Int. J. Environ. Sci. Technol.

DOI 10.1007/s13762-017-1294-2

ORIGINAL PAPER

Assessment of bacterial diversity associated with crude

oil-contaminated soil samples from Assam
R. Baruah1,2 • S. K. Mishra2,3 • D. J. Kalita4 • Y. Silla1 • P. S. Chauhan3 •

A. K. Singh1 • H. P. Deka Boruah1

Received: 19 July 2016 / Revised: 27 December 2016 / Accepted: 21 February 2017

Ó Islamic Azad University (IAU) 2017

Abstract In this study, we are reporting bacterial diversity bacterial milieu in the presence of crude oil contaminants.
in crude oil-contaminated soil of Assam, India. Integration Metabolic fingerprints data depicted in PCA plot demon-
of physiological community profiling, culture-dependent strated that sites CTF-D-1 and Core-10 were most
and culture-independent (metagenome) approaches, was diverged. It was further confirmed that variations of bac-
employed to obtain a complete picture of the total bacterial terial species dominance in different sites were due to
diversity. Samples collected from 10 sites contaminated origin of hydrocarbon contamination. We here claim that
with crude oil ranging from 0.22 to 89.36% were analysed, the present findings is a first-hand report on combined
and altogether 160 culturable bacteria were isolated (117 physiological community profiling, culture-based and cul-
Gram-positive and 43 Gram-negative bacteria). Molecular ture-independent approaches in assessing total bacterial
identification showed the predominance of genera Lysini- diversity in crude oil-contaminated soil of Assam.
bacillus, Alcaligenes, Bacillus, Clostridium, Enterobacter
and Pseudomonas. Conversely, denaturing gradient gel Keywords Hydrocarbon contamination  Bacterial
electrophoresis (DGGE) profiles of 16S rDNA phylotypes diversity  DGGE  Soil enzymes  CLPP
showed the predominance of Sphingomonas, Ralstonia,
Sphingobium, Massilia, Acinetobacter and Pseudomonas.
Both culture-dependent and culture-independent approa- Introduction
ches resulted in 11 genera of which Bacillus and Pseu-
domonas were the key inhabitants creating most favourable The inherent problem associated with hydrocarbon con-
tamination caused by anthropogenic activities of crude oil
drilling, exploration, refining, transport and storage has led
Editorial responsibiility: Zhenyao Shen. to making these compounds recalcitrant environmental
pollutants (Allen et al. 2007; Paisse et al. 2008; Mnif et al.
Electronic supplementary material The online version of this
article (doi:10.1007/s13762-017-1294-2) contains supplementary
2009; Lu et al. 2012). Studies have reported that hydro-
material, which is available to authorized users. carbon-contaminated environments are inhabited by
microorganisms which selectively grow and utilize petro-
& P. S. Chauhan leum hydrocarbons as carbon source for growth and
puneetnbri@gmail.com
development (Liu and Liu 2013; Beazley et al. 2012;
1
Biotechnology Division, CSIR-North-East Institute of Bargiela et al. 2015). Earlier studies also established that
Science and Technology, Jorhat, Assam 785006, India the presence of hydrocarbons determines the dominance of
2
Academy of Scientific and Innovative Research, New Delhi, specific microbes (Vila et al. 2010; Hazen et al. 2010).
India Various reports on variations of bacterial diversity in the
3
Division of Plant–Microbe Interaction, CSIR-National presence of hydrocarbons in an environment have shown
Botanical Research Institute, Rana Pratap Marg, Lucknow that the presence of hydrocarbon contaminants often leads
226001, India to selective enrichment of hydrocarbon-utilizing bacteria
4
Department of Chemistry, OIL, Duliajan, India (Abed et al. 2002; Saul et al. 2005; Hamamura et al. 2006).

123
 Int. J. Environ. Sci. Technol.

Thus, determination of community structure of hydrocar- Crude oil-contaminated areas in Assam are stretched to
bon-contaminated sites is required for getting first-hand a large extent, have persisted for long duration and are
information on microbial diversity (Albokari et al. 2015). mostly untapped (Gogoi et al. 2003; Yenn et al. 2014; Roy
Conventionally, characterization of microbial commu- et al. 2014). Thus, these sites have a high likelihood of
nity in contaminated soil was limited to culturing harbouring large diversity of unidentified bacteria that may
microorganisms from environmental samples termed as have the ability to grow under hydrocarbon stressed and
culture-dependent approach. Hydrocarbon-contaminated their utilization as bio-formulations may restore the envi-
soils appear to be more favourable to conventional culture- ronment. Recently, Li et al. (2015) and Howard and
dependent sampling than other soils; the reason being Howard (2016) had shared a vision to collaborate all
hydrocarbon contamination often leads to a shrink in environmental researchers towards a common goal, the
microbial diversity (Bell et al. 2013; Saul et al. 2005; Kim ‘‘New Silk Road’’ for both beneficially and sustainably
et al. 2015; Abbasian et al. 2016). Consequently, a minimal minimizing environmental degradation. In the present
sampling effort is required to isolate a representative frac- study, we attempt to determine the soil physicochemical
tion of the active community inhabiting those sites. In profiles, soil enzymes and bacterial diversity of 10 hydro-
culture-dependent methods, only a small part approximately carbon-contaminated sites of Duliajan and Jorajan districts
[3% of the microorganisms that inhabit soil contaminated in Assam state. To the best of our knowledge, this is the
with hydrocarbons could be cultured in the laboratory, and first report where we demonstrate the bacterial diversity
the rest[97% remain unreported (Macnaughton et al. 1999; associated with hydrocarbon-contaminated soil sites of
Keller and Zengler 2004; Achtman and Wagner 2008). Duliajan and Jorajan districts in Assam for its further
Hydrocarbon contaminants have been reported to restrain exploitation as a source for bioremediation purposes.
growth of certain responsive microbial groups (Santos dos
et al. 2011) and selectively trigger subgroups like that of the
Actinobacteria and Proteobacteria (Bell et al. 2013, 2014; Materials and methods
Jung et al. 2016). Selectivity of growth media, lack of
knowledge of the actual conditions under which most Site description, soil physical and chemical analysis
bacteria grow in soil, problems with soil sampling, recog-
nition of small cell size bacteria and bacterial viability are Crude oil-contaminated samples were collected from dif-
critical limitations when trying to gain an understanding of ferent locations operated under Oil India limited, Duliajan
bacterial diversity and community structure in soil. The of Tinsukia District. Sampling was done randomly at ten
understanding of microbial diversity has been extended by oil drilling-contaminated sites of Duliajan (27°210 4200 N,
culture-independent studies, which involve comparative 95°190 600 E) and Jorajan (95°110 –95°300 E; 27° 060 –27°
analysis of gene sequences directly from DNA extracted 220 N) of Dibrugarh and Tinsukia, Assam (Fig. 1). Soil,
from the environmental samples. It seems likely that the sludge and mud samples from different locations of crude
uncultured majority provides a vast, unexploited reservoir oil-contaminated sites were collected at random to a depth
of useful enzymes and biological probes. Therefore, inte- of 0–10 cm. To represent uniformity, bulk samples were
gration of culture-dependent and culture-independent prepared by mixing minimum five to ten samples collected
(metagenome) approaches is essential to get a complete from each location and mixed well. From these homoge-
picture of total bacterial diversity (Vaz-Moreira et al. 2011; nous bulk samples, minimum three representative samples
Beazley et al. 2012; Mason et al. 2012; Liu and Liu 2013; were collected and immediately stored at 4 °C and taken to
Kimes et al. 2013; Stefani et al. 2015). Approaches for the laboratory for analysis. Samples were analysed for their
predicting total bacterial diversity include PCR amplifica- total hydrocarbon, pH, moisture content, soil organic car-
tion of 16S rRNA genes from cultured isolates (Aislabie bon (SOC), soil enzyme activities and total bacterial count.
et al. 2004; Saul et al. 2005; Roy et al. 2014); 16S rRNA V3 For total hydrocarbon content, 5 g of contaminated sample
region amplified directly from soil DNA, followed by was taken in a glass beaker and extracted with diethyl
denaturing gradient gel electrophoresis (DGGE) profiling ether. The solvent was then filtered out into another fresh
and sequencing specific amplicon (Muyzer et al. 1998; glass beaker. The process was repeated minimum three
MacNaughton et al. 1999; Vinas et al. 2005; Greer et al. times or till the soil was found to be free of the oil content.
2010), phylogenetic analysis and community-level physio- The solvent obtained from all the extraction steps was
logical profiling through carbon utilization pattern (Mishra pooled together. This filtrate was then allowed to dry under
and Nautiyal 2009; Nautiyal 2009). Integration of both room temperature and weighed. The amount of dried fil-
culture-dependent and culture-independent methods is trate is equal to the total hydrocarbon content in the con-
crucial in getting a complete representation of total bacte- taminated sample and expressed as percentage (%). The
rial diversity. process was repeated minimum three times. The filtrate

123
Int. J. Environ. Sci. Technol.

Fig. 1 Schematic representation of study sites in Assam

obtained was dried and weighed. pH of the contaminated Urease activity of the samples was measured following the
sample was estimated in sample/water suspension (1:2.5) method of McGarity and Mayers, (1967) for which to 1 g
using pH meter (Eutech, Malaysia); moisture content was of sample, 1 ml of toluene was poured and allowed to stand
determined gravimetrically by drying the samples at 70 °C for 15 min. Subsequently, 10 ml buffer (pH 7) and 5 ml of
until constant weight. Total SOC was determined accord- 10% urea solution were added and incubated for 3 h at
ing to Walkley and Black (1934) Total organic carbon of 37 °C, adjusted to 100 ml with distilled water, mixed
the samples was determined according to Walkley and thoroughly and filtered through Whatman No. 5 filter
Black (1934). Briefly, to 1 g sample 10 ml of 1 N potas- paper. From this filtrate, 0.5 ml was taken and made to
sium dichromate and 20 ml of concentrated H2SO4 were 30 ml with distilled water and treated with 2 ml phenolate
added, agitated for about a minute and allowed to stand for solution and 1.5 ml sodium hypochlorite solution. Absor-
30 min. Following this, 200 ml distilled water, 10 ml bance was read at 630 nm. The amount of NH4?-N
orthophosphoric acid and 1 ml diphenylamine indicator released was calculated by a reference calibrated curve and
were added. The solution was than titrated against standard expressed as NH?–N mg per gm dry sample per 3 h.
ferrous ammonium sulphate (FAS) till bluish green colour. Phosphatase activity was determined as per by Tabatabami
Organic carbon is calculated in percentage. Dehydrogenase and Bremner (1969). To 1 g sample, 4 ml of universal
activity was estimated by using 2,3,5-triphenyl tetrazolium buffer, 0.25 ml of toluene and 1 ml of 0.115 ml p-nitro
chloride (TTC) red technique (Casid et al. 1964). To 1 g phenyl phosphate solution were added and incubated at
fresh sample, 0.1 gm of CaCO3 and 1 ml of TTC solution 37 °C for 1 h. One milligram of 0.5 M CaCl2 and 0.5 M
were added in 3 replicates each and incubated at 30 °C for NaOH solution were introduced to the mixture. The sus-
24 h. The resulting slurry was passed through Whatman pension was filtered through Whatman No. 1 filter paper,
No. 1 filter paper and extracted with successive aliquots of and optical density was measured at 430 nm. The phos-
methanol, adjusted to 50 ml and read at 485 nm using phatase activity was calculated in terms of concentration of
Specord 210 UV–Vis spectrophotometer (Analytikjena). PNP in each sample from a standard curve of PNP in water
Dehydrogenase activity of the samples per gm was and expressed as mole of PNP released per g dry sample
expressed in terms of lg TPF per g dry sample per 24 h. per hour.

123
 Int. J. Environ. Sci. Technol.

Crude oil fractionation, i.e. asphaltene, resin, wax, ali- TGTTACGACTT (Weisburg et al. 1991) with reaction
phatic/aromatic fraction, was separated according to Yenn conditions set at 94 °C for 5 min, followed by 35 cycles of
et al. (2014). To 5 g of crude oil, 150 ml of n-heptane was 94 °C for 30 s, 52 °C for 45 s and 72 °C for 1.30 min and
added and heated under reflux conditions at 100 °C for 1 h then final extension at 72 °C for 10 min. 16S rDNA
in a round-bottom flask. The flask was with stopper and amplicon from each strain was sequenced, and the data
allowed to cool under dark condition for 2 h. The content were searched using NCBI-BLAST (http://www.ncbi.nlm.
was then filtered through Whatman No. 42 filter paper nih.gov/blast) search tool for identification of the strain
without agitation. The residue obtained was asphaltene and type.
was dried and weighed for further experiments. The filtrate
then was absorbed in 120 g of silica gel and heated in a Soil DNA extraction and 16S rRNA gene PCR
water bath for 1 h with continuous stirring. The resulting amplification
material was then allowed to stand undisturbed overnight
and then filtered. The residue obtained after filtration was DNA was extracted from approximately 0.5 g of soil using
collected and washed with distilled water, dissolved in a UltraCleanTM soil DNA isolation kit (Mo Bio, CA, USA)
toluene–methanol (90:10) mixture and dried in a boiling following the manufacturer’s instructions. Further, the V3
water bath, and the dried fraction was weighed to estimate region of 16S rRNA gene from these metagenomic DNA
the percentage of resin. The filtrate was heated in an oven samples was obtained by the partial amplification of the
briefly, treated with 5 ml of H2SO4 and then allowed to respective gene using specific primers 341f and 518r
cool down to room temperature. The wax solution was (Muyzer et al. 1998). Briefly, PCR mixture was carried out
decanted and washed with warm water and ammonium in 50 ll volume consisting of 1.0 U Taq polymerase, 1X
hydroxide solution several times till the acid in it got PCR buffer, 1.5 mM MgCl2, 200 mM of each dNTPs,
removed. Then, the crude wax thus obtained was dissolved 10 lM of each primer (forward and reverse) and 20–30 ng
in ethylene chloride (CHCl2), cooled to around 32 °C and of soil DNA. PCR-grade water was used as a negative
filtered through a cold filter funnel, and the wax was col- control in PCR. The resultant amplicons were elec-
lected. The filter funnel was washed with hot n-heptane trophoresed to check their integrity against 100-bp DNA
solvent and collected in a weighed flask. The collected ladder (Thermo Scientific, USA) using image acquisition
material was evaporated and dried to obtain the residual software (Universal Hood III, Bio-Rad, USA). Thermal
aliphatic and aromatic components. cycling was done in an GENEI-TC3000 thermocycler
(GENEI, India) with the conditions given hereunder: 3 min
Enumeration and isolation of bacterial strain initial denaturation at 94 °C; 35 cycles of 30 s denaturation
at 94 °C, 30 s annealing at 58 °C and 60 s elongation at
Enumeration of bacterial population was done as described 72 °C; and a 10-min final elongation. PCR amplicons were
by Roy et al. (2014) and expressed as log10. Briefly, serial further subjected for DGGE-based fingerprinting analysis
dilution technique followed by plating on nutrient agar and then sequencing.
(NA), Reasoneŕs 2A agar (R2A), Pikovskaya, N2-Free
media and mineral media M1 with crude oil as carbon DGGE Profiling and 16S rRNA gene sequencing
source was done for isolating colonies. The incubation
temperature was maintained at 30 °C for 24 h. Morpho- Gels comprising of 40% (w/v) polyacrylamide (37.5:1
logically distinct colonies were picked and purified in fresh acrylamide/bisacrylamide) were cast using a Universal
NA plates. The purity was further confirmed microscopi- Mutation Detection System (DcodeTM, Bio-Rad, USA) for
cally. Morphological and biochemical properties of each denaturing gradient gel electrophoresis (DGGE) analysis.
isolate were documented as described in Cappuccino and The gels had a linear gradient from 40 to 60% denaturant,
Sherman laboratory manual (1998) and Bergey’s Manual where 100% denaturing acrylamide contained 7 M urea
of determinative bacteriology (Weeks and Breed 1957). and 40% (v/v) formamide (Muyzer et al. 1998). Elec-
trophoresis was conducted for 16 h at 60 V at a constant
Identification of bacterial strains by 16S rDNA temperature of 60 °C in 7 L of 1 9 TAE. The gels were
sequencing analysis stained in ddH2O containing 0.5 mg l-1 ethidium bromide
for 10 min, and the gel images were digitally captured
Bacterial genomic DNA was extracted from the isolates using image acquisition software (UVITEC, GENEI,
obtained using GenElute bacterial genomic DNA kit India). Any bands migrating to the same position in the gel
(Sigma Aldrich). PCR amplification of the genomic DNA were assumed to be identical amplicons. The DGGE bands
was carried out using the universal 16S rDNA primers fD1 were excised from the gel using a sterile scalpel and
AGAGTTTGATCCTGGCTCAG and rP2 ACGGCTACCT incubated for 24 h at 4 °C. Further, PCR was done with the

123
Int. J. Environ. Sci. Technol.

same primers devoid of GC-clamp, and the resultant Results and discussion
amplicons were outsourced for sequencing (3130xl
Applied Biosystems, ABI, USA). Physicochemical properties

Phylogenetic analysis A schematic map of the study site is depicted in Fig. 1. Site
description and characteristics of samples are summarized
To determine evolutionary relationship among the bacterial in Table 1. The total hydrocarbon content of the contami-
isolates as well as the uncultured 16S rRNA V3 sequences, nated soil was obtained in a range of 0.40–89.36% as
the gene sequence were compared against those obtained revealed by gravimetric assessment. Of the total samples,
from GenBank database using NCBI-Blast as mentioned 90% were of basic pH (7.8–9.1). The sample collected
above and Seqmatch tool (Cole et al. 2007). Multiple from Core-10 site was found to have significantly different
sequence alignment was carried out using ClustalW (http:// properties as compared to the other study sites. Organic
www.ebi.ac.uk/clustalw/) sequence alignment tool. Phylo- carbon content was found to be high in all the soil samples,
genetic tree was then constructed using the neighbour- ranging from 1.38 (in CTF-D-1) to 6.9 (in CTF-D2-2 and
joining method of MEGA6 program (Tamura et al. 2013). Core-10). Exceptionally low moisture content was found in
Branching orders of the trees were ascertained and com- the core sample compared to the others. Overall, a signif-
pared using distance-based neighbour-joining algorithms icantly different moisture content for Core-10 (1.25%),
with Kimura two-parameter corrections to improve the peat water samples PWS-J-4 (52.5%), PWS-DGU-7
reliability of internal branches (Kimura 1980). (38.8%) and drilling fluid site DF-MJ-3 (30.6%) was
observed. The variations in physical and chemical prop-
Carbon source utilization pattern-based community- erties of hydrocarbon-contaminated soils were mainly due
level physiological profiling to the source of hydrocarbon contamination as well as the
extent of crude oil contamination.
Metabolic fingerprint of microbial community were
obtained from Biolog Ecoplates (Biolog, Inc, Hayward, Soil enzyme activity
CA, USA). Utilization of 31 different carbon sources in
triplicate was analysed by inoculating the plates with Considerable differences in soil enzyme activity were
aqueous preparation of samples. Data were recorded at found among the samples (Fig. 1). Highest amount of
every 24-h interval till day 7 at 590 nm. The results dehydrogenase (68.6 ± 0.01 lg/g of fresh soil/h), alkaline
obtained on 7th day were used for comparison. Microbial phosphatase (8.2 ± 0.01 lg/g of fresh soil/hr) and neutral
activity in each microplate was expressed as average well phosphatase (2.9 ± 0.03 lg/g of fresh soil/h) activity was
colour development (AWCD) (Garland 1996). Shannon found for the samples collected from CC1-J-5 site. Nev-
diversity and evenness indices were calculated following ertheless, urease enzyme activity was found to be higher in
the method as described by Staddon et al. (1997) and site NCC-J-8 (0.002 ± 0.004 lg/g of fresh soil/h). From
Nautiyal (2009). the observation, it was noticed that compared to dehydro-
genase and phosphatase activities, very low urease activi-
Statistical analyses ties were observed in the hydrocarbon-contaminated soil.
In addition, Pearson correlation analysis revealed a sig-
All the data were mean of three independent experiments nificant positive correlation between the bacterial colony
each. All the data were subjected to analysis of variance counts on crude oil supplemented media (r = 0.6, 0.7) and
(ANOVA) after normalization, and significant differences the total hydrocarbon and organic carbon content (as
among the study sites were compared at p \ 0.01 accord- shown in supplementary table S1). The positive correlation
ing to Tukey’s test. Data related to CFU were converted may be due to the selective preference of bacterial growth.
into logarithmic values, before statistical analysis. Further,
to establish the relationship on physiological community Cultivable bacterial diversity
profiling of each site based on carbon source utilization
pattern, principal component analysis (PCA) was per- Using culture-dependent approach, a total of 160 mor-
formed. For this, dimension reduction in the Biolog data of phologically distinct culturable strains were isolated from
10 soil samples was normalized and transformed as the 10 different crude oil-contaminated sites using different
described by Weber et al. (2007). Statistical analysis was culture media (Table 1). Based on Gram staining, bio-
performed using IBM SPSS Statistics 20 software (version chemical and morphological observation 117 strains were
16.0). found to be Gram-positive bacteria and the rest 43 strains

123
 Table 1 Physical, chemical and biological characteristics of oil-contaminated soil of Assam used for isolation of hydrocarbonoclastic bacteria

123
Sample Description Total pH Moisture Organic Soil enzymes (lg/g fresh soil/hour) Total no. of
ID hydrocarbon content (%) carbon (%) morphologically
(%) Dehydrogenase Neutral Alkaline Urease distinct isolates
phosphatase phosphatase picked
a
CTF-D-1 Oil sludge pit central tank 15.8 ± 0.07c 9.1 ± 0.3 66.6 ± 0.3a 1.4 ± 0.07a 14.5 ± 0.1c 0.2 ± 0. 02c 1.1 ± 0.003c 0.001 ± 0.005a 52
farm (CTF), Duliajan
CTF-D2-2 Sludge having mostly crude 89.4 ± 0.02a 8.8 ± 0.3a 10.1 ± 0.3f 6.9 ± 0.2a 22.7 ± 0.1b 0.1 ± 0. 04c 0.5 ± 0.001d 0.001 ± 0.005a 13
oil, CTF, Duliajan
DF-MJ-3 Mud sample (drilling fluid) 1.1 ± 0.02e 8.6 ± 0.1a 30.6 ± 0.4d 6.9 ± 0.3a 10.4 ± 0.2d 0.5 ± 0.1c 0.4 ± 0.004d 0.001 ± 0.001a 21
DGU drilling site, Jorajan
PWS-J-4 Mud like peat water sample 0.04 ± 0.02e 8.9 ± 0.2a 52.5 ± 0.3b 5.4 ± 0.2a 11.8 ± 0.1d 0.3 ± 0.1c 0.5 ± 0.001d 0.001 ± 0.081a 14
DGU drilling site, Jorajan
CC1-J-5 Crude oil-contaminated soil 14.6 ± 0.02c 8.0 ± 0.2a 11.1 ± 0.3e 5.4 ± 0.3a 68.6 ± 0.2a 2.9 ± 0.2a 8.1 ± 0.01a 0.001 ± 0.003a 12
sample (1) near Jorajan
drilling site
CC2-J-6 Crude oil-contaminated soil 38.5 ± 0.05b 7.9 ± 0.2a 10.8 ± 0.3f 5.6 ± 0.2a 11.2 ± 0.1d 0.64 ± 0.5bc 2.9 ± 0.01b 0.001 ± 0.001a 13
sample (2) near Jorajan
drilling site
cd
PWS- Peat water sample DGU 0.2 ± 0.02e 8.7 ± 0.2a 38.8 ± 0.4c 3.7 ± 0.05a 3.7 ± 0. 2e 0.2 ± 0.1c 0.9 ± 0.001 0.002 ± 0.001a 11
DGU-7
cd
NCC-J-8 Soil taken from areas near 1.9 ± 0.01de 8.6 ± 0.3a 11.1 ± 0.3ef 2.2 ± 0.3a 11.8 ± 0. 8 0.5 ± 0.1c 0.9 ± 0.001d 0.002 ± 0.004a 11
contaminated sites in
Jorajan
GDS-J-9 Contaminated soil sample 3.0 ± 0.02d 8.8 ± 0.2a 67.1 ± 0.3a 4.7 ± 0.2a 25.7 ± 0. 5b 1.1 ± 0. 6b 2.3 ± 0.001b 0.001 ± 0.000a 8
abandoned gas drilling site,
Jorajan
g
Core-10 Core sample depth *3600 m 0.4 ± 0.04e 3.0 ± 0.2a 1.25 ± 0.2 6.9 ± 0.2a 11.4 ± 0. 6d 0.1 ± 0. 1c 0.3 ± 0.001d 0.002 ± 0.007a 5
(Eocene formation)
Data shown are mean of three individual observations. SD value followed by similar letter denotes no significant difference
The samples were collected on March, 1, 2013 from Duliajan and Jorajan of Dibrugarh and Tinsukia districts, respectively. The photograph of the sites is shown in Fig. 1. The outdoor
temperature during collection was 26 °C and an average sunny day. The area was contaminated more than a decade with crude oil. The Core-10 sample collected is distinctively different from
the others having a pH of 3. This was collected from a depth of around 3600 m (Eocene formation) that is characterized by large sequestration of carbon dioxide in the form of methane
clathrate, coal and crude oil that reduced the atmospheric carbon dioxide
Int. J. Environ. Sci. Technol.
Int. J. Environ. Sci. Technol.

were identified as Gram-negative bacteria. Highest number unit (OTU) were successfully sequenced (Fig. 4,
of bacterial colonies (n = 52) were identified from the Table S3). From this analysis, it was confirmed that the
CTF-D-1 site, whereas only 5 isolates could be collected bacterial community mainly originated from the genera
from Core-10 site. The order of bacterial population was Sphingomonas, Ralstonia, Sphingobium, Massilia, Acine-
highest in site CTF-D-1 followed by DF-MJ-3 [ PWS-J- tobacter and Pseudomonas. Further, DGGE fingerprints of
4 [ CTF-D2-2, CC2-J-6 [ CC1-J-5 [ PWS-DGU-7, each site were analysed to identify the species richness and
NCC-J-8 [ GDS-J-9 [ Core-10, respectively. The varia- diversity of the crude oil-contaminated sites (Fig. S2).
tion in the number of isolates was mainly due to the dif- Among the sites, PWS-J-4 was found to have highest
ferences in the TPH levels in these sites. bacterial richness (*11) and bacterial diversity (*2.3),
Based on the sequence similarity of 136 strains that were whereas CC1-J-5 site was found to have least bacterial
obtained from 160 isolates, we found that the majority of diversity as well as bacterial richness. Form the observa-
the strains belonged to the phylum Proteobacteria (Be- tion, we found that the lowest degree of crude oil con-
taproteobacteria-2, Gammaproteobacteria-17) and Fermi- tamination showed the maximum species richness and
cutes (Bacilli-115, Clostridia-2), under the genus hence the highest diversity.
Enterobacter, Pseudomonas, Alkaligenes, Bacillus,
Lysinibacillus and Clostridium. List of bacterial strains Carbon source utilization pattern-based community-
identified in the present study along with their closest rel- level physiological profiling
atives from NCBI database is shown in table S2. From the
observation, it was found that, in site CTF-D-1 the pres- Evaluation of community-level physiological profiling
ence of genera Enterobacter, Pseudomonas, Bacillus, based on carbon utilization pattern, a significantly different
Lysinibacillus and Clostridium, in site CTF-D2-2 Enter- Shannon diversity (p \ 0.05), Simpson diversity index and
obacter, Bacillus and Alkaligenes, in site DF-MJ-3 McIntosh evenness was observed in CTF-D-1 and Core-10
Clostridium, Bacillus, Lysinibacillus and Paenibacillus, in than in the other study site (Table 3). Principal component
sites PWS-J-4, CC2-J-6 and PWS-DGU-7 Pseudomonas, analysis (PCA) also showed no distinct association
Bacillus and Lysinibacillus, in site CC1-J-5 Pseudomonas, (Fig. 5). It was found that Core-10 (V10) was most diverse,
Bacillus, Exiguobacterium and Lysinibacillus, in site NCC- indicating the presence of significantly different microbial
J-8 Bacillus and Lysinibacillus, in site GDS-J-9 Bacillus, community. Similar to culture-dependent and culture-in-
Lysinibacillus and Alkaligenes and in site Core-10 Pseu- dependent approach, in physiological community profile
domonas and Bacillus were identified (Table 2). The we observed that source and crude oil contamination
dominance of genus Enterobacter, Pseudomonas, Bacillus, affected the overall microbial community-level physio-
Lysinibacillus, Alkaligenes and Clostridium could be due to logical activities.
their adaptability to the presence of crude oil and their Among other ecological niche crude oil-contaminated
ability to use petroleum hydrocarbons as carbon source for environment is one of the ecologically degraded environ-
growth processes. ments which harbour numerous bacteria (Aislabie et al.
2004; Saul et al. 2005). The microbes inhabited in crude
Culture-independent bacterial community profiling oil-contaminated environments determine the fate of crude
oil in nature. Therefore, assessment of diversity and species
In order to obtain the uncultured bacterial diversity asso- richness of microbial population in crude oil-degraded
ciated with crude oil-contaminated sites, soil metagenome environment is being given utmost important (Hazen et al.
isolation followed by DGGE of PCR-amplified 16S rDNA 2010; Beazley et al. 2012; Liu and Liu 2013). Assam
fragments was carried out (Fig. 2). All the 10 sites showed houses many crude oil-contaminated environments which
prominent DGGE banding profiles, having a total of 33 have emerged as major matter of concern. In our previous
bands, of which 9 were unique, while the others were study, we have compared bacterial diversity in different
present in two or more sites. Highest number of bands locations of Sivasagar and Jorhat districts and maximum of
(n = 11) were observed in PWS-J-4 site, showing maxi- oil-contaminated soil environment was found to contain
mum species richness. Dendrogram obtained from clus- 15.0–56.0% (Roy et al. 2014; Yenn et al. 2014; Das et al.
tering of all the sites based on DGGE banding patterns of 2015), whereas in the present study, the origin and nature
the 10 sites is shown in Fig. 3. From this analysis, 6 distinct of contamination were quite different (Table 1). Overall
clades were identified with sites CC1-J-5 and CC2-J-6 as hydrocarbon content in the present study was fairly high
two separate branches and CTF-D-1 and CTF-D2-2; PWS- and ranged from 0.04 to 89.36% which was due to bottom
DGU-7 and GDS-J-9; NCC-J-8 and Core-10; and DF-MJ-3 water tank sludge, drilling fluid, drilling sites, etc. The
and PWS-J-4 comprising the four clades. From the DGGE highest soil organic carbon (6.99%) was found in mud
profile, 17 distinct bands, referred as operational taxonomic sample, whereas lowest (1.38%) was seen for oil sludge

123
 Table 2 Comparative analysis of bacterial isolates from 10 crude oil-contaminated sites under study
Strain Sites under study
CTF-D-1 CTF-D2-2 DF-MJ-3 PWS-J-4 CC1-J-5 CC2-J-6 PWS-DGU-7 NCC-J-8 GDS-J-9 Core-10

Enterobacter KF843695 (R1)

123
hormaechei
KF843696 (R2)
KF843700 (R11)
Enterobacter sp. KM459022 (R3) KJ499800 (RC4)
KF843698 (R8)
KM459025 R15)
Pseudomonas putida KF843697 (R5) KU752847
(R89)
KU752806 (R39)
Clostridium sp. KM459023 (R6) KU752884
(RP1)
Lysinibacillus KM459024 (R7) KU752845 KU752854
sphaericus (R87) (R96)
Enterobacter cloacae KF843699 (R9)
Pseudomonas stutzeri KJ499784 (R16) KJ499802
(RC11)
Bacillus sp. KJ499785 (R17) KU752828 KU752839 KU752865 KU752869 KU752892
(R61) (R80) (R107) (R111) (RR3)
KJ499789 (R21) KU752871
(R114)
KJ499792 (R24) KU752872
(R116)
KJ499794 (R26) KU752873
(R117)
KJ499795 (R27)
KJ499797 (R29)
Lysinibacillus sp. KJ499786 (R18) KU752886 KU752844 KU752850 KU752861 KU752895 KU752877 KU752881
(RP3) (R86) (R92) (R103) (RR7) (R121) (R127)
KJ499796 (R28) KU752848 KU752852 KU752891 KU752887
(R90) (R94) (RR2) (RP4)
KU752888
(RP5)
KU752893
(RR4)
Bacillus megaterium KJ499787 (R19) KU752820
(R53)
Int. J. Environ. Sci. Technol.

KU752818 (R51)
 Table 2 continued
Strain Sites under study
CTF-D-1 CTF-D2-2 DF-MJ-3 PWS-J-4 CC1-J-5 CC2-J-6 PWS-DGU-7 NCC-J-8 GDS-J-9 Core-10

Bacillus cereus KJ499788 (R20) KU752832 KU752836 KU752856 KU752860 KU752874

(R71) (R77) (R98) (R102) (R118)
KJ499790 (R22) KU752835 KU752838 KU752867 KU752894
(R76) (R79) (R109) (RR5)
Int. J. Environ. Sci. Technol.

KU752811 (R44)
KU752812 (R45)
KU752813 (R46)
Pseudomonas KJ499791 (R23)
plecoglossicida
Bacillus aryabhattai KJ499793 (R25) KU752825 KM459019
(R58) (RC6)
Bacillus anthracis KJ499798 (R30)
Bacillus KU752799 (R31) KU752855 KU752862 KU752876
methylotrophicus (R97) (R104) (R120)
KU752803 (R35) KU752858
(R100)
KU752804 (R37)
KU752808 (R41)
KU752810 (R43)
KU752814 (R47)
KU752817 (R50)
Bacillus subtilis KU752800 (R32) KU752819 KU752829 KU752843 KU752863 KU752878 KM459020
(R52) (R64) (R85) (R105) (R122) (RC10)
KU752802 (R34) KU752822 KU752834 KU752866 KU752879
(R55) (R74) (R108) (R123)
KU752805 (R38) KU752827 KU752885
(R60) (RP2)
KU752807 (R40) KF953985 KJ499804
(RC2) (RC4)
KU752809 (R42)
KU752816 (R49)
Bacillus pumilus KU752801 (R33) KU752823 KM459021 KU752875
(R56) (RC13) (R119)
KU752824
(R57)
KU752826
(R59)

123
 Table 2 continued
Strain Sites under study
CTF-D-1 CTF-D2-2 DF-MJ-3 PWS-J-4 CC1-J-5 CC2-J-6 PWS-DGU-7 NCC-J-8 GDS-J-9 Core-10

Bacillus KU752815 (R48) KU752841 KJ499801

123
amyloliquefaciens (R82) (RC9)
Bacillus altitudinis KU752821
(R54)
Bacillus tequilensis KU752830
(R65)
Bacillus safensis KU752831
(R66)
Paenibacillus sp. KU752833
(R73)
Bacillus thuringiensis KU752837 KU752890
(R78) (RR1)
KU752840
(R81)
Lysinibacillus KU752842 KU752857 KU752868 KU752870 KU752889
fusiformis (R84) (R99) (R110 (R112) (RP6)
KU752846
(R88)
Pseudomonas KU752849
fluorescens (R91)
Exiguobacterium sp. KU752851
(R93)
Pseudomonas KU752853
koreensis (R95)
Bacillus flexus KU752859
(R101)
KM505011
(RC8)
Pseudomonas sp. KU752864
(R106)
Bacillus aerophilus KU752880
(R126)
Bacillus badius KU752882
(R130)
KU752883
(R131)
Alcaligenes faecalis KF843701
(RC1)
Int. J. Environ. Sci. Technol.
Int. J. Environ. Sci. Technol.

collected from pit, Duliajan. The contaminated samples

were alkaline in nature except for the Core-10 sample
Core-10 collected from a depth of 3600 m. Biological activities of
the present soils were very low. This wide variation in
physical, chemical and biological properties of crude oil-
KF953984
contaminated soil of present study was due to source of
GDS-J-9

(RC5) hydrocarbon contamination and hydrocarbon load. Soil

biological activity, including soil enzymatic activity, has
been reported to be influenced by a range of environmental
stresses and contaminants (Alrumman et al. 2015).
The natures of contamination of crude oil in different
NCC-J-8

soil environment were due to nature of the operational

contamination. Overall hydrocarbon content in the present
study was also quite high and ranges from 0.04 to 89.36%
PWS-DGU-7

which was due to bottom water tank sludge, drilling fluid,

drilling sites, etc. Studies on special environmental con-
ditions of crude oil contamination soils reported that there
were overall less microbial diversity and species richness
in oil-contaminated soil (Aislabie et al. 2004; Saul et al.
2005) which is in agreement with the present findings.
CC2-J-6

Hydrocarbon contaminants have also been reported to

restrain growth of certain responsive microbial groups
(Santos dos et al., 2011) and selectively trigger subgroups
like that of the Actinobacteria and Proteobacteria in con-
KJ499803
(RC12)
CC1-J-5

taminated soils (Bell et al. 2013, 2014), hence affecting the

microbial diversity. In the present study, we were able to
isolate 160 morphologically distinct bacteria and 16S
rDNA analysis confirmed that the isolates belonged to the
PWS-J-4

genus Bacillus, Alkaligenes, Enterobacter, Clostridium,

Exoguibacterium and Pseudomonas. The highest number
of population isolated was from CTF-D-1 followed by
TFD2-2 [ DF-MJ-3 [ PWS-J-4 [ CC1-J-5 [ CC2-J-
6 [ PWS-DGU-7 and NCC-J-8 [ GDS-J-9 [ Core-10,
DF-MJ-3

respectively. We are also reporting for the first time the

presence of Exiguobacterium sp. from CCJ2-J-6 which
might be due to drilling sludge and other stress. To forecast
KJ499799 (RC3)

any relationship between microbial population and

hydrocarbon, we found that except TPH with microbial
CTF-D2-2

population in M1 media, no other parameters showed

significant positive correlation (Table S1). The positive
correlation between TPH and M1 media is due to crude oil-
specific growth. Interestingly, previous study conducted by
Sites under study

Margesin et al. (2003) also showed no correlation between

KM505010

concentration of TPH in soil environment and microbial

CTF-D-1

(RC7)

population.
From the DGGE banding profile, 17 distinct bands were
successfully sequenced. BLAST-N analyses revealed
Bacillus licheniformis

prevalence of genus Sphingomonas, Ralstonia, Sphingob-

Table 2 continued

stratosphericus

ium, Massilia, Acinetobacter and Pseudomonas in the

cancerogenus
Alcaligenes sp.
Enterobacter

samples. Proteobacteria was reported to typically domi-

nate microbial assemblage in hydrocarbon-contaminated
Bacillus
Strain

soils (Greer et al. 2010). Several previous studies reported

Pseudomonas and Acenitobacter in various hydrocarbon-

123
 Int. J. Environ. Sci. Technol.

Fig. 2 DGGE band profiles of

PCR-amplified 16S rDNA
fragments obtained from 10
crude oil-contaminated soils.
Bands marked with arrow
(n = 25) showed prominent
bands that were excised for
sequencing

Fig. 3 Clustering based on

DGGE banding pattern of crude
oil-contaminated sites under
study. a DGGE gel showing
banding profiles of 16S rRNA-
V3 gene region isolated from
the each soil DNA;
b dendrogram obtained from
clustering of DGGE bands of
the 10 soil samples. A total of
six distinct clades with sites
CC1-J-5 and CC2-J-6 as two
separate branches; CTF-D-1 and
CTF-D2-2; PWS-DGU-7 and
GDS-J-9; NCC-J-8 and Core-
10; and DF-MJ-3 and PWS-J-4
comprising the four clades were
identified

contaminated environments using culture-dependent (Bel- Fig. 4 Phylogenetic tree showing the relationships among the 16S c
rRNA-V3 gene sequences of DGGE bands obtained from the 10 crude
haj et al. 2002; Bhattacharya et al. 2003) and culture-in-
oil-contaminated soils. Single OTUs identified from the sequenced
dependent (Kaplan and Kitts 2004; Margesin et al. 2003; data of amplified 16S rRNA-V3 gene region revealed the occurrence
Roling et al. 2004) approaches. The presence of Spin- of genera Sphingomonas, Ralstonia, Sphingobium, Massilia, Acine-
gomonas and Raslstonia in contaminated sites was also tobacter and Pseudomonas in the contaminated sites

123
Int. J. Environ. Sci. Technol.

123
 Int. J. Environ. Sci. Technol.

Table 3 Diversity indices for Sample ID Shannon diversity Shannon evenness Simpson McIntosh McEvn
contaminated sites of Assam
derived from carbon sources CTF-D-1 1.97 ± 0.10e 0.65 ± 0.13b 0.86 ± 0.02b 0.72 ± 0.02c 0.76 ± 0.08b
utilization pattern abc a a ab
CTF-D2-2 3.30 ± 0.03 0.96 ± 0.01 0.99 ± 0.00 0.98 ± 0.00 0.98 ± 0.00a
ab a a ab
DF-MJ-3 3.32 ± 0.01 0.97 ± 0.01 0.99 ± 0.00 0.98 ± 0.00 0.98 ± 0.01a
c a a b
PWS-J-4 3.16 ± 0.10 0.92 ± 0.01 0.98 ± 0.00 0.95 ± 0.01 0.95 ± 0.01a
a a a ab
CC1-J-5 3.33 ± 0.03 0.97 ± 0.00 0.99 ± 0.00 0.98 ± 0.00 0.98 ± 0.00a
CC2-J-6 3.35 ± 0.03a 0.98 ± 0.01a 1.00 ± 0.00a 0.98 ± 0.00a 0.98 ± 0.00a
bc a a ab
PWS-DGU-7 3.15 ± 0.05 0.93 ± 0.01 0.98 ± 0.00 0.95 ± 0.01 0.95 ± 0.01a
abc a a ab
NCC-J-8 3.22 ± 0.03 0.94 ± 0.02 0.99 ± 0.00 0.97 ± 0.00 0.97 ± 0.01a
abc a a ab
GDS-J-9 3.32 ± 0.09 0.98 ± 0.01 0.99 ± 0.00 0.98 ± 0.01 0.98 ± 0.01a
d b c c
Core-10 2.25 ± 0.11 0.68 ± 0.04 0.82 ± 0.03 0.67 ± 0.03 0.68 ± 0.04c
Diversity indices for the contaminated sites under study were calculated from 168-h data in triplicate
obtained from Biolog Ecoplates. The average values followed by ±0.1 = SD of observed values. SD
followed by superscript similar letter is not significantly different from each other within the column. All
the contaminated sites except CTF-D-1 and Core-10 have a Shannon diversity index above 3 and McIntosh
index close to 1, showing that the structure of these habitats is relatively stable and balanced

reported by various researchers (Juhasz and Naidu 2000;

Zocca et al. 2004). We also found many of the unidentified
clones having [99% sequence similarity to the bacterial
clones (Accession nos. KC884580.1, KC884570.1,
KC521869.1 and EU491331.1) (Table S3 and Fig. 4) that
were reported by researchers from other oil-contaminated
sites including Dagang oil fields of China (Li et al. 2006).
Interestingly, we observed a disparity between culture-
based techniques to that of uncultured diversity assessment
which was in agreement with the earlier reports (Lagier
et al. 2012; Shade et al. 2012) and contrary to many reports
(Lagier et al. 2012; Carraro et al. 2011; Vaz-Moreira et al.
2011). Hamamura et al. (2006) in their study also reported
cultivation of numerous HCB from oil-contaminated soil
which did not show relationship with the results obtained
using culture-independent molecular techniques. Here the
difference in culture-based techniques to that of uncultured
diversity assessment is mainly due to the lack of ability of
some of the bacteria to grow under laboratory condition.
Fig. 5 Principal component analysis (PCA) based on metabolic
This lack of ability may be as a result of inability of pro-
fingerprint obtained from 10 crude oil-contaminated sites. From the viding optimum conditions for the indigenous to grow in
PCA plot, it was seen that site Core-10 was most diverse at 45.35 and laboratory media plates.
13.9% on first 2 principle components, indicating that this had The PCA plot of carbon source utilization pattern by
significantly different bacterial phyla. Site CTF-D-1 also had a
diverse pattern as depicted by their physiological profile. Again sites
microbial community of soil samples: sites CTF-D-1 and
CC2-J-6 and GDS-J-9, CC1-J-5 and NCC-J-8, PWS-J-4 and PWS- Core-10 was seen to be most diverse and was also found to
DGU-7 were seen to have metabolic fingerprint pattern similar to have the highest pH of 9.11 and lowest pH of 3, respec-
each other but different from the rest. Sites CTF-D2-2 and DF-MJ-3 tively, as compared to the rest and hence different micro-
were seen to be different from each other in bacterial community
structure and also to the others
bial community inhabiting these sites. Previous studies

123
Int. J. Environ. Sci. Technol.

have also reported bacterial community composition to be the assessment of bacterial population of crude oil-con-
associated with the quality of soil organic matter, geo- taminated samples collected from different locations
graphical region and environmental factors such as tem- operated under Oil India limited, Duliajan
perature, nutrient availability, soil pH (Wallenstein et al. (27°210 4200 N, 95°190 600 E) and Jorajan (95°110 - 95°300 E;
2007; Coolen et al. 2011; Lauber et al. 2009; Shen et al. 27° 060 - 27° 220 N) of Dibrugarh and Tinsukia, Assam.
2013; Bartram et al. 2014). High moisture content of CTF- Here, we report 160 morphologically distinct bacteria
D-1 (66.6%) and significantly low moisture content of which could be isolated using conventional culturing
Core-10 (1.25%) as compared to the other sample were techniques of which 117 strains were found to be Gram-
another factor that can be responsible for variation in positive bacteria and the rest 43 strains were identified as
community structures of these sites. Soil water content Gram-negative bacteria; majority of the strains were seen
determines microbial community structure, and Zhou et al. to belong to the phylum Proteobacteria (Betaproteobacte-
(2002) suggested that free water connecting soil particles ria, Gammaproteobacteria and Fermicutes (Bacilli, Clos-
may influence diversity patterns, by controlling nutrient tridia), under the genus Enterobacter, Pseudomonas,
availability and cell movement. Low soil moisture was Alkaligenes, Bacillus, Lysinibacillus and Clostridium.
reported to decrease microbial activity by reducing diffu- Moreover, an alternative approach, the denaturing gradient
sion of soluble substrates, microbial mobility and intra- gel electrophoresis (DGGE) profiles of 16S rDNA phylo-
cellular water potential (Zhou et al. 2002). types showed the predominance of Sphingomonas, Ral-
The current study determined the diversity of indigenous stonia, Sphingobium, Massilia, Acinetobacter and
bacteria in the crude oil-contaminated sites of Duliajan and Pseudomonas. Both culture-dependent and culture-inde-
Jorajan, Assam. Bacterial isolates obtained from culture- pendent approaches resulted in 11 genera of which Bacillus
based approach showed predominance of Lysinibacillus, and Pseudomonas were the key inhabitants creating most
Alcaligenes, Bacillus, Clostridium, Enterobacter and favourable bacterial milieu in the presence of crude oil
Pseudomonas in these study sites. Culture-independent contaminants. Previous studies have reported that there was
DGGE technique confirmed the presence of genera Sph- an overall less microbial diversity and species richness in
ingomonas, Ralstonia, Sphingobium, Massilia, Acineto- crude oil-contaminated environments which is in agree-
bacter and Pseudomonas. For the first time, we are ment with the present findings. The highest bacterial pop-
reporting the presence of genus Exoguibacterium in crude ulation was obtained from CTF-D-1 followed by CTF-D2-
oil-contaminated soil of Assam. PCA analysis revealed 2 [ DF-MJ-3 [ PWS-J-4 [ CC1-J-5 [ CC2-J-6 [ PWS-
CTF-D-1 and Core-10 to be most diverged, indicating DGU-7 and NCC-J-8 [ GDS-J-9 [ Core-10, respectively.
significant bacterial phyla, while sites CC2-J-6 and GDS-J- This study also reports for the first time Exiguobac-
9 were found to have closely similar bacterial phyla. Both terium sp. from site CCJ2-J-6 to inhabit crude oil-con-
culture-dependent and culture-independent approach taminated areas of Assam. Currently, hydrocarbonoclastic
resulted in a total of 11 genera. The present findings is the bacteria are being given much importance by researchers
first-hand report on total bacterial diversity in crude oil- and have been found to be efficient alternatives in con-
contaminated soil of Assam, which can be assisted in fur- trolling the fate of natural and anthropogenic crude oil
ther exploitation of these for bioremediation purposes. seepage. Hence, increased interest is being paid in studying
the diversity of indigenous bacteria capable of degrading
hydrocarbon contaminants. This study thus helped in the
Conclusion identification of the principal bacterial species inhabiting
the contaminated sites that might be potential in degrada-
Pollution by hydrocarbons may stimulate the growth of tion of the contaminants, and these results will prove to be
hydrocarbon-utilizing/hydrocarbon-degrading bacteria and significant for chalking-out ways of most favourable in situ
alter the structure of microbial communities in the con- bioremediation strategies.
taminated area. Thus, classification of the organisms that
participate in hydrocarbon biodegradation is important for Acknowledgements Authors acknowledge Oil India Limited (OIL),
Duliajan, for their support in procuring crude oil and contaminated
assessing and developing in situ bioremediation strategies. samples. Authors also thank Directors, CSIR-NEIST and CSIR-
Assessment of diversity and species richness of microbial NBRI, for their support. Reshita Baruah acknowledges Department of
population in crude oil-degraded environment is being Science and Technology (DST), Govt. of India, for providing
given utmost importance. The present study demonstrated INSPIRE fellowship (IF120020). Financial support from Council of

123
 Int. J. Environ. Sci. Technol.

Scientific and Industrial Research for projects BSC0109 and BSC117 methods for bacterial community monitoring during Montasio
is duly acknowledged. cheese manufacturing. Res Microbiol 162:231–239
Casid LE, Klein DA, Santoro T (1964) Soil dehydrogenase activity.
Soil Sci 98:371–376
Cole JR, Chai B, Farris RJ, Wang Q, Kulam SA, McGarrell DM,
Garrity GM, Tiedje JM (2007) The ribosomal database project
References RDP-II, introducing myRDP space and quality controlled public
data. Nucleic Acids Res 35:D169–D172
Abbasian F, Lockington R, Mallavarapu M, Naidu R (2016) The Coolen MJL, van de Giessen J, Zhu EY, Wuchter C (2011)
biodiversity changes in the microbial population of soils Bioavailability of soil organic matter and microbial community
contaminated with crude oil. Curr Microbiol. doi:10.1007/ dynamics upon permafrost thaw. Environ Microbiol
s00284-016-1001-4 13:2299–2314
Abed RM, Safi NM, Koster J, De Beer D, El-Nahhal Y, Rullkotter J, Das D, Baruah R, Sarma Roy A, Singh AK, Deka Boruah HP, Kalit J,
Garcia-Pichel F (2002) Microbial diversity of a heavily polluted Bora TC (2015) Complete genome sequence analysis of
microbial mat and its community changes following degradation Pseudomonas aeruginosa N002 reveals its genetic adaptation
of petroleum compounds. Appl Environ Microbiol for crude oil degradation. Geno 105:182–190
68:1674–1683 Garland JL (1996) Analytical approaches to the characterization of
Achtman M, Wagner M (2008) Microbial diversity and the genetic samples of microbial communities using patterns of potential C
nature of microbial species. Nat Rev Microbiol 6:431–440 source utilization. Soil Biol Biochem 28:213–221
Aislabie J, Balks M, Foght J, Waterhouse E (2004) Hydrocarbon Gogoi B, Dutta N, Goswami P, Mohan TA (2003) Case study of
spills on Antarctic soils: effects and management. Environ Sci bioremediation of petroleum-hydrocarbon contaminated soil at a
Technol 38:1265–1274 crude oil spill site. Adv Environ Res 7:767–782
Albokari M, Mashhour I, Alshehri M, Boothman C, Al-Enezi M Greer CW, Whyte LG, Niederberger TD (2010) Microbial commu-
(2015) Characterization of microbial communities in heavy nities in hydrocarbon-contaminated temperate, tropical, alpine,
crude oil from Saudi Arabia. Ann Microbiol 65:95–104 and polar soils. In: Timmis KN (ed) Handbook of hydrocarbon
Allen J, Atekwana E, Atekwana E, Duris J, Werkema D, Rossbach and lipid microbiology. Springer, Berlin, pp 2313–2328
(2007) The microbial community structure in petroleum-con- Hamamura N, Olson SH, Ward DM, Inskeep WP (2006) Microbial
taminated sediments corresponds to geophysical signatures. Appl population dynamics associated with crude oil biodegradation in
Environ Microbiol 73:2860–2870 diverse soils. Appl Environ Microbiol 72:6316–6324
Alrumman SA, Standing DB, Paton GI (2015) Effects of hydrocarbon Hazen TC, Dubinsky EA, DeSantis TZ, Andersen GL, Piceno YM,
contamination on soil microbial community and enzyme activity. Singh N (2010) Deep-sea oil plume enriches indigenous oil-
J King Saud Univ Sci 27:31–41 degrading bacteria. Science 330:204–208
Bargiela R, Mapelli F, Rojo D, Chouaia B, Tornes J, Borin S et al Howard KWF, Howard KK (2016) The new ‘‘Silk Road Economic
(2015) Bacterial population and biodegradation potential in Belt’’ as a threat to the sustainable management of Central Asia’s
chronically crude oil-contaminated marine sediments are transboundary water resources. Environ Earth Sci 75:976
strongly linked to temperature. Sci Rep 5:11651 Juhasz AL, Naidu R (2000) Bioremediation of high molecular weight
Bartram AK, Jiang X, Lynch MD, Masella AP, Nicol GW, Dushoff J, polycyclic aromatic hydrocarbons, a review of the microbial
Neufeld JD (2014) Exploring links between pH and bacterial degradation of benzo[a]pyrene. Int Biodeterior Biodegrad
community composition in soils from the craibstone experimen- 45:57–88
tal farm. FEMS Microbiol Ecol 87:403–415 Jung J, Philippot L, Park W (2016) Metagenomic and functional
Beazley MJ, Martinez RJ, Rajan S, Powell J, Piceno YM, Lauren MT analyses of the consequences of reduction of bacterial diversity
(2012) Microbial community analysis of a coastal salt marsh on soil functions and bioremediation in diesel-contaminated
affected by the Deepwater Horizon oil spill. PLoS ONE microcosms. Sci Rep 6:23012
7:e41305 Kaplan CW, Kitts CL (2004) Bacterial succession in petroleum land
Belhaj A, Desnoues N, Elmerich C (2002) Alkane biodegradation in treatment unit. Appl Environ Microbiol 70:1777–1786
Pseudomonas aeruginosa strains isolated from polluted zone, Keller M, Zengler K (2004) Tapping into microbial diversity. Nat Rev
identification of alkB and alkB-related genes. Res Microbiol Microbiol 2:141–150
153:339–344 Kim S-J, Kweon O, Sutherland JB, Kim H-L, Jones RC, Burback BL,
Bell TH, Yergeau E, Maynard C, Juck D, Whyte LG, Greer CW Graves SW, Psurny E, Cerniglia CE (2015) Dynamic response of
(2013) Predictable bacterial composition and hydrocarbon Mycobacterium vanbaalenii PYR-1 to BP deepwater horizon
degradation in Arctic soils following diesel and nutrient crude oil. Appl Environ Microbiol 81:4263–4276
disturbance. ISME J 7:1200–1210 Kimes NE, Callaghan AV, Aktas DF, Smith WL, Sunner J, Golding
Bell TH, El-Din Hassan S, Lauron-Moreau A, Al-Otaibi F, Hijri M, B, Drozdowska M, Hazen TC, Suflita JM, Morris PJ (2013)
Yergeau E et al (2014) Linkage between bacterial and fungal Metagenomic analysis and metabolite profiling of deep-sea
rhizosphere communities in hydrocarbon-contaminated soils is sediments from the Gulf of Mexico following the deepwater
related to plant phylogeny. ISME J 8:331–343 horizon oil spill. Front Microbiol 4:50
Bhattacharya D, Sarma PM, Krishnan S, Mishr S, Lal B (2003) Kimura M (1980) A simple method for estimating evolutionary rates
Evaluation of genetic diversity among Pseudomonas citronel- of base substitutions through comparative studies of nucleotide
lolis strains isolated from oily sludge contaminated sites. Appl sequences. J Mol Evol 16:111–120
Environ Microbiol 69:1435–1441 Lagier JC, Armougom F, Million M, Hugon P, Pagnier I, Robert C
Carraro L, Maifreni M, Bartolomeol I, Martino ME, Novelli E, Frigo (2012) Microbial culturomics, paradigm shift in the human gut
F (2011) Comparison of culture-dependent and-independent microbiome study. Clin Microbiol Infect 18:1185–1193

123
Int. J. Environ. Sci. Technol.

Lauber CL, Hamady M, Knight R, Fierer N (2009) Pyrosequencing- Santos dos HF, Cury JC, do Carmo FL, Santos dos AL, Tiedje J, van
based assessment of soil pH as a predictor of soil bacterial Elsas JD et al (2011) Mangrove bacterial diversity and the
community structure at the continental scale. Appl Environ impact of oil contamination revealed by pyrosequencing:
Microbiol 75:5111–5120 bacterial proxies for oil pollution. PLoS ONE 6:e16943
Li H, Yang S, Mu B, Rong Z, Zhang J (2006) Molecular analysis of Saul D, Aislabie J, Brown C, Harris L, Foght J (2005) Hydrocarbon
the bacterial community in a continental high-temperature and contamination changes the bacterial diversity of soil from around
water-flooded petroleum reservoir. FEMS Microbiol Lett Scott Base, Antarctica. FEMS Microbiol Ecol 53:141–155
257:92–98 Shade A, Hogan CS, Klimowicz AK, Linske M, McManus PS,
Li P, Qian H, Howard KWF, Wu J (2015) Building a new and Handelsman J (2012) Culturing captures members of the soil rare
sustainable ‘‘Silk Road economic belt’’ Environ. Earth Sci biosphere. Environ Microbiol 14:2247–2252
74:7267–7270 Shen C, Xiong J, Zhang H, Feng Y, Lin X, Li X (2013) Soil pH drives
Liu Z, Liu J (2013) Evaluating bacterial community structures in oil the spatial distribution of bacterial communities along elevation
collected from the sea surface and sediment in the northern Gulf on Changbai Mountain. Soil Biol Biochem 57:204–211
of Mexico after the deepwater horizon oil spill. Microbiol Open Staddon WJ, Duchesne LC, Trevors JT (1997) Microbial diversity
2:492–504 and community structure of post disturbance forest soils as
Lu Z, Deng Y, Van Nostrand JD, He Z, Voordeckers J, Zhou A determined by sole-carbon-source utilization patterns. Microb
(2012) Microbial gene functions enriched in the Deepwater Ecol 34:125–130
Horizondeep-sea oil plume. ISME J 6:451–460 Stefani FOP, Bell TH, Marchand C, de la Providencia IE, Yassimi
MacNaughton SJ, Stephen JR, Venosa AO, Davis GA, Chang Y, AE, St-Arnaud M, Hijri M (2015) Culture-dependent and
White DC (1999) Microbial population changes during biore- independent methods capture different microbial community
mediation of an experimental oil spill. Appl Environ Microbiol fractions in hydrocarbon-contaminated soils. PLoS ONE
65:3566–3574 106:e0128272
Margesin R, Labbe D, Schinner F, Greer CW, Whyte LG (2003) Tabatabami A, Bremner JM (1969) Use of p-nitrophenyl phosphate
Characterization of hydrocarbon-degrading microbial popula- for assay of soil phosphataseactivity. Soil Biol Biochem
tions in contaminated and pristine Alpine soils. Appl Environ 1:301–307
Microbiol 69:3085–3092 Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013)
Mason OU, Hazen TC, Borglin S, Chain PS, Dubinsky EA, Fortney MEGA6: molecular evolutionary genetics analysis version 6.0.
JL (2012) Metagenome, metatranscriptome and single-cell Mol Biol Evol 30:2725–2729
sequencing re-veal microbial response to Deepwater Horizon Vaz-Moreira I, Egas C, Nunes OC, Manaia CM (2011) Culture-
oil spill. ISME J 6:1715–1727 dependent and culture-independent diversity surveys target
McGarity JW, Mayers MG (1967) A survey of urease activity in soils different bacteria, a case study in a freshwater sample. Antonie
of northern New South Wales. Plant Soil 27:217–238 Van Leeuwenhoek 100:245–257
Mishra A, Nautiyal CS (2009) Functional diversity of the microbial Vila J, Nieto M, Mertens J, Springael D, Grifoll M (2010) Microbial
community in the rhizosphere of chickpea grown in diesel fuel community structure of a heavy fuel oil-degrading marine
spiked soil amended with Trichoderma ressei using sole-carbon consortium, linking microbial dynamics with polycyclic aro-
source utilization profiles. World J Microbiol Biotechnol matic hydrocarbon utilization. FEMS Microbiol Ecol
25:1175–1180 73:349–362
Mnif S, Chamkha M, Sayadi S (2009) Isolation and characterization Vinas M, Sabate J, Espuny MJ, Solanas AS (2005) Bacterial
of a Halomonas sp. strain C2SS100 a hydrocarbon degrading community dynamics and polycyclic aromatic hydrocarbon
bacterium under hypersaline condition. J Appl Microbiol degradation during bioremediation of heavily creosote-contam-
107:785–794 inated soil. Appl Environ Microbiol 71:7008–7018
Muyzer G, Brinkhoff T, Nubel U, Santegoeds C, Schafer H, Wawer C Walkley A, Black IA (1934) An examination of the Degtjareff
(1998) Denaturing gradient gel electrophoresis (DGGE) in method for determining organic carbon in soils: effect of
microbial ecology. In: Akkermans ADL, Van Elsas JD, De variations in digestion conditions and of inorganic soil con-
Bruijn FT (eds) Molecular microbial ecology manual. Kluwer stituents. Soil Sci 63:251–263
Academic Publishers, Dordrecht, The Netherlands, pp 1–27 Wallenstein MD, McMahon S, Schimel J (2007) Bacterial and fungal
Nautiyal CS (2009) Self-purificatory Ganga water facilitates death of community structure in Arctic tundra tussock and shrub soils.
pathogenic Escherichia coli 157, H7. Curr Microbiol 58:25–29 FEMS Microbiol Ecol 59:428–435
Paisse S, Coulon F, Goni-Urriza M, Peperzak L, McGenity T, Duran Weber P, Grove J, Gehder M, Anderson W, Legge R (2007) Data
R (2008) Structure of bacterial communities along a hydrocar- transformations in the analysis of community-level substrate
bon contamination gradient in coastal sediment. FEMS Micro- utilization data from microplates. J Microbiol Methods
biol Ecol 66:295–305 69:461–469
Roling WFM, Milner MG, Jones DM, Fratepietro F, Swannell RP, Weeks OB, Breed RS (1957) In: Bergey’s manual of determinative
Daniel F, Head IM (2004) Bacterial community dynamics and bacteriology, 7th edn. Williams and Wilkins, Baltimore, p 320
hydrocarbon degradation during a field-scale evaluation of Weisburg WG, Barns SM, Pelletier DA, Lane DJ (1991) 16S
bioremediation on a mudflat beach contaminated with buried ribosomal DNA amplification for phylogenetic study. J Bacteriol
oil. Appl Environ Microbiol 70:2603–2613 173:697–703
Roy AS, Baruah R, Borah M, Singh AK, Deka Boruah HP, Saikia N Yenn R, Borah M, Deka Boruah HP, Baruah R, Saikia N, Sahu OP,
(2014) Bioremediation potential of native hydrocarbon degrad- Tamuli AK (2014) Phytoremediation of abandoned crude oil
ing bacterial strains in crude oil contaminated soil under contaminated drill sites of Assam with the aid of a hydrocarbon-
microcosm study. Int Biode Biodeg 94:79–89 degrading bacterial formulation. Int J Phytorem 9:909–925

123
 Int. J. Environ. Sci. Technol.

Zhou J, Xia B, Treves DS, Wu LY, Marsh TL, O’Neill RV, Palumbo Zocca C, Di S, Visentini F, Vallini G (2004) Gregorio biodiversity
AV, Tiedje JM (2002) Spatial and resource factors influencing amongst cultivable polycyclic aromatic hydrocarbon-transform-
high microbial diversity in soil. Appl Environ Microbiol ing bacteria isolated from an abandoned industrial site. FEMS
68:326–334 Microbiol Lett 238:375–382

123