Qurrohman et al Asian Journal of Pharmaceutical Research and Development.

2019; 8(1): 01-04

Available online on 15.02.2020 at http://ajprd.com

Asian Journal of Pharmaceutical Research and Development

Open Access to Pharmaceutical and Medical Research
© 2013-20, publisher and licensee AJPRD, This is an Open Access article which permits unrestricted non-
commercial use, provided the original work is properly cited

Open Access Research Article

INHIBITORY AKT2 AND VEGFR2 GENES EXPRESSION OF Avicennia
marina USING RT-PCR ON WiDr CELLS
Qurrohman T.1*., Hasibuan P.A.Z.1*., Basyuni M2.
1Department of Pharmacology, Faculty of Pharmacy, Universitas Sumatera Utara, Medan 20155,
Indonesia.
2Department of Forestry, Faculty of Forestry, Universitas Sumatera Utara, Medan, 20155, Indonesia.

ABSTRACT

Objectives: To evaluate the activities the anticancer of n-hexane extract of Avicennia marina leaves on WiDr cells in down-
regulated of expression of Akt2 and VEGFR2 genes.
Methods: Avicennia marina leaves were dried and extracted with n-hexane, analyzed the down-regulated Akt 2 and VEGFR2
expression which was determined the Reverse Transcription Polymerase Chain Reaction (RT-PCR) method.
Results: N-hexane extract of Avicennia marina, in which there were down regulated expression Akt 2 and VEGFR2 of 0.43 and
0.50 WiDr cells. N-hexane extract of mangrove leaves has cancer chemoprevention activity with down-regulated on WiDr cells.
Conclusions: :N-hexane extract of Avicennia marina leaves had anticancer activity with down-regulated on WiDr cells, suggest
that significantly inhibit the expression of Akt2 and VEGFR2 genes.

Keywords: Akt2, VEGFR2, WiDr cells, Avicennia marina, RT-PCR.

A R T I C L E I N F O: 01 Nov 2019 Received; Review Completed 21 Jan. 2019; Accepted 24 Jan 2020; Available online 15 Feb. 2020

Cite this article as:

Qurrohman T, Hasibuan, PAZ, Basyuni M, Inhibitory AKT2 and VEGR2 Genes Expression of Avicennia marina Using RT-PCR on
Widr Cells, Asian Journal of Pharmaceutical Research and Development. 2019; 7(6):01-04.
DOI: http://dx.doi.org/10.22270/ajprd.v8i1.641

*Address for Correspondence:

Qurrohman T, Department of Pharmacology, Faculty of Pharmacy, Universitas Sumatera Utara, Medan 20155, Indonesia.

INTRODUCTION Potential natural ingredient developed as chemotherapeutic

agents includes from mangrove leaves. Mangrove vegetation

C
ancer is a disease characterized by uncontrolled cell
defined as a plant or shrub distribution in intertidal zone of
growth. Cancer cells may avoid apoptotic and signals
tropical and sub-tropical regional3. Polyisoprenoid is
that suppress growth, the ability to form new blood
secondary metabolites found in mangroves, classified as
vessels (angiogenesis), and the ability to invade and
dolichol and polyprenol on mangrove leaves and roots. So
metastasize1. Chemotherapy agents is one of the treatments
far studies reporting pharmacological activity in
for colon cancer in addition to surgery and radiation therapy.
polyisoprenoid of mangrove species is still limited, so it is
Chemotherapy agents used today generally not only to
important to achieve the prospects, potential and mechanisms
suppress the growth or proliferation of cancer cells while
polyisoprenoid in mangroves as a natural ingredient of
causing toxicity to the body but also inhibit the proliferation
pharmaceutical and medication4.
of normal cell division, including the bone marrow,
gastrointestinal mucosa, hairfall, and lymphocyte tissue. This Studies that polyisoprenoid in mangrove leaves Nypa
condition raises concerns about various side effects caused fruticans induced the cancer cell cycle inhibition of
by the use of conventional chemotherapeutic agents, such as adenocarcinoma of the colon WiDr cell in G2/M phase and
heart (cardiotoxic) disorders, nausea, diarrhea and reduce the percentage of Bcl-2 and Bcl-xL5. It has been also
suppression of the immune system and the occurrence of reported that polyisoprenoid of A. marina and A. lanata
resistance, thus increasing people's interest in using leaves have anticancer colon activity. Polyisoprenoid of A.
traditional medicines2. marina have IS value of 5.195 (> 3) that is highly selective.
ISSN: 2320-4850 [1] CODEN (USA): AJPRHS
Qurrohman et al Asian Journal of Pharmaceutical Research and Development. 2019; 8(1): 01-04

This polyisoprenoid extract has a mechanism of inhibition of Preparation of isolation polyisoprenoid alcohols
cell cycle at G0-G1 phase, and Apoptotic phase analysis
Powder simplicia mangrove leaves of Avicennia marina (500
occurs in the early apoptotic phase on the WiDr cells with
g) was macerated with a mixture of chloroform: methanol
flow cytometry method6.
(2:1, v/v) for 48 h. Non-saponified lipid extracts of leaves
Activation of Akt, the major downstream effector of PI3K, is incubated of 65⁰C for 24h in 86% ethanol containing KOH 2
frequently observed in human cancers7. The Akt kinase M. Non-saponified lipid parts were further diluted with n-
family is composed of three members, Akt1, Akt2 and Akt3. hexane, and the solvent was evaporated. Then redissolved in
Akt1 and Akt2 are ubiquitously expressed, whereas Akt3 has n-hexane, a concentrated dried extract was obtained13.
a more limited tissue distribution [8]. Elevated Akt2
expression positively correlates with aggressiveness of Isolation WiDr Cells
cancer and poor survival rates [9]. Amplification and over Cell lines and cell culture conditions (WiDr cells), isolated
expression of Akt2 is frequently detected in a number of human colon cancer cells from the large intestine of 78-year-
human tumors. The distribution of PI3K/Akt pathway old women was provided by the Laboratory of Parasitology
component expression in human colorectal adenocarcinomas. collection, Faculty of Medicine, Gadjah Mada University,
Regulatory and p110, catalytic subunits of PI3K in colon Yogyakarta, Indonesia. WiDr cell lines was cultured in
cancer cell growth using an RNAi approach10. RPMI 1640 medium, and supplement with 10% (v/v) fetal
VEGF binding to the extracellular domain of the VEGFR bovine serum (FBS), 1% penicillin and streptomycin,
results in dimerization and autophosphorylation of the fungizone 0.5%, and in a 37°C incubator with 5% CO 2 14.
intracellular tyrosine kinases. This activates multiple Analysis of genes expression in vitro with RT-PCR
downstream proteins that play functional roles in cell
survival, proliferation vascular permeability and stabilization The expression of the genes was examined Reverse
of new blood vessels. For example, VEGF induces Transcription-Polymerase Chain Reaction (RT- PCR)
endothelial cell proliferation by activating the protein kinase method. Total RNA was extracted from the control and
Ras-MEK-ERK pathway. The pro-survival effects of cultured cells using the Total RNA Mini Kit (Geneaid)
VEGF/VEGFR-2 are mediated by the PI3K/AKT pathway11. according to the manufacturer’s protocol. Total RNA was
Recent studies indicate that VEGFR are also expressed by reverse-transcribed with 1 µg random primer and
some tumor cells and may represent an additional target 12. ReverTraAce (Toyobo) to produce a cDNA in a total volume
of 20 µl for 10 min at 30ºC, 60 min at 42ºC, and 5 min at
The goals of our current study were to extend the analysis of 99ºC according to manufacturer’s procedure. The resulting
Akt isoforms in colorectal carcinoma as well as metastatic cDNA mixture was diluted TE buffer and directly used for
tumors and to identify which specific steps in the metastatic the subsequent PCRs.
process are Akt2 dependent. Therefore, Akt2 appears to play
a critical role in the establishment of metastases in colorectal PCR consisted of 35 amplification cycles, and each cycle
cancer. Furthermore, concurrent PTEN down-regulation was carried out for 30s at 95°C, 1 min at annealing
Akt2 expression led to metastatic phenotype acquisition in temperature (58°C for beta-actin), (55°C for Akt-2) and
colon cancer cells that are non-metastatic. This study, (60°C for VEGFR2), and 1min at 72°C in a thermal cycle
TM
therefore, aimed to test of biological and pharmacological (ProFlex 3x 32-well PCR System, Applied Biosystems).
activities for the treatment of colon cancer from Avicennia The beta-actin housekeeping gene was used as an internal
marina polyisoprenoid in terms of the cycle and gene control to standardise the relative expression levels for all
expression of Akt2 and VEGFR2 using the Reverse bio markers15. The semi-quantitative RT-PCR product was
Transcription-Polymerase Chain Reaction (RT-PCR) observed using 2% agarose gel and stained with ethidium
method. bromide. The bands were documented using the image
scanner Doc XR Gel (Bio-Rad)16. The oligonucleotide
METHODS AND MATERIALS
primers for Akt2, VEGFR2 and beta-actin were shown in
Plant material Table1.
Mangrove leaves of Avicennia marina were collected the
village of Lubuk Kertang, District West Brandan, Langkat,
North Sumatra. Indonesia.
Table 1: Mouse oligonucleotide primers sequences used for RT-PCR (5-3’) and anealing temperature.
Gene Primer Sequences Size (bp) Temp (oC)
Beta-actin R 5’- TCGTCATACTCCTGCTTGCTG AT -3’
105 58
F 5’-GCTCCTCCTGAGCGCAAG T-3’
Akt2 R 5’-TGCTTGAGGCTGTTGGCGACC-3’
315 55
F 5’-ATGAATGAGGTGTCTGTCTGTCATCAAAGAAGGC-3’
VEGFR2 R 5’-GAAATGGGATTGGTAAGGATG-3’
87 60
F 5’-GTGTCAGAATCCCTGCGAAGTA-3’

ISSN: 2320-4850 [2] CODEN (USA): AJPRHS

Qurrohman et al Asian Journal of Pharmaceutical Research and Development. 2019; 8(1): 01-04

Statistical analysis anticancer activity inhibition down-regulated expression of

Akt2 and VEGFR2. As shown in Figure 1 and table 2 also
Data were statistically analyzed Duncan Test for density base
treatmen 5-Fu inhibits gene expression of Akt2. Βeta-actin
pair of Akt 2 and VEGFR2 genes, then completed with a
was used as an internal control in the analysis of gene
Duncan test. The value of P<0.05 was chosen as the
expression because it is a housekeeping gene, the gene that
threshold of statistical significance.
continuously expressed for a living organism. Housekeeping
RESULT AND DISCUSSION genes have stable expression levels in various tissues during
development stage17.
Effect extract Avicennia marina on the genes expression
Akt2 and VEGFR2 showed that Avicennia marina have
Gene Expression genes Base pair (bp)
(a) (b) (c)

B-actin 105

Akt2 315

87
VEGFR2

Figure 1. Effect Avicennia marina on Expression gene in WiDr cells. The Total RNA were isolated and RT-PCR was performed using the indicate primers
material and method (a) Control cell, (b ) Avicennia marina (c) 5-Fu

Figure 1 shows the semi-quantitative expression of the Akt 2, Avicennia marina. Beta-actin produced an amplification of
VEGFR2 and Beta-actin genes of Avicennia marina which 105 bp. Illustrates the Akt2 expression band with 315 bp of
were analyzed based on base pairs of each gene with RT- PCR product, VEGFR2 expression band with 87 bp of PCR
PCR. Beta actin as housekeeping gene showed stability product, in which 5-FU showed a clear band.
expression in cell control, 5-Fu as positive control of

Table 2:The value density of genes expression after treatment with WiDr cells.
No Gene Control cell A. marina 5-Fu
1 Beta-actin 1.00± 0.00 0.72 ±0.02 0.75 ±0.03
2 Akt2 1.00±0.00 0.43±0.01 0.50± 0.02
3 VEGFR2 1.00±0.00 0,50 ± 0,03 0,58 ±0.02

Table 2 showed that down-regulation values Akt 2 and preferentially favors persistence and growth of metastases.
VEGFR2 gene expression. The dolichol content of Avicennia PI3K/Akt inhibitors are under development as anti-cancer
marina showed the most down-regulated results in the Akt 2 therapy or have been approved for treatment of certain
and VEGFR2 genes. The value of gene expression in human cancers21.
Avicennia marina on control cells had a significant
VEGFR2 was largely and strongly expressed in cancer cells
difference with P <0.05. Akt is well-known major regulatory
in 203 colon cancer tissues, suggesting that it may have
signaling cascade that control cell proliferation, metabolism
another role in cancer cell biology aside from being a
and survival of cancer cells18. Therefore, several inhibitors,
vasculature-restricted receptor. In addition, in accordance
have been developed and used for treatment to induced
with a previous study, which demonstrated significant
apoptotic in cancer cells19-20. Our results indicated that the
association of VEGFR2 expression with poor tumor
expression levels of Akt-2 were down regulated as evident
histological differentiation in 128 colorectal adenocarcinoma
from the RT-PCR assay.
tissues, the present study showed that VEGFR2 expression
The oncogenic potential of Akt2 identified in this study correlated significantly with differentiation, metastasis, and
suggests that the frequent amplification and up-regulation of poor diagnosis22. In this regard, with its capacity to enhance
this kinase in colorectal cancer plays an important role of tumor cells into endothelial cells, VEGFR2 may be
during metastatic colonization. Results from our study advantageous for tumor progression. In summary, colon
suggest that colorectal cancer cells required Akt2 over cancer cells can trans differentiation along endothelial
expression and PTEN inactivation during separate steps of lineages, both morphologically and functionally. More
the metastatic process. Activated Akt2 appears to influence importantly, this study indicated critical role of VEGFR2 in
the metastatic phenotype by promoting extravasation at the promoting endothelial differentiation of colon cancer cells.
secondary metastatic sites, whereas PTEN deficiency
ISSN: 2320-4850 [3] CODEN (USA): AJPRHS
 Qurrohman et al Asian Journal of Pharmaceutical Research and Development. 2019; 8(1): 01-04

Results pose several implications for underlying importance significance of PI3K subunit targeting in colorectal carcinoma. Ann Surg
. 2006; 243:833– 842, discussion 843– 834.
of VEGFR2 as useful therapy target.
11. Byrne, A.M, Bouchier-Hayes, D.J, and Harmey, J.H. Angiogenic and cell
CONCLUSION survival functions of vascular endothelial growth factor (VEGF). J Cell
Mol Med. 2005;9: 777–794.
This study confirms that The dolichol content of Avicennia 12. Strizzi, L, Catalano, A, Vianale, G, Orecchia, S, and Casalini, A.
Vascular endothelial growth factor is an autocrine growth factor in
marina inhibits down-regulated of Akt 2 and VEGFR2. This human malignant mesothelioma. J Pathol. 2001; 193: 468–475.
study shows that dolichol in Avicennia marina blocked the 13. Basyuni, M, Sagami, H, Baba, S and Oku, H. Distribution, occurrence
growth factor of the WiDr cells. and cluster analysis of new polyprenyl acetones and other
polyisoprenoids from North Sumatran mangroves. Dendrobiology. 2017;
ACKNOWLEDGEMENT 78:18–31.
14. Cancer Chemoprevention Research Centre. The protocol of apoptic test
This research was funding by Ministry of Research double staining method. Yogyakarta. 2013;1-4.
Technology and Higher Education through “Hibah Penelitian 15. Zhang, Y, Guan, X.Y, Dong, B, Zhao, M, Wu, J.H, and Tian, X.Y.
Tesis Magister 2018”. Expression of MMP-9 and WAVE3 in colorectal cancer and its
relationship to clinicopathological features. J Cancer Res Clin Oncol.
REFERENCES 2011; 138:2035-2044.
16. Kamal, Reddy, K.S, Khan, M.N, Shetti, R.V,Ramaiah, MJ, and
1. McDonald, G.T. Inhibition of phosphatidylinositol 3-kinase promotes Pushpavalli, S.N. Synthesis, DNA-binding ability and anticancer activity
tumor cell resistance to chemotherapeutic agents via a mechanism of benzothiazole/benzoxazole–pyrrolo [2,1-c][1,4] benzodiazepine
involving delay in cell cycle progression. Elsevier. 2010; 316(19):3197- conjugates. Bioorg Med Chem. 2010; 18(13):4747–61.
206. 17. Liren. Lemon Pepper Fruit Extract (Zanthoxylum acanthopodium DC.)
2. Kurnijasanti, R., Hamid, S.I., and Rahmawati, K. Efek Sitotoksik In Vitro Suppresses the Expression of Inflammatory Mediators in Lipopoly
dari Ekstrak Buah Mahkota Dewa (Phaleria macrocarpa) Terhadap saccharide-Induced Macrophages In-Vitro. American Journal of
Kultur Sel Kanker Mieloma.Media Eksakta. 2008;7(1): 48–54. Biochemistry and Biotechnology. 2011;7(4):190-5.
3. Akter, R, Uddin, SJ, Grice, I.D and Tiralongo, E. Cytotoxic activity https://doi.org/10.3844/ajbbsp.2011.190.195.
screening of Bangladeshi medicinal plant extracts. J Nat Med. 2013: 1-7. 18. Yoon, D., Wang, Y., Stapleford, K., Wiesmuller, L and Chen, J. P53
4. Niranjana, R., Gayathri, R., MoSN, Sugawara, T., Hirata, T., Miyashita, Inhibits strand exchange and replication fork regression promoted by
K., and Ganesan, P. Carotenoids modulate the hallmar Control of cancer Human Rad 51. Journal of Molecular Biology. 2004. 336(3). 639- 654.
cells. Funct J Foods. 2015;18:968-985. 19. Radhakrishnan, P., Baraneedharan, U.,Veluchamy, S, Dhandapani, M,
5. Sari, P.D, Basyuni, M., and Hasibuan, PAZ. Inhibition Polyisoprenoids Pinto, D.D, and Thiyagarajan, S. Inhibition of Rapamycin-Induced AKT
from Nypa fruticans leaves on cyclooxygenase two expressions of Widr Activation Elicits Differential Antitumor Response in Head and Neck
colon cancer cells. Asians Journal of Pharmaceutical and Clinical Cancers. Cancer Research. 2013; 73(3):1118-27.
Research. 2018; 11:154-157.. 20. Khursheed, A. Plant-based natural compounds and herbal extracts as
6. Illian, ND, Basyuni, M., and Hasibuan, PAZ. Polyisoprenoids From A. promising apoptotic agents: their implications for cancer prevention and
marina and Avicennia lanata Widr cells inhibit proliferation. treatment. Advances in Biomedicine and Pharmacy. 2016; 03(04):225-48.
Pharmacognosy Magazine. 2018; 14:513-518. 21. Momota, H, Nerio, E, and Holland, E.C. Perifosine inhibits multiple
7. Brugge J, Hung M,C and Mills G,B. A new mutational Aktivation in the signaling pathways in glial progenitors and cooperates with
PI3K pathway. Cancer Cell. 2007.12:104 –107. temozolomide to arrest cell proliferation in gliomas in vivo. Cancer Res.
8. Testa, J.R, and Bellacosa, A. AKT plays a central role in tumorigenesis. 2005. 65:7429 –7435.
PNAS 98. 2001:10983 – 10985. 22. Giatromanolaki, A., Sivridis, E., and Koukourakis, M.I. Angiogenesis in
9. Bellacosa, A. Molecular alterations of the AKT2 oncogene in ovarian colorectal cancer: Prognostic and therapeutic implications. Am J Clin
and breast carcinomas. Int J Cancer. 1995. 64:280 –285. Oncol. 2006; 29:408–17.
10. Rychahou, P.G, Jackson, L.N, Silva, S.R, Rajaraman. S, and Evers, B.M
.Targeted molecular therapy of the PI3K pathway: Therapeutic

ISSN: 2320-4850 [4] CODEN (USA): AJPRHS