Send Orders for Reprints to reprints@benthamscience.

ae
Current Hypertension Reviews, 2019, 15, 000-000 1

RESEARCH ARTICLE

Alpha Adducin (ADD1) Gene Polymorphism and New Onset of Diabetes

Under the Influence of Selective Antihypertensive Therapy in Essential
Hypertension

Sumeet Guptaa,*, Vikas Jhawata, Bimal Kumar Agarwalc, Partha royb and Vipin Sainid

a
Department of Pharmacology, M. M. College of Pharmacy, M M (Deemed to be University), Mullana, (Ambala),
Haryana, India; bDepartment of Biotechnology, Indian Institute of Technology Roorkee, Uttarakhand, India; CDepart-
ment of Medicine, M. M. Institute of Medical Sciences and Research, M. M. University, Mullana, (Ambala), Haryana,
India; dM. M. Medical College & Hospital, Kumarhatti, Solan, Himachal Pardesh, India

Abstract: Background: Different antihypertensive therapies (especially diuretics) are reported to

induce the new onset of diabetes in some hypertensive patients. α-adducin-1 (ADD1) gene is salt
sensitive gene which has its role in etiology of hypertension via salt sensitivity. Therefore, the
G460T polymorphism of ADD1 gene may be associated with new onset of diabetes under the influ-
ence of diuretic and other antihypertensive therapies.
Aim: To assess the correlation between genetic polymorphism (ADD1 G460T polymorphism) and
glycaemic disturbance under influence of diuretic and other antihypertensive drug therapies.
Materials and Methods: We recruited study subjects, 270 normotensive as control (150 male and
120 females), 270 hypertensive patients (95 male and 175 females) and 240 hypertensive with new
onset of diabetes patients (80 male and 160 females). All study samples were genotyped for ADD1
ARTICLE HISTORY polymorphic alleles and analyzed the relationship between different genotypes with respect to an-
thropometric and clinical parameters along with drug therapies.
Received: November 28, 2017
Revised: July 10, 2018 Results: Clinical and anthropometric parameters (such as age, SBP, DBP, FBG, height, weight,
Accepted: July 23, 2018
WC, HP, W/H ratio, and BMI) of study population were found highly statistically significant
DOI:
10.2174/1573402114666180731111453 (p<0.05) at base value. Further, genotype wise comparison of all the above parameters revealed
most of them as non-significant (p>0.05). Whereas, comparison between genotype and different
antihypertensive drug therapy of hypertensive patients, specifically, diuretic therapy as mono in
male (p=0.0227) and female (p=0.0292) and in combination with BBs in both male (p=0.0023) and
female (p=0.0079) revealed a higher FBG level in variant T allele. In case of hypertensive with new
onset of diabetes patients, only female population showed a slightly statistically significant
(p=0.0413) difference in FBG level with diuretic mono therapy. Other antihypertensive drug thera-
pies were safe and effective either as mono or in combination therapy.
Discussion: Anthropometric parameters may be the indicative factors for hypertension and diabe-
tes. Variant T allele of ADD1 gene may be considered as the risk factor for the development of
diabetes in hypertensive patients. Diuretics as mono therapy and in combination with BBs may be
considered as the risk factor for new onset of diabetes in EH patients carrying variant T allele (ei-
ther as TG or TT).
Keywords: Hypertension, antihypertensive therapy, diuretics, new onset of diabetes alpha adducing gene (ADD1), gene poly-
morphism, pharmacogenomics.

INTRODUCTION non-communicable diseases having high mortality rates in

Asia, America and Europe [1, 2]. Hypertension alone is a
In the present scenario, both hypertension and diabetes
risk factor for the induction of other complications such as
mellitus are the most common killer diseases among top ten
angina pectoris, brain stroke, heart failure and end stage re-
nal disease [3]. According to World Health Organization
*Address correspondence to this author at the Department of Pharmacology, (WHO), the prevalence of hypertension is escalating year by
M. M. College of Pharmacy, M M (Deemed to be University), Mullana, year throughout the world and around 17 million peoples
(Ambala), Haryana, India; Tel: +91 9872620252, +918059930156;
E-mail: sumeetgupta25@gmail.com
(31% of all deaths in the world) die per year due to cardio-

1573-4021/19 $58.00+.00 © 2019 Bentham Science Publishers

2 Current Hypertension Reviews, 2019, Vol. 15, No. 1 Gupta et al.

vascular diseases, among which, hypertension alone contrib- tients after diuretics treatment [21]. The T allele (460W) of
uting for approximately 9.4 million deaths per year [4]. As salt sensitive ADD1 gene was found to be associated with
per the Joint National Committee VIII guidelines, recom- higher risk of diabetes with diuretic therapy as compared to
mended the drugs for the first line drug therapy as follows other alleles, although the significance level was very low,
angiotensin converting enzyme inhibitors (ACE inhibitors), but it might be due to less population size [22].
diuretics, beta blockers (BB), calcium channel blockers
The ADD1 gene polymorphism may be susceptible to the
(CCB) and angiotensin receptor blockers (ARB) [5]. Many
risk of diabetes by one or more of the above mentioned
debates conducted on the duration of onset of diabetes melli-
mechanisms. However, some studies deny the role of ADD1
tus after the chronic treatment of BBs, diuretics and CCBs
gene polymorphism in risk of new onset of diabetes.
[6-10]. Some of the clinical studies reported that an anti-
hypertensive treatment either as a mono-therapy or as a Therefore, in the present study, we attempted to access
combination therapy for more than 3 to 6 years showed to the role of ADD1 gene polymorphism during antihyperten-
induce the onset of diabetes mellitus instead of anti sive treatment causes the onset of diabetes.
hypertensive effect [11, 12]. All antihypertensive drugs have
almost similar beneficial outcome for the treatment of high MATERIAL AND METHODS
blood pressure but differ in their potential of causing adverse
Methods
events such as disturbance in blood glucose homeostasis
leading to induction of diabetes [13]. This disturbance in Ethics
glucose homeostasis and elevation in blood glucose level
during antihypertensive therapy is also associated with future The study was approved (IEC/670) by the Institutional
cardiovascular events [14]. Ethics Committee of M. M. University and written consent
was obtained from all the participants.
The interaction of rennin-angiotensin system and gene
polymorphism may be responsible for regulation of onset of Design and Sample Size
diabetes in hypertensive patients after treated with diuretics
and beta blockers. The inter-individual difference in drug The study was carried out on the basis of cross-sectional
response of anti hypertensive therapy and new onset of dia- survey by M. M. Institute of Medical Science & Research,
betes in some patients can be explained on the basis of ge- Mullana (Haryana), there are around 38,500 inhabitants re-
netic polymorphism related to metabolic functions. Hence, siding in 17 villages of this rural area. The survey recorded a
Genetic polymorphism of genes (which influence the patho- total of 2672 individuals afflicted with essential hyperten-
physiology of hypertension and diabetes) may be responsible sion. These patients will be referred to as hypertensive (HT)
for new onset of diabetes under the influence of certain with a disease prevalence of 6.94 %. Out of 2672 patients,
antihypertensive drugs due to alteration in physiological we have selected 510 patients who visited regularly in hospi-
processes. tal OPD. A sample size of 164 patients will be sufficient to
represent the hypertensive population residing in the rural
Gly460Trp polymorphism of alpha adducin-1 gene area under investigation with a power of 80% and a P-value
(ADD1) may be one of those genes which may affect the of 0.05. Patients who agree to participate were explained the
physiological processes related to hypertension and diabetes nature and the objectives of the study, and informed consent
under the influence of antihypertensive therapy, especially was obtained individually. The information about patient’s
with diuretics and BBs. ADD1 is the part of adducin family identity was not included with other data and only the con-
which is a heterodimeric cytoskeleton protein [15]. It is a sulting physician had the access to this information.
salt-sensitive gene associated with increased renal sodium re-
absorption via activation of Na+-K+ATPase pump. The po- Study Population
lymorphic alleles of ADD1 gene may show variations in the
amount of sodium reabsorbed and potassium excreted In the present investigation, the subjects under study
counter to sodium ion and results in physiological change (n=510) were divided into 2 groups with age and sex
[16]. Studies have shown that 460W allele is associated with matched, 1) Essential Hypertensive (EH) 2) Essential hyper-
more sodium re-absorption than 460G allele; therefore, tensive with the onset of diabetes (EHNOD). 1) The first
460W allele is at more risk of developing salt-sensitive hy- group comprised of 270 hypertensive patients had 95 male
pertension [17]. Therefore, 460W allele must be associated and 175 females 2) Second group consisted of 240, hyper-
with excretion of more potassium via Na+-K+ATPase pump tensive with diabetes patients, out of which 80 male and 160
as a counter ion to sodium. Potassium is considered to have a females. In order to made comparison with normal individu-
major role in glucose homeostasis via affecting the release of als, we have selected normal individuals (n=270) with age
insulin as well as insulin-mediated glucose uptake into skele- and sex matched from the same place and denoted as the
tal muscle. It has been well studied that hypokalemia may third group consists of 150 male and 120 females. Various
result in glucose disturbance [18, 19]. parameters like age, sex, body mass index (BMI), blood
pressure, education, and family history were recorded in a
It is also found that, 460W allele is more prominent
given questionnaire.
blood pressure reduction as compared to 460G allele after
diuretic therapy [20]. More and quick reduction in blood Inclusion Criteria
pressure is associated with higher glomerular filtration rate
(GFR) which is further associated with diabetes. So 460W Patients residing in rural area of Haryana for more than
allele may be associated with diabetes in hypertensive pa- two generations were recruited. They were the age of 18
Alpha Adducin (ADD1) Gene Polymorphism and New Onset of Diabetes Current Hypertension Reviews, 2019, Vol. 15, No. 1 3

years to 75 years with an average blood pressure limits calcium channel blockers alone or in combination in the
>140mmHg systolic blood pressure (SBP) and > 90 mmHg treatment of essential hypertension.
diastolic blood pressure (DBP) on three separate occasions.
Genotyping for ADD1
1) For essential hypertensive group [EH]: Only those
patients who had essential hypertension and were DNA samples were isolated from peripheral blood lym-
treated with selective antihypertensive medication phocytes by the standard modified inorganic method as de-
(Diuretics, BBs, CCBs) as mono or in combination scribed by Miller et al. [25], and quantified following stan-
for about 3 years or more. dard spectrophotometric analysis. The isolated DNA samples
were stored at -20°C till further analysis. The substitution of
2) For essential hypertensive with new onset of diabetes nucleotides from G-to-T resulted in the genetic variant of
mellitus [EHNOD]: Only those patients who had EH amino acid residue at 460 and was located at nucleotide posi-
(as per above criteria) with onset of diabetes mellitus tion 614 of exon 10 of the ADD1 (Gen bank accession num-
(diagnosed according to WHO criteria as either a ber L29294). The Gly460Trp polymorphism of ADD1
fasting plasma glucose > 7.0 mmol/L and/or random (rs4961) was detected using an Amplification Refractory
(non-fasting) blood glucose > 11.1 mmol/L) and were Mutation System polymerase chain reaction (PCR). The fol-
treated with selective antihypertensive medication lowing primer sets were used:
(Diuretics, BBs, CCBs) as mono or in combination
for about 3 years or more. F614G5’-GGGGCGACGAAGCTTCCGAGGTAG-3’;
(Forward-G allele specific primer)
3) Normotensives [NT]: Those who were residing in the
rural area of Haryana without any history of hyper- F614T5’-
tension or diabetes between the ages of 18 years to 75 GCTGAACTCTGGCCCAGGCCGACGAAGCTTCCGAG
years. GATT-3’; (Forward-T allele specific primer)
R614 5’-CCTCCGAAGCCCCAGCTACCCA-3’, (Re-
Exclusion Criteria verse primer)
All individuals with the age less than 18 years or above The polymerase chain reaction was carried out in thermal
75 years are spared. Essential hypertensive patients who cycler (Bio-Rad, Japan) in total volume of 25 µl in 0.2 ml PCR
were treated with other than diuretics, BBs and CCBs alone tubes containing 2 µl (40 ng) of template DNA, 5.5 µl master
or in combination were excluded. Pregnant and lactating mix (containing Taq polymerase, loading dye, dNTPs, Mgcl2
mothers were removed from the study. and buffer 10X), 1 µl (F614G primer, F614T primer and
common primer (R614)), and 16.5µl nuclease free water.
Blood Pressure Measurements Initial denaturation was carried out at 94 °C for 10 minutes
The blood pressure recordings were taken by the physi- followed by 35 amplification cycles at 94 ºC for 20 seconds,
cians in OPD. We verified blood pressure with a mercury primer annealing at 60º C for 30 seconds, initial extension at
sphygmomanometer at least twice a week before enrollment. 72 ºC for 30 seconds and final extension step at 72 °C for 3
Patients were made to sit quietly for at least 15 minutes in a minutes. The amplified DNA samples were separated using
chair. Intakes of caffeine, exercise, smoking and drugs gel electrophoresis (4% agarose gel) and observed under UV
(which may affect blood pressure) were avoided for at least documentation chamber to find type of genotype present i.e.
30 minutes prior to the measurement. Three readings were GG, TG, or TT genotype [23, 26]. The size of PCR products
taken at 5 minutes interval, and the average was recorded. If were 220 bp and 234 bp for the 460Gly and 460Trp alleles,
there was gross variation in them, a fourth reading was ob- respectively (NuSieve, 3:1 agarose, FMC Bioproducts).
tained and used for the diagnosis of hypertension. Blood
Pressure was measured in both arms and in the event of any Statistical Analysis
difference, the higher reading was taken. An appropriately Data analysis was done with the help of an SPSS version
sized cuff (cuff bladder encircling at least 80 percent of the arm) 14.5. Continuous variables are expressed as means ± SD.
was used to ensure accuracy in palpitatory obliteration of Intergroup comparisons are made using ANOVA with mul-
radial pulse pressure which was obtained before ausculating tiple comparison with post-hoc test. Allele frequencies were
for BP measurement. By the auscultatory method, appear- calculated from genotype frequencies and were compared
ance and disappearance of Korotkoff sound were taken as an using chi-squared (χ2) statistics. P value < 0.05 was consid-
indicator of systolic and diastolic BP, respectively [23]. ered statistically significant.

Collection of Blood Sample RESULTS

The blood samples were collected in tubes containing Study Populations and Baseline Characteristics
EDTA as an anticoagulant. The samples were transported on ice
A study population comprised of 510 (EH and EHNOD)
to the laboratory and were processed on the same day [24].
patients and 270 normotensive individuals. Among patients,
Glucose Monitoring 270 were EH and 240 were EHNOD after treated with
chronic anti hypertensive therapy. Out of 270 in
The blood glucose levels were monitored after the patient hypertensive group, 175 were females and 95 were males
complaint and had a symptom of diabetes mellitus that were same in the case of EHNOD, they were 160 females and 80
treated with chronic therapy of diuretics, beta blockers and males. As per Table 1, all baseline parameters showed sig-
4 Current Hypertension Reviews, 2019, Vol. 15, No. 1 Gupta et al.

nificant changes (p<0.0001) in comparison of different whereas in normotensive group, the T allele was 0.167 and G
groups. Height could not show any significant change in allele was 0.833.
multiple comparisons between normotensive versus essential
hypertensive and essential hypertensive with new onset of
diabetes. In blood pressure levels (SBP and DBP), there was
statistically higher significance among all three groups. In
fasting blood glucose levels (FBG), the average FBG levels
were 207.29 ± 81.02 mg/dl in EHNOD than 107.20±7.85
mg/dl in EH whereas average normotensive showed
97.1±6.6 mg/dl. It was statistical higher significant. Among
anthropometric parameters, BMI, waist circumference (WC)
and waist-hip ratio (W/H) were showed higher statistical
significant (p<0.0001) when compared between all three
groups in each parameter. The average duration of hyperten-
sion in both the groups [EH and EHNOD] were 4.70 ± 4.11
and 7.91 ± 4.52 years respectively and total duration of
diabetes after treatment with anti hypertensive therapy was
5.72 ± 4.32 years respectively in EHNOD.
The gel picture (Fig. 1) represented the different geno-
types of ADD1 gene. Table 2 represented genotype and the
allelic distribution of EH versus normotensive group. GG
Fig (1). Representative image of agarose gel electrophoresis of
homozygote was higher in percentage than TG and TT geno-
showing the Gly460Trp polymorphism of ADD1 gene. Panel A
types in both the groups [EH and EHNOD]. Non- statistical represents the G allele specific primer amplification (F614G) and
significance was found in patients and control according to Panel B, T allele specific (F614T). Lane L represents the 100 bp
Hardy-Weinberg equilibrium. Frequency of G allele was DNA ladder. Appearance of band in both panel shows TG genotype
0.813 than T allele (0.187) of EH group same in the case of (lane 3, 5, 6) while lane 1, 2, 7 represents GG genotype and lane 4
EHNOD, it was 0.813 of G allele and 0.707 had T allele represents TT genotype.

Table 1. Base line parameters of total population and gender based specific.

Total population Male Female

Genotypes Nor- Essential p Nor- P Nor- Essential p

Essential
motensive Essential Hyper- value motensive value motensive Hyper- value
Essential Hyper- Essential
(n=270) Hyper- tensive with tensive
Hyper- tensive with Hyper-
tensive new onset with new
tensive new onset tensive
(n=270) of diabetes onset of
of diabetes
(n=240) diabetes

Age (yrs) 51.8±11.9 53.4±10.8 54.9±9.2 0.005 52.2±11.7 54.7±13.5 53.9±9.1 0.0368 51.3±12.2 52.6±9.0 55.4±9.3 0.0001

SBP (mmHg) 123.3±4.9 152.5±10.2 155.4±8.1 0.0001 123.5±5.6 153.7±6.3 156.19±5.7 0.0001   123.1±4.0 151.9±11.8 155±9.1 0.0001  

DBP (mmHg) 81.5±3.7 91.8±2.6 92.3±2.4 0.0001 81.3±4.1 91.2±2.15 92.5±2.2 0.0001   81.7±3.2 92.1±2.7 92.2±2.5 0.0001  

FBG (mg/dl) 97.1±6.6 107.2±7.8 207.2±81.0 0.0001   96.8±6.0 106.7±7.1 186.25±65.2 0.0001   97.6±7.2 107.4±8.2 217.8±86.1 0.0001  

Weight (kg) 63.4±8.8 71.9±7.5 75.9±8.6 0.0001   67.8±8.5 74.8±8.34 82.2±6.9 0.0001   58.1±5.7 70.4±6.59 72.7±7.6 0.0001  

Height (cm) 158.5±9.3 156.8±8.7 158.0±8.3 0.088 164.6±7.0 165.0±6.9 166.84.2 0.0002 150.8±5.2 152.4±6.0 153.6±6.1 0.0005

BMI (kg/m2) 25.1±1.8 28.5±2.3 30.3±1.7 0.0001   24.9±1.7 27.3±1.6 29.5±1.5 0.0001   25.5±1.9 29.2±2.3 30.7±1.7 0.0001  

WC (cm) 76.3±7.5 94.1±7.0 103.1±11.3 0.0001   77.3±6.8 88.6±6.7 110.5±12.5 0.0001   75.1±8.1 97.0±5.3 99.4±8.6 0.0001  

HC (cm) 90.5±7.1 105.5±10.2 104.9±12.6 0.0001   87.3±6.64 94.2±4.96 114.2±12.7 0.0001   94.5±5.5 111.7±6.2 100.2±9.7 0.0001  

W/H Ratio 0.85±0.0 0.90±0.0 0.99±0.0 0.0001   0.89±0.0 0.94±0.0 0.97±0.0 0.0001   0.79±0.0 0.87±0.0 0.99±0.0 0.0001  

Duration of
hypertension - 4.70±4.1 7.91±4.5 - - 5.89±5.2 7±4.3 - - 4.06±3.1 8.36±4.57 -
(yrs)

Duration of
- 5.72±4.3 - - - - 5.97±4.5 -
diabetes (yrs)
Alpha Adducin (ADD1) Gene Polymorphism and New Onset of Diabetes Current Hypertension Reviews, 2019, Vol. 15, No. 1 5

Table 2. Distribution of ADD-1 genotypes and alleles in cases and normal population.

Genotypes Groups Groups

Gly460Trp Genotypes Normotensive Essential Hypertensive Normotensive Essential Hypertensive with

new Onset of Diabetes

Gly/Gly 190 (70.4 %) 182 (67.4%) 190 (70.4%) 165 (68.8)

Gly/Trp 70 (25.9%) 75 (27.8%) 70 (25.9%) 60 (25%)

Trp/Trp 10 (3.7%) 13 (4.8%) 10 (3.7%) 15 (6.3%)

P value 0.692 0.412

Gly 0.833 0.813 0.833 0.813

Try 0.167 0.187 0.167 0.707

P value 0.383 0.380

Table 3. Distribution of genotypes with respect to various parameters in gender based and total population of essential hyperten-
sion patients.

Total population Male Female

Genotypes GG TG TT p value GG (59) TG (34) TT (2) P value GG (123) TG (41) TT (11) p value

Age (yrs) 52.5±9.7 55.8±12.5 51.6±14.0 0.005 51.6±11.3 60.6±15.5 47.5±3.5 0.0055 52.91±8.9 51.95±7.4 54.09±13.1 0.733

SBP (mmHg) 152.4±10.7 153.0±8.7 151.6±11.6 0.008 152.3±6.7 156.3±4.5 150±5.6 0.0087 152.44±12.2 150.39±10.3 152.64±12.5 0.621

DBP (mmHg) 91.8±2.8 91.8±1.9 91.5±2.9 0.000 90.4±2.1 92.5±1.4 90±2.8 0.0001 92.41±2.9 91.22±2.1 92.09±2.8 0.061

FBG (mg/dl) 107.3±7.4 107.0±8.4 105.5±10.3 0.029 105.4±5.5 109.2±8.9 101.5±3.5 0.0296 108.26±8.0 105.24±7.5 107±10.6 0.121

Weight (kg) 71.7±7.5 72.4±6.7 71.4±11.4 0.158 75±8.4 73.9±8.0 85.5±4.9 0.1584 70.31±6.7 71.24±5.2 68.27±9.2 0.401

Height (cm) 156.2±8.8 158.0±7.5 159±11.5 0.009 165.1±7.3 163.9±5.2 179±1.4 0.0095 152±6 153.22±5.4 155.64±7.1 0.107

2
BMI (kg/m ) 28.6±2.1 28.5±2.5 28.1±2.7 0.841 27.3±1. 27.4±2.0 26.68±1.1 0.8412 29.23±2.1 29.47±2.6 28.3±2.9 0.341

WC (cm) 94.9±6.6 92.2±7.9 93.2±4.8 0.276 88.7±6.5 88.1±7.0 96±5.6 0.2763 97.91±4.2 95.59±7.1 93.73±5.0 0.004

HC (cm) 106.4±10.3 103.0±10.0 108.5±6.9 0.420 93.9±4.8 94.4±5.2 98.5±0.7 0.4207 112.41±5.9 110.12±7.1 110.18±5.9 0.0896

W/H Ratio 0.9±0.0 0.9±0.0 0.86±0.0 0.249 0.95±0.0 0.93±0.0 0.98±0.0 0.2493 0.87±0.0 0.87±0.0 0.85±0.05 0.3327

Duration of
4.12±3.3 5.9±5.1 5.4±5.1 0.005 4.6±3.9 8.15±6.5 3±2.8 0.0057 3.81±3.0 4.2±2.7 6.55±5.0 0.0208
hypertension (yrs)

Table 3 represented the distribution of genotypes with BMI of male population showed slightly significant
respect to various clinical and anthropometric parameters of (p=0.033) between different genotypes as compared to other
EH patients. In anthropometric parameters, only height parameters. Duration of hypertension was also showed non-
showed statistical significant difference (p =0.009) among significant.
different genotypes of total population and in male popula-
Table 5 represented the genotype distribution with re-
tion only. In female specific, only waist circumference
showed a slightly significant change (p=0.004) in compari- spect to drug therapy in male and female population of hy-
pertensive patients. In male patients, both the blood pressure
son with different genotypes. Blood pressure levels and fast-
[SBP (p=0.0087), DBP (p<0.0001)] showed the statistical
ing blood glucose both showed statistical good significant.
extremely significant difference in comparison between dif-
The duration of hypertension was also showed statistically
ferent genotypes. A similar result was obtained in FBG level
significant (p=0.005) difference in male specific group and
of male patients (p=0.0296). In female patients, only DBP
total population in comparison with different genotypes.
showed slightly significant change (p=0.0610) with respect
While, in case of essential hypertension with new onset to different genotypes. After one year treatment of mono
of diabetes (Table 4), the age of total population showed drug therapy (BBs/diuretics/CCBs), only fasting blood glu-
statistical lesser significant (p=0.02) when compared be- cose levels of patients treated with diuretics showed
tween different genotypes. According to gender wise, only statistical slightly significant difference in both the genders
6 Current Hypertension Reviews, 2019, Vol. 15, No. 1 Gupta et al.

Table 4. Distribution of genotypes with respect to various parameters in gender based and total population of essential hyperten-
sion with new onset of diabetes.

Total population Male Female

Genotypes GG TG TT p value GG (62) TG (13) TT (5) P value GG (103) TG (47) TT (10) p value

Age (yrs) 55.8±8.9 52.0±9.8 56.4±8.8 0.0229 54.1±9.1 50.7±6.7 60.2±11.8 0.1401 56.8±8.7 52.4±10.5 54.5±6.9 0.0263

SBP (mmHg) 155.2±7.1 155.4±10.0 156.8±10.9 0.7776 156.1±5.7 154.3±5.3 160.8±4.7 0.1024 154.6±7.8 155.7±10.9 154.8±12.7 0.8048

DBP (mmHg) 92.2±2.3 92.1±2.7 93.33±3.0 0.2338 92.5±2.2 92.1±2.5 92.4±1.82 0.8253 92.1±2.3 92.1±2.7 93.8±3.55 0.1330

FBG (mg/dl) 207.4±79.7 213.7±87.4 179.93±65.6 0.3523 187.2±64.0 197.3±68.7 144.8±68.4 0.3038 219.5±85.8 218.3±92.1 197.5±59.8 0.7433

Weight (kg) 76.8±8.5 73.3±8.3 76.27±9.35 0.0261 82.3±6.4 80.9±9.8 84.6±5.9 0.5991 73.5±7.9 71.2±6.6 72.1±7.9 0.2254

Height (cm) 158.7±8.3 156.2±8.3 157.13±7.8 0.1206 166.6±3.5 167.8±7.1 166.4±2.1 0.6271 154.0±6.6 153±5.1 152.5±4.6 0.5502

2
BMI (kg/m ) 30.4±1.7 30.0±1.8 30.78±1.6 0.1717 29.6±1.5 28.6±1.1 30.54±1.7 0.0333 30.9±1.6 30.3±1.7 30.9±1.5 0.1966

WC (cm) 104.0±11.4 101.5±10.9 99.2±10.7 0.1342 110.2±11.9 115.6±12.2 101±16.0 0.0769 100.3±9.4 97.6±6.5 98.3±7.8 0.2075

HC (cm) 105.9±13.2 103.2±10.9 100.53±11.1 0.1444 114.6±12.7 116.1±10.5 105±16.1 0.2289 100.7±10.6 99.6±8.0 98.3±7.8 0.6794

W/H Ratio 0.99±0.05 0.99±0.05 0.99±0.05 0.9999 0.96±0.04 0.99±0.05 0.96±0.0 0.0708 1±0.06 0.98±0.0 1±0.0 0.1302

Duration of
hypertension 7.8±4.5 8.2±4.51 7.0±4.0 0.6619 7.1±4.2 6.54±4.9 6.8±4.7 0.9075 8.32±4.75 8.6±4.3 7.2±3.9 0.6415
(yrs)

(p=0.022: male and p=0.029:female patients) when com- lowed by TG genotype and further GG genotypes. A combi-
pared between different genotypes. Parallel results were ob- nation of diuretic with BB also elevates the FBG level in TG
tained in case of combination drug therapy (BBs with genotype followed by TT genotype whereas GG genotype
diuretic) showed moderate significant in fasting blood glu- showed protective effect with fall in FBG level. Other drug
cose levels. Other parameters failed to show any statistical therapies were safe and no rise in FBG was observed.
significant difference.
Similarly, in EHNOD patients, most falls in SBP (Fig. 2)
The data (Table 6) represented the genotype distribution was observed in CCB mono therapy followed by diuretic
with respect to drug therapy in male and female of EHNOD alone and in combination with BB in TT genotype. All other
patients. Baseline of SBP, DBP and FBG of both male and drug therapies were equally effective in all genotypes. While
female genotypes were found non-significant when com- fall in DBP (Fig. 2) was best achieved in combination of
pared between different genotypes (GG/TG/TT). After one diuretic with CCB in GG genotype followed by diuretic +
year treated with different drugs, no significant changes were BB combination and CCB monotherapy in TT genotype. All
observed in any of drug treatment of male patients between other combinations were equally effective in all genotypes.
different genotypes in SBP, DBP and FBG levels. In case of Fig. (4) represents the average fall in FBG level in different
female patients, a slight significant difference (p=0.0413) genotypes after different antihypertensive drug treatment.
was found in FBG level with diuretic therapy only. Effective fall in FBG level was achieved with all drug thera-
pies except diuretic in which FBG level was observed to rise
The genotype wise average fall in SBP in EH patients
in TT genotype.
with different drug therapies is given in Fig. 2. The best re-
sults were obtained in the combination of BB with CCB in DISCUSSION
TT genotype followed by CCB mono therapy. In other geno-
types, diuretic with CCB and BB with diuretic were also In the present study, we evaluated the possible associa-
effective. BB mono therapy was least effective in all geno- tion of different polymorphic alleles of ADD1 gene with
types. Almost same trend was followed for average fall in antihypertensive therapy (especially diuretics as mono
DBP (Fig. 2). Here also BB+CCB were most effective com- therapy or as combination therapy) and new onset of diabe-
bination followed by CCB mono therapy. In both blood pres- tes in EH patients in rural population of Haryana. The preva-
sures (SBP and DBP), the combination drug therapies were lence of essential hypertension in this population was found
most effective than mono drug therapies. Overall, all drug around 40% as reported in previous studies [27, 28], there-
therapies were effective in controlling blood pressure. Fig. 3 fore, it was suitable to conduct the study on the given popu-
represents the average difference in the FBG level in EH lation to find the correlation of antihypertensive therapy and
patients after treatment with different antihypertensive drugs. new onset of diabetes in EH patients using pharmacogenom-
A positive value represent the fall in FBG while negative ics tool. Our results indicated variant T allele (either TG
value represents hike in FBG level. Most hike in FBG level heterozygous or TT homozygous) of ADD1 gene as the
was observed with diuretic treatment in TT genotype fol- independent risk factor for new onset of diabetes under the
Alpha Adducin (ADD1) Gene Polymorphism and New Onset of Diabetes Current Hypertension Reviews, 2019, Vol. 15, No. 1 7

Table 5. Distribution of genotypes with respect to various parameters in male and female of essential hypertensive patients before
and after drug treatment.

Genotypes

Drug Treatment Male Female

P value P value
GG TG TT GG TG TT

Base line readings

Number 59 34 2 123 41 11

SBP 152.37±6.75 156.32±4.56 150±5.66 0.0087 152.44±12.26 150.39±10.36 152.64±12.56 0.6210

DBP 90.46±2.11 92.59±1.44 90±2.83 <0.0001 92.41±2.95 91.22±2.1 92.09±2.81 0.0610

FBP 105.49±5.59 109.21±8.93 101.5±3.54 0.0296 108.26±8.09 105.24±7.58 107±10.64 0.1216

Readings after one year

Mono drug therapy

BB 6 4 1 17 2 2

SBP 133.33±5.68 135.25±3.95 132 0.5758 131±7.38 131.5±10.61 134.5±4.95 0.8238

DBP 86.17±2.93 87.75±3.86 86 0.4807 89.29±5.63 88.5±7.78 90.5±2.12 0.0935

FBP 106.33±5.57 110.75±7.46 110 0.3120 109.41±10.1 111.5±9.19 113.5±9.19 0.8413

Diuretic 7 3 1 15 4 2

SBP 129.86±6.36 125.33±5.86 121 0.3233 128.27±6.69 127.5±9.75 125.5±4.95 0.8628

DBP 85.71±5.22 85.33±4.16 82 0.9146 87.13±6.52 88.25±6.24 88.5±6.36 0.9431

FBP 109.29±9.6 128.33±10.41 141 0.0227 110.07±11.15 117.75±12.5 135.5±17.68 0.0292

CCB 9 6 24 5 1

SBP 127.33±6.12 131.17±6.37 - 0.2623 132.75±6.22 128.6±9.26 134 0.2223

DBP 87.11±4.81 86.17±4.45 - 0.7090 89.46±6.37 87.4±5.77 88 0.5106

FBP 103.44±5.59 101.83±6.79 - 0.9945 106.83±8.08 105.8±7.82 104 0.7964

Combination drug therapy

Diuretic + BB 14 10 27 15 2

SBP 121.79±4.39 124.7±5.06 - 0.1470 123.74±4.93 124.47±7.76 126.5±7.78 0.7973

DBP 82.43±3.52 84.1±3.7 - 0.2739 81.93±2.70 82.33±4.29 82.5±3.54 0.9193

FBP 105.29±5.88 115.5±8.7 - 0.0023 106.48±10.6 117.53±14.86 126.5±16.26 0.0079

BB + CCB 9 5 22 10 2

SBP 123.67±4.42 121.6±5.5 - 0.4550 124.82±6.46 121.8±4.89 125±5.66 0.4178

DBP 83.22±4.24 83.2±4.32 - 0.9934 83.68±3.93 82.6±3.53 83.5±4.95 0.7643

FBP 99.67±6.32 101.6±6.43 - 0.5962 103.59±10.26 106.6±8.11 102.5±9.19 0.6896

Diuretic + CCB 14 6 18 5 2

SBP 119.86±5.19 121.67±4.03 - 0.4584 120.83±4.67 120.6±7.83 126.5±7.78 0.3903

DBP 80.43±3.23 82.17±3.43 - 0.2923 81.17±2.53 83.4±5.18 83.5±6.36 0.3496

FBP 100.86±4.93 98.17±4.02 - 0.2556 100.89±10.44 99.8±9.65 100.5±6.36 0.9775

8 Current Hypertension Reviews, 2019, Vol. 15, No. 1 Gupta et al.

Table 6. Distribution of genotypes with respect to various parameters in male and female of essential hypertensive new onset of
diabetes patients before and after drug treatment.

Genotypes

Drug Treatment Male Female

P value P value
GG TG TT GG TG TT

Base line readings

Number 62 13 5 103 47 10

SBP 156.19±5.74 154.38±5.33 160.8±4.76 0.1024 154.68±7.81 155.74±10.99 154.8±12.77 0.8048

DBP 92.58±2.28 92.15±2.54 92.4±1.82 0.8253 92.12±2.32 92.11±2.79 93.8±3.55 0.1330

FBP 187.27±64.09 197.31±68.71 144.8±68.43 0.3038 219.55±85.89 218.32±92.12 197.5±59.89 0.7433

Readings after one year

Mono drug therapy

BB 6 2 - 8 3 -

SBP 134.33±4.41 131.5±9.19 - 0.5520 131.25±4.98 133.33±5.77 - 0.5667

DBP 84.83±3.49 82.5±3.54 - 0.4458 83.75±3.49 83.67±2.08 - 0.9716

FBP 100.83±26.55 101.5±37.48 - 0.9781 116.38±51.3 110.67±28.22 - 0.8620

Diuretic 5 2 2 10 4 3

SBP 132.2±8.23 129.5±7.78 131.5±9.19 0.9284 129.5±8.4 127.75±6.65 132.67±6.66 0.7151

DBP 85.8±4.27 86.5±4.95 86±7.07 0.9859 86.5±4.86 83.25±3.40 85.33±4.16 0.4891

FBP 110.2±24.94 127.5±74.25 166.5±77.07 0.4299 117.5±40.52 142.5±43.27 193.33±38.19 0.0413

CCB 9 2 1 17 4

SBP 130.78±6.36 128.5±6.36 131 0.6574 128.65±6.58 132.25±7.14 - 0.3437

DBP 83.67±3.12 84.5±3.54 85 0.7453 84.94±4.35 83.75±2.5 - 0.6087

FBP 104.33±16.43 103.5±17.68 105 0.9503 106.06±25.62 103.25±20.55 - 0.8412

Combination drug therapy

Diuretic + BB 12 2 16 6 2

SBP 128.25±7.2 132±5.66 - 0.5015 132.19±7.54 128.83±7.05 129.5±9.19 0.6211

DBP 85.33±4.83 85±4.24 - 0.9295 87.25±4.3 85.17±3.31 84.5±4.95 0.4570

FBP 115.58±36.48 137.5±36.06 - 0.4463 122.63±49.19 149.5±50.48 190.5±68.59 0.1537

BB + CCB 20 2 1 31 16 2

SBP 126.15±5.47 125±7.07 130 0.7832 125.71±5.09 128.69±5.41 126.5±6.36 0.1909

DBP 84.3±4.11 82±2.83 85 0.4534 83.87±3.88 84.63±3.18 83.5±3.54 0.7753

FBP 106.4±18.88 108.5±17.68 170 0.8819 108.03±26.3 109.38±38.72 102.5±38.89 0.9558

Diuretic + CCB 10 3 1 21 14 3

SBP 128.7±6.95 123.67±4.04 128 0.2659 127.33±4.76 130.43±7.27 128.67±7.23 0.3329

DBP 83.5±3.81 81.67±2.08 84 0.4512 81.86±3.14 84.43±3.90 83.67±3.79 0.1091

FBP 102.6±14.05 108.33±19.73 108 0.5794 103.1±16.34 107.43±49.31 110.33±39.63 0.9004

Alpha Adducin (ADD1) Gene Polymorphism and New Onset of Diabetes Current Hypertension Reviews, 2019, Vol. 15, No. 1 9

Fig (2). (A) Average fall in systolic blood pressure in EH patients among different genotypes with different antihypertensive therapies. (B)
Average fall in diastolic blood pressure in EH patients among different genotypes with different antihypertensive therapies after one year. (C)
Average fall in systolic blood pressure in EHNOD patients among different genotypes with different antihypertensive therapies. (D) Average
fall in diastolic blood pressure in EHNOD patients among different genotypes with different antihypertensive therapies after one year.

Fig (3). Average change in fasting blood glucose level in EH patients among different genotypes after different antihypertensive therapies
treatment after one year.

influence of diuretic therapy. The study population was WC, HC, W/H ratio) in all populations. The average duration
grouped as normotensives, EH and EHNOD groups. of hypertension in EH and EHNOD groups were statistically
non-significant. All clinical parameters (SBP, DBP and FBG
The base line parameters (clinical and anthropometric) of
level) were highly significant for EH and EHNOD groups
these groups were compared with overall population, male
when compared with normotensives. So, the study of base-
and female population respectively (Table 1). Data showed a line parameters suggested that different anthropometric pa-
higher statistical significance difference (p<0.0001) at p
rameters were indicative of risk factors for EH in both EH
value for different anthropometric parameters (Weight, BMI,
10 Current Hypertension Reviews, 2019, Vol. 15, No. 1 Gupta et al.

Fig (4). Average change in fasting blood glucose level in EHNOD patients among different genotypes after different antihypertensive thera-
pies treatment after one year.

and EHNOD groups when compared with normal popula- height. While in male patients (Table 4), it showed signifi-
tion. However, age and height were not significant for all cant difference only in BMI and in female patients, it
comparisons and could not be taken as the indicator of risk showed statistically significant difference only in age. All
factor for EH. other parameters showed non-significant results.
The comparison of the genotypic and allelic frequency Therefore, the above results revealed that there was a
distribution (G allele and T allele) among EH and normoten- slight difference in wild type and variant type genotypes of
sive group (Table 2) showed a higher percentage of GG ADD1 gene with respect to different clinical and anthro-
genotype as compared to TG and TT genotypes and hence pometric parameters. Although this difference was minor
higher G allele frequency than T allele in EH but it was non- and from the data, it was not observed properly but it sug-
significant when compared with that of normotensive group. gested that variant T allele as the risk factor for metabolic
While the genotypic and allelic frequency distribution disease via salt sensitivity. However, contradictory results
among EHNOD and normotensive group (Table 2) showed a were given by Ranade et al., 2000 [29] and Ramu et al.,
significant difference (p=0.0008) in T allele frequency of 2010 on Indian population [16].
EHNOD group when compared with normotensives. There-
The effect of first line antihypertensive drug therapy on
fore, the data showed a positive association between
different genotypes of male and female population of hyper-
EHNOD and TT genotypic polymorphism which may indi-
tensive patients (as mono therapy or as combination therapy)
cate that T allele as the probable risk factor for new onset of
was evaluated by comparing the genotype wise clinical pa-
diabetes in hypertensive population.
rameters (SBP, DBP and FBG) at baseline and after one year
The genotype wise comparison of all anthropometric and of drug therapy with different drugs such as BB, diuretics,
clinical parameters in overall EH population (Table 3) re- and CCB (Table 5). One year period for observation of pa-
vealed that few of the anthropometric parameters were non- tient’s clinical parameters was followed to assess the long
significant like weight, BMI, WC, HC and W/H ratio. How- term effect of different antihypertensive drug therapies on
ever, clinical parameters and anthropometric parameters of these clinical parameters with respect to genotype of pa-
essential hypertensive were showing extremely statistical tients. Among mono drug therapy of BB, no significant dif-
significant. In male population (Table 3), the statistical data ference was observed in SBP, DBP and FBG level in be-
suggested that p value were highly significant for age, SBP, tween GG, TG and TT genotype both in males and females.
DBP, FBG levels and duration of hypertension which signi- Monotherapy of CCB showed somewhat protective effect on
fied the clear difference in wild type and variant type allele blood glucose level with better management of hypertension.
in terms of clinical parameters. But other anthropometric But after one year of diuretic treatment patients, FBG level
parameters such as weight, body mass index, WC, HC and was significantly different among different genotypes in both
W/H ratio were found to be statistical non-significant at p males (p=0.0227) as well as females (p=0.0292) of EH
value. In female population (Table 3), it showed statistical group. TG and TT genotypes showed elevated blood glucose
significant difference in DBP, FBG levels, WC and duration level as compared to GG genotype in both male and female
of hypertension. All other anthropometric parameters were EH patients. The combination therapy of diuretic with BB
non-significant. also elevated the blood glucose level in T allele carrying
male (p=0.0023) and female patients (p=0.0079). However,
Similarly, the genotype wise comparison of different combination of diuretic with CCB and other drug combina-
anthropometric parameters in overall population of EHNOD
tions were safe and effectively controlled the blood pressure.
(Table 4) revealed significant difference in age, weight and
Alpha Adducin (ADD1) Gene Polymorphism and New Onset of Diabetes Current Hypertension Reviews, 2019, Vol. 15, No. 1 11

In EHNOD patients, the antihypertensive drug therapy <http://www.wma.net/policiespost/wmadeclaration-of-

effectively controlled the blood pressure in all genotypes. No helsinki-ethicalprinciples-> for-medicalresearch-involving-
significant difference was observed in FBG level of male human-subjects/>principles of 1975, as revised in 2008
population after one year treatment but a female patients (http://www.wma.net/en/20activities/10ethics/10helsinki/).
showed a slight significant difference (p=0.0413) with diu-
retic therapy (Table 6). In both monotherapy (diuretics) and CONSENT FOR PUBLICATION
in combination therapy (diuretic with BB) of male and fe-
Not applicable.
male patients, it showed fluctuations (given as standard de-
viations) in FBG levels as it was very high and the results CONFLICT OF INTEREST
were non-significant despite anti diabetic treatment in variant
T allele (GT and TT genotypes) as compared to G allele. The authors declare no conflict of interest, financial or
However, no such type of fluctuation in FBG level was ob- otherwise.
served with other mono drug therapy or combination drug
therapies and these were found quite effective. ACKNOWLEDGEMENTS
Therefore, from data (Fig. 2 to Fig. 7), we can suggest We would like to acknowledge the team of doctors and
that all antihypertensive drug therapies either as volunteers at M.M. Institute of Medical Science and Re-
monotherapy or in combination effectively controlled both search, M.M. University, Mullana, Ambala, India, for their
the blood pressures (SBP and DBP) in EH patients and help in collecting the data and blood samples during the
EHNOD patients. However, diuretic either as mono drug study. We would also appreciate Head, Department of Bio-
therapy or in combination with BB in both EH and EHNOD technology, IIT, Roorkee for analyzing the samples for geno-
patients were reported to elevate FBG level in T allele (either typic studies.
as TG or TT genotype or both) of ADD1 gene. In EHNOD
patients, diuretic mono therapy was associated with elevated REFERENCES
FBG level in TT genotype but the combination of diuretic [1] Mohan V, Seedat YK, Pradeepa R. The rising burden of diabetes
with BB was safe in this group. and hypertension in southeast Asian and African regions: Need for
effective strategies for prevention and control in primary health ca-
From our findings, we may suggest that those patients re settings. Int J Hypertens 2013; 2013: 409083.
who were treated with chronic diuretic therapy whether it [2] Swami SS, Swami SC, Patil VW, Kanhere AM. Hypertension and
was monotherapy or in combination therapy, the FBG levels diabetes in India: A review. Int J Clin Biochem Res 2015; 2: 54-8.
[3] Mills KT, Bundy JD, Kelly TN, et al. Global disparities of hyper-
may chance to elevate due to disturbance in glucose homeo- tension prevalence and control: A systematic analysis of popula-
stasis. The probable mechanism may lie behind the fact that tion-based studies from 90 countries. Circulation 2016; 134: 441-
variant T allele of ADD1 was suggested to be associated 50.
with the enhanced renal Na+ re-absorption through Na+-K + [4] World Health Organization. A global brief on hypertension. World
Health Day 2013; Page 1-39.
ATPase pump [30, 31] which in turn eliminate more K+ ions [5] James PA, Oparil S, Carter BL, et al. 2014 Evidence-based guide-
to balance the ionic potential across the renal membrane [16, line for the management of high blood pressure in adults report
17]. But a higher K+ elimination is associated with low insu- from the panel members appointed to the eighth Joint National
lin secretion and insulin insensitivity and hence leads to gly- Committee (JNC 8). JAMA 2014; 311: 507-20.
caemic dysregulation [31, 32] as described in Fig. 4. [6] Verdecchia P, Reboldi G, Angeli F, et al. Adverse prognostic signi-
ficance of new diabetes in treated hypertensive subjects. Hyperten-
Therefore, in our results, we can easily show the evi- sion 2004; 43: 963-69.
[7] Carter BL, Einhorn PT, Brands M, et al. Thiazide induced
dence that, those individuals who are having T allele may dysglycemia: Call for research from a working group from the na-
prone to high risk of essential hypertension as well as the tional heart, lung, and blood institute. Hypertension 2008; 52: 30-6.
new onset of diabetes mellitus after chronic diuretic therapy [8] Elliott WJ, Meyer PM. Incident diabetes in clinical trials of anti-
in essential hypertensive patients. hypertensive drugs: A network meta-analysis. Lancet 2007; 369:
201-7.
[9] Helgeland A, Leren P, Foss OP, Hjermann I, Holme I, Lund-Larsen
CONCLUSION PG. Serum glucose levels during long-term observation of treated
Our study suggested that variant T allele of the ADD1 and untreated men with mild hypertension. The Oslo study. Am J
Med 1984; 76: 802-5.
gene may be considered as the risk factor for the develop- [10] Mykkanen L, Kuusisto J, Pyorala K, Laakso M, Haffner SM. In-
ment of new onset of diabetes in EH patients of Haryanvi creased risk of non-insulin-dependent diabetes mellitus in elderly
population. hypertensive subjects. J Hypertens 1994; 12: 1425-2.
[11] Karagiannis A, Tziomalos K, Pagourelias ED, Gossios TD, A-
ETHICS APPROVAL AND CONSENT TO thyros VG. Effect of antihypertensive drug-associated diabetes on
cardiovascular risk. Hellenic J Cardiol 2010; 51: 195-9.
PARTICIPATE [12] Gurwitz JH, Bohn RL, Bohn RL, et al. Antihypertensive drug
therapy and the initiation of treatment for diabetes mellitus. Ann
The study was approved (IEC/670) by the Institutional Intern Med 1992; 118: 273-8.
Ethics Committee of M. M. University. [13] Blackburn DF, Wilson TW. Antihypertensive medications and
blood sugar: Theories and implications. Can J Cardiol 2006; 22:
HUMAN AND ANIMAL RIGHTS 229-3.
[14] Dunder K, Lind L, Zethelius B, Berglund L, Lithell H. Increase in
No animal were used in this research. All humans re- blood glucose concentration during antihypertensive treatment as a
search procedures followed were in accordance with the predictor of myocardial infarction: Population based cohort study.
standards set forth in the Declaration of Helsinki BMJ 2003; 326: 681.
12 Current Hypertension Reviews, 2019, Vol. 15, No. 1 Gupta et al.

[15] Hughes CA, Bennett V. Adducin: A physical model with implica- [24] Gupta S, Agrawal KB, Goel KR, Sehajpal KP. Angiotensin-
tions for function in assembly of spectrin-actin complexes. J Bio converting enzyme gene polymorphism in hypertensive rural popu-
Chem 1995; 270: 18990-6. lation of Haryana, India. J Emerg Trauma Shock 2009; 2: 150-4.
[16] Ramu P, Umamaheswaran G, Shewade DG, Swaminathan RP, [25] Miller SA, Dykes DD, Polesky HF. A simple salting procedure for
Balachander J, Adithan C. Gly460Trp polymorphism of the ADD1 extracting DNA from human nucleated cells. Nucleic Acids Res
gene and essential hypertension in an Indian population: A meta- 1988; 16: 1215.
analysis on hypertension risk. Ind J Human Gene 2010; 16: 8-15. [26] Shin MH, Chung EK, Kim HN, et al. Alphaadducin Gly460Trp
[17] Manunta P, Cusi D, Barlassina C, et al. Alpha-adducin polymor- polymorphism and essential hypertension in Korea. J Korean Med
phisms and renal sodium handling in essential hypertensive pa- Sci 2004; 19: 812-4.
tients. Kidney Int 1998; 53: 1471-8. [27] Gupta S, Agrawal BK, Sehajpal PK, Goel RK. Prevalence and
[18] Gorden P. Glucose intolerance with hypokalemia: Failure of short- predictors of essential hypertension in the rural population of har-
term potassium depletion in normal subjects to reproduce the glu- yana, India: An hospital based study. J Rural Trop Public Health
cose and insulin abnormalities of clinical hypokalemia. Diabetes 2011; 10: 29-4.
1973; 22: 544-51. [28] Gupta V, Singla R, Bedi M. Correlation of anthropometric parame-
[19] Zillich AJ, Garg J, Basu S, Bakris GL, Carter BL. Thiazide diure- ters with blood pressure: an anthropometric study in North Indian
tics, potassium, and the development of diabetes: A quantitative re- Haryanvi males. Int J Anat Res 2016; 4: 2485-9.
view. Hypertension 2006; 48: 219-4. [29] Ranade K, Hsuing AC, Wu KD, et al. Lack of evidence for an
[20] Cusi D, Barlassina C, Azzani T, et al. Adducin polymorphism in association between alpha adducing and blood pressure regulation
primary hypertension: Linkage and association study; relationship in Asian population. Amer J Hyper 2000; 13: 704-9.
to salt sensitivity. Lancet 1997; 349: 1353-7. [30] Manunta P, Burnier M, D’Amico M, et al. Adducin polymorphism
[21] Cooper ME, Rumble JR, Allen TJ, O'brien RC, Jerums G, Doyle affects renal proximal tubule reabsorption in hypertension. Hyper-
AE. Antihypertensive therapy in a model combining spontaneous tension 1999; 33: 694-7.
hypertension with diabetes. Kidney Int 1992; 4: 898-3. [31] Ferrandi M, Salardi S, Tripodi G, et al. Evidence for an interaction
[22] Bozkart O. Pharmacogenetics of antihypertensive drugs and risk of between adducin and Na(+)-K(+)-ATPase: relation to genetic
diabetes. Thesis Utrecht University, chapter 2.1, page 19-31, 2007. hypertension. Am J Physiol 1999; 277: H1338-9.
[23] Gupta S, Chattopadhyaya I, Agrawal BK, Sehajpal PK, Goel RK. [32] Plavinik FL, Rodrigues CIS, Zanella MT, Ribeiro AB. Hypokale-
Correlation of Renin Angiotensin System (RAS) candidate gene mia, glucose intolerance, and hyperinsulinemia during diuretic the-
polymorphisms with response to Ramipril in patients with essential rapy. Hypertension 1992; 19(suppl II): II-26-II-2.
hypertension. J Postgrad Med 2015; 61: 21-6.