WHO Manual PDF

WHO/IVB.11.
09
Laboratory Methods for the
Diagnosis of Meningitis caused by
Neisseria meningitidis, Streptococcus pneumoniae,
and Haemophilus influenzae
W H O M a n u a l , 2 n d E d i t i o n
Photo: Jon Shadid/UNICEF

WHO/IVB.11.09
Laboratory Methods for the

Diagnosis of Meningitis caused by
Neisseria meningitidis, Streptococcus pneumoniae,
1
W H O M a n u a l , 2 n d E d i t i o n
1
The first edition has the WHO reference WHO/CDS/CSR/EDC/99.7: Laboratory Methods for the Diagnosis
of Meningitis caused by Neisseria meningitidis, Streptococcus pneumoniae, and Haemophilus influenzae,
http://whqlibdoc.who.int/hq/1999/WHO_CDS_CSR_EDC_99.7.pdf
© World Health Organization 2011
This document is not a formal publication of the World Health Organization. All rights reserved.
This document may, however, be reviewed, abstracted, reproduced and translated, in part or in
whole, but not for sale or for use in conjunction with commercial purposes.
The designations employed and the presentation of the material in this publication do not imply
the expression of any opinion whatsoever on the part of the World Health Organization
concerning the legal status of any country, territory, city or area or of its authorities, or
concerning the delimitation of its frontiers or boundaries. Dotted lines on maps represent
approximate border lines for which there may not yet be full agreement.
The mention of specific companies or of certain manufacturers’ products does not imply that
they are endorsed or recommended by the World Health Organization in preference to others of a
similar nature that are not mentioned. Errors and omissions excepted, the names of proprietary
products are distinguished by initial capital letters.
All reasonable precautions have been taken by the World Health Organization to verify the
information contained in this publication. However, the published material is being distributed
without warranty of any kind, either expressed or implied. The responsibility for the
interpretation and use of the material lies with the reader. In no event shall the World Health
Organization be liable for damages arising from its use.
To ensure the highest integrity and public confidence in its activities, WHO required that all
contributors of this manual (authors and reviewers) disclose any circumstances that could give
rise to a potential conflict of interest related to the subject of the activity in which they were
involved. All contributors have signed the WHO declaration of interest form and none of the
declarations were judged to pose a conflict.
Additional copies of this book can be obtained from either:
WHO Press, World Health Organization,

20 Avenue Appia, 1211 Geneva 27, Switzerland
tel.: +41 22 791 3264;
fax: +41 22 791 4857;
e-mail: bookorders@who.int.
Requests for permission to reproduce or translate WHO publications – whether for sale or
for noncommercial distribution – should be addressed to WHO Press through the WHO
web site http://www.who.int/about/licensing/copyright_form/en/index.html
Website URL: http://whqlibdoc.who.int/hq/2011/WHO_IVB_11.09_eng.pdf
Or
Centers for Disease Control and Prevention
MVPDB/Meningitis Laboratory
1600 Clifton Road, NE
Atlanta, Georgia 30329 USA
tel: 800-CDC-INFO (800-232-5636)
fax: 404-639-4421
e-mail: cdcinfo@cdc.gov
Website URL: http://www.cdc.gov/meningitis/bacterial.html
I. 2011 WHO Meningitis Manual Authors
Division of Bacterial Diseases
National Center for Immunization and Respiratory Diseases
Meningitis and Vaccine Preventable Diseases Branch
Dana CASTILLO
imd3@cdc.gov
Brian HARCOURT
beh0@cdc.gov
Cynthia HATCHER
ctp0@cdc.gov
Michael JACKSON
hgk7@cdc.gov
Lee KATZ
gzu2@cdc.gov
Raydel MAIR
rdo7@cdc.gov
Leonard MAYER
Chief, Meningitis Laboratory
lwm1@cdc.gov
Ryan NOVAK
bnk4@cdc.gov
Lila RAHALISON
iuy6@cdc.gov
Susanna SCHMINK
zma6@cdc.gov
M. Jordan THEODORE
ale7@cdc.gov
Jennifer THOMAS
fsu8@cdc.gov
Jeni VUONG
iql1@cdc.gov
Xin WANG
gqe8@cdc.gov
Respiratory Diseases Branch
Lesley MCGEE
afi4@cdc.gov
Other Institutions
Dominique A. CAUGANT
WHO Collaborating Centre for Reference and Research on Meningococci
Department of Bacteriology and Immunology
Norwegian Institute of Public Health
dominique.caugant@fhi.no
Susanne CHANTEAU
Institut Pasteur
Nouméa
New Caledonia
schanteau@pasteur.nc
Sébastien COGNAT
International Health Regulations Coordination
Health Security and Environment
World Health Organization
Lyon
France
cognats@who.int
Pierre NICOLAS
WHO Collaborating Centre for Reference and Research on Meningococci
Institut de Recherche Biomédicale des Armées - IMTSSA
Marseille
France
nicolasp@imtssa.fr
II. Reviewers
Bernard BEALL
Chief, Streptococcus Laboratory
Respiratory Diseases Branch
beb0@cdc.gov
Thomas CLARK
Epidemiology Team Lead, Meningitis and Vaccine Preventable Diseases Branch
tnc4@cdc.gov
Amanda COHN
Meningitis and Vaccine Preventable Diseases Branch
anc0@cdc.gov
Kimberley FOX
Expanded Programme on Immunization
Western Pacific Regional Office
Manila
Philippines
foxk@wpro.who.int
Anne von GOTTBERG

Head of Respiratory and Meningeal Pathogens Reference Unit
National Institute for Communicable Diseases
Johannesburg
South Africa
anne.vgottberg@ncid.ac.za
Nancy MESSONNIER
Chief, Meningitis and Vaccine Preventable Diseases Branch
nar5@cdc.gov
Rasmata OUEDRAOGO
Centre Hospitalier Universitaire Pédiatrique Charles de Gaulle
Ouagadougou
Burkina Faso
ramaouedtra@yahoo.fr
Fem Julia PALADIN

Regional Office for the Western Pacific
Manila
Philippines
paladinf@wpro.who.int
Tanja POPOVIC
Deputy Associate Director for Science
Office of the Associate Director for Science
Office of the Director
txp1@cdc.gov
Manju RANI
Western Pacific Regional Office
Manila
Philippines
ranim@wpro.who.int
Aparna Singh SHAH

South East Asia Regional Office
New Delhi
India
shahap@searo.who.int
Muhamed-Kheir TAHA
Head of the Unit Invasive Bacterial Infections
Director of the National Reference Center for Meningococci
Institut Pasteur
Paris
France
mktaha@pasteur.fr
Cynthia WHITNEY
Chief, Respiratory Diseases Branch
cgw3@cdc.gov
III. 2011 WHO Meningitis Manual other Contributors

Mary AGOCS
Department of Immunization, Vaccines, and Biologicals
Geneva
Switzerland
agocsm@who.int
Eric BERTHERAT
Epidemic Readiness and Intervention
Department of Epidemic and Pandemic Alert and Response
Geneva
Switzerland
bertherate@who.int
Jean Bosco NDIHOKUBWAYO

Division of Health System and Services Development
Regional Office for Africa
Brazzaville
Republic of Congo
ndihokubwayoj@afro.who.int
Fatima SERHAN
Department of Immunization, Vaccines, and Biologicals
Geneva
Switzerland
serhanfa@who.int
Stephanie SCHWARTZ
zqd3@cdc.gov
Acknowledgements
The World Health Organization (WHO) and the Centers for Disease Control and Prevention
(CDC) express their gratitude to those who have contributed their time and experience to this 2nd
edition of the "Laboratory Methods for the Diagnosis of Meningitis caused by Neisseria
meningitidis, Streptococcus pneumoniae, and Haemophilus influenzae".
Special thanks should be given to Dr. Leonard Mayer, CDC, Atlanta, USA, WHO
Collaborating Center for Meningitis, for taking the lead in the process of developing as well as
compiling and editing this manual.
WHO manual – Foreword
Tanja Popovic, MD, PhD, Deputy Associate Director for Science, CDC
Microbiology and microbiologists have made extraordinary contributions to humanity saving

hundreds of millions of lives over the past few centuries. These contributions span from
developing and improving diagnostic assays and procedures to identify the causative agents, to
discovering antimicrobial agents for treatment and manufacturing of vaccines for disease
prevention. The first observations of living organisms were made in 1683 by Anthony von
Leeuwenhoek. In 1876, almost 200 years later, Robert Koch provided the first proof linking a
specific disease (anthrax) to a specific microorganism. From then on, a succession of subsequent
discoveries followed, three of which are the focus of this manual: in 1884, pneumococcus by
Albert Fraenkel; in 1887, meningococcus by Anton Weichselbaum; in 1892, Haemophilus
influenzae by Johannes Pfeiffer.
Almost 15 years ago, when we started working on developing the 1st edition of this manual, there
was an extraordinary amount of excitement about the work. We realized how important it was
to provide microbiologists, worldwide, with guidance for performing simple and reliable
procedures to isolate and characterize these microorganisms. Having this resource available,
empowers countries to build and strengthen their own laboratory capacities and capabilities. The
experience of having worked and providing trainings to many colleagues in Nigeria, Ghana,
Egypt, and South Africa have brought to me a sense of accomplishment and satisfaction of
making an important contribution. But, much more than that, this work made all of us realize
how proud these microbiologists are of their own work and what they can do to help people in
their countries when empowered with this skill and knowledge. Ultimately, it brought a renewed
sense of humility to all of us and a strong commitment to work continuously on strengthening
those relationships. This much enriched edition of the manual is the result of that commitment.
In response to the success of the first edition, we have updated this manual to include current
microbiological approaches to isolation and identification of Neisseria meningitidis,
Streptococus pneumoniae, and Haemophilus influenzae. In addition, ever-expanding knowledge
and consequent progress on laboratory methods, epidemiology and surveillance, and
development of vaccines are all reflected in several new chapters. Microbiology laboratories
have always played a critical role in prevention and control of bacterial meningitis. Today, that
very role in rapid detection and surveillance cannot be overemphasized. Recently, in June 2011,
a group of leaders in the global immunization area provided their insights into the importance of
microbiological monitoring after implementation of major vaccine efforts (1). They defined
surveillance as a critical component of broader efforts that are essential following the
introduction of new vaccines to detect any vaccine-induced serogroup or serotype replacement.
And a final word to those who will be using this manual – not only will you find a wealth of
useful information and procedures to guide you as you do the work yourself, but also be able to
successfully spread that knowledge to your colleagues!
References
1. Levine, O. S., D. E. Bloom, T. Cherian, C. de Quadros, S. Sow, J. Wecker, P. Duclos,
B. Greenwood. 2011. The future of immunisation policy, implementation, and financing.
Lancet 378:439-448.
Laboratory Methods for the Diagnosis of Meningitis Caused by Neisseria meningitidis,
Streptococcus pneumoniae, and Haemophilus influenzae
WHO Manual, 2nd Edition
Table of Contents
Chapter # Chapter Title Pages

Chapter 1 Introduction 1-2
Chapter 2 Epidemiology of Meningitis Caused by Neisseria meningitidis, 3-9
Chapter 3 Results Management and Reporting of Data 10-12
Chapter 4 Biosafety 13-20
Chapter 5 Collection and Transport of Clinical Specimens 21-31
Chapter 6 Primary Culture and Presumptive Identification of Neisseria 32-56
meningitidis, Streptococcus pneumoniae, and Haemophilus influenzae
Chapter 7 Identification and Characterization of Neisseria meningitidis 57-72
Chapter 8 Identification and Characterization of Streptococcus pneumoniae 73-86
Chapter 9 Identification and Characterization of Haemophilus influenzae 87-104
Chapter 10 PCR for Detection and Characterization of Bacterial Meningitis 105-156
Pathogens: Neisseria meningitidis, Haemophilus influenzae, and
Streptococcus pneumoniae
Chapter 11 Antimicrobial Susceptibility Testing of Neisseria meningitidis, 157-204
Haemophilus influenzae, and Streptococcus pneumoniae
Chapter 12 Characterization of Neisseria meningitidis, Haemophilus influenzae, and 205-258
Streptococcus pneumoniae by Molecular Typing Methods
Chapter 13 Quality Control/Quality Assurance 259-264
Chapter 14 Storage and Shipping of Neisseria meningitidis, Streptococcus 265-282
pneumoniae, and Haemophilus influenzae
Annex Preparation of Media and Reagents 283-311
CHAPTER 1
Introduction
Bacterial meningitis remains a serious global health problem. The laboratory plays a crucial role
in diagnosing this devastating disease. By identifying the causative organism and determining
antimicrobial susceptibility, laboratorians provide clinicians with the information required to
deliver appropriate treatment to their patients. Laboratories play a crucial role for communities
and populations as laboratory data are the foundation of public health surveillance for bacterial
meningitis. These surveillance data guide ministries of health when responding to epidemics,
making decisions about the introduction and use of vaccines, and properly allocating resources
according to the needs of the population. Thus, a well-trained and equipped diagnostic
laboratory is critical for the health of individuals and populations.
In 1999, the World Health Organization published the first edition of “Laboratory Methods for
the Diagnosis of Meningitis Caused by Neisseria meningitidis, Streptococcus pneumoniae, and
Haemophilus influenzae.” That manual aimed to provide laboratories with a clear, concise guide
to the basic procedures for isolating and identifying N. meningitidis, S. pneumoniae, and H.
influenzae from the blood or cerebrospinal fluid of patients with bacterial meningitis. The focus
was on including laboratory procedures chosen for their utility, ease of performance, and ability
to give reproducible results; while taking into account the diversity of laboratory capabilities,
availability of materials and reagents, and their cost. Since its publication, that manual has been
widely adopted by laboratories worldwide.
In the twelve years since the first edition of this manual, important changes have occurred both
in the epidemiology of bacterial meningitis and in the available laboratory techniques for
isolating, identifying, and characterizing the causative organism. In recent years, great progress
has been made in increasing worldwide access to vaccines to prevent meningococcal,
pneumococcal, and H. influenzae type b (Hib) disease. Most recently, the historic development
and implementation of a new meningococcal conjugate vaccine for serogroup A has the potential
to eliminate epidemic meningitis in sub-Saharan Africa. Surveillance for diseases caused by
infectious agents that are targeted by newer vaccines will likely require a syndromic approach.
Patients diagnosed with meningitis syndrome may all exhibit similar symptoms (i.e., fever,
headache, stiff neck) but each individual’s disease could be caused by a variety of organisms,
including the bacterial meningitis pathogens N. meningitidis, S. pneumoniae, and H. influenzae.
Hence, clinical syndromic surveillance must be complemented by a strong laboratory component
to allow for diagnostic confirmation of the specific disease agent. Laboratory networks
supporting surveillance, such as the Invasive Bacterial Vaccine Preventable Diseases (IB-VPD)
Surveillance Network and Integrated Disease Surveillance and Response (IDSR), have helped to
improve data quality to expedite and sustain evidence-informed decisions at the global, regional,
and national levels.
These developments prompted a revision of the manual to produce this second edition. The
revision follows the format of the first edition, but has been expanded to include Results
Management and Reporting of Data (Chapter 3); Biosafety (Chapter 4); PCR for Detection and
Characterization of Bacterial Meningitis Pathogens (Chapter 10); Antimicrobial Susceptibility
1
Testing (Chapter 11); Characterization by Molecular Typing Methods (Chapter 12); and Quality
Control/Quality Assurance (Chapter 13).
2
CHAPTER 2
Epidemiology of Meningitis Caused by Neisseria meningitidis, Streptococcus

pneumoniae, and Haemophilus influenzae
The term “meningitis” describes inflammation of the membranes (meninges) and/or

cerebrospinal fluid (CSF) that surrounds and protects the brain and spinal cord. Meningitis can
result from many causes, both infectious and non-infectious. Bacterial meningitis is a life-
threatening condition that requires prompt recognition and treatment. Beyond the newborn
period, the most common causes of bacterial meningitis are Neisseria meningitidis,
Streptococcus pneumoniae, and Haemophilus influenzae. All three of these organisms are
respiratory pathogens. They are spread from person to person by close contact with respiratory
secretions. Once acquired, each species can colonize the mucosa of the nasopharynx and
oropharynx, which is known as pharyngeal carriage. From there, they may cross the mucosa and
enter the blood. Once in the blood, they can reach the meninges, causing meningitis, or other
body sites causing other syndromes. Over 1.2 million cases of bacterial meningitis are estimated
to occur worldwide each year (24). The incidence and case-fatality rates for bacterial meningitis
vary by region, country, pathogen, and age group. Without treatment, the case-fatality rate can
be as high as 70 percent, and one in five survivors of bacterial meningitis may be left with
permanent sequelae including hearing loss, neurologic disability, or loss of a limb (18).
Neisseria meningitidis
N. meningitidis may either be encapsulated or unencapsulated. However, nearly all invasive N.

meningitidis organisms are encapsulated, or surrounded by a polysaccharide capsule. This
capsular polysaccharide is used to classify N. meningitidis into 12 serogroups. Six of these
serogroups cause the great majority of infections in people: A, B, C, W135, X, and Y (12).
Incidence rates of N. meningitidis meningitis are generally highest in children less than five years
of age and in adolescents. N. meningitidis can also cause a severe bacteremia, called
meningococcemia. The worldwide distribution of serogroups of N. meningitidis is variable. In
the Americas, Europe, and Australia, serogroups B and C are the most common, while serogroup
A causes the majority of disease in Africa and Asia (7). Sometimes serogroups can emerge,
increasing in importance in a specific country or region, like serogroup C in China (20) or
serogroup Y in North America (15, 17, 23).
Worldwide, the incidence of meningitis due to N. meningitidis is highest in a region of sub-

Saharan African known as the “meningitis belt” (Figure 1). This hyper-endemic region extends
from Senegal to Ethiopia, and is characterized by seasonal epidemics during the dry season
(incidence rate: 10-100 cases per 100,000 population), punctuated by explosive epidemics in 8-
12 year cycles (incidence rates can be greater than 1,000 cases per 100,000 population). Across
the meningitis belt, at least 350 million people are at risk for meningitis during these annual
epidemics. Meningitis epidemics are generally caused by serogroup A, although outbreaks have
also been caused by serogroups C, W135, and X (1-3, 7, 13, 21, 28). Outbreaks of different
serogroups may overlap, therefore, laboratory confirmation is important both to recognize and
monitor the progression of outbreaks (5-7).
3
Source: Control of epidemic meningococcal disease, WHO practical guidelines, World Health Organization, 1998, 2nd
edition, WHO/EMC/BAC/98.3
Figure 1. The African meningitis belt. These sub-Saharan countries are at high epidemic risk for
meningococcal meningitis.
Haemophilus influenzae
H. influenzae, like N. meningitidis, may be either unencapsulated or encapsulated with a

polysaccharide capsule. The makeup of this polysaccharide capsule allows encapsulated H.
influenzae isolates to be classified into six serotypes (a, b, c, d, e, and f) with the most common
cause of invasive disease being H. influenzae type b (Hib). Though H. influenzae meningitis is
rare in adolescents and adults, rates of meningitis due to Hib are highest in children less than five
years of age, with an estimated incidence rate of 31 cases per 100,000 (22). In young children,
the case-fatality rate for meningitis due to H. influenzae is generally higher than that for
meningitis due to N. meningitidis. In addition to meningitis, H. influenzae is also an important
cause of pneumonia as well as epiglottitis. While the worldwide burden of disease caused by H.
influenzae is not completely understood, lab networks supporting surveillance systems such as
Paediatric Bacterial Meningitis (PBM) and Invasive Bacterial Diseases (IBD) contribute
standardized disease burden data.
Streptococcus pneumoniae
S. pneumoniae, like N. meningitidis and H. influenzae, is an encapsulated bacterium. The

diversity of capsular types is large, with at least 93 serotypes recognized based on the
composition of the capsular polysaccharide. Many S. pneumoniae serotypes are capable of
causing invasive disease, including meningitis, bloodstream infections, and pneumonia;
however, most disease worldwide is caused by a small number of common serotypes (8). The
relative contribution of each serotype to the local burden of disease varies globally, with
serotypes 1 and 5 more prominent in developing countries. S. pneumoniae and Hib disease may
vary seasonally, and while they do not cause epidemics like N. meningitidis, large outbreaks do
occur rarely (4, 12). Meningitis due to S. pneumoniae occurs most commonly in the very young
and the very old, with an estimated incidence rate of 17 cases per 100,000 population in children
4
less than five years of age (14). The case fatality rate for meningitis due to S. pneumoniae in
children less than five years of age exceeds 73% in some parts of the world.
Prevention and control
The risk of secondary cases of meningococcal disease among close contacts of someone with
meningococcal disease (i.e., household members, day-care center contacts, or anyone directly
exposed to the patient’s oral secretions) is high. In non-epidemic settings, antimicrobial
chemoprophylaxis is effective in preventing secondary cases among close contacts by
eliminating nasopharyngeal carriage if administered rapidly after the index case is identified.
Such intervention may not be feasible in many countries. Mass chemoprophylaxis to
prevent/control epidemics is not recommended. Secondary cases are also seen for Hib
meningitis, particularly in unvaccinated children less than 4 years of age who are exposed to
someone with Hib disease. Oral rifampin is recommended to eliminate nasopharyngeal carriage
and prevent disease in these children. Secondary meningitis cases are very rare among those
exposed to a patient with pneumococcal disease.
Laboratory surveillance data are critical to tracking the spread of less susceptible strains and to
providing guidance in the empirical selection of antimicrobial agents. For all three bacterial
meningitis pathogens, antimicrobial resistance has been identified, affecting the treatment of
patients and chemoprophylaxis of close contacts. N. meningitidis isolates resistant to
sulfonamides are common in many countries. Isolates resistant to rifampicin, penicillin,
chloramphenicol, cotrimoxazole, ceftriaxone, and ciprofloxacin have also been identified (27).
One report from the United States described 2 isolates which were rifampin resistant (16).
Resistance to beta-lactam antimicrobials is common in H. influenzae isolates; the majority of
which produce beta-lactamase. S. pneumoniae isolates have been reported with resistance to
beta-lactams, macrolides, tetracycline, and trimethoprim/sulfamethoxazole. The increasing
proportion of pneumococci resistant to penicillin and the development of resistance to
ceftriaxone has huge implications for treatment and makes prevention through vaccination that
much more important. The introduction of vaccine in the United States has resulted in a
decreasing proportion of invasive isolates that are antibiotic-resistant, thus vaccine may have a
role in controlling the spread of antibiotic resistance (10).
Vaccines are the cornerstone of prevention and control of bacterial meningitis. Vaccines for N.
meningitidis made up of capsular polysaccharide have been available and used since the 1970s.
These include a bivalent vaccine (serogroups A and C), a trivalent vaccine (A, C, Y), and a
quadrivalent vaccine (A, C, W135, and Y). Timely mass-vaccination campaigns using
polysaccharide vaccines can effectively interrupt the course of meningitis epidemics, but they are
less effective in young children, do not provide long duration of protection, do not have
sustained impact on nasopharyngeal carriage, and therefore do not interrupt person to person
transmission. For this reason, they do not result in “herd immunity”, which is the extension of
protection to unvaccinated people in the community.
In 2010, a new serogroup A meningococcal conjugate vaccine was licensed, pre-qualified by

WHO, and introduced in Burkina Faso, Mali, and Niger (11). Conjugate vaccines generally
result in higher levels of protection, longer duration of protection, protection of children less than
5
2 years of age, and may interrupt nasopharyngeal carriage and transmission, resulting in herd
immunity. When implemented in national preventive vaccination programs across the
meningitis belt, it is hoped that the vaccine will prevent the occurrence of serogroup A
epidemics. Traditional public health and bacteriologic surveillance, as well as molecular
epidemiology, will play a crucial role in evaluating both the short- and long-term impact of these
vaccination programs. For example, the need for vaccines to other serogroups, the potential re-
emergence of serogroup A due to waning vaccine-induced immunity, or the emergence of new
serogroups will only become evident through ongoing, high-quality surveillance.
Polysaccharide-protein conjugate vaccines for Hib are available for young children. In most
industrialized countries, these vaccines have dramatically decreased the burden of Hib meningitis
and virtually eliminated it as a public health problem through direct effects and induction of herd
immunity without significant strain replacement. More recently, many developing countries
have introduced, or plan to introduce, Hib vaccines through various global initiatives, such as the
Hib Initiative and the GAVI Alliance, whose goals are to accelerate introduction of Hib vaccines
in low and middle income countries.
A 23-valent polysaccharide vaccine is available for S. pneumoniae. Like other polysaccharide

vaccines, it is not effective in children younger than two years of age; the group with the highest
risk of S. pneumoniae meningitis. Newer polysaccharide-protein conjugate vaccines have been
introduced in many industrialized countries, leading to dramatic declines in pneumococcal
meningitis in infants and young children and in adults through induction of herd immunity (9).
Currently, 7-valent, 10-valent, and 13-valent pneumococcal conjugate vaccines have been
developed and have received WHO prequalification. In some settings, serotypes not covered by
the 7-valent conjugate vaccine have increased somewhat following 7-valent conjugate vaccine
introduction (25). As with Hib vaccine, global initiatives such as PneumoADIP and the GAVI
Alliance have helped to accelerate introduction of these vaccines in low and middle income
countries. As of the end of 2010, 42 countries were using a pneumococcal conjugate vaccine for
routine infant immunization, including 3 low-income countries, and as many as 15 more low-
income countries are slated to introduce vaccine in 2011 (26).
Role of the laboratory
Microbiologists play a critical role in gathering data both for clinical and public health decision
making. Efficient and accurate microbiologic diagnosis of bacterial meningitis guides the choice
of antibiotics and other treatment options for the patient. Collectively, serogroup or serotype
results from isolates of bacterial meningitis in an effected population guide response efforts and
determine the appropriate vaccine to be used. Similarly, microbiologic surveillance is critical to
guide appropriate antibiotic therapy through the identification of local resistance profiles. Thus,
the role of the microbiology laboratory is essential to preventing morbidity and mortality from
bacterial meningitis.
Infection with N. meningitidis may be acquired through working with bacterial isolates in the
microbiology laboratory if appropriate protective procedures are not followed (19).
Microbiologists who routinely work with these isolates are at increased risk for infection. This
risk highlights the importance of consistent adherence to biosafety procedures. In addition,
6
vaccination against meningococcal disease is recommended for microbiologists who routinely
work with N. meningitidis, and antimicrobial chemoprophylaxis should be used if lapses in
biosafety procedures result in exposure to the organism.
Recommended reading
 Lapeyssonnie, L. 1963 La méningite cérébro-spinale en Afrique. Bulletin of the World

Health Organization 28:1–114.
 Greenwood, B. 1999. Meningococcal meningitis in Africa. Transactions of the Royal
Society of Tropical Medicine and Hygeine 93:341–353.
 Campagne, G., Schuchat, A., Djibo, S., Ousseini, A., Cisse, L., Chippaux, J. P. 1999.
Epidemiology of bacterial meningitis in Niamey, Niger, 1981-96. Bulletin of the World
Health Organization 77:499–508.
 Rosenstein, N. E., Perkins, B. A., Stephens, D. S., Popovic, T., Hughes, J. M. 2001.
Meningococcal disease. New England Journal of Medicine 344:1378–1388.
 World Health Organization, Control of epidemic meningococcal disease. WHO Practical
Guidelines. 1998.
 Harrison, L. H., Trotter, C.L. and Ramsay, M.E. 2009. Global epidemiology of
meningococcal disease. Vaccine 27:B51-B63.
 MVP: http://www.meningvax.org/.
 PATH: http://www.path.org/menafrivac/overview.php.
 WHO IVB 6Dec2011 – MenAfriVac launch:
http://www.who.int/immunization/newsroom/events/menafrivac/en/index.html.
 WHO AFRO 6Dec2011 – MenAfriVac launch:
 http://www.afro.who.int/en/media-centre/pressreleases/2598-revolutionary-new-
meningitis-vaccine-set-to-wipe-out-deadly-epidemics-in-africa.html.
References
1. Aguilera, J. F., A. Perrocheau, C. Meffre, S. Hahne, and W. W. Group. 2002.

Outbreak of serogroup W135 meningococcal disease after the Hajj pilgrimage, Europe,
2000. Emerging Infectious Diseases 8:761-767.
2. Anonymous. 2001. Meningococcal disease, serogroup W135 (update). Weekly
Epidemiological Record 76:213-214.
3. Anonymous. 2000. Serogroup W-135 meningococcal disease among travelers returning
from Saudi Arabia--United States, 2000. MMWR Morbidity and Mortality Weekly
Report 49:345-346.
4. Antonio, M., I. Hakeem, T. Awine, O. Secka, K. Sankareh, D. Nsekpong, G. Lahai,
A. Akisanya, U. Egere, G. Enwere, S. M. Zaman, P. C. Hill, T. Corrah, F. Cutts, B.
M. Greenwood, and R. A. Adegbola. 2008. Seasonality and outbreak of a predominant
Streptococcus pneumoniae serotype 1 clone from The Gambia: expansion of ST217
hypervirulent clonal complex in West Africa. BMC Microbiology 8:198.
5. Boisier, P., P. Nicolas, S. Djibo, M. K. Taha, I. Jeanne, H. B. Mainassara, B.
Tenebray, K. K. Kairo, D. Giorgini, and S. Chanteau. 2007. Meningococcal
7
meningitis: unprecedented incidence of serogroup X-related cases in 2006 in Niger.
Clinical Infectious Diseases 44:657-663.
6. Djibo, S., P. Nicolas, J. M. Alonso, A. Djibo, D. Couret, J. Y. Riou, and J. P.
Chippaux. 2003. Outbreaks of serogroup X meningococcal meningitis in Niger 1995-
2000. Tropical Medicine and International Health 8:1118-1123.
7. Harrison, L. H., C. L. Trotter, and M. E. Ramsay. 2009. Global epidemiology of
meningococcal disease. Vaccine 27:B51-B63.
8. Johnson, H. L., Deloria-Knoll M., Levine O. S., Stoszek S. K., Freimanis Hance L.,
Reithinger R., Muenz L. R., and O'Brien K. L. 2010. Systematic evaluation of
serotypes causing invasive pneumococcal disease among children under five: the
pneumococcal global serotype project. PLoS Medicine Oct 5;7. pii: e1000348.
9. Hsu, H. E., Shutt K. A., Moore M. R., Beall B. W., Bennett N. M., Craig A. S.,
Farley M. M., Jorgensen J. H., Lexau C. A., Petit S., Reingold A., Schaffner W.,
Thomas A., Whitney C. G., Harrison L. H. 2009. Effect of pneumococcal conjugate
vaccine on pneumococcal meningitis. New England Journal of Medicine 360:244-56.
10. Kyaw, M. H., Lynfield R., Schaffner W., Craig A. S., Hadler J., Reingold A.,
Thomas A. R., Harrison L. H., Bennett N. M., Farley M. M., Facklam R. R.,
Jorgensen J. H., Besser J., Zell E. R., Schuchat A., Whitney C. G. 2006. Active
Bacterial Core Surveillance of the Emerging Infections Program Network. Effect of
introduction of the pneumococcal conjugate vaccine on drug-resistant Streptococcus
pneumoniae. New England Journal of Medicine 354:1455-63.
11. LaForce, F. M., K. Konde, S. Viviani, and M. P. Preziosi. 2007. The Meningitis
Vaccine Project. Vaccine 25 Supplement 1:A97-100.
12. Leimkugel, J., A. AdamsForgor, S. Gagneux, V. Pfluger, C. Flierl, E. Awine, M.
Naegeli, J. P. Dangy, T. Smith, A. Hodgson, and G. Pluschke. 2005. An Outbreak of
Serotype 1 Streptococcus pneumoniae Meningitis in Northern Ghana with Features That
Are Characteristic of Neisseria meningitidis Meningitis Epidemics. Journal of Infectious
Diseases 192:192-199.
13. Mayer, L. W., M. W. Reeves, N. Al-Hamdan, C. T. Sacchi, M. K. Taha, G. W.
Ajello, S. E. Schmink, C. A. Noble, M. L. Tondella, A. M. Whitney, Y. Al-Mazrou,
M. Al-Jefri, A. Mishkhis, S. Sabban, D. A. Caugant, J. Lingappa, N. E. Rosenstein,
and T. Popovic. 2002. Outbreak of W135 meningococcal disease in 2000: not
emergence of a new W135 strain but clonal expansion within the electrophoretic type-37
complex. Journal of Infectious Diseases 185:1596-1605.
14. O'Brien, K. L, Wolfson L. J., Watt J. P., Henkle E., Deloria-Knoll M., McCall N., et
al. 2009. Burden of disease caused by Streptococcus pneumoniae in children younger
than 5 years: global estimates. Lancet 374:893-902.
15. Popovic, T., C. T. Sacchi, M. W. Reeves, A. M. Whitney, L. W. Mayer, C. A. Noble,
G. W. Ajello, F. Mostashari, N. Bendana, J. Lingappa, R. Hajjeh, and N. E.
Rosenstein. 2000. Neisseria meningitidis serogroup W135 isolates associated with the
ET-37 complex. Emerging Infectious Diseases 6:428-429.
16. Rainbow, J., Cebelinski E., Bartkus J., Glennen A., Boxrud D., Lynfield R. 2005.
Rifampin-resistant meningococcal disease. Emerging Infectious Diseases 11:977-979.
17. Rosenstein, N. E., B. A. Perkins, D. S. Stephens, L. Lefkowitz, M. L. Cartter, R.
Danila, P. Cieslak, K. A. Shutt, T. Popovic, A. Schuchat, L. H. Harrison, and A. L.
8
Reingold. 1999. The changing epidemiology of meningococcal disease in the United
States, 1992-1996. Journal of Infectious Diseases 180:1894-901.
18. Rosenstein, N. E., B. A. Perkins, D. S. Stephens, T. Popovic, and J. M. Hughes. 2001.
Meningococcal Disease. New England Journal of Medicine 344:1378-1388.
19. Sevjar, J.J., Johnson, D., Popovic, T., Miller, M. J., Downes, F., Somsel, P., Weyent,
R., Stephens, D. S., Perkins, B. A., and Rosenstein, N. E. 2005. Assessing the risk of
laboratory-acquired meningococcal disease. Journal of Clinical Microbiology, 43:4811-
4813.
20. Shao, Z., W. Li, J. Ren, X. Liang, L. Xu, B. Diao, M. Li, M. Lu, H. Ren, Z. Cui, B.
Zhu, Z. Dai, L. Zhang, X. Chen, B. Kan, and J. Xu. 2006. Identification of a new
Neisseria meningitidis serogroup C clone from Anhui province, China. Lancet 367:419-
423.
21. Taha, M. K., M. Achtman, J. M. Alonso, B. Greenwood, M. Ramsay, A. Fox, S.
Gray, and E. Kaczmarski. 2000. Serogroup W135 meningococcal disease in Hajj
pilgrims. Lancet 356:2159.
22. Watt, J. P., Wolfson, L.J. O'Brien, K. L., Henkle, E. Deloria-Knoll, M., McCall, N.,
et al. 2009. Burden of disease caused by Haemophilus influenzae type b in children
younger than 5 years: global estimates. Lancet 374:903-911.
23. Whitney, A. M., G. B. Coulson, A. von Gottberg, C. Block, N. Keller, L. W. Mayer,
N. E. Messonnier, and K. P. Klugman. 2009. Genotypic Comparison of Invasive
Neisseria meningitidis Serogroup Y Isolates from the United States, South Africa, and
Israel, Isolated from 1999 through 2002. Journal of Clinical Microbiology 47:2787-2793.
24. World Health Organization. 1988. Control of epidemic meningococcal disease. WHO
Practical Guidelines. Second Edition. Geneva.
25. World Health Organization. 2010. Changing epidemiology of pneumococcal serotypes
after introduction of conjugate vaccine: July 2010 report. Weekly Epidemiological
Record 85:425–436.
26. World Health Organization. 2010. WHO Vaccine Preventable Diseases Monitoring
System: Immunization schedules by antigen selection centre.
http://apps.who.int/immunization_monitoring/en/globalsummary/ScheduleResult.cfm;
accessed Feb 22, 2011; last updated 15 Dec 2010).
27. Wu, H. M., Harcourt, B. H., Hatcher, C. P., Wei, S. C., Novak, R. T., Wang, X.,
Juni, B. A., Glennen, A., Boxrud, D. J., Rainbow, J., Schmink, S. Mair, R. D.,
Theodore, M. J., Sander, M. A., Miller, T. K., Kruger, K., Cohn, A. C., Clark, T. A.,
Messonnier, N. E., Mayer, L. W., and Lynfield. R. 2009. Emergence of ciprofloxacin-
resistant Neisseria meningitidis in North America. New England Journal of Medicine
360:886-892.
28. Yousuf, M., and A. Nadeem. 1995. Fatal meningococcaemia due to group W135
amongst Haj pilgrims: implications for future vaccination policy. Annals of Tropical
Medicine & Parasitology 89:321-322.
9
CHAPTER 3
Results Management and Reporting of Data
I. Data management and reporting
Proper laboratory procedures are essential for correctly identifying and characterizing pathogens
from patients with bacterial meningitis. However, even the best laboratory efforts are not useful
if the results are not accurately reported to those who make policy and epidemic response
decisions. The development of an accurate data reporting system requires quality data
management: collection, recording, validation, and results feedback of important information
about patients, specimens, and laboratory results.
II. Data management systems
A data management system can be as simple as a laboratory logbook or as complex as a

computerized information system. Laboratories with small workloads may find that paper
records are sufficient for their data management requirements. However, computerized
information systems are recommended for laboratories that handle larger numbers of clinical
specimens and isolates. Regardless of whether the data management system is paper or
computerized, it should allow clinical and laboratory data to be accurately recorded, easily
accessed and reported, and reliably stored. It is also important to keep laboratory data linked
with epidemiological data to ensure the quality of results reported.
When considering computerized information systems, laboratory directors should consider the
user preferences, hardware and maintenance requirements, software costs, local expertise needed
to develop, install, refine, and maintain the system, and the costs of routine data backups.
Computerized information systems should allow easy recording of data, formatting and editing
of reports, and simple analyses such as frequencies and workload calculations. These basic
analyses can help laboratory managers estimate operating costs and supply needs, and can also
provide surveillance systems with useful summary information.
III. Request form and record keeping
Quality data management begins with the clinical request for laboratory testing. All clinical
specimens and isolates should be accompanied by a standardized request form that includes the
following information:
 Patient’s name, date of birth, sex, and residence address

 Unique Identification Number. Examples include, Patient Hospital Number, Case
Identification Number (for patients included in epidemiologic investigations or research
studies), or Surveillance Identification Number (such as an EPID number).
 Patient’s hospital, hospital address, and room number
 Physician’s name and contact information
 Clinical diagnosis and relevant patient history
10
 Specimen type (clinical specimen or isolate)
 Anatomical site of specimen collected (CSF, blood, other)
 Date and time of specimen collection
 Test(s) requested
 Antimicrobial therapy the patient is receiving or has received, if any
 Immunization status for meningitis pathogens (N. meningitidis, H. influenzae serotype b, S.
pneumoniae)
 Name and address for report recipient
Each specimen should have a label firmly attached to the specimen container bearing the
following information:
 Patient’s name
 Unique Identification Number
o Be sure this number matches the number on the request and report forms.
 Date and time of specimen collection
Upon receiving a clinical specimen or isolate, the laboratory staff should enter the above
information into the laboratory data management system. Additional information to be recorded
includes:
 Date and time the clinical specimen or isolate arrives to the laboratory
 Number of items received in the laboratory
 Gram stain result
 Whether or not the treating clinician was notified of the Gram stain result within one (1)
hour of the test result
 The date the specimen or isolate was stored by the laboratory
 The data the specimen or isolate was sent the national laboratory or regional reference
laboratory
Other important information to record includes transport conditions (e.g., conservation of ideal
temperature for transporting specimens and maintaining appropriate shipping conditions
according to guidelines), condition of the specimen upon arrival (e.g., volume, possible
contamination, compromised container, etc.), and any preparatory actions taken (e.g., aliquoting
or centrifugation). The specimen should be given a unique laboratory identification number to
be used in all subsequent procedures. It is important that the identification number be recorded
on the request form, the specimen container, and in the data management system so that results
are linked to the patient information.
Results for all tests performed on the clinical specimens and isolates should be entered into the
data management system as soon as they are obtained. Any information regarding quality
control and quality assurance (see Chapter 13: Quality Control and Quality Assurance) related to
the tests should be recorded in the appropriate logbook or database.
IV. Data reporting
11
Another important function of the laboratory is to provide users with timely and accurate
laboratory results. Users include physicians, surveillance units, disease control programs, local,
state, district, regional, and national health departments, and outbreak investigation teams. Each
of these users will need different information from the laboratory. For example, a surveillance
unit in the African meningitis belt may need summaries of all patients with confirmed N.
meningitidis by serogroup, while a physician treating a patient with bacterial meningitis may
need rapid reporting of the pathogen and antimicrobial susceptibility testing results. Laboratory
directors should work with users to develop a standardized report form, data formats, and regular
reporting frequencies. The expected flow of information and communication method should be
clearly agreed upon by both the laboratory and the data recipients. It is essential that efficient
reporting mechanisms are established as the best laboratory efforts are futile if the information is
not reported back to the patient’s physician, surveillance team, etc. Furthermore, surveillance
and study information must be reported to public health officials in order to affect public policy
decisions.
Recommended reading
 ISO 15189:2007. Medical laboratories: requirements for quality and competence.

Geneva, Switzerland: International Organization for Standardization; 2007.
 Polio laboratory manual, fourth edition. WHO/IVB/04.10. World Health Organization,
Geneva, 2004, p 157.
12
CHAPTER 4
Biosafety
Laboratorians working with infectious agents are at risk of laboratory-acquired infections as a

result of accidents or unrecognized incidents. The degree of hazard depends upon the virulence
and dose of the biological agent, route of exposure, host resistance, proper biosafety training, and
experience with biohazards. Laboratory-acquired infections occur when microorganisms are
inadvertently ingested, inhaled, or introduced into tissues. Multiple instances of laboratory-
acquired meningococcal infection have been reported with a case fatality rate of 50% (1, 2).
While laboratory-acquired H. influenzae and S. pneumoniae infections are not as extensively
reported, deadly infections with any of these organisms are possible if appropriate biosafety
procedures are not strictly followed in a properly equipped laboratory. Biosafety Level 2 (BSL-
2) practices are required for work involving these agents as they present a potential hazard to
personnel and the environment. The following requirements have been established for
laboratorians working in BSL-2 facilities:
 Laboratory personnel must receive specific training in handling pathogenic agents and be
directed by fully trained and experienced scientists.
 Access to the laboratory must be limited to personnel who have a need to be in the
laboratory and have undergone proper training when work is being conducted.
 Extreme precautions must be taken with contaminated sharp items and sharps must be
disposed of in labeled appropriate hardened plastic containers.
 Personal protective equipment (PPE) must be worn at all times, and particular care must be
taken when performing procedures that have the potential to create aerosols.
I. Protective clothing and equipment
A. Laboratory coats
Protective coats, gowns, smocks, or uniforms designated for laboratory use must be worn while
working in the laboratory. Laboratory coats should fit properly and should cover arms to the
wrist. This protective clothing must be removed and left in the laboratory before leaving for
non-laboratory areas, such as offices or eating areas. All protective clothing is either disposed of
in the laboratory or laundered by the institution; it should never be taken home by personnel.
B. Gloves
Regardless of the type of infectious material, gloves should be worn when performing potentially
hazardous procedures involving infectious materials in which there is a risk of splashing or skin
contamination or when the laboratory worker has cuts or broken skin on his or her hands.
Gloves should always be worn when handling clinical specimens, body fluids, and tissues from
humans and animals. These specimens should be handled as if they are positive for hepatitis B
virus, human immunodeficiency virus (HIV), or any bloodborne pathogens. Gloves must be
removed when contaminated by splashing or spills or when work with infectious materials is
13
completed. When removing gloves, avoid touching any areas of the gloves that may have come
in contact with infectious material.
Gloves should not be worn outside the laboratory. Personnel should not use the telephone,
computer, or open doors with gloves that have been used in laboratory procedures. All used
gloves should be disposed of by discarding them with other disposable materials and
autoclaving. Hands should be washed immediately after removing gloves.
C. Barrier precautions
Clinical specimens, body fluids, and tissues from humans and animals should be assumed to be
positive for human pathogens. These materials should be handled in a biosafety cabinet (BSC)
or using other barrier precautions (e.g., goggles, mask, face shield, or other splatter guards)
whenever a procedure is performed that can potentially create an aerosol. However,
manipulating suspensions of N. meningitidis outside of a biosafety cabinet is associated with a
high risk for contracting meningococcal disease (2) and using only a splatter guard on the bench
top does not provide adequate protection (1).
D. Foot Protection
Closed-toe comfortable shoes that have low heels should be worn in the laboratory or other areas
where chemicals are present. This will reduce injuries that may occur from spills, splashes,
falling objects, slipping, and broken glass.
II. Standard microbiological safety practices
The following safety guidelines listed below apply to all microbiology laboratories, regardless of
biosafety level. All procedures requiring handling of infectious materials, potentially infectious
materials, or clinical specimens should be performed while wearing appropriate PPE.
A. Limiting access to laboratory
Sometimes non-laboratorians attempt to enter the laboratory to obtain test results. Although this
occurs more frequently in clinical laboratories, access to the laboratory should be limited to
trained personnel with a need to work in the laboratory, regardless of the setting.
Biohazard signs or stickers should be posted near or on all laboratory doors and on all equipment
used for laboratory work (e.g., incubators, hoods, microwaves, ice machines, refrigerators, and
freezers). Children who have not reached the age of adulthood and pets are not allowed in
laboratory areas. All laboratories should be locked when not in use. In addition, all freezers and
refrigerators located in corridors should be locked, especially those that contain infectious
organisms or other hazardous materials.
B. Disinfectants
14
Organisms may have different susceptibilities to various disinfectants. As a surface disinfectant,
70% isopropyl alcohol is generally effective. However, 70% alcohol is not the disinfectant of
choice for decontaminating spills. It should be noted that 100% alcohol is not as effective a
disinfectant as 70% alcohol. Phenolic disinfectants, although expensive, are effective against
many organisms. Always read disinfectant labels for manufacturers’ recommendations for
dilution and for exposure times for efficacy. An effective general disinfectant is a 1:100 (1%)
dilution of household bleach (sodium hypochlorite) in water; at this dilution, bleach can be used
for wiping surfaces of benches, hoods, and other equipment. A 1:10 (10%) dilution of bleach
should be used to clean up spills of cultured or concentrated infectious material where heavy
contamination has occurred; however, it is more corrosive, will pit stainless steel, and should not
be used routinely. If bleach is used, wipe down the area with 70% alcohol to inactivate the
bleach. If bleach is used as a disinfectant, the diluted solutions should be made weekly from a
concentrated stock solution.
C. Decontamination of spills
The following procedure is recommended for decontaminating spills:
 Isolate the area to prevent anyone from entering.

 Wear gloves and protective clothing such as a gown or lab coat, shoes, and a mask (if the
spill may contain a respiratory agent or if the agent is unknown).
 Absorb or cover the spill with disposable towels, but do not wipe up the spill or remove the
towels.
 Saturate the towels and the affected area with an appropriately diluted intermediate or high-
level disinfectant (e.g., a phenolic formulation or household bleach) and leave them in
place for at least 15 minutes.
 Wipe area using clean disinfectant-soaked towels and allow area to air dry.
 Place all disposable materials used to decontaminate the spill into a biohazard container. If
broken glassware is involved, use mechanical means to dispose of it.
 Handle the material in the same manner as other infectious waste.
D. Hand washing
All laboratories should contain a sink with running water and soap for hand washing. Frequent
hand washing is one of the most effective procedures for avoiding laboratory-acquired
infections. Hands should be washed for at least one minute with an appropriate germicidal soap
after infectious materials are handled and before exiting the laboratory. If germicidal soap is
unavailable, then use 70% isopropyl or ethyl alcohol to cleanse hands.
E. Eating
Eating, drinking, and smoking are not permitted in laboratory work areas. Food must be stored
and eaten outside of the laboratory in designated areas used for that purpose only. Personal
articles (e.g., handbags, eyeglasses, or wallets) should not be placed on laboratory workstations.
F. Mouth pipetting
15
Mouth pipetting is strictly prohibited. Rubber bulbs or mechanical devices must be used.
G. Sharps
A high degree of precaution must always be taken with any contaminated sharp items, including
needles and syringes, slides, glass pipettes, capillary tubes, broken glassware, and scalpels.
Sharps should be disposed of in designated puncture-proof, leak-proof, and sealable sharps
containers. To minimize finger sticks, used disposable needles must not be bent, sheared,
broken, recapped, removed from disposable syringes, or otherwise manipulated by hand before
disposal. Non-disposable sharps should be placed in a labeled discard pan for decontamination
before cleaning. Broken glassware should not be handled directly by hand but should be
removed by mechanical means (e.g., brush and dustpan, tongs, or forceps).
H. Aerosols
All procedures must be carefully performed to minimize splashes or aerosolization. When

procedures with a high potential for creating infectious aerosols are conducted or when a
procedure that can result in splashing or spraying of the face with infectious or other hazardous
materials is used, laboratory work should be conducted in a biosafety cabinet or by laboratorians
wearing the appropriate face protection equipment (e.g., goggles, mask, face shield, or other
splatter guards). Face protection should also be used when working with high concentrations or
large volumes of infectious agents. Procedures that pose such a risk may include:
 Centrifugation, vortexing, and vigorous mixing: these procedures should be performed in

closed containers. If safety capped tubes are not available, sealed tubes should be used.
All body fluids and infectious materials should only be centrifuged in carriers with safety
caps.
 Handling tissue specimens or bodily fluids: gauze should be used to remove the tops on
blood specimens and should be placed around the top of blood culture bottles to minimize
aerosol production during removal of the needle. Grinding of tissue specimens should be
performed in a biosafety cabinet.
 Sonic disruption: infectious materials that undergo sonic disruption should be placed in a
sealed container within the sonicator.
 Opening containers of infectious materials whose internal pressures or temperatures may be
different from ambient pressures or temperatures.
 Loops containing infectious material should be dried in the hot air above a burner before
flaming.
 Inoculating wires and loops should be cooled after flame sterilization by holding them still
in the air for 5-10 seconds before they touch colonies or clinical material. Disposable loops
are preferred if resources are available.
I. Decontaminating bench tops and other surfaces
Bench tops and other potentially contaminated surfaces should be wiped with a phenolic
disinfectant (10% bleach) routinely after working with infectious agents or clinical specimens or
after spills, splashes, or other contamination by infectious materials. Following disinfection with
16
10% bleach, the surface must then be wiped down with 70% isopropyl or ethyl alcohol to
inactivate the bleach and prevent corrosion of the work surface. Solutions of disinfectants
should be maintained at each work station (see Disinfectants, Section II.B.).
J. Disposal of contaminated materials
All discarded plates, tubes, clinical samples, pipettes, gloves, and other contaminated materials
should be placed in disposal containers at each bench. Special disposal containers typically
constructed of puncture-proof plastic must be used for sharps to minimize the risk of injury.
Avoid overfilling disposal containers. The lids should rest flush with the top of the container.
Containers of contaminated material should be carefully transported to the autoclave room and
autoclaved before disposal. Water should be added to each container to be autoclaved for
optimal sterilization. Waste disposal containers in the laboratory should be clearly labeled for
disposal of infectious items or non-infectious items. Waste disposal containers for infectious or
potentially infectious items should be lined with a plastic biohazard or otherwise specially
marked bag.
K. Autoclaving
An autoclave must be available for the BSL-2 laboratory and must be operated only by personnel
who have been properly trained in its use. To verify that each autoclave is working properly,
spore strips (such as Bacillus stearothermophilus) or other biological indicators designed to test
for efficiency of sterilization should be included in autoclave loads on a regular basis (i.e.,
monthly). Each autoclave load should be monitored with temperature-sensitive tape,
thermograph, or by other means (i.e., biological indicators). A logbook should be maintained for
each autoclave to record the date, times, and indicator of sterilization of each autoclave run.
L. General laboratory cleanliness
All areas of the laboratory must be kept clean and orderly. Dirt, dust, crowding, or clutter is a
safety hazard, may lead to contamination of specimens, isolates, and/or biological assays, and is
not consistent with acceptable biological research. Floors should be kept clean and free of
unnecessary clutter and should be washed with a germicidal solution on a regular basis and after
any spill of infectious material.
M. Refrigerators and freezers
The temperature of laboratory refrigerators and freezers should be monitored daily to ensure that
they are functioning properly. They should also be regularly inspected for the presence of
broken vials or tubes containing infectious agents. When removing and discarding broken
material, laboratorians should wear gloves and PPE. If the broken material is suspected of being
infectious, disinfectant should be applied to the affected area and kept in place for at least 15
minutes before removal of the broken material. Refrigerators and freezers should be regularly
cleaned with a disinfectant and defrosted to prevent possible contamination or temperature
failure.
17
N. Fire prevention
Burners should be used away from light fixtures and flammable materials. Bulk flammable
material must be stored in a safety cabinet. Small amounts of these flammable materials (e.g.,
ethyl acetate, ethyl alcohol, and methanol) can be stored in safety containers such as a safety
bench can or dispenser can. Burners must be turned off when not in use. All laboratorians must
know the location of fire extinguishers, fire blankets, alarms, and showers, and fire safety
instructions and evacuation routes should be posted.
III. Special Practices
A. Accidents
All injuries or unusual incidents should be reported immediately to the supervisor. When cuts or
puncture wounds from potentially infected needles or glassware occur, the affected area should
be promptly washed with disinfectant soap and water for 15 minutes. Report a needle-stick
injury, any other skin puncture, to the supervisor and appropriate health officials immediately as
prophylactic treatment of the personnel performing the procedure may be indicated. In the event
of a centrifuge accident in which safety carriers have not been used, other personnel in the area
should be warned immediately and the area should be isolated to prevent anyone from entering.
B. Laboratory design and equipment
The laboratory should be designed to avoid conditions that pose biosafety problems. Ample
space should be provided to allow for safe circulation of staff when working and cleaning. There
should be clear separation of areas for infectious and non-infectious work. Illumination should
be adequate. Walls, ceiling, floors, benches, and chairs must be easy to clean, impermeable to
liquids, and resistant to chemicals and disinfectants. Hand-washing basins with running water
and soap and disinfectant must be provided in each room. An autoclave or other means of
decontamination must be available close to the laboratory. Adequate storage space for
specimens, reagents, supplies, or personal items should be provided inside and outside the
working area, as appropriate. Safety systems for fire, chemicals, electrical, or radiation
emergencies, and an emergency shower and eyewash facilities should be in place. Security
measures should also prevent theft, misuse, or deliberate release of the infectious materials.
C. Medical surveillance of laboratory workers
The employing authority is responsible for providing adequate surveillance and management of
occupationally acquired infections. Pre-employment and periodic health checks should be
organized and performed. Prophylaxis or other specific protective measures may be applied after
a risk assessment of possible exposure and a health check of the individual or individuals.
Special attention should be paid to women of childbearing age and pregnant women as some
microorganisms present a higher risk for the fetus (i.e., rubella virus).
Immunization of the laboratory workers can also be proposed taking into account the following
criteria:
18
 Conclusion of the risk assessment.
 Verification by serology of the immunization status of the worker (some workers may be
already immunized from prior vaccination or infection).
 The local availability, licensing state, and utility of vaccines (i.e., does the vaccine provide
protection against the prevalent serogroups or serotypes circulating in the region?).
 The availability of therapeutic drugs (i.e., antibiotics) in case of accident.
 The existence of national regulations or recommendations.
A first-aid box containing basic medical supplies should be available along with a written
emergency procedure to access a doctor for definitive treatment of the injury. First aid kits
should be periodically checked to ensure contents are within the expiration date.
D. Biosafety management and implementation
The laboratory director is responsible for implementation of biosafety measures. He or she can
delegate tasks to a qualified individual or a group of individuals who perform them on a part-
time basis, or even assign a biosafety officer with the appropriate background and knowledge.
E. Other sources of biosafety information
For more information, please review:
Centers for Disease Control and Prevention. 1999. Biosafety in microbiological and biomedical
laboratories, 5th ed. Centers for Disease Control and Prevention, Atlanta, Georgia, USA.
Clinical and Laboratory Standards Institute. Protection of Laboratory Workers From

Occupationally Acquired Infections; Approved Guidelines—Third Edition. CLSI document
M29-A3. [ISBN 1-56238-567-4]. Clinical and Laboratory Standards Institute, 940 West Valley
Road, Suite 1400, Wayne, Pennsylvania 19087-1898. USA, 2005.
Laboratory Biosafety Manual, third edition. WHO/CDS/CSR/LYO/2004.11. World Health

Organization, Geneva, 2004, p 178.
Laboratory Biosafety Guidelines, third edition. Public Health Agency of Canada, 2004, p 113.
Manual for the laboratory identification and antimicrobial susceptibility testing of bacterial
pathogens of public health importance in the developing world. Centers for Disease Control and
Prevention and World Health Organization, 2003, p 359.
References
1. Sevjar, J.J., Johnson, D., Popovic, T., Miller, M. J., Downes, F., Somsel, P., Weyent,
R., Stephens, D. S., Perkins, B. A., and Rosenstein, N. E. 2005. Assessing the risk of
laboratory-acquired meningococcal disease. Journal of Clinical Microbiology, 43:4811-
4813.
19
2. Boutet, R., Stuart, J. M., Kaczmarski, E. B., Gray, S. J., Jones, D. M, and Andrews,
N. 2001. Risk of Laboratory-Acquired Meningococcal Disease. Journal of Hospital
Infection, 49:282-284.
20
CHAPTER 5
Collection and Transport of Clinical Specimens
The proper collection and transport of clinical specimens is critical for the isolation,
identification, and characterization of agents that cause bacterial meningitis. Optimally, clinical
specimens should be obtained before antimicrobial therapy commences in order to avoid loss of
viability of the etiological agents. Treatment of the patient, however, should not be delayed
while awaiting collection of specimens or results from the laboratory and a specimen should be
obtained in all suspect cases as bacterial pathogens can still be detected even after antimicrobial
therapy has begun. N. meningitidis, S. pneumoniae, and H. influenzae are fastidious and fragile
bacteria. They are more reliably isolated if the clinical specimens are examined as soon as
possible after collection. Cerebrospinal fluid (CSF) should be processed in a microbiology
laboratory within 1 hour after collection or inoculated into Trans-Isolate (T-I) medium for
transport to the laboratory if processing within 1 hour is not feasible. Blood specimens should be
immediately inoculated into a blood culture bottle and transported to a microbiology laboratory
as soon as possible for overnight incubation and growth of bacteria.
I. Biosafety
It is important to adhere to proper biosafety guidelines while handling potentially infectious

clinical specimens in order to maintain a safe working environment for patients, health care
workers, and laboratorians. Infection may be transmitted from patient to staff and from staff to
patient during the procedures described below. In addition to the agents that cause bacterial
meningitis, the patient could have other bacterial or viral agents in either the CSF of blood and
both are a great hazard and potentially lethal. Of particular importance are the viruses causing
hepatitis and acquired immunodeficiency syndrome. To decrease the risk of transmission of
these agents, the recommendations below should be followed:
 Wear latex or nitrile gloves that are impermeable to liquids and change gloves between
every patient.
 Dispose of syringes and needles in a puncture-resistant, autoclavable discard container. Do

not attempt to re-cap, shear, or manipulate any needle. A new sterile syringe and needle
must be used for each patient.
 For transport to a microbiology laboratory, place the specimen in a container that can be
securely sealed. Wipe any bottles with CSF or blood on the outside thoroughly with a
disinfectant, such as a 70% alcohol swab.
o Do not use povidone-iodine on the rubber septum of a T-I or blood culture bottle.
 Remove gloves and discard in an autoclavable container.
 Wash hands with antibacterial soap and water immediately after removing gloves.
21
 In the event of a needle-stick injury or other skin puncture or wound, wash the wound
liberally with soap and water. Encourage bleeding.
 Report a needle-stick injury, any other skin puncture, or any contamination of the hands or
body with CSF to the supervisor and appropriate health officials immediately as
prophylactic treatment of the personnel performing the procedure may be indicated.
II. Collection and transport of CSF
The collection of CSF is an invasive procedure and should only be performed by experienced
personnel under aseptic conditions. If bacterial meningitis is suspected, CSF is the best clinical
specimen to use for isolation, identification, and characterization of the etiological agents.
Suspected agents should include N. meningitidis, S. pneumoniae, and H. influenzae and other
pathogens in some cases.
A. Preparing for lumbar puncture
If possible, three tubes (1 ml each) of CSF should be collected for microbiology, chemistry, and
cytology. If only one tube of CSF is available, it should be given to the microbiology laboratory.
Because the presence of blood can affect cultures of CSF, if more than one tube of CSF is
collected from a patient, the first tube collected (which could contain contaminating blood from
the lumbar puncture) should not be the tube sent to the microbiology laboratory.
The kit for collection of CSF should contain (Figure 1):
 Skin disinfectant: 70% alcohol swab and povidone-iodine

o Alcohol with concentrations greater than 70% should not be used because the increased
concentrations result in decreased bactericidal activity. Do not use alcohol with
glycerol added to it.
 Sterile gloves
o Be sure to check the expiration date.
 Sterile gauze
 Surgical mask
 Adhesive bandage
 Lumbar puncture needle
o 22 gauge/89 mm for adults
o 23 gauge/64 mm for children
 Sterile screw-cap tubes
 Syringe and needle
 Transport container
 T-I medium (if CSF cannot be analyzed in a microbiological laboratory immediately)
o T-I should be refrigerated at 4°C and added to the kit immediately before use in the
field.
 Venting needle (only if T-I is being used)
 Instructions for lumbar puncture and use of T-I medium
22
Figure 1. Kit for collection of cerebrospinal fluid (CSF)
B. Lumbar puncture procedure
Follow all appropriate biosafety precautions (see Section I).
1. Gather all materials from the CSF collection kit and a puncture-resistant autoclavable
container for used needles.
2. Wear surgical mask and sterile latex or nitrile gloves that are impermeable to liquids and
change gloves between every patient.
3. Label the collection tubes with appropriate information: patient’s name, date and time of
specimen collection, and Unique Identification Number. Be sure this number matches the
number on both the request and report forms.
4. Ensure that the patient is kept motionless during the lumbar puncture procedure, either sitting
up or lying on the side, with his or her back arched forward so that the head almost touches
the knees in order to separate the lumbar vertebrae during the procedure (Figure 2).
5. Disinfect the skin along a line drawn between the crests of the two ilia with 70% alcohol and
povidone-iodine to clean the surface and remove debris and oils. Allow to dry completely.
6. Position the spinal needle between the 2 vertebral spines at the L4-L5 level and introduce
into the skin with the bevel of the needle facing up.
 Accurate placement of the needle is rewarded by a flow of fluid, which normally is clear
and colorless.
23
7. Remove CSF (1 ml minimum, 3-4 ml if possible) and collect into sterile screw-cap tubes. If
3-4 ml CSF is available, use 3 separate tubes and place approximately 1ml into each tube.
8. Withdraw the needle and cover the insertion site with an adhesive bandage. Discard the
needle in a puncture-resistant, autoclavable discard container.
9. Remove mask and gloves and discard in an autoclavable container.
10. Wash hands with antibacterial soap and water immediately after removing gloves.
11. Transport the CSF to a microbiology laboratory within 1 hour for culture and analysis.
 If that is not possible, inoculate CSF into T-I medium (see Section I.C. below).
 If T-I is not available, incubate CSF at 35-37°C with ~5% CO2 (see Section I.D. below)
and store in an approved location if the laboratory is closed.
12. In the event of a needle-stick injury or other skin puncture or wound, wash the wound
liberally with soap and water. Encourage bleeding.
13. Report a needle-stick injury, any other skin puncture, or any contamination of the hands or
body with CSF to the supervisor and appropriate health officials immediately as prophylactic
treatment of the personnel performing the procedure may be indicated.
Figure 2. Collection of cerebrospinal fluid (CSF) by lumbar puncture
24
C. Inoculating and transporting T-I medium
T-I is a biphasic medium that is useful for the primary culture of meningococci and other
etiological agents of bacterial meningitis (S. pneumoniae and H. influenzae) from CSF (Figure 3)
(1). It can be used as a growth medium as well as a holding and transport medium. The
preparation of T-I media is described in the Annex. T-I media should be stored at 4°C and
warmed to room temperature (25°C) before use.
1. Label the T-I bottle with appropriate information: patient name, date and time of CSF
inoculation, and Unique Identification Number. Be sure this number matches the number on
both the request and report forms.
2. Use sterile forceps to pull the aluminum cover of a T-I bottle away from the rubber stopper
and disinfect the stopper with 70% alcohol. Allow to dry.
 Do not use povidone-iodine as it may be carried into the medium by the passing needle and
would inhibit growth of bacteria.
 Do not completely remove the aluminum cover.
3. Use a sterile syringe and needle to inoculate 0.5-1.0 ml of CSF into the T-I medium. The
remaining CSF should be kept in the collection tube. It should not be refrigerated, but should
be maintained at room temperature (20-25°C) before Gram staining and other tests. Discard
the needle in a puncture-resistant, autoclavable discard container.
4. After inoculation, invert the T-I bottle several times to mix.
5. If transport to a reference laboratory is delayed (next day or longer), insert a venting needle
(sterile cotton-plugged hypodermic needle) through the rubber stopper of the T-I bottle,
which will encourage growth and survival of the bacteria.
 Be sure that the venting needle does not touch the broth.
6. Incubate inoculated T-I medium at 35-37°C with ~5% CO2 (or in a candle-jar) overnight or
until transport is possible. If transportation is delayed more the 4 days, remove the vented T-
I bottle from the incubator or candle jar and place at room temperature until shipment.
7. Remove the venting needle and wipe the rubber stopper with 70% alcohol before shipping. It
is essential to avoid contamination when sampling the bottles to obtain specimens
aseptically.
8. If the T-I bottle can be transported to a reference laboratory the same day, do not vent the
bottle until it arrives in the receiving laboratory. Upon arrival, vent the T-I bottle, incubate at
35-37°C with ~5% CO2 (or in a candle-jar), and observe daily for turbidity in the liquid
phase for up to 7 days.
25
 If turbidity is observed, culture onto a blood agar plate (BAP) and a chocolate agar plate
(CAP) immediately (see Chapter 6: Primary Culture and Presumptive ID).
 If no turbidity is observed, culture onto a BAP and a CAP on day 4 and day 7.
 If T-I medium appears to be contaminated, selective media such as Modified Thayer-

Martin and chocolate agar with bacitracin may be used.
Figure 3. Trans-Isolate (T-I) medium
D. Transporting CSF specimens without T-I media
CSF specimens should be transported to a microbiology laboratory as soon as possible.

Specimens for culture should not be refrigerated or exposed to extreme cold, excessive heat, or
sunlight. They should be transported at temperatures between 20°C and 35°C. For proper
culture results, CSF specimens must be plated within 1 hour (Figure 4). See Chapter 6: Primary
Culture and Presumptive ID for instructions on processing CSF once it has arrived in the
laboratory.
If a delay of several hours in processing CSF specimens is anticipated and T-I medium is not
available, incubating the specimens (with screw-cap loosened) at 35-37°C with ~5% CO2 (or in a
candle-jar) may improve bacterial survival.
26
Transport to Transport to
laboratory laboratory
< 1 hour > 1 hour
CSF Specimen
Centrifuge at Inoculate
1000 x g for Trans-Isolate (T-I)
10 to 15 minutes medium
Freeze 250 l at
-70˚C for rt-PCR
Supernatant Sediment Incubate overnight

35˚C in CO2
Rapid Gram stain Primary Subculture to

diagnostic test plating on chocolate agar and
(RDT) chocolate and blood agar
blood agar
Figure 4. Processing of CSF without T-I media
III. Collection and transport of blood specimens
Blood should be collected when a spinal tap is contraindicated, cannot be performed for
technical reasons, or when bacteremia is suspected. Bacteremia can occur with or without
meningitis.
A. Sensitivity of blood cultures
Several variables affect the sensitivity of blood cultures: the number of collections, the volume
of each collection, the steps taken to inhibit or neutralize bactericidal properties of blood, and the
age of the patient. It may be difficult to collect more than 3 ml of blood from a child, but 1-3 ml
is considered adequate. Collected blood should be diluted in blood culture broth in order to
obtain blood cultures. Typically, 1-2 ml of blood from a child is added to 20 ml of blood culture
broth and 5-10 ml of blood from an adult is added to 50 ml of blood culture broth. It is important
to use appropriate ratios of blood to culture broth for optimal bacterial growth. The
recommendations of the culture broth manufacturer should be closely followed.
27
Blood should be cultured in trypticase soy broth (TSB) or brain heart infusion (BHI) broth with a
growth supplement (such as IsoVitaleX or Vitox) to support growth of other fastidious
organisms such as H. influenzae. Neutralization of normal bactericidal properties of blood and
potential antimicrobial agents is accomplished by adding chemical inhibitors such as 0.025%
sodium polyanetholesulfonate (SPS) to culture media and by diluting the blood. SPS, which has
anticoagulant, antiphagocytic, anticomplementary, and antilysozymal activity, may be inhibitory
to bacterial growth of Neisseria species if used in higher concentrations. The preparation of
blood culture media is described in the Annex.
B. Preparing for venipuncture
The materials required for venipuncture are:
 Skin disinfectant: 70% alcohol swab and povidone-iodine

o Alcohol with concentrations greater than 70% should not be used because the increased
concentrations result in decreased bactericidal activity. Do not use alcohol with
glycerol added to it.
 Sterile gloves
o Be sure to check the expiration date
 Sterile gauze
 Adhesive bandage
 Cotton ball
 Tourniquet
 Syringe
 Needle
o A 21 gauge/20-25 mm needle is generally used for adults
o A 23 gauge/20-25 mm needle is generally used for children
 Puncture-resistant, autoclavable container
 Thermal insulated transport carrier (such as extruded polystyrene foam)
 Blood culture bottle
C. Venipuncture and inoculating blood culture bottles
If possible, 1-3 ml of blood should be collected from a child, though it may be difficult to collect
more than 1 ml, and 5-10 ml of blood should be collected from an adult. Collected blood should
be diluted in blood culture broth in order to obtain blood cultures. Blood cannot be transported
before being placed in a blood culture bottle because the syringes do not contain any
anticoagulant and the blood will coagulate within a few minutes. A diagram of the proper
method for collecting blood from the arm is shown in Figure 5.
If using alternative blood collection methods, such as a blood collection tube or a partially
evacuated blood collection tube, immediately inoculate specimens into the blood-culture bottle
using a needle and syringe after disinfecting the top of the bottle with 70% alcohol.
1. Gather all materials required for venipuncture (listed above).
28
 Note: blood culture bottles should be stored at 4°C when not in use and pre-warmed to
room temperature (25°C) or 37°C before inoculation.
2. Label the blood culture bottle with appropriate information: patient name, date and time of
blood culture bottle inoculation, and Unique Identification Number. Be sure this number
matches the number on both the request and report forms.
3. Disinfect the rubber septum of the blood culture bottle with a 70% alcohol swab and allow it
to dry.
 Do not use povidone-iodine on the rubber septum as it may be carried into the medium by
the passing needle, thus inhibiting the growth of bacteria.
4. Select an arm and apply a tourniquet to restrict the flow of venous blood. The large veins of
the forearm are illustrated in Figure 5. The most prominent vein is usually chosen.
5. Wipe the skin with a 70% alcohol swab and then povidone-iodine. Allow to dry. If the vein
is palpated again, change gloves and repeat the skin disinfection.
6. Insert the needle into the vein with the bevel of the needle face up. Once the needle has
entered the vein, withdraw the blood by pulling back on the barrel of the syringe in a slow,
steady manner. Air must not be pumped into the vein. After the desired amount of blood
is obtained, release the tourniquet and place a sterile cotton ball or gauze over the insertion
site while holding the needle in place.
7. Withdraw the needle and have the patient hold the cotton ball or gauze firmly in place until
the wound has stopped bleeding. Cover the insertion site with an adhesive bandage.
8. Immediately (within 1 minute) inoculate the blood into the blood culture medium to prevent
the blood from clotting in the syringe. Do not attempt to recap the needle and discard it in a
puncture-resistant, autoclavable discard container. Wipe the surface of the blood culture
bottle with a 70% alcohol swab.
 In general, follow the manufacturer’s instructions for inoculating the specific size of blood
culture bottle with the correct volume of blood.
 For blood from young children, add 1-2 ml of blood into 20 ml of blood culture broth
(approximately a 1:10 to 1:20 dilution).
 For blood from adults, add 5-10 ml of blood into 50 ml of blood culture broth
(approximately a 1:5 to 1:10 dilution).
9. After inoculation, swirl the bottle several times to mix and transport to a microbiology
laboratory immediately (See section III.D.)
29
 If immediate transport to a microbiology laboratory is not feasible, place the inoculated
blood culture bottle in an incubator at 35-37°C with ~5% CO2 (or in a candle-jar) until
transport to a microbiology laboratory is possible.
 Inoculated blood culture bottles should not be placed in the refrigerator.
10. Remove gloves and discard in an autoclavable container.
11. Wash hands with antibacterial soap and water immediately after removing gloves.
D. Transporting blood culture bottles
Ideally, inoculated blood culture bottles should be transported to a microbiology laboratory

immediately for overnight incubation at 35-37°C with ~5% CO2 (or in a candle-jar) and
subsequent culture onto a BAP and CAP. All inoculated blood culture media should be
protected from temperature extremes (not less than 18°C or more than 37°C) with a transport
carrier and thermal insulator (such as extruded polystyrene foam).
Figure 5. Collection of blood from an arm
30
References
1. Ajello, G. W., Feeley, J. C., Hayes, P. S., Reingold, A.L., Bolan, G., Broome, C. V., et
al. 1984. Trans-Isolate medium: A new medium for primary culturing and transport of
Neisseria meningitidis, Streptococcus pneumoniae, and Haemophilus influenzae. Journal
of Clinical Microbiology 20:55-58.
31
CHAPTER 6
Primary Culture and Presumptive Identification of Neisseria meningitidis,

Microbiology laboratories commonly receive cerebrospinal fluid (CSF) or blood specimens from
patients with meningitis, pneumonia, or unexplained febrile illness. Laboratories may also
receive joint fluid, pleural fluid, or other sterile site specimens from these patients. Presumptive
identification of N. meningitidis, S. pneumoniae, and H. influenzae can be made on the basis of a
cytological examination of the CSF, specific colony morphology on blood and/or chocolate agar,
staining properties on a Gram stain, or by detection of specific antigens in the CSF by a latex
agglutination test or using a rapid diagnostic test (RDT). Methods for confirmatory
identification of N. meningitidis, S. pneumoniae, and H. influenzae are presented in the next
chapters of this laboratory manual (Chapters 7: Identification and Characterization of N.
meningitidis, 8: Identification and Characterization of S. pneumoniae, and 9: Identification and
Characterization of H. influenzae).
Personnel who are at risk of routine exposure to aerosolized N. meningitidis should strongly
consider vaccination. Additional health and safety information can be found in Chapter 4:
Biosafety. While laboratory-acquired infections with S. pneumoniae or H. influenzae are not as
extensively reported, fatal infections with these bacteria can occur, and vaccination against these
organisms may be recommended in some laboratories.
Because the primary purpose of this manual is to aid in the identification of N. meningitidis, S.
pneumoniae, and H. influenzae from clinical specimens collected from suspected cases of
bacterial meningitis, the methods described here will not allow for identification of other isolates
that may be of clinical importance but are less likely encountered. Microbiologists should refer
to clinical microbiology manuals, such as the American Society for Microbiology’s Manual of
Clinical Microbiology, for procedures to identify other bacteria.
I. Processing CSF specimens
A note about centrifugation: g (1 x gravity) represents relative centrifugal force (RCF), but the
recommended centrifugation speed is often listed in protocols as revolutions per minute (RPM).
RCF is dependent on the length of the radius of the rotor, thus the same RPM may not generate
the same g force in another centrifuge. Therefore, RCF should be used to describe the centrifuge
speed. If only RPM is given, RCF can be calculated using this formula:
RCF = 0.00001118 x r x RPM2
r = radius of rotor in centimeters
32
Once the CSF arrives in the microbiology laboratory, the volume of CSF available for analysis
should be noted. If < 1 ml of CSF is available, it should not be centrifuged; instead, the CSF
should be plated directly onto a blood agar plate (BAP) and onto a chocolate agar plate (CAP)
and also used for the Gram stain. If > 1 ml of CSF is available (i.e., if the specimen volume is
sufficient for centrifugation), it must be centrifuged at a force sufficient to sediment the bacteria.
Typically, centrifugation at 1000 x g for 10-15 minutes is sufficient to sediment bacteria.
After the specimen has been centrifuged, the supernatant should be drawn off with a Pasteur
pipette and reserved if antigen detection by latex agglutination is planned. The sediment should
be vigorously mixed (e.g., in a closed tube using a vortex machine). Once it has been well-
mixed, one or two drops of sediment should be used to prepare the Gram stain and one drop
should be used to streak the primary culture media.
A. Cytological examination of the CSF
Laboratory examination of the CSF is usually the first step to confirm the presence of bacterial
meningitis. Note that cytological examination should precede centrifugation and heating of the
CSF. Typical CSF abnormalities associated with bacterial meningitis include the following:
 Turbidity
 Increased opening pressure (>180 mm water)
 Pleocytosis (usually of polymorphonuclear (PMN) leukocytes); WBC counts >10
cells/mm3
 Decreased glucose concentration (<45 mg/dl)
 Increased protein concentration (>45 mg/dl)
Note: normal cytology of the CSF of an infant is 10-30 WBC/mm3 (50% PMNs).
B. Presumptive identification by Gram stain, latex agglutination, or rapid diagnostic test

(RDT)
In combination with a clinical picture and CSF examination consistent with bacterial meningitis,
a presumptive diagnosis of bacterial meningitis caused by N. meningitidis, S. pneumoniae, or H.
influenzae can be made after performing a Gram stain of the CSF sediment or by detection of
specific antigens in the CSF by a latex agglutination test or using RDTs. Positive results for any
of these tests can rapidly provide evidence of infection, even if cultures fail to grow.
1. Performing a Gram stain
The Gram stain is an empirical method for differentiating bacterial species into two large groups
based on the chemical and physical properties of their cell walls. Gram-positive bacteria retain
the primary stain while gram-negative bacteria take the color of the counterstain. A Gram stain
can also serve to assess the quality of a clinical specimen. The CSF should be properly
centrifuged in order to obtain the sediment for the procedure. Proper smear preparation using the
CSF sediment should produce a monolayer of organisms sufficiently dense for easy visualization
but thin enough to reveal morphological characteristics. Clean, new glass slides should be used.
33
Positive and negative quality control (QC) strains should be tested along with the unknown
specimens. In addition to known reference strains for N. meningitidis, S. pneumoniae, and H.
influenzae, other reference strains that may be used include Staphylococcus aureus for gram-
positive cocci and Escherichia coli for gram-negative rods.
Gram stain procedure for CSF
1. Centrifuge the CSF for 10-15 minutes at 1000 x g, if > 1 ml is available (see above).
2. Divide a glass slide into two sections using a marker. Use one section for the unknown
CSF and the other section for a known organism for QC.
3. Prepare a smear by placing 1-2 drops of the well-mixed CSF sediment on the slide,
allowing the drop(s) to form one large slightly turbid, uniform suspension.
 To prepare a smear using an isolate, add a small drop of sterile water or physiological
saline to the slide and create a slightly turbid, uniform suspension of cells from an
overnight culture.
4. Let the suspension air dry. The suspension MUST be completely dry before proceeding.
5. Fix the smear by the flooding the slide with 95% methanol for a minimum of 2 minutes
(3). Rinse with distilled water. Shake off excess water.
 If methanol is not available, heat-fix the smears by quickly passing the slide through a
flame three times. Do not over-heat the slide as over-heating will cause significant
distortion or destruction of the cells.
 It is possible to use simple water (filet d’eau de robinet) if distilled water is not
available for the entire Gram stain procedure.
6. Flood the slide with crystal violet ammonium oxalate for 1 minute to stain. Rinse with
distilled water. Shake off excess water.
 Avoid touching the slide with the tip of the reagent bottle or applying liquid directly
onto the smear.
7. Flood the slide with Gram’s iodine for 1 minute. The iodine acts as a mordant as it binds
the alkaline crystal violet dye to the cell wall. Rinse with distilled water. Shake off
excess water.
8. Decolorize with 95% ethanol until no more stain washes off (5-10 seconds may be
enough). Rinse with distilled water. Shake off excess water.
 It is essential to view decolorization closely: gram-positive bacteria can be made to

appear gram-negative by over-decolorization and gram-negative bacteria can be made
34
to appear gram-positive by under decolorization.
9. Counterstain with safranin for 30 seconds or with carbol-fuchsin for 10-15 seconds.
Rinse with distilled water. Shake off excess water.
10. Gently blot the slide using bibulous paper or a clean paper towel. Let air dry.
11. When dry, examine the stained smear under a microscope with 100X oil immersion
objective.
Reading the Gram stain results (under microscopic examination):
 Gram-positive organisms will appear dark violet or purple.

 Gram-negative organisms will appear red or pink (from the counterstain).
N. meningitidis may occur intracellularly or extracellularly in PMN leukocytes and will appear as
gram-negative, coffee-bean shaped diplococci.
Figure 1. Gram stain of N. meningitidis in CSF with associated PMNs.
35
S. pneumoniae may occur intracellularly or extracellularly and will appear as gram-positive,
lanceolate diplococci, sometimes occurring in short chains.
Figure 2. Gram stain of S. pneumoniae with WBCs
36
H. influenzae are small, pleomorphic gram-negative rods or coccobacilli with random
arrangements.
Figure 3. Gram stain of H. influenzae
2. Performing latex agglutination testing
Several commercial kits are available for latex agglutination testing. General recommendations
and instructions for the detection of soluble bacterial antigens (capsular polysaccharide) are
provided below, but the manufacturer’s instructions included in the kit should be followed
precisely when using these tests. For best results, the supernatant of the centrifuged CSF
specimen should be tested as soon as possible. If immediate testing is not possible, the CSF
specimen can be refrigerated (between 2-8°C) for several hours, or frozen at -20°C for longer
periods. It is imperative that the kits be kept refrigerated before use, but never frozen, especially
in tropical climates as the kits deteriorate at high temperatures which may make the test results
unreliable before the expiration date of the kit.
Latex agglutination procedure for CSF
Follow the manufacturer’s instructions on the package insert for the specific latex kit being used.
General instructions are listed below:
1. Centrifuge the CSF for 10-15 minutes at 1000 x g and collect the supernatant.
 The sediment should be used for Gram stain and primary culture.
37
2. Heat the CSF supernatant to be used for the test at 100°C for 3 minutes.
3. Shake the latex reagents gently until homogenous.
4. Place one drop of each latex reagent on a disposable card provided in the kit or a ringed
glass slide.
5. Add 30-50 μl of the supernatant of the CSF to each latex reagent.
6. Rotate by hand for 2-10 minutes. If available, mechanical rotation at 100 rpm is
recommended.
 Avoid cross-contamination when mixing and dispensing reagents.
7. Examine the agglutination reactions under a bright light without magnification.
Reading the latex agglutination results
 Positive reaction: agglutination (or visible clumping) of the latex particles and slight
clearing of the suspension occurs within 2-10 minutes (Figure 4).
 Negative reaction: the suspension remains homogenous and slightly milky in appearance.
Negative reaction Positive reaction
Figure 4. Negative and positive latex agglutination reactions
38
3. Rapid diagnostic tests (RDTs)
A. RDT for meningococcal meningitis
RDTs have been developed for direct testing of CSF specimens without prior heat or
centrifugation (2). The test is based on the principle of vertical flow immunochromatography in
which gold particles and nitrocellulose membranes are coated with monoclonal antibodies to
capture soluble serogroup-specific polysaccharide antigens in the CSF. The test consists of 2
duplex paper sticks (also called dipsticks), which together enable identification of four
serogroups of N. meningitidis (A, C, W135, and Y). RDT1 tests for serogroups A and W135/Y
and RDT2 tests for serogroups C and Y.
RDTs can be produced in large quantities, are relatively inexpensive, and remain stable for
weeks in hot weather if protected from humidity; therefore, they are practical for immediate
testing of specimens obtained during adverse conditions. Initial evaluation using RDTs on stored
CSF from patients in Niger showed correct identification of the meningococcal serogroup 97%
of the time (4). However, more recent studies under field conditions have shown similar
specificity, but much lower sensitivity of 70% (6) and, in contrast, similar sensitivity but much
lower specificity (5).
RDT procedure for CSF
Follow the manufacturer’s instructions on the package insert. General instructions are listed
below:
1. RDTs should be stored at 4°C in a moisture-proof bag until use.
2. Place the two dipsticks (RDT1 and RDT2) into two separate tubes (3 ml disposable
plastic tubes are recommended) of 150-200 µl of CSF or a reference strain suspension in
PBS, pH 7.2.
3. Record the chromatographic result on each strip after 10-15 minutes at room temperature
(25°C).
Reading the RDT results
 Appearance of red lines on the dipsticks will indicate whether one of the four
meningococcal serogroups has been detected in the CSF (Figure 5).
 The upper line on the dipstick is the positive control and should always be present.
 If the CSF is positive for one of the serogroups, a lower red line will also be present. The
position of that red line indicates the specific serogroup based on the RDT that was tested.
See Figure 5 for result combinations for each serogroup.
 A negative result consists of a single upper pink control line only.
39
Figure 5. RDT results for N. meningitidis serogroups A, C, W135, and Y, as well as a negative
control (2).
B. RDT for pneumococcal meningitis
RDT commercial kits are also available for S. pneumoniae detection by immunochromatography.
The principle is the same as the one described above for N.meningitidis. Follow the
manufacturer's instructions on the package insert.
II. Primary Culture
A. Selection of primary culture media
The best medium for growth of S. pneumoniae is a blood agar plate (BAP), which is a trypticase
soy agar (TSA) plate containing 5% sheep blood. Human blood is NOT an acceptable substitute
for the blood in the agar because the antibodies contained in human blood may inhibit bacterial
growth. S. pneumoniae will also grow on a chocolate agar plate (CAP).
For H. influenzae, a CAP made with heat lysed blood or supplemented with hemin (X factor) and
nicotinamide-adenine-dinucleotide (NAD; V factor) should be used. Growth of H. influenzae on
a BAP may be achieved by adding a source of NAD, traditionally done by cross-streaking the
inoculated medium with a Staphylococcus aureus or Enterococcus species strain. H. influenzae
forms satellite colonies along the length of the staphylococcal or enterococcal growth.
Additionally, applying filter paper (or disks) saturated with hemin and NAD to the surface of the
BAP after the medium has been inoculated will produce a halo of growth around the strip or
disk.
N. meningitidis grows on both BAP and CAP. Because N. meningitidis grows well in a humid
atmosphere, if an infection with N. meningitidis is suspected, laboratorians may choose to add a
shallow pan of water to the bottom of the incubator or add a dampened paper towel to the candle
jar. The moisture source should be changed regularly to prevent contamination with molds.
40
Ordinarily, both BAP and CAP are used for subculture. If only one type of plate is available, a
CAP should be used because it contains the hemin and NAD needed for H. influenzae, whereas a
BAP does not.
If primary cultures appear to be contaminated, selective media may improve the isolation of
these bacteria from specimens containing a mixed flora of bacteria and/or fungi. For primary
isolation of N. meningitidis, a chocolate agar base containing vancomycin, colistin, nystatin, and
trimethoprim can be used. For isolation of S. pneumoniae, tryptic soy agar with 5% sheep blood
and either gentamicin, neomycin or sulfamethoxazole-trimethoprim (SXT) may be useful. For
isolation of H. influenzae, chocolate agar with bacitracin can be used. Other antibiotic
formulations are also available.
B. QC of primary culture media
All primary culture media should be tested for QC to ensure that the media will support the
proper growth of N. meningitidis, S. pneumoniae, and H. influenzae. One plate from each new
lot of media received should be tested using an appropriate, well-characterized reference strain of
N. meningitidis, S. pneumoniae, and/or H. influenzae. In addition, all media should be tested
periodically (every 3 months) to ensure that it can support the growth of appropriate bacteria.
One uninoculated plate from each new lot should also be tested in order to check for
contamination of mold or other organisms in the laboratory and/or incubator. QC should be
repeated on plates from a lot if they have been exposed to temperatures above 4oC or if there is
reason to suspect that the plates have been contaminated since the initial QC was performed.
Procedure for QC of primary culture media
1. Inspect the media for any visible microbial contamination, discoloration, drying,
deterioration, or other physical defects that may interfere with use.
2. Inoculate the media with pure colonies from 18-24 hour growth of a well-characterized
reference strain. Streak for isolation and incubate for 18-24 hours at 35-37°C with ~5%
CO2 (or in a candle-jar).
3. Incubate an uninoculated plate for 18-24 hours at 35-37°C with ~5% CO2 (or in a candle-
jar).
4. Examine the inoculated and uninoculated plates after 18-24 hours.
Reading QC testing results
 Passing result: proper growth of the reference strain on appropriate media and no growth
on uninoculated media.
 Failing result: no growth or poor growth of the reference strain on appropriate media and
growth of organisms on the uninoculated media.
III. Inoculation of primary culture media from CSF specimens
41
A. Primary culture directly from CSF
1. If the CSF can be transported to a microbiology laboratory immediately (within 1 hour

from the time of collection) for culture and analysis, inoculate 1-5 drops of CSF
(depending on volume received in laboratory) directly onto both a BAP and CAP within
1 hour after collection.
 If the CSF was centrifuged, use 1 drop of the well-mixed sediment for primary culture.
2. Using a sterile bacteriological loop, cross-streak the inoculum to obtain single, isolated
colonies.
 Disposable loops are preferred, but if using a wire loop, it must be sterilized prior to
each step of the plate-streaking process.
 BAP and CAP that have been properly streaked are shown in Figures 6, 7, and 8.
3. A back-up broth (e.g., brain-heart infusion broth with proper supplements) should be
inoculated with some of the sediment pellet.
4. Agar plates and broth inoculated with the CSF sediment should be incubated for 18-24
hours at 35-37°C with ~5% CO2 (or in a candle-jar).
Figure 6. Proper streaking and growth of N. meningitidis on a BAP
42
Figure 7. Proper streaking and growth of S. pneumoniae on a BAP
43
Figure 8. Proper streaking and growth of H. influenzae on a CAP
B. Primary culture from Trans-Isolate (T-I) medium
1. If the CSF cannot be transported to a microbiology laboratory immediately (within 1 hour

from the time of collection) for culture and analysis, a bottle of T-I medium should be
inoculated (1). To do this remove the aluminum cap with forceps, wipe the rubber
stopper with a 70% alcohol swab (do not use povidone-iodine) and use a syringe to
aseptically inoculate 0.5-1.0 ml of the CSF into the T-I medium for transport and growth
of bacteria.
a. If the T-I medium cannot be transported to a microbiology laboratory the same day of
inoculation, insert a venting needle (sterile cotton-plugged hypodermic needle)
through the rubber stopper of the T-I bottle, which will encourage growth and
survival of the bacteria.
 Be sure that the venting needle does not touch the broth.
b. Incubate the inoculated T-I medium at 35-37°C with ~5% CO2 (or in a candle-jar)
overnight or until transport is possible. If transportation is delayed more the 4 days,
44
remove the vented T-I bottle from the incubator or candle jar and place it at room
temperature (25°C) until shipment.
c. Remove the venting needle and wipe the rubber stopper with 70% alcohol before
shipment. It is essential to avoid contamination when sampling the bottles to obtain
specimens aseptically.
d. Once the T-I medium arrives in the microbiological laboratory, it can be cultured
immediately.
2. If the T-I medium can be transported to a microbiology laboratory the same day of
inoculation, do not vent the T-I bottle until it arrives in the receiving laboratory. Upon
arrival, wipe the rubber stopper with 70% alcohol, insert a venting needle into the T-I
bottle, incubate at 35-37°C with ~5% CO2 (or in a candle-jar), and observe daily for
turbidity in the liquid phase for up to 7 days.
 Prior to subculture, remove the venting needle and wipe the rubber stopper with 70%
alcohol.
 Do not use povidone-iodine on the rubber stopper as it may be carried into the medium
by the passing needle, thus inhibiting the growth of bacteria.
3. After 18-24 hours of incubation at 35-37°C with ~5% CO2 (or in a candle-jar) with a
venting needle, use a sterile needle and syringe to transfer 50-100 μl of the liquid portion
of the T-I medium onto both a BAP and CAP for primary culture.
 Approximately 50-100 μl is used to streak each plate. To streak two plates, draw
approximately 100-200 μl with the syringe at one time to minimize the possibility of
contaminating the T-I medium.
4. Streak the BAP and CAP for isolation, incubate the plates at 35-37°C with ~5% CO2 (or
in a candle-jar), and examine the plates daily for up to 72 hours.
5. If no growth is observed, subculture the T-I medium again on day 4 and day 7.
6. Isolates should always be inspected for purity of growth by looking at colony

morphology before any testing is performed. If any contamination is seen, cultures
should be re-streaked to ensure purity prior to testing.
7. If the T-I medium appears to be contaminated, selective media may be used (see Section
II.A.).
IV. Processing blood specimens
45
Laboratory personnel handling blood culture specimens must be able to isolate bacteria on
appropriate primary culture media and properly subculture isolates to obtain pure cultures for
testing.
A. Primary culture from a blood culture bottle
The blood culture bottle should be immediately inoculated (within 1 minute) after venipuncture
to prevent the blood from clotting in the syringe. The inoculated blood culture bottle should be
transported to a microbiology laboratory as soon as possible for incubation and subculture.
1. If transport to a microbiology laboratory is not possible the same day, place the blood
culture bottle in an incubator at 35-37°C with ~5% CO2 (or in a candle-jar) until transport
is possible. Inoculated blood culture bottles should not be placed in the refrigerator.
2. If transport to a microbiology laboratory is feasible the same day, incubate the blood
culture bottle at 35-37°C with ~5% CO2 (or in a candle-jar).
3. Examine the blood culture bottle for turbidity at 14-17 hours and then every day for up to
7 days. Any turbidity or lysis of erythrocytes may be indicative of growth, and
subcultures onto primary culture media should be made immediately.
 Because N. meningitidis, S. pneumoniae, and H. influenzae are fragile organisms,

subcultures should be performed on day 4 and day 7 regardless of turbidity, as the
absence of turbidity does not always correlate with the absence of bacterial growth.
4. Before subculture, swirl the blood culture bottle several times to mix the contents.
5. Disinfect the rubber septum of the blood culture bottle with a 70% alcohol swab.
 Do not use povidone-iodine on the rubber septum as it may be carried into the medium
by the passing needle, thus inhibiting the growth of bacteria.
 Alternatively, if the blood culture bottle has a screw-cap, open the bottle and remove
the fluid using sterile technique (i.e., flaming the bottle mouth upon opening and
closing the cap).
6. Aspirate 1 ml with a sterile syringe and needle from the blood culture bottle and transfer
0.5 ml to a BAP and 0.5 ml to a CAP.
7. Streak the plates for isolation, incubate at 35-37°C with ~5% CO2 (or in a candle-jar),
and examine daily for up to 72 hours.
8. Isolates should always be inspected for purity of growth by looking at colony

morphology before any testing is performed. If any contamination is seen, cultures
should be re-streaked to ensure purity prior to testing.
46
9. Once pure bacterial growth has been confirmed by subculture from the blood culture
bottle, the bottle should be disposed of according to proper safety procedures.
B. MacConkey agar media
If the microbiology laboratory has the resources to support the use of a third plate for subculture,
MacConkey agar should be used, particularly if the specimen was obtained from a patient with
fever of unknown origin, when typhoid fever (S. typhi) is suspected symptomatically, or if a
Gram stain of blood culture broth reveals gram-negative bacilli. MacConkey agar is designed to
grow gram-negative bacteria and stain them for lactose fermentation, in order to distinguish
those that can ferment the sugar lactose (Lac+) from those that cannot (Lac-). It contains bile
salts (to inhibit most gram-positive bacteria, except Enterococcus and some species of
Staphylococcus, i.e., Staphylococcus aureus), crystal violet dye (which also inhibits certain
gram-positive bacteria), neutral red dye, (which stains microbes fermenting lactose), lactose, and
peptone.
1. Transfer approximately 0.5 ml of the blood culture broth onto MacConkey agar and
streak for isolated colonies.
2. Incubate the MacConkey agar for 18-24 hours at 35-37°C with ~5% CO2 (or in a candle-
jar).
3. Inspect plate for growth and identify the bacteria (Figure 9).
Figure 9. Growth of Salmonella ser. Typhi on MacConkey agar
47
V. Macroscopic examination of colonies
Presumptive identification of N. meningitidis, S. pneumoniae, and H. influenzae can be made on

the basis of growth and colony morphology on a BAP and CAP and a Gram stain of the
organisms (Table 1 and Figures 10 and 11).
Table 1. Presumptive identification of N. meningitidis, S. pneumoniae, and H. influenzae based

on growth on primary culture media and Gram stain results
Growth on Growth on
Gram stain Presumptive ID
CAP BAP
gram-negative
+ + N. meningitidis
diplococci
gram-positive
+ + S. pneumoniae
diplococci
gram-negative
+ - pleomorphic H. influenzae
coccobacilli
48
Figure 10. Growth of N. meningitidis on lower left and S. pneumoniae on upper left of a BAP
49
Figure 11. Growth of N. meningitidis on lower left, S. pneumoniae on top, and H. influenzae on
lower right of a CAP
50
H. influenzae appear as large, colorless-to-grey, opaque colonies on a CAP (Figure 12). No
hemolysis or discoloration of the medium is apparent. Encapsulated strains appear more
mucoidal than non-encapsulated strains, which appear as smaller compact grey colonies. H.
influenzae cannot grow on a BAP.
Figure 12. H. influenzae colonies on a CAP
51
Young colonies of N. meningitidis are round, smooth, moist, glistening, and convex, with a
clearly defined edge on a BAP (Figure 13). Some colonies appear to coalesce with other nearby
colonies. Actively growing colonies of N. meningitidis on a BAP are grey and unpigmented.
Older cultures (> 24 hours) become more opaquely grey and sometimes cause the underlying
agar to turn dark. On a CAP, N. meningitidis appear similar to H. influenzae (see description
above). While H. influenzae produce a pungent indol smell that can differentiate it from N.
meningitidis, plates should not be opened in order to smell the cultures.
Figure 13. N. meningitidis colonies on a BAP
52
S. pneumoniae appear as small, grey, moist (sometimes mucoidal), watery colonies with a
surrounding green zone of alpha-hemolysis on a BAP (Figure 14) and CAP. The degree of
mucoidness of S. pneumoniae colonies is strain and serotype dependent and is also influenced by
the freshness of the medium and the incubation atmosphere. Some serotypes appear more
mucoidal than others; the fresher the medium, the more mucoidal the cultures appear. Young
pneumococcal colonies appear raised, similar to viridans streptococci. Differentiating
pneumococci from viridans streptococci on a CAP is difficult. However, once the pneumococcal
culture ages 24-48 hours, the colonies become flattened, and the central portion becomes
depressed, which does not occur with viridans streptococci (Figure 15). A microscope (30X-
50X) or a 3X hand lens can also be a useful tool in differentiating pneumococci from alpha-
hemolytic viridans streptococci.
Figure 14. S. pneumoniae colonies on a BAP
53
Figure 15. S. pneumoniae colonies have a flattened and depressed center after 24-48 hours of
growth on a BAP, whereas the viridans streptococci retain a raised center
54
Other organisms that might appear on the culture plate along with S. pneumoniae are
Staphylococcus aureus, Staphylococcus epidermidis, or another Staphylococcus species. Figure
16 shows the two different types of colonies growing on a BAP. The dull gray flat colony
surrounded by a green zone of hemolysis is S. pneumoniae and the white colony with no
hemolytic activity is S. epidermidis.
Figure 16. The small grey, flat colonies surrounded by a greenish zone of alpha-hemolysis are S.
pneumoniae and the white colonies with no hemolytic activity are S. epidermidis (black arrow).
References
1. Ajello, G. W., J. C. Feeley, P. S. Hayes, A. L. Reingold, G. Bolan, C. V. Broome, and

C. J. Phillips. 1984. Trans-Isolate Medium: a New Medium for Primary Culturing and
Transport of Neisseria meningitidis, Streptococcus pneumoniae, and Haemophilus
influenzae. Journal of Clinical Microbiology 20:55-58.
55
2. Chanteau, S., S. Dartevelle, A. E. Mahamane, S. Djibo, P. Boisier, and F. Nato. 2006.
New rapid diagnostic tests for Neisseria meningitidis serogroups A, W135, C, and Y.
PLoS Medicine 3:e337.
3. Mangels, J. I., Cox, M. E., and Lindberg, L. H. 1984. Methanol Fixation: An
alternative to heat fixation of smears before staining. Diagnostic Microbiology and
Infectious Disease 2:129-137.
4. Murray, P. R., E. J. Baron, J. H. Jorgensen, M. L. Landry, and M. A. Pfaller (ed.).
2007. Manual of Clinical Microbiology, 9th ed, vol. ASM Press, Washington, D. C.
5. Rose, A. M., S. Gerstl, A. E. Mahamane, F. Sidikou, S. Djibo, L. Bonte, D. A.
Caugant, P. J. Guerin, and S. Chanteau. 2009. Field evaluation of two rapid diagnostic
tests for Neisseria meningitidis serogroup A during the 2006 outbreak in Niger. PLoS
ONE 4:e7326.
6. Rose, A. M., J. E. Mueller, S. Gerstl, B. M. Njanpop-Lafourcade, A. L. Page, P.
Nicolas, R. O. Traore, D. A. Caugant, and P. J. Guerin. 2010. Meningitis dipstick
rapid test: evaluating diagnostic performance during an urban Neisseria meningitidis
serogroup A outbreak, Burkina Faso, 2007. PLoS ONE 5:e11086.
56
CHAPTER 7
Identification and Characterization of Neisseria meningitidis
N. meningitidis are gram-negative, coffee-bean shaped diplococci that may occur intracellularly
or extracellularly in PMN leukocytes. N. meningitidis is a fastidious organism, which grows best
at 35-37°C with ~5% CO2 (or in a candle-jar). It can grow on both a blood agar plate (BAP) and
a chocolate agar plate (CAP). Colonies of N. meningitidis are grey and unpigmented on a BAP
and appear round, smooth, moist, glistening, and convex, with a clearly defined edge. N.
meningitidis appear as large, colorless-to-grey, opaque colonies on a CAP. Prior to identification
and characterization testing procedures, isolates should always be inspected for purity of growth
and a single colony should be re-streaked, when necessary, to obtain a pure culture. For the
following identification and characterization procedures, testing should be performed on 18-24
hour growth from a BAP (Figure 1) or a CAP (Figure 2) at 35-37°C with ~5% CO2 (or in a
candle-jar).
The following tests are recommended to confirm the identity of cultures that morphologically
appear to be N. meningitidis (Figure 3). N. meningitidis can be identified using Kovac’s oxidase
test and carbohydrate utilization. If the oxidase test is positive, carbohydrate utilization testing
should be performed. If the carbohydrate utilization test indicates that the isolate may be N.
meningitidis, serological tests to identify the serogroup should be performed. This sequence of
testing is an efficient way to save costly antisera and time. Additional methods for identification
and characterization of N. meningitidis using molecular tools are described in Chapter 10: PCR
Methods and Chapter 12: Molecular Methods.
Biosafety Level 2 (BSL-2) practices are required for work involving isolates of N. meningitidis,
as this organism presents a potential hazard to laboratory personnel and the surrounding working
environment. Please refer to Chapter 4: Biosafety in order to follow the guidelines that have
been established for laboratorians working in BSL-2 facilities as many of the tests described in
this chapter require opening plates with live cultures and are often performed outside of a
biosafety cabinet (BSC).
57
Figure 1. N. meningitidis colonies on a BAP
Figure 2. N. meningitidis colonies on a CAP
58
Sterile site specimen
Inoculate BAP or CAP (e.g., CSF or blood) from suspect
case patient
Perform Gram stain on CSF for
Examination of growth on BAP clinical decision-making
or CAP shows round, moist,
glistening, and convex colonies
Kovac’s Oxidase Test Gram-negative Other morphology or

diplococci = staining characteristics
N. meningitidis = not N. meningitidis
Oxidase Oxidase Not N. meningitidis
Positive Negative
Perform cystine trypticase agar (CTA) sugar

testing for glucose, maltose, sucrose, and lactose
Acid production in glucose No acid production in

and maltose and not in glucose and maltose and/or
sucrose or lactose acid production in sucrose or Not N. meningitidis
= N. meningitidis lactose
Slide agglutination - Freeze isolates at -70oC in 10% skim milk and glycerol solution
serogrouping to determine - Perform additional testing as needed: antimicrobial susceptibility
capsular serogroup testing, characterization by molecular methods, etc.
Figure 3. Flow chart for identification and characterization of a N. meningitidis isolate
I. Kovac’s oxidase test
Kovac’s oxidase test determines the presence of cytochrome oxidase. Kovac’s oxidase reagent,
tetramethyl-p-phenylenediamine dihydrochloride, is turned into a purple compound by
organisms containing cytochrome c as part of their respiratory chain. This test aids in the
recognition of N. meningitidis, but other members of the genus Neisseria, as well as unrelated
bacterial species, may also give a positive reaction. Positive and negative quality control (QC)
strains should be tested along with the unknown isolates to ensure that the oxidase reagent is
working properly.
A. Preparation of 1% oxidase reagent from oxidase powder
To prevent deterioration of stock oxidase powder, the powder should be stored in a tightly sealed
desiccator and kept in a cool, dark area. Kovac’s oxidase reagent is intended only for in vitro
diagnostic use. Avoid contact with the eyes and skin as it can cause irritation. In case of
accidental contact, immediately flush eyes or skin with water for at least 15 minutes.
1. Prepare a 1.0% Kovac’s oxidase reagent by dissolving 0.1 g of tetramethyl-p-

phenylenediamine dihydrochloride into 10 ml of sterile distilled water.
59
2. Mix well and then let stand for 15 minutes.
 The solution should be made fresh daily and the unused portion should be discarded.
 Alternatively, the reagent could be dispensed into 1 ml aliquots and stored frozen at -20°C.
The aliquots should be removed from the freezer and thawed before use. Discard the
unused portion each day the reagent is thawed.
B. Performing Kovac’s oxidase test
Filter paper method
1. Grow the isolate(s) to be tested for 18-24 hours on a BAP at 35-37°C with ~5% CO2 (or in a
candle-jar).
2. On a nonporous surface (i.e., Petri dish or glass plate), wet a strip of filter paper with a few
drops of Kovac’s oxidase reagent.
3. Let the filter paper strip air dry before use.
4. Use a disposable plastic loop, a platinum inoculating loop, or a wooden applicator stick to
pick a portion of a colony from overnight growth on the BAP and rub it onto the treated filter
paper (Figure 4).
 Do not use a nichrome loop, as it may produce a false-positive reaction.
5. Observe the filter paper for color change to purple.
6. Perform steps 3 and 4 with a positive and negative QC strain to ensure that the oxidase
reagent is working properly.
60
Figure 4. Kovac’s oxidase test: a negative and positive reaction on filter paper
Plate method
candle-jar).
2. Dispense a few drops of Kovac’s oxidase reagent directly on top of a few suspicious colonies
growing on the 18-24 hour BAP.
 Do not flood the entire plate as the bacteria exposed to the reagent are usually not viable for
subculture.
3. Tilt the plate and observe colonies for a color change to purple.
C. Reading the oxidase test results
61
 Positive reactions will develop within 10 seconds in the form of a purple color where the
bacteria were applied to the treated filter paper. Delayed reactions are unlikely with N.
meningitidis.
 Negative reactions will not produce a color change on the treated filter paper.
II. Carbohydrate utilization by N. meningitidis: cystine trypticase agar (CTA) method
Carbohydrate utilization tests are used to validate the identification of a strain as N. meningitidis.
For this procedure, 4 different carbohydrates (glucose [also called dextrose], maltose, lactose,
and sucrose) are added to tubes containing a CTA base for a final concentration of 1%. A phenol
red indicator is also included in the medium. It is a sensitive indicator that develops a yellow
color in the presence of acid at a pH of 6.8 or less. A panel of four tubes, each containing a
different carbohydrate, is used to test each isolate. Neisseria spp. produce acid from
carbohydrates by oxidation, not fermentation. N. meningitidis oxidizes glucose and maltose, but
not lactose or sucrose. While it is extremely rare, strains of N. meningitidis have been reported
to either utilize glucose or maltose, but not both. Well-characterized QC strains should be tested
along with the unknown isolates to ensure that the CTA sugars are working properly. N.
meningitidis and/or N. lactamica isolates should be used to QC the CTA sugar media. Methods
for preparation of the CTA sugar media are included in the Annex. CTA sugars should be stored
at 4°C and warmed to room temperature (25°C) before use.
A. Performing CTA sugar testing
candle-jar).
2. Allow the 4 CTA sugars, glucose (also called dextrose), maltose, lactose, and sucrose, to
warm to room temperature (25°C) and label the tubes with the lab ID.
3. Remove 3-5 colonies from overnight growth on the BAP using a 1 µl disposable loop.
4. Stab the CTA sugar several times into the upper 10 mm of medium. Approximately 8 stabs
with the same loopful are sufficient.
 Use a separate disposable loop for inoculating each carbohydrate to be tested.
5. Fasten the screw-cap of each tube loosely and place the tubes in a 35-37°C incubator without
CO2. Incubate the CTA sugars for at least 72 hours (and up to 5 days) before discarding
them as negative.
6. Observe the CTA sugars for development of visible turbidity and color change to yellow.
7. Perform steps 1-5 using a N. meningitidis, N. lactamica, and a N. sicca QC strain to ensure
that the CTA sugars are working properly.
B. Reading the CTA sugar results
62
Development of visible turbidity and a yellow color in the upper portion of the medium indicates
growth of bacteria and production of acid and is interpreted as a positive test (Figure 5).
Although reactions may occur as early as 24 hours after inoculation, some reactions are delayed
and negative results should not be interpreted before 72 hours of incubation. A color change to
yellow without turbidity is usually not a positive reaction. Carbohydrate utilization results for
differentiating N. meningitidis from other Neisseria spp. and bacteria are listed in Table 1.
Figure 5. CTA sugar reactions for N. meningitidis with utilization of glucose (dextrose) and
maltose, indicated by acid production (color change to yellow), and no utilization of lactose or
sucrose
Table 1. Carbohydrate utilization by some Neisseria and Moraxella spp.
Acid Production from:

1
Organism Glucose Maltose Lactose Sucrose
Neisseria meningitidis + + - -
Neisseria lactamica + + + -
Neisseria gonorrhoeae +2 - - -
Neisseria sicca + + - +
Moraxella catarrhalis - - - -
1
Glucose may also be referred to as dextrose.
2
Some strains of N. gonorrhoeae are weak acid producers and may appear to be glucose
negative in the CTA medium.
63
III. Identification of N. meningitidis serogroup
Twelve serogroups, based on the biochemical composition of capsular polysaccharides, are

currently recognized: A, B, C, H, I, K, L, W135, X, Y, Z, and 29E (Z’). Serogroup D is no
longer recognized as a serogroup. Serogroups A, B, C, W135 and Y are the 5 most common
causes of bacterial meningitis. Serogroup A has been the most common cause of epidemics in
Africa and Asia. Serogroups C, W135, and X have also been reported as causes of epidemics in
several parts of Africa as well. Serogroup-specific antisera for these major serogroups are
available commercially.
It is not always practical to test for all serogroups for which antisera are available in a laboratory.
Testing algorithms may be set up in laboratories with previous knowledge of the predominance
or lack of serogroups within that particular geographic region in order to test for the most
common serogroups first. Modifications may be made to the testing algorithm for any laboratory
based on information about current strains that are circulating in the region. For example, in
Africa, testing with antisera for serogroups A and W135 (and X in some regions) as well as with
a saline control to detect nonspecific autoagglutination should be adequate to characterize most
case isolates. Strains reacting negatively with A, W135, and X antisera should then be tested
with other available antisera, particularly C, Y, and B. Nearly all case isolates are serogroupable,
if they are tested against a comprehensive panel of antisera and proper controls are used. In rare
instances, an isolate that does not react with any of the serogroup-specific antisera or reacts with
more than one serogroup-specific antisera is considered nongroupable (NG). Polyvalent antisera
containing combinations of serogroups (e.g., A, B, and C or X, Y, W135, and Z) may also be
used.
It is essential that reference laboratories have the capacity to isolate, identify, and characterize
the serogroup of isolates of N. meningitidis. This valuable data provides laboratories and public
health authorities with the tools to identify outbreaks controllable by vaccination campaigns,
recognize serogroups causing sporadic disease, and detect emergence of new outbreak strains.
A. Slide agglutination serogrouping (SASG) test for serogrouping N. meningitidis isolates
Formalin-killed meningococcal suspensions should be used for SASG testing rather than saline
suspensions of living organisms to maintain a safe working environment. A solution of 5%
formalinized physiological saline is sufficient to kill the bacteria. However, formalin is a
carcinogen and must be stored and handled with great care. Alternatively, work should be
performed under a biosafety hood if formalin is not used. Antisera should be stored in the
refrigerator at 4°C and warmed to room temperature (25°C) before use. It must be put back in
the refrigerator as soon as testing is finished to prevent the loss of binding activity of the
antibody.
B. Performing the SASG test
candle-jar).
64
2. Clean a glass slide with alcohol (optional if slides are pre-cleaned).
3. Divide the slide into equal sections (e.g., twelve 11 X 22 mm sections on a standard 50 X 75
mm slide) with a liquid impermeable pen or a wax pencil.
 Each isolate will require as many sections on the slide as the individual serogroup-specific
antisera that will be tested as well as a saline negative control.
4. In the lower portion of each of the sections of the glass slide described in step (2), add 10 µl
of the 5% formalinized saline with a micropipettor.
 The instructions specify using a micropipettor with sterilized filtered tips to measure the 10
l of the 5% formalinized saline to suspend the bacteria. The micropipettor will transfer
precise and equal measurements for a proper SASG reaction.
 If a micropipettor and tips are not available, sterile, disposable 10 l inoculation loops can
be used to transfer 10 l of the 5% formalinized saline, but often do not deliver accurate
amounts (between 5-10 l).
5. Use a sterile, disposable 10 l inoculating loop to collect a few colonies from the surface of
the overnight culture incubated on the BAP.
6. Suspend the bacteria in the 5% formalinized saline solution in the lower portion of each of
the sections of the slide. The suspension should be moderately opaque (see saline control in
Figure 6). Do not allow the cell suspension to dry before adding the antisera.
 If the bacteria are difficult to suspend directly on the slide, make a moderately milky
suspension (comparable to McFarland 6 standard) of the test culture in a small vial with
250 l of 5% formalinized saline and briefly vortex the suspension to mix and break up any
pellets. Add 10 l of this suspension to the lower portion of the slide.
7. In the upper portion of each of the sections of the glass slide described in step (2), add 10 μl
of the serogroup-specific antisera to be tested as well as unformalinized saline or phosphate
buffered saline (PBS) for a negative control with a micropipettor.
 DO NOT use the dropper provided with the antisera because it usually delivers larger
amounts than is necessary and can easily be contaminated.
be used to transfer 10 l of the antisera, but often do not deliver accurate amounts (between
5-10 l).
 Dispose of the tip or loop used to transfer the antisera to the slide in a waste container after
each use to avoid contamination of the antisera. If the source of antisera is contaminated, a
new vial must be used.
65
8. Gently tilt the slide to mix the cell suspensions with the antisera in each section. Continue to
gently rock the slide for 1 to 2 minutes to allow the lower and upper portions to completely
blend. Do not use a circular motion while rocking, as it can cause the sections with different
serogroup-specific antisera to run together and contaminate each other.
9. After 2 minutes, examine the SASG reactions under a bright light and over a black
background. Use the rating system in Figure 6 to determine the intensity of the agglutination
reaction in each section of the slide. Disregard any agglutination that occurs after the 2
minute time period.
10. Record the SASG results in the laboratory log book.
C. Reading the SASG results
1. Rating the intensity of the agglutination reaction
Agglutination occurs when the antisera bind to the bacterial cells causing the cells to agglutinate
or clump together, thus making the cell suspension appear clearer. The intensity of the
agglutination reaction may vary according to the density of the cell suspension or the antisera
used. A description on the intensity ratings shown in Figure 6 are listed below.
4+ All of the cells agglutinate and the cell suspension appears clear
3+ 75% of the cells agglutinate and the cell suspension remains slightly cloudy
+/- Less than 25% of the cells agglutinate and a fine granular matter occurs
0 No visible agglutination; the suspension remains cloudy and smooth
Figure 6. Rating the intensity of the agglutination reaction
2. Determining the serogroup
 A positive result is designated by a 3+ or 4+ (strong agglutination) within 1-2 minutes,

except for serogroup B, which is considered positive with a rating of 2+ or greater.
66
 A negative result is designated by a 0 (saline), +/-, 1+ or 2+ (weak agglutination).
 The serogroup is determined when a positive result occurs with only one of the antisera and
not with the saline.
 If a serogroup is not determined, the isolate is considered NG. The following result
combinations are all reported as NG:
o Agglutination in the saline, regardless of strong reactions with other antisera,

characterizes the culture as autoagglutinating.
o Agglutination with more than one serogroup-specific antisera in the absence of

agglutination in saline characterizes the culture as polyagglutinating or cross-reactive.
o No agglutination with any of the antisera or the saline characterizes the strain as non-
reactive.
D. Troubleshooting procedures
N. meningitidis isolates are subject to variability (encapsulated vs. unencapsulated, small vs.
large colonies, slow growers vs. fast growers, and heavy agglutinators vs. light agglutinators)
and may be unclear or difficult to interpret. Some troubleshooting procedures are listed below:
1. Repeat the test directly on the slide using growth from another section of the same plate.
2. Make a cell suspension in a small tube and vortex if the result from SASG directly on the
slide is unclear and repeat the test.
3. Add 20 µl of antisera directly to slide and then add a loop full of organism without diluting
the specimen with 5% formalinized saline.
4. Subculture and retest fresh growth the following day.
5. If the original plate contains different size colonies, make a subculture for each type of
colony and test both cultures the next day. The larger colonies usually indicate better capsule
production and therefore better reactivity. However, the smaller colonies will occasionally
give a better result.
 If discrepancies are not immediately resolved, any subsequent SASG repeats should be
used in conjunction with control strains.
E. Quality control (QC) of antisera for SASG testing
A set of reference strains for N. meningitidis serogroups A, B, C, W135, X, Y, Z, 29E (one per
serogroup) and a nongroupable N. meningitidis strain should be used to QC the antisera before
testing any unknown isolates. QC of the antisera should be:
67
 Performed for each new lot of antisera received in the laboratory.
 Performed biannually after initial QC testing.
 Repeated if a vial has been exposed to temperatures above 4oC or if there is reason to suspect
that the vial has been contaminated since the initial QC was performed.
Follow the SASG testing procedure to QC each lot of antisera using all reference strains
available in the laboratory. Record the results provided on the example QC sheet in Figure 7.
Reading the QC test results
Passing test:
 The antiserum must give 3+ or 4+ agglutination with homologous antigens within 1-2
minutes.
 The antiserum must not react with heterologous N. meningitidis serogroups, with the NG
reference strain, or in saline.
Failing test:
 The antiserum agglutinates with one or more reference strains and/or with the NG reference
strain and/or in saline.
68
A B C W135 X Y Z 29E (Z’) NG
(strain (strain (strain (strain (strain (strain (strain (strain (strain
number) number) number) number) number) number) number) number) number)
A ++++ - - - - - - - -
Lot#
B
- ++++ - - - - - - -
Lot#
C
- - ++++ - - - - - -
Lot#
W135
- - - ++++ - - - - -
Lot#
X
- - - - ++++ - - - -
Lot#
Y
- - - - - ++++ - - -
Lot#
Z
- - - - - - ++++ - -
Lot#
29E
- - - - - - - ++++ -
Lot#
Saline - - - - - - - - -
Figure 7. Example QC sheet for testing antisera against all N. meningitidis serogroups
IV. Commercial identification kits
Several commercial identification systems that use biochemical or enzymatic substrates are
available for identification of Neisseria spp. These systems may occasionally require
supplemental tests, and additional characteristics, such as microscopic and colony morphology,
must be considered. Generally, each system is self-contained, but the addition of one or more
reagents to complete certain reactions may be necessary. The manufacturer’s instructions should
be followed precisely when using these kits. For detailed instructions and use of appropriate
control strains, consult the Clinical Microbiology Procedures Handbook (2).
V. Serotyping and serosubtyping of N. meningitidis with monoclonal antibodies (Mabs)
Differentiation and classification of bacterial strains at the sub-species level require methods that
are highly reproducible, little affected by the experimental conditions, and give effective
discrimination of epidemiologically unrelated strains. Further characterization of bacteria
causing meningitis is especially important to document the spread of particularly pathogenic
clones. Many immunoassays have been developed for serological characterization of
69
N. meningitidis antigens. Immunological detection of specific epitopes of two major outer-
membrane proteins, PorB and PorA, is the basis for the serological classification system
defining, respectively, the serotypes and serosubtypes of the species 1, 3-7). A simple, low cost
method for serotyping and serosubtyping meningococci, dot-blotting with Mabs, is described
below.
A. Preparation of whole-cell suspensions
 Whole-cell suspensions should not be used for PCR testing.
1. Grow the N. meningitidis isolate to be tested along with an appropriate reference isolate for
QC on a BAP for 18-24 hours at 35-37°C with ~5% CO2 (or in a candle-jar).
2. Collect 3-5 colonies using a sterile disposable loop or sterile swab and suspend in 1 ml of
PBS (pH=7.2) with 0.02% sodium-azide.
3. Inactivate the bacteria by heating the suspension at 60C for 30 minutes.
4. Adjust the optical density with PBS to 0.2 measured at 650 nm (equivalent to a McFarland
1.5).
5. Maintain whole-cell suspensions at 4C until use.
B. Performing the dot-blotting serotyping/serosubtyping test
1. Cut strips (0.5 x 10 cm) of nitrocellulose paper (pore 0.45 m). Divide each strip into 10
sections of 1 cm in length using a wax pencil and align them on a glass or hard plastic plate.
 Use gloves and/or forceps when handling nitrocellulose paper.
2. Label the strips with a permanent pen on the left section.
3. Dot 2 l of the whole-cell suspension of a relevant reference isolate in the middle of the next
marked section and 2 l of the test isolates successively onto each of the next sections, as
shown in Figure 8.
4. Dry the strips for 15 minutes or more.
5. Add 2 ml of the blocking buffer (PBS supplemented with 3% bovine serum albumin [BSA])
into each well of an 8-well incubation tray (8-well trays with lids are commercially
available).
6. Transfer the strips to be tested with the same Mab to a well (maximum 4 strips per well).
Mix gently for 30 minutes. The strips must be fully wetted by the blocking buffer.
70
 The minimum incubation volume of the blocking buffer for 1 strip is 0.5 ml. Up to 4 strips
with about 40 dotted samples can be in incubated in a total volume of 2 ml. Consider
leaving an empty well in the incubation trays between each set of strips that are incubated
with different Mabs.
7. Add the Mabs to the respective wells. Depending on the supplier of the Mab, the final
dilution may range from 1:10 to 1:500,000.
8. Place the lid on the incubation tray and incubate with gentle mixing overnight.
9. Carefully remove the antibody solutions from the strips using a pipet tip connected to a
suction pump or similar device. Rinse the tip with water between each set of strips that were
incubated with different Mabs to prevent transfer of the Mabs.
10. Rinse the strips 3 times with no more than 2 ml PBS directly in the wells. Remove the PBS
in the same manner in which the antibody solutions were removed.
11. Add 2 ml of PBS supplemented with 3% BSA with horseradish peroxidase-labelled rabbit
anti-mouse antibody (typically used at a 1:2,000 dilution) and incubate for 2 hours with
gentle mixing. Be sure that the strips are fully wetted.
12. Rinse the strips in 2 ml of PBS for 5 minutes twice as in step 9.
13. Wash the strips for several minutes in 0.05 M sodium acetate buffer, pH 5.0, and then discard
the solution.
14. Put the strips in a plastic box and add 10 ml of sodium acetate buffer with 0.4 ml of 3-amino-
9-ethylcarbazole (AEC) in dimethylformamide (DMF). Mix for 2-3 minutes.
15. Add 10 l of H2O2 at 30% and stain each dot until distinct red dots are observed for the
reference isolate (2-10 minutes).
Mab 1 Ref. A Isol. 1 Isol. 2 Isol. 3 Isol. 4 Isol. 5 Isol. 6 Isol. 7 Isol. 8
Mab 2 Ref. B Isol. 1 Isol. 2 Isol. 3 Isol. 4 Isol. 5 Isol. 6 Isol. 7 Isol. 8
Mab 3 Ref. C Isol. 1 Isol. 2 Isol. 3 Isol. 4 Isol. 5 Isol. 6 Isol. 7 Isol. 8
Mab 4 Ref. D Isol. 1 Isol. 2 Isol. 3 Isol. 4 Isol. 5 Isol. 6 Isol. 7 Isol. 8
Figure 8. Example of nitrocellulose paper strip for applying whole-cell suspensions
C. Reading the dot-blotting serotyping/serosubtyping test results
1. Rinse the strips under running water, align them on a glass plate, and absorb the excess water
with filter paper or tilt the plate slightly to dry the strips at room temperature (25°C).
2. Grade the staining intensity of each dot (positive, weak, or negative) visually relative to the
reference strain.
71
3. When dried, the strips can be taped onto a sheet of paper and kept in a plastic pocket
protected from light.
References
1. Arhin, F. F., F. Moreau, J. W. Coulton, and E. L. Mills. 1997. Outer membrane

proteins and serosubtyping with outer membrane vesicles from clinical isolates of
Neisseria meningitidis. Current Microbiology 34:18-22.
2. Clinical Microbiology Procedures Handbook, 3rd edition. 2010. ASM. Washington, D.C.
2,540 pages.
3. Frasch, C. E., W. D. Zollinger, and J. T. Poolman. 1985. Serotype antigens of
Neisseria meningitidis and a proposed scheme for designation of serotypes. Rev Infect
Dis 7:504-510.
4. Poolman, J. T., P. Kriz-Kuzemenska, F. Ashton, W. Bibb, Dankert J, Demina A, L.
O. Froholm, M. Hassan-King, D. M. Jones, and I. Lind. 1995. Serotypes and subtypes
of Neisseria meningitidis: results of an international study comparing sensitivities and
specificities of monoclonal antibodies. Clinical & Diagnostic Laboratory Immunology
2:69-72.
5. Sacchi, C. T., A. P. Lemos, M. E. Brandt, A. M. Whitney, C. E. Melles, C. A. Solari,
C. E. Frasch, and L. W. Mayer. 1998. Proposed standardization of Neisseria
meningitidis PorA variable-region typing nomenclature. Clinical & Diagnostic
Laboratory Immunology 5:845-855.
6. Sacchi, C. T., A. P. Lemos, A. M. Whitney, C. A. Solari, M. E. Brandt, C. E. Melles,
C. E. Frasch, and L. W. Mayer. 1998. Correlation between serological and sequencing
analyses of the PorB outer membrane protein in the Neisseria meningitidis serotyping
system. Clinical & Diagnostic Laboratory Immunology 5:348-354.
7. Swaminathan, B., G. M. Matar, M. W. Reeves, L. M. Graves, G. W. Ajello, W. F.
Bibb, L. O. Helsel, M. Morales, H. Dronavalli, M. el-Swify, W. DeWitt, and S. B.
Hunter. 1996. Molecular subtyping of Neisseria meningitidis serogroup B: comparison
of five methods. Journal of Clinical Microbiology 34:1468-1473.
72
CHAPTER 8
Identification and Characterization of Streptococcus pneumoniae
S. pneumoniae may occur intracellularly or extracellularly as gram-positive lanceolate

diplococci, but can also occur as single cocci or in short chains of cocci. S. pneumoniae is a
fastidious bacterium, growing best at 35-37°C with ~5% CO2 (or in a candle-jar). It is usually
cultured on media that contain blood, but can also grow on a chocolate agar plate (CAP). On a
blood agar plate (BAP), colonies of S. pneumoniae appear as small, grey, moist (sometimes
mucoidal), colonies and characteristically produce a zone of alpha-hemolysis (green) (Figure 1).
The alpha-hemolytic property differentiates this organism from many species, but not from the
commensal alpha-hemolytic (viridans) streptococci. Differentiating pneumococci from viridans
streptococci is difficult as young pneumococcal colonies appear raised, similar to viridans
streptococci. However, once the pneumococcal culture ages 24-48 hours, the colonies become
flattened, and the central portion becomes depressed, which does not occur with viridans
streptococci (Figure 2). A microscope (30-50X) or a 3X hand lens can also be a useful tool in
differentiating pneumococci from viridans streptococci. Prior to identification and
characterization testing procedures, isolates should always be inspected for purity of growth and
a single colony should be re-streaked, when necessary, to obtain a pure culture. For the
following identification and characterization procedures, it is essential to test alpha-hemolytic
colonies that are less than a day old, typically grown overnight at 35-37°C with ~5% CO2 (or in a
candle-jar).
The following specialized tests are used to identify colonies on a BAP that resemble
pneumococci (Figure 3). S. pneumoniae can be identified using Gram stain, catalase, and
optochin tests simultaneously, with bile solubility as a confirmatory test. If these tests indicate
that the isolate is S. pneumoniae, serological tests to identify the serotype can be performed.
This sequence of testing is an efficient way to save costly serotyping reagents and time.
Additional methods for identification and characterization of S. pneumoniae using molecular
tools are described in Chapter 10: PCR Methods and Chapter 12: Molecular Methods.
Additional protocols used for streptococcal species identification and updates to existing
methods can be found at: http://www.cdc.gov/ncidod/biotech/strep/strep-doc/index.htm.
Biosafety Level 2 (BSL-2) practices are required for work involving isolates of S. pneumoniae,
as this organism presents a potential hazard to laboratory personnel and the surrounding working
73
Figure 1. S. pneumoniae colonies with a surrounding green zone of alpha-hemolysis (black
arrow) on a BAP
Figure 2. S. pneumoniae colonies have a flattened and depressed center after 24-48 hours of
growth on a BAP, whereas the viridans streptococci retain a raised center
74
Specimen (CSF/blood)
Plate on blood agar
All 3 tests must be performed in parallel

Identify alpha-hemolytic colonies
Gram stain Catalase test Optochin test
Identify gram-positive Catalase negative Optochin susceptible Optochin resistant

diplococci or gram- (≥14 mm diameter) (<14 mm diameter)
positive cocci in short
chains
Identify as probable Report as S. Bile solubility test
Streptococcus spp. from Gram pneumoniae
stain and catalase result (assuming it is
Gram-positive, Bile soluble Bile insoluble
catalase-negative)
Report as S. -hemolytic
pneumoniae streptococci other
than S. pneumoniae
Determine serotype
75
Figure 3. Flow chart for identification and characterization of a S. pneumoniae isolate
I. Catalase test
Catalase is the enzyme that breaks down hydrogen peroxide (H2O2) into H2O and O2. The
oxygen is given off as bubbles in the liquid. The catalase test is primarily used to differentiate
between gram-positive cocci. Members of the genus Staphylococcus are catalase-positive, and
members of the genera Streptococcus and Enterococcus are catalase-negative.
A. Performing the catalase test
candle-jar).
2. From overnight growth on the BAP, use a disposable loop to carefully remove a colony and
place it on a glass slide.
 Do not transfer any of the blood agar to the slide as erythrocytes in the blood agar will
cause a false-positive reaction.
3. Add 1.0 ml of 3% H2O2 to the slide and mix with the bacteria.
 H2O2 can be obtained from a commercial drug store.
 After initially opening, store H2O2 at 4°C in a tightly closed bottle as it will slowly lose
potency once opened.
4. Observe the bacterial suspension on the slide immediately for vigorous bubbling.
5. It is essential to use a known positive and negative quality control (QC) strain. A
Staphylococcus spp. strain can be used for a positive control and a known S. pneumoniae
strain or any other streptococcal spp., i.e., S. pyogenes can be used for a negative control.
B. Reading the catalase test results
 The absence of bubbling from a transferred colony indicates a negative test.
 Any bubbling from a transferred colony indicates a positive test (Figure 4).
C. Troubleshooting
 False positives will result from transfer of red blood cells so take care when picking
colonies from the BAP for this test.
D. Quality control
76
 It is essential to use a known positive and negative QC strain as described in the procedure.
Opened bottles should be checked against a known catalase positive organism every 6
months.
Figure 4. Negative and positive catalase test results. The absence of bubbling from a
transferred colony indicates a negative test. All streptococci are catalase-negative.
II. Optochin test
S. pneumoniae strains are sensitive to the chemical optochin (ethylhydrocupreine hydrochloride).

Optochin sensitivity allows for the presumptive identification of alpha-hemolytic streptococci as
S. pneumoniae, although some pneumococcal strains are optochin-resistant. Other alpha-
hemolytic streptococcal species are optochin-resistant.
A. Performing the optochin test
Optochin (P) disks (6 mm, 5 µg) can be obtained from a commercial vendor. Optochin disks are
often called “P disks” and many commercial versions are labeled with a capital “P”. If a
commercial source of P disks is not available, a 1:4000 solution of ethylhydrocupreine
hydrochloride can be applied to sterile 6 mm filter paper disks.
1. Grow the strain(s) to be tested for 18-24 hours on a BAP at 35-37°C with ~5% CO2 (or in a
candle-jar).
2. Use a disposable loop to remove an isolated colony from the overnight culture on the BAP
and streak onto one half of a BAP.
77
 Two different isolates can be tested on the same plate, but care must be taken to ensure that
the cultures do not overlap.
3. Place a P disk within the streaked area of the plate and incubate the BAP overnight at 35-
37°C with ~5% CO2 (or in a candle-jar).
4. Observe the growth on the BAP near the P disk and measure the zone of inhibition, if
applicable.
B. Reading the optochin test results
 Using a 6 mm, 5 µg disk, a zone of inhibition of 14 mm or greater indicates sensitivity and

allows for presumptive identification of pneumococci (Figure 5).
 Zones of inhibition should be measured from the top surface of the plate with the top
removed.
 Use either calipers or a ruler with a handle attached for these measurements. Measure the
diameter of the zone holding the ruler over the center of the surface of the disk when
measuring the zone of inhibition. In the case of an isolate completely resistant to optochin,
the diameter of the disk (6 mm) should be recorded.
C. Troubleshooting
 A smaller zone of inhibition (< 14 mm) or no zone of inhibition indicates that the bile
solubility test is required. It is important to remember that pneumococci are sometimes
optochin-resistant.
D. Quality control
 Each new lot of optochin disks should be tested with positive and negative controls. The
growth of S. pneumoniae strain ATCC 49619 is inhibited by optochin and growth of S.
mitis strain ATCC 49456 is not inhibited by optochin.
78
Figure 5. Optochin test for S. pneumoniae using optochin disks. The strain on the left is S. mitis
and is resistant to optochin with no zone of inhibition. The strain on the right is susceptible to
optochin and is S. pneumoniae.
III. Bile solubility test
The bile (sodium deoxycholate) solubility test distinguishes S. pneumoniae from all other alpha-
hemolytic streptococci. S. pneumoniae is bile soluble whereas all other alpha-hemolytic
streptococci are bile resistant. Sodium deoxycholate (2% in water) will lyse the pneumococcal
cell wall.
A. Preparation of 2% sodium deoxycholate (bile salt) solution
1. Dissolve 2 g of sodium deoxycholate into 100 ml sterile distilled water.
B. Performing the bile solubility test
79
candle-jar).
2. Add bacterial growth from the overnight BAP to 1.0 ml of 0.85% saline to achieve turbidity
in the range of a 0.5-1.0 McFarland standard.
3. Divide the cell suspension equally into 2 tubes (0.5 ml per tube).
4. Add 0.5 ml of 2% sodium deoxycholate (bile salts) to one tube. Add 0.5 ml of 0.85% saline
to the other tube. Mix each tube well.
5. Incubate the tubes at 35-37°C in CO2.
6. Vortex the tubes.
7. Observe the tubes for any clearing of turbidity after 10 minutes. Continue to incubate the
tubes for up to 2 hours at 35-37C in CO2 if negative after 10 minutes. Observe again for
clearing.
C. Reading the bile solubility test results
 A clearing of the turbidity in the bile tube but not in the saline control tube indicates a
positive test (Figure 6).
D. Troubleshooting
 Partial clearing (partial solubility) is not considered positive for pneumococcal

identification. Partially soluble strains that have optochin zones of inhibition of less than
14 mm are not considered pneumococci.
E. Quality control
 Each new lot of sodium deoxycholate should be tested with positive and negative QC
strains. S. pneumoniae strain ATCC 49619 can be used as a positive control and S. mitis
strain ATCC 49456 can be used as a negative control.
80
Figure 6. Results of the bile solubility test are shown for two different strains of bacteria. For
strain 1, a slight decrease in turbidity is observed in the tube containing the bile salts (2nd from
left), but the contents are almost as turbid as the control tube (far left); therefore, strain 1 is not S.
pneumoniae. For strain 2, all turbidity in the tube containing the bile salts (far right) has cleared,
indicating that the cells have lysed, in contrast to the control tube (2nd from right), which remains
turbid; therefore, strain 2 is S. pneumoniae.
IV. Commercial test kits for identification
Several commercial identification systems that use slide agglutination tests are available for
identification of colony growth from a BAP as S. pneumoniae. These identification tests use
suspensions of latex beads with rabbit antibody specific for S. pneumoniae capsular antigens.
Visible agglutination occurs when the S. pneumoniae capsular antigen reacts with the antibody-
coated latex beads. The manufacturer’s instructions should be followed precisely when using
these kits. These kits should be regularly subjected to QC using a non-pneumococcal
streptococcal species, since they can become cross-reactive with prolonged storage.
V. Determining S. pneumoniae capsular serotypes using serologic methods
Although serotyping of pneumococci is not usually necessary for a clinical response, capsular
serotype determination is a critical component of successful pneumococcal disease surveillance
efforts. Effective current multivalent vaccines target combinations of key serotypes.
Determination of serotype distributions associated with disease in certain regions provides
81
information regarding the potential usefulness of applying existing vaccines and is also critical
for assessing vaccine impact.
Serotype distribution can be determined by culture of the organism followed by serological

determination of the capsular type by latex agglutination and the quellung reaction. Many
laboratories have opted to use simpler and less expensive methods of deducing capsular
serotypes through the use of specific PCR reactions (see Chapter 10: PCR Methods and
http://www.cdc.gov/ncidod/biotech/strep/pcr.htm for specific PCR protocols).
A. Latex agglutination
The standard quellung reaction test for serotyping pneumococci can be labor-intensive and time-
consuming, and requires a certain level of experience to be performed competently. An
agglutination method using anti-rabbit IgG-coated latex particles sensitized to pooled and select
individual serotype-specific antisera (PCV7 serotypes: 4, 6B, 9V, 14, 18C, 19F, 23F) for
serogrouping/serotyping S. pneumoniae has been developed and kits are commercially available.
The latex agglutination method is simpler and faster than the quellung reaction, but is only
intended for partial serotyping as it can only narrow the identification down to a group or pool of
serotypes. Then the quellung reaction should be performed using individual serotype-specific
antisera for each serotype in the group or pool to identify the serotype.
Performing latex agglutination testing
candle-jar).
2. From overnight growth on a BAP, use a sterile loop to prepare a light to moderate cell
suspension (approximately equal to a 0.5 McFarland density standard) in 0.5 ml of 0.85%
saline.
3. On a glass slide or reaction card, add 10 µl (1 droplet) of the latex reagent and 10 µl of the
cell suspension. Mix the two suspensions together.
4. After 10-30 seconds, observe the latex agglutination reaction at an angle with oblique
lighting.
Reading the latex agglutination results
 A positive reaction is indicated by agglutination (cells clumping together) appearing within 5-

10 seconds.
 A negative reaction is indicated by no agglutination appearing within 5-10 seconds.
Troubleshooting
82
 The latex agglutination reaction should be examined within 5-10 seconds. If the reaction time
exceeds 30 seconds, false positive reactions may occur.
Quality control
 Each lot of latex suspension should be tested for positive agglutination reactions using S.
pneumoniae reference strains with known capsular serotypes.
B. Quellung reaction
For proper quellung-based serotyping, a high quality microscope is required. A positive

quellung or Neufeld reaction is the result of the binding of the capsular polysaccharide of
pneumococci with type specific antibody contained in the typing antiserum. Pneumococcal
typing sera are commercially available as pooled, group, or serotype-specific (see
http://www.ssi.dk/English.aspx). It is recommended to initially test with pooled antisera in
succession until a positive reaction is observed. Typing should then proceed by testing with
individual group and serotype-specific antisera included in the antisera pool that gave a positive
reaction to determine the serogroup and serotype. An antigen-antibody reaction causes a change
in the refractive index of the capsule so that it appears “swollen” and more visible. After the
addition of a counter stain (methylene blue), the pneumococcal cells stain dark blue and are
surrounded by a sharply demarcated halo which represents the outer edge of the capsule. The
light transmitted through the capsule appears brighter than either the pneumococcal cell or the
background. Single cells, pairs, chains, and even clumps of cells may have positive quellung
reactions.
Performing the quellung reaction
candle-jar).
2. From overnight growth on the BAP, use a sterile loop to prepare a light to moderate cell
suspension (approximately equal to a 0.5 McFarland density standard) in 0.5 ml of 0.85%
saline.
 Optimum quellung reactions can be observed when there are 25-50 cells visible in a
microscopic field at 1000X magnification.
3. Dispense equal amounts of antiserum (5 µl) and methylene blue (5 µl) onto a microscope
slide. Add approximately 0.2-1.0 µl of the diluted cell suspension and mix all three with a
pipette tip.
4. Cover the suspension with a 22 mm2 square cover-slip and incubate at room temperature
(25°C) for 10-15 minutes.
 Do not allow the fluid on the slide to dry.
83
5. Examine the slide at 1000X using an oil immersion lens.
6. Begin testing with pooled antisera. Once a positive reaction is obtained, proceed with
individual group and serotype-specific antisera included in the pooled antisera that gave the
positive reaction to determine the serogroup and serotype.
Reading the quellung reaction results
 A positive quellung reaction is observed when the capsule appears as a sharply demarcated
halo around the dark blue stained cell (Figure 7).
 A negative quelling reaction is observed when there is no appearance of a clear, enlarged halo
surrounding the stained cell.
Troubleshooting
 In some instances, observing a positive reaction can be difficult. Prepare and read all quellung
reactions on the same day that the cell suspension is prepared.
 When reading the reactions, look for free floating single or paired cells.
 Agglutination (cells clumping together) is NOT a positive quellung reaction.
 If a quellung reaction is not observed in any of the antisera pools, the strain may be non-
typeable, but identification of the strain as S. pneumoniae should be confirmed by optochin
susceptibility and bile solubility testing.
Quality control
 Each lot of antisera received should be tested for positive quellung reactions using S.
pneumoniae reference strains with known capsular serotypes.
84
Figure 7. In a positive quellung reaction, the capsule appears as an enlarged clear halo
surrounding the dark blue stained cell
VI. Determining S. pneumoniae capsular serotypes using PCR-based methods
The high cost of antisera, subjectivity in interpretation, and technical expertise requirements
associated with these serologic methods have resulted in the development of PCR-based
serotyping systems. PCR-based serotyping has the potential to overcome some of the difficulties
associated with serologic testing and assays for direct detection of serotypes from clinical
specimens are a valuable aid in surveillance, particularly in situations where culture is
insensitive.
Conventional PCR-based methods have been developed to determine the serotypes of S.

pneumoniae specimens. Conventional multiplex PCR assays are available for detecting 40 of the
93 S. pneumoniae serotypes. Schemes for testing based on the strains that are historically and/or
currently circulating in specific regions are listed in Chapter 10: PCR Methods. Published real-
time PCR serotyping assays are also available for many common pneumococcal serotypes.
VII. General methods for genotyping S. pneumoniae
The continued study of the “seroepidemiology” of pneumococcal disease and carriage isolates is
important for understanding selective effects upon regional population structures of this species.
Trends in pneumococcal carriage and disease epidemiology are influenced by selective factors in
the environment, such as the use of antimicrobial drugs and the introduction of conjugate
85
vaccines. Understanding questions related to long-term effects of such pressures on the
pneumococcal population require precise isolate characterization using molecular methods to
characterize the strains at the genetic level. Chapter 12: Molecular Methods describes some of
the most common typing methodologies used to differentiate S. pneumoniae and includes pulsed-
field gel electrophoresis (PFGE), multilocus sequence typing (MLST) and the use of more
variable loci such as the penicillin binding protein (pbp) genes and the pneumococcal surface
protein (pspA) gene.
86
CHAPTER 9
Identification and Characterization of Haemophilus influenzae
H. influenzae are small, pleomorphic, gram-negative bacilli or coccobacilli with random

arrangements. H. influenzae is a fastidious organism which grows best at 35-37°C with ~5%
CO2 (or in a candle-jar) and requires hemin (X factor) and nicotinamide-adenine-dinucleotide
(NAD, also known as V factor) for growth. The standard medium used for growth of H.
influenzae is a chocolate agar plate (CAP), which can be prepared with heat-lysed horse blood, a
good source of both hemin and NAD, although sheep blood can also be used. Growth occurs on
a CAP because NAD is released from the blood during the heating process of chocolate agar
preparation (the heating process also inactivates growth inhibitors) and hemin is available from
non-hemolyzed as well as hemolyzed blood cells. Alternatively, NAD can be included as a
component of liquid H. influenzae growth media supplements, (available commercially or
prepared in the laboratory), which are incorporated into the chocolate agar. H. influenzae appear
as large, round, smooth, convex, colorless-to-grey, opaque colonies on a CAP (Figure 1).
Encapsulated strains appear more mucoidal than non-encapsulated strains, which appear as
smaller, compact grey colonies. No hemolysis or discoloration of the CAP is apparent. While
H. influenzae produce a pungent indol smell, plates should not be opened in order to smell the
cultures. H. influenzae cannot grow on an unsupplemented BAP. Prior to identification and
characterization testing procedures, isolates should always be inspected for purity of growth and
a single colony should be re-streaked, when necessary, to obtain a pure culture. For the
following identification and characterization procedures, testing should be performed on 18-24
hour growth from a CAP at 35-37°C with ~5% CO2 (or in a candle-jar) (Figure 2).
The following tests are recommended to confirm the identity of cultures that morphologically
appear to be H. influenzae (Figure 3). H. influenzae can be identified using Kovac’s oxidase test
and determining the necessity of hemin and NAD as growth requirements. If the oxidase test is
positive, hemin and NAD growth factor requirement testing should be performed. If the growth
factor requirement test indicates that the isolate may be H. influenzae, serological tests to identify
the serotype should be performed. This sequence of testing is an efficient way to save costly
antisera and time. Additional methods for identification and characterization of H. influenzae
using molecular tools are described in Chapter 10: PCR Methods and Chapter 12: Molecular
Methods
Biosafety Level 2 (BSL-2) practices are required for work involving isolates of H. influenzae, as
this organism presents a potential hazard to laboratory personnel and the surrounding working
87
88
Sterile site specimen
Inoculate CAP (e.g., CSF or blood) from suspect
case patient
Perform Gram stain on CSF for
Examination of growth on CAP clinical decision-making
shows large, round, colorless-
to-grey, opaque colonies
Kovac’s Oxidase Test Gram-negative Other morphology or

coccobacilli = staining characteristics
H. influenzae = not H. influenzae
Oxidase Oxidase Not H. influenzae
Positive Negative
Perform growth factor requirement testing for

hemin (X factor) and NAD (V factor)
Requires both hemin (X Does not require both

factor) and NAD (V factor) hemin (X factor) and
for growth NAD (V factor) for Not H. influenzae
= H. influenzae growth
Slide agglutination - Freeze isolates at -70oC in 10% skim milk and glycerol solution
serotyping to determine - Perform additional testing as needed: antimicrobial susceptibility
capsular serotype testing, characterization by molecular methods, etc.
Figure 3. Flow chart for identification and characterization of a H. influenzae isolate
VI. Kovac’s oxidase test
Kovac’s oxidase test determines the presence of cytochrome oxidase. Kovac’s oxidase reagent,
tetramethyl-p-phenylenediamine dihydrochloride, is turned into a purple compound by
organisms containing cytochrome c as part of their respiratory chain. This test aids in the
recognition of H. influenzae, but other members of the genus Haemophilus, as well as unrelated
bacterial species, may also give a positive reaction. Positive and negative quality control (QC)
strains should be tested along with the unknown isolates to ensure that the oxidase reagent is
working properly.
D. Preparation of 1% oxidase reagent from oxidase powder
To prevent deterioration of stock oxidase powder, the powder should be stored in a tightly sealed
desiccator and kept in a cool, dark area. Kovac’s oxidase reagent is intended only for in vitro
diagnostic use. Avoid contact with the eyes and skin as it can cause irritation. In case of
accidental contact, immediately flush eyes or skin with water for at least 15 minutes.
1. Prepare a 1.0% Kovac’s oxidase reagent by dissolving 0.1 g of tetramethyl-p-

phenylenediamine dihydrochloride into 10 ml of sterile distilled water.
2. Mix well and then let stand for 15 minutes.
89
 The solution should be made fresh daily and the unused portion should be discarded.
 Alternatively, the reagent could be dispensed into 1 ml aliquots and stored frozen at -20°C.
The aliquots should be removed from the freezer and thawed before use. Discard the
unused portion each day the reagent is thawed.
E. Performing Kovac’s oxidase test
Filter paper method
1. Grow the isolate(s) to be tested for 18-24 hours on a CAP at 35-37°C with ~5% CO2 (or in a
candle-jar).
2. On a nonporous surface (i.e., Petri dish or glass plate), wet a strip of filter paper with a few
drops of Kovac’s oxidase reagent.
3. Let the filter paper strip air dry before use.
4. Use a disposable plastic loop, a platinum inoculating loop, or a wooden applicator stick to
pick a portion of a colony from overnight growth on the CAP and rub it onto the treated filter
paper (Figure 4).
 Do not use a nichrome loop, as it may produce a false-positive reaction.
5. Observe the filter paper for color change to purple.
90
Figure 4. Kovac’s oxidase test: a negative and positive reaction on filter paper
Plate method
candle-jar).
2. Dispense a few drops of Kovac’s oxidase reagent directly on top of a few suspicious colonies
growing on the 18-24 hour CAP.
 Do not flood the entire plate as the bacteria exposed to the reagent are usually not viable for
subculture.
3. Tilt the plate and observe colonies for a color change to purple.
F. Reading the oxidase test results
91
 Positive reactions will develop within 10 seconds in the form of a purple color where the
bacteria were applied to the treated filter paper. Delayed reactions are unlikely with H.
influenzae.
 Negative reactions will not produce a color change on the treated filter paper.
VII. Identification of hemin and NAD as growth requirements
H. influenzae is a fastidious organism and can be identified on the basis of growth requirements
for hemin and NAD. H. influenzae can be differentiated from most other species of
Haemophilus by its specific requirement for both hemin and NAD for growth (Table 1). H.
haemolyticus is the only other species requiring both hemin and NAD for growth; however, this
species differs from H. influenzae by producing beta-hemolysis (clear) on horse or rabbit blood.
For patients with bacterial meningitis, H. influenzae must be considered as the presumptive
causative agent as opposed to H. haemolyticus when both hemin and NAD factors are required
for growth. To differentiate between the two species, hemolysis must be checked on horse or
rabbit blood agar (see Section II.B., Haemophilus ID Quad plate section below). H.
haemolyticus usually causes hemolysis on these media, while H. influenzae does not. It has
recently been reported that H. haemolyticus tend to rapidly lose their hemolytic property when
passed in vitro (2). This has made the definitive identification of H. influenzae and H.
haemolyticus using only biochemical tests very difficult and other methods, such as molecular
testing, may be employed for differentiating between the two species.
Table 1. Identification of Haemophilus spp. by their growth requirements for hemin (X factor)
and NAD (V factor) and β-hemolysis on horse blood agar
Requirement for Requirement for β-hemolysis on

Organism hemin (X factor) NAD (V factor) horse blood agar
H. influenzae + + -
H. parainfluenzae1 - + -
H. haemolyticus + + +
H. parahaemolyticus - + +
H. aphrophilus 2 + - -
H. paraphrophilus1,2 - + -
1
H. parainfluenzae is ornithine decarboxylase positive, whereas H. paraphrophilus is negative.
2
Although their requirements for hemin and NAD factor differ from each other, H. aphrophilus
and H. paraphrophilus have recently been reclassified as a single species with a new genus:
Aggregatibacter aphrophilus (3).
A. Performing hemin and NAD growth factor requirement test using paper disks and/or
strips
Growth factor requirements can be identified with paper disks and/or strips using the principles
of agar diffusion.
92
Growth factor requirement procedure using paper disks and/or strips
candle-jar).
2. Prepare a moderately heavy suspension of cells (comparable to a 1.0 McFarland standard)

from overnight growth on the CAP in a suitable broth (trypticase soy, heart infusion, or
peptone water) and mix well using a vortex.
 Do not transfer any of the chocolate agar media from the plate to the cell suspension as
even the smallest amount of agar will affect the test and may lead to misidentification of
the bacteria.
3. Inoculate one half of a heart infusion or trypticase soy agar plate with 10 µl of the cell
suspension using a sterile loop or swab and allow the suspension to dry.
 Two different isolates can be tested on the same plate, but care must be taken to ensure that
the cultures do not overlap.
4. Place paper disks or strips containing hemin, NAD, and hemin/NAD on the inoculated plate
after the inoculum has dried.
 When two bacterial strains are tested on the same plate (Figure 5), the disks must be placed
in the exact manner shown, keeping the individual hemin and NAD disks separated by the
one containing both factors and leaving as much space between the disks as possible.
5. Perform steps 1-4 using a H. influenzae and a different Haemophilus spp. QC strain to
ensure that the hemin and NAD disks or strips are working properly.
6. Carefully invert the plate and incubate for 18-24 hours at 35-37°C with ~5% CO2 (or in a
candle-jar).
7. Observe growth around the paper disks or strips.
93
Figure 5. Identification of hemin (X factor) and NAD (V factor) as growth requirements using
paper disks. The top strain is only growing around the disk containing both hemin and NAD
(black arrow), and is presumptively identified as H. influenzae.
Reading the hemin and NAD paper disk and/or strip results
 H. influenzae will only grow around the paper disk containing both hemin and NAD, as shown
in Figure 5 on the upper half of the plate (see black arrow).
o H. haemolyticus will also only grow around the paper disk containing both hemin and
NAD. To differentiate between the two species, hemolysis must be checked on horse or
rabbit blood agar by inoculating the cell suspension mentioned above on heart infusion agar
with 5% rabbit blood (or agar infusion base containing horse blood). Alternatively, a
Haemophilus ID Quad plate can be used (see Section II.B. below).
 Other Haemophilus spp. will grow around the disk containing both hemin and NAD and either
the individual hemin or the NAD disk.
 Alternatively, the porphyrin test (2) can be used. This determines the hemin requirement of
the isolate while avoiding the problem of hemin carryover from primary culture media and
hemin contamination of test media (3).
B. Performing hemin and NAD growth factor requirement test using Haemophilus ID
Quad plates
94
Haemophilus ID Quad plates are another method for determining growth requirements of
Haemophilus isolates (Figure 6). While they are more expensive than the paper disks or strips,
they can test for β-hemolysis (clear) on horse blood and assist in differentiating H. haemolyticus
from H. influenzae. The Quad plate is divided into four compartments. One quadrant includes
medium containing hemin only (Figure 6, lower left). The second quadrant includes medium
containing NAD only (Figure 6, upper left). The third quadrant contains medium that includes
both hemin and NAD (Figure 6, upper right). The fourth quadrant contains heart infusion agar or
blood agar base with 5% horse blood (Figure 6, lower right) for detecting hemolysis and
differentiating H. haemolyticus from H. influenzae.
Growth factor requirement procedure using Haemophilus ID Quad plates
candle-jar).
2. Prepare a suspension of cells (comparable to a 0.5 McFarland standard) from overnight

growth of suspected Haemophilus on a CAP in trypticase soy broth or distilled water and mix
well using a vortex.
3. Use a sterile, inoculating loop to streak one loopful of the cell suspension onto one quadrant
of the Quad plate. Streak the entire quadrant, starting at the periphery of the plate and
streaking toward the center of the plate.
 Use a different inoculating loop to streak each of the other quadrants with the cell
suspension.
 Stab into the blood agar for detection of β-hemolysis (clear).
4. Incubate for 18-24 hours at 35-37°C with ~5% CO2 (or in a candle-jar).
5. After incubation, examine the individual quadrants for growth and the quadrant with horse
blood for hemolysis where the plate was stabbed with the loop (Figure 6).
Reading the Haemophilus ID Quad plate results
 H. influenzae will only grow on the quadrant containing both hemin and NAD and the quadrant
containing horse blood. It will not hemolyze the horse blood cells.
 H. haemolyticus will only grow on the quadrant containing both hemin and NAD and the
quadrant containing horse blood. It will hemolyze the horse blood cells.
o H. haemolyticus may lose their hemolytic property when passed in vitro. This has made
the definitive identification of H. influenzae and H. haemolyticus using only biochemical
tests very difficult and other methods, such as molecular testing, may be employed for
differentiating between the two species.
95
 An organism growing on either the hemin or the NAD quadrant is likely another Haemophilus
species
 If growth occurs on every quadrant, the isolate is probably not a Haemophilus spp.
 H. influenzae may occasionally show slight growth in the quadrant containing NAD only.
hemin
NAD
and
NAD
5%
hemin
horse
blood
Figure 6. Growth pattern for H. influenzae on a Haemophilus ID Quad plate
Quality control of Quad plates
QC should be performed on each new lot of Quad plates before they are used for unknown
isolates to ensure that they will support the proper growth of Haemophilus spp. Three plates
from each new lot received should be tested using a well-characterized reference strain of
H. influenzae, H. haemolyticus, and H. parahaemolyticus. One uninoculated plate from each
new lot should also be tested in order to check for contamination of mold or other organisms in
the laboratory and/or incubator. QC should be repeated on plates from a lot if they have been
96
exposed to temperatures above 4oC or if there is reason to suspect that the plates have been
contaminated since the initial QC was performed.
Procedure for quality control of Quad plates
1. Examine the Quad plates for evidence of microbial contamination, discoloration, drying,
deterioration, or other physical defects that may interfere with use. Note the firmness of the
agar during the inoculation procedure.
2. Grow the reference strains to be tested for 18-24 hours on a CAP at 35-37°C with ~5% CO2
(or in a candle-jar).
3. Inoculate the Quad plates using cell suspensions from the reference strains as described in the
Quad plate procedure above.
4. Incubate the plates for 18-24 hours at 35-37°C with ~5% CO2 (or in a candle-jar).
5. As a negative control for contamination, incubate an uninoculated plate from each new lot
for 18-24 hours at 35-37°C with ~5% CO2 (or in a candle-jar).
6. Examine the inoculated and uninoculated plates after 18-24 hours for proper growth of
Haemophilus spp.
Reading the quality control test results
 H. influenzae will only grow on the quadrant containing both hemin and NAD and the quadrant
containing horse blood. It will not hemolyze the horse blood cells.
 H. haemolyticus will only grow on the quadrant containing both hemin and NAD and the
quadrant containing horse blood. It will hemolyze the horse blood cells.
 H. parahaemolyticus will grow on all quadrants except for the one containing only hemin. It
will hemolyze the horse blood cells.
 Passing result: proper growth of the reference strain on appropriate quadrants and no growth on
uninoculated media.
 Failing result: no growth or poor growth of the reference strain on appropriate media and/or
growth of organisms on the uninoculated media.
VIII. Identification of H. influenzae serotype
Haemophilus influenzae can be encapsulated with one of six types of antigenically distinct
capsules which can be serotyped using antisera to each capsule (serotypes a-f). H. influenzae
may also be non-encapsulated and such strains that cannot be serotyped are called H. influenzae
nontypeable (NT). Individual serotype-specific antisera for these major serotypes are available
97
commercially. A polyvalent antiserum that recognizes all 6 serotypes is also available
commercially.
It is not always practical to test for all serotypes for which antisera are available in a laboratory.
Testing algorithms may be set up in laboratories with previous knowledge of whether or not a H.
influenzae serotype b (Hib) vaccination program has been implemented within that particular
geographic region. Modifications may be made to the testing algorithm for any laboratory based
on information regarding Hib vaccination status of the region.
It is essential that reference laboratories have the capacity to isolate, identify, and characterize
the serotype of isolates of H. influenzae. This valuable data provides laboratories and public
health authorities with the tools to identify outbreaks controllable by vaccination campaigns and
recognize serotypes causing sporadic disease.
SAST test algorithm for areas without an established Hib vaccination program
If a Hib vaccination program has not been implemented in the country or region from which the
isolate originated, it is likely that the H. influenzae isolate is serotype b and the isolate should
first be tested for reactivity to serotype b antisera and a negative saline control. If the isolate
reacts positively with the serotype b antiserum with no agglutination in saline, the isolate is
identified as Hib. However, if the isolate is non-reactive with the serotype b antiserum, and if
polyvalent antiserum is available, it should be tested with the polyvalent antiserum. If positive,
the isolate should then be tested with the remaining monovalent antisera (a, c, d, e, and f) to
determine the serotype. If negative for all monovalent antisera and positive for hemin and NAD
growth requirements, then the isolate is considered NT.
SAST test algorithm for areas with an established Hib vaccination program
If the isolate is from a country or region with an established Hib vaccination program that has
high Hib vaccine coverage, the isolate is likely to be NT or a serotype other than b. In this case,
the isolate should first be tested with the polyvalent antiserum, if available, and a negative saline
control. If positive for the polyvalent antiserum with no agglutination in the saline, the isolate
should then be tested with the remaining monovalent antisera (a, b, c, d, e, and f) to determine
the serotype. If the isolate is negative for the polyvalent antiserum and/or the monovalent
antisera, and requires hemin and NAD for growth, then the isolate is considered NT.
A. Slide agglutination serotyping (SAST) test for serotyping H. influenzae isolates
Formalin-killed suspensions of H. influenzae should be used for SAST testing rather than saline
suspensions of living organisms to maintain a safe working environment. A solution of 5%
formalinized physiological saline is sufficient to kill the bacteria. However, formalin is a
carcinogen and must be stored and handled with great care. Alternatively, work should be
performed under a biosafety hood if formalin is not used. Antisera should be stored in the
refrigerator at 4°C and warmed to room temperature (25°C) before use. It must be put back in
the refrigerator as soon as testing is finished to prevent the loss of binding activity of the
antibody.
98
B. Performing the SAST test
candle-jar).
2. Clean a glass slide with alcohol (optional if slides are pre-cleaned).
3. Divide the slide into equal sections (e.g., twelve 11 X 22 mm sections on a standard 50 X 75
mm slide) with a liquid impermeable pen or a wax pencil.
 Each isolate will require as many sections on the slide as antisera that will be tested
(polyvalent and/or individual serotype-specific) as well as a saline negative control.
4. In the lower portion of each of the sections of the glass slide described in step (2), add 10 µl
of the 5% formalinized saline with a micropipettor.
 The instructions specify using a micropipettor with sterilized filtered tips to measure the 10
l of the 5% formalinized saline to suspend the bacteria. The micropipettor will transfer
precise and equal measurements for a proper SAST reaction.
be used to transfer 10 l of the 5% formalinized saline, but often do not deliver accurate
amounts (between 5-10 l).
5. Use a sterile, disposable 10 l inoculating loop to collect a few colonies from the surface of
the overnight culture incubated on the CAP.
6. Suspend the bacteria in the 5% formalinized saline solution in the lower portion of each of
the sections of the slide. The suspension should be moderately opaque (see saline control in
Figure 7). Do not allow the cell suspension to dry before adding the antisera.
 If the bacteria are difficult to suspend directly on the slide, make a moderately milky
suspension (comparable to McFarland 6.0 standard) of the test culture in a small vial with
250 l of 5% formalinized saline and briefly vortex the suspension to mix and break up any
pellets. Add 10 l of this suspension to the lower portion of the slide.
7. In the upper portion of each of the sections of the glass slide described in step (2), add 10 μl
of the polyvalent and/or serotype-specific antisera to be tested as well as unformalinized
saline or phosphate buffered saline (PBS) for a negative control with a micropipettor.
 DO NOT use the dropper provided with the antisera because it usually delivers larger
amounts than is necessary and can easily be contaminated.
be used to transfer 10 l of the antisera, but often do not deliver accurate amounts (between
5-10 l).
99
 Dispose of the tip or loop used to transfer the antisera to the slide in a waste container after
each use to avoid contamination of the antisera. If the source of antisera is contaminated, a
new vial must be used.
8. Gently tilt the slide to mix the cell suspensions with the antisera in each section. Continue to
gently rock the slide for 1 to 2 minutes to allow the lower and upper portions to completely
blend. Do not use a circular motion while rocking, as it can cause the sections with different
serogroup-specific antisera to run together and contaminate each other.
9. After 2 minutes, examine the SAST reactions under a bright light and over a black
background. Use the rating system in Figure 7 to determine the intensity of the agglutination
reaction in each section of the slide. Disregard any agglutination that occurs after the 2
minute time period.
10. Record the SAST results in the laboratory log book.
C. Reading the SAST results
Rating the intensity of the agglutination reaction
Agglutination occurs when the antisera bind to the bacterial cells causing the cells to agglutinate
or clump together, thus making the cell suspension appear clearer. The intensity of the
agglutination reaction may vary according to the density of the cell suspension or the antisera
used. A description on the intensity ratings shown in Figure 7 are listed below.
4+ All of the cells agglutinate and the cell suspension appears clear
+/- Less than 25% of the cells agglutinate and a fine granular matter occurs
0 No visible agglutination; the suspension remains cloudy and smooth
Figure 7. Rating the intensity of the agglutination reaction
100
Determining the serotype
 A positive result is designated by a 3+ or 4+ (strong agglutination) within 1-2 minutes.
 A negative result is designated by a 0 (saline), +/-, 1+ or 2+ (weak agglutination).
 The serotype is determined when a positive result occurs with the polyvalent antiserum
and/or only one of the serotype-specific antisera and not with the saline.
 If a serotype is not determined, the isolate is considered NT. The following result
combinations are all reported as NT:
o Agglutination in the saline, regardless of strong reactions with the polyvalent or other
serotype-specific antisera, characterizes the culture as autoagglutinating.
o Agglutination with the polyvalent and/or more than one serotype-specific antisera in the
absence of agglutination in saline characterizes the culture as polyagglutinating or
cross-reactive.
o No agglutination with the polyvalent or any of the serotype-specific antisera or the

saline characterizes the strain as non-reactive.
o Although rare, an isolate positive for the polyvalent antiserum, but negative for the
serotype-specific antisera is considered NT.
D. Troubleshooting the SAST procedure
H. influenzae isolates are subject to variability (encapsulated vs. unencapsulated, small vs. large
colonies, slow growers vs. fast growers, and heavy agglutinators vs. light agglutinators) and may
be unclear or difficult to interpret. Some troubleshooting procedures are listed below:
1. Repeat the test directly on the slide using growth from another section of the same plate.
2. Make a cell suspension in a small tube and vortex if the result from SAST directly on the
slide is unclear and repeat the test.
3. Add 20 µl of antisera directly to slide and then add a loopful of organism without diluting the
specimen with 5% formalinized saline.
4. Subculture and retest fresh growth the following day.
5. If the original plate contains different size colonies, make a subculture for each type of
colony and test both cultures the next day. The larger colonies usually indicate better capsule
production and therefore better reactivity. However, the smaller colonies will occasionally
give a better result.
101
 If discrepancies are not immediately resolved, any subsequent SAST repeats should be
used in conjunction with control strains.
E. Quality control of antisera for SAST testing
A set of reference strains for H. influenzae serotypes a, b, c, d, e, and f (one per serotype) and a
nontypeable H. influenzae strain should be used to QC the antisera before testing any unknown
isolates. QC of the antisera should be:
 Performed for each new lot of antisera received in the laboratory.
 Performed biannually after initial QC testing.
 Repeated if a vial has been exposed to temperatures above 4oC or if there is reason to suspect
that the vial has been contaminated since the initial QC was performed.
Follow the SAST testing procedure to QC each lot of antisera using all reference strains
available in the laboratory. Record the results provided on the example QC sheet in Figure 8.
Reading the quality control test results
Passing test:
 The antiserum must give 3+ or 4+ agglutination with homologous antigens within 1-2 minutes.
 The antiserum must not react with heterologous H. influenzae serotypes, with the NT reference
strain, or in saline.
Failing test:
 The antiserum agglutinates with one or more reference strains and/or with the NT reference
strain and/or in saline.
102
a b c d e f NT
(strain (strain (strain (strain (strain (strain (strain
number) number) number) number) number) number) number)
a ++++ - - - - - -
Lot#
b
- ++++ - - - - -
Lot#
c
- - ++++ - - - -
Lot#
d
- - - ++++ - - -
Lot#
e
- - - - ++++ - -
Lot#
f
- - - - - ++++ -
Lot#
Poly
++++ ++++ ++++ ++++ ++++ ++++ -
Lot#
Saline
- - - - - - -
Figure 8. Example QC sheet for testing antisera against all H. influenzae serotypes
IX. Commercial identification kits
Several commercial identification systems that use biochemical or enzymatic substrates are
available for identification of Haemophilus spp. These systems may occasionally require
supplemental tests, and additional characteristics, such as microscopic and colony morphology,
must be considered. Generally, each system is self-contained, but the addition of one or more
reagents to complete certain reactions may be necessary. The manufacturer’s instructions should
be followed precisely when using these kits. Some of the commercial identification kits also
include biotyping of H. influenzae. For detailed instructions and use of appropriate control
strains, consult the Clinical Microbiology Procedures Handbook (1).
References
1. Clinical Microbiology Procedures Handbook, 3rd edition. 2010. ASM. Washington, D.C.
2,540 pages.
2007. Manual of Clinical Microbiology, 9th ed, vol. ASM Press, Washington, D. C.
103
3. Norskov-Lauritsen, N., and M. Kilian. 2006. Reclassification of Actinobacillus
actinomycetemcomitans, Haemophilus aphrophilus, Haemophilus paraphrophilus and
Haemophilus segnis as Aggregatibacter actinomycetemcomitans gen. nov., comb. nov.,
Aggregatibacter aphrophilus comb. nov. and Aggregatibacter segnis comb. nov., and
emended description of Aggregatibacter aphrophilus to include NAD factor-dependent
and NAD factor-independent isolates. International Journal of Systematic and
Evolutionary Microbiology 56:2135-2146.
104
CHAPTER 10
PCR for Detection and Characterization of Bacterial Meningitis Pathogens:

Neisseria meningitidis, Haemophilus influenzae, and Streptococcus pneumoniae
I. Overview of PCR technologies
In developing countries, the most commonly used approaches for detection and characterization
of bacterial meningitis pathogens include culture, Gram stain, and latex agglutination. Although
culture is considered the gold standard for case confirmation in clinics, the positive rate is
relatively low due to suboptimal storage and transportation conditions, culture practice, and/or
antibiotic treatment administered before the specimen is collected. While Gram staining is
important, inexpensive, and should be performed whenever possible, it merely gives a clue as to
the genus and species of the etiological agent. The reading of latex agglutination results is
subjective and can be difficult to interpret, especially when a specimen’s bacterial load is low. It
is also not feasible to do quality control on latex agglutination. Culture should be kept as the
gold standard as cultured bacteria are sources of data for antibiotic susceptibility, complete
subtyping, the expression of antigens that are to be included in future vaccines, and
pathophysiology of isolates. Specimens that do not yield any culture can still be analyzed by
molecular methods (see below) that can be applied on DNA extracted from clinical specimens
(typically, blood and CSF).
A. Polymerase chain reaction (PCR)
PCR was developed in the mid- to late 1980s (36, 42) and is considered one of the most
important methodological inventions in molecular biology. It is designed to permit selective
amplification of a specific target DNA sequence(s) within a heterogeneous collection of DNA
sequences (e.g., total genomic DNA). In PCR, the DNA target is exponentially amplified
through repeating three major steps: 1) denaturation of double-stranded DNA into single-
stranded DNA; 2) annealing of primers to the complementary single-stranded target sequences;
and 3) extension of the primers in the 5’ to 3’ direction by heat-stable DNA polymerase to
produce double-stranded DNA molecules. The copy number of DNA molecules is doubled in
each extension step, generating millions of copies of the original DNA molecules when PCR is
completed. Because the method does not require live or intact cells, PCR is a valuable tool for
detecting bacterial pathogenic agents from clinical specimens, where bacteria die or lyse easily
due to inappropriate storage conditions or prior antibiotic treatment. PCR is now widely used in
the diagnosis and surveillance of bacterial pathogens because of its high sensitivity and
specificity and high throughput capabilities. It provides a complementary tool to classic
phenotype-based methods such as culture, Gram stain, and latex agglutination and often
enhances confirmatory results (3).
A number of conventional PCR assays have been developed for detection and subtyping of
bacterial and viral pathogens. Conventional PCR detects products at the end point of DNA
amplification by visualizing amplicons using agarose gel electrophoresis. Gel-based detection
requires that tubes containing PCR amplicons be opened and manipulated, thereby greatly
increasing the risk of contamination of laboratory space, equipment, and reagents with amplified
105
materials. Conventional PCR is also very time consuming and less sensitive and specific than a
type of PCR called real-time PCR, so it is primarily used for typing assays employing purified
cultures or clinical specimens that contain the organism in high density. The use of real-time
PCR is rapidly expanding because it is easier to perform and, being a closed system, it reduces
potential contamination problems inherent to conventional PCR. Many of the same precautions
mentioned for conventional PCR assays also apply to real-time PCR assays.
B. Real-time PCR technology
Real-time PCR is also known as quantitative real-time polymerase chain reaction (Q-
PCR/qPCR) or kinetic polymerase chain reaction, which combines amplification and detection in
one step through the use of fluorescent dyes. There are two types of detection systems: non-
specific and specific. Non-specific detection systems use a fluorescent dye that intercalates into
any double-stranded DNA molecules and emits enhanced fluorescence. This detection system is
relatively inexpensive but susceptible to false positivity. Specific detection systems rely on
fluorescent resonance energy transfer probes that specifically recognize target sequences, thus
making them the systems of choice for the molecular detection assays described here. Specific
detection systems are more expensive than non-specific detection systems and require
sophisticated probe designs. Three types of probes are currently in use, including: hydrolysis,
hybridization, and hairpin probes (7, 13). A fluorescent signal is only generated if the probe
interacts with its specific target and is subsequently hydrolyzed during amplification. The
resulting increase in fluorescence is proportional to the amount of amplified PCR product in the
reaction.
The first use of dual-labeled hydrolysis probes was reported in 1993 (30) and has been widely
used in many laboratories since that time. A dual-labeled hydrolysis probe is an oligonucleotide
(~17-35 bp long) labeled with a reporter fluorophore (usually a short wavelength colored dye) at
the 5’ end and a quencher fluorophore (usually a long wavelength colored dye) at the 3’ end or at
an internal thymine or “T” residue. Optimally, the quencher dye should be 7-15 base pairs from
the reporter dye. When the probe is intact and excited by a light source, the fluorescence
emission of the reporter (or donor) dye is absorbed by the quencher (or acceptor) dye as a result
of the close proximity of the dyes. This process is also known as fluorescence resonance energy
transfer (FRET). During PCR amplification, the probe anneals to an internal region of the target
DNA template between the forward and reverse primer. When DNA polymerase catalyzes the
extension of the primer and reaches the region where the probe is bound, the 5’ exonuclease
activity of the DNA polymerase cleaves the probe and releases the reporter from the quencher.
This allows emission of the fluorescence from the reporter dye to be observed because it is no
longer absorbed by the quencher which has diffused away (Figure 1). The increase in
fluorescence is proportional to the amount of amplified PCR product in the reaction and is
measured cumulatively over the course of the entire PCR run (7, 30).
106
Donor dye
(Reporter) Acceptor dye
(Quencher)
Unbound probe free in solution
Light
Energy transfer
Taq
Probe and primer bind target, FRET occurs
Light
Taq polymerase extends and hydrolyzes

Taq probe, donor dye free to emit
fluorescence --> accumulation of signal
Figure 1. Chemistry of a dual-labeled hydrolysis probe
II. Target gene assays for detection and characterization of bacterial meningitis etiologies
Over the past several years, conventional and real-time PCR assays have been developed for
detection of bacterial meningitis pathogens. Reliable assays have been extensively evaluated
using invasive clinical isolates and/or clinical specimens from around the world (8, 12, 15, 17,
29, 35, 52, 60). In general, validated assays should have high sensitivity and specificity. They
can be used as complementary approaches in bacterial disease diagnosis. The gene targets, DNA
sequence of primers and probes, and the final concentration used in the PCR reactions described
here to detect and characterize N. meningitidis, H. influenzae, and S. pneumoniae are listed in
Tables 2-5.
The PCR strategy typically employed to detect the causative agent in a suspected case of
bacterial meningitis is to first run each of the species-specific assays concurrently on the DNA
extracted from the clinical specimen or isolate. The appropriate serogroup/serotype specific
assays should then be run on any positive specimens. See Section V below, “Workflow for
detection of bacterial meningitis pathogens by PCR”, for more details.
A. Species-specific real-time PCR assays
PCR detection of N. meningitidis, H. influenzae, and S. pneumoniae can be achieved by

amplification of several potential gene targets (8, 35, 53, 60). The following assays have been
107
developed and validated to be used on DNA extracted from clinical specimens (typically, blood
and CSF) and bacterial isolates.
N. meningitidis
Two genes can be targeted in N. meningitidis species-specific assays, ctrA and sodC. The
capsule transport to cell surface gene, ctrA, is highly conserved among isolates responsible for
invasive meningococcal infections and has been used in both real-time and conventional PCR to
detect N. meningitidis (35). It is a gene within the capsule locus (Figure 2). However, since at
least 16% of carried meningococci lack ctrA (10, 14, 41), a real-time PCR assay to detect all
meningococci, regardless of encapsulation status, was recently developed and validated (15).
This assay targets the Cu, Zn superoxide dismutase gene, sodC, which is not genetically linked to
the capsule locus. The sodC assay detects encapsulated meningococci, but it is also useful for
detecting nongroupable meningococci that do not contain an intact ctrA, as will be recovered
during carriage studies. For this reason, it is recommended that sodC be used for detection of N.
meningitidis, if possible. sodC and ctrA primers and probes are listed in Table 2.
H. influenzae
The protein D encoding gene, hpd, encodes protein D, a highly conserved, surface-exposed
lipoprotein that is present in all encapsulated and non-encapsulated H. influenzae (24, 45). The
conserved nature of this gene and its presence in all strains of H. influenzae characterized to date
make it a highly attractive gene target for the development of a H. influenzae species-specific
real-time PCR assay. The recently developed and validated hpd real-time PCR assay is capable
of detecting all six serotypes (a-f) and nontypeable (HiNT) H. influenzae with high sensitivity
and specificity (60). Real-time PCR assays targeting bexA were developed and distributed
because bexA is present in all six serotypes of H. influenzae. However, though sensitive for
detection of Hib, it is less sensitive for Hia, Hic, and Hid, and does not detect Hie, Hif, or HiNT
and should no longer be used. The primers and probes for the hpd assay are listed in Table 2.
S. pneumoniae
Both conventional and real-time PCR assays have been developed for the detection of S.
pneumoniae, and target genes have included the pneumolysin (ply), autolysin (lytA), and
pneumococcal surface adhesion (psaA) genes (8). However, false-positive results with ply-based
PCR have been reported when applied to upper respiratory tract specimens. A suggested
explanation for these false positives is the detection of non-pneumococcal alpha-hemolytic
streptococci (37, 47), which are normally present in the respiratory flora (e.g., Streptococcus
mitis group and Streptococcus oralis) which sometimes contain a ply gene (62). The PCR
detection assay for S. pneumoniae using a specific segment of the autolysin gene (lytA) is
recommended because it is highly conserved within the species and it has been shown that this
assay best separates S. pneumoniae from the genotypically similar species S. mitis, S. oralis, and
S. pseudopneumoniae (33). The real-time PCR assay lytA primers and probes that have been
found to be extremely reliable for detection of S. pneumoniae are listed in Table 2. Due to
recombination events that occur between pneumococci and closely related streptococci, there
108
will probably be rare false-positives or false-negatives for virtually any real-time assay for
pneumococcal identification.
B. Serogroup/serotype-specific real-time PCR assays
The capsule gene loci of both N. meningitidis and H. influenzae have areas that are both unique
and conserved within each serogroup (N. meningitidis) or serotype (H. influenzae) thus providing
gene targets for the development or real-time PCR assays designed to identify each specific
serogroup or serotype.
N. meningitidis
N. meningitidis is classified into 12 serogroups on the basis of the chemical composition and
linkage type of saccharide subunits of the capsular polysaccharide that are expressed on the
bacterial cell surface. Major disease-causing serogroups include A, B, C, Y, and W135, the
latter four of which produce sialic acid containing capsular polysaccharides; whereas serogroup
A produces a poly-α1-6-linked N-acetylmannosamine 6-phosphate capsule (31). Outbreaks
caused by serogroup X meningococci, which express poly-α1-4-linked N-acetylglucosamine 1-
phosphate capsule (6) have also been reported (2, 20). Serogroup D is no longer recognized as a
serogroup of N. meningitidis.
As illustrated in Figure 2, the genetic organization of the capsule locus is conserved among the
serogroups. The capsule expression genes are located in four operons: one that encodes capsule
biosynthesis (called syn or sia genes, depending on which nomenclature system is used) and
three that encode the capsule transport to the cell surface proteins (ctr). The gene products of the
ctr operon share high similarity with the ATP-dependent transporters of the ABC family (19) and
are highly conserved among the major disease-causing serogroups (1, 18, 39, 55) and serogroup
X (56). Sensitive real-time PCR assays targeting ctrA, which is the first gene in the capsule
transport operon, have been developed for detection of all encapsulated and some non-
encapsulated (nongroupable) N. meningitidis (12, 35), though a more specific and sensitive assay
using the sodC gene as a target has been developed. The genetic differences among the capsule
biosynthesis operons of meningococcal serogroups have facilitated the development of real-time
PCR assays targeting serogroup-specific genes for capsule biosynthesis to determine the capsule
genotype of a meningococcal isolate (35).
The gene sia (for sialic acid biosynthesis (16, 22), also called syn for capsule biosynthesis (21,
51), are used for genotyping for serogroups B (synD), C (synE), Y (synF) and W135 (synG).
The sacB gene is targeted for serogroup A and the xcbA gene, which most likely encodes the
capsule polymerase, is targeted for serogroup X (2, 35). These target genes are depicted within
the structure of the capsule gene complex for serogroups A, B, C, Y, W135, and X (Figure 2).
The most current adapted primer and probe sequences for the serogrouping real-time PCR assays
are listed in Table 3, though, periodically, the primers and probes are adapted as new information
regarding probe chemistries and allelic variations become available.
There have been several different systems in place for naming the genes for meningococcal
capsule biosynthesis. Some groups have called this operon syn for capsule biosynthesis (21, 51);
109
other groups have used the sia nomenclature for sialic acid biosynthesis (16, 22); still others
have referred to them as neu genes based on homologies to E. coli K1 genes for N-
acetylneuraminic acid biosynthesis (21). While the siaD genes of serogroups B, C, W135, and Y
were initially thought to be alleles, more extensive sequencing analysis demonstrated that this is
not so. The synD and synE genes of serogroups B and C, respectively, are alleles and encode
capsular polysaccharide polymerases that catalyze different linkages of sialic acid monomers
(α2→8 linkage for serogroup B and α2→9 linkage for serogroup C). However, the Y and W135
genes are over twice the size of the B and C genes and differ in nucleotide sequence (11, 50),
though they are highly similar to each other. In addition, the polymerases for serogroups Y and
W135 link heteropolymers of sialic acid plus either glucose or galactose, respectively. Thus, the
capsular polysaccharide polymerase genes of serogroups Y and W135 are alleles. To continue to
call all of these polymerase genes siaD would be a misnomer. For these reasons and for
simplicity, this text will use the synABCD/E/F/G nomenclature listed above and in Table I.
Table 1. Serogroup capsule type and gene targets for genotyping real-time PCR assays
Gene
Sero- Target Alternate
group Capsule type Name Gene Names Ref
(1→6)-N-acetyl-D-mannosamine-
A 1-phosphate sacB (31)
 siaD
2→8)- N-acetylneuraminic acid siaD of B (5, 9, 23,
B synD siaDB 48, 61)
 siaD of C (5, 9, 50,
C 2→9)- N-acetylneuraminic acid synE siaDC 58, 61)
6-D-Gal1→4)-N- siaD of W135 (4, 9, 14,
W135 acetylneuraminic acid2→6) synG siaDW 35, 49, 61)
(1→4)-N-acetyl-D-glucosamine-1-
X phosphate xcbB (2, 6)
6-D-Glc1→4)-N- siaD of Y (4, 9, 14,
Y acetylneuraminic acid2→6) synF siaDY 35, 49, 61)
For serogroups B, C, Y and W135, the first three genes of the syn operon encode functions for
the synthesis of capsule polysaccharide precursors (32, 48, 51). The fourth gene product is a
polymerase that catalyzes the formation of polymers with the serogroup-specific linkage. In
serogroups B and C, the products of a four-gene operon (synABC plus the polysialyltransferase
gene synD [Nmen B] or synE [Nmen C]) are responsible for biosynthesis of the sialic acid (also
known as N-acetylneuraminic acid, NeuNAc, or NANA) homopolymer. Expression of the poly-
N-acetylmamosamine-1-phosphate capsule polymer of serogroup A requires the sacABCD
operon (formerly known as mynABCD (49), while expression of the poly-N-acetyl-D-
glucosamine-1-phosphate capsule of serogroup X requires the xcbABC operon.
110
N. meningitidis Serogroup B [(2→8)-N-acetylneuraminic acid]
10
ctrF ctrE tex ctrD ctrC ctrB ctrA synA synB synC synD 16 0065 galE
N. meningitidis Serogroup C [(2→9)-N-acetylneuraminic acid]
ctrF ctrE tex ctrD ctrC ctrB ctrA synA synB synC synE oatC 0065 galE
N. meningitidis Serogroup Y [6-D-Glc (1→4)-N-acetylneuraminic acid (2→6)]

oat
ctrF ctrE tex ctrD ctrC ctrB ctrA synA synB synC synF WY
1016 0065 galU galE
5 U
N. meningitidis Serogroup W135 [6-D-Gal (1→4)-N-acetylneuraminic acid (2→6)]

oat
ctrF ctrE tex ctrD ctrC ctrB ctrA synA synB synC synG WY
1016 0065 galU galE
5 U
N. meningitidis Serogroup A [(1→6)-N-acetyl-D-mannosamine-1-phosphate]
ctrF ctrE tex ctrD ctrC ctrB ctrA sacA sacB sacC sacD galE
N. meningitidis Serogroup X [(1→4)-N-acetyl-D-glucosamine-1-phosphate]
ctrF ctrE tex ctrD ctrC ctrB ctrA xcbA xcbB xcbC galE
N. gonorrhoeae, N. lactamica, and some nongroupable N. meningitidis
tex galE
111
Figure 2. Genetic maps of the capsule gene complex (cps) of N. meningitidis (adapted from
(14)). The ctrABCD operon encodes ATP-dependent export proteins (grid pattern). synABC
(solid gray) D/E/F/G (dotted), sacABCD (horizontal striped), and xcbABC (dashed upward
diagonal), encode the serogroup-specific enzymes for capsule polymer biosynthesis. oatC
(serogroup C) and oatWY (serogroups W135 and Y), are co-transcribed with the syn operons and
encode O-acetyltransferases (9). lipA and lipB code for proteins that were originally proposed to
add a phospholipid-anchoring group onto the polysaccharide reducing end before transport (19).
ctrE and ctrF (diagonal brick), formerly known as lipA and lipB, respectively, are involved in
capsule transport (57). These gene products were once thought to be involved in post-
polymerization modification. Many nongroupable, carried meningococci lack all or part of the
capsule locus (10, 14); those lacking the entire locus have a genetic configuration at this position
like those of N. gonorrhoeae and N. lactamica, which are not known to synthesize capsule.
Haemophilus influenzae
The capsule locus of all six serotypes of H. influenzae (Hi a, b, c, d, e, and f) consists of three
regions encoding functions for capsule polysaccharide synthesis, modification, and translocation
(Figures 3 and 4) (25, 43, 44). bexDCBA in the ATP-driven export region (also known as
Region I) code for protein components of an ATP-driven polysaccharide export apparatus. hcsA
and hcsB in post polymerization modification region (also known as Region III) share high
similarity with lipA and lipB (recently renamed ctrE and ctrF), respectively, which are involved
in modification and export of meningococcal capsule polysaccharide (43). Both regions are
common to all serotypes. The same nomenclature is used for genes in the two regions for all six
serotypes. The serotype-specific region (previously Region II) contains genes for capsule
synthesis and is unique to each serotype. The serotype-specific genes are named acs, bcs, etc.
for “a capsule synthesis”, “b capsule synthesis”, and so on.
The cap locus encodes functions for H. influenzae capsule synthesis. The genetic organization of
the cap locus has been well characterized in Hib and Hif, which belong to two phylogenetic
divisions that are defined by multilocus enzyme electrophoresis typing. The ATP-driven export
region includes most of Hia and Hib strains, and all of Hic, Hid, and Hie strains. Strains from
this region have at least one completed cap locus flanked by insertion sequence (IS) element
IS1016, except Hie. The majority of Hib strains and some Hia strains from this region have the
direct-repeat configuration with the second copy of the bexA gene partially deleted as illustrated
in Figure 4. The truncated cap locus is not required for capsule synthesis (26-28). In Hif, Hib,
and Hia strains of the serotype-specific region and some Hie strains of the ATP-driven export
region, the cap locus is flanked by sodC and HI1637 (26, 44).
While serotype b causes the vast majority of H. influenzae disease in countries without a Hib
vaccination program, serotypes a, c, d, e, and f, and nontypeable H. influenzae (NTHi), also
contribute to case numbers (43, 59). As implementation of Hib vaccine becomes more
widespread, it is important to monitor incoming specimens for both b and non-b serotypes of H.
influenzae. Therefore, serotype-specific real-time PCR assays have been developed that target
the serotype-specific region genes where possible, or the 5' end of bexD, which is less conserved
among the serotypes compared with the other genes in the export region. The genes targeted for
real-time PCR assays specific to each serotype are as follows: acsB (Hia), bcsB (Hib), ccsD
(Hic), dcsE (Hid), ecsH (Hie), and bexD (Hif) (Figure 3). The primer and probe information for
112
each of these serotyping assays can be found in Table 4. Each of these assays has been shown to
be highly specific and sensitive for their respective serotypes.
Figure 3. Capsule loci for H. influenzae serotypes a, b, c, d, e, and f, including the target genes
for serotype-specific real-time PCR assays. The capsule locus of all six serotypes of H.
influenzae (Hia-f) consists of three regions encoding functions for capsule polysaccharide
synthesis, modification, and translocation. bexDCBA in the ATP-driven export region (white
arrows) code for protein components of an ATP-driven polysaccharide export apparatus. hcsA
and hcsB are in the post polymerization modification region (gray arrows) and may be involved
in the modification and export of capsule polysaccharide. The serotype-specific region (colored
arrows) contains genes for capsule synthesis and is unique to each serotype. The serotype-
specific genes are named acs, bcs, etc. for “a capsule synthesis”, “b capsule synthesis”, and so
on. With the exception of the Hif serotype-specific assay, the target genes for the serotype-
specific assays can be found in this region and are highlighted by the red boxes.
113
Truncated Serotype- Post- ATP- Serotype- Post-
ATP-driven specific polymerization driven specific polymerization
export region region modification export region modification
region region region
bcsA bcsB bcsC bcsD hcsA hcsB orf3 bcsA bcsB bcsC bcsD hcsA hcsB orf3 IS1016
Figure 4. Genetic organization of the cap locus in Hib (adapted from (43)). Partially duplicated
cap locus of Hib Hi 1007 showing the truncated ATP-driven export region with the 1.2-kb
deletion between IS1016 and bexA.
C. S. pneumoniae serotyping PCR assays
S. pneumoniae can be further classified into at least 93 serotypes based on the immunochemistry
of their capsular polysaccharides. The high cost of antisera, subjectivity in interpretation, need
for a complete set of control strains, and technical expertise requirements associated with these
serologic methods have resulted in the more recent development of PCR-based serotyping
systems. PCR-serotyping has the potential to overcome some of the difficulties associated with
serologic testing and the development of PCR-based assays for direct detection of serotypes from
clinical specimens is a valuable aid in surveillance, particularly in situations where culture is
insensitive. PCR assays (both conventional and real-time) for the detection of the more common
serotypes are being developed and are discussed in more detail below (38, 54).
Multiplex conventional PCR assays for serotyping S. pneumoniae
A multiplex PCR-based serotyping scheme that includes 40 serotype specificities has been
developed (38). This PCR approach has the potential to greatly reduce reliance upon
conventional serotyping and provides serotype-determining potential to laboratories that lack
type-specific antisera and other reagents needed for conventional serotyping, yet have the
equipment necessary for DNA amplification and electrophoresis.
The multiplex approach uses 9 reactions to identify 40 serospecificities (Table 5 for primers,
Tables 6-8 for schemes, and Figure 5 for PCR products) but also provides some flexibility that
allows for altering combinations of serotypes included in each sequential reaction. These can be
modified based on the most prevalent serotypes in any given geographic region but do require
validation to ensure no cross reaction between serotype primer sets. Three such schemes based
upon pneumococcal serotype prevalence in the USA, Africa, and Latin America have been
designed (Tables 6-8). These schemes will continue to be refined as additional serotypes are
added and primer sets updated to improve specificity and sensitivity. The most current methods
are described at the CDC Streptococcus website and should be consulted on a regular basis
(www.cdc.gov/ncidod/biotech/strep/PCR.htm).
114
Real-time PCR assays for serotyping S. pneumoniae
A number of real-time PCR assays for serotyping S. pneumoniae have been published in the
literature and others are being developed (34, 40). These real-time assays are recommended for
determining serotypes from clinical specimens when DNA may be present in low amounts and
insufficient for conventional multiplex PCR serotyping. Please see the following website for an
example: www.cdc.gov/ncidod/biotech/strep/PCR.htm.
D. Multiplex real-time PCR for pathogen detection
Real-time PCR allows for development of multiplex assays for detection of several genes in the
same reaction by using specific probes with different fluorescent dye labels. Multiplex real-time
PCR assays are available for detection of N. meningitidis, H. influenzae, and S. pneumoniae in a
single reaction. In addition, assays for serogrouping N. meningitidis and serotyping S.
pneumoniae using a multiplex approach have also been developed. However, they are not
recommended for routine use. The multiplex approach requires careful optimization. Changes
in DNA polymerase or PCR reagent concentrations may lead to loss of sensitivity. The assays
need to be optimized and re-evaluated, which is a very time-consuming process and requires a
complete set of reference strains.
III. Preparation of DNA template for PCR
A. General considerations
Both crude DNA preps (boiled cell suspension) and extracted genomic DNA can be used as
template for PCR amplification. DNA extraction from clinical specimens or isolates should be
performed in a separate room from the room used for PCR reaction assembly (prior to DNA
addition). If separate rooms are not possible, separate laboratory benches should be used. The
use of boiled extracts may limit the risk of contamination as it limits manipulation. Moreover,
PCR on clinical specimens should be performed in a separate room from where bacteria are
cultured with strict organization of the laboratory workflow. Use of a biological safety cabinet is
necessary for infectious materials such as clinical isolates, blood, and CSF. Separate pipettes,
laboratory coats, and gloves should be used for performing DNA extraction procedures. Signage
indicating which spaces and equipment are DNA-free and which are used to prepare or
manipulate DNA would be helpful. UV irradiation and decontamination of surfaces and
equipment with 10% bleach followed by 70% ethanol should be performed after any
manipulation of nucleic acids at the laboratory bench. Always use filter-barrier pipette tips and
change and discard gloves frequently.
B. Equipment, consumables, and reagents for DNA extraction
Equipment
Microcentrifuge with refrigerating function
Water bath or dry block heater
Vortexer
Freezer
Refrigerator
115
pH meter
Balance
Stir plate
Consumables:
10% bleach (10:1, water: concentrated bleach) (make fresh weekly)
70% ethanol
1.5 ml microcentrifuge tubes (sterile, DNAase free, or PCR grade)
1 set of micropipettors (1-10 l, 2-20 l, 20-200 l, and 100-1000 l)
Pre-sterilized filter tips (10 l, 200 l, and 1000 l)
Reagents:
TE Buffer (10 mM Tris HCl, pH 8.0, 1 mM EDTA)
Tris buffer (10 mM Tris HCl, pH 8.0)
Lysozyme
Mutanolysin
Proteinase K (20 mg/ml)
Lysis buffer (4% SDS, 10 mM EDTA pH 8.0)
Digestion buffer
Phenol
Chloroform
Phenol: chloroform (1:1)
Commercial DNA extraction kits are available for culture and blood and body fluids
Commercial PCR Master Mix containing dNTPs and DNA polymerase is available
C. Preparing reagent solutions
EDTA, 0.1 M, pH 8.0 (100ml)

1. Dissolve 3.7 g EDTA in 70 ml distilled deionized H2O (ddH2O).
2. Adjust pH to 8.0 with 10 M NaOH.
3. Add ddH2O to 100 ml.
4. Autoclave at 121°C for 20 minutes.
5. Store at room temperature.
Tris-HCl, 0.1 M, pH 8.0

1. Dissolve 1.2 g Tris base in 80 ml ddH2O.
2. Adjust to pH 8.0 with concentrated HCl.
3. Mix and add ddH2O to 100 ml.

3. Mix and add ddH2O to 100 ml.
116
20% Sodium dodecyl sulfate (SDS)*

1. Dissolve 20 g SDS in 100 ml sterile ddH2O.
2. Place the container into a 50-60°C water bath to facilitate dissolving.
3. Avoid vigorous shaking that generates bubbles.
*Eye and respiratory protection should be worn when weighing powdered SDS.
TE buffer (10 mM Tris HCl, pH 8.0, 1 mM EDTA)

1. Add 10 ml of 0.1 M Tris-HCl, pH 8.0.
2. Add 1 ml of 0.1 M EDTA, pH 8.0.
3. Add sterile ddH2O to 100 ml and mix well.
Tris-HCl buffer (10 mM, pH 8.0)

1. Add 10 ml of 0.1 M Tris-HCl.
2. Add 90 ml sterile ddH2O and mix well.
Lysis buffer (4% SDS, 10 mM EDTA pH 8.0)

1. Add 20 ml of 20% SDS.
2. Add 10 ml of 0.1 M EDTA pH 8.0.
3. Add sterile ddH2O to 100 ml and mix well.
Mutanolysin stock solution (2,500 U/ml)

1. Reconstitute the entire bottle of mutanolysin with sterile ddH2O to produce a
concentration of 2,500 U/ml.
2. Aliquot into sterile screw-top microcentrifuge tubes.
3. Store aliquots at -20ºC.
Digestion buffer (0.04 g/ml lysozyme and 75 U/ml mutanolysin in TE buffer)

1. For 1 ml of TE buffer containing lysozyme and mutanolysin, add 40 mg lyophilized
lysozyme to a 1.5 ml microcentrifuge tube.
2. Add 1 ml TE buffer.
3. Add 30 l of a stock solution of mutanolysin at 2500 U/ml.
 This solution should be prepared ≤ 15 minutes prior to use and should not be reused.

1. Dissolve 200 mg of proteinase K powder in 10 ml of sterile ddH2O.
2. Aliquot 1 ml into microcentrifuge tubes.
3. Store at -20°C.
Hyaluronidase (30 mg/ml)

1. Dilute 100 mg in 3.3 ml sterile ddH2O to make 30 mg/ml solution.
117
2. Dispense in 500 µl aliquots; store at -20°C.
Sodium acetate (3.0 M, pH 5.5)

1. Dissolve 40.8 g sodium acetate in 80 ml sterile ddH2O.
2. Adjust pH to 5.5 with glacial acetic acid.
3. Add sterile ddH2O to final volume of 100 ml.
Phenol: chloroform (1:1)

1. Melt solid or liquified phenol in a 68°C water bath. Liquified phenol should be stored at
-20°C.
2. Mix equal volumes of phenol and chloroform.
3. Add an equal volume of 0.1 M Tris-HCl pH 7.6 to the phenol.
4. Mix for 15 minutes and place the bottle back to water bath to allow the phases to
separate.
5. Remove the top aqueous layer as much as possible.
6. Repeat step b-d until the top aqueous layer reaches ~pH 7.6 (pH should be measured with
pH paper. Do not use a pH meter.).
7. After the phenol is equilibrated, add an equal volume of 0.01 M Tris-HCl (pH 7.6).
8. Store in a dark glass bottle at 4°C up to 6 months.
D. Fast preparation of DNA template from clinical isolates
N. meningitidis and H. influenzae (gram-negative)
1. Dispense 1.0 ml of 10 mM Tris (pH 8.0) buffer into 1.5 ml microcentrifuge tubes and label.
2. Harvest colonies from 18-24 hour pure cultures of H. influenzae or N. meningitidis using a
sterile polyester or rayon-tipped swab and swirl the swab in the Tris buffer to make a turbid
suspension (equivalent to a McFarland 3.0 standard). Be careful not to pick up pieces of agar
on the swab.
3. Vortex briefly and boil cell suspension at 100oC for 10 minutes.
4. Proceed immediately with PCR or store at -20oC.
Fast DNA extraction protocol for S. pneumoniae (gram-positive)
1. Dispense 300 μl of 0.85% NaCl into 1.5 ml microcentrifuge tubes and label.
2. Harvest colonies (use 1 loopful of a 10 µl loop) from 18-24 hour pure cultures of S.
pneumoniae using a sterile polyester or rayon-tipped swab and swirl the swab in the 0.85%
NaCl to make a turbid suspension (equivalent to McFarland 3.0 standard). Be careful not to
pick up pieces of agar on swab.
118
3. Vortex briefly and incubate at 70ºC for 15 minutes.
4. Microcentrifuge at 12,000 x g for 2 minutes and remove the supernatant.
5. Re-suspend in 50 l TE buffer (10 mM Tris-HCl, 100 M EDTA, pH 8.0) and add 10 l

mutanolysin (3000 U/ ml)* and 8 l of hyaluronidase (30 mg/ml)**
6. Incubate at 37oC for 30 minutes up to 18 hours (overnight).
7. Heat-inactivate the enzymes in the suspension by boiling at 100ºC for 10 minutes.
8. Microcentrifuge at 12,000 x g for 4 minutes and remove supernatant for use as DNA
template.
*Mutanolysin (10,000 U). Dilute in 3.3 ml of TE buffer to make 3000 U/ml stock solution, store
at -20ºC as 500 µl aliquots.
**Hyaluronidase (100 mg). Dilute in 3.3 ml of TE buffer to make 30 mg/ml solution, store at -
20ºC as 500 µl aliquots.
E. Extracting genomic DNA from clinical isolates and specimens
Efficient extraction of the DNA template is a necessary step for any real-time PCR assay. The
goal of DNA extraction is to lyse the bacterial cells in the specimens to maximize bacterial DNA
yield and quality while removing any PCR inhibitors (i.e. salts, proteins), dissolve the DNA in a
buffer compatible with the enzymes used in the next step and concentrating the DNA at the same
time. When considering a DNA extraction method, it is important to select one that will produce
an adequate DNA yield for detection by real-time PCR (dependant on the assay-specific lower
limit of detection) without purifying potential PCR inhibitors as well. Things to consider are the
type and volume of specimen, nucleic acid sought (DNA or RNA), concentration of the target
DNA present in the specimen, impurities present that could act as PCR inhibitors,
facilities/equipment available, and safety requirements. Generally, methods with fewer steps
decrease chances of contamination and loss of DNA. Commercial methods are available for
both cell lysis and purification and include silica membrane, spin column, and magnetic bead
technology, in addition to biochemical and physical methods. In general, these methods produce
adequate results as long as the protocol provided by the manufacturer is precisely followed.
1. Bacterial cell lysis
The first step in extracting and purifying bacterial DNA is to lyse the bacterial cell walls for
maximum DNA yield. There are multiple ways to lyse bacterial cells, either physically or
chemically, and this step can be optimized by considering the suspected bacteria and starting
specimen material, as well as the materials available to each laboratory. Chemical or enzymatic
based lysis methods are typically simpler to perform and can be more cost efficient. Both N.
meningitidis and H. influenzae are Gram negative and can be effectively lysed using lysis buffer
119
containing protease such as Proteinase K along with a detergent. Incubation temperature and
duration vary between organisms and specimen material. The optimal temperature range for
Proteinase K activity is between 55-65°C. At temperatures above 65°C, the enzyme activity
decreases. However, specimens incubated at 37°C can be left for longer incubation periods
without affecting DNA quality. Specimens should be incubated until cells are completely lysed
(when solution clears) and the time will vary between specimens. Once the bacteria are
completely lysed one should proceed to the next step.
For optimal yields of S. pneumoniae, which is gram-positive, additional enzyme digestion with
lysozyme and mutanolysin will help to degrade the higher content of peptidoglycan in the cell
wall before being lysed with buffer. The temperature and length of the enzyme incubation will
depend on the concentration and type of enzyme used, as well as the lysis buffer used. High
temperature incubation and repeated freeze/thaw cycles are generally used with higher
concentrations of cells, such as when extracting from cultures. Physical lysis can be performed
using a liquid or pressure cell homogenizer, sonication, or shaking with glass beads, although
some of these methods will require additional and sometimes costly equipment and they tend to
shear the DNA in to smaller fragments.
Enzyme lysis for clinical specimens of unknown etiology or known gram-positive cell
suspensions (S. pneumoniae)
1. Prepare digestion buffer (0.04 g/ml lysozyme and 75 U/ml mutanolysin in TE buffer).
 This solution should be prepared ≤ 15 minutes before use and not reused.
2. Add 100 μl of digestion buffer to each microcentrifuge tube.
3. Add 200 μl of bacterial cell suspension or clinical specimen to each microcentrifuge tube.
Vortex and incubate at 37⁰C for 1 hour.
 If specimen volume is less than 200 µl, note the volume in lab records and add TE buffer to
a total volume of 200 µl. If the specimen tube appears to be empty, wash the sides of the
tube with 200 µl TE buffer.
4. Add 200 μl of cell lysis buffer to each microcentrifuge tube.
5. Add 20 μl of Proteinase K (20 mg/ml) and invert each tube until the phases are completely
mixed.
6. Incubate at 37oC for 30 minutes to 1 hour.
7. Purify DNA before using in real-time PCR reactions.
Enzyme lysis for known gram-negative clinical specimens or cell suspensions (N.
meningitidis and H. influenzae)
120
1. Prepare cell lysis buffer (4% SDS, 1 mM EDTA pH 8.0).
2. Add 200 μl of lysis buffer to each microcentrifuge tube.
3. Add 200 μl of bacterial cell suspension or clinical specimen (CSF, serum, or blood) to each
microcentrifuge tube.
4. Add 20 μl of Proteinase K (20 mg/ml) for a final concentration of 1 mg/ml and invert each
tube until the phases are completely mixed.
5. Incubate at 37oC for 30 minutes to 1 hour.
6. Purify DNA before using in real-time PCR reactions.
2. Removal of eukaryotes from blood
If DNA is being extracted from clinical specimens such as blood, CSF, or serum, considerations
should be taken to remove potential PCR inhibitors from the surrounding material before lysing
the cells. If the starting specimen is blood, steps to remove erythrocytes can results in higher
DNA yield with fewer PCR inhibitors. Hemoglobin is very inhibitory to DNA polymerases.
Erythrocytes can be removed through the use of a hypotonic buffer or by using gradient
centrifugation to create a buffy coat in which leukocytes are concentrated. Bacteria in large
volumes of clinical specimens can be concentrated by centrifugation or antigen capture to
increase yield.
Preparation of buffy coat
1. Centrifuge the blood specimen at 2,500 x g for 10 minutes at room temperature.
2. Three layers should be apparent after centrifugation. The top layer should be clear and
contains plasma. The light tan middle layer is the buffy coat and contains concentrated
leukocytes. The bottom red layer contains erythrocytes.
3. Purification of DNA
Purification of the extraction product is important to remove any residual material that could
potentially inhibit real-time PCR. Purification can be performed by many commercially
available extraction kits or with the use of organic solvents, such as the chloroform/phenol
method. Some methods may purify RNA along with DNA and as RNA may inhibit some
reactions, use of RNAase improves purity of DNA as well.
Phenol/Chloroform to remove cell debris and proteins
Phenol is a hazardous organic solvent and safety precautions should be taken when working with
phenol. Always use suitable chemical protection gloves when handling phenol containing
121
solutions. Specific waste procedures may be required for the disposal of solutions containing
phenol.
1. To a lysed specimen, add an equal volume of phenol: chloroform solution (1:1). Mix well by
inversion or briefly vortex.
2. Centrifuge the tube at 16,000 x g for 15 minutes in a microcentrifuge.
3. Carefully remove the top aqueous layer from the bottom phenol layer and transfer to a new
tube, being careful to avoid the interface.
4. Steps 1-3 can be repeated until an interface is no longer visible.
5. To remove all traces of phenol, add an equal volume of chloroform to the aqueous layer and
centrifuge the tube at 16,000 x g for 15 minutes in a microcentrifuge.
6. Carefully remove the top aqueous layer from the bottom chloroform layer and transfer to a
new tube, being careful to avoid the interface.
7. Steps 5-6 can be repeated until an interface is no longer visible.
8. Precipitate the DNA by ethanol or isopropanol.
Precipitation of DNA by ethanol or isopropanol
1. Add a 0.1 (1/10th) volume of 3.0 M sodium acetate (pH 5.5) to the aqueous phase and then 2
volumes of 95% ethanol. Incubate at -20°C overnight or for shorter periods at -80°C (e.g.
20-30 minutes). Proceed with step 3.
2. If isopropanol is used: Add a 0.1 volume of 3.0 M sodium acetate (pH 5.5) to the aqueous
phase and then 0.6 volumes of 100% isopropanol. Incubate at -20°C for 2 hours or for
shorter periods at -80°C (e.g., 10-20 minutes).
3. Centrifuge at 16,000 x g for 30 min at 4°C.
4. Recover the precipitated DNA by centrifuging the tube at 16,000 x g for 15 minutes at 4°C.
Remove the aqueous phase with care.
5. Add 2 volumes (of original sample) of 75% (v/v) ethanol and leave at room temperature for
5-10 minutes to remove excess salt and traces of phenol and chloroform from the pellet.
6. Centrifuge at 16,000 x g for 5 minutes. Remove with care as much ethanol as possible from
the microcentrifuge tube using a filtered pipette tip to avoid dislodging the pellet.
7. Dry the DNA pellet in air, in a desiccator, or in a 50°C oven for 5 minutes.
122
8. The dried DNA may be dissolved in sterile Tris buffer (10mM Tris-HCl, pH 8.0) and stored
at 4°C for further manipulation or at -20°C for long-term storage.
Storage of DNA
Extracted and purified DNA should be stored in a designated elution buffer from a commercial
kit or in Tris buffer (10 mM Tris-HCl, pH 8.0). Distilled water can also be used but these
specimens may experience degradation from acid hydrolysis. DNA can be kept at 4°C for short
periods of time and at -20°C for long-term storage.
F. Alternative protocol for genomic DNA extraction: Boom method
Reagent preparation
Extraction buffer L6
1. Add 120 g of guanidinium isothiocyanate (GuSCN) to 100 ml of 0.1 M Tris/HCl (pH 6.4)
and 22 ml of 0.2 M EDTA (pH 8.0) and 2.6 g of Triton X-100.
2. Stir overnight in the dark to dissolve.
3. Store away from light for up to 1 month.
 GuSCN is toxic and care should be taken when handling this substance.
Extraction buffer L2
1. Add 120 g of guanidinium isothiocyanate (GuSCN) to 100 ml of 0.1 M Tris/HCl (pH
6.4).
2. Stir overnight in the dark to dissolve.
3. Store away from light for 1 month.
Size fractionated silica

1. Add 60 g of silicon dioxide to 500 ml of distilled water in a graduated cylinder and leave
at room temperature for 24 hours.
2. Remove and discard 430 ml of supernatant and re-suspend solids in 500 ml of ddH2O.
3. Leave at room temperature for 5 hours and remove and discard 440 ml of supernatant.
4. Add 600 μl of concentrated HCl (pH 2.0), mix, and aliquot into 1.5 ml volumes.
5. Sterilize by autoclaving and store away from light for up to 6 months.
DNA isolation
1. Add 100 μl of specimen (bacterial suspension or clinical specimen) to 500 μl of L6 extraction

buffer and 10 μl of size fractionated silica in a 1.5 ml microcentrifuge tube. For double
volumes of specimen, double the amount of L6 extraction buffer and silica, as well as
reagents in the wash steps (L2 extraction buffer, ethanol and acetone).
2. Vortex the tube for 10 seconds and incubate, with shaking, at room temperature for 15
minutes.
3. Centrifuge the tube for 15 seconds at 16,100 x g and dispose of the supernatant.
123
4. Wash the pellet two times with 500 μl L2 extraction buffer, two times with 500 μl of 70%
ethanol and one time with 500 μl of acetone. Centrifuge for 15 seconds at 16,100 x g after
each wash and dispose of the supernatant following appropriate procedures for chemical
waste.
5. To remove the acetone, place the tube with the lid open at 56°C in a dry heating block for 5
minutes.
6. Elute the nucleic acid from the silica by adding 30 μl of distilled water, close the tube,
vortex, and incubate at 56°C for 15 minutes.
7. Centrifuge the tube at 16,100 x g for 2 minutes and collect the supernatant, taking care not to
include any silica. The extracted DNA can be stored at 4°C overnight or at -70°C for long-
term storage.
III. Conventional PCR
A. General considerations
PCR is a very sensitive method for amplifying a specific DNA target, but also very susceptible to
contamination with extraneous DNA. Extra precautions should be taken to minimize such cross-
contamination. It is recommended to physically separate the different steps including PCR
reaction assembly, addition of template DNA to the reaction wells, and agarose gel detection of
PCR products. If separate rooms are not possible, separate laboratory benches should be used
for these steps. Working in an unventilated still air biocontainment cabinet (sometimes called a
PCR hood), are also suggested to minimize cross-contamination. Separate micropipettors,
laboratory coats, and gloves should be used for reaction assembly. Signage indicating which
spaces and equipment are DNA-free and which are used to prepare or manipulate DNA would be
helpful. Decontamination of surfaces and equipment with 10% bleach followed by 70% ethanol
should be performed after any manipulation of nucleic acids at the laboratory bench. Always use
filter-barrier pipette tips and change and discard gloves frequently.
B. Equipment, consumables, and reagents
Equipment:
PCR thermocycler
Unventilated biocontainment cabinet or PCR hood
Freezer
Refrigerator
Electrophoresis tank
Power supply
Stir plate
Microwave oven
Gel viewing system
Gel documentation system
124
Consumables:
70% ethanol
1.5 mL microcentrifuge tubes (sterile DNase free or PCR grade)
96 well polypropylene plates, tube strips or individual
Optical caps
Optional:
Commercial DNA-removing surface decontaminant liquid
Cap installing tool
Reagents:
DNA polymerase
dNTPs
Primers
Positive and negative control DNA diluted to approximately 5 μg/ml
PCR grade water
TAE or TBE buffer
Agarose powder (molecular biology grade)
DNA ladder
6x DNA loading dye
Ethidium bromide
Bromophenol blue
Xylene cyanol FF
Sucrose
C. Preparing reagent stock solution and primer working solution
EDTA, 0.5 M, pH 8.0 (100 ml)

1. Dissolve 18.6 g EDTA in 70 ml ddH2O.
2. Adjust pH to 8.0 with 10 M NaOH (~5 ml).
3. Add ddH2O to 100 ml and mix well on a stir plate.
Ethidium bromide (EtBr), 10 mg/ml

1. Dissolve 0.2 g ethidium bromide in 20 ml ddH2O.
2. Mix well and store at 4˚C in the dark in 1 ml aliquots.
TAE (Tris/acetate/EDTA) electrophoresis buffer, 50 X stock solution*

1. To 750 ml of ddH2O add:
242 g Tris base
57.1 ml of glacial acetic acid
100 ml of 0.5 M EDTA pH 8.0
125
*TAE stock solution should be diluted to 1X in H2O before use.
TBE (Tris/borate/EDTA) electrophoresis buffer, 10X stock solution*

108 g Tris base (890 mM)
55 g boric acid (890 mM)
40 ml 0.5 M EDTA, pH 8.0 (20 mM)
*TBE stock solution should be diluted to 0.5X in H2O before use.
6X DNA loading dye I

1. 0.25% bromophenol blue
2. 0.25% xylene cyanol FF
3. 40% (w/v) sucrose in water
4. Store at 4°C.
6X DNA loading dye II

2. 0.25% xylene cyanol FF
3. 30% glycerol in water
4. Store at 4°C.
6X DNA loading dye III

2. 40% (w/v) sucrose in water
3. Store at 4°C.
2% agarose gel
1. Add 2 g of electrophoresis-grade agarose to 100 ml of 1X TAE or 0.5X TBE buffer in a
250 ml flask or bottle.
2. Melt the agarose in a microwave until the agarose is fully melted and the solution is clear.
Swirl the flask a few times while microwaving to avoid boiling and spilling over.
3. Cool to 55-60°C and then add 5 µl EtBr for a final concentration of 0.5 µg/ml.
 EtBr is a powerful carcinogen and must be handled with care.
Primer working stock solution
The primer working stock solution should be 20 µM.
D. Performing multiplex PCR for S. pneumoniae serotype deduction
PCR protocol
126
Prior to beginning the PCR, plan the experiment by filling out and printing a plate template
worksheet. Also, be sure sufficient quantities of primer working solutions to be used are
available.
1. Remove DNA templates and positive control DNAs from -20oC to the DNA addition area to
allow them to thaw completely.
2. In the PCR reaction assembly area, gather reagents needed for the PCR reactions, including
PCR master mix, primers, and PCR grade water. If the reagents are stored at -20oC, allow
them to thaw completely and vortex or flick each tube before use.
3. Sequential multiplex PCR reactions, based on one of the described schemes, are prepared in
standard 25 µl reaction volumes using primers and concentrations described in Table 5.
4. Each PCR reaction should contain:
200 µM (each) of deoxynucleoside triphosphates (dNTPs)

3.5 mM MgCl2
2 Units Taq DNA polymerase
Forward primer (Table 5)
Reverse primer (Table 5)
2.5 µl of DNA template from isolates (use 5 µl for clinical specimens)
PCR-grade water to 25 µl
5. A master mix can be prepared, which includes all components listed above except DNA
template. When calculating volumes of master mix reagents, remember to add enough master mix
reagents for 2 extra reactions than the number of specimens there are to be tested to ensure there will
be enough master mix.
6. Pipette 22.5 l of this master mix into each appropriate well of 96-well plate, according to
your plate template worksheet.
7. Cover the wells of the plate using cap strips. Spray down the clean workspace with 10%
bleach (10:1 water: concentrated bleach), and wipe. Repeat with 70% alcohol. Remove
laboratory coat and gloves. Put on a fresh pair of gloves. Carefully transport the 96-well
plate to the DNA addition area.
8. Put on new laboratory coat and keep the same pair of gloves on. Remove the cap strips from
the plate. Add 2.5 l of template DNA to each appropriate well of 96-well plate, according
to your plate template worksheet.
9. At least one negative and one positive control should be set up for each serotype per PCR
run.
 Negative control: add 2.5 l DNA resolving buffer to a reaction well instead of DNA
template.
127
 Positive control: add 2.5 l of DNA template that is known to contain the amplified
sequence to a reaction well.
10. Cap columns of wells as you go. Use the roller tool to secure caps tightly.
11. Wipe down the dirty workspace with 10% bleach, then 70% ethanol. Remove laboratory
coat and gloves. If possible, quickly spin the plate at 1000 rpm to bring down any droplets.
Transport plate directly to and place it in the PCR thermocycler.
12. The following PCR conditions are used:

1 cycle of 94oC for 4 minutes
30 cycles of 94oC for 45 seconds; 54ºC for 45 seconds and 72ºC for 2 minutes
1 cycle of 72ºC for 2 minutes
13. Current methodologies are detailed at the CDC website

(http://www.cdc.gov/ncidod/biotech/strep/pcr.htm).
Analysis of PCR products on an agarose gel
PCR products (10 µl) are run on 2% agarose gels to determine band sizes using positive controls.
A positive control for each serotype and a 50 bp ladder molecular size marker should be included
on each gel.
1. Melt the 2% agarose gel in a microwave oven. Cool the agar to approximately 55˚C. Add
ethidium bromide or other gel stain. Pour into a gel casting cassette, insert the comb, and
allow time for hardening (~30 minutes).
2. Add 1X TAE or TBE buffer to the electrophoresis tank and properly place the gel cassette
containing the solidified agarose gel into the tank.
3. Briefly spin the PCR plate or tubes at 500 x g to ensure all liquid is at the bottom.
4. Mix 10 µl of PCR reaction with 2 µl of 6X loading dye.
5. Pipette the DNA/loading dye mixtures into the wells. Load 5 µl of DNA size markers in one
of the wells.
6. Run the gel at 50-100 volts for 15-20 minutes or until the Bromophenol blue dye band is
halfway down the gel. The dye runs at approximately the same rate as a 500 base-pair DNA
fragment.
7. Visualize the gel under a UV light and print out or save the image, if possible.
8. Each reaction should give two bands, i.e., species-specific positive control (cpsA, although
some are cpsA negative) and a serotype-specific band.
9. Store the remainder of the amplicon at -20˚C, if necessary.
128
Interpretation
Band sizes on agarose gels must match those of positive controls before assigning a putative
serotype (Figure 5). PCR reactions are setup sequentially and will include those serotypes most
frequently determined for each of the schemes. For example, if a strain is negative for any of the
serotypes included in reaction 1 then proceed to reaction 2 and so forth until a serotype is
determined. If all reactions are completed for a specific scheme and no serotype bands were
identified that matched any of the positive controls then the strain may be a nontypeable or one
of the serotypes not yet included in the scheme and would need to be further typed using the
Quellung reaction (see Chapter 8: Identification and Characterization of Streptococcus
pneumoniae). Resolution of individual serotypes within some of the positive reactions could be
applicable in some circumstances. For example, to further resolve a PCR positive reaction for
12F/12A/44/46 (reaction 3 in Table 6), perform a Quellung reaction using type-specific antisera
to determine whether the strain has a 12F, 12A, 44, or 46 capsular type. It must be mentioned
that for practical reasons this is usually not necessary. For example, serotype 12F is commonly
detected in disease and carriage specimens, while serotypes 12A, 44, and 46 are extremely rare.
Helpful tips
The positive pneumococcal control band for cpsA can be negative in 1-2% of PCR-serotypeable
isolates. This is most often encountered in serotypes 25 and 38, but has also rarely been found
for serotypes 14 and 35A. Although a cpsA negative result is relatively rare, at present a
negative cpsA does not necessarily equate to a non-serotypeable isolate or a pneumococcus-
negative clinical specimen.
Quality control
A positive control for each serotype included in the PCR reaction(s) should be run on each gel to
ensure that bands are assigned to the correct serotype.
129
Table 2. Primers and probes used for detection of bacterial meningitis pathogens
Working
Primer or Stock Final
Probe Real-time Primers and Probes Conc Conc Suggested Probe
Target Name Nucleotide Sequence (5' to 3') (µM) (nM) Modifications
N. meningitidis
ctrA F753 TGTGTTCCGCTATACGCCATT 3.75 300
R846 GCCATATTCACACGATATACC 11.25 900
Pb820i AACCTTGAGCAA"T"CCATTTATCCTGACGTTCT 1.25 100 5' FAM, BHQ1 on "T", 3' SpC6
sodC F351 GCACACTTAGGTGATTTACCTGCAT 3.75 300

R478 CCACCCGTGTGGATCATAATAGA 7.5 600
Pb387 CATGATGGCACAGCAACAAATCCTGTTT 1.25 100 5' FAM, 3' BHQ1
H. influenzae
hpd hpdF822 GGTTAAATATGCCGATGGTGTTG 1.25 100
hpdR952 TGCATCTTTACGCACGGTGTA 3.75 300
Pb896i TTGTGTACACTCCGT"T"GGTAAAAGAACTTGCAC 1.25 100 5' FAM, BHQ1 on "T", 3' SpC6
S. pneumoniae
lytA F373 ACGCAATCTAGCAGATGAAGCA 2.5 200
R424 TCGTGCGTTTTAATTCCAGCT 2.5 200
Pb400i TGCCGAAAACGC”T”TGATACAGGGAG 2.5 200 5' FAM, BHQ1 on "T", 3' SpC6
Human DNA
RNAaseP RNAsePF CCA AGT GTG AGG GCT GAA AAG 4 400
RNAsePR TGT TGT GGC TGA TGA ACT ATA AAA GG 4 400
RNAsePPb CCC CAG TCT CTG TCA GCA CTC CCT TC 1 100 5' FAM, 3' BHQ1
130
Table 3. Primers and probes used for detection of the serogroups of N. meningitidis
Working
Nm A F2531 AAAATTCAATGGGTATATCACGAAGA 3.75 300
sacB R2624 ATATGGTGCAAGCTGGTTTCAATAG 11.25 900
Pb2591i CTAAAAG"T"AGGAAGGGCACTTTGTGGCATAAT 1.25 100 5' FAM, BHQ1 on "T", 3' SpC6
Nm B F737 GCTACCCCATTTCAGATGATTTGT 3.75 300

synD R882 ACCAGCCGAGGGTTTATTTCTAC 3.75 300
Pb839i AAGAGATGGGYAACAAC"T"ATGTAATGTCTTTATTT 1.25 100 5' FAM, BHQ1 on "T", 3' SpC6
Nm C F478 CCCTGAGTATGCGAAAAAAATT 11.25 900

synE R551 TGCTAATCCCGCCTGAATG 3.75 300
Pb495i TTTCAATGC"T"AATGAATACCACCGTTTTTTTGC 1.25 100 5' FAM, BHQ1 on "T", 3' SpC6
Nm W135 F857 TATTTATGGAAGGCATGGTGTATG 1.25 100

synG R964 TTGCCATTCCAGAAATATCACC 11.25 900
Pb907i AAATATGGAGCGAATGATTACAGTAACTATAATGAA 2.5 200 5' FAM, BHQ1 on "T", 3' SpC6
Nm X F173 TGTCCCCAACCGTTTATTGG 11.25 900

xcbB R237 TGCTGCTATCATAGCCGCC 11.25 900
Pb196 TGTTTGCCCACATGAATGGCGG 1.25 100 5' FAM, 3' BHQ1
Nm Y F787 TCCGAGCAGGAAATTTATGAGAATAC 11.25 900

synF R929 TTGCTAAAATCATTCGCTCCATAT 7.5 600
Pb1099i TATGGTG"T"ACGATATCCCTATCCTTGCCTATAAT 1.25 100 5' FAM, BHQ1 on "T", 3' SpC6
131
Table 4. Primers and probes used for detection of the serotypes of H. influenzae
Working
Hi a F261 GGT CTG CGG TGT CCT GTG T 1.25 100
acsB R427 CCG GTC ATC TTT TAT GCT CCA A 3.75 300
Pb375i TAA TTT TCT TGC “T”CA ATA CCG CCT TCC CA 1.25 100 5' FAM, BHQ1 on "T", 3' SpC6
Hi b F192 TGA TGC ATT GAA AGA AGG TGT AAT TT 3.75 300
bcsB R359 CCT GCG GTA ATA ACA TGA TCA TAA A 7.5 600
Pb244i TGT CGT GCA G”T”A GCA AAC CGT AAC CTT ACT C 1.25 100 5' FAM, BHQ1 on "T", 3' SpC6
Hi c F7667 CAT TGG TGA TGG TTC AGT TAT TGG 7.5 600
ccsD R7784 TAC AGC ATT CAG CAA TAA TGG G 3.75 300
Pb7726i ATT GCA “T”CG CCG CAG GAG TTC CCG 2.5 200 5' FAM, BHQ1 on "T", 3' SpC6
Hi d F2211 CCT AAA ATA CGG ACC TAG TGC AC 7.5 600
dcsE R2255 CCG ATG AGA CCA AGT ATG GTT A 1.25 100
Pb2221i AAC GAG C”T”A GAG CTG GTG CTG AA 3.75 300 5' FAM, BHQ1 on "T", 3' SpC6
Hi e F1523 ACT AAA ATA TGG CCC AAA CCC AC 7.5 600
ecsH R1589 CCG ATG AGC CCA AGT ATG ATG A 7.5 600
Pb1555i AAC GAG CAA AAG CCG G”T”G CGG AT 2.5 200 5' FAM, BHQ1 on "T", 3' SpC6
Hi f F7164 CCC TGA AAA GCG TTG ACT TTG 7.5 600
bexD R7313 CCA ACT TCA GGA CCA AGT CAT TC 3.75 300
Pb7242i TGC TGC TAA C”T”C AGA TGC ATC AGC TCC TT 2.5 200 5' FAM, BHQ1 on "T", 3' SpC6
132
Table 5. List of primers used for pneumococcal serotype deduction (http://www.cdc.gov/ncidod/biotech/strep/pcr.htm). Please note
that this website should be used as the primary source of primer sequences and protocols due to periodic introduced improvements.
*All serotypes that are co-detected are listed
Primer
Product
Primers* Primer sequence (5’-3’) Gene Concentration
size (bp)
(µM)
1-f CTC TAT AGA ATG GAG TAT ATA AAC TAT GGT TA wzy 0.3 280
1-r CCA AAG AAA ATA CTA ACA TTA TCA CAA TAT TGG C 0.3
2-f TAT CCC AGT TCA ATA TTT CTC CAC TAC ACC wzy 0.3 290
2-r ACA CAA AAT ATA GGC AGA GAG AGA CTA CT 0.3
3-f ATG GTG TGA TTT CTC CTA GAT TGG AAA GTA G galU 0.3 371
3-r CTT CTC CAA TTG CTT ACC AAG TGC AAT AAC G 0.3
4-f a CTG TTA CTT GTT CTG GAC TCT CGA TAA TTG G wzy 0.3 430
4-r GCC CAC TCC TGT TAA AAT CCT ACC CGC ATT G 0.3
5-f ATA CCT ACA CAA CTT CTG ATT ATG CCT TTG TG wzy 0.3 362
5-r GCT CGA TAA ACA TAA TCA ATA TTT GAA AAA GTA TG 0.3
6A/6B/6C/6D -f AAT TTG TAT TTT ATT CAT GCC TAT ATC TGG wciP 0.3 250
6A/6B/6C/6D -r TTA GCG GAG ATA ATT TAA AAT GAT GAC TA 0.3
6C/6D -f CAT TTT AGT GAA GTT GGC GGT GGA GTT wciNbeta 0.5 727
6C/6D -r AGC TTC GAA GCC CAT ACT CTT CAA TTA 0.5
7C/(7B/40)-f CTA TCT CAG TCA TCT ATT GTT AAA GTT TAC GAC GGG A wcwL 0.3 260
7C/(7B/40)-r GAA CAT AGA TGT TGA GAC ATC TTT TGT AAT TTC 0.3
7F/7A-f TCC AAA CTA TTA CAG TGG GAA TTA CGG wzy 0.4 599
7F/7A-r ATA GGA ATT GAG ATT GCC AAA GCG AC 0.4
133
Primer
Product
size (bp)
(µM)
8-f GAA GAA ACG AAA CTG TCA GAG CAT TTA CAT wzy 0.2 201
8-r CTA TAG ATA CTA GTA GAG CTG TTC TAG TCT 0.2
9N/9L-f GAA CTG AAT AAG TCA GAT TTA ATC AGC wzx 0.5 516
9N/9L-r ACC AAG ATC TGA CGG GCT AAT CAA T 0.5
9V/9A-f GGG TTC AAA G TC AGA CAG TG A ATC TTA A wzy 0.5 816
9V/9A-r CCA TGA ATG A AA TCA ACA TT G TCA GTA GC 0.5
10A-f GGT GTA GAT TTA CCA TTA GTG TCG GCA GAC wcrG 0.5 628
10A-r GAA TTT CTT CTT TAA GAT TCG GAT ATT TCT C 0.5
10F/(10C/33C)- f GGA GTT TAT CGG TAG TGC TCA TTT TAG CA wzx 0.3 248
10F/(10C/33C)-r CTA ACA AAT TCG CAA CAC GAG GCA ACA 0.3
11A/11D-f GGA CAT GTT CAG GTG ATT TCC CAA TAT AGT G wzy 0.3 463
11A/11D-r GAT TAT GAG TGT AAT TTA TTC CAA CTT CTC CC 0.3
12F/(12A/44/46)-f GCA ACA AAC GGC GTG AAA GTA GTT G wzx 0.5 376
12F/(12A/44/46)-r CAA GAT GAA TAT CAC TAC CAA TAA CAA AAC 0.5
13-f TAC TAA GGT AAT CTC TGG AAA TCG AAA GG wzx 0.4 655
13-r CTC ATG CAT TTT ATT AAC CG C TTT TTG TTC 0.4
14-f GAA ATG TTA CTT GGC GCA GGT GTC AGA ATT wzy 0.3 189
14-r GCC AAT ACT TCT TAG TCT CTC AGA TGA AT 0.3
15A/15F-f ATT AGT ACA GCT GCT GGA ATA TCT CTT C wzy 0.3 434
15A/15F-r GAT CTA GTG AAC GTA CTA TTC CAA AC 0.3
134
Primer
Product
size (bp)
(µM)
15B/15C-f TTG GAA TTT TTT AAT TAG TGG CTT ACC TA wzy 0.3 496
15B/15C-r CAT CCG CTT ATT AAT TGA AGT AAT CTG AAC C 0.3
16F-f, GAA TTT TTC AGG CGT GGG TGT TAA AAG wzy 0.4 717
16F-r CAG CAT ATA GCA CCG CTA AGC AAA TA 0.4
17F-f TTC GTG ATG ATA ATT CCA ATG ATC AAA CAA GAG wciP 0.5 693
17F-r GAT GTA ACA AAT TTG TAG CGA CTA AGG TCT GC 0.5
18/(18A/18B/18C/18F)-f CTT AAT AGC TCT CAT TAT TCT TTT TTT AAG CC wzy 0.3 573
18/(18A/18B/18C/18F)-r TTA TCT GTA AAC CAT ATC AGC ATC TGA AAC 0.3
19A-f GAG AGA TTC ATA ATC TTG CAC TTA GCC A wzy 0.3 566
19A-r CAT AAT AGC TAC AAA TGA CTC ATC GCC 0.3
19F-f GTT AAG ATT GCT GAT CGA TTA ATT GAT ATC C wzy 0.5 304
19F-r GTA ATA TGT CTT TAG GGC GTT TAT GGC GAT AG 0.5
20-f GAG CAA GAG TTT TTC ACC TGA CAG CGA GAA G wciL 0.3 514
20-r CTA AAT TCC TGT AAT TTA GCT AAA ACT CTT ATC 0.3
21-f CTA TGG TTA TTT CAA CTC AAT CGT CAC C wzx 0.2 192
21-r GGC AAA CTC AGA CAT AGT ATA GCA TAG 0.2
22F/22A-f GAG TAT AGC CAG ATT ATG GCA GTT TTA TTG TC wcwV 0.5 643
22F/22A-r CTC CAG CAC TTG CGC TGG AAA CAA CAG ACA AC 0.5
23A-f TAT TCT AGC AAG TGA CGA AGA TGC G wzy 0.5 722
23A-r CCA ACA TGC TTA AAA ACG CTG CTT TAC 0.5
135
Primer
Product
size (bp)
(µM)
23B-f CCA CAA TTA G CG CTA TAT TCA TTC AAT CG wzx 0.2 199
23B-r GTC CAC GCT GAA TAA AAT GAA GCT CCG 0.2
23F-f a GTA ACA GTT GCT GTA GAG GGA ATT GGC TTT TC wzy 0.5 384
23F-r CAC AAC ACC TAA CAC TCG ATG GCT ATA TGA TTC 0.5
24A/24B/24F-f GCT CCC TGC TAT TGT AAT CTT TAA AGA G wzy 0.2 99
24A/24B/24F-r GTG TCT TTT ATT GAC TTT ATC ATA GGT CGG 0.2
31-f GGA AGT TTT CAA GGA TAT GAT AGT GGT GGT GC wzy 0.5 701
31-r CCG AAT AAT ATA TTC AAT ATA TTC CTA CTC 0.5
33F/33A/37-f GAA GGC AAT CAA TGT GAT TGT GTC GCG wzy 0.3 338
33F/33A/37-r CTT CAA AAT GAA GAT TAT AGT ACC CTT CTA C 0.3
34-f GCT TTT GTA AGA GGA GAT TAT TTT CAC CCA AC wzy 0.3 408
34-r CAA TCC GAC TAA GTC TTC AGT AAA AAA CTT TAC 0.3
35A/35C/42-f ATT ACG ACT CCT TAT GTG ACG CGC ATA wzx 0.3 280
35A/35C/42-r CCA ATC CCA AGA TAT ATG CAA CTA GGT T 0.3
35B-f GAT AAG TCT GTT GTG GAG ACT TAA AAA GAA TG wcrH 0.5 677
35B-r CTT TCC AGA TAA TTA CAG GTA TTC CTG AAG CAA G 0.5
35F/47F-f GAA CAT AGT CGC TAT TGT ATT TTA TTT AAA GCA A wzy 0.3 517
35F/47F-r GAC TAG GAG CAT TAT TCC TAG AGC GAG TAA ACC 0.3
38/25F-f CGT TCT TTT ATC TCA CTG TAT AGT ATC TTT ATG wzy 0.3 574
38/25F-r ATG TTT GAA TTA AAG CTA ACG TAA CAA TCC 0.3
136
Primer
Product
size (bp)
(µM)
39-f TCA TTG TAT TAA CCC TAT GCT TTA TTG GTG wzy 0.2 98
39-r GAG TAT CTC CAT TGT ATT GAA ATC TAC CAA 0.2
cpsA-f GCA GTA CAG CAG TTT GTT GGA CTG ACC wzg 0.1 160
cpsA-r GAA TAT TTT CAT TAT CAG TCC CAG TC 0.1
137
Table 6. PCR-serotyping scheme for USA based on current serotype prevalence
Reaction Serotypes included

1 6A/6B/6C/6D, 3, 19A, 22F/22A, 16F
2 8, 33F/33A/37, 15A/15F, 7F/7A, 23A
3 19F, 12F/12A/44/46, 11A/11D, 38, 35B
4 24A/24B/24F, 7C/7B/40, 4, 18A/18B/18C/18F, 9V/9A
5 14, 1, 23F, 15B/15C, 10A
6 39, 10F/10C/33C, 5, 35F/47F, 17F
7 23B, 35A/35C/42, 34, 9N/9L, 31
8* 6A/6B/6C/6D, 6C/6D
*Only performed if PCR-positive for 6A/6B/6C/6D in reaction 1
Table 7. PCR-serotyping scheme for Africa based on current serotype prevalence

1 14, 1, 5, 4, 18A/18B/18C/18F
2 6A/6B/6C/6D, 19F, 23F, 38/25F, 9V/9A
3 7C/7B/40, 3, 15B/15C, 7F/7A, 17F
4 8, 12F/12A/44/46, 9L/9N, 22F/22A, 23A
5 24A/24B/24F, 2, 11A/11D, 19A, 16F
6 21, 33F/33A/37, 15A/15F, 35F/47F, 13
7 39, 23B, 35A/35C/42, 20, 35B
8 10F/10C/33C, 34, 10A, 31
9* 6A/6B/6C/6D, 6C/6D
Table 8. PCR-serotyping scheme for Latin America based on current serotype prevalence

1 14, 6A/6B/6C/6D, 23F, 19A, 9V/9A
2 19F, 3, 15B/15C, 18A/18B/18C/18F, 17F
3 1, 5, 9L/9N, 7F/7A, 16F
4 8, 2, 4, 20, 22F/22A
5 7C/7B/40, 12F/12A/44/46, 11A/11D, 10A, 23A
6 21, 33F/33A/37, 15A/15F, 35F/47F, 13
7 39, 23B, 35A/35C/42, 38/25F/25A, 35B
8 24A/24B/24F, 10F/10C/33C, 34, 31
9 6A/6B/6C/6D, 6C/6D
138
Reaction 1 Reaction 2 Reaction 3
cpsA
35B
38
19F
12F
11A
8
7F
33F
23A
15A
6
3
22F
16F
19A
Reaction 4 Reaction 5
15B Reaction 6
1
14
23F
10A
5
39
17F
10F
35F
4
24
18
7C
9V
Reaction 7 Reaction 8 Reaction 9

6C/6D
6
23B
34
31
9N
35A
2
20
21
13
Figure 5. PCR products for USA serotyping scheme detailed in Table 6
139
IV. Real-time PCR
A. Workstation for real-time PCR reaction set-up
The extremely sensitive lower limit of detection of real-time PCR assays increases the chance of
detection of cross-contamination with other DNA. Extra precautions should be taken to
minimize such cross-contamination. It is strongly recommended that reaction assembly be
performed in one room, which is designated a clean room, while DNA extraction from clinical
specimens or isolates and addition of template DNA to the reaction wells should be performed in
a separate room, which is designated a dirty room. If separate rooms are not possible, separate
laboratory benches should be used for these two steps. Working in an unventilated
biocontainment cabinet (sometimes called a PCR hood), is also suggested to minimize cross-
contamination. Use of a biological safety cabinet is necessary for infectious materials but does
not provide significant protection from amplicon cross-contamination. Separate micropipettors,
laboratory coats, and gloves should be used for DNA extraction and reaction assembly. Signage
indicating which spaces and equipment are DNA-free and which are used to prepare or
manipulate DNA would be helpful. Decontamination of surfaces and equipment with 10%
bleach followed by 70% ethanol should be done after any manipulation of nucleic acids at the
laboratory bench. Always use filter-barrier pipette tips and change and discard gloves
frequently. Even though real-time PCR is more expensive, it may be advisable to use given that
it is a closed system and has much less potential for cross-contamination of the workspace.
B. Equipment for real-time PCR analysis
The main piece of equipment needed is the real-time PCR machine. There are more than 30
different real-time PCR thermocycler models that are manufactured by 14 companies (13).
When choosing the machine to buy, be sure to consider the fluorescent filters that it will contain;
the filters in the machine must be able to detect the wavelengths of light that will be emitted by
the fluorophores conjugated to the probes. An accompanying desktop or laptop computer and
appropriate software will be necessary to view and analyze the results that are generated by the
machine. Given their replacement cost and sensitivity to damage by electrical surges, it is
strongly recommended that this machine and computer be plugged directly into a battery backup
with surge protection, to protect them from fluctuations in current, to protect your data, and to
keep the reactions running in case power is lost.
C. Consumables and reagents
Consumables:
70% ethanol
1.5 ml microcentrifuge tubes (sterile, DNase free, or PCR grade)
96 well polypropylene plates, tube strips or individual PCR tubes
Optical caps
Optional:
140
Optical adhesive film
Commercial DNA-removing surface decontaminant liquid
Cap installing tool
Reagents:
TE buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA)
Tris buffer (10 mM Tris-HCl, pH 8.0)
Commercial PCR Master Mix (containing dNTPs, DNA polymerase, and reference dye)
Primers and dual-labeled hydrolysis probes (probes contain 5' fluorophore and 3' or internal
quencher)
Positive control DNA diluted to about 5 μg/ml
PCR grade water
D. Preparing primer and probe working stocks
 The protocols, primers, and probes described in this chapter are adaptations of those previously
described (8, 35, 60).
Table 2 lists the recommended nucleotide sequences, working concentrations, and suggested
chemical modifications of the primers and probes for N. meningitidis, H. influenzae, and S.
pneumoniae species detection targeting the ctrA or sodC, hpd, and lytA genes, respectively.
Primers and probes for the detection of N. meningitidis serogroups (Table 3) and H. influenzae
serotypes (Table 4) are also given. Additional S. pneumoniae serotype assays are currently in
development. A two-tiered approach for detecting and characterizing bacterial meningitis
pathogens is recommended with the first tier being species-specific detection of N. meningitidis,
H. influenzae, or S. pneumoniae with subsequent serogroup/serotype determination of any
positive specimens (Figure 8).
Primers and probes must be diluted from concentrated stocks into working stocks. It is
convenient to dilute working stocks to concentrations that will allow 2 l of each primer and
probe to be added to the master mix per reaction. The optimized working stock concentration of
each primer and probe for the assays described here that will allow 2 l of each to be added to
the master mix is presented in the tables above.
To calculate the required dilution from concentrated stock to working stocks, use the formula:
(Concentration1)(Volume1)=(Concentration2)(Volume2). Example: A 500 l working stock of
the sacB forward primer is needed. For the purposes of this example, the sacB forward primer
has a stock concentration of 220 M. Table 3 shows that the working concentration of the sacB
forward primer should be 3.75 M; therefore the equation becomes:
(220 M is the given concentration of the concentrated stock)(x l of concentrated stock) =

(3.75 M is the desired concentration of the working stock)(500 l is the desired volume of
working stock)
Or: (220 M)(x l) / (3.75 M)(500 l)
Solve for x. x = (3.75 M)(500 l) / 220 M = (1875 M/l) / 220 M = 8.5 l of concentrated
stock.
141
Next, to calculate how much water to add to x l of concentrated stock calculated above:
l total volume of working stock - x l of concentrated stock = yl of water to add
Therefore, using the example above: l - 8.5 l = 491.5 l of water.
Of this working stock of the primer, add 2 l to the master mix per specimen to be tested.
When diluting primers and probes, it is important to use filter tips and to work in a clean space
(i.e., free of template DNA) to avoid cross-contamination of these reagents. It is optimal to use a
clean PCR cabinet or hood if one is available. Concentrated stocks of primers and probes should
be stored at -20oC. If used on a regular basis, the working stocks can be stored at 4oC. Be sure
to store probes in the dark, since they are light-sensitive (ideally, covered in aluminum foil and in
a box). Concentrated stocks of probes are especially susceptible to degradation due to their
fluorescent tags and should not be freeze-thawed more than 5 times. Primers should not be
freeze-thawed more than 20 times (46). Therefore, it is recommended that the primer and probe
stocks be aliquoted upon their arrival, before initially freezing them for longer-term storage.
The length of time for which primers and probes can be stored in this manner will vary.
Performing positive controls with each reaction will help you to determine when your primers
and probes need to be replaced.
E. Performing real-time PCR
General considerations
Before setting up the reactions, the real-time PCR machine should be turned on. For some
machines, it can take about 20 minutes for the lamp to warm up.
The high sensitivity of real-time PCR significantly increases the risk for cross-contamination.
Therefore, the following precautions are recommended:
 Separate rooms are suggested for handling DNA template (dirty room) and for handling
other reagents (clean room) to avoid cross-contamination. Post signs to designate these
areas.
 Always use barrier pipette tips.
 Always use clean laboratory coats. Use a different laboratory coat while in each of the
separate rooms. Change gloves frequently, and be sure to wear fresh gloves when moving
from the clean room to the dirty room.
 Use separate pipette sets in each room.
Assays are carried out in 25 l reaction volumes, using a commercial PCR master mix according
to the manufacturer’s instructions. Per sample to be tested, each reaction mix contains: 2 l of
DNA sample, 2 l of each primer, 2 l of probe, 12.5 l of master mix, and 4.5 l of sterile,
142
PCR-grade water. Add enough reagents for 1-2 extra reactions than the number of specimens
there are to be tested to ensure there will be enough mix.
Positive and negative controls are extremely important to ensure the laboratorian that
contamination of reagents and workspace has not generated false positives and that the assay is
detecting targets as expected. Non-template controls (NTCs) contain all reagents except for
template DNA; instead, 2 l of sterile, PCR-grade water should be added to the NTC reaction
wells. It is advisable to add water used in the clean room to at least two NTC reaction wells and
to add water used in the dirty room to at least two NTC reaction wells. If either NTC reaction
generates an amplification curve that crosses the threshold, the water from that room should be
discarded and replaced, and NTCs should be performed again to determine if other reagents are
the source of contamination. An additional control for contamination at the DNA extraction step
is the extraction of water, as suggested in the extraction protocol. If the extracted water negative
control(s) generate an amplification curve that crosses the threshold, then contamination
occurred during the DNA extraction process, and replacement of extraction reagents with new
ones and cleaning of workspace and pipettes is recommended. Positive control reactions should
be performed using DNA from known positive isolates. Dilute the positive control DNA in
order to decrease the likelihood of contamination of the PCR workspace, thereby avoiding false
positives. In summary, for each target gene to be detected (i.e., for each mix that is made up),
the following controls should be run:
 No-template negative controls (NTCs), at least in duplicate

 Extracted-water negative controls for DNA prep equipment and reagent
cross-contamination, in duplicate
 Positive control, using prepared DNA from a known isolate and running RNAse P when
using clinical specimens
A sample spreadsheet depicting the set-up of a 96-well real-time PCR plate is pictured below
(Figure 6):
143
144
Figure 6. Example PCR template sheet for the N. meningitidis, H. influenzae, and S. pneumoniae
species-specific real-time PCR assays. This example template should provide all the information
needed for the laboratorian to set up the real-time PCR assay. The template should include: the
assay(s) being run, date performed, PCR machine used, file name, cycle conditions, strain DNA
to use as positive controls, and any notes to assist the laboratorian. On the layout, each of the
wells to be used on the 96-well plate should be clearly labeled with either the specimen name or
type of control. In this case, three assays are being run on same plate and each assay is color-
coded: sodC (or ctrA) for N. meningitidis detection in pale red; hpd for H. influenzae detection in
green, and lytA for S. pneumoniae detection in blue. The non-template controls (ntc) for both the
clean and dirty rooms are done in duplicate for each assay type (more can be added if the user
deems it necessary). One positive control well should be used for each assay type and is labeled
sodC +, hpd +, and lytA +. The water extraction to control for contamination during DNA
extraction is labeled Extracted H2O. The 17 unknown specimens are labeled unk-1 to unk-17.
The panel to the right depicts the amount of reagent needed for 1 reaction and also the amount
needed to make a master mix of reagents for each assay being run. In this example, enough
Master Mix (Mmix), which is the commercial mix of DNA polymerase, dNTPs, and buffer to be
used, H2O, forward and reverse primers, and probe should be made for 25 reactions. The
number 25 was calculated from the number of wells needed for each assay plus an additional 2
wells to ensure that the user has enough master mix.
Real-time PCR protocol
 Prior to beginning, plan the experiment by filling out and printing a PCR template worksheet
(see Figure 6 for an example). Also, be sure sufficient quantities of working stocks of primers
and probes to be used are available.
1. Turn on the real-time PCR machine and make sure lamp is warming up.
2. Remove DNA preps and positive control DNA from -20oC to the dirty room/hood to thaw.
3. In the clean room/hood, gather reagents: commercial PCR master mix, primers, probes, and
PCR grade water. If they are used infrequently enough and are therefore stored at -20oC,
allow working stocks of primers and probes to thaw completely before use.
Vortex or flick each tube before using. Assemble one master mix per primer and probe set to
be used. For each extraction to be tested, the master mix should contain:
12.5 µl of master mix

4.5 µl of sterile, PCR-grade water
2 µl of forward primer
2 µl of reverse primer
2 µl of probe
23 µl total before adding 2 µl DNA
145
When calculating volumes of master mix reagents, add enough master mix reagents for 2
extra reactions to ensure there will be enough mix.
4. Pipette 23 l of this master mix into each appropriate well of a 96-well plate, according to
the plate template worksheet. Add 2 l of PCR-grade water to the clean NTC wells and then
cap only that row. Ensure that the lid is flush with the plate to avoid evaporation from wells
during PCR.
 Incorrectly capped or uncapped wells, if run in the machine, will lead to reaction failures
and could contaminate the machine. If this happens, wipe down the interior of the machine
with 70% isopropanol.
5. If available, cover plate with one-time use adhesive film. Wipe down the clean workspace
with 10% bleach (10:1 water: concentrated bleach), then 70% ethanol and turn on UV light
for 1 hour, if available. Remove laboratory coat and gloves. Put on a fresh pair of gloves.
Carefully transport the plate to the dirty room/hood.
6. Place the plate in the dirty room/hood. Put on a new laboratory coat and keep the same pair
of gloves on. If one was used, remove adhesive cover from plate.
7. According to your template worksheet, add 2 l to the appropriate well of the following in
this order:
 Template DNA
 Extracted water controls
 Dirty NTCs
 Positive control DNA
8. Cap columns of wells as you go, capping NTC control wells last. Use the roller tool to
secure caps tightly.
9. Wipe down the workspace with 10% bleach, then 70% ethanol and turn on the UV light for 1
hour, if available. Remove laboratory coat and gloves and discard the gloves.
10. If possible, spin the plate at 500 x g for a few seconds to bring down any droplets and to mix.
Transport the plate directly to and place it in the real-time PCR machine.
11. Follow the instructions for machine operation that were provided by the manufacturer. Make
sure that the machine is set to read the fluorescence of the reference dye contained in the
commercial master mix, which is often ROX, in addition to the dye conjugated to each probe
used (e.g., FAM, HEX, CY5). The cycle parameters suggested for the primers and probes
given in the table are:

50 cycles of 95oC for 15 seconds + 60oC for 1 minute
146
12. Turn off the machine lamp when the assay is complete.
F. Data analysis
Figure 7. Amplification plot generated by a real-time PCR assay. This is a graph showing a
plot of amplification cycle numbers on the X axis versus fluorescence units (dRn) on the Y axis
for each reaction. dRn is the baseline subtracted fluorescent reading normalized to the reference
dye. The green line of the fluorescence threshold is highlighted by the black arrow and the
exponential phase is highlighted by the red arrow.
The readout of the data generated by real-time PCR machines will come in two main formats:
amplification plots (Figure 7) and plate sample values. The curves that are generated should be
sigmoidal in shape, ideally plateauing as the last cycle is approached, indicating complete use of
reactants. The cycle number at which the fluorescence curve for each sample crosses the
fluorescence threshold (green line in the above graph, which is generated automatically by the
data analysis software) is referred to as the cycle threshold value, or Ct value. The plate sample
values format of data readout is simply a listing of the Ct value generated by each reaction. The
fluorescence threshold should be set higher than the negative controls and negative specimens
and should be within the start of the exponential phase (see Figure 7). In an optimal PCR
reaction running at 100% efficiency, exact doubling of the PCR product occurs at every cycle
during the exponential phase. The laboratorian should carefully examine each curve and
document all Ct values obtained. If possible, it is recommended that the electronic data files be
147
saved for each run of the real-time PCR machine, including amplification plots for future
reference.
As with any experiment, results for the unknowns cannot be evaluated without first assessing the
results for the controls. NTCs and negative controls should give “No Ct” and should produce
amplification curves that are straight lines near zero. Positive controls should give Ct values less
than 35, and the amplifications plots of the positive controls and any unknown specimens that
generate curves should all be sigmoidal. The commercial master mix used may contain a
reference dye, which is often ROX. If the real-time PCR machine is working properly, the
amplification plot and plate sample value for ROX in each reaction should resemble those of the
NTCs and negative controls. If these criteria are not met, it will be difficult to interpret the
results of the unknown samples. If this is the case, refer to the troubleshooting section below.
When determining whether to call an unknown specimen positive or negative for an etiology, the
following cutoff values are used in the Meningitis Laboratory at CDC:
Positive = Ct  35
Negative = Ct > 40
Equivocal = Ct 36-40
 Ct values  35 are considered positive and Ct values > 40 are considered negative. Those with
Ct values between 36 and 40 are considered equivocal and should be retested after diluting the
template DNA 1:4 and 1:10 in PCR-grade water to reduce any inhibitors that may be
interfering with the reaction. If the Ct value decreases to ≤35, the specimen should be
considered positive.
 The amplification plots should be analyzed to ensure they are smooth and sigmoidal in shape.
If a plot is lacking these characteristics, it should be considered negative or retested.
 Other troubleshooting suggestions are described below.
 Labs that are starting real-time PCR programs should try to pair with a reference lab to help
with QA/QC.
Commonly Used Terms
Reporter dye/fluorophore: Used to monitor PCR product accumulation.
Quencher dye: Absorbs the light energy of the excited-state reporter dye.
Reference dye: A dye, commonly ROX, which fluoresces at a constant level during the reaction.
It is used to normalize the fluorescent signal of the reporter dye. Some systems do not use a
reference dye.
148
Ct or cycle threshold: The PCR cycle number at which fluorescence measured by the instrument
is at a statistically significant level above background. The Ct is inversely proportional to the log
of the initial copy number.
Exponential phase: Phase at which exact doubling of the PCR product is accumulating at every
cycle, assuming 100 % reaction efficiency. Exponential amplification occurs because all of the
reagents are fresh and available and the kinetics of the reaction push the reaction to favor
doubling of amplicon.
R: Raw fluorescence reading in arbitrary units
Rn: Fluorescent reading normalized to the reference dye
dRn, ΔRn: Baseline subtracted fluorescent reading normalized to the reference dye
NTC (non-template control): A sample type containing all the reaction components except the
DNA template. Instead of template DNA, 2 l of sterile, PCR-grade water is added to the NTC reaction
wells. Water added in the clean room is called “clean NTC” and water added in the dirty room is called
“dirty NTC”.
Amplification plot: Graph showing a plot of amplification cycle numbers on the X axis versus
fluorescence units on the Y axis for each reaction
V. Workflow for detection of bacterial meningitis pathogens by PCR
CSF, blood, serum, etc Isolate or Trans-Isolate
Prepare DNA Template
Perform species-specific real-time PCR assays: sodC or ctrA, hpd, and lytA
If sodC (or ctrA) If hpd positive: If lytA positive:

positive: Perform serotype- Perform conventional
Perform serogroup- specific real-time PCR multiplex PCR assays to
specific real-time PCR assays for serotypes a, b, determine serotype.
assays for serogroups A, c, d, e, f.2 Use Tables 6-8 to
B, C, W135, X and Y.1 choose scheme based on
geographical region.3
149
Figure 8. Workflow for detection and characterization of bacterial meningitis pathogens by
PCR. Once DNA template is prepared from either a clinical specimen, an isolate, or from
sampling a bottle of inoculated Tran-Isolate medium, the species-specific real-time PCR assays
should be run. Any reactions positive for N. meningitis, H. influenzae, or S. pneumoniae should
be further characterized using the appropriate serogrouping or serotyping PCR assay.
1
It is not always practical to test for all serogroups for which assays are available in a
laboratory. Testing algorithms may be set up in laboratories with previous knowledge of the
predominance or lack of serogroups within that particular geographic region to test for the
most common serogroups first. Modifications may be made to the testing algorithm for any
laboratory based on information about current strains that are circulating in the region. For
example, in Africa, testing to detect serogroups A and W135 (and X in some regions) should
be adequate to characterize most specimens. Specimens reacting negatively in the A and
W135 assays should then be tested using the other available assays, particularly C, Y, X and B.
Nearly all invasive specimens are serogroupable, if they are tested against a comprehensive
panel of assays and proper controls are used.
2
It is not always practical to test for all serotypes for which assays are available in a laboratory.
If a Hib vaccination program does not exist or is fairly new, testing all hpd positive specimens
for Hib first may be adequate to characterize most specimens.
3
For bacterial isolates confirmed as S. pneumoniae by microbiological methods, conventional
multiplex PCR serotyping is used. For clinical specimens that are lytA-positive by real-time
PCR and have Ct values ≤30, conventional multiplex PCR serotyping can be used. If Ct values
are >30, then a real-time PCR serotyping approach is recommended for increased sensitivity.
VI. Troubleshooting
Cross-contamination is the number one problem in most laboratories. Due to the sensitivity of
real-time PCR, contamination is always a concern. If cross-contamination is suspected because
there are Ct counts in known negatives or NTCs, consider:
 Are separate rooms, laboratory coats, gloves, and pipettes being used for master mix
preparation versus template addition?
 Are sterile barrier-filtered tips being used?
 Are bleach and ethanol being used to clean work areas?
 Reaction tubes should not be re-opened and should be immediately discarded.
 Reaction tubes should be protected during transport from the clean room to the dirty room.
 Consumable reagents (tips, plates, caps, adhesive films, etc.) should not be reused.
 The amount of positive control DNA should be limited.
If there are high or no Ct counts in known positives, consider:
150
 Is specimen handling questioned? Was there sufficient specimen volume?
o Clinical specimens should ideally be shipped on dry ice and frozen at -70oC.
o The sample volume should ideally be at least 200 l for optimal yields.
 Was the DNA extraction process performed correctly?
o If mutanolysin and lysozyme are not used, DNA from gram-positive bacteria may not be
efficiently extracted and thus will not be detectable.
o Could any of the extraction reagents, supplies, or workspaces be contaminated?
 Are poor DNA integrity and/or inhibitors suspected?
o Dilute the template DNA 1:4 and 1:10 and repeating the reaction. If Ct values decrease
compared to undiluted, this can be indicative of an inhibitor in the DNA preparation. The
specimen should be considered positive if the Ct count is less than 35 upon repeat.
o Buffers containing phosphate such as phosphate buffered saline should be avoided as

phosphate is a strong inhibitor of PCR.
o If possible, consider sending the specimen or extraction to a reference laboratory.
o Perform human RNAaseP assay to determine if extensive DNA degradation had occurred.
o A dilution of the DNA preparation should also be assayed for RNAaseP to determine if
inhibitors are present.
 Did a power failure or electrical current surge affect your results?
o It is strongly recommended that the real-time PCR machine and associated computer be
plugged directly into a surge protector with a battery back-up.
If problems persist, contact an experienced reference laboratory for assistance.

Recommended for further reading: (7, 46).
References
1. Bentley, S. D., G. S. Vernikos, L. A. Snyder, C. Churcher, C. Arrowsmith, T.

Chillingworth, A. Cronin, P. H. Davis, N. E. Holroyd, K. Jagels, M. Maddison, S.
Moule, E. Rabbinowitsch, S. Sharp, L. Unwin, S. Whitehead, M. A. Quail, M.
Achtman, B. Barrell, N. J. Saunders, and J. Parkhill. 2007. Meningococcal genetic
variation mechanisms viewed through comparative analysis of serogroup C strain
FAM18. PLoS Genetics 3:e23.
151
2. Boisier, P., P. Nicolas, S. Djibo, M. K. Taha, I. Jeanne, H. B. Mainassara, B.
Tenebray, K. K. Kairo, D. Giorgini, and S. Chanteau. 2007. Meningococcal
meningitis: unprecedented incidence of serogroup X-related cases in 2006 in Niger.
Clinical Infectious Diseases 44:657-663.
3. Borel, T., A. M. Rose, M. Guillerm, F. Sidikou, S. Gerstl, A. Djibo, N. Nathan, S.
Chanteau, and P. J. Guerin. 2006. High sensitivity and specificity of the Pastorex latex
agglutination test for Neisseria meningitidis serogroup A during a clinical trial in Niger.
Transactions of the Royal Society of Tropical Medicine and Hygiene 100:964-969.
4. Borrow, R., H. Claus, U. Chaudhry, M. Guiver, E. B. Kaczmarski, M. Frosch, and
A. J. Fox. 1998. siaD PCR ELISA for confirmation and identification of serogroup Y
and W135 meningococcal infections. FEMS Microbiology Letters 159:209-214.
5. Borrow, R., H. Claus, M. Guiver, L. Smart, D. M. Jones, E. B. Kaczmarski, M.
Frosch, and A. J. Fox. 1997. Non-culture diagnosis and serogroup determination of
meningococcal B and C infection by a sialyltransferase (siaD) PCR ELISA.
Epidemiology and Infection 118:111-117.
6. Bundle, D. R., H. J. Jennings, and C. P. Kenney. 1974. Studies on the group-specific
polysaccharide of Neisseria meningitidis serogroup X and an improved procedure for its
isolation. Journal of Biological Chemistry 249:4797-4801.
7. Bustin, S. A. 2004. A-Z of quantitative PCR. International University Line, La Jolla, CA.
8. Carvalho, M. G., M. L. Tondella, K. McCaustland, L. Weidlich, L. McGee, L. W.
Mayer, A. Steigerwalt, M. Whaley, R. R. Facklam, B. Fields, G. Carlone, E. W.
Ades, R. Dagan, and J. S. Sampson. 2007. Evaluation and improvement of real-time
PCR assays targeting lytA, ply, and psaA genes for detection of pneumococcal DNA.
Journal of Clinical Microbiology 45:2460-2466.
9. Claus, H., R. Borrow, M. Achtman, G. Morelli, C. Kantelberg, E. Longworth, M.
Frosch, and U. Vogel. 2004. Genetics of capsule O-acetylation in serogroup C, W-135,
and Y meningococci. Molecular Microbiology 51:227-239.
10. Claus, H., M. C. Maiden, R. Maag, M. Frosch, and U. Vogel. 2002. Many carried
meningococci lack the genes required for capsule synthesis and transport. Microbiology
148:1813-1819.
11. Claus, H., U. Vogel, M. Muhlenhoff, R. Gerardy-Schahn, and M. Frosch. 1997.
Molecular divergence of the sia locus in different serogroups of Neisseria meningitidis
expressing polysialic acid capsules. Molecular and General Genetics 257:28-34.
12. Corless, C. E., M. Guiver, R. Borrow, V. Edwards-Jones, A. J. Fox, and E. B.
Kaczmarski. 2001. Simultaneous detection of Neisseria meningitidis, Haemophilus
influenzae, and Streptococcus pneumoniae in suspected cases of meningitis and
septicemia using real-time PCR. Journal of Clinical Microbiology 39:1553-1558.
13. Csako, G. 2006. Present and future of rapid and/or high-throughput methods for nucleic
acid testing. Clinica Chimica Acta 363:6-31.
14. Dolan-Livengood, J. M., Y. K. Miller, L. E. Martin, R. Urwin, and D. S. Stephens.
2003. Genetic basis for nongroupable Neisseria meningitidis. Journal of Infectious
Diseases 187:1616-1628.
15. Dolan Thomas, J., C.P. Hatcher, D.A. Satterfield, M.J. Theodore, M.C. Bach, K.B.
Linscott, X. Zhao, X. Wang, R. Mair, S. Schmink, K.E. Arnold, D.S. Stephens, L.H.
Harrison, R.A. Hollick, A.L. Andrade, J. Lamaro-Cardoso, A.P.S. de Lemos, J.
Gritzfeld, S. Gordon, A. Soysal, M. Bakir, D. Sharma, S. Jain, S.W. Satola, N.E.
152
Messonnier, and L.W. Mayer. 2011. sodC-Based Real-Time PCR for Detection of
Neisseria meningitidis. PLoS One 6:e19361.
16. Edwards, U., A. Muller, S. Hammerschmidt, R. Gerardy-Schahn, and M. Frosch.
1994. Molecular analysis of the biosynthesis pathway of the alpha-2,8 polysialic acid
capsule by Neisseria meningitidis serogroup B. Molecular Microbiology 14:141-149.
17. Falla, T. J., D. W. Crook, L. N. Brophy, D. Maskell, J. S. Kroll, and E. R. Moxon.
1994. PCR for capsular typing of Haemophilus influenzae. Journal of Clinical
Microbiology 32:2382-2386.
18. Frosch, M., U. Edwards, K. Bousset, B. Krausse, and C. Weisgerber. 1991. Evidence
for a common molecular origin of the capsule gene loci in gram-negative bacteria
expressing group II capsular polysaccharides. Molecular Microbiology 5:1251-1263.
19. Frosch, M., and A. Muller. 1993. Phospholipid substitution of capsular polysaccharides
and mechanisms of capsule formation in Neisseria meningitidis. Molecular Microbiology
8:483-493.
20. Gagneux, S. P., A. Hodgson, T. A. Smith, T. Wirth, I. Ehrhard, G. Morelli, B.
Genton, F. N. Binka, M. Achtman, and G. Pluschke. 2002. Prospective study of a
serogroup X Neisseria meningitidis outbreak in northern Ghana. Journal of Infectious
Diseases 185:618-626.
21. Ganguli, S., G. Zapata, T. Wallis, C. Reid, G. Boulnois, W. F. Vann, and I. S.
Roberts. 1994. Molecular cloning and analysis of genes for sialic acid synthesis in
Neisseria meningitidis group B and purification of the meningococcal CMP-NeuNAc
synthetase enzyme. Journal of Bacteriology 176:4583-4589.
22. Hammerschmidt, S., C. Birkholz, U. Zahringer, B. D. Robertson, J. van Putten, O.
Ebeling, and M. Frosch. 1994. Contribution of genes from the capsule gene complex
(cps) to lipooligosaccharide biosynthesis and serum resistance in Neisseria meningitidis.
Molecular Microbiology 11:885-896.
23. Hammerschmidt, S., A. Muller, H. Sillmann, M. Muhlenhoff, R. Borrow, A. Fox, J.
van Putten, W. D. Zollinger, R. Gerardy-Schahn, and M. Frosch. 1996. Capsule
phase variation in Neisseria meningitidis serogroup B by slipped-strand mispairing in the
polysialyltransferase gene (siaD): correlation with bacterial invasion and the outbreak of
meningococcal disease. Molecular Microbiology 20:1211-1220.
24. Janson, H., M. Ruan, and A. Forsgren. 1993. Limited diversity of the protein D gene
(hpd) among encapsulated and nonencapsulated Haemophilus influenzae strains.
Infection and Immunity 61:4546-4552.
25. Kroll, J. S. 1992. The genetics of encapsulation in Haemophilus influenzae. Journal of
Infectious Diseases 165 Suppl 1:S93-96.
26. Kroll, J. S., B. M. Loynds, and E. R. Moxon. 1991. The Haemophilus influenzae
capsulation gene cluster: a compound transposon. Molecular Microbiology 5:1549-1560.
27. Kroll, J. S., and E. R. Moxon. 1988. Capsulation and gene copy number at the cap locus
of Haemophilus influenzae type b. Journal of Bacteriology 170:859-864.
28. Kroll, J. S., S. Zamze, B. Loynds, and E. R. Moxon. 1989. Common organization of
chromosomal loci for production of different capsular polysaccharides in Haemophilus
influenzae. Journal of Bacteriology 171:3343-3347.
29. LaClaire, L. L., M. L. Tondella, D. S. Beall, C. A. Noble, P. L. Raghunathan, N. E.
Rosenstein, and T. Popovic. 2003. Identification of Haemophilus influenzae serotypes
153
by standard slide agglutination serotyping and PCR-based capsule typing. Journal of
Clinical Microbiology 41:393-396.
30. Lee, L. G., C. R. Connell, and W. Bloch. 1993. Allelic discrimination by nick-
translation PCR with fluorogenic probes. Nucleic Acids Research 21:3761-3766.
31. Liu, T. Y., E. C. Gotschlich, E. K. Jonssen, and J. R. Wysocki. 1971. Studies on the
meningococcal polysaccharides. I. Composition and chemical properties of the group A
polysaccharide. Journal of Biological Chemistry 246:2849-2858.
32. Masson, L., and B. E. Holbein. 1983. Physiology of sialic acid capsular polysaccharide
synthesis in serogroup B Neisseria meningitidis. Journal of Bacteriology 154:728-736.
33. Messmer, T. O., J. S. Sampson, A. Stinson, B. Wong, G. M. Carlone, and R. R.
Facklam. 2004. Comparison of four polymerase chain reaction assays for specificity in
the identification of Streptococcus pneumoniae. Diagnostic Microbiology and Infectious
Disease 49:249-254.
34. Moore, C. E., A. Sengduangphachanh, T. Thaojaikong, J. Sirisouk, D. Foster, R.
Phetsouvanh, L. McGee, D. W. Crook, P. N. Newton, and S. J. Peacock. 2010.
Enhanced determination of Streptococcus pneumoniae serotypes associated with invasive
disease in Laos by using a real-time polymerase chain reaction serotyping assay with
cerebrospinal fluid. American Journal of Tropical Medicine and Hygiene 83:451-457.
35. Mothershed, E. A., C. T. Sacchi, A. M. Whitney, G. A. Barnett, G. W. Ajello, S.
Schmink, L. W. Mayer, M. Phelan, T. H. Taylor, Jr., S. A. Bernhardt, N. E.
Rosenstein, and T. Popovic. 2004. Use of real-time PCR to resolve slide agglutination
discrepancies in serogroup identification of Neisseria meningitidis. Journal of Clinical
36. Mullis, K. B., and F. A. Faloona. 1987. Specific synthesis of DNA in vitro via a
polymerase-catalyzed chain reaction. Methods In Enzymology 155:335-350.
37. Murdoch, D. R., T. P. Anderson, K. A. Beynon, A. Chua, A. M. Fleming, R. T.
Laing, G. I. Town, G. D. Mills, S. T. Chambers, and L. C. Jennings. 2003. Evaluation
of a PCR assay for detection of Streptococcus pneumoniae in respiratory and
nonrespiratory samples from adults with community-acquired pneumonia. Journal of
38. Pai, R., R. E. Gertz, and B. Beall. 2006. Sequential multiplex PCR approach for
determining capsular serotypes of Streptococcus pneumoniae isolates. Journal of Clinical
39. Parkhill, J., M. Achtman, K. D. James, S. D. Bentley, C. Churcher, S. R. Klee, G.
Morelli, D. Basham, D. Brown, T. Chillingworth, R. M. Davies, P. Davis, K. Devlin,
T. Feltwell, N. Hamlin, S. Holroyd, K. Jagels, S. Leather, S. Moule, K. Mungall, M.
A. Quail, M. A. Rajandream, K. M. Rutherford, M. Simmonds, J. Skelton, S.
Whitehead, B. G. Spratt, and B. G. Barrell. 2000. Complete DNA sequence of a
serogroup A strain of Neisseria meningitidis Z2491. Nature 404:502-506.
40. Resti, M., M. Moriondo, M. Cortimiglia, G. Indolfi, C. Canessa, L. Becciolini, E.
Bartolini, F. M. de Benedictis, M. de Martino, and C. Azzari. 2010. Community-
acquired bacteremic pneumococcal pneumonia in children: diagnosis and serotyping by
real-time polymerase chain reaction using blood samples. Clinical Infectious Diseases
51:1042-1049.
154
41. Sadler, F., A. Fox, K. Neal, M. Dawson, K. Cartwright, and R. Borrow. 2003.
Genetic analysis of capsular status of meningococcal carrier isolates. Epidemiology and
Infection 130:59-70.
42. Saiki, R. K., S. Scharf, F. Faloona, K. B. Mullis, G. T. Horn, H. A. Erlich, and N.
Arnheim. 1985. Enzymatic amplification of beta-globin genomic sequences and
restriction site analysis for diagnosis of sickle cell anemia. Science 230:1350-1354.
43. Satola, S. W., P. L. Schirmer, and M. M. Farley. 2003. Complete sequence of the cap
locus of Haemophilus influenzae serotype b and nonencapsulated b capsule-negative
variants. Infection and Immunity 71:3639-3644.
44. Satola, S. W., P. L. Schirmer, and M. M. Farley. 2003. Genetic analysis of the capsule
locus of Haemophilus influenzae serotype f. Infection and Immunity 71:7202-7207.
45. Song, X. M., A. Forsgren, and H. Janson. 1995. The gene encoding protein D (hpd) is
highly conserved among Haemophilus influenzae type b and nontypeable strains.
Infection and Immunity 63:696-699.
46. Stratagene. 2006. Introduction to Quantitative PCR: Methods and Application Guide.
47. Suzuki, N., M. Yuyama, S. Maeda, H. Ogawa, K. Mashiko, and Y. Kiyoura. 2006.
Genotypic identification of presumptive Streptococcus pneumoniae by PCR using four
genes highly specific for S. pneumoniae. Journal of Medical Microbiology 55:709-714.
48. Swartley, J. S., J. H. Ahn, L. J. Liu, C. M. Kahler, and D. S. Stephens. 1996.
Expression of sialic acid and polysialic acid in serogroup B Neisseria meningitidis:
divergent transcription of biosynthesis and transport operons through a common promoter
region. Journal of Bacteriology 178:4052-4059.
49. Swartley, J. S., L. J. Liu, Y. K. Miller, L. E. Martin, S. Edupuganti, and D. S.
Stephens. 1998. Characterization of the gene cassette required for biosynthesis of the
(alpha1-->6)-linked N-acetyl-D-mannosamine-1-phosphate capsule of serogroup A
Neisseria meningitidis. Journal of Bacteriology 180:1533-1539.
50. Swartley, J. S., A. A. Marfin, S. Edupuganti, L. J. Liu, P. Cieslak, B. A. Perkins, J.
D. Wenger, and D. S. Stephens. 1997. Capsule switching of Neisseria meningitidis.
Proceedings of the National Academy of Sciences of the United States of America
94:271-276.
51. Swartley, J. S., and D. S. Stephens. 1994. Identification of a genetic locus involved in
the biosynthesis of N-acetyl-D-mannosamine, a precursor of the (alpha 2-->8)-linked
polysialic acid capsule of serogroup B Neisseria meningitidis. Journal of Bacteriology
176:1530-1534.
52. Taha, M.-K. 2000. Simultaneous approach for nonculture PCR-based identification and
serogroup prediction of Neisseria meningitidis. Journal of Clinical Microbiology 38:855-
857.
53. Taha, M. K., J. M. Alonso, M. Cafferkey, D. A. Caugant, S. C. Clarke, M. A. Diggle,
A. Fox, M. Frosch, S. J. Gray, M. Guiver, S. Heuberger, J. Kalmusova, K.
Kesanopoulos, A. M. Klem, P. Kriz, J. Marsh, P. Mölling, K. Murphy, P. Olcén, O.
Sanou, G. Tzanakaki, and U. Vogel. 2005. Interlaboratory comparison of PCR-based
identification and genogrouping of Neisseria meningitidis. Journal of Clinical
54. Tarrago, D., A. Fenoll, D. Sanchez-Tatay, L. A. Arroyo, C. Munoz-Almagro, C.
Esteva, W. P. Hausdorff, J. Casal, and I. Obando. 2008. Identification of
155
pneumococcal serotypes from culture-negative clinical specimens by novel real-time
PCR. Clinical Microbiology and Infection 14:828-834.
55. Tettelin, H., N. J. Saunders, J. Heidelberg, A. C. Jeffries, K. E. Nelson, J. A. Eisen,
K. A. Ketchum, D. W. Hood, J. F. Peden, R. J. Dodson, W. C. Nelson, M. L. Gwinn,
R. DeBoy, J. D. Peterson, E. K. Hickey, D. H. Haft, S. L. Salzberg, O. White, R. D.
Fleischmann, B. A. Dougherty, T. Mason, A. Ciecko, D. S. Parksey, E. Blair, H.
Cittone, E. B. Clark, M. D. Cotton, T. R. Utterback, H. Khouri, H. Qin, J.
Vamathevan, J. Gill, V. Scarlato, V. Masignani, M. Pizza, G. Grandi, L. Sun, H. O.
Smith, C. M. Fraser, E. R. Moxon, R. Rappuoli, and J. C. Venter. 2000. Complete
genome sequence of Neisseria meningitidis serogroup B strain MC58. Science 287:1809-
1815.
56. Tzeng, Y.-L., C. Noble, and D. S. Stephens. 2003. Genetic basis for biosynthesis of the
(alpha 1-->4)-linked N-acetyl-D-glucosamine 1-phosphate capsule of Neisseria
meningitidis serogroup X. Infection and Immunity 71:6712-6720.
57. Tzeng, Y. L., A. K. Datta, C. A. Strole, M. A. Lobritz, R. W. Carlson, and D. S.
Stephens. 2005. Translocation and surface expression of lipidated serogroup B capsular
Polysaccharide in Neisseria meningitidis. Infection and Immunity 73:1491-1505.
58. Vogel, U., H. Claus, and M. Frosch. 2000. Rapid serogroup switching in Neisseria
meningitidis. New England Journal of Medicine 342:219-220.
59. Waggoner-Fountain, L. A., J. O. Hendley, E. J. Cody, V. A. Perriello, and L. G.
Donowitz. 1995. The emergence of Haemophilus influenzae types e and f as significant
pathogens. Clinical Infectious Diseases 21:1322-1324.
60. Wang, X., R. Mair, C. Hatcher, M. J. Theodore, K. Edmond, H. M. Wu, B. H.
Harcourt, G. Carvalho Mda, F. Pimenta, P. Nymadawa, D. Altantsetseg, M. Kirsch,
S. W. Satola, A. Cohn, N. E. Messonnier, and L. W. Mayer. 2011. Detection of
bacterial pathogens in Mongolia meningitis surveillance with a new real-time PCR assay
to detect Haemophilus influenzae. International Journal of Medical Microbiology
301:303-309.
61. Weber, M. V., H. Claus, M. C. Maiden, M. Frosch, and U. Vogel. 2006. Genetic
mechanisms for loss of encapsulation in polysialyltransferase-gene-positive
meningococci isolated from healthy carriers. International Journal of Medical
62. Whatmore, A. M., A. Efstratiou, A. P. Pickerill, K. Broughton, G. Woodard, D.
Sturgeon, R. George, and C. G. Dowson. 2000. Genetic relationships between clinical
isolates of Streptococcus pneumoniae, Streptococcus oralis, and Streptococcus mitis:
Characterization of “atypical” pneumococci and organisms allied to S. mitis harboring S.
pneumoniae virulence factor-encoding genes. Infection and Immunity 68:1374–1382.
156
CHAPTER 11
Antimicrobial Susceptibility Testing of Neisseria meningitidis, Haemophilus

influenzae, and Streptococcus pneumoniae
Each laboratory must decide their own level of susceptibility testing to provide the essential data
for public health decision making relevant to that laboratory’s situation. N. meningitidis, H.
influenzae, and S. pneumoniae have all been associated with treatment or chemoprophylaxis
failures due to strains resistant to or with reduced susceptibility to the antimicrobials used. In
addition to monitoring for clinical or chemoprophylactic failures, surveillance of the antibiotic
susceptibility patterns in circulating strains of N. meningitidis, H. influenzae, and S. pneumoniae
is part of monitoring the emergence and spread of strains with reduced susceptibility to
antimicrobials. In order for a laboratory to successfully undertake isolation, identification, and
antimicrobial susceptibility testing responsibilities, it must participate in on-going investments in
materials, supplies, media, reagents, and quality control, along with periodic training of
personnel and quality assessment or proficiency testing. Any deviations from antimicrobial
susceptibility testing methods as described in the following pages may invalidate the test results,
especially for fastidious organisms such as N. meningitidis, H. influenzae, and S. pneumoniae.
Antimicrobial susceptibility test methods must be performed as described according to

internationally recognized clinical guidelines such as those provided by the Clinical and
Laboratory Standards Institute (CLSI) (formerly known as National Committee on Clinical
Laboratory Standards – NCCLS) (http://www.clsi.org/), which is an international,
interdisciplinary, nonprofit, educational organization that develops updated consensus standards
and guidelines for the healthcare community on an annual basis. The Comité de
l’Antibiogramme de la Société Française de Microbiologie (CA-SFM) (http://www.sfm-
microbiologie.org/) and the European Committee on Antimicrobial Susceptibility Testing
(EUCAST) (http://www.eucast.org/), whose main objectives are to harmonize breakpoints for
antimicrobial agents in Europe, to act as the breakpoint committee for the European Medicines
Agency (EMEA) during the registration of new antimicrobial agents, and to also provide
internationally recognized clinical guidelines. The overarching goals of these committees are to
provide meaningful guidelines for clinical and epidemiological interpretation of results.
There are a variety of methods by which one can determine the antimicrobial susceptibility of a
bacterial pathogen, commonly including disk diffusion, agar dilution or broth microdilution, and
antimicrobial gradient strip diffusion (14). The disk diffusion method presented in this chapter is
a modification of the Kirby-Bauer technique that has been carefully standardized by CLSI and
others. If performed precisely according to the following protocol, this method will yield data
that can reliably predict the in vivo effectiveness of the drug in question. Although disk diffusion
will provide information for most antimicrobial agents regarding interpretation of a strain as
susceptible, intermediate, or resistant, it does not provide accurate information about the minimal
inhibitory concentration (MIC). In addition, disk diffusion does not produce reliable results with
some antibiotic/organism combinations, such as for penicillin G in N. meningitidis and S.
pneumoniae. Therefore, this laboratory manual also recommends use of antimicrobial gradient
strip diffusion to gather data about the MIC of antimicrobial agents.
157
Antimicrobial gradient strips are an antimicrobial susceptibility testing method that is as
technically simple to perform as disk diffusion and produces semi-quantitative results that are
measured in micrograms per milliliter (μg/ml). It is drug-specific, consists of a thin plastic
antibiotic gradient strip that is applied to an inoculated agar plate, and is convenient in that it
applies the principles of agar diffusion to perform semi-quantitative testing. The continuous
concentration gradient of stabilized, dried antibiotic is equivalent to 15 two-fold dilutions by a
conventional reference MIC procedure as suggested by CLSI. Antimicrobial gradient test strips
have been compared and evaluated beside both the agar and broth dilution susceptibility testing
methods recommended by CLSI. Authoritative reports indicate that an ~85-100% correlation
exists between the accepted conventional MIC determinations and the MIC determined by the
test strip procedure for a variety of organism-drug combinations (2, 3, 9, 10). Some studies have
cited gradient test strip MICs as approximately one dilution higher than MICs determined by
standard dilution methods.
MIC testing can also be done by dilution; but because agar dilution and broth microdilution are
expensive and technically complex, this manual recommends that countries that do not currently
do MIC testing by dilution methods should utilize a reference laboratory rather than developing
the assay in-country. Alternatively, if resources are available, laboratories may purchase
commercially available, frozen MIC panels and follow the manufacturer’s instructions to carry
out the MIC test. It is important to note that the accuracy and reproducibility of these tests are
dependent on following standard quality control/quality assurance (QC/QA) testing procedures
and conditions in laboratories on an on-going basis.
This guide describes the optimal media, inoculum, antimicrobial agents to test, incubation
conditions, and interpretation of results for N. meningitidis, H. influenzae, and S. pneumoniae put
forth by CLSI, CA-SFM, and EUCAST. In multiple instances, the zone diameter and MIC
interpretative standards differ for the same antimicrobial between CLSI, CA-SFM, and
EUCAST. These differences arise for many reasons, including: different databases of
susceptibility data, differences in interpretation of that data, differences in both antimicrobials
and dosages used in different parts of the world, and public health policies. The interpretive
standards put forth by all 3 organizations are to be treated as guidelines and may be modified to
meet the needs of the region. It is incumbent on the laboratory and public health system to
remain alert for clinical treatment failures and trends of decreasing susceptibility to
antimicrobials, regardless of which set of interpretive standards are utilized.
I. Antimicrobial susceptibility program recommendations
Antimicrobial susceptibility testing is a resource-intensive activity requiring a significant amount

of labor, well-trained technicians, and quality control processes that must be maintained. Each
laboratory considering starting a testing program should perform a cost-benefit analysis to
determine the amount of testing that can be done without adversely affecting other laboratory
functions. While the optimal testing situation would be to perform susceptibility testing on all
incoming isolates, that is unlikely to be practical or economical. Susceptibility testing of a
subset of both endemic and epidemic isolates (i.e., every 10th isolate) would provide useful data.
During an epidemic caused by a clonal strain, testing every 25th isolate may be sufficient. These
numbers are arbitrary and may have to be revised as the epidemiologic situation changes. If an
158
isolate is found to be resistant to a given antimicrobial, it would be prudent to test more isolates
epidemiologically associated with the resistant isolate.
It is imperative that monitoring for clinical and/or chemoprophylaxis failures be performed

regardless of the amount of susceptibility testing being performed. A communication network
should be set up to allow clinicians to notify public health officials of the potential treatment
failure and to ship specimens from suspected treatment or chemoprophylaxis failures to the
reference laboratory for susceptibility testing. A mechanism must also exist to allow clinicians
and public health officials to receive the susceptibility data in a timely fashion. In addition, a
communication network should include links to pharmacies and pharmacists to monitor for
changes in prescription practices and antibiotic usage. Changes may reflect treatment and/or
chemoprophylaxis failures and may warrant further investigation.
II. Quality control for antimicrobial susceptibility testing of N. meningitidis, H. influenzae,

and S. pneumoniae
In order to ensure the validity and accuracy of the results obtained by susceptibility testing, it is
vital that a quality control (QC) system be in place in the laboratory. The goals of QC are to
verify the repeatability and accuracy of the susceptibility test being used, the performance of
reagents used in the tests, and the performance of the laboratorians performing the tests and
reading the results. Therefore, it is vital to include control organisms with known zone diameters
or MIC ranges to the antibiotics being tested. CLSI, CA-SFM, and EUCAST have
recommended strains that are to be used as quality controls for antimicrobial susceptibility tests.
See Tables 1-5 for strains and limits for both disk diffusion and MIC determination
recommended by CLSI, CA-SFM, and EUCAST. A laboratory should choose which QC
strain(s) to use based on the antimicrobials to be tested for susceptibility.
If QC testing of antimicrobial tests are performed daily for 20 or 30 days for each strain and
antimicrobial agent combination with no more than 1 out of 20 tests outside of control limits (see
Tables 1-5), then the tests can be performed once per week. Alternatively, if testing is done less
frequently, then QC testing should be performed with every group of tests. They should also be
done with each new batch of antimicrobial susceptibility test medium and every time a new lot of
disks or gradient strips are used. Note that CLSI QC and breakpoint guidelines can be found in
the document: Performance Standards for Antimicrobial Susceptibility Testing; Twenty-First
Informational Supplement (5).
A. Corrective action for out of range quality control results
Adapted from:
1. CLSI. Performance Standards for Antimicrobial Disk Susceptibility Tests; Approved

Standard—Tenth Edition. CLSI document M2-A10. Wayne, PA: Clinical and Laboratory
Standards Institute; 2009, p 27-33.
2. CLSI. Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow
Aerobically; Approved Standard – Eighth Edition. CLSI document M07-A8. Wayne, PA:
Clinical and Laboratory Standards Institute; 2009, p 32-40.
159
QC results periodically will be out of the normal range. If zone diameters or MICs produced by
the control strains are out of the expected ranges, the laboratorian should consider the following
possible sources of error:
 Antimicrobial susceptibility tests are affected by variations in media, inoculum size or

growth phase, incubation time, temperature, and other environmental factors. The
medium used may be a source of error if it fails to conform to CLSI, CA-SFM, or
EUCAST recommended guidelines. For example, agar containing excessive amounts of
thymidine or thymine can reverse the inhibitory effects of sulfonamides and trimethoprim,
causing the zones of growth inhibition to be smaller or less distinct. Organisms may
appear to be resistant to these drugs when in fact they are not. QC/QA guidelines for
preparation of the media must be closely followed.
 If the depth of the agar in the plate is not uniformly 3-4 mm, the rate of diffusion of the
antimicrobial agents or the activity of the drugs may be affected.
 If the pH of the test medium is not between 7.2 and 7.4, the rate of diffusion of the
antimicrobial agents or the activity of the drugs may be affected. Note: do not attempt to
adjust the pH of the Mueller-Hinton agar test medium if it is outside the range.
160
Table 1. CLSI recommendations for acceptable limits for quality control strains used to monitor
accuracy of Kirby-Bauer disk diffusion
Copyrighted material used with permission from the Clinical and Laboratory Standards Institute,
940 West Valley Road, Suite 1400, Wayne, PA, USA 19087, www.clsi.org.
CLSI document M100-S21; 2011, pp 114-117.
Antimicrobial Disk E. coli1 H. influenzae3 S. pneumoniae4

2
Agent Content ATCC 25922 ATCC 49427 ATCC 49619
zone diameter, nearest whole mm
Ampicillin 10 g 16-22 13-21 30-36
Ceftriaxone 30 g 29-35 31-39 30-35
Ciprofloxacin 5 g 30-40 34-42 -5
Erythromycin 15 g - - 25-30
Penicillin 10 units - - 24-30
Rifampicin 5 g 8-10 22-30 25-30
Trimethoprim- 1.25/23.75 23-29 24-32 20-28
sulfamethoxazole g
(cotrimoxazole)6
1
Values are valid for testing this QC strain on Mueller-Hinton agar without blood or other
supplements.
2
ATCC: American Type Culture Collection, Manassas, Virginia, USA. http://www.atcc.org/.
3
Values are valid for testing this QC strain on Haemophilus test medium incubated in 5% CO2
for 16-18 hr at 35°C.
4
Values are valid for testing this QC strain on Mueller-Hinton agar supplemented with 5%
defibrinated sheep blood incubated in 5% CO2 for 16-18 hr at 35°C.
5
- = no data available.
6
Trimethoprim-sulfamethoxazole is a combination of two drugs used in treatment
(cotrimoxazole). The 1:20 ratio is that at which the greatest synergy in treatment has been
demonstrated in serum. The disks are impregnated with 1.25 g trimethoprim and 23.75 g
sulfamethoxazole to mimic the 1:20 ratio.
161
Table 2. CLSI recommendations for acceptable limits for QC strains used to monitor accuracy of
minimal inhibitory concentrations (MIC)
Antimicrobial E. coli1 H. influenzae2 S. pneumoniae3

Agent ATCC 25922 ATCC 49427 ATCC 49619
(g/ml)
Ampicillin 2-8 2-8 0.06-0.25
Ceftriaxone 0.03-0.12 0.06-0.25 0.03-0.12
Ciprofloxacin 0.004-0.0154 0.004-0.03 -5
Erythromycin - - 0.03-0.12
Penicillin - - 0.25-1
Rifampicin 4-16 0.25-1 0.015-0.06
Tetracycline 0.5-2 4-32 0.06-0.5
Trimethoprim- ≤0.5/9.5 0.03/0.59-0.25/4.75 0.12/2.4-1/19
sulfamethoxazole
(cotrimoxazole)6
1
Values are valid for testing this QC strain on cation-adjusted Mueller-Hinton broth (CAMHB)
without blood or other supplements.
2
Values are valid for testing this QC strain on Haemophilus test medium broth incubated in
ambient air for 20-24 hr at 35°C.
3
Values are valid for testing this QC strain on CAMHB with lysed horse blood (2.5-5.0% v/v)
incubated in 5% CO2 or ambient air for 20-24 hr at 35°C. Note that for S. pneumoniae that is
not ATCC 49619, the plates should be incubated in ambient air.
4
QC limits are the same for ciprofloxacin if E. coli ATCC 25922 is tested in CAMHB with
lysed horse blood (2.5-5.0% v/v).
5
6
(cotrimoxazole). The greatest synergy in serum has been found when the two drugs are at a
1:20 ratio, thus the breakpoints are given at a 1/20 ratio of trimethoprim/sulfamethoxazole; i.e.,
≤0.5 g/ml trimethoprim/9.5 g/ml sulfamethoxazole.
162
Table 3. CA-SFM recommendations for acceptable limits for QC strains used to monitor
accuracy of Kirby-Bauer disk diffusion and to monitor accuracy of MIC
Kirby-Bauer disk diffusion QC limits are given for E. coli CIP 7624 and S. aureus CIP 7625 and
MIC QC limits are given for S. pneumoniae CIP 107808. Many antibiotics listed in this chapter
do not have QC limits set by CA-SFM.
Comite de L’Antibiogramme de la Société Française de Microbiologie, Société Française de

Microbiologie, Recommendations 2010, p8. More information available at http://www.sfm-
microbiologie.org/UserFiles/file/casfm_2010.pdf.
Antimicrobial Disk E. coli1 Staphylococcus S. pneumoniae4

Agent Content CIP 76242 aureus1 CIP 104485
CIP 76253
zone diameter, nearest whole mm (g/ml)
Cefotaxime 30 g 32.5-37.5 -5 0.03-0.25
Ciprofloxacin 5 g 31-38 - -
Erythromycin 15 units - 26.5-31.5 -
Penicillin G 6 g - 31-38.5 0.125-0.5
(10 units)
Rifampicin 30 g - 34.0-39.0 -
Trimethoprim- 1.25/23.75 25.5-30.5 28.0-32.5 -
(cotrimoxazole)6
1
Values are valid for testing this QC strain on Mueller-Hinton agar, McFarland 0.5, incubated
in ambient air for 20-24 h at 35-37°C.
2
CIP: Collection de Bactéries de l´ Institut Pasteur, Paris, France http://www.crbip.pasteur.fr/.
This strain is equivalent to E. coli ATCC 25922.
3
CIP: This strain is equivalent to S. aureus ATCC 25923.
4
Values are valid for testing this QC strain on Mueller-Hinton agar supplemented with 5%
sheep blood, McFarland 0.5, incubated in ambient air for 18-24 h at 35-37°C. For
cotrimoxazole, use Mueller-Hinton agar supplement with 5% haemolysed horse blood.
5
6
163
Table 4. EUCAST recommendations for acceptable limits for QC strains used to monitor
accuracy of Kirby-Bauer disk diffusion
Data is from the European Committee on Antimicrobial Susceptibility Testing (EUCAST)

website, http://www.eucast.org, version 1.3, December 2010. More information can be found at
this website.
Antimicrobial Disk E. H. S.
Agent Content coli1 influenzae3 pneumoniae5
ATCC ATCC ATCC
2 4
25922 9334 496196
zone diameter, nearest whole mm
Ampicillin 2 g -7 19-25 25-31
Ampicillin 10 g 16-22 - -
Azithromycin 15 g - - -
Benzylpenicillin 1 unit - - 15-21
Cefotaxime 5 g 25-31 29-35 28-34
Ceftriaxone 30 g 29-35 33-41 32-38
Chloramphenicol 30 g 21-27 30-38 24-30
Ciprofloxacin 5 g 30-40 31-39 22-28
Clindamycin 2 g - - 22-28
Erythromycin 15 g - 12-18 26-32
Levofloxacin 5 g 29-37 32-38 21-27
Meropenem 10 g 28-34 28-34 30-38
Nalidixic acid 30 g 22-28 27-33 -
Rifampicin 5 g - 20-26 26-32
Telithromycin 15 g - 15-21 27-33
Tetracycline 30 g 18-25 28-34 28-34
Trimethoprim- 1.25/23.75 23-29 26-34 20-26
(cotrimoxazole)8
1
Values are valid for testing this QC strain on Mueller-Hinton agar, McFarland 0.5, air, 35±1ºC,
18±2 hours.
2
Equivalent E. coli QC strains are: NCTC 12241, CIP 7624, DSM 1103, and CCUG 17620
NCTC: National Collection of Type Cultures, PHLS Central Public Health Laboratory,
London, U.K. http://www.hpacultures.org.uk/collections/nctc.jsp
CIP : Collection de Bactéries de l´ Institut Pasteur, Paris, France http://www.crbip.pasteur.fr/
DSM: DSMZ Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH,
Braunschweig, Germany http://www.dsmz.de/
CCUG: Culture Collection, University of Göteborg, Department of Clinical Bacteriology,
Göteborg, Sweden http://www.ccug.se/
3
Values are valid for testing this quality control strain on Mueller-Hinton agar with 5% horse
blood and 20 g/ml NAD, McFarland 0.5, 5% CO2, 35±1ºC, 18±2 hours.
4
Equivalent H. influenzae QC strains are: NCTC 8468, CIP 54.94, and CCUG 23946.
164
5
Values are valid for testing this QC strain on Mueller-Hinton agar with 5% horse blood and 20
g/ml -NAD, McFarland 0.5, 5% CO2, 35±1ºC, 18±2 hours.
6
Equivalent S. pneumoniae QC strains are: NCTC 12977, CIP 104340, DSM 11967, and CCUG
33638.
7
8
165
Table 5. EUCAST recommendations for acceptable limits for QC strains used to monitor
accuracy of MIC*

website, http://www.eucast.org, version 1.3, December 2010. More information can be found at
this website.
*EUCAST does not yet have established MIC QC limits for H. influenzae ATCC 9334
Antimicrobial E. coli1 S. pneumoniae3

Agent ATCC 259222 ATCC 496194
(g/ml)
Ampicillin 2-8 0.064-0.25
Azithromycin -5 0.064-0.25
Benzylpenicillin - -0.25-1
Cefotaxime 0.032-0.125 0.032-0.125
Ceftriaxone 0.032-0.125 0.032-0.125
Chloramphenicol 2-8 2-8
Ciprofloxacin 0.004-0.016 -
Clindamycin - 0.032-0.125
Erythromycin - 0.032-0.125
Levofloxacin 0.008-0.064 0.5-2
Meropenem 0.008-0.064 0.064-0.25
Nalidixic acid 1-4 -
Rifampicin - 0.016-0.064
Telithromycin 0.004-0.032
Tetracycline - 0.125-0.5
Trimethoprim- ≤0.5/9.57 0.125/2.4-1/19
sulfamethoxazole
(cotrimoxazole)6
1
Values are valid for testing this QC strain on Mueller-Hinton agar, McFarland 0.5, air, 35±1ºC,
18±2 hours.
2
Equivalent E. coli QC strains are: NCTC 12241, CIP 76.24, DSM 1103, and CCUG 17620.
3
Values are valid for testing this QC strain on Mueller-Hinton agar with 5% horse blood and 20
g/ml -NAD, McFarland 0.5, 5% CO2, 35±1ºC, 18±2 hours.
4
Equivalent S. pneumoniae QC strains are: NCTC 12977, CIP 104340, DSM 11967, and CCUG
33638.
5
6
(cotrimoxazole). The greatest synergy in serum has been found when the two drugs are at a
1:20 ratio, thus the breakpoints are given at a 1/20 ratio of trimethoprim/sulfamethoxazole; i.e.,
≤0.12 g/ml trimethoprim/2.4 g/ml sulfamethoxazole.
7
Target set by International Standard ISO 20776-1: 2006. No range available from EUCAST.
166
 If the inoculum is not a pure culture or does not contain a concentration of bacteria
that approximates the 0.5 McFarland turbidity standard, the antimicrobial
susceptibility test results will be affected. For instance, a resistant organism could appear
to be susceptible if too few bacteria are used in the inoculum. Also, even if the isolates are
susceptible, when colonies from blood agar medium are used to prepare a suspension by
the direct inoculum method, trimethoprim or sulfonamide antagonists may be carried over
and produce a haze of growth inside the zones of inhibition surrounding trimethoprim-
sulfamethoxazole (cotrimoxazole) disks. In addition, only cultures in growth phase, i.e.,
cultures grown within 20-24 hours, should be used.
If the out of range result is due to an obvious reason such as use of the wrong disk or gradient
strip, use of the wrong control strain, obvious contamination of the strain, or use of the wrong
incubation temperatures or conditions, then document the reason and retest the strain on the day
the error is observed. If the repeated result is within range, no further corrective action is
required.
If no obvious reason for the out of range result is apparent, immediate corrective action is
required. Test the out of range antimicrobial agent/organism combination on the day the error is
observed and monitor for a total of five consecutive test days and document all results. If the
results of the tests from all five days are within acceptable range, no additional corrective action
is necessary. However, if any of the five results remain out of range, then additional corrective
action is required. In the interim, daily control tests must be performed until the problem is
solved.
If immediate corrective action does not solve the problem, then other common sources of error
need to be investigated to verify that:
 Results were measured and transcribed correctly.

 The turbidity standard had not expired, was stored properly, met performance
requirements, and was adequately mixed prior to use.
 All materials, including disks and gradient test strips, used were within their expiration
dates and were stored and used at the proper temperature.
 The incubator was at the proper temperature and atmosphere.
 Other equipment used such as pipettors were functioning properly and measuring
accurately.
 The control strain had not changed and was not contaminated.
 Inoculum suspensions were prepared and adjusted correctly.
 The inoculum was used within 15 minutes of preparation.
 Inoculum for the test was prepared from a plate incubated for the correct length of time and
was not more than 24 hours old.
If necessary, obtain a new QC strain from either freezer storage or from a reliable source. New
lots of materials may be necessary, as well. It may be helpful to exchange quality control strains
and materials with another laboratory using the same method to verify results. Until the problem
is resolved, it may be necessary to use an alternative test method, if one is available.
167
III. Antimicrobial susceptibility testing of N. meningitidis
N. meningitidis does not commonly show widespread resistance to many antimicrobial agents,
though resistance to sulfonamides has become quite common (8). N. meningitidis with reduced
susceptibility to penicillin is common in many areas of the world, though the clinical
significance of this resistance has not yet been established (10, 13, 22). In addition, resistance to
rifampicin has been reported and such strains have resulted in prophylaxis and treatment failures
(16, 19, 21). Recently, sporadic resistance to ciprofloxacin, an antibiotic commonly used for
chemoprophylaxis of non-pregnant adults in many countries, has been reported throughout the
world, including Europe, South America, Australia, Asia, and North America (1, 4, 6, 18, 20,
23). Third generation cephalosporins such as ceftriaxone tend to be the empiric drugs of choice
for primary treatment in most areas of the world but ceftriaxone non-susceptible isolates have
been reported in India (12).
Susceptibility testing of N. meningitidis is difficult as a consensus has not been reached

regarding the best techniques for N. meningitidis susceptibility testing or their standardization.
The guidelines presented here must be adapted to each laboratory’s needs, capabilities, and
capacities as well as to the overarching public health requirements. This manual contains
suggested antibiotics to screen for reduced susceptibility and guidelines on how to both perform
and interpret susceptibility tests, but they should be modified and interpreted to meet the needs of
each country, region, and laboratory. CLSI, CA-SFM, EUCAST, and other international
organizations are working together to attempt to reach consensus recommendations.
A. Selection of antibiotics to screen for susceptibility
Selecting the antibiotics to screen for susceptibility is largely driven by the geographical regions
in which the isolates originate and the capacity of the laboratory. It is recommended to routinely
determine the susceptibility of circulating strains of N. meningitidis against the antimicrobials
used for primary treatment and chemoprophylaxis in the geographical region from which the
specimens originate. It may not be necessary for the laboratory to perform susceptibility testing
on all routine surveillance isolates; a random representative subset can be tested. Furthermore,
during an outbreak it is not necessary to perform susceptibility testing on all isolates.
Laboratories could also consider periodic, non-routine surveillance for characteristics such as ß-
lactamase production in penicillin or cephem class resistant strains, and ceftriaxone and
chloramphenicol resistance (if not already routinely tested), for example. These data would help
provide information to public health agencies and international reference laboratories regarding
the emergence of new N. meningitidis strains with reduced susceptibility to antimicrobials of
clinical and public health concern.
B. Biosafety precautions
Several fatal laboratory-acquired meningococcal disease cases have been reported, thus biosafety
should be a top priority (17). Biosafety Level 2 (BSL2) practices are recommended for N.
meningitidis in most countries. Whenever possible, procedures likely to generate aerosols should
be performed in a biological safety cabinet. Consider vaccination of laboratorians that work with
168
invasive meningococcal isolates, if possible, although current vaccines are not protective against
all serogroups.
C. Antimicrobial susceptibility testing of N. meningitidis by Kirby-Bauer disk diffusion
Kirby-Bauer disk diffusion is the least expensive screen for antimicrobial susceptibility testing,
but results can be difficult to interpret. These tests can be useful for screening isolates to
categorize them as susceptible, intermediate, resistant, or non-susceptible for several
antimicrobials. However, since this test does not determine MICs, it is not useful for detecting
subtle trends of decreasing susceptibility. Kirby-Bauer disk diffusion tests do not produce
reliable results for ampicillin and penicillin and false intermediate, resistant, or non-susceptible
results are seen with N. meningitidis. False intermediate or resistant results are not unusual when
testing the susceptibility of an isolate of N. meningitidis to ciprofloxacin with a 5 g
ciprofloxacin disk. Thus, results demonstrating an isolate with reduced susceptibility should be
verified using a MIC test.
Either 150-mm or 100-mm plates can be used for Kirby-Bauer disk diffusion depending on the
number of antimicrobial agents to be tested per isolate. CLSI guidelines state that no more than
two disks can be used on a 100-mm plate and up to five disks can be used on a 150-mm plate
(Figure 1). Mueller-Hinton with 5% sheep blood agar with a depth of 4 mm is used when testing
N. meningitidis isolates using this method.
169
Growth
Antimicrobial
disk
ATB ATB
1 2
ATB
3
Zone of
inhibition ATB ATB
4 5
(no growth)
50
40
30
20
10
Use a ruler with a handle

if calipers are unavailable
Figure 1. The antimicrobial susceptibility disk diffusion test: approximate disk placement and
measurement of inhibition zone diameters.
ATB1 = antibiotic 1, ATB2 = antibiotic 2, etc
Isolates to be tested should be subcultured onto a chocolate agar plate and incubated in a CO2-
enhanced atmosphere (5% CO2 in a CO2-incubator or candle-extinction jar) at 35±2°C for 20-24
hours prior to testing. If the organism has been frozen, it should be subcultured twice when it is
removed from the freezer before proceeding with susceptibility testing.
Remove agar plates from the refrigerator and allow them to come to room temperature (25°C)
before inoculating. Warm the cation-adjusted Mueller-Hinton broth (CAMHB) to 35°C before
using. Allow the antibiotic disks that will be used in the batch of testing to warm to room
temperature (25°C).
1. Using a sterile cotton-tip applicator, touch the surface of one to four morphologically
identical, isolated colonies. Immerse the applicator into a tube containing sterile CAMHB.
Rub the applicator against the wall of the tube slightly to release a small amount of growth
into the liquid. Cap the tube and mix the cells using a vortex to form a suspension, being
careful not to form froth or bubbles in the suspension when mixing the cells. Adjust the
170
turbidity of the inoculum to that of a 0.5 McFarland turbidity standard (approximately 1 to 4
x 108 CFU/ml). Preparation of a McFarland turbidity standard is described in the Annex. If
the turbidity of the inoculum is greater than the standard, dilute it with CAMHB to equal the
turbidity of the standard. This suspension must be used within 15 minutes.
 Perform regular colony counts to verify that the density of the inoculum suspension is
correct. For example, dilute the suspension 1:100 and subculture 10 µl onto the
recommended media. An acceptable inoculum should give approximately 100-500
colonies. It is not necessary to perform colony counts on every isolate tested.
2. Immerse a sterile cotton-tipped swab into the adjusted inoculum. Remove excess liquid by
pressing the swab tip against the inside of the tube. Inoculate the entire surface of a blood
agar plate three times with the same swab of inoculum, rotating the plate 60 degrees after
each inoculation to ensure even distribution of the inoculum and confluent growth of the
bacteria. Use a single swab of inoculum and do not return the swab to the broth after each
rotation.
3. Allow the inoculum to dry on the surface of the plate (which should take approximately 5-10
minutes). Be sure the plate is entirely dry before proceeding, but do not exceed 15 minutes.
4. When the surface of the inoculated plate is dry and the disks are at room temperature, place
the disks onto the agar with an applicator or sterile forceps. Make sure that the disks are
spaced enough distance apart on the agar so the zones of inhibition do not overlap (Figure 1).
Press down on the disks to ensure complete contact with the agar surface. Alternatively, a
mechanical disk dispenser can be used. Once applied, it is important to not move the
antibiotic disks as the antibiotic will begin to diffuse immediately upon contact with the
plate.
5. Incubate the plates in an inverted position in a 5% CO2 atmosphere or candle jar for 20-24
hours at 35±2°C.
6. After overnight incubation, measure the diameter of each zone of inhibition with a ruler or
calipers (Figure 2). Measurements should be performed in a biosafety cabinet, if possible.
The zones of inhibition on the media containing blood are measured from the top surface of
the plate with the top removed. Use either calipers or a ruler with a handle attached for these
measurements, holding the ruler over the center of the surface of the disk when measuring
the inhibition zone (Figures 1 and 2).
 Care should be taken not to touch the disk or surface of the agar. Decontaminate the ruler
occasionally to prevent transmission of the bacteria. In all measurements, the zones of
inhibition are measured as the diameter from the edges of the last visible colony of the
unaided eye. Record the results to the nearest millimeter (mm).
7. Interpret the antimicrobial susceptibility of the strain being tested (and check that results for
the QC strains are within the acceptable control range) by comparing the results to the CLSI
171
(Table 6) or CA-SFM (Table 7) standard zone sizes. See Figure 3 for a sample worksheet for
recording antimicrobial susceptibility test results for N. meningitidis.
Figure 2. Images showing proper measurement of zone diameter. In the case of an isolate
completely resistant to the antimicrobial, simply measure the diameter of the disk: 6 mm (left).
When there is a zone of inhibition, measure the diameter as shown: 16 mm (right).
172
Date of Testing: ______/____/______
Test performed by:__________________ Interpretation of susceptibility: S= susceptible I= intermediate R= resistant
Specimen Meningitis Organism Antibiotic #1 Antibiotic #2 Antibiotic #3 Antibiotic #4
number Isolate?
mm mm mm mm
µg/ml µg/ml µg/ml µg/ml
S I R S I R S I R S I R
mm mm mm mm
mm mm mm mm
mm mm mm mm
mm mm mm mm
QC strain N/A QC strain mm mm mm mm
Yes No Yes No Yes No Yes No
Figure 3. Sample sheet for recording data and quality control information. Note: After 20-24 hours of incubation, check the results for
the QC strain(s) against the standard acceptable ranges; if they are within control limits, continue reading results for the test isolate.
Record disk diffusion results in mm and MIC results in µg/ml. Inhibition zone ranges and breakpoints for interpretation of results
may be found in Tables 1-5, depending on the QC strains used and the guidelines being followed.
173
Table 6. Kirby-Bauer disk diffusion zone diameter interpretive standards and MIC interpretive
standards for N. meningitidis as recommended by CLSI
Antimicrobial Disk Zone Diameter, MIC Interpretive

Agent/Class Content nearest whole mm Standard (g/ml)
S I R S I R
PENICILLINS
Penicillin1 -2 - - ≤ 0.06 0.12- ≥ 0.5
0.25
CEPHEMS
Ceftriaxone3 30 g ≥ 34 - - ≤ 0.12 - -
MACROLIDES
Azithromycin3,4, 5 15 g ≥ 20 - - ≤2 - -
FLUOROQUINOLONES
Ciprofloxacin4 5 g ≥ 35 33-34 ≤ 32 ≤ 0.03 0.06 ≥ 0.12
PHENICOLS
Chloramphenicol6 30 g ≥ 26 20-25 ≤ 19 ≤2 4 ≥8
ANSAMYCINS
Rifampicin3 5 g ≥ 25 20-24 ≤ 19 ≤ 0.5 1 ≥2
1
Disk diffusion tests with penicillin for N. meningitidis are unreliable. MIC tests should be used
for this organism.
2
3
For some antimicrobial agents, the absence or rare occurrence of resistant strains precludes
defining any results categories other than “susceptible”.
4
May be appropriate only for prophylaxis of meningococcal case contacts. These breakpoints
do not apply to therapy of patients with invasive meningococcal disease. Recently, it has been
suggested that screening for reduced susceptibility to ciprofloxacin using a 30 ug nalidixic acid
disk is useful for detecting meningococcal quinolone-resistant strains associated with gyrA
mutations (7).
5
Interpretive criteria were developed initially using MICs determined by incubation in ambient
air for the pharmacodynamic calculations.
6
Not routinely reported on isolates from the urinary tract.
174
Table 7. Kirby-Bauer disk diffusion zone diameter interpretive standards and MIC interpretive
standards for N. meningitidis as recommended by CA-SFM
Comite de L’Antibiogramme de la Société Française de Microbiologie, Société Française de

Microbiologie, Recommendations 2010, p 44. More information available at: http://www.sfm-
microbiologie.org/UserFiles/file/casfm_2010.pdf.

Agent/Class Content nearest whole mm Standard (g/ml)
S R S R
PENICILLINS
Penicillin G1 -2 - - ≤ 0.06 > 0.25
Amoxicillin1 - - - ≤ 0.12 >1
5 g
1
Oxacillin ≥ 18 - - -
CEPHEMS
Cefotaxime2 30 g - - ≤ 0.12 -
2
Ceftriaxone 30 g - - ≤ 0.12 -
PHENICOLS
Chloramphenicol 30 g ≥ 30 - ≤2 >4
ANSAMYCINS
Rifampicin3 30 g ≥ 30 - ≤ 0.25 -
FLUOROQUINOLONES
Ciprofloxacin - - - ≤ 0.03 > 0.06
1
Disk diffusion tests with amoxicillin and penicillin G for N. meningitidis are unreliable.
Testing can be performed using 5 g/ml oxacillin disks. Diameters of ≥ 18 mm are sensitive to
penicillin G, but the MICs against penicillin G and/or amoxicillin should be determined for
those diameters of < 18 mm.
2
3
Used only for prophylaxis.
175
Table 8. MIC interpretive standards for N. meningitidis as recommended by EUCAST

website. http://www.eucast.org, version 1.3, December 2010.
EUCAST does not yet have interpretive guidelines for Kirby-Bauer disk diffusion for N.
meningitidis.
Antimicrobial MIC (g/ml)

Agent/Class Interpretive Standard
S R
PENICILLINS
Benzylpenicillin ≤ 0.064 > 0.25
Ampicillin ≤ 0.125 > 1.0
CEPHEMS
Cefotaxime1 ≤ 0.125 > 0.125
1
Ceftriaxone ≤ 0.125 > 0.125
CARBAPENEMS
Meropenem1,2 ≤ 0.25 > 0.25
ANSAMYCINS
Rifampicin ≤ 0.25 > 0.25
TETRACYCLINES
Tetracycline3 ≤ 1.0 > 2.0
FLUOROQUINOLONES
Ciprofloxacin4 ≤ 0.032 > 0.064
PHENICOLS
Chloramphenicol ≤ 2.0 > 4.0
1
Strains with MIC values above the susceptible breakpoint are very rare or not yet reported.
The identification and antimicrobial susceptibility tests on any such isolate must be repeated
and if the result is confirmed, the isolate should be sent to a reference laboratory. Until there is
evidence regarding clinical response for confirmed isolates with MIC above the current
resistant breakpoint they should be reported resistant.
2
These breakpoints relate to meningitis only.
3
Tetracycline can be used to determine minocycline susceptibility for prophylaxis of N.
meningitidis infections.
4
Breakpoints apply only to use in the prophylaxis of meningococcal disease.
176
D. Minimal inhibitory concentration testing of N. meningitidis by antimicrobial gradient
strips
Either 150-mm or 100-mm plates can be used for the gradient strip testing, depending on the
number of antimicrobial agents to be tested per isolate. Two different gradient strips can be
placed in opposite gradient directions on a 100-mm plate (Figure 4). Although one manufacturer
states that up to six gradient strips can be used on a 150-mm plate, this laboratory manual
suggests that in order to avoid overlapping zones of inhibition of growth, not more than five
gradient strips be used on a 150-mm plate, with the end with the lowest concentration of
antibiotic placed towards the center of the plate (Figure 5). Depending on the
bacteria/antimicrobial combinations, five strips on a 150-mm plate may lead to overlapping
ellipses. If this occurs, testing should be repeated using four strips per plate.
Isolates to be tested should be subcultured onto a chocolate agar plate and incubated in a CO2-
Mueller-Hinton agar with 5% sheep blood is used when testing N. meningitidis isolates with
gradient strips. Warm the cation-adjusted Mueller-Hinton broth (CAMHB) to 35°C before
using. Allow the gradient strips that will be used in the batch of testing to warm to room
temperature (25°C). It is recommended to follow the directions on the package insert included
with the gradient strips.
x108 CFU/ml). Preparation of a McFarland turbidity standard is described in the Annex. If
pressing the swab tip against the inside of the tube. Inoculate the entire surface of a 15x150-
mm Mueller-Hinton agar with 5% sheep blood plate three times with the same swab of
inoculum, rotating the plate 60 degrees after each inoculation to ensure even distribution of
the inoculum and confluent growth of the bacteria. Use a single swab of inoculum and do
not return the swab to the broth after each rotation.
177
T
Figure 4. Placement of gradient strips on a 100-mm agar plate. Gradient strips are placed in
opposite orientation. “T” represents the top of the gradient strip.
178
T
T
T
T
T
Figure 5. Placement of gradient strips on a 150-mm agar plate. Area of lowest antibiotic
concentration should be oriented towards the center of the plate. “T” represents the top of the
gradient strip.
179
minutes). Be sure the plate is entirely dry before proceeding.
4. When the surface of the inoculated plate is dry and the gradient strips are at room
temperature, place the antimicrobial gradient strips onto the agar with an applicator or sterile
forceps. Make sure that the printed MIC values are facing upward (i.e., that the bottom
surface of the strip containing the antimicrobial gradient is in contact with the agar).
Alternatively, robotic gradient strip applicators are available from some manufacturers.
Once applied, it is important to not move the antimicrobial gradient strips as the antibiotic
diffuses into the agar immediately upon contact.
 Return the antimicrobial gradient strips that will not be used in this batch of testing to the
-20°C freezer (some strips can be stored at 4°C. Follow the manufacturer’s instructions).
5. Incubate the plates in an inverted position in a 5% CO2 atmosphere for 18–22 hours at 37°C.
A candle-extinction jar may be used if a CO2-incubator is not available. Because N.
meningitidis grows well in a humid atmosphere, laboratorians may choose to add a shallow
pan of sterile water to the bottom of the incubator or add a dampened paper towel to the
candle-extinction jar.
6. After incubation, an ellipse of bacterial growth will have formed on the plate around the strip
and the test can be read (see below). QC results must be reviewed before reading and
interpreting the MIC.
Reading and interpreting the gradient strips
Read the MIC at the point where the zone of inhibition intersects the MIC scale on the strip. Use
oblique light to carefully examine the end point. A magnifying glass may be used if needed.
Read at the point of complete inhibition of all growth including hazes. A reading guide for the
gradient strips, which shows organism related effects, drug-related effects, resistance
mechanism-related effects, and technical and handling effects can be found at:
http://www.abbiodisk.com/pdf/pi/75002206.pdf.
Record the QC results first. If zones produced by the QC strain are out of the expected ranges
(see Tables 2, 3, and 5, depending on the strains and guidelines being used), the laboratorian
should consider possible sources of error. Because antimicrobial susceptibility test results can be
affected by many factors not necessarily associated with the actual susceptibility of the organism
(e.g., inoculum size, growth phase, agar depth, storage, time, and others), QC practices must be
followed carefully (see Section II above). If all antimicrobial agents are in the control range,
read the test MICs. Note any unusual observations such as a zone of incomplete killing (trailing
endpoints) or single colonies growing within the ellipse.
The gradation marks on the gradient strip correspond to the standard 2-fold dilution
concentrations for the agar dilution method, but also include increments between those standard
values. The standard values are used for interpretation and reporting of antimicrobial
susceptibility test results. It is advised that both the actual reading of the value from the strip and
180
the next-higher standard value (i.e., the value to be used for interpretation) be included in the
laboratory records for testing of the strain. For example, if testing susceptibility of an isolate to
penicillin, an MIC recorded from the gradations on the gradient strip might be 0.094 μg/ml;
however, the reported MIC would be 0.125 μg/ml.
The manufacturer of the gradient strips recommends following the MIC breakpoints developed
for agar and broth microdilution. The interpretive standards and MIC breakpoints recommend
by CLSI (Table 6), CA-SFM (Table 7), and EUCAST (Table 8) are given.
IV. Antimicrobial susceptibility testing of H. influenzae
This laboratory manual describes susceptibility testing of H. influenzae by the disk diffusion
method and by the antibiotic gradient strip testing method. Although disk diffusion will provide
information as to whether a strain is susceptible, intermediate, or resistant, the gradient strip
method provides more detailed information about the minimal inhibitory concentration (MIC) of
an antimicrobial agent. In addition, testing for strains employing a -lactamase will be
described.
The -lactamase usually observed circulating in H. influenzae is a TEM-type -lactamase, which

inactivates some antibiotics belonging to the -lactam family such as penicillin, ampicillin, and
amoxicillin, but, fortunately, does not inactivate third generation cephalosporins such as
ceftriaxone or cefotaxime. This -lactamase is inhibited by clavulanic acid. However, as
clavulanic acid does not cross the blood-brain barrier well, the association of amoxicillin and
clavulanic acid must not be employed for the treatment of a meningitis due to H. influenzae. In
this case, ceftriaxone or cefotaxime have to be recommended. Resistance due to a reduction of
affinity to the Penicillin Binding Protein (PBP) is rare but has been reported (3).
A. Testing H. influenzae for -lactamase production
A rapid -lactamase test may yield clinically relevant information earlier than the results of
antimicrobial susceptibility testing, so it should be performed as soon as a H. influenzae is
identified.
1. Nitrocefin-based tests are the preferred method. The reagent is composed of paper disks
impregnated with chromogenic cephalosporin, which releases a red compound on hydrolysis
by a -lactamase.
Performing the test: The disks can be stored in their cartridge at 2-8°C until the expiration
date. After opening the cartridge, disks can be stored for 2 months at 2-8°C.
a. Allow the tube containing the cartridge to come to room temperature (25°C).
b. Moisten a disk with sterile distilled water.
c. Collect a few isolated colonies of the strains to be tested and spread them over the surface
of the disk.
181
Reading and interpretation
The appearance of a red color reveals a positive reaction.

The reaction is negative if no color has appeared after 30 minutes.
Quality control strains
Staphylococcus aureus ATCC 29213 result +

Enterococcus faecalis ATCC 29212 result -
2. A modified acidometric agar plate method can test H. influenzae for the presence of -
lactamase activity (11, 15). Penicillin and phenol are combined in a non-nutrient plate; the
pH indicator detects increased acidity resulting from the cleavage of the -lactam ring of
penicillin that yields penicilloic acid and leads to a color change in the agar.
a. Using a loop, harvest several isolated colonies and place in a spot on the plate (penicillin
+ phenol).
b. Apply known -lactamase positive and negative control strains.
c. Incubate in ambient air at 37°C for 15 min.
d. Observe the plate for color change in the agar surrounding each discretely spaced colony.
The agar surrounding the positive control strain should be yellow, whereas the agar
surrounding the negative control strain should not exhibit any change in color.
Interpretation of the results
A positive -lactamase test predicts that the H. influenzae isolate is resistant to penicillin,
ampicillin, and amoxicillin. In cases of meningitis, ceftriaxone or cefotaxime should be
recommended to treat the patient. If results of susceptibility testing indicate resistance to a
penicillin-class antibiotic and the isolate is negative for β-lactamase, those results do not rule
out resistance due to other mechanisms, such as reduction of affinity in the PBP. Reduction
of affinity in PBP is unusual in H. influenzae and the presence of such a mechanism can be
detected using a 30 µg cefalotin disk (zone diameter < 17 mm) or a 2 µg ampicillin disk
(zone diameter < 20 mm). In these cases, activity of third generation cephalosporins is only
weakly affected.
B. Antimicrobial susceptibility testing of H. influenzae by Kirby-Bauer disk diffusion
The antibiotic susceptibility testing of H. influenzae using the disk diffusion method will provide
information as to whether a strain is susceptible, intermediate, or resistant to an antimicrobial.
Dilution methods or antimicrobial gradient strips can be used to accurately determine the MICs
to antimicrobials, but are not necessarily better than disk diffusion in providing reliable
information about determining whether the isolate is susceptible, intermediate, or resistant to an
182
antimicrobial. Laboratories must use standardized procedures to guarantee the accuracy and
reproducibility of antibiotic susceptibility testing.
Media and disks for antimicrobial susceptibility testing
For H. influenzae, antimicrobial susceptibility can be determined using the disk diffusion
method. The method presented in this chapter is a modification of the Kirby-Bauer technique
that has been standardized by CLSI. If performed precisely according to the following protocol,
this method will provide data that can reliably predict the in vivo effectiveness of the drug in
question. The accuracy and reproducibility of this test is dependent on the consistent use of a
standard set of procedures in the laboratory.
The optimal medium is Haemophilus test medium (HTM). The Mueller-Hinton agar used to
make HTM should be thymidine free to obtain consistent results if susceptibility to
cotrimoxazole is to be tested. HTM medium consists of the following ingredients: Mueller-
Hinton agar supplemented with 15 µg/ml NAD, 15 µg/ml bovine hemin, and 5 mg/ml yeast
extract. The pH is adjusted to 7.2 to 7.4. Recommended agents tested are ampicillin, ceftriaxone
and/or cefotaxime, and chloramphenicol, which are antibiotics commonly used for the treatment
of meningitis.
The 10 µg-ampicillin disk predicts both intrinsic (PBP-mediated) and -lactamase mediated
penicillin and ampicillin resistance of H. influenzae. A 30 µg-chloramphenicol disk is used for
predicting resistance to chloramphenicol, and a 30 µg-ceftriaxone and/or cefotaxime disk is used
for predicting susceptibility to these antibiotics. The zone diameter sizes can only be properly
interpreted when HTM is used. The results have to be compared to standards that have been
validated, such as those recommended by CLSI (Table 9), CA-SFM (Table 10), and EUCAST
(Table 11).
Quality control
QC tests should be performed once per week if susceptibility tests are performed daily or with
every group of tests when testing is done less frequently than every day. QC tests have to be
done for each new batch of test medium or new lot of disks. If the results found for the control
strain are accurate, the procedure is assumed to be correct. If this is not the case, the tests can be
affected by variation in media, inoculum size, incubation time, temperature, the depth of the agar
in the plate (uniformly 3-4 mm), the pH (between 7.2-7.4), disk potency, the purity of the culture
for inoculum, or if the concentration of bacteria does not approximate the 0.5 McFarland
turbidity standard. CLSI, CA-SFM, and EUCAST list recommended QC strains and test limits
(Tables 1, 3, and 4). A laboratory should choose which QC strain(s) to use based on the
antimicrobials to be tested for susceptibility.
183
Table 9. Kirby-Bauer disk diffusion zone diameter interpretive standards and MIC interpretive standards for H. influenzae as
recommended by CLSI
Copyrighted material used with permission from the Clinical and Laboratory Standards Institute, 940 West Valley Road, Suite 1400,
Wayne, PA, USA 19087, www.clsi.org.

Agent/Class Content Nearest Whole mm Standard (g/ml)
S I R S I R
PENICILLINS
Ampicillin1 10 g ≥ 22 19-21 ≤ 18 ≤1 2 ≥4
CEPHEMS
Cefotaxime2 30 g ≥ 26 - - ≤2 - -
Ceftriaxone2 30 g ≥ 26 - - ≤2 - -
PHENICOLS
Chloramphenicol 30 g ≥ 29 26-28 ≤ 25 ≤2 4 ≥8
1
In most cases, a direct -lactamase test can provide a rapid means of detecting ampicillin and amoxicillin resistance. The majority
of isolates of H. influenzae that are resistant to ampicillin and amoxicillin produce a TEM-type -lactamase.
2
For some antimicrobial agents, the absence or rare occurrence of resistant strains precludes defining any results categories other than
“susceptible”.
184
Table 10. Kirby-Bauer disk diffusion zone diameter and MIC interpretive standards for H. influenzae as recommended by CA-SFM
Comite de L’Antibiogramme de la Société Française de Microbiologie, Société Française de Microbiologie, Recommendations 2010,
pp 42-43. More information available at http://www.sfm-microbiologie.org/UserFiles/file/casfm_2010.pdf.
Antimicrobial Disk Zone Diameter, MIC (g/ml)

Agent/Class Content Nearest Whole mm Interpretive Standard
S R S R
PENICILLINS
Ampicillin1,2 2 g ≥ 20 < 20 ≤1 >1
CEPHEMS
Ceftriaxone or - - - ≤ 0.12 -
Cefotaxime3
PHENICOLS
Chloramphenicol 30 g ≥ 30 < 26 ≤1 >2
1
A positive direct chromogenic -lactamase test predicts resistance to penicillin, ampicillin, and amoxicillin.
2
-lactamase-negative, ampicillin-resistant (BLNAR) strains are rare, but detection of decreased susceptibility to beta-lactams in
BLNAR strains is possible using a 2 µg ampicillin disk (diameter < 20 mm) or a 30 µg cephalothin disk (diameter < 17 mm).
3
Neither clinical failure nor resistance has been reported for these antimicrobial agents, thus the criteria for interpretative breakpoints
has not been established for any category other than susceptible.
185
Table 11. Kirby-Bauer Disk Diffusion Zone Diameter and MIC Interpretive Standards for H. influenzae as Recommended by
EUCAST
Data from the European Committee on Antimicrobial Susceptibility Testing (EUCAST) website. http://www.eucast.org. Version 1.3,
December, 2010.
Antimicrobial Disk Zone Diameter, MIC (g/mL)

Agent/Class Content Nearest Whole mm Interpretive Standard
S R S R
PENICILLINS
Ampicillin1,2 2 g ≥ 16 < 16 ≤1 >1
CEPHEMS
Cefotaxime3 5 g ≥ 22 < 22 ≤ 0.125 -
Ceftriaxone3 30 g ≥ 27 < 27 ≤ 0.125 -
PHENICOLS
Chloramphenicol 30 g ≥ 30 < 26 ≤1 >2
1
Report -lactamase positive strains resistant to penicillins without -lactamase inhibitors.
2
Breakpoints relate only to -lactamase negative strains. Strains may be resistant to penicillins, aminopenicillins, cephalosporins
and/or carbapenems due to changes in penicillin binding proteins (BLNAR, -lactamase negative ampicillin resistant) and a few
strains have both resistance mechanisms (BLPACR, -lactamase positive, amoxicillin/clavulanate resistant).
3
Neither clinical failure nor resistance has been reported for these antimicrobial agents, thus the criteria for interpretative breakpoints
has not been established for any category other than susceptible.
186
Antimicrobial susceptibility testing procedure of H. influenzae by Kirby-Bauer disk
diffusion
Either 150-mm or 100-mm plates can be used for Kirby-Bauer disk diffusion depending on the
number of antimicrobial agents to be tested per isolate. CLSI guidelines state that no more than
two disks can be used on a 100-mm plate and up to five disks can be used on a 150-mm plate
(Figure 1).
Isolates to be tested should be subcultured onto a supplemented chocolate agar plate and
incubated in a CO2-enhanced atmosphere (5% CO2 in a CO2-incubator or candle-extinction jar)
at 35±2°C for 20-24 hours prior to testing. If the organism has been frozen, it should be
subcultured twice when it is removed from the freezer before proceeding with susceptibility
testing.
before inoculating. If HTM broth is to be used to make the 0.5 McFarland, warm it to 35°C
before using. Allow the antibiotic disks that will be used in the batch of testing to warm to room
identical, isolated colonies. Immerse the applicator into a tube containing sterile HTM broth
or saline. Rub the applicator against the wall of the tube slightly to release a small amount of
growth into the liquid. Cap the tube and mix the cells using a vortex to form a suspension,
being careful not to form froth or bubbles in the suspension when mixing the cells. Adjust
the turbidity of the inoculum to that of a 0.5 McFarland turbidity standard (approximately 1
to 4 x 108 CFU/ml). Preparation of a McFarland turbidity standard is described in the
Annex. If the turbidity of the inoculum is greater than the standard, dilute it with HTM broth
or saline to equal the turbidity of the standard. This suspension must be used within 15
minutes.
pressing the swab tip against the inside of the tube. Inoculate the entire surface of a HTM
plate three times with the same swab of inoculum, rotating the plate 60 degrees after each
inoculation to ensure even distribution of the inoculum and confluent growth of the bacteria.
Use a single swab of inoculum and do not return the swab to the broth after each rotation.
4. When the surface of the inoculated plate is dry and the disks are at room temperature, place
the disks onto the agar with an applicator or sterile forceps. Make sure that the disks are
187
spaced enough distance apart on the agar so the zones of inhibition do not overlap (Figure 1).
Press down on the disks to ensure complete contact with the agar surface. Alternatively, a
mechanical disk dispenser can be used. Once applied, it is important to not move the
antibiotic disks as the antibiotic will begin to diffuse immediately upon contact with the
plate.
5. Incubate the plates in an inverted position in a 5% CO2 atmosphere or candle jar for 20–24
hours at 35±2°C.
calipers (Figure 2). Measurements should be performed in a biosafety cabinet, if possible.
The zones of inhibition on the media are measured by holding the Petri dish a few inches
above a black, nonreflective background illuminated with reflected light. Use either calipers
or a ruler with a handle attached for these measurements, holding the ruler over the center of
the surface of the disk when measuring the inhibition zone (Figures 1 and 2).
inhibition are measured as the diameter from the edges of the last visible colony of the
unaided eye. Record the results to the nearest millimeter (mm).
the QC strains are within the acceptable control range) by comparing the results to the CLSI
(Table 9), CA-SFM (Table 10), or EUCAST (Table 11) standard zone sizes. See Figure 3 for
a sample worksheet for recording antimicrobial susceptibility test results for H. influenzae.
C. Minimal inhibitory concentration testing of H. influenzae by antimicrobial gradient

strips
In reference laboratories, it is necessary to precisely monitor for any changes in the MICs of the
isolates. It can be done either by an antibiotic dilution method or using antimicrobial gradient
strips. The gradient strip method is convenient and reliable, giving 85-100% correlation with the
dilution method. Gradient strips must be stored at -20°C or 4°C (follow the manufacturer’s
recommendations). Either 150-mm or 100-mm plates can be used for the gradient strip testing,
depending on the number of antimicrobial agents to be tested per isolate. Two different gradient
strips can be placed in opposite gradient directions on a 100-mm plate (Figure 4). Although one
manufacturer states that up to six gradient strips can be used on a 150-mm plate, this laboratory
manual suggests that in order to avoid overlapping zones of inhibition of growth, not more than
five gradient strips be used on a 150-mm plate, with the end with the lowest concentration of
antibiotic placed towards the center of the plate (Figure 5). Depending on the
bacteria/antimicrobial combinations, five strips on a 150 mm plate may lead to overlapping
ellipses. If this occurs, testing should be repeated using four strips per plate.
Isolates to be tested should be subcultured onto a supplemented chocolate agar plate and
incubated in a CO2-enhanced atmosphere (5% CO2 in a CO2-incubator or candle-extinction jar)
at 35±2°C for 20-24 hours prior to testing. If the organism has been frozen, it should be
188
subcultured twice when it is removed from the freezer before proceeding with susceptibility
testing.
before inoculating. If HTM broth is to be used to make the 0.5 McFarland, warm it to 35°C
before using. Allow the gradient strips that will be used in the batch of testing to warm to room
temperature (25°C). It is recommended to follow the directions on the package insert included
with the gradient strips
identical, isolated colonies. Immerse the applicator into a tube containing sterile HTM broth
or saline. Rub the applicator against the wall of the tube slightly to release a small amount of
growth into the liquid. Cap the tube and mix the cells using a vortex to form a suspension,
being careful not to form froth or bubbles in the suspension when mixing the cells. Adjust
the turbidity of the inoculum to that of a 0.5 McFarland turbidity standard (approximately 1
to 4 x 108 CFU/ml). Preparation of a McFarland turbidity standard is described in the
Annex. If the turbidity of the inoculum is greater than the standard, dilute it with HTM broth
or saline to equal the turbidity of the standard. This suspension must be used within 15
minutes.
pressing the swab tip against the inside of the tube. Inoculate the entire surface of a HTM
plate three times with the same swab of inoculum, rotating the plate 60 degrees after each
inoculation to ensure even distribution of the inoculum and confluent growth of the bacteria.
Use a single swab of inoculum and do not return the swab to the broth after each rotation.
4. When the surface of the inoculated plate is dry and the gradient strips are at room
temperature, place the antimicrobial gradient strips onto the agar with an applicator or sterile
forceps. Make sure that the printed MIC values are facing upward (i.e., that the bottom
surface of the strip containing the antimicrobial gradient is in contact with the agar).
Alternatively, robotic gradient strip applicators are available from some manufacturers.
Once applied, it is important to not move the antimicrobial gradient strips as the antibiotic
diffuses into the agar immediately upon contact.
 Return the antimicrobial gradient strips that will not be used in this batch of testing to the -
20°C freezer (some strips can be stored at 4°C. Follow the manufacturer’s instructions).
189
5. Incubate the plates in an inverted position in a 5% CO2 atmosphere or candle jar for 20–24
hours at 35±2°C.
6. After incubation, an ellipse of bacterial growth will have formed on the plate around the strip
and the test can be read (see below). QC results must be reviewed before reading and
interpreting the MIC.
Record the QC results first. If zones produced by the control strain are out of the expected
ranges (see Tables 2, 3, and 5, depending on the strains and guidelines being used), the
laboratorian should consider possible sources of error. Because antimicrobial susceptibility test
results can be affected by many factors not necessarily associated with the actual susceptibility of
the organism (e.g., inoculum size, growth phase, agar depth, storage, time, and others), QC
practices must be followed carefully (see Section II above). If all antimicrobial agents are in the
control range, read the test MICs. Note any unusual observations such as a zone of incomplete
killing (trailing endpoints) or single colonies growing within the ellipse.
for agar and broth microdilution. The interpretive standards and MIC breakpoints recommend
by CLSI (Table 9), CA-SFM (Table 10), and EUCAST (Table 11) are given.
V. Antimicrobial susceptibility testing of S. pneumoniae
This section describes the optimal media, inoculum, antimicrobial agents to test, incubation
conditions, and interpretation of results for S. pneumoniae by the disk diffusion method and the
antimicrobial gradient strip method. Although disk diffusion will provide information for most
antimicrobial agents regarding interpretation of a strain as susceptible, intermediate, or resistant,
the antimicrobial gradient strip test provides general information about the MIC of antibiotic.
190
The accuracy and reproducibility of this test are dependent on following a standard set of
procedures and conditions in laboratories on an everyday basis.
Quality control
Quality control tests must be performed as part of the normal laboratory routine. To verify that
antimicrobial susceptibility test results are accurate, at least one control organism should be
included with each test or new set of testing conditions. CLSI, CA-SFM, and EUCAST list
recommended QC strains and test limits (Table 1-5). A laboratory should choose which QC
strain(s) to use based on the antimicrobials to be tested for susceptibility. Further information
about trouble-shooting out of range quality control results can be found in Section II above.
A. Antimicrobial susceptibility testing of S. pneumoniae by Kirby-Bauer disk diffusion
Mueller-Hinton agar medium supplemented with 5% sheep blood is recommended for

determining the antimicrobial susceptibility of S. pneumoniae specimens by disk diffusion. The
agar plates should have a uniform depth of 3-4 mm. Prepare the inoculum for antimicrobial
susceptibility testing of S. pneumoniae from fresh pure cultures of S. pneumoniae (grown
overnight on blood or chocolate agar). Prepare cell suspensions of the bacteria to be tested in
sterile physiological saline or Mueller-Hinton broth. A cell suspension equal to a density of a 0.5
McFarland turbidity standard is used for the inoculum (approximately 1 to 4 x 108 CFU/ml).
Preparation of a McFarland turbidity standard is described in the Annex.
1. Suspend viable colonies from an overnight sheep blood or chocolate agar plate in a tube of
broth or saline to achieve a bacterial suspension equivalent to a 0.5 McFarland turbidity
standard; be careful not to form froth or bubbles in the suspension when mixing the cells with
the broth.
2. Compare the density of the suspension to the 0.5 McFarland turbidity standard by holding the
suspension and McFarland turbidity standard in front of a light against a white background
with contrasting black lines. If the density is too heavy, the suspension should be diluted
with saline or broth (whichever was used to make the suspension). If the density is not
sufficient, additional bacteria should be added to the suspension. This suspension should be
used within 15 minutes.
3. When the proper density is achieved, dip a cotton swab into the bacterial suspension. Lift it
out of the broth and remove excess fluid by pressing and rotating the swab against the wall of
the tube.
4. Use the swab to inoculate the entire surface of the supplemented Mueller-Hinton agar plate
three times, rotating the plate 60 degrees between each inoculation. Use the same swab with
191
each rotated streak, but do not re-dip the swab in the inoculum (i.e., the bacterial cell
suspension).
5. Allow the inoculum to dry before placing the disks on the plates. Drying usually takes only a
few minutes and should take no longer than 15 minutes. If drying takes longer than 15
minutes, use a smaller volume of inoculum in the future by pressing more liquid out of the
swab.
6. After the plate is dry, place the antimicrobial disks on the plates (Figure 1). Use sterile
forceps to place the disks on the Mueller-Hinton agar and tap them gently to ensure they
adhere to the agar. Alternatively, a mechanical disk dispenser can be used. Diffusion of the
drug in the disk begins immediately; therefore, once a disk contacts the agar surface, the disk
should not be moved.
7. Incubate the plates in an inverted position in a 5% CO2 atmosphere for 20-24 hours at 37°C.
A candle-extinction jar may be used if a CO2-incubator is not available.
 If this is a new batch of Mueller-Hinton agar, the antimicrobial disks are new, or it is an
otherwise appropriate time to perform QC, follow steps 1 through 7 above and run parallel
tests on the reference strain(s). Appropriate disk diffusion zone sizes for the reference QC
strains are included in Tables 1, 3 and 4.
calipers. The zones of inhibition are measured from the top surface of the plate with the top
removed. Use either calipers or a ruler with a handle attached for these measurements,
holding the ruler over the center of the surface of the disk when measuring the inhibition
zone (Figure 1).
inhibition are measured as the diameter from the edges of the last visible colony. Record
the results in millimeters (mm). Figure 3 provides a sample form for recording results.
the QC strain(s) are within the acceptable control range) by comparing the results to the
CLSI (Table 12), CA-SFM (Table 13), or EUCAST (Table 14) standard zone sizes.
B. Minimal inhibitory concentration testing of S. pneumoniae by antimicrobial gradient

strips
For S. pneumoniae, disk diffusion testing indicates whether an organism is susceptible or

resistant to an antimicrobial for most agents. However, disk diffusion testing for pneumococcal
isolates using oxacillin (a penicillin family antibiotic) is not sufficient to distinguish between
complete and intermediate resistance. For surveillance purposes, a laboratory may want to
quantify the results of the oxacillin disk diffusion test by performing MIC testing of penicillin or
any other -lactam antibiotic that would be used for treatment. As mentioned earlier in this
192
manual, MIC testing by dilution can be expensive and challenging, and because of the technical
complexity required for these tests, countries that do not currently do MIC testing by dilution
should utilize an international reference laboratory rather than developing the assay in-country.
In countries where MIC testing is done at more than one laboratory,
193
Table 12. Kirby-Bauer disk diffusion zone diameter interpretive standards and MIC interpretive standards for S. pneumoniae as
recommended by CLSI
Copyrighted material used with permission from the Clinical and Laboratory Standards Institute, 940 West Valley Road, Suite 1400,
Wayne, PA, USA 19087, www.clsi.org.

S I R S I R
PENICILLINS
Penicillin1,2,3 1 g4 ≥ 20 - - ≤ 0.06 - ≥ 0.12
parenteral oxacillin
(meningitis)
CEPHEMS
Cefotaxime2,3,5,6 - - - - ≤ 0.5 1 ≥2
(meningitis)
MACROLIDES
Erythromycin6 15 g ≥ 21 16-20 ≤ 15 ≤ 0.25 0.5 ≥1
FOLATE PATHWAY INHIBITORS 8,9
Trimethoprim- 1.25/ ≥ 19 16-18 ≤ 15 ≤ 0.5/9.5 1/19-2/38 ≥ 4/76
sulfamethoxazole 23.75g
(co-trimoxazole)
TETRACYCLINES
Tetracycline 10 30 g ≥ 23 19-22 ≤ 18 ≤2 4 ≥8
FLUOROQUINOLONES
Levofloxacin 5 g ≥ 17 14-16 ≤ 13 ≤2 4 ≥8
LINCOSAMIDES
Clindamycin 2 g ≥ 19 16-18 ≤ 15 ≤ 0.25 0.5 ≥1
KETOLIDES
Telithromycin 15 g ≥ 19 16-18 ≤ 15 ≤1 2 ≥4
194
1
Rx: Use of penicillin in meningitis requires therapy with maximum doses of intravenous penicillin (e.g., at least 3 million units
every four hours in adults with normal renal function).
2
Penicillin, cefotaxime, and ceftriaxone should be tested by a reliable MIC method and reported routinely with CSF isolates of S.
pneumoniae.
3
For CSF isolates, report only meningitis interpretations.
4
Isolates of pneumococci with oxacillin zone sizes of ≥ 20 mm are susceptible (MIC ≤ 0.06 g/ml) to penicillin. Penicillin and
cefotaxime, ceftriaxone, or meropenem MICs should be determined for those isolates with oxacillin zone diameters of ≤ 19 mm,
because zones of ≤ 19 mm occur with penicillin-resistant, intermediate, or certain susceptible strains. For isolates with oxacillin
zones ≤ 19 mm, do not report penicillin as resistant without performing a penicillin MIC test.
5
Rx: Use of cefotaxime or ceftriaxone in meningitis requires therapy with maximum doses.
6
Breakpoints for isolates from cases of meningitis are identical to ceftriaxone.
7
Susceptibility and resistance to azithromycin, clarithromycin, and dirithromycin can be predicted by using erythromycin.
8
The Mueller-Hinton agar used for this test should be thymidine free to obtain accurate results.
9
Trimethoprim-sulfamethoxazole is a combination of two drugs used in treatment (cotrimoxazole). The 1:20 ratio is that at which the
greatest synergy in treatment has been demonstrated in serum. The disks are impregnated with 1.25 g trimethoprim and 23.75 g
sulfamethoxazole. The MIC breakpoints mimic the 1/20 ratio.
10
Organisms susceptible to tetracycline are also considered susceptible to doxycycline and minocycline.
195
Table 13. Kirby-Bauer disk diffusion zone diameter and MIC interpretive standards for S. pneumoniae as recommended by CA-SFM
Comite de L’Antibiogramme de la Société Française de Microbiologie, Société Française de Microbiologie, Recommendations 2010,
pp 38-39. More information available at http://www.sfm-microbiologie.org/UserFiles/file/casfm_2010.pdf.

S R S R
PENICILLINS
Penicillin G1,2,3 5 g Oxacillin - - ≤ 0.06 >2
CEPHEMS
Cefotaxime1,2,3 - - ≤ 0.5 >2
Ceftriaxone1,2,3 - - ≤ 0.5 >2
MACROLIDES
Erythromycin4 15 IU ≥ 26 < 24 ≤ 0.25 > 0.5
FOLATE PATHWAY INHIBITORS5,6,7

Trimethoprim- 1.25/23.75 g ≥ 16 < 10 ≤ 2/38 >8/152
sulfamethoxazole
TETRACYCLINES
Tetracycline8 30 IU ≥ 23 < 21 ≤1 >2
FLUOROQUINOLONES
Levofloxacin9 5 g ≥ 17 < 17 ≤2 >2
LINCOSAMIDES
Clindamycin 15 g ≥ 21 < 17 ≤ 0.5 > 0.5
KETOLIDES
Telithromycin10 15 g ≥ 24 < 21 ≤ 0.25 > 0.5
1
Disk diffusion tests with penicillin G for S. pneumoniae are unreliable, but testing can be performed using 5 g/ml oxacillin (OXA-
5) disks according to the following criteria: Diameters of ≥ 26 mm using OXA-5 disks are sensitive to penicillin G and other -
lactams. Diameters of < 26 mm using OXA-5 disks have reduced susceptibility.
196
2
This test cannot assess the level of resistance to penicillin G or other -lactams. Using disks of other -lactam antibiotics cannot
determine the level of resistance to these -lactams.
3
In cases of severe infection, clinical failure, or any strain with reduced susceptibility, it is necessary to determine the MIC to
penicillin G and at least one of -lactam with pharmacodynamic properties which are consistent with therapeutic efficacy
(amoxicillin, cefotaxime, or ceftriaxone). Strains categorized as intermediate (MIC of > 0.064 g/ml to >2 g/ml) or even with low
level resistance should be considered resistant in the case of meningitis, but sensitive to high doses in the case of respiratory
infections.
4
Interpretation valid for azithromycin, clarithromycin, dirithromycin, and roxithromycin.
5
Trimethoprim-sulfamethoxazole testing predicts susceptibility and resistance to trimethoprim-sulfamethoxazole and sulfonamides.
6
The Mueller-Hinton agar used for this test should be thymidine free to obtain accurate results.
7
Trimethoprim-sulfamethoxazole is a combination of two drugs used in treatment (co-trimoxazole). The 1:20 ratio is that at which the
greatest synergy in treatment has been demonstrated in serum. The disks are impregnated with 1.25 g trimethoprim and 23.75 g
sulfamethoxazole to mimic the 1:20 ratio. The MIC breakpoints mimic the 1/20 ratio; i.e., ≤2 g/ml trimethoprim/38 g/ml
sulfamethoxazole.
8
Interpretations valid for other tetracyclines.
9
The screening of pneumococci with reduced susceptibility to fluoroquinolones is realized by measuring sensitivity to norfloxacin. If
the diameter around the disk of norfloxacin (5 ug) is less than 10 mm and/or if the MIC is > 16 g /ml, there is a high risk of in vivo
selection of mutants resistant to fluoroquinolones and clinical failure.
10
Resistance to telithromycin must be verified by retesting in the absence of CO2.
197
Table 14. Kirby-Bauer disk diffusion zone diameter and MIC interpretive standards for S. pneumoniae as recommended by EUCAST
Data is from the European Committee on Antimicrobial Susceptibility Testing (EUCAST) website, http://www.eucast.org, version
1.3, December, 2010.

S R S R
PENICILLINS1
Oxacillin 1 g ≥ 20 < 20 - -
(screen)1,2
Benzylpenicillin1,2,3 - - ≤ 0.064 >2
CEPHEMS
Cefotaxime4,5 - - ≤ 0.5 >2
Ceftriaxone4,5 - - ≤ 0.5 >2
MACROLIDES
Erythromycin6 15 g ≥ 22 < 19 ≤ 0.25 > 0.5
FOLATE PATHWAY INHIBITORS
Trimethoprim- 1.25/23.75 ≥ 18 < 15 ≤1 >2
(cotrimoxazole)7
TETRACYCLINES
Tetracycline8 30 g ≥ 23 < 20 ≤1 >2
FLUOROQUINOLONES9
Levofloxacin9,10 5 g ≥ 19 < 19 ≤2 >2
LINCOSAMIDES
Clindamycin11 2 g ≥ 19 < 19 ≤ 0.5 > 0.5
KETOLIDES
Telithromycin10 15 g ≥ 25 < 22 ≤ 0.25 > 0.5
198
1
Most MIC values for penicillin, ampicillin, amoxicillin, and piperacillin (with or without a -lactamase inhibitor) differ by no more
than one dilution step and isolates fully susceptible to benzylpenicillin (MIC ≤0.064 g/ml; susceptible by oxacillin disk screen, see
note 2) can be reported susceptible to  -lactam agents that have been given breakpoints.
2
Screen for  -lactam resistance with the oxacillin 1 μg disk. Isolates categorized as susceptible can be reported susceptible to
benzylpenicillin, phenoxymethylpenicillin, and aminopenicillins (with or without  -lactamase inhibitor) irrespective of clinical
indication. Isolates categorized as oxacillin resistant can be reported resistant to benzylpenicillin and phenoxymethylpenicillin in
meningitis. For other  -lactams, determine the MIC of the agent considered for clinical use.
3
In meningitis, only isolates with MIC ≤0.064 g/ml (susceptible by oxacillin disk screen, see note 2) should be categorized
susceptible to benzylpenicillin, otherwise report resistant. For indications other than meningitis and pneumonia, use breakpoints of
0.064 and 2 g/ml.
4
Strains with MIC values above the susceptible breakpoint are very rare or not yet reported. The identification and antimicrobial
susceptibility tests on any such isolate must be repeated and if the result is confirmed the isolate sent to a reference laboratory. Until
there is evidence regarding clinical response for confirmed isolates with MIC above the current resistant breakpoint, they should be
reported resistant.
5
Screen for  -lactam resistance with the oxacillin 1 μg disk. Isolates categorized as susceptible can be reported susceptible to
cefepime, cefotaxime, cefpodoxime, ceftriaxone and cefuroxime, and cefuroxime axetil. Isolates categorized as oxacillin resistant
should be tested with an MIC method with the agent considered for clinical use.
6
Erythromycin can be used to determine susceptibility to azithromycin, clarithromycin, and roxithromycin.
7
Trimethoprim-sulfamethoxazole in the ratio 1:19. Breakpoints are expressed as the trimethoprim concentration.
8
Isolates susceptible to tetracycline are also susceptible to doxycycline and minocycline. Some isolates resistant to tetracycline may
be susceptible to minocycline and/or doxycycline.
9
The norfloxacin disk diffusion test can be used to screen for fluoroquinolone resistance. Isolates categorized as susceptible can be
reported susceptible to levofloxacin and moxifloxacin and intermediate to ciprofloxacin and ofloxacin. Isolates categorized as
resistant should be tested for susceptibility to individual agents.
10
The breakpoints for levofloxacin relate to high dose therapy.
11
Inducible clindamycin resistance can be detected only in the presence of a macrolide antibiotic. In disk diffusion tests, look for
apparent antagonism of clindamycin by erythromycin (D-test).
199
standardization and QC should be conducted at each laboratory in accordance with the
standardized guidelines presented in this manual.
Methods for preservation and storage of isolates and detailed methods for transport of isolates
according to international regulations are presented in Chapter 14: Storage and Shipping of N.
meningitidis, S. pneumoniae, and H. influenzae.
With increasing antimicrobial resistance testing being performed outside of international

reference laboratories, antimicrobial gradient test strips serve as an assessment method that is
both convenient and reliable. They require less technical expertise than MIC testing by dilution
methods, but give comparable results. Store the antimicrobial gradient test strips as
recommended by the manufacturer, usually at 4°C or in a freezer at -20°C.
Although this manual serves as a general guide for the use of antimicrobial gradient strips,
always follow the manufacturer’s directions, as certain antibiotic-bacteria (“drug-bug”)
combinations have special testing requirements.
This laboratory manual therefore suggests that Mueller-Hinton agar with 5% sheep blood should
be used when performing antimicrobial susceptibility testing of S. pneumoniae with the
antimicrobial test strips (except when testing for susceptibility to trimethoprim-sulfamethoxazole
(cotrimoxazole), in which case horse blood should be used in place of sheep blood). Either 100-
mm or 150-mm plates can be used, depending on the number of antimicrobial test strips used per
sample (Figures 4 and 5). Two different antimicrobial test strips can be placed in opposite
gradient directions on a 100-mm plate. This laboratory manual suggests that in order to avoid
overlapping zones of inhibition of growth, not more than five antimicrobial test strips be used on
a 150-mm plate. Depending on the bacteria/antimicrobial combinations, five strips on a 150 mm
plate may lead to overlapping ellipses. If this occurs, redo the testing using four strips per plate.
Isolates to be tested should be subcultured onto a blood agar plate and incubated in a CO2-
Warm the cation-adjusted Mueller-Hinton broth (CAMHB) to 35°C before using. Allow the
gradient strips that will be used in the batch of testing to warm to room temperature (25°C). It is
recommended to follow the directions on the package insert included with the gradient strips.
x 108 CFU/ml). Preparation of a McFarland turbidity standard is described in the Annex. If
200
2. Allow the plate to dry for up to 15 minutes. Be sure the plate is entirely dry before
proceeding. While the plate is drying, remove the antimicrobial test strips from cold storage
(4°C or -20°C, depending on the manufacturer’s recommendations), and allow the strips that
will be used in the batch of testing to warm to room temperature (25°C). Return the strips
that will not be used in this batch of testing to cold storage.
3. Place the antimicrobial test strips onto the dried, inoculated agar plate with an applicator or
sterile forceps (Figures 4 and 5). Make sure that the printed MIC values are facing upward
(i.e., that the bottom surface of the strip containing the antimicrobial gradient is in contact
with the agar). Alternatively, robotic gradient strip applicators are available from some
manufacturers. Once applied, do not move the antimicrobial gradient strips as the drug
diffuses into the agar immediately on contact.
4. Incubate the plates in an inverted position in a CO2-enriched atmosphere (2-5% CO2) for 20–
24 hours at 37°C. A candle-extinction jar may be used if a CO2 incubator is not available.
 Always follow the manufacturer’s instructions included with each package of strips,
because incubation conditions may vary by organism-antimicrobial (or “drug-bug”)
combination.
5. After incubation, there will be an ellipse of bacterial growth formed on the plate around the
strip and the test strip can be read. It is important to review QC results before reading and
interpreting the antimicrobial test strips MIC.
Record the QC results first. If zones produced by the control strain are out of the expected
ranges (see Tables 2, 3, and 5, depending on the strains and guidelines being used), the
laboratorian should consider possible sources of error. Because antimicrobial susceptibility test
results can be affected by many factors not necessarily associated with the actual susceptibility of
the organism (e.g., inoculum size, growth phase, agar depth, storage, time, and others), QC
practices must be followed carefully (see Section II above). If all antimicrobial agents are in the
201
control range, read the test MICs. Note any unusual observations such as a zone of incomplete
killing (trailing endpoints) or single colonies growing within the ellipse.
for agar and broth microdilution. Interpretive breakpoints for S. pneumoniae antimicrobial
combinations from CLSI (Table 12), CA-SFM (Table 13), and EUCAST (Table 14) are shown.
References
1. Alcala, B., C. Salcedo, L. de la Fuente, L. Arreaza, M. J. Uria, R. Abad, R.

Enriquez, J. A. Vazquez, M. Motge, and J. de Batlle. 2004. Neisseria meningitidis
showing decreased susceptibility to ciprofloxacin: first report in Spain. Journal of
Antimicrobial Chemotherapy 53:409.
2. Barry, A. L., S. D. Brown, and P. C. Fuchs. 1996. In vitro activity of ceftizoxime,
ceftazidime, cefuroxime, ceftriaxone, cefotaxime, and penicillin against Streptococcus
pneumoniae as determined by three quantitative methods. European Journal of Clinical
Microbiology and Infectious Diseases 15:344-346.
3. Billal, D. S., M. Hotomi, and N. Yamanaka. 2007. Can the Etest correctly determine
the MICs of beta-lactam and cephalosporin antibiotics for beta-lactamase-negative
ampicillin-resistant Haemophilus influenzae? Antimicrobial Agents and Chemotherapy
51:3463-3464.
4. Chu, Y. W., T. K. M. Cheung, V. Tung, F. Tiu, J. Lo, R. Lam, R. Lai, and K. K.
Wong. 2007. A blood isolate of N. meningitidis showing reduced susceptibility to
quinolones in Hong Kong. International Journal of Antimicrobial Agents 30:94-95.
5. CLSI. Performance Standards for Antimicrobial Susceptibility Testing; 18th
Informational Supplement. CLSI document M100-S19. Wayne, P. C. L. S. I. 2011.
Performance Standards for Antimicrobial Susceptibility Testing; Twenty-First
Informational Supplement. , CLSI Document M100-S21 ed. Clinical and Laboratory
Standards Institute, Wayne, PA.
6. Corso, A., D. Faccone, M. Miranda, M. Rodriguez, M. Regueira, C. Carranza, C.
Vencina, J. A. Vazquez, and M. Galas. 2005. Emergence of Neisseria meningitidis with
decreased susceptibility to ciprofloxacin in Argentina. Journal of Antimicrobial
chemotherapy 55:596-597.
7. Enriquez, R., R. Abad, C. Salcedo, and J. A. Vazquez. 2009. Nalidixic acid disk for
laboratory detection of ciprofloxacin resistance in Neisseria meningitidis. Antimicrobial
Agents and Chemotherapy 53:796-797.
202
8. Fiebelkorn, K. R., S. A. Crawford, and J. H. Jorgensen. 2005. Mutations in folP
associated with elevated sulfonamide MICs for Neisseria meningitidis clinical isolates
from five continents. Antimicrobial Agents and Chemotherapy 49:536-540.
9. Jorgensen, J. H. 1994. Areas of recent emphasis of the National Committee for Clinical
Laboratory Standards Subcommittee on Antimicrobial Susceptibility Testing. Advances
in Experimental Medicine and Biology 349:61-65.
10. Jorgensen, J. H., J. M. Swenson, F. C. Tenover, M. J. Ferraro, J. A. Hindler, and P.
R. Murray. 1994. Development of interpretive criteria and quality control limits for
broth microdilution and disk diffusion antimicrobial susceptibility testing of
Streptococcus pneumoniae. Journal of Clinical Microbiology 32.
11. Lucas, T. J. 1979. An evaluation of 12 methods for the demonstration of penicillinase.
Journal of Clinical Pathology 32:1061-1065.
12. Manchanda, V., and P. Bhalla. 2006. Emergence of non-ceftriaxone-susceptible
Neisseria meningitidis in India. Journal of Clinical Microbiology 44:4290-4291.
13. Mortensen, J. E., M. J. Gerrety, and L. D. Gray. 2006. 2006. Surveillance of
antimicrobial resistance in Neisseria meningitidis from patients in the Cincinnati tristate
region (Ohio, Kentucky, and Indiana). . Journal of Clinical Microbiology 44:1592-1593.
2007. Manual of Clinical Microbiology, 9th ed. ASM Press, Washington, D.C.
15. Park, C. H., J. S. Lopez, and C. B. Cook. 1978. Acidometric agar plate method for
ampicillin susceptibility testing of Haemophilus influenzae. Antimicrobial Agents and
Chemotherapy 13:318-320.
16. Rainbow, J., E. Cebelinski, J. Bartkus, A. Glennen, D. Boxrud, and R. Lynfield.
2005. Rifampin-resistant meningococcal disease. Emerging Infectious Diseases 11:977-
979.
17. Sejvar, J. J., D. Johnson, T. Popovic, J. M. Miller, F. Downes, P. Somsel, R. Weyant,
D. S. Stephens, B. A. Perkins, and N. E. Rosenstein. 2005. Assessing the risk of
laboratory-acquired meningococcal disease. Journal of Clinical Microbiology 43:4811-
4814.
18. Skoczynska, A., J.-M. Alonso, and M.-K. Taha. 2008. Ciprofloxacin resistance in
Neisseria meningitidis, France. Emerging Infectious Diseases 14:1322-1323.
19. Stefanelli, P., C. Fazio, G. La Rosa, C. Marianelli, M. Muscillo, and P.
Mastrantonio. 2001. Rifampicin-resistant meningococci causing invasive disease:
detection of point mutations in the rpoB gene and molecular characterization of the
strains. Journal of Antimicrobial Chemotherapy 47:219-222.
20. Strahilevitz, J., A. Adler, G. Smollan, V. Temper, N. Keller, and C. Block. 2008.
Serogroup A Neisseria meningitidis with reduced susceptibility to ciprofloxacin.
Emerging Infectious Diseases 14:1667-1669.
21. Taha, M.-K., M. L. Zarantonelli, C. Ruckly, D. Giorgini, and J.-M. Alonso. 2006.
Rifampin-resistant N. meningitidis. Emerging Infectious Diseases 12:859-860.
22. Vázquez, J. A., R. Enriquez, R. Abad, B. Alcalá, C. Salcedo, and L. Arreaza. 2007.
Antibiotic resistant meningococci in Europe: Any need to act? FEMS Microbiology
Reviews 31:64-70.
23. Wu, H. M., B. H. Harcourt, C. P. Hatcher, S. C. Wei, R. T. Novak, X. Wang, B. A.
Juni, A. Glennen, D. J. Boxrud, J. Rainbow, S. Schmink, R. D. Mair, M. J.
Theodore, M. A. Sander, T. K. Miller, K. Kruger, A. C. Cohn, T. A. Clark, N. E.
203
Messonnier, L. W. Mayer, and R. Lynfield. 2009. Emergence of ciprofloxacin-resistant
Neisseria meningitidis in North America. New England Journal of Medicine 360:886-
892.
204
CHAPTER 12
Characterization of Neisseria meningitidis, Haemophilus influenzae, and

Streptococcus pneumoniae by Molecular Typing Methods
I. Introduction
A number of DNA-based molecular typing methods have been used in epidemiological

investigations of bacterial pathogens and studying bacterial population genetics and evolution.
Some methods are suitable for characterizing strains that cause localized outbreaks; others are
particularly useful for determining the long-term relationships of strains and their population
structures (1). For local outbreak investigation, molecular typing methods with a high degree of
resolution are necessary to detect subtle differences in what most likely are genetically related
strains. These assays are also useful for detecting changes in molecular type during prolonged
outbreaks. Highly discriminatory assays typically index genomic variations that accumulate
rapidly and can be used to detect microvariations that can be used to identify strains circulating
in a specific geographic area. The methods that have been used for this purpose including
ribotyping, random amplified polymorphic DNA, fluorescent amplified-fragment length
polymorphism, restriction fragment length polymorphism (RFLP), multiple-locus variable-
number tandem repeat analysis (MLVA) and pulsed-field gel electrophoresis (PFGE). The high
resolution of these assays will sometimes resolve subtle differences that MLST cannot, thus they
are particularly useful for studying local epidemiology or tracing the spread of highly related
strains during outbreaks/clusters of cases (1, 7, 15).
PFGE is one of the most widely used molecular typing methods because of the resolving power
of the technique. In brief, PFGE uses a restriction enzyme to cut genomic DNA infrequently at a
specific sequence to produce a number of fragments that are then size-fractionated on an agarose
gel. The resultant banding patterns are analyzed and compared to other isolates. During an
outbreak or a cluster of cases, PFGE is used in combination with epidemiologic information and
other typing techniques to help identify outbreak isolates and determine the relationships among
the isolates. A promising technique with similar discriminatory capabilities that is gaining
acceptance is multiple-locus variable-number tandem repeat analysis (MLVA). In MLVA, the
variability in the numbers of short tandem repeat sequences that are found in specific areas of the
genome are utilized to create DNA fingerprints for epidemiological studies. Once the
appropriate loci are established, MLVA yields clustering similar to PFGE (13) and the use of
highly variable-number tandem repeats results in a high degree of differentiation with suitable
resolution to discriminate between strains in an outbreak or cluster (24, 34).
Tracking the population biology of bacterial organisms on a global or even national scale
requires a molecular typing method based on slowly accumulating selectively neutral genetic
variations that will still distinguish between genotypes yet can identify clonal groups. One of the
most common selectively neutral areas of a genome are housekeeping genes encoding proteins
involved in the metabolism of the organism. The first molecular typing method to utilize this
attribute was multilocus enzyme electrophoresis (MLEE). MLEE analyses the electrophoretic
mobilities of metabolic housekeeping enzymes on a starch gel and equates changes in mobility of
each enzyme with allelic variants of each loci (1, 7). In order to obtain high resolution, 20 or
205
more loci are analyzed for each isolate. The genetic variation leading to the changes necessary
to cause mobility shifts are thought to be selectively neutral, thus the electrophoretic type of a
bacterial clone should be relatively stable over time (7). MLEE was instrumental as a typing
method in early global epidemiology studies and population biology analysis, but the method is
technically demanding, and because MLEE is gel-based, results between laboratories are very
difficult to compare.
In 1998, Maiden et al developed a DNA-based method of molecular typing N. meningitidis that

retained the concepts utilized by MLEE of analyzing housekeeping genes not under any known
immunologic selection. MLST defines strains by their allelic profiles determined from the
nucleotide sequences of internal fragments of seven housekeeping genes rather than by shifting
electrophoretic mobility patterns of the enzymes they encode (15). This approach has been
adapted for use in typing many types of bacteria, including H. influenzae, and S. pneumoniae,
and is now the most widely used method for molecular typing. While MLST is more expensive
to perform, it has the following advantages over MLEE:
 Directly measures genetic variations, and therefore resolves more alleles per locus
 Is readily scalable and adaptable for a high throughput format
 Sequence data is reproducible and can be objectively compared between laboratories
 Sequence analysis can be performed remotely and the results returned via the internet
 Sequence data can be uploaded to a centralized database and is accessible to all scientists
via the internet to produce a powerful tool for global epidemiology
 Information can be obtained from PCR amplification from clinical material
MLST is not suitable to use to characterize potential differences in strains within an outbreak as
its power to resolve small evolutionary differences is too low. Therefore, to provide further
discriminatory power, MLST data can be combined with PFGE and sequence data from other
more variable loci under positive selective pressure, such as PorA, PorB, FetA, and fHbp in N.
meningitidis, and the penicillin binding proteins (PBPs) and PspA in S. pneumoniae. It is this
variability that makes these proteins excellent markers for short-term epidemiology
investigations. Sequence data for these markers is also valuable for assessing the allelic
distribution of these vaccine candidate proteins that can aid in rational vaccine design.
A. Multilocus sequence typing (MLST) and typing of other variable genes of N.

meningitidis, H. influenzae, and S. pneumoniae
The PCR primers and protocols included here are used at CDC and work well. However, many
laboratories use different PCR reaction protocols, chemistries, buffers, primer concentrations and
even different equipment for PCR amplification and DNA sequencing. Other protocols work
well and it is up to the discretion of each laboratory to discern the optimal reagents and assay
conditions for their laboratory, including appropriate validation and quality control.
The primers listed in this manual have been designed and optimized over time as more sequence
data has become available. By comparing DNA sequences for a given area of interest from
dozens to hundreds of different strains of N. meningitidis, H. influenzae, or S. pneumoniae, small
areas of homology can be detected that provide an area from which PCR and DNA sequencing
206
primers can be designed that have the greatest likelihood of working. In some instances, a
perfect consensus cannot be found which will react with all strains. In these cases, degenerate
primers are designed that have a mix of nucleotides at a certain position. For example, when
either a “C” or a “T” nucleotide can occupy a position, the International Union of Pure and
Applied Chemistry (IUPAC), designates it as “Y”. For a complete list of IUPAC nucleotide
abbreviations, see: http://www.chem.qmul.ac.uk/iupac/.
B. Preparation of DNA template
For each of the assays described below a preparation of DNA must be extracted. A pure culture
of each isolate is grown on trypticase soy agar plates supplemented with 5% sheep blood for N.
meningitidis and S. pneumoniae, or chocolated agar plates supplemented with hemin and NAD
for H. influenzae in a humidified incubator for 18-24 hours at 37˚C with 5% CO2. Fast DNA
extraction protocols for N. meningitidis, H. influenzae, and S. pneumoniae can be found in
Appendix 1 at the end of this chapter or http://www.cdc.gov/ncidod/biotech/strep/pcr.htm.
Additional methods for DNA extraction that will provide purified DNA can be found in Chapter
10: PCR Methods or commercially available DNA extraction kits can be used.
II. Multilocus Sequence Typing (MLST)
A. Overview and MLST schemes for N. meningitidis, H. influenzae, and S. pneumoniae
The housekeeping genes selected for MLST are not closely linked in bacterial genomes and have
conserved sequence regions that are sufficient to design PCR primers that will amplify all or
nearly all of the isolates. The number of housekeeping genes to be examined reflects an optimal
balance between resolution of genotypes and laboratory workload. The internal fragments are of
a length to provide sufficient variation for identification of different alleles and for each strand to
be accurately sequenced using only a single primer for each direction. Sequences that differ by
even a single nucleotide are considered unique and no weight is given to the number of
nucleotide changes in a given allele. Each unique allele is assigned a number in order of
discovery and each isolate can be characterized by its multilocus genotypic or allelic profile,
designated as sequence type (ST), which is the combination of its alleles over the seven genetic
loci. STs can be further grouped into clonal complexes (CC), which are defined in the Neisseria
MLST profile database as a group of STs that share at least four of the seven loci in common
with a central ST (30).
MLST schemes have been developed for N. meningitidis (15) (Table 1), H. influenzae (20)
(Table 2), S. pneumoniae (7) (Table 3) and many others (see http://www.mlst.net/). Each
scheme uses defined regions of seven housekeeping genes. A general protocol for performing
MLST and analyzing the data is given below.
207
Table 1. N. meningitidis MLST scheme, including gene locus, amplicon length, and
trimmed length of sequence used for allelic determination
Gene Trimmed
Housekeeping genes
locus length
Putative ABC transporter abcZ 433
Adenylate kinase adk 465
Shikimate dehydrogenase aroE 490
Fumurate dehydrogenase fumC 465
Glucose-6-phosphate gdh 501
dehydrogenase
Pyruvate dehydrogenase subunit pdhC 480
Phosphoglucomutase pgm 450
Table 2. H. influenzae MLST scheme, including gene locus, amplicon length, and
Gene Trimmed
Housekeeping genes
locus length
Adenylate kinase adk 477
ATP synthase F1 subunit atpG 447
gamma
Fumarate reductase iron-sulfur frdB 489
protein
Fuculokinase fucK 345
Malate dehydrogenase mdh 405
Glucose-6-phosphate isomerase pgi 468
RecA protein recA 426
Table 3. S. pneumoniae MLST scheme, including gene locus, amplicon length, and
Gene Trimmed
Housekeeping genes
locus length
Shikimate dehydrogenase aroE 405
Glucose-6-phosphate gdh 460
dehydrogenase
Glucose kinase gki 483
Transketolase recP 450
Signal peptidase I spi 474
Xanthine xpt 486
phosphoribosyltransferase
D-alanine-D-alanine ligase ddl 441
208
Table 4. MLST amplification primers for N. meningitidis
Gene Primer Primer

Forward primer (5’-3’) Reverse primer (5’-3’)
locus name name
abcZ abcZ-P1C TGTTCCGCTTCGACTGCCAAC abcZ-P2C TCCCCGTCGTAAAAAACAATC
adk adk-P1B CCAAGCCGTGTAGAATCGTAAACC adk-P2B TGCCCAATGCGCCCAATAC
aroE aroE-P1B TTTGAAACAGGCGGTTGCGG aroE-P2B CAGCGGTAATCCAGTGCGAC
fumC fumC-P1B TCCCCGCCGTAAAAGCCCTG fumC-P2B GCCCGTCAGCAAGCCCAAC
gdh gdh-P1B CTGCCCCCGGGGTTTTCATCT gdh-P2B TGTTGCGCGTTATTTCAAAGAAGG
pdhC pdhC-P2B CCGGCCGTACGACGCTGAAC pdhC-P2B GATGTCGGAATGGGGCAAACA
pgm pgm-P1 CTTCAAAGCCTACGACATCCG pgm-P2 CGGATTGCTTTCGATGACGGC
Table 5. MLST amplification primers for H. influenzae
Gene Primer Primer

Forward primer (5’-3’) Reverse primer (5’-3’)
locus name name
adk adk-up GGTGCACCGGGTGCAGGTAA adk-dn CCTAAAGATTTTATCTAACTC
atpG atpG-up ATGGCAGGTGCAAAAGAGAT atpG-dn TTGTACAACAGGCTTTTGCG
frdB frdB-up CTTATCGTTGGTCTTGCCGT frdB-dn TTGGCACTTTCCACTTTTCC
fucK fucK-up ACCACTTTCGGCGTGGATGG fucK-dn AAGATTTCCCAGGTGCCAGA
mdh mdh-up TCATTGTATGATATTGCCCC mdh-dn ACTTCTGTACCTGCATTTTG
pgi pgi-up GGTGAAAAAATCAATCGTAC pgi-dn ATTGAAAGACCAATAGCTGA
recA recA-up ATGGCAACTCAAGAAGAAAA recA-dn TTACCAAACATCACGCCTAT
209
Table 6. MLST amplification primers for S. pneumoniae
Gene Primer Primer

Forward primer (5’-3’)1,2 Reverse primer (5’-3’)1,2
locus name name
aroE3 aroE-fwd TCCTATTAAGCATTCTATTTCTCCCTTC aroE-rev ACAGGAGAGGATTGGCCATCCATGCCCACACTG
gdh4 gdh-up ATGGACAAACCAGCNAGYTT gdh-dn GCTTGAGGTCCCATRCTNCC
gki4 gki-up GGCATTGGAATGGGATCACC gki-dn TCTCCCGCAGCTGACAC
recP3 recP-fwd GAATGTGTGATTCAATAATCACCTCAAATAGAAGG recP-rev TGCTGTTTCGATAGCAGCATGGATGGCTTCC
spi3 spi-fwd CGCTTAGAAAGGTAAGTTATGAATTT spi-rev GAAGAGGCTGAGATTGGTGATTCTCGGCC
xpt3 xpt-fwd TTAACTTTTAGACTTTAGGAGGTCTTATG xpt-rev CGGCTGCTTGCGAGTGTTTTTCTTGAG
ddl3 ddl-fwd TAAAATCACGACTAAGCGTGTTCTGG ddl-rev AAGTAGTGGGTACATAGACCACTGGG
1
IUPAC nucleotide designations: R = A or G; Y = C or T; N = A, T, G, or C.
2
In this instance, R = equal mixture of A and G; W = equal mixture of A and T; etc.
3
The primers for aroE, recP, spi, xpt, and ddl listed at http://spneumoniae.mlst.net/misc/info.asp#experimental are too close to the
target sequences for accurate sequencing results using a capillary sequencer, thus alternative primers that lie about 40 bases further
upstream and downstream of the target sequences are listed above. They can also be found at
http://www.cdc.gov/ncidod/biotech/strep/alt-MLST-primers.htm.
4
Primer sequence taken from: http://spneumoniae.mlst.net/misc/info.asp#experimental.
210
B. Primers used for PCR amplification
The primers used for PCR amplification for each scheme are shown in Table 4 (N. meningitidis),
Table 5 (H. influenzae), and Table 6 (S. pneumoniae). In addition, the primers currently in use
are listed in the MLST web pages for the schemes, http://pubmlst.org/neisseria/ look under
“information”, and http://haemophilus.mlst.net/, look under “Organism Specific Information”
and go to page 2. Note that for S. pneumoniae, the primers listed are from two different sources.
The original MLST primers for S. pneumoniae can be found at
http://spneumoniae.mlst.net/misc/info.asp#experimental. However, it has been found that these
primers for aroE, recP, spi, xpt, and ddl are too close to the target sequences for accurate
sequencing results using a capillary sequencer, thus alternative primers that lie about 40 bases
further upstream and downstream of the target sequences were designed and can be found at
http://www.cdc.gov/ncidod/biotech/strep/alt-MLST-primers.htm.
C. PCR reaction setup and cycling conditions
The PCR conditions to be used for each scheme are given below (Tables 7 and 8). PCR set up
and cycling conditions for each assay can also be found at http://pubmlst.org/neisseria/ look
under “information”, and http://haemophilus.mlst.net/ or http://spneumoniae.mlst.net/, look
under “Organism Specific Information”.
Reactions are performed in 50 μl volumes for N. meningitidis and H. influenzae, and in 25 μl

volumes for S. pneumoniae in either in 8-well tube strips or in 96-well plates. If doing many
reactions, it is useful to prepare a master mix of reagents equal to the number of reactions plus
one for each locus with all components except for the DNA. When setting up the PCR reactions
keep the reagents from warming up to room temperature by keeping them on ice. This is
especially important for the Taq DNA polymerase.
Table 7. MLST PCR amplification reaction set-up for N. meningitidis and H. influenzae
Reagent Volume (l)* Comments

PCR grade water 40.5
10X buffer 5.0
10 mM dNTPs 1.0 200 M final concentration
20 M forward primer 1.0 0.4 M final concentration
20 M reverse primer 1.0 0.4 M final concentration
DNA polymerase 0.5
Template DNA 1.0
Final volume 50.0
* Some laboratories scale back the reaction volumes to 25 l. Adjust each component of the
reaction accordingly if 25 μl volumes are desired.
211
Table 8. MLST PCR amplification reaction set-up for S. pneumoniae
Reagent Volume (l) Comments

PCR grade water 18.0 - 19.5
10X buffer 2.5
20 µM forward primer 0.5 0.2 µM final concentration
20 µM reverse primer 0.5 0.2 µM final concentration
DNA polymerase 0.5
Template DNA 1 – 2.5
Final volume 25.0
Once the PCR reactions are set-up, immediately place them in the PCR machine and run. The
cycling conditions for MLST differ slightly for each organism (Table 9, N. meningitidis, except
for pgm; Table 10, N. meningitidis, pgm; Table 11, H. influenzae; and Table 12, S. pneumoniae).
Note that the annealing temperature of the reactions may need to be optimized when adapting the
protocols for use in your laboratory.
Table 9. PCR cycling conditions for N. meningitidis MLST amplifications, except for pgm
1x (94˚C, 4 min)
35x (94˚C, 1 min); (55˚C, 1 min); (72˚C, 1 min)
1x (72˚C, 5 min)
1x (4˚C, ∞)
Table 10. PCR cycling conditions for pgm gene for N. meningitidis MLST amplifications
1x (95˚C, 5 min)
30x (94˚C, 1 min); (65˚C, 1 min)*; (72˚C, 1 min)
*Decrease the annealing temperature 0.5˚C per cycle
10x (94˚C, 1 min); (50˚C, 1 min); (72˚C, 2 min)
1x (72˚C, 5 min)
1x (4˚C, ∞)
1x (72˚C, 2 min)
1x (4˚C, ∞)
Table 11. PCR cycling conditions for H. influenzae MLST amplifications
1x (95˚C, 4 min)
30x (95˚C, 30 sec); (55˚C, 30 sec)*; (72˚C, 1 min)
*Use 50˚C for adk and frdB genes
1x (72˚C, 10 min)
1x (4˚C, ∞)
212
Table 12. PCR cycling conditions for S. pneumoniae MLST amplifications
1x (94˚C, 5 min)
10x (94˚C, 15 sec); (54˚C, 30 sec); (72˚C, 45 sec)
20x (94˚C, 15 sec); (54˚C, 30 sec); (72˚C, 45 sec)*
*Add 10 sec to the extension per cycle
1x (72˚C, 10 min)
1x (4˚C, ∞)
D. Analysis of PCR products on an agarose gel
It is useful to check for a successful PCR amplification before moving onto reaction clean-up
and sequencing. The protocol for analyzing the amplified PCR products can be found in
Appendix 2 at the end of this chapter.
E. Nucleotide sequencing of MLST PCR products
To perform DNA nucleotide sequencing, the DNA amplicons must be purified by the method of
choice before sequencing reactions can be performed. These include gel filtration columns, a
solid phase reversible immobilization magnetic bead-based system, or PEG8000/2.5M NaCl
precipitation. Commercial kits for gel filtration columns are available from several companies
and a protocol for PEG precipitation can be found at http://pubmlst.org/neisseria/ under
“information” then “PCR protocol”.
The PCR primers and protocols included here are those used at CDC and are optimized for these
laboratories. Other protocols work well and it is up to the discretion of each laboratory to
discern the optimal reagents and assay conditions for their laboratory, including appropriate
validation and quality control. For a commonly used protocol, see: http://pubmlst.org/neisseria/
under “information” then “sequencing protocol (microtiter plates)”.
Sequencing reactions for all assays described here should be carried out on both strands.
Sequencing each strand provides greater confidence in the base calls versus having base calls
made using a single data point.
F. Sequencing primers for N. meningitidis, H. influenzae, and S. pneumoniae MLST
For H. influenzae and S. pneumoniae, the same primers used for PCR amplification are used for
sequencing reactions. The sequencing primers used for N. meningitidis MLST are in Table 13.
213
Table 13. MLST sequencing primers for N. meningitidis
Gene Primer Primer

Forward primer (5’-3’)1,2 Reverse primer (5’-3’)1,2
locus name name
abcZ abcZ-S1A AATCGTTTATGTACCGCAGR abcZ-S2 GAGAACGAGCCGGGATAGGA
adk adk-S1A AGGCWGGCACGCCCTTGG adk-S2 CAATACTTCGGCTTTCACGG
aroE aroE-S1A TCGGTCAAYACGCTGRTK aroE-S2 ATGATGTTGCCGTACACATA
fumC fumC-S1 TCCGGCTTGCCGTTTGTCAG fumC-S2 TTGTAGGCGGTTTTGGCGAC
gdh gdh-S3 CCTTGGCAAAGAAAGCCTGC gdh-S4C RCGCACGGATTCATRYGG
pdhC pdhC-S1 TCTACTACATCACCCTGATG pdhC-S2 ATCGGCTTTGATGCCGTATTT
pgm pgm-S1 CGGCGATGCCGACCGCTTGG pgm-S2A GGTGATGATTTCGGTYGCRCC
1
IUPAC nucleotide designations: R = A or G; W = T or A; K = T or G; Y = C or T; N = A, T, G, or C.
2
In this instance, R = equal mixture of A and G; W = equal mixture of A and T; etc.
214
G. Sequencing PCR setup and cycling conditions
Reactions are performed in 20 μl volumes either in 8-well tube strips or in 96-well plates. Some
laboratories perform sequencing reactions in 10 μl volumes. Adjust each component of the
reaction accordingly if 10 μl volumes are desired. If doing many reactions, it is useful to prepare
a master mix of reagents equal to the number of reactions plus one for each locus with all
components except for the DNA. The setup in Table 14 will work for sequencing MLST
amplicons from N. meningitidis, H. influenzae, and S. pneumoniae.
Table 14. MLST sequencing PCR reaction set-up

5X buffer 4.0
Terminator nucleotides and polymerase* 1.0 200 M final concentration
3.2 M primer 1.0 0.16 M final concentration
Purified amplicon DNA 3.0
Final volume 20.0
*Note: chemistries can vary, thus optimize the reactions for your particular system. Primer
concentrations and PCR set up parameters may vary depending on the type of enzyme,
chemistry, and protocols used in individual laboratories. Each laboratory should optimize the
protocols.
Once the reactions are setup, follow the cycling conditions in Table 15.
Table 15. Cycling conditions for sequencing PCR
25x (95˚C, 10 sec); (52˚C, 5 sec); (60˚C, 4 min)

1x (4˚C, ∞)
H. Purification of the sequencing reaction products
Before the reaction products can be resolved on an automated DNA sequencer, the products must
be purified to remove unincorporated fluorescent dyes, buffer, and unused deoxyribonucleotide
triphosphates. This can be achieved using a variety of commercially available kits that utilize gel
filtration or a solid phase reversible immobilization magnetic bead-based system to purify the
products. Conversely, the reaction products can be purified by precipitation with ethanol and 3M
sodium acetate, pH 4.6 (see http://pubmlst.org/neisseria/ and click on “information” then
“sequencing protocol (microtiter plates)”. Typically, the reaction products will be purified and
dried down in a 96-well plate and reconstituted with formamide, EDTA, or water before
electrophoresis. Each laboratory should follow the manufacturer’s protocol for the automatic
sequencer system being employed.
See the Analysis of Sequence Data and Allele Determination section below for further
information about data analysis.
215
III. porA and porB typing
A. Overview
The antigenic diversity expressed by the five major classes of outer membrane proteins (OMP)
on the surface of N. meningitidis have been utilized to develop isolate subtyping and
characterization schemes and to develop vaccines. The largest of the OMPs expressed by most
meningococcal isolates is the PorA or class 1 protein. The PorA protein is a transmembrane
protein predicted to have 8 loops exposed on the surface of the organism. These loops contain
two hypervariable regions, VR1 (loop 1) and VR2 (loop 4), and two semivariable regions, SV1
(loop 5) and SV2 (loop 6). Sequence analysis of SV1 and SV2 demonstrated that sequence
differences in these regions were too limited to generate subtype differences between strains,
thus PorA typing is based on the VR1 and VR2 hypervariable sequences, which have greater
resolution (16, 19).
Additionally, all N. meningitidis express PorB which is expressed as 2 alternate alleles that were
previously called class 2 and 3 proteins. These have been named PorB2 and PorB3, respectively,
and are mutually exclusive, though hybrids do exist. PorB has four hypervariable loop regions
referred to as VR1, on loop I; VR2, on loop V; VR3, on loop VI; and VR4, on loop VII (32).
Historically, serotyping is based on the reactivity of specific antisera to the variable regions of
PorB. The antigenically important variable epitopes that are targeted by serological typing
reagents reside in the surface-exposed loops of PorA and PorB (29, 31). In addition, these
regions are targeted by the host immune response and are thus under intensive selective pressure.
Subtyping isolates based on sequencing of the porA and porB genes and translation of the DNA
into their respective amino acids for typing has been helpful in characterizing isolates in clusters
or outbreaks and for determining differences between isolates. Note that the porA gene is
deleted in some isolates, though this is a rare occurrence (32).
The primers used for PCR amplification of the porA and porB genes of N. meningitidis are
shown in Table 16. Primer set 1 should be used first when amplifying the porA gene. If PCR
amplification fails using primer set 1; alternative primer sets 2 and/or 3 should be used.
Reactions are performed in 50 μl volumes either in 8-well tube strips or in 96-well plates (Table
17). If doing many reactions, it is useful to prepare a master mix of reagents equal to the number
of reactions plus one for each locus with all components except for the DNA.
216
Table 16. PCR primers for porA and porB amplification
1 2
GenBank Amplicon
Gene Set Forward primer 5’-3’ Reverse primer 5’-3’
Accession # size (nts)
porA 1 P14 GGGTGTTTGCCCGATGTTTTTAGG P22 TTAGAATTTGTGGCGCAAACCGAC X12899 1236
porA 23 P21 CTGTACGGCGAAATCAAAGCCGGCGT P22 TTAGAATTTGTGGCGCAAACCGAC EF564254 1115
porA 33 U23 GTGTTTGCCCGATGTTTTTAGGT L24 TGCTGTCTTTATTGCCGTTTTTCT X12899 1368
porB 1 PB-A1 TAAATGCAAAGCTAAGCGGCTTG PB-A2 TTTGTTGATACCAATCTTTTCAG EU301792 1755
1
The GenBank Accession number given may not be that of the strain actually used to design the PCR primers, but it is a strain that
contains the primer sequences.
2
These are the predicted amplicon sizes for the strain with the given GenBank Accession number. Because of the variable nature of
these genes, the amplicon in other strains may differ from the size listed. porA is deleted in some strains, though deletions are rare.
3
Primers sets 2 and 3 are alternate primer sets that can be used when the porA gene does not amplify with primer set 1.
217
Table 17. porA and porB PCR amplification reaction set-up

10X buffer 5.0
20 µM reverse primer 1.0 0.4 M final concentration
DNA polymerase 0.5
Template DNA 1.0
Final volume 50.0
cycling conditions for porA and porB differ slightly for each assay (Table 18 for porA and Table
19 for porB). Note that the annealing temperature of the reactions may need to be optimized
when adapting the protocols for use in your laboratory.
Table 18. Cycling conditions for porA amplification
1x (95˚C, 5 min)
30x (95˚C, 1 min); (60˚C, 30 sec); (72˚C, 2 min)
1x (72˚C, 5 min)
4˚C, ∞
Table 19. Cycling conditions for porB amplification
1x (94˚C, 5 min)
35x (94˚C, 1 min); (60˚C, 30 sec); (72˚C, 1 min)
1x (72˚C, 5 min)
4˚C, ∞
and sequencing. The protocol analyzing the amplified PCR products can be found in Appendix 2
at the end of this chapter.
E. Nucleotide sequencing of porA and porB PCR products
218
F. Sequencing primers for porA and porB typing
The primers used to sequence the porA (Table 20) and porB (Table 21) amplicons are shown.
VR1 of porA can be determined by using primers U86 and R435 and VR2 can be determined by
using F435 and R773. To determine the class of the PorB protein, all seven of the primers listed
in the chart for porB must be used.
Table 20. Sequencing primers for porA
Gene Forward primer 5’-3’ Reverse primer 5’-3’

porA U86 R435
VR1 GCCCTCGTATTGTCCGCACTG TTGCTGTCCCAAGGATCAATGGC
porA F435 R773
VR2 GCCATTAATCCTTGGGACAGCAA GGCATAGTTCCCGGCAAAACCGCCAT
Table 21. Sequencing primers for porB

porB PB-S1 PB-S2
GCAGCCCTTCCTGTTGCAGC TTGCAGATTAGAATTTTGTG
porB 8U 8L
TCCGTACGCTACGATTCTCC GGAGAATCGTAGCGTACGGA
porB 244U 244L
CGCCCCGCGTTTCTTACG CGTAAGAAACGCGGGGCG
porB PB260
AGTGCGTTTGGAGAAGTCGT
219
components except for the DNA. The sequencing PCR setup and cycling conditions are shown
below in Tables 22 and 23, respectively.
Table 22. porA and porB sequencing PCR reaction set-up

5X buffer 4.0
Final volume 20.0
protocols.
25x (95˚C, 10 sec); (52˚C, 5 sec); (60˚C, 4 min)

1x (4˚C, ∞)
sodium acetate, pH 4.6 (see http://pubmlst.org/neisseria/ and click on “information” and
electrophoresis. Each laboratory should follow the manufacturer’s protocol for the automatic
sequencer system being employed.
IV. fetA typing
A. Overview
220
FetA (ferric enterobactin transport), formerly FrpB (iron-repressed protein B) is a 76 kDa iron-
regulated OMP that is expressed to a high level during iron limitation (6). Modeling of the
structure of FetA predicts 13 surface-exposed loops. Anti-FetA antibodies to the most variable
of these loops have bactericidal properties (29). FetA has been proposed as a potential vaccine
candidate. However, this region is highly variable which limits the potential of this antigen to be
the sole component of a vaccine. Obtaining the amino acid sequence of this variable region by
sequencing the DNA of this region of the fetA gene is useful in characterizing clones emerging or
circulating in local populations (28). Note that the fetA gene is deleted in some isolates, though
this is a rare occurrence (3, 17).
The primers used for PCR amplification of the fetA gene of N. meningitidis are shown in Table
24.
cycling conditions for fetA are shown in Table 26. Note that the annealing temperature of the
reactions may need to be optimized when adapting the protocols for use in your laboratory.
E. Nucleotide sequencing of fetA PCR products
221
222
Table 24. PCR primers for fetA amplification
1 2
GenBank Amplicon size
Accession # (nts)
fetA S1 CGGCGCAAGCGTATTCGG S8 CGCGCCCAATTCGTAACCGTG AF439258 1189
1
The GenBank Accession number given may not be that of the strain actually used to design the PCR primers, but it is a strain that
contains the primer sequences.
2
These are the predicted amplicon sizes for the strain with the given GenBank Accession number. Because of the variable nature of
these genes, the amplicon in other strains may differ from the size listed. fetA is deleted in some strains, though it is rare (3, 17).
Table 25. fetA PCR amplification reaction set-up

10X buffer 5.0
20 µM S1 1.0 0.4 M final concentration
20 µM S8 1.0 0.4 M final concentration
DNA polymerase 0.5
Template DNA 1.0
Final volume 50.0
* Some laboratories scale back the reaction volumes to 25 l. Adjust each component of the reaction accordingly if 25 μl volumes
are desired.
Table 26. Cycling conditions for fetA amplification
1x (95˚C, 5 min)
40x (95˚C, 1 min); (55˚C, 1 min); (72˚C, 2.5 min)
1x (72˚C, 7 min)
4˚C, ∞
223
F. Sequencing primers for fetA typing
The primers used to sequence the fetA amplicon are shown in Table 27.
Table 27. Sequencing primers for fetA

fetA S12 TTCAACTTCGACAGCCGCCTT S15 TTGCAGCGCGTCR*TACAGGCG
components except for the DNA. The sequencing PCR setup and cycling conditions are shown
below in Tables 28 and 29, respectively.
Table 28. fetA sequencing PCR reaction set-up

5X buffer 4.0
Final volume 20.0
protocols.
25x (95˚C, 10 sec); (52˚C, 5 sec); (60˚C, 4 min)

1x (4˚C, ∞)
224
sodium acetate, pH 4.6 (see http://pubmlst.org/neisseria/ and click on “information” then
electrophoresis. It is recommended that each laboratory follow the manufacturer’s protocol for
the automatic sequencer system being employed.
V. fHbp typing
A. Overview
Factor H binding protein (fHbp), also referred to as Genome-derived Neisserial Antigen 1870
(GNA1870) or lipoprotein 2086 (LP2086 protein), is a ~28 KD surface exposed protein that
binds to human factor H, a negative regulator of the alternative pathway of complement
activation. fHbp is widely distributed in N. meningitidis. Recruitment of factor H to the surface
of N. meningitidis facilitates bacterial escape from the host innate immune system and promotes
bacterial survival in the host (23). fHbp also induces bactericidal activity against N. meningitidis
strains expressing this protein; thus it is a viable vaccine candidate protein and component
vaccines including fHbp are currently under evaluation (9, 22). Analysis of the amino acid
sequences from the mature form of fHbp, which does not include the leader peptide, reveals two
distinct groups, subfamily A and B (22). However, DNA sequence analysis demonstrates three
variant groups: group 1 (corresponding to subfamily B) and group 2 and 3 (together
corresponding to subfamily A) (18). The data collected to date indicate some correlation of fHbp
alleles with MLST or serogroups (18). Continuing determination of fHbp sequence diversity
provides valuable information for the evaluation of potential vaccine efficacy and coverage as
well as characterizing circulating populations of N. meningitidis.
The primers used for PCR amplification of the fHbp gene of N. meningitidis are shown in Table
30.
cycling conditions for fHbp are shown in Table 32. Note that the annealing temperature of the
reactions may need to be optimized when adapting the protocols for use in your laboratory.
225
Table 30. PCR primers for fHbp amplification
1 2
GenBank Amplicon
3 3
Gene Forward primer 5’-3’ Reverse primer 5’-3’ Accession size
# (nts)
fHbp CDC3UNI CDC5UNI FM999788 895
GTCCGAACGGTAAATTATYGTG CTATTCTGVGTATGACTAG
1
The GenBank Accession number given may not be that of the strain actually used to design the
PCR primers, but it is a strain that contains the primer sequences.
2
These are the predicted amplicon sizes for the strain with the given GenBank Accession
number. Because of the variable nature of these genes, the amplicon in other strains may differ
from the size listed.
3
IUCAC designations: Y = C or T; V = C, G, or T.
Table 31. fHbp PCR amplification reaction set-up

10X buffer 5.0
10 M CDC3UNI 4.0 0.8 M final concentration
10 M CDC5UNI 6.0 1.2 M final concentration
DNA polymerase 0.5
Template DNA 2.0
Final volume 50.0
Table 32. Cycling conditions for fHbp amplification
1x (94˚C, 5 min)
30x (95˚C, 15 sec); (50˚C, 15 sec); (72˚C, 1.5 min)
1x (72˚C, 5 min)
4˚C, ∞
226
E. Nucleotide sequencing of fHbp PCR products
F. Sequencing primers for fHbp typing
The primers used to sequence the fHbp amplicon are the same as those used for amplification,
but should be used at a concentration of 3.2 M.
Reactions are performed in 20 μl volumes either in 8-well tube strips or in 96-well plates.
However, some laboratories perform sequencing reactions in 10 μl volumes. Adjust each
component of the reaction accordingly if 10 μl volumes are desired. If doing many reactions, it
is useful to prepare a master mix of reagents equal to the number of reactions plus one for each
locus with all components except for the DNA. The sequencing PCR setup and cycling
conditions are shown below in Tables 33 and 34, respectively.
227
Table 33. fHbp sequencing PCR reaction set-up

5X buffer 4.0
Final volume 20.0
protocols.
25x (95˚C, 10 sec); (52˚C, 5 sec); (60˚C, 4 min)

1x (4˚C, ∞)
sodium acetate, pH 4.6 (see http://pubmlst.org/neisseria/ and click on “information” and
electrophoresis. It is recommended that each laboratory follow the manufacturer’s protocol for
the automatic sequencer system being employed.
VI. Penicillin-binding proteins (PBPs)
Alterations in PBPs are the major mechanism of resistance to penicillins and cephalosporins in S.
pneumoniae. These bacteria possess several high-molecular-weight PBPs, and most decreased
susceptibility and resistance is associated with alterations in PBP1a, PBP2b, and PBP2x.
Remarkably, the vast majority of naturally occurring isolates displaying penicillin MICs > 0.25
ug/ml are characterized by carrying mosaic alleles of these genes that contain segments of
closely related non-pneumococcal species. Sequence differences in the genes encoding these
228
PBPs have been exploited to subtype β-lactam-resistant S. pneumoniae isolates. These methods
include restriction fragment length polymorphisms (RFLPs) analysis of PCR products amplified
from pbp1a, pbp2b and pbp2x, or comparisons of sequences of the amplified products to
determine amino acid changes in these genes (5, 21, 26)
A. Primers used for PCR amplification
PCR reactions for pbp1a, pbp2b and pbp2x are carried out in 3 separate reactions using the
primers listed in Table 35.
229
Table 35. Primers for amplification and sequencing of pbp1a, pbp2b and pbp2x
Primer Sequence (5’-3’) Gene Product size Reference

pn1af GGC ATT CGA TTT GAT TCG CTT CTA TCA T pbp1a 2.4kb (8)
pn1ar CTG AGA AGA TGT CTT CTC AGG CTT TTG
1a-S1 AAG CTC AAA AAC ATC TGT GGG pbp1a Sequencing (2)
1a-S2 TAC TCC ACT CTA CAA CTG GG
1a-S3 CCA ACA AAC ATT TCA TCT GGA GC
pbp2bf GAT CCT CTA AAT GAT TCT CAG GTG GCT GT pbp2b 1.5kb (8)
pbp2bR GTC AAT TAG CTT AGC AAT AGG TGT TGG AT
2b-S1 TTG CTG AAA AGT TAT TTC AAT TC pbp2b Sequencing (2)
2b-S2 ATT GTC TTC CAA GGT TCA GCT
pbp2xf CGT GGG ACT ATT TAT GAC CGA AAT GGA G pbp2x 2.1kb (8)
pbp2xr2 GGC GAA TTC CAG CAC TGA TGG AAA TAA
2x-S1 GGA ACA GAA CAA GTT TCC CAA C pbp2x Sequencing (2)
2x-S2 GAT GCC ACG ATT CGA GAT TGG G
2x-S3 TTT ACA GCT ATT GCT ATT GAT GG
230
B. PCR reaction setup and cycling conditions
PCR reactions are set up as shown in Table 36.
Table 36. pbp1a, pbp2b and pbp2x PCR amplification reaction set-up for S. pneumoniae

10X buffer 3.0
10 µM reverse primer 0.9 0.3 M final concentration
Taq DNA polymerase 1.0 1 unit Taq polymerase
Template DNA 1.0
Final volume 30.0
cycling conditions are shown in Table 37. Note that the annealing temperature of the reactions
may need to be optimized when adapting the protocols for use in your laboratory.
Table 37. Cycling conditions for pbp1a, pbp2b and pbp2x PCR amplification
1x (93˚C, 5 min)
30x (93˚C, 1 min); (52˚C, 1 min); (72˚C, 2 min)
1x (72˚C, 2 min)
4˚C, ∞
C. Analysis of PCR products on an agarose gel
To check for successful PCR amplification, run 5 l of the end-products on a 1% agarose gel
(see protocol in Appendix 2 at the end of this chapter). Store the remainder at -20C or proceed
to RFLP analyses and/or PCR cleanup and DNA sequencing.
D. RFLP analyses
PBP-gene amplicons are subjected to HaeIII plus RsaI digestion by the addition of 3U of the
respective enzymes to 5 µl of unpurified PCR product, followed by 1-4 hr of incubation at 37⁰C
(8). Fragments are then separated on a 2% agarose gel (see Appendix 2 at the end of the chapter,
but add 2 g of agarose to 100 ml sterile distilled H2O instead of 1 g) and should include a DNA
ladder (1kb) on each gel to allow for comparison of fingerprints. After electrophoresis, the gel is
visualized under UV and the image captured using a camera.
E. DNA sequencing
231
Sequencing of PCR products can also be setup to determine specific DNA sequences and amino
acid changes that may be present in pbp1a, pbp2b and pbp2x genes. To perform DNA
nucleotide sequencing, the DNA amplicons must be purified by the method of choice before
sequencing reactions can be performed. These include gel filtration columns, a solid phase
reversible immobilization magnetic bead-based system, or PEG8000/2.5M NaCl precipitation.
Commercial kits for gel filtration columns are available from several companies and a protocol
for PEG precipitation can be found at http://pubmlst.org/neisseria/ under “information” then
“PCR protocol”. Various chemistries and platforms are available for sequencing and many
laboratories outsource their sequencing to commercial companies.
F. Sequencing primers for pbp1a, pbp2b and pbp2x
The primers used to sequence the pbp1a, pbp2b and pbp2x amplicons are the same as those used
for amplification of the genes as well as the additional primers listed in Table 35, but should be
used at a final concentration of 0.3 M.
Reactions are performed in 20 l volumes either in 8-well tube strips or in 96-well plates.
However, some laboratories perform sequencing reactions in 10 l volumes. Adjust each
component of the reaction accordingly if 10 l volumes are desired. If doing many reactions, it
Table 38. pbp1a, pbp2b and pbp2x sequencing PCR reaction set-up

5X buffer 4.0
Final volume 20.0
protocols.
232
25x (95˚C, 10 sec); (52˚C, 5 sec); (60˚C, 4 min)

1x (4˚C, ∞)
H. Interpretation
After PCR and RFLP analysis the patterns can be visually compared or compared by using an
RFLP analyses program to determine clusters of related pbp patterns. For sequence analysis of
the pbp genes, the nucleotide and derived amino acid sequence data for strains are compared to
the corresponding sequence data for the β-lactam susceptible laboratory isolate R6 (sequence
available at GenBank accession numbers: pbp1a M90527; pbp2b X16022; pbp2x X16367) using
DNA sequence alignment software. Mutations at positions in or close to each of the three
(SXXK, SXN, and KXG) conserved motifs for PBP2b, PBP2x and PBP1a can then be identified
and compared.
VII. Pneumococcal surface protein A (PspA)
PspA is a surface protein and virulence factor found on all isolates of S. pneumoniae and is
highly immunogenic. The pspA gene is variable at the nucleotide level, and the amino acid
similarity of the surface-exposed N-terminal region of PspA proteins can be as little as 40%.
Based on nucleotide and amino acid identity, pspA genes and encoded PspA proteins are
classified together into six clades, subdivided into three families: family 1 (clades 1 and 2),
family 2 (clades 3, 4, and 5), and the rarely observed family 3 (clade 6) (11). The extent of
cross-reactivity of PspA clades follows roughly the degree of amino acid sequence homology
and is maximal within strains of the same PspA family. The family can be recognized
serologically, but the clade must be identified by the sequence. Studies have demonstrated that
PspA family and clade distribution are independent of serotype, age, and clinical origin of the
isolates, but are highly associated with genotype as determined by PFGE and/or MLST (33).
A PCR assay has been developed using primers specific for families 1, 2, and 3. Most isolates
are either in family 1 or 2, thus two PCR reactions using primers family1- and 2-specific should
be performed on each isolate. If both of these are negative, a PCR reaction using the primers
specific for the rarely seen family 3 should be performed. Clade determination requires
obtaining the DNA sequence of the allele, thus another PCR amplification reaction is required
using primers that will amplify all three families.
A. Primers used for PCR amplification
Primers specific for family 1 are LSM12 and SKH63 and for family 2 are LSM12 and SKH52
(33). A test for PspA family 3 can also be run using primers SKH41 and SKH42 (10) (Table
40). Isolates that are negative in all PCR reactions are classified as nontypeable (10).
If the isolate is positive for one of the families, the clade in which the isolate belongs can be
identified only through obtaining the DNA sequence of the allele. To do this, perform another
233
PCR amplification using primers LSM12 and SKH2, which will amplify all 3 families. This
amplicon will then need to be sequenced (see below).
Table 40. Primers for amplification of pspA families1
Primer Sequence (5’-3’) Reference

LSM12 CCGGATCCAGCGTCGCTATCTTAGGGGCTGGTT (33)
SKH63 TTTCTGGCTCATYAACTGCTTTC
SKH52 TGGGGGTGGAGTTTCTTCTTCATCT
SKH2 CCACATACCGTTTTCTTGTTTCCAGCC
SKH41 CGCACAGACTTAACAGATGAAC (10)
SKH42 CTTGTCCATCAACTTCATCC
1
IUPAC designations: Y = C.
B. PCR reaction setup and cycling conditions
PCR reactions are set up as shown in Table 41.
Table 41. pspA PCR amplification reaction set-up for S. pneumoniae

10X buffer 3.0
10 M reverse primer 0.9 0.3 M final concentration
Taq DNA polymerase 2.0 2 units Taq polymerase
Template DNA 1.0
Final volume 30.0
cycling conditions are shown in Table 42. Note that the annealing temperature of the reactions
may need to be optimized when adapting the protocols for use in your laboratory.
Table 42. Cycling conditions for pspA PCR amplification
1x (95˚C, 5 min)
30x (95˚C, 1 min); (55˚C, 1 min); (72˚C, 3 min)
1x (72˚C, 10 min)
4˚C, ∞
234
C. Analysis of PCR products on an agarose gel
To check for successful PCR amplification and to determine to which family the allele belongs,
run 5 l of the end-products on a 1% agarose gel (see protocol in Appendix 2 at the end of the
chapter). The remainder should be stored at -20C or PCR cleanup and DNA sequencing can be
performed immediately after successful PCR amplification has been confirmed.
D. Interpretation
The family 1-, 2- and 3-specific primers will produce PCR products that are approximately
1,000 bp for family 1, 1,200 bp for family 2 and 770 bp for family 3 and can be used to assign
strains into pspA families.
E. DNA Sequencing to determine clade
The amplicon derived from the PCR amplification using primers LSM12 and SKH2 can be
sequenced to determine the clade in which the isolate belongs. To perform DNA nucleotide
sequencing, the DNA amplicons must be purified either by gel filtration columns, a solid phase
reversible immobilization magnetic bead-based system, or PEG8000/2.5M NaCl precipitation
before sequencing reactions can be performed. Commercial kits for gel filtration columns are
available from several companies and a protocol for PEG precipitation can be found at
http://pubmlst.org/neisseria/ under “information” then “PCR protocol”. Various chemistries and
platforms are available for sequencing and many laboratories outsource their sequencing to
commercial companies.
F. Sequencing primers
Sequence using the LSM12 and SKH2 primers, but use them at a final concentration of 0.3 M.
Reactions are performed in 20 μl volumes either in 8-well tube strips or in 96-well plates.
However, some laboratories perform sequencing reactions in 10 μl volumes. Adjust each
component of the reaction accordingly if 10 μl volumes are desired. If doing many reactions, it
235
Table 43. Clade sequencing PCR reaction set-up

5X buffer 4.0
100 nM primer 1.0 5 nM final concentration
Final volume 20.0
protocols.
25x (95˚C, 10 sec); (52˚C, 5 sec); (60˚C, 4 min)

1x (4˚C, ∞)
H. Interpretation
The DNA sequences generated are used to determine the amino acid sequence searched against
the sequence database by using BLAST software (www.ncbi.nlm.nih.gov/BLAST). To further
classify the strains, the diversity based on pspA clades is determined by comparing the amino
acid sequences found for strains tested with those amino acid sequences of the clade-defining
region of 24 invasive reference sequences retrieved from GenBank [Accession numbers
AF071802 to AF071809 (Clade 1), AF07810 to AF071814, M74122 (Clade 2), AF071816 to
AF071818 (Clades 3), AF071821, AF071824, AF071826, U89711 (Clade 4), AF071820 (Clade
5), and AF071823 (Clade 6)] (33). PspA proteins in the same clade share similar sequences and
any variation of sequences within clades is restricted to single-amino-acid substitutions. Clade
type can also be established by determining clusters using the DNA sequences to generate a
dendrogram with software using Pearson’s coefficient and the hierarchical unweighted pair
group method (UPGMA). Proteins within the same clade are greater than 90% identical in
sequence.
I. Quality control
Controls for PspA family 1 (Spain14-ST-18) and PspA family 2

(Spain23F-ST-81) (PMEN clones http://www.sph.emory.edu/PMEN/pmen_table1.html) can be
run in each PCR reaction set.
236
VIII. Analysis of sequence data and allele determination
After the sequence reaction products have been resolved and the data obtained from the
sequencer, the trace files must be analyzed for incorrect base calls and the complementary
strands must be aligned. For MLST, the alleles must be aligned and trimmed so that they
correspond exactly to the regions that are used to define the alleles. For the OMPs, the sequence
is translated so that the allele types or clade determination based on the amino acid sequence can
be made. In addition the nucleotide changes in the domains typically responsible for penicillin
resistance in the pbp1a, pbp2b and pbp2x genes in S. pneumoniae need to be determined.
Various computer packages are suitable for assembling, aligning and editing the trace files from
the automated DNA sequencer to create consensus sequence files suitable for these analyses.
A. MLST sequence analysis
Once consensus sequences are available, they can be uploaded to websites for allelic analysis
and sequence type designations. For N. meningitidis MLST go to http://pubmlst.org/neisseria/
and look under “Access main databases”, for H. influenzae MLST go to
http://haemophilus.mlst.net/ and use “locus query” to obtain allele types and “profile query” to
obtain a sequence type, and for S. pneumoniae MLST go to http://spneumoniae.mlst.net/ and use
“locus query” to obtain allele types and “profile query” to obtain sequence types. Consensus
sequences of each gene fragment are compared with those in the databases. The software checks
that the sequences are the correct length and that they do not contain any undetermined
characters. Options are available to identify the allele at a single locus, to enter an allele profile,
to find isolates in the database that match or nearly match an allele profile, or to browse the
database. Consensus sequences not represented in the database can be submitted as a new allele.
The database curator evaluates the trace files of the sequence before assigning a number to the
new allele and including it in the database. In addition, the databases have links to various
programs for further data analyses.
Freeware programs that provide the capability of assembly, aligning, editing, producing a
consensus sequence, and also provide MLST types and clonal complex types in one package are
the Sequence Type Analysis and Retrieval System (STARS) and the Meningococcus Genome
Informatics Platform (MGIP). In addition, both systems are expandable to include other species
and loci. However, STARS is Linux-based, requires technical expertise to program for
expansion and no longer has technical support. MGIP is a web-based interface requiring only a
computer and an internet connection that allows the user to upload to the website sequence trace
files and a worksheet template (http://mgip.biology.gatech.edu/home.php). Analyzed sequence
data, including ST and CC designations, will be returned to the user within minutes of
submission (12). Furthermore, MGIP will also perform OMP analysis and is expandable to
include any loci the user wishes to add. At this writing, MGIP is only available for N.
meningitidis loci, but is being expanded to include S. pneumoniae and H. influenzae.
B. Analyzing a set of sequence data using MGIP
MGIP does not require a user to register to use the website. However, if accessing the website
functions as a public user any data uploaded is available for anyone to see and download. It is
237
thus advisable to register, which only requires a username, password, first and last name, email
address, and institution.
MGIP requires two files to be uploaded in order to analyze data: 1) A zip file or compressed
archive of the sequencing trace files; and 2) A spreadsheet template file in the CSV (comma
separated values) format that identifies the name of the reaction, the type of assay (MLST, porA,
etc), and primer in each well of the sequencing plate. Note that multiple typing schemes can be
analyzed on a single plate.
1. Compressing (or zipping) the trace files
Uploading is done by the set, which is all of the trace file data from a 96-well plate. Do not
rename the trace files. MGIP depends on the coordinates in each filename to map each trace
file back to the spreadsheet. Thus, if you must rename the trace filenames, preserve the
coordinates (e.g., instead of the filename 1433_B01.ab1, you can rename the file to
999_aroE_B01.ab1). In order to upload a data set:
a. Put all of the sequencing files associated with the data set to be analyzed into a single
folder.
b. Zip the folder. In Windows, right click the folder, select "Send To" and then
"Compressed “zipped” folder." (Figure 1). If the "send to" is not on the menu, then select
"add to zip file" or "create archive." Any of these options will create a zip file.
There are ways to create zip files in most operating systems such as MacOS or Linux, which
are very similar to the method described above. The resulting file must be a zip of the
directory of trace files and can have any name.
238
Figure 1. Creating a zip file of the sequencing data to be analyzed
2. Creating the template spreadsheet
Each cell in the spreadsheet corresponds to the appropriate well from the sequencing plate.
For example, a trace file from a well might be automatically named 1433_B01.ab1, which
corresponds to the first column, second row of your wells. Hypothetically, if the well B01
contains the locus pgm_ from the strain M2341 and it was the forward primer, then the
correct way to label the cell is M2341.MLST.pgm_.1. The correct way to label each cell in
the spreadsheet is strain.sequencingTypingMethod.locus.primer. Any blank well should
either be blank or have the word BLANK in the cell. Exact locus names and sequence typing
method names can be found on the MGIP upload page at
http://mgip.biology.gatech.edu/uploadTraces.php.
To generate an entire spreadsheet (which you may have to modify), you can use the form
found on the upload page under the Automatic Spreadsheet Generation section. After
viewing the resulting table from the Automatic Spreadsheet Generator, you can click the
download button to save the spreadsheet. The spreadsheet must be in CSV format, which is
available as a "save as..." option in Excel and in other spreadsheet programs. Therefore you
239
can convert any spreadsheet you have to a CSV format by opening it in a spreadsheet
program and saving it as a CSV.
3. Uploading the files
Upload the zipped sequence files and template spreadsheet at:

http://mgip.biology.gatech.edu/uploadTraces.php. After uploading, click “Analyze Trace
Files”.
C. Viewing results
1. By set
Once the files are analyzed, the alignments and results can be viewed by clicking on the
name of the set of sequences. Or starting from the main page, click “view results” and click
on the name of the set of sequences.
From the first box, choose the data set. The sets are named after your original zip file (Figure
2).
Figure 2. Selecting a set of sequence data to view
240
An alignment's blast results, fasta format sequence, or the actual trace files that were
uploaded can be viewed (Figure 3). Find the alignment's strain/locus and click the options
link to view the aforementioned choices. An editing function is available to adjust incorrect
base calls, if necessary. In addition, files that were unable to be fully analyzed and need the
attention of the user are marked with a red flag.
Figure 3. Allele calls and options for viewing analyzed data
2. By strain
The user can view their strains in a table alongside their alleles. Click the "strain table" link
from the main menu. Strains are listed on the left, alleles in the middle, and lastly, the
derived Sequence Type is on the right. If enough information is present, then the database
will indicate the ST of the isolate. If insufficient data is present to designate a ST, then a list
of all possible STs is given (Figure 4). In the case of a combination of alleles that are not
present in the database, a designation of "novel strain" will be displayed.
Figure 4. Viewing STs by strain
D. OMP sequence analysis
See above for assembling, editing, and aligning sequences to produce a consensus sequence.
Once the consensus sequences are created, they can be directly uploaded to the Neisseria.org
website for typing:
241
1. PorA
Neisseria meningitidis PorA variable region database: http://pubmlst.org/neisseria/PorA/,
click on “Single sequence query” or “Batch sequence query” under the heading “Identify
PorA variable regions to determine the VR1 and VR2 types.
2. PorB
Neisseria meningitidis PorB typing database: http://pubmlst.org/neisseria/porB/ click on
”porB (NEIS2020) [whole coding region]” or “’porB [partial coding sequence]” under the
heading “Identify porB alleles” to type the class and loop regions.
3. FetA
Neisseria meningitidis FetA variable region database: http://pubmlst.org/neisseria/FetA/,
click on “Single sequence query” or “Batch sequence query” under the heading “Identify
FetA variable regions” to determine the FetA type.
4. fHbp
Factor H-binding protein database: http://pubmlst.org/neisseria/fHbp/, click on “Single
sequence query” or “Batch sequence query” under the heading “Identify fHbp alleles and
peptides” to determine the fHpB type.
Consensus sequences not represented in the database can be submitted as a new allele. The
database curator evaluates the traces of the sequence before assigning a number to the new allele
and including it in the database. MGIP (see above MLST Analysis section) can also be used to
obtain allele types for each of these OMPs.
IX. Pulsed-field gel electrophoresis
A. Overview
Pulsed-field gel electrophoresis (PFGE) is an agarose gel-based typing method that assesses
strain inter-relatedness by comparison of complete genomes and has been applied to at least 40
pathogens (25). PFGE involves digesting genomic DNA with a restriction enzyme that cleaves
chromosomal DNA infrequently to produce a small number (11-41) of fragments of different
sizes. The resulting fragments are usually large and unable to be separated efficiently by
conventional uni-directional electrical field gel electrophoresis. Two of the most commonly
used methods to size-fractionate these large digestion products for PFGE are the contour-
clamped homogenous electric field (CHEF) and field inversion gel electrophoresis (FIGE).
CHEF uses a hexagonal array of 24 electrodes that produce an alternating 120° angle uniform
electrical field. FIGE is based on a conventional electrophoresis in which the electric field is
periodically inverted by 180° (25). In both CHEF and FIGE, the electric field used for PFGE is
periodically alternated or pulsed to facilitate the migration of the DNA fragments through the
gel. Larger fragments migrate through the gel slower than smaller fragments creating a size-
based banding pattern that has larger fragments near the top of the gel and smaller fragments
near the bottom of the gel (4, 14, 25). The resulting banding pattern can be analyzed by visual
inspection or by using a computer program to determine differences in the banding patterns
between isolates.
242
PFGE is a highly discriminatory subtyping tool and is particularly suitable for outbreak or cluster
investigations. PFGE is used in combination with epidemiologic information to help identify
outbreak isolates and to determine the relationships among isolates associated with the outbreak
or cluster. The etiological agents in outbreaks are often clonal and produce indistinguishable
PFGE patterns, but point mutations and insertions or deletions can occur during an outbreak that
lead to a PFGE pattern difference of two or three fragments in isolates linked to the outbreak.
Guidelines have been developed to interpret the minor variations in PFGE patterns from closely
related strains, but these guidelines do not take into account the total genetic variation observed
within the circulating population (27). Isolates that differ by two or three fragments are still
considered epidemiologically linked subtypes of the same strain.
B. Preparation for PFGE
Time required for procedure
PFGE requires approximately 28-30 hours once overnight cultures are available, thus time
management is important in planning the procedure.
Equipment
Electrophoresis equipment
CHEF system with pump and cooling unit module
Documentation system equipped with a camera that can provide computer compatible images
37°C incubator
37°C water bath
56°C water bath
50°C water bath
Orbital/shaker water bath
Turbidity meter, spectrophotometer, or McFarland standards
Scales/balances to measure solid reagents
Microwave to melt agarose
Select reagents
Appropriate agar plates for growing up cultures (see below)
Rapid resolution agarose (rapid resolution of DNA and PCR products between 1 kb and 50 kb by
electrophoresis) for making plugs
A serine protease/endopeptidase such as Proteinase K (liquid or powder)
10X 1 M Tris/borate/EDTA, pH 8.0 (TBE)
1 M Tris-HCl, pH 8.0
0.5 M EDTA, pH 8.0
N-Lauroyl sarcosine sodium salt
Ethidium bromide, 10 mg/ml
Restriction enzyme and enzyme-specific buffer
Sterile distilled deionized H2O (dd H2O)
Supplies
PFGE plug molds (reusable or disposable)
243
Gel comb and holder
Casting frame, platform, and leveling table
Sterile clear polystyrene 12 X 75 mm tubes with caps
Sterile 1.5 ml microcentrifuge tubes
Sterile 2 ml round bottom tubes
Scalpels or single edge razor blade
Glass slides
Sterile disposable Petri dishes or large glass slides
Flat spatula
Container to stain gel
Sterile screw cap flasks or bottles
Sterile graduated cylinders
Sterile 50 ml screw cap centrifuge tubes
Sterile pipettes
PPE (gloves, eye, and respiratory protection)
Heat-resistant gloves
C. Reagent and solutions
Tris-HCl, 1.0 M, pH 8.0 (1 L)

1. Dissolve 121 g Tris base in 800 ml ddH2O.
3. Mix and add sterile distilled H2O to 1 L.
4. Autoclave or filter sterilize.
EDTA, 0.5 M, pH 8.0 (1 L)

1. Dissolve 186 g EDTA in 700 ml ddH2O.
3. Add sterile distilled H2O to 1 L.
10% Sodium lauroyl sarcosine (Sarcosine)

1. Add 10 g of N-Lauroyl sarcosine salt to 100 ml ddH2O.*
2. Filter through a .22 micron membrane.
*Eye and respiratory protection should be worn when weighing powdered Sarcosine.

1. Add 100 mg of Proteinase K powder to 5 ml ddH2O.
2. Filter sterilize, aliquot, and store at -20°C.
 Alternatively, 5 ml of a 20 mg/ml solution is available commercially.

2. Mix well and store at 4°C in the dark in 1 ml aliquots.
 EtBr is a powerful mutagen and should be handled with care.
244
Cell suspension buffer (100 mM Tris and 100 mM EDTA, pH 8.0)
1. 10 ml of 1 M Tris, pH 8.0 (sterile solution, available commercially).
2. 20 ml of 0.5 M EDTA, pH 8.0 (sterile solution, available commercially).
3. Dilute to 100 ml with ddH2O, not tap water.
4. Can be stored at room temperature (20-25°C) for several months.
Plug wash TE buffer (10 mM Tris; 1 mM EDTA, pH 8.0)

1. 10 ml of 1 M Tris, pH 8.0.
2. 2 ml of 0.5M EDTA, pH 8.0.
4. Can be stored at room temperature (20-25°C) for several months.

108 g Tris base (890 mM).
55 g boric acid (890 mM).
40 ml 0.5 M EDTA, pH 8.0 (20mM).
2. Add ddH2O to 1 L.
*To make 0.5X TBE working solution, add 100 ml 10X TBE to 1.9 L distilled H2O.
Agarose (1.0% rapid resolution agarose)

1. Add 1.1 g of rapid resolution agarose to 110 ml of 0.5X TBE in a 250 ml flask and
microwave for 1 min, swirl, and then microwave in 15 sec increments with swirling until
the agarose is fully melted and the solution is clear.
2. Place in 56°C water bath to keep agarose from hardening.
3. Agar can be stored at room temperature for several months and can be re-melted and used
again.
Cell lysis buffer (50 mM Tris: 50 mM EDTA, pH 8.0 and 1% Sarcosine)

1. Add 25 ml of 1 M Tris, pH 8.0.
2. Add 50 ml of 0.5 M EDTA, pH 8.0.
3. Add 50 ml of 10% sodium lauroyl sarcosine (Sarcosine), membrane-filtered.
D. Performing PFGE
Growth of bacteria
A pure culture of each isolate is grown on trypticase soy agar plates supplemented with 5%
sheep blood for N. meningitidis and S. pneumoniae, or chocolate agar plates supplemented with
hemin and NAD for H. influenzae in a humidified incubator for 18-24 hours at 37˚C with 5%
CO2. If the isolate does not look pure or if the growth is not sufficient, subculture in a
humidified incubator for 18-24 hours at 37°C with 5% CO2.
245
Preparation of gel plugs
Fill water baths to the correct water level with deionized water. Turn on shaking bath at 54°C
and non-shaking baths at 56°C and 37°C. Prepare or re-melt agarose (see above) and hold at
56°C in the water bath until used.
1. Label and set up a 12 x 75 mm plastic capped tube containing 2 ml of cell suspension buffer
(CSB) for each isolate and for a control strain and a size marker.
2. Using a 1 µl disposable loop, gently harvest enough growth to make a suspension of cells
reading 0.48-0.52 using a turbidity meter or spectrophotometer at O.D.280. If a turbidity
meter or spectrophotometer is not available, this amount of growth is approximately a 0.5
McFarland standard.
 To make a uniform suspension, rub the growth onto the side-wall of the tube just above the
level of the CSB until it washes into the liquid. Before making the turbidity reading, gently
mix the tube by finger-tapping until the suspension appears homogeneous within the tube.
 The bacterial concentration needs to be adjusted precisely. Achieving uniform

concentrations is critical for reproducibility, resolution of the bands of similar size, and for
comparison between different strains.
3. Add 400 µl of each cell suspension to a labeled 1.5 ml microcentrifuge tube. Then add 20 µl
of Proteinase K (20 mg/ml) to the side-wall of each tube above the suspension to avoid
premature lysis of the cells.
4. Add 400 µl of melted agarose and mix gently by pipetting the mixture up and down several
times. Add 400 µl of the mix to fill a well of a 10-well reusable or disposable plug mold.
Repeat for each suspension, filling all of the designated wells. Let the plugs harden for 5 min
at 4°C or 15 min at room temperature (25°C). Extra plugs can be made from the left-over
cell suspensions, if desired.
 Avoid making bubbles and do not vortex. To prevent hardening of the agarose, keep the
flask in a beaker of water at 56°C until all of the plugs are made.
5. Add 5 ml of cell lysis buffer (CLB) and 133 µl Proteinase K (20 mg/ml) to labeled 50 ml
centrifuge tubes.
6. Open the plug molds and push a plug into each of the designated tubes of CLB and close the
caps tightly.
7. Incubate for 1.5 to 2 hours in a 54°C shaker water bath set at 75 strokes per min.
Washing the plugs
246
1. Pre-warm 500 ml of sterile reagent grade water and a liter of plug wash TE buffer in a 50°C
water bath.
2. Pour off CLB and add 15 ml sterile distilled water to each plug.
3. Incubate for 15 min in a 50°C shaker water bath set at 150 strokes per min.
4. Replace water with 15 ml of plug wash TE buffer and incubate for 20 min in a 50°C shaker
water bath set at 150 strokes per min. Decant buffer and repeat 4X.
5. Store plugs in tubes with 2-5 ml of plug wash TE buffer at 4°C until ready for restriction
digestion. Plugs are usable for up to 4 months but it is preferable to use them as soon as
possible after the washing step.
Restriction digestion
The restriction enzymes to use are dependent on the type of the bacteria being tested. For N.
meningitidis use NheI, and for H. influenzae and S. pneumoniae use SmaI. Note that for further
resolution, isolates can be cut with an additional enzyme, but do not cut with two enzymes in the
same reaction. This is useful if other molecular characterization such as MLST will not be
performed. SpeI can also be used for N. meningitidis and XmaI for H. influenzae and S.
pneumoniae.
1. Sterilize a single-edge razor blade and a clean 3 x 2 inch glass slide with 70% alcohol.
2. Add 180 µl of sterile reagent grade water and 20 µl of the 10X restriction buffer for the
enzyme to be used to a 1.5 ml microtube for each isolate.
3. Using a narrow spatula, remove a plug from the Plug Wash TE buffer and place it on the
glass slide.
4. Using the razor blade cut off and discard any uneven edges that may prevent the plug from
fitting in the gel well.
5. Cut two 1-2 mm thick slices from the plugs, including the standard plug and place them into
one of the 1.5 ml microcentrifuge tubes and incubate at 37°C for 15 minutes (30°C for SmaI).
 The unused portions of the plugs can be returned to their storage tubes and refrigerated.
 The overall goal is to cut plug slices that are sufficient in size to easily manipulate, fit in the
well, and that contain enough DNA to create a clear, easily readable banding pattern. The
size of the band may need to be optimized for the bacteria being tested.
6. Carefully aspirate the liquid from the tubes with a pipette, taking care not to damage or
remove the plug slice.
247
7. Replace the liquid with 170 µl of sterile distilled water, 20 µl of 10X restriction buffer, and
50 units of the appropriate enzyme.
8. This can be prepared as a “master-mix” or each reagent can be added separately with gentle
mixing.
9. Incubate plug slices in a 37°C (30˚C for SmaI) water bath for 1.5-3 hours.
 Note that SmaI loses 50% activity after one hour at 37°C.
10. Carefully aspirate the liquid from the tubes and add 150 µl of 0.5X TBE buffer.
Gel preparation and loading
1. Make agarose (1.0% rapid resolution agarose) and place in a 56°C water bath until use.
 Remove 2 ml to a sterile tube and hold at 56°C to use later in the procedure.
2. Assemble the gel-casting mold and make sure it is level on the leveling stand. Adjust the
height of the comb teeth so that, when upright, the teeth touch the gel platform.
3. Lay the comb flat and using a narrow spatula remove the plug slices from each tube and
place each one at the bottom of its designated comb tooth and allow plug slices to air-dry at
ambient temperature for 15 minutes.
 Run one plug slice per isolate and save extra plug slices.
4. Position the comb in the upper pair of slots of the gel casting stand and slowly pour 100 ml
of the molten agarose from the flask into the mold until the agarose is nearly to the top of the
teeth of the comb. Take care that the agarose is well-mixed to ensure a uniform gel. Let the
gel solidify for 25-30 min.
5. Once the gel has hardened, carefully remove the comb.
6. Seal the wells with the 2 ml of molten agarose set aside.
7. Transfer the gel on its platform into the chamber, be sure it is positioned properly in its frame
and is immersed in the 0.5X TBE buffer. Typically 2 L of buffer is required for the gel to be
submersed with 1 cm of buffer over the gel. Close the cover of the chamber and begin the
run after setting the following parameters on the power supply:
248
Table 45. Electrophoresis parameters for PFGE
Initial switch time 2.2 seconds

Final switch time 35 seconds
Run time 18 hours
Angle 120 degrees
Gradient 6.0 volts/cm
Temperature 14°C
Ramping factor Linear
Staining the gel and documenting the image
1. Turn off the equipment at the end of the run.
2. Set up a tray containing EtBr staining solution (400 ml of deionized water with 40 μl of [10
mg/ml] EtBr). Note that EtBr is a carcinogen and gloves and eye protection should be used.
 It is important that the gel box and cooling unit be cleaned after each run. To do this drain
the buffer and pour 1 L of distilled H2O into the gel box and circulate for 2-3 min. Drain
the distilled H2O and dry the apparatus.
3. Remove the gel from the chamber and platform and immerse it in staining solution.
4. Cover the tray to shield it from light and place it on a rotator or oscillating platform shaker
and rotate slowly for 30 min.
5. Pour off the EtBr staining solution according to safety regulations and destain the gel with
500 ml cold deionized water for 30 min on the rotator. Remove water and repeat 2X.
6. Transfer the gel to an imaging system to photograph the image under UV light and save it on
the computer as a tagged image file format (TIFF) file for further analysis. TIFF is the
preferred format because of its greater resolution but the files can be saved as .jpeg if file size
is a problem. If an imaging system is unavailable, a photo of the agarose gel can be taken.
Analysis of image and interpretation
Visual analysis can be used to directly compare the band patterns of a limited number of isolates
on a gel. However, several computer software programs have been developed to analyze gel
images, compare multiple gel images, match banding patterns, construct dendrograms, and store
gel data to allow for more accurate and sophisticated data analyses. The banding patterns are
analyzed with the Dice coefficient, an optimization of 1.0%, and a position tolerance of 1.5% for
the band migration distance. A PFGE-based clonal group is defined as a group of isolates with
genetically related PFGE patterns. In general, the PFGE patterns of strains categorized within a
clonal group have six or fewer differences from each other and ≥80% genetic relatedness on the
249
dendrogram. When comparing isolates associated with an outbreak, it is helpful to include
isolates that do not have an epidemiological link to the outbreak to determine if the outbreak
clone is currently circulating within the population or if it has been recently introduced. After
results are obtained using the software, it is recommended that the results be visually compared
to the bands on the gel to be sure the results make sense.
For S. pneumoniae, comparisons of PFGE profiles to those of major global clones should be
made by using the profiles described by the Pneumococcal Molecular Epidemiology Network
(PMEN) or reference isolates can be requested from this group to include in PFGE runs.
(http://www.sph.emory.edu/PMEN/pmen_clone_collection.html).
E. Technical considerations
Use of a standard
A standard or molecular weight size marker is used to provide an accurate fragment size estimate
and assists with normalization and correction of gel patterns due to variations in electrophoresis.
It should be included in each gel run to allow for inter- and intra-gel comparison of isolates. A
common commercial marker is the lambda bacteriophage, which consists of concatamers of the
bacteriophage lambda DNA. This marker is available in both high molecular weight and low
molecular weight varieties and some laboratories use both on a gel. However, inconsistency in
the DNA concentration and quality of the commercially available lambda ladders has been
observed between vendors and in lot-to-lot variation of the ladder. Alternatively, a bacterial
strain standard can be used that produces bands of known molecular weight. The bacterial
standard does not necessarily have to be of the same strain being tested. The caveat with using a
bacterial strain is that it must be prepared in the lab and mutations or genomic rearrangements
can occur to change a cleavage site, thus changing the size of two or more of the bands.
Regardless of the type of marker used, 3 lanes of the gel spaced evenly apart, but not on the edge
of the gel, should be used for markers.
Care needs to be taken in the interpretation of results, especially in inter-laboratory studies, as

small differences in electrophoresis conditions can alter the distance migrated by each band,
complicating the comparison between isolates in different gels.
Quality control
Quality control (QC) is a measure of precision and a way to ensure that test results are correct,
consistent and reproducible. Thus, QC for reagents used in a test is critical to the overall result
and interpretation of the test. QC measures are listed below:
1. Use clean glassware that is free of detergents to prepare reagents.
2. Use sterile distilled water, not tap water, to prepare reagents.
3. Perform regular maintenance on equipment; keep equipment clean; pipettors calibrated; and
keep a maintenance/calibration log.
250
4. New plugs to be used as standards should be run as an unknown to verify that the new
standard produces the same banding pattern and intensity as the old standard.
5. Test new lots of restriction enzyme to verify that the new enzyme is working properly and
produces a consistent pattern.
6. Sterilize the following reagents by filtration or by autoclaving before use: 10% Sarcosine, 1
M Tris-HCl, pH 8.0; 0.5 M EDTA, pH 8.0; and 10X Tris/Borate/EDTA buffer (TBE).
Troubleshooting
Unexpected results can be attributed to equipment failure, incorrect calculations, and improperly
made reagents. When errors arise in an assay, it is helpful to review the equipment, reagents,
and steps used in the procedure to look for errors. Listed below are some common problems
encountered when performing PFGE with suggestions on how to correct them.
1. No power to equipment:
 Check that equipment is plugged in and that the fuse in the back of the power supply is
functional.
2. Gel lanes are curved or slanted:
 Examine and replace any damaged electrodes.

 Check chamber for foreign objects and remove them if present.
 Be sure agarose plugs are firm enough for loading as fragmented plugs will not run
correctly.
 Verify that the electrophoresis chamber is level. The gel must be poured level.
 Verify that the gel is securely loaded into the gel chamber.
3. Bands have poor resolution:
 Fresh buffer should always be used and the buffer tank and circulation lines should be
cleaned and flushed after each use.
 The level of the buffer used to run the gel could be incorrect or have changed during the
run creating an electrical field that is not appropriate; therefore check buffer levels
carefully and add or drain buffer as needed.
 High buffer concentration elevates the temperature of the run buffer. If this is suspected,
remake the running buffer
 Check chiller to make sure it is working properly to cool the run buffer.
 Remove any kinks in the tubing. This may reduce the flow rate of the pump which would
increase the temperature of the buffer.
 The percentage of agarose used may have been too low.
4. Faint bands or no bands on gel:
251
 Low amounts of DNA or degraded/sheared DNA in the plugs will not produce good
results. If this problem is suspected, remake the plugs.
 The bacteria in the plug may not have been completely lysed. Verify that a sufficient
amount of Proteinase K was used and that the cell lysis buffer was made properly and used
at the correct temperature.
 Verify that the gel was stained with EtBr made at the correct concentration.
5. The gel has unspecific signal in areas where no signal is expected (background):
 Plugs may not have been washed thoroughly. Rewash the plug and repeat restriction
digest.
 The DNA concentration in the plug was too high. Use a thinner plug slice or remake the
plug with the proper cell concentration.
6. Faint bands that appear on the gel between normal bands:
 The agarose plug may not have been properly digested with restriction endonuclease.
Digest the plug again making sure that the correct concentration of enzyme is used for the
proper length of time, that the proper enzyme buffer was used, and that the plug slice is
completely submerged during digestion.
7. Specks appear in stained gel.
 Verify that the gel does not contain undissolved agarose. If so, remake the gel with agarose
completely dissolved and thoroughly mixed.
 Clean the surface of imager and lens to remove particles, if present.
 Wear non-powdered gloves during the procedure as powdered gloves leave powder that
gets on the gel and fluoresces when exposed to UV light.
 The EtBr may be incompletely dissolved.
Appendix 1
Fast DNA extraction protocol for N. meningitidis and H. influenzae (gram-negative)
1. Dispense 1.0 ml of 10 mM Tris (pH 8.0) buffer into vials and label.
2. Harvest colonies from 18-24 hour pure cultures of H. influenzae and/or N. meningitidis using
a sterile polyester or rayon-tipped swab and swirl the swab in the Tris buffer to make a turbid
suspension (equivalent to McFarland 3.0 standard). Be careful not to pick up pieces of agar
on swab.
3. Vortex briefly and boil cell suspension at 100°C for 10 minutes.
252
The procedure above is not vigorous enough to completely lyse the more robust cell wall of S.
pneumoniae, a gram positive organism. Use the protocol below to prepare DNA from isolates of
S. pneumoniae. Also use the protocol below if the identity of the bacterial isolate is unknown.
Fast DNA extraction protocol for S. pneumoniae (gram-positive)
1. Dispense 300 μl of 0.85% NaCl into vials and label.
2. Harvest colonies from 18-24 hour pure cultures of S. pneumoniae using a sterile polyester or
rayon-tipped swab and swirl the swab in the 0.85% NaCl to make a turbid suspension
(equivalent to McFarland 3.0 standard). Be careful not to pick up pieces of agar on the swab.
3. Vortex briefly and incubate at 70ºC for 15 minutes.
4. Microcentrifuge at 12,000 x g for 2 minutes and remove the supernatant.
5. Re-suspend in 50 l TE buffer (10 mM Tris-HCl, 100 M EDTA, pH 8.0) and add 10 l

mutanolysin (3000 U/ ml)* and 8 l of hyaluronidase (30 mg/ml)**
6. Incubate at 37oC for 30 minutes up to 18 hours (overnight).
7. Heat-inactivate the enzymes in the suspension by boiling at 100ºC for 10 minutes.
8. Microcentrifuge at 12,000 x g for 4 minutes and remove supernatant for use as DNA
template.
*Mutanolysin (10,000 U). Dilute in 3.3 ml of TE buffer to make 3000 U/ml stock solution, store
at -20ºC as 500 µl aliquots.
**Hyaluronidase (100 mg). Dilute in 3.3 ml of TE buffer to make 30 mg/ml solution, store at -
20ºC as 500 µl aliquots.
Methods for DNA extraction that will provide purified DNA can be found in Chapter 10: PCR
Methods.
Appendix 2
Analysis of PCR products on an agarose gel
To check for a successful PCR amplification, run an aliquot of the end-products on a 1% agarose
gel.
1. Briefly spin the PCR plate or tubes at 500 x g to ensure all liquid is at the bottom of the
wells.
253
2. Mix 5 l of PCR reaction with 1 l of 6X loading dye (see Table 46 for protocol). It is
important to include DNA size markers in one of the wells.
3. Make a 1% agarose gel. Add 1 g of electrophoresis grade agarose to 100 ml of 1X

Tris/Borate/EDTA (TBE) buffer (see below) in a 250 ml flask and melt the agarose in a
microwave. Microwave for 1 min, swirl, and then microwave in 15 sec increments with
swirling until the agarose is fully melted and the solution is clear. Be cautious as the molten
agarose will be extremely hot. Once the agar has cooled to approximately 55°C add 1-2 µl of
EtBr (see below) and swirl. Pour into a gel casting box, insert the comb, and allow time for
hardening. Remove the comb after the gel has hardened.
a. EtBr is a powerful carcinogen and must be handled with care.
4. Add 1X TBE buffer to the gel box until the buffer is just over the surface of the gel and
pipette the DNA/loading dye mixtures into the wells.
5. Electrophorese the gel at 50-100 volts for 15-20 minutes or until the Bromophenol Blue dye
band is halfway down the gel. The dye runs at approximately the same rate as a 500 base-
pair DNA fragment.
6. Visualize the gel under a UV light and print out or save the image, if possible.
7. Each reaction should give a single band. If multiple bands are consistently present, annealing
temperature optimization may be required.
8. Store the remainder of the amplicon at -20˚C unless proceeding directly to DNA purification.
Table 46. Protocol for making 6X loading dye
Reagents Needed for 10mls Notes

2.5% Ficoll 400 0.25 ml
11 mM EDTA, pH 8.0 1.1 ml 0.1 M EDTA See recipe below
3.3 mM Tris-HCl, pH 8.0 0.3 ml 0.1 M Tris-HCl See recipe below
0.017% SDS 0.17 ml 1% SDS 1 g SDS* to 100 ml sterile distilled
H2O for 1% SDS solution
0.015% Bromophenol 0.15 ml 1% Bromophenol 0.1 g Bromophenol Blue in 10 ml
Blue Blue sterile distilled H2O for 1% solution
sterile distilled H2O 8.03 ml sterile distilled H2O Make 0.5-1.0 ml aliquots of the
batch of 6X loading dye
*Eye and respiratory protection should be worn when weighing out powdered SDS.
Stock solutions for reagents:
EDTA, 0.5 M, pH 8.0 (100 ml)

254
EDTA, 0.1 M, pH 8.0 (100ml)

2. Adjust pH to 8.0 with 10 M NaOH.

2. Mix well and store at 4°C in the dark in 1 ml aliquots.
 EtBr is a powerful mutagen and should be handled with care.

3. Mix and add sterile distilled H2O to 100 ml.

108 g Tris base (890 mM).
55 g boric acid (890 mM).
40 ml 0.5 M EDTA, pH 8.0 (20mM).
2. Add ddH2O to a total volume of 1000 ml.
*10X TBE will have to be diluted 1:10 to 1X in ddH2O before use.
References
1. Brehony, C., K. A. Jolley, and M. C. J. Maiden. 2007. Multilocus sequence typing for
global surveillance of meningococcal disease. FEMS Microbiology Reviews 31:15-26.
2. Cafini, F., R. del Campo, L. Alou, D. Sevillano, M. I. Morosini, F. Baquero, and J.
Prieto. 2006. Alterations of the penicillin-binding proteins and murM alleles of clinical
Streptococcus pneumoniae isolates with high-level resistance to amoxicillin in Spain. The
Journal of Antimicrobial Chemotherapy 57:224-229.
3. Claus, H., J. Elias, C. Meinhardt, M. Frosch, and U. Vogel. 2007. Deletion of the
meningococcal fetA gene used for antigen sequence typing of invasive and commensal
isolates from Germany: Frequencies and mechanisms. Journal of Clinical Microbiology
45:2960-2964.
4. Diggle, M. A., and S. C. Clarke. 2006. Molecular methods for the detection and
characterization of Neisseria meningitidis. Expert Review of Molecular Diagnostics 6:79-
87.
255
5. Dowson, C. G., A. Hutchison, and B. G. Spratt. 1989. Extensive re-modelling of the
transpeptidase domain of penicillin-binding protein 2B of a penicillin-resistant South
African isolate of Streptococcus pneumoniae. Molecular Microbiology 3:95-102.
6. Dyer, D. W., West, E.P., McKenna, W., Thompson, S.A., and Sparling, P.F. . 1998.
A pleiotrophic iron-uptake mutant of Neisseria meningitidis lacks a 70-kilodalton iron-
regulated protein. Infection and Immunity 56:977-983.
7. Enright, M. C., and B. G. Spratt. 1999. Multilocus sequence typing. Trends in
8. Gherardi, G., C. G. Whitney, R. R. Facklam, and B. Beall. 2000. Major related sets of
antibiotic-resistant Pneumococci in the United States as determined by pulsed-field gel
electrophoresis and pbp1a-pbp2b-pbp2x-dhf restriction profiles. Journal of Infectious
Diseases 181:216-229.
9. Giuliani, M. M., J. Adu-Bobie, M. Comanducci, B. Arico, S. Savino, L. Santini, B.
Brunelli, S. Bambini, A. Biolchi, B. Capecchi, E. Cartocci, L. Ciucchi, F. Di
Marcello, F. Ferlicca, B. Galli, E. Luzzi, V. Masignani, D. Serruto, D. Veggi, M.
Contorni, M. Morandi, A. Bartalesi, V. Cinotti, D. Mannucci, F. Titta, E. Ovidi, J.
A. Welsch, D. Granoff, R. Rappuoli, and M. Pizza. 2006. A universal vaccine for
serogroup B meningococcus. Proceedings of the National Academy of Sciences of the
United States of America 103:10834-10839.
10. Hollingshead, S. K., L. Baril, S. Ferro, J. King, P. Coan, and D. E. Briles. 2006.
Pneumococcal surface protein A (PspA) family distribution among clinical isolates from
adults over 50 years of age collected in seven countries. Journal of Medical Microbiology
55:215-221.
11. Hollingshead, S. K., R. Becker, and D. E. Briles. 2000. Diversity of PspA: mosaic
genes and evidence for past recombination in Streptococcus pneumoniae. Infection and
Immunity 68:5889-5900.
12. Katz, L. S., C. R. Bolen, B. H. Harcourt, S. Schmink, X. Wang, A. Kislyuk, R. T.
Taylor, L. W. Mayer, and I. K. Jordan. 2009. Meningococcus genome informatics
platform: a system for analyzing multilocus sequence typing data. Nucleic Acids
Research 37:W606-11.
13. Liao, J.-C., C.-C. Li, and C.-S. Chiou. 2006. Use of a multilocus variable-number
tandem repeat analysis method for molecular subtyping and phylogenetic analysis of
Neisseria meningitidis isolates. BioMed Central Microbiology 6:44.
14. Lukinmaa, S., U.-M. Nakari, M. Eklund, and A. Siitonen. 2004. Application of
molecular genetic methods in diagnostics and epidemiology of food-borne bacterial
pathogens. Acta Pathologica, Microbiologica et Immunologica Scandinavica (APMIS)
112:908-929.
15. Maiden, M. C., J. A. Bygraves, E. Feil, G. Morelli, J. E. Russell, R. Urwin, Q.
Zhang, J. Zhou, K. Zurth, D. A. Caugant, I. M. Feavers, M. Achtman, and B. G.
Spratt. 1998. Multilocus sequence typing: a portable approach to the identification of
clones within populations of pathogenic microorganisms. Proceedings of the National
Academy of Sciences of the United States of America 95:3140-3145.
16. Maiden, M. C., J. Suker, A. J. McKenna, J. A. Bygraves, and I. M. Feavers. 1991.
Comparison of the class 1 outer membrane proteins of eight serological reference strains
of Neisseria meningitidis. Molecular Microbiology 5:727-736.
256
17. Marsh, J. W., M. M. O'Leary, K. A. Shutt, and L. H. Harrison. 2007. Deletion of fetA
Gene Sequences in Serogroup B and C Neisseria meningitidis Isolates. Journal of
18. Masignani, V., M. Comanducci, M. M. Giuliani, S. Bambini, J. Adu-Bobie, B. Arico,
B. Brunelli, A. Pieri, L. Santini, S. Savino, D. Serruto, D. Litt, S. Kroll, J. A. Welsch,
D. M. Granoff, R. Rappuoli, and M. Pizza. 2003. Vaccination against Neisseria
meningitidis Using Three Variants of the Lipoprotein GNA1870. Journal of Experimental
Medicine 197:789-799.
19. McGuinness, B. T., P. R. Lambden, and J. E. Heckels. 1993. Class 1 outer membrane
protein of Neisseria meningitidis: epitope analysis of the antigenic diversity between
strains, implications for subtype definition and molecular epidemiology. Molecular
20. Meats, E., E. J. Feil, S. Stringer, A. J. Cody, R. Goldstein, J. S. Kroll, T. Popovic,
and B. G. Spratt. 2003. Characterization of encapsulated and noncapsulated
Haemophilus influenzae and determination of phylogenetic relationships by multilocus
sequence typing. Journal of Clinical Microbiology 41:1623-1636.
21. Muñoz, R., T. J. Coffey, M. Daniels, C. G. Dowson, G. Laible, J. Casal, R.
Hakenbeck, M. Jacobs, J. M. Musser, and B. G. Spratt. 1991. Intercontinental spread
of a multiresistant clone of serotype 23F Streptococcus pneumoniae. Journal of Infectious
Diseases 164:302-306.
22. Murphy, E., L. Andrew, K. L. Lee, D. A. Dilts, L. Nunez, P. S. Fink, K. Ambrose, R.
Borrow, J. Findlow, M. K. Taha, A. E. Deghmane, P. Kriz, M. Musilek, J.
Kalmusova, D. A. Caugant, T. Alvestad, L. W. Mayer, C. T. Sacchi, X. Wang, D.
Martin, A. von Gottberg, M. du Plessis, K. P. Klugman, A. S. Anderson, K. U.
Jansen, G. W. Zlotnick, and S. K. Hoiseth. 2009. Sequence diversity of the factor H
binding protein vaccine candidate in epidemiologically relevant strains of serogroup B
Neisseria meningitidis. Journal of Infectious Diseases 200:379-389.
23. Schneider, M. C., R. M. Exley, H. Chan, I. Feavers, Y.-H. Kang, R. B. Sim, and C.
M. Tang. 2006. Functional significance of factor H binding to Neisseria meningitidis.
Journal of Immunology 176:7566-7575.
24. Schouls, L. M., A. van der Ende, M. Damen, and I. van de Pol. 2006. Multiple-Locus
Variable-Number Tandem Repeat analysis of Neisseria meningitidis yields groupings
similar to those obtained by Multilocus Sequence Typing. Journal of Clinical
25. Singh, A., R. V. Goering, S. Simjee, S. L. Foley, and M. J. Zervos. 2006. Application
of molecular techniques to the study of hospital infection. Clinical Microbiology Reviews
19:512-530.
26. Smith, A. M., and K. P. Klugman. 1998. Alterations in PBP 1A essential-for high-level
penicillin resistance in Streptococcus pneumoniae. Antimicrobial Agents and
Chemotherapy 42:1329-1333.
27. Tenover, F. C., R. D. Arbeit, R. V. Goering, P. A. Mickelsen, B. E. Murray, D. H.
Persing, and B. Swaminathan. 1995. Interpreting chromosomal DNA restriction
patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing.
Journal of Clinical Microbiology 33:2233-2239.
257
28. Thompson, E. A., I. M. Feavers, and M. C. Maiden. 2003. Antigenic diversity of
meningococcal enterobactin receptor FetA, a vaccine component. Microbiology
149:1849-1858.
29. Urwin, R. 2001. Nucleotide sequencing of antigen genes of Neisseria meningitidis, p.
157-167. In M. C. J. Maiden and A. J. Pollard (ed.), Methods in Molecular Medicine.,
vol. Meningococcal Disease: Methods and Protocols. Humana Press Inc., Totowa, New
Jersey.
30. Urwin, R., and M. C. Maiden. 2003. Multi-locus sequence typing: a tool for global
epidemiology. Trends in Microbiology 11:479-487.
31. Urwin, R., J. E. Russell, E. A. Thompson, E. C. Holmes, I. M. Feavers, and M. C.
Maiden. 2004. Distribution of surface protein variants among hyperinvasive
meningococci: implications for vaccine design. Infection and Immunity 72:5955-5962.
32. van der Ende, A., C. T. Hopman, and J. Dankert. 1999. Deletion of porA by
recombination between clusters of repetitive extragenic palindromic sequences in
Neisseria meningitidis. Infection and Immunity 67:2928-2934.
33. Vela Coral, M. C., N. Fonseca, E. Castañeda, J. L. Di Fabio, S. K. Hollingshead, and
D. E. Briles. 2001. Pneumococcal surface protein A of invasive Streptococcus
pneumoniae isolates from Colombian children. Emerging Infectious Diseases 7:832-836.
34. Yazdankhah, S. P., B. A. Lindstedt, and D. A. Caugant. 2005. Use of variable-number
tandem repeats to examine genetic diversity of Neisseria meningitidis. Journal of Clinical
258
CHAPTER 13
Quality Control/Quality Assurance
Quality Control/Quality Assurance (QC/QA) can be defined as the set of planned and systematic
activities focused on providing confidence that quality requirements will be fulfilled. It covers a
wide range of matters that influence the quality of a product or service. In a medical laboratory,
the quality can be defined as accuracy, reliability, and timeliness of the reported test results (1).
QC refers to those measures that must be included in each assay to verify that the test is working
properly. QA is defined as the overall program that ensures that the final results reported by the
laboratory are as correct and accurate as possible.
I. Negative consequences of laboratory errors
This broad concept applies to any kind of laboratory testing, including diagnostic testing for
bacterial meningitis. Inaccurate meningitis diagnostic results can have significant consequences
at the patient care or public health level. At the patient care level, errors can lead to:
 Failure to provide proper treatment to the patient
 Unnecessary treatment, treatment complications, or additional expenses
 Delay in correct diagnosis
 Additional and unnecessary diagnostic testing
At a public health level, laboratory errors on the species, serotype or serogroup identification, as
well as antibiotic susceptibility profiles, can impact a cornucopia of public health decisions on
the following matters:
 Delay in determining when the epidemic threshold has been reached and implementing
public health measures
 Inadequate national control measure recommendations or treatment algorithms
 Inappropriate choice of antibiotics or vaccines
These consequences result in increased cost in time, personnel effort, other resources, and poor
patient outcomes in terms of morbidity and mortality.
II. Quality management system
To achieve the highest level of accuracy and reliability, standard QC/QA testing procedures and
conditions must be practiced in laboratories on an every day basis. A quality management
system, which oversees the entire system, is very important for achieving optimal laboratory
performance. Laboratory processes can be grouped into pre-examination, examination, and post-
examination categories. Quality management measures should be applied during the entire path
of workflow that begins with the patient and ends in interpreting and reporting results. The
quality management system is not only concerned with monitoring QC/QA programs, but should
259
also include administrative considerations that may indirectly influence the quality and
efficiency of the laboratory operation.
A widely used quality management system model organizes all of the laboratory activities into
twelve quality system essentials, which are a set of coordinated activities that serve as building
blocks for quality management (2):
1. Organization and supervision

2. Personnel
3. Equipment
4. Purchasing and inventory
5. Documents and records
6. Process control
7. Information management
8. Occurrence management
9. Assessment
10. Customer service
11. Process improvement
12. Facilities and safety
Some of these elements constitute management requirements (i.e., organization, documents and
records, and purchasing and inventory) while other constitute technical requirements (personnel,
equipment, and process control with the examination procedures) (3). Many of the twelve
quality system essentials overlap each other (i.e., there is a close relationship between documents
and records, and information management).
A. Quality systems essentials for meningitis diagnostic laboratories
Most of the quality systems essentials described above are not specific to the meningitis
diagnostic laboratory and should apply to all laboratory disciplines regardless of the nature of the
specimens, pathogens, or assays. However, some specific meningitis laboratory quality
assurance measures can be highlighted. Many of them are detailed again in the respective
chapters of this manual.
1. Organization and supervision
The structure and management of the laboratory must be organized so that quality management
policies can be established and implemented. The laboratory should prepare an organizational
chart that reflects the hierarchy and lines of authority with functions and responsibilities of each
post. The current duties and responsibilities of staff should be specified in written job
descriptions including training required and necessary experience. The director’s commitment is
crucial. A quality manager should be designated to ensure the implementation and monitoring of
the quality policies.
2. Personnel
260
The most important laboratory resource is a competent, trained, and motivated staff. Continuous
education opportunities should be offered to the staff and recorded, especially if new tests or
methods are introduced. Regular competency assessment and proficiency testing should be
conducted and documented. This can be done by direct observation of the personnel, records
monitoring, and/or by analyzing the quality control or the external quality assessment results.
3. Equipment
Specimen identification and characterization requires many types of equipment, such as

microscopes, incubators, autoclaves, biosafety cabinets, refrigerators, freezers, water baths,
automated identification systems, or antibiotic susceptibility systems. Choosing the right
equipment, installing it correctly, assuring that the staff is properly trained to use the equipment,
and assuring that the new equipment works properly and receives proper maintenance are
crucial. Equipment manuals should be available in the laboratory area for easy reference. An
inventory of equipment including records of maintenance and repair should be maintained.
4. Purchasing and inventory
Proper management of purchasing and inventory of reagents, media, and supplies can produce
cost savings in addition to assuring accurate and timely reporting of laboratory results. The
procedures should be written and implemented to assure that all reagents and supplies are
correctly selected, purchased, used, and stored in a manner that preserves integrity and
reliability. The inventory should be kept up to date including information on reception, storage,
and issuance. Package inserts and Material Safety Data Sheets (MSDS) should be archived as
part of records keeping.
5. Documents and records
Documents provide written information about policies, processes, and testing procedures and
should be stored in the laboratory quality manual for each laboratory. This manual should serve
as a basis for writing the laboratory Standard Operating Procedures (SOPs) which need to be
adapted to the laboratory’s role and capacity. The SOPs, QC/QA procedures, specimen testing
request forms, report forms, and other laboratory forms are all important components of the
quality manual, which documents the quality management system.
An SOP should be written for all procedures in the laboratory, including specimen collection,
transport, storage, waste disposal, Gram stain, microscopy, biochemistry measurements, culture,
identification, antimicrobial susceptibility testing, typing methods (serological or molecular
methods), reagents and media preparation, equipment use and maintenance, and SOP writing.
Examples of records include request forms, report forms, logbooks, quality control results,
patient reports, critical communications, and notices from hospitals or public health authorities.
See Chapter 3: Results Management and Reporting of Data for items that should be included in
the request and report forms.
6. Process control
261
Process control refers to control of all activities involved in the operation of a laboratory, from
pre-examination to post-examination steps.
One of the most familiar process control measures is the use of internal QC to monitor the
performance of examination methods. Internal QC of specimen identification and
characterization should include:
 Regular QC to check media and reagents, such as agar plates and serogrouping or
serotyping antisera. QC should be performed quarterly as well as when a new lot is
received in the laboratory.
 Well-characterized reference control strains (gram-positive and gram-negative) should be

used to assess the following tests: Gram stain, culture procedures, identification,
serogrouping or serotyping, PCR, and antimicrobial susceptibility testing. If access to QC
strains is difficult, well-characterized clinical isolates confirmed and characterized in a
reference laboratory (such as a WHO Collaborating Center) are available. Isolates received
from another laboratory as part of a proficiency testing program received in the scope of
External Quality Assessment Schemes can also be used.
 Internal QCs included in rapid diagnostic tests are to be used each time the kit is used.
7. Information management
Written SOPs should be developed for data management, cleaning, and reporting.
See Chapter 3: Results Management and Reporting of Data.
8. Occurrence management
An “occurrence” is an error or an event that should not have happened. A system is needed for
detecting and documenting these occurrences, for handling them properly, and for taking
corrective action to reduce the chance of recurrence. Common errors include:
 Patient identification error

 Specimen misplacement
 Specimen transport delayed or at insufficient temperature
 Contaminated specimens
 Performing an inappropriate test
 Performing a test inconsistent with the written procedure
 Lack of QC/QA
 Transcription and clerical errors
Occurrences are detected through various means, such as supervisory review, physicians’ or
patients’ complaints, QC/QA results, or findings from external audits. Immediate remedial
corrective action should be undertaken before the result is reported to the clinician or public
health authorities. Ultimately, corrective actions should be implemented to prevent similar errors
from recurring.
262
9. Assessment
Assessment is a tool for examining laboratory performance and comparing it to known standards
or to performance of other laboratories. Assessment may be internal, performed by the
laboratory’s own staff, or may be external, conducted by an external group or agency outside the
laboratory.
 External Quality Assessment (EQA) is a system for objectively checking the laboratory’s
performance using an external agency or facility. There are three commonly used EQA
methods or processes:
o Proficiency testing (PT) through a panel of unknown specimens sent regularly to the
laboratory by an organizer. The laboratory reports the results back to the organizer who
will compare the test results with known results and record a pass (all results
concordant) or fail (any discrepant results) for the PT.
o Confirmation by sending a subset of isolates to a reference laboratory for re-

identification and characterization.
o Site visits conducted by inspection, certification, or accreditation bodies.
 Internal audits can be conducted by the staff of the laboratory to identify weaknesses and
undertake corrective actions.
 Quality indicators can be defined by the laboratory management and staff to complement
the use of internal QC. While internal QC primarily assesses the examination steps, other
quality indicators can be designed to monitor the pre- and post-examination steps:
o Percentage of cerebrospinal fluid (CSF) specimens received from remote areas and not
transported in Trans-Isolate (T-I) medium (if T-I was available but not used). This
indicator provides information on the pre-examination performance.
o Percentage of CSF specimens received without appropriate identification, which

provides information on the pre-examination performance.
o Discrepancies between the CSF macroscopic examination and the cell count, which
provides information on the examination performance.
o Inappropriate antibiotic treatment after the antimicrobial susceptibility testing report is

given to the physician, which provides information on the reporting system
performance, physician error, or if the proper antibiotic is not available.
o Percentage of results reported on time, which provides information on examination and

reporting performance.
10. Customer service
263
The laboratory should understand who their customers are (the patients, the physicians, or the
public health authorities), assess their needs, and use customer feedback for making
improvements. Customers’ satisfaction can be assessed by means of questionnaire, interviews,
or meetings.
11. Process improvement
The primary goal of a quality system is continuous improvement of the laboratory processes in a
systematic manner. A number of tools have been described above to identify errors, such as
customer service surveys, internal QC, EQA, auditing, and quality indicators. A rigorous
analysis of all of these indicators should lead to improvements in procedures and practices.
These changes should be recorded and reflected in the SOPs and implemented in the laboratory.
Open communication among staff members is also important to encourage suggestions that may
improve the quality and efficiency of the laboratory.
12. Facilities and safety
The laboratory should develop SOPs for biosafety, basic safe operating procedures, and waste
management that are adapted to their specific role in the laboratory and in conjunction with
institutional policies. See Chapter 4: Biosafety.
References
1. WHO/CDC/CLSI. Laboratory Quality Management System Training Toolkit. 2009.

http://www.who.int/ihr/training/laboratory_quality/en/index.html.
2. NCCLS. Application of a quality management system model for laboratory services;
Approved Guideline: Third Edition. NCCLS document GP26-A3. NCCLS. Wayne,
Pennsylvania. 2004.
3. ISO 15189:2007. Medical laboratories: requirements for quality and competence.
Geneva, Switzerland: International Organization for Standardization; 2007.
264
CHAPTER 14
Storage and Shipping of Neisseria meningitidis, Streptococcus pneumoniae,

I. Preservation and storage of isolates
It is often necessary for an isolate to be re-examined or further characterized at a time after the
culture was initially obtained and tested. If isolates need to be sent to a national reference
laboratory for confirmation of identity and/or further testing, they must be stored properly prior
to packing and shipping. Selection of a storage method depends on the length of time the
organisms are to be stored and the laboratory equipment and facilities available. Isolates to be
prepared for either short-term or long-term storage should be confirmed as pure cultures before
proceeding with any of these methodologies. Fresh cultures (i.e., 18-24 hour growth) should
always be used for the preparation of isolates to be stored.
N. meningitidis, S. pneumoniae, and H. influenzae are fragile bacteria and care must be employed
to preserve and transport them under the most ideal conditions possible. Aseptic techniques
should be used at all times during the preparation of isolates for storage and/or transport to avoid
contamination.
A. Short-term storage
N. meningitidis, S. pneumoniae, and H. influenzae can only survive for 3-4 days on blood agar
plates (BAP) and/or chocolate agar plates (CAP) and do not survive for long periods of time in
broth; hence the need for effective and practical short-term and long-term term storage methods.
Short-term storage methods are appropriate for bacterial isolates that only need to be stored for
several days to a few weeks at a time. These methods include Dorset Transport medium,
chocolate agar slants, and silica gel packages.
Dorset Transport medium
Dorset Transport medium can be used for room temperature (25°C) storage of N. meningitidis, S.
pneumoniae, and H. influenzae (1). On Dorset Transport medium, N. meningitidis and H.
influenzae can be stored for approximately 3 weeks, whereas S. pneumoniae can be stored for
approximately 6 weeks. Instructions for preparation of Dorset Transport medium are included in
the Annex. Dorset Transport medium is typically produced as a 4 ml slant in a 7 ml screw-cap
tube. It should be stored at 4°C when not in use and warmed to room temperature (25°C) before
use.
1. Grow the pure isolate(s) to be stored for 18-24 hours on a BAP or a CAP at 35-37°C with
~5% CO2 (or in a candle-jar).
2. Label the Dorset Transport slant with the Lab ID and the date.
265
3. Use a disposable plastic loop to collect a few colonies of the overnight growth on the
BAP or CAP and inoculate the Dorset Transport slant.
4. Incubate overnight at 37°C in 5% CO2 then store the Dorset Transport slant at room
Chocolate agar slants
If Dorset Transport medium is not readily prepared or used by the laboratory, short-term storage
of N. meningitidis, S. pneumoniae, and H. influenzae can be carried out on chocolate agar slants
for up to 1 week. Instructions for preparation of chocolate agar slants are included in the Annex.
Chocolate agar slants are typically produced as a 4 ml slant in a 7 ml screw-cap tube. They
should be stored at 4°C when not in use and warmed to room temperature (25°C) before use.
2. Label the chocolate agar slant with the Lab ID and the date.
3. Use a disposable plastic loop to collect a few colonies of the overnight growth on the
BAP or CAP and inoculate the chocolate agar slant.
4. Incubate the slant for 18-24 hours at 35-37°C with ~5% CO2 (or in a candle-jar).
5. Store the slant at room temperature (25°C).
 For N. meningitidis, solid screw-caps should be loosened during storage but permeable
membrane screw caps (which allow for an exchange of gases and are commercially
available) should be used when possible. An overlay of trypticase soy broth (TSB) may
also be helpful and might increase viability. N. meningitidis slants should not be
refrigerated.
 Viability is best for S. pneumoniae and H. influenzae if the slants are maintained at 4°C
with the cap tightened to avoid drying after incubation.
Silica gel packages
N. meningitidis, S. pneumoniae, and H. influenzae can also be stored short-term on swabs stored
in silica gel packets, which are typically 1.5 g foil bags, with 75% white gel and 25% blue gel
(the blue gel is added to detect moisture). Isolates can survive approximately 2 weeks at 4°C and
perhaps slightly shorter at room temperature (25°C). The packets are inexpensive and easy to
use (Figure 1), but are not often available from commercial manufacturers. Silica gel packages
can be stored at room temperature (25°C) when not in use.
266
2. Label the silica gel package with the Lab ID.
3. Cut open the silica gel package near the adhesive cover with sterile scissors.
 Inspect the contents of the package. Blue and white gels should be visible. If only
white gels are visible, that indicates that moisture was introduced into the silica gel
package and the package should not be used.
4. Collect the overnight pure culture growth from the BAP or CAP with a single sterile
polyester swab.
 Do not use cotton swabs as cotton has a bacteriostatic effect which will inhibit bacteria
growth.
5. Place the swab in the silica gel package with the tip inserted into the silica and the shaft
sticking out the top of the package.
6. Remove the cover of adhesive tape on the silica gel package and fold down the corners to
seal the package.
7. Place additional tape around the shaft of the swab and folded corners to secure the swab
and seal the package.
267
Figure 1. Procedure for inoculating silica gel packages for short-term storage
B. Long-term storage
Long-term storage of bacterial isolates is best accomplished by either freezing or lyophilization

(freeze-drying). Freezing is the most convenient storage method for frequently recovered
isolates as the cultures do not need to thaw completely each time they are removed from frozen
storage. Lyophilized bacteria can be stored for long periods at 4°C or -20°C and can be
transported without refrigeration. However, the equipment required for this procedure is
expensive and not all laboratories have the ability to lyophilize isolates. Reference laboratories
choosing to lyophilize bacteria should always maintain a frozen preparation in addition to larger
quantities of lyophilized strains as some lyophilized preparations may be nonviable upon
reconstitution. Bacterial cultures may be stored frozen or lyophilized in a variety of storage
media formulated for that purpose.
Frozen storage
268
Skim milk with glycerol, defibrinated sheep, horse, or rabbit blood, or Greaves medium is used
for freezing. Instructions for preparing these media are listed in the Annex. Human blood
should not be used due to safety issues (e.g., HIV and hepatitis transmission) and the possible
inhibition of growth of isolates resulting from antibodies or residual antibiotics. Glass ampoules
or vials for freezing in liquid nitrogen should not be used because they can explode upon
removal from the freezer.
2. Label the storage tube with the Lab ID and the date.
3. Use a sterile Pasteur pipette to add 1 ml of well-mixed, sterile storage media to a 2 ml,
externally-threaded, screw-cap cryovial.
4. Use a sterile polyester-tipped swab to harvest all of the pure overnight growth from the
BAP or CAP and inoculate the storage media by swirling the swab to release the
organisms.
growth.
 Squeeze the excess media from the swab by rotating it against the sides of the cryovial
before carefully withdrawing it. Discard the swab in disinfectant.
5. If possible, rapidly freeze the suspension in a bath of 95% alcohol and dry ice pellets.
6. Place the cryovials in a -70°C freezer or a liquid nitrogen freezer (-120°C). A -20°C
freezer can be used, but some loss of viability can be expected.
 Freezers with automatic defrost cycles should never be used for the laboratory.
Lyophilization
Some laboratories may have lyophilization facilities. Serum-based media, skim milk, or
polyvinylpyrrolidone (PVP) medium are generally used for lyophilization.
2. Label the storage tube and/or lyophilization vial with the Lab ID and the date.
3. Use a sterile Pasteur pipette to add 1-2 ml of well-mixed, sterile lyophilization medium to
a 2 ml, externally-threaded, screw-cap cryovial.
269
4. Use a sterile polyester-tipped swab to harvest all of the pure overnight growth from the
BAP or CAP and suspend it into 1-2 ml of sterile lyophilization medium by swirling the
swab to release the organisms.
growth.
 Squeeze the excess media from the swab by rotating it against the sides of the cryovial
before carefully withdrawing it. Discard the swab in disinfectant.
5. Place approximately 0.5 ml of the cell suspension into a sterile ampoule or lyophilization
vial.
 Several vials can be prepared from a single plate, if desired.
 Sterility should be maintained at all times during preparation of the vial.
6. Shell-freeze the cell suspension on the walls of the lyophilization vial. This is
accomplished using one of the following two methods:
 Keep the lyophilization vial at -70°C until just before the cell suspension is added. Add
the cell suspension and rapidly rotate the vial to freeze the suspension to the wall.
Return the vial to the -70°C freezer until it is ready to be attached to the lyophilizer.
 Alternatively, if a -70°C freezer is not available, prepare a mixture of alcohol (95%

ethanol) and dry ice. Add the cell suspension and rapidly rotate the lyophilization vial
at a 45-60° angle in the alcohol and dry-ice mixture.
7. Attach the vial to the lyophilizer and follow the manufacturer’s instructions for
lyophilization as the type of apparatus may vary slightly with each instrument.
 The time of lyophilization will depend on the number of vials being lyophilized and the
capacity of the instrument. On an average machine, 4-5 hours are required to
completely dry 10-20 small vials.
8. Once the run is completed, seal the vials using a heat source or a capping mechanism
while they are still attached to the lyophilizer and under a vacuum. The vials can be
stored at 4°C or -20°C after being sealed.
C. Recovery of N. meningitidis, S. pneumoniae, and H. influenzae isolates
Whether recovering an isolate from short-term or long-term storage, be sure to label all agar
plates with the appropriate Lab ID and date using a permanent marker. Use the appropriate agar
medium for each organism as specified in Chapter 6: Primary Culture and Presumptive
Identification.
270
Dorset Transport medium and chocolate agar slants
1. Use a sterile 10 µl loop to remove a loopful of growth from the Dorset Transport or
chocolate agar slant and streak for isolation on a BAP or a CAP.
2. Incubate the plate for 18–24 hours at 35-37°C with ~5% CO2 (or in a candle jar) and
observe for growth
3. If no growth is observed on the plate, repeat the above steps with another loopful of
growth from the Dorset Transport or chocolate agar slant and streak for isolation on a
BAP or a CAP.
Silica gel packages
1. Remove the swab from the silica gel package and streak a vertical line down 1/3 of the
center of a BAP or a CAP and then cross-streak 1/3 of the plate using the swab.
 Be sure that the entire surface area that contained the culture comes in contact with
the plate.
2. After streaking 1/3 of the plate, place the swab in approximately 1 ml of brain heart
infusion (BHI) broth and incubate the broth for 18-24 hours at 35-37°C with ~5% CO2
3. Streak the remaining 2/3 of the plate for isolation with a 10 µl loop.
4. Incubate the plate for 18-24 hours at 35-37°C with ~5% CO2 (or in a candle-jar) and
observe for growth.
5. If the organism is nonviable after overnight incubation, pipet 10 µl of the broth onto a
new plate and streak for isolation. Incubate the plate for 18-24 hours at 35-37°C with
~5% CO2 and check for growth the next day.
Frozen isolates
1. Allow frozen isolate to thaw at room temperature, just enough so that 10 µl of freezing
medium can be removed from the top.
 Return frozen stock to the freezer immediately after collection. Once completely
thawed, the frozen culture will begin to lose viability.
2. Place 10 µl of freezing medium onto a BAP or a CAP and streak for isolation.
observe for growth.
271
4. If no growth is observed on the plate, repeat above steps with another 10 µl of the frozen
culture.
 Isolates grown from frozen cultures should be subcultured at least once prior to
being used in tests.
Lyophilized cultures
1. Suspend lyophilized isolates in 0.25-0.5 ml of broth (e.g., TSB or Mueller-Hinton).
2. Add 10 µl of the cell suspension to a BAP or a CAP and streak for isolation.
3. Add approximately 50 l of the suspension to a liquid broth containing 50 l of blood

(sheep, rabbit, goat, or horse blood, but not human blood).
observe for growth.
5. If growth of the appropriate bacteria is visible, the broth tube can be discarded.
6. If no growth is observed on the plate, place 10 µl of the broth tube contents onto a new
agar plate, streak for isolation, and incubate for 18-24 hours at 35-37°C with ~5% CO2
 If the broth tube is not turbid, it is likely that the lyophilized sample is nonviable. This
is why it is strongly suggested that a specimen be prepared for long-term frozen storage
in addition to lyophilization.
 Isolates grown from lyophilized cultures should be subcultured at least once prior to
being used in tests
II. Preparation of infectious substances and diagnostic/patient specimens for packaging

and shipping
Transport of diagnostic specimens and etiologic agents (infectious substances) should be done
with care not only to minimize the hazard to humans and the environment, but also to protect the
viability of the suspected pathogens. Transport of infectious material by public or commercial
delivery systems may be subject to local, national, and international regulations.
If possible, specimens should be shipped so that they arrive in the receiving laboratory during
working hours to ensure proper handling, prompt plating, and storage of the specimens. The
receiving laboratory should be informed that the specimens are being shipped, preferably before
the specimens are sent, so that appropriate arrangements can be made.
Depending on local conditions, within-country transport may be by ground or by air. If

specimens are sent by a messenger, the messenger must know the location of the laboratory and
272
the appropriate person to contact. The sender should identify a quick, inexpensive, and reliable
mode of transport in advance and coordinate the shipping schedule and funding mechanism. For
longer distances and international shipments, the quickest transport service may be air-freight or
expedited delivery service. Because ice packs or dry ice for cold shipments will last only 24-48
hours, arrangements should be made for immediate collection at the receiving airport. In
addition, the sender should coordinate with a contact at the destination to identify any special
arrangements or criteria that need to be met for customs in that country. When specimens are
shipped by air, the following information should be communicated immediately to the receiving
laboratory: air freight company, air waybill number, flight number, times and dates of departure
and arrival of the flight, and contents of the package.
A. Preparation for transport of infectious specimens and cultures
N. meningitidis, S. pneumoniae, and H. influenzae specimens and isolates can be shipped frozen
or on chocolate agar slants, in silica gel packages, or as lyophilized cultures. They should be
packaged for transport as indicated below.
Frozen specimens and isolates
Frozen specimens and isolates should be shipped using a sufficient amount of ice packs or dry
ice to maintain the proper cold temperature throughout the duration of the transportation,
especially when shipping long distances or internationally. Ice packs will remain frozen for a
day or two after the dry ice has dissipated. Glass vials should not be used when shipping frozen
isolates. Guidelines for packaging infections substances and clinical specimens are listed in
Sections IV and V, respectively.
Chocolate agar slants
Chocolate agar slants in screw-cap tubes should be shipped at room temperature (25°C). Isolates
can survive for at least one week under these conditions.
Silica gel packages
Prepared silica gel packages should be shipped at 4°C (preferable) or at room temperature
(25°C). Isolates can survive for up to 2 weeks in silica gel packages. Silica gel packages should
be enclosed in 2 sealable bags within a plastic shipping container.
Lyophilized cultures
Lyophilized culture vials should be packaged according to the regulations specified in the WHO
Laboratory Safety Manual, which is available at:
http://www.who.int/csr/resources/publications/biosafety/WHO_CDS_CSR_LYO_2004_11/en/.
Each vial or tube should be individually wrapped before being enclosed in a metal container
along with enough absorbent material to absorb all liquid in the event of a spill. This container
should then be enclosed in a cardboard shipping container and can be transported at room
temperature (25°C). An address label and an etiological agent-warning label (EA label) should
273
be attached to the shipping container. No more than 50 ml of culture can be shipped in one
package.
III. Regulations regarding transport and shipment of infectious substances and

diagnostic/patient specimens
A. Regulatory organizations
The United Nations Committee of Experts on the Transport of Dangerous Goods is continually
developing recommendations for the safe transport of dangerous goods. The International Civil
Aviation Organization (ICAO) has used these recommendations as the basis for developing
regulations for the safe transportation of dangerous goods by air. The regulations of the
International Air Transport Association (IATA) contain all the requirements of the ICAO
Technical Instructions for the Safe Transport of Dangerous Goods. However, IATA has
included additional requirements that are more restrictive than those of ICAO. Member airlines
of the IATA have adopted the use of the IATA regulations governing dangerous goods and
shippers must comply with these regulations in addition to any applicable regulations of the state
of origin, transit, or destination.
The shipment of infectious substances or diagnostic specimens by air must comply with local,
national, and international regulations. International air transport regulations may be found in
the IATA publication titled Dangerous Goods Regulations. This reference is published annually
in January and the regulations are updated each year. A copy of the IATA regulations in
English, Spanish, French, or German may be obtained from one of the following regional offices.
Orders for IATA regulations from the Americas, Europe, Africa, and the Middle East:
Customer Service Representative

International Air Transport Association
800 Place Victoria, P.O. Box 113
Montreal, Quebec
CANADA H4Z 1M1
Telephone: +1 514 390 6726
Fax: +1 514 874 9659
Teletype: YMQTPXB
Orders for IATA Regulations from Asia and the Pacific:
Customer Service Representative

International Air Transport Association
77 Robinson Rd.
No. 05-00 SIA Building
SINGAPORE 068896
Telephone: +65 438 4555
Fax: +65 438 4666
Telex: RS 24200 TMS Ref: TM 2883
274
Cable: IATAIATA
Teletype: SINPSXB
Internet information:
www.iata.org
For internet orders, send e-mail to:

sales@iata.org
B. Shipping regulations for infectious substances and diagnostic/patient specimens
Packages that are shipped by air via commercial and cargo carriers (such as Federal Express,
DHL, and passenger aircraft) are affected by IATA regulations. These regulations are outlined
in this section of the laboratory manual to provide examples of acceptable packaging procedures
for infectious materials. However, because they may not reflect current national or IATA
requirements for packaging and labeling for infectious substances, anyone packaging isolates or
infectious specimens should consult the appropriate national regulations and the current edition
of the IATA Dangerous Goods Regulations before packing and shipping infectious substances
by any means of transport (2). Table 1 includes images of labels and packages appropriate for
shipping and different classifications of packages under IATA regulations. Note that a
completed Shipper’s Declaration for Dangerous Goods form is required for shipping hazardous
materials including infectious substances. Instructions for completing this form are provided at
the end of this section.
275
Table 1. Description of individual labels and markings required for safe and proper shipping of
different types of packages
276
C. Definition of infectious substances
According to IATA, infectious substances are defined as substances known or reasonably

expected to contain pathogens. Pathogens are microorganisms (including bacteria, viruses,
rickettsia, parasites, fungi) and other agents such as prions, which cause infectious disease in
humans or animals.
D. Definition of diagnostic/patient specimens
According to IATA, diagnostic/patient specimens are those collected directly from humans or
animals, including, but not limited to, excreta, secreta, blood and its components, tissue and
tissue fluid swabs, and body parts being transported for purposes such as research, diagnosis,
investigational activities, disease treatment and prevention.
IV. Guidelines for packaging and labeling infectious substances
Persons who ship infectious agents must comply with all local, national, and international
regulations pertaining to the packaging and handling of these materials. They must ensure that
specimens arrive at their destination in good condition and that they present no hazard to humans
or other organisms during transport.
A. The inner packaging of infectious substance shipments must include the following:
1. An inner watertight primary container that is glass, metal, or plastic and has a leak-proof
seal.
2. Packaged infectious agents or diagnostic specimens which are placed in the primary
container.
 Agar slants with screw-cap tops should be reinforced with adhesive tape. Petri plates
should not be shipped.
3. A watertight, impact-resistant secondary container.
 United Nations (UN) Specification Packaging that has been rigorously tested and
certified for infectious substances.
4. The primary receptacle or the secondary packaging must be capable of withstanding,

without leakage, an internal pressure producing a pressure differential of not less than 95
kPa and a temperature range of -40°C to 55°C (-40°F to 130°F).
5. Absorbent material (such as cotton wool) between the primary container and the
secondary container.
 If multiple primary containers are placed in a single secondary packaging, they must be
wrapped individually, separated, and supported to ensure that contact between them is
277
prevented. The absorbing material must be sufficient to absorb the entire contents of all
primary containers.
6. An itemized list of contents, placed between the secondary packaging and the outer
packaging.
B. The outer packaging of infectious substance shipments must meet the following
requirements:
1. Container should be of sufficient strength to adequately protect the contents.
2. Size must be at least 100 mm (4 inches) in its smallest overall external dimension and of
sufficient size to accommodate all labels to be placed on a single surface without
overlapping.
3. Package must be durably and legibly marked on the outside with the address and
telephone number of the shipper and the consignee (the intended recipient).
4. Infectious substance label must be affixed to the outside of the outer container and must
bear the inscription, “Infectious substance. In case of damage or leakage, immediately
notify public health authority.”
5. Marked with UN Specification Markings denoting that the packaging has been tested and
certified for shipping infectious substances.
6. Marked with the infectious substance marking (UN 2814): “Infectious substance,
affecting humans (Genus species or technical name) x total number of milliliters or
grams.” The species can be specified or otherwise indicated as “spp.” Note that this
marking can be written by hand and does not require a special adhesive label. For
example: “Infectious substance, affecting humans (N. meningitidis) x 5.0 ml” or
“Infectious substance, affecting humans (Streptococcus spp.) x 5.0 ml” or “Infectious
substance, affecting humans (HIV) x 0.5 ml”.
7. Labeled with a set of two up-arrows on at least two opposite sides of the outer box to
indicate the proper package orientation for the closures to be in the upright position.
8. Labeled on the top of the box with the statement “This End Up” or “This Side Up.”
9. Labeled with a “Cargo Aircraft Only” label if the total volume of the infectious substance
per outer shipping container is ≥50 ml.
10. Marked with the name and telephone number of the person responsible for the shipment.
The packaging requirements for transport of infectious substances are illustrated in Figure 2.
278
Image source: IATA Guidance Document, Infectious Substances, Annex 3, Montreal, Canada
Figure 2. Proper packing and labeling of the secondary container for shipping of infectious
substances
V. Guidelines for packaging and labeling diagnostic/patient specimens
Diagnostic/patient (clinical) specimens with a low probability of containing an infectious agent

must be packaged as follows, so that will not leak after a 1.2 meter drop test procedure:
1. Contents should be triple packed with a watertight primary container, a leak-proof

secondary container, and sufficient absorbent material to absorb all liquid in case of a
spill packed in between the primary and secondary containers.
2. The primary receptacle or the secondary packaging must be capable of withstanding,

without leakage, an internal pressure differential of 95 KiloPascals between -40°C and
55°C. Infectious substance containers exceed these criteria and are therefore acceptable
for use for packing and shipping of diagnostic specimens.
3. Include an itemized list of contents between the secondary packaging and the outer
packaging.
4. Marked with the “diagnostic specimens” statement on the outside of the outer container:
“Diagnostic specimen. UN 3373. Packed in compliance with IATA Packing Instruction
650.” This marking can be written by hand and does not require a special adhesive label.
5. If being shipped by air, the diagnostic specimens statement “Diagnostic specimen. UN

3373. Packed in compliance with IATA Packing Instruction 650” must be present on the
air waybill as well as on the outer container. The packaging requirements for transport of
diagnostic specimens are illustrated in Figure 3.
279
Image source: US Department of Transportation
Figure 3. Proper packing and labeling of the secondary container for shipping of
diagnostic/patient specimens
VI. Guidelines for packaging and labeling of specimens shipped on dry ice (CO2)
1. Dry ice must be placed outside the secondary packaging in an overpack and interior
supports must be provided to secure the secondary packaging in the original position after
the ice has dissipated.
2. Dry ice must be packed according to IATA Packing Instruction 954: the outer packaging
must permit the release of carbon dioxide (CO2) gas. Cardboard and polystyrene foam
are two examples of materials suitable for the packaging of dry ice. In a temperate
climate, approximately 6 pounds of dry ice will dissipate in a 24 hour period and are
therefore suitable for a 24 hour shipment. This amount should be adjusted accordingly
for warmer climates and size of the box to ensure that the contents remain frozen. For air
transport, the maximum dry ice allowed in a single outer container is 200 kg
(approximately 440 pounds).
3. Packages containing dry ice must be properly marked with the statement “Carbon
dioxide, solid (dry ice); UN1845; (and net weight of the dry ice in kg),” and a preprinted
Class 9 “Miscellaneous Dangerous Goods” label, as shown in Table 1.
4. When an overpack is used, it must be marked with the statement “Inner packages comply
with prescribed specifications” because the UN Specification Markings will not be
visible on the outer-most packaging.
280
VII. Guidelines for completion of the “Shipper’s Declaration for Dangerous Goods” form
All shipments of hazardous materials, including infectious substances, must be accompanied by

two original completed copies of the “Shipper’s Declaration for Dangerous Goods” form, along
with the other shipping documents. It is important to remember the following in order to reduce
the risk of a shipment being refused and returned to the laboratory of origin:
1. International regulations require the diagonal hatch marks in the left and right margins to
be printed in red. Therefore, black and white photocopies of this form may not be used.
2. The form must be completed in English, although translations may accompany it on the
same form.
3. Specific terms, spellings, and nomenclature must be used. For example, a cardboard box
must be referred to as “fibreboard box” (spelled with R before E), and there must be a
comma after the term “infectious substance” within the statement “infectious substance,
affecting humans”.
4. The person responsible for the shipment must be listed in one of the address boxes. If the
person responsible for the shipment is different than the shipper or recipient, the
responsible person’s telephone number should be included alongside the name.
5. Under the “Transport Details” portion of the form, cross out the option that does not
apply. If the shipment is less than 50 ml, cross out “cargo aircraft only.” If the shipment
is greater than 50 ml, cross out “passenger and cargo aircraft.”
6. Under the “Nature and Quantity of Dangerous Goods” portion of the form, the proper
shipping name for infectious substances is “Infectious substance, affecting humans
(technical name).” The technical name of the infectious substance(s) must be included in
parentheses after the proper shipping name; however, the specific species is not required
and “spp.” may follow the genus. The technical name of the infectious substance
Neisseria meningitidis should be listed as either “(Neisseria meningitidis)” or “(Neisseria
spp.).”
7. For “Infectious substances, affecting humans (technical name)”: the proper class is
Division 6.2, the UN number is UN2814, and the packing instruction is 620.
8. For “Carbon dioxide, solid (dry ice)”: the proper class is Class 9 Miscellaneous
Dangerous Good, the UN number is UN1845, the packing group is III, and the packing
instruction is 954.
9. For infectious substances, the quantity must be noted in ml under the “Quantity and Type
of Packing” portion of the form.
10. For dry ice, the quantity must be noted in kg (measured in whole numbers) under the
“Quantity and Type of Packing” portion of the form.
281
11. If the UN specification marking is not visible on the outer package, the declaration must
contain the statement “OVERPACK USED” under the “Quantity and Type of Packing”
portion of the form.
12. Under the “Additional Handling Information” portion of the form, the 24 hour emergency
contact telephone number must be answered by a person knowledgeable about
emergency response procedures for damaged and leaking boxes.
13. The “Shipper’s Declaration for Dangerous Goods” form is a legal document and must be
signed.
It is important to communicate shipping details to the intended recipient prior to shipment of the
package. In addition, arrangements should be made for proper handling during shipping and
legal importation of the infectious substance to ensure delivery without delay. These guidelines
are in accordance with IATA regulation 1.3.3.1.
References
1. Wasas, A.D., Huebner, R.E., and Klugman, K. 1999. Use of Dorset Egg Medium for
Maintenance and Transport of Neisseria meningitidis and Haemophilus influenzae Type
b. Journal of Clinical Microbiology 37:2045–6.
2. International Air Transport Association Dangerous Goods Regulations 52nd Edition,

Effective January 1, 2011. Montreal.
282
ANNEX
Preparation of Media and Reagents
Quality control (QC) of media
Each batch of media prepared in the laboratory and each new manufacturer’s lot number of
media should be tested using appropriate QC reference strains for sterility, the ability to support
growth of the target organism(s), and/or the ability to produce proper biochemical reactions. A
QC record should be maintained for all media prepared in the laboratory and purchased
commercially; including preparation or purchase date and QC test results. Any unusual
characteristic of the medium, such as color or texture, or slow growth of reference strains should
be noted.
I. Routine agar and broth media
All agar media should be aseptically prepared and dispensed into 15x100 mm Petri dishes (15-20
ml per dish). After pouring, the plates should be kept at room temperature (25°C) for several
hours to prevent excess condensation from forming on the covers of the dishes. For optimal
growth, the plates should be placed in a sterile plastic bag and stored in an inverted position at
4ºC until use. All broth media should be stored in an appropriate container at 4ºC until use.
A. Blood agar plate (BAP): trypticase soy agar (TSA) + 5% sheep blood
A BAP is used as a general blood agar medium. It is used for growth and testing of N.
meningitidis and S. pneumoniae. The plate should appear a bright red color. If the plates appear
dark red, they are either old or the blood was likely added when the agar was too hot. If so, the
media should be discarded and a new batch should be prepared.
Media preparation
1. Prepare the volume of TSA needed in a flask according to the instructions given on the label
of the dehydrated powder.
 It is convenient to prepare 500 ml of molten agar in a l-2 liter flask. If TSA broth powder
is used, add 20 g agar into 500 ml of distilled water.
 The media should be heated and fully dissolved with no powder on the walls of the vessel
before autoclaving.
3. Cool to 60ºC in a water bath.
4. Add 5% sterile, defibrinated sheep blood (5 ml sheep blood can be added to 100 ml of agar).
283
 If a different volume of basal medium is prepared, the amount of blood added must be
adjusted accordingly to 5% (e.g., 50 ml of blood per liter of medium). Do NOT use human
blood.
5. Dispense 20 ml into 15x100 mm Petri dishes. Allow the media to solidify and condensation
to dry.
6. Place the plates in sterile plastic bags and store at 4ºC until use.
Quality control
1. Grow a S. pneumoniae or an N. meningitidis QC strain for 18-24 hours on a BAP at 35-37°C

with ~5% CO2 (or in a candle-jar).
2. Observe the BAP for specific colony morphology and hemolysis.
3. As a sterility test, incubate an uninoculated plate for 48 hours at 35-37°C with ~5% CO2 (or
in a candle-jar).
Passing result:
 S. pneumoniae should appear as small, grey to grey-green colonies surrounded by a distinct
green halo (alpha-hemolysis).
 N. meningitidis should appear as large, round, smooth, moist, glistening, and convex, grey
colonies with a clearly defined edge on the BAP.
 After 48 hours, the sterility test plate should remain clear.
B. Blood culture broth
Blood culture medium is used to grow N. meningitidis, S. pneumoniae, and H. influenzae.
Media preparation
1. Follow the manufacturer’s instructions on the label of each bottle of dehydrated trypticase
soy broth (TSB).
2. Add 0.25 g sodium polyanetholsulfonate (SPS) per liter of medium.
 SPS is especially important for recovery of H. influenzae.
3. Dispense in 20 ml (for a pediatric blood culture bottle) and 50 ml (for an adult blood culture
bottle) amounts into suitable containers (tubes or bottles) with screw-caps with rubber
diaphragms.
 The amount of liquid in the containers should make up at least two-thirds of the total
volume of the container.
284
4. Autoclave at 121ºC for 15 minutes.
5. Allow to cool and store medium at room temperature (25°C).
Quality control
1. Grow N. meningitidis, S. pneumoniae, and H. influenzae QC strains for 18-24 hours on a

BAP or CAP at 35-37°C with ~5% CO2 (or in a candle-jar).
2. Add 1-3 ml of sterile rabbit, horse, or human blood to 3 bottles of freshly prepared blood
culture media.
3. Collect a loopful of overnight growth from each of the plates of bacteria and suspend it in 1-2
ml of blood culture broth (a different organism for each bottle).
4. Inoculate the bacterial suspensions into the 3 blood culture bottles.
5. Incubate the blood culture bottles at 35-37°C with ~5% CO2 (or in a candle-jar) for up to 7
days and observe for growth.
6. Subculture bacteria onto appropriate media at 14 hours and 48 hours.
7. As a sterility test, incubate an uninoculated blood culture bottle for 48 hours at 35-37°C with
Passing result:
 All three bacteria should be recovered on appropriate media after 24 and 48 hours.
C. Chocolate agar plate (CAP)
CAP is a medium that supports the special growth requirements (hemin and NAD) needed for
the isolation of fastidious organisms, such as H. influenzae, when incubated at 35-37°C in a 5%
CO2 atmosphere. CAP has a reduced concentration of agar, which increases the moisture content
of the medium. It can be prepared with heat-lysed horse blood, which is a good source of both
hemin and NAD, although sheep blood can also be used. Growth occurs on a CAP because
NAD is released from the blood during the heating process of chocolate agar preparation (the
heating process also inactivates growth inhibitors) and hemin is available from non-hemolyzed
as well as hemolyzed blood cells.
Media preparation
1. Heat-lyse a volume of horse or sheep blood that is 5% of the total volume of media being
prepared very slowly to 56°C in a water bath.
285
to dry.
in a candle-jar).
Quality control

CAP at 35-37°C with ~5% CO2 (or in a candle-jar).
2. Observe the CAP for specific colony morphology and hemolysis.
Passing result:
 N. meningitidis and H. influenzae should appear as large, round, smooth, convex, colorless-to-
grey, opaque colonies on the CAP with no discoloration of the medium.
 S. pneumoniae should appear as small grey to green colonies with a zone of alpha-hemolysis
(only slightly green) on the CAP.
D. CAP with bacitracin
CAP with bacitracin is a selective medium used to improve the primary isolation of H. influenzae
from specimens containing a mixed flora of bacteria and/or fungi.
Media preparation
1. Prepare double strength TSA (20 g into 250 ml distilled water) as the basal medium.
3. Cool to 50°C in a water bath.
 Use a thermometer to verify the temperature in the water bath.
4. Prepare a solution of 2% hemoglobin (5 g in 250 ml distilled water). Mix the hemoglobin in

5-6 ml of distilled water to form a smooth paste. Continue mixing as the rest of the water is
added.
7. Add the hemoglobin solution to the double strength TSA and continue to hold at 50ºC.
286
If a hemoglobin solution is unavailable, use the alternative method with defibrinated
sheep blood described below:
1. Add 5% sterile defibrinated sheep, rabbit, guinea pig, or horse blood (5 ml blood to
100 ml agar) to full-strength TSA agar base (20 g in 500 ml distilled water).
 Do NOT use human blood.
2. Heat to 56ºC in a water bath then cool to 50ºC.
8. After the hemoglobin solution or the defibrinated blood has been added to the base medium
and the medium has cooled to 50ºC, add the growth supplement containing hemin and NAD
to a final concentration of 1%. Mix the ingredients by gently swirling the flask in a figure 8
motion on the counter.
 Avoid forming bubbles.
9. Prepare a stock solution of bacitracin by suspending 3 g bacitracin in 20 ml distilled water.

Filter-sterilize, dispense into 1 ml amounts, and store at -20°C or -70°C.
10. While the medium is still at 50ºC, add 1 ml stock solution of bacitracin (prepared in step 9)
per 500 ml chocolate agar.
to dry.
Quality control
1. Grow an H. influenzae QC strain for 18-24 hours on a CAP with bacitracin at 35-37°C with
2. Observe the CAP with bacitracin for specific colony morphology and hemolysis.
in a candle-jar).
Passing result:
 H. influenzae should appear as large, round, smooth, convex, colorless-to-grey, opaque
colonies on the CAP with bacitracin with no discoloration of the medium.
E. Chocolate agar with TSA and growth supplement
287
Chocolate agar with TSA and growth supplements is a medium that supports the special growth
requirements (hemin and NAD) needed for the isolation of fastidious organisms, such as H.
influenzae, when incubated at 35-37°C in a 5% CO2 atmosphere.
Media preparation
1. Prepare double strength TSA (20 g into 250 ml distilled water) as the basal medium.
 Use a thermometer to verify the temperature in the water bath.
4. Prepare a solution of 2% hemoglobin (5 g in 250 ml distilled water). Mix the hemoglobin in

5-6 ml of distilled water to form a smooth paste. Continue mixing as the rest of the water is
added.
7. Add the hemoglobin solution to the double strength TSA and continue to hold at 50ºC.
If a hemoglobin solution is unavailable, use the alternative method with defibrinated

sheep blood described below:
1. Add 5% sterile defibrinated sheep, rabbit, guinea pig, or horse blood (5 ml blood to
100 ml agar) to full-strength TSA agar base (20 g in 500 ml distilled water).
 Do NOT use human blood.
2. Heat to 56ºC in a water bath then cool to 50ºC.
8. After the hemoglobin solution or the defibrinated blood has been added to the base medium
and the medium has cooled to 50ºC, add the growth supplement containing hemin and NAD
to a final concentration of 1%. Mix the ingredients by gently swirling the flask in a figure 8
motion on the counter.
 Avoid forming bubbles.
9. Dispense 20 ml in each 15x100 mm Petri dish. Allow the media to solidify and condensation
to dry.
288
Quality control

2. Observe the chocolate agar with TSA and growth supplements for specific colony
morphology and hemolysis.
in a candle-jar).
Passing result:
F. Chocolate agar with gonococcus medium (GC) base and growth supplement
Chocolate agar with GC base and growth supplement is a medium that supports the special
growth requirements (hemin and NAD) needed for the isolation of fastidious organisms, such as
H. influenzae, when incubated at 35-37°C in a 5% CO2 atmosphere.
Media preparation
1. Suspend 7.2 g of GC agar base in 100 ml distilled water in a flask. Mix thoroughly, heat
with frequent agitation, and bring to a boil for 1 minute to completely dissolve the powder.
2. Autoclave the flask at 121ºC for 15 minutes.
4. Add 100 ml of warm distilled water to 2 g of soluble hemoglobin powder. Mix the powder
with 5-10 ml of distilled water until a smooth paste is achieved. Gradually add the balance of
water until the solution is homogenous. Continually stir the solution during the addition of
water.
 Alternatively, 100 ml ready-made 2% sterile hemoglobin solution, warmed to 50ºC can be

used.
5. Autoclave the solution at 121ºC for 15 minutes. Cool to 50ºC in a water bath.
6. Reconstitute lyophilized growth supplement containing NAD and hemin by aseptically

transferring 10 ml of the accompanying diluent with a sterile needle and syringe. Shake to
289
assure complete solution. After reconstitution, use immediately, or store at 4ºC and use
within 2 weeks.
7. Aseptically add 100 ml sterile hemoglobin solution and growth supplement to 100 ml of the
GC agar base solution. Mix gently, but thoroughly, to avoid air bubbles in the agar.
to dry.
Quality control

2. Observe the chocolate agar with TSA and growth supplements for specific colony
morphology and hemolysis.
in a candle-jar).
Passing result:
G. Chocolate agar slants
Chocolate agar slants for transport and short-term storage can be prepared in the same manner as
described for agar plates with one difference: 4 ml of the medium should be dispensed into
16x125 mm screw-cap tubes and slanted before solidifying. Chocolate agar slants should look
brown to brownish-red in color. Chocolate agar slants should tested for QC using the same
methods used for QC testing of CAP.
H. Cystine trypticase agar (CTA) with 1% carbohydrate (a semi-solid medium)
Media preparation
1. Follow the manufacturer’s instructions for the amount of CTA medium to suspend in 900 ml
of distilled water. Mix thoroughly, heat with frequent agitation, and bring to a boil for 1
minute to completely dissolve the powder.
2. Autoclave the flask at 121°C for 15 minutes.
290
4. Prepare a 10% glucose (also called dextrose) solution by adding 10 g glucose to 100 ml
distilled water. Filter-sterilize using a 0.22 micron filter.
5. Aseptically add 100 ml of the 10% glucose solution from step 4 to 900 ml of CTA medium to
obtain a final concentration of 1% glucose.
6. Aseptically dispense 7 ml of the medium into 16x125 mm screw-cap glass tubes.
7. Repeat this procedure for the remaining 3 carbohydrates: maltose, lactose, and sucrose.
8. Store at 4°C and warm to room temperature (25°C) before use.
Quality control
1. Grow N. meningitidis, N. lactamica, and N. sicca QC strains to be tested for 18-24 hours on a
BAP at 35-37°C with ~5% CO2 (or in a candle-jar).
2. Allow the 4 CTA sugars, glucose, maltose, lactose, and sucrose, to warm to room
temperature (25°C) and label the tubes with the name of the QC strain.
3. Remove 3-5 colonies from overnight growth on the BAP using a 1 µl disposable loop.
4. Stab the CTA sugar several times into the upper 10 mm of medium. Approximately 8 stabs
with the same loopful are sufficient.
 Use a separate disposable loop for inoculating each carbohydrate to be tested.
5. Fasten the screw-cap of each tube loosely and place the tubes in a 35-37°C incubator without
CO2. Incubate the CTA sugars for at least 72 hours (and up to 5 days) before discarding as
negative.
6. Observe the CTA sugars for development of visible turbidity and color change to yellow.
Passing result:
 Development of visible turbidity and a yellow color in the upper portion of the medium
indicates growth of bacteria and production of acid and is interpreted as a positive test.
 N. meningitidis should utilize glucose and maltose, but not lactose or sucrose.
 N. lactamica should utilize glucose, maltose, and lactose, but not sucrose.
 N. sicca should utilize glucose, maltose, and sucrose, but not lactose.
I. Haemophilus test medium (HTM) plates
HTM is used for antimicrobial susceptibility testing for H. influenzae.
291
Media preparation
The Mueller-Hinton agar used to make HTM should be thymidine free to obtain consistent
results if susceptibility to cotrimoxazole is to be tested.
1. Prepare a fresh hemin stock solution by dissolving 50 mg of hemin powder in 100 ml of 0.01
mol/L NaOH with heat and stirring until the powder is thoroughly dissolved.
2. Prepare a nicotinamide adenine dinucleotide (NAD) stock solution by dissolving 50 mg of

NAD in 10 ml of distilled water; filter-sterilize.
3. Prepare Mueller-Hinton agar (MHA) from a commercially available dehydrated base

according to the manufacturer’s directions (or see protocol in section I.M.), adding 5 g of
yeast extract and 30 ml of hemin stock solution to 1 L of MHA.
4. After autoclaving, cool the medium to 45°C to 50°C in a water bath.
5. Aseptically add 3 ml of the NAD stock solution.
6. Pour agar into flat-bottom glass or plastic Petri dishes on a level pouring surface.
 Measure 60-70 ml medium per plate into 15x150 mm plates or measure 25-30 ml per plate
into 15x100 mm plates to give a uniform depth of approximately 4 mm.
 Plates should be uniformly 3-4 mm thick as the rate of diffusion of the antimicrobial agents
or the activity of the drugs may be affected.
 Using more or less agar will affect the susceptibility results.
7. Allow the media to solidify and condensation to dry.
8. The pH should be 7.2-7.4.
 Do not attempt to adjust the pH of the MHA test medium if it is outside the range.
Quality control
1. Grow a H. influenzae QC strain for 18-24 hours on a CAP at 35-37°C with ~5% CO2 (or in a
candle-jar).

292
3. Inoculate a HTM plate with 10 µl of the cell suspension using a sterile loop and streak for
isolation.
4. Observe HTM plate for specific colony morphology.
in a candle-jar).
Passing result:
colonies on the HTM plate with no discoloration of the medium.
J. Heart infusion agar (HIA) and trypticase soy agar (TSA)
HIA and TSA are general purpose media used with or without blood for isolating and cultivating
a number of microorganisms. The media should appear straw colored (yellowish to gold
coloring). HIA and TSA are also used for determining the hemin (X factor) and NAD (V factor)
growth requirements of H. influenzae.
Media preparation
1. Prepare the volume of HIA or TSA needed in a flask, according to the instructions on the
label of the dehydrated medium.
 These media should be fully dissolved with no powder on the walls of the vessel, before
autoclaving.
3. Cool to 50ºC in a water bath and dispense 20 ml into each 15x100 mm Petri dishes. Allow
the media to solidify and condensation to dry.
4. Place the plates in plastic bags and store at 4ºC until use.
Quality control
1. Grow a H. influenzae QC strain for 18-24 hours on a CAP at 35-37°C with ~5% CO2 (or in a
candle-jar).

293
 Do not transfer any of the chocolate agar media from the plate to the cell suspension as
even the smallest amount of agar will affect the test and may lead to misidentification of
the bacteria.
3. Inoculate one half of the HIA or TSA plate with 10 µl of the cell suspension using a sterile
loop or swab and allow the suspension to dry.
4. Place paper disks or strips containing hemin, NAD, and hemin/NAD on the inoculated plate
after the inoculum has dried.
5. Carefully invert the plates and incubate for 18-24 hours at 35-37°C with ~5% CO2 (or in a
candle-jar).
6. Observe growth on the HIA or TSA plate around the paper disks or strips.
in a candle-jar).
Passing Result:
 H. influenzae should grow only around the hemin/NAD disk.
K. Heart infusion rabbit blood agar plate (HIA - rabbit blood)
HIA-rabbit blood is used for determining the hemolytic reaction of Haemophilus species. This
medium should appear bright red and look very similar to BAP. If the medium is dark red, it
should be discarded and a new batch should be prepared. Horse blood may be substituted for
rabbit blood in this medium.
Media preparation
1. Prepare the volume of HIA needed in a flask according to the instructions on the label of the
dehydrated medium.
4. Add 5% sterile, defibrinated rabbit blood (alternatively, 5 ml sheep blood can be added to
100 ml of agar).
to dry.
294
Quality control
1. Grow a hemolytic H. haemolyticus QC strain for 18-24 hours on a HIA-rabbit blood at 35-
37°C with ~5% CO2 (or in a candle-jar).
 After streaking the plate with the QC stain, stab the media with the inoculating loop.
2. Observe the HIA-rabbit blood for specific colony morphology and beta-hemolysis (clear).
in a candle-jar).
Passing result:
 H. haemolyticus should appear as large, round, smooth, convex, colorless-to-grey, opaque
colonies and be surrounded by a distinct zone of complete hemolysis which appears as a clear
halo surrounding the colonies.
L. Horse blood agar (blood agar base)
This highly nutritive medium may be used for the primary isolation of H. influenzae and for the
determination of the hemolysis with H. haemolyticus or other bacteria.
Media preparation
1. Prepare the volume of blood agar base needed in a flask according to the manufacturer’s
instructions on the label of the dehydrated medium.
4. Add 5 ml horse blood per 100 ml of the medium.
5. Mix well and dispense 20 ml into 15x100 mm Petri dishes. Allow the media to solidify and
condensation to dry.
Quality control
1. Grow a hemolytic H. haemolyticus QC strain for 18-24 hours on a horse blood agar plate at
35-37°C with ~5% CO2 (or in a candle-jar).
 After streaking the plate with the QC stain, stab the media with the inoculating loop.
295
2. Observe the horse blood agar for specific colony morphology and beta-hemolysis (clear).
in a candle-jar).
Passing result:
 H. haemolyticus should appear as large, round, smooth, convex, colorless-to-grey, opaque
colonies and be surrounded by a distinct zone of complete hemolysis which appears as a clear
halo surrounding the colonies.
M. MacConkey (MAC) agar
MacConkey Agar is used for the isolation and differentiation of lactose-nonfermenting, gram-
negative enteric bacteria from lactose-fermenting organisms. It is recommended that MAC
medium be purchased commercially because preparing it with individual ingredients produces
variability among lots.
Media preparation
1. Prepare MAC according to manufacturer’s instructions.
2. Sterilize the medium by autoclaving at 121°C for 15 minutes.
to dry.
Quality control
1. Grow an E. coli QC strain for 18-24 hours on a MAC at 35-37°C with ~5% CO2 (or in a
candle-jar).
2. Observe the MAC for specific colony morphology.
in a candle-jar).
Passing result:
 E. coli should appear as pink to red colonies.
N. Modified Thayer-Martin (MTM) agar medium
296
MTM is a selective medium used to improve the primary isolation of N. meningitidis from
specimens containing a mixed flora of bacteria and/or fungi. MTM is a chocolate agar base
containing vancomycin, colistin, nystatin, and trimethoprim lactate.
Media preparation
1. Suspend 7.2 g of GC agar base in 100 ml distilled water in a flask. Mix thoroughly, heat
with frequent agitation, and bring to a boil for 1 minute to completely dissolve the powder.
2. Autoclave the flask at 121ºC for 15 minutes.
4. Add 100 ml of warm distilled water to 2 g of soluble hemoglobin powder. Mix the powder
with 5-10 ml of distilled water until a smooth paste is achieved. Gradually add the balance of
water until the solution is homogenous. Continually stir the solution during the addition of
water.
 Alternatively, 100 ml ready-made 2% sterile hemoglobin solution, warmed to 50ºC can be

used.
5. Autoclave the solution at 121ºC for 15 minutes. Cool to 50ºC in a water bath.
6. Reconstitute lyophilized growth supplement containing NAD and hemin by aseptically

transferring 10 ml of the accompanying diluent with a sterile needle and syringe. Shake to
assure complete solution. After reconstitution, use immediately or store at 4ºC and use
within 2 weeks.
7. Aseptically add 100 ml sterile hemoglobin solution and growth supplement to 100 ml of the
GC agar base solution. Mix gently, but thoroughly, to avoid air bubbles in the agar.
8. To the agar base solution, add the following ingredients:

3.0 µg/ml vancomycin
7.5 µg/ml colistin
12.5 units/ml nystatin
5.0 µg/ml trimethoprim lactate
to dry.
Quality control
1. Grow a N. meningitidis QC strain for 18-24 hours on a MTM at 35-37°C with ~5% CO2 (or
in a candle-jar).
297
2. Observe the MTM for specific colony morphology.
in a candle-jar).
Passing result:
 N. meningitidis should appear as large, round, smooth, convex, colorless-to-grey, opaque
colonies on the MTM with no discoloration of the medium.
O. Mueller-Hinton agar
Mueller-Hinton agar (MHA) is used for making the media required for susceptibility testing for
N. meningitidis, S. pneumoniae, and H. influenzae. It is recommended that dehydrated Mueller-
Hinton agar medium be purchased commercially because preparing it with individual ingredients
can diminish the quality.
Media Preparation
1. Follow manufacturer’s instructions to prepare MHA from a commercially available

dehydrated base.
2. After autoclaving, cool the agar in a 45°C to 50°C water bath.
5. The pH of MHA should be 7.2-7.4.
 Do not attempt to adjust the pH of the MHA test medium if it is outside the range.
Quality control
1. Grow an E. coli QC strain for 18-24 hours on a MHA plate at 35-37°C with ~5% CO2 (or in
a candle-jar).
298
in a candle-jar).
Passing result:
 Observe for E. coli growth.
P. Mueller-Hinton agar with 5% sheep or horse blood
Mueller-Hinton agar with 5% sheep or horse blood is used for susceptibility testing for N.
meningitidis and S. pneumoniae. It is recommended that dehydrated MHA medium be
purchased commercially because preparing it with individual ingredients can diminish the
quality.
Media preparation
1. Prepare MHA as described above in Section I.M. through step 2.
2. Add 5% sterile defibrinated sheep or horse blood to the medium at 5% (i.e., 50 ml blood per
liter of medium or 25 ml blood to 500 ml medium.
3. The pH of MHA after the addition of blood should be 7.2-7.4.
 Do not attempt to adjust the pH if it is outside the range.
Quality control
1. Grow a S. pneumoniae or a N. meningitidis QC strain for 18-24 hours on Mueller-Hinton

agar with 5% sheep or horse blood at 35-37°C with ~5% CO2 (or in a candle-jar).
in a candle-jar).
299
Passing result:
green halo (alpha-hemolysis).
 N. meningitidis should appear large, round, smooth, moist, glistening, and convex, grey
Q. Mueller-Hinton Broth
Mueller-Hinton broth is used to prepare the Mueller-Hinton broth (cation-adjusted).
Media Preparation
1. To 750 ml deionized H2O add:

3.0 g beef extract
17.5 g acid hydrolysate of casein (casamino acids)
1.5 g soluble starch
2. Adjust final volume to 1 liter.
3. Adjust pH to 7.3.
4. Autoclave the broth at 121°C for 20 minutes to sterilize.
Quality control
1. Streak 10 µl onto a BAP or a CAP and incubate for 48 hours at 35-37°C with ~5% CO2 (or in
a candle-jar) to verify the sterility of the solution.
Passing result: no growth should be observed.
R. Mueller-Hinton broth (cation-adjusted)
Mueller-Hinton broth (cation-adjusted) is used to prepare dilutions equivalent McFarland

standards with minimal loss of viability.
Media Preparation
1. Prepare a magnesium stock solution by dissolving 8.36 g of MgCl2·6H2O in 100 ml

deionized H2O to a final concentration of 10 ng/ml Mg2+.
2. Prepare a calcium stock solution by dissolving 3.68 g of CaCl2·2H2O in 100 ml deionized

H2O to a final concentration of 10 mg/ml Ca2+.
3. Filter-sterilize both stock solutions.
300
4. To Mueller-Hinton broth, add the magnesium stock solution to a final concentration of 10-
12.5 g/ml Mg2+.
5. Add the calcium stock solution to a final concentration of 20-25 g/ml Ca2+.
Quality control
S. Trypticase soy broth (TSB)
TSB is used for making suspensions of H. influenzae prior to testing for hemin and NAD
requirements. Heart infusion broth, sterile saline, or PBS may be substituted for TSB.
Media preparation
1. Prepare the volume of TSB needed in a flask according to the instructions on the label of the
dehydrated medium.
2. Dispense 5 ml into 15x125 mm tubes.
4. Cool and store at 4ºC.
Quality control
1. Grow a S. pneumoniae QC strain for 18-24 hours on a BAP at 35-37°C with ~5% CO2 (or in
a candle-jar).
 H. influenzae does not grow in TSB, but the medium should not be toxic to other bacteria.
Therefore, S. pneumoniae should be used to QC for toxicity.
2. Inoculate a tube of TSB with a loop of overnight growth from the BAP and incubate
overnight at 35ºC.
3. The broth should be turbid the next day. Subculture the broth onto a BAP to test for proper
growth characteristics of S. pneumoniae.
4. Observe the BAP for specific colony morphology and hemolysis.
Passing result: S. pneumoniae colonies are small and appear grey to grey-green surrounded by a
distinct green halo (alpha-hemolysis).
301
II. Storage and transport media
A. Defibrinated sheep blood
Defibrinated sheep blood is used for long term preservation of isolates by freezing at -70°C.
Media preparation
1. Mechanically shake 30 ml sheep blood with sterile glass beads or a wooden stick device in a
125-250 ml Erlenmeyer flask at approximately 90 rpm for 7-9 minutes.
 Clotting factors will be visible in the flask as a translucent, fibrous web.
2. Remove the clotting factors using sterile forceps.
3. Store at 4°C when not in use.
Quality control
B. Dorset Transport medium
Dorset Transport medium is used for short term storage of N. meningitidis, S. pneumoniae, and
H. influenzae isolates.
Media preparation
1. Combine sterile 0.85 % saline solution with beaten whole hen’s eggs at a 1:3 ratio.
2. Inspissate (i.e., thicken) the mixture in an electric inspissator at 80°C for 60 minutes.
Quality control
C. Greaves solution
302
Greaves solution is used for long term preservation of isolates by freezing at -70°C.
Media preparation
1. To 200.0 ml distilled water, add:

10.0 g bovine albumin, fraction V
10.0 g L-glutamic acid, sodium salt
20.0 ml glycerol
2. Mix all ingredients listed below until they are completely dissolved.
3. Filter-sterilize the solution and transfer to a sterile flask.
Quality control
D. Modified Trans-Isolate (MT-I) medium
Modified Trans-Isolate medium (MT-I) was designed and developed to be a simple and
inexpensive medium for transport of CSF and growth of meningococci in large scale epidemics
of meningococcal disease. It is less expensive and easier to produce than the standard T-I, and
can be produced in most microbiology laboratories at approximately USD $0.50/bottle,
providing a relatively inexpensive, rapidly available (reducing the production and shipping time
and cost) transport medium and diagnostic tool for use during a meningitis epidemic. The
ingredients of the MT-I formulation are similar to those in T-I, with modifications to eliminate
costly ingredients and save time.
Laboratory evaluation has demonstrated that growth/survival of isolates of meningococci was

equal in T-I and MT-I under several environmental conditions. It has not been evaluated under
field conditions with clinical specimens yet. It does not support the growth of H. influenzae;
therefore, it is not used for routine surveillance of agents of bacterial meningitis.
0.5 oz, sterile round, clear glass screw-cap (with rubber liner) bottles should be used.
MT-I bottles should be stored upright at 4oC when not in immediate use and warmed to room
temperature (25-30°C) before use. In the refrigerator, the liquid phase becomes gelatinous but
re-liquefies at room temperature. MT-I media has a shelf life of 1 year with proper storage.
Media preparation
1. Weigh all ingredients listed below and place them into a 500mL Erlenmeyer flask.
303
8 g 2.0% gelatin
2 g 0.5% agar
2.5 g Tris-HCl
0.5 g Tris base
12 g 3.0% Tryptic Soy Broth
2. Add 350 ml distilled, deionized water to the flask (pH should be 7.5 at 25°C).
3. Place a magnetic stirring bar in the flask and place the flask on hot plate stirrer.
4. Bring the solution to boiling (90-100oC) to melt and dissolve the gelatin until the medium is
completely clear (about 30-45 minutes).
5. Remove the flask from the hot plate stirrer.
6. Mix 2.6 g 0.5% soluble starch with a small amount of cold water and dissolve completely.
7. Once the starch is evenly distributed throughout medium, add 1.6 g 0.4% activated charcoal
and adjust water to 400ml.
8. Return the flask to the hot plate stirrer until all ingredients are thoroughly mixed (about 10
minutes).
 The solution should be liquid, appear black in color, and should not have any clumps.
9. Turn down the heat to low so the flask can be handled comfortably while dispensing the
medium.
 Optional: At this step, the procedure can be stopped overnight if there is not enough time to
dispense. Split the media into two flasks and place both flasks at 4ºC overnight. The next
day, apply heat until fully melted and aliquot (see step 10).
10. While the media is being stirred, use a sterile serological pipette to remove 7 ml of medium
and dispense into each bottle.
11. Cap each bottle loosely with a screw cap.
12. Autoclave the bottles for 15 minutes at 121oC.
13. Tighten the caps as soon as possible after autoclaving.
14. Swirl the bottles to avoid the charcoal settling.
15. Slant the bottles overnight (or at least 4 hours) on wooden slanting stick (35 mm, 35 mm, 500
mm).
 When slanted, the liquid should reach shoulder of the bottle.
304
16. Once the medium is firm, stand the bottles upright.
17. In approximately 1 hour, the weak slant should release some of the broth and the medium
should appear biphasic.
Quality control
1. Grow N. meningitidis and S. pneumoniae QC strains for 18-24 hours on a BAP or a CAP at
35-37°C with ~5% CO2 (or in a candle-jar).
2. For each organism, make a cell suspension equivalent to a 0.5 McFarland standard
(~equivalent to 1.5x108 CFU/ml) and serially dilute it to achieve an inoculum size of 103
CFU/ml in brain heart infusion (BHI) broth.
3. Remove the screw cap from 3 MT-I bottles.
4. Inoculate the MT-I bottles with 100 µl of the 103 CFU/ml suspensions within 15 minutes of
preparation (inoculum size is 100 CFU) and replace the screw caps tightly.
 After inoculation and replacement of the screw-caps, invert each MT-I bottle several times
to mix.
5. Slightly loosen the screw-caps of the MT-I bottles to allow some air exchange.
6. Incubate the MT-I bottles for 18-24 hours at 35-37°C with ~5% CO2 (or in a candle-jar).
7. Close the screw-caps tightly and invert each MT-I bottle several times to mix.
8. Remove 10 µl of broth from each MT-I bottle and inoculate a BAP for the MT-Is containing
N. meningitidis and S. pneumoniae and a CAP for the MT-I containing H. influenzae.
9. Streak for isolation with a sterile loop and incubate plates for 18-24 hours at 35-37°C with
~5% CO2 (or in a candle-jar) to detect growth of the QC strains.
Passing results:
 N. meningitidis should appear large, round, smooth, moist, glistening, and convex, grey
green halo (alpha-hemolysis) on the BAP.
E. 10% skim milk and 15% glycerol solution
10% skim milk and 15% glycerol solution is used for long term preservation of isolates by
freezing at -70°C.
305
Media preparation
1. Place 10 g dehydrated skim milk and 85 ml distilled water into flask A. Swirl to mix.
2. Place 15 ml of glycerol into flask B.
3. Autoclave both flasks at 115°C for 10 min, and exhaust the pressure carefully.
4. While still hot, pour the contents of flask A into flask B in a safety cabinet.
Quality control
F. Skim milk tryptone glucose glycerol (STGG) medium
STGG medium is used for transport and short term storage of nasopharyngeal swabs.
Media preparation
1. Add the following ingredients to 100 ml distilled water:

2 g skim milk powder
3 g TSB
0.5 g glucose
10 ml glycerol
2. Mix to completely dissolve all ingredients.
3. Dispense 1.0 ml amounts into 1.5 ml screw-cap vials.
4. Loosen the screw-caps and autoclave at 121°C for 10 minutes.
5. Tighten the caps after autoclaving and store at -20°C until use.
Quality control
306
G. Trans-Isolate (T-I) medium
T-I is used to transport CSF and grow N. meningitidis, H. influenzae, and S. pneumoniae from
CSF. 10 cc tubing vials with rubber septum plugs and aluminum crimp seal caps should be used.
T-I bottles should be stored upright at 4ºC when not in immediate use. T-I media should be
warmed to room temperature (25ºC) before use. In the refrigerator, the liquid phase becomes
gelatinous but re-liquefies at room temperature. T-I media has a shelf life of 1 year with proper
storage.
Media preparation
Diluent for solid and liquid phases: 3- (N-morpholino) propanesulfonic acid (MOPS)
buffer; 0.1 M, pH 7.2
1. Dissolve 20.93g MOPS in 900ml distilled water.
2. Adjust to pH 7.2 with 1N NaOH.
3. Adjust volume to 1000 ml with distilled water.
Solid phase
Activated charcoal 2.0 g
Soluble starch 2.5 g
Agar 10.0 g
1. Suspend activated charcoal, soluble starch, and agar into 500 ml of MOPS buffer in a flask
and add a magnetic bar to the flask.
2. Heat on a magnetic stirrer hot plate to dissolve the charcoal and starch and melt the agar.
3. While stirring to keep the charcoal in suspension, use a sterile serological pipette to remove
5.0 ml and dispense into each serum bottle.
4. Cap each bottle with a piece of aluminum foil and autoclave at 121°C for 20 minutes.
5. Remove from the autoclave and slant the bottles until they reach room temperature (25°C), so
that the apex of the agar reaches the shoulder of each bottle.
Liquid phase
Tryptic soy broth (TSB) 30.0 g
Gelatin 10.0 g
MOPS buffer 500.0 ml
1. Heat the TSB, gelatin, and MOPS buffer to completely dissolve the gelatin and avoid
coagulation.
307
2. Autoclave the media at 121°C for 15 minutes.
Optional additive for growth of H. influenzae
1. Once the bulk liquid phase medium has cooled to room temperature (25°C) after autoclaving,
add 10 ml of a sterile liquid growth supplement containing NAD and hemin aseptically to
help support growth of H. influenzae.
 Alternatively, aseptically add 0.1 ml of the supplement to an individual T-I bottle (1% of
the volume of both phases) or to a limited number of bottles, as needed.
 If a commercial growth supplement is used (preferred method), it should be a sterile

product and can be added directly to the T-I medium.
 If the growth supplement is prepared in the laboratory, it should be filter-sterilized prior to

being added to the T-I medium. To prepare the supplement in the laboratory:
1. Dissolve the lyophilized supplement into an appropriate diluent (usually water).

2. Filter-sterilize using a 0.45 micron pore size membrane.
3. Use immediately.
T-I medium
1. Dispense 5 ml of the liquid phase aseptically into each of the bottles containing the solid
phase slants.
2. Seal the bottles with sterile rubber septum plugs and aluminum caps. Use a hand crimping
tool to fasten the aluminum caps if an automated system is not available.
Quality control

BAP or CAP at 35-37°C with ~5% CO2 (or in a candle-jar).
2. For each organism, make a cell suspension equivalent to a 0.5 McFarland standard
(~equivalent to 1.5X108 CFU/ml) and serially dilute to achieve an inoculum size of 103
CFU/ml in brain heart infusion (BHI) broth.
3. Using sterile forceps pull the aluminum cover of 3 T-I bottles away from the rubber stopper
and wipe the stopper with 70% isopropanol or ethanol.
 Do not use povidone-iodine.
308
4. Use a sterile syringe and needle to inoculate the T-I bottles with 100 µl of the 103 CFU/ml
suspensions within 15 minutes of preparation (inoculum size is 100 CFU).
 Use a new needle and syringe for each T-I. After inoculation and removal of the syringe
and needle from the rubber stopper, invert each T-I bottle several times to mix.
5. Insert a sterilized T-I venting needle through the rubber stopper of each of the inoculated T-I
bottles.
 Be sure that the venting needles do not touch the broth.
6. Incubate vented T-I bottles for 18-24 hours at 35-37°C with ~5% CO2 (or in a candle-jar).
7. Remove and discard venting needles. Invert each T-I bottle several times to mix.
8. Use a sterile syringe and needle to remove 100-200 µl of broth from each T-I bottle and place
the broth into a sterile, labeled 1.5 ml microcentrifuge tube. Inoculate a BAP for the T-Is
containing N. meningitidis and S. pneumoniae and a CAP for the T-I containing H. influenzae
with 10 µl of this broth.
9. Streak for isolated colonies with a sterile loop and incubate plates for 18-24 hours at 35-37°C
with ~5% CO2 (or in a candle-jar) to detect growth of the QC strains.
Passing results:
 N. meningitidis should appear as large, round, smooth, moist, glistening, and convex, grey
green halo (alpha-hemolysis) on the BAP.
colonies on the CAP with no discoloration of the medium.
III. Miscellaneous reagents
A. Gram stain reagents
Ammonium oxalate-crystal violet
1. Dissolve 2.0 g certified crystal violet into 20.0 ml of 95% ethyl alcohol.
2. Dissolve 0.8 g ammonium oxalate into 80.0 ml distilled water.
3. Mix the two solutions together and allow them to stand overnight at room temperature
(25°C).
4. Filter through coarse filter paper before use.
309
5. Store at room temperature (25°C).
Gram’s iodine (protect solution from light)
1. Grind 1.0 g iodine (crystalline) and 2.0 g potassium iodide in a mortar. Small additions of
distilled water may be helpful in preparing the solution.
2. Add to 300.0 ml distilled water.
3. Store at room temperature (25°C) in a foil-covered bottle.
Decolorizer is 95% ethyl alcohol
Counterstain (there are 2 options: safranin or carbol-fuchin)
Safranin
1. Add 2.5 g certified safranin-O to 100.0 ml 95% ethyl alcohol.
2. Add 10.0 ml safranin and ethyl alcohol solution made in step 1 to 90.0 ml distilled water.
3. Store at room temperature (25°C).
Ziehl-Nielsen carbol-fuchsin (may be a more effective counterstain than safranin)
1. Dissolve 0.3 g basic fuchsin in 10.0 ml 95% ethyl alcohol.
2. Add 5.0 ml melted phenol crystals to 95.0 ml distilled water.
3. Add the 5% phenol solution to the fuchsin solution and let stand overnight.
4. Filter through coarse filter paper.
5. Store at room temperature (25°C) in a foil-covered bottle for up to 1 year.
B. Iodine tincture
Iodine tincture is used as a skin antiseptic and should not be used to disinfect the rubber stoppers
of T-I and blood culture bottles.
1. Add 1 g of iodine to 100 ml of 70% isopropyl alcohol.
2. Store at room temperature (25°C) in a foil-covered bottle for up to 1 year.
C. McFarland turbidity standards
310
1. Prepare a 1% solution of anhydrous BaCl2 (barium chloride).
2. Prepare a 1% solution of H2SO4 (sulfuric acid).
3. Combine and completely mix the barium chloride and sulfuric acid solutions to form a turbid
suspension of BaSO4 in a specific proportion for each McFarland turbidity standard as shown
in Table 1.
4. Place the resulting mixture in a foil-covered screw-cap tube.
5. Store the McFarland standard at room temperature (25°C) when not in use. Prepare a fresh
standard solution every 6 months. McFarland standard density solution will precipitate and
clump over time, and it needs vigorous vortexing before each use. Mark the tube to indicate
the level of liquid, and check before use to be sure that evaporation has not occurred.
Table 1. McFarland turbidity standards
McFarland turbidity standard no. 0.5 1 2 3 4

1% barium chloride (ml) 0.05 0.1 0.2 0.3 0.4
1% sulfuric acid (ml) 9.95 9.9 9.8 9.7 9.6
Approx. cell density (1x10^8 CFU/ml) 1.5 3.0 6.0 9.0 12.0
D. Phosphate buffered saline (PBS)
1. To 1000 ml distilled water, add the following ingredients for 0.1 M PBS:
7 g sodium dihydrogen phosphate
7 g disodium hydrogen phosphate
2. Mix to completely dissolve ingredients.
3. Adjust pH to 7.2 with 1 N acid or base.
4. Dispense buffer into a flask and autoclave at 121°C for 15 minutes.
5. Store at room temperature (25°C) for up to one year.
E. Physiological saline
1. Dissolve 8.5 g NaCl into 1 L distilled water.
2. Autoclave at 121°C for 15 minutes or sterilize using membrane filtration.
3. Store at room temperature (25°C) for up to 6 months.
311
Summary
This manual is the 2nd edition of the World Health Organization Manual “Laboratory
Methods for the Diagnosis of Meningitis Caused by Neisseria meningitidis, Streptococcus
pneumoniae, and Haemophilus influenzae.” The first edition was published in 1999 and
summarized the laboratory techniques used in isolation and identification of Neisseria
meningitidis, Streptococcus pneumoniae, and Haemophilus influenzae from the blood or
cerebrospinal fluid of patients with bacterial meningitis.
In the twelve years since the first edition of this manual, important changes have oc-
curred both in the epidemiology of bacterial meningitis and in the available laboratory
techniques for isolating, identifying, and characterizing the causative organism. Great
progress has been made in increasing worldwide access to vaccines to prevent pneumo-
coccal, Hib, and meningococcal disease. These developments have prompted a revision
of the manual to produce this second edition. The revision follows the format of the first
edition, but has been expanded to include specific chapters on Results Management and
Reporting of Data, Biosafety, PCR for Detection and Characterization of Bacterial Men-
ingitis Pathogens, Antimicrobial Susceptibility Testing, Characterization by Molecular
Typing Methods and Quality Control/Quality Assurance.
Surveillance for diseases caused by infectious agents targeted by newer vaccines are likely
to require a syndromic approach, that is identifying persons who are ill with a specific
group of symptoms that may indicate the presence of a specific disease that must be con-
firmed by laboratory testing. The laboratory plays a crucial role in the diagnosis of bacte-
rial meningitis. Patients diagnosed with meningitis syndrome may all exhibit similar
symptoms (i.e., fever, headache, stiff neck) but each individual’s disease could be caused
by a variety of organisms including the bacterial meningitis pathogens N. meningitidis,
S. pneumoniae, and H. influenzae. Hence, a strong laboratory component of surveillance
must complement the clinical syndromic surveillance to allow for diagnostic confirma-
tion of the specific disease.
Publication date: 01 DEC 2011
CS226509-A

WHO Manual PDF

Uploaded by

Copyright:

Available Formats

WHO Manual PDF

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

WHO Manual PDF

Uploaded by

Copyright:

Available Formats

WHO/IVB.11.

Photo: Jon Shadid/UNICEF

Laboratory Methods for the

Additional copies of this book can be obtained from either:

WHO Press, World Health Organization,

Meningitis and Vaccine Preventable Diseases Branch

Respiratory Diseases Branch

Anne von GOTTBERG

Fem Julia PALADIN

Aparna Singh SHAH

III. 2011 WHO Meningitis Manual other Contributors

Jean Bosco NDIHOKUBWAYO

Microbiology and microbiologists have made extraordinary contributions to humanity saving

Chapter # Chapter Title Pages

Epidemiology of Meningitis Caused by Neisseria meningitidis, Streptococcus

The term “meningitis” describes inflammation of the membranes (meninges) and/or

N. meningitidis may either be encapsulated or unencapsulated. However, nearly all invasive N.

Worldwide, the incidence of meningitis due to N. meningitidis is highest in a region of sub-

H. influenzae, like N. meningitidis, may be either unencapsulated or encapsulated with a

S. pneumoniae, like N. meningitidis and H. influenzae, is an encapsulated bacterium. The

Prevention and control

In 2010, a new serogroup A meningococcal conjugate vaccine was licensed, pre-qualified by

A 23-valent polysaccharide vaccine is available for S. pneumoniae. Like other polysaccharide

Role of the laboratory

 Lapeyssonnie, L. 1963 La méningite cérébro-spinale en Afrique. Bulletin of the World

1. Aguilera, J. F., A. Perrocheau, C. Meffre, S. Hahne, and W. W. Group. 2002.

Results Management and Reporting of Data

I. Data management and reporting

II. Data management systems

A data management system can be as simple as a laboratory logbook or as complex as a

III. Request form and record keeping

 Patient’s name, date of birth, sex, and residence address

IV. Data reporting

 ISO 15189:2007. Medical laboratories: requirements for quality and competence.

Laboratorians working with infectious agents are at risk of laboratory-acquired infections as a

I. Protective clothing and equipment

II. Standard microbiological safety practices

A. Limiting access to laboratory

The following procedure is recommended for decontaminating spills:

 Isolate the area to prevent anyone from entering.

All procedures must be carefully performed to minimize splashes or aerosolization. When

 Centrifugation, vortexing, and vigorous mixing: these procedures should be performed in

I. Decontaminating bench tops and other surfaces

J. Disposal of contaminated materials

L. General laboratory cleanliness

M. Refrigerators and freezers

III. Special Practices

B. Laboratory design and equipment

C. Medical surveillance of laboratory workers

D. Biosafety management and implementation

E. Other sources of biosafety information

For more information, please review:

Clinical and Laboratory Standards Institute. Protection of Laboratory Workers From

Laboratory Biosafety Manual, third edition. WHO/CDS/CSR/LYO/2004.11. World Health

Collection and Transport of Clinical Specimens

It is important to adhere to proper biosafety guidelines while handling potentially infectious

 Dispose of syringes and needles in a puncture-resistant, autoclavable discard container. Do

 Remove gloves and discard in an autoclavable container.

II. Collection and transport of CSF