March 7th, 2016

Class 35 Learning Goals

Biotechnology: PCR

•  After this class, you should be able to:

–  Diagram any stage of a PCR reaction
–  Predict the next stage in a PCR reaction and explain the types
and sizes of molecules present

–  Describe the process of designing PCR primers

–  Understand the process of PCR enough to hypothesize

uses for PCR in analyzing different kinds of DNA-related
issues
 Amplifying DNA: The need for many copies

•  In chemistry, you’ve use purified solutions of a single

molecule to analyze the characterize that molecule
•  We need to produce many copies of a single DNA region
•  The Polymerase Chain Reaction is a method for making many
copies of a single, specific region from any larger DNA
•  This is called ‘amplification’
PCR: Designing primers to a specific location

Design a DNA primers matching these regions

5ʹ 3ʹ

3ʹ 5ʹ
Region of DNA to
be amplified by PCR

When target DNA is single-stranded,

-primers bind
-create an accessible 3’OH
5ʹ -allow DNA polymerase to bind and polymerize 3ʹ

3ʹ 5ʹ
Primer
Primer
5ʹ 3ʹ
3ʹ 5ʹ
PCR: Resetting the cycle

Primers
5ʹ 3ʹ
3ʹ
5ʹ
5ʹ
3ʹ
3ʹ 5ʹ
dNTPs

Temperatures for each step:

1) Denaturation: 90-96°C
2) Annealing: 50-60°C
3) Extension: 67-72°C
PCR: Extending , Cycling
5ʹ 3ʹ 5ʹ 3ʹ

5ʹ 3ʹ 5ʹ

5ʹ 5ʹ 3ʹ

3ʹ 5ʹ 5ʹ
3ʹ
 Explain “Gel Electrophoresis”

A mixture of DNAs
+
+
++

What charge do pieces of DNA have?

In what direction does DNA move through this electrified gel?

Why do shorter fragments move farther through the gel?

 Peer Instruction
ddGTPs have no 3’OH and will terminate polymerization
Template DNA
3ʹ 5ʹ

5ʹ 5ʹ

Normal
dNTP 3ʹ 3ʹ
No OH
ddGTP
(terminates 5ʹ 3ʹ
synthesis) Labeled primer Non-template DNA

ddGTP’s

How does use of ddNTP create different-sized PCR fragments?

In this reaction, what do we know about each of these fragments?

 Peer Instruction
How does fluorescent sequencing work?

Long
fragments
Four different color-labels are added (one for each ddNTP)

Template DNA

DNA polymerase

Fragments of newly
synthesized DNA that result
have distinctive labels.
Reaction mix contains ddATP, Short
ddTTP, ddGTP, ddCTP with distinct fragments
fluorescent markers. Capillary Output
tube

Separate fragments via electrophoresis in mass-

produced, gel-filled capillary tubes.
Automated sequencing machine reads output.
 Concept Questions

What would a diagram of the elongation step of PCR look like?

What would a diagram of the annealing step of PCR look like?

Can PCR help to determine if two different PCR products are of

different sizes?

Can PCR help to determine if two pieces of DNA have different

sequence? (hint: primer sequence design could help)

Fill out the following table (hint: find the algorithms!):

Cycle # of Genomic # of half-long # of short (target # of total
Strands strands strands) strands
1
2
3
4
5
6
7
8
March 8th, 2016 Class 36 Learning Goals

Biotechnology: Genetic Modification

•  After this class, you should be able to:

–  Describe each step needed for a human immune gene therapy
procedure.

–  Compare and contrast

•  human gene therapy with retroviruses,
•  plant genetic modification with agrobacterium, and
•  DNA modification with CRISPR/Cas.

–  Analyze a gene therapy scheme and point out logistically

difficult parts of the procedure
Cloning: Reverse Transcriptase

Central Dogma: DNA RNA Protein

Reverse Transcriptase:
(developed from viruses)

Single-stranded “cDNA” Double-stranded cDNA

Primer DNA
mRNA polymerase
Reverse
transcriptase
 Restriction endonucleases Peer Instruction

BamH1 is an enzyme found in a strain of the DNA

bacteria Bacillus amyloliquefaciens.

This enzyme can cut DNA as shown here:

The sequence GGATCC is a palindrome that

Is not found in the Bacillus genome.

1)  How does this bacteria use the enzyme to destroy viruses?

BamH1 is one of thousands of different DNA of E. coli

“restriction endonucleases”.

Cut sites for different REs

2) How would a human biologist use a RE?

3) Why is a ‘sticky end’ more useful than
a typical double-stranded break?
Cloning: Plasmid Insertion

To carry and keep this gene safe,

we’ll load it onto a circular DNA plasmid

Restriction
endonuclease
(EcoR1)
Recognition site Recognition site
5ʹ 3ʹ

3ʹ 5ʹ 5ʹ 3ʹ
3ʹ 5

Plasmid

Sticky end
Transformation: Plasmid Vector DNA ligase catalyzes a
phosphodiester bond

Plasmid Recombinant
plasmid

E. Coli cells

Recombinant
plasmid
 Peer Instruction
What is happening in this reaction?

Why is a human retrovirus involved?

Double-stranded DNA of
Viral Human DNA complementary introduced genes
RNA RNA
to introduced RNA

Human cell

Host DNA

Reverse
transcriptase
A plant vector… Peer Instruction
Agrobacterium cell Genes that
help insert
Ti the T-DNA
plasmid

Main chromosome
T-DNA

Genes and promoters that increase cell growth

Host-cell
chromosomes How does the Agrobacterium make
a safe structure for itself in its host?
Plant cell
nucleus

Inserted T-DNA
Agrobacterium
cells
Explain vector preparation in Agrobacterium. Peer Instruction

Tumor-inducing genes

1. Start with normal

T-DNA Ti plasmids

2. Remove tumor-
T-DNA inducing genes.

r
Promote

3. Add genes for

Genes for three enzymes required for β-
enzymes carotene synthesis
along with promoter
that will be activated in
endosperm.
 Peer Instruction
Binds to the Cas9 enzyme

A guide RNA:

Complementary to a genomic sequence

The gRNA enters the nucleus…

The Cas9 enzyme:

Cas9 is guided to the •  Naturally occurring in bacteria
site and cuts the DNA •  Can be transfected into any cell

What can the Cas9 enzyme

do that vectors cannot?
 Peer Instruction
Binds to the Cas9 enzyme

A guide RNA:

Complementary to a genomic sequence

The gRNA enters the nucleus…

Break a particular
sequence
Cas9 is guided to the
site and cuts the DNA
Add a dsDNA for
insertion/replacement

Bring a regulating
factor to the site
 When Test Crossing is Difficult: Pedigrees

I Carrier male Carrier female

Each row represents a generation

Carriers (heterozygotes)
are indicated with half-
filled symbols

II Affected
male
Female Male

III Affected
female

IV
III.5
 Mapping a chromosome: recombination rates
radi ceto drckl abo elbow Forty.2

radi 0 50 19 18 17 4

ceto 50 0 50 50 50 50

drckl 19 50 0 37 2 15

abo 18 50 37 0 35 22

elbow 17 50 2 35 0 13

Forty.2 4 50 15 22 13 0

How to start? On a chromosome, elbow and forty.2 are

separated by 13 distance units.
 Concepts Questions
•  What are the steps needed to build insulin in a bacterial vector?
How does each one work?

•  Why can’t we use agrobacterium to modify human DNA?

•  How could CRISPR help in the fight against cancer? Against Alzheimer’s?

•  Which biotechnology discussed today is most likely to have negative

unintended consequences for a patient? Which is least likely?

•  If you could use the Cas/CRISPR system, what gene would you change?
How? Why?
•  What would be the molecular effect and the phenotype effect?
March 9th, 2016 Class 37 Learning Goals

Genomics

•  After this class, you should be able to:

–  Assess the likelihood of finding a particular kind of gene in a
human genomic region

–  Describe comparative features of several genomes

–  Build a small gene map from recombination data

–  Describe the differences between a genome, an enterome,

a proteome, a transcriptome, and a biome.
 Crossing over in Meiosis

Gene 1 Gene 1
Gene 2
Crossing over
Crossing over is occurs frequently
rare between between genes
genes that are that are far apart
close together
Gene 3
(a) Mapping genetic distance

Yellow body
White eyes

Singed bristles
 Mapping a chromosome: recombination rates
radi ceto drckl abo elbow Forty.2

radi 0 50 19 18 17 4

ceto 50 0 50 50 50 50

drckl 19 50 0 37 2 15

abo 18 50 37 0 35 22

elbow 17 50 2 35 0 13

Forty.2 4 50 15 22 13 0

How to start?
On a chromosome, elbow and forty.2 are separated by 13 distance units.
Radi is 4 units away from forty.2, so it must be in one of two places…
Genetic Mapping: Huntington’s
Disease
Close physical association between
recognition site and defective allele.

Genetic marker
restriction sites
absent
Defective
Chromosome of diseased Huntington’s gene
individual (disease allele)

Chromosome of healthy
individual Normal
Huntington’s gene

Genetic marker Genetic markers at

restriction sites
other locations are
present
equally likely to be
found in affected and
unaffected individuals
 Peer Instruction

HD brain: How does Huntington’s disease work?

Normal
Htt protein
Wt brain:

Mutant
Htt protein

Normal allele:
ATGCGCGTGATAGCTGATAGCGAGCAG[26xCAG]CAGTTAGCGATTA…
M R V I A E S D Q 26xQ Q L A I…

Disease causing allele:

ATGCGCGTGATAGCTGATAGCGAGCAG[150+ x CAG]CAGTTAGCGATTA…
M R V I A E S D Q 150xQ Q L A I…
Genome Sequencing

First genome sequenced: a 3,500 bp RNA phage ‘76

First DNA genome: a 5,000 bp DNA phage in ‘77
First prokaryote: A bacteria in ‘95 (1.8 million bp)

Billions of nucleotides sequenced

First eukaryote: A yeast in ‘96 (12 million bp)
First animal: C. elegans worm in ‘96 (100 million)
Human genome “finished”: ‘00
(~70% of 3.2 billion bp…currently ~93%)

Current # of genomes: 180+ and growing

Year
 Sequencing:
Two methods: Slow and Shotgun
new sequence
primer

known sequence
~160-kb fragments 1. Cut DNA at random locations
Genomic DNA into fragments of ~160 kb.

BAC 2. Clone using BACs.

BAC library
Main bacterial
chromosome
Many copies (three shown)
1-kb fragments of each 160-kb fragment, 3. Cut into 1-kb fragments.
each cut differently

“Shotgun 4. Clone using plasmids.

clones”

Shotgun 5. Sequence each fragment.

sequences

6. Assemble all the 1-kb fragments.

Draft sequence 7. Assemble all the 160-kb fragments.

 Peer Instruction

This is data from the human genome.

What do you notice?

Repeated DNA (centromeres, telomeres)

Genes

‘Junk’ DNA

Mobile genetic elements like

transposons (both viable and ‘dead’)
Data: Breakdown of Protein trafficking
human genes Cell cycle
Cell proliferation and differentiation
Cell structure and motility
Transport

Immunity and defense

Unknown
Developmental
processes

Other metabolism

Protein metabolism
Misc.
and modification
function
Signal Nucleoside, nucleotide,
transduction and nucleic acid metabolism
 Developmental
processes Protocadherins are the largest subgroup
within the cadherin family of Ca-dependent
cell-cell adhesion molecules. Interestingly, many of
the protocadherins in mammals are highly expressed
in the central nervous system. In the postnatal
mammal brain, protocadherins are possibly involved
in the modulation of synaptic transmission and the
generation of specific synaptic connections.

Human Octopus
Total amount of DNA 3.1 gbp 2.7 gbp

Total # of genes ~25,000 <33,000

Total # of 58 168
protocadherin genes

What happened in octopus evolution?

Unique arm neurons in this mollusk allow highly coordinated creative

sensory and motor action…even to act independently. This distributed
neural network makes octopi uniquely intelligent among invertebrates.
 Peer Instruction
Genome size (Mbp) What does this data tell us?

Nonparasitic
bacteria

Parasitic bacteria

Number of protein-encoding genes

Can you find a trend in genome size and number of genes?

What would be most closely related to a species with 220

million base pairs and ~27,000 genes?
Here is a species with 220 million base pairs and ~27,000 genes:

Tetrahymena:
•  Unicellular
•  Ciliate
•  Rotifer

Macronucleus

Micronucleus

bacterial prey
Here is a species with 220 million base pairs and ~27,000 genes:

Tetrahymena:
•  Unicellular
•  Ciliate
•  Rotifer

bacterial prey
 Gene duplication and evolution

8 repeats
1. Homologs pair up.
8 repeats

2. Repeats misalign. Crossing

over and recombination occur.
Chromosomes break
and exchange here

10 repeats
3. Products are unique.
6 repeats

Globin gene family

Pseudogene Coding gene

 Proteome research
•  The set of all proteins in a cell is the
‘proteome’
•  Because protein is the functional unit in
many systems, analyzing protein levels
can give exact data
–  Can decipher alternative splicing
variations
–  Can account for post-translational
modification and degradation
–  Allows for time-sensitive analysis of
signals and responses
–  However, it is very difficult due to the
variety of structures possible
•  Mass spectrometry can help analyze
cell protein content
•  Large-scale binding searches
Transcriptome Research: Microarrays

Normal High Example of a

temperature temperature functional genomics
comparison

1. Isolate mRNAs
and use reverse
transcriptase to
prepare single-
stranded cDNA.
Reverse
mRNA transcriptase

cDNA

2. Make cDNA
cDNA probes.
probes
 Microarrays:
Visualizing the 3. Probe a
microarray.
data Microarray

Microarray computer output:

4. Shine laser light
on one spot at a
time to induce
fluorescence.
Each gene transcribed
in the experimental
condition is a candidate
for further research…

Green spots: Yellow spots: Dark spots: Red spots:

genes genes low gene genes
transcribed transcribed expression transcribed
at normal equally in at high
temperature both cells temperature
 Concept Questions
•  Imagine a single nerve cell in the brain of a woman standing on the tundra in
northern Canada. In this situation, what are the enterome, biome, genome,
transcriptome and proteome most relevant to this nerve cell?
•  Look up genomic information for any already-sequenced animal that you want.
How does this genome differ from the human genome in terms of:
•  Chromosome number and size
•  Amount of DNA
•  % of coding DNA in genome
•  Structure of chromosomes
•  Ploidy
•  Major classes of genes
•  What is the likelihood that a random DNA mutation in a human cell affects a
single chromosome? A respiration gene? A coding region? Junk DNA?
•  Assign four gene names to four different loci on a chromosome. Build a map, and
describe the distances between each. Now, build a data chart of relative
recombination rates based on this map.
March 10th, 2016 Class 37 Learning Goals

The Human Microbiome

•  After this class, you should be able to:

–  Describe multiple differences between similar individuals in
terms of their microbiota

–  Hypothesize causes or potential treatments for human diseases

based on microbiomal disruptions
In your body: Peer Instruction
Human cells: somewhere between 20-40 trillion
Human cells: only about 50% of the total…

What is a microbiome? …Here is the other 50%

What is an enterotype?

Are microbiomes different between people?

 Key Questions
•  What are the molecular building blocks of life?
•  How do cells create new cells?
•  How do cells work, divide and signal each other?
•  What are the basic cellular structures that are needed in prokaryotic or
eukaryotic cells?
•  How is information transmitted from DNA into functional protein?
•  What are transcription, translation and replication
•  Why are they important?
•  Where does biological energy come from?
•  How do organisms develop?
•  How are gametes created? How do they fuse to create a new generation?
•  How can one cell develop into a full organism?
•  Why are viruses important, effective, and unlikely to be cured?
•  How can the human immune system protect from a universe of invaders?
•  Why do humans get sick?
•  Why is cancer so difficult to cure? Where does cancer come from?
•  What modern technologies are important for biological research?
•  How can we work with DNA and engineer genes?
•  What data can be taken from genomes?
•  How can this help develop understanding and cures for diseases?
•  What is next? How will I learn it?