Acta Tropica 134 (2014) 43–51

Contents lists available at ScienceDirect

Acta Tropica
journal homepage: www.elsevier.com/locate/actatropica

Deep intraspecific divergences in the medically relevant fat-tailed

scorpions (Androctonus, Scorpiones)
P. Coelho a , P. Sousa a,b , D.J. Harris a,b , A. van der Meijden a,∗
a
CIBIO, InBio, Centro de Investigação em Biodiversidade e Recursos Genéticos, Universidade do Porto, Campus Agrário de Vairão, Vairão 4485-661, Portugal
b
Departamento de Biologia, Faculdade de Ciências, Rua do Campo Alegre, Porto FC4 4169-007, Portugal

a r t i c l e i n f o a b s t r a c t

Article history: The genus Androctonus, commonly known as fat-tailed scorpions, contains 22 species distributed from
Received 9 October 2013 Togo and Mauritania in the west, North Africa, through the Middle East and to as far east as India. With
Received in revised form 28 January 2014 13 species, a substantial amount of this genus’ diversity occurs in North Africa, which is a major hotspot
Accepted 1 February 2014
of scorpion sting incidents. Androctonus are among the most medically relevant animals in North Africa.
Available online 11 February 2014
Since venom composition within species is known to vary regionally, the improvement of therapeutic
management depends on a correct assessment of the existing regional specific and sub-specific variation.
Keywords:
In this study, we assessed the phylogeographical patterns in six species of Androctonus scorpions from
Scorpionism
Androctonus
North Africa using mitochondrial DNA markers. We sequenced COX1, 12S, 16S and ND1 genes from
Scorpions 110 individuals. Despite lacking basal resolution in the tree, we found taxonomical and geographically
Phylogeny coherent clades. We discovered deep intraspecific variation in the widespread Androctonus amoreuxi
Biogeography and Androctonus australis, which consisted of several well-supported clades. Genetic distances between
Cryptic diversity some of these clades are as high as those found between species. North African A. australis have a deep
split in Tunisia around the Chott el-Djerid salt-lake. A novel split between A. amoreuxi scorpions was
found in Morocco. We also found deep divergences in Androctonus mauritanicus, corresponding to areas
attributed to invalidated subspecies. In addition we uncovered a clade of specimens from coastal south
Morocco, which could not be ascribed to any know species using morphological characters. Based on
these findings we recommend a reassessment of venom potency and anti-venom efficacy between these
deep intraspecific divergent clades.
© 2014 Elsevier B.V. All rights reserved.

1. Introduction australis (Linnaeus, 1758), which are the most dangerous Androc-
tonus in the Maghreb region (Morocco, Algeria, Tunisia) (Goyffon
Worldwide, 1.2 million people are stung by scorpions every year. and Guette, 2005). A. australis is known for envenomating humans
Scorpionism, defined as the severe to lethal incident as a conse- and possessing a high toxicity (LD50 = 0.32 mg/kg in mice; Watt
quence of a scorpion sting (Lourenço and Cuellar, 1995) may be and Simard, 1984). For this reason, A. australis was one of the first
responsible for 3250 global annual mortalities which are mostly species of scorpions to have its venom purified for neurotoxin char-
concentrated in a few high-risk areas (Chippaux and Goyffon, acterization (Miranda et al., 1966). As in snakes (Daltry et al., 1996;
2008). North Africa in particular is considered a high-risk area for Prasad et al., 1999), scorpion venom is known to have consider-
scorpionism (Chippaux and Goyffon, 2008), with the genera Leiu- able intraspecific regional variation in composition (Devaux et al.,
rus Ehrenberg, 1828 and Androctonus Ehrenberg, 1828 being the 2004; El Ayeb and Rochat, 1985; Newton et al., 2007; Smertenko
foremost cause of serious envenomation in this area (Goyffon and et al., 2001), and thus a different response to antivenom treatment
Guette, 2005; Graham, 2011; Habermehl, 1994). Five Androctonus (Omran and McVean, 2000). Furthermore, other species such as
species are considered as dangerous to man, particularly Androc- Androctonus amoreuxi (Audouin, 1826) may also cause more cases
tonus mauritanicus (Pocock, 1902) and thewidespread Androctonus of scorpionism than currently thought (Goyffon et al., 2012). It
is therefore important to study the phylogeographical patterns of
Androctonus over a great part of their distribution as it may have
direct applications in therapeutic management.
∗ Corresponding author. Tel.: +351 916712100. Androctonus is present in deserts and semi-arid regions from
E-mail address: mail@arievandermeijden.nl (A. van der Meijden). Togo to Morocco in the Atlantic coast of Africa (Lourenço and

http://dx.doi.org/10.1016/j.actatropica.2014.02.002
0001-706X/© 2014 Elsevier B.V. All rights reserved.
44 P. Coelho et al. / Acta Tropica 134 (2014) 43–51

Qi, 2007; Lourenço, 2008) to the Maghreb countries and Egypt well-accepted taxa (A. bicolor, A. australis and A. amoreuxi). Ben
where they are also present in relatively elevated areas like the Othmen et al. (2004), using allozymic differentiation, found little
Atlas Mountains and the Sinai Peninsula mountain range (Vachon, support for the monophyly of A. australis and A. amoreuxi individ-
1952), the Middle East (Levy and Amitai, 1980), reaching across ually. However three well-supported monophyletic lineages using
Afghanistan (Vachon, 1958) to India (Tikader and Bastawade, 1983). 16S-rDNA, each corresponding to a species were recovered in a sub-
Little is known about the biogeography of Androctonus, although sequent study, thus demonstrating the usefulness of this gene as
the radiation of buthids has been associated with the aridification a barcoding marker (Ben Othmen et al., 2009). Furthermore, they
of the Palearctic Region (Fet et al., 2003, 1998). found a phylogeographic pattern of A. australis in Tunisia, where
In this work, we assess five species of the Maghrebian countries each of its two lineages are distributed to the north or south of
except for Libya, plus Egypt and the Sinai Peninsula. A. mauritani- the Chott el-Djerid salt lake, situated in central Tunisia. However
cus occurs in Morocco. This country shares a further three species their molecular dating makes it unlikely that the salt lake forma-
with Algeria, Tunisia and/or Egypt (Androctonus liouvillei, A. aus- tion has generated a vicariant evolution of Tunisian A. australis. In
tralis and A. amoreuxi), while Androctonus bicolor occurs in Algeria recent years, molecular studies using the mitochondrial COX1 gene
and Tunisia. A. amoreuxi is known to occur mostly in sandy deserts already uncovered considerable cryptic diversity in other scorpion
while A. australis and A. mauritanicus can be found in anthropogenic genera in the Maghreb region (Gantenbein and Largiadèr, 2003;
environments (Stockmann and Ythier, 2010). The country in our Sousa et al., 2012, 2011, 2010). However, a molecular phylogenetic
area of study with the most species of Androctonus, Morocco, is also study of the medically relevant scorpions of the genus Androctonus
the most orographically diverse. The mountain chains that subdi- across the Maghreb region has thus far not been performed.
vide Morocco, North to south the Rif Mountains, Middle Atlas, High In this study, we assess the patterns of diversity estimated
Atlas and Anti-Atlas Mountains, are known to be important in the from COX1, 16S and 12S sequence data across the Maghreb region
diversification of the scorpion genus Buthus (Husemann et al., 2012; and Egypt. A separate reduced dataset was also made from ND1
Sousa et al., 2012; Pedroso et al., 2013). Similarly, the Tell Atlas sequences. We here provide the first molecular phylogeny for
Mountains and Aurès Mountains of Algeria and Tunisia are associ- Androctonus scorpions in Morocco, Algeria and Egypt.
ated with Buthus (Pedroso et al., 2013). Although Androctonus are
generally not as orophilic as Buthus, these mountain chains may 2. Materials and methods
form a barrier for dispersal of the lowland species. However, at least
one Maghreb Androctonus species is known to be associated with 2.1. Taxon sampling
the Hoggar mountains in Southern Algeria; Androctonus hoggarensis
(Pallary, 1929) We collected samples in the field in three countries: Morocco,
The scorpion genus Androctonus was first described by Ehren- Tunisia and Egypt (Fig. 1). Algerian samples were donated by Dr.
berg in 1828. Vachon (1952) stabilized the genus’ taxonomy, Said Larbes. Additional specimens were purchased through the
transforming it into a morphological and geographical coherent pet-trade for which no locality data were available other than the
group with seven species known in North Africa. Lourenço (2005) country of origin. Sampling sites are illustrated in Fig. 1 and fur-
produced an important taxonomical revision of the genus: the sub- ther details are provided in Table 1. Scorpions were captured with
species of A. australis and A. mauritanicus were no longer considered long forceps and preserved in 96% ethanol. To minimize the impact
valid, Androctonus crassicauda gonneti Vachon, 1948 was raised to on scorpion populations, non-lethal sampling methods were used
the status of species, Androctonus aeneas C. L. Koch, 1839 was placed when possible, and consisted of removing the distal part of one
in the synonymy of A. bicolor Ehrenberg, 1828 and A. liouvillei (Pal- of the second leg pairs. The scorpion was subsequently placed
lary, 1924) was raised to the species level. in the sand, facilitating the clotting process and thus minimiz-
Recently, molecular tools have been used to assess the phy- ing haemolymph loss. Scorpions can recover partially amputated
logeny of Androctonus in Tunisia. Ben Ali et al. (2000), using nuclear appendages after a few molts and it is common for scorpions to be
DNA ITS regions (ITS-rDNA), found paraphyletic clades in three active and functional even when missing appendages (pers. obs.).

Fig. 1. Map representing the sampling locations across North Africa of Androctonus scorpions. Inset shows Egyptian samples. Pet trade acquired samples were without locality
data, and are not shown. Symbols correspond to the phylogenetic clades (see Fig. 2).
 P. Coelho et al. / Acta Tropica 134 (2014) 43–51 45

Table 1
Geographical referencing of the sampled specimens, their voucher identifiers and respective countries of origin. Coordinates are in the WGS84 datum, in decimal degrees.
M.D. indicates missing data.

Taxon Country Clade Latitude Longitude Sc code Accession numbersa

12S 16S COI ND1

A. amoreuxi Morocco AM1 30.176 −6.875 304 KJ538271 KJ538272 M.D. M.D.
A. amoreuxi Algeria AM1 30.907 −3.997 450 KJ538273 KJ538274 KJ538275 KJ538276
A. amoreuxi Morocco AM1 31.143 −4.387 808 KJ538277 KJ538278 KJ538279 M.D.
A. amoreuxi Morocco AM1 28.250 −9.333 1472 KJ538280 KJ538281 KJ538282 KJ538283
A. amoreuxi Morocco AM1 28.446 −9.373 1479 KJ538284 KJ538285 KJ538286 KJ538287
A. amoreuxi Morocco AM1 28.773 −9.459 1485 KJ538288 KJ538289 KJ538290 KJ538291
A. amoreuxi Morocco AM1 28.606 −9.430 1487 KJ538292 KJ538293 KJ538294 M.D.
A. amoreuxi Morocco AM1 29.046 −8.777 1489 KJ538295 KJ538296 KJ538297 KJ538298
A. amoreuxi Morocco AM1 29.148 −8.605 1491 KJ538299 KJ538300 KJ538301 KJ538302
A. amoreuxi Morocco AM1 29.060 −8.852 1493 KJ538303 KJ538304 KJ538305 KJ538306
A. amoreuxi Morocco AM1 29.727 −7.975 1503 KJ538307 KJ538308 KJ538309 KJ538310
A. amoreuxi Morocco AM1 29.630 −8.010 1507 KJ538311 KJ538312 KJ538313 KJ538314
A. amoreuxi Morocco AM1 29.680 −7.982 1508 KJ538315 KJ538316 KJ538317 KJ538318
A. amoreuxi Algeria AM2 32.440 3.740 423 KJ538421 KJ538422 KJ538423 KJ538424
A. amoreuxi Algeria AM2 32.440 3.740 424 KJ538425 KJ538426 KJ538427 M.D.
A. amoreuxi Morocco AM2 32.476 −1.721 791 KJ538428 M.D. KJ538429 KJ538430
A. amoreuxi Morocco AM2 32.505 −1.502 794 KJ538431 KJ538432 KJ538433 M.D.
A. amoreuxi Morocco AM2 31.143 −4.022 807 KJ538434 KJ538435 KJ538436 M.D.
A. amoreuxi Tunisia AM2 33.943 8.034 913 KJ538437 KJ538438 KJ538439 KJ538440
A. amoreuxi Tunisia AM2 33.943 8.034 920 KJ538441 KJ538442 KJ538443 KJ538444
A. amoreuxi Morocco AM2 32.476 −1.721 1056 KJ538445 KJ538446 KJ538447 M.D.
A. amoreuxi Morocco AM2 33.892 −2.019 1403 KJ538448 KJ538449 KJ538450 M.D.
A. amoreuxi Egypt AM3 M.D. M.D. 627 KJ538476 KJ538477 KJ538478 M.D.
A. amoreuxi Egypt AM3 M.D. M.D. 671 KJ538479 M.D. KJ538480 M.D.
A. amoreuxi Egypt AM3 M.D. M.D. 770 KJ538481 KJ538482 KJ538483 M.D.
A. amoreuxi Egypt AM3 M.D. M.D. 1165 KJ538484 KJ538485 KJ538486 M.D.
A. amoreuxi Egypt AM3 M.D. M.D. 1375 KJ538487 KJ538488 KJ538489 M.D.
A. amoreuxi Egypt AM3 M.D. M.D. 1413 KJ538490 KJ538491 KJ538492 M.D.
A. australis Algeria AU1 32.440 3.740 416 KJ538337 KJ538338 KJ538339 M.D.
A. australis Algeria AU1 32.440 3.740 417 KJ538340 KJ538341 KJ538342 M.D.
A. australis Algeria AU1 32.440 3.740 418 M.D. KJ538343 KJ538344 M.D.
A. australis Algeria AU1 32.440 3.740 419 KJ538345 KJ538346 KJ538347 M.D.
A. australis Algeria AU1 32.440 3.740 420 KJ538348 KJ538349 KJ538350 KJ538351
A. australis Algeria AU1 32.440 3.740 421 M.D. KJ538352 KJ538353 M.D.
A. australis Algeria AU1 32.440 3.740 422 KJ538354 KJ538355 KJ538356 M.D.
A. australis Algeria AU2 35.115 5.182 378 KJ538385 M.D. KJ538386 M.D.
A. australis Algeria AU2 35.170 2.217 382 KJ538387 KJ538388 KJ538389 M.D.
A. australis Algeria AU2 35.368 2.055 385 KJ538390 M.D. KJ538391 KJ538392
A. australis Algeria AU2 35.368 2.055 386 KJ538393 KJ538394 M.D. M.D.
A. australis Tunisia AU2 34.334 8.579 903 KJ538395 KJ538396 KJ538397 M.D.
A. australis Tunisia AU2 34.334 8.579 904 KJ538398 KJ538399 KJ538400 KJ538401
A. australis Tunisia AU2 34.334 8.579 905 M.D. KJ538402 KJ538403 M.D.
A. australis Tunisia AU2 33.943 8.034 914 KF824968 KF825083 KF825024 M.D.
A. australis Tunisia AU2 33.943 8.034 915 KJ538406 KJ538407 KJ538408 M.D.
A. australis Tunisia AU2 33.943 8.034 916 KJ538409 KJ538410 KJ538411 M.D.
A. australis Tunisia AU2 33.943 8.034 917 KJ538412 KJ538413 KJ538414 M.D.
A. australis Tunisia AU2 33.943 8.034 918 KJ538415 KJ538416 KJ538417 M.D.
A. australis Tunisia AU2 33.943 8.034 919 KJ538418 KJ538419 KJ538420 M.D.
A. australis Tunisia AU3 33.527 8.790 922 KJ538150 KJ538151 KJ538152 M.D.
A. australis Tunisia AU3 33.527 8.790 923 KJ538153 KJ538154 KJ538155 M.D.
A. australis Tunisia AU3 33.527 8.790 924 KJ538156 M.D. KJ538157 M.D.
A. australis Tunisia AU3 33.536 9.522 928 KJ538158 KJ538159 M.D. M.D.
A. australis Tunisia AU3 33.533 9.991 932 KJ538160 KJ538161 KJ538162 M.D.
A. australis Tunisia AU3 33.533 9.991 933 KJ538163 KJ538164 KJ538165 M.D.
A. australis Tunisia AU3 33.533 9.991 934 KJ538166 KJ538167 KJ538168 M.D.
A. australis Tunisia AU3 32.785 10.373 938 KJ538169 KJ538170 KJ538171 M.D.
A. australis Tunisia AU3 32.785 10.373 939 KJ538172 KJ538173 KJ538174 M.D.
A. australis Tunisia AU3 32.785 10.373 940 KJ538175 KJ538176 KJ538177 M.D.
A. australis Tunisia AU3 33.650 10.317 948 KJ538178 KJ538179 KJ538180 KJ538181
A. australis Tunisia AU3 33.650 10.317 950 KJ538182 KJ538183 KJ538184 M.D.
A. australis Tunisia AU3 33.650 10.317 951 KJ538185 KJ538186 KJ538187 M.D.
A. australis Egypt AU4 M.D. M.D. 626 KJ538451 M.D. KJ538452 KJ538453
A. australis Egypt AU4 31.279 27.055 954 M.D. KJ538454 KJ538455 KJ538456
A. australis Egypt AU4 31.279 27.055 957 KJ538457 M.D. KJ538458 M.D.
A. australis Egypt AU4 28.809 34.228 981 KJ538459 M.D. KJ538460 M.D.
A. australis Egypt AU4 28.822 34.182 992 KF548101 KJ538461 KJ538462 KJ538463
A. australis Egypt AU4 28.822 34.182 993 KJ538464 KJ538465 KJ538466 KJ538467
A. australis Egypt AU4 M.D. M.D. 1374 KJ538468 KJ538469 KJ538470 KJ538471
A. australis Egypt AU4 M.D. M.D. 1414 KJ538472 KJ538473 KJ538474 KJ538475
A. bicolor Algeria B 35.208 1.541 377 KF548106 KJ538319 KJ538320 M.D.
A. bicolor Algeria B 35.208 1.541 383 KJ538321 KJ538322 M.D. M.D.
A. bicolor Tunisia B 33.846 10.128 947 KJ538323 KJ538324 KJ538325 KJ538326
46 P. Coelho et al. / Acta Tropica 134 (2014) 43–51

Table 1 (Continued )

Taxon Country Clade Latitude Longitude Sc code Accession numbersa

12S 16S COI ND1

A. bicolor Tunisia B 33.650 10.317 949 KJ538327 KJ538328 KJ538329 KJ538330

A. bicolor Egypt B M.D. M.D. 1093 KJ538331 KJ538332 KJ538333 KJ538334
A. bicolor Egypt B M.D. M.D. 1371 KJ538335 KJ538336 M.D. M.D.
A. cf. gonneti Morocco G 28.479 −11.212 1453 KJ538372 KJ538373 KJ538374 M.D.
A. cf. Gonneti Morocco G 28.479 −11.212 1454 KJ538375 KJ538376 KJ538377 KJ538378
A. cf. Gonneti Morocco G 28.479 −11.212 1455 KJ538379 KJ538380 KJ538381 KJ538382
A. cf. Gonneti Morocco G 28.479 −11.212 1456 KJ538383 KJ538384 M.D. M.D.
A. liouvillei Morocco L 30.668 −6.380 210 KJ538188 KJ538189 M.D. M.D.
A. liouvillei Morocco L 34.286 −3.169 780 KJ538190 M.D. KJ538191 KJ538192
A. liouvillei Morocco L 34.286 −3.169 781 KJ538193 KJ538194 KJ538195 M.D.
A. liouvillei Morocco L 33.892 −2.019 786 KJ538196 KJ538197 KJ538198 M.D.
A. liouvillei Morocco L 33.213 −2.019 787 KJ538199 KJ538200 KJ538201 M.D.
A. liouvillei Morocco L 32.087 −1.241 793 KJ538202 KJ538203 KJ538204 KJ538205
A. liouvillei Morocco L 32.571 −2.015 796 KJ538206 KJ538207 KJ538208 M.D.
A. liouvillei Morocco L 32.571 −2.015 797 KJ538209 KJ538210 KJ538211 KJ538212
A. liouvillei Morocco L 33.289 −3.780 816 KJ538213 KJ538214 KJ538215 M.D.
A. liouvillei Morocco L 33.508 −3.528 817 KJ538216 KJ538217 M.D. M.D.
A. liouvillei Morocco L 33.892 −2.019 830 KJ538218 KJ538219 KJ538220 M.D.
A. liouvillei Morocco L 32.087 −1.241 839 KJ538221 KJ538222 KJ538223 M.D.
A. liouvillei Morocco L 33.213 −2.019 1055 KJ538224 KJ538225 KJ538226 M.D.
A. liouvillei Morocco L 33.892 −2.019 1207 KJ538227 KJ538228 KJ538229 M.D.
A. liouvillei Morocco L 33.892 −2.019 1394 KJ538230 KJ538231 KJ538232 M.D.
A. mauritanicus Morocco M1 32.225 −8.166 15 KJ538253 KJ538254 KJ538255 KJ538256
A. mauritanicus Morocco M1 32.526 −7.863 287 KJ538257 KF825084 KJ538258 KJ538259
A. mauritanicus Morocco M1 32.661 −7.793 290 KJ538260 KJ538261 KJ538262 M.D.
A. mauritanicus Morocco M1 32.661 −7.793 291 KJ538263 KJ538264 KJ538265 KJ538266
A. mauritanicus Morocco M1 32.661 −7.793 292 KJ538267 KJ538268 M.D. M.D.
A. mauritanicus Morocco M1 M.D. M.D. 625 KJ538269 M.D. KJ538270 M.D.
A. mauritanicus Morocco M2 30.183 −9.580 1467 KJ538233 KJ538234 KJ538235 KJ538236
A. mauritanicus Morocco M2 30.183 −9.580 1468 KJ538237 KJ538238 KJ538239 KJ538240
A. mauritanicus Morocco M2 30.183 −9.580 1469 KJ538241 KJ538242 KJ538243 M.D.
A. mauritanicus Morocco M2 30.159 −8.481 1549 KJ538244 KJ538245 M.D. KJ538246
A. mauritanicus Morocco M2 30.059 −9.084 1558 KJ538247 KJ538248 KJ538249 KJ538250
A. mauritanicus Morocco M2 30.098 −8.938 1589 KJ538251 KJ538252 M.D. M.D.
A. mauritanicus Algeria M3 29.068 −10.248 438 KJ538357 KJ538358 KJ538359 M.D.
A. mauritanicus Morocco M3 29.087 −9.898 1443 KJ538360 KJ538361 KJ538362 KJ538363
A. mauritanicus Morocco M3 29.087 −9.898 1444 KJ538364 KJ538365 KJ538366 KJ538367
A. mauritanicus Morocco M3 29.087 −9.898 1445 KJ538368 KJ538369 KJ538370 KJ538371

Voucher specimens were collected at almost all sites. All specimens dye-labeled dideoxy terminator cycle sequencing on an ABI 3730XL
are deposited in the collection of CIBIO, Centro de Investigação at Macrogen Inc. The sequencing primers were the same as those
em Biodiversidade e Recursos Genéticos, Universidade do Porto, used in the PCRs.
Vairão, Vila do Conde, Portugal.
Some key species that could not be sampled in the field,
e.g. Egyptian A. bicolor, were obtained through reputable animal 2.3. Data analysis
traders. Morphological identification was done in the lab using
keys by Vachon (1952) and Lourenço (2005). A single specimen of Chromatographs were checked manually for sequencing errors
Opisthacanthus asper (Peters, 1861) (Scorpiones: Liochelidae) was using FinchTV 1.4.0 (Geospiza, Inc.; Seattle, USA). Sequences were
used as outgroup (details provided in Table 1). edited using MEGA 5 (Tamura et al., 2011) and aligned using default
settings of MUSCLE (Edgar, 2004) for non-coding sequences and
ClustalW (Larkin et al., 2007) for COX1 and ND1.
2.2. DNA extraction and PCR conditions Phylogeny reconstruction was performed using Maximum Like-
lihood (ML) and Bayesian Inference (BI) methods. A homogeneity
Fresh or preserved leg muscle tissue (or metasoma muscle partition test executed in Paup* 4.0 rejected homogeneity of the
for smaller specimens) was used for DNA extraction. Dissection different genes. We therefore carried out both a partitioned and
occurred, preferentially, from the third leg in order to minimize the a combined analysis. The best fitting models of sequence evo-
loss of important taxonomical characters. Total DNA was extracted lution were determined by the AIC criterion in JModeltest 2.1.2
using proteinase K digestion (10 mg/ml concentration) followed by (Darriba et al., 2012) both for the separate genes and the com-
a standard salt extraction protocol (Bruford et al., 1992). bined dataset. ML tree searches were performed using PhyML,
Four mitochondrial fragments were amplified: 16S ribosomal version 3.0 (Guindon et al., 2010). Bootstrap branch support values
RNA (16S rRNA), 12S ribosomal RNA (12S rRNA), cytochrome C were calculated with 1000 replicates. The BI analysis was con-
oxidase subunit 1 (COX1) and NADH dehydrogenase 1 (ND1) (see ducted with MrBayes 3.2.2, with 5,000,000 generations, sampling
Table 2). Polymerase chain reactions were performed in a final vol- trees every 10th generation (and calculating a consensus tree after
ume of 25 ␮L and using 1.0 ␮L each of 10 pmol primer, 12.5 ␮L omitting the first 12,500 trees). Mean genetic distances between
REDTaq ReadyMix PCR Reaction Mix with MgCl2 (Sigma–Aldrich, and within clades were calculated with MEGA5 based on COX1
St. Louis, USA), 1.0 ␮L of the purified DNA and 9.5 ␮L of water. Diffi- sequences. Variance was estimated with 4000 bootstrap replicates,
cult PCR reactions were amplified with a touchdown PCR approach. with uncorrected p-distances (Table 3). GenBank accession num-
Purified PCR templates were unidirectionally sequenced using bers are given in Table 1.
 P. Coelho et al. / Acta Tropica 134 (2014) 43–51 47

Table 2
List of primers and PCR conditions used for molecular analyses. PCR conditions start with temperature (◦ C) of each step followed by the time in seconds in brackets.

Gene Primer name Sequence (5 → 3 ) Source PCR conditions

18-mer (forward) CGATTTGAACTCAGATCA Simon et al. (1994) 94(180), [94(30), 50(45), 72(60)]
16S rRNA
20-mer (reverse) GTGCAAAGGTAGCATAAT Gantenbein et al. (2000) × 35, 72(300), 12(∞)

12S-F AvdM AGAG-TGACGGGCAATATGTG 94(180), [94(30), 52(45), 72(60)]

12S rRNA Van der Meijden et al. (2012)
12S-R AvdM CAGCGGCTGCGGTTATAC × 35, 72(300), 12(∞)

LCO1490 (forward) GGTCAACAAATCATCATAAAGATATTGG 94(180), [94(30), 48(45), 72(60)]

Folmer et al. (1994)
HCO219 (reverse) TAAACTTCAGGGTGACCAAAAAATCA × 35, 72(300), 12(∞)
COI
COI avdm F WTYCTACIAATCAYAARGATATTGG 94(180), [94(30), 49(45), 72(60)]
Van der Meijden et al. (2012)
COI avdm R TAMACYTCIGGGTGWCCAAAAAAYCA × 35, 72(300), 12(∞)

ND1-LR-N-12945 (forward) CGACCTCGATGTTGAATTAA 94(180), [94(30), 47(45), 72(60)]

ND1 Hedin (1997)
ND1-N1-J-12261 (reverse) TCGTAAGAAATTATTTGAGC × 35, 72(300), 12(∞)

In addition we downloaded all 16S rDNA sequences in Ben 3.3. Species-level clades
Othmen et al. (2009) from GenBank and we combined these with
our 16S dataset. Phylogeny reconstruction of this extended dataset A. amoreuxi, is divided into three clades: clades AM1 and
was performed with ML (tree not shown). AM2 contain specimens from Morocco, clade AM2 also contains
specimens from Tunisia and Algeria and clade AM3 consists of indi-
viduals from Egypt. Clades AM1 and AM2 are placed as sister groups
3. Results with a high support (BI = 1.00; ML = 87) and the AM3 clade has no
well-supported affinities but may be sister taxon to A. australis. The
3.1. Sequence data western part of the range, from Morocco to Tunisia, is divided into
two clades; a northeastern (AM2) and a southwestern clade (AM1);
We sequenced 110 Androctonus specimens and one outgroup (O. the Southern Moroccan amoreuxi (AM1) clade extends South, from
asper) (Table 1). The combined dataset consists of an alignment of the regions of Assa and Zag in the South, to the southern area of
1457 basepairs (bp) (606 bp of COX1, 374 bp of 16S rRNA and 477 bp the Anti-Atlas Mountains and North toward Taouz, in the Erfoud
of 12S rRNA). The dataset included 777 variable sites (53.3% of the area, close to the Morocco–Algerian border (Fig. 1). The A. amoreuxi
total nucleotide positions), 680 bp were constant (46.7%) and 511 clade AM2 groups specimens from three countries: in Morocco it
positions were parsimony informative (35.1%). Due to difficulties is distributed in the Erfoud area and also to the areas surrounding
in amplifying ND1 only 41 sequences were available, and thus this Bouarfa and Ain-Beni-Mathar (High Plateau in Northeast Morocco);
gene was not included in the combined analysis. In Algeria it is represented in one location, Ghardaia (between the
Great Ergs); in Tunisia it is represented in one location, close to
Tozeur (between Chott el-Gharsa and Chott el-Djerid salt lakes).
3.2. Overall phylogeny The third clade, AM3 groups specimens that were acquired via the
pet-trade from Egypt, none of which are georeferenced. Pairwise
Four of the six species were recovered as monophyletic (Fig. 2). genetic distances between these clades are in a range between
We identified 13 clades that correspond to biogeographical and/or 7.5% and 9.2% (Table 3). Downloaded 16S sequences of A. amoreuxi
taxonomical units. Most of the deeper branches present low values are split between clades AM1 and AM2 with a sequence from Ben
of bootstrap support (ML) and posterior probability (BI). Con- Othmen et al. (2009) (andr05) placed in the AM2 clade whereas the
sequently, the relationships between species could not always sequence of Fet et al. (2003) is placed within our AM1 clade (tree
be resolved. ML and BI trees using a dataset that included ND1 not shown).
sequences (not shown) did not differ in the topology of well- Clade L (the liouvillei clade) unites all Moroccan A. liouvillei
supported clades. Trees derived from the individual genes did not scorpions. A total of 15 specimens were collected, ranging from
contradict the groupings recovered from the concatenated dataset. the High-Atlas Mountains, to the Northeastern range of the

Table 3
Genetic distances between and within groups. Numbers below the diagonal are mean p-distances calculated between clades whereas the corresponding variances, based on
4000 bootstrap replicates, are shown above the diagonal. Mean p-distances within clades are shown to the right.

Distance between clades Within clades

AM1 0.010 0.011 0.011 0.011 0.011 0.011 0.011 0.010 0.011 0.010 0.010 0.011 0.011 0.012 0.016 0.002 A1
AM2 0.075 0.011 0.012 0.011 0.012 0.012 0.010 0.011 0.011 0.010 0.011 0.011 0.011 0.011 0.013 0.003 A2
AM3 0.092 0.089 0.012 0.011 0.011 0.011 0.012 0.012 0.011 0.011 0.011 0.012 0.011 0.013 0.003 0.001 A3
AU1 0.090 0.102 0.090 0.007 0.009 0.011 0.012 0.011 0.012 0.012 0.011 0.012 0.012 0.012 0.004 0.002 AU1
AU2 0.087 0.102 0.093 0.039 0.010 0.010 0.012 0.011 0.012 0.011 0.011 0.011 0.011 0.012 0.012 0.003 AU2
AU3 0.090 0.098 0.097 0.061 0.069 0.009 0.012 0.011 0.011 0.012 0.010 0.011 0.011 0.012 0.009 0.002 AU3
AU4 0.094 0.093 0.089 0.080 0.080 0.056 0.013 0.011 0.012 0.012 0.011 0.012 0.012 0.012 0.004 0.001 AU4
B1 0.088 0.086 0.096 0.093 0.090 0.097 0.108 0.008 0.011 0.011 0.012 0.011 0.012 0.012 n/c n/c B1
B2 0.077 0.082 0.100 0.093 0.087 0.087 0.096 0.042 0.010 0.011 0.011 0.011 0.011 0.013 0.010 0.004 B2
B3 0.094 0.100 0.099 0.106 0.099 0.098 0.107 0.079 0.074 0.011 0.010 0.011 0.011 0.012 n/c n/c B3
L 0.087 0.081 0.096 0.099 0.099 0.108 0.108 0.087 0.085 0.083 0.011 0.011 0.011 0.011 0.008 0.002 L
M1 0.084 0.098 0.095 0.087 0.087 0.081 0.096 0.085 0.080 0.090 0.096 0.011 0.011 0.012 0.012 0.003 M1
M2 0.110 0.103 0.115 0.109 0.108 0.099 0.116 0.096 0.099 0.094 0.099 0.105 0.010 0.011 0.023 0.004 M2
M3 0.103 0.104 0.097 0.107 0.102 0.100 0.107 0.109 0.104 0.095 0.098 0.093 0.090 0.011 0.014 0.003 M3
G 0.101 0.087 0.111 0.100 0.104 0.096 0.102 0.109 0.109 0.106 0.085 0.111 0.104 0.088 0.004 0.002 G

AM1 AM2 AM3 AU1 AU2 AU3 AU4 B1 B2 B3 L M1 M2 M3 G p-Distance St. err.
48 P. Coelho et al. / Acta Tropica 134 (2014) 43–51

Fig. 2. Bayesian estimate of phylogenetic relationships of Androctonus (outgroup not shown). Posterior probabilities values and bootstrap support values are shown above
and below nodes respectively. These samples are marked with the same colors and shapes in all figures.
 P. Coelho et al. / Acta Tropica 134 (2014) 43–51 49

Middle-Atlas and to the High Plateau along the Algerian borderland. For the past 20 M.a. the paleoclimatic history of North Africa
Average genetic distance within the clade is of 0.8%. It appears to has been characterized by drastic and oscillating events. The
be sister taxon to A. bicolor (ML 85% bootstrap support, BI posterior Mediterranean basin experienced extreme changes from the clos-
probability 0.96). ing of the Mediterranean Sea’s eastern end (15–19 M.a.) to its
A. mauritanicus, is presented in three clades; M2 and M3 are isolation from the Atlantic Ocean leading to the Messinian salin-
sister clades (BI = 0.60; ML = 80) whereas M1 was unrelated to these. ity crisis (5.96–5.33 M.a.) producing significant sea-level changes.
Specimens from the M1 clade are located in the northern range of Afterwards, the violent re-flooding of the Mediterranean basin
the Marrakech-Tensif-El Haouz administrative region. The speci- submerged large areas of North Africa and created islands in cur-
mens from the M2 clade occur in a horizontal stretch from the rent Morocco and Algeria (Krijgsman et al., 1999; Steininger and
peaks of the Anti-Atlas along the Souss valley with the westernmost Rogl, 1984). Furthermore, during the last 10 M.a. glacial cycles pro-
sample being 6 km from the seacoast. The M3 clade is comprised of duced climatic oscillations between wetter and drier conditions in
specimens from two sampling locations, both from the southwest North Africa. Consequently, the Saharan desert experienced con-
slope of the Anti-Atlas Mountains (see Fig. 1). Genetic distances tractions and expansions depending on the formation of heavily
between clades range from 9.0% to 10.5% while the highest genetic vegetated landscapes or hydrographic systems (Douady et al., 2003;
distance within these clades, in clade M2, is 2.3% (Table 3). Schuster et al., 2006). Fragmentation during these climatic oscilla-
A group of four dark-colored Androctonus, which morpholog- tions of more xeric habitats (Drake et al., 2011; Le Houérou, 1997),
ically resemble Androctonus gonneti most closely, are designated such as those favored by Androctonus species, may have also con-
here as A. cf. gonneti (see Section 4). These specimens (clade G) were tributed to the isolation and subsequent diversification in these
found in one sampling point in the southern limit of the Anti-Atlas scorpions.
Mountains near the mouth of the Oued Draa. The Atlas Mountains, formed in the mid-late Miocene, are a
A. australis forms a monophyletic unit, divided into four clades. major biogeographical barrier, and are thought to be the cause of
The AU3 (east Tunisian australis) and AU4 (Egyptian australis) clades diversification in several taxa (e.g. Fonseca et al., 2009; Gonçalves
are sister groups in the Bayesian tree (BI = 0.80), which is not the et al., 2012; Habel et al., 2012), and seem to have also played a role in
case in the ML analysis. Clades AU1 (Algerian australis) and AU2 Moroccan Androctonus. The distribution of the clades of A. mauritan-
(northern Algeria and west Tunisian australis) are sister groups in icus suggests that the mountain ranges could act as barriers to gene
both trees (BI = 0.95; ML = 99). Starting from the East, the AU4 clade flow. A. mauritanicus is found in median and low altitudes (e.g. clade
is exclusive to Egypt. Some of the specimens present in this clade M2 and M3). The High-Atlas is situated between M1 and M2 clades
are not geographically referenced, as they were obtained through and the Anti-Atlas between M2 and M3 clades. It seems from this
the pet-trade. The AU3 clade (East Tunisian australis) is distributed pattern that orography might be a probable cause for differentiation
solely in Tunisia: specimens range Southeast of the Chott el-Djerid in this species, as is the case in Buthus scorpions (Habel et al., 2012).
salt lake, north to the Chot el-Fejaj salt lake and as far south as Alternatively, the rivers associated with these mountains may have
the Tataouine desert region (Fig. 1). The AU2 clade is distributed also formed north–south barriers to dispersion, thus allowing dif-
from Algeria in the east, and westward to the Chott el-Djerid and ferentiation within A. mauritanicus. Vachon (1952) described two
Chot el-Gharsa salt lakes in Tunisia. The AU1 clade is comprised of subspecies in Morocco: A. m. mauritanicus and A. m. bourdoni. The
specimens from a single location between the Great Ergs of Alge- distribution of clade M1 largely coincides with the distribution of
ria (Fig. 1). Pairwise genetic distances between these clades range the former subspecies, while the distribution of clade M2 coincides
from 3.9% to 8.0%. The AU1 and AU4 clades present the lowest with the distribution of the latter. Although Lourenço (2005) did
values of within group genetic distance (0.4%). Among A. australis, not find evidence to support these two subspecies, the genetic dis-
the highest within group distance was found in clade AU2 (mean tances between them are at a level of those found between full
p-distance = 1.2%). Our samples from the Sinai Peninsula confirm species of Androctonus (Table 3). In addition, clades M2 and M3
former reports on this species’ occurrence in the Sinai (Levy and are also separated by a similar species-level genetic distance. An
Amitai, 1980). The extended 16S dataset shows that Ben Othmen exploratory morphological analysis of the specimens of clade M3
et al. (2009)’s “northern and southern lineage” sequences are placed found a very granulated prosoma and tergites, which does not fit the
throughout the AU2 and AU3 clades respectively (tree not shown). description of A. mauritanicus. These morphological characters also
The B clade (bicolor clade) unites all A. bicolor specimens. distinguish them from the specimens in clade M2, showing these
Notably, this clade has longer branches within it than any of the scorpions are distinct both genetically and morphologically. How-
other clades in this study. For this reason we divided this clade ever, a more detailed morphological assessment is clearly needed
into three subclades (B1, B2 and B3) and quantified the genetic dis- prior to a taxonomic revision. A. mauritanicus is, together with A.
tances between them. A. bicolor is present in the Tell Atlas in Algeria, australis, among the most dangerous scorpions in the Maghreb not
central Tunisia (Fig. 1) and Egypt (no GPS point available). Genetic only due to their venom toxicity but also because these species
distances between these subclades range from 4.2% to 7.9%. These occurrence often overlaps regions with relatively high human pop-
subclades were too small for mean p-distance within clades to be ulation densities (Chippaux and Goyffon, 2008). Between 1996 and
calculated. 2006 in Morocco, 53% of deaths that resulted from sting cases
come from incidents with A. mauritanicus (Touloun et al., 2012).
The genetically highly divergent subpopulations of A. mauritanicus
4. Discussion may, similar to A. australis (Devaux et al., 2004) and other scorpion
species (El Ayeb and Rochat, 1985; Newton et al., 2007; Smertenko
Genetic methods, using one or very few mitochondrial genes, et al., 2001), display differences in venom composition. This should
have proven very successful in uncovering cryptic diversity in North be taken into consideration in both the development of antisera
African scorpions (Froufe et al., 2008; Sousa et al., 2012, 2011). and the treatment of scorpion stings.
Despite using three genes with a high number of informative sites, A. liouvillei, although distributed in at least as large an area as
the dataset did not provide sufficient resolution above the species A. mauritanicus, is not as deeply split into separate clades. This
level. The relationships among these species therefore could not may be due to the less orographically complex area it inhabits. It
be resolved. Species-level clades, however, were well-resolved and is mainly found on the high plateau east of the Middle Atlas, and
received high support, and we resolved several novel and biogeo- eastward into Algeria. Although the A. liouvillei clade is sister to
graphically coherent clades within the species. the A. bicolor clade, genetic distances between them are near the
50 P. Coelho et al. / Acta Tropica 134 (2014) 43–51

species-level, corroborating Lourenço’s (2005) morphology-based gonnetti. A. liouvillei and A. sergenti are reported to have a smaller
assessment that A. liouvillei is a distinct species from A. bicolor. pectinal teeth count (Lourenço, 2005; Vachon, 1952). As no other
A. australis is one of the most widespread scorpions in North species are known for that region, we designated the G clade speci-
Africa and one of the leading causes of scorpionism in North Africa mens as A. cf gonneti, a species known from this region. Our estimate
(Chippaux and Goyffon, 2008). There is a deep split between clades of relationships based on mtDNA clearly indicates that these are
AU1 and AU2 on one side, and clades AU3 and AU4 on the other. The distinct from A. liouvillei (Fig. 2). Further sampling will be neces-
clades in Tunisia (clades AU2 and AU3) are therefore more closely sary to study the relationships between this population and other
related to clades distributed in countries as far east as Egypt (AU4) species from Morocco, but it appears to be A. gonneti, a variant of
and as far west as Algeria (AU1) than to each other. Substantial poly- this species, or an undescribed new species.
morphism for three toxins in the venom of A. australis was reported Summarizing, we were able to identify cryptic variation in A.
in Tunisia (Devaux et al., 2004). Differences were found between australis, A. mauritanicus and A. amoreuxi. Some cases were sim-
the venoms of specimens from localities corresponding to clades pler, in which we could corroborate the validity of a distinct
AU2 or AU3. This shows that it is highly likely that phylogenetically group, such as A. liouvillei. Further work should aim at sequenc-
divergent groups may have different venom compositions in A. aus- ing nuclear genes in order to resolve deeper relationships within
tralis. The genetic distance also reflects a higher distance between the genus. It would also be very interesting to obtain samples of
them than between the pairs AU1–AU2 and AU3–AU4. This sug- other species like Androctonus aleksandrplotkini, Androctonus hog-
gests either a strong biogeographic barrier between these clades, garensis, Androctonus maroccanus Lourenço et al., 2009, A. sergenti
or that their current proximity is an area of potential secondary con- and A. gonneti. Those, together with a more extensive sampling of
tact. There is a large salt lake, Chott el-Djerid, between the regions Algeria, Libya and Mauritania could provide a prime perspective
where clades AU2 and AU3 are in closest proximity. Salt lakes as on the patterns and processes shaping Androctonus evolution and
big as Chott el-Djerid might act as physical barriers for scorpion dis- current distribution in North Africa.
persion (Ben Othmen et al., 2009) and other taxa (Kornilios et al.,
2010). Although Ben Othmen et al. (2009) dealt only with Tunisian
Androctonus, had fewer samples, and used only 16S rRNA data, 5. Conclusions
they also found a deep divergence between the north-western and
south-eastern Tunisian A. australis. Their “northern” and “south- We here show that A. australis, A. mauritanicus and A. amoreuxi
ern lineages” are genetically and geographically congruent with have deeply divergent subclades. Such variation can be reflected in
our AU2 and AU3 clades respectively. They explored the possibil- the venom these animals produce, as seen in other scorpion species
ity of the lake’s formation causing the vicariant event. However (Borges et al., 2010; Newton et al., 2007; Omran and McVean, 2000;
the relatively recent dates for the lake’s formation (90–150 ka) do Smertenko et al., 2001). We therefore suggest that the venom of A.
not coincide with their divergence time estimation (3.43–9.90 Ma), australis, A. mauritanicus and A. amoreuxi should be studied with
and they suggest that the recently formed salt lake acts only as a these deep divergences in mind. Antivenom developed for scor-
barrier to secondary contact, rather than having caused vicariance pions in one region should be tested for efficacy against venoms
between these two populations. Their divergence time estimate from regions (Fatani et al., 2010) where scorpions correspond to
was not based on calibration points, but rather on a constant muta- different clades as identified here.
tion rate, and should therefore be regarded with caution. Pedroso Furthermore despite lack of basal resolution, our results have
et al. (2013) have found a similar high divergence between popula- clear bearing on the taxonomic status of some of the (sub)species
tions of Buthus scorpions to the North-West and South-East of Chott included in our study. In addition, we identified a population of A.
el-Djerid. Due to a lack of dependable internal calibration points for gonneti-like specimens near Tan-Tan (clade G) which merits further
molecular dating, we have refrained from calculating divergence study as a potential new species.
time estimates in our study, and placing the divergences between
clades and species in a paleogeographic or paleoclimatic context
therefore remains tentative. Acknowledgements
Surprising was the find of two distinct clades of A. amoreuxi
in Morocco. The distribution of clades AM1 and AM2 meet in the We are indebted to Dr. Said Larbes of the Département de Biologie,
Erfoud area. Although there are no obvious geographical formations Faculté des Sciences Biologiques et Agronomiques, Université M. Mam-
separating them, the genetic distance between clades is 7.5%, which meri, Tizi-Ouzou, Algeria for supplying important samples from
is similar to the distance recovered between the A. australis clades. Algeria. We thank Abdullah M. Nagy of the St. Catherine wildlife
As currently recognized the species appears to be paraphyletic, with preserve, Sérgio Henriques, Diana Pedroso and our colleagues at the
clade AM3 sister to A. australis although with very weak support lev- CIBIO institute for assistance in the field. Thanks to Arendo Flipse
els. Although some A. amoreuxi specimens were separated by the for supplying some of the Egyptian scorpions. This work was funded
largest geographic distance of any species in this study, we could by Fundação para a Ciência e Tecnologia, BIABDE/74349/2006
not find morphological differences between them in taxonomically (to D.J.H.), SFRH/BD/74934/2010 (to P.S.), SFRH/BPD/48042/2008
relevant characters (Lourenço, 2005; Vachon, 1952). The fact that (A.v.d.M.) and a FCT I&D project (PTDC/BIA-EVF/2687/2012) to
the genetic distance between clades AM2 and AM3 is relatively high A.v.d.M. DJH is supported by “Genomics and evolutionary biology”
(8.9%) corroborates the division of A. amoreuxi into two subspecies: co-financed by North Portugal Regional Operational Programme
A. a. amoreuxi in the Maghreb and A. a. levyi Fet, 1997 in the Sinai 2007/2013 (ON.2 – O Novo Norte), under the NSRF, through the
Peninsula. However, to what taxonomic level these groups should European Regional Development Fund (ERDF).
be ascribed requires further morphological study of the intervening
populations.
References
Near Tan Tan Plage, a coastal town near the mouth of the Draa
River, we found four specimens morphologically different from Ben Ali, Z., Boursot, P., Said, K., Lagnel, J., Chatti, N., Navajas, M., 2000. Compari-
A. mauritanicus and Androctonus sergenti Vachon, 1948 (also, dark son of ribosomal ITS regions among Androctonus spp. scorpions (Scorpionida:
colored species). Morphologically, they seem to be closer related Buthidae) from Tunisia. J. Med. Entomol. 37, 787–790.
Ben Othmen, A., Chatti, N., Ben Ali-Haouas, Z., Ouldbrahim, I., Said, K., 2004.
with A. gonneti. The 4 adult male specimens we captured have the Allozymic differentiation of Tunisian populations of Androctonus species and
same pectinal teeth count (33) as reported by Vachon (1952) for A. Buthus occitanus (Scorpiones: Buthidae). Biol. J. Linn. Soc. 81, 255–265.
 P. Coelho et al. / Acta Tropica 134 (2014) 43–51 51

Ben Othmen, A., Said, K., Mahamdallie, S.S., Testa, J.M., Haouas, Z., Chatti, N., Ready, Kornilios, P., Kyriazi, P., Poulakakis, N., Kumlutaş, Y., Ilgaz, C., Mylonas, M., Lym-
P.D., 2009. Phylogeography of Androctonus species (Scorpiones: Buthidae) in berakis, P., 2010. Phylogeography of the ocellated skink Chalcides ocellatus
Tunisia: diagnostic characters for linking species to scorpionism. Acta Trop. 112, (Squamata Scincidae), with the use of mtDNA sequences: a hitch-hiker’s guide
77–85. to the Mediterranean. Mol. Phylogenet. Evol. 54, 445–456.
Borges, A., Bermingham, E., Herrera, N., Alfonzo, M.J., Sanjur, O.I., 2010. Molecular Krijgsman, W., Hilgen, F.J., Raffi, I., Sierro, F.J., Wilson, D.S., 1999. Chronology, causes
systematics of the neotropical scorpion genus Tityus (Buthidae): the histori- and progression of the Messinian salinity crisis. Nature 400, 652–655.
cal biogeography and venom antigenic diversity of toxic Venezuelan species. Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., McGettigan, P.A., McWilliam,
Toxicon 55, 436–454. H., Valentin, F., Wallace, I.M., Wilm, A., Lopez, R., Thompson, J.D., Gibson, T.J.,
Bruford, M.W., Hanotte, O., Brookfield, J.F.Y., Burke, T., 1992. Single-locus and mul- Higgins, D.G., 2007. Clustal W and Clustal X version 2.0. Bioinformatics 23,
tilocus DNA fingerprinting. In: Hoelzel, A.R. (Ed.), Molecular Genetic Analysis of 2947–2948.
Populations: A Practical Approach. IRL Press, Oxford, pp. 225–270. Le Houérou, H.N., 1997. Climate, flora and fauna changes in the Sahara over the past
Chippaux, J.-P., Goyffon, M., 2008. Epidemiology of scorpionism: a global appraisal. 500 million years. J. Arid Environ. 37, 619–647.
Acta Trop. 107, 71–79. Levy, G., Amitai, P., 1980. Fauna Palaestina. Arachnida I: Scorpiones. Israel Academy
Daltry, J., Wuester, W., Thorpe, R., 1996. Diet and snake venom evolution. Nature of Sciences and Humanities, Jerusalem.
379, 537–540. Lourenço, W., Cuellar, O., 1995. Scorpions, scorpionism, life history strategies and
Darriba, D., Taboada, G.L., Doallo, R., Posada, D., 2012. jModelTest 2: more models, parthenogenesis. J. Venom. Anim. Toxins 1, 51–62.
new heuristics and parallel computing. Nat. Methods 9, 772. Lourenço, W., Qi, J., 2007. A new species of Androctonus Ehrenberg, 1828 from Mau-
Devaux, C., Jouirou, B., Naceur Krifi, M., Clot-Faybesse, O., El Ayeb, M., Rochat, H., ritania (Scorpiones, Buthidae). Bol. Soc. Entomol. Aragon. 1, 215–219.
2004. Quantitative variability in the biodistribution and in toxinokinetic studies Lourenço, W.R., 2005. Nouvelles considérations taxonomiques sur les espèces du
of the three main alpha toxins from the Androctonus australis hector scorpion genre Androctonus Ehrenberg, 1828 et description de deux nouvelles espèces
venom. Toxicon 43, 661–669. (Scorpiones, Buthidae). Rev. Suisse Zool. 112, 145–171.
Douady, C.J., Catzeflis, F., Raman, J., Springer, M.S., Stanhope, M.J., 2003. The Sahara as Lourenço, W.R., 2008. A new species of Androctonus Ehrenberg, 1828 from Togo
a vicariant agent, and the role of Miocene climatic events, in the diversification (Scorpiones, Buthidae). Entomol. Mitt. Zool Museum Hambg. 15, 37–44.
of the mammalian order Macroscelidea (elephant shrews). Proc. Natl. Acad. Sci. Miranda, F., Rochat, H., Rochat, C., Lissitzky, S., 1966. Complexes moléculaires
U.S.A. 100, 8325–8330. présentés par les neurotoxines animales—I, Neurotoxines des venins de scor-
Drake, N.A., Blench, R.M., Armitage, S.J., Bristow, C.S., White, K.H., 2011. Ancient pions (Androctonus australis hector et Buthus occitanus tunetanus). Toxicon 4,
watercourses and biogeography of the Sahara explain the peopling of the desert. 123–136.
Proc. Natl. Acad. Sci. U.S.A. 108, 458–462. Newton, K.A., Clench, M.R., Deshmukh, R., Jeyaseelan, K., Strong, P.N., 2007. Mass
Edgar, R.C., 2004. MUSCLE: multiple sequence alignment with high accuracy and fingerprinting of toxic fractions from the venom of the Indian red scorpion,
high throughput. Nucleic Acids Res. 32, 1792–1797. Mesobuthus tamulus: biotope-specific variation in the expression of venom pep-
El Ayeb, M., Rochat, H., 1985. Polymorphism and quantitative variations of toxins in tides. Rapid Commun. Mass Spectrom. 21, 3467–3476.
the venom of the scorpion Androctonus australis Hector. Toxicon 23, 755–760. Omran, M.A.A., McVean, A., 2000. Intraspecific variation in scorpion Leiurus quin-
Fatani, A.J., Ahmed, A.A.E., Abdel-Halim, R.M., Abdoon, N.A., Darweesh, A.Q., 2010. questriatus venom collected from Egypt (Sinai and Aswan Deserts). Toxin Rev.
Comparative study between the protective effects of Saudi and Egyptian 19, 247–264.
antivenoms, alone or in combination with ion channel modulators, against dele- Pedroso, D., Sousa, P., Harris, D.J., Van der Meijden, A., 2013. Phylogeography of
terious actions of Leiurus quinquestriatus scorpion venom. Toxicon 55, 773–786. Buthus Leach, 1815 (Scorpiones: Buthidae): a multigene molecular approach
Fet, V., Gantenbein, B., Gromov, A.A.V., Lowe, G., Lourenço, W.R., 2003. The first reveals futher evolutionary history in the Maghreb. Afr. Invertebr. 48, 298–308,
molecular phylogeny of Buthidae (Scorpiones). Euscorpius 4, 1–10. http://dx.doi.org/10.3377/004.048.0216.
Fet, V., Polis, G.A., Sissom, W.D., 1998. Life in sandy deserts: the scorpion model. J. Prasad, N., Uma, B., Bhatt, S., Gowda, V., 1999. Comparative characterisation of Rus-
Arid Environ. 39, 609–622. sell’s viper (Daboia/Vipera russelli) venoms from different regions of the Indian
Folmer, O., Black, M., Hoeh, W., Lutz, R., Vrijenhoek, R., 1994. DNA primers peninsula. Biochim. Biophys. Acta 1428, 121–136.
for amplification of mitochondrial cytochrome c oxidase subunit I from Schuster, M., Duringer, P., Ghienne, J.-F., Vignaud, P., Mackaye, H.T., Likius, A., Brunet,
diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 3 (5), 294–299, M., 2006. The age of the Sahara desert. Science 311, 821.
http://dx.doi.org/10.1371/journal.pone.0013102. Smertenko, A., Omran, M.A.A., Hussey, P.J., McVean, A., 2001. Toxin evolution in
Fonseca, M.M., Brito, J.C., Paulo, O.S., Carretero, M.A., Harris, D.J., 2009. System- scorpion venom: evidence for toxin divergence under strong negative selection
atic and phylogeographical assessment of the Acanthodactylus erythrurus group in Leiurus quinquestriatus subspecies. Toxin Rev. 20, 229–244.
(Reptilia: Lacertidae) based on phylogenetic analyses of mitochondrial and Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H., Flook, P., 1994. Evolution,
nuclear DNA. Mol. Phylogenet. Evol. 51, 131–142. weighting, and phylogenetic utility of mitochondrial gene sequences and a com-
Froufe, E., Sousa, P., Alves, P.C., Harris, D.J., 2008. Genetic diversity within Scorpio pilation of conserved polymerase chain reaction primers. Ann. Entomol. Soc. Am.
maurus (Scorpiones: Scorpionidae) from morocco: preliminary evidence based 87 (6), 651–700.
on CO1 mitochondrial DNA sequences. Biologia (Bratisl.) 63, 1157–1160. Sousa, P., Froufe, E., Alves, P., Harris, D.J., Alves, P.C., 2010. Genetic diversity within
Gantenbein, B., Kropf, C., Largiadèr, C.R., Scholl, A., 2000. Molecular and morpholog- scorpions of the genus Buthus from the Iberian Peninsula: mitochondrial DNA
ical evidence for the presence of a new Buthid taxon (Scorpiones: Buthidae) sequence data indicate additional distinct cryptic lineages. J. Arachnol. 28,
on the Island of Cyprus. Rev. Suisse Zool. 107 (1), 213–232, Retrieved from 206–211.
http://www.cabdirect.org/abstracts/20000507188.html Sousa, P., Froufe, E., Harris, D.J., Alves, P.C., Van der Meijden, A., 2011. Genetic
Gantenbein, B., Largiadèr, C.R., 2003. The phylogeographic importance of the Strait diversity of Maghrebian Hottentotta (Scorpiones: Buthidae) scorpions based on
of Gibraltar as a gene flow barrier in terrestrial arthropods: a case study with CO1: new insights on the genus phylogeny and distribution. Afr. Invertebr. 52,
the scorpion Buthus occitanus as model organism. Mol. Phylogenet. Evol. 28, 135–143.
119–130. Sousa, P., Harris, D.J., Froufe, E., Meijden, A., 2012. Phylogeographic patterns of Buthus
Gonçalves, D.V., Brito, J.C., Crochet, P.-A., Geniez, P., Padial, J.M., Harris, D.J., 2012. scorpions (Scorpiones: Buthidae) in the Maghreb and South-Western Europe
Phylogeny of North African Agama lizards (Reptilia: Agamidae) and the role based on CO1 mtDNA sequences. J. Zool. 288, 66–75.
of the Sahara desert in vertebrate speciation. Mol. Phylogenet. Evol. 64 (3), Steininger, F.F., Rogl, F., 1984. Paleogeography and palinspastic reconstruction of the
582–591, http://dx.doi.org/10.1016/j.ympev.2012.05.007. Neogene of the Mediterranean and Paratethys. Geological Society, London, Spe-
Goyffon, M., Dabo, A., Coulibaly, S., Togo, G., Chippaux, J., 2012. Dangerous scorpion cial Publications 17, 659–668, http://dx.doi.org/10.1144/GSL.SP.1984.017.01.52.
fauna of Mali. J. Venom. Anim. Toxins Incl. Trop. Dis. 18, 361–368. Stockmann, R., Ythier, E., 2010. Scorpions of the World. N.A.P. Editions, Verrières-le-
Goyffon, M., Guette, C., 2005. Scorpions dangereux du Niger. Bull. Soc. Pathol. Exot. Bruisson, France.
98, 293–295. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5:
Graham, M.R., 2011. Scorpions of the World Scorpions of the World. Roland Stock- molecular evolutionary genetics analysis using maximum likelihood, evolution-
mann, Eric Ythier 2010. N.A.P. Editions, France, ISBN 978-2-913688-11-7, pp. ary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739.
567, J. Arachnol. 39, 166–167. Tikader, B., Bastawade, D., 1983. The fauna of India. Scorpions (Scorpionida: Arach-
Guindon, S., Dufayard, J.-F., Lefort, V., Anisimova, M., Hordijk, W., Gascuel, O., 2010. nida), Arachnida, vol. 3. Zoological Survey of India, Calcutta.
New algorithms and methods to estimate maximum-likelihood phylogenies: Touloun, O., Boumezzough, A., Slimani, T., 2012. Scorpion envenomation in the
assessing the performance of PhyML 3.0. Syst. Biol. 59, 307–321. region of Marrakesh Tensift Alhaouz (Morocco): epidemiological characteriza-
Habel, J.C., Husemann, M., Schmitt, T., Zachos, F.E., Honnen, A.-C., Petersen, B., Par- tion and therapeutic approaches. Serket 13, 38–50.
makelis, A., Stathi, I., 2012. Microallopatry caused strong diversification in Buthus Vachon, M., 1952. Description des scorpions du Nord-Ouest de L’Afrique (Maroc,
scorpions (Scorpiones: Buthidae) in the Atlas Mountains (NW Africa). PLoS ONE Algerie, Tunisie, Fezzan, Sahara et Sahel). A. Familie des Buthidae E. Simon,
7, e29403. 1879. [Part II: Genus Androctonus]. In: Etudes Sur Les Scorpions. Institut Pasteur
Habermehl, G., 1994. Gift-Tiere und ihre Waffen: Eine Einführung für Biologen, d’Algérie, Alger, pp. 116–178.
Chemiker und Mediziner. Ein Leitfaden für Touristen, 5th ed. Springer Verlag, Vachon, M., 1958. Scorpionidea (Chelicerata) de l’Afghanistan. The 3rd Danish Expe-
Heidelberg. dition to Central Asia. (Zoological Results 23). Vidensk. Meddelelser fra Dansk
Hedin, M.C., 1997. Molecular phylogenetics at the population/species interface in Naturhistrorisk Foren. i Købehavn, vol. 120., pp. 121–187.
cave spiders of the southern Appalachians (Araneae:Nesticidae:Nesticus). Mol. Van der Meijden, A., Kleinteich, T., Coelho, P., 2012. Packing a pinch: functional impli-
Biol. Evol. 14 (3), 309–324. cations of chela shapes in scorpions using finite element analysis. J. Anat. 220
Husemann, M., Schmitt, T., Stathi, I., Habel, J.C., 2012. Evolution and radiation in the (5), 423–434, http://dx.doi.org/10.1111/j.1469-7580.2012.01485.x.
scorpion Buthus elmoutaouakili Lourenco and Qi 2006 (Scorpiones: Buthidae) at Watt, D.D., Simard, J.M., 1984. Neurotoxic proteins in scorpion venom. Toxin Rev. 3,
the foothills of the Atlas Mountains (North Africa). J. Hered. 103, 221–229. 181–221.