Combination effect of Daphne extract and Imatinib on Anti proliferation of the K562 cell line

A.Khorshid , S,Abroun , F. Ghanati

Alireza Khoshid

Department of Hematology

Tarbiat Modares University, P.O. Box 14115 111, Tehran, Iran

Ali.r.khorshid@gmail.com

Saeed Abroun

Department of Hematology, Faculty of Medical Sciences,

Tarbiat Modares University, P.O. Box 14115 111, Tehran, Iran

abroun@modares.ac.ir

Faezeh Ghanati

Department of Plant Science, Faculty of Science,

Tarbiat Modarres University (TMU), POB 14155-175, Tehran, Iran.

ghangia@modares.ac.ir
 Abstract

Modern and ancient medical sciences should be used to treat cancer. Herbal medicine is well

known among the ancient medical sciences. Healing properties have been observed in some

species of Daphne. The presence of some species of Daphne in Iran motivated us to evaluate the

cytotoxic activity of Daphne mucronata on human leukemia cancer cells.

The effect of Daphne plant extract on the k-562 cell line has been previously studied, and Gleevec

is a well-known and effective drug in the treatment of chronic myelogenous leukemia. In this

study, the simultaneous effect of using herbal medicine and a targeted therapy drug on the k-562

cell line was investigated.

Anti-proliferative activity of the dichloromethane extract of daphne mucronate (Thymelaeaceae)

as a new anticancer medicinal plant was evaluated. The K-562 cells responded to extract treatments

in a dose-dependent manner, and the MIC and the IC50 of the crude extract were calculated. The

cell viability was quantitated by MTT assay, and Daphne extract could effectively decrease the

viability of the cell line. Changes in Bax and Bcl2 gene expression were investigated using real-

time PCR. Apoptotic and necrotic changes of cells membrane were examined using the flow

cytometry method. The MIC and IC50 concentration of Daphne extract combine with Imatinib

were tested on the K-562 cell line. The necrotic effect of Daphne extract was evaluated by Flow

cytometry of Annexin, P.I., and an increase in gene expression of Bax and Bcl2 was observed in

cells exposed to the Daphne extract. The combination of Daphne extracts with Imatinib shows

enhancement in the cytotoxic effect of Imatinib.

Keywords: Daphne, Imatinib, apoptosis, herbal medicine, Bax, Bcl-2, CML

1. Introduction

Plant natural products are a valuable source of therapeutic agents with a wide range of mechanisms

of action (1). Daphne Mucronata Royle is a wild plant of the Thymelaeaceae family, distributed in

several regions of Iran, and popularly, it is known as Kheweshk in Kermanshah province (2). It

has been used in the treatment of skin disorders traditionally (2). Literature search reveals that

different species of Daphne, such as mezereum, genkawa, olidoies, and odora have an excellent

antimicrobial effect (3).

Mazarine component of Daphne mezereum has shown cytotoxic activity, Odoricin is a new

nematocidal compound from Daphne odora, and daphnetin-8-glycoside from Daphne acuminate

possesses cardiotoxic activity (4). Some species of the genus Thymelaeaceae have long been used

in traditional medicine in various countries like China, Iran, and Pakistan as valuable remedies and

have been increasingly used as a pain reliever. Some active compounds of the Daphne genus have

been isolated and identified (5).

The first targeted therapy in CML was Imatinib, which was marketed under the Gleevec brand and

led to many advances in the treatment of patients with CML and Increased overall survival so,

most patients continued to live up to 5 years without any clinical complications (6). This drug can

be considered as the first targeted therapy in leukemia. The protein from the combination of ABL

and BCR genes causes the production of a protein called tyrosine kinase, which activates a number

of intracellular proteins that are associated with increased cell proliferation (6). Imatinib has an

inhibitory effect on tyrosine kinase and binds specifically to tyrosine kinase encoded by the BCR-
ABL gene. The cancer cells that have been injected with this drug no longer are able to survive

and multiply, and they thereby undergo apoptosis (7). Imatinib keeps the disease in the dormant

phase for several years, but mortality from chronic myelogenous leukemia is still high (8). This

study tries to increase the effectiveness of Imatinib by examining the effect of Daphne extract and

its combination with Imatinib and investigating the intracellular mechanism of Daphne cytotoxic

effect. This study has evaluated the cytotoxic effects of Daphne extract on Chronic myelogenous

leukemia cells. To understand the mechanisms of cytotoxicity, Flow cytometry of Annexin, P.I.

and the changes in gene expression of proteins involved in the apoptosis cascade, including BCL2

and Bax, were also evaluated.

Apoptosis is called programmed cell death, and different proteins are involved in the process of

cell death (8). Some of these proteins prevent cell death by increasing the amount, and others

induce cell death. Bcl2 is a protein that has an anti-apoptotic role, and Bax is a pro-apoptotic

protein (8).

2. Materials and methods

2.1. Plant material

Daphne shrubs grow in the foothills of the Zagros Mountains in Kermanshah province. Daphne's

leaves were collected from shrubs in June (2). The identification feature of this plant this month

is small white flowers, and Herbarium Botanists of Tehran University approved this plant.

2.2. Preparation of plant extract

The leaves of this plant were separated from the stem and dried in the shade, and then powdered.

The powdered dried leaves (500 g) of the plant were soaking in pure dichloromethane (CH2Cl2)

for 24 h at Room temperature. The whole extract was filtered, and the solvent was evaporated

under reduced pressure at 40–45◦C, then extracted using a soxhlet extractor for 48 h. The extract

was filtered and concentrated under reduced pressure in a Rotary Flash Evaporator, which yielded

2% (10 g) of dry extract (3). The extracts were stored at 4◦C until analysis.

2.3. Reagents and chemicals

RPMI-1640(Sigma- Germany), Fetal Bovine Serum [FBS] (Gibco, Germany), streptomycin and

penicillin (Gibco, Germany), dimethyl sulfoxide [DMSO] (Sigma, USA), cryovial, T25 & T75

(jetbiofil), centrifuge (Eppendorf), the fluorescent probe Annexin, propidium iodide (P.I.), Silica

gel 60 (230-400 mesh)for column chromatography and TLC silica gel 60 F254from Merck

(Darmstadt, Germany); cDNA (CinnaGen), Real-time PCR (Amplicon), RNA RNX plus

(CinnaGen), 2X PCR Master Mix ( EmeraldAmp MAX PCR), Ladder (50 bp) Fermentas.

2.4. purified compound

The residue was fractionated on a silica gel column (40x 1.5 cm) using diethyl ether: chloroform

mixture (8:2, 6:4 and finally 4:6, v/v) as the eluting solvents, into three fractions. The active

component was purified from the second fraction using TLC techniques. The molecular weight of
the purified compound was 662 mass units, using FAB/MS. The purity of the isolated compound

has been confirmed by HPLC (5).

2.4. Cell cultures and treatment agent

The human leukemic cell line K562 was obtained from Pasteur Institute (Tehran, Iran) and

maintained in RPMI-1640 medium with 10% v/v fetal bovine serum and 100 u/ml penicillin and

100 mg/ml streptomycin at 37◦C in a humidified atmosphere of 5% CO2and 95% of air. About

5×103 K562 cells were seeded in each well of a 96-microwell plate and treated with various

concentrations of extract of Daphne, and the cultured cells were sub-cultured twice a week.

2.5. Analysis of cell viability and apoptosis

Cell viability was determined by MTT assay (9). K562 cells (5 ×103 cells/well) were seeded to a

96-well culture plate and cultured with and without extract and curcumin taken as standard (

20ug/ml) for 24 hr. At the end of treatment, 20 ul of MTT (5 mg/ml in PBS) was added to each

well and incubated for an additional three h at 37 ◦C. Supernatants of wells were taken out, the

formazan crystals were dissolved in 100 ul of DMSO, and the Optical density values (O.D.

absorption) were read at 570 nm using a multi-well plate reader (Statfax 2000, Awareness). Percent

inhibition of proliferation was calculated as a fraction of control (without extract). Cell viabilities

were evaluated by the following equation (10).

Viability (%) = 100 × (OD sample – OD blank) / (OD negative control – OD blank).
2.6. Minimum Inhibitory Concentration and IC50

The cytotoxicity of Daphne extract was evaluated by MTT assay so, MIC and IC50 was calculated

using Graph Pad Software (Graph Pad Prism version 5 software) with three replicates for each

concentration of Daphne extract. The stock solution of extract was prepared at 0.5 mg/ml in DMSO

and kept at −20◦C.

2.7. Flow cytometry Technique

Propidium Iodide and Annexin V-FITC dyes were used to evaluate apoptosis and necrosis using

the flow cytometry technique (10). In cells undergoing apoptosis, phospholipids increase in the

outer layer of the membrane and bind to Annexin, and are detectable by green fluorescence. P.I.

cannot cross the membrane of healthy cells and binds to DNA in dying cells (apoptosis or

necrosis), and is detectable by red fluorescence. In this method, healthy cells do not stain, and

apoptotic cells get both colors, and necrotic cells only get P.I. color (11).

2.7.RNA Extraction

Total RNA was extracted using TRIZOL (Invitrogen, USA) reagent, according to the protocols.

For RT-PCR analysis of both gene expression and quality, the NanoDrop UV-VIS 2000C

spectrophotometer (THERMO, USA) was determined. RNA quality parameters recommended for

RT-PCR analysis include UV SPECTROSCOPY A260/280 ratio of 1.8 - 2.0 and A260/A230 ratio

greater than 1.8, 18s/28s rRNA ratio of 1.8 - 2.1 (12).

2.8. cDNA Synthesis and Real-Time PCR (RT-PCR)

24 and after treatment with Daphne mucronate extract, cDNA was determined using the

SYBERGREEN q RT-PCR kit (Invitrogen, USA) according to the protocols from the total RNA.

PCR reaction was performed using reverse primers and forward primer for each gene

(Takapouzist, Tehran, Iran). The β-actin as a housekeeping gene was used to normalize the cDNA

variation. The sequence of forwarding and reverse primers for PCR was designed based on

previous studies. Primer sequence for training: BAX forward primer: 5`-

GCCCTTTTGCTTCAGGGTTT-C`; BAX reverse primer: 5`- TCCAATGTCCAGCCTTTG-3`;

BCL-2 forward primer: 5`-CGGAGGCTGGGATGCCTTTG-3`; BCL2 reverse primer: 5`

TTTGGGGCAGGCATGTTGAC3` (13). All reactions were triplicated.

3. Results

3.1. Determination of MIC and IC50

The anti-proliferative effects of Daphne mucronata on cancer cell lines K562 were evaluated by

MTT assay. A dose-dependent decrease in the growth of cancer cells was observed with increasing

concentrations. The minimum inhibitory concentration is the concentration of the extract that

prevents the increase in the number of cells after being added to the cells for a specified period of

time. In the control sample, an increase in the number of cells was observed after 24 hours. At a

concentration of 500 ng, the number of cells did not increase after 24 hours. IC50 is a concentration

of Daphne extract that reduces the cell population to half after a specific time period, so 7ug/ml is

the IC50 of the daphne extract.

Fig-1. MTT assay result with a percentage of cell viability.

3.2.Microscope examination

Morphologic change of K-562 cells after treatment with daphne extract analyzed under a

microscope. Pyknotic change after 24 hr has been seen in the number of cells, and ruptured cell

has been seen after 48 hr. Apoptosis or programmed cell death is recognized by characteristic

morphological and molecular changes occurring in a cell (9). In order to evaluate the cause of

growth inhibition of K562 cells by Daphne extract, characteristic features of morphological

apoptosis were studied. Daphne extract-treated cells showed prominent morphological changes

like cell shrinkage with rounding of cells and formation of membrane blebs characteristic of

apoptosis as evidenced by microscopic studies (Fig. 2).

Fig-2. Morphological change 24hr and 48hr after treatment with daphne extract. Normal K-562

Cell-line before treatment (A). Cells 24hr after Incubation (B). 24hr after treatment with 500 ng/ml
extract (C). 28hr after treatment with 500ng/ml extract (D). 24hr after treatment with 7ug/ml

extract (E). 48hr after treatment with 7ug/ml extract (F).

3.3. Combination Imatinib and Daphne extract

The concentration of Imatinib, which can reduce viable cell population to 50% after 24 hours, was

calculated. Then, this concentration of Imatinib combined with different concentrations of Daphne

extract on K-562 cells. The results show that this combination of imatinib and daphne extract

changes significantly in the cell population. The Anti-proliferative effect of Imatinib could

increase in the mix of Daphne extract.

Fig-3. Combine effect of Imatinib and daphne extract on K-562 cell line 24 hrs after treatment.

3.4. Flow cytometry results

Flow cytometry assay results show that cells at different concentrations of Daphne extract were

PI-positive and Annexin negative, which was an indicator of necrotic cells.

Fig.4. Effect of treatment of K-562 cell line with different concentrations of Daphne extract after

24hr. Gating of the cell population (A). K-562 without treatment – Normal Control (B). Treatment

with 125ng/ml Daphne extract (C). Treatment with 256 ng/ml Daphne extract (D). Treatment with

500ug/ml Daphne extract (E). Treatment with 1ug/ml Daphne extract (F).
Combination treats of K-562 cell line with Imatinib and Daphne extract show that some

populations of cells were apoptotic, and some populations were necrotic. The rate of necrosis in

cells increases with concentration (Fig-5).

Fig-5. Combination of 1uM Imatinib with different concentrations of Daphne extract on K-562

cell line after 24h. A control population of cell line(A). Imatinib (1uM) treatment (B). Combination
of Imatinib with 500ng/ml Daphne extract (C). Combination of Imatinib with 1ug/ml Daphne

extract (D). Combination of Imatinib with 3ug/ml Daphne extract (E).

3.5. Bax and Bcl-2 Real-time PCR

Bax proteins possess a crucial function in controlling cytochrome C release and apoptosis initiation

via the mitochondrial pathway (12). The vast majority of K562 cells in the untreated control were

healthy. By contrast, treatment by Daphne extracts resulted in marked necrotic induction in a dose-

dependent manner. Treatment with Daphne extract that blocks cell division led to a change in Bax

and Bcl-2 gene expression.

Fig-6. Bax and Bcl-2 change in gene expression after treatment with Imatinib and Daphne

Mucronata.

The ratio of Bax to Bcl-2 acts as an indicator for the cell apoptosis pathway. Bax/Bcl-2 Ratio could

clearly show the cell's tendency to apoptosis pathway, so an increase in Bax/Bcl-2 ratio conduct

cell to apoptosis, and a decrease in this ratio causes cell resistance to apoptosis (13).
Fig-7. Bax to Bcl-2 ratio in K-562 cell after treatment with Imatinib and different concentrations

of Daphne extract.

4. Discussion

The plant extract and the purified active component of Daphne extract could inhibit the

proliferation of the K-562 cell lines (5). This study investigated the effects of Daphne mucronata

extract to establish the scientific validation and understand the molecular mechanism behind these

folk claims.

Effect of Daphne mucronata on cancer cell lines K562 was carried by MTT assay. 500ng/ml

concentration of Daphne extract can inhibit cell proliferation. Daphne Extract can reduce cell
viability to half (IC50) at 7ug/ml concentration on K562 cell lines. Hence further studies to

confirm molecular mechanisms were carried on K562 cells. One of the biochemical features of

apoptotic cells is the expression of cell surface markers achieved by flip-flop movement of the P.S.

from the inner membrane to the outer membrane of the plasma membrane (11). Results from flow

cytometry assay demonstrated that the Annexin and P.I. positive cells indicated induction of

apoptosis by Imatinib. On the other hand, P.I. positive cell indicated induction of necrosis by the

Daphne extract (11). This study also explored the underlying molecular events occurring due to

Daphne extract treatment. Increase gene expression of Bax and reduction of Bcl-2 is an expected

outcome from the apoptosis process (13). K-562 cell line that was treated with Imatinib shows

these changes in gene expression that indicate the apoptosis effect of Imatinib on the K-562 cell

line. But K-562 cell that was treated with Daphne shows an increase in Bax and Bcl-2 gene

expression. Although flow cytometry result indicates and necrosis effect of Daphne extract, so

increase in gene expression of Bax along with Bcl-2 could demonstrate a necrosis prosses. It is

previously thought that necrosis is an alternative process of cell death. Recent studies suggest that

necrosis is a planned cell death process—one of the genes that increase its expression in both

apoptosis and necrosis in the Bax gene. However, Bcl2 gene expression decreases in the process

of apoptosis and should increase in necrosis. The current study clearly indicates that Daphne

extract could be a potent anti-leukemia agent against chronic myeloid leukemia cells, K-562 cell

line. Daphne extract decreases in cell viability after combination with Imatinib. So Imatinib's effect

on the treatment of CML disease could be increased in combination with Daphne extract. The

natural plant component has a lower clinical indication in comparison to the chemical component.

Daily consumption of Imatinib in CML patients can cause resistance to Imatinib after five years,

and many patients die after the recurrence of the disease (14). Combination treatment of patients
would be an effective method to overcome resistance and reduce daily Imatinib consumption dose

for CML patients.

5. Conclusion

Imatinib is a tyrosine kinase inhibitor that uses for target therapy of chronic myelogenous

leukemia. The median survival rate of CML patients with Imatinib treatment is five years. But

many patients died after the recurrence of the disease and became resistant to Imatinib. Results of

this study show that daphne extract has an anti-proliferative effect on the K-562 cell line. A

combination of daphne extract and Imatinib shows an excess reduction in the cell population.

However, Daphne extract cause cell to became necrosis but this necrosis process cause change in

gene expression. Patterns of gene expression were different in cells treated with daphne extract in

comparison to Imatinib treatment. Combine treatment of patients with Imatinib and daphne can

increase patients' survival rate and decrease resistance to Imatinib.

References

1. Mahdizadeh, S., Khaleghi Ghadiri, M., & Gorji, A. (2015). Avicenna's Canon of Medicine:

a review of analgesics and anti-inflammatory substances. Avicenna journal of

phytomedicine, 5(3), 182–202.

2. Katayoun, J., Ramin, M., Najafi, R.B., & Jahromi, N.F. (2003). A Preliminary study on the

biological activity of Daphne Mucronata Royal. Daru, 11, 28-31.

3. Kupchan, S. M., & Baxter, R. L. (1975). Mezerein: antileukemic principle isolated from

Daphne mezereum L. Science (New York, N.Y.), 187(4177), 652–653.

https://doi.org/10.1126/science.1114315

4. Nasipuri, R., & Ramstad, E. (1973). Isolation of daphnetin-8-beta-glucoside from Daphne

papyracea. Journal of pharmaceutical sciences, 62(8), 1359–1360.

https://doi.org/10.1002/jps.2600620832

5. Liou, Y. F., Hall, I. H., & Lee, K. H. (1982). Antitumor agents LVI: the protein synthesis

inhibition by genkwadaphnin and yuanhuacine of P-388 lymphocytic leukemia cells.

Journal of pharmaceutical sciences, 71(12), 1340–1344.

https://doi.org/10.1002/jps.2600711208

6. Sacha T. (2014). Imatinib in chronic myeloid leukemia: an overview. Mediterranean

journal of hematology and infectious diseases, 6(1), e2014007.

https://doi.org/10.4084/MJHID.2014.007

7. Ghanadian, M., Ali, Z., Khan, I. A., Balachandran, P., Nikahd, M., Aghaei, M., Mirzaei,

M., & Sajjadi, S. E. (2020). A new sesquiterpenoid from the shoots of Iranian Daphne

mucronata Royle with selective inhibition of STAT3 and Smad3/4 cancer-related

signaling pathways. Daru : journal of Faculty of Pharmacy, Tehran University of

Medical Sciences, 28(1), 253–262. https://doi.org/10.1007/s40199-020-00336-x

8. Bhamidipati, P. K., Kantarjian, H., Cortes, J., Cornelison, A. M., & Jabbour, E. (2013).

Management of imatinib-resistant patients with chronic myeloid leukemia. Therapeutic

advances in hematology, 4(2), 103–117. https://doi.org/10.1177/2040620712468289

9. Elmore S. (2007). Apoptosis: a review of programmed cell death. Toxicologic pathology,

35(4), 495–516. https://doi.org/10.1080/01926230701320337

10. Mosmann T. (1983). Rapid colorimetric assay for cellular growth and survival:

application to proliferation and cytotoxicity assays. Journal of immunological methods,

65(1-2), 55–63. https://doi.org/10.1016/0022-1759(83)90303-4

11. Rieger, A. M., Nelson, K. L., Konowalchuk, J. D., & Barreda, D. R. (2011). Modified

annexin V/propidium iodide apoptosis assay for accurate assessment of cell death. Journal

of visualized experiments : JoVE, (50), 2597. https://doi.org/10.3791/2597

12. Tan, S. C., & Yiap, B. C. (2009). DNA, RNA, and protein extraction: the past and the

present. Journal of biomedicine & biotechnology, 2009, 574398.

https://doi.org/10.1155/2009/574398

13. Bagci, E. Z., Vodovotz, Y., Billiar, T. R., Ermentrout, G. B., & Bahar, I. (2006).

Bistability in apoptosis: roles of bax, bcl-2, and mitochondrial permeability transition

pores. Biophysical journal, 90(5), 1546–1559.

https://doi.org/10.1529/biophysj.105.068122

14. Bhamidipati, P. K., Kantarjian, H., Cortes, J., Cornelison, A. M., & Jabbour, E. (2013).

Management of imatinib-resistant patients with chronic myeloid leukemia. Therapeutic

advances in hematology, 4(2), 103–117. https://doi.org/10.1177/2040620712468289