between transcription factors (TFs) and target genes
(Abdulrehman et al., 2011), and includes 284 specific DNA binding sites for 108 characterized TFs
(Monteiro et al., 2008). To identify TFBS inside of the motifs, Yeastract uses the SmithWaterman
algorithm that allows local alignments between sequences (Smith & Waterman, 1981). The
pattern matching method of YEASTRACT in search of TFBSs leads to the identification of
putative target genes for specific TFs (Monteiro et al., 2008). The SGD database was therefore
used to find yeast genes containing the motifs identified within the promoter sequences of the six
genes of the subfamily I lip genes from P. chrysosporium.
For each motif (1 to 5), a list of yeast genes was identified. The genes that contained one of
these motifs in their promoter sequence and that are included in the YEASTRACT database
were further analyzed. Each gene was queried using the SGD and finally searched with GO
(Gene Onthology) and its nature determined according to three defined categories:
Biological process, molecular function and cellular component (Table 2).
Motifs 1-5 Subfamily I Group of Genes

Motif 1 (+)|(-) Motif 2 (+)|(-) Motif 3 (+)|(-) Motif 4 (+)|(-) Motif 5 (+)|(-)
Evalue: 1e-05 Evalue: 1e-05 Evalue: 1e-05 Evalue: 1e-03 Evalue: 1e-02
YGR209C|TRX2 YHR135C|YCK1 YOL132W|GAS4 YLR194C|YLR194C YFR021W|ATG18
YLR173W|YLR173W YPL069C|BTS1 YOR034C- YJL006C|CTK2 YGR098C|ESP1
YPR094W|RDS3 YDR101C|ARX1 A|YOR034C-A YDL174C|DLD1 YCR084C|TUP1
YLR246W|ERF2 YKL085W|MDH1 YDR477W|SNF1 YDL173W|YDL173W YCR086W|CSM1
YIR042C|YIR042C YGL047W|ALG13 YPR181C|SEC23 YKL020C|SPT23 YKR024C|DBP7
YER039C- YPR182W|SMX3 YKL019W|RAM2 YKR025W|RPC37
A|YER039C-A YDR059C|UBC5 TS(CGA)C|SUP61 YLR327C|TMA10
YER040W|GLN3 YDR060W|MAK21 YML123C|PHO84 TS(GCU)L|TS(GCU)L
YGL186C|TPN1 YHR112C|YHR112C YML121W|GTR1 TG(GCC)P2|TG(GCC)P2
YIL071C|PCI8 YHR113W|YHR113W YML028W|TSA1 TY(GUA)F2|SUP6
YER038C|KRE29 YOL162W|YOL162W YBR170C|NPL4 YFR028C|CDC14
YJR148W|BAT2 YDR316W|OMS1 YNL033W|YNL033W YPL103C|FMP30
YBL066C|SEF1 YGR094W|VAS1 YBR268W|MRPL37 YPL101W|ELP4
YKL065C|YET1 YNL268W|LYP1 YLR297W|YLR297W YOR180C|DCI1
YKL064W|MNR2 YOR042W|CUE5 YOR181W|LAS17
YMR303C|ADH2 YDR178W|SDH4
YMR304W|UBP15 YOR140W|SFL1
YDL079C|MRK1
YCR076C|YCR076C
YKL041W|VPS24
TY(GUA)M1|SUP5
YBR068C|BAP2
YGR274C|TAF1
5 14 16 14 23
Table 1. Group of genes found in S. cerevisiae that share TFBSs found in Motifs 1 to 5.
The information of Cellular component for each gene was retrieved directly from the SGD
database for every individual gene identified in the previous step. YEASTRACT
simultaneously searches for TFBSs contained in each motif found and also searches for
documented TFs that bind to these motifs (See Figure 3). This approach reduces output to a
tractable size, amenable to different kinds of analysis (Table 2).
Putative functions of the identified genes suggest an interesting grouping: Motif 1 includes a
single gene (Trx2) involved in cellular response to oxidative stress that presents electron
carrier activity. It is noteworthy that the gene Trx2 corresponds to a cytoplasmic thioredoxin
isoenzyme that is present in fungal cell walls. Motif 2 is found mainly in genes related to
nitrogen metabolism and protein biosynthesis and appears to participate in biological
processes of cell aging. Several of these genes are involved in biosynthetic processes of
amino acids, amines and isoprenoids and also in the catabolism of amino acids. Motif 3
seems to be related to biological processes of cellular response to nitrogen and carbon
metabolism and possibly, growth and differentiation. Genes containing this motif are
involved in catabolic processes and cell aging, including cellular response to nitrogen
starvation and eventually fungal cell wall assembly. Motif 3 is the most proximal motif
identified and includes the TATA-box. This cis-element is conserved in all members of the
subfamily I lip genes and also in all members of the lip gene family (in Figure 4 it
corresponds to motif 4, the most proximal regulatory element for all genes, with the
exception of lipC). Indeed, the TATAbox is conserved in approximately 30% of all
eukaryotic genes (Mario-Ramrez et al., 2004) and therefore might correspond to an
ancestral regulatory feature. TATA element recognition has remained constant over the
course of evolution. Genes encoding TATA-binding proteins (TBPs) have been cloned from
organisms ranging from archaea to human and all share a phylogenetically conserved 180-
residue carboxyterminal or core segment, which supports all of the proteins biochemically
important functions in RNA Polymerase II transcription (Patikoglou et al., 1999). Motif 4 is
present in several genes that do not seem to relate to a common biological process.
However, one of these is an ion transporter. The finding of this motif in a gene coding for a
manganese/phosphate transporter is specially striking, since MnPs also participate in lignin
catabolism. This motif corresponds to the most distal element in the studied promoter (see
Figure 5). Motif 5 is related to mitosis, cell cycle, chromosome segregation and stress
response. The relevance of genes associated with each motif will be discussed below.
Since all genes analyzed were identified in the yeast database (SGD), an important
consideration was to determine if orthologous genes exist in the genome of P. chrysosporium.
A preliminary search in the genome of this basidiomicete (Martnez et al., 2004) indicated
that all genes shown in Table 2, with the exceptions of ARX1, MDH1, SPT23, GTR1 and
DLD1, are present in the P. chrysosporium genome.
Saccharomyces cerevisiae Genome Database

MAST AND
GO ANNOTATIONS
MEME YEASTRACT
ANALYSIS MOLECULAR CELLULAR
BIOLOGICAL PROCESS
FUNCTION COMPONENT
Cell redox homeostasis - cellular response
to oxidative stress
ER to Golgi vesicle-mediated transport
Retrograde vesicle-mediated transport,
MOTIF 1
Golgi to ER Disulfide Cytosol

YGR209C|TRX2
Vacuole fusion (non-autophagic) - oxidoreductase Fungal-type vacuole
vacuole inheritance
Protein deglutathionylation
Regulation of DNA replication
Sulfate assimilation
Branched chain family amino acid
Branched-chain-
biosynthetic process
YJR148W|BAT2 amino-acid No manually curated
Branched chain family amino acid
transaminase
catabolic process
Farnesyltranstra-
YPL069C|BTS1 Terpenoid biosynthetic process No manually curated
nsferase
Aerobic respiration - Tricarboxylic acid
cycle L-malate Mitochondrion -
MOTIF 2
YKL085W|MDH1
Chronological cell aging - Replicative cell dehydrogenase mitochondrial matrix
aging
Cytoplasm - Colocalizes
with cytosolic large
YDR101C|ARX1 Ribosomal large subunit biognesis Unknown
ribosomal subunit
Nucleoplasm
YBL066C|SEF1 Unknown Unknown Unknown
Sequence-specific
Nitrogen catabolite activation of
YER040W|GLN3 DNA binding Cytosol Nucleus
transcription
transcription factor
Amino acid catabolic process to alcohol

Alcohol
via Ehrlich pathway
YMR303C|ADH2 dehydrogenase No manually curated
Ethanol metabolic process Fermentation
(NAD) activity
NADH oxidation
Cellular response to nitrogen starvation
Invasive growth in response to glucose
limitation
Pseudohyphal growth AMP-activated protein
Regulation of carbohydrate metabolic kinase complex
process AMP-activated Cytoplasm
YDR477W|SNF1
Positive regulation of gluconeogenesis protein kinase activity Fungal-type vacuole
MOTIF 3
Biofilm formation - Cell adhesion Nuclear envelope lumen

Protein phosphorylation - Signal Nucleus
transduction
Negative regulation of translation
Replicative cell aging
U1 snRNP
U4/U6 x U5 tri-snRNP
YPR182W|SMX3 Nuclear mRNA splicing, via spliceosome Unknown
complex
U5 snRNP
Valine-tRNA ligase Cytoplasm
YGR094W|VAS1 Valyl-tRNA aminoacylation
activity Mitochondrion
1,3-Beta-
YOL132W|GAS4 Ascospore wall assembly Fungal-type cell wall
glucanosyltransferase
Fatty acid metabolic process
Integral to endoplasmic
Positive regulation of transcription from Transcription
YKL020C|SPT23 reticulum membrane
RNA polymerase II promoter activator activity
Nucleus
Response to cold
Cytoplasm -GSE
Chromatin silencing at telomere complex
Phosphate transport Late endosome
YML121W|GTR1 GDP / GTP binding
Transcription from RNA polymerase I / membrane
III promoters Nucleus - Vacuolar
membrane
MOTIF 4
Structural constituent Mitochondrial large

YBR268W|MRPL37 Mitochondrial translation
of ribosome ribosomal subunit
D-lactate Mitochondrial inner
Aerobic respiration
YDL174C|DLD1 dehydrogenase membrane
Cellular carbohydrate metabolic process
(cytochrome) activity Mitochondrion
Inorganic phosphate
transmembrane
Manganese ion transport
transporter activity Integral to plasma
YML123C|PHO84 Phosphate transport - Polyphosphate
Manganese ion membrane
metabolic process
transmembrane
transporter activity
Mitotic cell cycle
Nucleolus
Nucleolus organization Phosphoprotein
YFR028C|CDC14 RENT complex
Protein dephosphorylation phosphatase
Spindle pole body
Regulation of exit from mitosis
Apoptosis
MOTIF 5
Mitotic sister chromatid segregation

Cytoplasm
Negative regulation of protein Cysteine-type
YGR098C|ESP1 Nucleus
phosphatase type 2A activity endopeptidase
Spindle
Regulation of exit from mitosis
Regulation of mitotic spindle elongation
Cellular respiration Contributes to Mitochondrial
YDR178W|SDH4
Mitochondrial electron transport, succinate respiratory chain
succinate to ubiquinone dehydrogenase complex II

Tricarboxylic acid cycle (ubiquinone) activity
YOR180C|DCI1 Not clearly defined Not clearly defined Peroxisomal matrix
Actin cortical patch localization
Actin filament organization / actin
polymerization or depolymerization
Positive regulation of actin filament Cytoskeletal protein
YOR181W|LAS17 Actin cortical patch
bundle assembly binding
Bipolar cellular bud site selection
Cytokinesis Endocytosis
Response to osmotic stress
YOR140W|SFL1 Specific
transcriptional
repressor activity
MOTIF 5
Specific RNA
Negative regulation of transcription from
polymerase II Nuclear chromosome
RNA polymerase II promoter
activity
Transcription
activator activity
Ribosomal large subunit assembly ATP-dependent RNA
YKR024C|DBP7 Nucleolus
rRNA processing helicase activity
Protein phosphorylation Protein
YDL079C|MRK1 Regulation of protein catabolic process serine/threonine Unknown
Response to stress kinase activity
Chromatin binding
RNA polymerase II
Gene-specific transcription from RNA
activity
polymerase II promoter
Histone
General transcription from RNA Transcription factor
YGR274C|TAF1 acetyltransferase
polymerase II promoter TFIID complex
activity
RNA polymerase II transcriptional
Protein complex
preinitiation complex assembly
scaffold
TATA-binding
protein binding
Intralumenal vesicle formation
Late endosome to vacuole transport
Cytoplasm
YKL041W|VPS24 Ubiquitin-dependent protein catabolic Protein binding
ESCRT III complex
process via the multivesicular body
sorting pathway
Table 2. List of relevant genes obtained by YEASTRACT and grouped by motif. GO

classification is described for each gene.
2.2.4 Search of transcription factors that recognize TFBSs inside motifs

The YEASTRACT database also makes publicly available up-to-date information on
documented regulatory associations between TFs and DNA-binding sites in S. cerevisiae.
Information in this database has been curated on precise tests of the associations between
TFs and DNA-binding sites provided by experiments such as Chromatin
ImmunoPrecipitation (ChIP), ChIP-on-chip and Electrophoretic Mobility Shift Assay
(EMSA), that prove the direct binding of the TF to the target gene promoter region.
Alternatively, the effect on target-gene expression of the site-directed mutation of the TF
binding site in its promoter region was also considered by direct experimental evidence,
which strongly suggests that the TF interacts with that specific target (Abdulrehman et al.,
2011). Analysis of TFs that bind to TFBSs from genes listed in Table 2 was performed for
motifs 1 to 5. The TFs found to bind to motif 1 are shown in Table 3. The identified TFs are
mainly involved in the control of the cell cycle and unfolded protein response, and to a
lesser extent, in inter-organelle communication and energy metabolism. TFs that recognize
motifs 2-5 also include Ash1p, Hac1p and Mot3p. Strikingly, the transcription factor Stb5p,
an activator of multidrug resistance genes, binds to motifs 2, 4 and 5. Other TFs identified
are also involved in the regulation of energy metabolism and cell cycle. It is important to
point out that single base changes in the tested TFBSs dramatically increase the number of
putative TFs that bind to them, suggesting that the identified TFs are not likely to be chosen
randomly.
Transcription
Consensus Position Strand Protein Info
Factor
Target Sequence: Motif1_Subfamily I (size 92)
Transcription factor
that activates
that activates
expression of early
transcription of
G1-specific genes,
genes expressed at
localizes to daughter
the M/G1 phase
cell nuclei after
boundary and in G1
Ace2p, cytokinesis and delays
ACCAGC -19 R phase; localization
Swi5p G1 progression in
to the nucleus
daughters,
occurs during G1
localization is
and appears to be
regulated by
regulated by
phosphorylation;
phosphorylation by
potential Cdc28p
Cdc28p kinase
substrate
-87, -48 F Zinc-finger inhibitor of HO transcription;
mRNA is localized and translated in the
distal tip of anaphase cells, resulting in
Ash1p YTGAT
-68 R accumulation of Ash1p in daughter cell
nuclei and inhibition of HO expression;
potential Cdc28p substrate
bZIP transcription factor (ATF/CREB1
homolog) that regulates the unfolded
protein response, via UPRE binding, and
Hac1p CCAGC -20 R
membrane biogenesis; ER stress induced
splicing pathway utilizing Ire1p, Trl1p and
Ada5p facilitates efficient Hac1p synthesis
WAGGTA Nuclear transcription factor with two Cys2-
His2 zinc fingers; involved in repression of
a subset of hypoxic genes by Rox1p,
Mot3p -55 F
TAGGTA repression of several DAN/TIR genes
during aerobic growth, and repression of
ergosterol biosynthetic genes
Basic helix-loop-
helix-leucine zipper
(bHLH/Zip)
(bHLH) involved in
interorganelle
that forms a
communication
Rtg1p, Rtg3p GGTAC -22 F complex with
between
another bHLH/Zip
mitochondria,
protein, Rtg1p, to
peroxisomes, and
activate the
nucleus
retrograde (RTG)
and TOR pathways
Zinc-finger inhibitor of HO transcription;
mRNA is localized and translated in the
distal tip of anaphase cells, resulting in
Ash1p YTGAT -68 F
accumulation of Ash1p in daughter cell
nuclei and inhibition of HO expression;
potential Cdc28p substrate
bZIP transcription factor (ATF/CREB1
homolog) that regulates the unfolded
protein response, via UPRE binding, and
Hac1p CCAGC -1 R
membrane biogenesis; ER stressinduced
splicing pathway utilizing Ire1p, Trl1p and
Ada5p facilitates efficient Hac1p synthesis
-58 F Activator of multidrug resistance genes,
forms a heterodimer with Pdr1p; contains a
Zn(II)2Cys6 zinc finger domain that
Stb5p CGGNS
-56 R interacts with a PDRE (pleotropic drug
resistance element) in vitro; binds Sin3p in
a two-hybrid assay
Mot3p AAGGKA -62 F Described before
-25, -14 F
Stb5p CGGNS Described before
-18, -40 R
Putative zinc cluster protein of unknown
function; proposed to be involved in the
CGGNNNN
Gsm1p -25 F regulation of energy metabolism, based on
NNNNCGG
patterns of expression and sequence
analysis
Target Sequence: Motif5_SubfamilyI (size 63)
Transcriptional activator of genes involved
in glycolysis; DNA-binding protein that
Gcr1p CTTCC -56 R
interacts and functions with the
transcriptional activator Gcr2p
Mot3p CAGGYA -21 F Described before

Stb5p CGGNS -35 F Described before
Transcriptional repressor that binds to
promoter sequences of the cyclin genes,
CYS3, and SMF2; expression is induced by
Xbp1p CTCGA -51 F
stress or starvation during mitosis, and late
in meiosis; member of the Swi4p/Mbp1p
family; potential Cdc28p substrate
Table 3. Transcription factors that recognize TFBSs in Motifs 1 - 5.
The recognized consensus sequence, relative position and bound strand is indicated. For
each TF the protein information deposited in SGD and Yeastract is provided.
3. Discussion
This work was initiated as an attempt to understand and define the promoter structure of
the 10 lip genes from the ligninolytic basidiomycete P. chrysosporium, assuming that the
members of this family are co-regulated and have a common code for this particular
biological function. The first encouraging hint was the discovery of common TFBS
sequences which suggested a coordinated response to the various processes involved in
lignin biodegradation. Furthermore, the presence of a common organization might permit
the identification of additional genes in the P. chrysosporium genome that participate in
lignin degradation, on the basis that they received similar regulatory "inputs".
Multiple alignment of all lip promoters yielded short homologous sequences that included
experimentally validated TFBSs in other eukaryotic organisms, including yeast. These
results were very encouraging. Hoping to find that similar promoters would present
comparable physiological responses, transcriptional levels of lip genes of the fungus grown
in C- and N-limited cultures were examined. However, no clear correlation between
genomic organization and transcript levels was observed under these conditions. Analysis
of the 10 promoters using multiple programs and databases only showed scattered and
ambiguous (or degenerate) TFBSs and no clear structural organization emerged. The use of
MEME software represented a breakthrough, since it allowed finding sequences that share a
common (but hidden) property in conserved positions, which do not correspond to a priori
experimentally determined TFBSs (called Ab Initio). MEME detected the five relevant and
statistically significant motifs presented in this work. This is consistent with the group of six
lip genes with a highly conserved gene and protein structure, which had been previously
reported by Stewart and Cullen (1999). This finding suggested that the subfamily I lip genes
derived from several duplication events of an ancestral gene.
The next task consisted in determining if there is a common biological function associated to
each motif. For this, the sequence of each motif was analyzed in the YEASTRACT database
which identified yeast genes which also contained any of the five motifs within their
regulatory sequences. Indeed, one or more genes were found for each motif which
contained curated and experimentally validated TFBSs. How do these genes relate to the
biological process of lignin biodegradation? In order to answer this question, each motif was
analyzed.
Motif 1 included a single gene associated to the cellular response to oxidative stress. During
secretion of enzymes involved in the ligninolytic process, such as LiPs and MnPs, oxidative
stress is a natural condition of P. chrysosporium and resistance to oxidative stress is probably

an important function (Zacchi et al., 2000; Belinky et al., 2003; Jiang et al., 2005). To date
there is no clear evidence in the literature on the mechanisms used by P. chrysosporium to
tolerate the highly oxidative environment produced during lignin degradation. An
orthologue of the yeast TRX2 gene, which encodes a cytoplasmic thioredoxin isoenzyme,
could be involved in the protection of P. chrysosporium cells against oxidative and reductive
stress. Motif 1 is also related to the secretion of vesicles, which is fully consistent with the
manner in which these enzymes are carried into the extracellular medium.
Motif 2 is contained in several genes that do not share an obvious common function,
although most of them are related to nitrogen metabolism, the Krebs cycle and ribosomal
biogenesis. As is well known, LiPs are induced in response to low nitrogen and low carbon
conditions, which suggests that the cell might be increasing protein synthesis, a necessary
process for hyphal remodeling and growth.
Motif 3 is common to genes involved in cellular response to nitrogen and carbon
metabolism, including gluconeogenesis. Some genes containing this motif are involved in
the nitrogen cellular response to starvation and regulation of carbohydrate metabolic
processes. There is a partial overlap of biological functions (though not of genes) with Motif
2, however, other interesting biological processes also seem to be involved: invasive growth
in response to glucose limitation, which suggests remodeling of fungal cellular structures,
such as cell wall assembly. It is known that during the ligninolytic process, P. chrysosporium
apical tips of hyphae penetrate the wood through the tracheids and secrete ligninolytic
enzymes. The yeast gene YDR477W | SNF1 contains motif 3 in its promoter and encodes an
AMP-activated serine / threonine protein kinase, which is involved in signal transduction
and found in a complex with proteins required for the transcription of glucose-repressed
genes and involved in sporulation and peroxisome biogenesis. This gene might be related to
stress tolerance regulation and gene expression under low carbon conditions, as would
occur in secondary metabolism (ligninolysis), which is coupled to sporulation (structural
remodeling of the fungus) and possibly, peroxisome biogenesis.
Motif 4 is present in the promoter of two yeast genes described as ion transporters which are
of interest in relation to lignin biodegradation: genes YML121W | gtr1 and YML123C |
PHO84 are involved in phosphate transport, which is essential for nucleic acids synthesis,
and therefore also associated to cell cycle regulation, which in turn might be related to
hyphal growth. YML121W | gtr1 encodes a cytoplasmic GTP binding protein and negative
regulator of the Ran/Tc4 GTPase cycle; it is also a component of the GSE complex required
for sorting of Gap1p and is involved in phosphate transport and telomeric silencing, similar
to human Raga and Ragbir proteins. YML123C | PHO84 is a high-affinity inorganic
phosphate (Pi) and low-affinity manganese transporter. The latter is relevant in the context
ligninolysis since Mn+2 has a regulatory role in the formation of LiPs (Rabinovich et al.,
2004). Transport of this ion is important for the expression and activity of all kinds of
ligninolytic enzymes from P. chrysosporium. Motif 4 is the most distal motif identified in the
lip gene promoters. Due to its location on the promoter, it is tempting to speculate that this
motif might be involved in DNA looping.
Motif 5 appears to be related to mitosis, cell cycle, chromosome segregation and stress
response. The two yeast genes with motif 5 in their promoters and selected with the greatest
stringency by YEASTRACT, YFR028C | CDC14 and YGR098C | ESP1, are required for the
regulation of mitotic exit. This correlates well with active cell division that occurs in hyphae.
Other promoters which contain Motif 5, such as those from genes YDL079C | MRK1 (a
glycogen synthase kinase 3 (GSK-3)) homolog and YOR181W|LAS17 are stress responsive
genes. Finally, gene YGR274C | TAF1 (which encodes a TFIID subunit and is involved in
promoter binding and G1 / S progression) and gene YOR140W | SFL1 are RNA polymerase
II regulators. These functions appear to be complementary to those associated to the other
motifs.
How do these regulatory elements coordinate fungal metabolism in natural environments?
It is well known that filamentous fungi grow by apical extension and lateral branching to
form mycelial colonies (Richards et al., 2010). Because of key characteristics of hyphae,
filamentous fungi can efficiently colonize and exploit the substratum on which they grow,
e.g. wood (Weber, 2002). Fungal cells within a single mycelium are known to autolyse to
provide nutrients to ensure growth (Zacchi et al., 2000), involving processes related to the
remodeling of the mycelium. In fungi, vacuoles are very versatile organelles involved in
protein turnover, cellular homeostasis, membrane trafficking, signaling and nutrition (Veses
et al., 2008), as well as progression through cell cycle checkpoints (Richards et al., 2010).
Networks of spherical and tubular vacuoles have been found in a range of filamentous
fungi, including the wood rotting plant pathogen Phanerochaete velutina (Richards et al.,
2010). Under LiP producing conditions, hyphal cells undergo a major loss of cellular
ultrastructure, similar to that observed under oxidative stress (Zacchi et al., 2000). Therefore
LiPs may be enzymes that are induced under conditions of oxidative stress (Rabinovich et
al., 2004) and degrade lignin in order to access further carbon sources (Zacchi et al., 2000).
Taken together, many of the genes shown to contain any of these motifs have in common
that they regulate genes of relevance associated to the biological processes that occur during
lignin biodegradation. They include stress, mycelia remodeling which involves changes in
lipid and carbohydrate metabolism, and mitosis, that lead to organellar /ultrastructural
reorganization and changes related to the shift to secondary metabolism. In an analogous
manner, transcription factors that apparently recognize these motifs, also bind TFBSs of
genes involved in stress response and mitosis, among others (See Table 3).
4. Final remarks and conclusion

This work proposes an ordered and step by step approach for the analysis of the putative
structure of eukaryotic promoters. To test this strategy, the lip gene family from the
ligninolytic fungus P. chrysosporium was studied. The resulting analysis uncovered an
organization of TFBSs into structural motifs that is not evident using standard software. The
MEME software, which searches for signals that are shared by a group of sequences, was
instrumental to detect these hidden elements. Each of the discovered motifs contains several
TFBSs. One transcription factor may bind to various sites and hence it is speculated that the
TFBS pairs group into clusters, which may be bound by the same transcription factor.
Clusters with TATA-related and CAAT-related pairs have been reported (Ma et al., 2004).
Also, several TATA-box related triples have been described in the literature (Ma et al., 2004).
Each motif found in our analysis may represent this clustering of TFBSs and therefore may
correspond to the basic functional unit of a promoter. The functional promoter may then be
an organized sequence of motifs, as diagrammed in Figures 5 and 6. A simple sentence can
be envisioned as an analogy of this regulatory structure: a sentence containing an
instruction in any language corresponds to a meaningful sequence of words. The promoter
represents this sentence and each motif corresponds to one of the words. In turn, as each
word is composed by several syllables, each motif is built by combining several TFBSs. Just
as syllables, which contain several letters, isolated TFBSs contain several nucleotides and
may be present in more than one copy in a single word or appear in several different words
within the same sentence, but often do not have functional meaning on their own.
In conclusion, this work proposes an ordered and step by step approach for the analysis of
the putative structure of eukaryotic promoters. We devised a straightforward in silico
strategy that permits the identification of promoter structure in a set of related eukaryotic
genes. To test this strategy the lip gene family from the ligninolytic fungus P. chrysosporium
was studied. The resulting analysis uncovered an organization of TFBSs into structural
motifs (that are not evident using standard software) which are present in yeast genes and
transcription factors involved in diverse processes related to the biological context in which
ligninolysis is carried out. The structured motifs discovered in this study may represent a
functional organization of regulatory sequences. A future challenge will be to test other gene
families in order to determine if the proposed model is a general feature of eukaryotic
systems.
5. Acknowledgments
We wish to thank Dr. Roberta Farrell, Waikato University, New Zealand, for revision of the
manuscript.
6. References
Abdulrehman, D., Monteiro, P.T., Teixeira, M.C., Mira, N.P., Loureno, A.B., dos Santos,
S.C., Cabrito, T.R., Francisco, A.P., Madeira, S.C., Aires, R.S., Oliveira, A.L., S-
Correia, I. & Freitas, A.T. (January 2011). YEASTRACT: providing a programmatic
access to curated transcriptional regulatory associations in Saccharomyces cerevisiae
through a web services interface. Nucleic Acids Research, Vol. 39, No. (Database
issue, Epub 2010 Oct 23), pp. D136D140.
Bailey, T.L. & Elkan, C. (1994). Fitting a mixture model by expectation maximization to
discover motifs in biopolymers. Proceedings of the Second International Conference on
Intelligent Systems for Molecular Biology, pp. 28-36, AAAI Press, Menlo Park,
California, USA.
Bailey, T.L. & Gribskov, M. (1998). Combining evidence using p-values: application to
sequence homology searches. Bioinformatics. Vol. 14, pp. 48-54.
Bailey, T.L., Bodn, M., Whitington, T., & Machanick, P. (2010). The value of position-
specific priors in motif discovery using MEME. BMC Bioinformatics, Vol. 11 (April
2010), pp. 179.
Bailey, T.L., Williams, N. Misleh, C. & Li, W.W. (2006). MEME: discovering and analyzing
DNA and protein sequence motifs. Nucleic Acid Research, Vol. 34, No. WebServer
Issue, pp. W369-W373.
Belinky, P.A., Flikshtein, N., Lechenko, S., Gepstein, S., & Dosoretz, C.G. (2003). Reactive
oxygen species and induction of lignin peroxidase in Phanerochaete chrysosporium.
Applied and Environmental Microbiology. Vol. 69, No. 11 (November 2003), pp. 6500-
6506.
Dashtban, M., Schraft, H. & Qin, W. (2009). Fungal conversion of lignocellulosic residues;
opportunities & perspectives. International Journal of Biological Sciences, Vol. 5, No 6,
pp. 578-595.
Dempster, A.P., Laird, N.M. & Rubin, D.B. (1977). Maximum Likelihood from Incomplete
Data via the EM Algorithm. Journal of the Royal Statistical Society, Series B
(Methodological), Vol. 39, No. 1, pp. 138.
D'Souza, T.M., Merritt, C.S. & Reddy, C.A. (1999). Lignin-modifying enzymes of the white
rot basidiomycete Ganoderma lucidum. Applied and Environmental Microbiology, Vol.
65, No. 12, pp. 5307-5313.
Farrell, R.L., Murtach, K.B., Tien, M, Mozuch, M.D., & Kirk, T.K. (1989). Physical and
Enzymatic Properties of Lignin Peroxidase isoenzymes from Phanerochaete
chrysosporium. Enzyme Microbial Technology, Vol. 11, No. 6, pp. 322-28.
Han, L., Garcia, H.G., Blumberg, S., Towles, K.B., Beausang, J.F. & Phillips, R. (2009).
Concentration and length dependence of DNA looping in transcriptional regulation
Plos One, Vol. 4, No 5., pp. e5621.
Haygood, R., Babbitt, C.C., Fedrigo, O. & Wray, G.A. (2010). Contrasts between adaptative
coding and noncoding changes during human evolution. Proceedings of the National
Academy of Sciences. Vol. 107, No. 17 (May 2010), pp. 7853-7857.
Hein, J. (1990) Unified approach to alignment and phylogenies. Methods in Enzymology, Vol.
183, pp. 626-645, Academic Press, Inc. San Diego, California, USA.
Howard, M.L. & Davidson, E.H. (2004). Cis-Regulatory control circuits in development.
Developmental Biology, Vol. 271, No. 1, pp. 109-118.
Jiang, Q., Yan, Y.-H., Hu, G.-K. & Zhang, Y.-Z. (2005). Molecular cloning and
characterization of a peroxiredoxin from Phanerochaete chrysosporium. Cellular and
Molecular Biology Letters, Vol. 10, No. 4, pp. 659 668.
Jiang, X., Zeng, G., Huang, D., Chen, Y., Liu, F., Huang, G., Li, J., Xi, B. & Liu, H. (2006)
Remediation of pentachlorophenol-contaminated soil by composting with
immobilized Phanerochaete chrysosporium. World Journal of Microbiology and
Biotechnology, Vol. 22, No 9, pp. 909-913.
Kirk, T.K. & Farrell R.L. (1987). Enzymatic "combustion": the microbial degradation of
lignin. Annual Review of Microbiology, Vol. 41, pp. 465-505.
Kirk, T.K., Tien, M., Kersten, P., Kalyanaraman, B., Hammel, K., & Farrell, R.L. (1990).
Lignin Peroxidase from Fungi Phanerochaete chrysosporium. Methods of Enzymology,
Vol. 188, p. 159-171, Academic Press, Inc. San Diego, California, USA.
Lobos, S., Larran, J., Salas, L., Cullen, D. & Vicua, R. (1994). Isoenzymes of manganese-
dependent peroxidase and laccase produced by the lignin degrading basidiomycete
Ceriporiopsis subvermispora. Microbiology, Vol. 140, pp. 26912698.
Ma, X.-T., Qian, M.-P. & Tang H.-X. (2004). Predicting Polymerase II Core Promoters by
Cooperating Transcription Factor Binding Sites in Eukaryotic Genes. Acta
Biochimica et Biophysica Sinica, Vol. 36, No. 4, pp. 250258.
Mario-Ramrez, L., Spouge, J.L., Kanga, G.C. & Landsman, D. (2004). Statistical analysis of
over-represented words in human promoter sequences. Nucleic Acids Research, Vol.
32, No. 3, pp. 949-958.
Martnez, D., Larrondo, L.F., Sollewijn, G., Huang, K., Helfenbein, K.G., Ramaiya, P., Detter,
J.C., Larimer, F., Coutinho, P.M., Henrissat, B., Berka, R., Cullen, D., & Rokhsar, D.
(2004). Genome sequence of the lignocelluloses degrading fungus Phanerochaete

chrysosporium strain RP78. Nature Biotechnology, Vol. 22, pp. 695-700.
Martnez, D., Challacombe, J., Morgenstern, I., Hibbett, D., Schmoll, M., Kubicek, C.P.,
Ferreira, P., Ruiz-Duenase, F.J., Martinez, A.T., Kersten, P., Hammel, K.,
Wymelenbergg, A.V., Gaskell, J., Lindquist, E., Sabat, G., Splinter, S., BonDuranti,
Larrondo, L.F., Canessa, P., Vicua, R., Yadav, J., Doddapaneni, H., Subramanian,
V., Pisabarro, A.G., Lavn, J.L., Oguiza, J.A., Master, E., Henrissat, B., Coutinho,
P.M., Harris, P., Magnuson, J.K., Baker, S.E., Bruno, K., Kenealy, W., Hoegger, P.J.,
Kes, U., Ramaiya, P., Lucas, S., Salamov, A., Shapiro, H., Tu, H., Chee, C.L., Misra,
M., Xie, G., Teter, S., Yaver, D., James, T., Mokrejs, M., Pospisek, I.V. Grigoriev, T.
Brettin, D. Rokhsar, Berka, R. & Cullen, D. (2009). Genome, transcriptome, and
secretome analysis of wood decay fungus Postia placenta supports unique
mechanisms of lignocellulose conversion. Proceedings of the National Academy of
Sciences, Vol. 106, No. 6, pp. 19541959.
Matthews, K.S. (1992). DNA looping. Microbiology Review, Vol. 56, No. 1, pp. 123-136.
Monteiro, P.T., Mendes, N.D., Teixeira, M.C., d'Orey, S., Tenreiro, S., Mira, N.P., Pais, H.,
Francisc, A.P., Carvalho, A.M., Loureno, A.B., S-Correia, I., Oliveira, A.L.
&Freitas, A.T. (2008). YEASTRACT-DISCOVERER: new tools to improve the
analysis of transcriptional regulatory associations in Saccharomyces cerevisiae. Nucleic
Acids Research, Vol. 36, No. 36 Database issue (January 2008), pp. D132-D136.
Patikoglou, G.A., Kim, J.L., Sun, L., Yang, S.H., Kodadek, T. & Burley, S.K. (1999). TATA
element recognition by the TATA box-binding protein has been conserved
throughout evolution. Genes and Development, Vol. 13, (Dec 1999), No. 24, pp. 3217-
3230.
Rabinovich, M.L., Bolobova, A.V. & Vasilchenko L.G. (2004). Fungal decomposition of
natural aromatic structures and xenobiotics: a review. Applied Biochemistry and
Microbiology, Vol. 40, No. 1, pp. 1-17.
Rajakumar, S., Gaskell, J., Cullen, D, Lobos, S, Karahanian, E. & Vicua, R. (1996). Lip-Like
genes in Phanerochaete sordida and Ceriporiopsis subvermispora, white rot fungi with
no detectable lignin peroxidase activity. Applied and Environmental Microbiology,
Vol. 62, No. 7 (July 1996), pp. 26602663.
Richards, A., Veses, V. & Gow, N.A.R. (2010). Vacuole dynamics in fungi. Fungal Biology
Reviews, Vol. 24, pp. 93-105.
Rttimann-Johnson, C., Cullen, D. & Lamar, R. (1994). Manganese peroxidases of the white
rot fungus Phanerochaete sordida. Applied and Environmental Microbiology, Vol. 60, pp.
599605.
Snchez, C. (2009). Lignocellulosic residues: Biodegradation and bioconversion by fungi.
Biotechnology Advances, Vol. 27, No. 2 (March-April 2009), pp. 185-194.
Sato, S., Liu, F., Koc, H. & Tien, M. (2007). Expression analysis of extracellular proteins from
Phanerochaete chrysosporium grown on different liquid and solid substrates.
Microbiology, Vol. 153, No. Pt 9 (September 2007), pp. 3023-3033.
Schleif, R. (1992). DNA looping. Annual Review of Biochemistry, Vol. 61, pp. 199-223.
Shi, J., Chinn, M.S. & Sharma-Shivappa, R.R. (2008). Microbial pretreatment of cotton stalks
by solid state cultivation of Phanerochaete chrysosporium. Bioresources Technology, Vol.
99, No. 14 (September 2008), pp 6556-6564.
Shi, J., Sharma-Shivappa, R.R. & Chinn, M.S. (2009). Microbial pretreatment of cotton stalks
by submerged cultivation of Phanerochaete chrysosporium. Bioresources Technology,
Vol. 100, No. 19 (October 2009), pp. 4388-4395.
Singh, D. & Chen, S. (2008). The white-rot fungus Phanerochaete chrysosporium: conditions for
the production of lignin-degrading enzymes. Applied Microbiology and Biotechnology,
Vol. 81, No. 3 (December 2008), pp. 399-417.
Singh, P., Sulaiman, O., Hashim, R., Rupani, P.F. & Peng, L.C. (2010). Biopulping of
lignocellulosic material using different fungal species. Reviews in Environmental
Science and Biotechnology, Vol. 9, pp. 141-151.
Smith, T.F. & Waterman, M.S. (1981). Identification of common molecular subsequences.
Journal of Molecular Biology, Vol. 147, No. 1, pp. 195-197.
Stepanova, M., Tiazhelova, T., Skoblov, M. & Baranova, A. (2005). A comparative analysis of
relative occurrence of transcription factor binding sites in vertebrate genomes and
gene promoter areas Bioinformatics, Vol. 21, No. 9 (May 2005), pp. 17891796.
Stewart, P. & Cullen, D. (1999). Organization and Differential Regulation of a cluster of
lignin Peroxidase genes from Phanerochaete chrysosporium. Journal of Bacteriology,
Vol. 181, No. 11 (June 1999), pp. 3427-3432.
Thompson, J.D., Higgins, D.G. & Gibson, T.J. (1994). CLUSTAL W: improving the sensitivity
of progressive multiple sequence alignment through sequence weighting, position-
specific gap penalties and weight matrix. Nucleic Acids Research, Vol. 22, No. 22
(November 1994), pp. 4673-4680.
Veses, V., Richards, A. & Gow, N.A.R. (2008). Vacuoles and fungal biology. Current Opinion
in Microbiology, Vol. 11, pp. 503-510.
Weber, R.W.S. (2002). Vacuoles and the fungal lifestyle. Micologist, Vol. 16. Part 1, pp. 10-20.
Wei, W. & Yu. X.-D. (2007). Comparative analysis of regulatory motif discovery tools for
Transcription Factor Binding Sites. Genomics Proteomics Bioinformatics, Vol. 5, No. 2
(May 2007), pp. 131-142.
Wittkopp, P.J. (2006). Evolution of cis-regulatory sequence and function in Diptera. Heredity,
Vol. 97, No. 3 (July 2007), pp. 139-147.
Wu, J.M. & Zhang, Y.Z. (2010). Gene Expression in Secondary Metabolism and Metabolic
Switching Phase of Phanerochaete chrysosporium. Applied and Biochemical
Biotechnology, Vol. 162, No. 7 (November 2010), pp. 1961-1977.
Wymelenberg, A.V., Gaskell, J., Mozuch, M., Kersten, P., Sabat, G., Martinez, D. & Cullen, D.
(2009). Transcriptome and Secretome Analyses of Phanerochaete chrysosporium
Reveal Complex Patterns of Gene Expression. Applied and Environmental
Microbiology, Vol. 75, No. 12 (June 2009), pp. 40584068.
Zacchi, L. Morris, I. & Harvey, P.J. (2000). Disordered ultrastructure in lignin-peroxidase-
secreting hyphae of the white-rot fungus. Phanerochaete chrysosporium. Microbiology,
Vol.146, pp. 759-765.
5
Prediction and Experimental Detection

of Structural and Functional Motifs in
Intrinsically Unfolded Proteins
Cesira de Chiara and Annalisa Pastore
MRC National Institute for Medical Research, The Ridgeway, London,
UK
1. Introduction
Intrinsically unstructured proteins (IUPs) or proteins with intrinsically unstructured regions
(IURs) have quickly gained increasing interest within the biological community because of
their significant presence in the human genome and their potential links to major
pathologies such as cancer, neurodegeneration and diabetes (Tompa, 2005; Tompa &
Fuxreiter, 2008). The terms IUPs and IURs designate proteins or protein regions intrinsically
devoid of a well defined tertiary structure. The concept was introduced a few years ago in
the scientific literature as a brand new idea, which would represent a family of proteins
thought to have been previously ignored or unappreciated (Dunker et al., 2001; Wright &
Dyson, 1999). However, as in many other examples in Science, the concept of IUPs is far
from being new. In the 70s, it was universally accepted that what were known as
biologically active peptides had no intrinsic structure, often being too short to have a
proper hydrophobic core. Peptides would/could however fold in a definite conformation
upon interaction with a partner/receptor, thus having all the features of modern IUPs
(Boesch et al., 1978). Hormones and opioid peptides are two among several of the best
studied examples.
The concept of intrinsic disorder and/or flexibility has now been extended to proteins and
has deeply transformed our perception of the importance of protein dynamics as opposed to
the static picture introduced by years of crystallographic studies. Even more important is
the fact that accepting the existence of IUPs proposes a unique paradigm in which function
can be directly linked to structural disorder rather than to a defined structure.
IUPs have been classified in two broad categories. In the first family, IUPs function is
achieved through binding to one or several partner molecule(s) in a structurally adaptive
process, which enables an exceptional plasticity in cellular responses. These proteins do not
form a structure by themselves and are functionally inactive in the absence of a partner, but
structure can be induced upon recognition of another molecule. When bound to a substrate,
they are able to acquire a structure and become rigid, according to an induced-fit
mechanism or to what has been recently generalized in the concept of conformational
fuzziness (Wright & Dyson, 2009). Macromolecular association rates have in fact been
demonstrated to be highly enhanced by a relatively non-specific association enabled by
flexible recognition segments. Molecular recognition occurring in this way has been
described according to the fly-casting (Shoemaker et al., 2000) or protein fishing (Evans &
Owen, 2002) mechanisms. Examples of proteins belonging to this family are those bearing
RNA binding motifs which acquire a structure only upon interaction to RNA.
In the second family, IUPs work as entropic chains exploiting their ability of fluctuating
over ensembles of structural states with similar conformational energies. In this way they
either generate force against structural changes or influence the orientation/localization of
attached domains (Dunker et al., 2002). According to these properties, they are active in
their unstructured form and play the role of flexible linkers necessary to allow other
portions of the protein to move like a dog on a leash and ultimately to interact with other
partners. A classical example of such a case is the IUR, called PEVK, of the muscle protein
titin (Labeit & Kolmerer, 1995). This region confers some of the passive elastic properties of
the titin filament, providing the stiffness required in muscle contraction to keep the
sarcomere in register (Greaser et al., 2000).
These unique features are exploited in many biological processes thus explaining the
multiplicity of different functions in which IUPs are involved (Dunker et al., 2002). Protein
disorder prevails for instance in signaling, regulatory and cancer-associated proteins. The
functional importance of protein disorder is also underlined by its dominant presence in
proteins associated with signal transduction, cell-cycle regulation, gene expression and
chaperone activities (Dunker et al., 2002; Iakoucheva et al., 2002; Tompa & Csermely, 2004;
Uversky, 2002; Ward et al., 2004b). Because of their susceptibility to degradation, IUPs have
also been linked to the ubiquitin (Ub)/proteasome pathway (Csizmok et al., 2007).
In this chapter, we discuss the problems related to the prediction, production and
characterization of IUPs/IURs. We take as a representative case study ataxin-1, a human
protein of biological and clinical interest that is related to the neurodegenerative disease
spinocerebellar ataxia of type-1. Using ataxin-1, we retrace how the application of different
bioinformatics tools has contributed to shed light on the structure and functions of the
protein since its first identification. We also provide an update on the physico-chemical
methods used to translate the sequence information into structural and functional models of
the protein and its interactome. This hands-on example might provide a valuable paradigm
of how correct identification of linear motifs and IURs can provide the key for
understanding protein function.
2. Prediction methods of IUPs

While it has become increasingly easy to appreciate the importance of IUPs/IURs, their
prediction and experimental characterization remain somewhat problematic. Since Romero
et al. (Romero et al., 1997) indicated for the first time that lack of a defined protein tertiary
structure is predictable on the sole basis of the primary sequence, several different methods
have been developed that enable prediction (reviewed in Radivojac P et al. (Radivojac et al.,
2007) (Table 1). They are based on different definitions of IURs and detect different
indicators such as hydrophobicity, sequence composition, secondary structure content, etc.
These programs, however, are not always entirely reliable. Most weaknesses arise from the
intrinsic difference between the conceptual and operational definition of IUP/IUR. As
mentioned above, conceptually, there are two classes of IUP/IUR. The first does not form a
structure by itself, but this can be induced by a partner. Proteins belonging to the second
class can perform their function in three ways: (1) through the newly acquired structure, (2)
by inducing structural changes in their partners and modulating the function of these
Prediction and Experimental Detection of Structural
partners, or (3) through formation of protein complexes with partners. This class of
IUP/IUR does not function in its unstructured form, i.e., the unstructured form is inactive.
The second class performs its cellular function without forming a structure: the
unstructured form is the functional one.
Software Prediction Based on

Cascaded support vector
Disopred2
Regions lacking ordered machine classifiers
(http://bioninf.cs.ucl.ac.uk/disopred)
secondary structure trained on PSI-BLAST
(Ward et al., 2004b)
profiles
Non rigid regions from
PONDR Local aminoacid
random coils to partially
(http://www.pondr.com/) composition, flexibility,
unstructured regions and
(Radivojac et al., 2003) hydropathy, etc
molten globules
Regions with high
GlobPlot propensity for globularity
Russell/Linding scale of
(http://globplot.embl.de/) based on propensity for
disorder
(Linding et al., 2003b) secondary structure and
random coil
LOOPS (region without
secondary structure)
DisEMBL HOT LOOPS (loops with
Neural networks trained
(http://dis.embl.de/) high mobility)
on crystal structures
(Linding et al., 2003a) REMARK465 (regions of
crystal structures lacking
of electron density)
Local aminoacid
IUPred Regions devoid of well-
composition used to
(http://iupred.enzim.hu/) defined 3D structure
estimate inter-residue
(Dosztanyi et al., 2005a, 2005b) under native conditions
interaction energy
Table 1. List of predictors of protein disorder used for ataxin-1 in this study. The table,
which illustrates the features of the different methods, is adapted from Ferron et al. (Ferron
et al., 2006).
The operational definition used by bioinformatic software is typically based on the
likelihood of the protein/peptide forming a structure under certain (often poorly defined)
cellular environments, with little or no information on how the protein/peptide functions or
what partner the IUP/IPR may have. Intrinsically unstructured proteins are for instance
characterized by a low content of bulky hydrophobic amino acids and a high percentage of
polar and charged amino acids. As a consequence, they do not contain enough residues to
build a hydrophobic core that is typical of stably folded globular proteins. Another
symptomatic indication of an IUP is the presence of low complexity motifs, i.e. sequences
with over-representation of just a few residues (e.g. polyglutamine stretches, arginine-
glycine (RG) repeat observed in RNA binding proteins or arginine-serine (RS) repeats
observed in splicing factors). Of course, while low complexity sequences are a strong
indication of disorder, the reverse is not necessarily true, that is, not all disordered proteins
have low complexity sequences.
We can then expect that as these predictions become more robust the more we shall be able
to distinguish between the different IUPs/IURs and have functional clues. For the time
being, this software should be handled with care. For instance it is quite important to use
more than one approach on the same sequence and compare the resulting scores.
3. Detection of linear functional motifs

It is difficult to underestimate the importance of the concept of structural motifs or modules
in the world of globular proteins (Konagurthu & Lesk, 2010; Schaeffer & Daggett, 2010). A
similar role is taken now by linear motifs in the world of IUPs. Eukaryotic linear motifs
(ELMs) are short stretches of eukaryotic protein sequences (typically 3-10 amino acids long)
to which a molecular function is associated. These segments provide regulatory functions
independently of protein tertiary structure. While also potentially present in stably folded
proteins, they acquire a particular importance in IUPs because in these they cannot be
shielded by structure. It is in fact found experimentally that short functional sites, which are
frequently involved in regulatory processes, must reside in non-structured or non-globular
regions or, when within globular domains, in flexible highly exposed loops (Gibson, 2009).
Examples of linear motifs are phosphorylation sites, nuclear localization signals or
signalling sequences. A useful tool for the prediction of linear motifs is the ELM database
(http://elm.eu.org/) developed from a collaborative effort between EMBL and University
of Rome (Diella et al., 2008; Puntervoll et al., 2003). A sequence of interest can be screened
against this database to quickly suggest the position of ELMs.
4. When can we be sure that a protein is a IUP?

Many of us have been confronted with natural or recombinant proteins that, after
purification, result in being unfolded even when they are expressed in a soluble form. Are
these bona fide IUPs? It is some times difficult to distinguish between IUPs and orphan
complex proteins, yet there is a profound difference between the two families. IUPs have no
intrinsic capability to adopt a definite structure at least in the absence of a partner. Their
conformational state is also independent of the way they have been purified. On the
contrary, Orphan complex proteins are able to fold but their tertiary fold is only marginally
stable even though not being intrinsically devoid of a 3D structure (Sjekloa et al. 2011). This
is often due to the absence of a partner which stabilizes their fold. These proteins might be
produced as unfolded proteins, as folded/unfolded mixed populations or as species highly
prone to aggregation. Their misbehaviour can in principle be reduced or neutralized by
finding more suitable conditions or less drastic purification protocols (e.g. concentration is
often a problematic step). The only guidance to distinguish among the two families may be
sequence analysis coupled to comparison with other homologous. If the motif is observed in
other proteins where it adopts a stable fold, it is difficult to believe that it is intrinsically
unfolded. In such a case, we suggest putting more care in protein production and
attempting to identify the partners able to provide stabilization. A way to solve the
ambiguity when the protein of interest is purified as an unfolded monomer can be to
register an NMR spectrum directly on the cell lysate, if proper overexpression can be
achieved. This circumvents the purification step and shows the structural properties of the
protein independently of human intervention.
5. Experimental methods to study IUPs

How can we study the structure of intrinsically unstructured molecules? The statement
sounds like an oxymoron in which the two terms contradict each other. The problem closely
resembles the difficulties encountered in the study of denatured states of ordered proteins.
It goes without saying that IUPs cannot be crystallized in isolation because of their
flexibility. Solution studies are therefore more appropriate to characterize their structural
states. The ultimate goal of these studies cannot, however, be that of obtaining the structure
but rather to describe the protein as an ensemble of rapidly interconverting alternative
structures characterized by differing backbone torsion angles.
Among the biophysical methods able to provide structural and dynamic information, two
techniques are probably the ones that have given more interesting results over the last few
years: Nuclear magnetic resonance (NMR) and Small Angle X-ray Scattering (SAXS).
Despite the disadvantages of the very poor chemical shift dispersion (particularly for proton
and aliphatic carbon resonances) because of conformational averaging, NMR is particularly
powerful thanks to its ability of measuring different independent observables. These include
secondary chemical shifts, residual dipolar couplings (RDC), hydrogen bonds, torsional
angles and long-range NOE upon spin labelling (for an exhaustive review see Mittag &
Forman-Kay, 2007). Among them, detection of residual secondary chemical shifts is
probably the simplest qualitative way to detect complete or partial local disorder of a chain.
Most of the other NMR observables can be exploited in a more quantitative way: since the
early implementation of the ensemble-averaged nOe distance restraints (Bonvin & Brunger,
1996), a variety of restraining algorithms, including simultaneous time and ensemble
averaging (Fennen et al., 1995), have been developed and have been used to describe native,
transition, intermediate, and unfolded states (Clore & Schwieters, 2004a, 2004b; Kuszewski
et al., 1996; Vendruscolo & Paci, 2003; Vendruscolo & Dobson, 2005). A modern approach
that takes into account protein flexibility is that of imposing penalizing forces if the
calculated average distances at a given time across an ensemble of simulated molecules (the
replica ensemble) do not match the experimental ones. It is interesting to note that RDCs
provide a particularly powerful way to assess protein structures using an absolute reference
system despite the original scepticism towards applying these measurements for the
treatment of IUPs and IURs which pose fundamental problems in the way structural
averaging should be used. To address the problem, new methods based on RDC
measurements have been developed to provide detailed information on protein dynamics
also in cases of conformational averaging, for instance based on analytical deconvolution,
Gaussian axial fluctuation methods and restrained molecular dynamics simulations. Most of
these methods have, however, been used to assess the dynamics of relatively small
amplitude methods. Their application to flexible and conformationally interconverting
molecules such as IUPs and IURs remains to be fully established.
SAXS, by which it is possible to achieve the measurement of molecular dimensions and a
description of the overall shape of the ensemble, is, in many ways, complementary to NMR.
A key advancement to quantitatively characterizing flexible proteins in solution by SAXS
was achieved with the implementation of the approach known as ensemble optimization
method (EOM) (Bernado et al., 2007). In this approach, flexibility is taken into account by
postulating the coexistence of different conformational states for the protein contributing to
the experimental scattering pattern. The different conformers can then be selected by genetic
algorithms from a pool containing a large number of randomly generated models covering
the protein configurational space. The EOM selected models are then analysed by
quantitative statistical criteria also developed to determine the optimal number of
conformers necessary to represent the ensemble. When possible, the quality of the analysis
is increased by simultaneous fitting of multiple scattering patterns from deletion mutants, a
procedure which is somewhat equivalent to improving the quality of sequence alignment
introducing information about sequence homologues. The EOM protocol has now been
validated by applying it to the study of several examples of completely or partially unfolded
proteins and on multidomain proteins interconnected by flexible linkers and has shown to
be a robust and helpful approach to the study of IUPs.
6. Ataxin-1 as a case study

To discuss the problems related to the prediction and characterization of IURs we chose as a
representative case study ataxin-1, a human protein of biological and clinical interest that is
related to the neurodegenerative disease spinocerebellar ataxia of type-1 (SCA1). This
hereditary pathology is dominant and a member of a small family of neurodegenerative
diseases linked to protein aggregation and misfolding, all caused by anomalous expansion
of polyglutamine (polyQ) tracts in the gene coding region (Orr & Zoghbi, 2007) (Figure 1).
Fig. 1. Schematic representation of the protein members of the polyQ disease family. The
sequence predicted to be intrinsically unfolded according to predictor DisEMBL (Radivojac
et al., 2003) is indicated by a blue line. The position of polyQ tracts is indicated with
magenta boxes. The position of other structural and functional domains, as reported by
SMART (Schultz et al., 1998) and Pfam (Finn et al., 2010) databases, is indicated with
geometric symbols of different colours. HTT: Huntingtin; ATN1: Atrophin 1; AR: Androgen
receptor; ATXN1: Ataxin-1; ATXN2: Ataxin-2; ATXN3: Ataxin-3; A1A-vdcc: A1A-voltage
dependent calcium channel; ATXN7: Ataxin-7; TBP: TATA-box binding protein.
Other members of the polyQ pathology family are Huntingtons chorea, Machado-Joseph
disease and other spinocerebellar ataxias. Elongation of polyQ tracts is the result of a gene
polymorphism where unstable consecutive CAG triplets may become expanded during
DNA replication. The mutated proteins form intracellular aggregates which are thought to
be toxic for the cell and lead to cell death according to a gain rather than loss of function
mechanism. While generally accepted that polyQ expansion is the leading factor in
triggering pathology, it has become increasingly clear that protein context is an important
element that modulates protein behaviour and pathology. Despite best efforts, all the polyQ
pathologies are currently incurable. A way to develop a specific treatment is through the
identification of the function(s) of the native proteins. In this endeavour, the support of
bioinformatics analysis of the protein sequence becomes essential to predict structure and a
great help in suggesting a function for these proteins. The sequences of the polyQ disease
families are very different in length and position of the polyQ tract. They are also not
homologous and share only a rather loose common feature: they all seem to contain large
IURs which are sometimes interrupted by readily identifiable globular domains. As such,
they constitute an excellent example to discuss the problems inherent in detecting and
studying IUPs/IURs.
In the following sections we shall discuss a detailed analysis of the ataxin-1 primary
sequence and how this study has suggested working hypotheses which could then be tested
experimentally using structural and cellular approaches. We discuss the identification of
two major potential IURs in ataxin-1 which contain short linear motifs important for
phosphorylation, aggregation and protein-protein interactions that are directly related to
pathogenesis (Chen et al., 2003; de Chiara et al., 2009; Emamian et al., 2003; Jorgensen et al.,
2009; Klement et al., 1998). We pay particular attention to the prediction and
characterization of the structural and functional features of the different protein regions and
to the identification of key ELMs of crucial importance both for the normal and anomalous
behaviour of the protein.
6.1 Ataxin-1 domain architecture

Ataxin-1 is a ca. 98 kDa protein which is well conserved through vertebrates, ubiquitously
expressed and mainly localised in the cell nucleus (Klement et al., 1998). As with all the
other members of the polyQ protein family, which it shares a common pathogenic
mechanism with, ataxin-1 was originally identified by gene mapping (Banfi et al., 1994). In
its non-expanded form, human ataxin-1 is a protein of 816 amino acids although expansion
can significantly increase its length (Figure 2). Different predictions of IURs suggest the
presence of long unstructured regions (Figure 3).
Fig. 2. Architecture of non-expanded and expanded ataxin-1. The polyQ tract is shown in
magenta and the AXH domain in cyan. The positions of the nuclear localization signal
(NLS) and a phosphorylation site important for protein interactions and for pathology are
also indicated (de Chiara et al., 2009).
Fig. 3. IUR regions of ataxin-1 according to different predictors. From top to bottom:
Disopred2 (Ward et al., 2004a; Ward et al., 2004b), PONDR (Radivojac et al., 2003), IUPRED
(Dosztanyi et al., 2005a, 2005b), GlobPlot (Linding et al., 2003b) and DisEMBL (Linding et
al., 2003a).
6.1.1 The N-terminal IUR

6.1.1.1 The N-terminal IUR according to different IUR predictors
In addition to the low complexity polyQ tract, there is a long region potentially unfolded
from the N-terminus up to the AXH domain (567-689) which seems to be the only region of
the protein that is autonomously folded (Figure 2). According to GlobPlot (Linding et al.,
2003b), for instance, the region of ataxin-1 from the N-terminus to the beginning of the AXH
domain is predicted as a series of multiple disorder regions. Among these are short low-
complexity sequences (47-64, 88-99, 154-169, 366-377) as defined by SMART (Letunic et al.,
2009; Schultz et al., 1998). Disopred2 (Ward et al., 2004a; Ward et al., 2004b), PONDR
(Radivojac et al., 2003), DisEMBL (Linding et al., 2003a) and IUPRED (Dosztanyi et al.,
2005a, 2005b) also concordantly predict this region as almost entirely disordered (Figure 3).
6.1.1.2 The polyQ tract
The N-terminus of the human protein is characterized by the presence of a highly
polymorphic almost uninterrupted polyQ stretch which ranges from 4 to ~39 Qs in normal
population and is expanded to ~40-83 Qs in SCA1-affected individuals (Zoghbi & Orr, 2008).
Pathology typically develops when the repeat length exceeds a threshold of 35-45
glutamines (Genis et al., 1995; Jayaraman et al., 2009; Orr et al., 1993). Expansion of this
region is a feature not shared among other species suggesting an evolutionary gain
associated only to humans. The polyQ tract of ataxin-1 starts at residue 197. Indeed, the
structure of polyQ stretches in solution has been shown experimentally both by CD and
NMR spectroscopy to be a random coil when in a non-aggregated form (Masino et al., 2002).
This is at variance with predictions by SMART which propose a helical coiled-coil region for
the same region (amino acids 193-230). The discrepancy should anyway be ascribed by a
bias in SMART for poly-amino acids. Interestingly, we now know that expansion of the
polyQ tract in ataxin-1 is a condition necessary but not sufficient for triggering disease: two
other motifs, a nuclear localization signal (NLS) and phosphorylation of S776, both located
at the C-terminus and discussed in a session below, have been proved to also be required.
As for the other polyQ proteins the native function of the polyQ tracts is unknown, although
their presence has mostly been detected in proteins associated with transcriptional
regulation activity. Indeed, the transcriptional regulator poly-Q binding protein-1 (PQBP1)
has been found to bind ataxin-1 in a polyQ length-dependent manner, suggesting that
PQBP1 and mutant ataxin-1 may act cooperatively to repress transcription and induce cell
death (Okazawa et al., 2002). Direct evidence to support this hypothesis is now necessary.
6.1.1.3 Prediction of significant ELMs in the N-terminal IUR
Although ataxin-1 has been reported as a protein shuttling in and out the nucleus and the
cytoplasm, there is a large body of evidence showing that the protein is predominantly
located in the nucleus. Restricting the search for candidate short linear motifs and post-
translational modifications within the N-terminal IUR to those significant for the nuclear
localization, several ELMs have been predicted by using the ELM resource (Diella et al.,
2008; Puntervoll et al., 2003) (Table 2).
A plethora of potential phosphorylation sites are predicted by the ELM resource in the N-
terminal IUR of ataxin-1, among which only Ser239 (Vierra-Green et al., 2005) and Ser254
have been experimentally verified (Dephoure et al., 2008). Phosphorylation of these two
serine residues supports the prediction by ELM of two candidate Class IV WW domain
interaction motifs present in the regions 236-241 and 251-256 which mediate
phosphorylation-dependent interactions. In addition to the WW domain motifs, other
ELM Sequence Position Description Experimentally

Verified
LIG_14-3-3_1 RRWSAP 773-778 Mode 1 interacting phospho- Yes
motif for 14-3-3 proteins
LIG_14-3-3_3 KAPTLP 29-34 Interacting phospho-motif for
RTASPP 260-265 14-3-3 proteins not matching
KAESSR 309-314 Mode 1 and Mode 2
HSASEP 439-444
LIG_FHA_1 EGTAWLP 41-47 Phosphothreonine motif
PVTSAVA 154-160 binding FHA with preference
PHTLTLG 279-285 for large aliphatic at pT+3
PGTQPLL 486-492
FVTTALP 523-529
LIG_FHA_2 AGTSVEL 63-69 Phosphothreonine motif
LSTGLDY 81-87 binding FHA with preference
QATHREA 400-406 for acidic aminoacid at pT+3
PSTLNDK 408-414
GSTDMEA 496-502
FLTKIEP 758-764
LIG_WW_4 TPGSPP 236-241 Phosphopeptide motif
ISSSPQ 251-256 interacting with Class IV WW
domain
MOD_PKA_1 RRWSAPE 773-779 PKA-type AGC kinase Yesa
phosphorylation site
MOD_ProDKin_1 TPGSPPP 236-242 MAPK phosphorylation site Yesb
ISSSPQN 251-257 in higher eucaryotes Yesb
MOD_CK2 RRWSAPE 773-779 CK2 phosphorylation site
MOD_GSK3_1 ISSSPQNT 251-258 GSK3 phosphorylation Yesb
RRWSAPES 773-780 recognition site
LIG_ULM_U2AF6 RKRRWS 771-776 Pattern in ULMs of SF1 and Yes
5_1 SAP155 which bind to the
UHM of U2AF65
LIG_USP7_1 PATSR 20-24 Variant of the USP7 NTD
AGTSV 63-67 domain based on the MDM2
PVTSA 154-158 and P53 interactions
AVASA 158-162
AESSR 310-314
PYESR 356-360
PSPSD 366-370
ASPST 406-410
PVGST 494-498
PKPSL 795-799
MOD_SUMO PKSE 529-532 Motif recognized for
LKTE 594-597 modification by SUMO
TRG_NLS_MonoC TRKRRW 770-775 Monopartite variant of the Yes
ore_2 classical basically charged
NLS. Core version
Table 2. Prediction of relevant functional linear motifs in the N- and C-terminus of human
ataxin-1 by the ELM database (http://elm.eu.org/) (Diella et al., 2008; Puntervoll et al.,
2003). Among all the predicted phosphorylation sites only the ones which have been
confirmed in vivo and are supportive of the prediction of other phosphopeptide motifs have
been included. aPhosphorylation site and kinase experimentally confirmed in cerebellum
(Jorgensen et al., 2009). bPhosphorylation site confirmed, kinase not identified (Dephoure et
al., 2008; Vierra-Green et al., 2005)
putative phosphorylation-dependent protein-protein interaction motifs are predicted in the
N-terminus of ataxin-1. Among these are several forkhead-associated FHA domain type-1
and -2, and adaptor protein 14-3-3 ligand motifs suggesting that the N-terminus of ataxin-1
may play a significant role in the assembly of the protein interactome.
6.1.1.4 Self association region (SAR)
At the cross-point between the N-terminal IUR and the AXH domain, a region of ca 100 aa
(495-605) was identified in a yeast two hybrid system as responsible for protein self
association (SAR) in cell (Burright et al., 1997). SAR shares 39 aa with the N-terminus of the
AXH domain (567-689) which has been shown to be dimeric in solution (Chen et al., 2004; de
Chiara et al., 2003). Therefore, this region seems to account for dimerization of the full-
length ataxin-1. Interestingly, according to PONDR (VL3 predictor) and IUPRED, both
based on the analysis of the local aminoacid composition, the full region ~440-700, which
includes SAR and the AXH domain, is predicted as a potentially folded domain (Figure 3).
6.1.2 AXH domain

6.1.2.1 The structure of the ataxin-1 AXH domain
Soon after gene identification (Banfi et al., 1994), the analysis of the ataxin-1 sequence and
the prediction of the secondary structure performed from multiple alignment of the protein
from different species allowed the discovery of a new small putative independently folded
domain (ca. ~130 aa) (with predicted predominantly beta structure) (de Chiara et al., 2003).
The domain, successively named AXH (for Ataxin-1 Homology domain), did not show any
detectable homology with any other known folding units (SMART accession number
SM00536; http://smart.embl-heidelberg.de/) (Letunic et al., 2009; Schultz et al., 1998). A
few years later, the homology between the ataxin-1 AXH and a region of an unrelated
protein, the transcription factor HBP1, was detected (Mushegian et al., 1997). The two
proteins share ~28% identity and ~54% similarity with the HBP1 AXH domain showing a
ca. 10 aminoacids insertion loop between secondary structures respect to the ataxin-1
domain (de Chiara et al., 2003) (Figure 4).
The structure of ataxin-1 AXH, as solved by X-ray crystallography, consists of a non-
canonical oligonucleotide- and oligosaccharide-binding (OB) fold (Chen et al., 2004; Murzin,
1993) (Figure 5). The AXH appears as a constitutive asymmetric dimer which crystallizes as
an asymmetric dimer of dimers. Each monomer displays a common structure in the C-
terminal part (residues 610-685), recognizable as the OB-fold, which superposes with an
average root mean square deviation of 0.90 0.06 on the backbone atoms. Conversely,
approximately the first 30 N-terminal aminoacids show appreciable main chain differences
between each of the two monomers in the dimer, with the same stretch of aminoacids
adopting alternative secondary structures in the two cases. In this respect, the AXH domain
represents an interesting example of a chameleon protein, which is a protein that adopts
different folds under different environments. Interestingly, the observed structural
differences in ataxin-1 are not induced by different experimental conditions or by the
presence of ligands. Instead, they are present in the context of the same protein.
Fig. 4. Sequence alignment of the AXH from ataxin-1 (ATX1), ataxin-1 paralogue BOAT
(Brother Of ATaxin-1) and HBP1 from different species. The alignment was prepared by
ClustalX (version 2) (Larkin et al., 2007) and is based exclusively on sequence similarity. The
secondary structure of the ataxin-1 AXH domain as predicted by Jpred 3 (Cole et al., 2008) is
shown on the top for reference.
Fig. 5. X-ray structure of the AXH domain of ataxin-1 (PDB entry 1OA8) (Chen et al., 2004).
The monomers forming the dimer of dimers observed in the structure are alternatively
indicated in dark and light blue. Detailed analysis shows that they are not related by
symmetry.
An even bigger surprise was revealed by structure determination of the AXH domain of
HBP1. Whilst on the pure basis of sequence homology it would have been reasonable to
assume that the structure of each of the two domains could be easily modelled from the other
used as a template, an unexpected result came out when the solution structure of the HBP1
AXH domain was solved by NMR spectroscopy (de Chiara et al., 2005a) (Figures 6 and 7).
Fig. 6. Comparison between the structure of the AXH domains of ataxin-1 (monomer A)
(left) (PDB entry 1OA8) (Chen et al., 2004) and HBP1 (right) (PDB entry 1V06) (de Chiara et
al., 2005a). The N-terminal of the two monomers show the same elements of secondary
structure arranged in a different topology.
Fig. 7. Alignment based on structural comparison between the AXH from taxin-1 and HBP1
(Chen et al., 2004; de Chiara et al., 2005a). SS_ATX1 and SS_HBP1:experimental secondary
structure of ataxin-1 and HBP1.
When comparing the structure of the HBP1 domain, which is monomeric (de Chiara et al.,
2003; de Chiara et al., 2005a), to any of the ataxin-1 X-ray monomers, only the C-terminal
part, representing the core of the OB-fold, is structurally superposable, while the N-
terminus adopts a different topology, despite maintaining the same secondary structure
elements along the sequence (Figure 6). Only a structure-based comparison allowed us to
realign the sequences and to correctly position the HBP1 long-loop insertion, which was
originally set between beta-3 and beta-4, between helix-1 and beta-3 (Figure 7). These
findings support the possibility that the AXH motif is intrinsically able to adopt different
topologies.
6.1.2.2 The function of the ataxin-1 AXH domain
Further studies on the role of the OB-fold of the AXH domain have shown that this region is
designed to mediate interactions both with nucleic acids and proteins. The crystal structure
of the ataxin-1 AXH allowed us to rationalize previous literature notions on the ability of the
AXH to bind RNA homopolimers in vitro with the same nucleotide preference as full-length
ataxin-1 (de Chiara et al., 2003; Yue et al., 2001). In addition to a direct binding to RNA
through the AXH domain, the protein was found to co-localize with RNA also when the
AXH domain was deleted, thus suggesting an involvement of other RNA binding proteins
in the ataxin-1 interactome (de Chiara et al., 2005b). Recent findings on the ability of ataxin-1
to interact with splicing factors through a short motif localized C-terminally to the AXH
domain opened the intriguing possibility that the protein may be involved in pre-mRNA
processing at the level of the splicing machinery (de Chiara et al., 2009; Lim et al., 2008).
However, no RNA targets have, as yet, been identified and more research is needed to
address the question of whether the protein may play a role in RNA metabolism and/or
nuclear RNA export as suggested also by co-localization with the mRNA export factor
TAP/NXF1 (Irwin et al., 2005).
As for the ability of the AXH domain to mediate protein-protein interactions, several
binding partners with transcriptional activity have been identified whose interaction with
ataxin-1 is abolished when the AXH domain is deleted: the silencing mediator of retinoid
and thyroid hormone receptors SMRT/SMRTER (Tsai et al., 2004), the repressor Capicua
(Lam et al., 2006), the transcription factors Sensless/Gfi-1 (Tsuda et al., 2005) and Sp1 (Goold
et al., 2007). A potential role for ataxin-1 in transcriptional regulation was suggested at a
very early stage by the homology with HBP1 (Sampson et al., 2001; Tevosian et al., 1997). A
general read-out assay for repression of transcription (de Chiara et al., 2005b) confirmed that
the AXH domain represses transcription when tethered to DNA similarly to what was
observed for full-length ataxin-1 (Tsai et al., 2004). However, cross-linking experiments
showed that there is no direct binding between DNA and AXH domain indicating that the
interaction is mediated by other co-transcriptional regulators (de Chiara et al., 2005b), as
also confirmed experimentally later on (Bolger et al., 2007; Goold et al., 2007; Lam et al.,
2006; Serra et al., 2006; Tsuda et al., 2005).
6.1.3 The C-terminal IUR

The region downstream to the AXH domain up to the C-terminal end of the protein (amino
acids 690-816) represents an example of possible conflict between the results of different
predictors. Disopred2, PONDR, IUPRED and DisEMBL predict the C-terminus as an almost
completely disordered region (Figures 3). According to GlobPlot (http://globplot.embl.de),
which is based on the Russell/Linding scale (Linding et al., 2003b), the region 703-786 is
predicted as a potential globular domain. There is also no agreement with the prediction
from the SMART server which, instead, identifies the AXH as the only folded region in the
protein (Figures 2). While still awaiting for a systematic experimental validation, we can
already comment on these results in light of our findings.
6.1.3.1 Prediction of ELMs in the C-terminal IUR: A three-way molecular switch in
ataxin-1 C-terminus
Consistent with the presence of disorder, several linear motifs were predicted in the
protein C-terminus. Among these three overlapping linear motifs identified downstream
to AXH were experimentally verified: a nuclear localization signal (NLS) (771-774)
(Klement et al., 1998), a 14-3-3 binding motif (774-778: key conservation RxxSxP) (Chen et
al., 2003) and a UHM ligand motif (ULM) (771-776) (de Chiara et al., 2009), present in
proteins associated with splicing. These motifs represent a three-way molecular switch
which plays an important role both for the function of the native protein and for
pathogenesis. In addition to the expansion of the polyQ tract, nuclear localization is a
strict requirement for the development of the pathology. Expanded ataxin-1 with mutated
NLS fails to enter the nucleus and does not cause aggregation that is the typical
phenotypic hallmark of the SCA1 pathology (Klement et al., 1998). Further to polyQ
expansion and nuclear localization, phosphorylation of S776 has been identified as a
condition necessary for development of SCA1 (Emamian et al., 2003). Phosphorylation of
S776 has been confirmed to occur in vivo (Emamian et al., 2003; Jorgensen et al., 2009) and
is required for recognition of ataxin-1 by the protein 14-3-3, a molecular adaptor which
modulates, in a phosphorylation-dependent manner, the function of different proteins in
their specific context (Chen et al., 2003). Mutation of S776 to an alanine in expanded
ataxin-1, despite not affecting nuclear localization, prevented the development of the
SCA1 phenotype (Emamian et al., 2003).
Recently, an UHM ligand motif (ULM) predicted by the ELM server in the C-terminus of the
ataxin-1 sequence has been experimentally validated and characterized (de Chiara et al.,
2009). The ULM motif was first identified in the splicing factors SF1 and SAP155 and shown
to bind the UHM domain of U2AF65 (Corsini et al., 2007). Ataxin-1 ULM (771-776) strongly
overlaps with the 14-3-3 ligand motif (774-778). However, whilst phosphorylation of S776 is
crucial for recognition by 14-3-3, it only marginally affects the interaction with U2AF65,
increasing the dissociation constant by only ~3 folds. Being the Kd between ataxin-1 S776-
phosphorylated ULM and 14-3-3 ( isoform) two orders of magnitude smaller than U2AF65
(0.4 M versus 36 M) it was possible to conclude that, when S776 is phosphorylated, 14-3-3
is able to displace U2AF65. Under these conditions, the 14-3-3-bound expanded ataxin-1 is
prone to aggregation. The S776A mutation, which hampers the interaction with 14-3-3, still
allows the interaction with UHM domain of U2AF65 and potentially other splicing factors.
These interactions, likely because of the extended dimension of the spliceosome complex,
may play a protective role and prevent aggregation. Our findings allowed us to conclude
that phosphorylation of S776 provides the switch that regulates binding of ataxin-1 to the
protein 14-3-3 and components of the spliceosome, and suggests that pathology develops
when aggregation competes with native interactions (Figure 8). This example also shows
how the investigation of the native function of the polyQ proteins have provided valuable
hints for understanding the molecular mechanisms of pathogenesis.
Fig. 8. A model of the role played by phosphorylation of S776 in the modulation of

expanded ataxin-1 aggregation.
7. Conclusions
We have discussed here the concept of IUPs and IURs and shown how their detailed
bioinformatics analysis can assist structural and functional studies using ataxin-1 as a
paradigmatic example. Ataxin-1, like other members of the polyQ pathology family, is
mostly composed of IUPs. Very little is still known about this protein despite its
involvement in human neurodegeneration, yet this knowledge is essential for designing
specific therapeutic interventions. Identification of both structured (the AXH domain) and
unstructured linear functional motifs has played a key role in advancing our knowledge in
the ataxin-1 function in the cell. More advanced information will undoubtedly come from
experimental analysis of long stretches of the protein if the formidable challenges of their
recombinant production in a pure and stable form can be circumvented. It is also evident
from the example reported here how new approaches in the identification and study of IUPs
might be highly helpful to advance the field.
8. References
Banfi, S., Servadio, A., Chung, M.Y., Kwiatkowski, T.J., Jr., McCall, A.E., Duvick, L.A., Shen,
Y., Roth, E.J., Orr, H.T., & Zoghbi, H.Y. (1994). Identification and Characterization
of the Gene Causing Type 1 Spinocerebellar Ataxia. Nature Genetics, Vol. 7, No. 4,
(August 1994), pp. 513-520, ISSN 1061-4036
Bernado, P., Mylonas, E., Petoukhov, M.V., Blackledge, M., & Svergun, D.I. (2007). Structural
Characterization of Flexible Proteins Using Small-Angle X-Ray Scattering. Journal of
the American Chemical Society, Vol. 129, No. 17, (May 2007), pp. 5656-5664, ISSN
0002-7863
Boesch, C., Bundi, A., Oppliger, M., & Wuthrich, K. (1978). 1h Nuclear-Magnetic-Resonance
Studies of the Molecular Conformation of Monomeric Glucagon in Aqueous
Solution. European Journal of Biochemistry, Vol. 91, No. 1, (November 1978), pp. 209-
214, ISSN 0014-2956
Bolger, T.A., Zhao, X., Cohen, T.J., Tsai, C.C., &Yao, T.P. (2007). The Neurodegenerative
Disease Protein Ataxin-1 Antagonizes the Neuronal Survival Function of Myocyte
Enhancer Factor-2. Journal of Biologic Chemistry, Vol. 282, No. 40, (October 2007), pp.
29186-29192, ISSN 0021-9258
Bonvin, A.M., & Brunger, A.T. (1996). Do Noe Distances Contain Enough Information to
Assess the Relative Populations of Multi-Conformer Structures? Journal of
Biomolecular NMR, Vol. 7, No. 1, (January 1996), pp. 72-76, ISSN 0925-2738
Burright, E.N., Davidson, J.D., Duvick, L.A., Koshy, B., Zoghbi, H.Y., & Orr, H.T. (1997).
Identification of a Self-Association Region within the Sca1 Gene Product, Ataxin-1.
Human Molecular Genetics, Vol. 6, No. 4, (April 1997), pp. 513-518, ISSN 0964-6906
Chen, H.K., Fernandez-Funez, P., Acevedo, S.F., Lam, Y.C., Kaytor, M.D., Fernandez, M.H.,
Aitken, A., Skoulakis, E.M., Orr, H.T., Botas, J., & Zoghbi, H.Y. (2003). Interaction of
Akt-Phosphorylated Ataxin-1 with 14-3-3 Mediates Neurodegeneration in
Spinocerebellar Ataxia Type 1. Cell, Vol. 113, No. 4, (May 2003), pp. 457-468, ISSN
0092-8674
Chen, Y.W., Allen, M.D., Veprintsev, D.B., Lowe, J., & Bycroft, M. (2004). The Structure of
the Axh Domain of Spinocerebellar Ataxin-1. Journal of Biologic Chemistry, Vol. 279,
No. 5, (January 2004), pp. 3758-3765, ISSN 0021-9258
Clore, G.M., & Schwieters, C.D. (2004a). How Much Backbone Motion in Ubiquitin Is
Required to Account for Dipolar Coupling Data Measured in Multiple Alignment
Media as Assessed by Independent Cross-Validation? Journal of the American
Chemical Society, Vol. 126, No. 9, (March 2004a), pp. 2923-2938, ISSN 0002-7863
Clore, G.M., & Schwieters, C.D. (2004b). Amplitudes of Protein Backbone Dynamics and
Correlated Motions in a Small Alpha/Beta Protein: Correspondence of Dipolar
Coupling and Heteronuclear Relaxation Measurements. Biochemistry, Vol. 43, No.
33, (Aug 24 2004b), pp. 10678-10691, ISSN 0006-2960
Cole, C., Barber, J.D., & Barton, G.J. (2008). The Jpred 3 Secondary Structure Prediction
Server. Nucleic Acids Research, Vol. 36, Web Server issue, (July 2008), pp. W197-201,
ISSN 1362-4962
Corsini, L., Bonnal, S., Basquin, J., Hothorn, M., Scheffzek, K., Valcarcel, J., & Sattler, M.
(2007). U2af-Homology Motif Interactions Are Required for Alternative Splicing
Regulation by Spf45. Nature Structure and Molecular Biology, Vol. 14, No. 7, (July
2007), pp. 620-629, ISSN 1545-9993
Csizmok, V., Dosztanyi, Z., Simon, I., & Tompa, P. (2007). Towards Proteomic Approaches
for the Identification of Structural Disorder. Current Protein & Peptide Science, Vol. 8,
No. 2, (April 2007), pp. 173-179, ISSN 1389-2037
de Chiara, C., Giannini, C., Adinolfi, S., de Boer, J., Guida, S., Ramos, A., Jodice, C., Kioussis,
D., & Pastore, A. (2003). The Axh Module: An Independently Folded Domain
Common to Ataxin-1 and Hbp1. FEBS Letters, Vol. 551, No. 1-3, (September 2003),
pp. 107-112, ISSN 0014-5793
de Chiara, C., Menon, R.P., Adinolfi, S., de Boer, J., Ktistaki, E., Kelly, G., Calder, L.,
Kioussis, D., & Pastore, A. (2005a). The Axh Domain Adopts Alternative Folds the
Solution Structure of Hbp1 Axh. Structure, Vol. 13, No. 5, (May 2005a), pp. 743-753,
ISSN 0969-2126
de Chiara, C., Menon, R.P., Dal Piaz, F., Calder, L., &Pastore, A. (2005b). Polyglutamine Is
Not All: The Functional Role of the Axh Domain in the Ataxin-1 Protein. Journal of
Molecular Biology, Vol. 354, No. 4, (December 2005b), pp. 883-893, ISSN 0022-2836
de Chiara, C., Menon, R.P., Strom, M., Gibson, T.J., & Pastore, A. (2009). Phosphorylation of
S776 and 14-3-3 Binding Modulate Ataxin-1 Interaction with Splicing Factors. PLoS
One, Vol. 4, No. 12, (December 2009), pp. e8372, ISSN 1932-6203
Dephoure, N., Zhou, C., Villen, J., Beausoleil, S.A., Bakalarski, C.E., Elledge, S.J., & Gygi, S.P.
(2008). A Quantitative Atlas of Mitotic Phosphorylation. Proceedings of the National
Academy of Sciences U S A, Vol. 105, No. 31, (August 2008), pp. 10762-10767, ISSN
1091-6490
Diella, F., Haslam, N., Chica, C., Budd, A., Michael, S., Brown, N.P., Trave, G., & Gibson, T.J.
(2008). Understanding Eukaryotic Linear Motifs and Their Role in Cell Signaling
and Regulation. Frontiers in Bioscience, Vol. 13, No. (May 2008), pp. 6580-6603, ISSN
1093-4715
Dosztanyi, Z., Csizmok, V., Tompa, P., & Simon, I. (2005a). The Pairwise Energy Content
Estimated from Amino Acid Composition Discriminates between Folded and
Intrinsically Unstructured Proteins. Journal of Molecular Biology, Vol. 347, No. 4,
(April 2005a), pp. 827-839, ISSN 0022-2836
Dosztanyi, Z., Csizmok, V., Tompa, P., & Simon, I. (2005b). Iupred: Web Server for the
Prediction of Intrinsically Unstructured Regions of Proteins Based on Estimated
Energy Content. Bioinformatics, Vol. 21, No. 16, (August 2005b), pp. 3433-3434, ISSN
1367-4803
Dunker, A.K., Lawson, J.D., Brown, C.J., Williams, R.M., Romero, P., Oh, J.S., Oldfield, C.J.,
Campen, A.M., Ratliff, C.M., Hipps, K.W., Ausio, J., Nissen, M.S., Reeves, R., Kang,
C., Kissinger, C.R., Bailey, R.W., Griswold, M.D., Chiu, W., Garner, E.C., &
Obradovic, Z. (2001). Intrinsically Disordered Protein. Journal of Molecular Graphics
and Modelling, Vol. 19, No. 1, pp. 26-59, ISSN 1093-3263
Dunker, A.K., Brown, C.J., Lawson, J.D., Iakoucheva, L.M., & Obradovic, Z. (2002). Intrinsic
Disorder and Protein Function. Biochemistry, Vol. 41, No. 21, (May 2002), pp. 6573-
6582, ISSN 0006-2960
Emamian, E.S., Kaytor, M.D., Duvick, L.A., Zu, T., Tousey, S.K., Zoghbi, H.Y., Clark, H.B., &
Orr, H.T. (2003). Serine 776 of Ataxin-1 Is Critical for Polyglutamine-Induced
Disease in Sca1 Transgenic Mice. Neuron, Vol. 38, No. 3, (May 2003), pp. 375-387,
ISSN 0896-6273
Evans, P.R., & Owen, D.J. (2002). Endocytosis and Vesicle Trafficking. Current Opinion in
Structural Biology, Vol. 12, No. 6, (December 2002), pp. 814-821, ISSN 0959-440X
Fennen, J., Torda, A.E., & van Gunsteren, W.F. (1995). Structure Refinement with Molecular
Dynamics and a Boltzmann-Weighted Ensemble. Journal of Biomolecular NMR, Vol.
6, No. 2, (September 1995), pp. 163-170, ISSN 0925-2738
Ferron, F., Longhi, S., Canard, B., & Karlin, D. (2006). A Practical Overview of Protein
Disorder Prediction Methods. Proteins, Vol. 65, No. 1, (October 2006), pp. 1-14,
ISSN 1097-0134
Finn, R.D., Mistry, J., Tate, J., Coggill, P., Heger, A., Pollington, J.E., Gavin, O.L.,
Gunasekaran, P., Ceric, G., Forslund, K., Holm, L., Sonnhammer, E.L., Eddy, S.R., &
Bateman, A. (2010). The Pfam Protein Families Database. Nucleic Acids Research,
Vol. 38, Database issue, (January 2010), pp. D211-222, ISSN 1362-4962
Genis, D., Matilla, T., Volpini, V., Rosell, J., Davalos, A., Ferrer, I., Molins, A., & Estivill, X.
(1995). Clinical, Neuropathologic, and Genetic Studies of a Large Spinocerebellar
Ataxia Type 1 (Sca1) Kindred: (Cag)N Expansion and Early Premonitory Signs and
Symptoms. Neurology, Vol. 45, No. 1, (January 1995), pp. 24-30, ISSN 0028-3878
Gibson, T.J. (2009). Cell Regulation: Determined to Signal Discrete Cooperation. Trends in
Biochemical Sciences, Vol. 34, No. 10, (October 2009), pp. 471-482, ISSN 0968-0004
Goold, R., Hubank, M., Hunt, A., Holton, J., Menon, R.P., Revesz, T., Pandolfo, M., &
Matilla-Duenas, A. (2007). Down-Regulation of the Dopamine Receptor D2 in Mice
Lacking Ataxin 1. Human Molecular Genetics, Vol. 16, No. 17, (September 2007), pp.
2122-2134, ISSN 0964-6906
Greaser, M.L., Wang, S.M., Berri, M., Mozdziak, P., & Kumazawa, Y. (2000). Sequence and
Mechanical Implications of Titin's Pevk Region. Advances in Experimental Medicine
and Biology, Vol. 481, pp. 53-63; discussion 64-56, 107-110, ISSN 0065-2598
Iakoucheva, L.M., Brown, C.J., Lawson, J.D., Obradovic, Z., & Dunker, A.K. (2002). Intrinsic
Disorder in Cell-Signaling and Cancer-Associated Proteins. Journal of Molecular
Biology, Vol. 323, No. 3, (October 2002), pp. 573-584, ISSN 0022-2836
Irwin, S., Vandelft, M., Pinchev, D., Howell, J.L., Graczyk, J., Orr, H.T., & Truant, R. (2005).
Rna Association and Nucleocytoplasmic Shuttling by Ataxin-1. Journal of Cell
Science, Vol. 118, No. Pt 1, (January 2005), pp. 233-242, ISSN 0021-9533
Jayaraman, M., Kodali, R., & Wetzel, R. (2009). The Impact of Ataxin-1-Like Histidine
Insertions on Polyglutamine Aggregation. Protein Engineering Design Selection, Vol.
22, No. 8, (August 2009), pp. 469-478, ISSN 1741-0134
Jorgensen, N.D., Andresen, J.M., Lagalwar, S., Armstrong, B., Stevens, S., Byam, C.E.,
Duvick, L.A., Lai, S., Jafar-Nejad, P., Zoghbi, H.Y., Clark, H.B., & Orr, H.T. (2009).
Phosphorylation of Atxn1 at Ser776 in the Cerebellum. Journal of Neurochemistry,
Vol. 110, No. 2, (July 2009), pp. 675-686, ISSN 1471-4159
Klement, I.A., Skinner, P.J., Kaytor, M.D., Yi, H., Hersch, S.M., Clark, H.B., Zoghbi, H.Y., &
Orr, H.T. (1998). Ataxin-1 Nuclear Localization and Aggregation: Role in
Polyglutamine-Induced Disease in Sca1 Transgenic Mice. Cell, Vol. 95, No. 1,
(October 1998), pp. 41-53, ISSN 0092-8674
Konagurthu, A.S., &Lesk, A.M. Cataloging Topologies of Protein Folding Patterns. J Mol
Recognit, Vol. 23, No. 2, (March-April 2010) pp. 253-257, ISSN 1099-1352
Kuszewski, J., Gronenborn, A.M., & Clore, G.M. (1996). Improving the Quality of Nmr and
Crystallographic Protein Structures by Means of a Conformational Database
Potential Derived from Structure Databases. Protein Science, Vol. 5, No. 6, (June
1996), pp. 1067-1080, ISSN 0961-8368
Labeit, S., &Kolmerer, B. (1995). Titins: Giant Proteins in Charge of Muscle Ultrastructure
and Elasticity. Science, Vol. 270, No. 5234, (October 1995), pp. 293-296, ISSN 0036-
8075
Lam, Y.C., Bowman, A.B., Jafar-Nejad, P., Lim, J., Richman, R., Fryer, J.D., Hyun, E.D.,
Duvick, L.A., Orr, H.T., Botas, J., & Zoghbi, H.Y. (2006). Ataxin-1 Interacts with the
Repressor Capicua in Its Native Complex to Cause Sca1 Neuropathology. Cell, Vol.
127, No. 7, (December 2006), pp. 1335-1347, ISSN 0092-8674
Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., McGettigan, P.A., McWilliam, H.,
Valentin, F., Wallace, I.M., Wilm, A., Lopez, R., Thompson, J.D., Gibson, T.J., &
Higgins, D.G. (2007). Clustal W and Clustal X Version 2.0. Bioinformatics, Vol. 23,
No. 21, (November 2007), pp. 2947-2948, ISSN 1367-4811
Letunic, I., Doerks, T., & Bork, P. (2009). Smart 6: Recent Updates and New Developments.
Nucleic Acids Research, Vol. 37, Database issue, (January 2009), pp. D229-232, ISSN
1362-4962
Lim, J., Crespo-Barreto, J., Jafar-Nejad, P., Bowman, A.B., Richman, R., Hill, D.E., Orr, H.T.,
& Zoghbi, H.Y. (2008). Opposing Effects of Polyglutamine Expansion on Native
Protein Complexes Contribute to Sca1. Nature, Vol. 452, No. 7188, (April 2008), pp.
713-718, ISSN 1476-4687
Linding, R., Jensen, L.J., Diella, F., Bork, P., Gibson, T.J., & Russell, R.B. (2003a). Protein
Disorder Prediction: Implications for Structural Proteomics. Structure, Vol. 11, No.
11, (November 2003a), pp. 1453-1459, ISSN 0969-2126
Linding, R., Russell, R.B., Neduva, V., & Gibson, T.J. (2003b). Globplot: Exploring Protein
Sequences for Globularity and Disorder. Nucleic Acids Research, Vol. 31, No. 13,
(July 2003b), pp. 3701-3708, ISSN 1362-4962
Masino, L., Kelly, G., Leonard, K., Trottier, Y., & Pastore, A. (2002). Solution Structure of
Polyglutamine Tracts in Gst-Polyglutamine Fusion Proteins. FEBS Letters, Vol. 513,
No. 2-3, (February 2002), pp. 267-272, ISSN 0014-5793
Mittag, T., & Forman-Kay, J.D. (2007). Atomic-Level Characterization of Disordered Protein
Ensembles. Current Opinion in Structural Biology, Vol. 17, No. 1, (February 2007), pp.
3-14, ISSN 0959-440X
Murzin, A.G. (1993). Ob(Oligonucleotide/Oligosaccharide Binding)-Fold: Common
Structural and Functional Solution for Non-Homologous Sequences. The EMBO
Journal, Vol. 12, No. 3, (March 1993), pp. 861-867, ISSN 0261-4189
Mushegian, A.R., Bassett, D.E., Jr., Boguski, M.S., Bork, P., & Koonin, E.V. (1997).
Positionally Cloned Human Disease Genes: Patterns of Evolutionary Conservation
and Functional Motifs. Proceedings of the National Academy of Sciences U.S.A., Vol. 94,
No. 11, (May 1997), pp. 5831-5836, ISSN 0027-8424
Okazawa, H., Rich, T., Chang, A., Lin, X., Waragai, M., Kajikawa, M., Enokido, Y., Komuro,
A., Kato, S., Shibata, M., Hatanaka, H., Mouradian, M.M., Sudol, M., & Kanazawa,
I. (2002). Interaction between Mutant Ataxin-1 and Pqbp-1 Affects Transcription
and Cell Death. Neuron, Vol. 34, No. 5, (May 2002), pp. 701-713, ISSN 0896-6273
Orr, H.T., Chung, M.Y., Banfi, S., Kwiatkowski, T.J., Jr., Servadio, A., Beaudet, A.L., McCall,
A.E., Duvick, L.A., Ranum, L.P., & Zoghbi, H.Y. (1993). Expansion of an Unstable
Trinucleotide Cag Repeat in Spinocerebellar Ataxia Type 1. Nature Genetics, Vol. 4,
No. 3, (July 1993), pp. 221-226, ISSN 1061-4036
Orr, H.T., & Zoghbi, H.Y. (2007). Trinucleotide Repeat Disorders. Annual Review in
Neuroscience, Vol. 30, pp. 575-621, ISSN 0147-006X
Puntervoll, P., Linding, R., Gemund, C., Chabanis-Davidson, S., Mattingsdal, M., Cameron,
S., Martin, D.M., Ausiello, G., Brannetti, B., Costantini, A., Ferre, F., Maselli, V., Via,
A., Cesareni, G., Diella, F., Superti-Furga, G., Wyrwicz, L., Ramu, C., McGuigan, C.,
Gudavalli, R., Letunic, I., Bork, P., Rychlewski, L., Kuster, B., Helmer-Citterich, M.,
Hunter, W.N., Aasland, R., & Gibson, T.J. (2003). Elm Server: A New Resource for
Investigating Short Functional Sites in Modular Eukaryotic Proteins. Nucleic Acids
Research, Vol. 31, No. 13, (July 2003), pp. 3625-3630, ISSN 1362-4962
Radivojac, P., Obradovic, Z., Brown, C.J., & Dunker, A.K. (2003). Prediction of Boundaries
between Intrinsically Ordered and Disordered Protein Regions. Pacific Symposium
on Biocomputing, Vol. 8, pp. 216-227, ISSN 1793-5091
Radivojac, P., Iakoucheva, L.M., Oldfield, C.J., Obradovic, Z., Uversky, V.N., & Dunker,
A.K. (2007). Intrinsic Disorder and Functional Proteomics. Biophysical Journal, Vol.
92, No. 5, (March 2007), pp. 1439-1456, ISSN 1542-0086
Romero, P., Pbradovic, Z., Kissinger, C.R., Villafranca, J.E., & Dunker, A.K. Identifying
Disordered Regions in Proteins from Amino Acid Sequences; 1997; Houston, TX.
pp. 90-95.
Sampson, E.M., Haque, Z.K., Ku, M.C., Tevosian, S.G., Albanese, C., Pestell, R.G., Paulson,
K.E., & Yee, A.S. (2001). Negative Regulation of the Wnt-Beta-Catenin Pathway by
the Transcriptional Repressor Hbp1. The Embo Journal, Vol. 20, No. 16, (August
2001), pp. 4500-4511, ISSN 0261-4189
Schaeffer, R.D., &Daggett, V. Protein Folds and Protein Folding. Protein Engineering Design
and Selection, Vol. 24, No. 1-2, (January 2010), pp. 11-19, ISSN 1741-0134
Schultz, J., Milpetz, F., Bork, P., & Ponting, C.P. (1998). Smart, a Simple Modular
Architecture Research Tool: Identification of Signaling Domains. Proceedings of the
National Academy of Sciences U S A, Vol. 95, No. 11, (May 1998), pp. 5857-5864, ISSN
0027-8424
Serra, H.G., Duvick, L., Zu, T., Carlson, K., Stevens, S., Jorgensen, N., Lysholm, A., Burright,
E., Zoghbi, H.Y., Clark, H.B., Andresen, J.M., &Orr, H.T. (2006). Roralpha-Mediated
Purkinje Cell Development Determines Disease Severity in Adult Sca1 Mice. Cell,
Vol. 127, No. 4, (November 2006), pp. 697-708, ISSN 0092-8674
Shoemaker, B.A., Portman, J.J., & Wolynes, P.G. (2000). Speeding Molecular Recognition by
Using the Folding Funnel: The Fly-Casting Mechanism. Proceedings of the National
Academy of Sciences U S A, Vol. 97, No. 16, (August 2000), pp. 8868-8873, ISSN 0027-
8424
Sjekloa, L., Pauwels, K., & Pastore, A. (2011) FEBS Journal, Accepted Article; doi:
10.1111/j.1742-4658.2011.08108.x
Tevosian, S.G., Shih, H.H., Mendelson, K.G., Sheppard, K.A., Paulson, K.E., & Yee, A.S.
(1997). Hbp1: A Hmg Box Transcriptional Repressor That Is Targeted by the
Retinoblastoma Family. Genes & Development, Vol. 11, No. 3, (February 1997), pp.
383-396, ISSN 0890-9369
Tompa, P., & Csermely, P. (2004). The Role of Structural Disorder in the Function of Rna and
Protein Chaperones. Faseb Journal, Vol. 18, No. 11, (August 2004), pp. 1169-1175,
ISSN 1530-6860
Tompa, P. (2005). The Interplay between Structure and Function in Intrinsically
Unstructured Proteins. FEBS Letters, Vol. 579, No. 15, (June 2005), pp. 3346-3354,
ISSN 0014-5793
Tompa, P., & Fuxreiter, M. (2008). Fuzzy Complexes: Polymorphism and Structural Disorder
in Protein-Protein Interactions. Trends in Biochemical Sciences, Vol. 33, No. 1,
(January 2008), pp. 2-8, ISSN 0968-0004
Tsai, C.C., Kao, H.Y., Mitzutani, A., Banayo, E., Rajan, H., McKeown, M., & Evans, R.M.
(2004). Ataxin 1, a Sca1 Neurodegenerative Disorder Protein, Is Functionally
Linked to the Silencing Mediator of Retinoid and Thyroid Hormone Receptors.
Proceedings of the National Academy of Sciences U.S.A., Vol. 101, No. 12, (March 2004),
pp. 4047-4052, ISSN 0027-8424
Tsuda, H., Jafar-Nejad, H., Patel, A.J., Sun, Y., Chen, H.K., Rose, M.F., Venken, K.J., Botas, J.,
Orr, H.T., Bellen, H.J., & Zoghbi, H.Y. (2005). The Axh Domain of Ataxin-1
Mediates Neurodegeneration through Its Interaction with Gfi-1/Senseless Proteins.
Cell, Vol. 122, No. 4, (August 2005), pp. 633-644, ISSN 0092-8674
Uversky, V.N. (2002). What Does It Mean to Be Natively Unfolded? European Journal of
Biochemistry, Vol. 269, No. 1, (January 2002), pp. 2-12, ISSN 0014-2956
Vendruscolo, M., & Paci, E. (2003). Protein Folding: Bringing Theory and Experiment Closer
Together. Current Opinion in Structural Biology, Vol. 13, No. 1, (February 2003), pp.
82-87, ISSN 0959-440X
Vendruscolo, M., & Dobson, C.M. (2005). Towards Complete Descriptions of the Free-
Energy Landscapes of Proteins. Philos Transact A Math Phys Eng Sci, Vol. 363, No.
1827, (February 2005), pp. 433-450; discussion 450-432, ISSN 1364-503X
Vierra-Green, C.A., Orr, H.T., Zoghbi, H.Y., & Ferrington, D.A. (2005). Identification of a
Novel Phosphorylation Site in Ataxin-1. Biochimica et Biophysica Acta, Vol. 1744, No.
1, (May 2005), pp. 11-18, ISSN 0006-3002
Ward, J.J., McGuffin, L.J., Bryson, K., Buxton, B.F., & Jones, D.T. (2004a). The Disopred
Server for the Prediction of Protein Disorder. Bioinformatics, Vol. 20, No. 13,
(September 2004a), pp. 2138-2139, ISSN 1367-4803
Ward, J.J., Sodhi, J.S., McGuffin, L.J., Buxton, B.F., & Jones, D.T. (2004b). Prediction and
Functional Analysis of Native Disorder in Proteins from the Three Kingdoms of
Life. Journal of Molecular Biology, Vol. 337, No. 3, (March 2004b), pp. 635-645, ISSN
0022-2836
Wright, P.E., & Dyson, H.J. (1999). Intrinsically Unstructured Proteins: Re-Assessing the
Protein Structure-Function Paradigm. Journal of Molecular Biology, Vol. 293, No. 2,
(October 1999), pp. 321-331, ISSN 0022-2836
Wright, P.E., & Dyson, H.J. (2009). Linking Folding and Binding. Current Opinion in
Structural Biology, Vol. 19, No. 1, (February 2009), pp. 31-38, ISSN 1879-033X
Yue, S., Serra, H.G., Zoghbi, H.Y., & Orr, H.T. (2001). The Spinocerebellar Ataxia Type 1
Protein, Ataxin-1, Has Rna-Binding Activity That Is Inversely Affected by the
Length of Its Polyglutamine Tract. Human Molecular Genetics, Vol. 10, No. 1,
(January 2001), pp. 25-30, ISSN 0964-6906
Zoghbi, H.Y., & Orr, H.T. (2008). Pathogenic Mechanisms of a Polyglutamine Mediated
Neurodegenerative Disease: Sca1. Journal of Biologic Chemistry, Vol. 284, No. 12,
(October 2008), pp. 7425-7429, ISSN 0021-9258
6
Relaxed Linear Separability

(RLS) Approach to Feature
(Gene) Subset Selection
Leon Bobrowski1,2 and Tomasz ukaszuk1
1Faculty of Computer Science, Biaystok University of Technology,
2Institute of Biocybernetics and Biomedical Engineering, PAS, Warsaw
Poland
1. Introduction
Feature selection is one of active research area in pattern recognition or data mining
methods (Duda et al., 2001). The importance of feature selection methods becomes
apparent in the context of rapidly growing amount of data collected in contemporary
databases (Liu & Motoda, 2008).
Feature subset selection procedures are aimed at neglecting as large as possible number of
such features (measurements) which are irrelevant or redundant for a given problem. The
feature subset resulting from feature selection procedure should allow to build a model on
the base of available learning data sets that generalizes better to new (unseen) data. For the
purpose of designing classification or prediction models, the feature subset selection
procedures are expected to produce higher classification or prediction accuracy.
Feature selection problem is particularly important and challenging in the case when the
number of objects represented in a given database is low in comparison to the number of
features which have been used to characterise these objects. Such situation appears typically
in exploration of genomic data sets where the number of features can be thousands of times
greater than the number of objects.
Here we are considering the relaxed linear separability (RLS) method of feature subset
selection (Bobrowski & ukaszuk, 2009). Such approach to feature selection problem refers
to the concept of linear separability of the learning sets (Bobrowski, 2008). The term
relaxation means here deterioration of the linear separability due to the gradual neglect of
selected features. The considered approach to feature selection is based on repetitive
minimization of the convex and piecewise-linear (CPL) criterion functions. These CPL
criterion functions, which have origins in the theory of neural networks, include the cost of
various features (Bobrowski, 2005). Increasing the cost of individual features makes these
features falling out of the feature subspace. Quality the reduced feature subspaces is
assessed by the accuracy of the CPL optimal classifiers built in this subspace.
The article contains a new theoretical and experimental results related to the RLS method of
feature subset selection. The experimental results have been achieved through the analysis,
inter alia, two sets of genetic data.
2. Linear separability of two learning sets

Suppose that m objects Oj described in the database are represented by feature vectors
xj[n] = [xj1,...,xjn]T (j = 1,,m). The feature vectors xj[n] can be treated as points in the n-
dimensional feature space F[n] (xj[n] F[n]). The component xji of the vector xj[n] is the
numerical value of the i-th feature xi of the object Oj. For example, in the case of clinical
database, components xji can be the numerical results of the i-th diagnostic examinations of a
given patient Oj.
Consider two learning sets G+ and G- built from n-dimensional feature vectors xj[n]. The
positive set G+ contains m+ feature vectors xj[n] and the negative set G- contains m- vectors xj[n]:
G+ = {xj[n]: j J+} and G- = { xj[n]: j J-} (1)

where and are disjoined sets
J+ J- (J+ J- =
) of indices j.
The positive set G+ usually contains vectors xj[n] of only one category. For example, the set
G+ may contain feature vectors xj[n] representing patients with cancer and set G- may
represent patients without cancer.
Definition 1: The sets G+ and G- (1) are linearly separable, if and only if there exists such a
weight vector w[n] = [w1,...,wn]T (w[n]Rn) and threshold (R), that all the below
inequalities are fulfilled:
( w[n], ) (xj[n] G+) w[n]Txj[n]
(2)
and (xj[n] G-) w[n]Txj[n]
The parameters w[n] and define the separating hyperplane H(w[n],) in the feature space
F[n] (x[n] F[n]):
H(w[n],) = {x[n]: w[n]Tx[n] = } (3)

If the relations (2) are fulfilled, then all the elements xj[n] of the set are located on the
G+
positive side of the hyperplane H(w[n],) (3) and all the elements of the set G- are located on
the negative side of this hyperplane.
Fig. 1. An example of linearly separable sets G+ (denoted by ) and G- (denoted by ) in the

two-dimensional feature space F[2], where m+ = 8 and m- = 6
Relaxed Linear Separability (RLS) Approach to Feature (Gene) Subset Selection 105
Lemma 1: Such sets G+ and G- (1) which are linearly separable (2) in the feature space F[n], are
also linearly separable in any greater feature space F[n], where F[n] F[n].
The proof of the Lemma 1 is self-evident. The Lemma 1 shows, inter alia, that for any constant
c the sets G+ = {xj[n]: xji c} and G- ={xj[n]: xji c} are linearly separable in each feature space
F[n].
Lemma 2: The sets G+ and G- (1) constructed of linearly independent feature vectors xj[n] are
always linearly separable (2) in the feature space F[n].
The Lemma 2 can be proved by using arguments related to the construction of bases in the
feature space F[n] (Bobrowski, 2005). A base in the feature space F[n] can be created by any n
feature vectors xj[n] which are linearly independent. Such n vectors xj[n] can be separated by
the hyperplane H(w[n],) (3) for any subsets G+ and G- (1).
It can be seen that the linear separability (2) can be formulated equivalently to (2) as
(Bobrowski, 2005):
( v[n+1]) ( yj[n+1] G+) v[n+1]Tyj[n+1] 1

(4)
and ( yj[n+1] G-) v[n+1]Tyj[n+1] -1
where yj[n+1] are the augmented feature vectors, and v[n+1] is the augmented weight vector
(Duda et al., 2001):
(j {1,,m}) yj[n+1] = [xj[n]T, 1]T and v[n+1] = [w[n]T, -]T (5)
The inequalities (4) are used in the definition of the convex and piecewise-linear (CPL)
penalty functions j+(v[n+1]) and j-(v[n+1]).
3. Convex and piecewise linear (CPL) criterion functions

Let us define the convex and piecewise-linear penalty functions j+(v[n+1]) and j-(v[n+1])
using the augmented feature vectors yj[n+1] (5), and the weight vector v[n+1] (Bobrowski,
2005):
1 - v[n+1]Tyj[n+1] if v[n+1]Tyj[n+1] < 1

(yj[n+1] G+) j+ (v[n+1]) = (6)
0 if v[n+1]Tyj[n+1] 1
and
1 + v[n+1]Tyj[n+1] if v[n+1]Tyj[n+1] > -1

(yj[n+1] G-) j- (v[n+1]) = (7)
0 if v[n+1]Tyj[n+1] -1
The penalty function j+(v[n+1]) is equal to zero if and only if the vector
yj[n+1] (yj[n+1] G+) is situated on the positive side of the hyperplane H(v[n+1]) (3) and is not
too near to it (Fig. 2). Similarly, j-(v[n+1]) is equal to zero if the vector yj[n+1] (yj[n+1] G-) is
situated on the negative side of the hyperplane H(v[n+1]) and is not too near to it
(Fig. 3).
The perceptron criterion function (v[n+1]) is defined on the sets G+ and G- (1) as the
weighted sum of the penalty functions j+(v[n+1]) and j-(v[n+1]) (Bobrowski, 2005):
Fig. 2. The positive penalty function j+(v[n+1]) (6).
Fig. 3. The negative penalty function j-(v[n+1]) (7).
(v[n+1]) = j j+(v[n+1]) + j j-(v[n+1]) (8)

j J+ j J-
where nonnegative parameters j determine prices of particular feature vectors xj[n].

We are interested in the finding minimum (vk*[n+1]) of the criterion function (v[n+1]):
(v[n+1]) (v[n+1]) (vk*[n+1]) = * (9)

It has been proved that the minimal value * is equal to zero (* = 0) if and only if the sets
G+ and G- (1) are linearly separable (4) (Bobrowski, 2005).
(* = 0) (G+ and G- are linearly separable (4)) (10)

A modified CPL criterion function (v[n+1]) which includes additional penalty functions
i(v[n+1]) and the costs i (i 0) related to particular features xi has been introduced in order
of the feature selection (Bobrowski, 2005):
- ei[n+1]Tv[n+1] if ei[n+1]Tv[n+1] < 0

(i {1,...,n}) i(v[n+1]) = |wi| = (11)
ei[n+1]Tv[n+1] if ei[n+1]Tv[n+1] 0
and
(v[n+1]) = (v[n+1]) + ii(v[n+1]) (12)

iI
where ( 0) is the cost level, and I = {1,,n}.

Let us relate the hyperplane hj+[n+1] in the parameter space Rn+1 to each augmented feature
vector yj[n+1] (5) from the set G+ (1), and the hyperplane hj-[n+1] to each element yj[n+1] (5)
of the set G-.
(j J+) hj+[n+1] = {v[n+1]: yj[n+1]Tv[n+1] = 1}

(13)
and
(j J-) hj-[n+1] = {v[n+1]: yj[n+1]Tv[n+1] = -1}

The first n unit vectors ei[n+1] = [0,...,0,1,0,...,0]T (i = 1,...,n) without the vector
en+1[n+1] = [0,,0,1]T are used in defining hyperplanes hi0[n+1] in the augmented parameter
space Rn+1 (5):
(i {1,,n}) hi0[n+1] = {v[n+1]: ei[n+1]Tv = 0}= {v[n+1]: vi = 0} (14)

The hyperplanes hj+[n+1], hj-[n+1] and hi0[n+1] divide the parameter space Rn+1 (5) in the
disjoined regions Rl[n+1]. Each region Rl[n+1] is a convex polyhedron in the parameter
space with number of vertices vk[n+1]. The CPL criterion function (v[n+1]) (12) is linear
inside each region Rl[n+1]. It has been shown based on the theory of linear programming
that the minimum of the CPL criterion function (v[n+1]) (13) can be found in one of
vertices vk[n+1] of some region Rl[n+1] (Bobrowski, 2005). Each vertex vk[n+1] in the
parameter space Rn+1 is the intersection point of at lest (n + 1) hyperplanes hj+[n+1], hj-[n+1]
or hi0[n+1]. The below equations are fulfilled in each vertex vk[n+1]:
(j Jk+) yj[n+1]Tvk[n+1] = 1, and

(j Jk-) yj[n+1]Tvk[n+1] = -1, and
(i Ik0) ei[n+1]Tvk[n+1] = 0 (15)
where Jk+and Jk -
are the sets of indices j such hyperplanes hj+[n+1],
hj-[n+1] (13) that pass
through the vertex vk[n+1], Ik0 is the set of indices i such hyperplanes hi0[n+1] (14) that pass
through the vertex vk[n+1].
The above equations can be given in the matrix form:
Bk[n+1] vk[n+1] = k[n+1] (16)

where Bk[n+1] is a non-singular matrix (basis) with the rows constituted by the linearly
independent vectors yj[n+1] (j Jk+ Jk-) or the unit vectors ei[n+1] (i Ik0), and k[n+1] is
the margin vector with components equal to 1, -1 or 0 according to (15).
Remark 1: The number n1 of the independent vectors yj[n+1] in the matrix Bk[n+1] (16) can be
not greater than the rank r of the data set G+ G- (1). So, the number n0 of the unit vectors
ei[n+1] (i Ik0) (15) in the basis Bk[n+1] (16) is not less than n r (n0 n r ).
The vertex vk[n+1] can be computed by using the basis Bk[n+1] and the margin vector
k[n+1] (16):
vk[n+1] = Bk[n+1]-1 k[n+1] (17)

The criterion function (v[n+1]) (12), similarly to the function (v[n+1]) (8) is convex and
piecewise-linear (CPL). The minimum of this function is located in one of the vertices
vk[n+1] (17):
(vk^[n+1]) (v[n+1]) (v[n+1]) (vk^[n+1]) = ^ (18)

The basis exchange algorithms allow to find efficiently the optimal vertex vk^[n+1]
constituting the minimum of the CPL function (v[n+1]) (12), even in the case of large,
multidimentional data sets G+ and G- (1) (Bobrowski, 1991).
Remark 2: Such components wki of the vertex vk[n+1] = [wk[n]T,-k]T = [wk1,...,wkn,-k]T (5)
which are related to the unit vectors ei[n+1] (iIk0) in the basis Bk[n+1] (16) are equal to zero
(wki = 0) (15).
The n0 features xi (i Ik0) (15) with the weights wi equal to zero in the optimal vertex
vk^[n+1] (18) can be reduced without changing the separating hyperplane H(wk^[n+1],k^)
(4). The following rule of feature reduction has been proposed on this base:
(i Ik0) ei[n+1]Tvk^[n+1] = 0 wi = 0 the feature xi is reduced (19)

Remark 3: A sufficiently large increase of the cost level ( 0) in the criterion function
(v[n+1]) (12) results in an increase of the number n0 of unit vectors ei[n+1] in the basis
Bk^[n+1] (16) linked to the optimal vertex vk^[n+1] (18) (Bobrowski, 2005).
An arbitrary number n0 of features xi can be omitted and the feature space F[n] can be
reduced to the subspace Fk^[n - n0] by using of adequate value k of the parameter in the
criterion function (v[n +1]) (12). For example, the value = 0 means that the optimal
vertex vk^[n +1] (18) constitutes the minimum of the perceptron criterion function (v[n+1])
(8) defined in the full feature space F[n]. On the other hand, sufficiently large value of the
parameter results in the optimal vertex vk^[n+1] (18) equal to zero (vk^[n+1] = 0). Such
solution is not constructive, because it means that all the features xi have been reduced (19)
and the separating hyperplane H(w[n],) (3) cannot be defined.
For a given parameter value = k (12) the optimal vertex vk^[n+1] (18) is determined
unambiguously as the minimum (18) of the convex and piecewise linear function
(v[n+1]) (12). This vertex is characterized by the subset of such n - n0 features xi which are
not related to the unit vectors ei[n +1] (iIk0) in the basis Bk^[n +1] (16) related to the optimal
vertex vk^[n+1] (18). The feature subspace Fk^[nk] = Fk^[n - n0] can be also determined by
such n - n0 features xi. Quality of the feature subspace Fk^[nk] can be determined on the basis
of the quality of the optimal linear classifier designed in this subspace of dimensionality nk.
The optimal feature subspace Fk*[nk] can be identified as one that enables create the best
linear classifier. The RLS method of feature subset selection is based on this scheme
(Bobrowski, 2008; Bobrowski & ukaszuk, 2009).
Comparing our approach with the approach based on the least-squares criterion, we can
conclude that the discriminant function based on the least-squares criterion can be linked to
the Euclidean distance L2, whereas our method based on the convex and piece-wise linear
criterion function (CPL) can be linked to the L1 norm distance function.
4. Characteristics of the optimal vertices in the case of linear separabilty

Let us consider the case of long vectors in the exploratory data analysis. In this case, the
dimensionality n of the feature vectors xj[n] is much greater than the number m (n m) of
these vectors (j = 1,, m). We may expect in this case that the vectors xj[n] are linearly
independent (Duda et al., 2001). In accordance with the Lemma 2, the arbitrary sets G+ and G-
(1) of linearly independent vectors xj[n] are linearly separable (6). The minimal value * (9)
of the criterion function (v[n+1]) (8) defined on linearly separable sets G+ and G- (1) is
always equal to zero (* = 0) (Bobrowski,2005). The minimum (vk*[n+1]) (9) of the function
(v[n+1]) (8) can be located in the optimal vertex vk*[n+1] (9), where the below equations
hold (15):
(j Jk+) vk*[n]Tyj[n] = 1
and (j Jk-) vk*[n]Tyj[n] = -1 (20)
where n = n - n0 is the dimensionality of the reduced feature vectors yj[n] obtained from
yj[n+1] (5) after neglecting n0 features xi related to the set Ik0 (15) and vk*[n] is the reduced
vertex obtained from vk*[n+1] (9) by neglecting n0 components wi equal to zero (wi = 0).
The vectors yj[n] belong to the reduced feature subspace Fk[n] (yj[n] Fk[n]). We can
remark that if the learning sets G+[n] and G-[n] constituted from the vectors yj[n] are
linearly separable (4) in a given feature subspace Fk[n], there may be more than one optimal
vertex vk*[n] creating the minimum (9) of the function k(v[n]) (8) (k(vk*[n]) = 0). In this
case, each optimal vertex vk*[n] linearly separates (4) the sets G+[n] and G- [n] (Bobrowski,
2005):
(yj[n] G+[n]) vk*[n]Tyj[n] 1

and (yj[n] G-[n]) vk*[n]T yj[n] -1 (21)
Moreover, in the case of long vectors there may exist many such feature subspaces Fk[n] of
a given feature space F[n] (Fk[n]F[n]) which can assure the linear separability (21).
Therefore, a question arises which of the vertices vk*[n] constituting the minimum (9) of the
perceptron function (v[n+1]) (8) is the best one.
The answer for a such question can be given on the basis of minimization of the modified
criterion function (v[n+1]) (12). In contrary to the perceptron criterion function
(v[n+1]) (8) the modified criterion function (v[n+1]) (12) has only one optimal vertex
vk^[n+1] (16). The vertex vk^[n+1] (16) which constitutes minimum (18) of the function
(v[n+1]) (12) is unambiguously determined and can be treated as the optimal one.
It can be proved that the modified criterion function (v[n+1]) (12) with a sufficiently small
cost level ( 0), has the minimal value (18) in the same vertex vk*[n+1] (9) as the
perceptron criterion function (v[n+1]) (8) (Bobrowski, 2005):
( max) ( (0, max)) (v[n+1]) (v[n+1]) (vk*[n+1]) (22)

In other words, the replacement of the perceptron criterion function (v[n+1]) (8) by the
modified criterion function (v[n+1]) (12) does not necessarily mean changing the position
of the minimum.
The modified criterion function (v[n+1]) (12) can be expressed in the following manner
for such points v[n+1] which separate linearly (4) the sets G+ and G- (1):
(v[n+1]) = ii(v[n+1]) = i|vki| (23)

iI iI
Therefore, the minimization of the criterion function (v[n+1]) (12) can be replaced by the
minimization of the function (v[n+1]) (23) under the condition that the point v[n+1]
linearly separates (4) the sets G+ and G- (1).
Remark 5: If the sets G+ and G- (1) are linearly separable, then the vertex vk*[n+1] constituting
the minimum of the function (v[n+1]) (23) with equal feature costs i has the lowest L1
norm vk*[n+1]||L1 = i |vki| among all such vectors v[n+1] which linearly separate (4)
these sets.
The Remark 5 points out a possible similarity between the CPL solution vk*[n+1] (22) and the
optimal vector v*[n+1] obtained in the Support Vector Machines (SVM) approach (Vapnik,
1998). But the use of the CPL function (v[n+1]) (12) also allows obtain other types of
solutions vk*[n+1] (22) by another specification of feature costs i and the cost level
parameters. The modified criterion function (v[n+1]) (12) gives possibility to introduce
different feature costs i (i 0) related to particular features xi. As a result,
the outcome of feature subset selection process can be influenced by the feature costs
i (12).
5. Relaxed linear separability (RLS) approach to feature selection

The initial feature space F[n] (xj[n]F[n]) is composed of the all n features xi from a given set
{x1, xn}. Feature reduction rule (19) results in appearance of the feature subspaces Fk[nk]
(Fk[nk] F[n] and nk n).
Successive increase of the value of the cost level in the criterion function (v[n+1]) (12)
allows to reduce (19) additional features xi and, as a result, allows generate the descended
sequence of feature subspaces Fk[nk]:
F[n] F1[n1] F2[n2] Fk[nk], where nk nk + 1 (24)
The sequence (24) of the feature subspaces Fk[nk] is generated in a deterministic manner on
the basis data sets G+ and G- (1) in accordance with the relaxed linear separability (RLS)
method (Bobrowski & ukaszuk, 2009). Each step Fk[nk] Fk+1[nk+1] is realized by an
adequate increase k k+1 = k + k (where k > 0) of the cost level in the criterion
function (w[n],) (12).
One of the problems in applying the RLS method is to assess the quality characteristics of
successive subspaces Fk[nk] (24). In this approach, a quality of a given subspace Fk[nk] is
evaluated on the basis of the optimal linear classifier designed in this subspace. The better
optimal linear classifier means the better feature subspace Fk[nk].
The feature subspace Fk[nk] can be obtained from the initial feature space F[n] by reducing
the n - nk features xi. Such reduction can be based on the optimal vertex vk^[n+1] (18) with
the related basis Bk^[n+1] (16). The optimal vertex vk^[n+1] (18) appoints the minimum of
the criterion function (v[n+1]) (12) with the adequate value k of the cost level .
Definition 2: The reduced feature vectors yj[nk] (yj[nk]Fk[nk]) are obtained from the feature
vectors yj[n+1] = [xj[n]T,1]T (5) after neglecting n - nk features xi related to the set Ik0 (15) of
the optimal vertex vk^[n+1] (18). The reduced vertex (parameter vector) v^[nk]=[w^[nk-1]T,-^]T
(5) and vk^[nk] is obtained from the optimal vertex vk^[n+1] (18) by neglecting of these n - nk
components wi, which are equal to zero (wi = 0).
The reduced parameter vector v[nk] = [w[nk-1]T,-]T (5) defines the linear classifier LC(v[nk])
in the feature subspace Fk[nk]. The linear classifier LC(v[nk]) can be characterized by the
following decision rule:
if v[nk]T y[nk] 0, then y[nk] is allocated to the category +

if v[nk]T y[nk] 0, then y[nk] is allocated to the category - (25)
where y[nk] Fk[nk], and the category (class) + is represented by elements xj[n] of the
learning set G+ (1) and the category - is represented by elements of the set G-.
Definition 3: The CPL optimal linear classifier LC(v*[nk]) is defined in the feature subspace
Fk[nk] by a reduced parameter vector v*[nk] that constitutes the minimum * = k(v*[nk]) (9)
of the perceptron criterion function k(v[nk]) (8).
The perceptron criterion function k(v[nk]) is defined (8) on reduced feature vectors yj[nk]
(yj[nk]Fk[nk]) that belong to the reduced learning set G+[nk] or G-[nk] (1).
G+[nk] = {yj[nk]: j J+} and G-[nk] = {yj[nk]: j J-} (26)

Remark 6: The minimal value k* of the criterion function k(v[nk]) (8) on reduced feature
vectors yj[nk] is equal to zero (k* = 0 ) if and only if the sets G+[nk] and G-[nk] are linearly
separable (4) in the feature subspace Fk[nk] (similarly as (10)) (Bobrowski, 2005).
It has been proved that, if the learning sets G+[nk] and G-[nk] (26) are linearly separable (4),
then the decision rule (25) based on the optimal vector vk*[nk] (9) allocates correctly all
elements yj[nk] of these learning sets (Bobrowski, 2005). It means that (21):
(yj[nk] G+[nk]) v*[nk]Tyj[nk] 0, and

(yj[nk] G-[nk]) v*[nk]Tyj[nk] 0 (27)
If the setsG+[nk] and G-[nk] (26) are not linearly separable (4), then not all but only a majority
of the vectors yj[nk] fulfil the above inequalities.
According to the considerations of the previous paragraph, if the learning sets
G+[nk] and G-[nk] (26) are linearly separable (4), then there is more than one vertex vi*[nk]
forming a minimum of the function k(v[nk]) (8). To avoid such ambiguity, the criterion
function k(v[nk]) (8) can be replaced by the modified criterion function k(v[nk]) (12) with
the small value (22) of the parameter .
6. Evaluation of linear classifiers

The quality of the linear classifier LC(v*[nk]) (25) can be evaluated by using the error
estimator (apparent error rate) ea(v*[nk]) as the fraction of wrongly classified elements yj[nk] of
the learning sets G+[nk] and G-[nk] (26):
ea(v*[nk]) = me(v*[nk]) / m (28)

where m is the number of all elements yj[nk] of the learning sets G+[nk] and G-[nk] (26) xj[n],
and me(v*[nk]) is the number of elements yj[nk] wrongly allocated by the rule (25).
The parameters v*[nk] of the linear classifier LC(v*[nk]) (25) are estimated from the learning
sets G+[nk] and G-[nk] (26) through minimization of the perceptron criterion function
k(v[nk]) (8) determined on elements yj[nk] of these sets. It is known that if the same data
yj[nk] is used for classifier designing and for classifier evaluation, then the evaluation results
are too optimistic (biased). The error rate (28) evaluated on the elements yj[nk] of the learning
sets is called the apparent error (AE). For example, if the learning sets G+[nk] and G-[nk] (26)
are linearly separable (4), then the relation (27) holds and, as a result, the apparent error (28)
evaluated on elements yj[nk] is equal to zero (ea(v*[nk]) = 0). But it is observed in practice
that the error rate of the classifier (25) evaluated on new vectors y[nk] is usually greater than
zero.
For the purpose of the classifiers bias reducing, the cross validation procedures are applied
(Lachenbruch, 1975). The term p-fold cross validation means that the learning sets G+[nk] and
G-[nk] (26) have been divided into p parts Gi, where i = 1,,p (for example p = 10). The
vectors yj[nk] contained in p 1 parts Gi are used for definition of the criterion function
k(v[nk]) (8) and computing of the parameters v*[nk]. The remaining vectors yj[nk] are used
as the test set (one part Gi) for computing (evaluation) the error rate e(v*[nk]) (28). Such
evaluation is repeated p times, and each time different part Gi is used as the test set. The
cross valid1ation procedure allows to use different vectors yj[nk] (1) for the classifier (25)
designing and evaluation (28) and as a result, to reduce the bias of the error rate estimation
(28). The error rate (28) estimated during the cross validation procedure will be called the
cross-validation error (CVE).
The CVE error rate eCVE(v*[nk]) (28) of the linear classifier (25) is used in the relaxed linear
separability (RLS) method as a basic criterion in evaluation of particular feature subspaces
Fk[nk] in the sequence (24) (Bobrowski & ukaszuk, 2009). Feature subspace Fk[nk] that is
linked to the linear classifier LC(v*[nk]) (25) with the lowest CVE error rate eCVE(v*[nk]) can be
considered as the optimal one in accordance with the RLS method of feature selection.
7. Toy example
The data set used in the experiment was generated by the authors. In the two-dimensional
space seven points were selected. Four of them were assigned to the positive set G+, three to
the negative set G-. The allocation of points to the sets G+ and G- were made in a way that the
linear separability of sets was preserved. After that each point was extended to 10
dimensions. The values the remaining coordinates were drawn from the distribution N(0,1).
Table 1 contains the complete data set. Features x2 and x7 constitute the coordinates of points
in the initial two-dimensional space.
Previously described the RLS method was applied to the data set presented in Table 1. Table
2 shows a sequence of feature subsets studied by the method and values of the apparent error
(28) and the cross-validation error obtained in particular subsets of features. The best subset of
features designated by the method is a subset Fk[2] = {x7, x2}. It is characterized by the lowest
value of the cross-validation error.
x1 x2 x3 x4 x5 x6 x7 x8 x9 x10 subset
x1[10] 0,04 -0,20 0,66 0,83 0,12 -0,06 2,70 -0,37 0,04 -0,43 G+
x2[10] -1,47 0,70 1,16 -0,54 -0,15 -0,47 1,80 0,24 0,12 0,15 G+
x3[10] 0,34 1,10 0,27 0,22 2,45 1,19 1,30 0,45 -1,06 -1,25 G+
x4[10] -1,44 2,60 1,23 -1,86 -0,31 1,26 -0,30 0,34 0,19 0,14 G+
x4[10] -0,48 -0,80 -0,55 -0,77 -0,13 0,41 1,10 -0,13 -0,83 -0,97 G-
x6[10] 0,54 0,20 -0,53 0,90 -0,25 0,54 0,30 -0,34 -0,60 0,70 G-
x7[10] -0,06 1,20 1,65 -1,77 0,34 1,41 -0,80 -0,65 0,98 -0,27 G-
Table 1. Feature vectors xj[10] constituting the sets G+ and G-
Subset of features AE CVE

Fk[5] = {x7, x2, x1, x8, x3} 0 0,28571
Fk[4] = {x7, x2, x8, x3} 0 0,14286
Fk[3] = {x7, x2, x3} 0 0,14286
Fk[2] = {x7, x2} 0 0
Fk[1] = {x7} 0,2619 0,28571
Table 2. Subsets of features evaluated by the RLS method, apparent error rate (AE) and cross-
validation error rate (CVE) obtained in particular subsets of features
Fig. 4. Points in the feature space selected by the RLS method, hyperplane separated points
falling within the sets G+ (denoted by circles) and G- (denoted by squares)
The RLS method in addition to the designation of the best subset of features has also
determined the hyperplane separating objects from the sets G+ and G-.
H(w[2],) = {x[2]: 1,0204 x7 + 1,0884 x2 = 1,5238} (29)

8. Experiment on synthetic data

The data set used in the experiment contained 1000 objects, each described by 100 features.
Data were drawn from a multivariate normal distribution. The values of each feature had a
mean equal to 0 and standard deviation equal to 1. All the features were independent of
each other (diagonal covariance matrix). The objects were divided into two disjoined subsets
G+ and G- (1) in accordance with the values of the following linear combination:
3x4+4x10-7x17+2x28-6x36+3x41+3x58-8x63+x75-x92+5 (30)
Objects corresponded to the value of expression (30) greater than 0 were assigned to subset
G+. Objects corresponded to the value of expression (30) less than 0 were assigned to subset
G-. The result was two linearly separable subsets G+ and G- (1) containing 630 and 370
objects.
The RLS method of feature selection was applied in analysis of the so-prepared synthetic
data. The expected result was the preference by the method the subset of features used in
the expression (30).
Figure 4 shows the apparent error (AE) and cross-validation error (CVE) values in the various
tested features subspaces generated by the RLS method. Each subspace larger than 10
features ships with all 10 features used in the expression (30). Subspace of size 10 consists
only of the features used in the expression (30).
Fig. 5. The apparent error (AE) and the cross-validation error (CVE) in different feature
subspaces Fk[nk] of the synthetic data set
9. Experiment on the Leukemia and the Breast cancer data sets

The Leukemia (Golub et al., 1999) data set contains expression levels of 7129 genes taken over 72
samples. Labels of objects indicate which of two variants of leukemia is present in the sample:
acute myeloid (AML, 25 samples), or acute lymphoblastic leukemias (ALL, 47 samples).
The Breast cancer (vant Veer et al., 2002) data set describes the patients tested for the presence
of breast cancer. The data contains 97 patient samples, 46 of which are from patients who had
developed distance metastases within 5 years (labelled as relapse), the rest 51 samples are
from patients who remained healthy from the disease after their initial diagnosis for interval of
at least 5 years (labelled as non-relapse). The number of genes is 24481.
subspaces Fk[nk] of the Leukemia data set
Fk[7] Fk[3]
feature name
weights wi weights wi
attribute4951 -0,99614 -1,71845
attribute1882 -0,73666 -11,6251
attribute3847 -0,55316 -
attribute6169 -0,47317 -
attribute4973 0,41573 -
attribute6539 -0,25898 -
attribute1779 -0,1519 -1,69028
threshold -0,55316 2,53742
Table 3. Features xi constituting the optimal subspace Fk[7] characterised by the lowest cross-
validation error (CVE) and features xi constituting the lowest subspace Fk[3] with apparent
error (AE) equal to 0 of the Leukemia data set
Original data sets come with training and test samples that were drawn from different
conditions. Here we combine them together for the purpose of cross validation. Data have
also been standardized before experiment.
subspaces Fk[nk] of the Breast cancer data set
Fk[14] Fk[11]
feature name
weights wi weights wi
Contig32002_RC 0,81467 1,89334
NM_000127 0,76305 2,67913
Contig412_RC -0,71647 -
D86979 0,65172 -
Contig38438_RC -0,63018 -1,58491
NM_016153 0,62345 1,81026
NM_015434 0,58631 1,43095
NM_013360 -0,58122 -1,38681
NM_002200 0,47752 1,94796
Contig44278_RC -0,42246 -0,906564
NM_019886 0,4143 2,75393
AF055033 0,37546 1,24607
AL080059 0,31843 1,50648
NM_000909 -0,27537 -
threshold 0,1117 -0,247492
Table 4. Features xi constituting the optimal subspace Fk[14] characterised by the lowest
cross-validation error (CVE) and features xi constituting the lowest subspace Fk[11] with
apparent error (AE) equal to 0 of the Breast cancer data set
Figures 6 and 7 show the apparent error (AE) and cross-validation error (CVE) obtained in
different feature subspaces generated by the RLS method. Full separability of data subsets is
preserved in feature subsets much smaller than the initial very large sets of genes.
10. Conclusion
The problem of feature selection is usually resolved in practice through the evaluation of the
usefulness (the validity) of individual features (attributes, factors) (Liu & Motoda, 2008). In
this approach, resulting feature subsets are composed of such features which have the
strongest individual influence on the analysed outcome. Such approach is related to the
assumption about the independence of the factors. However, in a complex system, such as
the living organism, these factors are often related. An advantage of the relaxed linear
separability (RLS) method is that one may identify directly and efficiently a subset of
features that influences the outcome and assesses the combined effect of these features as
prognostic factors.
In accordance with the RLS method, the feature selection process involves two basic actions.
The first of these actions is to generate the descending sequence (24) of feature subspaces
Fk[nk]. The second of the these actions is to evaluate the quality of the individual feature
subspaces Fk[nk] in the sequence (24).
Generation of descending sequence (24) of feature subspaces Fk[nk] is done in the
deterministic manner by multiple minimization of the criterion function the criterion
function (v[n+1]) (12) combined with gradual increasing of the parameter value. The
criterion function (v[n+1]) (12) depends on the three nonnegative parameters: j - prices of
the particular feature vectors xj[n] (1), i - feature costs, and - the cost level. The
composition of the consecutive feature subspaces Fk[nk] (24) depends on the choice of these
parameters. For example, the costly features xi should have a sufficiently large values of the
parameter i. A high value of the parameter i increases the chance for elimination of a given
feature xi.
Evaluation of the quality of the individual feature subspaces Fk[nk] is based in the RLS
method on the cross-validation of the CPL optimal (Definition 3) linear classifier (25)
designed in this subspace. The optimal linear classifier (25) is designed in the feature
subspace Fk[nk] through the multiple minimization of the perceptron criterion function
k(v[nk]) defined (8) on the reduced feature vectors yj[nk] (yj[nk]Fk[nk]) or the modified
criterion function k(v[nk]) (12) with a small value (22) of the cost level .
This article also contains a description of the experiments with feature selection based on the
RLS method. Experiments of the first group were carried out on synthetic data. The
multivariate synthetic data were generated randomly and deterministically divided into two
learning sets according of predetermined key. The given key was in the form of linear
combination of the unknown number of selected features. The aim of the experiment was to
find an unknown key, based on available sets of multidimensional data. The experiment
confirmed this possibility.
Experiments of the second group were carried out on the genetic data sets Leucemia (Golub
et al., 1999) and Brest cancer (vant Veer et al., 2002). These experiments have shown, inter
alia, that the RLS method enables finding interesting and not too large subsets of features,
even if the number of features at the beginning is a huge. For example, in the case of the
Brest cancer set, the feature space was reduced from the dimensionality n = 24481 till nk = 11
while the linear separability (27) of the learning sets G+[nk] and G-[nk] (26) were preserved.
The results of calculations described in this paper were obtained by using its own
implementation of the basis exchange algorithms (http://irys.wi.pb.edu.pl/dmp).
Calculations in so high dimensional feature space F[n] as n = 24481 were made possible by
achieving a high efficiency of these algorithms.
11. Acknowledgment
This work was supported by the by the NCBiR project N R13 0014 04, and partially financed
by the project S/WI/2/2011 from the Biaystok University of Technology, and by the project
16/St/2011 from the Institute of Biocybernetics and Biomedical Engineering PAS.
12. References
Bobrowski, L. (1991). Design of piecewise linear classifiers from formal neurons by some
basis exchange technique, In: Pattern Recognition, 24(9), pp. 863-870
Bobrowski, L. & ukaszuk, T. (2004). Selection of the linearly separable feature subsets, In:
Artificial Intelligence and Soft Computing - ICAISC 2004, eds. L. Rutkowski et al.,
Springer Verlag, pp. 544-549
Bobrowski, L. (2005). Eksploracja danych oparta na wypukych i odcinkowo-liniowych funkcjach
kryterialnych (Data mining based on convex and piecewise linear (CPL) criterion
functions) (in Polish), Biaystok University of Technology
Bobrowski, L. (2008). Feature subsets selection based on linear separbilty, In: Lecture Notes of
the VII-th ICB Seminar: Statistics and Clinical Practice, ed. by H. Bacelar-Nicolau, L.
Bobrowski, J. Doroszewski, C. Kulikowski, N. Victor, June 2008, Warsaw
Bobrowski L. & ukaszuk T. (2009). Feature selection based on relaxed linear separability,
In: Biocybernetical and Biomedical Engineering, vol.29, nr 2, pp. 43-58
Duda, O. R.; Hart, P. E. & Stork D. G. (2001). Pattern Classification, J. Wiley, New York
Fukunaga, K. (1972). Introduction to Statistical Pattern Recognition, Academic Press
Golub, T. R., et al. (1999). Molecular classification of cancer: class discovery and class
prediction by gene expression monitoring, Sciences, 286, pp. 531537
Guyon, I.; Weston, J.; Barnhill, S. & Vapnik, V. N. (2002). Gene Selection for Cancer
Classification using Support Vector Machines, In: Machine Learning, 46, pp. 389-422
Lachenbruch, P.A. (1975). Discriminant Analysis, Hafner Press, New York.
Liu, H. & Motoda, H. (Eds.) (2008). Computational Methods of Feature Selection, Chapmann &
Hall/CRC, New York
Vapnik, V. N. (1998). Statistical Learning Theory, J. Wiley, New York
vant Veer, L. J., et al. (2002). Gene expression profiling predicts clinical outcome of breast
cancer, Nature, 415(6871), pp. 530536
0
7
Disease Gene Prioritization

Carlos Roberto Arias1 , Hsiang-Yuan Yeh2 and Von-Wun Soo1,2
1 Institute of Information Systems and Applications, National Tsing Hua University
2 Computer Science Department, National Tsing Hua University
Taiwan, ROC
1. Introduction
The identication of genes is an ongoing research issue in the biomedical and bioinformatics
community. The Human Genome Project which was completed in 2003, identied
approximately 20,000+ genes in the human DNA, but there are still many of these genes
for which their function or role is unknown, and this accounts only for healthy DNA.
Genetic diseases like Cancer, Alzheimer, Hemophilia and others, have mechanisms that we
currently just started to understand. For instance, genes BRCA1 and BRCA2, famous for
their role in breast cancer (Friedman et al., 1994), only account for 5% of the incidence of the
aforementioned cancer (Oldenburg et al., 2007). Many questions rise: What are the rest of
the mechanisms involved in this cancer type? Are there other genes involved? How? This
only accounts for one type of cancer, and there are at least 177 different types according to
the National Cancer Institute 1 . The straightforward method to deal with this problem is
to do wet lab experiments with large samples of normal and disease tissue, to test under
different conditions the reactions, and check the expression or lack of it in different genes.
The complication with this method is the cost, it takes time, it requires specialized equipment,
and thus the economic price tag is high. Fortunately the bioinformatics area has acquired
maturity during the recent years, biological data is becoming available in different formats
throughout different databases and publications are providing new insights. Thanks to these,
computational methods can be developed, methods that would save time, effort and money,
methods that could help biomedical researchers get clues on which genes to explore on the
wet laboratory, so that time is not wasted on genes that are unlikely to contribute in a given
disease.
Gene Prioritization methods can be used to nd genes that were previously unknown to be
related to a given disease. The general denition of gene prioritization is: Given a disease D, a
candidate gene set C, and the training data T, then input all these data to the method and it will
compute a score for each of the candidate genes, higher scoring genes are supposed to be the
genes that are most likely related to disease D, see g. 1. Methods can be classied according
to the type of input data that the method uses, as Text and Data Mining Methods and Network
Based Methods. Text and Data Mining methods use training data like genetic localisation,
gene expression, phenotypic data (van Driel et al., 2003), PubMeb abstracts (Tifn et al., 2005),
spatial gene expression proles, linkage analysis (Piro et al., 2010), gene ontology and others
(Adie et al., 2005; Ashburner et al., 2000; Schlicker et al., 2010); as the name suggests this
1 http://www.cancer.gov/cancertopics/alphalist
120
Bioinformatics
methods mine the genome or mine the available biomedical literature to produce the scores
of the candidate genes. Network Based Methods, use biological networks (Chen et al., 2009;
Morrison et al., 2005) as the back bone of the prioritization method, however, some network
based methods also combine some data and text mining techniques to improve their results
(Aerts et al., 2006; Hutz et al., 2008).
The purpose of this chapter is to give an introduction into the Gene Prioritization Problem.
Following the introduction a section explaining Biological Networks is presented as this is
necessary background to understand the network based prioritization methods. After this
section, we discuss about current state of the art prioritization methods with emphasis in
network based methods. Next sections discuss our own prioritization method that is a
network based method with a novel microarray data integration. A discussion on Challenges
and Future Research opportunities follows and nally the conclusions of this chapter along
with a list of available resources for Gene Prioritization.
Fig. 1. General Gene Prioritization Overview
2. Biological networks
2.1 Graph theory background
A graph is a data structure that represents a set of relationships between elements or objects.
Formally a graph G is a pair dened by G = (V, E ), where V is a set of elements that
represent the nodes or vertices of the graph, the vertices in most applications hold the
name of the attribute being represented. E is the set of edges, where each edge represent
a relation between two vertices, an edge is dened by E = {(u, v)| u, v V }, this edges
may hold additional information as weight, condence or distance between nodes, therefore
having E = {(u, v, w)| u, v V and w Re}. The edges may represent direction, where
(u, v) = (v, u ), in which case the graph is called directed graph, and when direction is not
important, the graph is called undirected graph.
Graph Properties
Among the intrinsic properties of a graph we have: Nodes, the number of nodes in the
network, formally n = |V |. Edges, the number of edges in the graph, formally e = | E |.
Connectivity is a property of the graph, it is dened to be connectivity( G ) = Ne where
N = (n2 ) is the maximum number of possible edges the graph can have. A graph with
connectivity values closer to one would be called dense, and if the connectivity value is close
to zero the graph would be called sparse, it is worth mentioning that there is no agreed
exact value to consider a graph sparse or dense among the graph theory community. The
Disease
Disease Gene Gene Prioritization
Prioritization 1213
diameter of a graph is the distance of the longest shortest path on the graph. Graph Path, is
a sequence of vertices of the form {v1 , v2 , v3 , ..., vk } where v1 is the starting node and vk is the
destination node, and (vi , vi+1 ) E; the length of the path is dened by l = ik=11 wi where
wi (vi , vi+1 , wi ), when all weights are equal to 1 then the length of the path is k 1. A
shortest path from vertex v to u is one of the paths that has the least accumulated weight from
u to v, note that there can be multiple shortest paths from one node to another.
Nodes Properties
The most basic node property is the degree that denotes the number of connections a node
has; in directed graphs there can be a distinction between incoming and outgoing connections,
called in-degree and out-degree respectively. Several measures of centrality have been created
to represent how central a node with respect to the other nodes in the graph, this measures
are: Closeness Centrality, based in the average shortest path to the other vertices in the
network; Betweenness Centrality, based on the occurrence of the vertex in the shortest paths
of the network, Eigenvalue Centrality, based in the eigenvector of the adjacency matrix that
represents the graph (Freeman, 1979).
2.2 Biological networks overview

In this section a brief background on biological networks is presented. As it was explained
in the previous section, a graph, or network, is a set of relationship between objects, in
the specic case of biological networks those objects are related to biological processes.
Typical biological networks include: gene regulation networks, signal transduction networks,
metabolic networks and protein interaction networks (PIN) (Junker & Schreiber, 2008). Gene
regulation networks, also known as signal transcriptional regulation networks, represent
how genes control the expression of other genes; these networks are often represented by
directed graphs. Signal transduction networks are an extension of gene regulation networks
that represents the links between intracellular processes to extracellular functions in response
to diverse external events and stimuli. The nal target in a signal transduction pathway
is either a transcription factor or a metabolic enzyme. Metabolic networks are determined
through biochemical experiments, and consist in metabolites converting into each other with
the interaction of enzymes. The last of the typical biological networks are the PINs, they
represent the interaction between different gene products, they are usually modeled with
undirected networks, indicating only that there is a probable functional relation between the
two related proteins without indicating direction. Some other networks exist that represent
specic problem oriented networks, like (Yeh et al., 2009) that identies genetic regulatory
network in prostate cancer using microarray data. Fig. 2 and Fig. 3 show the general structure
of a biological network and a sample of a PIN.
2.3 Protein interaction networks

These networks are the central focus of attention in the network based disease gene
prioritization, so they deserve special attention. There are four main approaches to create
PIN: high throughput technology, manual curation from published experiments results,
automatic text mining from published literature and computational prediction from diverse
genomic data (Wu et al., 2008). Some publicly available databases hold high quality, manually
curated PIN, such as HPRD (Prasad et al., 2009), BIND (Bader et al., 2003) and BioGRID
(Breitkreutz et al., 2008), in our work we have used BioIR (Liu et al., 2009) which integrates the
previously mentioned databases along with DIP (Salwinski et al., 2004), IntAct (Aranda et al.,
2010), MIPS (Pagel et al., 2005) and MINT (Ceol et al., 2010).
122
Bioinformatics
Fig. 2. Structure of a Biological Network
Fig. 3. Sample of Human PIN
2.3.1 Creation and curation of PIN

Current PIN databases are a rich resource of protein interactions, they mostly differ on the way
they acquire their data, or on the way they validate it. For instance HPRD, BIND, BioGRID,
MINT and MIPS are manually curated, this means a team of biologists check the literature
to nd new interactions, and once an interaction is conrmed it is added to the database.
On the other hand DIP and IntAct are based on literature mining, they achieve this using
computational methods that retrieve the interaction knowledge automatically from published
papers. Another method to create PIN is using microarray data samples, these methods rely
Disease
Prioritization 1235
on the principle that co-expressing genes must be related, so by using statistical methods they
can produce the list of likely relationships from the list of gene products in the microarray
data.
2.3.2 Properties of PIN

PIN are known to have the following properties:
Sparseness, although there is no one preset value of connectivity, it has been showed that
biological networks are sparse containing much less than O(n2 ) edges in the network. Due
to this property biological networks can be stored more efciently in memory, and some
algorithms exploit it to improve signicantly their time performance.
Small World, the concept was originated in the social sciences to explain how inside social
networks the path length to go from one node to another is very small. However this is a
subjective measure that lacks statistical or objective measure for actual networks. A more
precise property that is seen in most empirical networks is Power law degree distribution,
where the networks show that some few vertices have high degree and much more vertices
have very low degree (Barabasi & Albert, 1999). Recent research has shown that biological
networks do not necessarily follow power law degree distribution, but conrm that the
distribution of degrees is heavy tailed (Garcia De Lomana et al., 2010).
One of the disadvantageous properties of PIN is that they have a noisy nature, there is a
enormous amount of missing information and false positives in the data (Edwards et al.,
2002), therefore this fact must be taken into consideration when dealing with this kind of
networks.
As a consequence of the small world property, few nodes have high degree value, and it
has been discovered that these nodes play an important role in the network, as opposed to
other nonessential genes.
Motifs, deep analysis in PIN has shown that there are recurrent subnetworks appearing in
the full network, these subnetworks are called motifs. They have been discovered using
statistical tools and showing that they occur more in the network than just by random
coincidence (Junker & Schreiber, 2008).
3. Previous and on-going research

As was discussed in the introduction of the chapter prioritization methods can be classied
as text and data mining based and network based methods. The main difference between the
different approaches is the kind of data they use to do the prioritization of the candidate set.
3.1 Text and data mining methods

These methods usually rank candidate genes by matching their information and prole
across multiple biological data sources. GeneSeeker is a web tool that selects candidate
genes of the interest disease based on gene expression and phenotypic data from human
and mouse (van Driel et al., 2003). eVOC system performs candidate gene selection based
on the co-occurrence of disease name in PubMed abstracts through data-mining methods
(Tifn et al., 2005). DGP (Disease Gene Prediction) (Lpez-Bigas & Ouzounis, 2004) and
PROSPECTS (Adie et al., 2005) use basic sequence information to classify genes as likely or
unlikely to be involved with the disease under study. The extended version of PROSPECTS,
SUSPECTS (Adie et al., 2006), is developed by integrating annotation data from Gene
124
Bioinformatics
Ontology (GO) (Ashburner et al., 2000), InterPro and expression data. However, many of the
methods suffer from limitations imposed by the data source which has little knowledge about
the disease. GO terms include a brief description of the corresponding biological function
of the genes but only 60% of all human genes have associated GO terms and these terms
may be inconsistent due to differences in curators judgment (Dolan et al., 2005). Due to
the incomplete data, the approaches reduce the probability to rank the candidate genes of
a specic disease.
Most recent methods of this kind of prioritization include MedSim (Schlicker et al., 2010)
and a method based on spatially mapped gene expression (Piro et al., 2010). MedSim uses
GO enrichment and applies their own similarities measures (Schlicker et al., 2007), by doing
so they manage to extend the existing annotations to achieve the assignment of known
disease genes to the correct phenotypes. The spatially mapped gene expression method
uses a combination of data including linkage analysis, differential expression to acquire the
list of candidates genes, then by using the phenotypes and associated phenotypes they nd
reference genes which in turn are ltered with the spatial gene-expression data; then by using
both the candidate genes and the reference genes they apply their method to do the gene
ranking.
3.2 Network based methods

As the name suggests these methods primarily use biological networks to do the prioritization
process, this is mainly due to the increasing availability of human protein interaction data,
and the emergence of network analysis. These methods usually rely on the the assumption
that genes that are associated with diseases have a heavy interaction with each other
(Erten & Koyutrk, 2010). Fig. 4 shows a general overview of these type of methods. The
input that they commonly receive is the set of seed genes S that represent the previous
knowledge to the method, genes that are known to be related to some disease D, along with
these genes a score of how much they are related to the disease is given, denoted by (v, D ).
The other part of the input is the genome of the organism represented by its PIN, denoted
in the picture as the candidate set C. After the method calculates the score, just like any other
method, it outputs the set of candidate genes with their score, where higher scores have higher
probability of being related to disease D.
Fig. 4. Network Based Gene Prioritization Methods

Furthermore, network based methods can be classied in local and global methods. Local
methods use local information to the seed genes, basically classifying by network proximity
Disease
Prioritization 1257
through the inspection of the direct neighbors of the seed genes or higher order neighbors in
other words nodes in the network that are not directly adjacent to the seed nodes but are easily
reached by them. Global methods model the ow through the whole network to provide a
score of the connectivity and impact of the seed genes or previous knowledge on the rest of
the nodes.
Network based gene prioritization is performed by assessing how much genes interact
together and are close to known disease genes in protein networks. Endeavour takes a
machine learning approach by building a model with initial known disease-related genes
as training set, then that model is used to rank the test set of candidate genes according
to the similarity score using multiple genomic data sources(Aerts et al., 2006). Chen et al.
applied link based strategies widely used in social and web network analyses such as HITS
with priors, PageRank, and K-step Markov to prioritize disease candidate genes based on
protein networks (Chen et al., 2009). Ma et al. developed a system for gene prioritization
by Combining Gene expression and protein-protein Interaction network (CGI) using Markov
random eld theory (Ma et al., 2007). CANDID used information from publications, protein
domain descriptions, cross-species conservation measures, gene expression proles and
protein-protein interactions to do a prioritization algorithm on candidate genes that inuence
complex human traits (Hutz et al., 2008). GeneRank ranks genes based on Googles PageRank
algorithm and expression data to do gene prioritization(Morrison et al., 2005). Ozgur et al.
explored the connectivity properties of biological networks to compute an association score
between candidate and disease-related genes (zgr et al., 2008). Mani et al. proposed
a method called Interactome Dysregulation Enrichment Analysis (IDEA) to predict cancer
related genes using interactome and microarray data (Mani et al., 2008). Karni, Soreq,
and Sharan attempted to predict the causal gene from expression prole data and they
identied a set of disease-related genes that could best explain the expression changes of the
disease-related genes in terms of probable pathways leading from the causal to the affected
genes in the network (Karni et al., 2009).Tables 1 and 2 show a summary of the aforementioned
methods.
4. Gene prioritization from microarray data based on shortest paths GP-MIDAS

In this section we present our current advances in our own method: Gene Prioritization from
MIcroarray DAta on Shortest Paths (GP-MIDAS). Our approach differs from other network
based methods in the way that we assign the weights to the edges of the PIN, by doing so we
manage to get considerable performance compared to other state of the art methods.
4.1 Material
We applied GP-MIDAS for the study of prostate cancer, using the following data sources:
PIN: Taking advantage of the availability of public protein interaction databases, and
to have a more complete protein-protein interaction network, we integrated PIN data
warehouse including HPRD, DIP, BIND, IntAct, MIPS, MINT and BioGrid databases which
has successfully gathered 54,283 available and non-redundant PIN pairs among 10,710
proteins into BioIR database (Liu et al., 2009).
Microarray Data: We integrated microarray data taken from (Lapointe et al., 2004) that
consists of 72 primary tumors and 41 normal control sample in Stanford Microarray
Database (SMD) (Hubble et al., 2009).
126
Bioinformatics
Method Brief Description
Gene Seeker Gene Expression and Phenotypic Data from Human and Mouse
(van Driel et al., 2003)
eVOC Co-Occurrence of disease name on PubMed abstracts (Tifn et al.,

2005)
DGP Basic Sequence Information (Lpez-Bigas & Ouzounis, 2004)
PROSPECTS Basic Sequence Information (Adie et al., 2006)
SUSPECTS Extension of PROSPECTS, incorporates GO (Adie et al., 2005;

Ashburner et al., 2000)
MedSim Gene Ontology enrichment with their functional similarity measures

(Schlicker et al., 2010)
Spatially Mapped 3D Gene Expression Data, Expression Proles, Phenotype data

Expression (Piro et al., 2010)
Limitations Generally imposed by the data source which carries little knowledge
about the disease. For instance GO terms include brief description
of the corresponding biological function of the genes but only 60%
of all human genes have associated GO terms, and they may be
inconsistent due to differences in curators judgement (Dolan et al.,
2005).
Table 1. Data and Text Mining Gene Prioritization Methods
Seed Genes: The initial seed genes known to be related to the prostate cancer are
extracted from public Online Mendelian Inheritance in Man (OMIM) database which stores
gene-disease associations provided by summaries of publications. The list of the seed
genes are shown in Table 3.
Test Genes: We took the KEGG pathway database (Kanehisa et al., 2004) and PGDB
database (Li et al., 2003) that are manually curated database for prostate cancer and
obtained 102 genes as the truly disease-related genes for prostate cancer. We use this set to
test the accuracy of our method.
4.2 Input preparation

The collected material needs to be prepared to be useful for our method, the details on this
procedure are presented as follows.
4.2.1 Cope with missing values

The microarray dataset consists of N genes and M experiments and can be represented as an
M N matrix. It presents different gene expression levels Xij | (i M, j N ) in this matrix.
Gene expressions either over-expressed or under-expressed can be revealed in terms of two
colored channel in the microarray data representing the intensity of the cancer and normal
samples, with values ranging from 0 to 255. The gene expression ratios were calculated as
Disease
Prioritization 1279
Method Brief Description Data Sources
Endeavor Machine Learning: Using initially known BIND

disease genes; then multiple genomic data
sources to rank (Aerts et al., 2006)
HITS with Priors Prioritization Based on Networks
HPRD, BIND,
using Social and Web Networks
PageRank BioGRID
Analysis (Chen et al., 2009)
K-Step Markov
CGI Combination of Protein Interaction MIPS, DIP

Network and Gene Expression using
Markov Random Field Theory (Ma et al.,
2007)
CANDID Uses Publications, Protein domain NCBI Conserved Domain
descriptions, cross species conservation Database
measures, gene expression proles and
Protein Interaction Networks (Hutz et al.,
2008)
GeneRank Based on Googles PageRank algorithm, GO and Synthetic Networks
uses expression data (Morrison et al., 2005)
IDEA Uses the Interactome and Microarray data B Cell Interactome and
(Mani et al., 2008) OMIM
CIPHER Based on the assembly of a HPRD and OMIM

Gene-Phenotype Network (Wu et al.,
2008)
zgr et al. (2008) Using connectivity properties of the Literature Mining by GIN
networks
Karni et al. (2009) Veries expression changes of downstream HPRD
genes
Limitations Most of these approaches include additional interactions

predicted from co-expression, pathway, functional or
literature data, but still fail to incorporate weights
expressing the condence on the evidence of the
interactions.
GP-MIDAS Our proposed method, integrates Protein Interaction
Network with Normal and Disease Microarray Data,
using this integration we apply all-pairs shortest paths to
nd the signicant networks and calculate the score for
the genes.
Table 2. Network Based Gene Prioritization Methods

128
Bioinformatics
Gene ID Gene Symbol Gene name

367 AR Androgen receptor
675 BRCA2 Breast cancer type 2 susceptibility protein
3732 CD82 CD82 antigen
11200 CHEK2 Serine/threonine-protein kinase Chk2
60528 ELAC2 Zinc phosphodiesterase ELAC protein 2
2048 EPHB2 Ephrin type-B receptor 2 precursor
3092 HIP1 Huntingtin-interacting protein 1
1316 KLF6 Krueppel-like factor 6
8379 MAD1L1 Mitotic spindle assembly checkpoint protein MAD
4481 MSR1 Macrophage scavenger receptor types I and II
4601 MXI1 MAX-interacting protein 1
7834 PCAP Predisposing for prostate cancer
5728 PTEN/ PTENP1 Phosphatidylinositol-3,4,5-trisphosphate
3-phosphatase and dual- specicity protein
phosphatase PTEN
6041 RNASEL 2-5A-dependent ribonuclease
5513 HPC1 Hereditary prostate cancer 1
Table 3. Seed Genes of Prostate Cancer from OMIM Database
the median value of the pixels minus background pixel median value for one color channel
divided by the same for the other channel because the mean value of the normalized ratio is
much easier to be affected by noise than the median value. We applied the base-2 logarithmic
transformation of each gene among experimental dataset and this value carried out the
normalization of the gene expression value with mean 0 and standard deviation 1 in every
experiment. Although microarray can be used to detect thousands of genes under a variety
of conditions, there are still many missing values in microarray (Troyanskaya et al., 2001).
The reasons for missing values include insufcient resolution, image corruption, and dust or
scratches on the slide. If a gene contains many missing values in experiments, it is not easy to
determine a precise expression value for each gene that causes a difculty in the subsequent
analysis of the regulation networks. However, we can not simply remove all gene data that
contains missing values because the number of remaining genes will become too small to
predict the network correctly. In order to get a better result, the genes that contain less than
20% entries missing in all experiment are picked. In order to get as complete data as possible,
we use the K-Nearest-Neighbors (KNN) algorithm (Troyanskaya et al., 2001) to estimate the
missing values.
4.2.2 Update of microarray expression values

Once the necessary microarray data is collected, we need to preprocess it, so that it becomes
ready to be used in our methods. The preprocessing procedure consists of two steps:
1. Transform the Microarray Data Expression Values. The purpose of this transformation
is to make the expression values ready to be used as weights in the network. This
transformation has two steps, initially the values are updated using a sample of normal
expression microarray data, the effect of this operation is that values that are very
similar between normal and cancer samples should have less impact on our analysis. To
accomplish this we subtract the value from the cancer microarray data to the value of
Disease
Prioritization 129
11
the normal expression data as shown in Equation 1. The next step is to transform the
values, the rationale behind this transformation is that expression values may be negative
for under expressed genes, and if these values are used as they are, our network may have
negative weights, thus making shortest paths analysis more difcult. Equation 2 shows
how the expression values are transformed.
ExpressionValuei = ExpressionValuei NormalExpresionValuei (1)

| ExpresionValuei | min
Trans f ormedExpresionValuei = ln (2)
max min
Considering that the sign of of the value in the microarray data represents over or under
expression, and the fact that we want to make a representation of distance, for this is what
we want in our quantitative analysis, we use the absolute value of the microarray data,
then these results are normalized, using the max and min values found, by doing these two
steps we get values in the range [0, 1], where values closer to 1 mean that they are more
expressed (either over expressed or under expressed). Finally we compute the negative
of the natural logarithm on the previous results, this is to make smaller numbers (less
expression level) become large distances, and bigger numbers (higher expression level)
become short distances. The result of this step is a transformation of the gene expression,
where more expressed genes have smaller value, and less expressed genes have higher
values, in the next step we convert this values into distances between genes, thus more
expressed genes relationships will become shorter distances than less expressed genes
relationships. In the case the ExpresionValuei == min we just set the whole result to
be a big value, since ln(0) is not dened.
2. Convert to Human Protein Interaction Network to a Weighted Network. Since we need
the network to become a weighted one, where these weights are related to the specic
interactions in cancer related network, we use the transformed values of the microarray
data. However the microarray data provides transformed expression values for the genes,
not for the relationship between genes. The Pearson correlation coefcient for analyzing
gene-pair relationships could be unsuitable to explore the true gene relationship because
it is overly sensitive to the shape of an expression curve (Kim et al., 2007).To overcome
this issue, we combine the values of the two interacting genes together. For instance
if we have microarray values {(SEPW1, 4.097), (BRCA1, 1.395), (AKT1, 2.006), (BACH1,
2.823), (AHNAK, 3.597)} and we have the following edges in our graph {(AKT1, AHNAK),
(BACH1, BRCA1), (BRCA1, AKT1)}, then the rst edge weight would be the addition of the
transformed expression values of each of the vertices 2.006 + 3.597 = 5.603 providing the
weight of the rst edge. The resulting weighted edges of this instance would be {(AKT1,
AHNAK, 5.603), (BACH1, BRCA1, 4.218), (BRCA1, AKT1, 3.401)}.
4.3 Method description

Our current method is based on the analysis of the shortest paths between all the pairs of the
genes on the input network.
4.3.1 Shortest paths analysis

Genes co-occurring in a particular network tend to participate together in related biological
processes based on their linkage with the known disease genes (Tin et al., 2009). Our
methodology is based in the the computation of all pairs shortest paths (APSP) in the network
130
Bioinformatics
and the retrieval of these paths for posterior analysis in our experiments. The computation
of APSP is carried out using our implementation of the all pairs shortest paths algorithm
(Arias & Soo, 2010), which takes advantage of the topology and special characteristics of
biological networks, such as sparseness and singles, nodes that have only one connection.
We call our implementation KC-APSP. At this step of the process we input our prepared PIN
and get as result a list of all the shortest paths between all the pair combination of the genes.
4.3.2 Scoring of genes on shortest paths

Once all the shortest paths are computed, we traverse the list of shortest paths (PathList),
to verify if any of the seed genes are on the resulting paths, if so, these paths need to be
considered for the scoring. Finally a score is computed for each gene. This analysis is done
across M microarray data experiments.
4.3.3 Compute the score function

Having all the paths stored in PathListm for m M we can compute the denominator denomm ,
to be used in the score function using Equation 3, this is done for each microarray experiment
m.
n
1
denomm = (3)
i =1
l im
Where l im is the length of the i th path in sample m M for n generated and ltered by seed set
paths. Once the denominator is ready, we proceed to compute the score. For each experiment
m of M, and for each gene g on the network we compute the score for each gene according to
Equation 4.
PathListm 1
l j,m
Score( Genei,m ) = denomm
(4)
Gene i,m Path j,m
The motivation behind Equation 4 is that a gene that appears in more generated paths is going
to achieve higher score, even higher for paths with shorter length, the highest being 1 if the
gene appears in all the found paths.
5. Current results
In this section we present our current results, rst we discuss the leave one out cross
validation, and lastly we present the precision and recall of our method compared to other
methods that use similar data sources to GP-MIDAS. As it is shown in this section, our method
presents promising results that can lay the foundation for more advanced and accurate
approaches.
5.1 Leave-one-out cross validation of our method

The performance of our algorithm was evaluated by leave-one-out cross validation method. In
each experimental test on a known-disease gene set S, known as the Seed Set, which contains
| S | genes; we delete one gene g from the Seed Set thus having S = S g. We used S set to
train our prioritization model. Then, we prioritized the Candidate Gene Set to determine the
rank of that deleted gene g. We got 100% to cover the deleted genes from the Candidate Gene
Set and the rankness of those seed genes are listed in Table 4; LOO Score Position refers to the
result of GP-MIDAS after deleting the given gene g from the seed set, Closeness Centrality
Disease
Prioritization 131
13
Recovered Subnetworks All Seed Genes Subnet.

Gene LOO Score Position Closeness Centrality Closeness Centrality
Position Position
AR 1 2 2
PTEN 6 23 24
BRCA2 10 36 26
EPHB2 13 46 42
HIP1 14 43 43
CHEK2 15 35 34
RNASEL 19 53 53
MXI1 20 58 58
MAD1L1 21 53 47
ELAC2 22 61 63
KLF6 26 42 40
MSR1 27 61 62
CD82 33 54 50
Table 4. Leave One Out Experiment Results
on Recovered Network refers to this centrality measure on the induced subgraph made from
the seed set without the given gene g and all the shortest paths generated by this set pairs,
and the last column refers to the centrality measure position on the full network for the given
gene g. In order to realize the performance of gene prioritization with the weighted graph
based on the gene expression, we compare the closeness centrality position in the entire PIN
and sub-networks reconstructed from seed genes. From the entire network and sub-network
of the seed genes using closeness properties, only 1 original seed genes rank among its top 20
ranking genes. However, we recover 8 seed genes among top 20 ranking genes. The results
conrmed that PIN without any gene expression have more false positive and our method
integrated gene expression is potentially able to perform better in the identication of genes
associated with a given disease and should be more informative.
5.2 The precision and recall comparison with previous methods

We evaluated the performance of our algorithm in terms of overall precision versus recall
when varying the rank threshold. Precision is the fraction of true gene-disease associations
that ranked within the top k% in the corresponding trial of the cross validation procedure.
Recall is the fraction of trials in which the disease-related genes from PGDB was recovered
as one of the top k% scoring ones. We compare the performance with the following network
based methods: GeneRanker, ENDEAVOUR, HITS with priors, PageRank, K-step Markov and
CIPHER. In GeneRanker, we do not use 543 genes reported to be associated to prostate cancer
in the literature but applied the seed as presented in the list of genes in Table 3. We set a back
probability of 0.3 for PageRank with priors and HITS with priors, this value is selected because
(Chen et al., 2009) express that this is the optimal value for back probability, and step size 6
for K-Step Markov method in ToppNet. Further, we reason that the use of literature evidence
in this benchmark test would unfairly improve ENDEAVOURs performance because these
literatures may include direct evidence that reports the association between the gene and
the disease. Neither one of these methods rank the seed genes therefore we only compare
the performance with all the genes in the candidate set except the seed genes. Among the
top 10 genes, we got 4 prostate cancer-related genes while applying both normal and cancer
132
Bioinformatics
Precision (%)
Top K 10 20 30 40 50
Methods
HITS with Priors 40 25 23.3 17.5 18
K-Step Markov 20 20 20 22.5 18
PageRank 20 15 20 17.5 18
GeneRanker 30 20 20 20 18
Endeavour 10 15 20 20 20
CIPHER 10 10 10 20 20
GP-MIDAS 40 30 23.3 17.5 20
Table 5. Precision for Top K Rank Comparison Across Methods
Recall (%)
Top K 10 20 30 40 50
Methods
HITS with Priors 4.5 5.6 7.9 7.9 10.1
K-Step Markov 2.2 4.5 6.7 10.1 10.1
PageRank 2.2 3.4 6.7 7.9 10.1
GeneRanker 3.4 4.5 6.7 9 10.1
Endeavour 1 2.9 5.9 7.8 14.6
CIPHER 1.1 2.2 3.4 9.0 11.2
GP-MIDAS 4.5 6.7 7.9 7.9 14.6
Table 6. Recall for Top K Rank Comparison Across Methods
samples and the performance is equal to the HITS with priors which is the highest one from
the previous methods. We also get the highest precision among the top 50 ranking genes.
Tables 5 and 6 denote that our method gets the highest precision and recall. Using the different
expression values between cancer and normal samples may help us to extract more signicant
genes and rank them to be higher. Fig. 5 shows the combined precision and recall value using
F-Measure, in the gure can be clearly seen that in most instances GP-MIDAS outperforms
other methods.
6. Challenges and future research opportunities

As it was previously discussed gene prioritization methods can be either data and text mining
based or network based, however the division line between these two approaches is less clear
every day as some methods integrate both approaches and use more information to improve
the accuracy of the results. Despite the increase of accuracy, the main challenge is to nd
novel genes that are actually involved with a given disease, genes that have not been reported
before, presenting the problem of proving that the newly found genes are in fact involved with
the disease. Therefore it becomes essential to present more and better biological explanations
on the denition of newer approaches, by doing so biomedical researchers will have more
condence in trying the novel genes in in-vitro experiments. One clear research opportunity is
presented, and it is the combination of different network based approaches, by using local and
global information. The work of (Erten & Koyutrk, 2010) shows promising results, aiming
at the discovery of loosely connected genes using statistical correction schemes that help
overcome the preference of straightforward method for genes with high centrality values; this
Disease
Prioritization 133
15
Fig. 5. F-Measure of different methods applied to Prostate Cancer
aproach uses only global methods, (Navlakha & Kingsford, 2010) combines several network
based methods to produce a new score which also shows a potential new research line.
7. Conclusions
The past few years have shown an increasing interest in the disease gene prioritization
problem and thanks to the availability of more and better data sources there has been a
growing number of methods and approaches to this problem. A plethora of methods have
become available for the genetics disease research community, and as the methods become
more mature the results will become increasingly accurate and more biologically meaningful.
Our own approach GP-MIDAS has proven to be promising showing a better performance
in most instances to related methods, exposing that by setting the weights of the PIN to have
more related meaning to the given disease the results can be better than previous plain shortest
paths methodologies.
8. Acknowledgments
This research is partially supported by the Bioresources Collection and Research Center of
Linko Chang Gung Memorial Hospital and National Tsing Hua University of Taiwan R. O.
C. under the grant number 98N2424E1, and the Universidad Tecnolgica Centroamericana in
Honduras.
Resources
In this last section we present online resources, please note that since this is an evolving eld,
some of these resources can change with time. For a list of projects hosting biological networks
134
Bioinformatics
see Table 7; these sites have the capability of being queried for specic proteins, or the user
can also download the interaction network that is needed for his particular research. For a
list of sites that offer online diseases information or software tools for disease information see
Table 8. For a list of sites that offer online ontologies or software tools for ontologies see Table
9. And for a list of sites that offer online prioritization or software tools to do prioritization
see Table 10.
Human Protein HPRD http://www.hprd.org
Reference Database
Biomolecular Interaction BIND http://bond.unleashedinformatics.com
Network Database
Biological General BioGRID http://thebiogrid.org/
Repository for
Interaction Datasets
Database of Interacting DIP http://dip.doe-mbi.ucla.edu/
Proteins
IntAct Molecular IntAct http://www.ebi.ac.uk/intact/
Interaction Database
The MIPS Mammalian MIPS http://mips.helmholtzmuenchen.de/proj/ppi/
Protein-Protein
Interaction Database
Molecular Interaction MINT http://mint.bio.uniroma2.it/mint/
Database
Kyoto Encyclopedia of KEGG http://www.genome.jp/kegg/
Genes and Genomes
National Center NCBI http://www.ncbi.nlm.nih.gov/
for Biotechnology
Information
Table 7. Available Biological Networks Sites
Online Mendelian OMIM http://www.ncbi.nlm.nih.gov/omim

Inheritance in Man
The Human Gene GeneCards http://www.genecards.org/
Compendium
Genetic Association GAD http://geneticassociationdb.nih.gov/
Database
Catalog of Published GWAS http://www.genome.gov/gwastudies/
Genome Wide
Association Studies
Table 8. Available Disease Information Sites
Gene Ontology (The Gene Ontology Consortium, 2008) http://www.geneontology.org/

eVOC Ontology (Kelso et al., 2003) http://www.evocontology.org/
InterPro (Hunter et al., 2009) http://www.ebi.ac.uk/interpro/
Table 9. Available Biological Ontology Sites
Disease
Prioritization 135
17
MedSim http://www.funsimmat.de/
Endeavor http://homes.esat.kuleuven.be/ bioiuser/endeavour/index.php
ToppGene http://toppgene.cchmc.org/
Cypher http://rulai.cshl.edu/tools/cipher/
CANDID https://dsgweb.wustl.edu/hutz/candid.html
SUSPECTS http://www.genetics.med.ed.ac.uk/suspects/
GP-MIDAS http://bioir.cs.nthu.edu.tw/bne
Table 10. Available Gene Prioritization Sites
9. References
Adie, E. A., Adams, R. R., Evans, K. L., Porteous, D. J. & Pickard, B. S. (2005). Speeding disease
gene discovery by sequence based candidate prioritization., BMC Bioinformatics 6(1).
URL: http://dx.doi.org/10.1186/1471-2105-6-55
Adie, E. A., Adams, R. R., Evans, K. L., Porteous, D. J. & Pickard, B. S. (2006). Suspects:
enabling fast and effective prioritization of positional candidates., Bioinformatics
22(6): 7734. URL: http://www.biomedsearch.com/nih/SUSPECTS-enabling-fast-effective
-prioritization/16423925.html
Aerts, S., Lambrechts, D., Maity, S., Van Loo, P., Coessens, B., De Smet, F., Tranchevent,
L.-C. C., De Moor, B., Marynen, P., Hassan, B., Carmeliet, P. & Moreau, Y. (2006).
Gene prioritization through genomic data fusion., Nature biotechnology 24(5): 537544.
URL: http://dx.doi.org/10.1038/nbt1203
Aranda, B., Achuthan, P., Alam-Faruque, Y., Armean, I., Bridge, A., Derow, C., Feuermann,
M., Ghanbarian, A. T., Kerrien, S., Khadake, J., Kerssemakers, J., Leroy, C., Menden,
M., Michaut, M., Montecchi-Palazzi, L., Neuhauser, S. N., Orchard, S., Perreau, V.,
Roechert, B., van Eijk, K. & Hermjakob, H. (2010). The IntAct molecular interaction
database in 2010, NUCLEIC ACIDS RESEARCH 38(Suppl. 1): D525D531.
Arias, C. R. & Soo, V.-W. (2010). Computing all pairs shortest paths on graphs with articulation
points, Under Review .
Ashburner, M., Ball, C. A., Blake, J. A., Botstein, D., Butler, H., Cherry, J. M., Davis, A. P.,
Dolinski, K., Dwight, S. S., Eppig, J. T., Harris, M. A., Hill, D. P., Issel-Tarver, L.,
Kasarskis, A., Lewis, S., Matese, J. C., Richardson, J. E., Ringwald, M., Rubin, G. M.
& Sherlock, G. (2000). Gene ontology: tool for the unication of biology. the gene
ontology consortium., Nature genetics 25(1): 2529.
URL: http://dx.doi.org/10.1038/75556
Bader, G., Betel, D. & Hogue, C. (2003). BIND: the Biomolecular Interaction Network
Database, NUCLEIC ACIDS RESEARCH 31(1): 248250.
Barabasi, A. & Albert, R. (1999). Emergence of scaling in random networks, SCIENCE
286(5439): 509512.
Breitkreutz, B.-J., Stark, C., Reguly, T., Boucher, L., Breitkreutz, A., Livstone, M., Oughtred,
R., Lackner, D. H., Bahler, J., Wood, V., Dolinski, K. & Tyers, M. (2008). The
BioGRID interaction database: 2008 update, NUCLEIC ACIDS RESEARCH 36(Sp. Iss.
SI): D637D640.
Ceol, A., Aryamontri, A. C., Licata, L., Peluso, D., Briganti, L., Perfetto, L., Castagnoli, L.
& Cesareni, G. (2010). MINT, the molecular interaction database: 2009 update,
NUCLEIC ACIDS RESEARCH 38(Suppl. 1): D532D539.
136
Bioinformatics
Chen, J., Bardes, E. E., Aronow, B. J. & Jegga, A. G. (2009). Toppgene suite for gene list
enrichment analysis and candidate gene prioritization., Nucleic acids research 37(Web
Server issue): gkp427+.
URL: http://dx.doi.org/10.1093/nar/gkp427
Dolan, M. E., Ni, L., Camon, E. & Blake, J. A. (2005). A procedure for assessing go annotation
consistency, Bioinformatics 21(suppl_1): i136143.
URL: http://dx.doi.org/10.1093/bioinformatics/bti1019
Edwards, A., Kus, B., Jansen, R., Greenbaum, D., Greenblatt, J. & Gerstein, M. (2002). Bridging
structural biology and genomics: assessing protein interaction data with known
complexes, TRENDS IN GENETICS 18(10): 529536.
Erten, S. & Koyutrk, M. (2010). Role of centrality in network-based prioritization of disease
genes, in C. Pizzuti, M. Ritchie & M. Giacobini (eds), Evolutionary Computation,
Machine Learning and Data Mining in Bioinformatics, Vol. 6023 of Lecture Notes in
Computer Science, Springer Berlin / Heidelberg, pp. 1325.
Freeman, L. (1979). Centrality in social networks: Conceptual clarication, Social Networks
1(3): 215239.
URL: http://dx.doi.org/10.1016/0378-8733(78)90021-7
Friedman, L., Ostermeyer, E., Szabo, C., Dowd, P., Lynch, E., Rowell, S. & King, M. (1994).
Conrmation of brca1 lay analysis of germline mutations linked to breast and
ovarian-cancer in 10 families, Nature genetics 8(4): 399404.
Garcia De Lomana, A. L., Beg, Q. K., De Fabritiis, G. & Villa-Freixa, J. (2010). Statistical
Analysis of Global Connectivity and Activity Distributions in Cellular Networks,
Journal of Computational Biology 17(7): 869878.
Hubble, J., Demeter, J., Jin, H., Mao, M., Nitzberg, M., Reddy, T. B., Wymore, F., Zachariah,
Z. K., Sherlock, G. & Ball, C. A. (2009). Implementation of genepattern within the
stanford microarray database., Nucleic acids research 37(Database issue).
URL: http://dx.doi.org/10.1093/nar/gkn786
Hunter, S., Apweiler, R., Attwood, T. K., Bairoch, A., Bateman, A., Binns, D., Bork, P., Das,
U., Daugherty, L., Duquenne, L., Finn, R. D., Gough, J., Haft, D., Hulo, N., Kahn, D.,
Kelly, E., Laugraud, A., Letunic, I., Lonsdale, D., Lopez, R., Madera, M., Maslen, J.,
McAnulla, C., McDowall, J., Mistry, J., Mitchell, A., Mulder, N., Natale, D., Orengo,
C., Quinn, A. F., Selengut, J. D., Sigrist, C. J. A., Thimma, M., Thomas, P. D., Valentin,
F., Wilson, D., Wu, C. H. & Yeats, C. (2009). InterPro: the integrative protein signature
database, NUCLEIC ACIDS RESEARCH 37(Sp. Iss. SI): D211D215.
Hutz, J., Kraja, A., McLeod, H. & Province, M. (2008). Candid: a exible method
for prioritizing candidate genes for complex human traits., Genetic Epidemiology
32(8): 779790.
URL: http://www.ncbi.nlm.nih.gov/pubmed/18613097
Junker, B. H. & Schreiber, F. (eds) (2008). Analysis of Biological Networks, Wiley Series on
Bioinformatics: Computational Techniques and Engineering, John Wiley & Sons, Inc.,
Hoboken, New Jersey, USA.
Kanehisa, M., Goto, S., Kawashima, S., Okuno, Y. & Hattori, M. (2004). The kegg resource for
deciphering the genome., Nucleic acids research 32(Database issue): D277280.
URL: http://dx.doi.org/10.1093/nar/gkh063
Karni, S., Soreq, H. & Sharan, R. (2009). A network-based method for predicting
disease-causing genes, Journal of Computational Biology 16(2): 181189.
URL: http://dx.doi.org/10.1089/cmb.2008.05TT
Disease
Prioritization 137
19
Kelso, J., Visagie, J., Theiler, G., Christoffels, A., Bardien, S., Smedley, D., Otgaar, D.,
Greyling, G., Jongeneel, C., McCarthy, M., Hide, T. & Hide, W. (2003). eVOC:
A controlled vocabulary for unifying gene expression data, GENOME RESEARCH
13(6): 12221230.
Kim, K., Jiang, K., Zhang, S., Cai, L., beum Lee, I., Feldman, L. & Huang, H. (2007). Measuring
similarities between gene expression proles through new data transformations,
BMC Bioinformatics 8: 29.
Lapointe, J., Li, C., Higgins, J., van de Rijn, M., Bair, E., Montgomery, K., Ferrari, M., Egevad,
L., Rayford, W., Bergerheim, U., Ekman, P., DeMarzo, A., Tibshirani, R., Botstein, D.,
Brown, P., Brooks, J. & Pollack, J. (2004). Gene expression proling identies clinically
relevant subtypes of prostate cancer, Proceedings of the National Academy of Sciences of
the United States of America 101(3): 811816.
Li, L.-C., Zhao, H., Shiina, H., Kane, C. J. & Dahiya, R. (2003). Pgdb: a curated and integrated
database of genes related to the prostate, Nucleic Acids Research 31(1): 291293.
Liu, H.-C., Arias, C. R. & Soo, V.-W. (2009). Bioir: An approach to public domain resource
integration of human protein-protein interaction, The proceeding of the Seventh Asia
Pacic Bioinformatics Conference.
Lpez-Bigas, N. & Ouzounis, C. A. (2004). Genome-wide identication of genes likely to be
involved in human genetic disease., Nucleic Acids Res 32(10): 31083114.
URL: http://dx.doi.org/10.1093/nar/gkh605
Ma, X., Lee, H., Wang, L. & Sun, F. (2007). Cgi: a new approach for prioritizing genes
by combining gene expression and protein-protein interaction data, Bioinformatics
23(2): 215221.
URL: http://dx.doi.org/10.1093/bioinformatics/btl569
Mani, K. M., Lefebvre, C., Wang, K., Lim, W. K. K., Basso, K., Dalla-Favera, R. & Califano,
A. (2008). A systems biology approach to prediction of oncogenes and molecular
perturbation targets in b-cell lymphomas., Molecular systems biology 4.
URL: http://dx.doi.org/10.1038/msb.2008.2
Morrison, J. L., Breitling, R., Higham, D. J. & Gilbert, D. R. (2005). Generank: using search
engine technology for the analysis of microarray experiments., BMC Bioinformatics
6: 233. URL: http://www.biomedsearch.com/nih/GeneRank-using-search-engine-technology/
16176585.html
Navlakha, S. & Kingsford, C. (2010). The power of protein interaction networks for associating
genes with diseases, BIOINFORMATICS 26(8): 10571063.
Oldenburg, R. A., Meijers-Heijboer, H., Cornelisse, C. J. & Devilee, P. (2007). Genetic
susceptibility for breast cancer: How many more genes to be found?, CRITICAL
REVIEWS IN ONCOLOGY HEMATOLOGY 63(2): 125149.
zgr, A., Vu, T., Erkan, G. & Radev, D. R. (2008). Identifying gene-disease associations using
centrality on a literature mined gene-interaction network, ISMB, pp. 277285.
Pagel, P., Kovac, S., Oesterheld, M., Brauner, B., Dunger-Kaltenbach, I., Frishman, G.,
Montrone, C., Mark, P., Stumpen, V., Mewes, H., Ruepp, A. & Frishman, D. (2005).
The MIPS mammalian protein-protein interaction database, BIOINFORMATICS
21(6): 832834.
Piro, R. M., Molineris, I., Ala, U., Provero, P. & Di Cunto, F. (2010). Candidate gene
prioritization based on spatially mapped gene expression: an application to XLMR,
BIOINFORMATICS 26(18): I618I624. 9th European Conference on Computational
Biology, Ghent, BELGIUM, SEP 26-29, 2010.
138
Bioinformatics
Prasad, T. S. K., Goel, R., Kandasamy, K., Keerthikumar, S., Kumar, S., Mathivanan, S.,
Telikicherla, D., Raju, R., Shafreen, B., Venugopal, A., Balakrishnan, L., Marimuthu,
A., Banerjee, S., Somanathan, D. S., Sebastian, A., Rani, S., Ray, S., Kishore, C. J. H.,
Kanth, S., Ahmed, M., Kashyap, M. K., Mohmood, R., Ramachandra, Y. L., Krishna,
V., Rahiman, B. A., Mohan, S., Ranganathan, P., Ramabadran, S., Chaerkady, R.
& Pandey, A. (2009). Human Protein Reference Database-2009 update, NUCLEIC
ACIDS RESEARCH 37(Sp. Iss. SI): D767D772.
Salwinski, L., Miller, C., Smith, A., Pettit, F., Bowie, J. & Eisenberg, D. (2004). The
Database of Interacting Proteins: 2004 update, NUCLEIC ACIDS RESEARCH 32(Sp.
Iss. SI): D449D451.
Schlicker, A., Lengauer, T. & Albrecht, M. (2010). Improving disease gene prioritization
using the semantic similarity of Gene Ontology terms, BIOINFORMATICS
26(18): i561i567. 9th European Conference on Computational Biology, Ghent,
BELGIUM, SEP 26-29, 2010.
Schlicker, A., Rahnenfuehrer, J., Albrecht, M., Lengauer, T. & Domingues, F. S. (2007). GOTax:
investigating biological processes and biochemical activities along the taxonomic
tree, GENOME BIOLOGY 8(3).
The Gene Ontology Consortium (2008). The gene ontology project in 2008, Nucl. Acids Res.
36(36 Database issue): 440444.
URL: http://dx.doi.org/10.1093/nar/gkm883
Tifn, N., Kelso, J. F., Powell, A. R., Pan, H., Bajic, V. B. & Hide, W. A. (2005). Integration of
text- and data-mining using ontologies successfully selects disease gene candidates.,
Nucleic acids research 33(5): 15441552.
URL: http://dx.doi.org/10.1093/nar/gki296
Tin, N., Andrade, M. A. & Perez-Iratxeta, C. (2009). Linking genes to diseases: its all in the
data, Genome Medicine 1(8): 77.
Troyanskaya, O., Cantor, M., Sherlock, G., Brown, P., Hastie, T., Tibshirani, R., Botstein, D.
& Altman, R. B. (2001). Missing value estimation methods for dna microarrays.,
Bioinformatics (Oxford, England) 17(6): 520525.
URL: http://dx.doi.org/10.1093/bioinformatics/17.6.520
van Driel, M., Cuelenaere, K., Kemmeren, P., Leunissen, J. & Brunner, H. (2003). A new
web-based data mining tool for the identication of candidate genes for human
genetic disorders, EUROPEAN JOURNAL OF HUMAN GENETICS 11(1): 5763.
Wu, X., Jiang, R., Zhang, M. Q. & Li, S. (2008). Network-based global inference of human
disease genes, MOLECULAR SYSTEMS BIOLOGY 4.
Yeh, H.-Y., Cheng, S.-W., Lin, Y.-C., Yeh, C.-Y., Lin, S.-F. & Soo, V.-W. (2009). Identifying
signicant genetic regulatory networks in the prostate cancer from microarray
data based on transcription factor analysis and conditional independency, BMC
MEDICAL GENOMICS 2.
8
Exploiting Protein Interaction

Networks to Unravel Complex
Biological Questions
Bernd Sokolowski1 and Sandra Orchard2
1University of South Florida, College of Medicine,
2European Bioinformatics Institute, Wellcome Trust Genome Campus
1USA
2UK
1. Introduction
The past thirty years have witnessed a renaissance in biology as advances in technology
contributed to discoveries at ever-greater orders of magnitude. One of the primary reasons
for this revolution has been the advancement of technologies that allow high-throughput
discovery and processing of data. This accomplishment has placed volumes of data in the
realm of discovery science. An important point in this period came with the complete
sequencing of several microbial genomes followed by the sequencing of the first
multicellular organism, Caenorhabditis elegans, and eventually that of humans and various
model organisms, such as Drosophila melanogaster. The edifice of the genetic code fell by
wedding a biological technique developed by Sanger, known as shotgun sequencing (Sanger
et al., 1977), with that of computational techniques utilizing high-speed computers. Without
the advances in computer chips and processors, at a pace defined by Moores law (Moore,
1965), sequencing would have been dramatically slower and would not have brought about
the age of bioinformatics, a symbiosis of biological data, large amounts of information, and
computer science.
The hypothesis that gene number is related to organism complexity is quickly discarded
when comparing Homo sapiens, which have a genome of only 3.1 billion base pairs (Olivier et
al., 2001; Venter et al., 20010), to other organisms. Estimates for the marbled lungfish,
Protopterus aethiopicus, suggest 133 billion base pairs (Pedersen, 1971), making it the largest
vertebrate genome, while, to date, the lowly amoeba, Amoeba dubia, is estimated to have the
largest genome overall at 670 billion base pairs (McGrath & Katz, 2004). However, large
genomes may be a liability, as suggested in the plant world, where Japonica paris, which has
a genome of approximately 150 billion base pairs (Pellicer et al., 2010), grows more slowly
and is more sensitive to changes in the environment (Vinogradov, 2003). In vertebrates,
there appears to be an inverse correlation between genome size and brain size (Andrews &
Gregory, 2009), thus, complexity may lie with other factors such as epigenetics and protein
interactions. While estimates of human gene numbers rest between 20,000 30,000 genes,
these genes may encode over 500,000 proteins. Thus, the proteome of a cell can range from
several thousand proteins in prokaryotes to over 10,000 in eukaryotes. These numbers are
made more daunting with the realization that approximately 80% of the proteins in a cell do
not stand alone, but rather form complexes with other proteins. Moreover, this complexity
increases as the proteome of a cell can change under various conditions such as stress,
disease, cell cycle, etc.
Unraveling the biological complexities in a cells fate, growth, function, death, and disease
has led to a number of techniques to unlock the mechanisms to these processes. Among
these advances are those that produce large amounts of data and include gene and protein
arrays, phage displays, yeast two-hybrid screens, and coaffinity or coimmunoprecipitation
in combination with shotgun proteomics, which utilizes mass spectrometry. Innovations in
techniques exploiting mass spectrometry are of particular significance, as this technology
has improved increasingly over time. With these improvements, many technologies, once
outside the realm of anyone but experts, are now user-friendly, opening the possibilities for
utilization by many more scientists. Consequently, these changes in technology and
accessibility have led to the formation of large databanks curated by individuals with an
expertise in bioinformatics. A global view of ones own data relative to those published by
others increases dramatically, as one begins to delve into these databases with software tools
that retrieve large amounts of deposited data.
A number of methods can be used to unravel protein pathways, but the starting point is
always the wet bench experiment that will reveal the complexity of gene expression or
protein-protein interactions. This first step is fraught with potential limitations and pitfalls
that vary depending on the technique. However, the object is to use an approach that will
allow for the capture of many protein-protein interactions without the inclusion of too many
artifacts. In my lab, we have used two techniques over the last 10 years. These are the yeast
two-hybrid system and coimmunoprecipitation in conjunction with two-dimensional gel
electrophoresis and mass spectrometry. Both of these procedures can yield large amounts of
viable data, which leaves one with the option of either cherry-picking specific protein
partners or opening a whole new world, by examining the data from a global perspective
using bioinformatics. The latter approach, also known as systems biology, examines the
newly discovered proteins in the larger context of protein networks or interactomes. These
discoveries are made by using large datasets readily available online with software that will
map the many interactions once mining of these libraries is completed and integrated with
the experimental data. Within these maps you will find single proteins, or nodes, connected
to other proteins, via lines known as edges. In other instances, you may find clusters of
proteins in which, for example, a central protein acts like the hub in a wheel, forming
connections to six or more other proteins. These hubs might reveal previously unknown
functions of your protein, since they can have important regulatory roles in the cell (Fox et
al., 2011). Moreover, they might suggest new subcellular functions, if they are localized
primarily to specific cellular organelles.
In light of these challenges, this chapter will describe the use of bench experiments and
computational techniques to determine and exploit protein-protein interactions and unravel
their relation to protein networks and possibly newly discovered mechanisms. These
descriptions will include coimmunoprecipitation, verification using reciprocal
coimmunoprecipitation and RNAi, and data mining of specific databases. Their purpose is
to provide a primer without going into specific details, since many have been described
previously in great detail (e.g., Golemis & Adams, 2005; Harvey & Sokolowski, 2009;
Kathiresan et al., 2009; Navaratnam, 2009).
Exploiting Protein Interaction Networks to Unravel Complex Biological Questions 141
2. Experimental design and use of bait proteins

The advances in molecular biology and protein chemistry have brought a myriad of
techniques to the forefront to study molecule-molecule interactions as investigators seek
to wed the relationship of their molecule of interest to various mechanisms, cycles and
diseases. Among the techniques that have evolved for such studies are yeast two-hybrid
screening and coimmunoprecipitation/coaffinity assays. The use of one or the other
depends on which technique will reveal the biologically relevant answer and which might
supply the most data for obtaining large numbers of proteins to map and build networks
or interactomes. The yeast two-hybrid system does not need expensive hardware, such as
a mass spectrometer, it can be done in a small laboratory, while providing high-
throughput capability, and it can provide reasonably quick insights into potential binding
sites. However, the system is used in vitro with cDNA, so any search is only as good as the
quality of the screened cDNA, plus any validation of findings will occur in vivo,
eventually. Coimmunoprecipitation combined with two-dimensional electrophoresis and
mass spectrometry: allows you to pull the proteins directly from the source, since you are
not dependent on obtaining a cDNA library; provides insights into protein complexes and
post-translational modifications; provides amino acid sequences for potentially unknown
proteins. However, further studies of interacting binding sites may need the yeast two-
hybrid assay or other systems in vitro. Both systems generate false positives and
negatives.
Yeast two-hybrid screening packages the protein of interest as cDNA in an engineered viral
vector or plasmid, which is used to go fishing for other proteins that are all initially dressed
as cDNA and in their own plasmid. The former is the bait, whereas the latter, known as a
prey, consists of a known protein or a library of unknown proteins that are, again, in the
form of cDNA (cDNA library), encoding fragments of protein derived from a tissue or
organism of interest. In fusion with the bait or prey cDNAs are gene sequences that
respectively encode a eukaryotic binding and activating domain. Both bait and prey can be
mixed together in one soup, containing yeast cells that are transformed by the plasmids, so
that many will now contain a bait and a prey cDNA. The cDNAs are incorporated into the
cellular machinery and expressed as protein, after which the cells are plated on an agar-
based medium. If an interaction occurs between the bait and prey proteins, the activating
and binding domains interact to form a transcription factor that initiates a reporter gene,
thereby changing the chromatic phenotype of the yeast for visualization. The prey cDNA,
encoding a fragment of protein, is isolated from the yeast and sequenced to identify the
protein involved in the interaction. Typically, this procedure involves many culture plates
since the more plates the more likely you will capture a number of different interacting
proteins of interest. One advantage of the yeast-two hybrid system is that you can get a
fairly quick picture of the domains of interaction between the bait and prey proteins, since
one of the fragments pulled from the interactions likely will be a binding site. If you do not
begin with this technique for high-throughput analyses, you can use it on a low scale for
studying site-directed mutagenesis in a relatively quick and reliable fashion. The downside
for the yeast two-hybrid approach is that you will have to obtain a cDNA library from your
tissue of interest and insert the fragments into the proper plasmid. This first step can be a
weakness, because the screening is only as good as the library and proteins that are weakly
or indirectly associated with your protein may be lost.
Fig. 1. Coimmunoprecipitation uses (1) a substrate consisting of protein A- or G-coated

beads that bind the Fc fragment of a known antibody targeting a known antigen. (2) Once
cells are homogenized the released protein lysate is mixed either with antibody alone or
with antibody attached to protein-coated beads. (3) The antigen serves as bait as it brings
many protein partners (prey). (4) This immunocomplex is eluted from the beads and
prepared for western blotting. In high-throughput experiments, western blotting is skipped
and the protein partners are separated on a 2-D gel and prepared for mass spectrometry (see
Fig. 2). (5) For western blotting, an antibody is used to probe the blot for a known
coimmunoprecipitated prey (blue). The blot can also be probed for precipitated antigen,
since the known bait interacts with itself (red). In a reciprocal coimmunoprecipitation, the
reverse experiment is performed, because the prey will now be used to precipitate the bait.
Coimmunoprecipitation (Figure 1) involves the use of an antibody on a substrate, with the
antibody directed towards an antigen (the bait protein) that brings along the prey, that is,
interacting proteins and protein complexes. The antibody also can be directed toward the
epitope of a protein tag in fusion with a bait protein. The advantage of the technique is that
you can fish in a protein soup made from your tissue or organism of interest and you can
vary the antibody/antigen bait for fishing. In addition, you can pull down both direct,
indirect, and weak interactions as these are highly relevant to building protein networks.
The difficulty is in getting rid of interaction artifacts, so the more artifact filtering the more
likely the interactions will be real. To support this effort, one can rely on a combination of
centrifugation of different cellular components and using 2-D gels to better separate protein
partners from one another. The components in the gel are then identified using MALDI
TOF-TOF and LC-MS/MS.
3. Coimmunoprecipitation
3.1 Protein tags
The first task in setting up an experiment is to determine whether the use of cells obtained
from conditions in vivo or in vitro are more suitable to the biological question at hand. At
first glance, this issue may not seem relevant; however, cells obtained from conditions in
vitro are easily accessible, allowing more freedom in the design of bait proteins and in the
use of tags for quantification. A major part in this decision is determining which approach is
feasible and will answer the question in a biologically relevant manner. If a system in vitro is
chosen, there are a number of techniques that can be used, whereas the approach is more
limited if cells are obtained from whole organisms or tissue lysates. For experiments in vitro,
various heterologous expression systems are readily available, such as Chinese Hamster
Ovary (CHO) and Human Embryonic Kidney (HEK) 293 cells. The increase in accessibility
allows the use of isotope labeling of amino acids with Stable Isotope Labeling by Amino
Acids (SILAC), Isotope-Coded Affinity Tags (ICAT), and Isobaric Tags for Relative and
Absolute Quantitation (iTRAQ). These tags are successfully used in proteomic experiments
involving protein-protein interactions through the differential labeling of peptides and are
described extensively in a recent review (Vetter et al., 2009). Here, however, we will focus on
different types of nucleotides encoding a protein tag for bait cDNA.
The cDNA of bait proteins transfected into a cell system can be epitope tagged, using FLAG
(DYKDDDDK), c-myc (EQKLISEEDL), hemagglutinin (HA; YPYDVPDYA), histidine 6
(his6; HHHHHH), vesicular stomatitis virus glycoprotein (VSV-G; YTDIEMNRLGK), simian
virus 5 (V5; GKPIPNPLLGLDST), and herpes simplex virus (HSV; QPELAPEDPED) tags,
among others (for additional tags see Terpe, 2003). The FLAG tag is a hydrophobic octapeptide
(Hopp et al., 1988), recognized by different anti-FLAG monoclonal antibodies (M1, M2, and
M5), each with different binding and recognition characteristics. Typically this tag is used at
either the N- or C-terminal ends, as is the viral hemagglutinin coat protein or HA tag.
However, both can be used as an epitope tag within the C- and N-terminal domains, since
tagging at the very end of either terminal may interfere with a protein-protein interaction
(Duzhyy et al., 2005). Moreover, if the protein is a signaling protein, a tag at the N-terminus
will be cleaved-off the main body of the protein and thus, not resolvable on a gel. These
cleavage sites can be less than 20 amino acids from the N-terminus. HA tags are usually
attached in multiples of two or three in fusion with a bait protein, allowing for a better
signal during western blotting. The c-myc tag (Evan et al., 1985) is especially popular since
there are over 150 antibodies available from different species for this particular label. In
comparison, the advantage of using poly-His tags is that His binds to a chelating resin
charged with metal ions such as Ni2+, Cu2+, or Zn2+ (Noronha et al., 1999; Mateo et al., 2001).
It can be used to not only purify proteins, but also to bind the prey in a protein lysate
poured over a bait-bound matrix in an affinity column. Once bound, the matrix-His tag can
be disrupted and the prey eluted. In this scenario, lysates are used from whole organisms or
tissues dissected from the organism.
3.2 Antibodies and tissue preparation

The technique for capturing protein partners is to coimmunoprecipitate protein-protein
interactions using a bait antigen bound to an antibody. A second technique is to use the
metal ion binding His tag in fusion with a bait protein, as mentioned above. Here, we will
focus on the antibody approach, where a major hurdle is the antibody itself. These
complexes can vary not only in relation to the epitope (specificity) that is targeted, but also
in relation to the affinity, which can differ by source and/or fluctuate by lot number. The
first rule of thumb is that that not all antibodies are created equal. Before purchasing an
antibody, check that the targeted sequence of the epitope in your protein is not similar to the
sequence in a different antigen. While you might assume that this comparison was made
previously, particularly if the antibody is commercially available, a quick check never hurts,
as sequence databases are updated on a continual basis. Gene depositories are found at the
US National Institutes of Health at http://blast.ncbi.nlm.nih.gov/Blast.cgi, the European
Molecular Biology Laboratory Nucleotide Sequence Database in the UK at
http://www.ebi.ac.uk/Tools/sss/psiblast/, or the DNA Data Bank of Japan at
http://blast.ddbj.nig.ac.jp/top-e.html. However, all three form a consortium of the
International Nucleotide Sequence Database Collaboration, so information is exchanged on
a daily basis. When checking, be sure to contrast species differences; however, while these
differences are not fatal, the epitope should consist of 5 8 amino acids that are available for
binding following cell/tissue denaturation. Once these sequences are checked, initial tests
using western blots are valuable to determine if the antibody recognizes the denatured
target.
Prior to running a coimmunoprecipitation, a necessary step is to test the chosen
precipitating antibody, because many commercial antibodies are not tested for this use.
Here, the second rule of thumb is that if the antibody cannot immunoprecipitate its targeted
antigen (bait), it will be useless in coimmunoprecipitating any partners (prey). Thus,
checking the antibody entails doing an immunoprecipitation. The procedure is similar to a
coimmunoprecipitation, but rather than probing the western blot for antigen partners, you
probe for the immunoprecipitated antigen. Once verified, the antibody is suitable for use in
a coimmunoprecipitation. Additionally, immunoprecipitations are useful in other
applications, for example, as a control with which to compare the coimmunoprecipitated
species. In this scenario, you must be working with already identified proteins. As an
example, use a newly discovered partner (prey), from your high-throughput experiment to
coimmunoprecipitate the bait, while also immunoprecipitating the bait as control. Both co-
and immunoprecipitated species should have the same weight. This step is also referred to
as a reciprocal coimmunoprecipitation (discussed in section 3.2), since it validates the
original bait/prey interaction. Finally, a third use for immunoprecipitation is to increase the
quantity of the antigen for western blotting and Enhanced Chemiluminescent (ECL)
visualization. This technique is especially useful in pulling down lowly expressed proteins.
These techniques are useful for validation following the initial high-throughput
experiments.
3.3 Lysate preparation and preclearing

Once an antibody is chosen and tested, preparation of the cells/tissues for
coimmunoprecipitation can begin (Figure 1). A step-by-step procedure was presented
previously (Harvey and Sokolowski, 2009), so here, we will just touch on the salient points
and limitations. The initial preparation of the tissues for coimmunoprecipitation is critical as
the quality of the protein lysate is important. The goal is to disrupt the tissue sufficiently
without disrupting protein-protein interactions. Thus, lysis buffers contain anywhere from
120 1000 mM NaCl (less to more disruptive) as well as detergents to release hydrophobic-
hydrophylic interactions. Among the reagents that can disrupt protein-protein interactions
are ionic detergents, such as sodium Deoxycholate (DOC) and Sodium Dodecyl Sulfate
(SDS). However, nonionic detergents, such as Triton X-100, Tween20, Octyl -D-Glucoside,
N-dodecyl--D-Maltoside, Brij, Cymal, Digitonin, and NP-40, are useful in maintaining
interactions. Octyl -D-glucoside is especially helpful for releasing protein partners from
lipid rafts, whereas n-dodecyl--D-maltoside isolates hydrophobic membrane proteins and
preserves their activity. The isolation and separation of membrane proteins on a 2-D gel can
be especially challenging. For example, our own initial studies, to cleanly separate BK
channel partners from the membrane fraction on a 2-D gel, revealed amidosulfobetaine-14
(ASB-14), a zwitterionic detergent, as the best candidate relative to CHAPS (zwitterionic),
octyl -glucoside, and n-dodecyl -D-maltopyranoside.
Once the tissue is dissected on ice and placed in a cold buffer with the proper protease and
phosphatase inhibitors, any physical disruption is accomplished with pre-cooled
equipment, on ice, and for short durations. These tissue perturbations include: mechanical
disruption by grinding with a blade; liquid homogenization, by squeezing through a narrow
space, as with a French press or Dounce; sonication, by using a vibrating probe to produce
bubbles that burst and cause a sonic wave; or freeze/thaw, which bursts membranes via ice
crystals. For minute tissues, such as the cochlea, use a 3 mm size probe to disrupt cells for 30
sec three times with one-minute intervals for cool down. Also, a simple mortar and pestle
can be used and obtained in many different sizes. However, there is an art to the process,
since you will not want to over-sonicate/homogenize. Such errors are reflected in mass
spectroscopy results, where cytoplasmic proteins appear in the membrane fraction and vice
versa. Again, as a reminder, the tube containing the tissues is kept on ice and any ensuing
centrifugation should be done in either a refrigerator or a cold room.
Lysis buffers can be relatively standardized or they can vary from lab to lab with everyone
swearing that theirs works the best. RIPA and Tris-HCl are commonly used lysis buffers
and their ingredients can be easily found on the web with other types of buffers at sites such
as http://www.abcam.com/index.html?pageconfig=resource&rid=11379#A1. However,
some buffers contain metal chelating agents such as EGTA or EDTA. These chelators have
the ability to bind or sequester metal ions, keeping them in solution and decreasing their
activity. For example, EGTA sequesters Ca2+ and Mg2+, but has a higher affinity for Ca2+
than Mg2+ ions, whereas EDTA binds Fe3+, Ca2+, Pb2+, Co3+, Mn2+, and Mg2+. The choice as to
whether you add these chelators can depend on whether the protein-protein interactions
you are interested in are metal ion dependent. The real differences come into play when
deciding on which protease or phosphatase inhibitors to use (Table 1). Concentrations of
these inhibitors can vary and may depend on, for example, whether or not you are
interested in examining phosphorylated proteins. Protease/phosphatase inhibitors should
always be mixed on the day of the experiment, since their stability varies quite a bit.
Pepstatin A at a working solution of 1 g/mL is stable for about one day, whereas the stock
solution (100 g/mL) is stable for several months. Leupeptin at 1-2 g/mL is stable for a
few hours, whereas the stock solution is stable for up to six months. Aprotinin, on the other
hand is stable for about a week at 4oC in a solution of pH 7 at a concentration of
approximately 0.5-2 g/mL. Moreover, microcystin-LR may be preferred in place of okadaic
acid, as an inhibitor of protein phosphatases PP1 and PP2A, since it is more potent. The
downside of using this inhibitor is that in the U.S., microcystin is on the government list of
monitored reagents and, also, it is quite expensive.
Table 1. Protease and phosphatase inhibitors that can be used in a cocktail mixed with a
lysis buffer for protein extraction.
In order to obtain the cleanest and best protein separation on your 2-D gel, a useful step is to
separate the lysate into different cellular components via centrifugation and prior to
preclearing. This step is practical, especially for high-throughput experiments involving
mass spectrometry (Kathiresan et al., 2009; Harvey & Sokolowski, 2009). After clearing
debris, nuclei, etc., separate the membrane fraction from other soluble proteins using
ultracentrifugation, by spinning the sample at 100k x g for about an hour at 4oC. The pellet
will contain membrane from the plasmalemma, mitochondrion, and endoplasmic reticulum,
while the supernatant will contain any remaining soluble proteins. To obtain additional
separation of organelles and various other cellular components, a necessary step is density
gradient centrifugation (Huber et al., 2003). However, the initial separation of membrane
and cytosolic components is useful for obtaining proteins that have undergone
phosphorylation or any other changes resulting from a cells response to cycle,
developmental stage, drug response, environment, disease, etc.
Prior to preclearing and coimmunoprecipitation, a choice is made with regard to the type of
beads to be used as the substrate for binding the antibody. These substrates include Protein
A- or G-coated agarose, sepharose or magnetic beads. Proteins A and G bind
immunoglobulins in the Fc regions of an antibody, thereby, leaving the Fab region free for
antigen binding. Protein A, originally derived from Staphylococcus aureus, binds
immunoglobulins from a number of species and has a strong affinity for mouse IgG2a, 2b, 3,
and rabbit IgG. Protein G was originally derived from Group G streptococcus and tends to
have an affinity for a greater number of immunoglobulins across a broader range of species
and subclasses of IgG. Its affinity is strong for polyclonals made from cow, horse, sheep, and
mouse IgG1. Also, Protein G has less affinity for albumin, thereby decreasing background
and providing cleaner preparations. Protein A and G binding affinities for various species
can be found at http://www.millipore.com/immunodetection /id3/affinitypurification.
The question of agarose/sepharose or magnetic beads is a matter of choice, since arguments
can be made for either one. Magnetic beads are smaller at 1 4 m and provide more
surface area per volume, fewer handling steps, faster protocol time, greater sample
recovery, and less risk of bead inclusion in the sample. However, you need a magnetic
separator. In the long run, there is likely not that much difference and the outcome will lie in
performing the necessary pilot experiments.
Once the tissue is cleared of debris and nuclei, separated into different cellular components,
and a choice of beads is made, begin the preclearing step. Preclearing with beads involves
reducing the proportion of proteins that may bind non-specifically to the agarose/sepharose
beads that are used in the coimmunoprecipitation. For high-throughput experiments, where
western blots are not used, it is essential. However, if the endgame is a western blot and
ECL, preclear if the background masks your protein species. One limitation of preclearing is
that you may lose signal, which is especially disadvantageous if the expression of your
protein is low. However, signal loss can be traced by saving non-bound components during
the procedure. For preclearing, the lysate is mixed with a small volume of coated beads so
that any contaminating elements that increase background noise are allowed to bind over
time, usually over 30 min at 4oC. The resultant complex of sticky proteins and beads are
discarded (or saved for testing signal loss) after centrifugation and the supernatant is
processed for coimmunoprecipitation. Preclearing is not to be confused with a bead control.
Here, the cleared lysate is mixed with beads in the absence of antibody to form a non-
immunocomplex, which is then processed and fractionated on a gel. An additional
Fig. 2. Schematic of a high-throughput proteome experiment using coimmunoprecipitation,

two-dimensional gels, and mass spectrometry. Initially, proteins are solubilized and
separated by ultracentrifugation into membrane and cytoplasmic fractions (blue and
yellow), which then are divided into two separate aliquots. Anti-bait antibody (Ab) with
protein G beads (red tubes) is used to coimmunoprecipitate putative protein partners
obtained from an organism or tissue lysate. The different subcellular fractions are probed
with an antibody to a specific protein and the immunocomplex captured with Protein G-
coated beads. The resultant immunocomplexes are eluted, fractionated on two-dimensional
gels, and analyzed using LC-MS/MS. Control samples consist of running membrane and
cytoplasmic fractions: in the absence of antibody and beads (total proteome; green tubes);
with beads alone (purple tubes); or with a nonspecific antibody and beads (purple tubes).
approach to preclearing, but which can also be used as a negative control, is to use a non-
specific antibody. The antibody must be isotype specific, when using a monoclonal
antibody, or source specific, when using a polyclonal antibody for coimmunoprecipitation.
For example, in the event that the coimmunoprecipitating antibody is a mouse monoclonal
IgG1, then use a nonspecific mouse monoclonal IgG1. If, on the other hand, the antibody to
be used is a rabbit polyclonal, use a non-specific rabbit polyclonal antibody. When used as a
control, mix the precleared lysate with the non-specific antibody and beads and process for
gel fractionation. Finally, empirically determine how much antibody to add to the lysate
fraction or to the beads, by determining the signal to noise in your result. A good starting
point is to begin with 5 g of antibody and work up or down in concentration from there.
The cells are now ready for coimmunoprecipitation for high-throughput analyses using 2-D
gels (Figure 2). Control experiments consist of: any sticky proteins adhering to the beads
(non-immunocomplexed protein), any proteins obtained using a non-specific antibody, and
finally all proteins from the entire proteome of the tissue/organism. While controls may
take more samples, they are of value for comparison purposes and troubleshooting, and for
acceptance into high impact journals. The gel showing the total proteome is important, since
it will provide an overall pattern of protein spots with which to compare the gel containing
the immunocomplexed proteins. You will likely see some similar spot patterns between the
gels if the separation is of a good quality. One question that will arise is whether to first bind
the antibody to the beads or bind the antibody to the antigen in the lysate and then to the
beads. One argument for binding the antibody to the beads first is that, since the beads are
already covered with antibody, there will be a decrease in contaminant binding, and thus, a
decrease in background. Antibody can be covalently bound to beads using Dimethyl
Pimelimidate (DMP) Disuccinimidyl Glutarate (DSG), Disuccinimidyl Suberate (DSS), or
Disuccinimidyl Tartrate (DST). Arguments against crosslinking include, the buildup of
aggregates, antibodies such as monoclonals may lose their affinity, or the antibody cross-
links to the beads in the incorrect position causing hindrance to antigen binding.
3.4 Fractionation and gel staining

Once both immunocomplexed and non-immunocomplexed beads are washed, perform the
elution step using equal volumes of IEF sample and elution buffers, since the proteins are
fractionated in two dimensions. At this point there are various nuances in terms of
technique for running a 2-D gel. Among these is a step-by-step description by Kathiresan et
al., (2009). Here, we will suggest some of the initial troubleshooting that may be necessary
before and/or after running a full-fledged experiment. If little is known about the proteome
of the tissue in your experiment, it will be of value to use an Immobilized pH Gradient (IPG)
strip with a broad pH range (e.g., pH 3 - 10). Moreover, rather than initially using strips of
18 to 24 cm, which give a better resolution, use a 7 cm strip to get a quick representation of
the pI ranges that you will be working with. Also, remember that the protein volume you
can load is related to the size of the IPG strip, so that 7, 11, 17, 18, and 24 cm strips require
volumes of 125, 185, 300, 325, and 450 L, respectively. After separation in the first
dimension, proteins are fractionated according to weight in the second dimension at which
point the gel is prepared for staining.
There are several staining methods available, assuming that a CyDye was not used, since
this step is accomplished prior to running the gel. The choice of stain is dependent on
whether you are interested in searching for the low hanging fruit, that is, proteins that are
highly expressed, or you may wish to increase staining sensitivity to detect as many protein
partners as possible. Colorimetric stains include Coomassie Brilliant Blue, which will suffice
for the former choice, since this stain will detect in-gel protein concentrations as low as 10
ng. For more inclusive resolution of proteins you can use silver staining, which detects
protein concentrations less than 0.25 ng. For a detection range that lies between these two
stains, fluorescent dyes are available that detect 0.25 2 ng. However, all the stains have
their advantages and limitations. Coomassie Blue has less sensitivity, but is probably the
most compatible stain for mass spectrometry. Silver staining has greater sensitivity but is
less compatible with mass spectrometry, because, as with Coomassie Blue, the protein must
be destained prior to tryptic digestion. Since formaldehyde is part of the silver staining
process, cross-linking of the protein occurs (Richert et al., 2004), thereby causing problems
with protein extraction from the gel and interference with mass spectrometry. A few
techniques have been suggested to circumvent this problem, including ammoniacal silver
staining (Richert et al., 2004; Chevallet et al., 2006). Moreover, some vendors (e.g., Thermo
Scientific Pierce) optimize their reagents to make silver staining more compatible for mass
spectrometry. However, silver staining still remains problematic, with its poor
reproducibility and a nonlinear dynamic range, when measuring staining intensity relative
to the amount of protein. There are many fluorescent stains, including those of a non-
covalent variety such as SYPRO Orange, Red, Ruby, and Tangerine (Invitrogen, Carlsbad,
CA, USA), ruthenium II, Deep Purple (GE Healthcare, Piscataway, NJ, USA), Krypton
(Thermo Scientific, Inc., Rockford, IL, USA), and Oriole (Biorad, Hercules, CA, USA). The
advantages are sensitivity, a greater dynamic range, and compatibility with mass
spectrometry. Disadvantages lie primarily with cost, because of the necessity for extensive
hardware for detection and quantification, the loss of signal with exposure to light, and the
potential for masking certain peptides. For example, Deep Purple and SYPRO Ruby begin to
lose their fluorescence after two minutes of exposure to UV transillumination, so that by 19
minutes they have lost 83% and 44% of their fluorescence, respectively (Smejkal et al., 2004).
SYPRO Ruby may also inhibit identification of cysteine- and tryptophan-containing
peptides (Ball & Karuso, 2007). In addition, not all fluorescent stains are compatible with the
various gel types that are used to fractionate proteins for LC-MS/MS. Ruthenium II, which
is much cheaper than SYPRO stains, causes increased background staining in Bis-Tris gels
relative to Tris-Glycine gels (Moebius et al., 2007). These are all factors to keep in mind as
part of your experimental design. Finally, once the gel is stained, any vertical streaking of
protein is likely the result of insufficient equilibration or problems with the buffer solution,
whereas horizontal streaking may be the result of incomplete solubilization, impurities,
improper detergent, or an isoelectric focusing time that is too long or too short. With the
completion of staining, the gel will need to be destained prior to removal of gel spots either
manually or with a robotic arm.
4. Verification of protein partners

4.1 Manual verification of peptides
While the specifics of understanding how the data are obtained and analyzed are beyond
the scope of this chapter, a quick review of some highlights are useful before describing
potential experiments to validate your interactions. Once tandem mass spectrometry is
completed you will obtain data derived from database search engines such as MASCOT,
Seaquest, and X! Tandem. Search engines such as MASCOT generate scores as well as a
compilation of spectral data. Scores above 60 can be considered valid for protein
identification, assuming other parameters such as spectral data are in order. However, one
may want to be conservative, especially when examining potential new partners.
Regardless, scores should not be taken at face value without analyzing the fragmentation
spectra for each identified peptide, since you can have good scores and bad spectral data as
well as bad scores and good spectral data. Personnel from your mass spectrometry core
facility can assist in these analyses, however, you should familiarize yourself with how the
ion spectra are generated and identified for your own understanding. A good starting point
in comprehending spectral data is a tutorial at proteome software.com that comes in the
form of a short presentation, http://www.proteomesoftware.com /Proteome_
software_pro_protein_ id.html. In addition, there are many other sources of value in
understanding the mechanics of mass spectrometry-based proteomics, including light
reading in review articles (Aebersold and Mann, 2003), as well as more intense reading in
specialized books (Gross, 2004). Also, before deciding on a core facility to analyze your
precious data, assuming you have a choice, you may want to give this sobering article a
quick read (Bell et al., 2009). This paper will likely push your choice towards a facility where
the personnel have a great amount of experience and the search engines are continually
maintained and up-to-date. Finally, the data should be analyzed for false positive rates,
since some proteomics journals now require these analyses, including Molecular and Cellular
Proteomics, which published standards in 2005 (Bradshaw, 2005).
4.2 Reciprocal coimmunoprecipitation

Once you have obtained the results, showing the putative protein-protein interactions, you
can use various means to begin assessing their validity using bioinformatics and different
experimental procedures. Here, we will discuss some of the methods for experimentally
verifying interactions as well as assessing the potential functions of these interactions. The
methods to verify are many and can depend on the protein of interest as well as the
experimental question. However, one of the first and relatively easy steps for verification,
considering that youve just run a two-dimensional gel, is to perform a reciprocal
coimmunoprecipitation. Here, the goal is to coimmunoprecipitate the protein that was
originally used as bait (antigen) by using the newfound prey (protein partner). In essence,
there is a role reversal, so that the former bait is now prey and vice-versa. The means to
accomplish this procedure are similar to those used for a coimmunoprecipitation using
western blotting. Once you step into the realm of probing the results of a
coimmunoprecipitation experiment with an antibody in a western blot, you have to consider
the IgG artifacts that may appear on your film. These artifacts are the result of the presence
of light (~25 kDa) and heavy (~50 kDa) immunoglobulin fragments that are detected when
using an antibody from the same species for both the immunoprecipitation
/coimmunoprecipitation pull-down and the western blot. The secondary antibody will
recognize both IgG chains, since these are eluted from the beads along with the antibody
and fractionated on the gel. The consequence is that the antigen will be masked if it has a
weight similar to either IgG. Moreover, if monoclonals are used to both pull down and
probe the blot, the secondary recognizes the 25 kDa band; if polyclonals are used for both,
the 50 kDa band will appear as artifact. A problematic example is the use of a rabbit
polyclonal antibody for both the immunoprecipitation and the western blot. To circumvent
this issue, you can use antibodies from different species or use a secondary antibody
consisting of HRP bound to Protein A or G. An HRP conjugated to either of these proteins
will detect their non-denatured forms but not their denatured forms (Lal et al., 2005). A
third solution is to use secondary antibodies that only recognize the light or heavy chain
IgGs (Jackson Immunoresearch Laboratories, Inc., Westgrove PA, USA). Thus, if your
protein of interest lies in the 45 - 55 kDa range, you would use a secondary that recognizes
only the light chain IgG and vice versa, if your protein lies in the 20 to 30 kDa range.
However, one assumption that should not be made in running the reciprocal
coimmunoprecipitation is that all the parameters in washing and stringencies are the same
as for the original coimmunoprecipitation. We find that at times these variables have to be
tweaked slightly differently. However, with practice these issues are usually fixed relatively
quickly.
4.3 RNAi and overexpression

A method of verification that can clarify the function of your newly discovered interactions
is the use of RNAi in a heterologous expression system. This approach is especially useful
for proteins that lend themselves well to this sort of system, such as ion channels. There are
several different types of cells to use, including HEK 293 and CHO cells, and if cell polarity
is of concern, Madin-Darby Canine Kidney (MDCK) epithelial cells. These expression
systems provide a vehicle for, not only expressing your proteins, but also as a means to
silence the protein endogenously.
Fig. 3. Experiments, using cDNAs, are conducted to probe the function of protein-protein
interactions when the prey protein is silenced in a heterologous expression system. (1) The
original bait protein, in the form of an HA-tagged cDNA, is transfected with (2) siRNAs
targeting specific nucleotides of the newly- discovered protein partner, or with scrambled
RNAs (scRNAs; control) containing nonsense sequences. In this scenario, the (3) prey
protein is endogenous to the expression system. Plates for each treatment are prepared in
triplicate. (4) Cells from each treatment are scraped, homogenized and prepared for western
blotting. (5) The resultant blot is probed for expression of the HA-tagged protein in both
treatment and control conditions.
In order to accomplish these experiments, you will need the gene or genes that encode one
or both of your proteins, that is, the bait and the prey. If the cDNA comes from either a
private source or a vendor, do not assume that the construct you receive contains cDNA
with a correct sequence. Be sure that it was sequenced very recently before use, as in, after
the last amplification, because it is not uncommon to obtain constructs from either source
only to discover a mutation during the course of your study, when its too late. Once
sequenced, tag the cDNA on either the C- or N-terminus with one of the specified tags
discussed previously. We typically find that the antibodies to the HA and FLAG tags work
quite well in these experiments. However, you have to keep in mind that the tag itself may
interfere with the interaction. If the coimmunoprecipitation fails, there is no need to panic,
because you can just place the tag at the other end. Also, remember that if the tag is placed
on the N-terminal end of a signaling protein, you may lose your tag. Inserting the tag farther
into the construct resolves this issue.
The decision then comes down to, when to silence and when to over-express, once all the
necessary cDNA constructs are in order. In our work, we find that inserting and over-
expressing the cDNA, encoding the original bait protein, and silencing the partner (prey)
with siRNAs endogenously, works the best in our RNAi experiments (Figure 3). This
approach entails determining that the partner, pulled from the high-throughput study, is
expressed endogenously in your heterologous system. If so, check that the sequences of the
siRNAs match those of the endogenous protein found in the heterologous cells. Be sure to
have at least three to four siRNAs, targeting 18 23 bases of the sequence in different
regions that are approximately 70 100 bases from either the 5 or 3 ends. Search for AA
dinucleotides, since siRNAs with an overhanging UU pair at the 3 end is the most effective,
although other dinucleotides are effective to some extent (Elbashir et al., 2001; Elbashir et al.,
2002). Avoid runs of G or C, since these are cut by RNAses. In addition, the GC content
should not exceed 30 50% because the siRNA becomes less active. BLAST siRNA
sequences to avoid knockdown of genes with similar sequences.
Once all materials are ready, transfect the cells with the siRNAs and the over-expressed
protein (Figure 3). A fluorescent tag such as Cerulean can be used to check for the earliest
expression of protein in live cells. We find that proteins are expressed within the first two
hours, with transfection reagents such as Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA),
which can be removed after four hours of transfection. However, the efficiency of transfection
may vary from cell type to cell type, so a test of comparable products is needed to find the
most efficient one. Anywhere from one to all of the siRNAs can be added in an equivalent
ratio. Following transfection, cells are allowed to grow for approximately 48 hours at which
time they are processed for protein quantification. Run triplicate plates along with a negative
control, such as cells treated with scrambled RNA and over-expressed protein. Experiments
are repeated a total of three times. Band densities are measured, averaged, and analyzed for
statistical significance by comparing experimental versus control groups. In order to control
for protein loading, perform a protein assay and verify by analyzing a control protein on the
same blot as experimental and control treatments (e.g., -actin, GAPDH).
In a similar manner, over-expression of the partner can be managed through transfection of
heterologous expression systems (Figure 4). Again, the bait protein can be measured, but
this time in response to over-expressing the prey as opposed to silencing. Transfect both
constructs in a 1:1 ratio and use a control, consisting of empty vector or vector with the
construct in reverse sequence along with the construct carrying the prey sequence. This
procedure will clarify if the addition of another vector dilutes the expression of the prey
protein. Densitometry measurements are made as before and analyzed statistically.
In summary, the search for mechanisms that regulate the many proteins in different cell
systems can be tackled using a variety of different techniques. The results can provide you
with a bounty of data that can be verified and used to mine many different databases. The
outcomes from these experiments will provide you with new and fascinating insights that,
heretofore, you may not have thought about. The critical issues are that you will need to obtain
a clear understanding of what is occurring to the proteins at different stages of the experiment.
This understanding will allow you to obtain clean representations of the proteins to be
assessed with fewer inherent artifacts. Once mass spectrometry is completed, the data can then
be used to mine various databases in order to fit and expand your data into an interactome.
Fig. 4. Experiments, using cDNAs, are conducted to probe the function of protein-protein
interactions when the prey is over-expressed in a heterologous expression system. (1) The
original bait with the (2) newly-discovered prey or the bait with plasmid containing the
reverse sequence of the prey (control) are cotransfected into (3) CHO cells. (4) Cells are
collected and prepared for western blotting, where expression of the bait protein is probed
(5) for both treatment and control conditions.
5. Bioinformatics
5.1 Comparison of high-throughput data with existing data
Once the initial experiments are completed, the lab worker will often wish to analyze the data
by comparison to known interactions already existing in molecular interaction databases.
These resources exist to collate and curate experimental data from laboratories around the
world. Initially, interaction databases were established in isolation and often performed
redundant curation of the same, high-visibility papers to their own standards, subsequently
releasing the data in their own proprietary formats. However, more interaction data is
published in any one calendar month than can be captured by these resources collectively, and
no single database can claim to have complete coverage of the literature. In order to approach
a complete interactome for the organism or process of interest, the user has always had to
combine data from multiple resources. This was well nigh impossible prior to 2004, as the
different data formats, required separate parsers to be written for each data source. This
approach began to change with the release of the first HUPO-PSI standard representation of
interaction data. Nowadays, two related formats exist PSI-MI XML2.5 and MITAB2.5
(Kerrien et al., 2007), which are supported by both the majority of interaction databases and
also by related visualization and analytical resources. These formats have enabled consistent
data capture by multiple resources, with the choice of XML or tab-deliminated files often
driven by either the complexity of data that the user wishes to harvest, or the amount of
bioinformatic support available to them. Controlled vocabularies now make the terminology
used to annotate these data consistent across the many data resources.
One major advantage of multiple resources sharing the same data format is that it is now
possible to simultaneously access multiple resources with a single query, cluster the results,
and visualize these in a single graph. A PSI Common Query InterfaCe (PSICQUIC) was
developed that allows software clients to interact with multiple services and is based on the
existing PSI MI file formats and the new Molecular Interaction Query Language (MIQL)
(Aranda et al., in preparation). MIQL is based on standard Lucene syntax
(http://lucene.apache.org/) and offers single word or phrase queries (abl1 AND pull
down), search in specific data attributes/columns (abl1 AND species:human), wildcards
(abl*), and logical operators. At the time of writing, 16 data providers were providing
PSICQUIC servers, with a total of 16 million interactions available to query. PSICQUIC lays
no constraint on data type or quality and much of what is available is also redundant, in that
databases, which do not have their own curation team, will import information from those
that do. To address this issue, several of the major databases have come together to
synchronize their curation rules and data release through the IMEx Consortium
(www.imexconsortium.org). This consortium allows the user to access and download a non-
redundant, consistently annotated set of data, again using a PSICQUIC client to access
appropriately tagged records (Orchard et al. in preparation).
5.2 Data resources

A number of databases exist, many of which have a bias in their curation strategy, either
towards particular organisms or cellular processes. A brief summary of a number of these
resources is given below, a more complete but less detailed list can be obtained from
Pathguide (www.pathguide.org/). All the databases listed make their data available both
through a dedicated website and also from their respective ftp sites in one or both of the PSI
formats.
IntAct (www.ebi.ac.uk/intact) no species or process bias, collects data from all organisms.
Mainly contains protein-protein interactions but also annotates protein-small molecule,
protein-nucleic acid. Interactions are derived from literature curation or direct user
submissions and are freely available. Database and associated tools are open-source and
available for download. IntAct provides a PSICQUIC service and is a full member of IMEx.
MINT (http://mint.bio.uniroma2.it/mint/) - no species or process bias, collects data from
all organisms. Focuses on experimentally verified protein-protein interactions mined from
the scientific literature. MINT provides a PSICQUIC service and is a full member of IMEx.
DIP (http://dip.doe-mbi.ucla.edu/dip) - no species or process bias, collects data from all

organisms. Catalogs experimentally determined protein-protein interactions between
proteins. The data are both manually curated and also automatically, using computational
approaches that utilize knowledge about the protein-protein interaction networks extracted
from the most reliable, core subset of the DIP data. DIP provides a PSICQUIC service and is
a full member of IMEx.
MatrixDB (http://matrixdb.ibcp.fr) - focuses on interactions established by extracellular
proteins and polysaccharides, mainly in human and mouse. Reports interactions of proteins,
individual polypeptide chains or multimers (permanent complexes) and carbohydrates.
MatrixDB provides a PSICQUIC service and is a full member of IMEx.
InnateDB (www.innatedb.ca/)- a database of the genes, proteins, experimentally-verified
interactions and signaling pathways involved in the innate immune response of humans
and mice to microbial infection. Integrates known interactions and pathways from major
public databases together with manually-curated data. InnateDB provides a PSICQUIC
service and is a full member of IMEx.
MPIDB (http://jcvi.org/mpidb/) - collects physical microbial interactions manually
curated from the literature or imported from other databases. MPIDB provides a PSICQUIC
service and is a full member of IMEx.
BioGrid (http://thebiogrid.org/) a resource of proteinprotein and genetic interactions
for many model organism species. BioGRID provides a PSICQUIC service and is an
observer member of IMEx.
HPRD (www.hprd.org/) a database of human interactions, mixed species interactions
(e.g. human-mouse) are modeled to human. Commercial entities have to pay a fee to use the
data, under a licensing arrangement.
5.3 Data visualization

Once the user has downloaded their required data from one or all of the listed resources, the
next step is to combine the networks then import and overlay your own data. The tool of
choice for this exercise is most commonly Cytoscape (www.cytoscape.org), a free software
package for visualizing, modeling and analyzing molecular and genetic interaction
networks. In Cytoscape, nodes representing biological entities, such as proteins or genes, are
connected with edges representing pairwise interactions, such as experimentally determined
proteinprotein interactions. Nodes and edges can have associated data attributes
describing properties of the protein or interaction. Cytoscape allows users to extend its
functionality by creating or downloading additional software modules known as plugins.
These plugins provide additional functionality in areas such as network data query,
network data integration and filtering, attribute-directed network layout, Gene Ontology
(GO) enrichment analysis and network motif functional module, protein complex or domain
interaction detection.
Network data can be imported into Cytoscape is several formats, including those of the PSI-
MI. To merge files in Cytoscape, the gene or protein identifier in the file must exactly match
the corresponding Cytoscape node ID (or other Cytoscape attribute that has been previously
loaded). If no matching identifiers are present, the situation can be corrected by loading an
additional identifier into Cytoscape as a new node attribute. The ID mapping service
supplied by UniProt (www.uniprot.org/) or by PICR (www.ebi.ac.uk/Tools/picr/) are
recommended to achieve this correction. The Advanced Network Merge, a core Cytoscape
plugin will allow network merging on the click of a single button.
Fig. 5. An interaction network as viewed in Cytoscape.
5.4 Interolog mapping

Large-scale PPI networks are only available for a limited number of model organisms, therefore,
groups working on less well-studied organisms have to rely on network inference using the
interolog concept originally introduced by Walhout et al. (2000). This concept combines known
PPIs from one or more source species and orthology relationships between the source and
target species to predict PPIs in the target species. There are a number of resources available
which perform the orthology mapping Inparanoid (http://inparanoid.sbc. su.se/cgi-
bin/index.cgi) and Compara ( www.ensembl.org /info/docs/api/ compara/index.html) being
probably the best known. Few tools exist for interolog mapping, however, two database
resources exist in which this exercise has been pre-computed for the user; STRING
(http://string-db.org/) transfers associations/interactions between several hundred organisms
and InteroPORC (http://biodev.extra.cea.fr/interoporc/) for the fully sequenced organisms
described in the Integr8 database (www.ebi.ac.uk/integr8). Both resources make the data
available in PSI format and both have a PSICQUIC server. Additionally, the InteroPORC
software is freely available for in-house use (Michaut et al. 2008).
6. Conclusions
The data generated from experiments that examine genes and proteins has increased
logarithmically over the last 20 years, largely driven by recent advances in high-throughput
technologies that examine proteins individually, as well as in complexes. High-throughput
protein studies that combine coimmunoprecipitations with 2-D gels have increased as a result
of the higher quality of data obtained from mass spectrometry. The advent of these technologies
has helped to fuel a need for the formation of many curated databases, such as those that
capture molecular interactions. These molecular interactions databases are increasing their
usefulness to the community by making their datasets available in a single, unified format. In
addition, many are also linked in a unifying organization, such as the IMEx Consortium, which
is ensuring that the user can download a non-redundant set of consistently annotated data. This
means that the user now has a single point of entry from which to download data, and an
increasing number of tools with which to subsequently analyze those data.
7. Acknowledgements
We thank Margaret Harvey for a critical reading of the manuscript and Sophia Sokolowski
for help with the figures. This project was supported by grant R01-DC004295 to B.S. from
the National Institute on Deafness and Other Communication Disorders.
8. References
Andrews, C.B., & Gregory, T.R. (2009) Genome Size is Inversely Correlated with Relative
Brain Size in Parrots and Cockatoos. Genome, Vol.52, No.3 (March 2009), pp. 261
267, ISSN 0831-2796.
Ball, M.S., & Karuso P. (2007) Mass Spectral Compatibility of Four Proteomics Stains. Journal
of Proteome Research, Vo.6, No.11 (November 2007), pp. 4313-4320, ISSN 1535-3893.
Bell, A.W., Deutsch, E.W., Au, C.E., Kearney, R.E., Beavis, R., Sechi, S., Nilsson, T., &
Bergeron, J.J. & HUPO Test Sample Working Group (2009) A HUPO Test Sample
Study Reveals Common Problems in Mass Spectrometry-Based Proteomics. Nature
Methods, Vol.6, No.6, (June 2009), pp. 423-430, ISSN 1548-709.
Bradshaw RA. (2005) Revised Draft Guidelines for Proteomic Data Publication. Molecular
and Cellular Proteomics, Vol.4, No.9, pp. 1223-1225, ISSN 1535-9476.
Chevallet, M., Diemer, H., Luche, S., van Dorsselaer, A., Rabilloud, T., & Leize-Wagner, E.
(2006) Improved Mass Spectrometry Compatibility is Afforded by Ammoniacal
Silver Staining. Proteomics, 2006, Vol.6, No.8 (April 2006), pp. 23502354, ISSN 1615-
9853.
Cline, M.S., Smoot, M., Cerami, E., Kuchinsky, A., Landys, N., Workman, C., Christmas, R.,
Avila-Campilo, I., Creech, M., Gross, B., Hanspers, K., Isserlin, R., Kelley, R.,
Killcoyne, S., Lotia, S., Maere, S., Morris, J., Ono, K., Pavlovic, V., Pico, A.R.,
Vailaya, A., Wang, P.L., Adler, A., Conklin, B.R., Hood, L., Kuiper, M., Sander, C.,
Schmulevich, I., Schwikowski, B., Warner, G.J., Ideker, T., Bader, G.D. (2007),
Integration of Biological Networks and Gene Expression Data Using Cytoscape.
Nature Protocols, Vol. 2, No. 10 (September 2007), pp. 2366-2382, ISSN 1754-2189.
Duzhyy, D., Harvey, M., & Sokolowski, B. (2005) A Secretory-Type Protein, Containing a
Pentraxin Domain, Interacts With an A-type K+ Channel. Journal of Biological
Chemistry, Vol.280, No.15, (April 2005), pp. 15165-15172, ISSN 0021-9258.
Elbashir, S.M., Harborth, J., Weber, K., & Tuschl, T. (2002) Analysis of Gene Function in
Somatic Mammalian Cells Using Small Interfering RNAs. Methods, Vol.26, No.2,
(February 2002), pp. 199-213. ISSN 1046-2023.
Elbashir, S.M. Martinez, J., Patkaniowska, A., Lendeckel, W., & Tuschl, T. (2001) Functional
Anatomy of siRNA for Mediating Efficient RNAi in Drosophila melanogaster Embryo
Lysate. European Molecular Biology Organization Journal, Vol.20, No.23, (December

2001), pp. 6877-6888, ISSN 0261-4189.
Eng, J.K., McCormack, A.L., & Yates III, J.R. (1994) An Approach to Correlate Tandem Mass
Spectral Data of Peptides with Amino Acid Sequences in a Protein Database.
Journal of the American Society Mass Spectrometry, Vol.5, pp. 976989. ISSN 1044-0305.
Evan, G.I., Lewis, G.K., Ramsa, G., & Bishop, J.M. (1985) Isolation of Monoclonal Antibodies
Specific for Human c-myc Proto-onco- Gene Product. Molecular and Cellular Biology,
Vol.5 No.12, (December 1985), pp. 36103616. ISSN 0270-7306.
Fox, A.D., Hescott, B.J., Blumer, A., & Slonim, D.K. (2011) Connectedness of PPI Network
Neighborhoods Identifies Regulatory Hub Proteins. Bioinformatics, Vol.27, No.8,
(April 2011), pp. 1135-1142,, ISSN 1367-4803.
Gross J.H. (2004) Mass Spectrometry. Springer-Verlag, New York, NY 592 pp, ISBN
3540407391.
Golemis, E.A., & Adams, P.D. (2005) Protein-Protein Interactions, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY, 938 pp, ISBN 0-87969-723-7.
Harvey, M.C., & Sokolowski, B.H.A. (2009) In Vivo Verification of Protein Interactions in the
Inner Ear by Coimmunoprecipitation. In: Auditory and Vestibular Research, Methods
and Protocols, B. Sokolowski (Ed.), Vol.493, No.II, 299-310, Humana Press, Springer
Protocols. New York, NY, ISBN 978-1-934115-62-6.
Hopp, T.P., Prickett, K.S., Price V.L., Libby, R.T., March, C.J., Cerett, D.P., Urdal, D.L., &
Conlon, P.J. (1988) A Short Polypeptide Marker Sequence Useful for Recombinant
Protein Identification and Purification. Nature Biotechnology, Vol.6, (October 1988),
pp. 12041210, ISSN 1087-0156.
Huber, L.A., Pfaller, K., & Vietor, I. (2003) Organelle Proteomics: Implications for
Subcellular Fractionation in Proteomics. Circulation Research, Vol.92, No.9, (May
2003), pp. 962-968, ISSN 1524-4571.
Kathiresan, T., Harvey, M.C., & Sokolowski, B.H.A. (2009) The Use of 2-D Gels to Identify
Novel ProteinProtein Interactions in the Cochlea. In: Auditory and Vestibular
Research, Methods and Protocols, B. Sokolowski (Ed.), Vol.493, No.II, 269-286,
Humana Press, Springer Protocols. New York, NY, ISBN 978-1-934115-62-6.
Kerrien S, Orchard S, Montecchi-Palazzi L, Aranda B, Quinn AF, Vinod N, Bader G,
Xenarios I, Wojcik J, Sherman D, Tyers M, Salama JJ, Moore S, Ceol A, Chatr-
aryamontri A, Oesterheld M, Stmpflen V, Salwinski L, Nerothin J, Cerami E,
Cusick ME, Vidal M, Gilson M, Armstrong J, Woollard P, Hogue C, Eisenberg D,
Cesareni G, Apweiler R, Hermjakob H (2007) Broadening the Horizon--Level 2.5 of
the HUPO-PSI Format for Molecular Interactions. BMC Bioinformatics Vol.5, No.44
(October 2007), ISSN 1471-2105.
Lal, A., Haynes, S.R. & Gorospe, M. (2005) Clean Western Blot Signals From Immunopre-
cipitated Samples. Molecular and Cellular Probes, Vol.19, No.6, (December 2005), pp.
385388, ISSN 0890-8508.
Mateo, C., Fernandez-Lorente, G., Pessela, B.C., Vian, A., Carrascosa, A.V., Garcia, J.L.,
Fernandez-Lafuente, R., & Guisan J.M. (2001) Affinity Chromatography of
Polyhistidine Tagged Enzymes. New Dextran-Coated Immobilized Metal Ion Affinity
Chromatography Matrices for Prevention of Undesired Multipoint Adsorptions.
Journal of Chromatography A, Vol.915, No.1-2. (April 2001), pp. 97-106, ISSN 021-9673.
McGrath C.L. &. Katz, L.A. (2004) Genome Diversity in Microbial Eukaryotes. Trends in
Ecology and Evolution, Vol.19, No.1 (January 2004), pp. 32-38, ISSN 0169-5347.
Michaut, M., Kerrien, S., Montecchi-Palazzi, L., Chauvat, F., Cassier-Chauvat, C., Aude, J.C.,
Legrain, P., Hermjakob, H. (2008) InteroPORC: Automated Inference of Highly
Conserved Protein Interaction Networks. Bioinformatics, Vol. 24, No.14 (July 2008),
pp. 1625-1631, ISSN 1367-4803.
Moebius, J., Denker, K., & Sickmann, A. (2007) Ruthenium (II) Tris-Bathophenanthroline
Disulfonate Is Well Suitable for Tris-Glycine PAGE But Not for Bis-Tris Gels.
Proteomics Vol7, No.4, (February 2007), pp. 524527, ISSN 1615-9853.
Moore, G.E. Cramming More Components Onto Integrated Circuits. Electronics (Magazine),
Vol.38, No.8, (April 1965), pp. 114-117, Available from ftp://download.intel.com
/museum/Moores_Law/Articles-press_Releases/Gordon_Moore_1965_Article. pdf.
Navaratnam, D., (2009) Yeast Two-Hybrid Screening to Test for Protein-Protein Interactions
inf the Auditory system. In: Auditory and Vestibular Research, Methods and Protocols,
B. Sokolowski (Ed.), Vol.493, No.II, 299-310, Humana Press, Springer Protocols.
New York, NY, ISBN 978-1-934115-62-6.
Noronha, S., Kaufman, J., & Shiloach, J. (1999) Streamline Chelating for Capture and
Purification of Poly-His-Tagged Recombinant Proteins. Bioseparation, Vol.8, (1999),
pp. 145151, ISSN 0923-179X.
Olivier, M., Aggarwal, A., Allen, J., Almendras, A.A., Bajorek, E.S., Beasley, E.M., Brady,
S.D., Bushard, J.M., & Stanford Human Genome Group (2001) A High-Resolution
Radiation Hybrid map of the Human Genome Draft Sequence. Science, Vol.291,
No.5507, (February 2001), pp. 1298-1302, ISSN 0036-8075.
Pedersen RA. (1971) DNA Content, Ribosomal Gene Multiplicity, and Cell Size in Fish. Journal
of Experimental Zoology, Vol.177, No.1, (May 1971), pp. 65-78. ISSN 1932-5231.
Pellicer, J., Fay, M.F., & Leitch, I.J. (2010) The Largest Eukaryotic Genome of Them All?
Botanical Journal of the Linnean Society, Vol.164, No.1 (September 2010), pp. 1015,
ISSN 0024-4074.
Richert, S., Luche, S., Chevallet, M., Van Dorsselaer, A., Leize-Wagner, E., & Rabilloud, T.
(2004) About the Mechanism of Interference of Silver Staining with Peptide Mass
Spectrometry. Proteomics, Vol.4, No.4 (April 2004), pp. 909916, ISSN 1615-9853.
Sanger, F., Nicklen, S., & Coulson, A.R. (1977) DNA Sequencing with Chain-Terminating
Inhibitors, Proceedings of the National Academy of Sciences USA, Vol.74, No.12,
(December 1977), pp. 54635467, 0027-8424, ISSN 0027-8424.
Smejkal, G.B., Robinson, M.H., & Lazarev, A. (2004) Comparison of Fluorescent Stains:
Relative Photostability and Differential Staining of Proteins in Two-Dimensional
Gels. Electrophoresis, Vol.25, No.15, (August 2004), pp. 2511-2519, ISSN 0173-0835.
Terpe, K. (2003) Overview of Tag Protein Fusions: From Molecular and Biochemical
Fundamentals to Commercial Systems. Applied Microbiology and Biotechnology,
Vol.60, No.5, (January 2003), pp. 523-533, ISSN 0175-7598.
Venter, J.C., Adams, M.D., Myer, E.W., Li, P.W., Mural, R.J., Sutton, G.G., Smith, H.O.,
Yandell, M., & Celera Genome Working Group (2001) The Sequence of the Human
Genome, Science, Vol.291, No.5507, (February 2001), pp. 1304-1351, ISSN 0036-8075.
Vetter, D.E., Basappa, J., & Turcan, S. (2009) Multiplexed Isobaric Tagging Protocols for
Quantitative Mass Spectrometry Approaches to Auditory Research, In: Auditory and
Vestibular Research, Methods and Protocols, B. Sokolowski (Ed.), Vol.493, No.II, 345-
366, Humana Press, Springer Protocols. New York, NY, ISBN 978-1-934115-62-6.
Vinogradov, A.E. (2003) Selfish DNA is Maladaptive: Evidence From the Plant Red List.
Trends in Genetics, Vol.19, No.11, (November 2003), pp. 609614, ISSN 0168-9525.
Walhout, A.J., Boulton, S.J., Vidal, M. (2000) Yeast Two-Hybrid Systems and Protein
Interaction Mapping Projects for Yeast and Worm. Yeast, Vol.17, No.2, (June 2000),
pp.88-94, ISSN 0749-503X.
9
Flexible Protein-Protein Docking

Sebastian Schneider and Martin Zacharias
Technische Universitt Mnchen/Physik Department T38,
85747 Garching,
Germany
1. Introduction
Biological processes almost always involve protein-protein interactions. Understanding the
function of protein-protein interactions requires knowledge of the structure of the
corresponding protein-protein complexes. The experimental structure determination by X-
ray crystallography requires purification of large amounts of proteins. In addition, it is
necessary to crystallize the proteins in the native complex which may not be feasible for all
known interacting proteins. Multi-protein complexes mediate many cellular functions and
are in a dynamic equilibrium with the isolated components or sub-complexes (Gavin et al.,
2002; Rual et al., 2005). In particular, complexes of weakly or transiently interacting protein
partners are often not stable enough to allow experimental structure determination at high
(atomic) resolution. Experimental studies on detecting all protein-protein interactions in a
cell indicate numerous possible interactions ranging from few to several hundred possible
binding partners for one protein (Gavin et al., 2002; Rual et al., 2005). A full understanding
of cellular functions requires structural knowledge of all these interactions. In the
foreseeable future it will not be possible to determine the structure of all detected protein-
protein interactions experimentally at high resolution. Structural modeling and structure
prediction is therefore of increasing importance to obtain at least realistic structural models
of complexes (Bonvin, 2006; Andrusier et al., 2008; Vajda & Kozakov, 2009; Zacharias, 2010).
If the structure of the isolated protein partners or of closely related proteins is available it is
possible to use a variety of computational docking methods to generate putative complex
structures.
The driving force for the protein binding process corresponds to the associated change in
free energy which depends on the structural and physicochemical properties of the protein
partners. The lock and key concept of binding proposed by E. Fischer (Fischer, 1894)
emphasizes the importance of optimal sterical complementarity at binding interfaces as a
decisive factor to achieve high affinity and specificity. However, proteins and other
interacting biomolecules are not rigid but can undergo a variety of motions even at
physiological temperatures. The induced fit concept has evolved based on the observation
that binding can result in significant conformational changes of partner molecules
(Koshland, 1958). Within this concept protein partners induce conformational changes
during the binding process that are required for specific complex formation. It should be
emphasized, that in principle all possible molecular recognition processes require a certain
degree of conformational adaptation. In recent years extensions of the induced-fit concept,
based on ideas from statistical physics, emerged. A pre-existing ensemble of several inter-
convertible conformational states being in equilibrium has been postulated (Tsai et al., 1999).
Among these states are structures close to the bound and unbound forms. Binding of a
partner molecule to the bound form shifts the equilibrium towards the bound form. Since
every conformation is, in principle, accessible albeit with a potentially low statistical weight
already in the unbound state the original induced fit concept is a special case of ensemble
selection where only the presence of a ligand gives rise to an appreciable concentration of
the bound partner structure.
Progress in protein-protein docking prediction methods has been monitored with the help
of the community wide Critical Assessment of Predicted Interactions (CAPRI) experiment
(Janin et al., 2003; Lensink et al., 2007). In this challenge participating groups test the
performance of docking methods in blind predictions of protein-protein complex structures.
The results of the CAPRI challenge indicate that for protein partners with minor
conformational differences between unbound and bound conformation and some
experimental hints on the interaction region often quite accurate predictions of complex
structures are possible (Bonvin, 2006; Andrusier et al., 2008; Zacharias, 2010). However, the
docking problem becomes much more difficult when protein partners undergo significant
conformational changes upon association or for protein structures based on comparative
modeling (Andrusier et al., 2008; Zacharias, 2010). The magnitude of possible
conformational changes during association can range from local alterations of side chain
conformations to global changes of domain geometries and can even involve refolding of
protein segments upon association. Computational approaches to realistically predict
protein-protein binding geometries need to account for such conformational changes. Often,
protein-protein complex structures obtained from protein-protein docking but also in case of
comparative modeling are of limited accuracy and require further structural refinement to
achieve the generation of a realistic structural model. Since rigid docking is computationally
much faster compared to flexible docking, the majority of current protein-protein docking
approaches distinguishes between a first exhaustive systematic docking search followed by
a second refinement step of pre-selected putative complexes (Bonvin, 2006; Vajda &
Kozakov, 2009). Docking protocols may even consist of several consecutive refinement and
rescoring steps (Andrusier et al., 2008). In the present contribution recent progress in the
area of protein-protein docking with an emphasis on modeling conformational changes and
adaptation during protein binding processes will be discussed.
2. Protein protein docking

The purpose of computational protein-protein docking methods is to predict the structure of
a protein-protein complex based on the structure of the isolated protein partners. If the
structure of the isolated partner proteins is not known it is often possible to build structures
based on sequence homology to a known structure using comparative modelling methods.
Receptor and ligand proteins are discretized on three-dimensional grids and are portioned
into inside, surface and outside regions, respectively. Matching of surfaces is measured by
the overlap of surface regions. For each ligand rotation with respect to the receptor the
correlation problem is solved using Fast-Fourier-Transformation (FFT). After filtering and
possible refinement steps solutions with high overlap of surface regions (high surface
complementarity) are collected as putative solutions.
Flexible Protein-Protein Docking 163
Fig. 1. Rigid protein-protein docking using Fast Fourier Transformation to solve a

correlation problem.
2.1 Rigid docking methods

A variety of computational methods have been developed in recent years to efficiently
generate a large number of putative binding geometries. The initial stage consists typically
of a systematic docking search keeping partner structures rigid (Bonvin, 2006; Vajda &
Kozakov, 2009). Subsequently, one or more refinement and scoring steps of a set of
preselected rigid docking solutions are added to achieve closer agreement with the native
geometry and to recognize near-native docking solutions preferentially as the best or among
the best scoring complexes. In the initial search some unspecific sterical overlap between
docking partners is typically tolerated to implicitly account for conformational adjustment
of binding partners (e.g. Pons et al., 2009). Among the most common are geometric hashing
methods to rapidly match geometric surface descriptors of proteins (Norel et al., 1994) and
fast Fourier transform (FFT) correlation techniques to efficiently locate overlaps between
complementary protein surfaces (Katchalski-Katzir et al., 1992). In the latter approach the
two protein partners are represented by cubic grids, the grid points are assigned discrete
values for inside, outside and on the surface of the protein. A geometric complementarity
score can be calculated for the two binding partners by computing the correlation of the two
grids representing each protein. Instead of summing up all the pair products of the grid
entries one can make use of the Fourier correlation theorem. The corresponding correlation
integral can easily be computed in Fourier space. The discrete Fourier transform for the
receptor grid needs to be calculated only once. Due to the special shifting properties of
Fourier transforms the different translations of the ligand grid with respect to the receptor
grid can be computed by a simple multiplication in Fourier space. This process is repeated
for various relative orientations of the two proteins. A disadvantage of standard Cartesian
FFT-based correlation methods is the need to perform FFTs for each relative orientation of
one protein molecule with respect to the partner. This can be avoided by correlating
spherical polar basis functions that represent, for example, the surface shape of protein
molecules. It has been successfully applied in the field of protein-protein docking (Ritchie et
al., 2008). Recently, new multidimensional correlation methods have been developed that
allow the correlation of multi-term potentials. Each function needs to be expressed in terms
of spherical basis functions characterizing the surface properties of the protein partners
(Ritchie et al., 2008; Zhang et al., 2009).
Geometric hashing is another common approach to identify possible protein-protein
arrangements. It has been originally used as a computer visualization technique to match
complementary substructures of one or several data sets (Norel et al., 1994). In protein-
protein docking each protein surface is discretized as a set of triangles, which are stored in a
hash table. By means of a hash key similar matching triangles on the surface of protein
partners can be found quickly. During docking, these triangles comprise points on a
molecular surface, having a certain geometrical (concave, convex) or physico-chemical
(polar, hydrophobic) character. By matching triangles belonging to different molecules and
being of complementary character, putative complex geometries can be generated.
A third class of methods uses either Brownian Dynamics (Schreiber et al., 2009; Gabdoulline
& Wade, 2002), Monte Carlo, or multi-start docking minimization to generate large sets of
putative protein-protein docking geometries (Zacharias, 2003; Fernandez-Recio et al., 2003;
Gray et al., 2003). These methods have in principle the capacity to introduce conformational
flexibility of binding partners already at the initial search step. Since these approaches are
computational more expensive compared to FFT based correlation methods or geometric
hashing a search is frequently limited to predefined regions of the binding partners (Bonvin,
2006). Alternatively, it is possible instead of atomistic models to employ coarse-grained
(reduced) protein models to perform systematic docking searches. With such reduced
protein models it is possible to optimize docking geometries starting from tens of thousands
of protein start configurations (Zacharias, 2003; May & Zacharias, 2005). In order to limit the
number of putative complex structures generated during an initial docking search cluster
analysis is typically employed to reduce the number to a subset of representative complex
geometries. Recently, the limitations of rigid docking strategies combined with a rescoring
step have been systematically investigated by Pons et al. (2009). The authors applied a
combination of rigid FFT-correlation based docking and re-scoring using the pyDock
approach (Cheng et al., 2007). PyDock combines electrostatic Coulomb interactions with a
surface-area-based solvation term (and an optional van der Waals term). The protocol
showed very good performance for most proteins that undergo minor conformational
changes upon complex formation (<1 Rmsd between unbound and bound structures) but
unsatisfactory results for cases with significant binding induced conformational changes or
applications that involved homology modelled proteins. A conclusion is that more specific
scoring requires at the same time an improvement of the prediction accuracy of proposed
binding modes in terms of deviation from the experimental binding interface. It also
indicates the coupling between realistic scoring and accurate prediction of the complex
structure.
Fig. 2. Illustration of the ATTRACT docking methodology In the ATTRACT docking

approach (Zacharias, 2003) atomic resolution partner structures are first translated (arrows)
into a reduced (coarse-grained) representation based on pseudo atoms representing whole
chemical groups. The smaller (ligand) protein is placed at various orientations on many
starting placements around the receptor protein (in the middle of the Figure) followed by
energy minimization to find an optimal docking geometry. In case of an attractive pseudo
atom pair (black line in the plot on the right) an r-8/r-6-Lennard-Jones-type potential is used
(r is the distance between atoms). For a repulsive pair (red curve) the energy minimum is
replaced by a saddle point. The mathematical form of the scoring function is given in
(Fiorucci & Zacharias, 2010b).
2.2 Flexible docking methods

A significant fraction of experimentally known protein-protein complexes belongs to the
class that show only little conformational change upon complex formation. As indicated
above in such cases it is possible to separate the initial rigid search from a subsequent
flexible refinement and re-scoring step (see below). However, for many interesting docking
cases with large associated conformational changes explicit consideration of conformational
flexibility during the entire docking procedure or at an early refinement step appears to be
necessary. Furthermore, in order to enhance the impact of docking in structural biology it is
highly desirable to be able to use protein structures obtained by comparative (homology)
modeling based on a known template structure with sufficient sequence similarity to the
target protein. The accuracy of such comparative models depends on the correct alignment
of target and template sequence. Even in cases of significant average target-template
similarity the quality of the alignment is often not uniform along the whole protein
sequence for example due to insertions or deletions in the aligned sequences which can
result in structural inaccuracies. Overlap of such inaccurate structural segments with the
protein region in contact with binding partners may interfere with the possibility to produce
near-native complexes using rigid docking methods. This is also reflected in the fact that
docking cases that involve homology modelled protein partners belong to the most difficult
cases in the CAPRI docking challenge (Lensink et al., 2007).
One possibility to directly use computationally rapid rigid docking algorithms is to
indirectly account for receptor flexibility by representing the receptor target as an ensemble
of structures. The structural ensemble can, for example, be a set of structures obtained
experimentally (e.g. from nuclear magnetic resonance (NMR) spectroscopy) or can be
formed by several structural models of a protein. It is also possible to generate ensembles
from MD simulations (Grunberg et al., 2004) or from distance geometry calculations (de
Groot et al., 1997). Docking to an ensemble increases the computational demand and due to
the large number of protein conformations may also increase the number of false positive
docking solutions. In the field of small-molecule docking a variety of ensemble based
approaches have been developed in recent years (reviewed in Totrov & Abagyan, 2008).
Cross docking to ensembles from MD simulations have also been used to implicitly account
for conformational flexibility in protein docking (Krol et al., 2007). Mustard & Ritchie (2005)
generated protein structures deformed along directions compatible with a set of distance
constraints reflecting large scale sterically allowed deformations. Subsequently, the
structures were used in rigid body docking searches to identify putative complex structures.
Conformer selection and induced fit mechanism of protein-protein association have been
compared by ensemble docking methods using the RosettaDock approach (Chaudhury &
Gray, 2008). The RossettaDock approach includes the possibility of modelling both side
chain as well as backbone changes for a set of starting geometries obtained from a low-
resolution initial search (Wang et al., 2007). The method was able to successfully select
binding-competent conformers out of the ensemble based on favourable interaction energy
with the binding partner (Chaudhury & Gray, 2008). It was recently shown that the Rosetta
approach can also be used to simultaneously fold and dock the structure of symmetric
homo-oligomeric complexes starting from completely extended (unfolded) structures of the
partner proteins (Das et al., 2009).
For a limited number of start configurations (in case of knowledge of the binding sites) it is
possible to combine docking with molecular dynamics (MD) or Monte Carlo (MC)
simulations. This allows, in principle, for full atomic flexibility or flexibility restricted to
relevant parts of the proteins during docking. The HADDOCK program employs MD
simulations including ambiguous restraints to drive the partner structures towards the
approximately known interface (Dominguez et al., 2003). The success of HADDOCK in
many Capri rounds for targets where some knowledge of the interface region was available
underscores also the benefits of treating flexibility explicitly during early stages of the
docking process. For protein-protein docking it is always helpful to include some
knowledge on the putative interaction region. In these cases the docking problem can often
be reduced to the refinement of a limited set of docked complexes close to the known
binding site. Fortunately, for proteins of biological interest and with experimentally
determined structure there is often also some biochemical (e.g. mutagenesis) data available
on residues involved in binding to other proteins. Alternatively, bioinformatics techniques
to predict putative protein interaction regions can often be used to limit or restraint the
docking search to relevant protein surface parts. Several new techniques to locate putative
binding sites based on physico-chemical properties or evolutionary conservation have been
developed in recent years (e.g. de Vries & Bonvin, 2008).
Protein partner structures can undergo not only local adjustments (e.g. conformational
adaptation of side chains and backbone relaxation at the interface) during association but
also more global conformational changes that involve for example large loop movements or
domain opening-closing motions. Proteins in solution are dynamic and the question to what
extend the accessible conformational space in the unbound form overlaps with the bound
conformation has been at the focus of several experimental and computational studies.
Elastic Network Model (ENM) calculations are based on simple distance dependent springs
between protein atoms and despite its simplicity are very successful to describe the mobility
of proteins around a stable state (Bahar et al., 1997; Bahar et al., 2006). Systematic
applications to a variety of proteins indicate that there is often significant overlap between
observed conformational changes and a few soft normal modes obtained from an ENM of
the unbound form (Keskin, 1998; Tobi & Bahar, 2005; Bakan & Bahar, 2009). ENM-based
normal mode analysis has been used to identify hinge regions in proteins (Emekli et al.,
2008) and can also be used to design conformational ensembles.
Fig. 3. Docking including minimization in soft flexible normal modes (A) Illustration of the
flexible docking process of the taxi-inhibitor protein (pdb3HD8) to the xylanase target
receptor protein (pdb1UKR) using the ATTRACT program (May & Zacharias, 2005).
Putative translational motion of the inhibitor during docking approach is indicated by an
arrow and the deformability of the xylanse by the superposition of several structures
deformed in the softest normal mode (grey backbone tube representation). Best possible
docking solutions (in pink) of the inhibitor relative to the bound (green cartoon) and
unbound xylanase (red tube) are shown for rigid (B) and flexible (C) docking employing
minimization along the 5 softest normal mode directions of the xylanase receptor protein.
The placement of the inhibitor in the experimental structure is shown as grey tube. For
flexible docking the root-mean-square deviation (Rmsd) from the inhibitor placement in the
experimental structure was < 2 compared to > 8 in case of rigid docking.
It is also possible to use soft collective normal mode directions as additional variables
during docking by energy minimization (Zacharias & Sklenar, 1999; May & Zacharias, 2005).
This allows the rapid relaxation of protein structures on a global scale involving much larger
collective displacements of atoms during minimization then conventional energy
minimization using Cartesian or other internal coordinates. The application of refinement in
normal mode variables has been applied successfully in a number of studies (Lindahl &
Delarue, 2005; May & Zacharias, 2005; Mashiach et al., 2010). Based on a coarse-grained
protein model in the ATTRACT docking program (Zacharias, 2003) it has also been used in
systematic docking searches to account approximately for global conformational changes
already during the initial screen for putative binding geometries (May & Zacharias, 2008). In
cases where protein partners undergo collective changes that overlap with the NM variables
the approach can result in improved geometry and ranking of near-native docking solutions
and can also lead to an enrichment of solutions close to the native complex structure
(illustrated for an example case in Figure 3).
It should be emphasized that the inclusion of pre-calculated flexible degrees of freedom
obtained from the unbound partners assumes that the collective directions of putative
conformational change do not change upon binding to a partner protein. Although it has
been shown that in many cases one can indeed describe a significant part of the observed
conformational changes upon binding by a few collective degrees of freedom calculated for
the unbound protein partners this does not need to be generally correct (Keskin, 1998; Tobi
& Bahar, 2005; Bakan & Bahar, 2009). The binding partners may induce structural changes
that are not possible for the isolated partner. In such cases pre-calculated flexible degrees of
freedom cannot account for the true conformational change upon binding.
2.3 Prediction of putative binding regions prior to docking

If no experimental data on binding sites is available, binding site prediction methods can
provide useful data for information driven docking. This type of information can be very
helpful in order to limit the docking search or to evaluate and filter docking results. Docking
approaches like HADDOCK (Dominguez et al., 2003) are based on applying restraints
derived from experimentally known binding sites or predicted binding regions. Several
different approaches exist to identify putative protein-protein binding sites. These methods
focus on different characteristics of protein interaction sites like solvent accessibility (Chen
& Zhou, 2005) or desolvation properties (Pons et al., 2009; Fiorucci & Zacharias, 2010a) and
in many cases on combining different surface properties (Neuvirth et al., 2004; Liang et al.,
2006). De Vries and Bonvin (2008) divided the properties of binding sites into three groups:
1. Properties of residues; 2. Evolutionary conservation; 3. Data obtained from atomic
coordinates. The latter property includes, for example, secondary structure or solvent
accessibility of residues or protein regions.
The data generated by predictors using one or more binding site features is presented either
as a list of residues (Qin & Zhou, 2007) or as a patch on the proteins surface (Jones &
Thornton, 1997a,b). Patch methods generate one or more patches of circular shape which
can be found close to each other or distributed on the surface, sometimes additionally centre
coordinates of these spots are given. In the other case residues from residue list predictors
do not have to be nearby each other but are often clustered afterwards to receive a joined
prediction at one or more spots on the proteins surface. Since proteins often have more than
one binding site, prediction tools can indicate a correct binding site but maybe for the wrong
binding partner.
Zhou & Qin (2007) and de Vries & Bonvin (2008) analysed existing predictors which are
available as Web servers and evaluated the performance of these servers using 25 structures
from the CAPRI targets and several other datasets. The binding site predictions can be used
to evaluate possible predicted docking geometries but also to generate artificial binding sites
around the prediction to bias the docking run towards a desired region. On the other hand
predictions can be used to discard complexes with a low overlap of predicted contacts after
a systematic docking run. Examples of predicted binding regions compared to the known
binding sites are illustrated for two cases in Figure 4.
Fig. 4. Prediction of putative protein binding interfaces. Predictions were performed with
the meta-PPISP server (Qin & Zhou, 2007) on the partner proteins of an enzyme inhibitor
complex (pdb2SIC, left panel) and partners of a second complex (pdb1BUH, right panel). In
each case one partner is represented as surface or collection of spheres, respectively. Protein
partners are slightly displaced from the complexed state to indicate the native binding
interface. Red indicates high predicted probability for a residue to be in the binding site and
dark blue represents a low probability. Left example: The results match the real binding site.
Right panel: The prediction for the smaller protein overlaps with the real binding site while
for the larger protein residues quite far apart from the correct binding site are marked as
putative binding site residues.
2.4 Flexible refinement and rescoring of docking solutions

As indicated in the two previous paragraphs protein-protein docking solutions obtained
from an initial systematic docking run require typically a refinement and possibly also a
rescoring step (Bonvin, 2006; Andrusier et al., 2008). This is not only necessary in case of
rigid docking but also often if flexibility has been included approximately in the initial
search by methods described in the previous paragraph (e.g. minimization in normal mode
directions). The success of a multistep docking strategy requires that the set of initially
docking structures contains solutions sufficiently close to the native structure in order to
allow for further improvement during the refinement process. Hence, the initial scoring
needs to recognize and preselect a binding mode sufficiently close the native placement and
it has to simultaneously tolerate possible inaccuracies (atomic overlaps) at the interface.
Before refinement the docking solutions are clustered to reduce the number of distinct
docking geometries. Only one (the best scoring) solution from each cluster is typically used
for further refinement and possible rescoring.
Refinement of a docked complex can be achieved by energy minimization based on a force
field description of the proteins at atomic resolution. However, this results typically only in
small displacements of atoms to minimize overlap and to optimize locally a hydrogen

bonding network. Frequently, molecular dynamics (MD) simulations are employed to
achieve larger conformational adjustments compared to energy minimization during
docking refinement. MD simulations are based on numerically solving Newtons equation
of motion in small time steps (1-2 fs = 1-2 10-15 s) based on a molecular mechanics force field
description of the protein-protein complex (Karplus & McCammon, 2002). Due to the kinetic
energy of every atom of the proteins, it is in many cases possible to overcome energy
barriers and to move the structure significantly farer away from the initial docking
geometry. Depending on the simulation temperature and length displacements up to several
Angstroms from the initial atom positions are possible. However, if the displacements
during MD simulations indeed move the proteins towards a more realistic complex
structure depends on the accuracy of the force field and on a realistic representation of the
aqueous solution. Refinement simulations on a given protein-protein complex should,
ideally, include surrounding aqueous solvent and ions. This, however, increases the
computational demand for such refinement simulations. In addition, the equilibration of
explicit solvent molecules around a solute molecule requires significant simulation times
(currently limited to tens or in some cases hundreds of nanoseconds). Nevertheless, during
the final stages of some protein-protein docking protocols explicit water molecules can be
added to the simulation system (van Dijk & Bonvin, 2006). Explicit solvent MD simulations
can also be used to investigate the flexibility of protein structures prior to docking (Rajamani
et al., 2004; Camacho, 2005). It is for example possible to identify the alternative or most
likely side chain conformations. Using principal component analysis of the motions
extracted from MD simulations it is also possible to analyse the global conformational
flexibility of binding partners prior to docking (Amadei et al., 1993; Smith et al., 2005).
The possibility to implicitly account for solvent effects can be used to accelerate the
refinement process. A variety of implicit solvation models has been developed (reviewed in
Bashford & Case, 2000; Baker, 2005; Chen et al., 2008). Only a brief description of the most
relevant concepts for protein-protein docking and scoring will be given. A macroscopic
solvation concept describes the protein interior as a medium with a low dielectric
permittivity embedded in a high dielectric continuum representing the aqueous solution
(Baker, 2005). The effect of the solvent is then calculated as a reaction field from a solution of
Poissons equation for the charges assigned to each atom of the molecule. The mean effect of
a salt atmosphere can be included by solving the Poisson-Boltzmann equation. The most
common method to solve the Poisson-Boltzmann equation is the finite-difference method on
a grid representation of the protein system. However, the method cannot easily be
combined with MD refinement due to the difficulty to extract accurate solvation forces from
grid solutions of the Poisson-Boltzmann equation (Gilson et al., 1993).
It is possible to use more approximate methods like the Generalized Born (GB) method (Still
et al., 1990; Hawkins et al., 1995; Bashford & Case, 2000). In the GB approach an effective
solvation radius is assigned to each atom. This effective radius can be thought of as an
average distance of the selected atom from the solvent or from the solvent accessible surface
of the molecule. With the effective Born radii calculated for each atom the electrostatic
solvation and its derivative (solvation forces) can be calculated very rapidly (Schaefer &
Karplus, 1996; Onufriev et al., 2002). The GB method and related implicit solvent
approaches are frequently used during refinement of docked protein-protein complexes.
Once a set of docked and structurally refined complexes has been obtained a rescoring step
can be used to finally select the most realistic predicted complex. An ideal scoring function
should recognize favourable native contacts as found in the bound complex and
discriminate those from non-native contacts with lower scores. Scoring can be based on a
physical force field with optimized weights on the energetic contributions (Dominguez et
al., 2003; Bonvin, 2006; Audie, 2009) or can involve knowledge-based statistical potentials
derived from known protein protein complex structures (Gottschalk et al., 2004; Zhang et
al., 2005; Huang & Zou, 2008). Often a single descriptor (e.g. surface complementarity) or a
single binding energy component (e.g. van der Waals or electrostatic energy) is non-optimal
to distinguish non-native from near-native solutions. A combination of different surface and
interface descriptors has been shown to better enrich near-native solutions in the pool of
best scoring docking solutions (Murphy et al., 2003; Duan et al., 2005; Liu et al., 2006; Martin
& Schomburg, 2008; Pierce & Weng, 2008; Audie, 2009;Liang et al., 2009).
The experimentally determined protein-protein complex structures allow the extraction of
data on the statistics of residue-residue and atom-atom contact preferences at interfaces.
Based on these statistics it is possible to design knowledge-based scoring functions which in
general compare the frequency of contact pairs in known interfaces with the expected
frequency if residues or atoms would randomly distributed at interfaces. Effective
knowledge-based potentials have been developed that are based on contact preferences of
amino acids at known interfaces compared to interfaces of non-native decoy complexes
(Huang & Zou, 2008; Ravikant & Elber, 2009; Kowalsman & Eisenstein, 2009). The resulting
contact or distance dependent pair-potentials can improve the scoring of near-native
complexes. The distribution of amino acids in the core region of protein-protein interfaces
differs on average from the whole interface and the rim region which is partially exposed to
water even in the presence of the binding partner. This observation has also been explored
to improve the recognition of near-native binding geometries and has been demonstrated on
several test cases (Kowalsman & Eisenstein, 2009).
3. Conclusion
The rational modifications of protein surfaces are increasingly being used to design new
protein-protein binding interfaces. Another ultimate aim of protein-protein docking
approaches is the application on a systematic proteomic scale. Methods of protein-protein
docking and interface refinement could help to predict possible protein interaction
geometries and guide such protein interaction design. The realistic prediction of binding
geometries of protein-protein complexes is highly desirable to provide structural models for
the many important protein-protein interactions in a cell. Progress in both the efficiency and
in the development of new docking algorithms has been achieved in recent years. Still a
major challenge is the appropriate inclusion of possible conformational changes during the
docking searches. This is of great importance since for the many protein interaction cases
only homology modelled structures of the partners are available. Employing an appropriate
ensemble of protein conformations or, alternatively, the efficient explicit consideration of
conformational changes during docking are possible routes of progress. For many protein-
protein interactions experimental data (e.g. low resolution structural or biochemical data) is
available that restricts the range of possible complex structures. Here, restraint driven
docking techniques that include flexibility of the binding partners at early refinement stages
are promising. In recent years it has become clear that many protein-protein interactions
involve coupled folding of disordered parts of proteins upon association. The possibility of
structure prediction and modelling of such interactions is at a very early stage. Progress in
this area will require many new algorithms and method developments.
4. Acknowledgment
This work has been support by the Deutsche Forschungsgemeinschaft (DFG grant Za153/5-
3) and funding under the Sixth Research Framework Programme of the European Union
(FP6 STREP BacAbs, ref. LSHB-CT-2006-037325).
5. References
Amadei, A., Linssen, A. B. M. & Berendsen H. J. C. (1993). Essential dynamics of proteins,
Proteins 17, 412-425.
Andrusier, N., Mashiach E., Nussinov R. & Wolfson H. J. (2008). Principles of flexible
protein-protein docking, Proteins: Structure, Function, and Bioinformatics 73, 271-289.
Audie, J. (2009). Development and validation of an empirical free energy function for
calculating protein-protein binding free energy surfaces, Biophysical Chemistry 139,
84-91.
Bahar, I., Atilgan, A.R., Erman, B. (1997). Direct evaluation of thermal fluctuations in
proteins using a single-parameter harmonic potential, Folding Design 2, 173-181.
Bahar, I., Chennubhotla, C. & Tobi D. (2006). Intrinsic dynamics of enzymes in the unbound
state and relation to allosteric regulation, Current Opinion Structural Biology 16, 194-
200.
Bakan, A. & Bahar, I. (2009). The intrinsic dynamics of enzymes plays a dominant role in
determining the structural changes induced upon inhibitor binding, Proceeding of
the National Academy of Sciences USA 106, 14349-14354.
Bashford, D. & Case, D. A. (2000). Generalized born models of macromolecular solvation
effects, Annual Review of Physical Chemistry 51 , 129-152.
Baker, N. A. (2005). Improving implicit solvent simulations: a Poisson-centric view, Current
Opinion Structural Biology 15, 137-143.
Bonvin, A. M. J. J. (2006). Flexible protein-protein docking, Current Opinion Structural Biology
16, 194-200.
Camacho, C. J. (2005). Modeling side-chains using molecular dynamics improve recognition
of binding region in CAPRI targets, Proteins: Structure, Function, and Bioinformatics
60, 245-251.
Chaudhury, S. & Gray, J. J. (2008). Conformer selection and induced fit in flexible backbone
protein-protein docking using computational and NMR ensembles. Journal of
Molecular Biology 381, 1068-1087.
Chen, J., Brooks, C. L. 3rd & Khandogin J. (2008). Recent advances in implicit solvent-based
methods for biomolecular simulations, Current Opinion Structural Biology 18 , 140-
148.
Chen, H. & Zhou, H.-X. (2005). Prediction of interface residues in proteinprotein complexes
by a consensus neural network method: Test against NMR data, Proteins: Structure,
Function, and Bioinformatics 61, 2135.
Cheng, T. M., Blundell, T. L. & Fernandez-Recio, J. (2007). PyDock: electrostatics and
desolvation for effective scoring of rigid-body protein-protein docking, Proteins 68,
503-515.
Das, R., Andre, I., Shen, Y., Wu, Y., Lemak, A., Bansal, S., Arrowsmith, C.H., Szyperski, T.,
Baker, D. (2009). Simultaneous prediction of protein folding and docking at high
resolution, Proceeding of the National Academy of Sciences USA 106, 18978-18983.
de Groot, B. L., van Aalten, D. M. F., Scheek, R. M., Amadei, A., Vriend, G., and Berendsen,
H. J. C. (1997). Prediction of protein conformational freedom from distance
constraints. Proteins: Structure, Function, and Bioinformatics 29, 240-251.
De Vries, S. J. & Bonvin, A. M. J. J. (2008). How proteins get in touch: interface prediction in
the study of biomolecular complexes,. Current Protein Peptide Science 9, 394-406.
Dominguez, C., Boelens, R. & Bonvin, A. M. J. J. (2003). HADDOCK: A protein-protein
docking approach based on biochemical and biophysical information, Journal of the
American Chemical Society 125, 1731-1737.
Duan, Y., Reddy, B. V. B. & Kaznessis, Y. N. (2005). Physicochemical and residue
conservation calculations to improve the ranking of protein-protein docking
solutions, Protein Science 14, 316-328.
Emekli, U., Schneidman-Duhovny, D., Wolfson, H.J., Nussionov, R., Haliloglu, T. (2008).
HingeProt: automated prediction of hinges in protein structures, Proteins: Structure,
Function, and Bioinformatics 70, 1219-1227.
Fernandez-Recio, J., Totrov, M. & Abagyan, R. (2003). ICM-DISCO docking by global energy
optimization with fully flexible side-chains, Proteins: Structure, Function, and
Bioinformatics 52, 113-117.
Fiorucci, S. & Zacharias, M. (2010a). Prediction of Protein-Protein Interaction Sites Using
Electrostatic Desolvation Profiles, Biophysical Journal 98, 1921-1930.
Fiorucci, S. & Zacharias, M. (2010b). Binding site prediction and improved scoring during
flexible protein-protein docking with ATTRACT. Proteins. 78, 3131-3139.
Fischer, H. (1894). Einflu der Configuration auf die Wirkung der Enzyme, Chemische
Berichte 27, 2985-2993.
Gabdoulline, R. R. & Wade, R. C. (2002). Biomolecular diffusional association, Current
Opinion Structural Biology 12, 204-213.
Gavin, A. C., Bosche, M., Krause, R., Grandi, P., Marzioch, M., Bauer, A., Schultz, J., Rick, J.
M., Michon, A. M., Cruciat, C. M., et al. (2002). Functional organization of the yeast
proteome by systematic analysis of protein complexes, Nature, 415, 141-147.
Gilson, M. K., Davis, M. E., Luty, B. A. & McCammon, J. A. (1993). Computation of
Electrostatic Forces on Solvated Molecules Using the Poisson-Boltzmann Equation,
Journal of Physical Chemistry 97, 3591-3600.
Gottschalk, K. E., Neuvirth, H. & Schreiber G. (2004). A novel method for scoring of docked
protein complexes using predicted protein-protein interaction sites, Protein
Engneering 17 183-189.
Gray, J. J., Moughon, S. E., Kortemme, T., Schueler-Furman, O., Misura, K. M. S., Morozov,
A. V. & Baker, D. (2003). Protein-protein docking predictions or the CAPRI
experiments, Proteins: Structure, Function, and Bioinformatics 52, 118-122.
Grunberg R., Leckner, J. & Nilges, M. (2004). Complementarity of structure ensembles in
protein-protein docking, Structure 12, 2125-2136.
Hawkins, G. D., Cramer, C. J. & Truhlar, D. G. (1995). Pairwise solute descreening of solute
charges from a dielectric medium, Chemical Physics Letters 246, 122-129.
Huang, S-Y., Zou, X. (2008). An iterative knowledge-based scoring function for protein-
protein recognition, Proteins 71, 557-579.
Janin, J., Henrick, K., Moult, J., Eyck LT, Sternberg, M. J., Vajda, S., Vasker, I., Wodak, S. J.
(2003). CAPRI: a critical assessment of predicted interactions, Proteins : Structure,
Jones, S. & Thornton, J. M. ( 1997a). Analysis of protein-protein interaction sites using
surface patches, Journal of Molecular Biology 272, 121-132.
Jones, S. & Thornton, J. M. ( 1997b). Prediction of protein-protein interaction sites using
patch analysis, Journal of Molecular Biology 272, 133-143.
Karplus, M. & McCammon, J. A. (2002). Molecular dynamics of biomolecules. Nature
Structural Biolog, 9 646-652.
Katchalski-Katzir, E., Shariv, I., Eisenstein, M., Friesem, A. A., Aflalo, C. & Vakser I. A.
(1992). Molecular surface recognition: Determination of geometric fit between
proteins and their ligands by correlation techniques, Proceeding of the National
Academy of Sciences USA 89, 2195-2199.
Keskin, O. (1998). Binding induced conformational changes of proteins correlate with their
intrinsic fluctuations: a case study of antibodies. BMC Structural Biology 7, 31-42.
Koshland, D. E. (1958). Application of a theory of enzyme specificity to protein synthesis,
Proceeding of the National Academy of Sciences USA 17, 1145-1150.
Kowalsman, N. & Eisenstein M. (2009). Combining interface core and whole interface
descriptors in postscan processing of protein-protein docking models, Proteins:
Structure, Function, and Bioinformatics 77, 297-318.
Krol, M., Chaleil, R. A., Tournier, A. L. & Bates P. A. (2007). Implicit flexibility in protein
docking : cross docking and local refinement, Proteins: Structure, Function, and
Lensink, M. F., Mendez, R., Wodak, S. J. (2007). Docking and scoring protein complexes:
CAPRI 3rd Edition, Proteins Structure, Function, and Bioinformatics, 69, 704-718.
Lindahl, E. & Delarue, M. (2005). Refinement of docked protein-ligand and protein-DNA
structures using low-frequency normal mode amplitude optimization, Nucleic Acids
Research 33, 4496-4506.
Liang, S., Zhang, C., Liu, S. & Zhou, Y. (2006). Protein binding site prediction using an
empirical scoring function, Nucleic Acid Research 34, 3698-3707.
Liang, S., Meroueh , S. O., Wang, G., Qiu, C., Zhou, Y. (2009). Consensus scoring for
enriching near-native structures from protein-protein docking decoys, Proteins:
Liu, S., Li, Q. & Lai, L. (2006). A combinatorial score to distinguish biological and non-
biological protein-protein interfaces, Proteins: Structure, Function, and Bioinformatics
64, 68-78.
Martin, O., Schomburg, D. (2008). Efficient comprehensive scoring of docked protein
complexes using probabilistic support vector machines. Proteins: Structure,
Mashiach, E., Nussinov, R. & Wolfson. H. J. (2010). FiberDock: Flexible induced-fit backbone
refinement in molecular docking, Proteins: Structure, Function, and Bioinformatics 78,
1503-1519.
May, A. & Zacharias, M. (2005). Accounting for global protein deformability during protein
protein and proteinligand docking, Biochimica et Biophysica Acta 1754, 225-231.
May, A. & Zacharias, M. (2008). Energy minimization in low-frequency normal modes to

efficiently allow for global flexibility during systematic protein-protein docking,
Proteins 70, 794-809.
Murphy, J., Gatchell, D. W., Prasad, J. C. & Vajda S. (2003). Combination of scoring functions
improves discrimination in protein-protein docking, Proteins 53, 840-854.
Mustard, D. & Ritichie, D. W. (2005). Docking essential dynamics eigenstructures, Proteins:
Neuvirth, H., Raz, R. Schreiber, G. (2004). ProMate: A Structure Based Prediction Program to
Identify the Location of ProteinProtein Binding Sites, Journal of Molecular Biology
338, 181-199.
Norel, R., Fischer, D., Wolfson, H. J. & Nussinov R. (1994). Molecular surface recognition by
a computer vision-based technique, Protein Engneering. 7, 39-46.
Onufriev, A., Case, D. A. & Bashford, D. (2002). Effective Born radii in the generalized Born
approximation: the importance of being perfect, Journal of Computational Chemistry
23, 1297-1304.
Pierce, B., Weng, Z. (2008). A combination of rescoring and refinement significantly
improves protein docking performance, Proteins: Structure, Function, and
Pons, C., Grosdidier, S., Solernou, A., Perez-Cano, L. & Fernandez-Recio, J. (2009) Present
and future challenges and limitations in protein-protein docking, Proteins: Structure,
Function, and Bioinformatics, 78, 95-108.
Qin, S. & Zhou, H.-X. (2007). meta-PPISP: a meta web server for protein-protein interaction
site prediction, Bioinformatics 23, 3386-3387.
Rajamani, D., Thiel, S., Vajda, S. & Camacho, C. J. (2004). Anchor residues in protein- protein
interactions, Proceeding of the National Academy of Sciences USA 101, 11287-11292.
Ravikant, D. V. S, Elber, R, (2009). PIE-efficient filters and coarse grained potentials for
unbound protein-protein docking. Proteins: Structure, Function, and Bioinformatics,
75, 133-145.
Ritchie, D., Kozakov, D., Vadja, S. (2008). Accelerating and focusing protein-protein docking
correlations using Multi-dimensional rotational FFT generating functions.
Rual, J. F., Venkatesan, K., Hao, T., Hirozane-Kishikawa, T., Dricot, A., et al. (2005). Towards
a proteome-scale map of the human protein-protein interaction network, Nature,
437, 1173-1178.
Schaefer, M. & Karplus, M. (1996). A comprehensive analytical treatment of continuum
electrostatics, Journal of Physical Chemistry 100, 1578-1599.
Schreiber, G., Haran, G., Zhou, H.-X (2009) Fundamental Aspects of protein-protein
association kinetics, Chemical Reviews 1009, 839-860.
Smith, G. R., Sternberg, M. J. E. & Bates P. A. (2005). The relationship between the flexibility
of proteins and their conformational states on forming protein-protein complexes
with an application to protein-protein docking. Journal of Molecular Biology 347,
1077-1101.
Still, W. C., Tempczyk, A., Hawley, R. C. & Hendrikson, T. (1990). Semianalytical Treatment
of Solvation for Molecular Mechanics and Dynamics, Journal of the American
Chemical Society 112, 6127-6129.
Totrov M. & Abagyan, R. (2008). Flexible ligand docking to multiple receptor conformations:
a practical alternative, Current Opinion Structural Biology 18:178-184.
Tsai, C. J., Kumar, S., Ma, B. (1999). Nussinov R: Folding funnels, binding funnels, and
protein function, Protein Science 8, 1181-1190.
Tobi, D., & Bahar, I. (2005). Structural changes involved in protein binding correlate with
intrinsic motions of proteins in the unbound state, Proceeding of the National
Academy of Sciences USA 2005, 102:18908-18913.
van Dijk, A. D. J. & Bonvin, A. M. J. J. (2006). Solvated docking: introducing water into the
modelling of biomolecular complexes. Bioinformatics. 22, 2340-2347.
Vajda, S. & Kozakov D, (2009) Convergence and combination of methods in protein-protein
docking. Current Opinion Structural Biology 19:164-170.
Wang, C., Bradley, P. & Baker, D. (2007). Protein-protein docking with backbone flexibility,
Journal of Molecular Biology 373, 503-519.
Zacharias, M. & Sklenar, H. (1999). Harmonic modes as variables to approximately account
for receptor flexibility in ligand-receptor docking simulations: Application to a
DNA minor groove ligand complex, Journal of Comput Chemistry 20, 287-300.
Zacharias, M. (2003). Protein-protein docking using a reduced model, Protein Science 12,
1271-1282.
Zacharias, M. (2010). Accounting for conformational changes during protein-protein
docking,. Current Opinion Structural Biology 16, 194-200.
Zhang, C., Liu, S. & Zhou, Y. (2005). Docking prediction using biological information,
ZDOCK sampling technique, and clustering guided by the DFIRE statistical energy
function,. Proteins: Structure, Function, and Bioinformatics 60, 314-318.
Zhang, Q., Sanner, M. & Olson A. J. (2009). Shape complementarity of protein-protein
complexes at multiple resolutions, Proteins: Structure, Function, and Bioinformatics
75, 453-467.
Zhou, H.-X. & Qin, S. (2007). Interaction-site prediction for protein complexes: a critical
assessment, Bioinformatics 23, 2203-2209.

17373.selected Works in Bioinformatics by Xuhua Xia PDF

Uploaded by

Copyright:

Available Formats

17373.selected Works in Bioinformatics by Xuhua Xia PDF

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

17373.selected Works in Bioinformatics by Xuhua Xia PDF

Uploaded by

Copyright:

Available Formats

SELECTED WORKS IN

Copyright 2011 InTech

Publishing Process Manager Silvia Vlase

First published October, 2011

A free online edition of this book is available at www.intechopen.com

Selected Works in Bioinformatics, Edited by Xuhua Xia

Chapter 1 Allergen Bioinformatics:

Chapter 2 Family Based Studies in Complex Disorders:

Chapter 3 Guide to Genome-Wide Bacterial

Chapter 4 Understanding LiP Promoters from

Chapter 5 Prediction and Experimental Detection of Structural

Chapter 6 Relaxed Linear Separability (RLS)

Chapter 7 Disease Gene Prioritization 119

Chapter 8 Exploiting Protein Interaction Networks

Chapter 9 Flexible Protein-Protein Docking 161

Publicly available databases also facilitate the identification of disease genes,

Angela Xuereb Anastasi provides a real example of such an application involving

Given a set of aligned sequence segments that are experimentally verified to be

While many bioinformatic studies focus on identifying shared sequence features in

How can we identify a regulon in response to an environmental change? In the case

A conceptually closely related but computationally different method is presented by

To be fair, biomedical scientists in general, and biochemists in particular, have

readers might feel concerned about an overemphasis on physical interactions in recent

With a large number of protein physical interactions and interaction networks

Dr. Xuhua Xia

Allergen Bioinformatics: Recent

2. Allergen bioinformatics - a need of the hour

Name (URL) Purpose

3.1 Allergens seen as proteins without bacterial homolog

3.2 Allergenic proteins can be organized into families

Allfam ID Name Pfam ID Allergens Examples

Expansin, N- Phl p 1 (timothy grass)

Fig. 3. Dendrogram showing evolutionary relationship among 12 different parvalbumins (a)

Fig. 4. Un-rooted neighbor-joining tree showing evolutionary relationship among the

3.3 Allergen-associated protein domains

Fig. 5. Distribution of Pfam domains in allergenic proteins according to Motifmate database.

4. Insights from structural bioinformatics

respective human homologues(Crameri et al., 1996) and such cross-reactivity might be

retained the basic cyclophilin structure. More recently, a comprehensive 3D structural

(2003) Molecular characterization of recombinant T1, a non-allergenic periwinkle

Family Based Studies in Complex Disorders:

1.1 Gene mapping using families

1.1.1 Linkage analysis

1.1.2 Parametric linkage analysis

z(x) = log10 [L(=x) L(=0.5)] (1)

1.1.3 Non-parametric linkage analysis

1.2 Phenotype definition, selection of family and population

2. Materials and methods

2.2.1 Microsatellite genotyping

2.3 Analysis of linkage data

2.3.1 Using EasyLinkage v5.05 graphical user interface (GUI)

2.3.2 Data entry

A_1 A_1_01 A_1_11 A_1_12 2 2

MARKER LANE ID A_1 A_2

2.3.3 Running EasyLinkage analysis

3.2 Linkage results

Phenotype LOD (cM) HLOD () NPL (p-val) Zlr

Phenotype LOD (cM) HLOD () NPL (p-val) Zlr

Penetrance LOD/HLOD LOD/HLOD LOD/HLOD LOD/HLOD LOD/HLOD