See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/309100554

Isolation and Identification of Plant Growth-Promoting Rhizobacteria (PGPR)

from the Rhizosphere of Sugarcane in Saline and Non-Saline Soil

Article  in  International Journal of Current Microbiology and Applied Sciences · October 2016

DOI: 10.20546/ijcmas.2016.510.113

CITATIONS READS

7 136

3 authors, including:

Naeimeh Enayatizamir Hossein Motamedi

Shahid Chamran University of Ahvaz 133 PUBLICATIONS   1,098 CITATIONS   
11 PUBLICATIONS   65 CITATIONS   
SEE PROFILE
SEE PROFILE

Some of the authors of this publication are also working on these related projects:

The Determination of Assay for Laccase of Bacillus subtilis WPI with Two Classes of Chemical Compounds as Substrates View project

The facile preparation and structural characterization of two new isostructural 2D coordination polymers, {[M 2 (bbit) 3 Cl 2 ][MCl 4 ]} n [where M = Zn and Cd; bbit = 1,1-bis
(3-methyl-4-imidazoline-2-thione) butane] View project

All content following this page was uploaded by Naeimeh Enayatizamir on 22 October 2018.

The user has requested enhancement of the downloaded file.

 Int.J.Curr.Microbiol.App.Sci (2016) 5(10): 1072-1083

International Journal of Current Microbiology and Applied Sciences

ISSN: 2319-7706 Volume 5 Number 10 (2016) pp. 1072-1083
Journal homepage: http://www.ijcmas.com

Original Research Article http://dx.doi.org/10.20546/ijcmas.2016.510.113

Isolation and Identification of Plant Growth-Promoting Rhizobacteria

(PGPR) from the Rhizosphere of Sugarcane in Saline and Non-Saline Soil
Elham Lamizadeh1, Naeimeh Enayatizamir2* and Hossein Motamedi3
1
Master student of Soil Science, Agriculture Faculty, Shahid Chamran University of Ahvaz
2
Ph.D of Soil Science, Agriculture Faculty, Shahid Chamran University of Ahvaz, Iran
3
Ph.D of Microbiology, Science Faculty, Shahid Chamran University of Ahvaz, Iran
*Corresponding author

ABSTRACT

Soil salinity is one of the limiting factors of agricultural production in arid and
semi-arid areas that reduces yields and optimal crop production. Awareness of
Keywords rhizosphere bacterial diversity and use of salinity-resistant bacteria is considered as
a critical strategy to increase plant growth in these areas. This study aimed to
Phosphate, determine the population diversity of sugarcane rhizosphere bacteria in saline and
Inceptisol, non-saline soil and survey some growth-promoting properties. For this purpose,
Potassium, random sampling from the rhizosphere of sugarcane was performed. Bacteria were
Nitrogen, Auxin, isolated by culturing serial on nutrient agar medium and were identified based on
Enterobacter biochemical assays. The ability of isolates to fix nitrogen, dissolute phosphate and
cloacae.
potassium and auxin production was investigated. Finally, the best growth-
Article Info promoting isolates were identified based on 16S rRNA sequences. Generally, 40
bacteria were isolated from saline and non-saline soil that these strains were mainly
Accepted:
28 September 2016 from Bacillus, Paenibacillus and Pseudomonas. Salinity had the highest effect on
Available Online: bacterial community structure with the higher diversity of microorganisms in saline
10 October 2016 soils. Four strains were selected as growth-promoting strains which based on
biochemical and phylogenetic analysis were identified asEnterobacter cloacae
R13, Enterobacter cloacae R33, Paenibacillus lactis and Pseudomonas sp.

Introduction
Salinity challenge is one of the major 2010). In Iran over 32 million hectares of
problems that reduce productivity of fertile soils are affected by salinity that covers
lands. Salinity affects not only plant nearly 30 percent of the entire country (34
production but also the biodiversity million hectares) and 55% of arable lands
(Fernandez et al., 2010). High levels of (Paziraand Homaee, 2010). Sugarcane
salinity (more than 4 dS/m) are created culture in Khuzestan has a significant role in
usually due to salts in irrigation water and providing sugar. Nowadays, this industry
fertilizers, low rainfall, high temperature, developed in the region and produces more
inappropriate management practices and than half of the country's sugar. Salinity of
long-term drop irrigation (Yao et al., soil under sugarcane cultivation due

1072
 Int.J.Curr.Microbiol.App.Sci (2016) 5(10): 1072-1083

irrigation practices and application of adhered to the roots. Soil properties such as
chemical fertilizer is now being a serious soil texture parameters (Hydrometery), pH
issue. Some of the microorganisms, in saturated mud, the electrical conductivity
particularly valuable bacteria can develop of saturated extract (ECe), Soil organic
plant performance under stress condition matter (the K2Cr2O7-H2SO4 oxidation–
and, improve yield (Evelin et al., 2010; reduction titration method), soil respiration
Sahoo and Dhal, 2009). Their abundance (Anderson, 1982) and microbial biomass
and activities are controlled by various carbon by fumigation-extraction method
physical and chemical factors. Measuring were measured (Jenkinson and Powlson,
biodiversity of microbial communities for 1976).
the immediate application and fundamental
understanding of microbial communities are To isolate bacteria, 10g of soil was serially
important. Plant growth promoting diluted to 10-8. About 50µl of 10-3 to 10-8
rhizobacteria (PGPR) employed to promote dilutions were spread on nutrient agar
plant growth by supplying nutrients such as medium and incubated at 28°C for 72 h. The
nitrogen through biological nitrogen appeared colonies on the medium were
fixation, phosphate and potassium through purified based on appearance and color.
solubilization of their insoluble forms, Purified bacteria were examined by
induce phytohormones production and plant morphological characteristics such as shape,
resistance to microbial pathogens and margin, color and pigment occurrence,
siderophore production aiding plant nutrition elevation, texture and size of colony, after
by chelation (Ogboand Okonkwo, 2010). that, the bacteria were identified by standard
Our knowledge about microbial diversity biochemical tests on the basis of the
and microorganisms’ activity in the Bergey’s manual of bacterial classification
rhizosphere of sugarcane is very important (Harrigan and McCance, 1976). Microbial
in understanding the plants function and this diversity was assayed by Shannon index
knowledge is necessary to adjust the effect (H'). The higher Shannon index reflects the
of management and conservation strategies. higher diversity (Swingland, 2001).
There is no information about associated
bacteria with sugarcane growing in the fields Shannon's index ⟹ ,
of Iran, therefore this study was conducted
to isolate and characterize potential
beneficial bacteria that may be present in
rhizosphere of sugarcane in saline and non- Evenness index ⟹Evenness= H/Hmax(Hmax=
saline soil. ln N)

Materials and Methods All bacterial isolates were screened for

nitrogen fixation, indole acetic acid
In order to isolate rhizobacteria from the production, and mineral phosphate and
rhizosphere of sugarcane, different points of potassium solubilization by using following
the sugarcane farm with salinity levels of assays. To determine the phosphate
around 1.5-5(dS/m) located in the agro- solubility in solid medium, strains were
industrial region of Khuzestan cultured in Pikovskaya's agar (PVK)
DebalKhazaei (42 11’’31°05 ' North and medium containing: 1% glucose, 0.5% Ca3
43.1’’ 48° 30' East) were sampled in (PO4)2, 0.05% (NH4)2SO4, 0.05% yeast
October 2014. Rhizosphere soil was extract, 0.01% MgSO4.7H2O, 0.02% NaCl,
collected by sampling the soil that was 0.00002% FeSO4, 0.0002% MnSO4, 0.02%

1073
 Int.J.Curr.Microbiol.App.Sci (2016) 5(10): 1072-1083

KCl and 2% Agar and set to pH 6.8-7. From Results and Discussion
overnight culture of isolates, 10µl were
cultured on PVK medium in plates and Some chemical and physical properties of
incubated for 7 days at 30°C. Appearance of the soil are presented in Table 1. The soil
clear zone around the colony was regarded texture of both samples with EC= 1.5 and
as their ability of the phosphate solubility. 4.7 dS/m was clay loam and soil pH for
The phosphorus solubility index (SI) was saline and non-saline soils were 9.02 and
calculated from the ratio of colony to halo 8.86, respectively. Microbial biomass
zone diameter. The solubility of phosphorus carbon in non- saline soil was higher than
in liquid medium was also determined in saline soil. Decreased microbial biomass
Pikovskaya's broth medium using the carbon by increasing soil salinity has been
standard curve and determining the reported (Yuan et al., 2007).The low
absorption intensity at 880 nm (Ramani, respiration rate in saline soil is in agreement
2011). Nitrogen-fixation ability investigated with other studies (Yuan et al., 2007;
according to Döbereiner (Döbereiner, 1972) Wichern et al., 2006; Rietz and Haynes,
and the dissolution of potassium was also 2003)and can be explained salt induced low
performed on Aleksandrov agar medium osmotic potential which reduces water
containing vermiculite powder (Aleksandrov availability to microbes and may draw water
et al., 1967). Auxin production was out of the cells.
discovered according to Bric et al., (Bric et
al., 1991). Isolation and Identification of Bacteria

Molecular identification of most suitable Table 2 indicates the list of identified

strains was performed through 16S rRNA bacteria from sugarcane rhizosphere of
sequencing. DNA was extracted using saline and non- saline soils. Overall, 40
CinnaGen kit and qualified by strains were isolated from two soil types (19
electrophoresis on 1% agarose gel isolates from saline soil and 21 isolates from
Amplification of extracted DNA was done non-saline soil).According to the results
using general 16SrRNAprimers. presented in table 2, among 40 strains, 20
strains belonged to Bacillus, including 12
The primers were forward FD1 and 8 isolates from non-saline and saline
(5’CCGAATTCGTCGACAACAGAGTTT soil, respectively. Also 9 isolates of
GATCCTGGCTCAG3’) and reverse RP1 Paenibacillus genus (including 6 isolates
(5’CCCGGGATCCAAGCTTACGGTTAC from non-saline soils and 3 ones from saline
CTTGTTACGACTT3’) primers (Weisburg soils), 4 isolates of Pseudomonas (including
et al., 1991). Amplification cycle was 2 and 2 isolates isolated from non-saline and
included an initial denaturation (94ºC,5 saline soil), 3 isolates of Enterobacter from
min), 30 cycles each consisted of 1 min at saline soil, 1 isolate of Micrococcus from
94°C denaturation, 40 s at 58°C annealing saline soils, 1 isolates of Corynebacterium
and 150 s at 72°Cforelongation, followed from saline soils, 1 isolate of
by a final extension of 10 min at 72°C. Pediococcus from saline soil and 1 isolate of
Target amplification was confirmed by Arthrobacter from non-saline soil have been
electrophoresis in 1% agarose containing diagnosed. Amongst all the bacterial isolates
DNA safe stain. The PCR products were genera Bacillus was found to be the most
sequenced and compared with the 16S dominant in both saline and non-saline soils
rRNA sequences present in Genbank of followed by Paenibacillus in non-saline soil
NCBI.
1074
 Int.J.Curr.Microbiol.App.Sci (2016) 5(10): 1072-1083

and by Paenibacillus and Enterobacter in specific roles in the rhizosphere saline soil
saline soil. Numbers of bacterial species to induce plant toleration against salinity.
associated with sugarcane rhizosphere have
been isolated which belonging to Growth Promoting Properties of Isolates
Azospirillum, Alcaligens, Arthrobacter,
Acinetobacter, Bacillus, Burkholderia, Generally, 87.5% of the isolates were able to
Enterobacter, Erwinia, Flavobacterium, grow in Deubernier medium and because of
Pseudomonas, Rhizobium, and Serratia nitrogen fixation, color change of medium
(Nakade Dhanraj, 2013). Diversity and from dark green to yellow was
evenness of isolated bacteria in both saline happened(Table 4). Of these, 45.9 percent of
and non-saline soils was calculated using isolates were from non-saline soil and
Shannon’s index. Diversity (Shannon’s 41.5% from saline soil. Emtiazi et al.,
Index) and evenness of isolated bacteria (2007) identified Paenibacillus as nitrogen-
from saline soil was as H= 1.63 and fixing bacterium. The different genuses of
E=0.840, respectively, and these was H= Paenibacillus have nitrogen fixation ability
1.04 and E=0.753 for non-saline soil. (Xieand Du, 2014).
Diversity and evenness of isolated bacteria
from sugarcane rhizosphere in saline soil Various reports have shown Pseudomonas
were higher than non-saline soil that as diazotrophicus bacteria in the rhizosphere
indicates high severity of salt stress of different plants such as rice (Mirza et al.,
increases diversity in the bacterial 2006), sugarcane (Ramesh kumar et al.,
communities (Table3). This might be 2012; Ashraf et al., 2011) and legumes
attributed to proliferation of halophylic (Ahmad et al., 2008). Khanet al.(2008)
bacteria in soil. Yang et al., (Yang et al., isolated and identified Bacillus and
2016)determined higher diversity of bacteria Enterobacter as nitrogen-fixing bacteria
in the rhizosphere soil at high salinity than from the rhizosphere of rice in Bangladesh.
low. In this study, Enterobacter, Nitrogen-fixing enterobacteria have been
Corynebacterium, Micrococcus and isolated from sugarcane plants cultivated in
Pediococcus were only found in saline soil. other countries (Loiret et al., 2004; Magnani
Pediococci commonly grow with plant et al., 2010; Mehnaz et al., 2010; Mirza et
associated lactic acid bacteria in various al., 2001; Taulé et al., 2010).
types of forage crops. Pediococci have
potential of fermenting xylose and Some isolates with following codes of E1-1
arabinose, they can be used as good (10), E1-2 (10) and E1-3 (10) isolated from
candidates for efficient lignocellulosic saline soil and E1-9 (12) isolated from non-
feedstock bioconversions (Boguta et al., saline soil had the ability to produce auxin,
2014). In industry, Corynebacterium species which first 3 isolates were related to
are used for economic production of Enterobacter and the other was
glutamic acid (Hermann, 2003). Paenibacillus. Change in the color intensity
due to auxin production in the presence of
The production of amino acids by (10) E1-1 and (10) E1-3, both were isolated
rhizobacteria may play an important role in from saline soil, was greater than other
the growth of plants and might also have a isolates. Earlier research reported that auxin
direct application in agricultural producing Enterobacter sp. strain 35
technologies. More research is required to isolated from sugarcane successfully
determine whether those bacteria have colonized and promoted growth of Brassica
oleracea (Zakria et al., 2008).The
1075
 Int.J.Curr.Microbiol.App.Sci (2016) 5(10): 1072-1083

production of auxin and various other ratio of halo to colony diameter (0.8) was in
indolic and phenolic compounds by second place and Bacillus [E1-2] with a halo
Paenibacillus. Polymyxa RP, RS and NRS diameter ratio (0.75) in third place.
isolates has been reported (Lebuhn et al., According to the study of Mehnazet al.,
1997). (2010)on isolation of sugarcane rhizosphere
bacteria in Punjab, 32 isolates, including
Potassium is one of the essential nutrients Enterobacter, Klebsiella and Pseudomonas
for plant growth and development. Most of were detected that, 17 isolates had
the potassium in soil exists in various phosphate dissolution ability. Phosphate
insoluble minerals (Goldstein, 1994). solubilizing microorganisms by production
Microorganisms play an important role to of phosphatase enzymes and organic acids,
release potassium from minerals and supply increase plants availability to the soluble
soluble K for plant. Test results of potassium phosphorus (Khan et al., 2009).
dissolution by our isolates have been
provided in Table 5. Isolates 10(E1-2) from The quantity of phosphate solubilizing by
saline soil had higher ratio of halo to colony isolates in liquid medium have been
diameter. provided in Table 7.Based on these results,
the highest phosphate solubilization ability
Most of the KSB obtained from the plant was respectively belong to Bacillus [12(K2)]
rhizosphere are Bacillus sp. and from non-saline soil, Pseudomonas[E1-2-2]
Pseudomonas sp (Archana et al., 2013; isolated from non-saline soil and Bacillus
Gopal et al., 2005; Liu et al., 2001; [2.6(K6)] from saline soil. Pearson
Sugumaran and Janarthanam, 2007; Zhou et correlation coefficient between phosphate
al., 2006). Zhang and Kong (Zhang and dissolution and pH of the medium (-0.73)
Kong, 2014) found 2 strains belonged to showed a significant negative correlation
Enterobacter cloacae as potassium (p<0.01) between these two parameters.
solubilizing from mica. Potassium Since the phosphate dissolution reaction
solubilizing bacteria have been isolated from occurs in rhizosphere so the probability of
rice crops, corn crops, and coconut tree finding solubilizing bacteria in this area is
(Gopal et al., 2005), tobacco (Zhang and higher (Mehta and Nautiyal, 2001).The pH
Kong, 2014). However, there are relatively reduction of the medium suggests the release
few studies on potassium solubilizing of organic acids by the P-solubilizing
bacteria in the sugarcane rhizosphere. microorganisms (Nautiyal et al., 2001,
Ghevariya and Deasi (2014) show Rashid et al., 2004).
Pseudomonas sp. of potassium
solubilization from mica. Figure 1 shows PCR amplification product
of extracted DNA from selected bacteria in
The results of phosphate dissolution by terms of growth-promoting properties, 1,500
isolates have been provided in Table 6. bp product represents correct genome
Based on these results, Pseudomonas (E1-2- amplification. Results of the sequencing of
2) with high ratio of halo to colony diameter the amplified fragment of each bacterium
(2.4) showed the greatest ability of insoluble were edited using Bio edit software and
phosphate dissolution in solid medium. Then were identified by Blast.
Enterobacter cloacae [10(E1-2)] with the

1076
 Int.J.Curr.Microbiol.App.Sci (2016) 5(10): 1072-1083

Table.1 Some physicochemical properties of soil

Properties Saline soil Non saline soil

Soil texture Clay loam Clay loam
Ec(dS/m) 4.7 1.5
pH 9.02 8.9
Organic carbon)%( 0.24 0.61
Calcium (meq/lit( 16.8 12.8
Magnesium (meq/lit( 10.9 7.36
Nitrate(meq/lit) 33.0 26.3
Bicarbonate (meq/lit) 5 4.7
Chlorine (meq/lit) 76.6 79.3
Microbial biomass carbon
324.21 477.96
(mg/100gr(
Soil respiration
4.5 4.8
)mgC-Co2/100gsoil.1day(

Table.2 List of identified bacteria isolates

Non- saline soil Saline soil

Isolate code Name of bacterial Isolate code Name of bacterial
isolate isolate
(12)E1-4 Paenibacillus (10)E1-9 Paenibacillus
E1-2(12) bacillus (10)E1-8 Bacillus
(12)E1-1 bacillus (10)E1-6 Pseudomonas
-8
(12)10 bacillus (10)E1-5 Micrococcus
(1)S7 bacillus (10)E1-4 Bacillus
(1)S2 bacillus (10)E1-3 Enterobacter
(1)H7E bacillus (10)E1-2 Enterobacter
(1)G3E Paenibacillus (10)E1-1 Enterobacter
(1)D9E bacillus (2.6)K6 Bacillus
(1)A1E Arthrobacter (2.6)7-2 Bacillus
E1-2 Bacillus K6 Bacillus
E1-2-2 Pseudomonas K2 Pseudomonas
(12)K5 Bacillus E1-8 Paenibacillus
(12)K2-1 Bacillus (10)K8 Paenibacillus
(12)K2 Bacillus (10)E3-2 Bacillus
(12)K1 Bacillus (10)E2-4 Bacillus
(12)E1-10 Pseudomonas (10)E2-3 Bacillus
(12)E1-9 Paenibacillus (10)E2-2 Pediococcus
(12)E1-8 Paenibacillus (10)E1-10 Corynebacterium
(12)E1-6 Paenibacillus
K8 Paenibacillus

1077
 Int.J.Curr.Microbiol.App.Sci (2016) 5(10): 1072-1083

Table.3 Number and shanon diversity components of isolates

Number Pi ln Pi* Pi
non-Saline non-Saline non-Saline
Saline soil Saline soil Saline soil
soil soil soil
Paenibacillus 3 6 0.157 0.285 -0.290 -0.356
Bacillus 8 12 0.421 0.571 -0.364 -0.319
Pseudomonas 2 2 0.105 0.095 -0.236 -0.223
Enterobacter 3 - 0.157 - -0.290 -
Pediococcus 1 - 0.052 - -0.153 -
Corynebacterium 1 - 0.052 - -0.153 -
Micrococcus 1 - 0.052 - -0.153 -
Arthrobacter - 1 - 0.047 - -0.143

Table.4 Results of nitrogen fixation ability of isolates

Saline soil Non saline soil
Isolate code Nitrogen fixation Isolate code Nitrogen fixation
10(E1-2) + 12(K2-1) +
10(E1-9) - 12(E1-8) +
10(E1-5) + 1(S7) +
10(E2-4) - 12(E1-9) +
10(E1-4) + 12(K5) -
10(E2-2) + E1-2 +
10(E1-1) + 12(E1-1) +
10(E1-10) + K8 +
K6 + 1(S2) +
10(E1-8) + 1(a1)E -
10(E1-6) + 12(K2) +
10(E2-3) + 12(E1-6) +
10(E3-2) + 12(K1) +
2.6(K6) + 1(d9)E +
10(K8) + 12(E1-4) +
E1-8 + 12(E1-10) +
10(E1-3) + 12(E1-2) +
2.6(7-2) + 12(10-8) -
K2 + E1-2-2 +
1(h7) +
1(g3) +

Table.5 Halo and colony diameter (mm) of isolates solubilizing potassium in

Aleksandrovagar medium

K2HPO4 Vermiculite
Bacteria code
Halo Colony Halo/Colony Halo Colony Halo/Colony
10(E1-2) 7 3 2.3 - - -
E1-2-2 7 5 1.4 10 5 2
10(E1-3) - - - 9 5 1.8
12(K1) 3 5 0.6 - - -

1078
 Int.J.Curr.Microbiol.App.Sci (2016) 5(10): 1072-1083

Table.6 Halo and colony diameter (mm) of isolates solubilizing phosphate in PVK agar medium
and pH and quantity of phosphate solubilizing in broth PVK medium

Bacteria Phosphate
Halo Colony Halo/Colony pH
code solubilizing(mg/L)
10(E1-2) 8 10 0.8 10.10 5.37
10(E1-5) 2 10 0.2 7.07 5.06
10(E1-4) 4 10 0.4 10.73 4.55
E1-2-2 12 5 2.4 13.64 4.1
10(E1-1) 4 8 0.5 10.42 5.41
1(S7) 4 10 0.4 7.06 4.84
10(E2-3) 2 8 0.25 2.95 5.26
10(E3-2) 4 10 0.4 10.42 4.82
12(E1-9) 4 8 0.5 6.68 5.7
2.6(K6) 2 10 0.2 13.53 4.8
E1-2 6 8 0.75 4.89 5.45
1(a1)E 2 10 0.2 11.19 4.48
10(E1-3) 8 10 0.8 12.13 4.2
12(K2) 6 8 0.75 14.15 4.7
K2 3 7 0.43 12.59 4.42
1(d9)E 5 9 0.55 7.77 4.84

Fig.1 PCR products of 16S rDNA from Bacteria (1500 bp).

1 2 3 4
5

1500bp

1: 10(E1-1); 2: 12(E1-9);3: 10(E1-3); 4: E1-2-2;5: molecular weight marker 1 KB (Fermentas, UK)

According to the results of comparing the In conclusion, during recent years, a great
sequences of 16S rRNA, growth-promoting attention has been paid to saline soils due to
strains had 98 percent similarity with the reducing arable land, and of the
Enterobacter cloacae R13 [10(E1-1)], increasing demand for agricultural
Paenibacillus lactis [12(E1-9)], and production of areas influenced by secondary
Pseudomonas sp [E1-2-2], Enterobacter salinization processes. Actually salt-affected
cloacae R33 [10(E1-3)], which were soils may have a biotechnological potential
deposited in Gene Bank under accession No: in their microbial communities, which
KX262855, KX262856, KX262854, represent a reserve for future exploitation in
KX262856, respectively. biotechnological applications. A survey of
available literature, suggests that

1079
 Int.J.Curr.Microbiol.App.Sci (2016) 5(10): 1072-1083

microbiology of saline soil and exploitation properties (methods of soil an 2), 831-
of microorganisms from these soil has not 871.
been dealt extensively. As mentioned in the Archana, D., Nandish, M., Savalagi,V.,
introduction, very few studies have Alagawadi, A., 2013.
considered in addressing the diversity of Characterization of potassium
PGPR, in relation to salinity. According to solubilizing bacteria (KSB) from
our results salinity had the strongest effect rhizosphere soil. BIOINFOLET-A
on bacterial community structure. On Quarterly J. Life Sci., 248-257.
completing this investigation, I am Ashraf, M.A., Rasool, M., Mirza, M.S.
impressed with the wide diversity of 2011. Nitrogen fixation and indole
microorganisms present in saline soils. Our acetic acid production potential of
study revealed a high plasticity of bacterial bacteria isolated from rhizosphere of
phyla that evidently possess genera and sugarcane (Saccharum officinarum
species adaptable to salinity conditions with L.). Adv. Biol. Res., 5(6): 348-355.
plant growth promoting properties. There is Boguta, A.M., Bringel, F., Martinussen, J.,
scope for use of nitrogen fixer and Jensen, P.R. 2014. Screening of lactic
phosphate and potassium solubilizing acid bacteria for their potential as
bacteria as potential biofertilizers for microbial cell factories for
reclamation saline soils of local area because bioconversion of lignocellulosic
isolates belongs to the same soil. From 40 feedstocks. Microbial cell factories
isolates on two saline and non- saline soils 4 13(1): 1.
isolates having good plant growth promotion Bric, J.M., Bostock, R.M., Silverstone, S.E.
were chosen and will be suggested to 1991. Rapid in situ assay for
produce for sugarcane cultivation in the indoleacetic acid production by
future. bacteria immobilized on a
nitrocellulose membrane. Appl.
Acknowledgments Environ. Microbiol., 57(2): 535-538.
Döbereiner, J., Day, L., Dart, P. 1972.
The authors thank the Shahid Chamran Nitrogenase activity and oxygen
University of Ahvaz for support this project. sensitivity of the Paspalum notatum-
Azotobacter paspali association.
References Microbiol., 71(1): 103-116.
Emtiazi, G., Pooyan, M., Shamalnasab, M.
Ahmad, F., Ahmad, I., Khan M. 2008. 2007. Cellulase activities in nitrogen
Screening of free-living rhizospheric fixing Paenibacillus isolated from soil
bacteria for their multiple plant growth in N-free media. World J. Agri. Sci.,
promoting activities. Microbiol. Res., 3(5): 602-608.
163(2): 173-181. Evelin, H., Kapoor,R.,Giri, B.,2009.
Aleksandrov,V., Blagodyr, R., Ilev, I. 1967. Arbuscular mycorrhizal fungi in
Liberation of phosphoric acid from alleviation of salt stress: a review.
apatite by silicate bacteria. Mikrobiol. Annals of botany.104(7), 1263-1280.
Z (Kiev)., 29: 111-114. Fernandez, O., Béthencourt, A., Quero, RS.,
Anderson, J.P. 1982. Soil respiration. SangwanClément, C. 2010. Trehalose
Methods of soil analysis. Part 2. and plant stress responses: friend or
Chemical and microbiological foe? Trends in plant Sci., 15(7), 409-
417.

1080
 Int.J.Curr.Microbiol.App.Sci (2016) 5(10): 1072-1083

Ghevariya, K.K., Desai, P.B. 2014. and phenolic compounds by

Rhizobacteria of sugarcane: In Paenibacillus polymyxa strains
vitroscreening for their plant Growth isolated from different proximity to
Promoting potentials. Res. J. Recent plant roots. FEMS Microbiol. Ecol.,
Sci., 3: 52-58. 22(4): 325-334.
Goldstein, A.H. 1994. Involvement of the Liu, G., Lin, Y., Huang, Z. 2001. Screening
quinoprotein glucose dehydrogenase of silicate bacteria with potassium-
in the solubilization of exogenous releasing and antagonistical activity.
phosphates by gram-negative bacteria. Chinese Journal of Applied &
Phosphate in microorganisms: cellular Environmental Biology. 7(1), 66-68.
and molecular biology. ASM Press, Loiret, F., Ortega, E., Kleiner, D.,
Washington, DC, 197-203. Ortega‐Rodés, P., Rodes, R., Dong, Z.
Gopal, M., Gupta, A., Nair, R., 2005. 2004. A putative new endophytic
Variations in hosting beneficial plant- nitrogen‐fixing bacterium Pantoea sp.
associated microorganisms by root from sugarcane. J. Appl. Microbiol.,
(wilt)-diseased and field-tolerant 97(3), 504-511.
coconut palms of West Coast Tall Magnani, G., Didonet, C., Cruz, L., Picheth,
variety. Curr. Sci., .89(11): 1922- C., Pedrosa, F., Souza, E., 2010.
1927. Diversity of endophytic bacteria in
Harrigan, W., Mc Cance, M. 1976. Brazilian sugarcane. Genet. Mol. Res.,
Laboratory methods in foods and 9(1): 250-258.
microbiology Academic press. In. Mehnaz, S., Baig, DN., Lazarovits, G.,
(London). 2010. Genetic and phenotypic
Hermann, T. 2003. Industrial production of diversity of plant growth promoting
amino acids by coryneform bacteria. J. rhizobacteria isolated from sugarcane
Biotechnol., 104(1): 155-172. plants growing in Pakistan. J.
Jenkinson, D., Powlson, D.S. 1976. The Microbiol. Biotechnol., 20(12): 1614-
effects of biocidal treatments on 1623.
metabolism in soil—V: a method for Mehta, S., Nautiyal, C.S. 2001. An efficient
measuring soil biomass. Soil Biol. method for qualitative screening of
Biochem., 8(3): 209-213. phosphate-solubilizing bacteria. Curr.
Khan, M.S., Zaidi, A., Wani, P.A., Oves, Microbiol., 43(1); 51-56.
M. 2009. Role of plant growth Mirza, M.S., Mehnaz, S., Normand, P.,
promoting rhizobacteria in the Prigent-Combaret, C., Moënne-
remediation of metal contaminated Loccoz, Y., Bally, R., Malik K.A.
soils. Environ. Chem. Lett., 7(1): 1-19. 2006. Molecular characterization and
Khan, H., Mohiuddin, M., Rahman, M. PCR detection of a nitrogen-fixing
2008. Enumeration, Isolation and Pseudomonas strain promoting rice
Identification of Nitrogen-Fixing growth. Biol. Fertility of Soils, 43(2):
bacterial strains at seedling stage in 163-170.
Rhizosphere of rice grown in Non- Mirza, M.S., Ahmad,W., Latif, F., Haurat,
Calcareous Grey flood plain soil of J., Bally, R., Normand, P., Malik,
Bangladesh. J. Fac. Env. Sc. Tech., K.A. 2001. Isolation, partial
Okayama University. 13, 97-101. characterization, and the effect of
Lebuhn, M., Heulin, T., Hartman, A. 1997. plant growth-promoting bacteria
Production of auxin and other indolic (PGPB) on micro-propagated

1081
 Int.J.Curr.Microbiol.App.Sci (2016) 5(10): 1072-1083

sugarcane in vitro. Plant and Soil, under in vitro conditions. Pak. J. Biol.
237(1): 47-54. Sci., 7(2): 187-196.
Nakade Dhanraj, B. 2013. Bacterial Rietz, D., Haynes, R. 2003. Effects of
diversity in sugarcane (Saccharum irrigation-induced salinity and sodicity
officinarum) rhizosphere of saline soil. on soil microbial activity. Soil Biol.
Int. Res. J. Biol. Sci., 2(2): 60-64. Biochem., 35(6): 845-854.
Nautiyal, C.S., Bhadauria, S., Kumar, P., Sahoo, K., Dhal, N. 2009. Potential
Lal, H., Mondal, R., and Verma, D. microbial diversity in mangrove
2000. Stress induced phosphate ecosystems: a review. Indian J.
solubilization in bacteria isolated from Marine Sci., 38(2): 249.
alkaline soils. FEMS Microbiol. Lett., Sugumaran, P., Janarthanam, B., 2007.
182(2): 291-296. Solubilization of potassium containing
Ogbo, F., Okonkwo, J. 2012. Some minerals by bacteria and their effect
characteristics of a plant growth on plant growth. World J. Agri. Sci.,
promoting Enterobacter sp. isolated 3(3): 350-355.
from the roots of maize. Adv. Swingland, I.R. 2001. Biodiversity,
Microbiol., 2(03): 368. definition of. Encyclopedia of
Pazira, E., Homaee, M. 2010. Salt leaching biodiversity 1, 377-391.
efficiency of subsurface drainage Taulé, C., Mareque, C., Barlocco, C.,
systems at presence of diffusing saline Hackembruch, F., Reis, V.M.,
water table boundary: a case study in Sicardi, M., Battistoni, F. 2012. The
Khuzestan plains, Iran. In '9th contribution of nitrogen fixation to
International Drainage Symposium sugarcane (Saccharum officinarum
held jointly with CIGR and L.), and the identification and
CSBE/SCGAB Proceedings, 13-16 characterization of part of the
June 2010, Québec City Convention associated diazotrophic bacterial
Centre, Quebec City, Canada', 2010, p. community. Plant and Soil, 356(1-2):
1 35-49.
Ramani, V., 2011. Effect of pesticides on Weisburg, W.G., Barns, S.M., Pelletie,
phosphate solubilization by Bacillus D.A., Lane, D.J. 1991. 16S ribosomal
sphaericus and Pseudomonas cepacia. DNA amplification for phylogenetic
Pesticide Biochem. Physiol., 99(3), study. J. Bacteriol., 173(2): 697-703.
232-236. Wichern, J., Wichern, F., Joergensen, R.G.
Rameshkumar, N., Ayyadurai, N., 2006. Impact of salinity on soil
Kayalvizhi, N., Gunasekaran, P. 2012. microbial communities and the
Genotypic and phenotypic diversity of decomposition of maize in acidic soils.
PGPR fluorescent pseudomonads Geoderma, 137(1): 100-108.
isolated from the rhizosphere of Xie, J.B., Du, Z. 2014. Comparative
sugarcane (Saccharum officinarum genomic analysis of N 2-fixing and
L.). J. Microbiol. Biotechnol., 22(1): non-N 2-fixing Paenibacillus spp.:
13-24. organization, evolution and expression
Rashid, M., Khalil, S., Ayub, N., Alam, S., of the nitrogen fixation genes. PLoS
Latif, F. 2004. Organic acids Genet., 10(3): e1004231.
production and phosphate Yang, H., Hu, J., Long, X., Liu, Z., Rengel,
solubilization by phosphate Z. 2016. Salinity altered root
solubilizing microorganisms (PSM) distribution and increased diversity of

1082
 Int.J.Curr.Microbiol.App.Sci (2016) 5(10): 1072-1083

bacterial communities in the characteristics of Enterobacter sp. and

rhizosphere soil of Jerusalem Herbaspirillum sp. on Brassica
artichoke. Scientific reports, 6. oleracea. Soil Sci. Plant Nutri., 54(4),
Yao, L., Wu, Z., Zheng, Y., Kaleem, I., Li, 507-516.
C. 2010. Growth promotion and Zhang, C., Kong, F., 2014. Isolation and
protection against salt stress by identification of potassium-
Pseudomonas putida Rs-198 on solubilizing bacteria from tobacco
cotton. European J. Soil Biol., 46(1): rhizospheric soil and their effect on
49-54. tobacco plants. Appl. Soil Ecol., 82:
Yuan, B., Li, Z., Liu, H., Gao, M., Zhang, 18-25.
Y. 2007. Microbial biomass and Zhou, H., Zeng, X., Liu, F., Qiu, G., Hu, Y.,
activity in salt affected soils under arid 2006. Screening, identification and
conditions. Appl. Soil Ecol., 35(2): desilication of a silicate bacterium. J.
319-328. Central South University of Technol.,
Zakria, M., Ohsako, A., Saeki,Y., 13(4): 337-341.
Yamamoto, A., Akao, S., 2008.
Colonization and growth promotion

How to cite this article:

Elham Lamizadeh, Naeimeh Enayatizamir and Hossein Motamedi. 2016. Isolation and
Identification of Plant Growth-Promoting Rhizobacteria (PGPR) from the Rhizosphere of
Sugarcane in Saline and Non-Saline Soil. Int.J.Curr.Microbiol.App.Sci. 5(10): 1072-1083.
doi: http://dx.doi.org/10.20546/ijcmas.2016.510.113

1083

View publication stats