Fasting Inhibits Aerobic Pathway, Cancer

ARTICLE
https://doi.org/10.1038/s41467-020-15795-8 OPEN
Fasting inhibits aerobic glycolysis and proliferation

in colorectal cancer via the Fdft1-mediated AKT/
mTOR/HIF1α pathway suppression
Mei-lin Weng1,11, Wan-kun Chen 1,2,11, Xiang-yuan Chen1,11, Hong Lu1, Zhi-rong Sun1, Qi Yu3, Peng-fei Sun1,
Ya-jun Xu1, Min-min Zhu1, Nan Jiang4,5, Jin Zhang4,5, Jian-ping Zhang6, Yuan-lin Song7, Duan Ma4,5,8 ✉,
Xiao-ping Zhang9,10 ✉ & Chang-hong Miao 1,2 ✉
1234567890():,;
Evidence suggests that fasting exerts extensive antitumor effects in various cancers, including
colorectal cancer (CRC). However, the mechanism behind this response is unclear. We
investigate the effect of fasting on glucose metabolism and malignancy in CRC. We find that
fasting upregulates the expression of a cholesterogenic gene, Farnesyl-Diphosphate Farne-
syltransferase 1 (FDFT1), during the inhibition of CRC cell aerobic glycolysis and proliferation.
In addition, the downregulation of FDFT1 is correlated with malignant progression and poor
prognosis in CRC. Moreover, FDFT1 acts as a critical tumor suppressor in CRC. Mechan-
istically, FDFT1 performs its tumor-inhibitory function by negatively regulating AKT/mTOR/
HIF1α signaling. Furthermore, mTOR inhibitor can synergize with fasting in inhibiting the
proliferation of CRC. These results indicate that FDFT1 is a key downstream target of the
fasting response and may be involved in CRC cell glucose metabolism. Our results suggest
therapeutic implications in CRC and potential crosstalk between a cholesterogenic gene and
glycolysis.
1 Department of Anesthesiology, Fudan University Shanghai Cancer Center; Department of Oncology, Shanghai Medical College, Fudan University, Shanghai
200032, China. 2 Department of Anesthesiology, Zhongshan Hospital, Fudan University, Shanghai 200032, China. 3 Department of Radiation Oncology,
Fudan University Shanghai Cancer Center; Department of Oncology, Shanghai Medical College, Fudan University, Shanghai 200032, China. 4 Key Laboratory
of Metabolism and Molecular Medicine, Ministry of Education, Department of Biochemistry and Molecular Biology, Collaborative Innovation Center of
Genetics and Development, Institutes of Biomedical Science, School of Basic Medical Science, Fudan University, Shanghai 200032, China. 5 Institute of
Biomedical Science, Fudan University, Shanghai 200032, China. 6 Institute of Modern Physics, Fudan University; Department of Nuclear Medicine, Fudan
University Shanghai Cancer Center; Department of Oncology, Shanghai Medical College, Fudan University, Shanghai 200032, China. 7 Department of
Pulmonary Medicine, Zhongshan Hospital, Fudan University, Shanghai 200032, China. 8 Children’s Hospital, Fudan University, Shanghai 200032, China.
9 The Institute of Intervention Vessel, Tongji University School of Medicine, Shanghai 200092, China. 10 Shanghai Center of Thyroid Diseases, Tongji
University School of Medicine, Shanghai 200092, China. 11These authors contributed equally: Mei-lin Weng, Wan-kun Chen, Xiang-yuan Chen.
✉email: duanma@fudan.edu.cn; zxpsibs@163.com; whitedolphin2007@hotmail.com
NATURE COMMUNICATIONS | (2020)11:1869 | https://doi.org/10.1038/s41467-020-15795-8 | www.nature.com/naturecommunications 1

ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-020-15795-8
C
olorectal cancer (CRC) is one of the deadliest diseases we examined cell proliferation by using a Cell Counting Kit-8
globally, ranking third in cancer morbidity and second in (CCK8) and EdU assays. Fasting significantly inhibited CRC cell
cancer mortality worldwide1. The incidence has stabilized proliferation in the CCK8 assay (Fig. 1a; Supplementary Fig. 2a).
or is declining in the US and some other developed countries, but In the EdU immunofluorescence staining assay, the fasting group
the incidence and mortality are increasing in some developing contained a lower relative fold fraction of EdU-positive cells than
countries, especially China and Spain2,3. Although great progress the control group (Fig. 1b, d; Supplementary Fig. 2b, d). To
has been achieved in surgical techniques and treatment for CRC, further investigate the effect of fasting on cell invasion, a
the 5-year relative survival rate of CRC patients has not changed Transwell assay was performed. Fasting markedly inhibited CT26
significantly in the past decades4,5. Therefore, there is an urgent cell invasion (Supplementary Fig. 1a, b). Moreover, to explore the
need to better understand the molecular mechanisms that govern role of fasting in the cell cycle and apoptosis distribution, flow
the oncogenesis and progression of CRC. cytometry was performed. Our results demonstrated that fasting-
Fasting, defined as consuming no or minimal amounts of food, induced cell cycle arrest in the G0/G1 and G2/M phases and
usually from 12 h to 3 weeks, is known for extending the lifespan induced apoptosis (Supplementary Figs. 1c, d, 2c, e; Supple-
in numerous experimental organisms6–8. Many prospective clin- mentary Figs. 28, 29), which probably explains why fasting
ical trials have shown that fasting can reduce risk factors for aging- inhibits the proliferation of CRC cells.
related diseases, including cardiovascular disease, diabetes, and To further assess the effect of fasting on the proliferation of
cancer9–11. Fasting can also increase resistance to various oxidative CRC, an 8-plex iTRAQ proteomic technique and bioinformatics
stresses, such as acute surgical stress12–14. On the molecular level, analysis were performed (Fig. 1c; Supplementary Figs. 3a, 4a, b).
fasting is not well understood but based on the data from studies The heatmap showed 111 differentially upregulated genes and
on fasting-mediated longevity and stress resistance, it is thought to 168 differentially downregulated genes between the control and
work at least in part through the inhibition of insulin/IGF- fasting groups. Gene Ontology analysis of the differentially
1/mTORC1 signaling15–18. Although fasting exerts extensive expressed genes (DEGs) was carried out (Supplementary
antitumor effects in numerous contexts, the impact of fasting on Fig. 5a–c). Pathways in the Kyoto Encyclopedia of Genes and
metabolic changes in CRC remains poorly studied. Genomes (KEGG) that were enriched in DEGs indicated that the
Aberrant metabolism has been considered a hallmark of cancer “Glycolysis/gluconeogenesis” pathway was highly downregulated
cells, and this important research field has recently attracted (Supplementary Fig. 6a, b; Fig. 1c). To validate the impact of
interest19,20. Unlike normal cells, which derive most of their energy fasting on glucose metabolism, we examined glucose uptake and
from mitochondrial oxidative phosphorylation, cancer cells rely on lactate production, two primary indicators of the Warburg effect.
aerobic glycolysis as their primary energy resource. This process is As expected, fasting reduced glucose uptake and lactate produc-
recognized as the “Warburg effect”21–23. AKT/mTOR/HIF1α sig- tion in cells (Fig. 1e, f; Supplementary Fig. 2g, h). The
naling has been suggested to play critical roles in promoting gly- extracellular acidification rate (ECAR), which is another indicator
colysis and lactate production and thus in the “metabolic of glycolysis, was reduced in cells cultured in the fasting mimic
reprogramming” of cancer cells24–28. However, fasting could medium (Fig. 1h; Supplementary Fig. 2j). The oxygen consump-
reprogram metabolic derangements to inhibit cancer growth8,29–31. tion rate (OCR), which reflects mitochondrial respiration, was
Therefore, an understanding of the effects of fasting on metabolic increased in in the fasting mimic medium (Fig. 1i; Supplementary
alterations in CRC could lead to better therapeutic approaches. Fig. 2k). Aerobic glycolysis was accompanied by the activation of
Farnesyl-diphosphate farnesyltransferase 1 (FDFT1) encodes a a series of glycolytic genes. Therefore, several key rate-limiting
membrane-associated enzyme acting at a branch point in the enzymes in glucose metabolism were examined. The transcription
mevalonate pathway. The encoded protein is the first enzyme in and expression of rate-limiting enzymes in glucose metabolism
cholesterol biosynthesis and catalyzes the dimerization of two (GLUT1, HK2, LDHA, PGK1, and GPI) were downregulated in
molecules of farnesyl diphosphate via a two-step reaction to form CT26 and SW620 cells cultured in the fasting mimic medium
squalene32, which plays an important role in cholesterol (Fig. 1g, k; Supplementary Fig. 2f, i). Our data indicated that
biosynthesis33,34. Although increased FDFT1 transcription is asso- fasting plays a vital role in inhibiting glycolysis in CRC cells.
ciated with increased invasion in prostate cancer, the exact role of To further verify the effect of fasting on glucose metabolism
FDFT1 in CRC progression has not been investigated35. However, observed in vitro, we subcutaneously injected CT26 cells into
our results indicated that fasting upregulated the expression of BALB/c mice. When the tumors were palpable, the mice were
FDFT1 during the inhibition of CRC cell glucose metabolism and randomly assigned to a control or the fasting mimic diet (FMD)
proliferation. Clinically, high FDFT1 expression in CRC is associated group. The FMD appreciably attenuated tumor growth in the
with better prognosis in The Cancer Genome Atlas (TCGA) data mice (Fig. 1j, l). The final tumor weights and volumes in the
sets. This finding prompted us to speculate that FDFT1 may play a fasting group were markedly lower than those in the control
negative regulatory role in glucose metabolism, which is a critical group (Fig. 1m, o). Furthermore, we used an 18F-
aspect in the fasting-mediated suppression of CRC oncogenesis and fluorodeoxyglucose (18F-FDG) microPET/CT imaging system to
progression. assess the role of fasting in glucose metabolism. Consistent with
In this study, we provide ample evidence that fasting negatively the results in vitro, fasting dramatically inhibited 18F-FDG uptake
regulates glucose metabolism and proliferation via the in the in vivo xenograft model (Fig. 1n, p). Weight profiles during
FDFT1/AKT-mTOR-HIF1α axis in CRC. Overall, our results the normal diet and FMD cycle are shown in Supplementary
indicate that FDFT1 is a key downstream target of the fasting Fig. 7. Taken together, these results suggested that fasting impairs
response and involve in CRC cell glucose metabolism. More glycolysis and inhibits proliferation in CRC.
broadly, our present study also suggests potential therapeutic
implications (involving fasting and mTOR) for CRC and implies
potential crosstalk between a cholesterogenic gene and glycolysis. FDFT1 is upregulated by fasting and correlates with prognosis
in CRC. To further explore the effect of fasting on the pro-
liferation of CRC cells, the GSE60653 data set28 (from a study on
Results fasting-induced anti-Warburg effects in CRC) was analyzed to
Fasting impairs glycolysis and inhibits proliferation in CRC. identify DEGs between the control and fasting groups (Supple-
To explore the effect of fasting on the proliferation of CRC cells, mentary Figs. 8a, b and 9a, b). Gene Ontology and KEGG
2 NATURE COMMUNICATIONS | (2020)11:1869 | https://doi.org/10.1038/s41467-020-15795-8 | www.nature.com/naturecommunications

NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-020-15795-8 ARTICLE
a b CT26 DAPI EDU Merge

CT26
Con
2.0 Fasting 24 h
OD value (450nm)
Fasting 48 h Con
1.5
1.0
0.5 Fasting 24 h
0.0
1 2 3
Time (days)
Fasting 48 h
c
Groups
Groups 1.5
F
ADH7 1 N
0.5
EN03 0
–0.5
EN02
ALDH2
–1
–1.5 d 1.5
CT26
Con
Relative fold of EDU

ALDH5 Fasting 24 h
positive cells
PKM Fasting 48 h
ENO1 1.0
LDHA
GPI 0.5
ALDOC
PGAM1
PGK1 0.0
on
h
h
TPI1
48
24
C
g
g
N1 N2 N3 F1 F2 F3
tin
tin
s
s
Fa
Fa
e CT26 f Relative lactate production CT26 g
h
h
48
Relative glucose uptake
24
1.5 1.5
g
g
tin
CT26
tin
on
s
s
Con
Fa
Fa
C
Con
Fasting 24h
1.0 Fasting 24 h 1.0
Fasting 48 h
Fasting 48h PGK1 45 kDa
0.5 0.5
LDHA 37 kDa
0.0 0.0
on
h
h
on
h
h
48
24
C
48
24
C
g
g
g
g
tin
tin
102 kDa
tin
tin
HK2
s
s
s
s
Fa
Fa
Fa
Fa
h CT26
i CT26
GLUT1 54 kDa
FCCP
150
OCR (pmol/min/105 cells)
Oligomycin Rotenone
ECAR (mpH/min/105 cells)
2-DG
80 Olycomycin
Control
Control Fasting 24h 63 kDa
60 GPI
Glucose
Fasting 24 h
100 Fasting 48h
40 Fasting 48 h
50 Vinculin 124 kDa

20
0 0
0 20 40 60 80 0 20 40 60 80
Time (min) Time (min) CT26
Con
k
Relative mRNA expression
1.5
Fasting 24 h
j Fasting 48 h
1.0
Fasting mimic diet
(FMD)
0.5
0.0
K2
K1
T1
PI
Control
H
G
H
PG
LU
LD
G
n
i 400 P = 0.0291
m
Tumor volume (mm3)
Control
3
FMD
Tumor weight (g)
300 Control
Control
2
FMD
200
P = 0.001
100 1
0 0
9 11 12 13 14 15 16 18 19 20 21 22 23 25 Control FMD
Time (days) The 25th day
o p
Tumor volume (mm3)
500 Control 3
FMD Control
400 FMD
P = 0.0292 FMD
SUVmax
300 2
P = 0.0459
200
1
100
0 0
Control FMD Control FMD
The 25th day
pathway analyses for the DEGs were performed using FunRich (DAVID, https://david.ncifcrf.gov/), the top significantly enriched
software (http://www.funrich.org/). Surprisingly, the most enri- biological process and KEGG pathway were the “Cholesterol
ched biological pathway and biological process were the “Cho- biosynthetic process” and the “Steroid biosynthesis pathway”,
lesterol biosynthesis” pathway and the “Energy pathway” and respectively (Supplementary Fig. 10a, b). FDFT1 acts at the
“Metabolism” processes (Supplementary Fig. 9c–f). Via the beginning of the “Steroid biosynthesis” pathway. Therefore, we
Database for Annotation, Visualization and Integrated Discovery chose the FDFT1 as our hub gene for further research. First, we

Fig. 1 Fasting impairs glycolysis and proliferation of CT26 cells in vitro and in vivo. Fasting inhibited CT26 cell proliferation as measured by a CCK8
assay (from left to right: P = 0.0009; P = 0.0006). b Cell proliferation was also evaluated using EdU immunofluorescence staining. Proliferating cells were
labeled with EdU. n = 3; scale bar: 100 µm. c Bioinformatics analysis of differentially expressed genes identified via iTRAQ proteomics. We magnified the
genes related to the glycolysis pathway particularly. d The graph shows the relative fold fraction of EdU-positive cells. e Fasting reduced glucose uptake in
CT26 cells. f Fasting decreased lactate production via glycolysis in CT26 cells. g Fasting downregulated the expression of rate-limiting glycolytic enzymes
in glucose metabolism (GLUT1, HK2, LDHA, PGK1, and GPI) by western blot. h ECAR, an indicator of glycolysis, was reduced in CT26 cell cultured in the
fasting mimic medium. i OCR, which reflects mitochondrial respiration, was increased in CT26 cell cultured in the fasting mimic medium. j CT26 cells were
injected into BALB/c mice. When the tumors were palpable, the mice were randomly assigned to the control group or the fasting mimic diet (FMD) group.
Photograph of dissected tumors (upper: FMD group; lower: control group; n = 5). k Fasting downregulated the transcription of rate-limiting glycolytic
enzymes in glucose metabolism (GLUT1, HK2, LDHA, PGK1, and GPI) by qRT-PCR. l The tumor volumes were measured every day after the 9th day. The
FMD attenuated tumor growth in mice (n = 5). m, o Tumor weights and tumor volumes on the 25th day (n = 5; P = 0.001; P = 0.0292). n Representative
18F-FDG microPET/CT imaging of tumor-bearing mice (n = 3) (upper: control group; lower: FMD group). The tumors are indicated with arrows. p The ratio
of the tumor SUVmax in the control group and the FMD group (n = 3; P = 0.0459). Error bars, mean ± SD, the data are from three independent
experiments. Two-sided t tests. *P < 0.05, **P < 0.01, ***P < 0.001, compared with the control group.
validated that fasting can upregulate FDFT1 expression. In the the FDFT1 gene was significantly lower in CRC tissues than in
GSE60653 data set, the expression of FDFT1 was increased sig- normal tissues in the GDS2609 and GDS4382 data sets (Fig. 2j, k).
nificantly in the fasting group compared with that in the control Furthermore, the GEPIA database (http://gepia.cancer-pku.cn/)
group (Fig. 2a). Furthermore, in the iTRAQ proteomics analysis, indicated lower FDFT1 correlated with higher TNM stage (P =
the relative expression of FDFT1 was greatly elevated in the 1.91 × 10−5) in CRC patients (Fig. 2l). The survival analysis of the
fasting group compared with that in the control group (Fig. 2b). data from the TCGA data set indicated that high FDFT1
In addition, the mRNA expression of FDFT1 in dissected tumor expression was associated with better prognosis (P = 0.018, log-
samples from the fasting mimic group and the control group was rank test) (Fig. 2m). These results were consistent with our results
measured by qRT-PCR. The mRNA expression of FDFT1 was in the FUSCC cohort. Altogether, these results indicated that
markedly increased in the fasting group (Fig. 2c), and western FDFT1 was downregulated in CRC tissues, and was correlated
blotting indicated that fasting mimic medium increased the with malignant progression and poor prognosis in patients
protein level of FDFT1 in cells (Fig. 2d, e). Our results thus with CRC.
showed that fasting upregulates the expression of FDFT1 in CRC. Subsequently, to gain a deeper understanding of its mechan-
The expression of FDFT1 was compared in 23 human CRC ism, we studied the role of sterol regulatory element-binding
tissues and matched adjacent noncancerous tissues, by immuno- protein-2 (SREBP2), a key transcriptional regulator of metabolic
histochemical (IHC) staining and qRT-PCR. The expression of genes. The results showed that fasting simulation increased the
FDFT1 was downregulated and lower in most of the tumor tissues protein and mRNA levels of SREBP2 in CRC cells (Supplemen-
(19/23), but upregulated in most of the adjacent noncancerous tary Fig. 12a–c). To assess the biological function of SREBP2 in
tissues (18/23) (Fig. 2f, g). The relative expression levels of FDFT1 CRC, we used lentiviral-mediated SREBP2 overexpression and
mRNA was also assessed in 81 CRC tissues and matched adjacent knockdown in CT26 cells (Supplementary Fig. 12d, e). We also
noncancerous tissues. The levels of FDFT1 in CRC tissues were performed a colony-formation assay when overexpressing or
dramatically lower than those in noncancerous tissues (Fig. 2h). knocking down SREBP2, and the results showed that SREBP2
We further examined FDFT1 expression in CRC cell lines (DLD1, overexpression decreased, whereas SREBP2 knockdown increased
HCT116, SW620, SW480, and CT26) and the colorectal mucosal colony-formation capacity (Supplementary Fig. 12f, g). Then, we
epithelial cell line NCM460 by qRT-PCR. As expected, the examined the protein and mRNA levels of FDFT1 when
expression of FDFT1 was also appreciably decreased in the CRC overexpressing or knocking down SREBP2, and found that
cell lines compared with NCM460 cells (Supplementary Fig. 11a), overexpression of SREBP2 upregulated FDFT1 and vice versa,
consistent with the results in Cancer Cell Line Encyclopedia moreover, the overexpression of SREBP2 was more pronounced
(CCLE) database (Supplementary Fig. 11b, c). Therefore, FDFT1 during fasting simulation (Supplementary Fig. 12h, i). Subse-
is downregulated in CRC tissues and cell lines. quently, we used a cloning assay to detect whether SREBP2
To further determine the role of FDFT1 in CRC, we assessed reverses cell proliferation caused by knockdown of FDFT1 in
the association between FDFT1 expression and clinicopathologi- CT26 Supplementary Fig. 12j, k). In conclusion, these results
cal features in patients with CRC. The median expression level indicated that FDFT1 played a role in reducing the proliferation
was used as the cutoff. The low expression of FDFT1 was of CRC cells under the action of SREBP2.
significantly associated with tumor size, histological type, lymph
node metastasis, tumor differentiation, invasion, distant metas- FDFT1 negatively regulates the proliferation of CRC cells. To
tasis, and clinical stage (Table 1). However, no significant assess the biological function of FDFT1 in CRC, lentivirus-
association was found between FDFT1 expression and age, mediated overexpression and knockdown of FDFT1 were per-
gender, tumor location, or carcinoembryonic antigen (CEA) level. formed in CT26 and SW620 cells. Images of GFP expression in
These findings indicated that FDFT1 downregulation is involved CRC cells after lentiviral infection were acquired with a fluores-
in the malignant progression of CRC. To further evaluate the cence microscope (Supplementary Figs. 13a–16a). The efficiency
relationship between FDFT1 expression and the survival time of of FDFT1 overexpression (Fig. 3a, b; Supplementary Fig. 15b, c)
CRC patients, a Kaplan–Meier analysis was performed. Our data and knockdown (Fig. 3c, d; Supplementary Fig. 16c, d) were
showed that high FDFT1 expression predicts better prognoses for effectively achieved in CT26 and SW620 cells, as indicated by the
patients with CRC in the Fudan University Shanghai Cancer q-PCR and western blotting results.
Center (FUSCC) cohort (P = 0.0238, log-rank test) (Fig. 2i). To further investigate the effect of FDFT1 on cell proliferation,
Moreover, to further validate the role of FDFT1 in CRC, we CCK8, EdU, and colony-formation assays were conducted.
used GEO and Gene Expression Profiling Interactive Analysis FDFT1 overexpression inhibited CRC cell proliferation (Fig. 3e;
(GEPIA) databases to analyze TCGA data sets. The expression of Supplementary Fig. 15d), whereas FDFT1 knockdown promoted

a GSE60653/1448130_PM_at/Fdft1 b c
9.6
Fdft1 relative expression by iTRAQ

9.3 CT26 Control
Fasting mimic medium
8000
9 0.020 P < 0.0001
Fdft1/actin mRNA ratio

Control P = 0.0319
8.7
6000 Fasting 48 h
0.015
8.4 4000 0.010
8.1 2000 0.005

GSM1484215
GSM1484216
GSM1484217
GSM1484218
GSM1484219
GSM1484220
0 0.000
Control Fasting 48 h Control Fasting mimic medium
Control Fasting
f Non-cancerous tissue Cancer tissue
Expression value
d e
h
h
24
48
24
48
g
g
tin
tin
tin
tin
on
on
s
s
Fa
Fa
Fa
Fa
SW620
C
C
CT26
Fdft1 48 kDa Fdft1 48 kDa
Vincullin 124 kDa

Vincullin 124 kDa
g Tumor
h Tumor
Fdft1 expression in samples
40 P < 0.0001 Tumor

Non-tumor P < 0.0001
Relative Fdft1 expression
Non-tumor
Relative Fdft1 expression

0.06 Non-tumor
P = 0.0004 0.06
30
0.04 0.04
20
0.02 0.02
10
0 0.00 0.00
High expression Low expression Tumor Non-tumor Tumor Non-tumor
i 100
j GDS2609
Overall survival rate (%)
P > 0.0001
Fdft1 relative expression
High expression 15,000

80 Normal tissue
CRC tissue
60 Low expression
10,000
40
P = 0.0238 5000
20
0 0
0 500 1000 1500 2000 Normal tissue CRC tissue
Days
k l m Overall survival
10 F value = 8.57
1.0 Low FDFT1 TPM
High FDFT1 TPM
Pr(>F) = 1.91e-05 Logrank p = 0.018
GDS4382 HR(high) = 0.55
0.8 p(HR) = 0.02
P = 0.0049 9
Fdft1 relative expression
14 n(high) = 135
Normal tissue
Percent survival
n(low) = 135
CRC tissue 0.6
13 8
12 0.4
7
11
0.2
6
10
Normal tissue CRC tissue 0.0
0 50 100 150
Stage l Stage ll Stage lll Stage lV
Months
it (Fig. 3f; Supplementary Fig. 16b). In EdU immunofluorescence colony-forming capacity of CRC cells (Fig. 3k, l; Supplementary
staining assay, FDFT1 overexpression resulted in a lower relative Fig. 15e, f), whereas FDFT1 knockdown enhanced it (Fig. 3m, n;
fold fraction of EdU-positive cells (Fig. 3g, h; Supplementary Supplementary Fig. 16e, h). To further investigate the effect
Fig. 15g, h), yet FDFT1 knockdown resulted in a greater relative of FDFT1 on cell invasion, a Transwell assay was performed.
fold fraction of EdU-positive cells (Fig. 3i, j; Supplementary FDFT1 overexpression inhibited cell invasion (Fig. 3o, p), whereas
Fig. 16f, g). In addition, FDFT1 overexpression decreased the FDFT1 knockdown increased it (Fig. 3q, r). In addition, FDFT1

Fig. 2 Fasting upregulates the level of FDFT1, which is correlated with prognosis in CRC. a The expression of FDFT1 was increased significantly in the
fasting group compared with that in the control group in the GSE60653 data set (n = 3). b The relative expression of FDFT1 was also increased greatly in
the fasting group compared with that in the control group by iTRAQ (n = 3; P = 0.0319). c The mRNA expression of FDFT1 in dissected tumor tissue from
the fasting mimic group and the control group was measured by qRT-PCR (n = 15; P < 0.0001). d, e Fasting mimic medium also increased the protein level
of FDFT1 in CT26 and SW620 cells. f Representative graph of the IHC analysis carried out in human CRC and noncancerous tissues (n = 23; upper: scale
bar is 200 µm; lower: scale bar is 100 µm). g The expression of FDFT1 was downregulated in most of the tumor tissues (19/23), but was upregulated in
most of the adjacent noncancerous tissues (18/23) (n = 23; P = 0.0004). h The relative expression levels of FDFT1 mRNA in CRC tissues and matched
adjacent noncancerous tissues were determined by qRT-PCR (n = 81; both P < 0.0001). i Kaplan–Meier analysis of the overall survival of patients with CRC
in the FUSCC cohort according to FDFT1 expression. The median expression level was used as the cutoff. High FDFT1 expression predicted better prognoses
for CRC patients in the FUSCC cohort. (high FDFT1 patients = 39, low FDFT1 patients = 42; P = 0.0238, log-rank test) j, k The expression of the FDFT1 gene
was significantly lower in CRC tissues than in normal tissues in the GDS2609 and GDS4382 data sets (P < 0.0001; P = 0.0049). l Analysis of the
correlation of FDFT1 expression with TNM stage in CRC patients. Lower FDFT1 expression was correlated with higher TNM stage (P = 1.91 × 10−5).
m Survival analysis of FDFT1 data from the TCGA database stratified by FDFT1 expression. High FDFT1 expression indicated a better prognosis. (P = 0.018,
log-rank test). Error bars, mean ± SD, the data are from three independent experiments. Two-sided t tests. Box denotes 25th to 75th percentile, horizontal
bar is median in h, j, and k. Kaplan–Meier analysis and log-rank tests were used in panels i, m. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, compared
with the control group (or non-tumor/normal tissue).
Table 1 The relationship between Fdft1 expression and clinicopathological features in 81 CRC patients from FUSCC.
Fdft1
Variable Number Low expression High expression X2 test
P-value
Age (years) <60 51 27 24 0.798
≥60 30 15 15
Gender Female 60 33 27 0.338
Male 21 9 12
Tumor location Colon 30 12 18 0.102
Rectum 51 30 21
Size <5 cm 42 15 27 0.003*
≥5 39 27 12
Histological type Adenocarcinoma 66 30 36 0.016*
Mucinous adenocarcinoma 15 12 3
Lymph node metastasis No 42 12 30 0.000***
Yes 39 30 9
Tumor differentiation Well, moderate 60 27 33 0.037*
Poor and others 21 15 6
Invasion T1–2 21 6 15 0.013*
T3–4 60 36 24
Distant metastasis No 75 36 39 0.043*
Yes 6 6 0
Clinical stage I–II 30 9 21 0.003**
III–IV 51 33 18
CEA < 5 ng/ml 54 24 30 0.059
≥5 ng/ml 27 18 9
Pearson’s X2 tests were used. The results were considered statistically significant at P < 0.05. *P < 0.05, **P < 0.01, ***P < 0.001.
overexpression induced G0/G1 phase cell cycle arrest and FDFT1 is an important downstream target of fasting in CRC.
apoptosis (Supplementary Figs. 13b, c and 15i, j), whereas FDFT1 We further evaluated whether the inhibitory effect of fasting on
knockdown induced S phase cell cycle arrest and attenuated CRC increases when combined with FDFT1 overexpression. Our
apoptosis (Supplementary Figs. 14b, c and 16i, j). In summary, data demonstrated that compared with either treatment alone,
FDFT1 overexpression inhibited cell proliferation and induced FDFT1 overexpression combined with fasting had the greatest
G0/G1 phase cell cycle arrest and apoptosis, while FDFT1 inhibitory effect on CRC cell proliferation (Fig. 4a; Supplemen-
knockdown promoted cell proliferation, induced S phase cell tary Fig. 19c). Moreover, an EdU assay showed that FDFT1
cycle arrest, and attenuated apoptosis in CRC cells. overexpression combined with fasting yielded the most marked
We also extend our experiments to PIK3CA-Mut cell line reduction in the proliferative capacity of CRC cells (Supple-
(HCT116 and HT29) and the human colorectal mucosal mentary Fig. 19a, b, d, e). Furthermore, we studied FDFT1 protein
epithelial cell line NCM460 to see whether fasting or FDFT1 levels in four groups in vitro. Western blotting indicated that
have effects on cell proliferation. The results showed that the fasting and FDFT1 overexpression increased the protein level of
effect of fasting and FDFT1 on PIK3CA-Mut cell lines (HCT116 FDFT1 in CRC cells. Fasting exerted an additive effect on FDFT1
and HT29) proliferation were similar to that in the previous expression level in cells overexpressing FDFT1 in the suppression
PIK3CA-WT cell lines (CT26 and SW620) (Supplementary of CRC cell proliferation (Fig. 4b).
Fig. 17a–p), but FDFT1 had no effect on NCM460 proliferation To further confirm the effect of combining FDFT1 over-
(Supplementary Fig. 18a–d). expression with fasting on cell proliferation observed in vitro, we

a b c d
ft1
CT26
Fd
N
CT26
A-
A-
Fdft1/GAPDH mRNA ratio
Fdft1/GAPDH mRNA ratio

N
N
0.10 Con
0.010 CT26 Con shcon sh1 sh3
D
on
pc
pc
shcon
CT26
C
0.08 0.008 sh1
Con sh3 Fdft1 48 kDa
0.06 pcDNA-NC Fdft1 48 kDa
0.006
pcDNA-Fdft1
0.04 0.004
0.02 Vinculin 124 kDa Vinculin 124 kDa
0.002
0.00 0.000
on
ft1
C
Con shcon sh1 sh3
N
C
Fd
A-
A-
N
N
D
D
pc g
pc
CT26 DAPI EDU Merge
e CT26 f CT26
2.0 4
Con Con
OD value (450nm)
OD value (450nm)
pcDNA-NC 3 shcon Con
1.5
pcDNA-Fdft1 sh1
1.0 2 sh3
0.5 1
0.0 0 pcDNA-Fdft1
1 2 3 4 1 2 3
Time (days) Time (days)
h i CT26 DAPI EDU Merge j
Con CT26
Relative fold of EDU positive cells
CT26
Relative fold of EDU positive cells

1.5 Con
2.0 sh1
Con
pcDNA-Fdft1 sh3
1.0 1.5
0.5 sh1 1.0
0.5
0.0
Con pcDNA-Fdft1 0.0
Con sh1 sh3
sh3
k CT26 Con pcDNA-NC pcDNA-Fdft1

m n
CT26 Con shcon
CT26
Con
100 shcon
sh1
80 sh3
Colonies
sh1 sh3 60
l 60
CT26 40
Con
pcDNA-NC
50 pcDNA-Fdft1 20
Colonies
40 0
Con shcon sh1 sh3
30
20
on
ft1
N
C
Fd
A-
A-
N
D
p
pc
D
pc
250 CT26
Number of invasion cells
o CT26
200
Con
150 pcDNA-Fdft1
100
50
0
Con pcDNA-Fdft1
Con pcDNA-Fdft1
r 500 CT26
q
Number of invasion cells
Con
CT26 sh1
400
sh3
300
200
100
0
Con sh1 sh3
Con sh1 sh3
subcutaneously injected CT26 cells and FDFT1-overexpressing FMD combined with FDFT1 overexpressing had the most
CT26 cells into BALB/c mice. Our results indicated that significant inhibitory effect on 18F-FDG uptake in the in the
both the FMD and FDFT1 overexpression inhibited tumor xenograft model (Fig. 4e, f). In addition, the protein expression
growth in the mice. Compared with FMD alone or FDFT1- of FDFT1 in dissected tumor samples evaluated by IHC
overexpressing alone, FMD combined with FDFT1 overexpres- indicated that either FMD or FDFT1 overexpression with a
sing had the most dramatic inhibitory effect on tumor growth normal diet increased the protein level of FDFT1 in vivo.
in the mice (Fig. 4c, d). Consistent with these results, (Fig. 4g, h).

Fig. 3 FDFT1 negatively regulates the proliferation of CRC cells. a, b The efficiency of FDFT1 overexpression in CT26 cells was measured by qRT-PCR and
western blotting (P < 0.0001). c, d The efficiency of FDFT1 knockdown in CT26 cells was measured by qRT-PCR and western blotting (both P < 0.0001).
e FDFT1 overexpression inhibited CT26 cell proliferation as measured by a CCK8 assay (P = 0.0006). f FDFT1 knockdown increased CT26 cell proliferation
as measured by a CCK8 assay (sh1 vs con: P = 0.0008; sh3 vs con: P = 0.0009). g Cell proliferation in control and FDFT1-overexpressing CT26 cells was
also evaluated using EdU immunofluorescence staining. Scale bar: 100 µm. h The graph shows the relative fold fraction of EdU-positive cells. i Cell
proliferation was also evaluated in control and FDFT1 knockdown CT26 cells using EdU immunofluorescence staining. Scale bar: 100 µm. j The graph shows
the relative fold fraction of EdU-positive cells. k FDFT1 overexpression decreased the colony-forming capacity of CT26 cells as measured by a colony-
formation assay. l The graph shows the statistical results of the colonies. m FDFT1 knockdown increased the colony-forming capacity of CT26 cells as
measured by a colony-formation assay. n The graph shows the statistical results of the colonies (from left to right: P = 0.0003; P = 0.0006). o FDFT1
overexpression inhibited CT26 cell invasion as measured by a Transwell assay. Scale bar: 100 µm. p The graph shows the number of invaded cells. q FDFT1
knockdown increased CT26 cell invasion as measured by a Transwell assay. Scale bar: 100 µm. r The graph shows the number of invaded cells. Error bars,
mean ± SD, the data are from three independent experiments. Two-sided t tests. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, compared with the
control group.
Our previous data showed that fasting upregulated the effects of FDFT1 knockdown. First, we transfected CT26 and
expression of FDFT1 and FDFT1 acted as a tumor suppressor SW620 cells with siRNA targeting mTOR (Fig. 5c). Our results
in CRC. Our data also suggested that fasting synergizes with indicated that mTOR silencing increased the FDFT1 expression
FDFT1 overexpression in the inhibition of CRC proliferation level in CT26 cell (Fig. 5d). An mTOR inhibitor prevents an
in vitro and in vivo. To evaluate whether the inhibitory effect of increase in mTOR protein levels in FDFT1 knockdown cells
fasting on CRC is mediated by FDFT1, we assessed whether (Fig. 5e). Moreover, an mTOR activator prevents an increase in
FDFT1 knockdown would reverse the inhibitory effect of fasting FDFT1 protein levels in FDFT1 overexpression cells, identifying
on CRC. Our data demonstrated that FDFT1 knockdown an inverse relationship between FDFT1 and mTOR (Supplemen-
combined with fasting reversed the inhibitory effect of fasting tary Fig. 22a). Meanwhile, phosphorylation of two mTOR
on CRC cell proliferation (Fig. 4i; Supplementary Fig. 20c). downstream target proteins, S6k and S6, were decreased under
Moreover, an EdU assay showed that FDFT1 knockdown fasting or FDFT1 overexpression in colorectal cells (Fig. 5f;
combined with fasting abrogated the fasting inhibition of CRC Supplementary Fig. 22b).
cell proliferation (Supplementary Fig. 20a, b, d, e). To explore the function of mTOR in CRC, we examined the
To further confirm our in vitro observation, we subcutaneously influence of mTOR on CRC cell proliferation by CCK8 and EdU
injected CT26 cells and FDFT1-knockdown CT26 cells into assays and found that the silencing of mTOR decreased cell
BALB/c mice. When the FMD was combined with the proliferation (Fig. 5g, h). In the EdU immunofluorescence staining
implantation of FDFT1 knockdown CT26 cells in vivo, the assay, the silencing of mTOR resulted in a lower relative fold fraction
inhibitory effect of fasting on CRC tumor growth was reversed of EdU-positive cells (Supplementary Fig. 22c–f). These data showed
(Fig. 4j, k). Overall, these results demonstrated that FDFT1 was an that mTOR was a positive regulator of CRC cell proliferation.
important downstream target of fasting that mediates the Next, the impact of mTOR on glycolysis in CRC cells was assessed.
inhibition of CRC cell proliferation. Silencing mTOR reduced glucose uptake and lactate production in
CRC cells (Fig. 5k, n). Furthermore, the silencing of mTOR decreased
The mTOR level is inversely correlated with FDFT1 level in the ECAR, but increased the OCR of CT26 and SW620 cells (Fig. 5i,
CRC. To identify the core signaling pathway underlying the j, l, o). In addition, we examined the protein expression of AKT,
inhibitory effect of FDFT1 on the proliferation of CRC cells, the HIF1α, and relevant glycolytic genes by western blotting. As expected,
8-plex iTRAQ proteomic technique and bioinformatics analysis the silencing of mTOR decreased the expression of AKT, HIF1α, and
were performed again. The most enriched pathways involving proteins encoded by relevant glycolytic genes, such as GLUT1, HK2,
DEGs between FDFT1 knockdown and control CT26 cells LDHA, GPI, and PGK1 (Fig. 5m). Finally, we analyzed the correlation
included the “mTOR signaling” and “Glycolysis” pathways in between mTOR expression and AKT, HIF1α, GLUT1, HK2, and GPI
Ingenuity Pathway Analysis (IPA) (Supplementary Fig. 21a). The expression in TCGA data sets. Consistent with the results of previous
most enriched pathways involving DEGs between FDFT1-over- studies, a strong correlation was observed between mTOR expression
expressing and control CT26 cells included the “mTOR signaling” and AKT1, HIF1α, GLUT1, HK2, and GPI expression (Fig. 5p–t).
and “Oxidative phosphorylation” pathways in IPA (Supplemen- Therefore, these observations supported the hypothesis that mTOR
tary Fig. 21b). We speculated that FDFT1 inhibited the mTOR- positively regulates the aerobic glycolysis involved in CRC cell
related pathway, thereby suppressing glycolysis in CRC cells. proliferation.
First, we investigated the correlation between FDFT1 and mTOR.
mTOR protein levels decreased following FDFT1 overexpression, FDFT1 inhibits the AKT-mTOR-HIF1α pathway in CRC gly-
but increased following FDFT1 knockdown (Fig. 5a). Our results colysis. Our iTRAQ proteomics analysis indicated that FDFT1 is
suggested that FDFT1 expression is inversely correlated with probably a negative regulator of glucose metabolism in CRC. Our
mTOR expression. To further confirm our observation, the results showed that FDFT1 overexpression reduced glucose
expression of FDFT1 and mTOR was examined by IHC staining uptake and lactate production in CT26 and SW620 cells (Fig. 6a,
in parallel human CRC specimens from FUSCC (Fig. 5b). b; Supplementary Fig. 23a, b). Subsequent analysis indicated that
Patients with high FDFT1 expression had low mTOR expression, in cells overexpressing FDFT1, ECAR was reduced, but OCR was
which increased the validity of our previous results. Therefore, increased (Fig. 6c, d; Supplementary Fig. 23c, d). In contrast,
our data implied that FDFT1 expression was negatively correlated FDFT1 knockdown increased glucose uptake and lactate pro-
with mTOR expression, and that mTOR was a potential down- duction (Fig. 6e, f; Supplementary Fig. 23e, f). Moreover, in
stream target of FDFT1 in CRC. FDFT1 knockdown, ECAR was increased, but OCR was decreased
To make the link between FDFT1 and mTOR stronger, we (Fig. 6g, h; Supplementary Fig. 23g, h). Furthermore, FDFT1
evaluated the effect of mTOR silencing on FDFT1 expression level overexpression inhibited the protein and mRNA expression of
and whether treatment with an mTOR inhibitor would reverse the mTOR-targeted glycolytic enzymes, including GLUT1, HK2,

a Con b
CT26 pcDNA-Fdft1
Fasting 48 h h h
2.5 48 48
pcDNA-Fdft1 fasting 48 h ting ting
fas fas
dft
1 ft1 dft
1 ft1
8 h Fd 8 h Fd
OD value (450nm)
2.0
A-F g 4 A- A-F g 4 A-
CT26 o n pcDN astin pcDN SW620 on pcDN astin pcDN
1.5 C F C F
1.0
0.5 Vincullin 124 kDa Vincullin 124 kDa
0.0
1 2 3 4
Time (days)
d
Normal diet
c 800 Normal diet
Tumor volume (mm3)
FMD
600 Normal diet + Fdft1
overexpresion FMD
400 FMD + Fdft1 overexpression
Normal diet +
200
Fdft1 overexpression
0
12 15 17 19 21 23 FMD+
Time (days) Fdft1 overexpression
e Fdf
t1
t+ n
l die sion re ssio
iet m a s D + rexp
ld Nor rexpre FM 1 ove
Norma FM
D
ove F d f t
f 5 Normal diet
FMD
4
Normal diet+
SUVmax
3
FMD +
2
0
Groups
g Normal diet + FMD +

Normal diet FMD Fdft1 overexpression Fdft1 overexpression
Fdft1
h i Fdft1 shRNA
Fasting 48 h + Fdft1 shRNA
CT26 Con
100 Normal diet
4 Fasting 48 h
FMD
OD value (450nm)
80 ns
% Fdft1 staining
Normal diet + CT26 Fdft1 3

overexpression
60
FMD + CT26 Fdft1 2
40 overexpression
1
20
0
0 1 2 3 4
Time (days)
j Normal diet + Fdft1 knockdown k

FMD + Fdft1 knockdown
Normal diet
Normal diet
800
FMD
(mm3)
ns FMD
600 P = 0.0002
Tumor volume
P = 0.0006
400
Normal diet +
P = 0.0003
Fdft1 knockdown
200
0 FMD +
14 17 20 23 26 Fdft1 knockdown
Time (days)
PGK1, GPI, and LDHA (Fig. 6i, m; Supplementary Fig. 23i, m). Because the AKT-mTOR-HIF1α pathway is an essential
In contrast, FDFT1 knockdown increased the protein and mRNA pathway that governs glycolysis and proliferation in CRC and
expression of mTOR-targeted glycolytic enzymes, including FDFT1 expression is inversely correlated with mTOR expression,
GLUT1, HK2, PGK1, GPI, and LDHA (Fig. 6j, m; Supplemen- we decided to determine whether FDFT1 is negatively correlated
tary Fig. 23j, m). These results confirmed that FDFT1 was a with the AKT-mTOR-HIF1α pathway. Notably, FDFT1 over-
negative regulator of glucose metabolism in CT26 and SW620 expression decreased the protein and mRNA expression of AKT,
cells. mTOR, and HIF1α in CRC cells (Fig. 6k, n; Supplementary

Fig. 4 FDFT1 is a downstream target of fasting in suppressing CRC proliferation. a FDFT1 overexpression and fasting for 48 h inhibited CT26 cell
proliferation as measured by a CCK8 assay. Compared with either treatment alone, FDFT1 overexpression combined with fasting for 48 h had the most
obvious inhibitory effect on CT26 cell proliferation (from left to right: P = 0.0021; P = 0.0005; P = 0.0003). b Western blotting indicated that fasting 48 h
and FDFT1 overexpression increased the protein level of FDFT1 in CRC cells. Fasting exerted an additive effect on FDFT1 expression level in cells
overexpressing FDFT1 in the suppression of CRC cell proliferation. c, d Photograph of dissected tumors (first line: CT26 cells + normal diet; second line:
CT26 cells + FMD; third line: FDFT1-overexpressing CT26 cells + normal diet; fourth line: FDFT1-overexpressing CT26 cells + FMD; n = 4; both P <
0.0001). Both the FMD and FDFT1 overexpression inhibited tumor growth in the mice. The FMD combined with the implantation of FDFT1-overexpressing
CT26 cells had the most obvious inhibitory effect on tumor growth in the mice. e Representative 18F-FDG microPET/CT imaging of tumor-bearing mice.
f The ratio of the tumor SUVmax in the four groups. The SUVmax was decreased most significantly in the FDFT1-overexpressing CT26 cells + FMD group
(n = 3; from left to right: P = 0.0018; P = 0.0018; P = 0.0003). g The protein expression of FDFT1 in dissected tumor samples was evaluated by IHC. Scale
bar: 100 µm. h Graph shows the quantitative analysis of FDFT1 staining (n = 3). i The effect of FDFT1 knockdown, fasting 48 h and FDFT1 knockdown
combined with fasting 48 h on CT26 cell proliferation was evaluated by CCK8 (upper: P = 0.005; lower: P = 0.0045). j, k Photograph of dissected tumors
(first line: CT26 cells + normal diet; second line: CT26 cells + FMD; third line: shFDFT1 CT26 cells + normal diet; fourth line: shFDFT1 CT26 cells + FMD;
n = 4; P = 0.0006; P = 0.0002; P = 0.0003). The FMD inhibited tumor growth in mice. FDFT1 knockdown promoted tumor growth in mice. The FMD
combined with shFDFT1 CT26 cells did not inhibit tumor growth in the mice. Error bars, mean ± SD, the data are from three independent experiments. Two-
sided t tests. *P < 0.05, **P < 0.01, ***P < 0.001, compared with the control group (or normal diet group). #P < 0.05, ##P < 0.01.
Fig. 16k, n). In contrast, FDFT1 knockdown increased the protein data set. Because we speculated FDFT1 as a tumor suppressor in
and mRNA expression of AKT, mTOR, and HIF1α (Fig. 6l, n; CRC, we assessed the expression of FDFT1 with that of AKT1,
Supplementary Fig. 23l, n). These results suggested that FDFT1 mTOR, HIF1α, GLUT1, and HK2. The patients with a high
inhibited glucose metabolism through suppressing the AKT- expression of FDFT1 and a low expression of AKT1, mTOR,
mTOR-HIF1α pathway in CRC. HIF1α, GLUT1, and HK2 exhibited longer survival than those
Because fasting and FDFT1 upregulation reduced mTOR, AKT, with a low expression of FDFT1 and a high expression of the
and HIF1α expression in vitro, we hypothesized that the effect of AKT-mTOR-HIF1α pathway and glycolytic genes (Fig. 7f–j;
fasting may be due to a strong glucose reduction during FMD, so Supplementary Fig. 27).
we added a group of FMD + glucose in vivo tumor formation
experiment. In this group, glucose was added to drinking water in Discussion
correspondence with the FMD. This group can reverse the tumor Mounting evidence indicates that fasting exerts extensive anti-
growth inhibition induced by the FMD (Fig. 6o, p). Compared tumor effects in various cancers8,29,36,37. However, the mechan-
with FMD group, the protein level of FDFT1 and mTOR was ism by which fasting inhibits CRC remains unclear. Our results
reversed in FMD + glucose group (Fig. 6q). The glucose level in showed that fasting inhibits the malignant progression of CRC by
FMD + glucose mice was significantly higher than that of the impairing aerobic glycolysis. In particular, our in vivo and in vitro
FMD group (Fig. 6r). experiments showed that fasting could dramatically elevate the
We also examined the effect of fasting, FDFT1 overexpression expression of the cholesterogenic gene FDFT1. Moreover, we
and fasting combined with FDFT1 overexpression on the showed that FDFT1 played an important tumor-suppressive role
glycolysis and total cholesterol production in CRC cell lines with clinical significance and function in CRC, and was also an
and found that overexpression of FDFT1 and fasting reduced important downstream target of fasting. Mechanistically, FDFT1
glycolysis and total cholesterol levels. Meanwhile, overexpression performs its tumor-inhibitory function on glucose metabolism by
of FDFT1 combined with fasting had additive effects in reducing negatively regulating AKT/mTOR/HIF1α signaling. Furthermore,
glycolysis and total cholesterol levels in CRC cell lines the pharmacological mTOR inhibitor rapamycin can synergize
(Supplementary Fig. 24a–n). The mRNA level of key genes in with FMD in inhibiting the proliferation of CRC. We conclude
cholesterol biosynthesis and efflux pathway were activated after that fasting negatively regulates glucose metabolism and cell
fasting or FDFT1 upregulation (Supplementary Fig. 25a–c). proliferation via the FDFT1/AKT-mTOR-HIF1α axis in CRC
(Fig. 7k).
Fasting and mTOR inhibitor synergize in suppressing CRC Cancer cells usually exhibit aberrant metabolism resulting from
proliferation. We explored whether rapamycin, a pharmacolo- metabolic reprogramming. The most prominent metabolic
gical inhibitor of mTOR, can synergize with FMD in inhibiting reprogramming occurring in cancer results in aerobic glycolysis
the proliferation of CRC. The results indicated that both FMD in preference to mitochondrial oxidative phosphorylation, which
and 1 mg/kg dose of rapamycin can robustly inhibit the pro- provides continuous energy and nutrients to support uncon-
liferation of CRC and drastically improve survival (Fig. 7a–c). In trolled proliferation; this reprogramming is termed the Warburg
addition, we found that rapamycin therapy could increase the effect8,23,31,38. Previous studies have demonstrated that caloric
levels of FDFT1 protein and mRNA like fasting (Fig. 7d, e). restriction or fasting can alter the overall metabolic state of cancer
Moreover, we also found that fasting and rapamycin synergize in cells, including the dependence on aerobic glycolysis8,11,39,40. In
delaying CRC progression, improving survival, and upregulating this study, we provided evidence that fasting inhibits the pro-
FDFT1 (Fig. 7a–e). Weight profile in four groups is shown in liferation of CRC cells. Proteomics analysis showed that the
Supplementary Fig. 26. Overall, these results demonstrated that glycolysis pathway was highly downregulated during fasting. A
fasting and rapamycin can be potential therapeutic implications series of aerobic glycolysis-related assays indicated that fasting
to inhibit the proliferation of CRC. plays a vital role in inhibiting glycolysis in CRC cells. The pro-
teasome pathway also was downregulated during fasting, which
can be another promising direction to explore41–43. We con-
Clinical significance of the FDFT1/AKT-mTOR-HIF1α pathway firmed these results in an in vivo xenograft model. Fasting dra-
in CRC patients. To further validate our observation, we exam- matically inhibited 18F-FDG uptake and attenuated tumor growth
ined the clinical significance of AKT1, mTOR, HIF1α, GLUT1, in this xenograft model. These results suggested that, similar to
and HK2 expression with FDFT1 in CRC by analyzing the TCGA traditional cancer therapy, fasting can be a potential therapeutic

a b Fdft1 mTOR
dft1 d ft1
N A-F N A-F
Co
n pcD Co
n pcD Con sh1 sh3 Con sh1 sh3

Case1
mTOR 289 kDa mTOR 289 kDa
Vinculin 124 kDa Vinculin 124 kDa
CT26 SW620 CT26 SW620
Case2
c CT26 Con Si-1 Si-2 SW620 Con Si-1 Si-2
f ft1
β-Tubulin 50 kDa β-Tubulin 50 kDa Fd
in
g
N A-
n st cD
CT26 Co Fa p
p-s6 53 kDa
d CT26 Con Si-1 Si-2 e Ra
p
+
t1 t1 s6
289 kDa n F df F df
mTOR CT26 Co sh sh
p-sk 60 kDa
mTOR 289 kDa
Fdft1 48 kDa
sk
Vinculin 124 kDa β-Tublin 50 kDa
β-actin 42 kDa
g CT26
h SW620
i CT26
j SW620
2-DG

4 4 80 Olycomycin 200 2-DG
Oligomycin
Con Con Control
OD value (450 nm)
OD value (450 nm)
Si-1 Control
3 Si-1 3 60 Glucose 150
Si-2 Si-1 Si-1
Glucose
Si-2
Si-2
2 2 40 Si-2 100
1 1 20 50
0 0 0 0
1 2 3 4 1 2 3 4 0 20 40 60 80 0 20 40 60 80
Time (days) Time (days)
Time (min) Time (min)
k l CT26 m Con Si-1 Si-2 Con Si-1 Si-2

1.5 Con 289 kDa
mTOR
150 FCCP Rotenone

Si-1 Oligomycin
Si-2 Control
1.0 Si-1
100 AKT 60 kDa
Si-2
0.5
50 HIF 1α 120 kDa
0.0
0 54 kDa
GLUT1
26
0
62
0 20 40 60 80
CT
SW
Time (min)
n o SW620
HK2 102 kDa
150 FCCP
1.5 2-DG
Relative lactate production
Con
LDHA 37 kDa
Si-1 Oligomycin
Si-2 Control
1.0 100 Si-1
Si-2 GPI 63 kDa
0.5 50
PGK1 45 kDa
0.0 0
0 20 40 60 80
β-tubulin
26
50 kDa
62
CT
SW
Time (min)
CT26 SW620
p q r s t
7.5 8 9.5 p – value = 7.2e–06
p – value = 2.6e–08 p – value = 0.017 p – value = 0.00059
p – value = 0 10 R = 0.25
R = 0.31 R = 0.13 R = 0.19
R = 0.5
7.0 7
7 9.0
9
6.5
log2(AKT1 TPM)
log2(SLC2A1 TPM)
8 6
log2(HIF1A TPM)
8.5
log2(HK2 TPM)
log2(GPI TPM)
6
6.0 7
5 8.0
5.5 5 6
4 7.5
5.0 5
4
7.0
4 3
4.5
3 6.5
2.0 2.5 3.0 3.5 4.0 4.5 5.0 2.0 2.5 3.0 3.5 4.0 4.5 5.0 2.0 2.5 3.0 3.5 4.0 4.5 5.0 2.0 2.5 3.0 3.5 4.0 4.5 5.0 2.0 2.5 3.0 3.5 4.0 4.5 5.0
log2(MTOR TPM) log2(MTOR TPM) log2(MTOR TPM) log2(MTOR TPM) log2(MTOR TPM)
approach in CRC. Given the critical role of fasting in CRC glucose fasting that mediates the inhibition of CRC cell proliferation, we
metabolism, we further explored the potential underlying analyzed the GSE6065329 data set (from a study on fasting-
mechanism and downstream effectors. induced anti-Warburg effects in CRC) to identify DEGs between
Some studies have suggested that the antitumor effect of fasting the control and fasting groups. Intriguingly, the results indicated
is mediated through the modulation of insulin-like growth factor that fasting upregulates the “Steroid biosynthesis” pathway, and
(IGF)-1 or insulin, or through the enhancement of antitumor that FDFT1 was dramatically upregulated. FDFT1 acts at a branch
immunity15,16,37,44. To investigate the downstream target of point in the mevalonate pathway, and is the first specific enzyme

Fig. 5 mTOR expression is inversely correlated with FDFT1 expression. a FDFT1 overexpression inhibited the protein level of mTOR, whereas FDFT1
knockdown increased the protein level of mTOR in CT26 and SW620 cells. b FDFT1 expression and mTOR expression were negatively correlated in CRC
patient samples. Scale bar: 200 µm. c The mTOR silencing efficiency of the siRNA in CT26 and SW620 cells was validated by western blotting. d The effect
of mTOR silencing on FDFT1 expression level in CT26 was evaluated by western blotting. e The protein level of mTOR when FDFT1 knockdown combined
with or without mTOR inhibitor in CT26. f The protein level of pS6k, S6k, pS6, and S6 under the effect of fasting and FDFT1 overexpression in CRC cells.
g, h CCK8 proliferation assays showed that the silencing of mTOR decreased the proliferation of CT26 and SW620 cells. k, n The silencing of mTOR
reduced glucose uptake and lactate production in CT26 and SW620 cells. i, j, l, o The silencing of mTOR decreased the ECAR and increased the OCR in
CT26 and SW620 cells. m The silencing of mTOR decreased the expression of AKT, HIF1α, and proteins encoded by relevant glycolytic genes, such as
GLUT1, HK2, LDHA, GPI, PGK1, in CT26 and SW620 cells. p–t Based on TCGA data set analysis, mTOR expression was positively correlated with AKT1, HIF1α,
GLUT1, HK2, and LDHA expression. Error bars, mean ± SD, the data are from three independent experiments. Two-sided t tests. *P < 0.05, **P < 0.01, ***P <
0.001, compared with the control group.
in cholesterol synthesis, catalyzing the reaction that produces metabolism through suppressing the AKT-mTOR-HIF1α pathway
squalene synthase34,45. Clinically, high FDFT1 expression in CRC during fasting in CRC. As the clinical application of FDFT1 will
is associated with better prognosis in The Cancer Genome Atlas be challenging, we explored whether a pharmacological inhibitor
(TCGA) data sets. However, FDFT1 has seldom been studied in of mTOR could be an effective therapy for colorectal cancer.
the field of cancer research. Limited studies addressed FDFT1 in Consistent with our in vitro observations, mTOR inhibitor can
prostate cancer35, ovarian cancer46, and lung cancer47, but there synergize with FMD in supressing the proliferation of CRC.
is no information on the function of FDFT1 in CRC. Therefore, Moreover, patients with high FDFT1 expression and low
we selected FDFT1 as the target gene. Our study validated that expression of the AKT-mTOR-HIF1α pathway and glycolytic
fasting upregulates the expression of FDFT1 in CRC cells both genes exhibited longer survival, adding validation to our
in vitro and in vivo. Then, we observed that the downregulation hypothesis. The survival data also show a worse prognosis of
of FDFT1 was correlated with malignant progression and poor FDFT1-low tumors regardless of the expression of other mTOR
prognosis in CRC in both the FUSCC cohort and TCGA pathway genes, which suggest an alternative pathway for FDFT1
data sets. to effect cancer proliferation potential. Several studies have found
To our knowledge, the biological function of FDFT1 in CRC that cholesterol deprivation can inhibit tumor growth, decrease
has not been studied. Our study showed that FDFT1 negatively the phosphorylation of AKT, promote apoptosis62, decrease Bcl-
regulates the proliferation of CRC cells, and acts as a tumor xl, downregulate caspase 3 activation63, or hinder entry of cells
suppressor in CRC. Furthermore our data suggested that fasting into the S phase64. Our study showed that fasting and FDFT1
synergizes with FDFT1 overexpression in the inhibition of CRC overexpression reduced the total cholesterol production in CRC
cell proliferation in vitro and in vivo. However, when fasting was cell lines. So we agree there may be other pathways for FDFT1
combined with FDFT1 knockdown in vivo, the inhibitory effect of affect tumor growth. The mechanism by which FDFT1 affects
fasting on CRC was reversed, indicating that FDFT1 was an mTOR needs to be further explored. We will focus on studying
important downstream target of fasting that mediated the inhi- these problems in the future.
bition of CRC cell proliferation. In conclusion, we demonstrated that fasting was a negative
To further identify the core signaling pathway underlying the regulator of glucose metabolism and proliferation via the
inhibitory effect of FDFT1 on the proliferation of CRC cells, FDFT1/AKT-mTOR-HIF1α axis in CRC cells. A therapy based on
another proteomics analysis was performed. Based on the mTOR inhibition could be a promising approach against CRC.
bioinformatics results, we speculated that FDFT1 inhibited the These results indicated a good function of the cholesterogenic
mTOR-related pathway, thereby suppressing glycolysis in CRC gene FDFT1 in CRC glucose metabolism and suggest that FDFT1
cells. mTOR is a conserved serine/threonine kinase that plays a is a potential marker in CRC. Our results also elucidate potential
key role in integrating multiple physiological stimuli to regulate therapeutic implications (involving fasting and mTOR) for CRC
cell growth and metabolic pathways27,28,40,48. mTOR deregulation and indicate potential crosstalk between a cholesterogenic gene
occurs in many human pathologies, including cancer, metabolic and glycolysis.
diseases, nervous system diseases, and inflammation49,50. There
are already many mTOR inhibitors for the treatment of human
Methods
cancer, and many more have been evaluated in clinical trials51–55. Cells and reagents. CRC cell lines CT26, SW620, HCT116, HT29, and human
mTOR activates glycolysis through modulating the expression of colorectal cancer mucosal epithelial cell line NCM460 were obtained from the
the transcription factor HIF-1α, indirectly upregulating the American Type Culture Collection (ATCC; Shanghai, China) and cultured in
transcription of almost all glycolytic genes in tumor cell5,28,56. DMEM (Biological Industries, USA) supplemented with 10% FBS (Gibco, USA).
Isogenic PIK3CA mutant (HCT116 and HT29) were generated in advance65,66. All
Our results indicated that FDFT1 expression is negatively corre- culture media contained 100 U/ml penicillin and 100 mg/ml streptomycin and
lated with mTOR expression. Consistent with the data in previous maintained at 37 °C in a humidified atmosphere containing 5% CO2. The fasting
reports27,57–60, our data showed that mTOR is a positive regulator mimic medium comprised of glucose-free DMEM (Gibco, USA) supplemented
of aerobic glycolysis and proliferation in CRC cells. HIF1α is a with 0.5 g/L glucose and 1% FBS; fasting was mimicked by incubating cells in this
medium for 24 h or 48 h67,68.To determine if mTOR can reverse FDFT1 over-
key regulator of the Warburg effect and regulates the expression expression, pretreat CT26 and SW620 with mTOR activator MHY1485 (10 µmM)
of a variety of metabolism-related proteins61. The correlation for 24 h.
between mTOR and HIF1α prompted us to validate that FDFT1
could regulate glucose metabolism through the AKT-mTOR-
Lentivirus production and stable cell line selection. The PGMLV-CMV-FDFT1-
HIF1α pathway. Through the effect of fasting on glucose meta- EF1-ZsGreen1-T2A-Puro (Genomeditech, Shanghai, China) plasmid was used to
bolism as well as on the connection among mTOR signaling, generate the FDFT1 overexpression constructs. The PGMLV-hU6-FDFT1-CMV-
fasting and glucose metabolism have been reported. To our ZsGreen1-PGK-Puro (Genomeditech) plasmid was used to generate the FDFT1
knowledge, the impact of FDFT1 on inhibiting the Warburg effect shRNA constructs. The 21-bp sequences targeting FDFT1 were GTGTTTAACTT
CTGTGCTATT, GCAGGTATTCAAAGGAGTAGT, and GCCGTCAAAGCTAT
has not been reported during fasting; thus, our results innova- CATATAC. The PGMLV-CMV-SREBP2-EF1-ZsGreen1-T2A-Puro (Genomedi-
tively validated that FDFT1 is a negative regulator of glucose tech) plasmid was used to generate the SREBP2 overexpression constructs. The

a CT26
b CT26
c CT26
d CT26

100 150
1.5 2-DG

Oligomycin

1.5 Con Rotenone
FCCP
80 pcDNA-Fdft1
Con Glucose Oligomycin
Con 100 Control
1.0 pcDNA-Fdft1 1.0 pcDNA-Fdft1 60 pcDNA-Fdft1
40 50
0.5 0.5
20
0.0 0.0 0 0
Con pcDNA-Fdft1 0 20 40 60 80 0 20 40 60 80
Con pcDNA-Fdft1
Time (min)
Time (min)
e f CT26
g h CT26
CT26 Con CT26
Con

150

FCCP
2.5 2.0 sh1

sh1 2-DG
80
2-DG
sh3 sh3 Oligomycin Control
Oligomycin Control
2.0 1.5 sh1
sh1 60
100 Glucose
sh3
1.5 sh3
1.0
1.0 40
0.5 50
0.5 20
0.0 0.0
Con sh1 sh3 0 0
Con sh1 sh3 0 20 40 60 80
0 20 40 60 80
Time (min) Time (min)
i CT26 Con pcDNA-Fdft1 j CT26 Con sh1 sh3 k CT26 Con pcDNA-Fdft1
l
CT26 Con sh1 sh3

PGK1 45 kDa
PGK1 45 kDa
AKT 60 kDa AKT 60 kDa
LDHA 37 kDa
LDHA 37 kDa
HIF 1a HIF 1a 120 kDa
120 kDa
HK2 102 kDa

HK2 102 kDa
Vinculin 124 kDa
Vinculin 124 kDa
GLUT1 54 kDa
GLUT1 54 kDa
n Relative mRNA expression CT26 Con
2.5 pcDNA-Fdft1
GPI 63 kDa
GPI 63 kDa sh1
2.0
sh3
Vinculin 124 kDa 1.5

Vinculin 124 kDa
1.0
0.5
m CT26 Con 0.0

pcDNA-Fdft1 AKT mTOR HIF1a
Relative mRNA expression
3
sh1
sh3 p 800
Normal diet q
2
se
FMD + Glucose
Tumor volume (mm3)
co
FMD et
lu
ns
di
600
G
al
+
m
D
1
or
FM
FM
N
400
Fdft1 48 kDa
0 200
GLUT1 HK2 PGK1 LDHA GPI mTOR 289 kDa
0 Vinculin 124 kDa

13 15 17 19 21 23 25
Time (days)
o
Normal diet
r 250 Normal diet
FMD + Glucose
FMD + Glucose 200 FMD
Glucose (mg/dl)
150
FMD 100
50
0
se
et
D
FM
di
co
al
lu
m
G
or
+
N
D
FM
PGMLV-hU6-SREBP2-CMV-ZsGreen1-PGK-Puro (Genomeditech) plasmid was The siRNA transfection. We silenced mTOR expression in CRC cells by using
used to generate the SREBP2 shRNA constructs. The sequences targeting SREBP2 siRNA-mediated silencing. The siRNAs targeting mTOR were 5′-CGAUCCAGUU
were ATGATGCGAGGCTGAGTTGTC and CCCTGGCTGTCCTGTGTAATAC. GUCAUGGAAdTdT-3′/5′-UUCCAUGACAACUGGAUCGdTdT-3′, 5′-GAGAC
Lentiviral particles were produced by transfecting the psPAX2 and pMD2.G UUGAUGGAAGAGAAdTdT-3′/5′-UUCUCUUCCAUCAAGUCUCdTdT-3′, and
plasmids into HEK293T cells using Lipofectamine 2000 (Invitrogen, USA) 5′-GGUCGGAGUUUAAGGUCUAdTdT-3′/5′-UAGACCUUAAACUCCGACCd
according to the manufacturer’s protocol. Stable cell lines were obtained by TdT-3′ (Proteintech, Shanghai, China). siRNA duplexes targeting mTOR were
infection with the lentiviral particles followed by puromycin selection. The effi- transfected into colorectal cancer cells using Lipofectamine 2000 (Invitrogen, USA)
ciency of transfection was examined using real-time PCR and western blotting. in serum-free medium according to the manufacturer’s instructions.

Fig. 6 FDFT1 inhibits glycolysis through suppressing the AKT-mTOR-HIF1α pathway in CRC. a FDFT1 overexpression reduced glucose uptake in CT26
cells. b FDFT1 overexpression decreased lactate production via glycolysis in CT26 cells. c ECAR was reduced when FDFT1 was overexpressed in CT26 cells.
d OCR was increased when FDFT1 was overexpressed in CT26 cells. e FDFT1 knockdown increased glucose uptake in CT26 cells. f FDFT1 knockdown
increased lactate production via glycolysis in CT26 cells. g ECAR was increased when FDFT1 was knocked down in CT26 cells. h OCR was decreased when
FDFT1 was knocked down in CT26 cells. i, m FDFT1 overexpression inhibited the protein and mRNA expression of mTOR-targeted glycolytic enzymes,
including GLUT1, HK2, PGK1, GPI, and LDHA, in CT26 cells. j, m FDFT1 knockdown increased the protein and mRNA expression of mTOR-targeted glycolytic
enzymes, including GLUT1, HK2, PGK1, GPI, and LDHA, in CT26 cells. k, n FDFT1 overexpression decreased the protein and mRNA expression of AKT, mTOR,
and HIF1α. l, n FDFT1 knockdown increased the protein and mRNA expression of AKT, mTOR, and HIF1α. o Photograph of dissected tumors (the first line:
normal diet, the second line: FMD + glucose, the third line: FMD, n = 5). p The tumor volumes were measured every 2 days after the 13th day. The FMD +
glucose group can reverse the tumor growth inhibition induced by the FMD (n = 5; ns: P = 0.1838; P = 0.0001). q The protein level of FDFT1 and mTOR in
dissected tumor samples from normal diet group, FMD group and FMD + glucose group was measured by western blotting. r The glucose level in these
three groups. Error bars, mean ± SD, the data are from three independent experiments. Two-sided t tests. *P < 0.05, **P < 0.01, ***P < 0.001, compared with
the control group (or normal diet group). #P < 0.05, ##P < 0.01.
Cell proliferation assay. Cell proliferation was examined using a Cell Counting real-time PCR system (Applied Biosystems). The primer sequences are listed in
Kit-8 (CCK8; Dojindo Laboratories, Japan). Briefly, cell suspensions (3 × 103/well) Supplementary Table 1.
were seeded in 96-well culture plates and incubated for 5 days. CCK8 solution (10
µL) was added to each well, and the cells were cultured for another 4 h. The optical
Proteomics. After samples were lysed in 1 × protease inhibitor cocktail (Roche
density was measured at 450 nm using a microplate reader.
Ltd., Switzerland), the protein was digested with sequence-grade modified trypsin
(Promega, WI) and lyophilized. The resultant peptide mixture was labeled with an
Colony-formation assay. Cells were seeded in triplicate in six-well plates at a iTRAQ 8-plex labeling kit (Sciex) following the manufacturer’s instructions. The
density of 500 cells/well. After 14 days, most single colonies contained more than peptide mixture was fractionated by high pH separation using an Ultimate
50 cells. The cells were fixed with 4% paraformaldehyde for 20 min at room 3000 system (ThermoFisher Scientific, USA). The peptides were analyzed by on-
temperature, stained with 4 mg/mL crystal violet for 20 min, and counted under a line nanospray LC-MS/MS. Tandem mass spectra were processed by PEAKS Studio
light microscope (Leica DM IL, Germany). version 8.5 (Bioinformatics Solutions Inc., Canada). Differentially expressed pro-
teins were filtered if their fold change was greater than 1.5 and they contained at
EdU assay cells. In total, 1 × 105 cells from each group were seeded on coverslips least two unique peptides with a significance greater than 13. The mass spectro-
and cultured for 24 h. Click-iT EdU Imaging Kits (#C10339, Invitrogen, USA) were metry proteomics data have been deposited to the ProteomeXchange Consortium
used to label and detect the incorporated EdU according to the manufacturer’s via the PRIDE partner repository with the data set identifier PXD012029 and
protocol. The staining results were observed under an inverted fluorescence 10.6019/PXD012029.
microscope (IX51; Olympus, Tokyo, Japan).
Clinical samples. CRC and paired noncancerous tissues were obtained from 81
Transwell migration assay. The Transwell migration assay was performed using patients who underwent surgical resection without preoperative chemotherapy or
24-well cell culture inserts containing a transparent PET membrane (8.0-µm pore radiotherapy at FUSCC from 2012 to 2013. Prior patient consent and approval
size, #353097; BD Biosciences, USA). A total of 2 × 105 cells in 200 µL serum-free from the Institutional Research Ethics Committee were obtained. The patients were
DMEM were added to the upper chamber, and 800 µL DMEM supplemented with followed up after surgery every 3 months. All tissues were frozen at −125 °C
10% FBS was added to the lower chamber. Following 24 h of incubation, the until use.
migrated cells on the bottom of the membrane were fixed with 4% PFA for 20 min
and stained with 0.1% Crystal violet for further analysis. IHC staining. IHC staining of paraffin-embedded tissues with antibodies against
FDFT1 (Abcam, ab195046) was performed and scored according to standard
Cell cycle and apoptosis analysis. Cell cycle analysis was performed via propi- procedures. The staining score was determined by two independent pathologists at
dium iodide (PI) staining following the manufacturer’s protocols (Signalway our center.
Antibody, #CA002). To identify apoptotic cells, a PE Annexin V Apoptosis
Detection Kit I (BD Biosciences, #559763) was used according to the manu- Animal model. BALB/c mice (female, 4–6 weeks of age, 18–20 g; Shanghai SLAC
facturer’s protocol. The cells were analyzed by flow cytometry (Cell Lab Quanta, Laboratory Animal Co., Ltd) were housed in a specific pathogen-free (SPF)
Beckman Coulter, USA). environment. In total, 2 × 104 cells (CT26, CT26 pcDNA-FDFT1, or
CT26 shFDFT1) were injected subcutaneously into the right flank of the mice.
Glycolysis analysis. Glucose Uptake Fluorometric Assay Kits (Biovision, #K666- When the tumors were palpable, the mice were randomly assigned to the control
100) and Lactate Colorimetric Assay Kits (Biovision, #K627-100) were purchased, group or the FMD group. In the control group, food was provided ad libitum with
and glycolysis was detected in CRC cells according to the manufacturer’s protocols. TD.7912 rodent chow. The average daily consumption of mice was 14.9 kJ in the
control group. The FMD consisted of three components11,67–70, designated as the
day 1 diet, day 2–3 diet, and day 4–7 diet, fed in this order. The day 1 diet
OCR and ECAR. Cellular mitochondrial function and cellular glycolytic capacity contained only 50% of the calories of the normal intake, which consists of a variety
were measured by using a Seahorse Bioscience XF96 Extracellular Flux Analyzer of vegetable powders, low-calorie broth powders, essential fatty acids, extra virgin
according to the manufacturer’s instructions for the Seahorse XF Glycolysis Stress olive oil, minerals, and vitamins, containing 7.67 kJ/g; carbohydrate 2.2k J/g,
Test Kit and Cell Mito Stress Test Kit (Seahorse Bioscience, USA). Briefly, 2 × 104 protein 0.46k J/g, fat 5.00 kJ/g. The day 2–3 diet contained only 10% of the normal
cells were seeded into 96-well cell culture XF microplates and incubated overnight calories intake, which consists of glycerol and low-calorie broth powders, con-
for further testing. The ECAR and OCR values were calculated after normalization taining 1.48 kJ/g, carbohydrates 1.47 kJ/g, and protein/fat 0.01 kJ/g. For the day 4–7
to the total cell number and are plotted as the mean ± SD. diet, the mice were fed their normal intake; this progression was followed by
another cycle of the FMD. The animals had free access to water. At the end of the
Protein extraction and western blot analysis. Briefly, total protein was extracted, study, the mice underwent microPET/CT scanning. After scanning, the tumors
qualified by BCA protein assay reagent, separated by SDS-PAGE, and detected by were surgically dissected. Fasting mimic group + glucose group were provided with
immunoblotting with specific antibodies. Antibodies against FDFT1 (Abcam, 10 mg/kg glucose supplementation in the drinking water during the FMD. All
ab195046), mTOR (Abcam, ab10268), AKT (Cell Signaling, #9272), vinculin (Cell animal experiments were performed according to the procedures approved by the
Signaling, #4650), HIF1α (Novus, NB100-105), GLUT1 (HIF-Proteintech, 66290-1- Institutional Animal Care and Use Committee of Fudan University.
lg), LDHA (Proteintech, 19987-1-AP), HK2 (Proteintech, 22029-1-AP), PGK1
(Proteintech, 17811-1-AP), and GPI (Abcam, ab66340) were purchased from the
MicroPET/CT imaging. MicroPET/CT scanning and image analysis were per-
designated manufacturers. Vinculin was used as the loading control.
formed using an Inveon microPET/CT system and the manufacturer-supplied
display software (Inveon Research Workplace, Siemens Medical Solutions, USA).
RNA isolation and quantitative real-time PCR. The total RNA was extracted Each tumor-bearing mouse was injected with 5.55 MBq (150 μCi) of 18F-
using TRIzol reagent (Invitrogen). A Takara PrimeScript RT reagent kit was used fluorodeoxyglucose (18F-FDG) via the tail vein. Ten-min static scans were acquired
for reverse transcription to obtain cDNA. The expression of the candidate genes at 1.0 h post injection, and the animals were maintained under isoflurane anes-
and GAPDH was assessed by quantitative real-time PCR using an ABI 7900HT thesia during the scanning period. The images were reconstructed using a three-

a b Normal diet
FMD
800 Rap 1mg/kg

Normal diet
FMD + Rap 1mg/kg P = 0.0008
Tumor volume (mm3)

FMD 600
Rap 1mg/kg 400

P = 0.0003
#
FMD + Rap 1mg/kg 200
P = 0.0133
0
9 12 15 18 21 24
Days after inoculation
c d # P = 0.0133
Survival
# P = 0.0351
100 Normal diet Normal diet
3 P = 0.0008
FMD FMD
Fdft/actin mRNA ratio

75 Rap 1mg/kg P = 0.0097
P = 0.0025 Rap 1mg/kg
% survival
FMD + Rap 1mg/kg

2 FMD + Rap 1mg/kg
50
25 1
0
0 3 6 9 12 15 18 21 24 27 0
Days after inoculation
e f FDFT1 high and AKT1 low

g FDFT1 high and mTOR low
P = 0.0189 P = 0.0465
FDFT1 low and AKT1 high FDFT1 low and mTOR high
kg
100 FDFT1 high and AKT1 high FDFT1 high and mTOR high
g/
P = 0.05 P = 0.0223
1m
FDFT1 low and AKT1 low 100 FDFT1 low and mTOR low
Overall survival rate(%)
kg
ap
et
80

g/
di
R
1m
80
al
+
m
D
D
60
ap
or
FM
FM
R
N
60
40
FDFT1 48 kDa 40
20
Vinculin 124 kDa 20
0
0 1000 2000 3000 0
0 1000 2000 3000
Days
Days
h i FDFT1 high and GLUT1 low j

FDFT1 high and HIF1a low P = 0.0234
P = 0.05 FDFT1 low and GLUT1 high FDFT1 high and HK2 low
FDFT1 low and HIF1a high P = 0.0434
FDFT1 high and GLUT1 high FDFT1 low and HK2 high
FDFT1 high and HIF1a high FDFT1 low and GLUT1 low P = 0.0455 FDFT1 high and HK2 high
100 P = 0.0196 100
FDFT1 low and HIF1a low 100 P = 0.0247
FDFT1 low and HK2 low
80 80
80
60 60 60
40 40 40
20 20 20
0 0 0
0 1000 2000 3000 0 1000 2000 3000 0 1000 2000 3000
Days Days Days
k CRC
AKT-mTOR-HIF 1a
pathway
1
FDFT1 FT
FD
OR Glycolysis
mT
Fasting Proliferation
dimensional ordered-subset expectation-maximization (OSEM3D)/maximum Total cholesterol levels. The total cell cholesterol levels were measured by a
algorithm. Inveon Research Workplace was used to obtain the maximum standard cholesterol/cholesteryl ester quantitation kit (Abcam, ab65359) according to the
uptake value (SUVmax). manufacturers’ instructions.
In vivo rapamycin treatment. Rapamycin (1 mg/kg/d, CAS 53123-88-9, Santa Statistical analysis. The experiments were repeated at least three times. All data
Cruz Biotechnology, USA) was injected into mice intraperitoneally when the are presented as the means ± SDs. SPSS 17.0 software (IBM, USA) and GraphPad
tumors were palpable. FMD also was started when the tumors were palpable. Prism 7.0 software were used for data analysis. Two-sided unpaired Student’s t

Fig. 7 Fasting and mTOR inhibitor synergize in suppressing CRC proliferation and clinical significance of the FDFT1/AKT-mTOR-HIF1α pathway in
CRC patients. a CT26 cells were injected into BALB/c mice. When the tumors were palpable, the mice were randomly assigned to the normal diet group,
FMD group, the rapamycin 1 mg/kg group and FMD + rapamycin 1 mg/kg group. Photograph of dissected tumors (the first line: normal diet, the second
line: FMD, the third line: rapamycin 1 mg/kg, the fourth line: FMD + rapamycin 1 mg/kg, n = 5). b The tumor volumes were measured every 3 days after
the 9th day (n = 30; ***P = 0.0008, P = 0.0003; #P = 0.0133). On day 9 after inoculation, all the tumor were palpable. c Kaplan–Meier analysis of the
overall survival of mice after the inoculation in normal diet group, FMD group, normal diet mice treated with rapamycin 1 mg/kg group and FMD +
rapamycin 1 mg/kg group (n = 30; log-rank score: P = 0.0049 for FMD group, P = 0.0058 for rapamycin 1 mg/kg group; P = 0.00069 for FMD +
rapamycin 1 mg/kg group.) d, e The expression level of FDFT1 in four groups was evaluated by western blotting and qRT-PCR (**P = 0.0025, P = 0.0097;
***P = 0.0008; #P = 0.0133, P = 0.0351). f–j Survival analysis stratified by combining FDFT1 levels with AKT1, mTOR, HIF1α, GLUT1, and HK2 levels from
CRC patients in the TCGA cohort. k Proposed model of the mechanism underlying the fasting-mediated regulation of glucose metabolism via the
FDFT1/AKT-mTOR-HIF1α axis in colorectal cancer. Fasting upregulates the expression of FDFT1 during the inhibition of colorectal cancer cell aerobic
glycolysis and proliferation. FDFT1, whose downregulation is correlated with malignant progression and poor prognosis in CRC, acts as a critical tumor
suppressor in CRC. We then observed that FDFT1 is an important downstream target of fasting that mediates the inhibition of CRC cell proliferation.
Mechanistically, FDFT1 inhibits the AKT-mTOR-HIF1α pathway, impairing aerobic glycolysis, and thereby suppressing the proliferation of CRC cells. There is
also a reverse regulation of FDFT1 by mTOR. Error bars, mean ± SD, the data are from three independent experiments. Two-sided t tests. Kaplan–Meier
analysis and log-rank tests were used in panel c. *P < 0.05, **P < 0.01, ***P < 0.001, compared with normal diet group. #P < 0.05, ##P < 0.01.
tests, one-way analysis of variance, chi-square tests, Kaplan–Meier analysis and 12. Robertson, L. T. et al. Protein and calorie restriction contribute additively to
log-rank tests were used to evaluate the data. Differences were considered sig- protection from renal ischemia reperfusion injury partly via leptin reduction
nificant at *P < 0.05; **P < 0.01; ***P < 0.01; ****P < 0.0001; #P < 0.05; and ##P < in male mice. J. Nutr. 145, 1717–1727 (2015).
0.01. 13. Mauro, C. R. et al. Preoperative dietary restriction reduces intimal hyperplasia
and protects from ischemia-reperfusion injury. J. Vasc. Surg. 63, 500–509 e501
Reporting summary. Further information on research design is available in the (2016).
Nature Research Reporting Summary linked to this article. 14. Sutton, E. F. et al. Early time-restricted feeding improves insulin sensitivity,
blood pressure, and oxidative stress even without weight loss in men with
prediabetes. Cell Metab. 27, 1212–1221 (2018).
Data availability 15. Efeyan, A., Comb, W. C. & Sabatini, D. M. Nutrient-sensing mechanisms and
Raw mass spectrometry proteomics data files have been deposited in the pathways. Nature 517, 302–310 (2015).
ProteomeXchange Consortium with the data set identifier PXD012029 and 10.6019/ 16. Buono, R. & Longo, V. D. Starvation, stress resistance, and cancer. Trends
PXD012029. All the other data supporting the findings of this study are available within Endocrinol. Metab. 29, 271–280 (2018).
the article and its supplementary information files and from the corresponding author 17. Tulsian, R., Velingkaar, N. & Kondratov, R. Caloric restriction effects on
upon reasonable request. A reporting summary for this article is available as a liver mTOR signaling are time-of-day dependent. Aging 10, 1640–1648
Supplementary Information file. (2018).
18. Blagosklonny, M. V. Fasting and rapamycin: diabetes versus benevolent
Received: 9 December 2018; Accepted: 26 March 2020; glucose intolerance. Cell Death Dis. 10, 607 (2019).
19. Hanahan, D. & Weinberg, R. A. Hallmarks of cancer: the next generation. Cell
144, 646–674 (2011).
20. Pavlova, N. N. & Thompson, C. B. The emerging hallmarks of cancer
metabolism. Cell Metab. 23, 27–47 (2016).
21. Warburg, O. On the origin of cancer cells. Science 123, 309–314 (1956).
22. Cairns, R. A., Harris, I. S. & Mak, T. W. Regulation of cancer cell metabolism.
References Nat. Rev. Cancer 11, 85–95 (2011).
1. Bray, F. et al. Global cancer statistics 2018: GLOBOCAN estimates of 23. Liberti, M. V. & Locasale, J. W. The Warburg effect: how does it benefit cancer
incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer cells? Trends Biochem. Sci. 41, 211–218 (2016).
J. Clin. 68, 394–424 (2018). 24. Polivka, J. Jr. & Janku, F. Molecular targets for cancer therapy in the PI3K/
2. Brenner, H., Kloor, M. & Pox, C. P. Colorectal cancer. Lancet 383, 1490–1502 AKT/mTOR pathway. Pharm. Ther. 142, 164–175 (2014).
(2014). 25. Xiao, Y. et al. PDGF promotes the Warburg effect in pulmonary arterial
3. Global Burden of Disease Cancer C et al. Global, regional, and national smooth muscle cells via activation of the PI3K/AKT/mTOR/HIF-1 alpha
cancer incidence, mortality, years of life lost, years lived with disability, and signaling pathway. Cell Physiol. Biochem. 42, 1603–1613 (2017).
disability-adjusted life-years for 32 cancer groups, 1990 to 2015: a systematic 26. Charbonnier, L. M. et al. Functional reprogramming of regulatory T cells in
analysis for the global burden of disease study. JAMA Oncol. 3, 524–548 the absence of Foxp3. Nat. Immunol. 20, 1208–1219 (2019).
(2017). 27. Mossmann, D., Park, S. & Hall, M. N. mTOR signalling and cellular
4. Dekker, E. & Rex, D. K. Advances in CRC prevention: screening and metabolism are mutual determinants in cancer. Nat. Rev. Cancer 18, 744–757
surveillance. Gastroenterology 154, 1970–1984 (2018). (2018).
5. Schreuders, E. H. et al. Colorectal cancer screening: a global overview of 28. Shih-Chin, C. et al. mTOR- and HIF-1α-mediated aerobic glycolysis as
existing programmes. Gut 64, 1637–1649 (2015). metabolic basis for trained immunity. Science 345, 1250684 (2014).
6. Fontana, L. & Partridge, L. Promoting health and longevity through diet: from 29. Bianchi, G., Martella, R., Ravera, S., Marini, C. & Longo, V. D. Fasting induces
model organisms to humans. Cell 161, 106–118 (2015). anti-Warburg effect that increases respiration but reduces ATP-synthesis to
7. Longo, V. D. & Panda, S. Fasting, circadian rhythms, and time-restricted promote apoptosis in colon cancer models. Oncotarget 6, 11806 (2015).
feeding in healthy lifespan. Cell Metab. 23, 1048–1059 (2016). 30. Patterson, R. E. & Sears, D. D. Metabolic effects of intermittent fasting. Annu.
8. Nencioni, A., Caffa, I., Cortellino, S. & Longo, V. D. Fasting and cancer: Rev. Nutr. 37, 371–393 (2017).
molecular mechanisms and clinical application. Nat. Rev. Cancer 18, 707–719 31. Lien, E. C. & Vander Heiden, M. G. A framework for examining how diet
(2018). impacts tumour metabolism. Nat. Rev. Cancer 19, 651–661 (2019).
9. Luigi, F., Meyer, T. E., Samuel, K. & Holloszy, J. O. Long-term calorie 32. Brusselmans, K. et al. Squalene synthase, a determinant of Raft-associated
restriction is highly effective in reducing the risk for atherosclerosis in cholesterol and modulator of cancer cell proliferation. J. Biol. Chem. 282,
humans. Proc. Natl Acad. Sci. USA 101, 6659–6663 (2004). 18777–18785 (2007).
10. Eitan, E. et al. In a randomized trial in prostate cancer patients, dietary protein 33. Do, R., Kiss, R. S., Gaudet, D. & Engert, J. C. Squalene synthase: a
restriction modifies markers of leptin and insulin signaling in plasma critical enzyme in the cholesterol biosynthesis pathway. Clin. Genet. 75, 19–29
extracellular vesicles. Aging cell 16, 1430–1433 (2017). (2009).
11. Wei, M. et al. Fasting-mimicking diet and markers/risk factors for aging, 34. Coman, D. et al. Squalene synthase deficiency: clinical, biochemical, and
diabetes, cancer, and cardiovascular disease. Science Transl. Med. 9, eaai8700 molecular characterization of a defect in cholesterol biosynthesis. Am. J. Hum.
(2017). Genet. 103, 125–130 (2018).

35. Fukuma, Y. et al. Role of squalene synthase in prostate cancer risk and the proliferation in vitro with enhanced cyclin-dependent kinase-2 activity. J. Biol.
biological aggressiveness of human prostate cancer. Prostate Cancer Prostatic Chem. 279, 33079–33084 (2004).
Dis. 15, 339–345 (2012). 65. Song, B. L. et al. Human acyl-CoA:cholesterol acyltransferase 2 gene
36. Marinac, C. R. et al. Prolonged nightly fasting and breast cancer prognosis. expression in intestinal Caco-2 cells and in hepatocellular carcinoma.
JAMA Oncol 2, 1049–1055 (2016). Biochem. J. 394, 617–626 (2006).
37. O’Flanagan, C. H., Smith, L. A., Mcdonell, S. B. & Hursting, S. D. When less 66. Samuels, Y. et al. Mutant PIK3CA promotes cell growth and invasion of
may be more: calorie restriction and response to cancer therapy. BMC Med. human cancer cells. Cancer Cell 7, 561–573 (2005).
15, 106 (2017). 67. Brandhorst, S. et al. A periodic diet that mimics fasting promotes multi-system
38. Upadhyay, M., Samal, J., Kandpal, M., Singh, O. V. & Vivekanandan, P. The regeneration, enhanced cognitive performance, and healthspan. Cell Metab.
Warburg effect: insights from the past decade. Pharmacol. Therapeut. 137, 22, 86–99 (2015).
318–330 (2013). 68. Di Biase, S. et al. Fasting-mimicking diet reduces HO-1 to promote T cell-
39. Vernieri, C. et al. Targeting cancer metabolism: dietary and pharmacologic mediated tumor cytotoxicity. Cancer Cell 30, 136–146 (2016).
interventions. Cancer Discov. 6, 1315–1333 (2016). 69. Cheng, C. W. et al. Fasting-mimicking diet promotes Ngn3-driven beta-Cell
40. Masui, K. et al. mTOR complex 2 controls glycolytic metabolism in regeneration to reverse diabetes. Cell 168, 775–788.e712 (2017).
glioblastoma through FoxO acetylation and upregulation of c-Myc. Cell 70. Rangan, P. et al. Fasting-mimicking diet modulates microbiota and promotes
Metab. 18, 726–739 (2013). intestinal regeneration to reduce inflammatory bowel disease pathology. Cell
41. Adams, J. The proteasome: a suitable antineoplastic target. Nat. Rev. Cancer 4, Rep. 26, 2704–2719.e2706 (2019).
349–360 (2004).
42. Arlt, A. et al. Increased proteasome subunit protein expression and
proteasome activity in colon cancer relate to an enhanced activation of nuclear Acknowledgements
factor E2-related factor 2 (Nrf2). Oncogene 28, 3983–3996 (2009). We thank Ping Zhang for providing flow cytometry analyses and Jianping Zhang for
43. Fang, Y. et al. CD36 inhibits beta-catenin/c-myc-mediated glycolysis through providing microPET/CT imaging. We also thank Zhenhuan Zhao, Zhenhua Jiang, Jun Li,
ubiquitination of GPC4 to repress colorectal tumorigenesis. Nat. Commun. 10, Ping Wei, and Yi Qin for valuable comments and suggestions. This study was supported
3981 (2019). by, the National Key Research and Development Program of China (2018YFC2001904),
44. Sun, P. et al. Fasting inhibits colorectal cancer growth by reducing M2 National Natural Science Foundation of China (no. 81372101, no. 81873948, no.
polarization of tumor-associated macrophages. Oncotarget 8, 74649–74660 81871591 and no. 81572626), State Key Basic Research Program (973) project
(2017). (2015CB553404), the Shanghai Anticancer Association EYAS project (SACA-CY1B07),
45. Shechter, I. et al. Localization of the squalene synthase gene (FDFT1) to the Key Technology and Development Program of Shanghai (no.17411963400), Shanghai
human chromosome 8p22-p23.1. Genomics 20, 116–118 (1994). Municipal Commission of Health and Family Planning, Key Developing Disciplines
46. Zheng, L., Li, L., Lu, Y., Jiang, F. & Yang, X. A. SREBP2 contributes to cisplatin (2015ZB0104), the Shanghai Shenkang Hospital Development Center Clinical Science
resistance in ovarian cancer cells. Exp. Biol. Med. 243, 655–662 (2018). and Technology Innovation Project (SHDC12018105) and the 2018 Xin Chen Cup
47. Dehghani, M. et al. Relationship of SNP rs2645429 in farnesyl-diphosphate Young Anesthesiologist Training Grant.
farnesyltransferase 1 gene promoter with susceptibility to lung cancer. Int J.
Genomics 2018, 4863757 (2018). Author contributions
48. Salmond, R. J. mTOR regulation of glycolytic metabolism in T cells. Front. M.L.W., D.M., and C.H.M. designed the study; M.L.W., X.Y.C., H.L., Z.R.S., M.M.Z., and
Cell Develop. Biol. 6, 122 (2018). P.F.S. performed the experiments; Q.Y., Y.J.X., and N.J. analyzed the data; J.P.Z. and J.Z.
49. Saxton, R. A. & Sabatini, D. M. mTOR signaling in growth, metabolism, and provided reagents; M.L.W. and W.K.C. wrote the paper; M.L.W. and X.P.Z. revised
disease. Cell 168, 960–976 (2017). the paper.
50. Sabatini, D. M. Twenty-five years of mTOR: uncovering the link from
nutrients to growth. Proc. Natl Acad. Sci. USA 114, 11818–11825 (2017).
51. Hua, H. et al. Targeting mTOR for cancer therapy. J. Hematol. Oncol. 12, 71 Competing interests
(2019). The authors declare no competing financial interests.
52. Baselga, J. et al. Everolimus in postmenopausal hormone-receptor-positive
advanced breast cancer. N. Engl. J. Med. 366, 520–529 (2012).
53. Franz, D. N. et al. Efficacy and safety of everolimus for subependymal giant
Additional information
Supplementary information is available for this paper at https://doi.org/10.1038/s41467-
cell astrocytomas associated with tuberous sclerosis complex (EXIST-1): a
020-15795-8.
multicentre, randomised, placebo-controlled phase 3 trial. Lancet 381,
125–132 (2013).
Correspondence and requests for materials should be addressed to D.M., X.-p.Z. or
54. Yao, J. C. et al. Everolimus for the treatment of advanced, non-functional
C.-h.M.
neuroendocrine tumours of the lung or gastrointestinal tract (RADIANT-4): a
randomised, placebo-controlled, phase 3 study. Lancet 387, 968–977 (2016).
Peer review information Nature Communications thanks Marios Giannakis, Valter
55. Janku, F., Yap, T. A. & Meric-Bernstam, F. Targeting the PI3K pathway in
Longo and the other, anonymous, reviewer(s) for their contribution to the peer review of
cancer: are we making headway? Nat. Rev. Clin. Oncol. 15, 273–291 (2018).
this work. Peer reviewer reports are available.
56. Masoud, G. N. & Li, W. HIF-1 α pathway: role, regulation and intervention for
cancer therapy. Acta Pharmaceutica Sin. B 5, 378–389 (2015).
Reprints and permission information is available at http://www.nature.com/reprints
57. Kosinsky, R. L. et al. USP22 exerts tumor-suppressive functions in colorectal
cancer by decreasing mTOR activity. Cell Death Differ. 27, 1328–1340 (2019).
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in
58. Wang, H. et al. Targeting mTOR suppressed colon cancer growth through
published maps and institutional affiliations.
4EBP1/eIF4E/PUMA pathway. Cancer Gene Ther. 1–13. https://doi.org/
10.1038/s41417-019-0117-7 (2019).
59. Zhong, Z. et al. PORCN inhibition synergizes with PI3K/mTOR inhibition in
Wnt-addicted cancers. Oncogene 38, 6662–6677 (2019). Open Access This article is licensed under a Creative Commons
60. Chen, X. et al. DEPTOR is an in vivo tumor suppressor that inhibits prostate Attribution 4.0 International License, which permits use, sharing,
tumorigenesis via the inactivation of mTORC1/2 signals. Oncogene 39, adaptation, distribution and reproduction in any medium or format, as long as you give
1557–1571 (2019). appropriate credit to the original author(s) and the source, provide a link to the Creative
61. Semenza, G. L. Hypoxia-inducible factors: mediators of cancer progression Commons license, and indicate if changes were made. The images or other third party
and targets for cancer therapy. Trends Pharmacol. Sci. 33, 207–214 (2012). material in this article are included in the article’s Creative Commons license, unless
62. Zhuang, L., Kim, J., Adam, R. M., Solomon, K. R. & Freeman, M. R. indicated otherwise in a credit line to the material. If material is not included in the
Cholesterol targeting alters lipid raft composition and cell survival in prostate article’s Creative Commons license and your intended use is not permitted by statutory
cancer cells and xenografts. J. Clin. Investig. 115, 959–968 (2005). regulation or exceeds the permitted use, you will need to obtain permission directly from
63. Li, Y. C., Park, M. J., Ye, S. K., Kim, C. W. & Kim, Y. N. Elevated levels of the copyright holder. To view a copy of this license, visit http://creativecommons.org/
cholesterol-rich lipid rafts in cancer cells are correlated with apoptosis licenses/by/4.0/.
sensitivity induced by cholesterol-depleting agents. Am. J. Pathol. 168,
1107–1118 (2006).
64. Duncan, R. E., El-Sohemy, A. & Archer, M. C. Mevalonate promotes the © The Author(s) 2020
growth of tumors derived from human cancer cells in vivo and stimulates

Fasting Inhibits Aerobic Pathway, Cancer

Uploaded by

Copyright:

Available Formats

Fasting Inhibits Aerobic Pathway, Cancer

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Fasting Inhibits Aerobic Pathway, Cancer

Uploaded by

Copyright:

Available Formats

ARTICLE

Fasting inhibits aerobic glycolysis and proliferation

NATURE COMMUNICATIONS | (2020)11:1869 | https://doi.org/10.1038/s41467-020-15795-8 | www.nature.com/naturecommunications 1

2 NATURE COMMUNICATIONS | (2020)11:1869 | https://doi.org/10.1038/s41467-020-15795-8 | www.nature.com/naturecommunications

a b CT26 DAPI EDU Merge

Relative fold of EDU

50 Vinculin 124 kDa

NATURE COMMUNICATIONS | (2020)11:1869 | https://doi.org/10.1038/s41467-020-15795-8 | www.nature.com/naturecommunications 3

4 NATURE COMMUNICATIONS | (2020)11:1869 | https://doi.org/10.1038/s41467-020-15795-8 | www.nature.com/naturecommunications

Fdft1 relative expression by iTRAQ

Fdft1/actin mRNA ratio

8.4 4000 0.010

8.1 2000 0.005

Fdft1 48 kDa Fdft1 48 kDa

Vincullin 124 kDa

40 P < 0.0001 Tumor

Relative Fdft1 expression

High expression 15,000

NATURE COMMUNICATIONS | (2020)11:1869 | https://doi.org/10.1038/s41467-020-15795-8 | www.nature.com/naturecommunications 5

6 NATURE COMMUNICATIONS | (2020)11:1869 | https://doi.org/10.1038/s41467-020-15795-8 | www.nature.com/naturecommunications

Fdft1/GAPDH mRNA ratio

h i CT26 DAPI EDU Merge j

Relative fold of EDU positive cells

0.5 sh1 1.0

k CT26 Con pcDNA-NC pcDNA-Fdft1

NATURE COMMUNICATIONS | (2020)11:1869 | https://doi.org/10.1038/s41467-020-15795-8 | www.nature.com/naturecommunications 7

8 NATURE COMMUNICATIONS | (2020)11:1869 | https://doi.org/10.1038/s41467-020-15795-8 | www.nature.com/naturecommunications

0.5 Vincullin 124 kDa Vincullin 124 kDa

g Normal diet + FMD +

Normal diet + CT26 Fdft1 3

j Normal diet + Fdft1 knockdown k

NATURE COMMUNICATIONS | (2020)11:1869 | https://doi.org/10.1038/s41467-020-15795-8 | www.nature.com/naturecommunications 9

10 NATURE COMMUNICATIONS | (2020)11:1869 | https://doi.org/10.1038/s41467-020-15795-8 | www.nature.com/naturecommunications

Fdft1 48 kDa Fdft1 48 kDa

Vinculin 124 kDa Vinculin 124 kDa

CT26 SW620 CT26 SW620

mTOR 289 kDa mTOR 289 kDa

ECAR (mpH/min/105 cells)

ECAR (mpH/min/105 cells)

OD value (450 nm)

k l CT26 m Con Si-1 Si-2 Con Si-1 Si-2

150 FCCP Rotenone

NATURE COMMUNICATIONS | (2020)11:1869 | https://doi.org/10.1038/s41467-020-15795-8 | www.nature.com/naturecommunications 11

12 NATURE COMMUNICATIONS | (2020)11:1869 | https://doi.org/10.1038/s41467-020-15795-8 | www.nature.com/naturecommunications

OCR (pmol/min/105 cells)

Relative lactate production

Relative glucose uptake

ECAR (mpH/min/105 cells)

Relative lactate production

OCR (pmol/min/105 cells)

Fdft1 289 kDa Fdft1 48 kDa

HK2 102 kDa

Vinculin 124 kDa 1.5

m CT26 Con 0.0

0 Vinculin 124 kDa

NATURE COMMUNICATIONS | (2020)11:1869 | https://doi.org/10.1038/s41467-020-15795-8 | www.nature.com/naturecommunications 13

14 NATURE COMMUNICATIONS | (2020)11:1869 | https://doi.org/10.1038/s41467-020-15795-8 | www.nature.com/naturecommunications

800 Rap 1mg/kg

Tumor volume (mm3)