736 INTERNATIONAL JOURNAL OF ONCOLOGY 50: 736-744, 2017

Insulin induction instigates cell proliferation and

metastasis in human colorectal cancer cells
CHI-CHENG LU1,2, PEI-YI CHU2, SHIH-MIN HSIA1, CHI-HAO WU1,
YU-TANG TUNG1,2 and GOW-CHIN YEN2,3

1
School of Nutrition and Health Sciences, Taipei Medical University, Taipei 110;
2
Department of Food Science and Biotechnology, National Chung Hsing University, Taichung 402;
3
Agricultural Biotechnology Center, National Chung Hsing University, Taichung 402, Taiwan, R.O.C.

Received September 30, 2016; Accepted December 30, 2016

DOI: 10.3892/ijo.2017.3844

Abstract. The progression of colorectal cancer has been Introduction

reported to have a positive correlation with the combination
of hyperglycemia and hyperinsulinemia in diabetic patients, Diabetes mellitus has become one of the major diseases that
leading to a lower survival rate. However, how insulin acts on is hazardous to human health and is caused by the change in
colorectal cancer remains not well understood. The purpose of lifestyle and western style diet in recent years (1). Diabetes
this study was to explore the effect of insulin on colon cancer is a systemic disease of metabolic disorders and leads to an
cell proliferation and its underlying molecular signaling as increasing number of deaths (2). Poor insulin activity and inad-
well as the impact of insulin-induced in vitro metastasis. equate insulin secretion can cause carbohydrate metabolism
Our results showed that insulin markedly promoted cell problems, finally resulting in patients developing hypergly-
proliferation, migration and anchorage-independent growth in cemia and hyperinsulinemia (3). In addition, there is growing
human colon cancer HCT-116 cells. Insulin‑regulated insulin evidence that there is a connection between type 2 diabetes
receptors (IRs) stimulate insulin receptor substrate 1 (IRS-1) and the increased appearance of new tumor cases as shown
and interact with the downstream signals, causing a rise in in retrospective and prospective epidemiological studies (4,5).
HCT-116 cell proliferation. Moreover, insulin significantly Patients with type 2 diabetes have a high risk of cancer, and
induced the migration ability of HCT-116 cells. The metastatic colorectal cancer is the third leading cause of cancer death
ability of matrix metalloproteinase-2 (MMP-2) mRNA and according to the cancer statistics in Taiwan (6). The principal
activity was activated by insulin. Overall, insulin-triggered source of energy upon the glycolysis of glucose has been
cell proliferation and metastatic effects on colorectal cancer directly monitored in migrating tumor cells (7). However,
cells are mediated by IRS-1 and downstream molecules and by in the insulin-free condition, the high blood glucose fails to
increasing phosphoinositide 3-kinase (PI3K)/Akt and mitogen- promote tumor growth due to insulin deficiency (8,9), which
activated protein kinase (MAPK) signaling. Therefore, insulin might be a mediator in the induction of hyperinsulinemia to
induction might have the potential to induce colorectal cancer increase the factors of cancer progression (10).
progression in diabetes patients. Colorectal cancer patients with diabetes have a higher
mortality rate than those with type 2 diabetes alone (11,12).
In addition, human evidence has also demonstrated that high
levels of insulin with an increased risk of colon cancer and
increased circulating concentrations of insulin are associated
Correspondence to: Dr Gow-Chin Yen, Department of Food with a higher risk of colonic neoplasia (13). Furthermore,
Science and Biotechnology, National Chung Hsing University, chronic hyperinsulinemia might stimulate insulin receptor
145 Xingda Road, Taichung 40227, Taiwan, R.O.C. (IR) signaling to induce tumor growth in breast and pancreatic
E-mail: gcyen@nchu.edu.tw cancers (14,15). Currently, there is no available information
regarding a link between colorectal cancer and type 2 diabetes
Abbreviations: ECM, extracellular matrix; IR, insulin receptor; in patients, and the molecular mechanism of high insulin-
IRS-1, insulin receptor substrate 1; MAPKs, mitogen-activated
induced signaling in colon cancer remains unclear. Herein, we
protein kinases; MMP-2, matrix metalloproteinase-2; PI3K,
phosphoinositide 3-kinase; poly-HEMA, poly(2-hydroxyethyl
focused on the role of insulin in the proliferation and meta-
methacrylate) static effects on human colorectal cancer cells.
We further investigated how the addition of insulin
Key words: diabetes, insulin, colon cancer, cell proliferation, cell promoted cell proliferation and migration by modifying the
migration expression of IR signaling, the phosphoinositide 3-kinase
(PI3K)/Akt/glycogen synthase kinase-3β (GSK3β) pathway
and matrix metalloproteinase-2 (MMP-2) regulation in treated
colorectal cancer cells. Therefore, our results confirm a link
 lu et al: Effect of insulin on colon cancer cells 737

between insulin and colorectal cancer cell progression and cells were treated with various concentrations (100, 150 and
clarify how insulin acts as a molecular modulator using a 200 nM) of insulin in RPMI-1640 medium with 1% FBS
cultured cell model. and further incubated for 48 h. CellTiter 96 AQueous One
Solution Cell Proliferation Assay kit (Promega, Madison, WI,
Materials and methods USA) was used, and the absorbance at 490 nm was recorded
with a FLUOstar galaxy spectrophotometer (BMG Labtech,
Chemicals and reagents. Anti-β-actin antibody, fish gelatin Ortenberg, Germany).
and poly(2-hydroxyethyl methacrylate) (poly-HEMA) were
obtained from Sigma-Aldrich (St. Louis, MO, USA). Penicillin- Western blotting. The treated HCT-116 cells were harvested
streptomycin solution, insulin, sodium pyruvate, RPMI-1640 and lysed in RIPA Lysis Buffer (EMD Millipore). Nuclear
medium, trypsin-EDTA and TRI Reagent Solution were and cytosolic fractions were prepared utilizing the Nuclear/
purchased from Thermo Fisher Scientific (Waltham, MA, Cytosol Fractionation kit (BioVision) as specified in the manu-
USA). Fetal bovine serum (FBS) was obtained from Biological facturer's protocol. The protein concentration was detected
Industries (Cromwell, CT, USA). Nuclear/Cytosol Fractionation using the Bio-Rad protein assay (Bio-Rad Laboratories,
kit and anti-lamin B1 antibody were from BioVision (Mountain Hercules, CA, USA), and then the lysate was mixed with
View, CA, USA). Anti-IR antibody was obtained from protein loading dye and boiled, as previously described (21).
Abcam (Cambridge, UK). Anti-phospho-mTOR (Ser2448), The sample (50 µg) was subjected to sodium dodecyl sulfate
anti-mTOR, anti-cyclin D1, SB203580 (a p38 inhibitor) and (SDS)-polyacrylamide gel electrophoresis, and the separated
wortmannin (a PI3K inhibitor) were from EMD Millipore protein was transferred onto cellulose nitrate membrane
(Billerica, MA, USA). Antibodies against JNK and p-JNK (Sartorius Stedim Biotech GmbH, Goettingen, Germany). Each
(Thr183/Tyr185) were obtained from Santa Cruz Biotechnology membrane was immunoblotted directly against an appropriate
(Santa Cruz, CA, USA). The other antibodies used in this study antibody [anti-IR, anti-IRS-1, anti-phospho-PI3K, anti-PI3K,
were purchased from Cell Signaling Technology (Beverly, anti-phospho-Akt (Ser473), anti-Akt, anti-phospho-mTOR
MA, USA). Anti-rabbit and anti-mouse secondary horseradish (Ser2448), anti-mTOR, anti-phospho-GSK3β (Ser9), anti-
peroxidase (HRP) antibodies were obtained from Bethyl GSK3β, anti-p53, anti-cyclin D1, anti-c-Myc, anti-heat shock
Laboratories (Montgomery, TX, USA). PD98059 (an ERK protein 27 (HSP27), anti-phospho-ERK1/2 (Thr202/Tyr204),
inhibitor) and SP600125 (a JNK inhibitor) were obtained from anti-ERK1/2, anti-phospho-JNK (Thr183/Tyr185), anti-JNK,
Biosource International, Inc. (Camarillo, CA, USA). anti-phospho-p38 (Thr180/Tyr182) and anti-p38] overnight
and then further incubated with HRP-conjugated secondary
Cell culture. Human colorectal carcinoma HCT-116 cell antibody (1:10000 dilutions). The protein levels were normal-
line (BCRC no. 60349) was purchased from the Bioresource ized to lamin B1 or β-actin. The signal was analyzed using
Collection and Research Center (BCRC) (Hsinchu, Taiwan). Immobilon Western Chemiluminescent HRP Substrate (EMD
Based on the information of BCRC, the initial origin of this Millipore), and the signal intensity was quantified using
cell line is from male colorectal carcinoma tissue. HCT-116 VisionWorks LS Image Acquisition and Analysis Software
cells have been shown to express Akt1 and Akt2 in the absence (version 6.3.3, UVP, Upland, CA, USA).
of Akt3 in insulin-stimulated conditions (16,17). The cells
were maintained in RPMI-1640 medium supplemented with Wound healing assay. The Culture-Insert 2 Well (Ibidi,
10% FBS, 100 µg/ml penicillin and 100 U/ml streptomycin at Martinsried, Germany) was placed onto a 12-well plate, and
37˚C in a humidified atmosphere of 95% air and 5% CO2. The HCT-116 cells (7x104 cells/well) were seeded into the culture-
culture medium was renewed each day. Cells were subcultured insert. After 12 h of incubation, the culture-insert was removed,
every 3 days with 0.1% trypsin-EDTA. and cells were treated with various concentrations (100, 150
and 200 nM) of insulin in RPMI-1640 medium with 1% FBS
Cell viability assay. Cell viability was determined with and further incubated for 24, 48 and 72 h. Photographs of the
a trypan blue assay as previously described (18). HCT-116 wound adjacent to reference lines scraped on the bottom of
cells (5x10 4 cells/well) were seeded onto a 24-well plate in the plate were taken using an Olympus IX71 Inverted System
RPMI-1640 medium with 1% FBS. After a 24 h incubation, Microscope. The cells were examined and quantified to
pretreatment with or without 20 µM of SP600125, PD98059, measure relative to a control well.
SB203580 and wortmanin, respectively, for 1 h, and the cells
were treated with or without various concentrations (100, Transwell migration assay. Cell migration was determined
150, 200, 250 and 300 nM) of insulin in culture medium with a Transwell migration assay. Transwell polycarbonate
with 1% FBS for 48 h. Cells were harvested and then stained membrane cell culture inserts (Corning, Lowell, MA,
with 0.4% trypan blue to count the live and dead cells using USA) were placed onto a 24-well plate, and HCT-116 cells
an Olympus IX71 Inverted System Microscope (Olympus, (1x105 cells/well) were treated at various concentrations
Tokyo, Japan). (100, 150 and 200 nM) of insulin in serum-free RPMI-1640
medium. A serum-containing medium (650 µl) was added to
Cell proliferation assay. The 96-well plate was coated with the lower chambers. After incubating for 48 h, filter inserts
50 µl of 12% poly-HEMA solution dissolved in 95% ethanol were removed from the wells, and the cells that migrated
as described by previous studies  (19,20). HCT-116 cells through the membrane were fixed with methanol and stained
(5x103  cells/well) were seeded onto 96-well plates coated with crystal violet, as previously described (22). Photographs
with or without poly-HEMA. After 24 h of incubation, the were taken using an Olympus Power IX71 microscope, and
738 INTERNATIONAL JOURNAL OF ONCOLOGY 50: 736-744, 2017

tcacgtagcccacttgg; 18S rRNA, forward: GTAACC

CGTTGAACCCCATT, reverse: CCATCCAATCGGTAGTA
GCG. The PCR products were separated by electrophoresis on
a 1.5% agarose gel, and the DNA bands were detected using
the SYBR Safe DNA gel stain (Thermo Fisher Scientific). The
gel was then photographed using a BioDoc-It system (UVP).
The results were expressed as the ratio of each DNA signal
relative to the corresponding 18S rRNA signal.

Gelatin zymography. HCT-116 cells (1x105 cells/well) were

seeded onto 24-well plates in serum-free RPMI-1640 medium
and thereafter treated with various concentrations (100, 150
and 200 nM) of insulin for 48 h. Thereafter, the conditioned
media were collected, and the unboiled sample was separated
by electrophoresis on 8% SDS-polyacrylamide gels containing
0.1% gelatin (Sigma-Aldrich). After electrophoresis, the gels
were washed twice in washing buffer and then incubated in
reaction buffer at 37˚C for 16 h as previously described (22,23).
Bands corresponding to activity were visualized by negative
staining using Coomassie Brilliant Blue R-250 (Bio-Rad
Laboratories), and quantitative data were analyzed utilizing
VisionWorks LS Image Acquisition and Analysis Software
(version 6.3.3, UVP).

Statistical analysis. The data are expressed as the mean ± SD

of three independent experiments. Kruscal-Wallis H test was
subsequently followed up with Bonferroni method to evaluate
the statistical significance. P-value <0.05 was considered to
indicate a statistically significant difference.

Results

Insulin induces human colorectal carcinoma HCT-116 cell

proliferation in vitro. To examine the effects of insulin on
cytotoxicity, the trypan blue method was performed. Insulin
Figure 1. Effect of insulin on HCT-116 cell proliferation in vitro. Cells at 100-300 nM showed no cytotoxic influence on the number
were treated with or without 100, 150, 200, 250 or 300 nM insulin for 48 h.
(A) Cell proliferation was determined by the trypan blue exclusion method.
of dye-excluding HCT-116 cells (Fig. 1A). Importantly, insulin
Cells were added to wells precoated with or without poly-HEMA and at 100-250 nM significantly increased cell proliferation
then were incubated with the indicated concentrations of insulin for 48 h. (Fig. 1A). Next, the effect of cell proliferation on insulin-
(B) Cells were observed and photographed under a phase-contract micro- induced cells was examined by the poly-HEMA-coated plate
scope (scale bar=20 µm). (C) Quantification of cell proliferation from coated
and uncoated plates was performed as described in Materials and methods.
assay. Our data demonstrated that cells grew in aggregates
The data are expressed as the mean ± SD (n=3). *P<0.05 vs. untreated control; and showed sphere formation in a poly-HEMA-precoated
#
P<0.05 vs. untreated control in the uncoated poly-HEMA plate. plates (Fig. 1B, top panel). A comparison of adherent and
aggregated cells revealed that cells floated in the media.
In addition, HCT-116 cell growth was notably increased
the migrated cells were quantified by ImageJ 1.47 program by insulin in coated and uncoated poly-HEMA samples
for Windows from the National Institute of Health (NIH) compared with their untreated counterparts (Fig. 1C). Thus,
(Bethesda, MD, USA). these data indicated that insulin effectively promoted HCT-116
cell growth and proliferation in vitro.
Reverse transcription PCR. HCT-116 cells were treated with
100, 150 and 200 nM of insulin for 48 h before being collected Insulin modulates the IR pathway via PI3K/Akt signaling in
to extract total RNA using TRIzol Reagent (Thermo Fisher HCT-116 cells. Cells were exposed to various concentrations
Scientific), as previously described (21) and reverse transcribed of insulin, and the protein levels of IR and IRS-1 were then
to produce cDNA using the SuperScript III First-Strand assessed by immunoblotting analysis. Both the IR and IRS-1
Synthesis SuperMix for qRT-PCR kit (Thermo Fisher levels were increased after treatment with insulin (Fig. 2A).
Scientific) according to the manufacturer's protocols. The Moreover, treatment with insulin induced the phosphoryla-
primers used for PCR to amplify the target genes were as tion of PI3K and Akt (Ser473) in HCT-116 cells, but no effect
follows: MMP-2, forward: tacaccgggcctggagaac appeared in the protein levels of PI3K and Akt in insulin-
tag, reverse: gctctgagggttggtgggattg; MMP-9, treated cells (Fig. 2B). These results suggest that insulin
forward: ctggaggttcgacgtgaagg, reverse: agg induced the IR signal by regulating the PI3K/Akt pathway,
 lu et al: Effect of insulin on colon cancer cells 739

Figure 2. Effect of insulin on the insulin receptor (IR) pathway and PI3K/
Akt signaling in HCT-116 cells. Cells were exposed to 100, 150 and 200 nM Figure 3. Effect of insulin downstream of PI3K/Akt signaling of HCT-116
insulin for 48 h, and cell lysates were subjected to western blotting. The cells. Cells were incubated with different concentrations (100, 150 and
protein level of (A) insulin receptor (IR) and insulin receptor substrates 1 200 nM) of insulin for 48 h. Whole-cell lysates were extracted for the detec-
(IRS-1), as well as (B) p-PI3K (Tyr458), PI3K, p-Akt (Ser473) and Akt, was tion of the protein levels of (A) p-mTOR (Ser2448) and mTOR, (B) p-GSK3β
detected and adjusted for equivalent loading using the β-actin protein level. (Ser9) and GSK3β, and (C) p53 by immunoblotting. β -actin served as an
internal control.

showing that IR functionally enhances pro-tumorigenic signals

in HCT-116 cells.

Insulin regulates downstream PI3K/Akt signaling in HCT-116

cells. To determine whether the downstream signals are
involved in the regulation of insulin-treated HCT-116 cells
through the PI3K/Akt signaling pathway, we further tested the
protein levels of mTOR, GSK3β and p53 to specifically clarify
the functional regulation. Insulin treatment induced the phos-
phorylation of mTOR (Ser2448) (Fig. 3A) and GSK3β (Ser9)
(Fig. 3B). In addition, treatment with insulin induced the p53
level in a concentration-dependent manner in treated cells
(Fig. 3C). These results demonstrate that the enhancement of
insulin-induced IR signaling was observed via the PI3K/Akt
pathway by activation of mTOR/GSK3β, an activity that was
not due to the suppression of the p53 signal in HCT-116 cells.

Insulin affects cell cycle-associated protein expression of

c-Myc and cyclin D1, as well as HSP27 in HCT-116 cells.
Our results have shown that insulin increased HCT-116 cell
proliferation (Fig. 1). To verify whether c-Myc and cyclin D1
are involved in insulin-induced HCT-116 cell proliferation, we
examined the levels of c-Myc and cyclin D1 by western blot
analysis. Insulin increased the cyclin D1 level, but it decreased
c-Myc protein expression in HCT-116 cells (Fig. 4A). It seems Figure 4. Effect of insulin on the protein levels of c-Myc, cyclin D1 and
that insulin stimulated cell proliferation through regulating HSP27 in HCT-116 cells. Cells were treated with 100, 150 and 200 nM
c-Myc and cyclin D1 levels in HCT-116 cells. To further insulin for 48 h. (A) Total cell lysates were submitted to cyclin D1 and c-Myc
by western blot analysis. (B) The nuclear and cytosolic fractions were pre-
detect whether insulin causes the translocation of HSP27 and pared, and immunoblot analysis showed the expression levels of c-Myc and
c-Myc, we further analyzed the protein expression of c-Myc HSP27 in cells. Lamin B1 was used for nuclear loading control, and each
and HSP27 in nuclear and cytosolic fractions, respectively. protein level was normalized relative to the β-actin protein level.
740 INTERNATIONAL JOURNAL OF ONCOLOGY 50: 736-744, 2017

Figure 5. Effect of insulin on MAPK signaling and their specific inhibitors

in HCT-116 cells. (A) Cells were incubated with 100, 150 and 200 nM insulin
for 48 h and then were harvested to measure the indicated protein levels
[p-ERK1/2 (Thr202/Tyr204), ERK1/2, p-JNK (Thr183/Tyr185), JNK, p-p38
(Thr180/Tyr182) and p38] by western blotting. β-actin served as the loading
control. (B) After individual pretreatment with 20 µM SP600125, PD98059,
SB203580 and wortmannin, exposure to insulin for 48 h was determined by
the trypan blue exclusion assay. The data are expressed as the mean ± SD
(n=3). *P<0.05 vs. untreated control; #P<0.05 vs. only insulin-treated cells.
Figure 6. Effect of insulin on motility of HCT-116 cells. Confluent mono-
layers of cells were wounded before incubation with 100, 150 and 200 nM of
insulin for indicated periods of time. (A) The relative denuded zone (wound
We observed a decrease in c-Myc nuclear translocation and closures) and migrated cells were examined and photographed. (B) The
an increase in HSP27 trafficking into the nucleus of HCT-116 migrated cells were monitored and quantified. The data are expressed as the
cells after insulin exposure, while insulin attenuated cytosolic mean ± SD (n=3). *P<0.05 vs. untreated control.
c-Myc and enhanced HSP27 in the cytosol (Fig. 4B). These
data implied that the activity of c-Myc and HSP27 might be
required in insulin-induced HCT-116 cell proliferation. cell proliferation (Fig. 5B). Specifically, PD98059 and wort-
mannin significantly attenuated insulin-induced viability by
Insulin enhances MAPK signaling in HCT-116 cells. To up to 45.5% and 67.4%, respectively, compared with insulin
examine whether cell proliferation in response to insulin treatment alone. Therefore, we provide bimolecular evidence
challenge is associated with the MAPK pathway, we deter- regarding the influence of MAPK and PI3K signaling that
mined the level of MAPK (ERK, JNK and p38) molecules in contribute to insulin-provoked proliferation in HCT-116 cells.
insulin-treated HCT-116 cells. Insulin challenge resulted in
an upregulation of phosphorylated MAPK-associated protein Insulin promotes HCT-116 cell motility and migration in vitro.
levels, including the phosphorylation of ERK1/2 on Thr202/ We then further investigated whether insulin has an impact on
Tyr204, JNK on Thr183/Tyr185 and p38 on Thr180/Tyr182 cell migration in HCT-116 cells by the wound-healing assay.
(Fig. 5A). To confirm the roles of MAPK-triggered cell prolif- Insulin treatment significantly enhanced cell migration to the
eration by insulin, we individually pretreated HCT-116 cells denuded zone (Fig. 6A) and stimulated cell motility in a time-
with or without SP600125 (a JNK-specific inhibitor), PD98059 and concentration-dependent manner (Fig. 6B). After 48 h of
(an ERK-specific inhibitor), SB203580 (a p38-specific insulin exposure, the cells on the lower surface of the filter
inhibitor) or wortmannin (a PI3K-specific inhibitor) before were examined under a microscope in HCT-116 cells. Insulin
exposure to insulin to investigate cell viability. These four markedly elicited the number of migrated cells as measured by
inhibitors were effective on the inhibition of insulin-enhanced the Transwell migration assay at 48 h after insulin treatment
 lu et al: Effect of insulin on colon cancer cells 741

Figure 7. Effect of insulin on migration of HCT-116 cells. Cells were seeded

in the upper chamber of the Transwell insert and exposed to insulin (100, 150
and 200 nM). (A) After a 48-h incubation, cells migrating to lower side of the
membrane were stained and subsequently photographed. Scale bar, 20 µm.
(B) Quantitative results of migrated cells were measured, and the data are
expressed as the mean ± SD (n=3). *P<0.05 vs. untreated control. Figure 8. Effect of insulin on the gene expression and enzymatic activity of
matrix metalloproteinase-2 (MMP-2) in HCT-116 cells. Cells were incubated
with 100, 150 and 200 nM of insulin for 48 h and then individually subjected
to (A) RT-PCR and (B) gelatin zymography assay, as described in Materials
and methods. The gene expression of MMP-2 and MMP-9, as well as MMP-2
(Fig. 7A). The migration ability was increased by insulin enzymatic activity were performed and quantified. The data are expressed as
treatment of (Fig. 7B). These findings demonstrate that insulin the mean ± SD (n=3). *P<0.05 vs. untreated control.
promoted the migration ability of HCT-116 cells.

Insulin upregulates gene expression and gelatinolytic activity

of MMP-2 in HCT-116 cells. To clarify whether insulin with abnormal carbohydrate metabolism inducing hyper-
regulates the secretion of MMP-2 by HCT-116 cells, we glycemia and hyperinsulinemia, which are the major causes
employed RT-PCR and gelatin zymography assays. There was of the systemic inflammatory response (2,24). It has been
a noticeable induction in MMP-2 gene expression after insulin noted that the recurrence rate and mortality of patients were
treatment at 150 and 200 nM for 48 h (Fig. 8A). However, substantially increased with the coexistence of diabetes and
insulin had no effect on the MMP-9 mRNA level in treated some cancers (10,25). Regarding the lack of insulin, tumor cell
cells (Fig. 8A). In addition, a gelatinolytic band corresponding growth cannot directly be promoted in diabetes patients with
to MMP-2 was significantly increased by insulin in the culture hyperglycemia (9). However, the high concentration of insulin
medium that was stimulated, and quantitative analysis of has been reported to activate IR signaling to enhance tumor
these results was performed to show that enzymatic activity growth, which acts an important mediator (15,26). Currently,
of MMP-2 was increased in HCT-116 cells (Fig. 8B). Based on the mortality of patients with diabetes and colorectal cancer
the data, insulin leads to cell migration through increasing the is higher than that in patients with colorectal cancer only;
MMP-2 levels in HCT-116 cells. among them, the patients with type 2 diabetes possess a
higher risk of colorectal cancer (12,27,28). Therefore, this
Discussion study focused on exploring the effect of insulin on colorectal
cancer cell proliferation and migration, as well as clarifying
Diabetes is a systemic metabolic disorder caused by defects the underlying molecular mechanism in human colorectal
in insulin secretion and insulin activity, resulting in patients cancer cells in vitro.
742 INTERNATIONAL JOURNAL OF ONCOLOGY 50: 736-744, 2017

In this study, the human colon cancer cell line HCT-116 and cyclin D1); p53 can alter the effect of apoptosis and cell
was used to assess the effects of different concentrations of cycle-related signals (39). It has been reported that mRNA
insulin on the cytotoxicity of the tumor cells. A previous transcription, cell growth and cell proliferation can modulate
study has shown that insulin treatment at 100 nM interacted the phosphorylation of mTOR by activating the PI3K/Akt/
with optimal defensing expression (29) and was involved in mTOR pathway (40,41).
β-cell function during fasting plasma insulin concentrations Our current study provides information that the insulin-
in man (30). We found that insulin at 100-300 nM had no promoted cell proliferation occurred partly through mTOR
significant cytotoxic effect and exhibited an increase in cell signaling (Fig. 3A), indicating that mTOR signaling is a
proliferation in HCT-116 cells (Fig. 1), agreeing with that in minor mediator, and the other crucial regulators might
a previously published study (31). In addition, the process exist in insulin-treated HCT‑116 cells. It was reported that
of attached cell adhesion to the extracellular matrix (ECM) the activation of PI3K/Akt/GSK3 β signaling promotes
is critical during cancer cell proliferation and progression. the phosphorylated GSK3β on Ser9 to increase cyclin  D1
The transformation of cancer cells may be dependent on the expression, which accelerates the entry from G1 phase into
behavior of continued growth, which can serve as an impor- S phase (42,43). Our results clearly showed that insulin signifi-
tant clue for the malignant progression of cancer (32). cantly increased phosphorylated GSK3β (Ser9) (Fig. 3B) and
We further investigated the impact of insulin on anchorage- cyclin D1 (Fig. 4A) in HCT-116 cells, suggesting that insulin
independent cancer cell growth. Our findings demonstrate that activated the Akt signal to phosphorylate GSK3β following
insulin significantly increased cell proliferation and markedly the induction of cell proliferation through increasing cyclin D1
promoted the growth of cancer cells by the poly-HEMA expression, an activity that is required for cell cycle progression.
coated assay to prevent cell attachment (Fig. 1B). Moreover, Furthermore, the growth factors can suppress p53 expression
for long-term analysis (7 days), there was a similar effect on through stimulating PI3K/Akt signaling to promote cell cycle
HCT-116 cell proliferation (data not shown). Previous studies progression. However, the regulation of PTEN expression
have shown that mitogenic and oncogenic stimulation enhance by p53 can inhibit Akt activation (44). In the present study,
tumor cell growth and alter protein kinase activity and nuclear our results showed that insulin treatment markedly promoted
localization (19,33). Thus, it can be speculated that insulin p53 expression in HCT-116 cells (Fig. 3C). A previous study
promotes the characteristics of cancer cell proliferation to demonstrated that the p53-dependent effect contributing to
stimulate cancer progression in HCT-116 cells. the proliferation in uterine serous carcinoma USPC-1 cells
Insulin might play a vital role in the patients with diabetes carrying wild-type p53 was induced by metformin through
and cancer progression (34). Increasing evidence has suggested the downregulation of insulin/IGF-1 signaling (45). These
that the activation of IR signaling is mediated through the results suggest that the insulin-stimulated Akt signal could not
binding of insulin and IR to cause cancer cell survival and suppress p53 expression due to HCT-116 cells carrying wild-
mitotic actions (10). It has been recognized that the activation type p53 (46), creating a feedback effect to reach the balance
of insulin signaling stimulates IRS-1 to further affect the of dramatic cell proliferation caused by insulin.
PI3K/Akt pathway and to induce ERK phosphorylation, finally MAPK family members can regulate cell proliferation, cell
leading to cancer cell survival and mitotic effects (35-37). Our differentiation and cancer progression and play vital roles in
data showed that insulin increased the levels of IR and IRS-1 cell apoptosis (47,48). Insulin signaling induces cell prolifera-
expression in HCT-116 cells (Fig. 2), a finding that agrees with tion through the activation of the ERK/MAPK pathway, and the
a previously published study regarding insulin enhancing IR JNK and p38 MAPK had similar effects (36,38). Our findings
expression and then dramatically altering the downstream showed that insulin significantly increased the phosphoryla-
signaling pathway in breast cancer LCC6 cells (36). Therefore, tion of ERK, JNK and p38 MAPKs in HCT-116 cells (Fig. 5A).
we suggest that it is unnecessary that a dramatic increase in Additionally, it is well known that HSP27 and the transcription
the IR signal caused by insulin occurs, but their downstream factor c-Myc are regulated by MAPK signaling (47,49). We
proteins are important after IR activation in colon cancer cells. found that the transcription factor c-Myc was decreased in the
Many studies have provided consistent evidence that the nuclear fraction, but HSP27 was translocated to the nucleus in
phosphorylation of PI3K/Akt and ERK signaling can be cells after insulin challenge (Fig. 4B). This finding is also in
upregulated upon insulin pathway activation  (36,38). Our agreement with other reports showing that MAPK signaling
experimental results showed that the induction of the protein can modulate c-Myc expression, and the cancer cell invasive
levels of phosphorylated PI3K/Akt and ERK signals was ability can be regulated by p38 MAPK (47,49).
observed in insulin-treated HCT-116 cells (Figs. 2B and 5A). Based on our functional study, it was demonstrated that
In addition, insulin increased the phosphorylated proteins insulin triggered cell proliferation and metastatic effects
of JNK and p38 MAPKs in the examined cells (Fig.  5A). through MAPK signaling, as well as decreasing c-Myc
Importantly, preincubation with MAPK inhibitors (SP600125, expression and increasing HSP27 signaling in HCT-116
PD98059 and SB203580) after insulin exposure diminished cells. Evidence has shown that the function of the oncogene
HCT cell proliferation (Fig. 5B). Therefore, the event of the c-Myc exhibits stimulated cell proliferation and apoptosis,
MAPK signaling response for cell proliferation requires the and cyclin D1 can drive cell cycle progression and acts on
accumulation of insulin in human colorectal cancer cells. cell growth to integrate the cell cycle machinery (42,50). Our
Furthermore, the roles of the PI3K/Akt pathway and its down- results revealed that insulin increased the amount of cyclin D1
stream signaling are vital during cancer progression (39). For expression and reduced the protein levels of c-Myc expression
example, the mTOR signal is involved in cell proliferation; (Fig. 4A), suggesting that cancer cell apoptosis was evaded
GSK3β can regulate the cell cycle-associated proteins (c-Myc by insulin and showed a high ability of drug resistance (50).
 lu et al: Effect of insulin on colon cancer cells 743

Cancer cell metastasis has been shown to be involved in the 11. Will JC, Galuska DA, Vinicor F and Calle EE: Colorectal cancer:
Another complication of diabetes mellitus? Am J Epidemiol 147:
vital events of the intercellular degradation of the extracellular 816-825, 1998.
matrix, invasion and migration ability during tumor progres- 12. Saydah SH, Platz EA, Rifai N, Pollak MN, Brancati FL and
sion (22,51). Furthermore, chronic hyperinsulinemia promotes Helzlsouer KJ: Association of markers of insulin and glucose
primary tumor growth and the progression to lung metastasis control with subsequent colorectal cancer risk. Cancer Epidemiol
Biomarkers Prev 12: 412-418, 2003.
in a mouse model of type 2 diabetes. We further investigated 13. Giovannucci E: Insulin, insulin-like growth factors and
the effect of insulin on the metastatic effects of HCT-116 cells. colon cancer: A review of the evidence. J Nutr 131 (Suppl):
Our data demonstrated that insulin enhanced HCT-116 cell 3109S‑3120S, 2001.
14. Zhang H, Pelzer AM, Kiang DT and Yee D: Down-regulation of
migration, and MMP-2 might be involved in the metastatic type I insulin-like growth factor receptor increases sensitivity of
process caused by insulin (Figs. 6-8), eventually leading to breast cancer cells to insulin. Cancer Res 67: 391-397, 2007.
cancer cell progression. This finding is also in agreement 15. Dinchuk JE, Cao C, Huang F, Reeves KA, Wang J, Myers F,
Cantor GH, Zhou X, Attar RM, Gottardis M, et al: Insulin receptor
with the report by Qi et al (52), proving that insulin/protein (IR) pathway hyperactivity in IGF-IR null cells and suppression
kinase B signaling upregulates metastasis-related phenotypes of downstream growth signaling using the dual IGF-IR/IR
and molecules in human hepatocarcinoma cells. inhibitor, BMS-754807. Endocrinology 151: 4123‑4132, 2010.
16. Guo H, Gao M, Lu Y, Liang J, Lorenzi PL, Bai S, Hawke DH,
In conclusion, our study showed, for the first time, that Li J, Dogruluk T, Scott KL, et al: Coordinate phosphorylation
insulin triggers cell proliferation and the induction of meta- of multiple residues on single AKT1 and AKT2 molecules.
static effects on human colorectal cancer HCT-116 cells that is Oncogene 33: 3463-3472, 2014.
modulated by IR signaling and the PI3K/Akt/GSK3β pathway 17. Ericson K, Gan C, Cheong I, Rago C, Samuels Y, Velculescu VE,
Kinzler KW, Huso DL, Vogelstein B and Papadopoulos N:
as well as MMP-2 regulation. We report a concept and insight Genetic inactivation of AKT1, AKT2, and PDPK1 in human
addressing how insulin interacts with cell proliferation and colorectal cancer cells clarifies their roles in tumor growth regu-
migration in colon cancer cells. Therefore, these data support lation. Proc Natl Acad Sci USA 107: 2598-2603, 2010.
18. Strober W: Trypan blue exclusion test of cell viability. Curr
our hypothesis and offer an approach for insulin induction. The Protoc Immunol 111: A3.B.1-3, 2015.
existing evidence indicates that colorectal cancer progression 19. Fukazawa H, Mizuno S and Uehara Y: A microplate assay for
might be involved in insulin induction, and diabetes patients quantitation of anchorage-independent growth of transformed
cells. Anal Biochem 228: 83-90, 1995.
might need to pay close attention to this issue. 20. Folkman J and Moscona A: Role of cell shape in growth control.
Nature 273: 345-349, 1978.
Acknowledgements 21. Lu CC, Yang SH, Hsia SM, Wu CH and Yen GC: Inhibitory
effects of Phyllanthus emblica L. on hepatic steatosis and liver
fibrosis in vitro. J Funct Foods 20: 20-30, 2016.
This work was supported in part by the Ministry of Education, 22. Lu CC, Yang JS, Chiang JH, Hour MJ, Amagaya S, Lu KW,
Taiwan, under the ATU plan and in part by the grant MOST103- Lin JP, Tang NY, Lee TH and Chung JG: Inhibition of invasion
2313-B-038-003-MY3 from the Ministry of Science and and migration by newly synthesized quinazolinone MJ-29
in human oral cancer CAL 27 cells through suppression of
Technology, Taiwan. MMP-2/9 expression and combined down-regulation of MAPK
and AKT signaling. Anticancer Res 32: 2895-2903, 2012.
References 23. Lu CC, Yang JS, Huang AC, Hsia TC, Chou ST, Kuo CL, Lu HF,
Lee TH, Wood WG and Chung JG: Chrysophanol induces
necrosis through the production of ROS and alteration of ATP
 1. Zimmet P, Alberti KG and Shaw J: Global and societal impli- levels in J5 human liver cancer cells. Mol Nutr Food Res 54:
cations of the diabetes epidemic. Nature 414: 782-787, 2001. 967-976, 2010.
 2. Tsai TY, Cheng JF and Lai YM: Prevalence of metabolic 24. Kitabchi AE, Umpierrez GE, Miles JM and Fisher JN: Hyper­
syndrome and related factors in Taiwanese high-tech industry glycemic crises in adult patients with diabetes. Diabetes Care 32:
workers. Clinics (Sao Paulo) 66: 1531-1535, 2011. 1335-1343, 2009.
 3. Maria Rotella C, Pala L and Mannucci E: Role of insulin in the 25. Barone BB, Yeh HC, Snyder CF, Peairs KS, Stein KB, Derr RL,
type 2 diabetes therapy: Past, present and future. Int J Endocrinol Wolff AC and Brancati FL: Long-term all-cause mortality in
Metab 11: 137-144, 2013. cancer patients with preexisting diabetes mellitus: A systematic
 4. Krone CA and Ely JT: Controlling hyperglycemia as an adjunct review and meta-analysis. JAMA 300: 2754-2764, 2008.
to cancer therapy. Integr Cancer Ther 4: 25-31, 2005. 26. Lawlor MA and Alessi DR: PKB/Akt: A key mediator of cell
 5. Stattin P, Björ O, Ferrari P, Lukanova A, Lenner P, Lindahl B, proliferation, survival and insulin responses? J Cell Sci 114:
Hallmans G and Kaaks R: Prospective study of hyperglycemia
and cancer risk. Diabetes Care 30: 561-567, 2007. 2903-2910, 2001.
 6. Hsieh MC, Lee TC, Cheng SM, Tu ST, Yen MH and Tseng CH: 27. Le Marchand L, Wilkens LR, Kolonel LN, Hankin JH and
The influence of type 2 diabetes and glucose-lowering therapies Lyu LC: Associations of sedentary lifestyle, obesity, smoking,
on cancer risk in the Taiwanese. Exp Diabetes Res 2012: 413782, alcohol use, and diabetes with the risk of colorectal cancer.
2012. Cancer Res 57: 4787-4794, 1997.
 7. Beckner ME, Stracke ML, Liotta LA and Schiffmann E: 28. Kono S, Honjo S, Todoroki I, Nishiwaki M, Hamada H,
Glycolysis as primary energy source in tumor cell chemotaxis. J Nishikawa H, Koga H, Ogawa S and Nakagawa K: Glucose
Natl Cancer Inst 82: 1836-1840, 1990. intolerance and adenomas of the sigmoid colon in Japanese men
  8. Heuson JC and Legros N: Influence of insulin deprivation (Japan). Cancer Causes Control 9: 441-446, 1998.
on growth of the 7,12-dimethylbenz(a)anthracene-induced 29. Barnea M, Madar Z and Froy O: Glucose and insulin are needed
mammary carcinoma in rats subjected to alloxan diabetes and for optimal defensin expression in human cell lines. Biochem
food restriction. Cancer Res 32: 226-232, 1972. Biophys Res Commun 367: 452-456, 2008.
  9. Masur K, Vetter C, Hinz A, Tomas N, Henrich H, Niggemann B 30. Matthews DR, Hosker JP, Rudenski AS, Naylor BA, Treacher DF
and Zänker KS: Diabetogenic glucose and insulin concentrations and Turner RC: Homeostasis model assessment: Insulin resistance
modulate transcriptome and protein levels involved in tumour and beta-cell function from fasting plasma glucose and insulin
cell migration, adhesion and proliferation. Br J Cancer 104: concentrations in man. Diabetologia 28: 412-419, 1985.
345-352, 2011. 31. Ayiomamitis GD, Notas G, Zaravinos A, Drygiannakis I,
10. Giovannucci E, Harlan DM, Archer MC, Bergenstal RM, Georgiadou M, Sfakianaki O, Mastrodimou N, Thermos K
Gapstur SM, Habel LA, Pollak M, Regensteiner JG and Yee D: and Kouroumalis E: Effects of octreotide and insulin on colon
Diabetes and cancer: A consensus report. CA Cancer J Clin 60: cancer cellular proliferation and correlation with hTERT activity.
207-221, 2010. Oncoscience 1: 457-467, 2014.
744 INTERNATIONAL JOURNAL OF ONCOLOGY 50: 736-744, 2017

32. DeBerardinis RJ, Lum JJ, Hatzivassiliou G and Thompson CB: 44. Maddocks OD and Vousden KH: Metabolic regulation by p53. J
The biology of cancer: Metabolic reprogramming fuels cell Mol Med (Berl) 89: 237-245, 2011.
growth and proliferation. Cell Metab 7: 11-20, 2008. 45. Sarfstein R, Friedman Y, Attias-Geva Z, Fishman A, Bruchim I
33. Lv L, Xu YP, Zhao D, Li FL, Wang W, Sasaki N, Jiang Y, Zhou X, and Werner H: Metformin downregulates the insulin/IGF-I
Li TT, Guan KL, et al: Mitogenic and oncogenic stimulation of signaling pathway and inhibits different uterine serous carcinoma
K433 acetylation promotes PKM2 protein kinase activity and (USC) cells proliferation and migration in p53-dependent or
nuclear localization. Mol Cell 52: 340-352, 2013. -independent manners. PLoS One 8: e61537, 2013.
34. Duan W, Shen X, Lei J, Xu Q, Yu Y, Li R, Wu E and Ma Q: 46. Zawacka-Pankau J, Issaeva N, Hossain S, Pramanik A,
Hyperglycemia, a neglected factor during cancer progression. Selivanova G and Podhajska AJ: Protoporphyrin IX interacts
BioMed Res Int 2014: 461917, 2014. with wild-type p53 protein in vitro and induces cell death of
35. Saltiel AR and Pessin JE: Insulin signaling pathways in time and human colon cancer cells in a p53-dependent and -independent
space. Trends Cell Biol 12: 65-71, 2002. manner. J Biol Chem 282: 2466-2472, 2007.
36. Zhang H, Fagan DH, Zeng X, Freeman KT, Sachdev D and 47. Zhang W and Liu HT: MAPK signal pathways in the regulation
Yee D: Inhibition of cancer cell proliferation and metastasis of cell proliferation in mammalian cells. Cell Res 12: 9-18,
by insulin receptor downregulation. Oncogene 29: 2517-2527, 2002.
2010. 48. Wada T and Penninger JM: Mitogen-activated protein kinases in
37. Lau MT and Leung PC: The PI3K/Akt/mTOR signaling pathway apoptosis regulation. Oncogene 23: 2838-2849, 2004.
mediates insulin-like growth factor 1-induced E-cadherin down- 49. Huang C, Jacobson K and Schaller MD: MAP kinases and cell
regulation and cell proliferation in ovarian cancer cells. Cancer migration. J Cell Sci 117: 4619-4628, 2004.
Lett 326: 191-198, 2012. 50. Liao DJ, Thakur A, Wu J, Biliran H and Sarkar FH: Perspectives
38. Ulanet DB, Ludwig DL, Kahn CR and Hanahan D: Insulin on c-Myc, Cyclin D1, and their interaction in cancer formation,
receptor functionally enhances multistage tumor progression progression, and response to chemotherapy. Crit Rev Oncog 13:
and conveys intrinsic resistance to IGF-1R targeted therapy. Proc 93-158, 2007.
Natl Acad Sci USA 107: 10791-10798, 2010. 51. Lu Z, Lu N, Li C, Li F, Zhao K, Lin B and Guo Q: Oroxylin A
39. Jiang BH and Liu LZ: PI3K/PTEN signaling in tumorigenesis inhibits matrix metalloproteinase-2/9 expression and activation
and angiogenesis. Biochim Biophys Acta 1784: 150-158, 2008. by up-regulating tissue inhibitor of metalloproteinase-2 and
40. Dancey J: mTOR signaling and drug development in cancer. Nat suppressing the ERK1/2 signaling pathway. Toxicol Lett 209:
Rev Clin Oncol 7: 209-219, 2010. 211-220, 2012.
41. Laplante M and Sabatini DM: mTOR signaling in growth control 52. Qi HL, Zhang Y, Ma J, Guo P, Zhang XY and Chen  HL:
and disease. Cell 149: 274-293, 2012. Insulin/protein kinase B signalling pathway upregulates
42. Yang K, Guo Y, Stacey WC, Harwalkar J, Fretthold J, Hitomi M metastasis-related phenotypes and molecules in H7721 human
and Stacey DW: Glycogen synthase kinase 3 has a limited role hepatocarcinoma cell line. Eur J Biochem 270: 3795-3805, 2003.
in cell cycle regulation of cyclin D1 levels. BMC Cell Biol 7: 33,
2006.
43. Takahashi-Yanaga F and Sasaguri T: GSK-3beta regulates
cyclin D1 expression: A new target for chemotherapy. Cell
Signal 20: 581-589, 2008.